summaryrefslogtreecommitdiff
path: root/spec/ruby/core/array/shared/slice.rb
diff options
context:
space:
mode:
Diffstat (limited to 'spec/ruby/core/array/shared/slice.rb')
-rw-r--r--spec/ruby/core/array/shared/slice.rb889
1 files changed, 0 insertions, 889 deletions
diff --git a/spec/ruby/core/array/shared/slice.rb b/spec/ruby/core/array/shared/slice.rb
deleted file mode 100644
index 8fb33738b9..0000000000
--- a/spec/ruby/core/array/shared/slice.rb
+++ /dev/null
@@ -1,889 +0,0 @@
-describe :array_slice, shared: true do
- it "returns the element at index with [index]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 1).should == "b"
-
- a = [1, 2, 3, 4]
-
- a.send(@method, 0).should == 1
- a.send(@method, 1).should == 2
- a.send(@method, 2).should == 3
- a.send(@method, 3).should == 4
- a.send(@method, 4).should == nil
- a.send(@method, 10).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns the element at index from the end of the array with [-index]" do
- [ "a", "b", "c", "d", "e" ].send(@method, -2).should == "d"
-
- a = [1, 2, 3, 4]
-
- a.send(@method, -1).should == 4
- a.send(@method, -2).should == 3
- a.send(@method, -3).should == 2
- a.send(@method, -4).should == 1
- a.send(@method, -5).should == nil
- a.send(@method, -10).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns count elements starting from index with [index, count]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 2, 3).should == ["c", "d", "e"]
-
- a = [1, 2, 3, 4]
-
- a.send(@method, 0, 0).should == []
- a.send(@method, 0, 1).should == [1]
- a.send(@method, 0, 2).should == [1, 2]
- a.send(@method, 0, 4).should == [1, 2, 3, 4]
- a.send(@method, 0, 6).should == [1, 2, 3, 4]
- a.send(@method, 0, -1).should == nil
- a.send(@method, 0, -2).should == nil
- a.send(@method, 0, -4).should == nil
-
- a.send(@method, 2, 0).should == []
- a.send(@method, 2, 1).should == [3]
- a.send(@method, 2, 2).should == [3, 4]
- a.send(@method, 2, 4).should == [3, 4]
- a.send(@method, 2, -1).should == nil
-
- a.send(@method, 4, 0).should == []
- a.send(@method, 4, 2).should == []
- a.send(@method, 4, -1).should == nil
-
- a.send(@method, 5, 0).should == nil
- a.send(@method, 5, 2).should == nil
- a.send(@method, 5, -1).should == nil
-
- a.send(@method, 6, 0).should == nil
- a.send(@method, 6, 2).should == nil
- a.send(@method, 6, -1).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns count elements starting at index from the end of array with [-index, count]" do
- [ "a", "b", "c", "d", "e" ].send(@method, -2, 2).should == ["d", "e"]
-
- a = [1, 2, 3, 4]
-
- a.send(@method, -1, 0).should == []
- a.send(@method, -1, 1).should == [4]
- a.send(@method, -1, 2).should == [4]
- a.send(@method, -1, -1).should == nil
-
- a.send(@method, -2, 0).should == []
- a.send(@method, -2, 1).should == [3]
- a.send(@method, -2, 2).should == [3, 4]
- a.send(@method, -2, 4).should == [3, 4]
- a.send(@method, -2, -1).should == nil
-
- a.send(@method, -4, 0).should == []
- a.send(@method, -4, 1).should == [1]
- a.send(@method, -4, 2).should == [1, 2]
- a.send(@method, -4, 4).should == [1, 2, 3, 4]
- a.send(@method, -4, 6).should == [1, 2, 3, 4]
- a.send(@method, -4, -1).should == nil
-
- a.send(@method, -5, 0).should == nil
- a.send(@method, -5, 1).should == nil
- a.send(@method, -5, 10).should == nil
- a.send(@method, -5, -1).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns the first count elements with [0, count]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 0, 3).should == ["a", "b", "c"]
- end
-
- it "returns the subarray which is independent to self with [index,count]" do
- a = [1, 2, 3]
- sub = a.send(@method, 1,2)
- sub.replace([:a, :b])
- a.should == [1, 2, 3]
- end
-
- it "tries to convert the passed argument to an Integer using #to_int" do
- obj = mock('to_int')
- obj.stub!(:to_int).and_return(2)
-
- a = [1, 2, 3, 4]
- a.send(@method, obj).should == 3
- a.send(@method, obj, 1).should == [3]
- a.send(@method, obj, obj).should == [3, 4]
- a.send(@method, 0, obj).should == [1, 2]
- end
-
- it "raises TypeError if to_int returns non-integer" do
- from = mock('from')
- to = mock('to')
-
- # So we can construct a range out of them...
- def from.<=>(o) 0 end
- def to.<=>(o) 0 end
-
- a = [1, 2, 3, 4, 5]
-
- def from.to_int() 'cat' end
- def to.to_int() -2 end
-
- -> { a.send(@method, from..to) }.should raise_error(TypeError)
-
- def from.to_int() 1 end
- def to.to_int() 'cat' end
-
- -> { a.send(@method, from..to) }.should raise_error(TypeError)
- end
-
- it "returns the elements specified by Range indexes with [m..n]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 1..3).should == ["b", "c", "d"]
- [ "a", "b", "c", "d", "e" ].send(@method, 4..-1).should == ['e']
- [ "a", "b", "c", "d", "e" ].send(@method, 3..3).should == ['d']
- [ "a", "b", "c", "d", "e" ].send(@method, 3..-2).should == ['d']
- ['a'].send(@method, 0..-1).should == ['a']
-
- a = [1, 2, 3, 4]
-
- a.send(@method, 0..-10).should == []
- a.send(@method, 0..0).should == [1]
- a.send(@method, 0..1).should == [1, 2]
- a.send(@method, 0..2).should == [1, 2, 3]
- a.send(@method, 0..3).should == [1, 2, 3, 4]
- a.send(@method, 0..4).should == [1, 2, 3, 4]
- a.send(@method, 0..10).should == [1, 2, 3, 4]
-
- a.send(@method, 2..-10).should == []
- a.send(@method, 2..0).should == []
- a.send(@method, 2..2).should == [3]
- a.send(@method, 2..3).should == [3, 4]
- a.send(@method, 2..4).should == [3, 4]
-
- a.send(@method, 3..0).should == []
- a.send(@method, 3..3).should == [4]
- a.send(@method, 3..4).should == [4]
-
- a.send(@method, 4..0).should == []
- a.send(@method, 4..4).should == []
- a.send(@method, 4..5).should == []
-
- a.send(@method, 5..0).should == nil
- a.send(@method, 5..5).should == nil
- a.send(@method, 5..6).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns elements specified by Range indexes except the element at index n with [m...n]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 1...3).should == ["b", "c"]
-
- a = [1, 2, 3, 4]
-
- a.send(@method, 0...-10).should == []
- a.send(@method, 0...0).should == []
- a.send(@method, 0...1).should == [1]
- a.send(@method, 0...2).should == [1, 2]
- a.send(@method, 0...3).should == [1, 2, 3]
- a.send(@method, 0...4).should == [1, 2, 3, 4]
- a.send(@method, 0...10).should == [1, 2, 3, 4]
-
- a.send(@method, 2...-10).should == []
- a.send(@method, 2...0).should == []
- a.send(@method, 2...2).should == []
- a.send(@method, 2...3).should == [3]
- a.send(@method, 2...4).should == [3, 4]
-
- a.send(@method, 3...0).should == []
- a.send(@method, 3...3).should == []
- a.send(@method, 3...4).should == [4]
-
- a.send(@method, 4...0).should == []
- a.send(@method, 4...4).should == []
- a.send(@method, 4...5).should == []
-
- a.send(@method, 5...0).should == nil
- a.send(@method, 5...5).should == nil
- a.send(@method, 5...6).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns elements that exist if range start is in the array but range end is not with [m..n]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 4..7).should == ["e"]
- end
-
- it "accepts Range instances having a negative m and both signs for n with [m..n] and [m...n]" do
- a = [1, 2, 3, 4]
-
- a.send(@method, -1..-1).should == [4]
- a.send(@method, -1...-1).should == []
- a.send(@method, -1..3).should == [4]
- a.send(@method, -1...3).should == []
- a.send(@method, -1..4).should == [4]
- a.send(@method, -1...4).should == [4]
- a.send(@method, -1..10).should == [4]
- a.send(@method, -1...10).should == [4]
- a.send(@method, -1..0).should == []
- a.send(@method, -1..-4).should == []
- a.send(@method, -1...-4).should == []
- a.send(@method, -1..-6).should == []
- a.send(@method, -1...-6).should == []
-
- a.send(@method, -2..-2).should == [3]
- a.send(@method, -2...-2).should == []
- a.send(@method, -2..-1).should == [3, 4]
- a.send(@method, -2...-1).should == [3]
- a.send(@method, -2..10).should == [3, 4]
- a.send(@method, -2...10).should == [3, 4]
-
- a.send(@method, -4..-4).should == [1]
- a.send(@method, -4..-2).should == [1, 2, 3]
- a.send(@method, -4...-2).should == [1, 2]
- a.send(@method, -4..-1).should == [1, 2, 3, 4]
- a.send(@method, -4...-1).should == [1, 2, 3]
- a.send(@method, -4..3).should == [1, 2, 3, 4]
- a.send(@method, -4...3).should == [1, 2, 3]
- a.send(@method, -4..4).should == [1, 2, 3, 4]
- a.send(@method, -4...4).should == [1, 2, 3, 4]
- a.send(@method, -4...4).should == [1, 2, 3, 4]
- a.send(@method, -4..0).should == [1]
- a.send(@method, -4...0).should == []
- a.send(@method, -4..1).should == [1, 2]
- a.send(@method, -4...1).should == [1]
-
- a.send(@method, -5..-5).should == nil
- a.send(@method, -5...-5).should == nil
- a.send(@method, -5..-4).should == nil
- a.send(@method, -5..-1).should == nil
- a.send(@method, -5..10).should == nil
-
- a.should == [1, 2, 3, 4]
- end
-
- it "returns the subarray which is independent to self with [m..n]" do
- a = [1, 2, 3]
- sub = a.send(@method, 1..2)
- sub.replace([:a, :b])
- a.should == [1, 2, 3]
- end
-
- it "tries to convert Range elements to Integers using #to_int with [m..n] and [m...n]" do
- from = mock('from')
- to = mock('to')
-
- # So we can construct a range out of them...
- def from.<=>(o) 0 end
- def to.<=>(o) 0 end
-
- def from.to_int() 1 end
- def to.to_int() -2 end
-
- a = [1, 2, 3, 4]
-
- a.send(@method, from..to).should == [2, 3]
- a.send(@method, from...to).should == [2]
- a.send(@method, 1..0).should == []
- a.send(@method, 1...0).should == []
-
- -> { a.send(@method, "a" .. "b") }.should raise_error(TypeError)
- -> { a.send(@method, "a" ... "b") }.should raise_error(TypeError)
- -> { a.send(@method, from .. "b") }.should raise_error(TypeError)
- -> { a.send(@method, from ... "b") }.should raise_error(TypeError)
- end
-
- it "returns the same elements as [m..n] and [m...n] with Range subclasses" do
- a = [1, 2, 3, 4]
- range_incl = ArraySpecs::MyRange.new(1, 2)
- range_excl = ArraySpecs::MyRange.new(-3, -1, true)
-
- a.send(@method, range_incl).should == [2, 3]
- a.send(@method, range_excl).should == [2, 3]
- end
-
- it "returns nil for a requested index not in the array with [index]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 5).should == nil
- end
-
- it "returns [] if the index is valid but length is zero with [index, length]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 0, 0).should == []
- [ "a", "b", "c", "d", "e" ].send(@method, 2, 0).should == []
- end
-
- it "returns nil if length is zero but index is invalid with [index, length]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 100, 0).should == nil
- [ "a", "b", "c", "d", "e" ].send(@method, -50, 0).should == nil
- end
-
- # This is by design. It is in the official documentation.
- it "returns [] if index == array.size with [index, length]" do
- %w|a b c d e|.send(@method, 5, 2).should == []
- end
-
- it "returns nil if index > array.size with [index, length]" do
- %w|a b c d e|.send(@method, 6, 2).should == nil
- end
-
- it "returns nil if length is negative with [index, length]" do
- %w|a b c d e|.send(@method, 3, -1).should == nil
- %w|a b c d e|.send(@method, 2, -2).should == nil
- %w|a b c d e|.send(@method, 1, -100).should == nil
- end
-
- it "returns nil if no requested index is in the array with [m..n]" do
- [ "a", "b", "c", "d", "e" ].send(@method, 6..10).should == nil
- end
-
- it "returns nil if range start is not in the array with [m..n]" do
- [ "a", "b", "c", "d", "e" ].send(@method, -10..2).should == nil
- [ "a", "b", "c", "d", "e" ].send(@method, 10..12).should == nil
- end
-
- it "returns an empty array when m == n with [m...n]" do
- [1, 2, 3, 4, 5].send(@method, 1...1).should == []
- end
-
- it "returns an empty array with [0...0]" do
- [1, 2, 3, 4, 5].send(@method, 0...0).should == []
- end
-
- it "returns a subarray where m, n negatives and m < n with [m..n]" do
- [ "a", "b", "c", "d", "e" ].send(@method, -3..-2).should == ["c", "d"]
- end
-
- it "returns an array containing the first element with [0..0]" do
- [1, 2, 3, 4, 5].send(@method, 0..0).should == [1]
- end
-
- it "returns the entire array with [0..-1]" do
- [1, 2, 3, 4, 5].send(@method, 0..-1).should == [1, 2, 3, 4, 5]
- end
-
- it "returns all but the last element with [0...-1]" do
- [1, 2, 3, 4, 5].send(@method, 0...-1).should == [1, 2, 3, 4]
- end
-
- it "returns [3] for [2..-1] out of [1, 2, 3]" do
- [1,2,3].send(@method, 2..-1).should == [3]
- end
-
- it "returns an empty array when m > n and m, n are positive with [m..n]" do
- [1, 2, 3, 4, 5].send(@method, 3..2).should == []
- end
-
- it "returns an empty array when m > n and m, n are negative with [m..n]" do
- [1, 2, 3, 4, 5].send(@method, -2..-3).should == []
- end
-
- it "does not expand array when the indices are outside of the array bounds" do
- a = [1, 2]
- a.send(@method, 4).should == nil
- a.should == [1, 2]
- a.send(@method, 4, 0).should == nil
- a.should == [1, 2]
- a.send(@method, 6, 1).should == nil
- a.should == [1, 2]
- a.send(@method, 8...8).should == nil
- a.should == [1, 2]
- a.send(@method, 10..10).should == nil
- a.should == [1, 2]
- end
-
- describe "with a subclass of Array" do
- before :each do
- ScratchPad.clear
-
- @array = ArraySpecs::MyArray[1, 2, 3, 4, 5]
- end
-
- ruby_version_is ''...'3.0' do
- it "returns a subclass instance with [n, m]" do
- @array.send(@method, 0, 2).should be_an_instance_of(ArraySpecs::MyArray)
- end
-
- it "returns a subclass instance with [-n, m]" do
- @array.send(@method, -3, 2).should be_an_instance_of(ArraySpecs::MyArray)
- end
-
- it "returns a subclass instance with [n..m]" do
- @array.send(@method, 1..3).should be_an_instance_of(ArraySpecs::MyArray)
- end
-
- it "returns a subclass instance with [n...m]" do
- @array.send(@method, 1...3).should be_an_instance_of(ArraySpecs::MyArray)
- end
-
- it "returns a subclass instance with [-n..-m]" do
- @array.send(@method, -3..-1).should be_an_instance_of(ArraySpecs::MyArray)
- end
-
- it "returns a subclass instance with [-n...-m]" do
- @array.send(@method, -3...-1).should be_an_instance_of(ArraySpecs::MyArray)
- end
- end
-
- ruby_version_is '3.0' do
- it "returns a Array instance with [n, m]" do
- @array.send(@method, 0, 2).should be_an_instance_of(Array)
- end
-
- it "returns a Array instance with [-n, m]" do
- @array.send(@method, -3, 2).should be_an_instance_of(Array)
- end
-
- it "returns a Array instance with [n..m]" do
- @array.send(@method, 1..3).should be_an_instance_of(Array)
- end
-
- it "returns a Array instance with [n...m]" do
- @array.send(@method, 1...3).should be_an_instance_of(Array)
- end
-
- it "returns a Array instance with [-n..-m]" do
- @array.send(@method, -3..-1).should be_an_instance_of(Array)
- end
-
- it "returns a Array instance with [-n...-m]" do
- @array.send(@method, -3...-1).should be_an_instance_of(Array)
- end
- end
-
- it "returns an empty array when m == n with [m...n]" do
- @array.send(@method, 1...1).should == []
- ScratchPad.recorded.should be_nil
- end
-
- it "returns an empty array with [0...0]" do
- @array.send(@method, 0...0).should == []
- ScratchPad.recorded.should be_nil
- end
-
- it "returns an empty array when m > n and m, n are positive with [m..n]" do
- @array.send(@method, 3..2).should == []
- ScratchPad.recorded.should be_nil
- end
-
- it "returns an empty array when m > n and m, n are negative with [m..n]" do
- @array.send(@method, -2..-3).should == []
- ScratchPad.recorded.should be_nil
- end
-
- it "returns [] if index == array.size with [index, length]" do
- @array.send(@method, 5, 2).should == []
- ScratchPad.recorded.should be_nil
- end
-
- it "returns [] if the index is valid but length is zero with [index, length]" do
- @array.send(@method, 0, 0).should == []
- @array.send(@method, 2, 0).should == []
- ScratchPad.recorded.should be_nil
- end
-
- it "does not call #initialize on the subclass instance" do
- @array.send(@method, 0, 3).should == [1, 2, 3]
- ScratchPad.recorded.should be_nil
- end
- end
-
- it "raises a RangeError when the start index is out of range of Fixnum" do
- array = [1, 2, 3, 4, 5, 6]
- obj = mock('large value')
- obj.should_receive(:to_int).and_return(bignum_value)
- -> { array.send(@method, obj) }.should raise_error(RangeError)
-
- obj = 8e19
- -> { array.send(@method, obj) }.should raise_error(RangeError)
-
- # boundary value when longs are 64 bits
- -> { array.send(@method, 2.0**63) }.should raise_error(RangeError)
-
- # just under the boundary value when longs are 64 bits
- array.send(@method, max_long.to_f.prev_float).should == nil
- end
-
- it "raises a RangeError when the length is out of range of Fixnum" do
- array = [1, 2, 3, 4, 5, 6]
- obj = mock('large value')
- obj.should_receive(:to_int).and_return(bignum_value)
- -> { array.send(@method, 1, obj) }.should raise_error(RangeError)
-
- obj = 8e19
- -> { array.send(@method, 1, obj) }.should raise_error(RangeError)
- end
-
- it "raises a type error if a range is passed with a length" do
- ->{ [1, 2, 3].send(@method, 1..2, 1) }.should raise_error(TypeError)
- end
-
- it "raises a RangeError if passed a range with a bound that is too large" do
- array = [1, 2, 3, 4, 5, 6]
- -> { array.send(@method, bignum_value..(bignum_value + 1)) }.should raise_error(RangeError)
- -> { array.send(@method, 0..bignum_value) }.should raise_error(RangeError)
- end
-
- it "can accept endless ranges" do
- a = [0, 1, 2, 3, 4, 5]
- a.send(@method, eval("(2..)")).should == [2, 3, 4, 5]
- a.send(@method, eval("(2...)")).should == [2, 3, 4, 5]
- a.send(@method, eval("(-2..)")).should == [4, 5]
- a.send(@method, eval("(-2...)")).should == [4, 5]
- a.send(@method, eval("(9..)")).should == nil
- a.send(@method, eval("(9...)")).should == nil
- a.send(@method, eval("(-9..)")).should == nil
- a.send(@method, eval("(-9...)")).should == nil
- end
-
- ruby_version_is "3.0" do
- describe "can be sliced with Enumerator::ArithmeticSequence" do
- before :each do
- @array = [0, 1, 2, 3, 4, 5]
- end
-
- it "has endless range and positive steps" do
- @array.send(@method, eval("(0..).step(1)")).should == [0, 1, 2, 3, 4, 5]
- @array.send(@method, eval("(0..).step(2)")).should == [0, 2, 4]
- @array.send(@method, eval("(0..).step(10)")).should == [0]
-
- @array.send(@method, eval("(2..).step(1)")).should == [2, 3, 4, 5]
- @array.send(@method, eval("(2..).step(2)")).should == [2, 4]
- @array.send(@method, eval("(2..).step(10)")).should == [2]
-
- @array.send(@method, eval("(-3..).step(1)")).should == [3, 4, 5]
- @array.send(@method, eval("(-3..).step(2)")).should == [3, 5]
- @array.send(@method, eval("(-3..).step(10)")).should == [3]
- end
-
- it "has beginless range and positive steps" do
- # end with zero index
- @array.send(@method, (..0).step(1)).should == [0]
- @array.send(@method, (...0).step(1)).should == []
-
- @array.send(@method, (..0).step(2)).should == [0]
- @array.send(@method, (...0).step(2)).should == []
-
- @array.send(@method, (..0).step(10)).should == [0]
- @array.send(@method, (...0).step(10)).should == []
-
- # end with positive index
- @array.send(@method, (..3).step(1)).should == [0, 1, 2, 3]
- @array.send(@method, (...3).step(1)).should == [0, 1, 2]
-
- @array.send(@method, (..3).step(2)).should == [0, 2]
- @array.send(@method, (...3).step(2)).should == [0, 2]
-
- @array.send(@method, (..3).step(10)).should == [0]
- @array.send(@method, (...3).step(10)).should == [0]
-
- # end with negative index
- @array.send(@method, (..-2).step(1)).should == [0, 1, 2, 3, 4,]
- @array.send(@method, (...-2).step(1)).should == [0, 1, 2, 3]
-
- @array.send(@method, (..-2).step(2)).should == [0, 2, 4]
- @array.send(@method, (...-2).step(2)).should == [0, 2]
-
- @array.send(@method, (..-2).step(10)).should == [0]
- @array.send(@method, (...-2).step(10)).should == [0]
- end
-
- it "has endless range and negative steps" do
- @array.send(@method, eval("(0..).step(-1)")).should == [0]
- @array.send(@method, eval("(0..).step(-2)")).should == [0]
- @array.send(@method, eval("(0..).step(-10)")).should == [0]
-
- @array.send(@method, eval("(2..).step(-1)")).should == [2, 1, 0]
- @array.send(@method, eval("(2..).step(-2)")).should == [2, 0]
-
- @array.send(@method, eval("(-3..).step(-1)")).should == [3, 2, 1, 0]
- @array.send(@method, eval("(-3..).step(-2)")).should == [3, 1]
- end
-
- it "has closed range and positive steps" do
- # start and end with 0
- @array.send(@method, eval("(0..0).step(1)")).should == [0]
- @array.send(@method, eval("(0...0).step(1)")).should == []
-
- @array.send(@method, eval("(0..0).step(2)")).should == [0]
- @array.send(@method, eval("(0...0).step(2)")).should == []
-
- @array.send(@method, eval("(0..0).step(10)")).should == [0]
- @array.send(@method, eval("(0...0).step(10)")).should == []
-
- # start and end with positive index
- @array.send(@method, eval("(1..3).step(1)")).should == [1, 2, 3]
- @array.send(@method, eval("(1...3).step(1)")).should == [1, 2]
-
- @array.send(@method, eval("(1..3).step(2)")).should == [1, 3]
- @array.send(@method, eval("(1...3).step(2)")).should == [1]
-
- @array.send(@method, eval("(1..3).step(10)")).should == [1]
- @array.send(@method, eval("(1...3).step(10)")).should == [1]
-
- # start with positive index, end with negative index
- @array.send(@method, eval("(1..-2).step(1)")).should == [1, 2, 3, 4]
- @array.send(@method, eval("(1...-2).step(1)")).should == [1, 2, 3]
-
- @array.send(@method, eval("(1..-2).step(2)")).should == [1, 3]
- @array.send(@method, eval("(1...-2).step(2)")).should == [1, 3]
-
- @array.send(@method, eval("(1..-2).step(10)")).should == [1]
- @array.send(@method, eval("(1...-2).step(10)")).should == [1]
-
- # start with negative index, end with positive index
- @array.send(@method, eval("(-4..4).step(1)")).should == [2, 3, 4]
- @array.send(@method, eval("(-4...4).step(1)")).should == [2, 3]
-
- @array.send(@method, eval("(-4..4).step(2)")).should == [2, 4]
- @array.send(@method, eval("(-4...4).step(2)")).should == [2]
-
- @array.send(@method, eval("(-4..4).step(10)")).should == [2]
- @array.send(@method, eval("(-4...4).step(10)")).should == [2]
-
- # start with negative index, end with negative index
- @array.send(@method, eval("(-4..-2).step(1)")).should == [2, 3, 4]
- @array.send(@method, eval("(-4...-2).step(1)")).should == [2, 3]
-
- @array.send(@method, eval("(-4..-2).step(2)")).should == [2, 4]
- @array.send(@method, eval("(-4...-2).step(2)")).should == [2]
-
- @array.send(@method, eval("(-4..-2).step(10)")).should == [2]
- @array.send(@method, eval("(-4...-2).step(10)")).should == [2]
- end
-
- it "has closed range and negative steps" do
- # start and end with 0
- @array.send(@method, eval("(0..0).step(-1)")).should == [0]
- @array.send(@method, eval("(0...0).step(-1)")).should == []
-
- @array.send(@method, eval("(0..0).step(-2)")).should == [0]
- @array.send(@method, eval("(0...0).step(-2)")).should == []
-
- @array.send(@method, eval("(0..0).step(-10)")).should == [0]
- @array.send(@method, eval("(0...0).step(-10)")).should == []
-
- # start and end with positive index
- @array.send(@method, eval("(1..3).step(-1)")).should == []
- @array.send(@method, eval("(1...3).step(-1)")).should == []
-
- @array.send(@method, eval("(1..3).step(-2)")).should == []
- @array.send(@method, eval("(1...3).step(-2)")).should == []
-
- @array.send(@method, eval("(1..3).step(-10)")).should == []
- @array.send(@method, eval("(1...3).step(-10)")).should == []
-
- # start with positive index, end with negative index
- @array.send(@method, eval("(1..-2).step(-1)")).should == []
- @array.send(@method, eval("(1...-2).step(-1)")).should == []
-
- @array.send(@method, eval("(1..-2).step(-2)")).should == []
- @array.send(@method, eval("(1...-2).step(-2)")).should == []
-
- @array.send(@method, eval("(1..-2).step(-10)")).should == []
- @array.send(@method, eval("(1...-2).step(-10)")).should == []
-
- # start with negative index, end with positive index
- @array.send(@method, eval("(-4..4).step(-1)")).should == []
- @array.send(@method, eval("(-4...4).step(-1)")).should == []
-
- @array.send(@method, eval("(-4..4).step(-2)")).should == []
- @array.send(@method, eval("(-4...4).step(-2)")).should == []
-
- @array.send(@method, eval("(-4..4).step(-10)")).should == []
- @array.send(@method, eval("(-4...4).step(-10)")).should == []
-
- # start with negative index, end with negative index
- @array.send(@method, eval("(-4..-2).step(-1)")).should == []
- @array.send(@method, eval("(-4...-2).step(-1)")).should == []
-
- @array.send(@method, eval("(-4..-2).step(-2)")).should == []
- @array.send(@method, eval("(-4...-2).step(-2)")).should == []
-
- @array.send(@method, eval("(-4..-2).step(-10)")).should == []
- @array.send(@method, eval("(-4...-2).step(-10)")).should == []
- end
-
- it "has inverted closed range and positive steps" do
- # start and end with positive index
- @array.send(@method, eval("(3..1).step(1)")).should == []
- @array.send(@method, eval("(3...1).step(1)")).should == []
-
- @array.send(@method, eval("(3..1).step(2)")).should == []
- @array.send(@method, eval("(3...1).step(2)")).should == []
-
- @array.send(@method, eval("(3..1).step(10)")).should == []
- @array.send(@method, eval("(3...1).step(10)")).should == []
-
- # start with negative index, end with positive index
- @array.send(@method, eval("(-2..1).step(1)")).should == []
- @array.send(@method, eval("(-2...1).step(1)")).should == []
-
- @array.send(@method, eval("(-2..1).step(2)")).should == []
- @array.send(@method, eval("(-2...1).step(2)")).should == []
-
- @array.send(@method, eval("(-2..1).step(10)")).should == []
- @array.send(@method, eval("(-2...1).step(10)")).should == []
-
- # start with positive index, end with negative index
- @array.send(@method, eval("(4..-4).step(1)")).should == []
- @array.send(@method, eval("(4...-4).step(1)")).should == []
-
- @array.send(@method, eval("(4..-4).step(2)")).should == []
- @array.send(@method, eval("(4...-4).step(2)")).should == []
-
- @array.send(@method, eval("(4..-4).step(10)")).should == []
- @array.send(@method, eval("(4...-4).step(10)")).should == []
-
- # start with negative index, end with negative index
- @array.send(@method, eval("(-2..-4).step(1)")).should == []
- @array.send(@method, eval("(-2...-4).step(1)")).should == []
-
- @array.send(@method, eval("(-2..-4).step(2)")).should == []
- @array.send(@method, eval("(-2...-4).step(2)")).should == []
-
- @array.send(@method, eval("(-2..-4).step(10)")).should == []
- @array.send(@method, eval("(-2...-4).step(10)")).should == []
- end
-
- it "has range with bounds outside of array" do
- # end is equal to array's length
- @array.send(@method, (0..6).step(1)).should == [0, 1, 2, 3, 4, 5]
- -> { @array.send(@method, (0..6).step(2)) }.should raise_error(RangeError)
-
- # end is greater than length with positive steps
- @array.send(@method, (1..6).step(2)).should == [1, 3, 5]
- @array.send(@method, (2..7).step(2)).should == [2, 4]
- -> { @array.send(@method, (2..8).step(2)) }.should raise_error(RangeError)
-
- # begin is greater than length with negative steps
- @array.send(@method, (6..1).step(-2)).should == [5, 3, 1]
- @array.send(@method, (7..2).step(-2)).should == [5, 3]
- -> { @array.send(@method, (8..2).step(-2)) }.should raise_error(RangeError)
- end
-
- it "has endless range with start outside of array's bounds" do
- @array.send(@method, eval("(6..).step(1)")).should == []
- @array.send(@method, eval("(7..).step(1)")).should == nil
-
- @array.send(@method, eval("(6..).step(2)")).should == []
- -> { @array.send(@method, eval("(7..).step(2)")) }.should raise_error(RangeError)
- end
- end
- end
-
- it "can accept beginless ranges" do
- a = [0, 1, 2, 3, 4, 5]
- a.send(@method, (..3)).should == [0, 1, 2, 3]
- a.send(@method, (...3)).should == [0, 1, 2]
- a.send(@method, (..-3)).should == [0, 1, 2, 3]
- a.send(@method, (...-3)).should == [0, 1, 2]
- a.send(@method, (..0)).should == [0]
- a.send(@method, (...0)).should == []
- a.send(@method, (..9)).should == [0, 1, 2, 3, 4, 5]
- a.send(@method, (...9)).should == [0, 1, 2, 3, 4, 5]
- a.send(@method, (..-9)).should == []
- a.send(@method, (...-9)).should == []
- end
-
- ruby_version_is "3.2" do
- describe "can be sliced with Enumerator::ArithmeticSequence" do
- it "with infinite/inverted ranges and negative steps" do
- @array = [0, 1, 2, 3, 4, 5]
- @array.send(@method, (2..).step(-1)).should == [2, 1, 0]
- @array.send(@method, (2..).step(-2)).should == [2, 0]
- @array.send(@method, (2..).step(-3)).should == [2]
- @array.send(@method, (2..).step(-4)).should == [2]
-
- @array.send(@method, (-3..).step(-1)).should == [3, 2, 1, 0]
- @array.send(@method, (-3..).step(-2)).should == [3, 1]
- @array.send(@method, (-3..).step(-3)).should == [3, 0]
- @array.send(@method, (-3..).step(-4)).should == [3]
- @array.send(@method, (-3..).step(-5)).should == [3]
-
- @array.send(@method, (..0).step(-1)).should == [5, 4, 3, 2, 1, 0]
- @array.send(@method, (..0).step(-2)).should == [5, 3, 1]
- @array.send(@method, (..0).step(-3)).should == [5, 2]
- @array.send(@method, (..0).step(-4)).should == [5, 1]
- @array.send(@method, (..0).step(-5)).should == [5, 0]
- @array.send(@method, (..0).step(-6)).should == [5]
- @array.send(@method, (..0).step(-7)).should == [5]
-
- @array.send(@method, (...0).step(-1)).should == [5, 4, 3, 2, 1]
- @array.send(@method, (...0).step(-2)).should == [5, 3, 1]
- @array.send(@method, (...0).step(-3)).should == [5, 2]
- @array.send(@method, (...0).step(-4)).should == [5, 1]
- @array.send(@method, (...0).step(-5)).should == [5]
- @array.send(@method, (...0).step(-6)).should == [5]
-
- @array.send(@method, (...1).step(-1)).should == [5, 4, 3, 2]
- @array.send(@method, (...1).step(-2)).should == [5, 3]
- @array.send(@method, (...1).step(-3)).should == [5, 2]
- @array.send(@method, (...1).step(-4)).should == [5]
- @array.send(@method, (...1).step(-5)).should == [5]
-
- @array.send(@method, (..-5).step(-1)).should == [5, 4, 3, 2, 1]
- @array.send(@method, (..-5).step(-2)).should == [5, 3, 1]
- @array.send(@method, (..-5).step(-3)).should == [5, 2]
- @array.send(@method, (..-5).step(-4)).should == [5, 1]
- @array.send(@method, (..-5).step(-5)).should == [5]
- @array.send(@method, (..-5).step(-6)).should == [5]
-
- @array.send(@method, (...-5).step(-1)).should == [5, 4, 3, 2]
- @array.send(@method, (...-5).step(-2)).should == [5, 3]
- @array.send(@method, (...-5).step(-3)).should == [5, 2]
- @array.send(@method, (...-5).step(-4)).should == [5]
- @array.send(@method, (...-5).step(-5)).should == [5]
-
- @array.send(@method, (4..1).step(-1)).should == [4, 3, 2, 1]
- @array.send(@method, (4..1).step(-2)).should == [4, 2]
- @array.send(@method, (4..1).step(-3)).should == [4, 1]
- @array.send(@method, (4..1).step(-4)).should == [4]
- @array.send(@method, (4..1).step(-5)).should == [4]
-
- @array.send(@method, (4...1).step(-1)).should == [4, 3, 2]
- @array.send(@method, (4...1).step(-2)).should == [4, 2]
- @array.send(@method, (4...1).step(-3)).should == [4]
- @array.send(@method, (4...1).step(-4)).should == [4]
-
- @array.send(@method, (-2..1).step(-1)).should == [4, 3, 2, 1]
- @array.send(@method, (-2..1).step(-2)).should == [4, 2]
- @array.send(@method, (-2..1).step(-3)).should == [4, 1]
- @array.send(@method, (-2..1).step(-4)).should == [4]
- @array.send(@method, (-2..1).step(-5)).should == [4]
-
- @array.send(@method, (-2...1).step(-1)).should == [4, 3, 2]
- @array.send(@method, (-2...1).step(-2)).should == [4, 2]
- @array.send(@method, (-2...1).step(-3)).should == [4]
- @array.send(@method, (-2...1).step(-4)).should == [4]
-
- @array.send(@method, (4..-5).step(-1)).should == [4, 3, 2, 1]
- @array.send(@method, (4..-5).step(-2)).should == [4, 2]
- @array.send(@method, (4..-5).step(-3)).should == [4, 1]
- @array.send(@method, (4..-5).step(-4)).should == [4]
- @array.send(@method, (4..-5).step(-5)).should == [4]
-
- @array.send(@method, (4...-5).step(-1)).should == [4, 3, 2]
- @array.send(@method, (4...-5).step(-2)).should == [4, 2]
- @array.send(@method, (4...-5).step(-3)).should == [4]
- @array.send(@method, (4...-5).step(-4)).should == [4]
-
- @array.send(@method, (-2..-5).step(-1)).should == [4, 3, 2, 1]
- @array.send(@method, (-2..-5).step(-2)).should == [4, 2]
- @array.send(@method, (-2..-5).step(-3)).should == [4, 1]
- @array.send(@method, (-2..-5).step(-4)).should == [4]
- @array.send(@method, (-2..-5).step(-5)).should == [4]
-
- @array.send(@method, (-2...-5).step(-1)).should == [4, 3, 2]
- @array.send(@method, (-2...-5).step(-2)).should == [4, 2]
- @array.send(@method, (-2...-5).step(-3)).should == [4]
- @array.send(@method, (-2...-5).step(-4)).should == [4]
- end
- end
- end
-
- it "can accept nil...nil ranges" do
- a = [0, 1, 2, 3, 4, 5]
- a.send(@method, eval("(nil...nil)")).should == a
- a.send(@method, (...nil)).should == a
- a.send(@method, eval("(nil..)")).should == a
- end
-end
70365cd5315f608c46e4a1ffde89726a00'>benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_raise1.rb18
-rw-r--r--benchmark/bm_vm2_raise2.rb18
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_struct_big_aref_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aref_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aref.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aset.rb7
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rwxr-xr-xbenchmark/bm_vm3_gc.rb7
-rw-r--r--benchmark/bm_vm_thread_alive_check1.rb6
-rw-r--r--benchmark/bm_vm_thread_mutex1.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex2.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex3.rb20
-rw-r--r--benchmark/bm_vm_thread_pass.rb15
-rw-r--r--benchmark/bm_vm_thread_pass_flood.rb8
-rw-r--r--benchmark/bm_vm_thread_pipe.rb17
-rw-r--r--benchmark/bm_vm_thread_queue.rb18
-rw-r--r--benchmark/cgi_escape_html.yml40
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/driver.rb321
-rw-r--r--benchmark/enum_lazy_flat_map.yml16
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/enum_lazy_zip.yml22
-rw-r--r--benchmark/erb_render.yml24
-rw-r--r--benchmark/fiber_chain.yml36
-rw-r--r--benchmark/fiber_locals.yml8
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/gc/aobench.rb2
-rw-r--r--benchmark/gc/binary_trees.rb2
-rw-r--r--benchmark/gc/gcbench.rb3
-rw-r--r--benchmark/gc/pentomino.rb2
-rw-r--r--benchmark/hash_aref_dsym.rb4
-rw-r--r--benchmark/hash_aref_dsym_long.rb21
-rw-r--r--benchmark/hash_aref_fix.rb4
-rw-r--r--benchmark/hash_aref_flo.rb (renamed from benchmark/bm_hash_aref_flo.rb)0
-rw-r--r--benchmark/hash_aref_miss.rb (renamed from benchmark/bm_hash_aref_miss.rb)0
-rw-r--r--benchmark/hash_aref_str.rb (renamed from benchmark/bm_hash_aref_str.rb)0
-rw-r--r--benchmark/hash_aref_sym.rb (renamed from benchmark/bm_hash_aref_sym.rb)0
-rw-r--r--benchmark/hash_aref_sym_long.rb (renamed from benchmark/bm_hash_aref_sym_long.rb)0
-rw-r--r--benchmark/hash_defaults.yml6
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_flatten.rb (renamed from benchmark/bm_hash_flatten.rb)0
-rw-r--r--benchmark/hash_ident_flo.rb (renamed from benchmark/bm_hash_ident_flo.rb)0
-rw-r--r--benchmark/hash_ident_num.rb (renamed from benchmark/bm_hash_ident_num.rb)0
-rw-r--r--benchmark/hash_ident_obj.rb (renamed from benchmark/bm_hash_ident_obj.rb)0
-rw-r--r--benchmark/hash_ident_str.rb (renamed from benchmark/bm_hash_ident_str.rb)0
-rw-r--r--benchmark/hash_ident_sym.rb (renamed from benchmark/bm_hash_ident_sym.rb)0
-rw-r--r--benchmark/hash_keys.rb (renamed from benchmark/bm_hash_keys.rb)0
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_shift.rb (renamed from benchmark/bm_hash_shift.rb)0
-rw-r--r--benchmark/hash_shift_u16.rb10
-rw-r--r--benchmark/hash_shift_u24.rb10
-rw-r--r--benchmark/hash_shift_u32.rb10
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb9
-rw-r--r--benchmark/hash_values.rb (renamed from benchmark/bm_hash_values.rb)0
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb (renamed from benchmark/bm_io_file_create.rb)0
-rw-r--r--benchmark/io_file_read.rb (renamed from benchmark/bm_io_file_read.rb)0
-rw-r--r--benchmark/io_file_write.rb (renamed from benchmark/bm_io_file_write.rb)0
-rw-r--r--benchmark/io_nonblock_noex.rb22
-rw-r--r--benchmark/io_nonblock_noex2.rb21
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb (renamed from benchmark/bm_io_select.rb)0
-rw-r--r--benchmark/io_select2.rb (renamed from benchmark/bm_io_select2.rb)0
-rw-r--r--benchmark/io_select3.rb (renamed from benchmark/bm_io_select3.rb)0
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/kernel_clone.yml6
-rw-r--r--benchmark/kernel_float.yml5
-rw-r--r--benchmark/kernel_tap.yml6
-rw-r--r--benchmark/kernel_then.yml6
-rw-r--r--benchmark/keyword_arguments.yml13
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit.rb34
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit_exec.rb237
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_for.rb (renamed from benchmark/bm_loop_for.rb)0
-rw-r--r--benchmark/loop_generator.rb (renamed from benchmark/bm_loop_generator.rb)0
-rw-r--r--benchmark/loop_times.rb (renamed from benchmark/bm_loop_times.rb)0
-rw-r--r--benchmark/loop_whileloop.rb (renamed from benchmark/bm_loop_whileloop.rb)0
-rw-r--r--benchmark/loop_whileloop2.rb (renamed from benchmark/bm_loop_whileloop2.rb)0
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/marshal_dump_flo.rb (renamed from benchmark/bm_marshal_dump_flo.rb)0
-rw-r--r--benchmark/marshal_dump_load_geniv.rb10
-rw-r--r--benchmark/marshal_dump_load_time.rb1
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/mjit_exec_jt2jt.yml6
-rw-r--r--benchmark/mjit_exec_vm2jt.yml6
-rw-r--r--benchmark/mjit_exec_vm2vm.yml6
-rw-r--r--benchmark/mjit_exivar.yml18
-rw-r--r--benchmark/mjit_integer.yml30
-rw-r--r--benchmark/mjit_kernel.yml20
-rw-r--r--benchmark/mjit_leave.yml8
-rw-r--r--benchmark/mjit_opt_cc_insns.yml27
-rw-r--r--benchmark/mjit_struct_aref.yml10
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/num_zero_p.yml8
-rw-r--r--benchmark/object_allocate.yml21
-rw-r--r--benchmark/objspace_dump_all.yml13
-rw-r--r--benchmark/other-lang/fact.py2
-rw-r--r--benchmark/pm_array.yml19
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/realpath.yml30
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/securerandom.rb (renamed from benchmark/bm_securerandom.rb)0
-rw-r--r--benchmark/so_ackermann.rb19
-rw-r--r--benchmark/so_array.rb23
-rw-r--r--benchmark/so_binary_trees.rb (renamed from benchmark/bm_so_binary_trees.rb)0
-rw-r--r--benchmark/so_concatenate.rb18
-rw-r--r--benchmark/so_count_words.yml65
-rw-r--r--benchmark/so_exception.rb61
-rw-r--r--benchmark/so_fannkuch.rb (renamed from benchmark/bm_so_fannkuch.rb)0
-rw-r--r--benchmark/so_fasta.rb81
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb (renamed from benchmark/bm_so_lists.rb)0
-rw-r--r--benchmark/so_mandelbrot.rb (renamed from benchmark/bm_so_mandelbrot.rb)0
-rw-r--r--benchmark/so_matrix.rb48
-rw-r--r--benchmark/so_meteor_contest.rb563
-rw-r--r--benchmark/so_nbody.rb (renamed from benchmark/bm_so_nbody.rb)0
-rw-r--r--benchmark/so_nested_loop.rb24
-rw-r--r--benchmark/so_nsieve.rb (renamed from benchmark/bm_so_nsieve.rb)0
-rw-r--r--benchmark/so_nsieve_bits.rb (renamed from benchmark/bm_so_nsieve_bits.rb)0
-rw-r--r--benchmark/so_object.rb56
-rw-r--r--benchmark/so_partial_sums.rb (renamed from benchmark/bm_so_partial_sums.rb)0
-rw-r--r--benchmark/so_pidigits.rb92
-rw-r--r--benchmark/so_random.rb (renamed from benchmark/bm_so_random.rb)0
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb (renamed from benchmark/bm_so_sieve.rb)0
-rw-r--r--benchmark/so_spectralnorm.rb (renamed from benchmark/bm_so_spectralnorm.rb)0
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_casecmp.yml26
-rw-r--r--benchmark/string_casecmp_p.yml26
-rw-r--r--benchmark/string_downcase.yml18
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_slice.yml11
-rw-r--r--benchmark/string_split.yml22
-rw-r--r--benchmark/string_swapcase.yml18
-rw-r--r--benchmark/string_upcase.yml18
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/vm_array.yml4
-rw-r--r--benchmark/vm_attr_ivar.yml14
-rw-r--r--benchmark/vm_attr_ivar_set.yml14
-rw-r--r--benchmark/vm_backtrace.rb (renamed from benchmark/bm_vm3_backtrace.rb)0
-rw-r--r--benchmark/vm_bigarray.yml105
-rw-r--r--benchmark/vm_bighash.yml4
-rw-r--r--benchmark/vm_block.yml9
-rw-r--r--benchmark/vm_block_handler.yml27
-rw-r--r--benchmark/vm_blockparam.yml7
-rw-r--r--benchmark/vm_blockparam_call.yml8
-rw-r--r--benchmark/vm_blockparam_pass.yml12
-rw-r--r--benchmark/vm_blockparam_yield.yml8
-rw-r--r--benchmark/vm_case.yml13
-rw-r--r--benchmark/vm_case_lit.yml23
-rw-r--r--benchmark/vm_clearmethodcache.rb (renamed from benchmark/bm_vm3_clearmethodcache.rb)0
-rw-r--r--benchmark/vm_const.yml7
-rw-r--r--benchmark/vm_defined_method.yml8
-rw-r--r--benchmark/vm_dstr.yml6
-rw-r--r--benchmark/vm_ensure.yml14
-rw-r--r--benchmark/vm_eval.yml4
-rw-r--r--benchmark/vm_fiber_allocate.yml8
-rw-r--r--benchmark/vm_fiber_count.yml10
-rw-r--r--benchmark/vm_fiber_reuse.yml14
-rw-r--r--benchmark/vm_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm_fiber_switch.yml9
-rw-r--r--benchmark/vm_float_simple.yml8
-rw-r--r--benchmark/vm_freezestring.yml10
-rw-r--r--benchmark/vm_gc.rb6
-rw-r--r--benchmark/vm_gc_old_full.rb4
-rw-r--r--benchmark/vm_gc_old_immediate.rb4
-rw-r--r--benchmark/vm_gc_old_lazy.rb4
-rw-r--r--benchmark/vm_gc_short_lived.yml9
-rw-r--r--benchmark/vm_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm_gc_short_with_long.yml13
-rw-r--r--benchmark/vm_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm_gc_wb_ary.yml12
-rw-r--r--benchmark/vm_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm_gc_wb_obj.yml15
-rw-r--r--benchmark/vm_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm_iclass_super.yml20
-rw-r--r--benchmark/vm_ivar.yml6
-rw-r--r--benchmark/vm_ivar_init.yml14
-rw-r--r--benchmark/vm_ivar_set.yml5
-rw-r--r--benchmark/vm_ivar_set_subclass.yml17
-rw-r--r--benchmark/vm_length.yml8
-rw-r--r--benchmark/vm_lvar_init.yml21
-rw-r--r--benchmark/vm_lvar_set.yml4
-rw-r--r--benchmark/vm_method.yml8
-rw-r--r--benchmark/vm_method_missing.yml11
-rw-r--r--benchmark/vm_method_with_block.yml8
-rw-r--r--benchmark/vm_module_ann_const_set.yml4
-rw-r--r--benchmark/vm_module_const_set.yml8
-rw-r--r--benchmark/vm_mutex.yml8
-rw-r--r--benchmark/vm_neq.yml7
-rw-r--r--benchmark/vm_newlambda.yml4
-rw-r--r--benchmark/vm_not.yml6
-rw-r--r--benchmark/vm_poly_method.yml24
-rw-r--r--benchmark/vm_poly_method_ov.yml24
-rw-r--r--benchmark/vm_poly_same_method.yml25
-rw-r--r--benchmark/vm_poly_singleton.yml18
-rw-r--r--benchmark/vm_proc.yml12
-rw-r--r--benchmark/vm_raise1.yml16
-rw-r--r--benchmark/vm_raise2.yml16
-rw-r--r--benchmark/vm_regexp.yml8
-rw-r--r--benchmark/vm_rescue.yml6
-rw-r--r--benchmark/vm_send.yml14
-rw-r--r--benchmark/vm_send_cfunc.yml3
-rw-r--r--benchmark/vm_simplereturn.yml7
-rw-r--r--benchmark/vm_string_literal.yml4
-rw-r--r--benchmark/vm_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm_struct_big_aset.yml11
-rw-r--r--benchmark/vm_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm_struct_big_hset.yml11
-rw-r--r--benchmark/vm_struct_small_aref.yml7
-rw-r--r--benchmark/vm_struct_small_aset.yml11
-rw-r--r--benchmark/vm_struct_small_href.yml7
-rw-r--r--benchmark/vm_struct_small_hset.yml7
-rw-r--r--benchmark/vm_super.yml17
-rw-r--r--benchmark/vm_swap.yml7
-rw-r--r--benchmark/vm_symbol_block_pass.rb13
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb (renamed from benchmark/bm_vm_thread_close.rb)0
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb (renamed from benchmark/bm_vm_thread_create_join.rb)0
-rw-r--r--benchmark/vm_thread_mutex1.rb21
-rw-r--r--benchmark/vm_thread_mutex2.rb21
-rw-r--r--benchmark/vm_thread_mutex3.rb20
-rw-r--r--benchmark/vm_thread_pass.rb15
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb17
-rw-r--r--benchmark/vm_thread_queue.rb18
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--benchmark/vm_unif1.yml7
-rw-r--r--benchmark/vm_yield.yml13
-rw-r--r--benchmark/vm_zsuper.yml18
-rw-r--r--benchmark/wc.input.base25
-rw-r--r--bignum.c1655
-rwxr-xr-xbin/bundle27
-rwxr-xr-xbin/bundler27
-rwxr-xr-xbin/erb188
-rwxr-xr-xbin/irb28
-rwxr-xr-xbin/racc27
-rwxr-xr-xbin/rake33
-rwxr-xr-xbin/rdoc53
-rwxr-xr-xbin/ri31
-rw-r--r--bootstraptest/pending.rb24
-rwxr-xr-xbootstraptest/runner.rb109
-rw-r--r--bootstraptest/test_env.rb12
-rw-r--r--bootstraptest/test_eval.rb13
-rw-r--r--bootstraptest/test_exception.rb2
-rw-r--r--bootstraptest/test_fiber.rb39
-rw-r--r--bootstraptest/test_flow.rb18
-rw-r--r--bootstraptest/test_fork.rb6
-rw-r--r--bootstraptest/test_insns.rb439
-rw-r--r--bootstraptest/test_io.rb4
-rw-r--r--bootstraptest/test_jump.rb30
-rw-r--r--bootstraptest/test_literal.rb40
-rw-r--r--bootstraptest/test_literal_suffix.rb6
-rw-r--r--bootstraptest/test_method.rb32
-rw-r--r--bootstraptest/test_objectspace.rb11
-rw-r--r--bootstraptest/test_proc.rb17
-rw-r--r--bootstraptest/test_ractor.rb1444
-rw-r--r--bootstraptest/test_syntax.rb8
-rw-r--r--bootstraptest/test_thread.rb68
-rw-r--r--builtin.c69
-rw-r--r--builtin.h83
-rw-r--r--ccan/list/list.h223
-rw-r--r--class.c1330
-rw-r--r--common.mk14999
-rw-r--r--compar.c191
-rw-r--r--compile.c11172
-rw-r--r--complex.c1304
-rw-r--r--configure.ac4262
-rw-r--r--configure.in4340
-rw-r--r--constant.h34
-rw-r--r--cont.c3291
-rw-r--r--coroutine/Stack.h16
-rw-r--r--coroutine/amd64/Context.S46
-rw-r--r--coroutine/amd64/Context.h54
-rw-r--r--coroutine/arm32/Context.S33
-rw-r--r--coroutine/arm32/Context.h53
-rw-r--r--coroutine/arm64/Context.S62
-rw-r--r--coroutine/arm64/Context.h52
-rw-r--r--coroutine/copy/Context.c162
-rw-r--r--coroutine/copy/Context.h90
-rw-r--r--coroutine/ppc64le/Context.S75
-rw-r--r--coroutine/ppc64le/Context.h51
-rw-r--r--coroutine/ucontext/Context.c22
-rw-r--r--coroutine/ucontext/Context.h70
-rw-r--r--coroutine/win32/Context.S47
-rw-r--r--coroutine/win32/Context.asm55
-rw-r--r--coroutine/win32/Context.h59
-rw-r--r--coroutine/win64/Context.S77
-rw-r--r--coroutine/win64/Context.asm79
-rw-r--r--coroutine/win64/Context.h69
-rw-r--r--coroutine/x86/Context.S42
-rw-r--r--coroutine/x86/Context.h55
-rw-r--r--coverage/README2
-rw-r--r--cygwin/GNUmakefile.in48
-rw-r--r--debug.c454
-rw-r--r--debug_counter.c160
-rw-r--r--debug_counter.h461
-rw-r--r--defs/default_gems4
-rw-r--r--defs/gmake.mk375
-rw-r--r--defs/id.def90
-rw-r--r--defs/keywords4
-rw-r--r--defs/known_errors.def251
-rw-r--r--defs/lex.c.src4
-rw-r--r--defs/opt_insn_unif.def2
-rw-r--r--defs/separated_version.mk38
-rw-r--r--defs/universal.mk5
-rw-r--r--dir.c1877
-rw-r--r--dir.rb136
-rw-r--r--dln.c105
-rw-r--r--dln.h21
-rw-r--r--dln_find.c51
-rw-r--r--dmydln.c3
-rw-r--r--doc/.document2
-rw-r--r--doc/ChangeLog-0.06_to_0.521147
-rw-r--r--doc/ChangeLog-0.50_to_0.60462
-rw-r--r--doc/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog-1.8.04
-rw-r--r--doc/ChangeLog-1.9.310
-rw-r--r--doc/ChangeLog-2.0.06
-rw-r--r--doc/ChangeLog-2.1.06
-rw-r--r--doc/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog-2.3.012187
-rw-r--r--doc/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog-YARV12
-rw-r--r--doc/NEWS-1.8.74
-rw-r--r--doc/NEWS-1.9.24
-rw-r--r--doc/NEWS-2.0.08
-rw-r--r--doc/NEWS-2.2.0359
-rw-r--r--doc/NEWS-2.3.0384
-rw-r--r--doc/NEWS-2.4.0399
-rw-r--r--doc/NEWS-2.5.0565
-rw-r--r--doc/NEWS-2.6.0662
-rw-r--r--doc/NEWS-2.7.0826
-rw-r--r--doc/bug_triaging.rdoc79
-rw-r--r--doc/contributing.rdoc234
-rw-r--r--doc/contributors.rdoc778
-rw-r--r--doc/csv/arguments/io.rdoc5
-rw-r--r--doc/csv/options/common/col_sep.rdoc63
-rw-r--r--doc/csv/options/common/quote_char.rdoc42
-rw-r--r--doc/csv/options/common/row_sep.rdoc100
-rw-r--r--doc/csv/options/generating/force_quotes.rdoc17
-rw-r--r--doc/csv/options/generating/quote_empty.rdoc12
-rw-r--r--doc/csv/options/generating/write_converters.rdoc33
-rw-r--r--doc/csv/options/generating/write_empty_value.rdoc15
-rw-r--r--doc/csv/options/generating/write_headers.rdoc29
-rw-r--r--doc/csv/options/generating/write_nil_value.rdoc14
-rw-r--r--doc/csv/options/parsing/converters.rdoc46
-rw-r--r--doc/csv/options/parsing/empty_value.rdoc13
-rw-r--r--doc/csv/options/parsing/field_size_limit.rdoc39
-rw-r--r--doc/csv/options/parsing/header_converters.rdoc43
-rw-r--r--doc/csv/options/parsing/headers.rdoc63
-rw-r--r--doc/csv/options/parsing/liberal_parsing.rdoc19
-rw-r--r--doc/csv/options/parsing/nil_value.rdoc12
-rw-r--r--doc/csv/options/parsing/return_headers.rdoc22
-rw-r--r--doc/csv/options/parsing/skip_blanks.rdoc31
-rw-r--r--doc/csv/options/parsing/skip_lines.rdoc37
-rw-r--r--doc/csv/options/parsing/strip.rdoc15
-rw-r--r--doc/csv/options/parsing/unconverted_fields.rdoc27
-rw-r--r--doc/csv/recipes/filtering.rdoc156
-rw-r--r--doc/csv/recipes/generating.rdoc244
-rw-r--r--doc/csv/recipes/parsing.rdoc543
-rw-r--r--doc/csv/recipes/recipes.rdoc6
-rw-r--r--doc/dig_methods.rdoc82
-rw-r--r--doc/dtrace_probes.rdoc88
-rw-r--r--doc/etc.rd.ja75
-rw-r--r--doc/extension.ja.rdoc1845
-rw-r--r--doc/extension.rdoc2180
-rw-r--r--doc/fiber.md191
-rw-r--r--doc/globals.rdoc89
-rw-r--r--doc/implicit_conversion.rdoc198
-rw-r--r--doc/irb/irb.rd.ja80
-rw-r--r--doc/keywords.rdoc10
-rw-r--r--doc/maintainers.rdoc459
-rw-r--r--doc/make_cheatsheet.md124
-rw-r--r--doc/marshal.rdoc6
-rw-r--r--doc/memory_view.md167
-rw-r--r--doc/method_documentation.rdoc183
-rw-r--r--doc/ractor.md931
-rw-r--r--doc/regexp.rdoc65
-rw-r--r--doc/security.rdoc55
-rw-r--r--doc/shell.rd.ja335
-rw-r--r--doc/signals.rdoc106
-rw-r--r--doc/standard_library.rdoc86
-rw-r--r--doc/syntax.rdoc7
-rw-r--r--doc/syntax/assignment.rdoc36
-rw-r--r--doc/syntax/calling_methods.rdoc108
-rw-r--r--doc/syntax/comments.rdoc253
-rw-r--r--doc/syntax/control_expressions.rdoc109
-rw-r--r--doc/syntax/exceptions.rdoc16
-rw-r--r--doc/syntax/literals.rdoc118
-rw-r--r--doc/syntax/methods.rdoc239
-rw-r--r--doc/syntax/miscellaneous.rdoc41
-rw-r--r--doc/syntax/modules_and_classes.rdoc43
-rw-r--r--doc/syntax/pattern_matching.rdoc503
-rw-r--r--doc/syntax/precedence.rdoc6
-rw-r--r--doc/syntax/refinements.rdoc121
-rw-r--r--doc/yarvarch.en (renamed from template/yarvarch.en)0
-rw-r--r--doc/yarvarch.ja (renamed from template/yarvarch.ja)0
-rw-r--r--enc/Makefile.in17
-rw-r--r--enc/ascii.c12
-rw-r--r--enc/big5.c3
-rw-r--r--enc/cesu_8.c454
-rw-r--r--enc/cp949.c3
-rw-r--r--enc/depend6296
-rw-r--r--enc/ebcdic.h11
-rw-r--r--enc/emacs_mule.c3
-rw-r--r--enc/encdb.c2
-rw-r--r--enc/euc_jp.c11
-rw-r--r--enc/euc_kr.c26
-rw-r--r--enc/euc_tw.c1
-rw-r--r--enc/gb18030.c2
-rw-r--r--enc/gb2312.c4
-rw-r--r--enc/gbk.c1
-rw-r--r--enc/iso_2022_jp.h2
-rw-r--r--enc/iso_8859.h1
-rw-r--r--enc/iso_8859_1.c55
-rw-r--r--enc/iso_8859_10.c58
-rw-r--r--enc/iso_8859_11.c3
-rw-r--r--enc/iso_8859_13.c72
-rw-r--r--enc/iso_8859_14.c67
-rw-r--r--enc/iso_8859_15.c64
-rw-r--r--enc/iso_8859_16.c66
-rw-r--r--enc/iso_8859_2.c53
-rw-r--r--enc/iso_8859_3.c67
-rw-r--r--enc/iso_8859_4.c56
-rw-r--r--enc/iso_8859_5.c33
-rw-r--r--enc/iso_8859_6.c3
-rw-r--r--enc/iso_8859_7.c65
-rw-r--r--enc/iso_8859_8.c3
-rw-r--r--enc/iso_8859_9.c79
-rw-r--r--enc/jis/props.h227
-rw-r--r--enc/jis/props.h.blt56
-rw-r--r--enc/jis/props.kwd6
-rw-r--r--enc/jis/props.src6
-rw-r--r--enc/koi8_r.c2
-rw-r--r--enc/koi8_u.c1
-rwxr-xr-xenc/make_encmake.rb32
-rw-r--r--enc/mktable.c42
-rw-r--r--enc/prelude.rb4
-rw-r--r--enc/shift_jis.c530
-rw-r--r--enc/shift_jis.h546
-rw-r--r--enc/trans/GB/GB12345%UCS.src61
-rw-r--r--enc/trans/GB/GB2312%UCS.src75
-rw-r--r--enc/trans/GB/UCS%GB12345.src61
-rw-r--r--enc/trans/GB/UCS%GB2312.src75
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src2
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src2
-rw-r--r--enc/trans/cesu_8.trans85
-rw-r--r--enc/trans/ebcdic.trans278
-rw-r--r--enc/trans/escape.trans3
-rw-r--r--enc/trans/ibm720-tbl.rb122
-rw-r--r--enc/trans/newline.trans10
-rw-r--r--enc/trans/single_byte.trans12
-rw-r--r--enc/trans/windows-1255-tbl.rb3
-rw-r--r--enc/unicode.c331
-rw-r--r--enc/unicode/12.1.0/casefold.h7428
-rw-r--r--enc/unicode/12.1.0/name2ctype.h41810
-rw-r--r--[-rwxr-xr-x]enc/unicode/case-folding.rb258
-rw-r--r--enc/unicode/casefold.h5619
-rw-r--r--enc/unicode/name2ctype.h32679
-rw-r--r--enc/unicode/name2ctype.h.blt28722
-rw-r--r--enc/unicode/name2ctype.kwd26550
-rw-r--r--enc/unicode/name2ctype.src26550
-rw-r--r--enc/us_ascii.c10
-rw-r--r--enc/utf_16_32.h2
-rw-r--r--enc/utf_16be.c4
-rw-r--r--enc/utf_16le.c4
-rw-r--r--enc/utf_32be.c23
-rw-r--r--enc/utf_32le.c22
-rw-r--r--enc/utf_7.h2
-rw-r--r--enc/utf_8.c38
-rw-r--r--enc/windows_1250.c59
-rw-r--r--enc/windows_1251.c49
-rw-r--r--enc/windows_1252.c55
-rw-r--r--enc/windows_1253.c297
-rw-r--r--enc/windows_1254.c302
-rw-r--r--enc/windows_1257.c304
-rw-r--r--enc/windows_31j.c9
-rw-r--r--enc/x_emoji.h4
-rw-r--r--encindex.h70
-rw-r--r--encoding.c944
-rw-r--r--enum.c1776
-rw-r--r--enumerator.c2845
-rw-r--r--error.c1892
-rw-r--r--eval.c1426
-rw-r--r--eval_error.c534
-rw-r--r--eval_intern.h237
-rw-r--r--eval_jump.c37
-rw-r--r--ext/-test-/RUBY_ALIGNOF/c.c15
-rw-r--r--ext/-test-/RUBY_ALIGNOF/cpp.cpp9
-rw-r--r--ext/-test-/RUBY_ALIGNOF/depend163
-rw-r--r--ext/-test-/RUBY_ALIGNOF/extconf.rb6
-rw-r--r--ext/-test-/arith_seq/extract/depend162
-rw-r--r--ext/-test-/arith_seq/extract/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/extract.c27
-rw-r--r--ext/-test-/array/concat/depend322
-rw-r--r--ext/-test-/array/concat/extconf.rb2
-rw-r--r--ext/-test-/array/concat/to_ary_conact.c34
-rw-r--r--ext/-test-/array/resize/depend162
-rw-r--r--ext/-test-/array/resize/extconf.rb1
-rw-r--r--ext/-test-/auto_ext.rb10
-rw-r--r--ext/-test-/bignum/big2str.c2
-rw-r--r--ext/-test-/bignum/bigzero.c2
-rw-r--r--ext/-test-/bignum/depend1101
-rw-r--r--ext/-test-/bignum/div.c2
-rw-r--r--ext/-test-/bignum/extconf.rb10
-rw-r--r--ext/-test-/bignum/intpack.c2
-rw-r--r--ext/-test-/bignum/mul.c6
-rw-r--r--ext/-test-/bignum/str2big.c2
-rw-r--r--ext/-test-/bug-14834/bug-14384.c39
-rw-r--r--ext/-test-/bug-14834/depend163
-rw-r--r--ext/-test-/bug-14834/extconf.rb2
-rw-r--r--ext/-test-/bug-3571/bug.c4
-rw-r--r--ext/-test-/bug-3571/depend163
-rw-r--r--ext/-test-/bug-3571/extconf.rb3
-rw-r--r--ext/-test-/bug-3662/bug.c16
-rw-r--r--ext/-test-/bug-3662/extconf.rb1
-rw-r--r--ext/-test-/bug-5832/bug.c2
-rw-r--r--ext/-test-/bug-5832/depend163
-rw-r--r--ext/-test-/bug-5832/extconf.rb3
-rw-r--r--ext/-test-/bug_reporter/depend163
-rw-r--r--ext/-test-/bug_reporter/extconf.rb3
-rw-r--r--ext/-test-/class/depend323
-rw-r--r--ext/-test-/class/extconf.rb10
-rw-r--r--ext/-test-/cxxanyargs/cxxanyargs.cpp961
-rw-r--r--ext/-test-/cxxanyargs/depend25
-rw-r--r--ext/-test-/cxxanyargs/extconf.rb42
-rw-r--r--ext/-test-/cxxanyargs/failure.cpp13
-rw-r--r--ext/-test-/cxxanyargs/failurem1.cpp13
-rw-r--r--ext/-test-/debug/depend455
-rw-r--r--ext/-test-/debug/extconf.rb9
-rw-r--r--ext/-test-/dln/empty/depend3
-rw-r--r--ext/-test-/dln/empty/extconf.rb1
-rw-r--r--ext/-test-/enumerator_kw/depend163
-rw-r--r--ext/-test-/enumerator_kw/enumerator_kw.c21
-rw-r--r--ext/-test-/enumerator_kw/extconf.rb1
-rw-r--r--ext/-test-/exception/depend611
-rw-r--r--ext/-test-/exception/enc_raise.c2
-rw-r--r--ext/-test-/exception/ensured.c14
-rw-r--r--ext/-test-/exception/extconf.rb9
-rw-r--r--ext/-test-/fatal/depend163
-rw-r--r--ext/-test-/fatal/extconf.rb1
-rw-r--r--ext/-test-/file/depend457
-rw-r--r--ext/-test-/file/extconf.rb11
-rw-r--r--ext/-test-/file/fs.c34
-rw-r--r--ext/-test-/float/depend329
-rw-r--r--ext/-test-/float/extconf.rb10
-rw-r--r--ext/-test-/funcall/depend163
-rw-r--r--ext/-test-/funcall/extconf.rb3
-rw-r--r--ext/-test-/funcall/funcall.c72
-rw-r--r--ext/-test-/funcall/passing_block.c30
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c76
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend163
-rw-r--r--ext/-test-/gvl/call_without_gvl/extconf.rb2
-rw-r--r--ext/-test-/hash/depend324
-rw-r--r--ext/-test-/hash/extconf.rb10
-rw-r--r--ext/-test-/integer/core_ext.c36
-rw-r--r--ext/-test-/integer/depend494
-rw-r--r--ext/-test-/integer/extconf.rb3
-rw-r--r--ext/-test-/integer/init.c11
-rw-r--r--ext/-test-/integer/my_integer.c16
-rw-r--r--ext/-test-/iseq_load/depend163
-rw-r--r--ext/-test-/iseq_load/extconf.rb3
-rw-r--r--ext/-test-/iter/break.c4
-rw-r--r--ext/-test-/iter/depend485
-rw-r--r--ext/-test-/iter/extconf.rb10
-rw-r--r--ext/-test-/iter/yield.c2
-rw-r--r--ext/-test-/load/dot.dot/depend3
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb3
-rw-r--r--ext/-test-/load/protect/depend163
-rw-r--r--ext/-test-/load/protect/extconf.rb1
-rw-r--r--ext/-test-/load/protect/protect.c19
-rw-r--r--ext/-test-/marshal/compat/depend163
-rw-r--r--ext/-test-/marshal/compat/extconf.rb1
-rw-r--r--ext/-test-/marshal/internal_ivar/depend163
-rw-r--r--ext/-test-/marshal/internal_ivar/extconf.rb2
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c48
-rw-r--r--ext/-test-/marshal/usr/depend163
-rw-r--r--ext/-test-/marshal/usr/extconf.rb1
-rw-r--r--ext/-test-/memory_status/depend163
-rw-r--r--ext/-test-/memory_status/extconf.rb12
-rw-r--r--ext/-test-/memory_status/memory_status.c69
-rw-r--r--ext/-test-/memory_view/depend164
-rw-r--r--ext/-test-/memory_view/extconf.rb3
-rw-r--r--ext/-test-/memory_view/memory_view.c446
-rw-r--r--ext/-test-/method/depend324
-rw-r--r--ext/-test-/method/extconf.rb9
-rw-r--r--ext/-test-/notimplement/bug.c18
-rw-r--r--ext/-test-/notimplement/depend163
-rw-r--r--ext/-test-/notimplement/extconf.rb2
-rw-r--r--ext/-test-/num2int/depend163
-rw-r--r--ext/-test-/num2int/extconf.rb3
-rw-r--r--ext/-test-/path_to_class/depend163
-rw-r--r--ext/-test-/path_to_class/extconf.rb3
-rw-r--r--ext/-test-/popen_deadlock/depend163
-rw-r--r--ext/-test-/popen_deadlock/extconf.rb6
-rw-r--r--ext/-test-/popen_deadlock/infinite_loop_dlsym.c50
-rw-r--r--ext/-test-/postponed_job/depend165
-rw-r--r--ext/-test-/postponed_job/extconf.rb1
-rw-r--r--ext/-test-/postponed_job/postponed_job.c49
-rw-r--r--ext/-test-/printf/depend169
-rw-r--r--ext/-test-/printf/extconf.rb1
-rw-r--r--ext/-test-/printf/printf.c8
-rw-r--r--ext/-test-/proc/depend485
-rw-r--r--ext/-test-/proc/extconf.rb10
-rw-r--r--ext/-test-/random/depend328
-rw-r--r--ext/-test-/random/extconf.rb3
-rw-r--r--ext/-test-/random/init.c11
-rw-r--r--ext/-test-/random/loop.c110
-rw-r--r--ext/-test-/rational/depend168
-rw-r--r--ext/-test-/rational/extconf.rb1
-rw-r--r--ext/-test-/rational/rat.c10
-rw-r--r--ext/-test-/rb_call_super_kw/depend163
-rw-r--r--ext/-test-/rb_call_super_kw/extconf.rb1
-rw-r--r--ext/-test-/rb_call_super_kw/rb_call_super_kw.c14
-rw-r--r--ext/-test-/recursion/depend163
-rw-r--r--ext/-test-/recursion/extconf.rb1
-rw-r--r--ext/-test-/regexp/depend325
-rw-r--r--ext/-test-/regexp/extconf.rb3
-rw-r--r--ext/-test-/regexp/init.c11
-rw-r--r--ext/-test-/regexp/parse_depth_limit.c23
-rw-r--r--ext/-test-/scan_args/depend163
-rw-r--r--ext/-test-/scan_args/extconf.rb1
-rw-r--r--ext/-test-/scan_args/scan_args.c305
-rw-r--r--ext/-test-/st/foreach/depend163
-rw-r--r--ext/-test-/st/foreach/extconf.rb1
-rw-r--r--ext/-test-/st/foreach/foreach.c14
-rw-r--r--ext/-test-/st/numhash/depend163
-rw-r--r--ext/-test-/st/numhash/extconf.rb1
-rw-r--r--ext/-test-/st/numhash/numhash.c7
-rw-r--r--ext/-test-/st/update/depend163
-rw-r--r--ext/-test-/st/update/extconf.rb1
-rw-r--r--ext/-test-/string/capacity.c17
-rw-r--r--ext/-test-/string/coderange.c12
-rw-r--r--ext/-test-/string/cstr.c99
-rw-r--r--ext/-test-/string/depend2516
-rw-r--r--ext/-test-/string/ellipsize.c2
-rw-r--r--ext/-test-/string/enc_associate.c10
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c16
-rw-r--r--ext/-test-/string/extconf.rb10
-rw-r--r--ext/-test-/string/fstring.c30
-rw-r--r--ext/-test-/string/init.c2
-rw-r--r--ext/-test-/string/modify.c2
-rw-r--r--ext/-test-/string/new.c21
-rw-r--r--ext/-test-/string/nofree.c2
-rw-r--r--ext/-test-/string/normalize.c4
-rw-r--r--ext/-test-/string/qsort.c2
-rw-r--r--ext/-test-/string/rb_interned_str.c14
-rw-r--r--ext/-test-/string/rb_str_dup.c35
-rw-r--r--ext/-test-/string/set_len.c2
-rw-r--r--ext/-test-/struct/depend646
-rw-r--r--ext/-test-/struct/extconf.rb10
-rw-r--r--ext/-test-/struct/len.c13
-rw-r--r--ext/-test-/symbol/depend324
-rw-r--r--ext/-test-/symbol/extconf.rb9
-rw-r--r--ext/-test-/symbol/init.c16
-rw-r--r--ext/-test-/thread_fd_close/depend162
-rw-r--r--ext/-test-/thread_fd_close/extconf.rb2
-rw-r--r--ext/-test-/thread_fd_close/thread_fd_close.c14
-rw-r--r--ext/-test-/time/depend489
-rw-r--r--ext/-test-/time/extconf.rb3
-rw-r--r--ext/-test-/time/init.c11
-rw-r--r--ext/-test-/time/leap_second.c14
-rw-r--r--ext/-test-/time/new.c34
-rw-r--r--ext/-test-/tracepoint/depend302
-rw-r--r--ext/-test-/tracepoint/extconf.rb1
-rw-r--r--ext/-test-/tracepoint/gc_hook.c13
-rw-r--r--ext/-test-/typeddata/depend163
-rw-r--r--ext/-test-/typeddata/extconf.rb3
-rw-r--r--ext/-test-/typeddata/typeddata.c26
-rw-r--r--ext/-test-/vm/depend163
-rw-r--r--ext/-test-/wait_for_single_fd/depend152
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb9
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c64
-rw-r--r--ext/-test-/win32/console/attribute.c29
-rw-r--r--ext/-test-/win32/console/extconf.rb9
-rw-r--r--ext/-test-/win32/dln/depend9
-rw-r--r--ext/-test-/win32/dln/extconf.rb42
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb1
-rw-r--r--ext/.document43
-rw-r--r--ext/Setup20
-rw-r--r--ext/Setup.atheos3
-rw-r--r--ext/Setup.emx31
-rw-r--r--ext/Setup.nacl45
-rw-r--r--ext/Setup.nt3
-rw-r--r--ext/bigdecimal/bigdecimal.c1538
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec44
-rw-r--r--ext/bigdecimal/bigdecimal.h96
-rw-r--r--ext/bigdecimal/depend155
-rw-r--r--ext/bigdecimal/extconf.rb53
-rw-r--r--ext/bigdecimal/lib/bigdecimal.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb5
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb19
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb158
-rw-r--r--ext/bigdecimal/sample/linear.rb22
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb11
-rw-r--r--ext/bigdecimal/sample/pi.rb1
-rw-r--r--ext/cgi/escape/depend166
-rw-r--r--ext/cgi/escape/escape.c412
-rw-r--r--ext/cgi/escape/extconf.rb3
-rw-r--r--ext/continuation/depend162
-rw-r--r--ext/continuation/extconf.rb1
-rw-r--r--ext/coverage/coverage.c428
-rw-r--r--ext/coverage/depend183
-rw-r--r--ext/coverage/extconf.rb1
-rw-r--r--ext/coverage/lib/coverage.rb14
-rw-r--r--ext/date/date.gemspec26
-rw-r--r--ext/date/date_core.c2056
-rw-r--r--ext/date/date_parse.c506
-rw-r--r--ext/date/date_strftime.c9
-rw-r--r--ext/date/date_strptime.c88
-rw-r--r--ext/date/date_tmx.h2
-rw-r--r--ext/date/depend618
-rw-r--r--ext/date/extconf.rb10
-rw-r--r--ext/date/lib/date.rb22
-rw-r--r--ext/date/prereq.mk12
-rw-r--r--ext/date/update-abbr52
-rw-r--r--ext/date/zonetab.h1562
-rw-r--r--ext/date/zonetab.list327
-rw-r--r--ext/dbm/dbm.c137
-rw-r--r--ext/dbm/dbm.gemspec21
-rw-r--r--ext/dbm/depend163
-rw-r--r--ext/dbm/extconf.rb7
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c3
-rw-r--r--ext/digest/bubblebabble/depend155
-rw-r--r--ext/digest/bubblebabble/extconf.rb1
-rw-r--r--ext/digest/depend153
-rw-r--r--ext/digest/digest.c125
-rw-r--r--ext/digest/digest.gemspec47
-rw-r--r--ext/digest/digest.h40
-rw-r--r--ext/digest/digest_conf.rb17
-rw-r--r--ext/digest/extconf.rb1
-rw-r--r--ext/digest/lib/digest.rb3
-rw-r--r--ext/digest/md5/depend324
-rw-r--r--ext/digest/md5/extconf.rb13
-rw-r--r--ext/digest/md5/md5cc.h19
-rw-r--r--ext/digest/md5/md5init.c33
-rw-r--r--ext/digest/md5/md5ossl.c9
-rw-r--r--ext/digest/md5/md5ossl.h13
-rw-r--r--ext/digest/rmd160/depend336
-rw-r--r--ext/digest/rmd160/extconf.rb13
-rw-r--r--ext/digest/rmd160/rmd160init.c33
-rw-r--r--ext/digest/rmd160/rmd160ossl.c8
-rw-r--r--ext/digest/rmd160/rmd160ossl.h19
-rw-r--r--ext/digest/sha1/depend334
-rw-r--r--ext/digest/sha1/extconf.rb13
-rw-r--r--ext/digest/sha1/sha1cc.h14
-rw-r--r--ext/digest/sha1/sha1init.c35
-rw-r--r--ext/digest/sha1/sha1ossl.c10
-rw-r--r--ext/digest/sha1/sha1ossl.h20
-rw-r--r--ext/digest/sha2/depend335
-rw-r--r--ext/digest/sha2/extconf.rb14
-rw-r--r--ext/digest/sha2/lib/sha2.rb45
-rw-r--r--ext/digest/sha2/sha2.c2
-rw-r--r--ext/digest/sha2/sha2cc.h31
-rw-r--r--ext/digest/sha2/sha2init.c16
-rw-r--r--ext/digest/sha2/sha2ossl.c13
-rw-r--r--ext/digest/sha2/sha2ossl.h17
-rw-r--r--ext/etc/depend174
-rw-r--r--ext/etc/etc.c127
-rw-r--r--ext/etc/etc.gemspec44
-rw-r--r--ext/etc/extconf.rb15
-rw-r--r--ext/etc/mkconstants.rb17
-rwxr-xr-xext/extmk.rb394
-rw-r--r--ext/fcntl/depend163
-rw-r--r--ext/fcntl/extconf.rb1
-rw-r--r--ext/fcntl/fcntl.c16
-rw-r--r--ext/fcntl/fcntl.gemspec21
-rw-r--r--ext/fiber/depend3
-rw-r--r--ext/fiber/extconf.rb1
-rw-r--r--ext/fiddle/closure.c130
-rw-r--r--ext/fiddle/conversions.c221
-rw-r--r--ext/fiddle/conversions.h21
-rw-r--r--ext/fiddle/depend1354
-rw-r--r--ext/fiddle/extconf.rb170
-rw-r--r--ext/fiddle/extlibs15
-rw-r--r--ext/fiddle/fiddle.c167
-rw-r--r--ext/fiddle/fiddle.gemspec66
-rw-r--r--ext/fiddle/fiddle.h128
-rw-r--r--ext/fiddle/function.c399
-rw-r--r--ext/fiddle/handle.c27
-rw-r--r--ext/fiddle/lib/fiddle.rb17
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb1
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb240
-rw-r--r--ext/fiddle/lib/fiddle/function.rb6
-rw-r--r--ext/fiddle/lib/fiddle/import.rb36
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb24
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb311
-rw-r--r--ext/fiddle/lib/fiddle/types.rb36
-rw-r--r--ext/fiddle/lib/fiddle/value.rb28
-rw-r--r--ext/fiddle/lib/fiddle/version.rb3
-rw-r--r--ext/fiddle/memory_view.c254
-rw-r--r--ext/fiddle/pinned.c123
-rw-r--r--ext/fiddle/pointer.c173
-rw-r--r--[-rwxr-xr-x]ext/fiddle/win32/fficonfig.h0
-rw-r--r--ext/fiddle/win32/libffi-3.2.1-mswin.patch65
-rwxr-xr-xext/fiddle/win32/libffi-config.rb3
-rw-r--r--[-rwxr-xr-x]ext/fiddle/win32/libffi.mk.tmpl0
-rw-r--r--ext/gdbm/depend163
-rw-r--r--ext/gdbm/extconf.rb1
-rw-r--r--ext/gdbm/gdbm.c60
-rw-r--r--ext/gdbm/gdbm.gemspec21
-rwxr-xr-xext/io/console/buildgem.sh5
-rw-r--r--ext/io/console/console.c1072
-rw-r--r--ext/io/console/depend192
-rw-r--r--ext/io/console/extconf.rb25
-rw-r--r--ext/io/console/io-console.gemspec24
-rw-r--r--ext/io/console/lib/console/size.rb3
-rw-r--r--ext/io/console/win32_vk.chksum1
-rw-r--r--ext/io/console/win32_vk.inc1391
-rw-r--r--ext/io/console/win32_vk.list166
-rw-r--r--ext/io/nonblock/depend171
-rw-r--r--ext/io/nonblock/extconf.rb1
-rw-r--r--ext/io/nonblock/io-nonblock.gemspec25
-rw-r--r--ext/io/nonblock/nonblock.c12
-rw-r--r--ext/io/wait/depend171
-rw-r--r--ext/io/wait/extconf.rb1
-rw-r--r--ext/io/wait/io-wait.gemspec27
-rw-r--r--ext/io/wait/wait.c239
-rw-r--r--ext/json/VERSION1
-rw-r--r--ext/json/depend2
-rw-r--r--ext/json/extconf.rb2
-rw-r--r--ext/json/fbuffer/fbuffer.h3
-rw-r--r--ext/json/generator/depend157
-rw-r--r--ext/json/generator/generator.c404
-rw-r--r--ext/json/generator/generator.h34
-rw-r--r--ext/json/json.gemspec73
-rw-r--r--ext/json/lib/json.rb579
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb5
-rw-r--r--ext/json/lib/json/add/complex.rb12
-rw-r--r--ext/json/lib/json/add/core.rb1
-rw-r--r--ext/json/lib/json/add/date.rb2
-rw-r--r--ext/json/lib/json/add/date_time.rb2
-rw-r--r--ext/json/lib/json/add/exception.rb2
-rw-r--r--ext/json/lib/json/add/ostruct.rb6
-rw-r--r--ext/json/lib/json/add/range.rb2
-rw-r--r--ext/json/lib/json/add/rational.rb11
-rw-r--r--ext/json/lib/json/add/regexp.rb6
-rw-r--r--ext/json/lib/json/add/set.rb29
-rw-r--r--ext/json/lib/json/add/struct.rb2
-rw-r--r--ext/json/lib/json/add/symbol.rb2
-rw-r--r--ext/json/lib/json/add/time.rb4
-rw-r--r--ext/json/lib/json/common.rb545
-rw-r--r--ext/json/lib/json/ext.rb6
-rw-r--r--ext/json/lib/json/generic_object.rb9
-rw-r--r--ext/json/lib/json/version.rb3
-rw-r--r--ext/json/parser/depend156
-rw-r--r--ext/json/parser/extconf.rb26
-rw-r--r--ext/json/parser/parser.c886
-rw-r--r--ext/json/parser/parser.h26
-rw-r--r--ext/json/parser/parser.rl359
-rw-r--r--ext/json/parser/prereq.mk4
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb3
-rw-r--r--ext/mathn/rational/extconf.rb3
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/monitor/depend162
-rw-r--r--ext/monitor/extconf.rb2
-rw-r--r--ext/monitor/lib/monitor.rb284
-rw-r--r--ext/monitor/monitor.c225
-rw-r--r--ext/nkf/depend152
-rw-r--r--ext/nkf/extconf.rb1
-rw-r--r--ext/nkf/lib/kconv.rb1
-rw-r--r--ext/nkf/nkf-utf8/nkf.c60
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c160
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h2
-rw-r--r--ext/nkf/nkf.c10
-rw-r--r--ext/nkf/nkf.gemspec24
-rw-r--r--ext/objspace/depend499
-rw-r--r--ext/objspace/extconf.rb1
-rw-r--r--ext/objspace/lib/objspace.rb91
-rw-r--r--ext/objspace/object_tracing.c129
-rw-r--r--ext/objspace/objspace.c517
-rw-r--r--ext/objspace/objspace_dump.c658
-rw-r--r--ext/openssl/History.md485
-rw-r--r--ext/openssl/depend5151
-rw-r--r--ext/openssl/deprecation.rb21
-rw-r--r--ext/openssl/extconf.rb260
-rw-r--r--ext/openssl/lib/openssl.rb38
-rw-r--r--ext/openssl/lib/openssl/bn.rb13
-rw-r--r--ext/openssl/lib/openssl/buffering.rb117
-rw-r--r--ext/openssl/lib/openssl/cipher.rb48
-rw-r--r--ext/openssl/lib/openssl/config.rb103
-rw-r--r--ext/openssl/lib/openssl/digest.rb47
-rw-r--r--ext/openssl/lib/openssl/hmac.rb13
-rw-r--r--ext/openssl/lib/openssl/marshal.rb30
-rw-r--r--ext/openssl/lib/openssl/pkcs5.rb22
-rw-r--r--ext/openssl/lib/openssl/pkey.rb42
-rw-r--r--ext/openssl/lib/openssl/ssl.rb368
-rw-r--r--ext/openssl/lib/openssl/version.rb5
-rw-r--r--ext/openssl/lib/openssl/x509.rb205
-rw-r--r--ext/openssl/openssl.gemspec27
-rw-r--r--ext/openssl/openssl_missing.c380
-rw-r--r--ext/openssl/openssl_missing.h263
-rw-r--r--ext/openssl/ossl.c648
-rw-r--r--ext/openssl/ossl.h168
-rw-r--r--ext/openssl/ossl_asn1.c988
-rw-r--r--ext/openssl/ossl_asn1.h15
-rw-r--r--ext/openssl/ossl_bio.c75
-rw-r--r--ext/openssl/ossl_bio.h9
-rw-r--r--ext/openssl/ossl_bn.c765
-rw-r--r--ext/openssl/ossl_bn.h11
-rw-r--r--ext/openssl/ossl_cipher.c542
-rw-r--r--ext/openssl/ossl_cipher.h6
-rw-r--r--ext/openssl/ossl_config.c22
-rw-r--r--ext/openssl/ossl_config.h5
-rw-r--r--ext/openssl/ossl_digest.c169
-rw-r--r--ext/openssl/ossl_digest.h6
-rw-r--r--ext/openssl/ossl_engine.c255
-rw-r--r--ext/openssl/ossl_engine.h3
-rw-r--r--ext/openssl/ossl_hmac.c187
-rw-r--r--ext/openssl/ossl_hmac.h3
-rw-r--r--ext/openssl/ossl_kdf.c303
-rw-r--r--ext/openssl/ossl_kdf.h6
-rw-r--r--ext/openssl/ossl_ns_spki.c73
-rw-r--r--ext/openssl/ossl_ns_spki.h4
-rw-r--r--ext/openssl/ossl_ocsp.c1193
-rw-r--r--ext/openssl/ossl_ocsp.h11
-rw-r--r--ext/openssl/ossl_pkcs12.c119
-rw-r--r--ext/openssl/ossl_pkcs12.h4
-rw-r--r--ext/openssl/ossl_pkcs5.c189
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c150
-rw-r--r--ext/openssl/ossl_pkcs7.h20
-rw-r--r--ext/openssl/ossl_pkey.c475
-rw-r--r--ext/openssl/ossl_pkey.h167
-rw-r--r--ext/openssl/ossl_pkey_dh.c322
-rw-r--r--ext/openssl/ossl_pkey_dsa.c301
-rw-r--r--ext/openssl/ossl_pkey_ec.c1316
-rw-r--r--ext/openssl/ossl_pkey_rsa.c545
-rw-r--r--ext/openssl/ossl_rand.c94
-rw-r--r--ext/openssl/ossl_rand.h4
-rw-r--r--ext/openssl/ossl_ssl.c2253
-rw-r--r--ext/openssl/ossl_ssl.h14
-rw-r--r--ext/openssl/ossl_ssl_session.c160
-rw-r--r--ext/openssl/ossl_ts.c1524
-rw-r--r--ext/openssl/ossl_ts.h16
-rw-r--r--ext/openssl/ossl_version.h16
-rw-r--r--ext/openssl/ossl_x509.c184
-rw-r--r--ext/openssl/ossl_x509.h29
-rw-r--r--ext/openssl/ossl_x509attr.c159
-rw-r--r--ext/openssl/ossl_x509cert.c188
-rw-r--r--ext/openssl/ossl_x509crl.c169
-rw-r--r--ext/openssl/ossl_x509ext.c186
-rw-r--r--ext/openssl/ossl_x509name.c228
-rw-r--r--ext/openssl/ossl_x509req.c137
-rw-r--r--ext/openssl/ossl_x509revoked.c109
-rw-r--r--ext/openssl/ossl_x509store.c516
-rw-r--r--ext/openssl/ruby_missing.h20
-rw-r--r--ext/pathname/depend169
-rw-r--r--ext/pathname/extconf.rb3
-rw-r--r--ext/pathname/lib/pathname.rb60
-rw-r--r--ext/pathname/pathname.c440
-rw-r--r--ext/pathname/pathname.gemspec25
-rw-r--r--ext/psych/.gitignore11
-rw-r--r--ext/psych/depend852
-rw-r--r--ext/psych/extconf.rb9
-rw-r--r--ext/psych/lib/psych.rb307
-rw-r--r--ext/psych/lib/psych/class_loader.rb11
-rw-r--r--ext/psych/lib/psych/coder.rb1
-rw-r--r--ext/psych/lib/psych/core_ext.rb20
-rw-r--r--ext/psych/lib/psych/deprecated.rb85
-rw-r--r--ext/psych/lib/psych/exception.rb1
-rw-r--r--ext/psych/lib/psych/handler.rb10
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb1
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb1
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb1
-rw-r--r--ext/psych/lib/psych/json/stream.rb1
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb1
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb1
-rw-r--r--ext/psych/lib/psych/nodes.rb1
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb3
-rw-r--r--ext/psych/lib/psych/nodes/document.rb3
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb3
-rw-r--r--ext/psych/lib/psych/nodes/node.rb24
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb5
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb3
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb3
-rw-r--r--ext/psych/lib/psych/omap.rb1
-rw-r--r--ext/psych/lib/psych/parser.rb1
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb65
-rw-r--r--ext/psych/lib/psych/set.rb1
-rw-r--r--ext/psych/lib/psych/stream.rb1
-rw-r--r--ext/psych/lib/psych/streaming.rb1
-rw-r--r--ext/psych/lib/psych/syntax_error.rb1
-rw-r--r--ext/psych/lib/psych/tree_builder.rb49
-rw-r--r--ext/psych/lib/psych/versions.rb10
-rw-r--r--ext/psych/lib/psych/visitors.rb1
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb1
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb1
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb1
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb97
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb21
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb262
-rw-r--r--ext/psych/lib/psych/y.rb1
-rw-r--r--ext/psych/psych.c9
-rw-r--r--ext/psych/psych.gemspec78
-rw-r--r--ext/psych/psych.h3
-rw-r--r--ext/psych/psych_emitter.c73
-rw-r--r--ext/psych/psych_parser.c128
-rw-r--r--ext/psych/psych_to_ruby.c4
-rw-r--r--ext/psych/psych_yaml_tree.c12
-rw-r--r--ext/psych/yaml/LICENSE19
-rw-r--r--ext/psych/yaml/api.c138
-rw-r--r--ext/psych/yaml/config.h82
-rw-r--r--ext/psych/yaml/dumper.c6
-rw-r--r--ext/psych/yaml/emitter.c81
-rw-r--r--ext/psych/yaml/loader.c339
-rw-r--r--ext/psych/yaml/parser.c17
-rw-r--r--ext/psych/yaml/reader.c6
-rw-r--r--ext/psych/yaml/scanner.c125
-rw-r--r--ext/psych/yaml/yaml.h72
-rw-r--r--ext/psych/yaml/yaml_private.h70
-rw-r--r--ext/pty/depend162
-rw-r--r--ext/pty/extconf.rb8
-rw-r--r--ext/pty/lib/expect.rb10
-rw-r--r--ext/pty/pty.c236
-rw-r--r--ext/racc/cparse/README2
-rw-r--r--ext/racc/cparse/cparse.c48
-rw-r--r--ext/racc/cparse/depend163
-rw-r--r--ext/racc/cparse/extconf.rb7
-rw-r--r--ext/rbconfig/sizeof/depend326
-rw-r--r--ext/rbconfig/sizeof/extconf.rb35
-rw-r--r--ext/readline/.gitignore1
-rw-r--r--ext/readline/depend154
-rw-r--r--ext/readline/depend-gem4
-rw-r--r--ext/readline/extconf.rb12
-rw-r--r--ext/readline/readline-ext.gemspec26
-rw-r--r--ext/readline/readline.c221
-rw-r--r--ext/ripper/depend206
-rw-r--r--ext/ripper/eventids2.c358
-rw-r--r--ext/ripper/extconf.rb11
-rw-r--r--ext/ripper/lib/ripper.rb9
-rw-r--r--ext/ripper/lib/ripper/core.rb24
-rw-r--r--ext/ripper/lib/ripper/filter.rb11
-rw-r--r--ext/ripper/lib/ripper/lexer.rb200
-rw-r--r--ext/ripper/lib/ripper/sexp.rb141
-rw-r--r--ext/ripper/tools/dsl.rb88
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/generate-param-macros.rb1
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/generate.rb14
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/preproc.rb54
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/strip.rb8
-rw-r--r--ext/rubyvm/depend2
-rw-r--r--ext/rubyvm/extconf.rb1
-rw-r--r--ext/rubyvm/lib/forwardable/impl.rb16
-rw-r--r--ext/sdbm/_sdbm.c952
-rw-r--r--ext/sdbm/depend19
-rw-r--r--ext/sdbm/extconf.rb4
-rw-r--r--ext/sdbm/init.c1065
-rw-r--r--ext/sdbm/sdbm.h86
-rw-r--r--ext/socket/ancdata.c294
-rw-r--r--ext/socket/basicsocket.c140
-rw-r--r--ext/socket/constants.c3
-rw-r--r--ext/socket/depend2483
-rw-r--r--ext/socket/extconf.rb40
-rw-r--r--ext/socket/getaddrinfo.c16
-rw-r--r--ext/socket/getnameinfo.c28
-rw-r--r--ext/socket/ifaddr.c93
-rw-r--r--ext/socket/init.c435
-rw-r--r--ext/socket/ipsocket.c85
-rw-r--r--ext/socket/lib/socket.rb614
-rw-r--r--ext/socket/mkconstants.rb32
-rw-r--r--ext/socket/option.c50
-rw-r--r--ext/socket/raddrinfo.c215
-rw-r--r--ext/socket/rubysocket.h134
-rw-r--r--ext/socket/socket.c545
-rw-r--r--ext/socket/sockssocket.c14
-rw-r--r--ext/socket/tcpserver.c46
-rw-r--r--ext/socket/tcpsocket.c45
-rw-r--r--ext/socket/udpsocket.c193
-rw-r--r--ext/socket/unixserver.c45
-rw-r--r--ext/socket/unixsocket.c81
-rw-r--r--ext/stringio/README18
-rw-r--r--ext/stringio/README.md10
-rw-r--r--ext/stringio/depend171
-rw-r--r--ext/stringio/extconf.rb2
-rw-r--r--ext/stringio/stringio.c753
-rw-r--r--ext/stringio/stringio.gemspec31
-rw-r--r--ext/strscan/depend155
-rw-r--r--ext/strscan/extconf.rb4
-rw-r--r--ext/strscan/strscan.c489
-rw-r--r--ext/strscan/strscan.gemspec28
-rw-r--r--ext/syslog/depend151
-rw-r--r--ext/syslog/extconf.rb3
-rw-r--r--ext/syslog/lib/syslog/logger.rb5
-rw-r--r--ext/syslog/syslog.c16
-rw-r--r--ext/syslog/syslog.gemspec23
-rw-r--r--ext/thread/extconf.rb3
-rw-r--r--ext/thread/thread.c656
-rw-r--r--ext/tk/ChangeLog.tkextlib949
-rw-r--r--ext/tk/MANUAL_tcltklib.eng473
-rw-r--r--ext/tk/MANUAL_tcltklib.ja584
-rw-r--r--ext/tk/README.1st19
-rw-r--r--ext/tk/README.ActiveTcl62
-rw-r--r--ext/tk/README.fork34
-rw-r--r--ext/tk/README.macosx-aqua67
-rw-r--r--ext/tk/README.tcltklib152
-rw-r--r--ext/tk/config_list.in41
-rw-r--r--ext/tk/depend2
-rw-r--r--ext/tk/extconf.rb2094
-rw-r--r--ext/tk/lib/README30
-rw-r--r--ext/tk/lib/multi-tk.rb3754
-rw-r--r--ext/tk/lib/remote-tk.rb530
-rw-r--r--ext/tk/lib/tcltk.rb367
-rw-r--r--ext/tk/lib/tk.rb5775
-rw-r--r--ext/tk/lib/tk/after.rb6
-rw-r--r--ext/tk/lib/tk/autoload.rb762
-rw-r--r--ext/tk/lib/tk/bgerror.rb29
-rw-r--r--ext/tk/lib/tk/bindtag.rb138
-rw-r--r--ext/tk/lib/tk/busy.rb118
-rw-r--r--ext/tk/lib/tk/button.rb31
-rw-r--r--ext/tk/lib/tk/canvas.rb846
-rw-r--r--ext/tk/lib/tk/canvastag.rb459
-rw-r--r--ext/tk/lib/tk/checkbutton.rb32
-rw-r--r--ext/tk/lib/tk/clipboard.rb75
-rw-r--r--ext/tk/lib/tk/clock.rb71
-rw-r--r--ext/tk/lib/tk/composite.rb484
-rw-r--r--ext/tk/lib/tk/console.rb52
-rw-r--r--ext/tk/lib/tk/dialog.rb326
-rw-r--r--ext/tk/lib/tk/encodedstr.rb187
-rw-r--r--ext/tk/lib/tk/entry.rb120
-rw-r--r--ext/tk/lib/tk/event.rb562
-rw-r--r--ext/tk/lib/tk/font.rb2351
-rw-r--r--ext/tk/lib/tk/fontchooser.rb180
-rw-r--r--ext/tk/lib/tk/frame.rb132
-rw-r--r--ext/tk/lib/tk/grid.rb279
-rw-r--r--ext/tk/lib/tk/image.rb395
-rw-r--r--ext/tk/lib/tk/itemconfig.rb1222
-rw-r--r--ext/tk/lib/tk/itemfont.rb327
-rw-r--r--ext/tk/lib/tk/kinput.rb71
-rw-r--r--ext/tk/lib/tk/label.rb22
-rw-r--r--ext/tk/lib/tk/labelframe.rb31
-rw-r--r--ext/tk/lib/tk/listbox.rb284
-rw-r--r--ext/tk/lib/tk/macpkg.rb80
-rw-r--r--ext/tk/lib/tk/menu.rb718
-rw-r--r--ext/tk/lib/tk/menubar.rb137
-rw-r--r--ext/tk/lib/tk/menuspec.rb456
-rw-r--r--ext/tk/lib/tk/message.rb24
-rw-r--r--ext/tk/lib/tk/mngfocus.rb33
-rw-r--r--ext/tk/lib/tk/msgcat.rb299
-rw-r--r--ext/tk/lib/tk/namespace.rb546
-rw-r--r--ext/tk/lib/tk/optiondb.rb377
-rw-r--r--ext/tk/lib/tk/optionobj.rb212
-rw-r--r--ext/tk/lib/tk/pack.rb107
-rw-r--r--ext/tk/lib/tk/package.rb143
-rw-r--r--ext/tk/lib/tk/palette.rb55
-rw-r--r--ext/tk/lib/tk/panedwindow.rb260
-rw-r--r--ext/tk/lib/tk/place.rb128
-rw-r--r--ext/tk/lib/tk/radiobutton.rb73
-rw-r--r--ext/tk/lib/tk/root.rb95
-rw-r--r--ext/tk/lib/tk/scale.rb112
-rw-r--r--ext/tk/lib/tk/scrollable.rb82
-rw-r--r--ext/tk/lib/tk/scrollbar.rb183
-rw-r--r--ext/tk/lib/tk/scrollbox.rb39
-rw-r--r--ext/tk/lib/tk/selection.rb86
-rw-r--r--ext/tk/lib/tk/spinbox.rb144
-rw-r--r--ext/tk/lib/tk/tagfont.rb43
-rw-r--r--ext/tk/lib/tk/text.rb1604
-rw-r--r--ext/tk/lib/tk/textimage.rb88
-rw-r--r--ext/tk/lib/tk/textmark.rb204
-rw-r--r--ext/tk/lib/tk/texttag.rb321
-rw-r--r--ext/tk/lib/tk/textwindow.rb154
-rw-r--r--ext/tk/lib/tk/timer.rb669
-rw-r--r--ext/tk/lib/tk/tk_mac.rb158
-rw-r--r--ext/tk/lib/tk/toplevel.rb264
-rw-r--r--ext/tk/lib/tk/ttk_selector.rb98
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb39
-rw-r--r--ext/tk/lib/tk/validation.rb397
-rw-r--r--ext/tk/lib/tk/variable.rb1799
-rw-r--r--ext/tk/lib/tk/virtevent.rb139
-rw-r--r--ext/tk/lib/tk/winfo.rb392
-rw-r--r--ext/tk/lib/tk/winpkg.rb156
-rw-r--r--ext/tk/lib/tk/wm.rb552
-rw-r--r--ext/tk/lib/tk/xim.rb122
-rw-r--r--ext/tk/lib/tkafter.rb4
-rw-r--r--ext/tk/lib/tkbgerror.rb4
-rw-r--r--ext/tk/lib/tkcanvas.rb4
-rw-r--r--ext/tk/lib/tkclass.rb47
-rw-r--r--ext/tk/lib/tkconsole.rb4
-rw-r--r--ext/tk/lib/tkdialog.rb4
-rw-r--r--ext/tk/lib/tkentry.rb4
-rw-r--r--ext/tk/lib/tkextlib/ICONS.rb13
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb129
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS193
-rw-r--r--ext/tk/lib/tkextlib/blt.rb189
-rw-r--r--ext/tk/lib/tkextlib/blt/barchart.rb79
-rw-r--r--ext/tk/lib/tkextlib/blt/bitmap.rb112
-rw-r--r--ext/tk/lib/tkextlib/blt/busy.rb83
-rw-r--r--ext/tk/lib/tkextlib/blt/component.rb2218
-rw-r--r--ext/tk/lib/tkextlib/blt/container.rb28
-rw-r--r--ext/tk/lib/tkextlib/blt/cutbuffer.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/dragdrop.rb269
-rw-r--r--ext/tk/lib/tkextlib/blt/eps.rb32
-rw-r--r--ext/tk/lib/tkextlib/blt/graph.rb67
-rw-r--r--ext/tk/lib/tkextlib/blt/htext.rb112
-rw-r--r--ext/tk/lib/tkextlib/blt/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/blt/spline.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/stripchart.rb74
-rw-r--r--ext/tk/lib/tkextlib/blt/table.rb412
-rw-r--r--ext/tk/lib/tkextlib/blt/tabnotebook.rb110
-rw-r--r--ext/tk/lib/tkextlib/blt/tabset.rb504
-rw-r--r--ext/tk/lib/tkextlib/blt/ted.rb68
-rw-r--r--ext/tk/lib/tkextlib/blt/tile.rb25
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/button.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/checkbutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/frame.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/label.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/radiobutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/scrollbar.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/toplevel.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tree.rb1058
-rw-r--r--ext/tk/lib/tkextlib/blt/treeview.rb1287
-rw-r--r--ext/tk/lib/tkextlib/blt/unix_dnd.rb141
-rw-r--r--ext/tk/lib/tkextlib/blt/vector.rb256
-rw-r--r--ext/tk/lib/tkextlib/blt/watch.rb175
-rw-r--r--ext/tk/lib/tkextlib/blt/win_printer.rb61
-rw-r--r--ext/tk/lib/tkextlib/blt/winop.rb107
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb153
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb90
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb194
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dragsite.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dropsite.rb39
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb63
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb43
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb41
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb80
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb52
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb361
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb132
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb192
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb166
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb42
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panelframe.rb67
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb44
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb58
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb40
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb48
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb25
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb91
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb98
-rw-r--r--ext/tk/lib/tkextlib/bwidget/statusbar.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb33
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb500
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb129
-rw-r--r--ext/tk/lib/tkextlib/itcl.rb13
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb178
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb446
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/iwidgets.rb94
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb125
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb53
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb130
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb104
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb185
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb40
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb42
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb365
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb39
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb45
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb67
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb212
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb93
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb175
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb134
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb131
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb353
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb59
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb207
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb568
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb102
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb169
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb181
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb145
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb25
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb112
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb56
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb184
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb105
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README135
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb158
-rw-r--r--ext/tk/lib/tkextlib/tcllib/calendar.rb55
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_sqmap.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_zoom.rb21
-rw-r--r--ext/tk/lib/tkextlib/tcllib/chatwidget.rb151
-rw-r--r--ext/tk/lib/tkextlib/tcllib/crosshair.rb117
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb160
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb97
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dateentry.rb62
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/diagrams.rb224
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dialog.rb84
-rw-r--r--ext/tk/lib/tkextlib/tcllib/getstring.rb134
-rw-r--r--ext/tk/lib/tkextlib/tcllib/history.rb73
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ico.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb75
-rw-r--r--ext/tk/lib/tkextlib/tcllib/khim.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/menuentry.rb47
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ntext.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/panelframe.rb78
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb1404
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ruler.rb65
-rw-r--r--ext/tk/lib/tkextlib/tcllib/screenruler.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrolledwindow.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrollwin.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib/statusbar.rb79
-rw-r--r--ext/tk/lib/tkextlib/tcllib/style.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/superframe.rb51
-rw-r--r--ext/tk/lib/tkextlib/tcllib/swaplist.rb150
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist.rb28
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_core.rb1072
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb43
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb314
-rw-r--r--ext/tk/lib/tkextlib/tcllib/toolbar.rb175
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tooltip.rb104
-rw-r--r--ext/tk/lib/tkextlib/tcllib/validator.rb65
-rw-r--r--ext/tk/lib/tkextlib/tcllib/widget.rb82
-rw-r--r--ext/tk/lib/tkextlib/tclx.rb13
-rw-r--r--ext/tk/lib/tkextlib/tclx/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tclx/tclx.rb74
-rw-r--r--ext/tk/lib/tkextlib/tile.rb449
-rw-r--r--ext/tk/lib/tkextlib/tile/dialog.rb102
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tile/sizegrip.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb336
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tcombobox.rb55
-rw-r--r--ext/tk/lib/tkextlib/tile/tentry.rb49
-rw-r--r--ext/tk/lib/tkextlib/tile/tframe.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabelframe.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb147
-rw-r--r--ext/tk/lib/tkextlib/tile/tpaned.rb245
-rw-r--r--ext/tk/lib/tkextlib/tile/tprogressbar.rb57
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/treeview.rb1336
-rw-r--r--ext/tk/lib/tkextlib/tile/tscale.rb56
-rw-r--r--ext/tk/lib/tkextlib/tile/tscrollbar.rb63
-rw-r--r--ext/tk/lib/tkextlib/tile/tseparator.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tspinbox.rb107
-rw-r--r--ext/tk/lib/tkextlib/tile/tsquare.rb30
-rw-r--r--ext/tk/lib/tkextlib/tkDND.rb18
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb125
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb182
-rw-r--r--ext/tk/lib/tkextlib/tkHTML.rb13
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb453
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg.rb36
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README26
-rw-r--r--ext/tk/lib/tkextlib/tkimg/bmp.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/dted.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/gif.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ico.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/jpeg.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pcx.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pixmap.rb44
-rw-r--r--ext/tk/lib/tkextlib/tkimg/png.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ppm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ps.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/raw.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sgi.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sun.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tga.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tiff.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/window.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xbm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xpm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tktable.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb966
-rw-r--r--ext/tk/lib/tkextlib/tktrans.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb64
-rw-r--r--ext/tk/lib/tkextlib/treectrl.rb13
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb2522
-rw-r--r--ext/tk/lib/tkextlib/trofs.rb13
-rw-r--r--ext/tk/lib/tkextlib/trofs/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/trofs/trofs.rb51
-rw-r--r--ext/tk/lib/tkextlib/version.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu.rb48
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb61
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb53
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb102
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb286
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb22
-rw-r--r--ext/tk/lib/tkextlib/winico.rb14
-rw-r--r--ext/tk/lib/tkextlib/winico/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/winico/winico.rb224
-rw-r--r--ext/tk/lib/tkfont.rb4
-rw-r--r--ext/tk/lib/tkmacpkg.rb4
-rw-r--r--ext/tk/lib/tkmenubar.rb4
-rw-r--r--ext/tk/lib/tkmngfocus.rb4
-rw-r--r--ext/tk/lib/tkpalette.rb4
-rw-r--r--ext/tk/lib/tkscrollbox.rb4
-rw-r--r--ext/tk/lib/tktext.rb4
-rw-r--r--ext/tk/lib/tkvirtevent.rb4
-rw-r--r--ext/tk/lib/tkwinpkg.rb4
-rw-r--r--ext/tk/old-README.tcltklib.ja159
-rw-r--r--ext/tk/old-extconf.rb440
-rw-r--r--ext/tk/sample/24hr_clock.rb286
-rw-r--r--ext/tk/sample/binding_sample.rb87
-rw-r--r--ext/tk/sample/bindtag_sample.rb127
-rw-r--r--ext/tk/sample/binstr_usage.rb45
-rw-r--r--ext/tk/sample/btn_with_frame.rb20
-rw-r--r--ext/tk/sample/cd_timer.rb81
-rw-r--r--ext/tk/sample/cmd_res_test.rb17
-rw-r--r--ext/tk/sample/cmd_resource5
-rw-r--r--ext/tk/sample/demos-en/ChangeLog64
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev9
-rw-r--r--ext/tk/sample/demos-en/README138
-rw-r--r--ext/tk/sample/demos-en/README.1st18
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding29
-rw-r--r--ext/tk/sample/demos-en/anilabel.rb174
-rw-r--r--ext/tk/sample/demos-en/aniwave.rb118
-rw-r--r--ext/tk/sample/demos-en/arrow.rb249
-rw-r--r--ext/tk/sample/demos-en/bind.rb127
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb75
-rw-r--r--ext/tk/sample/demos-en/browse163
-rw-r--r--ext/tk/sample/demos-en/browse282
-rw-r--r--ext/tk/sample/demos-en/button.rb84
-rw-r--r--ext/tk/sample/demos-en/check.rb72
-rw-r--r--ext/tk/sample/demos-en/check2.rb109
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb87
-rw-r--r--ext/tk/sample/demos-en/colors.rb158
-rw-r--r--ext/tk/sample/demos-en/combo.rb96
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb136
-rw-r--r--ext/tk/sample/demos-en/ctext.rb207
-rw-r--r--ext/tk/sample/demos-en/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-en/dialog2.rb41
-rw-r--r--ext/tk/sample/demos-en/doc.org/README7
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-en/entry1.rb58
-rw-r--r--ext/tk/sample/demos-en/entry2.rb93
-rw-r--r--ext/tk/sample/demos-en/entry3.rb220
-rw-r--r--ext/tk/sample/demos-en/filebox.rb102
-rw-r--r--ext/tk/sample/demos-en/floor.rb1723
-rw-r--r--ext/tk/sample/demos-en/floor2.rb1722
-rw-r--r--ext/tk/sample/demos-en/form.rb64
-rw-r--r--ext/tk/sample/demos-en/goldberg.rb2006
-rw-r--r--ext/tk/sample/demos-en/hello14
-rw-r--r--ext/tk/sample/demos-en/hscale.rb75
-rw-r--r--ext/tk/sample/demos-en/icon.rb105
-rw-r--r--ext/tk/sample/demos-en/image1.rb65
-rw-r--r--ext/tk/sample/demos-en/image2.rb107
-rw-r--r--ext/tk/sample/demos-en/image3.rb125
-rw-r--r--ext/tk/sample/demos-en/items.rb381
-rw-r--r--ext/tk/sample/demos-en/ixset333
-rw-r--r--ext/tk/sample/demos-en/ixset2367
-rw-r--r--ext/tk/sample/demos-en/knightstour.rb271
-rw-r--r--ext/tk/sample/demos-en/label.rb72
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb95
-rw-r--r--ext/tk/sample/demos-en/mclist.rb117
-rw-r--r--ext/tk/sample/demos-en/menu.rb196
-rw-r--r--ext/tk/sample/demos-en/menu84.rb215
-rw-r--r--ext/tk/sample/demos-en/menubu.rb237
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb90
-rw-r--r--ext/tk/sample/demos-en/msgbox2.rb91
-rw-r--r--ext/tk/sample/demos-en/paned1.rb47
-rw-r--r--ext/tk/sample/demos-en/paned2.rb94
-rw-r--r--ext/tk/sample/demos-en/pendulum.rb240
-rw-r--r--ext/tk/sample/demos-en/plot.rb124
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb134
-rw-r--r--ext/tk/sample/demos-en/radio.rb86
-rw-r--r--ext/tk/sample/demos-en/radio2.rb109
-rw-r--r--ext/tk/sample/demos-en/radio3.rb117
-rw-r--r--ext/tk/sample/demos-en/rmt268
-rw-r--r--ext/tk/sample/demos-en/rolodex320
-rw-r--r--ext/tk/sample/demos-en/ruler.rb205
-rw-r--r--ext/tk/sample/demos-en/sayings.rb106
-rw-r--r--ext/tk/sample/demos-en/search.rb187
-rw-r--r--ext/tk/sample/demos-en/spin.rb65
-rw-r--r--ext/tk/sample/demos-en/square81
-rw-r--r--ext/tk/sample/demos-en/states.rb80
-rw-r--r--ext/tk/sample/demos-en/style.rb231
-rw-r--r--ext/tk/sample/demos-en/tcolor526
-rw-r--r--ext/tk/sample/demos-en/text.rb128
-rw-r--r--ext/tk/sample/demos-en/textpeer.rb76
-rw-r--r--ext/tk/sample/demos-en/timer136
-rw-r--r--ext/tk/sample/demos-en/tkencoding.rb42
-rw-r--r--ext/tk/sample/demos-en/toolbar.rb130
-rw-r--r--ext/tk/sample/demos-en/tree.rb119
-rw-r--r--ext/tk/sample/demos-en/ttkbut.rb139
-rw-r--r--ext/tk/sample/demos-en/ttkmenu.rb85
-rw-r--r--ext/tk/sample/demos-en/ttknote.rb89
-rw-r--r--ext/tk/sample/demos-en/ttkpane.rb213
-rw-r--r--ext/tk/sample/demos-en/ttkprogress.rb66
-rw-r--r--ext/tk/sample/demos-en/twind.rb291
-rw-r--r--ext/tk/sample/demos-en/twind2.rb384
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb114
-rw-r--r--ext/tk/sample/demos-en/vscale.rb79
-rw-r--r--ext/tk/sample/demos-en/widget1087
-rw-r--r--ext/tk/sample/demos-jp/README54
-rw-r--r--ext/tk/sample/demos-jp/README.1st20
-rw-r--r--ext/tk/sample/demos-jp/anilabel.rb177
-rw-r--r--ext/tk/sample/demos-jp/aniwave.rb120
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb247
-rw-r--r--ext/tk/sample/demos-jp/bind.rb125
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb74
-rw-r--r--ext/tk/sample/demos-jp/browse163
-rw-r--r--ext/tk/sample/demos-jp/browse282
-rw-r--r--ext/tk/sample/demos-jp/button.rb83
-rw-r--r--ext/tk/sample/demos-jp/check.rb70
-rw-r--r--ext/tk/sample/demos-jp/check2.rb110
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb84
-rw-r--r--ext/tk/sample/demos-jp/colors.rb155
-rw-r--r--ext/tk/sample/demos-jp/combo.rb98
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb134
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb204
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb39
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb43
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README7
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb60
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb91
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb225
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb102
-rw-r--r--ext/tk/sample/demos-jp/floor.rb1721
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb1719
-rw-r--r--ext/tk/sample/demos-jp/form.rb66
-rw-r--r--ext/tk/sample/demos-jp/goldberg.rb2011
-rw-r--r--ext/tk/sample/demos-jp/hello10
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb78
-rw-r--r--ext/tk/sample/demos-jp/icon.rb103
-rw-r--r--ext/tk/sample/demos-jp/image1.rb64
-rw-r--r--ext/tk/sample/demos-jp/image2.rb106
-rw-r--r--ext/tk/sample/demos-jp/image3.rb127
-rw-r--r--ext/tk/sample/demos-jp/items.rb379
-rw-r--r--ext/tk/sample/demos-jp/ixset333
-rw-r--r--ext/tk/sample/demos-jp/ixset2369
-rw-r--r--ext/tk/sample/demos-jp/knightstour.rb273
-rw-r--r--ext/tk/sample/demos-jp/label.rb69
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb102
-rw-r--r--ext/tk/sample/demos-jp/mclist.rb121
-rw-r--r--ext/tk/sample/demos-jp/menu.rb201
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb213
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb233
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb238
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb89
-rw-r--r--ext/tk/sample/demos-jp/msgbox2.rb90
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb52
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb100
-rw-r--r--ext/tk/sample/demos-jp/pendulum.rb242
-rw-r--r--ext/tk/sample/demos-jp/plot.rb126
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb131
-rw-r--r--ext/tk/sample/demos-jp/radio.rb84
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb112
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb119
-rw-r--r--ext/tk/sample/demos-jp/rmt268
-rw-r--r--ext/tk/sample/demos-jp/rolodex320
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j300
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb203
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb103
-rw-r--r--ext/tk/sample/demos-jp/search.rb184
-rw-r--r--ext/tk/sample/demos-jp/spin.rb71
-rw-r--r--ext/tk/sample/demos-jp/square81
-rw-r--r--ext/tk/sample/demos-jp/states.rb74
-rw-r--r--ext/tk/sample/demos-jp/style.rb270
-rw-r--r--ext/tk/sample/demos-jp/tcolor534
-rw-r--r--ext/tk/sample/demos-jp/text.rb120
-rw-r--r--ext/tk/sample/demos-jp/textpeer.rb82
-rw-r--r--ext/tk/sample/demos-jp/timer136
-rw-r--r--ext/tk/sample/demos-jp/toolbar.rb136
-rw-r--r--ext/tk/sample/demos-jp/tree.rb120
-rw-r--r--ext/tk/sample/demos-jp/ttkbut.rb145
-rw-r--r--ext/tk/sample/demos-jp/ttkmenu.rb91
-rw-r--r--ext/tk/sample/demos-jp/ttknote.rb97
-rw-r--r--ext/tk/sample/demos-jp/ttkpane.rb216
-rw-r--r--ext/tk/sample/demos-jp/ttkprogress.rb71
-rw-r--r--ext/tk/sample/demos-jp/twind.rb292
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb384
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb119
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb80
-rw-r--r--ext/tk/sample/demos-jp/widget1122
-rw-r--r--ext/tk/sample/editable_listbox.rb148
-rw-r--r--ext/tk/sample/encstr_usage.rb30
-rw-r--r--ext/tk/sample/figmemo_sample.rb456
-rw-r--r--ext/tk/sample/images/earth.gifbin51712 -> 0 bytes-rw-r--r--ext/tk/sample/images/earthris.gifbin6343 -> 0 bytes-rw-r--r--ext/tk/sample/images/face.xbm173
-rw-r--r--ext/tk/sample/images/flagdown.xbm27
-rw-r--r--ext/tk/sample/images/flagup.xbm27
-rw-r--r--ext/tk/sample/images/gray25.xbm6
-rw-r--r--ext/tk/sample/images/grey.256
-rw-r--r--ext/tk/sample/images/grey.56
-rw-r--r--ext/tk/sample/images/letters.xbm27
-rw-r--r--ext/tk/sample/images/noletter.xbm27
-rw-r--r--ext/tk/sample/images/pattern.xbm6
-rw-r--r--ext/tk/sample/images/tcllogo.gifbin2341 -> 0 bytes-rw-r--r--ext/tk/sample/images/teapot.ppm31
-rw-r--r--ext/tk/sample/irbtk.rb30
-rw-r--r--ext/tk/sample/irbtkw.rbw156
-rw-r--r--ext/tk/sample/iso2022-kr.txt2
-rw-r--r--ext/tk/sample/menubar1.rb51
-rw-r--r--ext/tk/sample/menubar2.rb56
-rw-r--r--ext/tk/sample/menubar3.rb72
-rw-r--r--ext/tk/sample/msgs_rb/README3
-rw-r--r--ext/tk/sample/msgs_rb/cs.msg84
-rw-r--r--ext/tk/sample/msgs_rb/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb/el.msg98
-rw-r--r--ext/tk/sample/msgs_rb/en.msg83
-rw-r--r--ext/tk/sample/msgs_rb/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_rb/eo.msg87
-rw-r--r--ext/tk/sample/msgs_rb/es.msg84
-rw-r--r--ext/tk/sample/msgs_rb/fr.msg84
-rw-r--r--ext/tk/sample/msgs_rb/it.msg84
-rw-r--r--ext/tk/sample/msgs_rb/ja.msg13
-rw-r--r--ext/tk/sample/msgs_rb/nl.msg123
-rw-r--r--ext/tk/sample/msgs_rb/pl.msg87
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg87
-rw-r--r--ext/tk/sample/msgs_rb2/README5
-rw-r--r--ext/tk/sample/msgs_rb2/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb2/ja.msg85
-rw-r--r--ext/tk/sample/msgs_tk/README4
-rw-r--r--ext/tk/sample/msgs_tk/cs.msg84
-rw-r--r--ext/tk/sample/msgs_tk/de.msg88
-rw-r--r--ext/tk/sample/msgs_tk/el.msg103
-rw-r--r--ext/tk/sample/msgs_tk/en.msg83
-rw-r--r--ext/tk/sample/msgs_tk/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_tk/eo.msg87
-rw-r--r--ext/tk/sample/msgs_tk/es.msg84
-rw-r--r--ext/tk/sample/msgs_tk/fr.msg84
-rw-r--r--ext/tk/sample/msgs_tk/it.msg84
-rw-r--r--ext/tk/sample/msgs_tk/ja.msg13
-rw-r--r--ext/tk/sample/msgs_tk/license.terms39
-rw-r--r--ext/tk/sample/msgs_tk/nl.msg123
-rw-r--r--ext/tk/sample/msgs_tk/pl.msg87
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg87
-rw-r--r--ext/tk/sample/multi-ip_sample.rb103
-rw-r--r--ext/tk/sample/multi-ip_sample2.rb29
-rw-r--r--ext/tk/sample/optobj_sample.rb67
-rw-r--r--ext/tk/sample/propagate.rb30
-rw-r--r--ext/tk/sample/remote-ip_sample.rb33
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb56
-rw-r--r--ext/tk/sample/resource.en13
-rw-r--r--ext/tk/sample/resource.ja13
-rw-r--r--ext/tk/sample/safe-tk.rb134
-rw-r--r--ext/tk/sample/scrollframe.rb249
-rw-r--r--ext/tk/sample/tcltklib/batsu.gifbin538 -> 0 bytes-rw-r--r--ext/tk/sample/tcltklib/lines0.tcl42
-rw-r--r--ext/tk/sample/tcltklib/lines1.rb50
-rw-r--r--ext/tk/sample/tcltklib/lines2.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines3.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines4.rb54
-rw-r--r--ext/tk/sample/tcltklib/maru.gifbin481 -> 0 bytes-rw-r--r--ext/tk/sample/tcltklib/safeTk.rb22
-rw-r--r--ext/tk/sample/tcltklib/sample0.rb39
-rw-r--r--ext/tk/sample/tcltklib/sample1.rb634
-rw-r--r--ext/tk/sample/tcltklib/sample2.rb451
-rw-r--r--ext/tk/sample/tkalignbox.rb235
-rw-r--r--ext/tk/sample/tkballoonhelp.rb220
-rw-r--r--ext/tk/sample/tkbiff.rb155
-rw-r--r--ext/tk/sample/tkbrowse.rb79
-rw-r--r--ext/tk/sample/tkcombobox.rb497
-rw-r--r--ext/tk/sample/tkdialog.rb61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/Orig_LICENSE.txt61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons-sample.kde658
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons.kde195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb329
-rw-r--r--ext/tk/sample/tkextlib/blt/barchart5.rb101
-rw-r--r--ext/tk/sample/tkextlib/blt/calendar.rb117
-rw-r--r--ext/tk/sample/tkextlib/blt/graph6.rb2222
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7a.rb63
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7b.rb41
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7c.rb45
-rw-r--r--ext/tk/sample/tkextlib/blt/images/buckskin.gifbin7561 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/chalk.gifbin4378 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/qv100.t.gifbin2694 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/rain.gifbin3785 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/sample.gifbin186103 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/pareto.rb90
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1.rb9
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1b.rb10
-rw-r--r--ext/tk/sample/tkextlib/blt/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/blt/scripts/stipples.rb156
-rw-r--r--ext/tk/sample/tkextlib/blt/winop1.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/winop2.rb28
-rw-r--r--ext/tk/sample/tkextlib/bwidget/Orig_LICENSE.txt53
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb198
-rw-r--r--ext/tk/sample/tkextlib/bwidget/bwidget.xbm46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb243
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb150
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb82
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb221
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb289
-rw-r--r--ext/tk/sample/tkextlib/bwidget/x1.xbm2258
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/Orig_LICENSE.txt42
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/box.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/clear.gifbin279 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/close.gifbin249 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/copy.gifbin269 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/cut.gifbin179 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/exit.gifbin396 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/find.gifbin386 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/help.gifbin591 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/line.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/mag.gifbin183 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/new.gifbin212 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/open.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/oval.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/paste.gifbin376 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/points.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/poly.gifbin141 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/print.gifbin263 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/ruler.gifbin174 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/save.gifbin270 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/select.gifbin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/text.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/buttonbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintdialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/checkbox.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dateentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/datefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialog.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb39
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectiondialog.rb29
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/feedback.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectiondialog.rb28
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/finddialog.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb25
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hyperhelp.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledframe.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb64
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb124
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb9
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/radiobox.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledcanvas.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb18
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb11
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spindate.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb33
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spintime.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb26
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabset.rb34
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timeentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb152
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb18
-rw-r--r--ext/tk/sample/tkextlib/tcllib/Orig_LICENSE.txt46
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb29
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb158
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb71
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb83
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb17
-rw-r--r--ext/tk/sample/tkextlib/tile/Orig_LICENSE.txt30
-rw-r--r--ext/tk/sample/tkextlib/tile/demo.rb983
-rw-r--r--ext/tk/sample/tkextlib/tile/iconlib.tcl110
-rw-r--r--ext/tk/sample/tkextlib/tile/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/tile/repeater.tcl117
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue.tcl149
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-h.gifbin315 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-p.gifbin312 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown.gifbin313 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-h.gifbin329 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-p.gifbin327 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft.gifbin323 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-h.gifbin330 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-p.gifbin327 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright.gifbin324 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-h.gifbin309 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-p.gifbin313 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup.gifbin314 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-h.gifbin696 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.gifbin770 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.xcfbin1942 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-p.gifbin769 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hc.gifbin254 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hu.gifbin234 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nc.gifbin249 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nu.gifbin229 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hc.gifbin1098 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hu.gifbin626 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nc.gifbin389 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nu.gifbin401 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb-p.gifbin343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb.gifbin316 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb-p.gifbin333 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb.gifbin308 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider-p.gifbin182 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider.gifbin182 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider-p.gifbin183 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider.gifbin283 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/pkgIndex.tcl6
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik.tcl194
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-n.gifbin273 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-p.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-n.gifbin292 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-p.gifbin272 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-n.gifbin274 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-p.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-n.gifbin286 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-p.gifbin271 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-d.gifbin1266 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-h.gifbin896 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-n.gifbin881 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-p.gifbin625 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-s.gifbin859 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-c.gifbin434 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-u.gifbin423 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-n.gifbin401 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-p.gifbin395 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hslider-n.gifbin592 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-a.gifbin1116 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-arrow-n.gifbin61 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-d.gifbin1057 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-n.gifbin1095 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-c.gifbin695 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-u.gifbin686 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-n.gifbin383 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-p.gifbin878 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-a.gifbin907 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-n.gifbin238 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-p.gifbin927 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-n.gifbin405 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-p.gifbin399 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vslider-n.gifbin587 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc.rb226
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc.tcl163
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-h.gifbin522 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-n.gifbin554 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-p.gifbin548 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hc.gifbin281 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hu.gifbin273 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nc.gifbin303 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nu.gifbin294 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hc.gifbin652 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hu.gifbin644 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nc.gifbin632 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nu.gifbin621 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/pkgIndex.tcl16
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik.tcl125
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-n.gifbin362 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-p.gifbin250 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-n.gifbin378 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-p.gifbin267 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-n.gifbin379 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-p.gifbin266 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-n.gifbin363 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-p.gifbin251 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-h.gifbin439 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-n.gifbin443 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-p.gifbin302 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hc.gifbin169 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hu.gifbin170 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nc.gifbin235 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nu.gifbin226 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-pc.gifbin169 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hsb-n.gifbin269 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hslider-n.gifbin342 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hc.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hu.gifbin179 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nc.gifbin236 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nu.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-pc.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vsb-n.gifbin366 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vslider-n.gifbin336 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/toolbutton.tcl152
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/Orig_COPYRIGHT.txt12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb313
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image1bin8995 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image10bin3095 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image11bin1425 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image12bin2468 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image13bin4073 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image14bin53 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image2bin42 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image3bin3473 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image4bin1988 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image5bin973 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image6bin2184 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image7bin2022 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image8bin1186 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image9bin139 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/index.html115
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image1bin1966 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image10bin255 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image11bin590 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image12bin254 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image13bin493 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image14bin195 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image15bin68 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image16bin157 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image17bin81 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image18bin545 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image19bin53 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image2bin49 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image20bin533 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image21bin564 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image22bin81 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image23bin539 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image24bin151 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image25bin453 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image26bin520 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image27bin565 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image28bin416 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image29bin121 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image3bin10835 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image30bin663 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image31bin78 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image32bin556 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image33bin598 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image34bin496 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image35bin724 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image36bin404 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image37bin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image38bin8330 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image39bin369 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image4bin268 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image5bin492 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image6bin246 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image7bin551 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image8bin497 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image9bin492 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html433
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image1bin113 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image10bin5088 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image11bin4485 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image12bin3579 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image13bin5119 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image14bin3603 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image2bin74 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image3bin681 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image4bin3056 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image5bin2297 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image6bin79 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image7bin1613 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image8bin864 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image9bin2379 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html2787
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image1bin42 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image2bin14343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image3bin17750 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image4bin61 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image5bin201 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image6bin214 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image7bin149 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image8bin203 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image9bin1504 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/index.html768
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb436
-rw-r--r--ext/tk/sample/tkextlib/tkimg/demo.rb1478
-rw-r--r--ext/tk/sample/tkextlib/tkimg/license_terms_of_Img_extension41
-rw-r--r--ext/tk/sample/tkextlib/tkimg/readme.txt3
-rw-r--r--ext/tk/sample/tkextlib/tktable/Orig_LICENSE.txt52
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb60
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb76
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb89
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb101
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb99
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb67
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb137
-rw-r--r--ext/tk/sample/tkextlib/tktable/tcllogo.gifbin2341 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb88
-rw-r--r--ext/tk/sample/tkextlib/treectrl/bitmaps.rb76
-rw-r--r--ext/tk/sample/tkextlib/treectrl/demo.rb1305
-rw-r--r--ext/tk/sample/tkextlib/treectrl/explorer.rb430
-rw-r--r--ext/tk/sample/tkextlib/treectrl/help.rb404
-rw-r--r--ext/tk/sample/tkextlib/treectrl/imovie.rb130
-rw-r--r--ext/tk/sample/tkextlib/treectrl/layout.rb159
-rw-r--r--ext/tk/sample/tkextlib/treectrl/mailwasher.rb269
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-folders.rb124
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-newgroup.rb448
-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-dll.gifbin437 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-exe.gifbin368 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-file.gifbin466 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-folder.gifbin459 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-txt.gifbin392 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/checked.gifbin78 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/file.gifbin279 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-closed.gifbin111 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-open.gifbin120 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-closed.gifbin115 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-open.gifbin128 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-page.gifbin132 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-01.gifbin5406 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-02.gifbin5912 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-03.gifbin4696 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-04.gifbin5783 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-05.gifbin3238 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-06.gifbin3509 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-07.gifbin2091 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-off.gifbin70 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-on.gifbin76 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-print.gifbin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-off.gifbin68 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-on.gifbin71 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-search.gifbin114 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-security.gifbin108 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-collapse.gifbin275 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-expand.gifbin277 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-arrow.gifbin73 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-clip.gifbin73 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-deleted.gifbin138 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-draft.gifbin134 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-folder.gifbin133 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-group.gifbin144 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-inbox.gifbin133 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-local.gifbin146 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-main.gifbin174 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-outbox.gifbin136 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read-2.gifbin343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read.gifbin304 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-sent.gifbin132 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-server.gifbin163 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-unread.gifbin303 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-watch.gifbin98 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/sky.gifbin6454 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-dll.gifbin311 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-exe.gifbin115 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-file.gifbin338 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-folder.gifbin307 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-txt.gifbin302 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/unchecked.gifbin72 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/random.rb508
-rw-r--r--ext/tk/sample/tkextlib/treectrl/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/treectrl/www-options.rb303
-rw-r--r--ext/tk/sample/tkextlib/vu/Orig_LICENSE.txt51
-rw-r--r--ext/tk/sample/tkextlib/vu/README.txt50
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb90
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb82
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb101
-rw-r--r--ext/tk/sample/tkextlib/vu/dial_demo.rb113
-rw-r--r--ext/tk/sample/tkextlib/vu/m128_000.xbm174
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb56
-rw-r--r--ext/tk/sample/tkextlib/vu/vu_demo.rb67
-rw-r--r--ext/tk/sample/tkfrom.rb132
-rw-r--r--ext/tk/sample/tkhello.rb10
-rw-r--r--ext/tk/sample/tkline.rb47
-rw-r--r--ext/tk/sample/tkmenubutton.rb135
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb118
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb743
-rw-r--r--ext/tk/sample/tkmultilistbox.rb654
-rw-r--r--ext/tk/sample/tkmultilistframe.rb940
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb73
-rw-r--r--ext/tk/sample/tkoptdb.rb106
-rw-r--r--ext/tk/sample/tkrttimer.rb77
-rw-r--r--ext/tk/sample/tksleep_sample.rb29
-rw-r--r--ext/tk/sample/tktextframe.rb281
-rw-r--r--ext/tk/sample/tktextio.rb1060
-rw-r--r--ext/tk/sample/tktimer.rb50
-rw-r--r--ext/tk/sample/tktimer2.rb47
-rw-r--r--ext/tk/sample/tktimer3.rb59
-rw-r--r--ext/tk/sample/tktree.rb103
-rw-r--r--ext/tk/sample/tktree.tcl305
-rw-r--r--ext/tk/sample/ttk_wrapper.rb154
-rw-r--r--ext/tk/stubs.c592
-rw-r--r--ext/tk/stubs.h33
-rw-r--r--ext/tk/tcltklib.c11130
-rw-r--r--ext/tk/tkutil/depend1
-rw-r--r--ext/tk/tkutil/extconf.rb11
-rw-r--r--ext/tk/tkutil/tkutil.c1878
-rw-r--r--ext/win32/depend2
-rw-r--r--ext/win32/extconf.rb3
-rw-r--r--ext/win32/lib/Win32API.rb37
-rw-r--r--ext/win32/lib/win32/importer.rb8
-rw-r--r--ext/win32/lib/win32/registry.rb38
-rw-r--r--ext/win32/lib/win32/resolv.rb311
-rw-r--r--ext/win32/lib/win32/sspi.rb628
-rw-r--r--ext/win32/resolv/depend17
-rw-r--r--ext/win32/resolv/extconf.rb3
-rw-r--r--ext/win32/resolv/resolv.c65
-rw-r--r--ext/win32ole/extconf.rb1
-rw-r--r--ext/win32ole/lib/win32ole.rb33
-rw-r--r--ext/win32ole/lib/win32ole/property.rb1
-rw-r--r--ext/win32ole/sample/excel1.rb5
-rw-r--r--ext/win32ole/sample/excel2.rb3
-rw-r--r--ext/win32ole/sample/excel3.rb3
-rw-r--r--ext/win32ole/sample/ie.rb3
-rw-r--r--ext/win32ole/sample/ieconst.rb1
-rw-r--r--ext/win32ole/sample/ienavi.rb7
-rw-r--r--ext/win32ole/sample/ienavi2.rb1
-rw-r--r--ext/win32ole/sample/oledirs.rb1
-rw-r--r--ext/win32ole/sample/olegen.rb1
-rw-r--r--ext/win32ole/sample/xml.rb1
-rw-r--r--ext/win32ole/win32ole.c487
-rw-r--r--ext/win32ole/win32ole.gemspec21
-rw-r--r--ext/win32ole/win32ole.h16
-rw-r--r--ext/win32ole/win32ole_error.c4
-rw-r--r--ext/win32ole/win32ole_error.h5
-rw-r--r--ext/win32ole/win32ole_event.c68
-rw-r--r--ext/win32ole/win32ole_method.c40
-rw-r--r--ext/win32ole/win32ole_method.h2
-rw-r--r--ext/win32ole/win32ole_param.c2
-rw-r--r--ext/win32ole/win32ole_record.c10
-rw-r--r--ext/win32ole/win32ole_record.h2
-rw-r--r--ext/win32ole/win32ole_type.c10
-rw-r--r--ext/win32ole/win32ole_type.h2
-rw-r--r--ext/win32ole/win32ole_typelib.c10
-rw-r--r--ext/win32ole/win32ole_typelib.h2
-rw-r--r--ext/win32ole/win32ole_variable.c4
-rw-r--r--ext/win32ole/win32ole_variable.h2
-rw-r--r--ext/win32ole/win32ole_variant.c45
-rw-r--r--ext/win32ole/win32ole_variant.h2
-rw-r--r--ext/win32ole/win32ole_variant_m.c54
-rw-r--r--ext/win32ole/win32ole_variant_m.h2
-rw-r--r--ext/zlib/.gitignore1
-rw-r--r--ext/zlib/depend173
-rw-r--r--ext/zlib/extconf.rb86
-rw-r--r--ext/zlib/extlibs6
-rw-r--r--ext/zlib/zlib.c1057
-rw-r--r--ext/zlib/zlib.gemspec35
-rw-r--r--file.c2354
-rw-r--r--gc.c8200
-rw-r--r--gc.h41
-rw-r--r--gc.rb241
-rw-r--r--gem_prelude.rb12
-rw-r--r--gems/bundled_gems12
-rw-r--r--golf_prelude.rb9
-rw-r--r--goruby.c14
-rw-r--r--hash.c5702
-rw-r--r--hrtime.h168
-rw-r--r--ia64.s42
-rw-r--r--id_table.c325
-rw-r--r--id_table.h36
-rw-r--r--include/ruby.h31
-rw-r--r--include/ruby/assert.h234
-rw-r--r--include/ruby/atomic.h236
-rw-r--r--include/ruby/backward.h79
-rw-r--r--include/ruby/backward/2/assume.h43
-rw-r--r--include/ruby/backward/2/attributes.h170
-rw-r--r--include/ruby/backward/2/bool.h37
-rw-r--r--include/ruby/backward/2/gcc_version_since.h38
-rw-r--r--include/ruby/backward/2/inttypes.h132
-rw-r--r--include/ruby/backward/2/limits.h100
-rw-r--r--include/ruby/backward/2/long_long.h65
-rw-r--r--include/ruby/backward/2/r_cast.h33
-rw-r--r--include/ruby/backward/2/rmodule.h37
-rw-r--r--include/ruby/backward/2/stdalign.h30
-rw-r--r--include/ruby/backward/2/stdarg.h47
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/cxxanyargs.hpp683
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h47
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h53
-rw-r--r--include/ruby/defines.h280
-rw-r--r--include/ruby/encoding.h258
-rw-r--r--include/ruby/intern.h1027
-rw-r--r--include/ruby/internal/anyargs.h375
-rw-r--r--include/ruby/internal/arithmetic.h38
-rw-r--r--include/ruby/internal/arithmetic/char.h58
-rw-r--r--include/ruby/internal/arithmetic/double.h39
-rw-r--r--include/ruby/internal/arithmetic/fixnum.h44
-rw-r--r--include/ruby/internal/arithmetic/gid_t.h34
-rw-r--r--include/ruby/internal/arithmetic/int.h163
-rw-r--r--include/ruby/internal/arithmetic/intptr_t.h42
-rw-r--r--include/ruby/internal/arithmetic/long.h244
-rw-r--r--include/ruby/internal/arithmetic/long_long.h53
-rw-r--r--include/ruby/internal/arithmetic/mode_t.h34
-rw-r--r--include/ruby/internal/arithmetic/off_t.h49
-rw-r--r--include/ruby/internal/arithmetic/pid_t.h34
-rw-r--r--include/ruby/internal/arithmetic/short.h54
-rw-r--r--include/ruby/internal/arithmetic/size_t.h56
-rw-r--r--include/ruby/internal/arithmetic/st_data_t.h59
-rw-r--r--include/ruby/internal/arithmetic/uid_t.h34
-rw-r--r--include/ruby/internal/assume.h90
-rw-r--r--include/ruby/internal/attr/alloc_size.h32
-rw-r--r--include/ruby/internal/attr/artificial.h46
-rw-r--r--include/ruby/internal/attr/cold.h37
-rw-r--r--include/ruby/internal/attr/const.h46
-rw-r--r--include/ruby/internal/attr/constexpr.h85
-rw-r--r--include/ruby/internal/attr/deprecated.h63
-rw-r--r--include/ruby/internal/attr/diagnose_if.h42
-rw-r--r--include/ruby/internal/attr/enum_extensibility.h32
-rw-r--r--include/ruby/internal/attr/error.h32
-rw-r--r--include/ruby/internal/attr/flag_enum.h33
-rw-r--r--include/ruby/internal/attr/forceinline.h40
-rw-r--r--include/ruby/internal/attr/format.h38
-rw-r--r--include/ruby/internal/attr/maybe_unused.h38
-rw-r--r--include/ruby/internal/attr/noalias.h58
-rw-r--r--include/ruby/internal/attr/nodiscard.h45
-rw-r--r--include/ruby/internal/attr/noexcept.h91
-rw-r--r--include/ruby/internal/attr/noinline.h35
-rw-r--r--include/ruby/internal/attr/nonnull.h32
-rw-r--r--include/ruby/internal/attr/noreturn.h48
-rw-r--r--include/ruby/internal/attr/pure.h43
-rw-r--r--include/ruby/internal/attr/restrict.h45
-rw-r--r--include/ruby/internal/attr/returns_nonnull.h37
-rw-r--r--include/ruby/internal/attr/warning.h32
-rw-r--r--include/ruby/internal/attr/weakref.h32
-rw-r--r--include/ruby/internal/cast.h53
-rw-r--r--include/ruby/internal/compiler_is.h45
-rw-r--r--include/ruby/internal/compiler_is/apple.h41
-rw-r--r--include/ruby/internal/compiler_is/clang.h38
-rw-r--r--include/ruby/internal/compiler_is/gcc.h46
-rw-r--r--include/ruby/internal/compiler_is/intel.h41
-rw-r--r--include/ruby/internal/compiler_is/msvc.h57
-rw-r--r--include/ruby/internal/compiler_is/sunpro.h55
-rw-r--r--include/ruby/internal/compiler_since.h61
-rw-r--r--include/ruby/internal/config.h144
-rw-r--r--include/ruby/internal/constant_p.h37
-rw-r--r--include/ruby/internal/core.h35
-rw-r--r--include/ruby/internal/core/rarray.h270
-rw-r--r--include/ruby/internal/core/rbasic.h85
-rw-r--r--include/ruby/internal/core/rbignum.h51
-rw-r--r--include/ruby/internal/core/rclass.h47
-rw-r--r--include/ruby/internal/core/rdata.h184
-rw-r--r--include/ruby/internal/core/rfile.h36
-rw-r--r--include/ruby/internal/core/rhash.h62
-rw-r--r--include/ruby/internal/core/rmatch.h73
-rw-r--r--include/ruby/internal/core/robject.h96
-rw-r--r--include/ruby/internal/core/rregexp.h84
-rw-r--r--include/ruby/internal/core/rstring.h215
-rw-r--r--include/ruby/internal/core/rstruct.h73
-rw-r--r--include/ruby/internal/core/rtypeddata.h186
-rw-r--r--include/ruby/internal/ctype.h203
-rw-r--r--include/ruby/internal/dllexport.h92
-rw-r--r--include/ruby/internal/dosish.h63
-rw-r--r--include/ruby/internal/error.h84
-rw-r--r--include/ruby/internal/eval.h50
-rw-r--r--include/ruby/internal/event.h75
-rw-r--r--include/ruby/internal/fl_type.h471
-rw-r--r--include/ruby/internal/gc.h57
-rw-r--r--include/ruby/internal/glob.h35
-rw-r--r--include/ruby/internal/globals.h157
-rw-r--r--include/ruby/internal/has/attribute.h164
-rw-r--r--include/ruby/internal/has/builtin.h105
-rw-r--r--include/ruby/internal/has/c_attribute.h38
-rw-r--r--include/ruby/internal/has/cpp_attribute.h87
-rw-r--r--include/ruby/internal/has/declspec_attribute.h48
-rw-r--r--include/ruby/internal/has/extension.h33
-rw-r--r--include/ruby/internal/has/feature.h31
-rw-r--r--include/ruby/internal/has/warning.h31
-rw-r--r--include/ruby/internal/intern/array.h78
-rw-r--r--include/ruby/internal/intern/bignum.h105
-rw-r--r--include/ruby/internal/intern/class.h57
-rw-r--r--include/ruby/internal/intern/compar.h34
-rw-r--r--include/ruby/internal/intern/complex.h60
-rw-r--r--include/ruby/internal/intern/cont.h41
-rw-r--r--include/ruby/internal/intern/dir.h33
-rw-r--r--include/ruby/internal/intern/enum.h33
-rw-r--r--include/ruby/internal/intern/enumerator.h80
-rw-r--r--include/ruby/internal/intern/error.h82
-rw-r--r--include/ruby/internal/intern/eval.h59
-rw-r--r--include/ruby/internal/intern/file.h42
-rw-r--r--include/ruby/internal/intern/gc.h57
-rw-r--r--include/ruby/internal/intern/hash.h59
-rw-r--r--include/ruby/internal/intern/io.h70
-rw-r--r--include/ruby/internal/intern/load.h44
-rw-r--r--include/ruby/internal/intern/marshal.h35
-rw-r--r--include/ruby/internal/intern/numeric.h42
-rw-r--r--include/ruby/internal/intern/object.h90
-rw-r--r--include/ruby/internal/intern/parse.h64
-rw-r--r--include/ruby/internal/intern/proc.h53
-rw-r--r--include/ruby/internal/intern/process.h46
-rw-r--r--include/ruby/internal/intern/random.h45
-rw-r--r--include/ruby/internal/intern/range.h35
-rw-r--r--include/ruby/internal/intern/rational.h46
-rw-r--r--include/ruby/internal/intern/re.h50
-rw-r--r--include/ruby/internal/intern/ruby.h37
-rw-r--r--include/ruby/internal/intern/select.h52
-rw-r--r--include/ruby/internal/intern/select/largesize.h103
-rw-r--r--include/ruby/internal/intern/select/posix.h82
-rw-r--r--include/ruby/internal/intern/select/win32.h124
-rw-r--r--include/ruby/internal/intern/signal.h39
-rw-r--r--include/ruby/internal/intern/sprintf.h43
-rw-r--r--include/ruby/internal/intern/string.h298
-rw-r--r--include/ruby/internal/intern/struct.h47
-rw-r--r--include/ruby/internal/intern/thread.h76
-rw-r--r--include/ruby/internal/intern/time.h51
-rw-r--r--include/ruby/internal/intern/variable.h83
-rw-r--r--include/ruby/internal/intern/vm.h77
-rw-r--r--include/ruby/internal/interpreter.h93
-rw-r--r--include/ruby/internal/iterator.h65
-rw-r--r--include/ruby/internal/memory.h281
-rw-r--r--include/ruby/internal/method.h39
-rw-r--r--include/ruby/internal/module.h39
-rw-r--r--include/ruby/internal/newobj.h73
-rw-r--r--include/ruby/internal/rgengc.h199
-rw-r--r--include/ruby/internal/scan_args.h401
-rw-r--r--include/ruby/internal/special_consts.h204
-rw-r--r--include/ruby/internal/static_assert.h77
-rw-r--r--include/ruby/internal/stdalign.h133
-rw-r--r--include/ruby/internal/stdbool.h51
-rw-r--r--include/ruby/internal/symbol.h114
-rw-r--r--include/ruby/internal/token_paste.h75
-rw-r--r--include/ruby/internal/value.h66
-rw-r--r--include/ruby/internal/value_type.h354
-rw-r--r--include/ruby/internal/variable.h62
-rw-r--r--include/ruby/internal/warning_push.h91
-rw-r--r--include/ruby/internal/xmalloc.h362
-rw-r--r--include/ruby/io.h86
-rw-r--r--include/ruby/memory_view.h165
-rw-r--r--include/ruby/missing.h149
-rw-r--r--include/ruby/onigmo.h941
-rw-r--r--include/ruby/oniguruma.h841
-rw-r--r--include/ruby/ractor.h68
-rw-r--r--include/ruby/random.h92
-rw-r--r--include/ruby/re.h70
-rw-r--r--include/ruby/regex.h22
-rw-r--r--include/ruby/ruby.h1952
-rw-r--r--include/ruby/st.h184
-rw-r--r--include/ruby/subst.h10
-rw-r--r--include/ruby/thread.h55
-rw-r--r--include/ruby/thread_native.h42
-rw-r--r--include/ruby/util.h83
-rw-r--r--include/ruby/version.h58
-rw-r--r--include/ruby/vm.h45
-rw-r--r--include/ruby/win32.h233
-rw-r--r--inits.c42
-rw-r--r--insns.def2266
-rw-r--r--integer.rb150
-rw-r--r--internal.h1233
-rw-r--r--internal/array.h119
-rw-r--r--internal/bignum.h246
-rw-r--r--internal/bits.h566
-rw-r--r--internal/class.h174
-rw-r--r--internal/compar.h50
-rw-r--r--internal/compile.h32
-rw-r--r--internal/compilers.h108
-rw-r--r--internal/complex.h30
-rw-r--r--internal/cont.h26
-rw-r--r--internal/dir.h17
-rw-r--r--internal/enc.h20
-rw-r--r--internal/encoding.h31
-rw-r--r--internal/enum.h19
-rw-r--r--internal/enumerator.h22
-rw-r--r--internal/error.h124
-rw-r--r--internal/eval.h33
-rw-r--r--internal/file.h39
-rw-r--r--internal/fixnum.h185
-rw-r--r--internal/gc.h167
-rw-r--r--internal/hash.h241
-rw-r--r--internal/imemo.h244
-rw-r--r--internal/inits.h51
-rw-r--r--internal/io.h35
-rw-r--r--internal/load.h19
-rw-r--r--internal/loadpath.h17
-rw-r--r--internal/math.h24
-rw-r--r--internal/missing.h19
-rw-r--r--internal/numeric.h255
-rw-r--r--internal/object.h83
-rw-r--r--internal/parse.h23
-rw-r--r--internal/proc.h33
-rw-r--r--internal/process.h136
-rw-r--r--internal/random.h17
-rw-r--r--internal/range.h41
-rw-r--r--internal/rational.h72
-rw-r--r--internal/re.h29
-rw-r--r--internal/sanitizers.h191
-rw-r--r--internal/scheduler.h44
-rw-r--r--internal/serial.h24
-rw-r--r--internal/signal.h22
-rw-r--r--internal/static_assert.h17
-rw-r--r--internal/string.h141
-rw-r--r--internal/struct.h154
-rw-r--r--internal/symbol.h41
-rw-r--r--internal/thread.h54
-rw-r--r--internal/time.h35
-rw-r--r--internal/transcode.h21
-rw-r--r--internal/util.h31
-rw-r--r--internal/variable.h84
-rw-r--r--internal/vm.h131
-rw-r--r--internal/warnings.h17
-rw-r--r--io.c4562
-rw-r--r--io.rb123
-rw-r--r--iseq.c3144
-rw-r--r--iseq.h283
-rw-r--r--kernel.rb174
-rw-r--r--lex.c.blt218
-rw-r--r--lib/.document26
-rw-r--r--lib/English.gemspec24
-rw-r--r--lib/English.rb53
-rw-r--r--lib/abbrev.gemspec22
-rw-r--r--lib/abbrev.rb1
-rw-r--r--lib/base64.gemspec22
-rw-r--r--lib/base64.rb27
-rw-r--r--lib/benchmark.rb58
-rw-r--r--lib/benchmark/benchmark.gemspec29
-rw-r--r--lib/benchmark/version.rb3
-rw-r--r--lib/bundler.rb697
-rw-r--r--lib/bundler/build_metadata.rb43
-rw-r--r--lib/bundler/bundler.gemspec45
-rw-r--r--lib/bundler/capistrano.rb22
-rw-r--r--lib/bundler/cli.rb851
-rw-r--r--lib/bundler/cli/add.rb47
-rw-r--r--lib/bundler/cli/binstubs.rb53
-rw-r--r--lib/bundler/cli/cache.rb43
-rw-r--r--lib/bundler/cli/check.rb40
-rw-r--r--lib/bundler/cli/clean.rb25
-rw-r--r--lib/bundler/cli/common.rb128
-rw-r--r--lib/bundler/cli/config.rb194
-rw-r--r--lib/bundler/cli/console.rb43
-rw-r--r--lib/bundler/cli/doctor.rb151
-rw-r--r--lib/bundler/cli/exec.rb88
-rw-r--r--lib/bundler/cli/fund.rb36
-rw-r--r--lib/bundler/cli/gem.rb433
-rw-r--r--lib/bundler/cli/info.rb85
-rw-r--r--lib/bundler/cli/init.rb47
-rw-r--r--lib/bundler/cli/inject.rb60
-rw-r--r--lib/bundler/cli/install.rb207
-rw-r--r--lib/bundler/cli/issue.rb41
-rw-r--r--lib/bundler/cli/list.rb66
-rw-r--r--lib/bundler/cli/lock.rb67
-rw-r--r--lib/bundler/cli/open.rb29
-rw-r--r--lib/bundler/cli/outdated.rb290
-rw-r--r--lib/bundler/cli/platform.rb46
-rw-r--r--lib/bundler/cli/plugin.rb41
-rw-r--r--lib/bundler/cli/pristine.rb52
-rw-r--r--lib/bundler/cli/remove.rb17
-rw-r--r--lib/bundler/cli/show.rb75
-rw-r--r--lib/bundler/cli/update.rb118
-rw-r--r--lib/bundler/cli/viz.rb31
-rw-r--r--lib/bundler/compact_index_client.rb125
-rw-r--r--lib/bundler/compact_index_client/cache.rb110
-rw-r--r--lib/bundler/compact_index_client/gem_parser.rb28
-rw-r--r--lib/bundler/compact_index_client/updater.rb103
-rw-r--r--lib/bundler/constants.rb7
-rw-r--r--lib/bundler/current_ruby.rb96
-rw-r--r--lib/bundler/definition.rb832
-rw-r--r--lib/bundler/dep_proxy.rb55
-rw-r--r--lib/bundler/dependency.rb144
-rw-r--r--lib/bundler/deployment.rb69
-rw-r--r--lib/bundler/deprecate.rb44
-rw-r--r--lib/bundler/digest.rb71
-rw-r--r--lib/bundler/dsl.rb615
-rw-r--r--lib/bundler/endpoint_specification.rb141
-rw-r--r--lib/bundler/env.rb150
-rw-r--r--lib/bundler/environment_preserver.rb85
-rw-r--r--lib/bundler/errors.rb175
-rw-r--r--lib/bundler/feature_flag.rb55
-rw-r--r--lib/bundler/fetcher.rb317
-rw-r--r--lib/bundler/fetcher/base.rb52
-rw-r--r--lib/bundler/fetcher/compact_index.rb140
-rw-r--r--lib/bundler/fetcher/dependency.rb82
-rw-r--r--lib/bundler/fetcher/downloader.rb90
-rw-r--r--lib/bundler/fetcher/index.rb52
-rw-r--r--lib/bundler/friendly_errors.rb112
-rw-r--r--lib/bundler/gem_helper.rb238
-rw-r--r--lib/bundler/gem_helpers.rb110
-rw-r--r--lib/bundler/gem_tasks.rb7
-rw-r--r--lib/bundler/gem_version_promoter.rb190
-rw-r--r--lib/bundler/gemdeps.rb29
-rw-r--r--lib/bundler/graph.rb152
-rw-r--r--lib/bundler/index.rb213
-rw-r--r--lib/bundler/injector.rb273
-rw-r--r--lib/bundler/inline.rb85
-rw-r--r--lib/bundler/installer.rb291
-rw-r--r--lib/bundler/installer/gem_installer.rb76
-rw-r--r--lib/bundler/installer/parallel_installer.rb250
-rw-r--r--lib/bundler/installer/standalone.rb72
-rw-r--r--lib/bundler/lazy_specification.rb158
-rw-r--r--lib/bundler/lockfile_generator.rb95
-rw-r--r--lib/bundler/lockfile_parser.rb223
-rw-r--r--lib/bundler/man/.document1
-rw-r--r--lib/bundler/man/bundle-add.166
-rw-r--r--lib/bundler/man/bundle-add.1.ronn46
-rw-r--r--lib/bundler/man/bundle-binstubs.142
-rw-r--r--lib/bundler/man/bundle-binstubs.1.ronn41
-rw-r--r--lib/bundler/man/bundle-cache.155
-rw-r--r--lib/bundler/man/bundle-cache.1.ronn72
-rw-r--r--lib/bundler/man/bundle-check.131
-rw-r--r--lib/bundler/man/bundle-check.1.ronn26
-rw-r--r--lib/bundler/man/bundle-clean.124
-rw-r--r--lib/bundler/man/bundle-clean.1.ronn18
-rw-r--r--lib/bundler/man/bundle-config.1496
-rw-r--r--lib/bundler/man/bundle-config.1.ronn396
-rw-r--r--lib/bundler/man/bundle-doctor.144
-rw-r--r--lib/bundler/man/bundle-doctor.1.ronn33
-rw-r--r--lib/bundler/man/bundle-exec.1165
-rw-r--r--lib/bundler/man/bundle-exec.1.ronn152
-rw-r--r--lib/bundler/man/bundle-gem.1115
-rw-r--r--lib/bundler/man/bundle-gem.1.ronn117
-rw-r--r--lib/bundler/man/bundle-info.120
-rw-r--r--lib/bundler/man/bundle-info.1.ronn17
-rw-r--r--lib/bundler/man/bundle-init.125
-rw-r--r--lib/bundler/man/bundle-init.1.ronn29
-rw-r--r--lib/bundler/man/bundle-inject.133
-rw-r--r--lib/bundler/man/bundle-inject.1.ronn22
-rw-r--r--lib/bundler/man/bundle-install.1338
-rw-r--r--lib/bundler/man/bundle-install.1.ronn405
-rw-r--r--lib/bundler/man/bundle-list.150
-rw-r--r--lib/bundler/man/bundle-list.1.ronn33
-rw-r--r--lib/bundler/man/bundle-lock.184
-rw-r--r--lib/bundler/man/bundle-lock.1.ronn94
-rw-r--r--lib/bundler/man/bundle-open.132
-rw-r--r--lib/bundler/man/bundle-open.1.ronn19
-rw-r--r--lib/bundler/man/bundle-outdated.1155
-rw-r--r--lib/bundler/man/bundle-outdated.1.ronn111
-rw-r--r--lib/bundler/man/bundle-platform.161
-rw-r--r--lib/bundler/man/bundle-platform.1.ronn42
-rw-r--r--lib/bundler/man/bundle-pristine.134
-rw-r--r--lib/bundler/man/bundle-pristine.1.ronn34
-rw-r--r--lib/bundler/man/bundle-remove.131
-rw-r--r--lib/bundler/man/bundle-remove.1.ronn23
-rw-r--r--lib/bundler/man/bundle-show.123
-rw-r--r--lib/bundler/man/bundle-show.1.ronn21
-rw-r--r--lib/bundler/man/bundle-update.1394
-rw-r--r--lib/bundler/man/bundle-update.1.ronn350
-rw-r--r--lib/bundler/man/bundle-viz.139
-rw-r--r--lib/bundler/man/bundle-viz.1.ronn30
-rw-r--r--lib/bundler/man/bundle.1136
-rw-r--r--lib/bundler/man/bundle.1.ronn111
-rw-r--r--lib/bundler/man/gemfile.5712
-rw-r--r--lib/bundler/man/gemfile.5.ronn525
-rw-r--r--lib/bundler/man/index.txt25
-rw-r--r--lib/bundler/match_platform.rb24
-rw-r--r--lib/bundler/mirror.rb223
-rw-r--r--lib/bundler/plugin.rb350
-rw-r--r--lib/bundler/plugin/api.rb81
-rw-r--r--lib/bundler/plugin/api/source.rb326
-rw-r--r--lib/bundler/plugin/dsl.rb53
-rw-r--r--lib/bundler/plugin/events.rb61
-rw-r--r--lib/bundler/plugin/index.rb185
-rw-r--r--lib/bundler/plugin/installer.rb109
-rw-r--r--lib/bundler/plugin/installer/git.rb38
-rw-r--r--lib/bundler/plugin/installer/rubygems.rb27
-rw-r--r--lib/bundler/plugin/source_list.rb31
-rw-r--r--lib/bundler/process_lock.rb24
-rw-r--r--lib/bundler/psyched_yaml.rb22
-rw-r--r--lib/bundler/remote_specification.rb115
-rw-r--r--lib/bundler/resolver.rb387
-rw-r--r--lib/bundler/resolver/spec_group.rb110
-rw-r--r--lib/bundler/retry.rb66
-rw-r--r--lib/bundler/ruby_dsl.rb18
-rw-r--r--lib/bundler/ruby_version.rb137
-rw-r--r--lib/bundler/rubygems_ext.rb234
-rw-r--r--lib/bundler/rubygems_gem_installer.rb160
-rw-r--r--lib/bundler/rubygems_integration.rb633
-rw-r--r--lib/bundler/runtime.rb312
-rw-r--r--lib/bundler/settings.rb512
-rw-r--r--lib/bundler/settings/validator.rb102
-rw-r--r--lib/bundler/setup.rb27
-rw-r--r--lib/bundler/shared_helpers.rb350
-rw-r--r--lib/bundler/similarity_detector.rb63
-rw-r--r--lib/bundler/source.rb115
-rw-r--r--lib/bundler/source/gemspec.rb18
-rw-r--r--lib/bundler/source/git.rb356
-rw-r--r--lib/bundler/source/git/git_proxy.rb263
-rw-r--r--lib/bundler/source/metadata.rb63
-rw-r--r--lib/bundler/source/path.rb260
-rw-r--r--lib/bundler/source/path/installer.rb74
-rw-r--r--lib/bundler/source/rubygems.rb555
-rw-r--r--lib/bundler/source/rubygems/remote.rb68
-rw-r--r--lib/bundler/source/rubygems_aggregate.rb68
-rw-r--r--lib/bundler/source_list.rb221
-rw-r--r--lib/bundler/source_map.rb58
-rw-r--r--lib/bundler/spec_set.rb188
-rw-r--r--lib/bundler/stub_specification.rb114
-rw-r--r--lib/bundler/templates/.document1
-rw-r--r--lib/bundler/templates/Executable29
-rw-r--r--lib/bundler/templates/Executable.bundler114
-rw-r--r--lib/bundler/templates/Executable.standalone14
-rw-r--r--lib/bundler/templates/Gemfile7
-rw-r--r--lib/bundler/templates/gems.rb8
-rw-r--r--lib/bundler/templates/newgem/CHANGELOG.md.tt5
-rw-r--r--lib/bundler/templates/newgem/CODE_OF_CONDUCT.md.tt84
-rw-r--r--lib/bundler/templates/newgem/Gemfile.tt23
-rw-r--r--lib/bundler/templates/newgem/LICENSE.txt.tt21
-rw-r--r--lib/bundler/templates/newgem/README.md.tt49
-rw-r--r--lib/bundler/templates/newgem/Rakefile.tt47
-rw-r--r--lib/bundler/templates/newgem/bin/console.tt15
-rw-r--r--lib/bundler/templates/newgem/bin/setup.tt8
-rw-r--r--lib/bundler/templates/newgem/circleci/config.yml.tt13
-rw-r--r--lib/bundler/templates/newgem/exe/newgem.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf.rb.tt5
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.c.tt9
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.h.tt6
-rw-r--r--lib/bundler/templates/newgem/github/workflows/main.yml.tt27
-rw-r--r--lib/bundler/templates/newgem/gitignore.tt20
-rw-r--r--lib/bundler/templates/newgem/gitlab-ci.yml.tt9
-rw-r--r--lib/bundler/templates/newgem/lib/newgem.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/lib/newgem/version.rb.tt9
-rw-r--r--lib/bundler/templates/newgem/newgem.gemspec.tt44
-rw-r--r--lib/bundler/templates/newgem/rspec.tt3
-rw-r--r--lib/bundler/templates/newgem/rubocop.yml.tt13
-rw-r--r--lib/bundler/templates/newgem/sig/newgem.rbs.tt8
-rw-r--r--lib/bundler/templates/newgem/spec/newgem_spec.rb.tt11
-rw-r--r--lib/bundler/templates/newgem/spec/spec_helper.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/standard.yml.tt2
-rw-r--r--lib/bundler/templates/newgem/test/minitest/newgem_test.rb.tt13
-rw-r--r--lib/bundler/templates/newgem/test/minitest/test_helper.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/test/test-unit/newgem_test.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/test/test-unit/test_helper.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/travis.yml.tt6
-rw-r--r--lib/bundler/ui.rb9
-rw-r--r--lib/bundler/ui/rg_proxy.rb19
-rw-r--r--lib/bundler/ui/shell.rb142
-rw-r--r--lib/bundler/ui/silent.rb69
-rw-r--r--lib/bundler/uri_credentials_filter.rb43
-rw-r--r--lib/bundler/vendor/.document1
-rw-r--r--lib/bundler/vendor/connection_pool/LICENSE20
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool.rb126
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/timed_stack.rb174
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/version.rb3
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/wrapper.rb57
-rw-r--r--lib/bundler/vendor/fileutils/LICENSE.txt22
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils.rb1764
-rw-r--r--lib/bundler/vendor/molinillo/LICENSE9
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo.rb11
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/specification_provider.rb88
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph.rb255
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/vertex.rb164
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/errors.rb143
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/specification_provider.rb112
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolution.rb839
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/bundler/vendor/net-http-persistent/README.rdoc82
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent.rb1073
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/connection.rb40
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/pool.rb53
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/timed_stack_multi.rb79
-rw-r--r--lib/bundler/vendor/thor/LICENSE.md20
-rw-r--r--lib/bundler/vendor/thor/lib/thor.rb516
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions.rb336
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_file.rb104
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_link.rb61
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/directory.rb108
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/empty_directory.rb143
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/file_manipulation.rb375
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/inject_into_file.rb120
-rw-r--r--lib/bundler/vendor/thor/lib/thor/base.rb699
-rw-r--r--lib/bundler/vendor/thor/lib/thor/command.rb142
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/hash_with_indifferent_access.rb97
-rw-r--r--lib/bundler/vendor/thor/lib/thor/error.rb110
-rw-r--r--lib/bundler/vendor/thor/lib/thor/group.rb281
-rw-r--r--lib/bundler/vendor/thor/lib/thor/invocation.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/basic.rb37
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/readline.rb88
-rw-r--r--lib/bundler/vendor/thor/lib/thor/nested_context.rb29
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/argument.rb70
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/arguments.rb179
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/option.rb159
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/options.rb237
-rw-r--r--lib/bundler/vendor/thor/lib/thor/rake_compat.rb72
-rw-r--r--lib/bundler/vendor/thor/lib/thor/runner.rb325
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell.rb81
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/basic.rb494
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/color.rb157
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/html.rb126
-rw-r--r--lib/bundler/vendor/thor/lib/thor/util.rb284
-rw-r--r--lib/bundler/vendor/thor/lib/thor/version.rb3
-rw-r--r--lib/bundler/vendor/tmpdir/lib/tmpdir.rb154
-rw-r--r--lib/bundler/vendor/tsort/LICENSE.txt22
-rw-r--r--lib/bundler/vendor/tsort/lib/tsort.rb453
-rw-r--r--lib/bundler/vendor/uri/LICENSE.txt22
-rw-r--r--lib/bundler/vendor/uri/lib/uri.rb104
-rw-r--r--lib/bundler/vendor/uri/lib/uri/common.rb744
-rw-r--r--lib/bundler/vendor/uri/lib/uri/file.rb94
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ftp.rb267
-rw-r--r--lib/bundler/vendor/uri/lib/uri/generic.rb1568
-rw-r--r--lib/bundler/vendor/uri/lib/uri/http.rb88
-rw-r--r--lib/bundler/vendor/uri/lib/uri/https.rb23
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldap.rb261
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldaps.rb21
-rw-r--r--lib/bundler/vendor/uri/lib/uri/mailto.rb294
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc2396_parser.rb546
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb125
-rw-r--r--lib/bundler/vendor/uri/lib/uri/version.rb6
-rw-r--r--lib/bundler/vendored_fileutils.rb4
-rw-r--r--lib/bundler/vendored_molinillo.rb4
-rw-r--r--lib/bundler/vendored_persistent.rb47
-rw-r--r--lib/bundler/vendored_thor.rb8
-rw-r--r--lib/bundler/vendored_tmpdir.rb4
-rw-r--r--lib/bundler/vendored_tsort.rb4
-rw-r--r--lib/bundler/vendored_uri.rb4
-rw-r--r--lib/bundler/version.rb9
-rw-r--r--lib/bundler/version_ranges.rb122
-rw-r--r--lib/bundler/vlad.rb17
-rw-r--r--lib/bundler/worker.rb119
-rw-r--r--lib/bundler/yaml_serializer.rb89
-rw-r--r--lib/cgi.rb6
-rw-r--r--lib/cgi/cgi.gemspec31
-rw-r--r--lib/cgi/cookie.rb121
-rw-r--r--lib/cgi/core.rb106
-rw-r--r--lib/cgi/html.rb11
-rw-r--r--lib/cgi/session.rb39
-rw-r--r--lib/cgi/session/pstore.rb4
-rw-r--r--lib/cgi/util.rb93
-rw-r--r--lib/cmath.rb442
-rw-r--r--lib/csv.rb4118
-rw-r--r--lib/csv/core_ext/array.rb9
-rw-r--r--lib/csv/core_ext/string.rb9
-rw-r--r--lib/csv/csv.gemspec64
-rw-r--r--lib/csv/delete_suffix.rb18
-rw-r--r--lib/csv/fields_converter.rb84
-rw-r--r--lib/csv/match_p.rb20
-rw-r--r--lib/csv/parser.rb1142
-rw-r--r--lib/csv/row.rb624
-rw-r--r--lib/csv/table.rb621
-rw-r--r--lib/csv/version.rb6
-rw-r--r--lib/csv/writer.rb209
-rw-r--r--lib/debug.gemspec22
-rw-r--r--lib/debug.rb53
-rw-r--r--lib/delegate.rb165
-rw-r--r--lib/delegate/delegate.gemspec31
-rw-r--r--lib/did_you_mean.rb112
-rw-r--r--lib/did_you_mean/core_ext/name_error.rb25
-rw-r--r--lib/did_you_mean/did_you_mean.gemspec27
-rw-r--r--lib/did_you_mean/experimental.rb2
-rw-r--r--lib/did_you_mean/formatters/plain_formatter.rb33
-rw-r--r--lib/did_you_mean/formatters/verbose_formatter.rb49
-rw-r--r--lib/did_you_mean/jaro_winkler.rb87
-rw-r--r--lib/did_you_mean/levenshtein.rb57
-rw-r--r--lib/did_you_mean/spell_checker.rb46
-rw-r--r--lib/did_you_mean/spell_checkers/key_error_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/method_name_checker.rb69
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/class_name_checker.rb49
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/variable_name_checker.rb82
-rw-r--r--lib/did_you_mean/spell_checkers/null_checker.rb6
-rw-r--r--lib/did_you_mean/spell_checkers/require_path_checker.rb35
-rw-r--r--lib/did_you_mean/tree_spell_checker.rb109
-rw-r--r--lib/did_you_mean/verbose.rb4
-rw-r--r--lib/did_you_mean/version.rb3
-rw-r--r--lib/drb.rb1
-rw-r--r--lib/drb/acl.rb11
-rw-r--r--lib/drb/drb.gemspec30
-rw-r--r--lib/drb/drb.rb345
-rw-r--r--lib/drb/eq.rb1
-rw-r--r--lib/drb/extserv.rb3
-rw-r--r--lib/drb/extservm.rb11
-rw-r--r--lib/drb/gw.rb3
-rw-r--r--lib/drb/invokemethod.rb1
-rw-r--r--lib/drb/observer.rb3
-rw-r--r--lib/drb/ssl.rb15
-rw-r--r--lib/drb/timeridconv.rb68
-rw-r--r--lib/drb/unix.rb11
-rw-r--r--lib/drb/version.rb3
-rw-r--r--lib/drb/weakidconv.rb59
-rw-r--r--lib/e2mmap.rb172
-rw-r--r--lib/erb.gemspec24
-rw-r--r--lib/erb.rb349
-rw-r--r--lib/fileutils.gemspec31
-rw-r--r--lib/fileutils.rb934
-rw-r--r--lib/find.gemspec24
-rw-r--r--lib/find.rb12
-rw-r--r--lib/forwardable.rb150
-rw-r--r--lib/forwardable/forwardable.gemspec26
-rw-r--r--lib/forwardable/impl.rb16
-rw-r--r--lib/getoptlong.rb28
-rw-r--r--lib/getoptlong/getoptlong.gemspec32
-rw-r--r--lib/ipaddr.gemspec24
-rw-r--r--lib/ipaddr.rb114
-rw-r--r--lib/irb.rb469
-rw-r--r--lib/irb/.document1
-rw-r--r--lib/irb/cmd/chws.rb9
-rw-r--r--lib/irb/cmd/fork.rb9
-rw-r--r--lib/irb/cmd/help.rb19
-rw-r--r--lib/irb/cmd/info.rb25
-rw-r--r--lib/irb/cmd/load.rb11
-rw-r--r--lib/irb/cmd/ls.rb83
-rw-r--r--lib/irb/cmd/measure.rb40
-rw-r--r--lib/irb/cmd/nop.rb15
-rw-r--r--lib/irb/cmd/pushws.rb12
-rw-r--r--lib/irb/cmd/show_source.rb86
-rw-r--r--lib/irb/cmd/subirb.rb13
-rw-r--r--lib/irb/cmd/whereami.rb20
-rw-r--r--lib/irb/color.rb251
-rw-r--r--lib/irb/color_printer.rb47
-rw-r--r--lib/irb/completion.rb302
-rw-r--r--lib/irb/context.rb211
-rw-r--r--lib/irb/easter-egg.rb138
-rw-r--r--lib/irb/ext/change-ws.rb2
-rw-r--r--lib/irb/ext/history.rb59
-rw-r--r--lib/irb/ext/loader.rb67
-rw-r--r--lib/irb/ext/math-mode.rb47
-rw-r--r--lib/irb/ext/multi-irb.rb16
-rw-r--r--lib/irb/ext/save-history.rb47
-rw-r--r--lib/irb/ext/tracer.rb17
-rw-r--r--lib/irb/ext/use-loader.rb12
-rw-r--r--lib/irb/ext/workspaces.rb2
-rw-r--r--lib/irb/extend-command.rb180
-rw-r--r--lib/irb/frame.rb20
-rw-r--r--lib/irb/help.rb4
-rw-r--r--lib/irb/init.rb185
-rw-r--r--lib/irb/input-method.rb202
-rw-r--r--lib/irb/inspector.rb27
-rw-r--r--lib/irb/irb.gemspec42
-rw-r--r--lib/irb/lc/.document4
-rw-r--r--lib/irb/lc/error.rb72
-rw-r--r--lib/irb/lc/help-message28
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb1
-rw-r--r--lib/irb/lc/ja/error.rb70
-rw-r--r--lib/irb/lc/ja/help-message16
-rw-r--r--lib/irb/locale.rb20
-rw-r--r--lib/irb/magic-file.rb3
-rw-r--r--lib/irb/notifier.rb29
-rw-r--r--lib/irb/output-method.rb15
-rw-r--r--lib/irb/ruby-lex.rb1610
-rw-r--r--lib/irb/ruby-token.rb266
-rw-r--r--lib/irb/ruby_logo.aa37
-rw-r--r--lib/irb/slex.rb281
-rw-r--r--lib/irb/src_encoding.rb7
-rw-r--r--lib/irb/version.rb6
-rw-r--r--lib/irb/workspace.rb110
-rw-r--r--lib/irb/ws-for-case-2.rb1
-rw-r--r--lib/irb/xmp.rb5
-rw-r--r--lib/logger.rb435
-rw-r--r--lib/logger/errors.rb9
-rw-r--r--lib/logger/formatter.rb36
-rw-r--r--lib/logger/log_device.rb205
-rw-r--r--lib/logger/logger.gemspec29
-rw-r--r--lib/logger/period.rb47
-rw-r--r--lib/logger/severity.rb19
-rw-r--r--lib/logger/version.rb5
-rw-r--r--lib/mathn.rb191
-rw-r--r--lib/matrix.rb957
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb232
-rw-r--r--lib/matrix/lup_decomposition.rb11
-rw-r--r--lib/matrix/matrix.gemspec29
-rw-r--r--lib/matrix/version.rb5
-rw-r--r--lib/mkmf.rb410
-rw-r--r--lib/monitor.rb300
-rw-r--r--lib/mutex_m.gemspec27
-rw-r--r--lib/mutex_m.rb16
-rw-r--r--lib/net/ftp.rb794
-rw-r--r--lib/net/http.rb403
-rw-r--r--lib/net/http/backward.rb1
-rw-r--r--lib/net/http/exceptions.rb8
-rw-r--r--lib/net/http/generic_request.rb27
-rw-r--r--lib/net/http/header.rb174
-rw-r--r--lib/net/http/net-http.gemspec36
-rw-r--r--lib/net/http/proxy_delta.rb1
-rw-r--r--lib/net/http/request.rb1
-rw-r--r--lib/net/http/requests.rb1
-rw-r--r--lib/net/http/response.rb35
-rw-r--r--lib/net/http/responses.rb68
-rw-r--r--lib/net/http/status.rb83
-rw-r--r--lib/net/https.rb5
-rw-r--r--lib/net/imap.rb246
-rw-r--r--lib/net/net-ftp.gemspec36
-rw-r--r--lib/net/net-imap.gemspec37
-rw-r--r--lib/net/net-pop.gemspec34
-rw-r--r--lib/net/net-protocol.gemspec36
-rw-r--r--lib/net/net-smtp.gemspec35
-rw-r--r--lib/net/pop.rb45
-rw-r--r--lib/net/protocol.rb162
-rw-r--r--lib/net/smtp.rb159
-rw-r--r--lib/net/telnet.rb763
-rw-r--r--lib/observer.rb30
-rw-r--r--lib/observer/observer.gemspec32
-rw-r--r--lib/open-uri.gemspec26
-rw-r--r--lib/open-uri.rb61
-rw-r--r--lib/open3.gemspec33
-rw-r--r--lib/open3.rb141
-rw-r--r--lib/optionparser.rb1
-rw-r--r--lib/optparse.rb571
-rw-r--r--lib/optparse/ac.rb8
-rw-r--r--lib/optparse/date.rb1
-rw-r--r--lib/optparse/kwargs.rb20
-rw-r--r--lib/optparse/optparse.gemspec33
-rw-r--r--lib/optparse/shellwords.rb1
-rw-r--r--lib/optparse/time.rb1
-rw-r--r--lib/optparse/uri.rb1
-rw-r--r--lib/optparse/version.rb1
-rw-r--r--lib/ostruct.rb401
-rw-r--r--lib/ostruct/ostruct.gemspec29
-rw-r--r--lib/pp.gemspec27
-rw-r--r--lib/pp.rb161
-rw-r--r--lib/prettyprint.gemspec22
-rw-r--r--lib/prettyprint.rb14
-rw-r--r--lib/prime.gemspec28
-rw-r--r--lib/prime.rb252
-rw-r--r--lib/profile.rb10
-rw-r--r--lib/profiler.rb148
-rw-r--r--lib/pstore.rb31
-rw-r--r--lib/pstore/pstore.gemspec32
-rw-r--r--lib/racc.rb6
-rw-r--r--lib/racc/compat.rb33
-rw-r--r--lib/racc/debugflags.rb60
-rw-r--r--lib/racc/exception.rb16
-rw-r--r--lib/racc/grammar.rb1118
-rw-r--r--lib/racc/grammarfileparser.rb561
-rw-r--r--lib/racc/info.rb17
-rw-r--r--lib/racc/iset.rb92
-rw-r--r--lib/racc/logfilegenerator.rb212
-rw-r--r--lib/racc/parser-text.rb637
-rw-r--r--lib/racc/parser.rb82
-rw-r--r--lib/racc/parserfilegenerator.rb512
-rw-r--r--lib/racc/pre-setup13
-rw-r--r--lib/racc/racc.gemspec107
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc32
-rw-r--r--lib/racc/sourcetext.rb35
-rw-r--r--lib/racc/state.rb972
-rw-r--r--lib/racc/statetransitiontable.rb317
-rw-r--r--lib/racc/static.rb5
-rw-r--r--lib/rake.rb79
-rw-r--r--lib/rake/alt_system.rb110
-rw-r--r--lib/rake/application.rb790
-rw-r--r--lib/rake/backtrace.rb23
-rw-r--r--lib/rake/clean.rb76
-rw-r--r--lib/rake/cloneable.rb16
-rw-r--r--lib/rake/contrib/compositepublisher.rb21
-rw-r--r--lib/rake/contrib/ftptools.rb137
-rw-r--r--lib/rake/contrib/publisher.rb81
-rw-r--r--lib/rake/contrib/rubyforgepublisher.rb18
-rw-r--r--lib/rake/contrib/sshpublisher.rb61
-rw-r--r--lib/rake/contrib/sys.rb4
-rw-r--r--lib/rake/cpu_counter.rb125
-rw-r--r--lib/rake/default_loader.rb14
-rw-r--r--lib/rake/dsl_definition.rb201
-rw-r--r--lib/rake/early_time.rb21
-rw-r--r--lib/rake/ext/core.rb25
-rw-r--r--lib/rake/ext/module.rb2
-rw-r--r--lib/rake/ext/pathname.rb25
-rw-r--r--lib/rake/ext/string.rb173
-rw-r--r--lib/rake/ext/time.rb16
-rw-r--r--lib/rake/file_creation_task.rb24
-rw-r--r--lib/rake/file_list.rb428
-rw-r--r--lib/rake/file_task.rb46
-rw-r--r--lib/rake/file_utils.rb128
-rw-r--r--lib/rake/file_utils_ext.rb144
-rw-r--r--lib/rake/gempackagetask.rb4
-rw-r--r--lib/rake/invocation_chain.rb56
-rw-r--r--lib/rake/invocation_exception_mixin.rb16
-rw-r--r--lib/rake/late_time.rb17
-rw-r--r--lib/rake/linked_list.rb103
-rw-r--r--lib/rake/loaders/makefile.rb40
-rw-r--r--lib/rake/multi_task.rb13
-rw-r--r--lib/rake/name_space.rb38
-rw-r--r--lib/rake/packagetask.rb199
-rw-r--r--lib/rake/pathmap.rb3
-rw-r--r--lib/rake/phony.rb15
-rw-r--r--lib/rake/private_reader.rb20
-rw-r--r--lib/rake/promise.rb99
-rw-r--r--lib/rake/pseudo_status.rb29
-rw-r--r--lib/rake/rake_module.rb38
-rw-r--r--lib/rake/rake_test_loader.rb22
-rw-r--r--lib/rake/rdoctask.rb4
-rw-r--r--lib/rake/ruby182_test_unit_fix.rb29
-rw-r--r--lib/rake/rule_recursion_overflow_error.rb20
-rw-r--r--lib/rake/runtest.rb27
-rw-r--r--lib/rake/scope.rb42
-rw-r--r--lib/rake/task.rb383
-rw-r--r--lib/rake/task_argument_error.rb7
-rw-r--r--lib/rake/task_arguments.rb98
-rw-r--r--lib/rake/task_manager.rb310
-rw-r--r--lib/rake/tasklib.rb24
-rw-r--r--lib/rake/testtask.rb212
-rw-r--r--lib/rake/thread_history_display.rb48
-rw-r--r--lib/rake/thread_pool.rb164
-rw-r--r--lib/rake/trace_output.rb22
-rw-r--r--lib/rake/version.rb7
-rw-r--r--lib/rake/win32.rb56
-rw-r--r--lib/rbconfig/.document1
-rw-r--r--lib/rbconfig/datadir.rb13
-rw-r--r--lib/rdoc.rb36
-rw-r--r--lib/rdoc/.document2
-rw-r--r--lib/rdoc/alias.rb1
-rw-r--r--lib/rdoc/anon_class.rb1
-rw-r--r--lib/rdoc/any_method.rb73
-rw-r--r--lib/rdoc/attr.rb1
-rw-r--r--lib/rdoc/class_module.rb7
-rw-r--r--lib/rdoc/code_object.rb14
-rw-r--r--lib/rdoc/code_objects.rb1
-rw-r--r--lib/rdoc/comment.rb43
-rw-r--r--lib/rdoc/constant.rb5
-rw-r--r--lib/rdoc/context.rb101
-rw-r--r--lib/rdoc/context/section.rb20
-rw-r--r--lib/rdoc/cross_reference.rb47
-rw-r--r--lib/rdoc/encoding.rb147
-rw-r--r--lib/rdoc/erb_partial.rb3
-rw-r--r--lib/rdoc/erbio.rb11
-rw-r--r--lib/rdoc/extend.rb1
-rw-r--r--lib/rdoc/generator.rb2
-rw-r--r--lib/rdoc/generator/darkfish.rb94
-rw-r--r--lib/rdoc/generator/json_index.rb22
-rw-r--r--lib/rdoc/generator/markup.rb15
-rw-r--r--lib/rdoc/generator/pot.rb7
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb1
-rw-r--r--lib/rdoc/generator/pot/po.rb5
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb21
-rw-r--r--lib/rdoc/generator/ri.rb1
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml10
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml10
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml10
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml8
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml8
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml92
-rw-r--r--lib/rdoc/generator/template/darkfish/css/fonts.css12
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css61
-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml7
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js123
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js4
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js63
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml31
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml32
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js45
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js17
-rw-r--r--lib/rdoc/ghost_method.rb1
-rw-r--r--lib/rdoc/i18n.rb5
-rw-r--r--lib/rdoc/i18n/locale.rb3
-rw-r--r--lib/rdoc/i18n/text.rb9
-rw-r--r--lib/rdoc/include.rb1
-rw-r--r--lib/rdoc/known_classes.rb1
-rw-r--r--lib/rdoc/markdown.rb1843
-rw-r--r--lib/rdoc/markdown/entities.rb1
-rw-r--r--lib/rdoc/markdown/literals.rb416
-rw-r--r--lib/rdoc/markdown/literals_1_9.rb420
-rw-r--r--lib/rdoc/markup.rb30
-rw-r--r--lib/rdoc/markup/attr_changer.rb1
-rw-r--r--lib/rdoc/markup/attr_span.rb11
-rw-r--r--lib/rdoc/markup/attribute_manager.rb164
-rw-r--r--lib/rdoc/markup/attributes.rb13
-rw-r--r--lib/rdoc/markup/blank_line.rb1
-rw-r--r--lib/rdoc/markup/block_quote.rb1
-rw-r--r--lib/rdoc/markup/document.rb1
-rw-r--r--lib/rdoc/markup/formatter.rb48
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb767
-rw-r--r--lib/rdoc/markup/hard_break.rb1
-rw-r--r--lib/rdoc/markup/heading.rb7
-rw-r--r--lib/rdoc/markup/include.rb1
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb1
-rw-r--r--lib/rdoc/markup/inline.rb1
-rw-r--r--lib/rdoc/markup/list.rb1
-rw-r--r--lib/rdoc/markup/list_item.rb1
-rw-r--r--lib/rdoc/markup/paragraph.rb1
-rw-r--r--lib/rdoc/markup/parser.rb139
-rw-r--r--lib/rdoc/markup/pre_process.rb21
-rw-r--r--lib/rdoc/markup/raw.rb1
-rw-r--r--lib/rdoc/markup/regexp_handling.rb41
-rw-r--r--lib/rdoc/markup/rule.rb1
-rw-r--r--lib/rdoc/markup/special.rb40
-rw-r--r--lib/rdoc/markup/table.rb47
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb114
-rw-r--r--lib/rdoc/markup/to_ansi.rb1
-rw-r--r--lib/rdoc/markup/to_bs.rb9
-rw-r--r--lib/rdoc/markup/to_html.rb96
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb66
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb19
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb38
-rw-r--r--lib/rdoc/markup/to_label.rb19
-rw-r--r--lib/rdoc/markup/to_markdown.rb17
-rw-r--r--lib/rdoc/markup/to_rdoc.rb41
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb2
-rw-r--r--lib/rdoc/markup/to_test.rb1
-rw-r--r--lib/rdoc/markup/to_tt_only.rb5
-rw-r--r--lib/rdoc/markup/verbatim.rb1
-rw-r--r--lib/rdoc/meta_method.rb1
-rw-r--r--lib/rdoc/method_attr.rb3
-rw-r--r--lib/rdoc/mixin.rb1
-rw-r--r--lib/rdoc/normal_class.rb5
-rw-r--r--lib/rdoc/normal_module.rb1
-rw-r--r--lib/rdoc/options.rb150
-rw-r--r--lib/rdoc/parser.rb67
-rw-r--r--lib/rdoc/parser/c.rb442
-rw-r--r--lib/rdoc/parser/changelog.rb173
-rw-r--r--lib/rdoc/parser/markdown.rb1
-rw-r--r--lib/rdoc/parser/rd.rb1
-rw-r--r--lib/rdoc/parser/ripper_state_lex.rb590
-rw-r--r--lib/rdoc/parser/ruby.rb1103
-rw-r--r--lib/rdoc/parser/ruby_tools.rb66
-rw-r--r--lib/rdoc/parser/simple.rb6
-rw-r--r--lib/rdoc/parser/text.rb1
-rw-r--r--lib/rdoc/rd.rb1
-rw-r--r--lib/rdoc/rd/block_parser.rb109
-rw-r--r--lib/rdoc/rd/inline.rb9
-rw-r--r--lib/rdoc/rd/inline_parser.rb333
-rw-r--r--lib/rdoc/rdoc.gemspec249
-rw-r--r--lib/rdoc/rdoc.rb140
-rw-r--r--lib/rdoc/require.rb1
-rw-r--r--lib/rdoc/ri.rb1
-rw-r--r--lib/rdoc/ri/driver.rb191
-rw-r--r--lib/rdoc/ri/formatter.rb1
-rw-r--r--lib/rdoc/ri/paths.rb24
-rw-r--r--lib/rdoc/ri/store.rb1
-rw-r--r--lib/rdoc/ri/task.rb4
-rw-r--r--lib/rdoc/ruby_lex.rb1377
-rw-r--r--lib/rdoc/ruby_token.rb460
-rw-r--r--lib/rdoc/rubygems_hook.rb17
-rw-r--r--lib/rdoc/servlet.rb40
-rw-r--r--lib/rdoc/single_class.rb1
-rw-r--r--lib/rdoc/stats.rb1
-rw-r--r--lib/rdoc/stats/normal.rb41
-rw-r--r--lib/rdoc/stats/quiet.rb1
-rw-r--r--lib/rdoc/stats/verbose.rb1
-rw-r--r--lib/rdoc/store.rb119
-rw-r--r--lib/rdoc/task.rb5
-rw-r--r--lib/rdoc/test_case.rb217
-rw-r--r--lib/rdoc/text.rb58
-rw-r--r--lib/rdoc/token_stream.rb88
-rw-r--r--lib/rdoc/tom_doc.rb28
-rw-r--r--lib/rdoc/top_level.rb11
-rw-r--r--lib/rdoc/version.rb8
-rw-r--r--lib/readline.gemspec35
-rw-r--r--lib/readline.rb6
-rw-r--r--lib/reline.rb471
-rw-r--r--lib/reline/ansi.rb259
-rw-r--r--lib/reline/config.rb347
-rw-r--r--lib/reline/general_io.rb93
-rw-r--r--lib/reline/history.rb76
-rw-r--r--lib/reline/key_actor.rb7
-rw-r--r--lib/reline/key_actor/base.rb7
-rw-r--r--lib/reline/key_actor/emacs.rb517
-rw-r--r--lib/reline/key_actor/vi_command.rb518
-rw-r--r--lib/reline/key_actor/vi_insert.rb517
-rw-r--r--lib/reline/key_stroke.rb55
-rw-r--r--lib/reline/kill_ring.rb125
-rw-r--r--lib/reline/line_editor.rb2781
-rw-r--r--lib/reline/reline.gemspec27
-rw-r--r--lib/reline/unicode.rb626
-rw-r--r--lib/reline/unicode/east_asian_width.rb1164
-rw-r--r--lib/reline/version.rb3
-rw-r--r--lib/reline/windows.rb328
-rw-r--r--lib/resolv-replace.gemspec24
-rw-r--r--lib/resolv-replace.rb2
-rw-r--r--lib/resolv.gemspec22
-rw-r--r--lib/resolv.rb280
-rw-r--r--lib/rexml/attlistdecl.rb62
-rw-r--r--lib/rexml/attribute.rb191
-rw-r--r--lib/rexml/cdata.rb67
-rw-r--r--lib/rexml/child.rb96
-rw-r--r--lib/rexml/comment.rb79
-rw-r--r--lib/rexml/doctype.rb269
-rw-r--r--lib/rexml/document.rb290
-rw-r--r--lib/rexml/dtd/attlistdecl.rb10
-rw-r--r--lib/rexml/dtd/dtd.rb46
-rw-r--r--lib/rexml/dtd/elementdecl.rb17
-rw-r--r--lib/rexml/dtd/entitydecl.rb56
-rw-r--r--lib/rexml/dtd/notationdecl.rb39
-rw-r--r--lib/rexml/element.rb1240
-rw-r--r--lib/rexml/encoding.rb50
-rw-r--r--lib/rexml/entity.rb173
-rw-r--r--lib/rexml/formatters/default.rb111
-rw-r--r--lib/rexml/formatters/pretty.rb141
-rw-r--r--lib/rexml/formatters/transitive.rb57
-rw-r--r--lib/rexml/functions.rb394
-rw-r--r--lib/rexml/instruction.rb70
-rw-r--r--lib/rexml/light/node.rb195
-rw-r--r--lib/rexml/namespace.rb47
-rw-r--r--lib/rexml/node.rb75
-rw-r--r--lib/rexml/output.rb29
-rw-r--r--lib/rexml/parent.rb165
-rw-r--r--lib/rexml/parseexception.rb51
-rw-r--r--lib/rexml/parsers/baseparser.rb532
-rw-r--r--lib/rexml/parsers/lightparser.rb58
-rw-r--r--lib/rexml/parsers/pullparser.rb196
-rw-r--r--lib/rexml/parsers/sax2parser.rb272
-rw-r--r--lib/rexml/parsers/streamparser.rb52
-rw-r--r--lib/rexml/parsers/treeparser.rb100
-rw-r--r--lib/rexml/parsers/ultralightparser.rb56
-rw-r--r--lib/rexml/parsers/xpathparser.rb656
-rw-r--r--lib/rexml/quickpath.rb265
-rw-r--r--lib/rexml/rexml.rb31
-rw-r--r--lib/rexml/sax2listener.rb97
-rw-r--r--lib/rexml/security.rb27
-rw-r--r--lib/rexml/source.rb296
-rw-r--r--lib/rexml/streamlistener.rb92
-rw-r--r--lib/rexml/syncenumerator.rb32
-rw-r--r--lib/rexml/text.rb425
-rw-r--r--lib/rexml/undefinednamespaceexception.rb8
-rw-r--r--lib/rexml/validation/relaxng.rb538
-rw-r--r--lib/rexml/validation/validation.rb143
-rw-r--r--lib/rexml/validation/validationexception.rb9
-rw-r--r--lib/rexml/xmldecl.rb115
-rw-r--r--lib/rexml/xmltokens.rb84
-rw-r--r--lib/rexml/xpath.rb80
-rw-r--r--lib/rexml/xpath_parser.rb703
-rw-r--r--lib/rinda/rinda.gemspec28
-rw-r--r--lib/rinda/rinda.rb2
-rw-r--r--lib/rinda/ring.rb12
-rw-r--r--lib/rinda/tuplespace.rb7
-rw-r--r--lib/rss.rb91
-rw-r--r--lib/rss/0.9.rb461
-rw-r--r--lib/rss/1.0.rb484
-rw-r--r--lib/rss/2.0.rb142
-rw-r--r--lib/rss/atom.rb839
-rw-r--r--lib/rss/content.rb33
-rw-r--r--lib/rss/content/1.0.rb9
-rw-r--r--lib/rss/content/2.0.rb11
-rw-r--r--lib/rss/converter.rb170
-rw-r--r--lib/rss/dublincore.rb163
-rw-r--r--lib/rss/dublincore/1.0.rb12
-rw-r--r--lib/rss/dublincore/2.0.rb12
-rw-r--r--lib/rss/dublincore/atom.rb16
-rw-r--r--lib/rss/image.rb197
-rw-r--r--lib/rss/itunes.rb412
-rw-r--r--lib/rss/maker.rb78
-rw-r--r--lib/rss/maker/0.9.rb508
-rw-r--r--lib/rss/maker/1.0.rb435
-rw-r--r--lib/rss/maker/2.0.rb223
-rw-r--r--lib/rss/maker/atom.rb172
-rw-r--r--lib/rss/maker/base.rb944
-rw-r--r--lib/rss/maker/content.rb21
-rw-r--r--lib/rss/maker/dublincore.rb121
-rw-r--r--lib/rss/maker/entry.rb163
-rw-r--r--lib/rss/maker/feed.rb426
-rw-r--r--lib/rss/maker/image.rb111
-rw-r--r--lib/rss/maker/itunes.rb242
-rw-r--r--lib/rss/maker/slash.rb33
-rw-r--r--lib/rss/maker/syndication.rb18
-rw-r--r--lib/rss/maker/taxonomy.rb118
-rw-r--r--lib/rss/maker/trackback.rb61
-rw-r--r--lib/rss/parser.rb570
-rw-r--r--lib/rss/rexmlparser.rb49
-rw-r--r--lib/rss/rss.rb1352
-rw-r--r--lib/rss/slash.rb51
-rw-r--r--lib/rss/syndication.rb68
-rw-r--r--lib/rss/taxonomy.rb147
-rw-r--r--lib/rss/trackback.rb290
-rw-r--r--lib/rss/utils.rb199
-rw-r--r--lib/rss/xml-stylesheet.rb105
-rw-r--r--lib/rss/xml.rb71
-rw-r--r--lib/rss/xmlparser.rb94
-rw-r--r--lib/rss/xmlscanner.rb121
-rw-r--r--lib/rubygems.rb745
-rw-r--r--lib/rubygems/LICENSE.txt54
-rw-r--r--lib/rubygems/available_set.rb12
-rw-r--r--lib/rubygems/basic_specification.rb179
-rw-r--r--lib/rubygems/bundler_version_finder.rb109
-rw-r--r--lib/rubygems/command.rb153
-rw-r--r--lib/rubygems/command_manager.rb49
-rw-r--r--lib/rubygems/commands/build_command.rb98
-rw-r--r--lib/rubygems/commands/cert_command.rb173
-rw-r--r--lib/rubygems/commands/check_command.rb13
-rw-r--r--lib/rubygems/commands/cleanup_command.rb74
-rw-r--r--lib/rubygems/commands/contents_command.rb50
-rw-r--r--lib/rubygems/commands/dependency_command.rb92
-rw-r--r--lib/rubygems/commands/environment_command.rb36
-rw-r--r--lib/rubygems/commands/fetch_command.rb18
-rw-r--r--lib/rubygems/commands/generate_index_command.rb17
-rw-r--r--lib/rubygems/commands/help_command.rb52
-rw-r--r--lib/rubygems/commands/info_command.rb38
-rw-r--r--lib/rubygems/commands/install_command.rb170
-rw-r--r--lib/rubygems/commands/list_command.rb21
-rw-r--r--lib/rubygems/commands/lock_command.rb18
-rw-r--r--lib/rubygems/commands/mirror_command.rb4
-rw-r--r--lib/rubygems/commands/open_command.rb44
-rw-r--r--lib/rubygems/commands/outdated_command.rb10
-rw-r--r--lib/rubygems/commands/owner_command.rb53
-rw-r--r--lib/rubygems/commands/pristine_command.rb89
-rw-r--r--lib/rubygems/commands/push_command.rb95
-rw-r--r--lib/rubygems/commands/query_command.rb332
-rw-r--r--lib/rubygems/commands/rdoc_command.rb15
-rw-r--r--lib/rubygems/commands/search_command.rb18
-rw-r--r--lib/rubygems/commands/server_command.rb18
-rw-r--r--lib/rubygems/commands/setup_command.rb446
-rw-r--r--lib/rubygems/commands/signin_command.rb33
-rw-r--r--lib/rubygems/commands/signout_command.rb31
-rw-r--r--lib/rubygems/commands/sources_command.rb62
-rw-r--r--lib/rubygems/commands/specification_command.rb34
-rw-r--r--lib/rubygems/commands/stale_command.rb5
-rw-r--r--lib/rubygems/commands/uninstall_command.rb89
-rw-r--r--lib/rubygems/commands/unpack_command.rb77
-rw-r--r--lib/rubygems/commands/update_command.rb186
-rw-r--r--lib/rubygems/commands/which_command.rb19
-rw-r--r--lib/rubygems/commands/yank_command.rb61
-rw-r--r--lib/rubygems/compatibility.rb31
-rw-r--r--lib/rubygems/config_file.rb213
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb14
-rw-r--r--[-rwxr-xr-x]lib/rubygems/core_ext/kernel_require.rb96
-rw-r--r--lib/rubygems/core_ext/kernel_warn.rb54
-rw-r--r--lib/rubygems/core_ext/tcpsocket_init.rb52
-rw-r--r--lib/rubygems/defaults.rb192
-rw-r--r--lib/rubygems/dependency.rb104
-rw-r--r--lib/rubygems/dependency_installer.rb241
-rw-r--r--lib/rubygems/dependency_list.rb62
-rw-r--r--lib/rubygems/deprecate.rb65
-rw-r--r--lib/rubygems/doctor.rb24
-rw-r--r--lib/rubygems/errors.rb59
-rw-r--r--lib/rubygems/exceptions.rb56
-rw-r--r--lib/rubygems/ext.rb14
-rw-r--r--lib/rubygems/ext/build_error.rb4
-rw-r--r--lib/rubygems/ext/builder.rb125
-rw-r--r--lib/rubygems/ext/cmake_builder.rb14
-rw-r--r--lib/rubygems/ext/configure_builder.rb15
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb80
-rw-r--r--lib/rubygems/ext/rake_builder.rb36
-rw-r--r--lib/rubygems/gem_runner.rb20
-rw-r--r--lib/rubygems/gemcutter_utilities.rb201
-rw-r--r--lib/rubygems/indexer.rb175
-rw-r--r--lib/rubygems/install_default_message.rb6
-rw-r--r--lib/rubygems/install_message.rb6
-rw-r--r--lib/rubygems/install_update_options.rb128
-rw-r--r--lib/rubygems/installer.rb489
-rw-r--r--lib/rubygems/installer_test_case.rb193
-rw-r--r--lib/rubygems/installer_uninstaller_utils.rb29
-rw-r--r--lib/rubygems/local_remote_options.rb18
-rw-r--r--lib/rubygems/mock_gem_ui.rb15
-rw-r--r--lib/rubygems/name_tuple.rb20
-rw-r--r--lib/rubygems/openssl.rb7
-rw-r--r--lib/rubygems/optparse.rb3
-rw-r--r--lib/rubygems/optparse/.document1
-rw-r--r--lib/rubygems/optparse/COPYING56
-rw-r--r--lib/rubygems/optparse/lib/optionparser.rb2
-rw-r--r--lib/rubygems/optparse/lib/optparse.rb2230
-rw-r--r--lib/rubygems/optparse/lib/optparse/ac.rb54
-rw-r--r--lib/rubygems/optparse/lib/optparse/date.rb18
-rw-r--r--lib/rubygems/optparse/lib/optparse/kwargs.rb22
-rw-r--r--lib/rubygems/optparse/lib/optparse/shellwords.rb7
-rw-r--r--lib/rubygems/optparse/lib/optparse/time.rb11
-rw-r--r--lib/rubygems/optparse/lib/optparse/uri.rb7
-rw-r--r--lib/rubygems/optparse/lib/optparse/version.rb71
-rw-r--r--lib/rubygems/package.rb282
-rw-r--r--lib/rubygems/package/digest_io.rb10
-rw-r--r--lib/rubygems/package/file_source.rb14
-rw-r--r--lib/rubygems/package/io_source.rb10
-rw-r--r--lib/rubygems/package/old.rb42
-rw-r--r--lib/rubygems/package/source.rb2
-rw-r--r--lib/rubygems/package/tar_header.rb50
-rw-r--r--lib/rubygems/package/tar_reader.rb37
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb36
-rw-r--r--lib/rubygems/package/tar_test_case.rb137
-rw-r--r--lib/rubygems/package/tar_writer.rb86
-rw-r--r--lib/rubygems/package_task.rb14
-rw-r--r--lib/rubygems/path_support.rb73
-rw-r--r--lib/rubygems/platform.rb50
-rw-r--r--lib/rubygems/psych_additions.rb3
-rw-r--r--lib/rubygems/psych_tree.rb3
-rw-r--r--lib/rubygems/query_utils.rb353
-rw-r--r--lib/rubygems/rdoc.rb333
-rw-r--r--lib/rubygems/remote_fetcher.rb213
-rw-r--r--lib/rubygems/request.rb118
-rw-r--r--lib/rubygems/request/connection_pools.rb52
-rw-r--r--lib/rubygems/request/http_pool.rb11
-rw-r--r--lib/rubygems/request/https_pool.rb5
-rw-r--r--lib/rubygems/request_set.rb181
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb183
-rw-r--r--lib/rubygems/request_set/lockfile.rb555
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb343
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb112
-rw-r--r--lib/rubygems/requirement.rb146
-rw-r--r--lib/rubygems/resolver.rb418
-rw-r--r--lib/rubygems/resolver/activation_request.rb106
-rw-r--r--lib/rubygems/resolver/api_set.rb65
-rw-r--r--lib/rubygems/resolver/api_set/gem_parser.rb20
-rw-r--r--lib/rubygems/resolver/api_specification.rb43
-rw-r--r--lib/rubygems/resolver/best_set.rb22
-rw-r--r--lib/rubygems/resolver/composed_set.rb20
-rw-r--r--lib/rubygems/resolver/conflict.rb23
-rw-r--r--lib/rubygems/resolver/current_set.rb6
-rw-r--r--lib/rubygems/resolver/dependency_request.rb18
-rw-r--r--lib/rubygems/resolver/git_set.rb14
-rw-r--r--lib/rubygems/resolver/git_specification.rb17
-rw-r--r--lib/rubygems/resolver/index_set.rb16
-rw-r--r--lib/rubygems/resolver/index_specification.rb42
-rw-r--r--lib/rubygems/resolver/installed_specification.rb10
-rw-r--r--lib/rubygems/resolver/installer_set.rb118
-rw-r--r--lib/rubygems/resolver/local_specification.rb6
-rw-r--r--lib/rubygems/resolver/lock_set.rb26
-rw-r--r--lib/rubygems/resolver/lock_specification.rb25
-rw-r--r--lib/rubygems/resolver/molinillo.rb2
-rw-r--r--lib/rubygems/resolver/molinillo/LICENSE9
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb11
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb88
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb255
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb164
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb143
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb112
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb839
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/rubygems/resolver/requirement_list.rb4
-rw-r--r--lib/rubygems/resolver/set.rb8
-rw-r--r--lib/rubygems/resolver/source_set.rb45
-rw-r--r--lib/rubygems/resolver/spec_specification.rb20
-rw-r--r--lib/rubygems/resolver/specification.rb37
-rw-r--r--lib/rubygems/resolver/stats.rb3
-rw-r--r--lib/rubygems/resolver/vendor_set.rb12
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb8
-rw-r--r--lib/rubygems/s3_uri_signer.rb175
-rw-r--r--lib/rubygems/safe_yaml.rb57
-rw-r--r--lib/rubygems/security.rb163
-rw-r--r--lib/rubygems/security/policies.rb4
-rw-r--r--lib/rubygems/security/policy.rb74
-rw-r--r--lib/rubygems/security/signer.rb109
-rw-r--r--lib/rubygems/security/trust_dir.rb26
-rw-r--r--lib/rubygems/security_option.rb42
-rw-r--r--lib/rubygems/server.rb156
-rw-r--r--lib/rubygems/source.rb100
-rw-r--r--lib/rubygems/source/git.rb38
-rw-r--r--lib/rubygems/source/installed.rb10
-rw-r--r--lib/rubygems/source/local.rb88
-rw-r--r--lib/rubygems/source/lock.rb16
-rw-r--r--lib/rubygems/source/specific_file.rb13
-rw-r--r--lib/rubygems/source/vendor.rb8
-rw-r--r--lib/rubygems/source_list.rb21
-rw-r--r--lib/rubygems/source_local.rb5
-rw-r--r--lib/rubygems/source_specific_file.rb4
-rw-r--r--lib/rubygems/spec_fetcher.rb76
-rw-r--r--lib/rubygems/specification.rb1669
-rw-r--r--lib/rubygems/specification_policy.rb486
-rw-r--r--lib/rubygems/ssl_certs/AddTrustExternalCARoot-2048.pem25
-rw-r--r--lib/rubygems/ssl_certs/AddTrustExternalCARoot.pem32
-rw-r--r--lib/rubygems/ssl_certs/Class3PublicPrimaryCertificationAuthority.pem14
-rw-r--r--lib/rubygems/ssl_certs/DigiCertHighAssuranceEVRootCA.pem23
-rw-r--r--lib/rubygems/ssl_certs/EntrustnetSecureServerCertificationAuthority.pem28
-rw-r--r--lib/rubygems/ssl_certs/GeoTrustGlobalCA.pem20
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA_R3.pem21
-rw-r--r--lib/rubygems/stub_specification.rb192
-rw-r--r--lib/rubygems/syck_hack.rb76
-rw-r--r--lib/rubygems/test_case.rb1441
-rw-r--r--lib/rubygems/test_utilities.rb383
-rw-r--r--lib/rubygems/text.rb36
-rw-r--r--lib/rubygems/tsort.rb3
-rw-r--r--lib/rubygems/tsort/.document1
-rw-r--r--lib/rubygems/tsort/LICENSE.txt22
-rw-r--r--lib/rubygems/tsort/lib/tsort.rb454
-rw-r--r--lib/rubygems/uninstaller.rb190
-rw-r--r--lib/rubygems/uri.rb111
-rw-r--r--lib/rubygems/uri_formatter.rb10
-rw-r--r--lib/rubygems/user_interaction.rb179
-rw-r--r--lib/rubygems/util.rb123
-rw-r--r--lib/rubygems/util/licenses.rb544
-rw-r--r--lib/rubygems/util/list.rb33
-rw-r--r--lib/rubygems/util/stringio.rb34
-rw-r--r--lib/rubygems/validator.rb58
-rw-r--r--lib/rubygems/version.rb142
-rw-r--r--lib/rubygems/version_option.rb25
-rw-r--r--lib/scanf.rb776
-rw-r--r--lib/securerandom.gemspec22
-rw-r--r--lib/securerandom.rb376
-rw-r--r--lib/set.rb641
-rw-r--r--lib/set/set.gemspec25
-rw-r--r--lib/set/sorted_set.rb6
-rw-r--r--lib/shell.rb458
-rw-r--r--lib/shell/builtin-command.rb146
-rw-r--r--lib/shell/command-processor.rb667
-rw-r--r--lib/shell/error.rb25
-rw-r--r--lib/shell/filter.rb137
-rw-r--r--lib/shell/process-controller.rb310
-rw-r--r--lib/shell/system-command.rb158
-rw-r--r--lib/shell/version.rb15
-rw-r--r--lib/shellwords.gemspec22
-rw-r--r--lib/shellwords.rb69
-rw-r--r--lib/singleton.rb37
-rw-r--r--lib/singleton/singleton.gemspec30
-rw-r--r--lib/sync.rb328
-rw-r--r--lib/tempfile.gemspec24
-rw-r--r--lib/tempfile.rb189
-rw-r--r--lib/thwait.rb140
-rw-r--r--lib/time.gemspec22
-rw-r--r--lib/time.rb279
-rw-r--r--lib/timeout.rb39
-rw-r--r--lib/timeout/timeout.gemspec30
-rw-r--r--lib/tmpdir.gemspec26
-rw-r--r--lib/tmpdir.rb89
-rw-r--r--lib/tracer.rb20
-rw-r--r--lib/tracer/tracer.gemspec25
-rw-r--r--lib/tsort.gemspec22
-rw-r--r--lib/tsort.rb2
-rw-r--r--lib/ubygems.rb10
-rw-r--r--lib/un.gemspec23
-rw-r--r--lib/un.rb65
-rw-r--r--lib/unicode_normalize.rb78
-rw-r--r--lib/unicode_normalize/normalize.rb39
-rw-r--r--lib/unicode_normalize/tables.rb10116
-rw-r--r--lib/uri.rb70
-rw-r--r--lib/uri/common.rb235
-rw-r--r--lib/uri/file.rb94
-rw-r--r--lib/uri/ftp.rb68
-rw-r--r--lib/uri/generic.rb520
-rw-r--r--lib/uri/http.rb77
-rw-r--r--lib/uri/https.rb4
-rw-r--r--lib/uri/ldap.rb83
-rw-r--r--lib/uri/ldaps.rb3
-rw-r--r--lib/uri/mailto.rb65
-rw-r--r--lib/uri/rfc2396_parser.rb74
-rw-r--r--lib/uri/rfc3986_parser.rb26
-rw-r--r--lib/uri/uri.gemspec29
-rw-r--r--lib/uri/version.rb6
-rw-r--r--lib/uri/ws.rb84
-rw-r--r--lib/uri/wss.rb22
-rw-r--r--lib/weakref.rb51
-rw-r--r--lib/weakref/weakref.gemspec34
-rw-r--r--lib/webrick.rb226
-rw-r--r--lib/webrick/accesslog.rb158
-rw-r--r--lib/webrick/cgi.rb308
-rw-r--r--lib/webrick/compat.rb35
-rw-r--r--lib/webrick/config.rb151
-rw-r--r--lib/webrick/cookie.rb171
-rw-r--r--lib/webrick/htmlutils.rb29
-rw-r--r--lib/webrick/httpauth.rb95
-rw-r--r--lib/webrick/httpauth/authenticator.rb116
-rw-r--r--lib/webrick/httpauth/basicauth.rb108
-rw-r--r--lib/webrick/httpauth/digestauth.rb408
-rw-r--r--lib/webrick/httpauth/htdigest.rb131
-rw-r--r--lib/webrick/httpauth/htgroup.rb93
-rw-r--r--lib/webrick/httpauth/htpasswd.rb124
-rw-r--r--lib/webrick/httpauth/userdb.rb52
-rw-r--r--lib/webrick/httpproxy.rb337
-rw-r--r--lib/webrick/httprequest.rb584
-rw-r--r--lib/webrick/httpresponse.rb466
-rw-r--r--lib/webrick/https.rb86
-rw-r--r--lib/webrick/httpserver.rb278
-rw-r--r--lib/webrick/httpservlet.rb22
-rw-r--r--lib/webrick/httpservlet/abstract.rb153
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb46
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb120
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb87
-rw-r--r--lib/webrick/httpservlet/filehandler.rb521
-rw-r--r--lib/webrick/httpservlet/prochandler.rb46
-rw-r--r--lib/webrick/httpstatus.rb196
-rw-r--r--lib/webrick/httputils.rb509
-rw-r--r--lib/webrick/httpversion.rb75
-rw-r--r--lib/webrick/log.rb155
-rw-r--r--lib/webrick/server.rb365
-rw-r--r--lib/webrick/ssl.rb196
-rw-r--r--lib/webrick/utils.rb230
-rw-r--r--lib/webrick/version.rb17
-rw-r--r--lib/xmlrpc.rb301
-rw-r--r--lib/xmlrpc/base64.rb62
-rw-r--r--lib/xmlrpc/client.rb628
-rw-r--r--lib/xmlrpc/config.rb43
-rw-r--r--lib/xmlrpc/create.rb286
-rw-r--r--lib/xmlrpc/datetime.rb129
-rw-r--r--lib/xmlrpc/marshal.rb66
-rw-r--r--lib/xmlrpc/parser.rb870
-rw-r--r--lib/xmlrpc/server.rb707
-rw-r--r--lib/xmlrpc/utils.rb171
-rw-r--r--lib/yaml.rb20
-rw-r--r--lib/yaml/dbm.rb1
-rw-r--r--lib/yaml/store.rb21
-rw-r--r--lib/yaml/yaml.gemspec23
-rwxr-xr-xlibexec/bundle50
-rwxr-xr-xlibexec/bundler4
-rwxr-xr-xlibexec/erb174
-rwxr-xr-xlibexec/irb11
-rwxr-xr-xlibexec/racc320
-rwxr-xr-xlibexec/rdoc44
-rwxr-xr-xlibexec/ri12
-rw-r--r--load.c735
-rw-r--r--loadpath.c1
-rw-r--r--localeinit.c98
-rw-r--r--main.c14
-rw-r--r--man/erb.125
-rw-r--r--man/goruby.14
-rw-r--r--man/index.txt25
-rw-r--r--man/irb.188
-rw-r--r--man/rake.1141
-rw-r--r--man/ri.1244
-rw-r--r--man/ruby.1129
-rw-r--r--marshal.c663
-rw-r--r--math.c438
-rw-r--r--memory_view.c869
-rw-r--r--method.h264
-rw-r--r--mini_builtin.c84
-rw-r--r--miniinit.c23
-rw-r--r--misc/README18
-rwxr-xr-xmisc/expand_tabs.rb167
-rw-r--r--misc/inf-ruby.el418
-rwxr-xr-xmisc/lldb_cruby.py534
-rw-r--r--misc/lldb_disasm.py239
-rwxr-xr-xmisc/rb_optparse.zsh2
-rw-r--r--misc/rdoc-mode.el166
-rw-r--r--misc/ruby-additional.el126
-rw-r--r--misc/ruby-electric.el475
-rw-r--r--misc/ruby-mode.el1584
-rw-r--r--misc/ruby-style.el19
-rw-r--r--misc/rubydb2x.el104
-rw-r--r--misc/rubydb3x.el115
-rw-r--r--misc/test_lldb_cruby.rb40
-rw-r--r--missing/alloca.c2
-rw-r--r--missing/crypt.c546
-rw-r--r--missing/crypt.h247
-rw-r--r--missing/des_tables.c1616
-rw-r--r--missing/dtoa.c3470
-rw-r--r--missing/dup2.c2
-rw-r--r--missing/explicit_bzero.c94
-rw-r--r--missing/file.h3
-rw-r--r--missing/fileblocks.c1
-rw-r--r--missing/flock.c4
-rw-r--r--missing/isinf.c2
-rw-r--r--missing/memcmp.c3
-rw-r--r--missing/mt19937.c158
-rw-r--r--missing/nan.c28
-rw-r--r--missing/os2.c138
-rw-r--r--missing/procstat_vm.c85
-rw-r--r--missing/setproctitle.c6
-rw-r--r--missing/strerror.c2
-rw-r--r--missing/strlcat.c86
-rw-r--r--missing/strlcpy.c77
-rw-r--r--missing/strtol.c27
-rw-r--r--missing/tgamma.c57
-rw-r--r--missing/x86_64-chkstk.S (renamed from missing/x86_64-chkstk.s)0
-rw-r--r--mjit.c1023
-rw-r--r--mjit.h216
-rw-r--r--mjit_compile.c606
-rw-r--r--mjit_worker.c1528
-rw-r--r--nacl/GNUmakefile.in100
-rw-r--r--nacl/README.nacl51
-rw-r--r--nacl/create_nmf.rb70
-rw-r--r--nacl/dirent.h15
-rw-r--r--nacl/example.html150
-rwxr-xr-xnacl/nacl-config.rb61
-rw-r--r--nacl/package.rb113
-rw-r--r--nacl/pepper_main.c732
-rw-r--r--nacl/resource.h8
-rw-r--r--nacl/select.h7
-rw-r--r--nacl/signal.h6
-rw-r--r--nacl/stat.h10
-rw-r--r--nacl/unistd.h9
-rw-r--r--nacl/utime.h11
-rw-r--r--node.c1152
-rw-r--r--node.h544
-rw-r--r--numeric.c3704
-rw-r--r--object.c2750
-rw-r--r--pack.c702
-rw-r--r--pack.rb283
-rw-r--r--parse.y12974
-rw-r--r--prelude.rb33
-rw-r--r--probes.d17
-rw-r--r--probes_helper.h79
-rw-r--r--proc.c2911
-rw-r--r--process.c3464
-rw-r--r--ractor.c3257
-rw-r--r--ractor.rb838
-rw-r--r--ractor_core.h341
-rw-r--r--random.c1415
-rw-r--r--range.c1159
-rw-r--r--rational.c1991
-rw-r--r--re.c1102
-rw-r--r--regcomp.c813
-rw-r--r--regenc.c85
-rw-r--r--regenc.h140
-rw-r--r--regerror.c73
-rw-r--r--regexec.c1712
-rw-r--r--regint.h464
-rw-r--r--regparse.c1393
-rw-r--r--regparse.h65
-rw-r--r--regsyntax.c15
-rw-r--r--ruby-runner.c98
-rw-r--r--ruby.c1560
-rw-r--r--ruby_assert.h15
-rw-r--r--ruby_atomic.h193
-rw-r--r--rubystub.c60
-rw-r--r--safe.c133
-rw-r--r--sample/README2
-rw-r--r--sample/biorhythm.rb9
-rw-r--r--sample/cbreak.rb8
-rw-r--r--sample/delegate.rb2
-rw-r--r--sample/dir.rb2
-rw-r--r--sample/drb/dchats.rb1
-rw-r--r--sample/drb/dhasen.rb3
-rw-r--r--sample/drb/dlogd.rb3
-rw-r--r--sample/drb/dqueue.rb3
-rw-r--r--sample/drb/http0serv.rb13
-rw-r--r--sample/drb/name.rb8
-rw-r--r--sample/drb/old_tuplespace.rb4
-rw-r--r--sample/drb/ring_echo.rb1
-rw-r--r--sample/drb/simpletuple.rb2
-rw-r--r--sample/dualstack-httpd.rb1
-rw-r--r--sample/export.rb2
-rw-r--r--sample/exyacc.rb2
-rw-r--r--sample/fact.rb4
-rw-r--r--sample/fib.py2
-rw-r--r--sample/freq.rb12
-rw-r--r--sample/iseq_loader.rb243
-rw-r--r--sample/list.rb7
-rw-r--r--sample/list3.rb2
-rw-r--r--sample/observ.rb3
-rw-r--r--sample/occur.rb2
-rw-r--r--sample/occur2.rb13
-rw-r--r--sample/openssl/c_rehash.rb2
-rw-r--r--sample/openssl/cipher.rb4
-rw-r--r--sample/openssl/echo_svr.rb2
-rw-r--r--sample/openssl/gen_csr.rb2
-rw-r--r--sample/philos.rb3
-rw-r--r--sample/pty/expect_sample.rb14
-rw-r--r--sample/pty/script.rb2
-rw-r--r--sample/pty/shl.rb47
-rw-r--r--sample/ripper/ruby2html.rb6
-rw-r--r--[-rwxr-xr-x]sample/test.rb2365
-rw-r--r--sample/timeout.rb18
-rw-r--r--sample/trick2013/README.md2
-rw-r--r--sample/trick2013/kinaba/remarks.markdown8
-rw-r--r--sample/trick2013/mame/music-box.mp4bin580724 -> 0 bytes-rw-r--r--sample/trick2013/mame/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/entry.rb2
-rw-r--r--sample/trick2015/README.md16
-rw-r--r--sample/trick2015/eregon/authors.markdown3
-rw-r--r--sample/trick2015/eregon/entry.rb16
-rw-r--r--sample/trick2015/eregon/remarks.markdown70
-rw-r--r--sample/trick2015/kinaba/authors.markdown4
-rw-r--r--sample/trick2015/kinaba/entry.rb150
-rw-r--r--sample/trick2015/kinaba/remarks.markdown85
-rw-r--r--sample/trick2015/ksk_1/authors.markdown3
-rw-r--r--sample/trick2015/ksk_1/entry.rb1
-rw-r--r--sample/trick2015/ksk_1/remarks.markdown120
-rw-r--r--sample/trick2015/ksk_2/abnormal.cnf6
-rw-r--r--sample/trick2015/ksk_2/authors.markdown3
-rw-r--r--sample/trick2015/ksk_2/entry.rb1
-rw-r--r--sample/trick2015/ksk_2/quinn.cnf21
-rw-r--r--sample/trick2015/ksk_2/remarks.markdown204
-rw-r--r--sample/trick2015/ksk_2/sample.cnf9
-rw-r--r--sample/trick2015/ksk_2/uf20-01.cnf99
-rw-r--r--sample/trick2015/ksk_2/unsat.cnf11
-rw-r--r--sample/trick2015/monae/authors.markdown1
-rw-r--r--sample/trick2015/monae/entry.rb26
-rw-r--r--sample/trick2015/monae/remarks.markdown25
-rw-r--r--sample/trick2018/01-kinaba/authors.markdown3
-rw-r--r--sample/trick2018/01-kinaba/entry.rb8
-rw-r--r--sample/trick2018/01-kinaba/remarks.markdown55
-rw-r--r--sample/trick2018/02-mame/authors.markdown3
-rw-r--r--sample/trick2018/02-mame/entry.rb15
-rw-r--r--sample/trick2018/02-mame/remarks.markdown16
-rw-r--r--sample/trick2018/03-tompng/Gemfile2
-rw-r--r--sample/trick2018/03-tompng/Gemfile.lock13
-rw-r--r--sample/trick2018/03-tompng/authors.markdown3
-rw-r--r--sample/trick2018/03-tompng/entry.rb31
-rw-r--r--sample/trick2018/03-tompng/output.txt44
-rw-r--r--sample/trick2018/03-tompng/remarks.markdown19
-rw-r--r--sample/trick2018/03-tompng/trick.pngbin0 -> 5661 bytes-rw-r--r--sample/trick2018/04-colin/authors.markdown3
-rw-r--r--sample/trick2018/04-colin/entry.rb2
-rw-r--r--sample/trick2018/04-colin/remarks.markdown62
-rw-r--r--sample/trick2018/05-tompng/authors.markdown3
-rw-r--r--sample/trick2018/05-tompng/entry.rb41
-rw-r--r--sample/trick2018/05-tompng/preview_of_output.pngbin0 -> 66800 bytes-rw-r--r--sample/trick2018/05-tompng/remarks.markdown31
-rw-r--r--sample/trick2018/README.md16
-rw-r--r--sample/webrick/demo-app.rb66
-rw-r--r--sample/webrick/demo-multipart.cgi12
-rw-r--r--sample/webrick/demo-servlet.rb6
-rw-r--r--sample/webrick/demo-urlencoded.cgi12
-rw-r--r--sample/webrick/hello.cgi11
-rw-r--r--sample/webrick/hello.rb8
-rw-r--r--sample/webrick/httpd.rb23
-rw-r--r--sample/webrick/httpproxy.rb25
-rw-r--r--sample/webrick/httpsd.rb33
-rw-r--r--scheduler.c212
-rw-r--r--signal.c797
-rw-r--r--siphash.c14
-rw-r--r--siphash.h2
-rw-r--r--sparc.c2
-rw-r--r--spec/README31
-rw-r--r--spec/README.md130
-rw-r--r--spec/bundler/bundler/build_metadata_spec.rb49
-rw-r--r--spec/bundler/bundler/bundler_spec.rb465
-rw-r--r--spec/bundler/bundler/cli_spec.rb216
-rw-r--r--spec/bundler/bundler/compact_index_client/updater_spec.rb59
-rw-r--r--spec/bundler/bundler/definition_spec.rb289
-rw-r--r--spec/bundler/bundler/dep_proxy_spec.rb32
-rw-r--r--spec/bundler/bundler/digest_spec.rb17
-rw-r--r--spec/bundler/bundler/dsl_spec.rb300
-rw-r--r--spec/bundler/bundler/endpoint_specification_spec.rb71
-rw-r--r--spec/bundler/bundler/env_spec.rb239
-rw-r--r--spec/bundler/bundler/environment_preserver_spec.rb79
-rw-r--r--spec/bundler/bundler/fetcher/base_spec.rb76
-rw-r--r--spec/bundler/bundler/fetcher/compact_index_spec.rb109
-rw-r--r--spec/bundler/bundler/fetcher/dependency_spec.rb287
-rw-r--r--spec/bundler/bundler/fetcher/downloader_spec.rb265
-rw-r--r--spec/bundler/bundler/fetcher/index_spec.rb99
-rw-r--r--spec/bundler/bundler/fetcher_spec.rb162
-rw-r--r--spec/bundler/bundler/friendly_errors_spec.rb248
-rw-r--r--spec/bundler/bundler/gem_helper_spec.rb435
-rw-r--r--spec/bundler/bundler/gem_version_promoter_spec.rb179
-rw-r--r--spec/bundler/bundler/index_spec.rb36
-rw-r--r--spec/bundler/bundler/installer/gem_installer_spec.rb40
-rw-r--r--spec/bundler/bundler/installer/parallel_installer_spec.rb80
-rw-r--r--spec/bundler/bundler/installer/spec_installation_spec.rb66
-rw-r--r--spec/bundler/bundler/lockfile_parser_spec.rb153
-rw-r--r--spec/bundler/bundler/mirror_spec.rb331
-rw-r--r--spec/bundler/bundler/plugin/api/source_spec.rb88
-rw-r--r--spec/bundler/bundler/plugin/api_spec.rb83
-rw-r--r--spec/bundler/bundler/plugin/dsl_spec.rb38
-rw-r--r--spec/bundler/bundler/plugin/events_spec.rb22
-rw-r--r--spec/bundler/bundler/plugin/index_spec.rb204
-rw-r--r--spec/bundler/bundler/plugin/installer_spec.rb131
-rw-r--r--spec/bundler/bundler/plugin/source_list_spec.rb25
-rw-r--r--spec/bundler/bundler/plugin_spec.rb345
-rw-r--r--spec/bundler/bundler/psyched_yaml_spec.rb9
-rw-r--r--spec/bundler/bundler/remote_specification_spec.rb187
-rw-r--r--spec/bundler/bundler/retry_spec.rb81
-rw-r--r--spec/bundler/bundler/ruby_dsl_spec.rb95
-rw-r--r--spec/bundler/bundler/ruby_version_spec.rb528
-rw-r--r--spec/bundler/bundler/rubygems_integration_spec.rb100
-rw-r--r--spec/bundler/bundler/settings/validator_spec.rb111
-rw-r--r--spec/bundler/bundler/settings_spec.rb337
-rw-r--r--spec/bundler/bundler/shared_helpers_spec.rb521
-rw-r--r--spec/bundler/bundler/source/git/git_proxy_spec.rb171
-rw-r--r--spec/bundler/bundler/source/git_spec.rb73
-rw-r--r--spec/bundler/bundler/source/path_spec.rb31
-rw-r--r--spec/bundler/bundler/source/rubygems/remote_spec.rb172
-rw-r--r--spec/bundler/bundler/source/rubygems_spec.rb47
-rw-r--r--spec/bundler/bundler/source_list_spec.rb459
-rw-r--r--spec/bundler/bundler/source_spec.rb200
-rw-r--r--spec/bundler/bundler/spec_set_spec.rb77
-rw-r--r--spec/bundler/bundler/stub_specification_spec.rb47
-rw-r--r--spec/bundler/bundler/ui/shell_spec.rb53
-rw-r--r--spec/bundler/bundler/ui_spec.rb41
-rw-r--r--spec/bundler/bundler/uri_credentials_filter_spec.rb127
-rw-r--r--spec/bundler/bundler/vendored_persistent_spec.rb77
-rw-r--r--spec/bundler/bundler/version_ranges_spec.rb40
-rw-r--r--spec/bundler/bundler/worker_spec.rb69
-rw-r--r--spec/bundler/bundler/yaml_serializer_spec.rb194
-rw-r--r--spec/bundler/cache/cache_path_spec.rb32
-rw-r--r--spec/bundler/cache/gems_spec.rb315
-rw-r--r--spec/bundler/cache/git_spec.rb224
-rw-r--r--spec/bundler/cache/path_spec.rb169
-rw-r--r--spec/bundler/cache/platform_spec.rb49
-rw-r--r--spec/bundler/commands/add_spec.rb251
-rw-r--r--spec/bundler/commands/binstubs_spec.rb491
-rw-r--r--spec/bundler/commands/cache_spec.rb432
-rw-r--r--spec/bundler/commands/check_spec.rb491
-rw-r--r--spec/bundler/commands/clean_spec.rb916
-rw-r--r--spec/bundler/commands/config_spec.rb544
-rw-r--r--spec/bundler/commands/console_spec.rb141
-rw-r--r--spec/bundler/commands/doctor_spec.rb146
-rw-r--r--spec/bundler/commands/exec_spec.rb1222
-rw-r--r--spec/bundler/commands/fund_spec.rb82
-rw-r--r--spec/bundler/commands/help_spec.rb90
-rw-r--r--spec/bundler/commands/info_spec.rb224
-rw-r--r--spec/bundler/commands/init_spec.rb171
-rw-r--r--spec/bundler/commands/inject_spec.rb117
-rw-r--r--spec/bundler/commands/install_spec.rb961
-rw-r--r--spec/bundler/commands/issue_spec.rb16
-rw-r--r--spec/bundler/commands/licenses_spec.rb37
-rw-r--r--spec/bundler/commands/list_spec.rb195
-rw-r--r--spec/bundler/commands/lock_spec.rb562
-rw-r--r--spec/bundler/commands/newgem_spec.rb1509
-rw-r--r--spec/bundler/commands/open_spec.rb118
-rw-r--r--spec/bundler/commands/outdated_spec.rb1344
-rw-r--r--spec/bundler/commands/post_bundle_message_spec.rb205
-rw-r--r--spec/bundler/commands/pristine_spec.rb221
-rw-r--r--spec/bundler/commands/remove_spec.rb702
-rw-r--r--spec/bundler/commands/show_spec.rb224
-rw-r--r--spec/bundler/commands/update_spec.rb1331
-rw-r--r--spec/bundler/commands/version_spec.rb47
-rw-r--r--spec/bundler/commands/viz_spec.rb146
-rw-r--r--spec/bundler/install/allow_offline_install_spec.rb96
-rw-r--r--spec/bundler/install/binstubs_spec.rb51
-rw-r--r--spec/bundler/install/bundler_spec.rb239
-rw-r--r--spec/bundler/install/deploy_spec.rb462
-rw-r--r--spec/bundler/install/failure_spec.rb51
-rw-r--r--spec/bundler/install/gemfile/eval_gemfile_spec.rb122
-rw-r--r--spec/bundler/install/gemfile/gemspec_spec.rb625
-rw-r--r--spec/bundler/install/gemfile/git_spec.rb1579
-rw-r--r--spec/bundler/install/gemfile/groups_spec.rb412
-rw-r--r--spec/bundler/install/gemfile/install_if_spec.rb44
-rw-r--r--spec/bundler/install/gemfile/lockfile_spec.rb48
-rw-r--r--spec/bundler/install/gemfile/path_spec.rb893
-rw-r--r--spec/bundler/install/gemfile/platform_spec.rb531
-rw-r--r--spec/bundler/install/gemfile/ruby_spec.rb109
-rw-r--r--spec/bundler/install/gemfile/sources_spec.rb1446
-rw-r--r--spec/bundler/install/gemfile/specific_platform_spec.rb315
-rw-r--r--spec/bundler/install/gemfile_spec.rb118
-rw-r--r--spec/bundler/install/gems/compact_index_spec.rb943
-rw-r--r--spec/bundler/install/gems/dependency_api_spec.rb770
-rw-r--r--spec/bundler/install/gems/env_spec.rb107
-rw-r--r--spec/bundler/install/gems/flex_spec.rb335
-rw-r--r--spec/bundler/install/gems/fund_spec.rb137
-rw-r--r--spec/bundler/install/gems/mirror_spec.rb39
-rw-r--r--spec/bundler/install/gems/native_extensions_spec.rb184
-rw-r--r--spec/bundler/install/gems/post_install_spec.rb150
-rw-r--r--spec/bundler/install/gems/resolving_spec.rb349
-rw-r--r--spec/bundler/install/gems/standalone_spec.rb431
-rw-r--r--spec/bundler/install/gems/sudo_spec.rb205
-rw-r--r--spec/bundler/install/gems/win32_spec.rb25
-rw-r--r--spec/bundler/install/gemspecs_spec.rb160
-rw-r--r--spec/bundler/install/git_spec.rb102
-rw-r--r--spec/bundler/install/global_cache_spec.rb254
-rw-r--r--spec/bundler/install/path_spec.rb226
-rw-r--r--spec/bundler/install/prereleases_spec.rb54
-rw-r--r--spec/bundler/install/process_lock_spec.rb35
-rw-r--r--spec/bundler/install/redownload_spec.rb91
-rw-r--r--spec/bundler/install/security_policy_spec.rb72
-rw-r--r--spec/bundler/install/yanked_spec.rb104
-rw-r--r--spec/bundler/lock/git_spec.rb35
-rw-r--r--spec/bundler/lock/lockfile_spec.rb1449
-rw-r--r--spec/bundler/other/cli_dispatch_spec.rb20
-rw-r--r--spec/bundler/other/ext_spec.rb61
-rw-r--r--spec/bundler/other/major_deprecation_spec.rb719
-rw-r--r--spec/bundler/other/platform_spec.rb1288
-rw-r--r--spec/bundler/plugins/command_spec.rb78
-rw-r--r--spec/bundler/plugins/hook_spec.rb109
-rw-r--r--spec/bundler/plugins/install_spec.rb353
-rw-r--r--spec/bundler/plugins/list_spec.rb60
-rw-r--r--spec/bundler/plugins/source/example_spec.rb458
-rw-r--r--spec/bundler/plugins/source_spec.rb111
-rw-r--r--spec/bundler/plugins/uninstall_spec.rb49
-rw-r--r--spec/bundler/quality_es_spec.rb61
-rw-r--r--spec/bundler/quality_spec.rb247
-rw-r--r--spec/bundler/realworld/dependency_api_spec.rb46
-rw-r--r--spec/bundler/realworld/double_check_spec.rb40
-rw-r--r--spec/bundler/realworld/edgecases_spec.rb527
-rw-r--r--spec/bundler/realworld/ffi_spec.rb57
-rw-r--r--spec/bundler/realworld/fixtures/warbler/.gitignore1
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile7
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile.lock30
-rw-r--r--spec/bundler/realworld/fixtures/warbler/bin/warbler-example.rb3
-rw-r--r--spec/bundler/realworld/fixtures/warbler/demo/demo.gemspec10
-rw-r--r--spec/bundler/realworld/gemfile_source_header_spec.rb53
-rw-r--r--spec/bundler/realworld/mirror_probe_spec.rb139
-rw-r--r--spec/bundler/realworld/parallel_spec.rb66
-rw-r--r--spec/bundler/realworld/slow_perf_spec.rb22
-rw-r--r--spec/bundler/resolver/basic_spec.rb308
-rw-r--r--spec/bundler/resolver/platform_spec.rb360
-rw-r--r--spec/bundler/runtime/executable_spec.rb169
-rw-r--r--spec/bundler/runtime/gem_tasks_spec.rb106
-rw-r--r--spec/bundler/runtime/inline_spec.rb420
-rw-r--r--spec/bundler/runtime/load_spec.rb113
-rw-r--r--spec/bundler/runtime/platform_spec.rb311
-rw-r--r--spec/bundler/runtime/require_spec.rb467
-rw-r--r--spec/bundler/runtime/setup_spec.rb1538
-rw-r--r--spec/bundler/runtime/with_unbundled_env_spec.rb302
-rw-r--r--spec/bundler/spec_helper.rb118
-rw-r--r--spec/bundler/support/api_request_limit_hax.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index.rb120
-rw-r--r--spec/bundler/support/artifice/compact_index_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/compact_index_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/compact_index_checksum_mismatch.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_concurrent_download.rb32
-rw-r--r--spec/bundler/support/artifice/compact_index_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/compact_index_extra.rb37
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api.rb52
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_host_redirect.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_no_gem.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update.rb38
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update_no_etag_not_incremental.rb40
-rw-r--r--spec/bundler/support/artifice/compact_index_range_not_satisfiable.rb34
-rw-r--r--spec/bundler/support/artifice/compact_index_rate_limited.rb48
-rw-r--r--spec/bundler/support/artifice/compact_index_redirects.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_dependencies.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_gem_checksum.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint.rb115
-rw-r--r--spec/bundler/support/artifice/endpoint_500.rb18
-rw-r--r--spec/bundler/support/artifice/endpoint_api_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/endpoint_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/endpoint_extra.rb33
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_api.rb34
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_fallback.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_host_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_mirror_source.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint_timeout.rb15
-rw-r--r--spec/bundler/support/artifice/fail.rb34
-rw-r--r--spec/bundler/support/artifice/vcr.rb165
-rw-r--r--spec/bundler/support/artifice/windows.rb46
-rw-r--r--spec/bundler/support/build_metadata.rb49
-rw-r--r--spec/bundler/support/builders.rb683
-rw-r--r--spec/bundler/support/bundle.rb8
-rw-r--r--spec/bundler/support/command_execution.rb33
-rw-r--r--spec/bundler/support/filters.rb40
-rw-r--r--spec/bundler/support/hax.rb44
-rw-r--r--spec/bundler/support/helpers.rb576
-rw-r--r--spec/bundler/support/indexes.rb424
-rw-r--r--spec/bundler/support/matchers.rb225
-rw-r--r--spec/bundler/support/path.rb309
-rw-r--r--spec/bundler/support/permissions.rb12
-rw-r--r--spec/bundler/support/platforms.rb104
-rw-r--r--spec/bundler/support/rubygems_ext.rb138
-rw-r--r--spec/bundler/support/rubygems_version_manager.rb120
-rw-r--r--spec/bundler/support/silent_logger.rb10
-rw-r--r--spec/bundler/support/streams.rb19
-rw-r--r--spec/bundler/support/sudo.rb18
-rw-r--r--spec/bundler/support/switch_rubygems.rb4
-rw-r--r--spec/bundler/support/the_bundle.rb35
-rw-r--r--spec/bundler/update/gemfile_spec.rb47
-rw-r--r--spec/bundler/update/gems/fund_spec.rb50
-rw-r--r--spec/bundler/update/gems/post_install_spec.rb76
-rw-r--r--spec/bundler/update/git_spec.rb335
-rw-r--r--spec/bundler/update/path_spec.rb19
-rw-r--r--spec/bundler/update/redownload_spec.rb34
-rw-r--r--spec/default.mspec60
-rw-r--r--spec/mspec/Gemfile4
-rw-r--r--spec/mspec/Gemfile.lock21
-rw-r--r--spec/mspec/LICENSE22
-rw-r--r--spec/mspec/README.md84
-rw-r--r--spec/mspec/Rakefile6
-rwxr-xr-xspec/mspec/bin/mkspec7
-rwxr-xr-xspec/mspec/bin/mkspec.bat1
-rwxr-xr-xspec/mspec/bin/mspec7
-rwxr-xr-xspec/mspec/bin/mspec-ci7
-rwxr-xr-xspec/mspec/bin/mspec-ci.bat1
-rwxr-xr-xspec/mspec/bin/mspec-run7
-rwxr-xr-xspec/mspec/bin/mspec-run.bat1
-rwxr-xr-xspec/mspec/bin/mspec-tag7
-rwxr-xr-xspec/mspec/bin/mspec-tag.bat1
-rwxr-xr-xspec/mspec/bin/mspec.bat1
-rw-r--r--spec/mspec/lib/mspec.rb8
-rwxr-xr-xspec/mspec/lib/mspec/commands/mkspec.rb155
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-ci.rb79
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-run.rb87
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-tag.rb133
-rwxr-xr-xspec/mspec/lib/mspec/commands/mspec.rb118
-rw-r--r--spec/mspec/lib/mspec/expectations.rb2
-rw-r--r--spec/mspec/lib/mspec/expectations/expectations.rb35
-rw-r--r--spec/mspec/lib/mspec/expectations/should.rb35
-rw-r--r--spec/mspec/lib/mspec/guards.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/block_device.rb16
-rw-r--r--spec/mspec/lib/mspec/guards/bug.rb29
-rw-r--r--spec/mspec/lib/mspec/guards/conflict.rb23
-rw-r--r--spec/mspec/lib/mspec/guards/endian.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/feature.rb45
-rw-r--r--spec/mspec/lib/mspec/guards/guard.rb141
-rw-r--r--spec/mspec/lib/mspec/guards/platform.rb100
-rw-r--r--spec/mspec/lib/mspec/guards/quarantine.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/superuser.rb15
-rw-r--r--spec/mspec/lib/mspec/guards/support.rb14
-rw-r--r--spec/mspec/lib/mspec/guards/version.rb44
-rw-r--r--spec/mspec/lib/mspec/helpers.rb13
-rw-r--r--spec/mspec/lib/mspec/helpers/argf.rb35
-rw-r--r--spec/mspec/lib/mspec/helpers/argv.rb44
-rw-r--r--spec/mspec/lib/mspec/helpers/datetime.rb47
-rw-r--r--spec/mspec/lib/mspec/helpers/fixture.rb24
-rw-r--r--spec/mspec/lib/mspec/helpers/flunk.rb3
-rw-r--r--spec/mspec/lib/mspec/helpers/fs.rb64
-rw-r--r--spec/mspec/lib/mspec/helpers/io.rb87
-rw-r--r--spec/mspec/lib/mspec/helpers/mock_to_path.rb6
-rw-r--r--spec/mspec/lib/mspec/helpers/numeric.rb78
-rw-r--r--spec/mspec/lib/mspec/helpers/ruby_exe.rb159
-rw-r--r--spec/mspec/lib/mspec/helpers/scratch.rb21
-rw-r--r--spec/mspec/lib/mspec/helpers/tmp.rb48
-rw-r--r--spec/mspec/lib/mspec/helpers/warning.rb19
-rw-r--r--spec/mspec/lib/mspec/matchers.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/base.rb61
-rw-r--r--spec/mspec/lib/mspec/matchers/be_an_instance_of.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/be_ancestor_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_close.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/be_computed_by.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/be_empty.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_kind_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nan.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nil.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true_or_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/block_caller.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/complain.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/eql.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal_element.rb78
-rw-r--r--spec/mspec/lib/mspec/matchers/have_class_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_constant.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_protected_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_public_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_singleton_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/include.rb31
-rw-r--r--spec/mspec/lib/mspec/matchers/include_any_of.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/infinity.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/match_yaml.rb46
-rw-r--r--spec/mspec/lib/mspec/matchers/method.rb10
-rw-r--r--spec/mspec/lib/mspec/matchers/output.rb67
-rw-r--r--spec/mspec/lib/mspec/matchers/output_to_fd.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/raise_error.rb89
-rw-r--r--spec/mspec/lib/mspec/matchers/respond_to.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/signed_zero.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/skip.rb5
-rw-r--r--spec/mspec/lib/mspec/matchers/variable.rb24
-rw-r--r--spec/mspec/lib/mspec/mocks.rb3
-rw-r--r--spec/mspec/lib/mspec/mocks/mock.rb212
-rw-r--r--spec/mspec/lib/mspec/mocks/object.rb28
-rw-r--r--spec/mspec/lib/mspec/mocks/proxy.rb186
-rw-r--r--spec/mspec/lib/mspec/runner.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/actions.rb6
-rw-r--r--spec/mspec/lib/mspec/runner/actions/constants_leak_checker.rb84
-rw-r--r--spec/mspec/lib/mspec/runner/actions/filter.rb40
-rw-r--r--spec/mspec/lib/mspec/runner/actions/leakchecker.rb318
-rw-r--r--spec/mspec/lib/mspec/runner/actions/profile.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tag.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/taglist.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tagpurge.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tally.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timeout.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timer.rb22
-rw-r--r--spec/mspec/lib/mspec/runner/context.rb236
-rw-r--r--spec/mspec/lib/mspec/runner/evaluate.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/example.rb34
-rw-r--r--spec/mspec/lib/mspec/runner/exception.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/filters/match.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/filters/profile.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters/regexp.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/filters/tag.rb29
-rw-r--r--spec/mspec/lib/mspec/runner/formatters.rb13
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/base.rb128
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/describe.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/dotted.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/file.rb24
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/html.rb81
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/junit.rb87
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/method.rb95
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/multi.rb47
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/profile.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/specdoc.rb41
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/spinner.rb111
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/stats.rb57
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/summary.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/unit.rb20
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/yaml.rb38
-rw-r--r--spec/mspec/lib/mspec/runner/mspec.rb418
-rw-r--r--spec/mspec/lib/mspec/runner/object.rb26
-rw-r--r--spec/mspec/lib/mspec/runner/parallel.rb98
-rw-r--r--spec/mspec/lib/mspec/runner/shared.rb10
-rw-r--r--spec/mspec/lib/mspec/runner/tag.rb38
-rw-r--r--spec/mspec/lib/mspec/utils/deprecate.rb6
-rw-r--r--spec/mspec/lib/mspec/utils/format.rb24
-rw-r--r--spec/mspec/lib/mspec/utils/name_map.rb121
-rw-r--r--spec/mspec/lib/mspec/utils/options.rb491
-rw-r--r--spec/mspec/lib/mspec/utils/script.rb283
-rw-r--r--spec/mspec/lib/mspec/utils/version.rb52
-rw-r--r--spec/mspec/lib/mspec/utils/warnings.rb59
-rw-r--r--spec/mspec/lib/mspec/version.rb5
-rw-r--r--spec/mspec/spec/commands/fixtures/four.txt0
-rw-r--r--spec/mspec/spec/commands/fixtures/level2/three_spec.rb (renamed from lib/rake/contrib/.document)0
-rw-r--r--spec/mspec/spec/commands/fixtures/one_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/three.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/two_spec.rb1
-rw-r--r--spec/mspec/spec/commands/mkspec_spec.rb363
-rw-r--r--spec/mspec/spec/commands/mspec_ci_spec.rb150
-rw-r--r--spec/mspec/spec/commands/mspec_run_spec.rb173
-rw-r--r--spec/mspec/spec/commands/mspec_spec.rb207
-rw-r--r--spec/mspec/spec/commands/mspec_tag_spec.rb414
-rw-r--r--spec/mspec/spec/expectations/expectations_spec.rb29
-rw-r--r--spec/mspec/spec/expectations/should.rb73
-rw-r--r--spec/mspec/spec/expectations/should_spec.rb61
-rw-r--r--spec/mspec/spec/fixtures/a_spec.rb15
-rw-r--r--spec/mspec/spec/fixtures/b_spec.rb7
-rw-r--r--spec/mspec/spec/fixtures/chatty_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/config.mspec8
-rw-r--r--spec/mspec/spec/fixtures/die_spec.rb7
-rwxr-xr-xspec/mspec/spec/fixtures/my_ruby4
-rw-r--r--spec/mspec/spec/fixtures/object_methods_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/print_interpreter_spec.rb4
-rw-r--r--spec/mspec/spec/fixtures/tagging_spec.rb16
-rw-r--r--spec/mspec/spec/guards/block_device_spec.rb46
-rw-r--r--spec/mspec/spec/guards/bug_spec.rb151
-rw-r--r--spec/mspec/spec/guards/conflict_spec.rb53
-rw-r--r--spec/mspec/spec/guards/endian_spec.rb55
-rw-r--r--spec/mspec/spec/guards/feature_spec.rb120
-rw-r--r--spec/mspec/spec/guards/guard_spec.rb421
-rw-r--r--spec/mspec/spec/guards/platform_spec.rb337
-rw-r--r--spec/mspec/spec/guards/quarantine_spec.rb35
-rw-r--r--spec/mspec/spec/guards/superuser_spec.rb35
-rw-r--r--spec/mspec/spec/guards/support_spec.rb54
-rw-r--r--spec/mspec/spec/guards/user_spec.rb20
-rw-r--r--spec/mspec/spec/guards/version_spec.rb112
-rw-r--r--spec/mspec/spec/helpers/argf_spec.rb37
-rw-r--r--spec/mspec/spec/helpers/argv_spec.rb27
-rw-r--r--spec/mspec/spec/helpers/datetime_spec.rb44
-rw-r--r--spec/mspec/spec/helpers/fixture_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/flunk_spec.rb20
-rw-r--r--spec/mspec/spec/helpers/fs_spec.rb195
-rw-r--r--spec/mspec/spec/helpers/io_spec.rb136
-rw-r--r--spec/mspec/spec/helpers/mock_to_path_spec.rb17
-rw-r--r--spec/mspec/spec/helpers/numeric_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/ruby_exe_spec.rb197
-rw-r--r--spec/mspec/spec/helpers/scratch_spec.rb24
-rw-r--r--spec/mspec/spec/helpers/suppress_warning_spec.rb19
-rw-r--r--spec/mspec/spec/helpers/tmp_spec.rb27
-rw-r--r--spec/mspec/spec/integration/interpreter_spec.rb18
-rw-r--r--spec/mspec/spec/integration/object_methods_spec.rb18
-rw-r--r--spec/mspec/spec/integration/run_spec.rb71
-rw-r--r--spec/mspec/spec/integration/tag_spec.rb59
-rw-r--r--spec/mspec/spec/matchers/base_spec.rb228
-rw-r--r--spec/mspec/spec/matchers/be_an_instance_of_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/be_ancestor_of_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_close_spec.rb48
-rw-r--r--spec/mspec/spec/matchers/be_computed_by_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/be_empty_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/be_false_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_kind_of_spec.rb31
-rw-r--r--spec/mspec/spec/matchers/be_nan_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_nil_spec.rb27
-rw-r--r--spec/mspec/spec/matchers/be_true_or_false_spec.rb19
-rw-r--r--spec/mspec/spec/matchers/be_true_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/block_caller_spec.rb13
-rw-r--r--spec/mspec/spec/matchers/complain_spec.rb97
-rw-r--r--spec/mspec/spec/matchers/eql_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/equal_element_spec.rb75
-rw-r--r--spec/mspec/spec/matchers/equal_spec.rb32
-rw-r--r--spec/mspec/spec/matchers/have_class_variable_spec.rb49
-rw-r--r--spec/mspec/spec/matchers/have_constant_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/have_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_instance_variable_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/have_method_spec.rb55
-rw-r--r--spec/mspec/spec/matchers/have_private_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_private_method_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/have_protected_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_public_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_singleton_method_spec.rb45
-rw-r--r--spec/mspec/spec/matchers/include_any_of_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/include_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/infinity_spec.rb34
-rw-r--r--spec/mspec/spec/matchers/match_yaml_spec.rb39
-rw-r--r--spec/mspec/spec/matchers/output_spec.rb74
-rw-r--r--spec/mspec/spec/matchers/output_to_fd_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/raise_error_spec.rb159
-rw-r--r--spec/mspec/spec/matchers/respond_to_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/signed_zero_spec.rb32
-rw-r--r--spec/mspec/spec/mocks/mock_spec.rb530
-rw-r--r--spec/mspec/spec/mocks/proxy_spec.rb405
-rw-r--r--spec/mspec/spec/runner/actions/filter_spec.rb84
-rw-r--r--spec/mspec/spec/runner/actions/tag_spec.rb315
-rw-r--r--spec/mspec/spec/runner/actions/taglist_spec.rb152
-rw-r--r--spec/mspec/spec/runner/actions/tagpurge_spec.rb154
-rw-r--r--spec/mspec/spec/runner/actions/tally_spec.rb352
-rw-r--r--spec/mspec/spec/runner/actions/timer_spec.rb44
-rw-r--r--spec/mspec/spec/runner/context_spec.rb1028
-rw-r--r--spec/mspec/spec/runner/example_spec.rb117
-rw-r--r--spec/mspec/spec/runner/exception_spec.rb146
-rw-r--r--spec/mspec/spec/runner/filters/a.yaml4
-rw-r--r--spec/mspec/spec/runner/filters/b.yaml11
-rw-r--r--spec/mspec/spec/runner/filters/match_spec.rb34
-rw-r--r--spec/mspec/spec/runner/filters/profile_spec.rb117
-rw-r--r--spec/mspec/spec/runner/filters/regexp_spec.rb31
-rw-r--r--spec/mspec/spec/runner/filters/tag_spec.rb92
-rw-r--r--spec/mspec/spec/runner/formatters/describe_spec.rb67
-rw-r--r--spec/mspec/spec/runner/formatters/dotted_spec.rb285
-rw-r--r--spec/mspec/spec/runner/formatters/file_spec.rb84
-rw-r--r--spec/mspec/spec/runner/formatters/html_spec.rb216
-rw-r--r--spec/mspec/spec/runner/formatters/junit_spec.rb147
-rw-r--r--spec/mspec/spec/runner/formatters/method_spec.rb178
-rw-r--r--spec/mspec/spec/runner/formatters/multi_spec.rb70
-rw-r--r--spec/mspec/spec/runner/formatters/specdoc_spec.rb106
-rw-r--r--spec/mspec/spec/runner/formatters/spinner_spec.rb83
-rw-r--r--spec/mspec/spec/runner/formatters/summary_spec.rb26
-rw-r--r--spec/mspec/spec/runner/formatters/unit_spec.rb74
-rw-r--r--spec/mspec/spec/runner/formatters/yaml_spec.rb125
-rw-r--r--spec/mspec/spec/runner/mspec_spec.rb598
-rw-r--r--spec/mspec/spec/runner/shared_spec.rb90
-rw-r--r--spec/mspec/spec/runner/tag_spec.rb123
-rw-r--r--spec/mspec/spec/runner/tags.txt4
-rw-r--r--spec/mspec/spec/spec_helper.rb55
-rw-r--r--spec/mspec/spec/utils/deprecate_spec.rb17
-rw-r--r--spec/mspec/spec/utils/name_map_spec.rb175
-rw-r--r--spec/mspec/spec/utils/options_spec.rb1304
-rw-r--r--spec/mspec/spec/utils/script_spec.rb475
-rw-r--r--spec/mspec/spec/utils/version_spec.rb45
-rwxr-xr-xspec/mspec/tool/find.rb10
-rwxr-xr-xspec/mspec/tool/pull-latest-mspec-spec26
-rw-r--r--spec/mspec/tool/remove_old_guards.rb66
-rw-r--r--spec/mspec/tool/sync/.gitignore4
-rw-r--r--spec/mspec/tool/sync/sync-rubyspec.rb242
-rwxr-xr-xspec/mspec/tool/tag_from_output.rb44
-rwxr-xr-xspec/mspec/tool/wrap_with_guard.rb28
-rw-r--r--spec/ruby/.gitignore5
-rw-r--r--spec/ruby/.mspec.constants231
-rw-r--r--spec/ruby/.rubocop.yml133
-rw-r--r--spec/ruby/.rubocop_todo.yml148
-rw-r--r--spec/ruby/CONTRIBUTING.md292
-rw-r--r--spec/ruby/LICENSE22
-rw-r--r--spec/ruby/README.md153
-rw-r--r--spec/ruby/TODO8
-rw-r--r--spec/ruby/command_line/dash_a_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_c_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_d_spec.rb22
-rw-r--r--spec/ruby/command_line/dash_e_spec.rb41
-rw-r--r--spec/ruby/command_line/dash_encoding_spec.rb30
-rw-r--r--spec/ruby/command_line/dash_external_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_internal_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_l_spec.rb31
-rw-r--r--spec/ruby/command_line/dash_n_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_p_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_r_spec.rb28
-rw-r--r--spec/ruby/command_line/dash_s_spec.rb52
-rw-r--r--spec/ruby/command_line/dash_upper_c_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_upper_e_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_upper_f_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_upper_i_spec.rb51
-rw-r--r--spec/ruby/command_line/dash_upper_k_spec.rb65
-rw-r--r--spec/ruby/command_line/dash_upper_s_spec.rb29
-rw-r--r--spec/ruby/command_line/dash_upper_u_spec.rb43
-rw-r--r--spec/ruby/command_line/dash_upper_w_spec.rb52
-rw-r--r--spec/ruby/command_line/dash_upper_x_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_v_spec.rb12
-rw-r--r--spec/ruby/command_line/dash_w_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_x_spec.rb21
-rw-r--r--spec/ruby/command_line/error_message_spec.rb11
-rw-r--r--spec/ruby/command_line/feature_spec.rb63
-rw-r--r--spec/ruby/command_line/fixtures/bad_syntax.rb1
-rw-r--r--spec/ruby/command_line/fixtures/bin/bad_embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/dash_s_fail1
-rw-r--r--spec/ruby/command_line/fixtures/bin/embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/hybrid_launcher.sh4
-rwxr-xr-xspec/ruby/command_line/fixtures/bin/launcher.rb2
-rw-r--r--spec/ruby/command_line/fixtures/change_directory_script.rb1
-rw-r--r--spec/ruby/command_line/fixtures/conditional_range.txt5
-rw-r--r--spec/ruby/command_line/fixtures/dash_s_script.rb12
-rw-r--r--spec/ruby/command_line/fixtures/debug.rb10
-rw-r--r--spec/ruby/command_line/fixtures/debug_info.rb11
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files_diff_enc.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_one_literal.rb2
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required.rb1
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required_diff_enc.rbbin0 -> 121 bytes-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_two_literals.rb1
-rw-r--r--spec/ruby/command_line/fixtures/full_names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/loadpath.rb1
-rw-r--r--spec/ruby/command_line/fixtures/names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/passwd_file.txt3
-rw-r--r--spec/ruby/command_line/fixtures/require.rb1
-rw-r--r--spec/ruby/command_line/fixtures/rubyopt.rb1
-rw-r--r--spec/ruby/command_line/fixtures/test_file.rb1
-rw-r--r--spec/ruby/command_line/fixtures/verbose.rb1
-rw-r--r--spec/ruby/command_line/frozen_strings_spec.rb29
-rw-r--r--spec/ruby/command_line/rubylib_spec.rb69
-rw-r--r--spec/ruby/command_line/rubyopt_spec.rb187
-rw-r--r--spec/ruby/command_line/shared/change_directory.rb21
-rw-r--r--spec/ruby/command_line/shared/verbose.rb9
-rw-r--r--spec/ruby/command_line/syntax_error_spec.rb13
-rw-r--r--spec/ruby/core/argf/argf_spec.rb11
-rw-r--r--spec/ruby/core/argf/argv_spec.rb19
-rw-r--r--spec/ruby/core/argf/binmode_spec.rb43
-rw-r--r--spec/ruby/core/argf/bytes_spec.rb8
-rw-r--r--spec/ruby/core/argf/chars_spec.rb8
-rw-r--r--spec/ruby/core/argf/close_spec.rb35
-rw-r--r--spec/ruby/core/argf/closed_spec.rb18
-rw-r--r--spec/ruby/core/argf/codepoints_spec.rb8
-rw-r--r--spec/ruby/core/argf/each_byte_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_char_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_codepoint_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_line_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_spec.rb6
-rw-r--r--spec/ruby/core/argf/eof_spec.rb10
-rw-r--r--spec/ruby/core/argf/file_spec.rb21
-rw-r--r--spec/ruby/core/argf/filename_spec.rb6
-rw-r--r--spec/ruby/core/argf/fileno_spec.rb6
-rw-r--r--spec/ruby/core/argf/fixtures/bin_file.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file1.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file2.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/filename.rb3
-rw-r--r--spec/ruby/core/argf/fixtures/lineno.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/rewind.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/stdin.txt2
-rw-r--r--spec/ruby/core/argf/getc_spec.rb20
-rw-r--r--spec/ruby/core/argf/gets_spec.rb49
-rw-r--r--spec/ruby/core/argf/lineno_spec.rb30
-rw-r--r--spec/ruby/core/argf/lines_spec.rb8
-rw-r--r--spec/ruby/core/argf/path_spec.rb6
-rw-r--r--spec/ruby/core/argf/pos_spec.rb38
-rw-r--r--spec/ruby/core/argf/read_nonblock_spec.rb80
-rw-r--r--spec/ruby/core/argf/read_spec.rb85
-rw-r--r--spec/ruby/core/argf/readchar_spec.rb19
-rw-r--r--spec/ruby/core/argf/readline_spec.rb23
-rw-r--r--spec/ruby/core/argf/readlines_spec.rb6
-rw-r--r--spec/ruby/core/argf/readpartial_spec.rb75
-rw-r--r--spec/ruby/core/argf/rewind_spec.rb39
-rw-r--r--spec/ruby/core/argf/seek_spec.rb63
-rw-r--r--spec/ruby/core/argf/set_encoding_spec.rb41
-rw-r--r--spec/ruby/core/argf/shared/each_byte.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_char.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_codepoint.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_line.rb62
-rw-r--r--spec/ruby/core/argf/shared/eof.rb24
-rw-r--r--spec/ruby/core/argf/shared/filename.rb28
-rw-r--r--spec/ruby/core/argf/shared/fileno.rb24
-rw-r--r--spec/ruby/core/argf/shared/getc.rb17
-rw-r--r--spec/ruby/core/argf/shared/gets.rb99
-rw-r--r--spec/ruby/core/argf/shared/pos.rb31
-rw-r--r--spec/ruby/core/argf/shared/read.rb58
-rw-r--r--spec/ruby/core/argf/shared/readlines.rb22
-rw-r--r--spec/ruby/core/argf/skip_spec.rb42
-rw-r--r--spec/ruby/core/argf/tell_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_a_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_i_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_io_spec.rb23
-rw-r--r--spec/ruby/core/argf/to_s_spec.rb14
-rw-r--r--spec/ruby/core/array/allocate_spec.rb19
-rw-r--r--spec/ruby/core/array/any_spec.rb37
-rw-r--r--spec/ruby/core/array/append_spec.rb40
-rw-r--r--spec/ruby/core/array/array_spec.rb7
-rw-r--r--spec/ruby/core/array/assoc_spec.rb40
-rw-r--r--spec/ruby/core/array/at_spec.rb56
-rw-r--r--spec/ruby/core/array/bsearch_index_spec.rb85
-rw-r--r--spec/ruby/core/array/bsearch_spec.rb84
-rw-r--r--spec/ruby/core/array/clear_spec.rb52
-rw-r--r--spec/ruby/core/array/clone_spec.rb31
-rw-r--r--spec/ruby/core/array/collect_spec.rb11
-rw-r--r--spec/ruby/core/array/combination_spec.rb74
-rw-r--r--spec/ruby/core/array/compact_spec.rb81
-rw-r--r--spec/ruby/core/array/comparison_spec.rb97
-rw-r--r--spec/ruby/core/array/concat_spec.rb132
-rw-r--r--spec/ruby/core/array/constructor_spec.rb24
-rw-r--r--spec/ruby/core/array/count_spec.rb15
-rw-r--r--spec/ruby/core/array/cycle_spec.rb101
-rw-r--r--spec/ruby/core/array/deconstruct_spec.rb11
-rw-r--r--spec/ruby/core/array/delete_at_spec.rb63
-rw-r--r--spec/ruby/core/array/delete_if_spec.rb68
-rw-r--r--spec/ruby/core/array/delete_spec.rb68
-rw-r--r--spec/ruby/core/array/difference_spec.rb24
-rw-r--r--spec/ruby/core/array/dig_spec.rb52
-rw-r--r--spec/ruby/core/array/drop_spec.rb51
-rw-r--r--spec/ruby/core/array/drop_while_spec.rb15
-rw-r--r--spec/ruby/core/array/dup_spec.rb31
-rw-r--r--spec/ruby/core/array/each_index_spec.rb42
-rw-r--r--spec/ruby/core/array/each_spec.rb48
-rw-r--r--spec/ruby/core/array/element_reference_spec.rb50
-rw-r--r--spec/ruby/core/array/element_set_spec.rb487
-rw-r--r--spec/ruby/core/array/empty_spec.rb10
-rw-r--r--spec/ruby/core/array/eql_spec.rb19
-rw-r--r--spec/ruby/core/array/equal_value_spec.rb51
-rw-r--r--spec/ruby/core/array/fetch_spec.rb55
-rw-r--r--spec/ruby/core/array/fill_spec.rb327
-rw-r--r--spec/ruby/core/array/filter_spec.rb16
-rw-r--r--spec/ruby/core/array/find_index_spec.rb6
-rw-r--r--spec/ruby/core/array/first_spec.rb93
-rw-r--r--spec/ruby/core/array/fixtures/classes.rb522
-rw-r--r--spec/ruby/core/array/fixtures/encoded_strings.rb69
-rw-r--r--spec/ruby/core/array/flatten_spec.rb288
-rw-r--r--spec/ruby/core/array/frozen_spec.rb16
-rw-r--r--spec/ruby/core/array/hash_spec.rb83
-rw-r--r--spec/ruby/core/array/include_spec.rb33
-rw-r--r--spec/ruby/core/array/index_spec.rb6
-rw-r--r--spec/ruby/core/array/initialize_spec.rb156
-rw-r--r--spec/ruby/core/array/insert_spec.rb78
-rw-r--r--spec/ruby/core/array/inspect_spec.rb7
-rw-r--r--spec/ruby/core/array/intersection_spec.rb21
-rw-r--r--spec/ruby/core/array/join_spec.rb50
-rw-r--r--spec/ruby/core/array/keep_if_spec.rb10
-rw-r--r--spec/ruby/core/array/last_spec.rb87
-rw-r--r--spec/ruby/core/array/length_spec.rb7
-rw-r--r--spec/ruby/core/array/map_spec.rb11
-rw-r--r--spec/ruby/core/array/max_spec.rb116
-rw-r--r--spec/ruby/core/array/min_spec.rb121
-rw-r--r--spec/ruby/core/array/minmax_spec.rb14
-rw-r--r--spec/ruby/core/array/minus_spec.rb7
-rw-r--r--spec/ruby/core/array/multiply_spec.rb144
-rw-r--r--spec/ruby/core/array/new_spec.rb122
-rw-r--r--spec/ruby/core/array/pack/a_spec.rb62
-rw-r--r--spec/ruby/core/array/pack/at_spec.rb30
-rw-r--r--spec/ruby/core/array/pack/b_spec.rb108
-rw-r--r--spec/ruby/core/array/pack/buffer_spec.rb50
-rw-r--r--spec/ruby/core/array/pack/c_spec.rb75
-rw-r--r--spec/ruby/core/array/pack/comment_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/d_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/e_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/empty_spec.rb11
-rw-r--r--spec/ruby/core/array/pack/f_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/g_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/h_spec.rb200
-rw-r--r--spec/ruby/core/array/pack/i_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/j_spec.rb217
-rw-r--r--spec/ruby/core/array/pack/l_spec.rb221
-rw-r--r--spec/ruby/core/array/pack/m_spec.rb309
-rw-r--r--spec/ruby/core/array/pack/n_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/p_spec.rb62
-rw-r--r--spec/ruby/core/array/pack/percent_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/q_spec.rb61
-rw-r--r--spec/ruby/core/array/pack/s_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/shared/basic.rb69
-rw-r--r--spec/ruby/core/array/pack/shared/encodings.rb16
-rw-r--r--spec/ruby/core/array/pack/shared/float.rb229
-rw-r--r--spec/ruby/core/array/pack/shared/integer.rb381
-rw-r--r--spec/ruby/core/array/pack/shared/numeric_basic.rb44
-rw-r--r--spec/ruby/core/array/pack/shared/string.rb48
-rw-r--r--spec/ruby/core/array/pack/shared/taint.rb35
-rw-r--r--spec/ruby/core/array/pack/shared/unicode.rb94
-rw-r--r--spec/ruby/core/array/pack/u_spec.rb130
-rw-r--r--spec/ruby/core/array/pack/v_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/w_spec.rb42
-rw-r--r--spec/ruby/core/array/pack/x_spec.rb64
-rw-r--r--spec/ruby/core/array/pack/z_spec.rb34
-rw-r--r--spec/ruby/core/array/partition_spec.rb43
-rw-r--r--spec/ruby/core/array/permutation_spec.rb138
-rw-r--r--spec/ruby/core/array/plus_spec.rb59
-rw-r--r--spec/ruby/core/array/pop_spec.rb176
-rw-r--r--spec/ruby/core/array/prepend_spec.rb7
-rw-r--r--spec/ruby/core/array/product_spec.rb68
-rw-r--r--spec/ruby/core/array/push_spec.rb7
-rw-r--r--spec/ruby/core/array/rassoc_spec.rb38
-rw-r--r--spec/ruby/core/array/reject_spec.rb143
-rw-r--r--spec/ruby/core/array/repeated_combination_spec.rb84
-rw-r--r--spec/ruby/core/array/repeated_permutation_spec.rb94
-rw-r--r--spec/ruby/core/array/replace_spec.rb7
-rw-r--r--spec/ruby/core/array/reverse_each_spec.rb43
-rw-r--r--spec/ruby/core/array/reverse_spec.rb42
-rw-r--r--spec/ruby/core/array/rindex_spec.rb80
-rw-r--r--spec/ruby/core/array/rotate_spec.rb129
-rw-r--r--spec/ruby/core/array/sample_spec.rb138
-rw-r--r--spec/ruby/core/array/select_spec.rb14
-rw-r--r--spec/ruby/core/array/shared/clone.rb44
-rw-r--r--spec/ruby/core/array/shared/collect.rb140
-rw-r--r--spec/ruby/core/array/shared/delete_if.rb13
-rw-r--r--spec/ruby/core/array/shared/difference.rb78
-rw-r--r--spec/ruby/core/array/shared/enumeratorize.rb5
-rw-r--r--spec/ruby/core/array/shared/eql.rb92
-rw-r--r--spec/ruby/core/array/shared/index.rb37
-rw-r--r--spec/ruby/core/array/shared/inspect.rb133
-rw-r--r--spec/ruby/core/array/shared/intersection.rb84
-rw-r--r--spec/ruby/core/array/shared/join.rb181
-rw-r--r--spec/ruby/core/array/shared/keep_if.rb60
-rw-r--r--spec/ruby/core/array/shared/length.rb11
-rw-r--r--spec/ruby/core/array/shared/push.rb33
-rw-r--r--spec/ruby/core/array/shared/replace.rb60
-rw-r--r--spec/ruby/core/array/shared/select.rb32
-rw-r--r--spec/ruby/core/array/shared/slice.rb523
-rw-r--r--spec/ruby/core/array/shared/union.rb79
-rw-r--r--spec/ruby/core/array/shared/unshift.rb46
-rw-r--r--spec/ruby/core/array/shift_spec.rb136
-rw-r--r--spec/ruby/core/array/shuffle_spec.rb96
-rw-r--r--spec/ruby/core/array/size_spec.rb7
-rw-r--r--spec/ruby/core/array/slice_spec.rb172
-rw-r--r--spec/ruby/core/array/sort_by_spec.rb52
-rw-r--r--spec/ruby/core/array/sort_spec.rb252
-rw-r--r--spec/ruby/core/array/sum_spec.rb42
-rw-r--r--spec/ruby/core/array/take_spec.rb27
-rw-r--r--spec/ruby/core/array/take_while_spec.rb15
-rw-r--r--spec/ruby/core/array/to_a_spec.rb24
-rw-r--r--spec/ruby/core/array/to_ary_spec.rb20
-rw-r--r--spec/ruby/core/array/to_h_spec.rb81
-rw-r--r--spec/ruby/core/array/to_s_spec.rb8
-rw-r--r--spec/ruby/core/array/transpose_spec.rb53
-rw-r--r--spec/ruby/core/array/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/array/union_spec.rb27
-rw-r--r--spec/ruby/core/array/uniq_spec.rb261
-rw-r--r--spec/ruby/core/array/unshift_spec.rb7
-rw-r--r--spec/ruby/core/array/values_at_spec.rb70
-rw-r--r--spec/ruby/core/array/zip_spec.rb65
-rw-r--r--spec/ruby/core/basicobject/__id__spec.rb6
-rw-r--r--spec/ruby/core/basicobject/__send___spec.rb10
-rw-r--r--spec/ruby/core/basicobject/basicobject_spec.rb91
-rw-r--r--spec/ruby/core/basicobject/equal_spec.rb52
-rw-r--r--spec/ruby/core/basicobject/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/basicobject/fixtures/classes.rb33
-rw-r--r--spec/ruby/core/basicobject/fixtures/common.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/remove_method_missing.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/singleton_method.rb10
-rw-r--r--spec/ruby/core/basicobject/initialize_spec.rb13
-rw-r--r--spec/ruby/core/basicobject/instance_eval_spec.rb188
-rw-r--r--spec/ruby/core/basicobject/instance_exec_spec.rb107
-rw-r--r--spec/ruby/core/basicobject/method_missing_spec.rb39
-rw-r--r--spec/ruby/core/basicobject/not_equal_spec.rb53
-rw-r--r--spec/ruby/core/basicobject/not_spec.rb11
-rw-r--r--spec/ruby/core/basicobject/singleton_method_added_spec.rb86
-rw-r--r--spec/ruby/core/basicobject/singleton_method_removed_spec.rb24
-rw-r--r--spec/ruby/core/basicobject/singleton_method_undefined_spec.rb24
-rw-r--r--spec/ruby/core/binding/clone_spec.rb7
-rw-r--r--spec/ruby/core/binding/dup_spec.rb7
-rw-r--r--spec/ruby/core/binding/eval_spec.rb140
-rw-r--r--spec/ruby/core/binding/fixtures/classes.rb66
-rw-r--r--spec/ruby/core/binding/fixtures/irb.rb3
-rw-r--r--spec/ruby/core/binding/fixtures/irbrc1
-rw-r--r--spec/ruby/core/binding/fixtures/location.rb6
-rw-r--r--spec/ruby/core/binding/irb_spec.rb16
-rw-r--r--spec/ruby/core/binding/local_variable_defined_spec.rb46
-rw-r--r--spec/ruby/core/binding/local_variable_get_spec.rb56
-rw-r--r--spec/ruby/core/binding/local_variable_set_spec.rb71
-rw-r--r--spec/ruby/core/binding/local_variables_spec.rb35
-rw-r--r--spec/ruby/core/binding/receiver_spec.rb11
-rw-r--r--spec/ruby/core/binding/shared/clone.rb34
-rw-r--r--spec/ruby/core/binding/source_location_spec.rb11
-rw-r--r--spec/ruby/core/builtin_constants/builtin_constants_spec.rb63
-rw-r--r--spec/ruby/core/class/allocate_spec.rb41
-rw-r--r--spec/ruby/core/class/dup_spec.rb64
-rw-r--r--spec/ruby/core/class/fixtures/classes.rb47
-rw-r--r--spec/ruby/core/class/inherited_spec.rb101
-rw-r--r--spec/ruby/core/class/initialize_spec.rb34
-rw-r--r--spec/ruby/core/class/new_spec.rb155
-rw-r--r--spec/ruby/core/class/superclass_spec.rb27
-rw-r--r--spec/ruby/core/comparable/between_spec.rb25
-rw-r--r--spec/ruby/core/comparable/clamp_spec.rb88
-rw-r--r--spec/ruby/core/comparable/equal_value_spec.rb114
-rw-r--r--spec/ruby/core/comparable/fixtures/classes.rb36
-rw-r--r--spec/ruby/core/comparable/gt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/gte_spec.rb47
-rw-r--r--spec/ruby/core/comparable/lt_spec.rb49
-rw-r--r--spec/ruby/core/comparable/lte_spec.rb46
-rw-r--r--spec/ruby/core/complex/abs2_spec.rb9
-rw-r--r--spec/ruby/core/complex/abs_spec.rb6
-rw-r--r--spec/ruby/core/complex/angle_spec.rb6
-rw-r--r--spec/ruby/core/complex/arg_spec.rb6
-rw-r--r--spec/ruby/core/complex/coerce_spec.rb70
-rw-r--r--spec/ruby/core/complex/comparision_spec.rb27
-rw-r--r--spec/ruby/core/complex/conj_spec.rb6
-rw-r--r--spec/ruby/core/complex/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/complex/constants_spec.rb7
-rw-r--r--spec/ruby/core/complex/denominator_spec.rb13
-rw-r--r--spec/ruby/core/complex/divide_spec.rb6
-rw-r--r--spec/ruby/core/complex/eql_spec.rb31
-rw-r--r--spec/ruby/core/complex/equal_value_spec.rb93
-rw-r--r--spec/ruby/core/complex/exponent_spec.rb61
-rw-r--r--spec/ruby/core/complex/fdiv_spec.rb129
-rw-r--r--spec/ruby/core/complex/finite_spec.rb32
-rw-r--r--spec/ruby/core/complex/hash_spec.rb16
-rw-r--r--spec/ruby/core/complex/imag_spec.rb6
-rw-r--r--spec/ruby/core/complex/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/complex/infinite_spec.rb32
-rw-r--r--spec/ruby/core/complex/inspect_spec.rb16
-rw-r--r--spec/ruby/core/complex/integer_spec.rb11
-rw-r--r--spec/ruby/core/complex/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/complex/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/complex/minus_spec.rb45
-rw-r--r--spec/ruby/core/complex/multiply_spec.rb49
-rw-r--r--spec/ruby/core/complex/negative_spec.rb13
-rw-r--r--spec/ruby/core/complex/numerator_spec.rb19
-rw-r--r--spec/ruby/core/complex/phase_spec.rb6
-rw-r--r--spec/ruby/core/complex/plus_spec.rb45
-rw-r--r--spec/ruby/core/complex/polar_spec.rb27
-rw-r--r--spec/ruby/core/complex/positive_spec.rb13
-rw-r--r--spec/ruby/core/complex/quo_spec.rb6
-rw-r--r--spec/ruby/core/complex/rationalize_spec.rb31
-rw-r--r--spec/ruby/core/complex/real_spec.rb28
-rw-r--r--spec/ruby/core/complex/rect_spec.rb10
-rw-r--r--spec/ruby/core/complex/rectangular_spec.rb10
-rw-r--r--spec/ruby/core/complex/shared/abs.rb10
-rw-r--r--spec/ruby/core/complex/shared/arg.rb9
-rw-r--r--spec/ruby/core/complex/shared/conjugate.rb8
-rw-r--r--spec/ruby/core/complex/shared/divide.rb82
-rw-r--r--spec/ruby/core/complex/shared/image.rb8
-rw-r--r--spec/ruby/core/complex/shared/rect.rb94
-rw-r--r--spec/ruby/core/complex/to_c_spec.rb12
-rw-r--r--spec/ruby/core/complex/to_f_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_i_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_r_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_s_spec.rb44
-rw-r--r--spec/ruby/core/complex/uminus_spec.rb11
-rw-r--r--spec/ruby/core/data/constants_spec.rb15
-rw-r--r--spec/ruby/core/dir/chdir_spec.rb124
-rw-r--r--spec/ruby/core/dir/children_spec.rb136
-rw-r--r--spec/ruby/core/dir/chroot_spec.rb47
-rw-r--r--spec/ruby/core/dir/close_spec.rb19
-rw-r--r--spec/ruby/core/dir/delete_spec.rb15
-rw-r--r--spec/ruby/core/dir/dir_spec.rb7
-rw-r--r--spec/ruby/core/dir/each_child_spec.rb103
-rw-r--r--spec/ruby/core/dir/each_spec.rb64
-rw-r--r--spec/ruby/core/dir/element_reference_spec.rb33
-rw-r--r--spec/ruby/core/dir/empty_spec.rb31
-rw-r--r--spec/ruby/core/dir/entries_spec.rb70
-rw-r--r--spec/ruby/core/dir/exist_spec.rb15
-rw-r--r--spec/ruby/core/dir/fileno_spec.rb37
-rw-r--r--spec/ruby/core/dir/fixtures/common.rb172
-rw-r--r--spec/ruby/core/dir/foreach_spec.rb56
-rw-r--r--spec/ruby/core/dir/getwd_spec.rb15
-rw-r--r--spec/ruby/core/dir/glob_spec.rb184
-rw-r--r--spec/ruby/core/dir/home_spec.rb45
-rw-r--r--spec/ruby/core/dir/initialize_spec.rb23
-rw-r--r--spec/ruby/core/dir/inspect_spec.rb24
-rw-r--r--spec/ruby/core/dir/mkdir_spec.rb91
-rw-r--r--spec/ruby/core/dir/open_spec.rb15
-rw-r--r--spec/ruby/core/dir/path_spec.rb15
-rw-r--r--spec/ruby/core/dir/pos_spec.rb40
-rw-r--r--spec/ruby/core/dir/pwd_spec.rb39
-rw-r--r--spec/ruby/core/dir/read_spec.rb43
-rw-r--r--spec/ruby/core/dir/rewind_spec.rb36
-rw-r--r--spec/ruby/core/dir/rmdir_spec.rb15
-rw-r--r--spec/ruby/core/dir/seek_spec.rb19
-rw-r--r--spec/ruby/core/dir/shared/chroot.rb41
-rw-r--r--spec/ruby/core/dir/shared/closed.rb9
-rw-r--r--spec/ruby/core/dir/shared/delete.rb63
-rw-r--r--spec/ruby/core/dir/shared/exist.rb56
-rw-r--r--spec/ruby/core/dir/shared/glob.rb416
-rw-r--r--spec/ruby/core/dir/shared/open.rb73
-rw-r--r--spec/ruby/core/dir/shared/path.rb30
-rw-r--r--spec/ruby/core/dir/shared/pos.rb51
-rw-r--r--spec/ruby/core/dir/shared/pwd.rb45
-rw-r--r--spec/ruby/core/dir/tell_spec.rb18
-rw-r--r--spec/ruby/core/dir/to_path_spec.rb15
-rw-r--r--spec/ruby/core/dir/unlink_spec.rb15
-rw-r--r--spec/ruby/core/encoding/_dump_spec.rb5
-rw-r--r--spec/ruby/core/encoding/_load_spec.rb5
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb43
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb11
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb379
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb37
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb131
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb45
-rw-r--r--spec/ruby/core/encoding/converter/convpath_spec.rb24
-rw-r--r--spec/ruby/core/encoding/converter/destination_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb36
-rw-r--r--spec/ruby/core/encoding/converter/insert_output_spec.rb5
-rw-r--r--spec/ruby/core/encoding/converter/inspect_spec.rb13
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb91
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb119
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb211
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb68
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb47
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb72
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb30
-rw-r--r--spec/ruby/core/encoding/converter/source_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb63
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb74
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb14
-rw-r--r--spec/ruby/core/encoding/find_spec.rb82
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb33
-rw-r--r--spec/ruby/core/encoding/list_spec.rb51
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb56
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb23
-rw-r--r--spec/ruby/core/encoding/name_spec.rb5
-rw-r--r--spec/ruby/core/encoding/names_spec.rb35
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb46
-rw-r--r--spec/ruby/core/encoding/shared/name.rb15
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb5
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb27
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb29
-rw-r--r--spec/ruby/core/enumerable/all_spec.rb190
-rw-r--r--spec/ruby/core/enumerable/any_spec.rb203
-rw-r--r--spec/ruby/core/enumerable/chain_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerable/chunk_while_spec.rb42
-rw-r--r--spec/ruby/core/enumerable/collect_concat_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/collect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/count_spec.rb59
-rw-r--r--spec/ruby/core/enumerable/cycle_spec.rb104
-rw-r--r--spec/ruby/core/enumerable/detect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/drop_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/drop_while_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/each_cons_spec.rb99
-rw-r--r--spec/ruby/core/enumerable/each_entry_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/each_slice_spec.rb101
-rw-r--r--spec/ruby/core/enumerable/each_with_index_spec.rb53
-rw-r--r--spec/ruby/core/enumerable/each_with_object_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/entries_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/filter_map_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/filter_spec.rb9
-rw-r--r--spec/ruby/core/enumerable/find_all_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_index_spec.rb89
-rw-r--r--spec/ruby/core/enumerable/find_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/first_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/fixtures/classes.rb345
-rw-r--r--spec/ruby/core/enumerable/flat_map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/grep_spec.rb84
-rw-r--r--spec/ruby/core/enumerable/grep_v_spec.rb73
-rw-r--r--spec/ruby/core/enumerable/group_by_spec.rb47
-rw-r--r--spec/ruby/core/enumerable/include_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/inject_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/lazy_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/max_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/max_spec.rb119
-rw-r--r--spec/ruby/core/enumerable/member_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/min_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/min_spec.rb123
-rw-r--r--spec/ruby/core/enumerable/minmax_by_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/minmax_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/none_spec.rb156
-rw-r--r--spec/ruby/core/enumerable/one_spec.rb158
-rw-r--r--spec/ruby/core/enumerable/partition_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/reduce_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/reject_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/reverse_each_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/select_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/shared/collect.rb68
-rw-r--r--spec/ruby/core/enumerable/shared/collect_concat.rb54
-rw-r--r--spec/ruby/core/enumerable/shared/entries.rb26
-rw-r--r--spec/ruby/core/enumerable/shared/enumerable_enumeratorized.rb33
-rw-r--r--spec/ruby/core/enumerable/shared/enumeratorized.rb42
-rw-r--r--spec/ruby/core/enumerable/shared/find.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/find_all.rb31
-rw-r--r--spec/ruby/core/enumerable/shared/include.rb34
-rw-r--r--spec/ruby/core/enumerable/shared/inject.rb69
-rw-r--r--spec/ruby/core/enumerable/shared/take.rb63
-rw-r--r--spec/ruby/core/enumerable/slice_after_spec.rb61
-rw-r--r--spec/ruby/core/enumerable/slice_before_spec.rb64
-rw-r--r--spec/ruby/core/enumerable/slice_when_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sort_by_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/sort_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sum_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/take_spec.rb13
-rw-r--r--spec/ruby/core/enumerable/take_while_spec.rb51
-rw-r--r--spec/ruby/core/enumerable/tally_spec.rb35
-rw-r--r--spec/ruby/core/enumerable/to_a_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/to_h_spec.rb90
-rw-r--r--spec/ruby/core/enumerable/uniq_spec.rb122
-rw-r--r--spec/ruby/core/enumerable/zip_spec.rb41
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/begin_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/each_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/end_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/eq_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/first_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/hash_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/inspect_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/last_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/new_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/size_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/step_spec.rb13
-rw-r--r--spec/ruby/core/enumerator/chain/each_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/chain/initialize_spec.rb33
-rw-r--r--spec/ruby/core/enumerator/chain/inspect_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/chain/rewind_spec.rb53
-rw-r--r--spec/ruby/core/enumerator/chain/size_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/each_spec.rb89
-rw-r--r--spec/ruby/core/enumerator/each_with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/each_with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enum_for_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enumerator_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/feed_spec.rb52
-rw-r--r--spec/ruby/core/enumerator/first_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/fixtures/common.rb9
-rw-r--r--spec/ruby/core/enumerator/generator/each_spec.rb40
-rw-r--r--spec/ruby/core/enumerator/generator/initialize_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/initialize_spec.rb63
-rw-r--r--spec/ruby/core/enumerator/inspect_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_while_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_concat_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_spec.rb58
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_while_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/eager_spec.rb29
-rw-r--r--spec/ruby/core/enumerator/lazy/enum_for_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/find_all_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/fixtures/classes.rb54
-rw-r--r--spec/ruby/core/enumerator/lazy/flat_map_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/lazy/force_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_spec.rb121
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_v_spec.rb123
-rw-r--r--spec/ruby/core/enumerator/lazy/initialize_spec.rb63
-rw-r--r--spec/ruby/core/enumerator/lazy/lazy_spec.rb28
-rw-r--r--spec/ruby/core/enumerator/lazy/map_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/lazy/reject_spec.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/select_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect.rb62
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect_concat.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/select.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/to_enum.rb55
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_after_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_before_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_when_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/take_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/take_while_spec.rb60
-rw-r--r--spec/ruby/core/enumerator/lazy/to_enum_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/uniq_spec.rb74
-rw-r--r--spec/ruby/core/enumerator/lazy/zip_spec.rb86
-rw-r--r--spec/ruby/core/enumerator/new_spec.rb120
-rw-r--r--spec/ruby/core/enumerator/next_spec.rb38
-rw-r--r--spec/ruby/core/enumerator/next_values_spec.rb55
-rw-r--r--spec/ruby/core/enumerator/peek_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/peek_values_spec.rb57
-rw-r--r--spec/ruby/core/enumerator/plus_spec.rb35
-rw-r--r--spec/ruby/core/enumerator/produce_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/rewind_spec.rb70
-rw-r--r--spec/ruby/core/enumerator/size_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/to_enum_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/with_index_spec.rb72
-rw-r--r--spec/ruby/core/enumerator/with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/yielder/append_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/yielder/initialize_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/to_proc_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/yield_spec.rb33
-rw-r--r--spec/ruby/core/env/assoc_spec.rb31
-rw-r--r--spec/ruby/core/env/clear_spec.rb20
-rw-r--r--spec/ruby/core/env/delete_if_spec.rb54
-rw-r--r--spec/ruby/core/env/delete_spec.rb49
-rw-r--r--spec/ruby/core/env/each_key_spec.rb34
-rw-r--r--spec/ruby/core/env/each_pair_spec.rb6
-rw-r--r--spec/ruby/core/env/each_spec.rb6
-rw-r--r--spec/ruby/core/env/each_value_spec.rb34
-rw-r--r--spec/ruby/core/env/element_reference_spec.rb76
-rw-r--r--spec/ruby/core/env/element_set_spec.rb6
-rw-r--r--spec/ruby/core/env/empty_spec.rb23
-rw-r--r--spec/ruby/core/env/fetch_spec.rb63
-rw-r--r--spec/ruby/core/env/filter_spec.rb15
-rw-r--r--spec/ruby/core/env/has_key_spec.rb6
-rw-r--r--spec/ruby/core/env/has_value_spec.rb6
-rw-r--r--spec/ruby/core/env/include_spec.rb6
-rw-r--r--spec/ruby/core/env/index_spec.rb14
-rw-r--r--spec/ruby/core/env/indexes_spec.rb1
-rw-r--r--spec/ruby/core/env/indices_spec.rb1
-rw-r--r--spec/ruby/core/env/inspect_spec.rb11
-rw-r--r--spec/ruby/core/env/invert_spec.rb16
-rw-r--r--spec/ruby/core/env/keep_if_spec.rb54
-rw-r--r--spec/ruby/core/env/key_spec.rb11
-rw-r--r--spec/ruby/core/env/keys_spec.rb14
-rw-r--r--spec/ruby/core/env/length_spec.rb6
-rw-r--r--spec/ruby/core/env/member_spec.rb6
-rw-r--r--spec/ruby/core/env/merge_spec.rb8
-rw-r--r--spec/ruby/core/env/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/env/rehash_spec.rb7
-rw-r--r--spec/ruby/core/env/reject_spec.rb101
-rw-r--r--spec/ruby/core/env/replace_spec.rb51
-rw-r--r--spec/ruby/core/env/select_spec.rb13
-rw-r--r--spec/ruby/core/env/shared/each.rb65
-rw-r--r--spec/ruby/core/env/shared/include.rb23
-rw-r--r--spec/ruby/core/env/shared/key.rb31
-rw-r--r--spec/ruby/core/env/shared/length.rb13
-rw-r--r--spec/ruby/core/env/shared/select.rb61
-rw-r--r--spec/ruby/core/env/shared/store.rb60
-rw-r--r--spec/ruby/core/env/shared/to_hash.rb33
-rw-r--r--spec/ruby/core/env/shared/update.rb100
-rw-r--r--spec/ruby/core/env/shared/value.rb22
-rw-r--r--spec/ruby/core/env/shift_spec.rb58
-rw-r--r--spec/ruby/core/env/size_spec.rb6
-rw-r--r--spec/ruby/core/env/slice_spec.rb29
-rw-r--r--spec/ruby/core/env/spec_helper.rb26
-rw-r--r--spec/ruby/core/env/store_spec.rb6
-rw-r--r--spec/ruby/core/env/to_a_spec.rb18
-rw-r--r--spec/ruby/core/env/to_h_spec.rb60
-rw-r--r--spec/ruby/core/env/to_hash_spec.rb6
-rw-r--r--spec/ruby/core/env/to_s_spec.rb7
-rw-r--r--spec/ruby/core/env/update_spec.rb6
-rw-r--r--spec/ruby/core/env/value_spec.rb6
-rw-r--r--spec/ruby/core/env/values_at_spec.rb38
-rw-r--r--spec/ruby/core/env/values_spec.rb14
-rw-r--r--spec/ruby/core/exception/backtrace_locations_spec.rb39
-rw-r--r--spec/ruby/core/exception/backtrace_spec.rb93
-rw-r--r--spec/ruby/core/exception/case_compare_spec.rb39
-rw-r--r--spec/ruby/core/exception/cause_spec.rb56
-rw-r--r--spec/ruby/core/exception/dup_spec.rb74
-rw-r--r--spec/ruby/core/exception/equal_value_spec.rb68
-rw-r--r--spec/ruby/core/exception/errno_spec.rb58
-rw-r--r--spec/ruby/core/exception/exception_spec.rb69
-rw-r--r--spec/ruby/core/exception/exit_value_spec.rb13
-rw-r--r--spec/ruby/core/exception/fixtures/common.rb95
-rw-r--r--spec/ruby/core/exception/frozen_error_spec.rb26
-rw-r--r--spec/ruby/core/exception/full_message_spec.rb92
-rw-r--r--spec/ruby/core/exception/hierarchy_spec.rb62
-rw-r--r--spec/ruby/core/exception/inspect_spec.rb24
-rw-r--r--spec/ruby/core/exception/interrupt_spec.rb35
-rw-r--r--spec/ruby/core/exception/io_error_spec.rb45
-rw-r--r--spec/ruby/core/exception/key_error_spec.rb21
-rw-r--r--spec/ruby/core/exception/load_error_spec.rb21
-rw-r--r--spec/ruby/core/exception/message_spec.rb27
-rw-r--r--spec/ruby/core/exception/name_error_spec.rb30
-rw-r--r--spec/ruby/core/exception/name_spec.rb43
-rw-r--r--spec/ruby/core/exception/new_spec.rb7
-rw-r--r--spec/ruby/core/exception/no_method_error_spec.rb138
-rw-r--r--spec/ruby/core/exception/reason_spec.rb13
-rw-r--r--spec/ruby/core/exception/receiver_spec.rb58
-rw-r--r--spec/ruby/core/exception/result_spec.rb23
-rw-r--r--spec/ruby/core/exception/set_backtrace_spec.rb56
-rw-r--r--spec/ruby/core/exception/shared/new.rb18
-rw-r--r--spec/ruby/core/exception/signal_exception_spec.rb125
-rw-r--r--spec/ruby/core/exception/signm_spec.rb9
-rw-r--r--spec/ruby/core/exception/signo_spec.rb9
-rw-r--r--spec/ruby/core/exception/standard_error_spec.rb23
-rw-r--r--spec/ruby/core/exception/status_spec.rb9
-rw-r--r--spec/ruby/core/exception/success_spec.rb15
-rw-r--r--spec/ruby/core/exception/system_call_error_spec.rb143
-rw-r--r--spec/ruby/core/exception/system_exit_spec.rb17
-rw-r--r--spec/ruby/core/exception/to_s_spec.rb37
-rw-r--r--spec/ruby/core/exception/top_level_spec.rb47
-rw-r--r--spec/ruby/core/exception/uncaught_throw_error_spec.rb12
-rw-r--r--spec/ruby/core/false/and_spec.rb11
-rw-r--r--spec/ruby/core/false/dup_spec.rb7
-rw-r--r--spec/ruby/core/false/falseclass_spec.rb15
-rw-r--r--spec/ruby/core/false/inspect_spec.rb7
-rw-r--r--spec/ruby/core/false/or_spec.rb11
-rw-r--r--spec/ruby/core/false/to_s_spec.rb17
-rw-r--r--spec/ruby/core/false/xor_spec.rb11
-rw-r--r--spec/ruby/core/fiber/fixtures/classes.rb12
-rw-r--r--spec/ruby/core/fiber/new_spec.rb39
-rw-r--r--spec/ruby/core/fiber/raise_spec.rb101
-rw-r--r--spec/ruby/core/fiber/resume_spec.rb79
-rw-r--r--spec/ruby/core/fiber/yield_spec.rb49
-rw-r--r--spec/ruby/core/file/absolute_path_spec.rb96
-rw-r--r--spec/ruby/core/file/atime_spec.rb55
-rw-r--r--spec/ruby/core/file/basename_spec.rb168
-rw-r--r--spec/ruby/core/file/birthtime_spec.rb60
-rw-r--r--spec/ruby/core/file/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/file/chardev_spec.rb6
-rw-r--r--spec/ruby/core/file/chmod_spec.rb185
-rw-r--r--spec/ruby/core/file/chown_spec.rb144
-rw-r--r--spec/ruby/core/file/constants/constants_spec.rb31
-rw-r--r--spec/ruby/core/file/constants_spec.rb141
-rw-r--r--spec/ruby/core/file/ctime_spec.rb51
-rw-r--r--spec/ruby/core/file/delete_spec.rb6
-rw-r--r--spec/ruby/core/file/directory_spec.rb10
-rw-r--r--spec/ruby/core/file/dirname_spec.rb108
-rw-r--r--spec/ruby/core/file/empty_spec.rb13
-rw-r--r--spec/ruby/core/file/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/exist_spec.rb6
-rw-r--r--spec/ruby/core/file/expand_path_spec.rb265
-rw-r--r--spec/ruby/core/file/extname_spec.rb76
-rw-r--r--spec/ruby/core/file/file_spec.rb16
-rw-r--r--spec/ruby/core/file/fixtures/common.rb22
-rw-r--r--spec/ruby/core/file/fixtures/do_not_remove1
-rw-r--r--spec/ruby/core/file/fixtures/file_types.rb66
-rw-r--r--spec/ruby/core/file/flock_spec.rb106
-rw-r--r--spec/ruby/core/file/fnmatch_spec.rb10
-rw-r--r--spec/ruby/core/file/ftype_spec.rb82
-rw-r--r--spec/ruby/core/file/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/file/identical_spec.rb6
-rw-r--r--spec/ruby/core/file/initialize_spec.rb19
-rw-r--r--spec/ruby/core/file/inspect_spec.rb17
-rw-r--r--spec/ruby/core/file/join_spec.rb148
-rw-r--r--spec/ruby/core/file/lchmod_spec.rb32
-rw-r--r--spec/ruby/core/file/lchown_spec.rb59
-rw-r--r--spec/ruby/core/file/link_spec.rb39
-rw-r--r--spec/ruby/core/file/lstat_spec.rb33
-rw-r--r--spec/ruby/core/file/lutime_spec.rb38
-rw-r--r--spec/ruby/core/file/mkfifo_spec.rb51
-rw-r--r--spec/ruby/core/file/mtime_spec.rb51
-rw-r--r--spec/ruby/core/file/new_spec.rb162
-rw-r--r--spec/ruby/core/file/null_spec.rb15
-rw-r--r--spec/ruby/core/file/open_spec.rb698
-rw-r--r--spec/ruby/core/file/owned_spec.rb35
-rw-r--r--spec/ruby/core/file/path_spec.rb40
-rw-r--r--spec/ruby/core/file/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/printf_spec.rb18
-rw-r--r--spec/ruby/core/file/read_spec.rb6
-rw-r--r--spec/ruby/core/file/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/readlink_spec.rb86
-rw-r--r--spec/ruby/core/file/realdirpath_spec.rb104
-rw-r--r--spec/ruby/core/file/realpath_spec.rb94
-rw-r--r--spec/ruby/core/file/rename_spec.rb37
-rw-r--r--spec/ruby/core/file/reopen_spec.rb32
-rw-r--r--spec/ruby/core/file/setgid_spec.rb36
-rw-r--r--spec/ruby/core/file/setuid_spec.rb38
-rw-r--r--spec/ruby/core/file/shared/fnmatch.rb241
-rw-r--r--spec/ruby/core/file/shared/open.rb12
-rw-r--r--spec/ruby/core/file/shared/path.rb92
-rw-r--r--spec/ruby/core/file/shared/read.rb15
-rw-r--r--spec/ruby/core/file/shared/stat.rb32
-rw-r--r--spec/ruby/core/file/shared/unlink.rb61
-rw-r--r--spec/ruby/core/file/size_spec.rb119
-rw-r--r--spec/ruby/core/file/socket_spec.rb42
-rw-r--r--spec/ruby/core/file/split_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/atime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/birthtime_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blksize_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blockdev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/blocks_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/chardev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/comparison_spec.rb66
-rw-r--r--spec/ruby/core/file/stat/ctime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/dev_major_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_minor_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/directory_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/file_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/file/stat/ftype_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/gid_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/grpowned_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/ino_spec.rb28
-rw-r--r--spec/ruby/core/file/stat/inspect_spec.rb26
-rw-r--r--spec/ruby/core/file/stat/mode_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/mtime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/new_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/nlink_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/owned_spec.rb33
-rw-r--r--spec/ruby/core/file/stat/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/rdev_major_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_minor_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setgid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setuid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/size_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/socket_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/sticky_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/symlink_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/uid_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/world_readable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/world_writable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/zero_spec.rb7
-rw-r--r--spec/ruby/core/file/stat_spec.rb55
-rw-r--r--spec/ruby/core/file/sticky_spec.rb50
-rw-r--r--spec/ruby/core/file/symlink_spec.rb57
-rw-r--r--spec/ruby/core/file/to_path_spec.rb6
-rw-r--r--spec/ruby/core/file/truncate_spec.rb177
-rw-r--r--spec/ruby/core/file/umask_spec.rb57
-rw-r--r--spec/ruby/core/file/unlink_spec.rb6
-rw-r--r--spec/ruby/core/file/utime_spec.rb89
-rw-r--r--spec/ruby/core/file/world_readable_spec.rb12
-rw-r--r--spec/ruby/core/file/world_writable_spec.rb12
-rw-r--r--spec/ruby/core/file/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/zero_spec.rb13
-rw-r--r--spec/ruby/core/filetest/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/chardev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/directory_spec.rb10
-rw-r--r--spec/ruby/core/filetest/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/executable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/exist_spec.rb6
-rw-r--r--spec/ruby/core/filetest/file_spec.rb10
-rw-r--r--spec/ruby/core/filetest/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/filetest/identical_spec.rb6
-rw-r--r--spec/ruby/core/filetest/owned_spec.rb6
-rw-r--r--spec/ruby/core/filetest/pipe_spec.rb6
-rw-r--r--spec/ruby/core/filetest/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/readable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/setgid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/setuid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/size_spec.rb34
-rw-r--r--spec/ruby/core/filetest/socket_spec.rb6
-rw-r--r--spec/ruby/core/filetest/sticky_spec.rb7
-rw-r--r--spec/ruby/core/filetest/symlink_spec.rb10
-rw-r--r--spec/ruby/core/filetest/world_readable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/world_writable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/writable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/zero_spec.rb13
-rw-r--r--spec/ruby/core/float/abs_spec.rb6
-rw-r--r--spec/ruby/core/float/angle_spec.rb6
-rw-r--r--spec/ruby/core/float/arg_spec.rb6
-rw-r--r--spec/ruby/core/float/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/float/ceil_spec.rb21
-rw-r--r--spec/ruby/core/float/coerce_spec.rb18
-rw-r--r--spec/ruby/core/float/comparison_spec.rb66
-rw-r--r--spec/ruby/core/float/constants_spec.rb55
-rw-r--r--spec/ruby/core/float/denominator_spec.rb29
-rw-r--r--spec/ruby/core/float/divide_spec.rb39
-rw-r--r--spec/ruby/core/float/divmod_spec.rb43
-rw-r--r--spec/ruby/core/float/dup_spec.rb8
-rw-r--r--spec/ruby/core/float/eql_spec.rb16
-rw-r--r--spec/ruby/core/float/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/float/exponent_spec.rb15
-rw-r--r--spec/ruby/core/float/fdiv_spec.rb6
-rw-r--r--spec/ruby/core/float/finite_spec.rb19
-rw-r--r--spec/ruby/core/float/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/float/fixtures/coerce.rb15
-rw-r--r--spec/ruby/core/float/float_spec.rb19
-rw-r--r--spec/ruby/core/float/floor_spec.rb21
-rw-r--r--spec/ruby/core/float/gt_spec.rb17
-rw-r--r--spec/ruby/core/float/gte_spec.rb17
-rw-r--r--spec/ruby/core/float/hash_spec.rb11
-rw-r--r--spec/ruby/core/float/infinite_spec.rb19
-rw-r--r--spec/ruby/core/float/inspect_spec.rb6
-rw-r--r--spec/ruby/core/float/lt_spec.rb17
-rw-r--r--spec/ruby/core/float/lte_spec.rb18
-rw-r--r--spec/ruby/core/float/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/float/minus_spec.rb12
-rw-r--r--spec/ruby/core/float/modulo_spec.rb10
-rw-r--r--spec/ruby/core/float/multiply_spec.rb17
-rw-r--r--spec/ruby/core/float/nan_spec.rb9
-rw-r--r--spec/ruby/core/float/negative_spec.rb33
-rw-r--r--spec/ruby/core/float/next_float_spec.rb49
-rw-r--r--spec/ruby/core/float/numerator_spec.rb39
-rw-r--r--spec/ruby/core/float/phase_spec.rb6
-rw-r--r--spec/ruby/core/float/plus_spec.rb12
-rw-r--r--spec/ruby/core/float/positive_spec.rb33
-rw-r--r--spec/ruby/core/float/prev_float_spec.rb49
-rw-r--r--spec/ruby/core/float/quo_spec.rb6
-rw-r--r--spec/ruby/core/float/rationalize_spec.rb43
-rw-r--r--spec/ruby/core/float/round_spec.rb130
-rw-r--r--spec/ruby/core/float/shared/abs.rb21
-rw-r--r--spec/ruby/core/float/shared/arg.rb36
-rw-r--r--spec/ruby/core/float/shared/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/float/shared/comparison_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/float/shared/equal.rb17
-rw-r--r--spec/ruby/core/float/shared/modulo.rb48
-rw-r--r--spec/ruby/core/float/shared/quo.rb59
-rw-r--r--spec/ruby/core/float/shared/to_i.rb10
-rw-r--r--spec/ruby/core/float/shared/to_s.rb308
-rw-r--r--spec/ruby/core/float/to_f_spec.rb9
-rw-r--r--spec/ruby/core/float/to_i_spec.rb6
-rw-r--r--spec/ruby/core/float/to_int_spec.rb6
-rw-r--r--spec/ruby/core/float/to_r_spec.rb5
-rw-r--r--spec/ruby/core/float/to_s_spec.rb6
-rw-r--r--spec/ruby/core/float/truncate_spec.rb14
-rw-r--r--spec/ruby/core/float/uminus_spec.rb28
-rw-r--r--spec/ruby/core/float/uplus_spec.rb9
-rw-r--r--spec/ruby/core/float/zero_spec.rb9
-rw-r--r--spec/ruby/core/gc/count_spec.rb17
-rw-r--r--spec/ruby/core/gc/disable_spec.rb18
-rw-r--r--spec/ruby/core/gc/enable_spec.rb13
-rw-r--r--spec/ruby/core/gc/garbage_collect_spec.rb15
-rw-r--r--spec/ruby/core/gc/profiler/clear_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/disable_spec.rb16
-rw-r--r--spec/ruby/core/gc/profiler/enable_spec.rb17
-rw-r--r--spec/ruby/core/gc/profiler/enabled_spec.rb21
-rw-r--r--spec/ruby/core/gc/profiler/report_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/result_spec.rb7
-rw-r--r--spec/ruby/core/gc/profiler/total_time_spec.rb7
-rw-r--r--spec/ruby/core/gc/start_spec.rb12
-rw-r--r--spec/ruby/core/gc/stat_spec.rb16
-rw-r--r--spec/ruby/core/gc/stress_spec.rb27
-rw-r--r--spec/ruby/core/hash/allocate_spec.rb15
-rw-r--r--spec/ruby/core/hash/any_spec.rb30
-rw-r--r--spec/ruby/core/hash/assoc_spec.rb50
-rw-r--r--spec/ruby/core/hash/clear_spec.rb32
-rw-r--r--spec/ruby/core/hash/clone_spec.rb12
-rw-r--r--spec/ruby/core/hash/compact_spec.rb59
-rw-r--r--spec/ruby/core/hash/compare_by_identity_spec.rb138
-rw-r--r--spec/ruby/core/hash/constructor_spec.rb123
-rw-r--r--spec/ruby/core/hash/deconstruct_keys_spec.rb25
-rw-r--r--spec/ruby/core/hash/default_proc_spec.rb80
-rw-r--r--spec/ruby/core/hash/default_spec.rb46
-rw-r--r--spec/ruby/core/hash/delete_if_spec.rb44
-rw-r--r--spec/ruby/core/hash/delete_spec.rb44
-rw-r--r--spec/ruby/core/hash/dig_spec.rb66
-rw-r--r--spec/ruby/core/hash/each_key_spec.rb23
-rw-r--r--spec/ruby/core/hash/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_value_spec.rb23
-rw-r--r--spec/ruby/core/hash/element_reference_spec.rb134
-rw-r--r--spec/ruby/core/hash/element_set_spec.rb7
-rw-r--r--spec/ruby/core/hash/empty_spec.rb15
-rw-r--r--spec/ruby/core/hash/eql_spec.rb9
-rw-r--r--spec/ruby/core/hash/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/hash/except_spec.rb34
-rw-r--r--spec/ruby/core/hash/fetch_spec.rb44
-rw-r--r--spec/ruby/core/hash/fetch_values_spec.rb35
-rw-r--r--spec/ruby/core/hash/filter_spec.rb12
-rw-r--r--spec/ruby/core/hash/fixtures/classes.rb75
-rw-r--r--spec/ruby/core/hash/fixtures/name.rb30
-rw-r--r--spec/ruby/core/hash/flatten_spec.rb62
-rw-r--r--spec/ruby/core/hash/gt_spec.rb42
-rw-r--r--spec/ruby/core/hash/gte_spec.rb42
-rw-r--r--spec/ruby/core/hash/has_key_spec.rb7
-rw-r--r--spec/ruby/core/hash/has_value_spec.rb7
-rw-r--r--spec/ruby/core/hash/hash_spec.rb44
-rw-r--r--spec/ruby/core/hash/include_spec.rb7
-rw-r--r--spec/ruby/core/hash/index_spec.rb9
-rw-r--r--spec/ruby/core/hash/initialize_spec.rb61
-rw-r--r--spec/ruby/core/hash/inspect_spec.rb7
-rw-r--r--spec/ruby/core/hash/invert_spec.rb27
-rw-r--r--spec/ruby/core/hash/keep_if_spec.rb37
-rw-r--r--spec/ruby/core/hash/key_spec.rb12
-rw-r--r--spec/ruby/core/hash/keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/length_spec.rb7
-rw-r--r--spec/ruby/core/hash/lt_spec.rb42
-rw-r--r--spec/ruby/core/hash/lte_spec.rb42
-rw-r--r--spec/ruby/core/hash/member_spec.rb7
-rw-r--r--spec/ruby/core/hash/merge_spec.rb102
-rw-r--r--spec/ruby/core/hash/new_spec.rb36
-rw-r--r--spec/ruby/core/hash/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/hash/rehash_spec.rb66
-rw-r--r--spec/ruby/core/hash/reject_spec.rb102
-rw-r--r--spec/ruby/core/hash/replace_spec.rb7
-rw-r--r--spec/ruby/core/hash/ruby2_keywords_hash_spec.rb47
-rw-r--r--spec/ruby/core/hash/select_spec.rb10
-rw-r--r--spec/ruby/core/hash/shared/comparison.rb15
-rw-r--r--spec/ruby/core/hash/shared/each.rb103
-rw-r--r--spec/ruby/core/hash/shared/eql.rb250
-rw-r--r--spec/ruby/core/hash/shared/equal.rb90
-rw-r--r--spec/ruby/core/hash/shared/greater_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/index.rb27
-rw-r--r--spec/ruby/core/hash/shared/iteration.rb19
-rw-r--r--spec/ruby/core/hash/shared/key.rb38
-rw-r--r--spec/ruby/core/hash/shared/length.rb12
-rw-r--r--spec/ruby/core/hash/shared/less_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/replace.rb51
-rw-r--r--spec/ruby/core/hash/shared/select.rb91
-rw-r--r--spec/ruby/core/hash/shared/store.rb115
-rw-r--r--spec/ruby/core/hash/shared/to_s.rb98
-rw-r--r--spec/ruby/core/hash/shared/update.rb78
-rw-r--r--spec/ruby/core/hash/shared/value.rb14
-rw-r--r--spec/ruby/core/hash/shared/values_at.rb9
-rw-r--r--spec/ruby/core/hash/shift_spec.rb79
-rw-r--r--spec/ruby/core/hash/size_spec.rb7
-rw-r--r--spec/ruby/core/hash/slice_spec.rb53
-rw-r--r--spec/ruby/core/hash/sort_spec.rb17
-rw-r--r--spec/ruby/core/hash/store_spec.rb7
-rw-r--r--spec/ruby/core/hash/to_a_spec.rb39
-rw-r--r--spec/ruby/core/hash/to_h_spec.rb74
-rw-r--r--spec/ruby/core/hash/to_hash_spec.rb14
-rw-r--r--spec/ruby/core/hash/to_proc_spec.rb99
-rw-r--r--spec/ruby/core/hash/to_s_spec.rb7
-rw-r--r--spec/ruby/core/hash/transform_keys_spec.rb140
-rw-r--r--spec/ruby/core/hash/transform_values_spec.rb97
-rw-r--r--spec/ruby/core/hash/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/hash/update_spec.rb7
-rw-r--r--spec/ruby/core/hash/value_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_at_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_spec.rb10
-rw-r--r--spec/ruby/core/integer/abs_spec.rb6
-rw-r--r--spec/ruby/core/integer/allbits_spec.rb37
-rw-r--r--spec/ruby/core/integer/anybits_spec.rb36
-rw-r--r--spec/ruby/core/integer/bit_and_spec.rb97
-rw-r--r--spec/ruby/core/integer/bit_length_spec.rb76
-rw-r--r--spec/ruby/core/integer/bit_or_spec.rb68
-rw-r--r--spec/ruby/core/integer/bit_xor_spec.rb72
-rw-r--r--spec/ruby/core/integer/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/integer/ceil_spec.rb19
-rw-r--r--spec/ruby/core/integer/chr_spec.rb256
-rw-r--r--spec/ruby/core/integer/coerce_spec.rb104
-rw-r--r--spec/ruby/core/integer/comparison_spec.rb177
-rw-r--r--spec/ruby/core/integer/complement_spec.rb20
-rw-r--r--spec/ruby/core/integer/constants_spec.rb27
-rw-r--r--spec/ruby/core/integer/denominator_spec.rb20
-rw-r--r--spec/ruby/core/integer/digits_spec.rb32
-rw-r--r--spec/ruby/core/integer/div_spec.rb146
-rw-r--r--spec/ruby/core/integer/divide_spec.rb89
-rw-r--r--spec/ruby/core/integer/divmod_spec.rb117
-rw-r--r--spec/ruby/core/integer/downto_spec.rb69
-rw-r--r--spec/ruby/core/integer/dup_spec.rb13
-rw-r--r--spec/ruby/core/integer/element_reference_spec.rb196
-rw-r--r--spec/ruby/core/integer/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/integer/even_spec.rb40
-rw-r--r--spec/ruby/core/integer/exponent_spec.rb7
-rw-r--r--spec/ruby/core/integer/fdiv_spec.rb49
-rw-r--r--spec/ruby/core/integer/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/integer/floor_spec.rb19
-rw-r--r--spec/ruby/core/integer/gcd_spec.rb69
-rw-r--r--spec/ruby/core/integer/gcdlcm_spec.rb53
-rw-r--r--spec/ruby/core/integer/gt_spec.rb43
-rw-r--r--spec/ruby/core/integer/gte_spec.rb43
-rw-r--r--spec/ruby/core/integer/integer_spec.rb20
-rw-r--r--spec/ruby/core/integer/lcm_spec.rb58
-rw-r--r--spec/ruby/core/integer/left_shift_spec.rb168
-rw-r--r--spec/ruby/core/integer/lt_spec.rb45
-rw-r--r--spec/ruby/core/integer/lte_spec.rb53
-rw-r--r--spec/ruby/core/integer/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/integer/minus_spec.rb43
-rw-r--r--spec/ruby/core/integer/modulo_spec.rb10
-rw-r--r--spec/ruby/core/integer/multiply_spec.rb45
-rw-r--r--spec/ruby/core/integer/next_spec.rb6
-rw-r--r--spec/ruby/core/integer/nobits_spec.rb36
-rw-r--r--spec/ruby/core/integer/numerator_spec.rb18
-rw-r--r--spec/ruby/core/integer/odd_spec.rb38
-rw-r--r--spec/ruby/core/integer/ord_spec.rb17
-rw-r--r--spec/ruby/core/integer/plus_spec.rb43
-rw-r--r--spec/ruby/core/integer/pow_spec.rb51
-rw-r--r--spec/ruby/core/integer/pred_spec.rb11
-rw-r--r--spec/ruby/core/integer/rationalize_spec.rb39
-rw-r--r--spec/ruby/core/integer/remainder_spec.rb51
-rw-r--r--spec/ruby/core/integer/right_shift_spec.rb194
-rw-r--r--spec/ruby/core/integer/round_spec.rb83
-rw-r--r--spec/ruby/core/integer/shared/abs.rb18
-rw-r--r--spec/ruby/core/integer/shared/arithmetic_coerce.rb31
-rw-r--r--spec/ruby/core/integer/shared/comparison_coerce.rb11
-rw-r--r--spec/ruby/core/integer/shared/equal.rb58
-rw-r--r--spec/ruby/core/integer/shared/exponent.rb118
-rw-r--r--spec/ruby/core/integer/shared/integer_rounding.rb19
-rw-r--r--spec/ruby/core/integer/shared/modulo.rb74
-rw-r--r--spec/ruby/core/integer/shared/next.rb25
-rw-r--r--spec/ruby/core/integer/shared/to_i.rb8
-rw-r--r--spec/ruby/core/integer/size_spec.rb34
-rw-r--r--spec/ruby/core/integer/sqrt_spec.rb31
-rw-r--r--spec/ruby/core/integer/succ_spec.rb6
-rw-r--r--spec/ruby/core/integer/times_spec.rb79
-rw-r--r--spec/ruby/core/integer/to_f_spec.rb23
-rw-r--r--spec/ruby/core/integer/to_i_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_int_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_r_spec.rb26
-rw-r--r--spec/ruby/core/integer/to_s_spec.rb95
-rw-r--r--spec/ruby/core/integer/truncate_spec.rb19
-rw-r--r--spec/ruby/core/integer/uminus_spec.rb30
-rw-r--r--spec/ruby/core/integer/upto_spec.rb69
-rw-r--r--spec/ruby/core/io/advise_spec.rb96
-rw-r--r--spec/ruby/core/io/binmode_spec.rb60
-rw-r--r--spec/ruby/core/io/binread_spec.rb47
-rw-r--r--spec/ruby/core/io/binwrite_spec.rb6
-rw-r--r--spec/ruby/core/io/bytes_spec.rb45
-rw-r--r--spec/ruby/core/io/chars_spec.rb14
-rw-r--r--spec/ruby/core/io/close_on_exec_spec.rb80
-rw-r--r--spec/ruby/core/io/close_read_spec.rb60
-rw-r--r--spec/ruby/core/io/close_spec.rb95
-rw-r--r--spec/ruby/core/io/close_write_spec.rb64
-rw-r--r--spec/ruby/core/io/closed_spec.rb20
-rw-r--r--spec/ruby/core/io/codepoints_spec.rb28
-rw-r--r--spec/ruby/core/io/constants_spec.rb19
-rw-r--r--spec/ruby/core/io/copy_stream_spec.rb322
-rw-r--r--spec/ruby/core/io/dup_spec.rb87
-rw-r--r--spec/ruby/core/io/each_byte_spec.rb57
-rw-r--r--spec/ruby/core/io/each_char_spec.rb12
-rw-r--r--spec/ruby/core/io/each_codepoint_spec.rb43
-rw-r--r--spec/ruby/core/io/each_line_spec.rb11
-rw-r--r--spec/ruby/core/io/each_spec.rb11
-rw-r--r--spec/ruby/core/io/eof_spec.rb107
-rw-r--r--spec/ruby/core/io/external_encoding_spec.rb216
-rw-r--r--spec/ruby/core/io/fcntl_spec.rb8
-rw-r--r--spec/ruby/core/io/fdatasync_spec.rb5
-rw-r--r--spec/ruby/core/io/fileno_spec.rb12
-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16BE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16LE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32BE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32LE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/classes.rb189
-rw-r--r--spec/ruby/core/io/fixtures/copy_in_out.rb2
-rw-r--r--spec/ruby/core/io/fixtures/copy_stream.txt6
-rw-r--r--spec/ruby/core/io/fixtures/empty.txt0
-rw-r--r--spec/ruby/core/io/fixtures/incomplete.txt1
-rw-r--r--spec/ruby/core/io/fixtures/lines.txt9
-rw-r--r--spec/ruby/core/io/fixtures/no_bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/numbered_lines.txt5
-rw-r--r--spec/ruby/core/io/fixtures/one_byte.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_binary.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_euc_jp.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_text.txt1
-rw-r--r--spec/ruby/core/io/fixtures/reopen_stdout.rb3
-rw-r--r--spec/ruby/core/io/flush_spec.rb37
-rw-r--r--spec/ruby/core/io/for_fd_spec.rb10
-rw-r--r--spec/ruby/core/io/foreach_spec.rb81
-rw-r--r--spec/ruby/core/io/fsync_spec.rb24
-rw-r--r--spec/ruby/core/io/getbyte_spec.rb42
-rw-r--r--spec/ruby/core/io/getc_spec.rb42
-rw-r--r--spec/ruby/core/io/gets_spec.rb327
-rw-r--r--spec/ruby/core/io/initialize_spec.rb49
-rw-r--r--spec/ruby/core/io/inspect_spec.rb23
-rw-r--r--spec/ruby/core/io/internal_encoding_spec.rb138
-rw-r--r--spec/ruby/core/io/io_spec.rb11
-rw-r--r--spec/ruby/core/io/ioctl_spec.rb32
-rw-r--r--spec/ruby/core/io/isatty_spec.rb6
-rw-r--r--spec/ruby/core/io/lineno_spec.rb95
-rw-r--r--spec/ruby/core/io/lines_spec.rb44
-rw-r--r--spec/ruby/core/io/new_spec.rb10
-rw-r--r--spec/ruby/core/io/open_spec.rb86
-rw-r--r--spec/ruby/core/io/output_spec.rb27
-rw-r--r--spec/ruby/core/io/pid_spec.rb35
-rw-r--r--spec/ruby/core/io/pipe_spec.rb214
-rw-r--r--spec/ruby/core/io/popen_spec.rb271
-rw-r--r--spec/ruby/core/io/pos_spec.rb11
-rw-r--r--spec/ruby/core/io/pread_spec.rb50
-rw-r--r--spec/ruby/core/io/print_spec.rb53
-rw-r--r--spec/ruby/core/io/printf_spec.rb32
-rw-r--r--spec/ruby/core/io/putc_spec.rb11
-rw-r--r--spec/ruby/core/io/puts_spec.rb139
-rw-r--r--spec/ruby/core/io/pwrite_spec.rb43
-rw-r--r--spec/ruby/core/io/read_nonblock_spec.rb99
-rw-r--r--spec/ruby/core/io/read_spec.rb616
-rw-r--r--spec/ruby/core/io/readbyte_spec.rb24
-rw-r--r--spec/ruby/core/io/readchar_spec.rb44
-rw-r--r--spec/ruby/core/io/readline_spec.rb51
-rw-r--r--spec/ruby/core/io/readlines_spec.rb210
-rw-r--r--spec/ruby/core/io/readpartial_spec.rb96
-rw-r--r--spec/ruby/core/io/reopen_spec.rb313
-rw-r--r--spec/ruby/core/io/rewind_spec.rb38
-rw-r--r--spec/ruby/core/io/seek_spec.rb79
-rw-r--r--spec/ruby/core/io/select_spec.rb120
-rw-r--r--spec/ruby/core/io/set_encoding_by_bom_spec.rb57
-rw-r--r--spec/ruby/core/io/set_encoding_spec.rb191
-rw-r--r--spec/ruby/core/io/shared/binwrite.rb78
-rw-r--r--spec/ruby/core/io/shared/chars.rb73
-rw-r--r--spec/ruby/core/io/shared/codepoints.rb54
-rw-r--r--spec/ruby/core/io/shared/each.rb183
-rw-r--r--spec/ruby/core/io/shared/gets_ascii.rb19
-rw-r--r--spec/ruby/core/io/shared/new.rb402
-rw-r--r--spec/ruby/core/io/shared/pos.rb72
-rw-r--r--spec/ruby/core/io/shared/readlines.rb209
-rw-r--r--spec/ruby/core/io/shared/tty.rb24
-rw-r--r--spec/ruby/core/io/shared/write.rb109
-rw-r--r--spec/ruby/core/io/stat_spec.rb24
-rw-r--r--spec/ruby/core/io/sync_spec.rb64
-rw-r--r--spec/ruby/core/io/sysopen_spec.rb50
-rw-r--r--spec/ruby/core/io/sysread_spec.rb98
-rw-r--r--spec/ruby/core/io/sysseek_spec.rb44
-rw-r--r--spec/ruby/core/io/syswrite_spec.rb71
-rw-r--r--spec/ruby/core/io/tell_spec.rb7
-rw-r--r--spec/ruby/core/io/to_i_spec.rb12
-rw-r--r--spec/ruby/core/io/to_io_spec.rb21
-rw-r--r--spec/ruby/core/io/try_convert_spec.rb49
-rw-r--r--spec/ruby/core/io/tty_spec.rb6
-rw-r--r--spec/ruby/core/io/ungetbyte_spec.rb77
-rw-r--r--spec/ruby/core/io/ungetc_spec.rb148
-rw-r--r--spec/ruby/core/io/write_nonblock_spec.rb85
-rw-r--r--spec/ruby/core/io/write_spec.rb164
-rw-r--r--spec/ruby/core/kernel/Array_spec.rb97
-rw-r--r--spec/ruby/core/kernel/Complex_spec.rb187
-rw-r--r--spec/ruby/core/kernel/Float_spec.rb347
-rw-r--r--spec/ruby/core/kernel/Hash_spec.rb63
-rw-r--r--spec/ruby/core/kernel/Integer_spec.rb818
-rw-r--r--spec/ruby/core/kernel/Rational_spec.rb6
-rw-r--r--spec/ruby/core/kernel/String_spec.rb106
-rw-r--r--spec/ruby/core/kernel/__callee___spec.rb48
-rw-r--r--spec/ruby/core/kernel/__dir___spec.rb37
-rw-r--r--spec/ruby/core/kernel/__method___spec.rb40
-rw-r--r--spec/ruby/core/kernel/abort_spec.rb15
-rw-r--r--spec/ruby/core/kernel/at_exit_spec.rb69
-rw-r--r--spec/ruby/core/kernel/autoload_spec.rb160
-rw-r--r--spec/ruby/core/kernel/backtick_spec.rb84
-rw-r--r--spec/ruby/core/kernel/binding_spec.rb51
-rw-r--r--spec/ruby/core/kernel/block_given_spec.rb38
-rw-r--r--spec/ruby/core/kernel/caller_locations_spec.rb80
-rw-r--r--spec/ruby/core/kernel/caller_spec.rb66
-rw-r--r--spec/ruby/core/kernel/case_compare_spec.rb135
-rw-r--r--spec/ruby/core/kernel/catch_spec.rb127
-rw-r--r--spec/ruby/core/kernel/chomp_spec.rb65
-rw-r--r--spec/ruby/core/kernel/chop_spec.rb53
-rw-r--r--spec/ruby/core/kernel/class_spec.rb26
-rw-r--r--spec/ruby/core/kernel/clone_spec.rb128
-rw-r--r--spec/ruby/core/kernel/comparison_spec.rb31
-rw-r--r--spec/ruby/core/kernel/define_singleton_method_spec.rb99
-rw-r--r--spec/ruby/core/kernel/display_spec.rb6
-rw-r--r--spec/ruby/core/kernel/dup_spec.rb67
-rw-r--r--spec/ruby/core/kernel/enum_for_spec.rb5
-rw-r--r--spec/ruby/core/kernel/eql_spec.rb10
-rw-r--r--spec/ruby/core/kernel/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/kernel/eval_spec.rb416
-rw-r--r--spec/ruby/core/kernel/exec_spec.rb18
-rw-r--r--spec/ruby/core/kernel/exit_spec.rb27
-rw-r--r--spec/ruby/core/kernel/extend_spec.rb79
-rw-r--r--spec/ruby/core/kernel/fail_spec.rb42
-rw-r--r--spec/ruby/core/kernel/fixtures/__callee__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/__dir__.rb2
-rw-r--r--spec/ruby/core/kernel/fixtures/__method__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/at_exit.rb3
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_b.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_d.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module2.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_frozen.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_at_exit.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_locations.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/classes.rb492
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_locals.rb6
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_with_lambda.rb12
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_without_lambda.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/singleton_methods.rb13
-rw-r--r--spec/ruby/core/kernel/fixtures/test.rb362
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_core_method.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_require.rb1
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_require_caller.rb2
-rw-r--r--spec/ruby/core/kernel/fork_spec.rb15
-rw-r--r--spec/ruby/core/kernel/format_spec.rb14
-rw-r--r--spec/ruby/core/kernel/freeze_spec.rb91
-rw-r--r--spec/ruby/core/kernel/frozen_spec.rb76
-rw-r--r--spec/ruby/core/kernel/gets_spec.rb17
-rw-r--r--spec/ruby/core/kernel/global_variables_spec.rb26
-rw-r--r--spec/ruby/core/kernel/gsub_spec.rb96
-rw-r--r--spec/ruby/core/kernel/initialize_copy_spec.rb29
-rw-r--r--spec/ruby/core/kernel/inspect_spec.rb33
-rw-r--r--spec/ruby/core/kernel/instance_of_spec.rb40
-rw-r--r--spec/ruby/core/kernel/instance_variable_defined_spec.rb41
-rw-r--r--spec/ruby/core/kernel/instance_variable_get_spec.rb105
-rw-r--r--spec/ruby/core/kernel/instance_variable_set_spec.rb93
-rw-r--r--spec/ruby/core/kernel/instance_variables_spec.rb29
-rw-r--r--spec/ruby/core/kernel/is_a_spec.rb6
-rw-r--r--spec/ruby/core/kernel/iterator_spec.rb14
-rw-r--r--spec/ruby/core/kernel/itself_spec.rb9
-rw-r--r--spec/ruby/core/kernel/kind_of_spec.rb6
-rw-r--r--spec/ruby/core/kernel/lambda_spec.rb126
-rw-r--r--spec/ruby/core/kernel/load_spec.rb40
-rw-r--r--spec/ruby/core/kernel/local_variables_spec.rb48
-rw-r--r--spec/ruby/core/kernel/loop_spec.rb79
-rw-r--r--spec/ruby/core/kernel/match_spec.rb24
-rw-r--r--spec/ruby/core/kernel/method_spec.rb37
-rw-r--r--spec/ruby/core/kernel/methods_spec.rb101
-rw-r--r--spec/ruby/core/kernel/nil_spec.rb6
-rw-r--r--spec/ruby/core/kernel/not_match_spec.rb21
-rw-r--r--spec/ruby/core/kernel/object_id_spec.rb6
-rw-r--r--spec/ruby/core/kernel/open_spec.rb144
-rw-r--r--spec/ruby/core/kernel/p_spec.rb87
-rw-r--r--spec/ruby/core/kernel/pp_spec.rb9
-rw-r--r--spec/ruby/core/kernel/print_spec.rb12
-rw-r--r--spec/ruby/core/kernel/printf_spec.rb63
-rw-r--r--spec/ruby/core/kernel/private_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/proc_spec.rb66
-rw-r--r--spec/ruby/core/kernel/protected_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/public_method_spec.rb32
-rw-r--r--spec/ruby/core/kernel/public_methods_spec.rb76
-rw-r--r--spec/ruby/core/kernel/public_send_spec.rb108
-rw-r--r--spec/ruby/core/kernel/putc_spec.rb39
-rw-r--r--spec/ruby/core/kernel/puts_spec.rb29
-rw-r--r--spec/ruby/core/kernel/raise_spec.rb38
-rw-r--r--spec/ruby/core/kernel/rand_spec.rb155
-rw-r--r--spec/ruby/core/kernel/readline_spec.rb12
-rw-r--r--spec/ruby/core/kernel/readlines_spec.rb12
-rw-r--r--spec/ruby/core/kernel/remove_instance_variable_spec.rb59
-rw-r--r--spec/ruby/core/kernel/require_relative_spec.rb437
-rw-r--r--spec/ruby/core/kernel/require_spec.rb34
-rw-r--r--spec/ruby/core/kernel/respond_to_missing_spec.rb100
-rw-r--r--spec/ruby/core/kernel/respond_to_spec.rb72
-rw-r--r--spec/ruby/core/kernel/select_spec.rb18
-rw-r--r--spec/ruby/core/kernel/send_spec.rb68
-rw-r--r--spec/ruby/core/kernel/set_trace_func_spec.rb12
-rw-r--r--spec/ruby/core/kernel/shared/dup_clone.rb115
-rw-r--r--spec/ruby/core/kernel/shared/kind_of.rb55
-rw-r--r--spec/ruby/core/kernel/shared/lambda.rb11
-rw-r--r--spec/ruby/core/kernel/shared/load.rb172
-rw-r--r--spec/ruby/core/kernel/shared/method.rb50
-rw-r--r--spec/ruby/core/kernel/shared/require.rb776
-rw-r--r--spec/ruby/core/kernel/shared/sprintf.rb887
-rw-r--r--spec/ruby/core/kernel/shared/sprintf_encoding.rb36
-rw-r--r--spec/ruby/core/kernel/shared/then.rb20
-rw-r--r--spec/ruby/core/kernel/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/kernel/singleton_method_spec.rb41
-rw-r--r--spec/ruby/core/kernel/singleton_methods_spec.rb192
-rw-r--r--spec/ruby/core/kernel/sleep_spec.rb56
-rw-r--r--spec/ruby/core/kernel/spawn_spec.rb25
-rw-r--r--spec/ruby/core/kernel/sprintf_spec.rb24
-rw-r--r--spec/ruby/core/kernel/srand_spec.rb65
-rw-r--r--spec/ruby/core/kernel/sub_spec.rb26
-rw-r--r--spec/ruby/core/kernel/syscall_spec.rb12
-rw-r--r--spec/ruby/core/kernel/system_spec.rb117
-rw-r--r--spec/ruby/core/kernel/taint_spec.rb62
-rw-r--r--spec/ruby/core/kernel/tainted_spec.rb31
-rw-r--r--spec/ruby/core/kernel/tap_spec.rb13
-rw-r--r--spec/ruby/core/kernel/test_spec.rb109
-rw-r--r--spec/ruby/core/kernel/then_spec.rb8
-rw-r--r--spec/ruby/core/kernel/throw_spec.rb80
-rw-r--r--spec/ruby/core/kernel/to_enum_spec.rb5
-rw-r--r--spec/ruby/core/kernel/to_s_spec.rb18
-rw-r--r--spec/ruby/core/kernel/trace_var_spec.rb54
-rw-r--r--spec/ruby/core/kernel/trap_spec.rb12
-rw-r--r--spec/ruby/core/kernel/trust_spec.rb43
-rw-r--r--spec/ruby/core/kernel/untaint_spec.rb43
-rw-r--r--spec/ruby/core/kernel/untrace_var_spec.rb12
-rw-r--r--spec/ruby/core/kernel/untrust_spec.rb42
-rw-r--r--spec/ruby/core/kernel/untrusted_spec.rb46
-rw-r--r--spec/ruby/core/kernel/warn_spec.rb247
-rw-r--r--spec/ruby/core/kernel/yield_self_spec.rb6
-rw-r--r--spec/ruby/core/main/define_method_spec.rb28
-rw-r--r--spec/ruby/core/main/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement.rb7
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement_user.rb11
-rw-r--r--spec/ruby/core/main/fixtures/wrapped_include.rb1
-rw-r--r--spec/ruby/core/main/include_spec.rb16
-rw-r--r--spec/ruby/core/main/private_spec.rb44
-rw-r--r--spec/ruby/core/main/public_spec.rb44
-rw-r--r--spec/ruby/core/main/to_s_spec.rb7
-rw-r--r--spec/ruby/core/main/using_spec.rb132
-rw-r--r--spec/ruby/core/marshal/dump_spec.rb614
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_data.rb420
-rw-r--r--spec/ruby/core/marshal/fixtures/random.dumpbin0 -> 2520 bytes-rw-r--r--spec/ruby/core/marshal/float_spec.rb77
-rw-r--r--spec/ruby/core/marshal/load_spec.rb6
-rw-r--r--spec/ruby/core/marshal/major_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/minor_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/restore_spec.rb6
-rw-r--r--spec/ruby/core/marshal/shared/load.rb931
-rw-r--r--spec/ruby/core/matchdata/allocate_spec.rb10
-rw-r--r--spec/ruby/core/matchdata/begin_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/captures_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/dup_spec.rb14
-rw-r--r--spec/ruby/core/matchdata/element_reference_spec.rb87
-rw-r--r--spec/ruby/core/matchdata/end_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/eql_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/hash_spec.rb5
-rw-r--r--spec/ruby/core/matchdata/inspect_spec.rb23
-rw-r--r--spec/ruby/core/matchdata/length_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/named_captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/names_spec.rb33
-rw-r--r--spec/ruby/core/matchdata/offset_spec.rb30
-rw-r--r--spec/ruby/core/matchdata/post_match_spec.rb36
-rw-r--r--spec/ruby/core/matchdata/pre_match_spec.rb36
-rw-r--r--spec/ruby/core/matchdata/regexp_spec.rb24
-rw-r--r--spec/ruby/core/matchdata/shared/eql.rb26
-rw-r--r--spec/ruby/core/matchdata/shared/length.rb5
-rw-r--r--spec/ruby/core/matchdata/size_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/string_spec.rb25
-rw-r--r--spec/ruby/core/matchdata/to_a_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/to_s_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/values_at_spec.rb21
-rw-r--r--spec/ruby/core/math/acos_spec.rb56
-rw-r--r--spec/ruby/core/math/acosh_spec.rb41
-rw-r--r--spec/ruby/core/math/asin_spec.rb48
-rw-r--r--spec/ruby/core/math/asinh_spec.rb42
-rw-r--r--spec/ruby/core/math/atan2_spec.rb54
-rw-r--r--spec/ruby/core/math/atan_spec.rb40
-rw-r--r--spec/ruby/core/math/atanh_spec.rb14
-rw-r--r--spec/ruby/core/math/cbrt_spec.rb27
-rw-r--r--spec/ruby/core/math/constants_spec.rb22
-rw-r--r--spec/ruby/core/math/cos_spec.rb42
-rw-r--r--spec/ruby/core/math/cosh_spec.rb37
-rw-r--r--spec/ruby/core/math/erf_spec.rb44
-rw-r--r--spec/ruby/core/math/erfc_spec.rb43
-rw-r--r--spec/ruby/core/math/exp_spec.rb37
-rw-r--r--spec/ruby/core/math/fixtures/classes.rb28
-rw-r--r--spec/ruby/core/math/frexp_spec.rb37
-rw-r--r--spec/ruby/core/math/gamma_spec.rb69
-rw-r--r--spec/ruby/core/math/hypot_spec.rb41
-rw-r--r--spec/ruby/core/math/ldexp_spec.rb54
-rw-r--r--spec/ruby/core/math/lgamma_spec.rb54
-rw-r--r--spec/ruby/core/math/log10_spec.rb43
-rw-r--r--spec/ruby/core/math/log2_spec.rb41
-rw-r--r--spec/ruby/core/math/log_spec.rb57
-rw-r--r--spec/ruby/core/math/sin_spec.rb39
-rw-r--r--spec/ruby/core/math/sinh_spec.rb37
-rw-r--r--spec/ruby/core/math/sqrt_spec.rb36
-rw-r--r--spec/ruby/core/math/tan_spec.rb42
-rw-r--r--spec/ruby/core/math/tanh_spec.rb39
-rw-r--r--spec/ruby/core/method/arity_spec.rb222
-rw-r--r--spec/ruby/core/method/call_spec.rb7
-rw-r--r--spec/ruby/core/method/case_compare_spec.rb7
-rw-r--r--spec/ruby/core/method/clone_spec.rb14
-rw-r--r--spec/ruby/core/method/compose_spec.rb102
-rw-r--r--spec/ruby/core/method/curry_spec.rb36
-rw-r--r--spec/ruby/core/method/element_reference_spec.rb7
-rw-r--r--spec/ruby/core/method/eql_spec.rb6
-rw-r--r--spec/ruby/core/method/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/method/fixtures/classes.rb216
-rw-r--r--spec/ruby/core/method/hash_spec.rb15
-rw-r--r--spec/ruby/core/method/inspect_spec.rb6
-rw-r--r--spec/ruby/core/method/name_spec.rb22
-rw-r--r--spec/ruby/core/method/original_name_spec.rb22
-rw-r--r--spec/ruby/core/method/owner_spec.rb26
-rw-r--r--spec/ruby/core/method/parameters_spec.rb261
-rw-r--r--spec/ruby/core/method/receiver_spec.rb22
-rw-r--r--spec/ruby/core/method/shared/call.rb51
-rw-r--r--spec/ruby/core/method/shared/eql.rb94
-rw-r--r--spec/ruby/core/method/shared/to_s.rb81
-rw-r--r--spec/ruby/core/method/source_location_spec.rb113
-rw-r--r--spec/ruby/core/method/super_method_spec.rb45
-rw-r--r--spec/ruby/core/method/to_proc_spec.rb104
-rw-r--r--spec/ruby/core/method/to_s_spec.rb6
-rw-r--r--spec/ruby/core/method/unbind_spec.rb37
-rw-r--r--spec/ruby/core/module/alias_method_spec.rb173
-rw-r--r--spec/ruby/core/module/allocate_spec.rb14
-rw-r--r--spec/ruby/core/module/ancestors_spec.rb70
-rw-r--r--spec/ruby/core/module/append_features_spec.rb75
-rw-r--r--spec/ruby/core/module/attr_accessor_spec.rb106
-rw-r--r--spec/ruby/core/module/attr_reader_spec.rb80
-rw-r--r--spec/ruby/core/module/attr_spec.rb168
-rw-r--r--spec/ruby/core/module/attr_writer_spec.rb80
-rw-r--r--spec/ruby/core/module/autoload_spec.rb942
-rw-r--r--spec/ruby/core/module/case_compare_spec.rb31
-rw-r--r--spec/ruby/core/module/class_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/class_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/class_variable_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/class_variable_get_spec.rb76
-rw-r--r--spec/ruby/core/module/class_variable_set_spec.rb62
-rw-r--r--spec/ruby/core/module/class_variables_spec.rb26
-rw-r--r--spec/ruby/core/module/comparison_spec.rb36
-rw-r--r--spec/ruby/core/module/const_defined_spec.rb144
-rw-r--r--spec/ruby/core/module/const_get_spec.rb229
-rw-r--r--spec/ruby/core/module/const_missing_spec.rb36
-rw-r--r--spec/ruby/core/module/const_set_spec.rb143
-rw-r--r--spec/ruby/core/module/const_source_location_spec.rb220
-rw-r--r--spec/ruby/core/module/constants_spec.rb91
-rw-r--r--spec/ruby/core/module/define_method_spec.rb671
-rw-r--r--spec/ruby/core/module/define_singleton_method_spec.rb15
-rw-r--r--spec/ruby/core/module/deprecate_constant_spec.rb50
-rw-r--r--spec/ruby/core/module/eql_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/module/extend_object_spec.rb70
-rw-r--r--spec/ruby/core/module/extended_spec.rb44
-rw-r--r--spec/ruby/core/module/fixtures/autoload.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_abc.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_c.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_callback.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_concur.rb9
-rw-r--r--spec/ruby/core/module/fixtures/autoload_d.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_autoload.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require_current_file.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_e.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_empty.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_ex1.rb16
-rw-r--r--spec/ruby/core/module/fixtures/autoload_exception.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_f.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_g.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_h.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_i.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_j.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_k.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_lm.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_location.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_nested.rb8
-rw-r--r--spec/ruby/core/module/fixtures/autoload_never_set.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_o.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_overridden.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_r.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_raise.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_nested.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_no_constant.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_s.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_self_during_require.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_subclass.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_t.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_v.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w2.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_x.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_z.rb5
-rw-r--r--spec/ruby/core/module/fixtures/classes.rb614
-rw-r--r--spec/ruby/core/module/fixtures/constant_unicode.rb5
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload.rb6
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_a.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_b.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_c.rb3
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_d.rb4
-rw-r--r--spec/ruby/core/module/fixtures/module.rb4
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo.rb6
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo/bar_baz.rb11
-rw-r--r--spec/ruby/core/module/fixtures/name.rb10
-rw-r--r--spec/ruby/core/module/fixtures/path1/load_path.rb9
-rw-r--r--spec/ruby/core/module/fixtures/path2/load_path.rb1
-rw-r--r--spec/ruby/core/module/fixtures/refine.rb25
-rw-r--r--spec/ruby/core/module/fixtures/repeated_concurrent_autoload.rb8
-rw-r--r--spec/ruby/core/module/freeze_spec.rb6
-rw-r--r--spec/ruby/core/module/gt_spec.rb36
-rw-r--r--spec/ruby/core/module/gte_spec.rb33
-rw-r--r--spec/ruby/core/module/include_spec.rb258
-rw-r--r--spec/ruby/core/module/included_modules_spec.rb12
-rw-r--r--spec/ruby/core/module/included_spec.rb44
-rw-r--r--spec/ruby/core/module/initialize_copy_spec.rb18
-rw-r--r--spec/ruby/core/module/initialize_spec.rb18
-rw-r--r--spec/ruby/core/module/instance_method_spec.rb85
-rw-r--r--spec/ruby/core/module/instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/lt_spec.rb36
-rw-r--r--spec/ruby/core/module/lte_spec.rb33
-rw-r--r--spec/ruby/core/module/method_added_spec.rb83
-rw-r--r--spec/ruby/core/module/method_defined_spec.rb100
-rw-r--r--spec/ruby/core/module/method_removed_spec.rb33
-rw-r--r--spec/ruby/core/module/method_undefined_spec.rb33
-rw-r--r--spec/ruby/core/module/module_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/module_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/module_function_spec.rb269
-rw-r--r--spec/ruby/core/module/name_spec.rb144
-rw-r--r--spec/ruby/core/module/nesting_spec.rb31
-rw-r--r--spec/ruby/core/module/new_spec.rb31
-rw-r--r--spec/ruby/core/module/prepend_features_spec.rb78
-rw-r--r--spec/ruby/core/module/prepend_spec.rb378
-rw-r--r--spec/ruby/core/module/prepended_spec.rb25
-rw-r--r--spec/ruby/core/module/private_class_method_spec.rb81
-rw-r--r--spec/ruby/core/module/private_constant_spec.rb32
-rw-r--r--spec/ruby/core/module/private_instance_methods_spec.rb54
-rw-r--r--spec/ruby/core/module/private_method_defined_spec.rb122
-rw-r--r--spec/ruby/core/module/private_spec.rb93
-rw-r--r--spec/ruby/core/module/protected_instance_methods_spec.rb57
-rw-r--r--spec/ruby/core/module/protected_method_defined_spec.rb122
-rw-r--r--spec/ruby/core/module/protected_spec.rb55
-rw-r--r--spec/ruby/core/module/public_class_method_spec.rb80
-rw-r--r--spec/ruby/core/module/public_constant_spec.rb38
-rw-r--r--spec/ruby/core/module/public_instance_method_spec.rb65
-rw-r--r--spec/ruby/core/module/public_instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/public_method_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/public_spec.rb44
-rw-r--r--spec/ruby/core/module/refine_spec.rb1128
-rw-r--r--spec/ruby/core/module/remove_class_variable_spec.rb44
-rw-r--r--spec/ruby/core/module/remove_const_spec.rb84
-rw-r--r--spec/ruby/core/module/remove_method_spec.rb109
-rw-r--r--spec/ruby/core/module/shared/class_eval.rb159
-rw-r--r--spec/ruby/core/module/shared/class_exec.rb29
-rw-r--r--spec/ruby/core/module/shared/equal_value.rb14
-rw-r--r--spec/ruby/core/module/shared/set_visibility.rb186
-rw-r--r--spec/ruby/core/module/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/module/to_s_spec.rb45
-rw-r--r--spec/ruby/core/module/undef_method_spec.rb181
-rw-r--r--spec/ruby/core/module/using_spec.rb377
-rw-r--r--spec/ruby/core/mutex/lock_spec.rb34
-rw-r--r--spec/ruby/core/mutex/locked_spec.rb36
-rw-r--r--spec/ruby/core/mutex/owned_spec.rb55
-rw-r--r--spec/ruby/core/mutex/sleep_spec.rb103
-rw-r--r--spec/ruby/core/mutex/synchronize_spec.rb66
-rw-r--r--spec/ruby/core/mutex/try_lock_spec.rb32
-rw-r--r--spec/ruby/core/mutex/unlock_spec.rb38
-rw-r--r--spec/ruby/core/nil/and_spec.rb11
-rw-r--r--spec/ruby/core/nil/case_compare_spec.rb13
-rw-r--r--spec/ruby/core/nil/dup_spec.rb7
-rw-r--r--spec/ruby/core/nil/inspect_spec.rb7
-rw-r--r--spec/ruby/core/nil/match_spec.rb23
-rw-r--r--spec/ruby/core/nil/nil_spec.rb7
-rw-r--r--spec/ruby/core/nil/nilclass_spec.rb15
-rw-r--r--spec/ruby/core/nil/or_spec.rb11
-rw-r--r--spec/ruby/core/nil/rationalize_spec.rb16
-rw-r--r--spec/ruby/core/nil/to_a_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_c_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_f_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_h_spec.rb8
-rw-r--r--spec/ruby/core/nil/to_i_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_r_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_s_spec.rb17
-rw-r--r--spec/ruby/core/nil/xor_spec.rb11
-rw-r--r--spec/ruby/core/numeric/abs2_spec.rb34
-rw-r--r--spec/ruby/core/numeric/abs_spec.rb6
-rw-r--r--spec/ruby/core/numeric/angle_spec.rb6
-rw-r--r--spec/ruby/core/numeric/arg_spec.rb6
-rw-r--r--spec/ruby/core/numeric/ceil_spec.rb15
-rw-r--r--spec/ruby/core/numeric/clone_spec.rb25
-rw-r--r--spec/ruby/core/numeric/coerce_spec.rb59
-rw-r--r--spec/ruby/core/numeric/comparison_spec.rb48
-rw-r--r--spec/ruby/core/numeric/conj_spec.rb6
-rw-r--r--spec/ruby/core/numeric/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/numeric/denominator_spec.rb24
-rw-r--r--spec/ruby/core/numeric/div_spec.rb22
-rw-r--r--spec/ruby/core/numeric/divmod_spec.rb15
-rw-r--r--spec/ruby/core/numeric/dup_spec.rb16
-rw-r--r--spec/ruby/core/numeric/eql_spec.rb22
-rw-r--r--spec/ruby/core/numeric/fdiv_spec.rb32
-rw-r--r--spec/ruby/core/numeric/finite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/fixtures/classes.rb17
-rw-r--r--spec/ruby/core/numeric/floor_spec.rb14
-rw-r--r--spec/ruby/core/numeric/i_spec.rb15
-rw-r--r--spec/ruby/core/numeric/imag_spec.rb6
-rw-r--r--spec/ruby/core/numeric/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/numeric/infinite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/integer_spec.rb8
-rw-r--r--spec/ruby/core/numeric/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/numeric/modulo_spec.rb24
-rw-r--r--spec/ruby/core/numeric/negative_spec.rb41
-rw-r--r--spec/ruby/core/numeric/nonzero_spec.rb18
-rw-r--r--spec/ruby/core/numeric/numerator_spec.rb33
-rw-r--r--spec/ruby/core/numeric/numeric_spec.rb7
-rw-r--r--spec/ruby/core/numeric/phase_spec.rb6
-rw-r--r--spec/ruby/core/numeric/polar_spec.rb50
-rw-r--r--spec/ruby/core/numeric/positive_spec.rb41
-rw-r--r--spec/ruby/core/numeric/quo_spec.rb55
-rw-r--r--spec/ruby/core/numeric/real_spec.rb37
-rw-r--r--spec/ruby/core/numeric/rect_spec.rb6
-rw-r--r--spec/ruby/core/numeric/rectangular_spec.rb6
-rw-r--r--spec/ruby/core/numeric/remainder_spec.rb67
-rw-r--r--spec/ruby/core/numeric/round_spec.rb14
-rw-r--r--spec/ruby/core/numeric/shared/abs.rb19
-rw-r--r--spec/ruby/core/numeric/shared/arg.rb38
-rw-r--r--spec/ruby/core/numeric/shared/conj.rb20
-rw-r--r--spec/ruby/core/numeric/shared/imag.rb26
-rw-r--r--spec/ruby/core/numeric/shared/quo.rb7
-rw-r--r--spec/ruby/core/numeric/shared/rect.rb48
-rw-r--r--spec/ruby/core/numeric/shared/step.rb419
-rw-r--r--spec/ruby/core/numeric/singleton_method_added_spec.rb41
-rw-r--r--spec/ruby/core/numeric/step_spec.rb222
-rw-r--r--spec/ruby/core/numeric/to_c_spec.rb45
-rw-r--r--spec/ruby/core/numeric/to_int_spec.rb10
-rw-r--r--spec/ruby/core/numeric/truncate_spec.rb14
-rw-r--r--spec/ruby/core/numeric/uminus_spec.rb31
-rw-r--r--spec/ruby/core/numeric/uplus_spec.rb9
-rw-r--r--spec/ruby/core/numeric/zero_spec.rb18
-rw-r--r--spec/ruby/core/objectspace/_id2ref_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/add_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/call_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/count_objects_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/define_finalizer_spec.rb172
-rw-r--r--spec/ruby/core/objectspace/each_object_spec.rb213
-rw-r--r--spec/ruby/core/objectspace/finalizers_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/fixtures/classes.rb64
-rw-r--r--spec/ruby/core/objectspace/garbage_collect_spec.rb22
-rw-r--r--spec/ruby/core/objectspace/remove_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/undefine_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_key_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_value_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_reference_spec.rb24
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_set_spec.rb61
-rw-r--r--spec/ruby/core/objectspace/weakmap/include_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/inspect_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/weakmap/key_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/keys_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/length_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/member_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/each.rb10
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/include.rb34
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/members.rb14
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/size.rb14
-rw-r--r--spec/ruby/core/objectspace/weakmap/size_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/values_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap_spec.rb12
-rw-r--r--spec/ruby/core/proc/allocate_spec.rb9
-rw-r--r--spec/ruby/core/proc/arity_spec.rb640
-rw-r--r--spec/ruby/core/proc/binding_spec.rb21
-rw-r--r--spec/ruby/core/proc/block_pass_spec.rb43
-rw-r--r--spec/ruby/core/proc/call_spec.rb16
-rw-r--r--spec/ruby/core/proc/case_compare_spec.rb16
-rw-r--r--spec/ruby/core/proc/clone_spec.rb6
-rw-r--r--spec/ruby/core/proc/compose_spec.rb156
-rw-r--r--spec/ruby/core/proc/curry_spec.rb180
-rw-r--r--spec/ruby/core/proc/dup_spec.rb6
-rw-r--r--spec/ruby/core/proc/element_reference_spec.rb27
-rw-r--r--spec/ruby/core/proc/eql_spec.rb12
-rw-r--r--spec/ruby/core/proc/equal_value_spec.rb12
-rw-r--r--spec/ruby/core/proc/fixtures/common.rb51
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref.rb9
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref_frozen.rb10
-rw-r--r--spec/ruby/core/proc/fixtures/source_location.rb55
-rw-r--r--spec/ruby/core/proc/hash_spec.rb17
-rw-r--r--spec/ruby/core/proc/inspect_spec.rb6
-rw-r--r--spec/ruby/core/proc/lambda_spec.rb60
-rw-r--r--spec/ruby/core/proc/new_spec.rb238
-rw-r--r--spec/ruby/core/proc/parameters_spec.rb95
-rw-r--r--spec/ruby/core/proc/shared/call.rb96
-rw-r--r--spec/ruby/core/proc/shared/call_arguments.rb29
-rw-r--r--spec/ruby/core/proc/shared/compose.rb47
-rw-r--r--spec/ruby/core/proc/shared/dup.rb10
-rw-r--r--spec/ruby/core/proc/shared/equal.rb100
-rw-r--r--spec/ruby/core/proc/shared/to_s.rb62
-rw-r--r--spec/ruby/core/proc/source_location_spec.rb86
-rw-r--r--spec/ruby/core/proc/to_proc_spec.rb9
-rw-r--r--spec/ruby/core/proc/to_s_spec.rb6
-rw-r--r--spec/ruby/core/proc/yield_spec.rb16
-rw-r--r--spec/ruby/core/process/abort_spec.rb6
-rw-r--r--spec/ruby/core/process/clock_getres_spec.rb33
-rw-r--r--spec/ruby/core/process/clock_gettime_spec.rb137
-rw-r--r--spec/ruby/core/process/constants_spec.rb63
-rw-r--r--spec/ruby/core/process/daemon_spec.rb115
-rw-r--r--spec/ruby/core/process/detach_spec.rb46
-rw-r--r--spec/ruby/core/process/egid_spec.rb19
-rw-r--r--spec/ruby/core/process/euid_spec.rb46
-rw-r--r--spec/ruby/core/process/exec_spec.rb241
-rw-r--r--spec/ruby/core/process/exit_spec.rb10
-rw-r--r--spec/ruby/core/process/fixtures/clocks.rb18
-rw-r--r--spec/ruby/core/process/fixtures/common.rb88
-rw-r--r--spec/ruby/core/process/fixtures/daemon.rb111
-rw-r--r--spec/ruby/core/process/fixtures/in.txt1
-rw-r--r--spec/ruby/core/process/fixtures/kill.rb45
-rw-r--r--spec/ruby/core/process/fixtures/map_fd.rb9
-rw-r--r--spec/ruby/core/process/fixtures/setpriority.rb12
-rw-r--r--spec/ruby/core/process/fork_spec.rb6
-rw-r--r--spec/ruby/core/process/getpgid_spec.rb17
-rw-r--r--spec/ruby/core/process/getpgrp_spec.rb7
-rw-r--r--spec/ruby/core/process/getpriority_spec.rb23
-rw-r--r--spec/ruby/core/process/getrlimit_spec.rb91
-rw-r--r--spec/ruby/core/process/gid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/gid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/gid_spec.rb22
-rw-r--r--spec/ruby/core/process/groups_spec.rb67
-rw-r--r--spec/ruby/core/process/initgroups_spec.rb22
-rw-r--r--spec/ruby/core/process/kill_spec.rb132
-rw-r--r--spec/ruby/core/process/last_status_spec.rb18
-rw-r--r--spec/ruby/core/process/maxgroups_spec.rb19
-rw-r--r--spec/ruby/core/process/pid_spec.rb9
-rw-r--r--spec/ruby/core/process/ppid_spec.rb9
-rw-r--r--spec/ruby/core/process/set_proctitle_spec.rb23
-rw-r--r--spec/ruby/core/process/setpgid_spec.rb29
-rw-r--r--spec/ruby/core/process/setpgrp_spec.rb37
-rw-r--r--spec/ruby/core/process/setpriority_spec.rb60
-rw-r--r--spec/ruby/core/process/setrlimit_spec.rb232
-rw-r--r--spec/ruby/core/process/setsid_spec.rb16
-rw-r--r--spec/ruby/core/process/spawn_spec.rb721
-rw-r--r--spec/ruby/core/process/status/bit_and_spec.rb5
-rw-r--r--spec/ruby/core/process/status/coredump_spec.rb5
-rw-r--r--spec/ruby/core/process/status/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/process/status/exited_spec.rb37
-rw-r--r--spec/ruby/core/process/status/exitstatus_spec.rb25
-rw-r--r--spec/ruby/core/process/status/inspect_spec.rb5
-rw-r--r--spec/ruby/core/process/status/pid_spec.rb15
-rw-r--r--spec/ruby/core/process/status/right_shift_spec.rb5
-rw-r--r--spec/ruby/core/process/status/signaled_spec.rb35
-rw-r--r--spec/ruby/core/process/status/stopped_spec.rb5
-rw-r--r--spec/ruby/core/process/status/stopsig_spec.rb5
-rw-r--r--spec/ruby/core/process/status/success_spec.rb51
-rw-r--r--spec/ruby/core/process/status/termsig_spec.rb43
-rw-r--r--spec/ruby/core/process/status/to_i_spec.rb13
-rw-r--r--spec/ruby/core/process/status/to_int_spec.rb5
-rw-r--r--spec/ruby/core/process/status/to_s_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/geteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/issetugid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/seteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setregid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setreuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setrgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setruid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setuid_spec.rb5
-rw-r--r--spec/ruby/core/process/times_spec.rb35
-rw-r--r--spec/ruby/core/process/uid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/uid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/uid_spec.rb57
-rw-r--r--spec/ruby/core/process/wait2_spec.rb36
-rw-r--r--spec/ruby/core/process/wait_spec.rb91
-rw-r--r--spec/ruby/core/process/waitall_spec.rb48
-rw-r--r--spec/ruby/core/process/waitpid2_spec.rb5
-rw-r--r--spec/ruby/core/process/waitpid_spec.rb13
-rw-r--r--spec/ruby/core/queue/append_spec.rb6
-rw-r--r--spec/ruby/core/queue/clear_spec.rb6
-rw-r--r--spec/ruby/core/queue/close_spec.rb6
-rw-r--r--spec/ruby/core/queue/closed_spec.rb6
-rw-r--r--spec/ruby/core/queue/deq_spec.rb6
-rw-r--r--spec/ruby/core/queue/empty_spec.rb6
-rw-r--r--spec/ruby/core/queue/enq_spec.rb6
-rw-r--r--spec/ruby/core/queue/length_spec.rb6
-rw-r--r--spec/ruby/core/queue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/queue/pop_spec.rb6
-rw-r--r--spec/ruby/core/queue/push_spec.rb6
-rw-r--r--spec/ruby/core/queue/shift_spec.rb6
-rw-r--r--spec/ruby/core/queue/size_spec.rb6
-rw-r--r--spec/ruby/core/random/bytes_spec.rb32
-rw-r--r--spec/ruby/core/random/default_spec.rb38
-rw-r--r--spec/ruby/core/random/equal_value_spec.rb37
-rw-r--r--spec/ruby/core/random/fixtures/classes.rb15
-rw-r--r--spec/ruby/core/random/new_seed_spec.rb24
-rw-r--r--spec/ruby/core/random/new_spec.rb37
-rw-r--r--spec/ruby/core/random/rand_spec.rb219
-rw-r--r--spec/ruby/core/random/random_number_spec.rb10
-rw-r--r--spec/ruby/core/random/raw_seed_spec.rb6
-rw-r--r--spec/ruby/core/random/seed_spec.rb29
-rw-r--r--spec/ruby/core/random/shared/bytes.rb17
-rw-r--r--spec/ruby/core/random/shared/rand.rb9
-rw-r--r--spec/ruby/core/random/shared/urandom.rb23
-rw-r--r--spec/ruby/core/random/srand_spec.rb39
-rw-r--r--spec/ruby/core/range/begin_spec.rb6
-rw-r--r--spec/ruby/core/range/bsearch_spec.rb333
-rw-r--r--spec/ruby/core/range/case_compare_spec.rb33
-rw-r--r--spec/ruby/core/range/cover_spec.rb10
-rw-r--r--spec/ruby/core/range/dup_spec.rb15
-rw-r--r--spec/ruby/core/range/each_spec.rb88
-rw-r--r--spec/ruby/core/range/end_spec.rb6
-rw-r--r--spec/ruby/core/range/eql_spec.rb10
-rw-r--r--spec/ruby/core/range/equal_value_spec.rb16
-rw-r--r--spec/ruby/core/range/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/range/first_spec.rb49
-rw-r--r--spec/ruby/core/range/fixtures/classes.rb90
-rw-r--r--spec/ruby/core/range/hash_spec.rb24
-rw-r--r--spec/ruby/core/range/include_spec.rb10
-rw-r--r--spec/ruby/core/range/initialize_spec.rb50
-rw-r--r--spec/ruby/core/range/inspect_spec.rb35
-rw-r--r--spec/ruby/core/range/last_spec.rb55
-rw-r--r--spec/ruby/core/range/max_spec.rb88
-rw-r--r--spec/ruby/core/range/member_spec.rb10
-rw-r--r--spec/ruby/core/range/min_spec.rb82
-rw-r--r--spec/ruby/core/range/minmax_spec.rb170
-rw-r--r--spec/ruby/core/range/new_spec.rb85
-rw-r--r--spec/ruby/core/range/percent_spec.rb18
-rw-r--r--spec/ruby/core/range/range_spec.rb7
-rw-r--r--spec/ruby/core/range/shared/begin.rb10
-rw-r--r--spec/ruby/core/range/shared/cover.rb155
-rw-r--r--spec/ruby/core/range/shared/cover_and_include.rb73
-rw-r--r--spec/ruby/core/range/shared/end.rb10
-rw-r--r--spec/ruby/core/range/shared/equal_value.rb53
-rw-r--r--spec/ruby/core/range/shared/include.rb91
-rw-r--r--spec/ruby/core/range/size_spec.rb38
-rw-r--r--spec/ruby/core/range/step_spec.rb514
-rw-r--r--spec/ruby/core/range/to_a_spec.rb28
-rw-r--r--spec/ruby/core/range/to_s_spec.rb34
-rw-r--r--spec/ruby/core/rational/abs_spec.rb5
-rw-r--r--spec/ruby/core/rational/ceil_spec.rb5
-rw-r--r--spec/ruby/core/rational/coerce_spec.rb5
-rw-r--r--spec/ruby/core/rational/comparison_spec.rb22
-rw-r--r--spec/ruby/core/rational/denominator_spec.rb5
-rw-r--r--spec/ruby/core/rational/div_spec.rb17
-rw-r--r--spec/ruby/core/rational/divide_spec.rb19
-rw-r--r--spec/ruby/core/rational/divmod_spec.rb13
-rw-r--r--spec/ruby/core/rational/equal_value_spec.rb17
-rw-r--r--spec/ruby/core/rational/exponent_spec.rb5
-rw-r--r--spec/ruby/core/rational/fdiv_spec.rb5
-rw-r--r--spec/ruby/core/rational/floor_spec.rb5
-rw-r--r--spec/ruby/core/rational/hash_spec.rb5
-rw-r--r--spec/ruby/core/rational/inspect_spec.rb5
-rw-r--r--spec/ruby/core/rational/integer_spec.rb12
-rw-r--r--spec/ruby/core/rational/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/rational/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/rational/minus_spec.rb7
-rw-r--r--spec/ruby/core/rational/modulo_spec.rb5
-rw-r--r--spec/ruby/core/rational/multiply_spec.rb19
-rw-r--r--spec/ruby/core/rational/numerator_spec.rb5
-rw-r--r--spec/ruby/core/rational/plus_spec.rb18
-rw-r--r--spec/ruby/core/rational/quo_spec.rb5
-rw-r--r--spec/ruby/core/rational/rational_spec.rb7
-rw-r--r--spec/ruby/core/rational/rationalize_spec.rb36
-rw-r--r--spec/ruby/core/rational/remainder_spec.rb5
-rw-r--r--spec/ruby/core/rational/round_spec.rb6
-rw-r--r--spec/ruby/core/rational/to_f_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_i_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_r_spec.rb20
-rw-r--r--spec/ruby/core/rational/to_s_spec.rb5
-rw-r--r--spec/ruby/core/rational/truncate_spec.rb5
-rw-r--r--spec/ruby/core/rational/zero_spec.rb13
-rw-r--r--spec/ruby/core/regexp/case_compare_spec.rb25
-rw-r--r--spec/ruby/core/regexp/casefold_spec.rb8
-rw-r--r--spec/ruby/core/regexp/compile_spec.rb15
-rw-r--r--spec/ruby/core/regexp/encoding_spec.rb62
-rw-r--r--spec/ruby/core/regexp/eql_spec.rb6
-rw-r--r--spec/ruby/core/regexp/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/regexp/escape_spec.rb6
-rw-r--r--spec/ruby/core/regexp/fixed_encoding_spec.rb36
-rw-r--r--spec/ruby/core/regexp/hash_spec.rb20
-rw-r--r--spec/ruby/core/regexp/initialize_spec.rb23
-rw-r--r--spec/ruby/core/regexp/inspect_spec.rb44
-rw-r--r--spec/ruby/core/regexp/last_match_spec.rb14
-rw-r--r--spec/ruby/core/regexp/match_spec.rb146
-rw-r--r--spec/ruby/core/regexp/named_captures_spec.rb35
-rw-r--r--spec/ruby/core/regexp/names_spec.rb29
-rw-r--r--spec/ruby/core/regexp/new_spec.rb27
-rw-r--r--spec/ruby/core/regexp/options_spec.rb54
-rw-r--r--spec/ruby/core/regexp/quote_spec.rb6
-rw-r--r--spec/ruby/core/regexp/shared/equal_value.rb31
-rw-r--r--spec/ruby/core/regexp/shared/new.rb505
-rw-r--r--spec/ruby/core/regexp/shared/quote.rb31
-rw-r--r--spec/ruby/core/regexp/source_spec.rb29
-rw-r--r--spec/ruby/core/regexp/to_s_spec.rb62
-rw-r--r--spec/ruby/core/regexp/try_convert_spec.rb21
-rw-r--r--spec/ruby/core/regexp/union_spec.rb159
-rw-r--r--spec/ruby/core/signal/fixtures/trap_all.rb15
-rw-r--r--spec/ruby/core/signal/list_spec.rb68
-rw-r--r--spec/ruby/core/signal/signame_spec.rb22
-rw-r--r--spec/ruby/core/signal/trap_spec.rb182
-rw-r--r--spec/ruby/core/sizedqueue/append_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/clear_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/close_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/closed_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/deq_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/empty_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/enq_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/length_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/max_spec.rb10
-rw-r--r--spec/ruby/core/sizedqueue/new_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/pop_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/push_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/shift_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/size_spec.rb6
-rw-r--r--spec/ruby/core/string/allocate_spec.rb19
-rw-r--r--spec/ruby/core/string/append_spec.rb8
-rw-r--r--spec/ruby/core/string/ascii_only_spec.rb83
-rw-r--r--spec/ruby/core/string/b_spec.rb24
-rw-r--r--spec/ruby/core/string/bytes_spec.rb55
-rw-r--r--spec/ruby/core/string/bytesize_spec.rb33
-rw-r--r--spec/ruby/core/string/byteslice_spec.rb27
-rw-r--r--spec/ruby/core/string/capitalize_spec.rb214
-rw-r--r--spec/ruby/core/string/case_compare_spec.rb8
-rw-r--r--spec/ruby/core/string/casecmp_spec.rb194
-rw-r--r--spec/ruby/core/string/center_spec.rb148
-rw-r--r--spec/ruby/core/string/chars_spec.rb10
-rw-r--r--spec/ruby/core/string/chomp_spec.rb432
-rw-r--r--spec/ruby/core/string/chop_spec.rb134
-rw-r--r--spec/ruby/core/string/chr_spec.rb42
-rw-r--r--spec/ruby/core/string/clear_spec.rb37
-rw-r--r--spec/ruby/core/string/clone_spec.rb57
-rw-r--r--spec/ruby/core/string/codepoints_spec.rb18
-rw-r--r--spec/ruby/core/string/comparison_spec.rb108
-rw-r--r--spec/ruby/core/string/concat_spec.rb26
-rw-r--r--spec/ruby/core/string/count_spec.rb105
-rw-r--r--spec/ruby/core/string/crypt_spec.rb122
-rw-r--r--spec/ruby/core/string/delete_prefix_spec.rb90
-rw-r--r--spec/ruby/core/string/delete_spec.rb129
-rw-r--r--spec/ruby/core/string/delete_suffix_spec.rb90
-rw-r--r--spec/ruby/core/string/downcase_spec.rb202
-rw-r--r--spec/ruby/core/string/dump_spec.rb410
-rw-r--r--spec/ruby/core/string/dup_spec.rb52
-rw-r--r--spec/ruby/core/string/each_byte_spec.rb61
-rw-r--r--spec/ruby/core/string/each_char_spec.rb7
-rw-r--r--spec/ruby/core/string/each_codepoint_spec.rb8
-rw-r--r--spec/ruby/core/string/each_grapheme_cluster_spec.rb9
-rw-r--r--spec/ruby/core/string/each_line_spec.rb9
-rw-r--r--spec/ruby/core/string/element_reference_spec.rb35
-rw-r--r--spec/ruby/core/string/element_set_spec.rb606
-rw-r--r--spec/ruby/core/string/empty_spec.rb12
-rw-r--r--spec/ruby/core/string/encode_spec.rb184
-rw-r--r--spec/ruby/core/string/encoding_spec.rb187
-rw-r--r--spec/ruby/core/string/end_with_spec.rb8
-rw-r--r--spec/ruby/core/string/eql_spec.rb21
-rw-r--r--spec/ruby/core/string/equal_value_spec.rb8
-rw-r--r--spec/ruby/core/string/fixtures/classes.rb60
-rw-r--r--spec/ruby/core/string/fixtures/freeze_magic_comment.rb3
-rw-r--r--spec/ruby/core/string/fixtures/iso-8859-9-encoding.rb9
-rw-r--r--spec/ruby/core/string/fixtures/utf-8-encoding.rb7
-rw-r--r--spec/ruby/core/string/force_encoding_spec.rb71
-rw-r--r--spec/ruby/core/string/freeze_spec.rb17
-rw-r--r--spec/ruby/core/string/getbyte_spec.rb69
-rw-r--r--spec/ruby/core/string/grapheme_clusters_spec.rb13
-rw-r--r--spec/ruby/core/string/gsub_spec.rb724
-rw-r--r--spec/ruby/core/string/hash_spec.rb9
-rw-r--r--spec/ruby/core/string/hex_spec.rb49
-rw-r--r--spec/ruby/core/string/include_spec.rb35
-rw-r--r--spec/ruby/core/string/index_spec.rb312
-rw-r--r--spec/ruby/core/string/initialize_spec.rb26
-rw-r--r--spec/ruby/core/string/insert_spec.rb84
-rw-r--r--spec/ruby/core/string/inspect_spec.rb506
-rw-r--r--spec/ruby/core/string/intern_spec.rb7
-rw-r--r--spec/ruby/core/string/length_spec.rb7
-rw-r--r--spec/ruby/core/string/lines_spec.rb20
-rw-r--r--spec/ruby/core/string/ljust_spec.rb131
-rw-r--r--spec/ruby/core/string/lstrip_spec.rb58
-rw-r--r--spec/ruby/core/string/match_spec.rb167
-rw-r--r--spec/ruby/core/string/modulo_spec.rb820
-rw-r--r--spec/ruby/core/string/multiply_spec.rb7
-rw-r--r--spec/ruby/core/string/new_spec.rb61
-rw-r--r--spec/ruby/core/string/next_spec.rb11
-rw-r--r--spec/ruby/core/string/oct_spec.rb88
-rw-r--r--spec/ruby/core/string/ord_spec.rb28
-rw-r--r--spec/ruby/core/string/partition_spec.rb38
-rw-r--r--spec/ruby/core/string/plus_spec.rb49
-rw-r--r--spec/ruby/core/string/prepend_spec.rb64
-rw-r--r--spec/ruby/core/string/replace_spec.rb7
-rw-r--r--spec/ruby/core/string/reverse_spec.rb50
-rw-r--r--spec/ruby/core/string/rindex_spec.rb366
-rw-r--r--spec/ruby/core/string/rjust_spec.rb131
-rw-r--r--spec/ruby/core/string/rpartition_spec.rb33
-rw-r--r--spec/ruby/core/string/rstrip_spec.rb54
-rw-r--r--spec/ruby/core/string/scan_spec.rb201
-rw-r--r--spec/ruby/core/string/scrub_spec.rb101
-rw-r--r--spec/ruby/core/string/setbyte_spec.rb105
-rw-r--r--spec/ruby/core/string/shared/chars.rb80
-rw-r--r--spec/ruby/core/string/shared/codepoints.rb62
-rw-r--r--spec/ruby/core/string/shared/concat.rb162
-rw-r--r--spec/ruby/core/string/shared/each_char_without_block.rb26
-rw-r--r--spec/ruby/core/string/shared/each_codepoint_without_block.rb33
-rw-r--r--spec/ruby/core/string/shared/each_line.rb174
-rw-r--r--spec/ruby/core/string/shared/each_line_without_block.rb17
-rw-r--r--spec/ruby/core/string/shared/encode.rb247
-rw-r--r--spec/ruby/core/string/shared/eql.rb34
-rw-r--r--spec/ruby/core/string/shared/equal_value.rb29
-rw-r--r--spec/ruby/core/string/shared/grapheme_clusters.rb16
-rw-r--r--spec/ruby/core/string/shared/length.rb39
-rw-r--r--spec/ruby/core/string/shared/replace.rb77
-rw-r--r--spec/ruby/core/string/shared/slice.rb651
-rw-r--r--spec/ruby/core/string/shared/succ.rb100
-rw-r--r--spec/ruby/core/string/shared/to_a.rb9
-rw-r--r--spec/ruby/core/string/shared/to_s.rb20
-rw-r--r--spec/ruby/core/string/shared/to_sym.rb63
-rw-r--r--spec/ruby/core/string/size_spec.rb7
-rw-r--r--spec/ruby/core/string/slice_spec.rb526
-rw-r--r--spec/ruby/core/string/split_spec.rb561
-rw-r--r--spec/ruby/core/string/squeeze_spec.rb123
-rw-r--r--spec/ruby/core/string/start_with_spec.rb8
-rw-r--r--spec/ruby/core/string/string_spec.rb7
-rw-r--r--spec/ruby/core/string/strip_spec.rb60
-rw-r--r--spec/ruby/core/string/sub_spec.rb594
-rw-r--r--spec/ruby/core/string/succ_spec.rb11
-rw-r--r--spec/ruby/core/string/sum_spec.rb22
-rw-r--r--spec/ruby/core/string/swapcase_spec.rb200
-rw-r--r--spec/ruby/core/string/to_c_spec.rb99
-rw-r--r--spec/ruby/core/string/to_f_spec.rb70
-rw-r--r--spec/ruby/core/string/to_i_spec.rb337
-rw-r--r--spec/ruby/core/string/to_r_spec.rb58
-rw-r--r--spec/ruby/core/string/to_s_spec.rb7
-rw-r--r--spec/ruby/core/string/to_str_spec.rb7
-rw-r--r--spec/ruby/core/string/to_sym_spec.rb7
-rw-r--r--spec/ruby/core/string/tr_s_spec.rb144
-rw-r--r--spec/ruby/core/string/tr_spec.rb139
-rw-r--r--spec/ruby/core/string/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/string/uminus_spec.rb79
-rw-r--r--spec/ruby/core/string/undump_spec.rb451
-rw-r--r--spec/ruby/core/string/unicode_normalize_spec.rb115
-rw-r--r--spec/ruby/core/string/unicode_normalized_spec.rb74
-rw-r--r--spec/ruby/core/string/unpack/a_spec.rb66
-rw-r--r--spec/ruby/core/string/unpack/at_spec.rb29
-rw-r--r--spec/ruby/core/string/unpack/b_spec.rb193
-rw-r--r--spec/ruby/core/string/unpack/c_spec.rb63
-rw-r--r--spec/ruby/core/string/unpack/comment_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/d_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/e_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/f_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/g_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/h_spec.rb135
-rw-r--r--spec/ruby/core/string/unpack/i_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/j_spec.rb272
-rw-r--r--spec/ruby/core/string/unpack/l_spec.rb265
-rw-r--r--spec/ruby/core/string/unpack/m_spec.rb187
-rw-r--r--spec/ruby/core/string/unpack/n_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/p_spec.rb56
-rw-r--r--spec/ruby/core/string/unpack/percent_spec.rb7
-rw-r--r--spec/ruby/core/string/unpack/q_spec.rb64
-rw-r--r--spec/ruby/core/string/unpack/s_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/shared/basic.rb29
-rw-r--r--spec/ruby/core/string/unpack/shared/float.rb271
-rw-r--r--spec/ruby/core/string/unpack/shared/integer.rb339
-rw-r--r--spec/ruby/core/string/unpack/shared/string.rb51
-rw-r--r--spec/ruby/core/string/unpack/shared/taint.rb83
-rw-r--r--spec/ruby/core/string/unpack/shared/unicode.rb60
-rw-r--r--spec/ruby/core/string/unpack/u_spec.rb97
-rw-r--r--spec/ruby/core/string/unpack/v_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/w_spec.rb35
-rw-r--r--spec/ruby/core/string/unpack/x_spec.rb62
-rw-r--r--spec/ruby/core/string/unpack/z_spec.rb23
-rw-r--r--spec/ruby/core/string/unpack1_spec.rb10
-rw-r--r--spec/ruby/core/string/upcase_spec.rb194
-rw-r--r--spec/ruby/core/string/uplus_spec.rb22
-rw-r--r--spec/ruby/core/string/upto_spec.rb98
-rw-r--r--spec/ruby/core/string/valid_encoding_spec.rb135
-rw-r--r--spec/ruby/core/struct/clone_spec.rb7
-rw-r--r--spec/ruby/core/struct/deconstruct_keys_spec.rb70
-rw-r--r--spec/ruby/core/struct/deconstruct_spec.rb12
-rw-r--r--spec/ruby/core/struct/dig_spec.rb42
-rw-r--r--spec/ruby/core/struct/dup_spec.rb23
-rw-r--r--spec/ruby/core/struct/each_pair_spec.rb33
-rw-r--r--spec/ruby/core/struct/each_spec.rb27
-rw-r--r--spec/ruby/core/struct/element_reference_spec.rb52
-rw-r--r--spec/ruby/core/struct/element_set_spec.rb29
-rw-r--r--spec/ruby/core/struct/eql_spec.rb13
-rw-r--r--spec/ruby/core/struct/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/struct/filter_spec.rb12
-rw-r--r--spec/ruby/core/struct/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/struct/hash_spec.rb60
-rw-r--r--spec/ruby/core/struct/initialize_spec.rb43
-rw-r--r--spec/ruby/core/struct/inspect_spec.rb12
-rw-r--r--spec/ruby/core/struct/instance_variable_get_spec.rb16
-rw-r--r--spec/ruby/core/struct/instance_variables_spec.rb16
-rw-r--r--spec/ruby/core/struct/length_spec.rb12
-rw-r--r--spec/ruby/core/struct/members_spec.rb13
-rw-r--r--spec/ruby/core/struct/new_spec.rb207
-rw-r--r--spec/ruby/core/struct/select_spec.rb10
-rw-r--r--spec/ruby/core/struct/shared/accessor.rb7
-rw-r--r--spec/ruby/core/struct/shared/dup.rb9
-rw-r--r--spec/ruby/core/struct/shared/equal_value.rb37
-rw-r--r--spec/ruby/core/struct/shared/inspect.rb5
-rw-r--r--spec/ruby/core/struct/shared/select.rb26
-rw-r--r--spec/ruby/core/struct/size_spec.rb11
-rw-r--r--spec/ruby/core/struct/struct_spec.rb43
-rw-r--r--spec/ruby/core/struct/to_a_spec.rb12
-rw-r--r--spec/ruby/core/struct/to_h_spec.rb58
-rw-r--r--spec/ruby/core/struct/to_s_spec.rb12
-rw-r--r--spec/ruby/core/struct/values_at_spec.rb16
-rw-r--r--spec/ruby/core/struct/values_spec.rb11
-rw-r--r--spec/ruby/core/symbol/all_symbols_spec.rb19
-rw-r--r--spec/ruby/core/symbol/capitalize_spec.rb41
-rw-r--r--spec/ruby/core/symbol/case_compare_spec.rb11
-rw-r--r--spec/ruby/core/symbol/casecmp_spec.rb144
-rw-r--r--spec/ruby/core/symbol/comparison_spec.rb51
-rw-r--r--spec/ruby/core/symbol/downcase_spec.rb25
-rw-r--r--spec/ruby/core/symbol/dup_spec.rb7
-rw-r--r--spec/ruby/core/symbol/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/symbol/empty_spec.rb11
-rw-r--r--spec/ruby/core/symbol/encoding_spec.rb23
-rw-r--r--spec/ruby/core/symbol/end_with_spec.rb10
-rw-r--r--spec/ruby/core/symbol/equal_value_spec.rb14
-rw-r--r--spec/ruby/core/symbol/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/symbol/id2name_spec.rb6
-rw-r--r--spec/ruby/core/symbol/inspect_spec.rb105
-rw-r--r--spec/ruby/core/symbol/intern_spec.rb11
-rw-r--r--spec/ruby/core/symbol/length_spec.rb6
-rw-r--r--spec/ruby/core/symbol/match_spec.rb77
-rw-r--r--spec/ruby/core/symbol/next_spec.rb6
-rw-r--r--spec/ruby/core/symbol/shared/id2name.rb9
-rw-r--r--spec/ruby/core/symbol/shared/length.rb23
-rw-r--r--spec/ruby/core/symbol/shared/slice.rb282
-rw-r--r--spec/ruby/core/symbol/shared/succ.rb18
-rw-r--r--spec/ruby/core/symbol/size_spec.rb6
-rw-r--r--spec/ruby/core/symbol/slice_spec.rb6
-rw-r--r--spec/ruby/core/symbol/start_with_spec.rb10
-rw-r--r--spec/ruby/core/symbol/succ_spec.rb6
-rw-r--r--spec/ruby/core/symbol/swapcase_spec.rb29
-rw-r--r--spec/ruby/core/symbol/symbol_spec.rb19
-rw-r--r--spec/ruby/core/symbol/to_proc_spec.rb70
-rw-r--r--spec/ruby/core/symbol/to_s_spec.rb6
-rw-r--r--spec/ruby/core/symbol/to_sym_spec.rb9
-rw-r--r--spec/ruby/core/symbol/upcase_spec.rb21
-rw-r--r--spec/ruby/core/systemexit/initialize_spec.rb26
-rw-r--r--spec/ruby/core/systemexit/success_spec.rb13
-rw-r--r--spec/ruby/core/thread/abort_on_exception_spec.rb106
-rw-r--r--spec/ruby/core/thread/add_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/alive_spec.rb58
-rw-r--r--spec/ruby/core/thread/allocate_spec.rb9
-rw-r--r--spec/ruby/core/thread/backtrace/location/absolute_path_spec.rb83
-rw-r--r--spec/ruby/core/thread/backtrace/location/base_label_spec.rb49
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path.rb4
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_main.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_method_added.rb10
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/classes.rb35
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_required.rb3
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/path.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/inspect_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/label_spec.rb37
-rw-r--r--spec/ruby/core/thread/backtrace/location/lineno_spec.rb23
-rw-r--r--spec/ruby/core/thread/backtrace/location/path_spec.rb124
-rw-r--r--spec/ruby/core/thread/backtrace/location/to_s_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace_locations_spec.rb75
-rw-r--r--spec/ruby/core/thread/backtrace_spec.rb69
-rw-r--r--spec/ruby/core/thread/current_spec.rb31
-rw-r--r--spec/ruby/core/thread/element_reference_spec.rb44
-rw-r--r--spec/ruby/core/thread/element_set_spec.rb51
-rw-r--r--spec/ruby/core/thread/exclusive_spec.rb49
-rw-r--r--spec/ruby/core/thread/exit_spec.rb15
-rw-r--r--spec/ruby/core/thread/fetch_spec.rb36
-rw-r--r--spec/ruby/core/thread/fixtures/classes.rb297
-rw-r--r--spec/ruby/core/thread/fork_spec.rb9
-rw-r--r--spec/ruby/core/thread/group_spec.rb5
-rw-r--r--spec/ruby/core/thread/initialize_spec.rb27
-rw-r--r--spec/ruby/core/thread/inspect_spec.rb6
-rw-r--r--spec/ruby/core/thread/join_spec.rb70
-rw-r--r--spec/ruby/core/thread/key_spec.rb53
-rw-r--r--spec/ruby/core/thread/keys_spec.rb44
-rw-r--r--spec/ruby/core/thread/kill_spec.rb25
-rw-r--r--spec/ruby/core/thread/list_spec.rb55
-rw-r--r--spec/ruby/core/thread/main_spec.rb10
-rw-r--r--spec/ruby/core/thread/name_spec.rb54
-rw-r--r--spec/ruby/core/thread/new_spec.rb83
-rw-r--r--spec/ruby/core/thread/pass_spec.rb8
-rw-r--r--spec/ruby/core/thread/priority_spec.rb72
-rw-r--r--spec/ruby/core/thread/raise_spec.rb208
-rw-r--r--spec/ruby/core/thread/report_on_exception_spec.rb106
-rw-r--r--spec/ruby/core/thread/run_spec.rb8
-rw-r--r--spec/ruby/core/thread/set_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/shared/exit.rb180
-rw-r--r--spec/ruby/core/thread/shared/start.rb41
-rw-r--r--spec/ruby/core/thread/shared/to_s.rb55
-rw-r--r--spec/ruby/core/thread/shared/wakeup.rb61
-rw-r--r--spec/ruby/core/thread/start_spec.rb9
-rw-r--r--spec/ruby/core/thread/status_spec.rb60
-rw-r--r--spec/ruby/core/thread/stop_spec.rb54
-rw-r--r--spec/ruby/core/thread/terminate_spec.rb7
-rw-r--r--spec/ruby/core/thread/thread_variable_get_spec.rb25
-rw-r--r--spec/ruby/core/thread/thread_variable_set_spec.rb26
-rw-r--r--spec/ruby/core/thread/thread_variable_spec.rb21
-rw-r--r--spec/ruby/core/thread/thread_variables_spec.rb29
-rw-r--r--spec/ruby/core/thread/to_s_spec.rb6
-rw-r--r--spec/ruby/core/thread/value_spec.rb31
-rw-r--r--spec/ruby/core/thread/wakeup_spec.rb7
-rw-r--r--spec/ruby/core/threadgroup/add_spec.rb39
-rw-r--r--spec/ruby/core/threadgroup/default_spec.rb11
-rw-r--r--spec/ruby/core/threadgroup/enclose_spec.rb24
-rw-r--r--spec/ruby/core/threadgroup/enclosed_spec.rb14
-rw-r--r--spec/ruby/core/threadgroup/list_spec.rb23
-rw-r--r--spec/ruby/core/time/_dump_spec.rb55
-rw-r--r--spec/ruby/core/time/_load_spec.rb52
-rw-r--r--spec/ruby/core/time/asctime_spec.rb6
-rw-r--r--spec/ruby/core/time/at_spec.rb258
-rw-r--r--spec/ruby/core/time/ceil_spec.rb46
-rw-r--r--spec/ruby/core/time/comparison_spec.rb104
-rw-r--r--spec/ruby/core/time/ctime_spec.rb6
-rw-r--r--spec/ruby/core/time/day_spec.rb6
-rw-r--r--spec/ruby/core/time/dst_spec.rb6
-rw-r--r--spec/ruby/core/time/dup_spec.rb46
-rw-r--r--spec/ruby/core/time/eql_spec.rb29
-rw-r--r--spec/ruby/core/time/fixtures/classes.rb106
-rw-r--r--spec/ruby/core/time/floor_spec.rb38
-rw-r--r--spec/ruby/core/time/friday_spec.rb11
-rw-r--r--spec/ruby/core/time/getgm_spec.rb6
-rw-r--r--spec/ruby/core/time/getlocal_spec.rb169
-rw-r--r--spec/ruby/core/time/getutc_spec.rb6
-rw-r--r--spec/ruby/core/time/gm_spec.rb10
-rw-r--r--spec/ruby/core/time/gmt_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/gmt_spec.rb8
-rw-r--r--spec/ruby/core/time/gmtime_spec.rb6
-rw-r--r--spec/ruby/core/time/gmtoff_spec.rb6
-rw-r--r--spec/ruby/core/time/hash_spec.rb11
-rw-r--r--spec/ruby/core/time/hour_spec.rb17
-rw-r--r--spec/ruby/core/time/inspect_spec.rb21
-rw-r--r--spec/ruby/core/time/isdst_spec.rb6
-rw-r--r--spec/ruby/core/time/local_spec.rb11
-rw-r--r--spec/ruby/core/time/localtime_spec.rb140
-rw-r--r--spec/ruby/core/time/mday_spec.rb6
-rw-r--r--spec/ruby/core/time/min_spec.rb17
-rw-r--r--spec/ruby/core/time/minus_spec.rb123
-rw-r--r--spec/ruby/core/time/mktime_spec.rb11
-rw-r--r--spec/ruby/core/time/mon_spec.rb6
-rw-r--r--spec/ruby/core/time/monday_spec.rb11
-rw-r--r--spec/ruby/core/time/month_spec.rb6
-rw-r--r--spec/ruby/core/time/new_spec.rb337
-rw-r--r--spec/ruby/core/time/now_spec.rb6
-rw-r--r--spec/ruby/core/time/nsec_spec.rb31
-rw-r--r--spec/ruby/core/time/plus_spec.rb120
-rw-r--r--spec/ruby/core/time/round_spec.rb35
-rw-r--r--spec/ruby/core/time/saturday_spec.rb11
-rw-r--r--spec/ruby/core/time/sec_spec.rb7
-rw-r--r--spec/ruby/core/time/shared/asctime.rb6
-rw-r--r--spec/ruby/core/time/shared/day.rb15
-rw-r--r--spec/ruby/core/time/shared/getgm.rb9
-rw-r--r--spec/ruby/core/time/shared/gm.rb70
-rw-r--r--spec/ruby/core/time/shared/gmt_offset.rb59
-rw-r--r--spec/ruby/core/time/shared/gmtime.rb33
-rw-r--r--spec/ruby/core/time/shared/inspect.rb21
-rw-r--r--spec/ruby/core/time/shared/isdst.rb8
-rw-r--r--spec/ruby/core/time/shared/local.rb47
-rw-r--r--spec/ruby/core/time/shared/month.rb15
-rw-r--r--spec/ruby/core/time/shared/now.rb33
-rw-r--r--spec/ruby/core/time/shared/time_params.rb262
-rw-r--r--spec/ruby/core/time/shared/to_i.rb16
-rw-r--r--spec/ruby/core/time/strftime_spec.rb52
-rw-r--r--spec/ruby/core/time/subsec_spec.rb27
-rw-r--r--spec/ruby/core/time/succ_spec.rb41
-rw-r--r--spec/ruby/core/time/sunday_spec.rb11
-rw-r--r--spec/ruby/core/time/thursday_spec.rb11
-rw-r--r--spec/ruby/core/time/time_spec.rb7
-rw-r--r--spec/ruby/core/time/to_a_spec.rb12
-rw-r--r--spec/ruby/core/time/to_f_spec.rb7
-rw-r--r--spec/ruby/core/time/to_i_spec.rb6
-rw-r--r--spec/ruby/core/time/to_r_spec.rb11
-rw-r--r--spec/ruby/core/time/to_s_spec.rb6
-rw-r--r--spec/ruby/core/time/tuesday_spec.rb11
-rw-r--r--spec/ruby/core/time/tv_nsec_spec.rb5
-rw-r--r--spec/ruby/core/time/tv_sec_spec.rb6
-rw-r--r--spec/ruby/core/time/tv_usec_spec.rb5
-rw-r--r--spec/ruby/core/time/usec_spec.rb43
-rw-r--r--spec/ruby/core/time/utc_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/utc_spec.rb21
-rw-r--r--spec/ruby/core/time/wday_spec.rb9
-rw-r--r--spec/ruby/core/time/wednesday_spec.rb11
-rw-r--r--spec/ruby/core/time/yday_spec.rb21
-rw-r--r--spec/ruby/core/time/year_spec.rb17
-rw-r--r--spec/ruby/core/time/zone_spec.rb90
-rw-r--r--spec/ruby/core/tracepoint/binding_spec.rb21
-rw-r--r--spec/ruby/core/tracepoint/callee_id_spec.rb18
-rw-r--r--spec/ruby/core/tracepoint/defined_class_spec.rb27
-rw-r--r--spec/ruby/core/tracepoint/disable_spec.rb76
-rw-r--r--spec/ruby/core/tracepoint/enable_spec.rb551
-rw-r--r--spec/ruby/core/tracepoint/enabled_spec.rb15
-rw-r--r--spec/ruby/core/tracepoint/eval_script_spec.rb25
-rw-r--r--spec/ruby/core/tracepoint/event_spec.rb22
-rw-r--r--spec/ruby/core/tracepoint/fixtures/classes.rb40
-rw-r--r--spec/ruby/core/tracepoint/inspect_spec.rb125
-rw-r--r--spec/ruby/core/tracepoint/lineno_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/method_id_spec.rb15
-rw-r--r--spec/ruby/core/tracepoint/new_spec.rb72
-rw-r--r--spec/ruby/core/tracepoint/parameters_spec.rb30
-rw-r--r--spec/ruby/core/tracepoint/path_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/raised_exception_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/return_value_spec.rb17
-rw-r--r--spec/ruby/core/tracepoint/self_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/trace_spec.rb10
-rw-r--r--spec/ruby/core/true/and_spec.rb11
-rw-r--r--spec/ruby/core/true/case_compare_spec.rb13
-rw-r--r--spec/ruby/core/true/dup_spec.rb7
-rw-r--r--spec/ruby/core/true/inspect_spec.rb7
-rw-r--r--spec/ruby/core/true/or_spec.rb11
-rw-r--r--spec/ruby/core/true/to_s_spec.rb17
-rw-r--r--spec/ruby/core/true/trueclass_spec.rb15
-rw-r--r--spec/ruby/core/true/xor_spec.rb11
-rw-r--r--spec/ruby/core/unboundmethod/arity_spec.rb207
-rw-r--r--spec/ruby/core/unboundmethod/bind_call_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/bind_spec.rb61
-rw-r--r--spec/ruby/core/unboundmethod/clone_spec.rb12
-rw-r--r--spec/ruby/core/unboundmethod/eql_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/equal_value_spec.rb101
-rw-r--r--spec/ruby/core/unboundmethod/fixtures/classes.rb87
-rw-r--r--spec/ruby/core/unboundmethod/hash_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/inspect_spec.rb7
-rw-r--r--spec/ruby/core/unboundmethod/name_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/original_name_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/owner_spec.rb26
-rw-r--r--spec/ruby/core/unboundmethod/parameters_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/shared/to_s.rb34
-rw-r--r--spec/ruby/core/unboundmethod/source_location_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/super_method_spec.rb28
-rw-r--r--spec/ruby/core/unboundmethod/to_s_spec.rb7
-rw-r--r--spec/ruby/core/warning/element_reference_spec.rb14
-rw-r--r--spec/ruby/core/warning/element_set_spec.rb31
-rw-r--r--spec/ruby/core/warning/warn_spec.rb91
-rw-r--r--spec/ruby/default.mspec50
-rw-r--r--spec/ruby/fixtures/basicobject/method_missing.rb55
-rw-r--r--spec/ruby/fixtures/class.rb138
-rw-r--r--spec/ruby/fixtures/class_variables.rb58
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/b/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/concurrent.rb12
-rw-r--r--spec/ruby/fixtures/code/concurrent2.rb8
-rw-r--r--spec/ruby/fixtures/code/concurrent3.rb2
-rw-r--r--spec/ruby/fixtures/code/file_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/gem/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/line_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/load_ext_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture_and__FILE__.rb1
-rw-r--r--spec/ruby/fixtures/code/load_wrap_method_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code/methods_fixture.rb364
-rw-r--r--spec/ruby/fixtures/code/raise_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/recursive_load_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/recursive_require_fixture.rb3
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink1.rb1
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink2/symlink2.rb1
-rw-r--r--spec/ruby/fixtures/code/wrap_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code_loading.rb41
-rw-r--r--spec/ruby/fixtures/constants.rb302
-rw-r--r--spec/ruby/fixtures/enumerator/classes.rb15
-rw-r--r--spec/ruby/fixtures/math/common.rb3
-rw-r--r--spec/ruby/fixtures/rational.rb14
-rw-r--r--spec/ruby/fixtures/reflection.rb352
-rw-r--r--spec/ruby/language/BEGIN_spec.rb41
-rw-r--r--spec/ruby/language/END_spec.rb15
-rw-r--r--spec/ruby/language/README30
-rw-r--r--spec/ruby/language/alias_spec.rb263
-rw-r--r--spec/ruby/language/and_spec.rb80
-rw-r--r--spec/ruby/language/array_spec.rb162
-rw-r--r--spec/ruby/language/block_spec.rb1006
-rw-r--r--spec/ruby/language/break_spec.rb383
-rw-r--r--spec/ruby/language/case_spec.rb436
-rw-r--r--spec/ruby/language/class_spec.rb350
-rw-r--r--spec/ruby/language/class_variable_spec.rb84
-rw-r--r--spec/ruby/language/comment_spec.rb15
-rw-r--r--spec/ruby/language/constants_spec.rb765
-rw-r--r--spec/ruby/language/def_spec.rb815
-rw-r--r--spec/ruby/language/defined_spec.rb1122
-rw-r--r--spec/ruby/language/delegation_spec.rb41
-rw-r--r--spec/ruby/language/encoding_spec.rb36
-rw-r--r--spec/ruby/language/ensure_spec.rb331
-rw-r--r--spec/ruby/language/execution_spec.rb15
-rw-r--r--spec/ruby/language/file_spec.rb29
-rw-r--r--spec/ruby/language/fixtures/argv_encoding.rb1
-rw-r--r--spec/ruby/language/fixtures/array.rb32
-rw-r--r--spec/ruby/language/fixtures/begin_file.rb3
-rw-r--r--spec/ruby/language/fixtures/binary_symbol.rb4
-rw-r--r--spec/ruby/language/fixtures/block.rb61
-rw-r--r--spec/ruby/language/fixtures/break.rb291
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel.rb9
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_block.rb23
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_method.rb17
-rw-r--r--spec/ruby/language/fixtures/bytes_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/case_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/classes.rb31
-rw-r--r--spec/ruby/language/fixtures/coding_us_ascii.rb11
-rw-r--r--spec/ruby/language/fixtures/coding_utf_8.rb11
-rw-r--r--spec/ruby/language/fixtures/constant_visibility.rb98
-rw-r--r--spec/ruby/language/fixtures/constants_sclass.rb54
-rw-r--r--spec/ruby/language/fixtures/def.rb14
-rw-r--r--spec/ruby/language/fixtures/defined.rb303
-rw-r--r--spec/ruby/language/fixtures/delegation.rb11
-rw-r--r--spec/ruby/language/fixtures/dollar_zero.rb6
-rw-r--r--spec/ruby/language/fixtures/emacs_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/ensure.rb121
-rw-r--r--spec/ruby/language/fixtures/file.rb1
-rw-r--r--spec/ruby/language/fixtures/for_scope.rb15
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_diff_enc.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_no_comment.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_one_literal.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_diff_enc.rbbin0 -> 181 bytes-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_no_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_two_literals.rb3
-rw-r--r--spec/ruby/language/fixtures/hash_strings_binary.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_usascii.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_utf8.rb7
-rw-r--r--spec/ruby/language/fixtures/magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/match_operators.rb9
-rw-r--r--spec/ruby/language/fixtures/metaclass.rb33
-rw-r--r--spec/ruby/language/fixtures/module.rb24
-rw-r--r--spec/ruby/language/fixtures/next.rb134
-rw-r--r--spec/ruby/language/fixtures/no_magic_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/precedence.rb16
-rw-r--r--spec/ruby/language/fixtures/print_magic_comment_result_at_exit.rb3
-rw-r--r--spec/ruby/language/fixtures/private.rb59
-rw-r--r--spec/ruby/language/fixtures/rescue.rb67
-rw-r--r--spec/ruby/language/fixtures/rescue_captures.rb107
-rw-r--r--spec/ruby/language/fixtures/return.rb139
-rw-r--r--spec/ruby/language/fixtures/second_line_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/second_token_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/send.rb141
-rwxr-xr-xspec/ruby/language/fixtures/shebang_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/squiggly_heredoc.rb63
-rw-r--r--spec/ruby/language/fixtures/super.rb742
-rw-r--r--spec/ruby/language/fixtures/utf16-be-nobom.rbbin0 -> 68 bytes-rw-r--r--spec/ruby/language/fixtures/utf16-le-nobom.rbbin0 -> 69 bytes-rw-r--r--spec/ruby/language/fixtures/utf8-bom.rb2
-rw-r--r--spec/ruby/language/fixtures/utf8-nobom.rb2
-rw-r--r--spec/ruby/language/fixtures/variables.rb85
-rw-r--r--spec/ruby/language/fixtures/vim_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/yield.rb41
-rw-r--r--spec/ruby/language/for_spec.rb182
-rw-r--r--spec/ruby/language/hash_spec.rb169
-rw-r--r--spec/ruby/language/heredoc_spec.rb114
-rw-r--r--spec/ruby/language/if_spec.rb371
-rw-r--r--spec/ruby/language/lambda_spec.rb656
-rw-r--r--spec/ruby/language/line_spec.rb45
-rw-r--r--spec/ruby/language/loop_spec.rb67
-rw-r--r--spec/ruby/language/magic_comment_spec.rb92
-rw-r--r--spec/ruby/language/match_spec.rb81
-rw-r--r--spec/ruby/language/metaclass_spec.rb143
-rw-r--r--spec/ruby/language/method_spec.rb1864
-rw-r--r--spec/ruby/language/module_spec.rb101
-rw-r--r--spec/ruby/language/next_spec.rb410
-rw-r--r--spec/ruby/language/not_spec.rb51
-rw-r--r--spec/ruby/language/numbered_parameters_spec.rb106
-rw-r--r--spec/ruby/language/numbers_spec.rb101
-rw-r--r--spec/ruby/language/optional_assignments_spec.rb353
-rw-r--r--spec/ruby/language/or_spec.rb90
-rw-r--r--spec/ruby/language/order_spec.rb75
-rw-r--r--spec/ruby/language/pattern_matching_spec.rb1035
-rw-r--r--spec/ruby/language/precedence_spec.rb447
-rw-r--r--spec/ruby/language/predefined/data_spec.rb48
-rw-r--r--spec/ruby/language/predefined/fixtures/data1.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data2.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/data3.rb6
-rw-r--r--spec/ruby/language/predefined/fixtures/data4.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data5.rb5
-rw-r--r--spec/ruby/language/predefined/fixtures/data_offset.rb12
-rw-r--r--spec/ruby/language/predefined/fixtures/data_only.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/empty_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/print_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic_required.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id_required.rb1
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_required_before.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_values.rb9
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables_required.rb2
-rw-r--r--spec/ruby/language/predefined/toplevel_binding_spec.rb34
-rw-r--r--spec/ruby/language/predefined_spec.rb1278
-rw-r--r--spec/ruby/language/private_spec.rb67
-rw-r--r--spec/ruby/language/proc_spec.rb220
-rw-r--r--spec/ruby/language/range_spec.rb26
-rw-r--r--spec/ruby/language/redo_spec.rb66
-rw-r--r--spec/ruby/language/regexp/anchors_spec.rb179
-rw-r--r--spec/ruby/language/regexp/back-references_spec.rb53
-rw-r--r--spec/ruby/language/regexp/character_classes_spec.rb637
-rw-r--r--spec/ruby/language/regexp/encoding_spec.rb131
-rw-r--r--spec/ruby/language/regexp/escapes_spec.rb81
-rw-r--r--spec/ruby/language/regexp/grouping_spec.rb23
-rw-r--r--spec/ruby/language/regexp/interpolation_spec.rb58
-rw-r--r--spec/ruby/language/regexp/modifiers_spec.rb115
-rw-r--r--spec/ruby/language/regexp/repetition_spec.rb48
-rw-r--r--spec/ruby/language/regexp_spec.rb189
-rw-r--r--spec/ruby/language/rescue_spec.rb523
-rw-r--r--spec/ruby/language/retry_spec.rb52
-rw-r--r--spec/ruby/language/return_spec.rb489
-rw-r--r--spec/ruby/language/safe_navigator_spec.rb99
-rw-r--r--spec/ruby/language/safe_spec.rb152
-rw-r--r--spec/ruby/language/send_spec.rb580
-rw-r--r--spec/ruby/language/shared/__FILE__.rb23
-rw-r--r--spec/ruby/language/shared/__LINE__.rb15
-rw-r--r--spec/ruby/language/singleton_class_spec.rb310
-rw-r--r--spec/ruby/language/source_encoding_spec.rb61
-rw-r--r--spec/ruby/language/string_spec.rb311
-rw-r--r--spec/ruby/language/super_spec.rb434
-rw-r--r--spec/ruby/language/symbol_spec.rb106
-rw-r--r--spec/ruby/language/throw_spec.rb81
-rw-r--r--spec/ruby/language/undef_spec.rb72
-rw-r--r--spec/ruby/language/unless_spec.rb43
-rw-r--r--spec/ruby/language/until_spec.rb234
-rw-r--r--spec/ruby/language/variables_spec.rb827
-rw-r--r--spec/ruby/language/while_spec.rb344
-rw-r--r--spec/ruby/language/yield_spec.rb187
-rw-r--r--spec/ruby/library/English/English_spec.rb171
-rw-r--r--spec/ruby/library/English/alias_spec.rb14
-rw-r--r--spec/ruby/library/abbrev/abbrev_spec.rb31
-rw-r--r--spec/ruby/library/base64/decode64_spec.rb25
-rw-r--r--spec/ruby/library/base64/encode64_spec.rb23
-rw-r--r--spec/ruby/library/base64/strict_decode64_spec.rb41
-rw-r--r--spec/ruby/library/base64/strict_encode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_decode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_encode64_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/BigDecimal_spec.rb298
-rw-r--r--spec/ruby/library/bigdecimal/abs_spec.rb50
-rw-r--r--spec/ruby/library/bigdecimal/add_spec.rb193
-rw-r--r--spec/ruby/library/bigdecimal/case_compare_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/ceil_spec.rb104
-rw-r--r--spec/ruby/library/bigdecimal/clone_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/coerce_spec.rb26
-rw-r--r--spec/ruby/library/bigdecimal/comparison_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/constants_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/div_spec.rb110
-rw-r--r--spec/ruby/library/bigdecimal/divide_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/divmod_spec.rb180
-rw-r--r--spec/ruby/library/bigdecimal/double_fig_spec.rb9
-rw-r--r--spec/ruby/library/bigdecimal/dup_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/eql_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/equal_value_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/exponent_spec.rb38
-rw-r--r--spec/ruby/library/bigdecimal/finite_spec.rb34
-rw-r--r--spec/ruby/library/bigdecimal/fix_spec.rb57
-rw-r--r--spec/ruby/library/bigdecimal/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/bigdecimal/floor_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/frac_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/gt_spec.rb96
-rw-r--r--spec/ruby/library/bigdecimal/gte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/hash_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/infinite_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/inspect_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/limit_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/lt_spec.rb94
-rw-r--r--spec/ruby/library/bigdecimal/lte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/minus_spec.rb66
-rw-r--r--spec/ruby/library/bigdecimal/mode_spec.rb36
-rw-r--r--spec/ruby/library/bigdecimal/modulo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/mult_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/multiply_spec.rb41
-rw-r--r--spec/ruby/library/bigdecimal/nan_spec.rb23
-rw-r--r--spec/ruby/library/bigdecimal/nonzero_spec.rb29
-rw-r--r--spec/ruby/library/bigdecimal/plus_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/power_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/precs_spec.rb50
-rw-r--r--spec/ruby/library/bigdecimal/quo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/remainder_spec.rb92
-rw-r--r--spec/ruby/library/bigdecimal/round_spec.rb234
-rw-r--r--spec/ruby/library/bigdecimal/shared/clone.rb13
-rw-r--r--spec/ruby/library/bigdecimal/shared/eql.rb61
-rw-r--r--spec/ruby/library/bigdecimal/shared/modulo.rb125
-rw-r--r--spec/ruby/library/bigdecimal/shared/mult.rb97
-rw-r--r--spec/ruby/library/bigdecimal/shared/power.rb72
-rw-r--r--spec/ruby/library/bigdecimal/shared/quo.rb67
-rw-r--r--spec/ruby/library/bigdecimal/shared/to_int.rb16
-rw-r--r--spec/ruby/library/bigdecimal/sign_spec.rb46
-rw-r--r--spec/ruby/library/bigdecimal/split_spec.rb86
-rw-r--r--spec/ruby/library/bigdecimal/sqrt_spec.rb112
-rw-r--r--spec/ruby/library/bigdecimal/sub_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/to_d_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/to_f_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/to_i_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/to_int_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/to_r_spec.rb16
-rw-r--r--spec/ruby/library/bigdecimal/to_s_spec.rb97
-rw-r--r--spec/ruby/library/bigdecimal/truncate_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/uminus_spec.rb58
-rw-r--r--spec/ruby/library/bigdecimal/uplus_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/util_spec.rb42
-rw-r--r--spec/ruby/library/bigdecimal/zero_spec.rb27
-rw-r--r--spec/ruby/library/bigmath/log_spec.rb10
-rw-r--r--spec/ruby/library/cgi/cookie/domain_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/expires_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/initialize_spec.rb147
-rw-r--r--spec/ruby/library/cgi/cookie/name_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/parse_spec.rb26
-rw-r--r--spec/ruby/library/cgi/cookie/path_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/secure_spec.rb70
-rw-r--r--spec/ruby/library/cgi/cookie/to_s_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/value_spec.rb76
-rw-r--r--spec/ruby/library/cgi/escapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/escapeHTML_spec.rb17
-rw-r--r--spec/ruby/library/cgi/escape_spec.rb18
-rw-r--r--spec/ruby/library/cgi/htmlextension/a_spec.rb49
-rw-r--r--spec/ruby/library/cgi/htmlextension/base_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/blockquote_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/br_spec.rb22
-rw-r--r--spec/ruby/library/cgi/htmlextension/caption_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_group_spec.rb76
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/doctype_spec.rb27
-rw-r--r--spec/ruby/library/cgi/htmlextension/file_field_spec.rb72
-rw-r--r--spec/ruby/library/cgi/htmlextension/fixtures/common.rb15
-rw-r--r--spec/ruby/library/cgi/htmlextension/form_spec.rb58
-rw-r--r--spec/ruby/library/cgi/htmlextension/frame_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/frameset_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/hidden_spec.rb59
-rw-r--r--spec/ruby/library/cgi/htmlextension/html_spec.rb66
-rw-r--r--spec/ruby/library/cgi/htmlextension/image_button_spec.rb69
-rw-r--r--spec/ruby/library/cgi/htmlextension/img_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/multipart_form_spec.rb64
-rw-r--r--spec/ruby/library/cgi/htmlextension/password_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/popup_menu_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_button_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_group_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/reset_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/scrolling_list_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/shared/popup_menu.rb94
-rw-r--r--spec/ruby/library/cgi/htmlextension/submit_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/text_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/textarea_spec.rb73
-rw-r--r--spec/ruby/library/cgi/http_header_spec.rb8
-rw-r--r--spec/ruby/library/cgi/initialize_spec.rb133
-rw-r--r--spec/ruby/library/cgi/out_spec.rb51
-rw-r--r--spec/ruby/library/cgi/parse_spec.rb24
-rw-r--r--spec/ruby/library/cgi/pretty_spec.rb24
-rw-r--r--spec/ruby/library/cgi/print_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_charset_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_encoding_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_language_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/auth_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cache_control_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/content_length_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/content_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cookies_spec.rb10
-rw-r--r--spec/ruby/library/cgi/queryextension/element_reference_spec.rb27
-rw-r--r--spec/ruby/library/cgi/queryextension/from_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/gateway_interface_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/has_key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/include_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/keys_spec.rb20
-rw-r--r--spec/ruby/library/cgi/queryextension/multipart_spec.rb40
-rw-r--r--spec/ruby/library/cgi/queryextension/negotiate_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/params_spec.rb37
-rw-r--r--spec/ruby/library/cgi/queryextension/path_info_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/path_translated_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/pragma_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/query_string_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie2_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/referer_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_addr_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_ident_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_user_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/request_method_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/script_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_port_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/server_protocol_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_software_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/shared/has_key.rb19
-rw-r--r--spec/ruby/library/cgi/queryextension/user_agent_spec.rb22
-rw-r--r--spec/ruby/library/cgi/rfc1123_date_spec.rb10
-rw-r--r--spec/ruby/library/cgi/shared/http_header.rb112
-rw-r--r--spec/ruby/library/cgi/unescapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/unescapeHTML_spec.rb44
-rw-r--r--spec/ruby/library/cgi/unescape_spec.rb15
-rw-r--r--spec/ruby/library/cmath/math/acos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/acosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan2_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atanh_spec.rb20
-rw-r--r--spec/ruby/library/cmath/math/cos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/cosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/exp_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/cmath/math/log10_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/log_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/shared/acos.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/acosh.rb37
-rw-r--r--spec/ruby/library/cmath/math/shared/asin.rb47
-rw-r--r--spec/ruby/library/cmath/math/shared/asinh.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan2.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/atanh.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cos.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cosh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/exp.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/log.rb39
-rw-r--r--spec/ruby/library/cmath/math/shared/log10.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/sin.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/sinh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/sqrt.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/tan.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/tanh.rb32
-rw-r--r--spec/ruby/library/cmath/math/sin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sqrt_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tanh_spec.rb18
-rw-r--r--spec/ruby/library/conditionvariable/broadcast_spec.rb40
-rw-r--r--spec/ruby/library/conditionvariable/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/conditionvariable/signal_spec.rb77
-rw-r--r--spec/ruby/library/conditionvariable/wait_spec.rb175
-rw-r--r--spec/ruby/library/coverage/fixtures/eval_code.rb11
-rw-r--r--spec/ruby/library/coverage/fixtures/second_class.rb5
-rw-r--r--spec/ruby/library/coverage/fixtures/some_class.rb16
-rw-r--r--spec/ruby/library/coverage/fixtures/start_coverage.rb3
-rw-r--r--spec/ruby/library/coverage/peek_result_spec.rb64
-rw-r--r--spec/ruby/library/coverage/result_spec.rb92
-rw-r--r--spec/ruby/library/coverage/start_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/data_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/fixtures/one_line.csv1
-rw-r--r--spec/ruby/library/csv/foreach_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_line_spec.rb30
-rw-r--r--spec/ruby/library/csv/generate_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_spec.rb32
-rw-r--r--spec/ruby/library/csv/iobuf/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/liberal_parsing_spec.rb19
-rw-r--r--spec/ruby/library/csv/open_spec.rb6
-rw-r--r--spec/ruby/library/csv/parse_spec.rb93
-rw-r--r--spec/ruby/library/csv/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/readlines_spec.rb35
-rw-r--r--spec/ruby/library/csv/streambuf/add_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/buf_size_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/drop_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/element_reference_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/get_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/idx_is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/rel_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/add_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/append_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/create_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/generate_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/terminate_spec.rb6
-rw-r--r--spec/ruby/library/date/accessor_spec.rb91
-rw-r--r--spec/ruby/library/date/add_month_spec.rb38
-rw-r--r--spec/ruby/library/date/add_spec.rb30
-rw-r--r--spec/ruby/library/date/ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/append_spec.rb6
-rw-r--r--spec/ruby/library/date/asctime_spec.rb6
-rw-r--r--spec/ruby/library/date/boat_spec.rb24
-rw-r--r--spec/ruby/library/date/case_compare_spec.rb6
-rw-r--r--spec/ruby/library/date/civil_spec.rb12
-rw-r--r--spec/ruby/library/date/commercial_spec.rb17
-rw-r--r--spec/ruby/library/date/commercial_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/constants_spec.rb48
-rw-r--r--spec/ruby/library/date/conversions_spec.rb43
-rw-r--r--spec/ruby/library/date/ctime_spec.rb6
-rw-r--r--spec/ruby/library/date/cwday_spec.rb6
-rw-r--r--spec/ruby/library/date/cweek_spec.rb6
-rw-r--r--spec/ruby/library/date/cwyear_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_to_time_spec.rb6
-rw-r--r--spec/ruby/library/date/day_spec.rb9
-rw-r--r--spec/ruby/library/date/downto_spec.rb18
-rw-r--r--spec/ruby/library/date/england_spec.rb6
-rw-r--r--spec/ruby/library/date/eql_spec.rb12
-rw-r--r--spec/ruby/library/date/format/bag/method_missing_spec.rb6
-rw-r--r--spec/ruby/library/date/format/bag/to_hash_spec.rb6
-rw-r--r--spec/ruby/library/date/friday_spec.rb12
-rw-r--r--spec/ruby/library/date/gregorian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/gregorian_spec.rb16
-rw-r--r--spec/ruby/library/date/hash_spec.rb8
-rw-r--r--spec/ruby/library/date/infinity/abs_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/coerce_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/d_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/finite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/infinite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/nan_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uminus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uplus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/zero_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity_spec.rb67
-rw-r--r--spec/ruby/library/date/inspect_spec.rb6
-rw-r--r--spec/ruby/library/date/iso8601_spec.rb44
-rw-r--r--spec/ruby/library/date/italy_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_spec.rb15
-rw-r--r--spec/ruby/library/date/jd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_civil_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_commercial_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ld_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ordinal_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_wday_spec.rb6
-rw-r--r--spec/ruby/library/date/julian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/julian_spec.rb16
-rw-r--r--spec/ruby/library/date/ld_spec.rb6
-rw-r--r--spec/ruby/library/date/ld_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/leap_spec.rb10
-rw-r--r--spec/ruby/library/date/mday_spec.rb6
-rw-r--r--spec/ruby/library/date/minus_month_spec.rb23
-rw-r--r--spec/ruby/library/date/minus_spec.rb30
-rw-r--r--spec/ruby/library/date/mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/mjd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/mon_spec.rb6
-rw-r--r--spec/ruby/library/date/monday_spec.rb8
-rw-r--r--spec/ruby/library/date/month_spec.rb9
-rw-r--r--spec/ruby/library/date/new_spec.rb8
-rw-r--r--spec/ruby/library/date/new_start_spec.rb6
-rw-r--r--spec/ruby/library/date/next_day_spec.rb14
-rw-r--r--spec/ruby/library/date/next_month_spec.rb29
-rw-r--r--spec/ruby/library/date/next_spec.rb6
-rw-r--r--spec/ruby/library/date/next_year_spec.rb12
-rw-r--r--spec/ruby/library/date/ordinal_spec.rb7
-rw-r--r--spec/ruby/library/date/ordinal_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/parse_spec.rb159
-rw-r--r--spec/ruby/library/date/plus_spec.rb20
-rw-r--r--spec/ruby/library/date/prev_day_spec.rb14
-rw-r--r--spec/ruby/library/date/prev_month_spec.rb29
-rw-r--r--spec/ruby/library/date/prev_year_spec.rb12
-rw-r--r--spec/ruby/library/date/relationship_spec.rb20
-rw-r--r--spec/ruby/library/date/rfc3339_spec.rb13
-rw-r--r--spec/ruby/library/date/right_shift_spec.rb6
-rw-r--r--spec/ruby/library/date/saturday_spec.rb8
-rw-r--r--spec/ruby/library/date/shared/civil.rb57
-rw-r--r--spec/ruby/library/date/shared/commercial.rb39
-rw-r--r--spec/ruby/library/date/shared/jd.rb14
-rw-r--r--spec/ruby/library/date/shared/new_bang.rb14
-rw-r--r--spec/ruby/library/date/shared/ordinal.rb22
-rw-r--r--spec/ruby/library/date/shared/parse.rb54
-rw-r--r--spec/ruby/library/date/shared/parse_eu.rb37
-rw-r--r--spec/ruby/library/date/shared/parse_us.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_civil.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_commercial.rb34
-rw-r--r--spec/ruby/library/date/shared/valid_jd.rb32
-rw-r--r--spec/ruby/library/date/shared/valid_ordinal.rb26
-rw-r--r--spec/ruby/library/date/start_spec.rb6
-rw-r--r--spec/ruby/library/date/step_spec.rb56
-rw-r--r--spec/ruby/library/date/strftime_spec.rb40
-rw-r--r--spec/ruby/library/date/strptime_spec.rb149
-rw-r--r--spec/ruby/library/date/succ_spec.rb6
-rw-r--r--spec/ruby/library/date/sunday_spec.rb8
-rw-r--r--spec/ruby/library/date/thursday_spec.rb8
-rw-r--r--spec/ruby/library/date/time_to_day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/to_s_spec.rb6
-rw-r--r--spec/ruby/library/date/today_spec.rb14
-rw-r--r--spec/ruby/library/date/tuesday_spec.rb8
-rw-r--r--spec/ruby/library/date/upto_spec.rb16
-rw-r--r--spec/ruby/library/date/valid_civil_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_commercial_spec.rb8
-rw-r--r--spec/ruby/library/date/valid_date_spec.rb7
-rw-r--r--spec/ruby/library/date/valid_jd_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_ordinal_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_time_spec.rb6
-rw-r--r--spec/ruby/library/date/wday_spec.rb9
-rw-r--r--spec/ruby/library/date/wednesday_spec.rb8
-rw-r--r--spec/ruby/library/date/yday_spec.rb6
-rw-r--r--spec/ruby/library/date/year_spec.rb9
-rw-r--r--spec/ruby/library/date/zone_to_diff_spec.rb6
-rw-r--r--spec/ruby/library/datetime/_strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/add_spec.rb9
-rw-r--r--spec/ruby/library/datetime/civil_spec.rb6
-rw-r--r--spec/ruby/library/datetime/commercial_spec.rb6
-rw-r--r--spec/ruby/library/datetime/hour_spec.rb47
-rw-r--r--spec/ruby/library/datetime/httpdate_spec.rb6
-rw-r--r--spec/ruby/library/datetime/iso8601_spec.rb10
-rw-r--r--spec/ruby/library/datetime/jd_spec.rb6
-rw-r--r--spec/ruby/library/datetime/jisx0301_spec.rb10
-rw-r--r--spec/ruby/library/datetime/min_spec.rb6
-rw-r--r--spec/ruby/library/datetime/minute_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_spec.rb52
-rw-r--r--spec/ruby/library/datetime/now_spec.rb25
-rw-r--r--spec/ruby/library/datetime/offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/ordinal_spec.rb6
-rw-r--r--spec/ruby/library/datetime/parse_spec.rb127
-rw-r--r--spec/ruby/library/datetime/rfc2822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/rfc3339_spec.rb10
-rw-r--r--spec/ruby/library/datetime/rfc822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_spec.rb6
-rw-r--r--spec/ruby/library/datetime/shared/min.rb40
-rw-r--r--spec/ruby/library/datetime/shared/sec.rb45
-rw-r--r--spec/ruby/library/datetime/strftime_spec.rb51
-rw-r--r--spec/ruby/library/datetime/strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/subtract_spec.rb19
-rw-r--r--spec/ruby/library/datetime/to_date_spec.rb37
-rw-r--r--spec/ruby/library/datetime/to_datetime_spec.rb9
-rw-r--r--spec/ruby/library/datetime/to_s_spec.rb17
-rw-r--r--spec/ruby/library/datetime/to_time_spec.rb36
-rw-r--r--spec/ruby/library/datetime/xmlschema_spec.rb10
-rw-r--r--spec/ruby/library/datetime/zone_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_method_spec.rb52
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_methods_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegate_class/private_instance_methods_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegate_class/protected_instance_methods_spec.rb29
-rw-r--r--spec/ruby/library/delegate/delegate_class/public_instance_methods_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegate_class/respond_to_missing_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegator/case_compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/complement_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/eql_spec.rb35
-rw-r--r--spec/ruby/library/delegate/delegator/equal_spec.rb13
-rw-r--r--spec/ruby/library/delegate/delegator/equal_value_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/frozen_spec.rb39
-rw-r--r--spec/ruby/library/delegate/delegator/hash_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/marshal_spec.rb21
-rw-r--r--spec/ruby/library/delegate/delegator/method_spec.rb69
-rw-r--r--spec/ruby/library/delegate/delegator/methods_spec.rb37
-rw-r--r--spec/ruby/library/delegate/delegator/not_equal_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/not_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/private_methods_spec.rb20
-rw-r--r--spec/ruby/library/delegate/delegator/protected_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/public_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/send_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/taint_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegator/tap_spec.rb16
-rw-r--r--spec/ruby/library/delegate/delegator/trust_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/untaint_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/untrust_spec.rb25
-rw-r--r--spec/ruby/library/delegate/fixtures/classes.rb60
-rw-r--r--spec/ruby/library/digest/bubblebabble_spec.rb29
-rw-r--r--spec/ruby/library/digest/hexencode_spec.rb31
-rw-r--r--spec/ruby/library/digest/instance/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/instance/new_spec.rb19
-rw-r--r--spec/ruby/library/digest/instance/shared/update.rb8
-rw-r--r--spec/ruby/library/digest/instance/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/md5/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/equal_spec.rb37
-rw-r--r--spec/ruby/library/digest/md5/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/md5/shared/sample.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/md5/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/to_s_spec.rb24
-rw-r--r--spec/ruby/library/digest/md5/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha1/digest_spec.rb20
-rw-r--r--spec/ruby/library/digest/sha1/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha1/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha2/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha256/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha256/file_spec.rb47
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha256/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha256/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha256/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha256/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha384/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha384/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/shared/constants.rb19
-rw-r--r--spec/ruby/library/digest/sha384/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha384/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha384/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha384/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha512/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha512/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha512/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha512/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha512/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha512/update_spec.rb7
-rw-r--r--spec/ruby/library/drb/fixtures/test_server.rb8
-rw-r--r--spec/ruby/library/drb/start_service_spec.rb28
-rw-r--r--spec/ruby/library/erb/def_class_spec.rb29
-rw-r--r--spec/ruby/library/erb/def_method_spec.rb26
-rw-r--r--spec/ruby/library/erb/def_module_spec.rb27
-rw-r--r--spec/ruby/library/erb/defmethod/def_erb_method_spec.rb64
-rw-r--r--spec/ruby/library/erb/filename_spec.rb40
-rw-r--r--spec/ruby/library/erb/fixtures/classes.rb9
-rw-r--r--spec/ruby/library/erb/new_spec.rb148
-rw-r--r--spec/ruby/library/erb/result_spec.rb86
-rw-r--r--spec/ruby/library/erb/run_spec.rb96
-rw-r--r--spec/ruby/library/erb/src_spec.rb33
-rw-r--r--spec/ruby/library/erb/util/h_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/html_escape_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/shared/html_escape.rb42
-rw-r--r--spec/ruby/library/erb/util/shared/url_encode.rb42
-rw-r--r--spec/ruby/library/erb/util/u_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/url_encode_spec.rb7
-rw-r--r--spec/ruby/library/etc/confstr_spec.rb14
-rw-r--r--spec/ruby/library/etc/endgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/endpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrgid_spec.rb69
-rw-r--r--spec/ruby/library/etc/getgrnam_spec.rb30
-rw-r--r--spec/ruby/library/etc/getlogin_spec.rb43
-rw-r--r--spec/ruby/library/etc/getpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getpwnam_spec.rb28
-rw-r--r--spec/ruby/library/etc/getpwuid_spec.rb36
-rw-r--r--spec/ruby/library/etc/group_spec.rb27
-rw-r--r--spec/ruby/library/etc/nprocessors_spec.rb9
-rw-r--r--spec/ruby/library/etc/passwd_spec.rb15
-rw-r--r--spec/ruby/library/etc/shared/windows.rb7
-rw-r--r--spec/ruby/library/etc/struct_group_spec.rb35
-rw-r--r--spec/ruby/library/etc/struct_passwd_spec.rb43
-rw-r--r--spec/ruby/library/etc/sysconf_spec.rb22
-rw-r--r--spec/ruby/library/etc/sysconfdir_spec.rb8
-rw-r--r--spec/ruby/library/etc/systmpdir_spec.rb8
-rw-r--r--spec/ruby/library/expect/expect_spec.rb62
-rw-r--r--spec/ruby/library/fiber/alive_spec.rb46
-rw-r--r--spec/ruby/library/fiber/current_spec.rb63
-rw-r--r--spec/ruby/library/fiber/resume_spec.rb23
-rw-r--r--spec/ruby/library/fiber/transfer_spec.rb128
-rw-r--r--spec/ruby/library/find/find_spec.rb30
-rw-r--r--spec/ruby/library/find/fixtures/common.rb174
-rw-r--r--spec/ruby/library/find/prune_spec.rb12
-rw-r--r--spec/ruby/library/getoptlong/each_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/each_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/error_message_spec.rb23
-rw-r--r--spec/ruby/library/getoptlong/get_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/get_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/initialize_spec.rb28
-rw-r--r--spec/ruby/library/getoptlong/ordering_spec.rb38
-rw-r--r--spec/ruby/library/getoptlong/set_options_spec.rb98
-rw-r--r--spec/ruby/library/getoptlong/shared/each.rb18
-rw-r--r--spec/ruby/library/getoptlong/shared/get.rb62
-rw-r--r--spec/ruby/library/getoptlong/terminate_spec.rb30
-rw-r--r--spec/ruby/library/getoptlong/terminated_spec.rb17
-rw-r--r--spec/ruby/library/ipaddr/hton_spec.rb30
-rw-r--r--spec/ruby/library/ipaddr/ipv4_conversion_spec.rb44
-rw-r--r--spec/ruby/library/ipaddr/new_spec.rb93
-rw-r--r--spec/ruby/library/ipaddr/operator_spec.rb82
-rw-r--r--spec/ruby/library/ipaddr/reverse_spec.rb27
-rw-r--r--spec/ruby/library/ipaddr/to_s_spec.rb20
-rw-r--r--spec/ruby/library/logger/device/close_spec.rb31
-rw-r--r--spec/ruby/library/logger/device/new_spec.rb47
-rw-r--r--spec/ruby/library/logger/device/write_spec.rb51
-rw-r--r--spec/ruby/library/logger/fixtures/common.rb9
-rw-r--r--spec/ruby/library/logger/logger/add_spec.rb81
-rw-r--r--spec/ruby/library/logger/logger/close_spec.rb20
-rw-r--r--spec/ruby/library/logger/logger/datetime_format_spec.rb60
-rw-r--r--spec/ruby/library/logger/logger/debug_spec.rb52
-rw-r--r--spec/ruby/library/logger/logger/error_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/fatal_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/info_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/new_spec.rb118
-rw-r--r--spec/ruby/library/logger/logger/unknown_spec.rb36
-rw-r--r--spec/ruby/library/logger/logger/warn_spec.rb53
-rw-r--r--spec/ruby/library/logger/severity_spec.rb13
-rw-r--r--spec/ruby/library/matrix/I_spec.rb6
-rw-r--r--spec/ruby/library/matrix/antisymmetric_spec.rb37
-rw-r--r--spec/ruby/library/matrix/build_spec.rb73
-rw-r--r--spec/ruby/library/matrix/clone_spec.rb25
-rw-r--r--spec/ruby/library/matrix/coerce_spec.rb8
-rw-r--r--spec/ruby/library/matrix/collect_spec.rb6
-rw-r--r--spec/ruby/library/matrix/column_size_spec.rb13
-rw-r--r--spec/ruby/library/matrix/column_spec.rb35
-rw-r--r--spec/ruby/library/matrix/column_vector_spec.rb25
-rw-r--r--spec/ruby/library/matrix/column_vectors_spec.rb26
-rw-r--r--spec/ruby/library/matrix/columns_spec.rb42
-rw-r--r--spec/ruby/library/matrix/conj_spec.rb6
-rw-r--r--spec/ruby/library/matrix/conjugate_spec.rb6
-rw-r--r--spec/ruby/library/matrix/constructor_spec.rb65
-rw-r--r--spec/ruby/library/matrix/det_spec.rb7
-rw-r--r--spec/ruby/library/matrix/determinant_spec.rb7
-rw-r--r--spec/ruby/library/matrix/diagonal_spec.rb72
-rw-r--r--spec/ruby/library/matrix/divide_spec.rb54
-rw-r--r--spec/ruby/library/matrix/each_spec.rb74
-rw-r--r--spec/ruby/library/matrix/each_with_index_spec.rb81
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalue_matrix_spec.rb9
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalues_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvector_matrix_spec.rb20
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvectors_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/initialize_spec.rb24
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/to_a_spec.rb18
-rw-r--r--spec/ruby/library/matrix/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/matrix/empty_spec.rb68
-rw-r--r--spec/ruby/library/matrix/eql_spec.rb11
-rw-r--r--spec/ruby/library/matrix/equal_value_spec.rb11
-rw-r--r--spec/ruby/library/matrix/exponent_spec.rb51
-rw-r--r--spec/ruby/library/matrix/find_index_spec.rb146
-rw-r--r--spec/ruby/library/matrix/fixtures/classes.rb7
-rw-r--r--spec/ruby/library/matrix/hash_spec.rb15
-rw-r--r--spec/ruby/library/matrix/hermitian_spec.rb34
-rw-r--r--spec/ruby/library/matrix/identity_spec.rb6
-rw-r--r--spec/ruby/library/matrix/imag_spec.rb6
-rw-r--r--spec/ruby/library/matrix/imaginary_spec.rb6
-rw-r--r--spec/ruby/library/matrix/inspect_spec.rb27
-rw-r--r--spec/ruby/library/matrix/inv_spec.rb7
-rw-r--r--spec/ruby/library/matrix/inverse_from_spec.rb6
-rw-r--r--spec/ruby/library/matrix/inverse_spec.rb7
-rw-r--r--spec/ruby/library/matrix/lower_triangular_spec.rb24
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/determinant_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/initialize_spec.rb13
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/l_spec.rb18
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/p_spec.rb18
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/solve_spec.rb53
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/to_a_spec.rb33
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/u_spec.rb18
-rw-r--r--spec/ruby/library/matrix/map_spec.rb6
-rw-r--r--spec/ruby/library/matrix/minor_spec.rb85
-rw-r--r--spec/ruby/library/matrix/minus_spec.rb42
-rw-r--r--spec/ruby/library/matrix/multiply_spec.rb68
-rw-r--r--spec/ruby/library/matrix/new_spec.rb8
-rw-r--r--spec/ruby/library/matrix/normal_spec.rb26
-rw-r--r--spec/ruby/library/matrix/orthogonal_spec.rb26
-rw-r--r--spec/ruby/library/matrix/permutation_spec.rb32
-rw-r--r--spec/ruby/library/matrix/plus_spec.rb42
-rw-r--r--spec/ruby/library/matrix/rank_spec.rb19
-rw-r--r--spec/ruby/library/matrix/real_spec.rb43
-rw-r--r--spec/ruby/library/matrix/rect_spec.rb6
-rw-r--r--spec/ruby/library/matrix/rectangular_spec.rb6
-rw-r--r--spec/ruby/library/matrix/regular_spec.rb31
-rw-r--r--spec/ruby/library/matrix/round_spec.rb21
-rw-r--r--spec/ruby/library/matrix/row_size_spec.rb13
-rw-r--r--spec/ruby/library/matrix/row_spec.rb36
-rw-r--r--spec/ruby/library/matrix/row_vector_spec.rb24
-rw-r--r--spec/ruby/library/matrix/row_vectors_spec.rb26
-rw-r--r--spec/ruby/library/matrix/rows_spec.rb41
-rw-r--r--spec/ruby/library/matrix/scalar/Fail_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/Raise_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/divide_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/exponent_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/included_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/initialize_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/minus_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/multiply_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/plus_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar_spec.rb67
-rw-r--r--spec/ruby/library/matrix/shared/collect.rb26
-rw-r--r--spec/ruby/library/matrix/shared/conjugate.rb20
-rw-r--r--spec/ruby/library/matrix/shared/determinant.rb38
-rw-r--r--spec/ruby/library/matrix/shared/equal_value.rb33
-rw-r--r--spec/ruby/library/matrix/shared/identity.rb19
-rw-r--r--spec/ruby/library/matrix/shared/imaginary.rb20
-rw-r--r--spec/ruby/library/matrix/shared/inverse.rb38
-rw-r--r--spec/ruby/library/matrix/shared/rectangular.rb18
-rw-r--r--spec/ruby/library/matrix/shared/trace.rb12
-rw-r--r--spec/ruby/library/matrix/shared/transpose.rb19
-rw-r--r--spec/ruby/library/matrix/singular_spec.rb31
-rw-r--r--spec/ruby/library/matrix/spec_helper.rb35
-rw-r--r--spec/ruby/library/matrix/square_spec.rb28
-rw-r--r--spec/ruby/library/matrix/symmetric_spec.rb29
-rw-r--r--spec/ruby/library/matrix/t_spec.rb6
-rw-r--r--spec/ruby/library/matrix/to_a_spec.rb11
-rw-r--r--spec/ruby/library/matrix/to_s_spec.rb6
-rw-r--r--spec/ruby/library/matrix/tr_spec.rb7
-rw-r--r--spec/ruby/library/matrix/trace_spec.rb7
-rw-r--r--spec/ruby/library/matrix/transpose_spec.rb6
-rw-r--r--spec/ruby/library/matrix/unit_spec.rb6
-rw-r--r--spec/ruby/library/matrix/unitary_spec.rb33
-rw-r--r--spec/ruby/library/matrix/upper_triangular_spec.rb24
-rw-r--r--spec/ruby/library/matrix/vector/cross_product_spec.rb14
-rw-r--r--spec/ruby/library/matrix/vector/each2_spec.rb49
-rw-r--r--spec/ruby/library/matrix/vector/eql_spec.rb16
-rw-r--r--spec/ruby/library/matrix/vector/inner_product_spec.rb22
-rw-r--r--spec/ruby/library/matrix/vector/normalize_spec.rb18
-rw-r--r--spec/ruby/library/matrix/zero_spec.rb52
-rw-r--r--spec/ruby/library/mkmf/mkmf_spec.rb7
-rw-r--r--spec/ruby/library/monitor/mon_initialize_spec.rb31
-rw-r--r--spec/ruby/library/net/FTPError_spec.rb8
-rw-r--r--spec/ruby/library/net/FTPPermError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPProtoError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPReplyError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPTempError_spec.rb12
-rw-r--r--spec/ruby/library/net/ftp/abort_spec.rb62
-rw-r--r--spec/ruby/library/net/ftp/acct_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/binary_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/chdir_spec.rb99
-rw-r--r--spec/ruby/library/net/ftp/close_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/closed_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/connect_spec.rb49
-rw-r--r--spec/ruby/library/net/ftp/debug_mode_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/default_passive_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/delete_spec.rb59
-rw-r--r--spec/ruby/library/net/ftp/dir_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/fixtures/default_passive.rb3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/passive.rb2
-rw-r--r--spec/ruby/library/net/ftp/fixtures/putbinaryfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/puttextfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/server.rb277
-rw-r--r--spec/ruby/library/net/ftp/get_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/getbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/getdir_spec.rb7
-rw-r--r--spec/ruby/library/net/ftp/gettextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/help_spec.rb66
-rw-r--r--spec/ruby/library/net/ftp/initialize_spec.rb405
-rw-r--r--spec/ruby/library/net/ftp/last_response_code_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/last_response_spec.rb25
-rw-r--r--spec/ruby/library/net/ftp/lastresp_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/list_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/login_spec.rb195
-rw-r--r--spec/ruby/library/net/ftp/ls_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/mdtm_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/mkdir_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/mtime_spec.rb50
-rw-r--r--spec/ruby/library/net/ftp/nlst_spec.rb92
-rw-r--r--spec/ruby/library/net/ftp/noop_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/open_spec.rb55
-rw-r--r--spec/ruby/library/net/ftp/passive_spec.rb28
-rw-r--r--spec/ruby/library/net/ftp/put_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/putbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/puttextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/pwd_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/quit_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/rename_spec.rb94
-rw-r--r--spec/ruby/library/net/ftp/resume_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/retrbinary_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/retrlines_spec.rb34
-rw-r--r--spec/ruby/library/net/ftp/return_code_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/rmdir_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/sendcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/set_socket_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/shared/getbinaryfile.rb150
-rw-r--r--spec/ruby/library/net/ftp/shared/gettextfile.rb100
-rw-r--r--spec/ruby/library/net/ftp/shared/last_response_code.rb25
-rw-r--r--spec/ruby/library/net/ftp/shared/list.rb104
-rw-r--r--spec/ruby/library/net/ftp/shared/putbinaryfile.rb167
-rw-r--r--spec/ruby/library/net/ftp/shared/puttextfile.rb120
-rw-r--r--spec/ruby/library/net/ftp/shared/pwd.rb3
-rw-r--r--spec/ruby/library/net/ftp/site_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/size_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/spec_helper.rb5
-rw-r--r--spec/ruby/library/net/ftp/status_spec.rb67
-rw-r--r--spec/ruby/library/net/ftp/storbinary_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/storlines_spec.rb43
-rw-r--r--spec/ruby/library/net/ftp/system_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/voidcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/welcome_spec.rb25
-rw-r--r--spec/ruby/library/net/http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPClientExcepton_spec.rb14
-rw-r--r--spec/ruby/library/net/http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPServerException_spec.rb26
-rw-r--r--spec/ruby/library/net/http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net/http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net/http/http/fixtures/http_server.rb109
-rw-r--r--spec/ruby/library/net/http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_spec.rb95
-rw-r--r--spec/ruby/library/net/http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net/http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net/http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net/http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net/http/http/post_spec.rb74
-rw-r--r--spec/ruby/library/net/http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net/http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net/http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net/http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net/http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net/http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net/http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net/http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net/http/httpexceptions/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/net/http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net/http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/exec_spec.rb131
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net/http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net/http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net/http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net/http/httpheader/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/net/http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net/http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_content_type.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_form_data.rb27
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_type_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/exception_type_spec.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net/http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_body_spec.rb85
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_new_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net/http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/shared/body.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/value_spec.rb29
-rw-r--r--spec/ruby/library/objectspace/memsize_of_spec.rb34
-rw-r--r--spec/ruby/library/objectspace/reachable_objects_from_spec.rb61
-rw-r--r--spec/ruby/library/observer/add_observer_spec.rb23
-rw-r--r--spec/ruby/library/observer/count_observers_spec.rb23
-rw-r--r--spec/ruby/library/observer/delete_observer_spec.rb19
-rw-r--r--spec/ruby/library/observer/delete_observers_spec.rb19
-rw-r--r--spec/ruby/library/observer/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/observer/notify_observers_spec.rb31
-rw-r--r--spec/ruby/library/open3/capture2_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture3_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_r_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_rw_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_start_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_w_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen3_spec.rb41
-rw-r--r--spec/ruby/library/openssl/cipher_spec.rb9
-rw-r--r--spec/ruby/library/openssl/config/freeze_spec.rb22
-rw-r--r--spec/ruby/library/openssl/digest_spec.rb63
-rw-r--r--spec/ruby/library/openssl/hmac/digest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/hmac/hexdigest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/random/pseudo_bytes_spec.rb8
-rw-r--r--spec/ruby/library/openssl/random/random_bytes_spec.rb6
-rw-r--r--spec/ruby/library/openssl/random/shared/random_bytes.rb29
-rw-r--r--spec/ruby/library/openssl/shared/constants.rb11
-rw-r--r--spec/ruby/library/openssl/x509/name/parse_spec.rb48
-rw-r--r--spec/ruby/library/openstruct/delete_field_spec.rb19
-rw-r--r--spec/ruby/library/openstruct/element_reference_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/element_set_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/equal_value_spec.rb28
-rw-r--r--spec/ruby/library/openstruct/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/openstruct/frozen_spec.rb40
-rw-r--r--spec/ruby/library/openstruct/initialize_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/inspect_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/openstruct/marshal_load_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/method_missing_spec.rb26
-rw-r--r--spec/ruby/library/openstruct/new_spec.rb20
-rw-r--r--spec/ruby/library/openstruct/shared/inspect.rb20
-rw-r--r--spec/ruby/library/openstruct/to_h_spec.rb70
-rw-r--r--spec/ruby/library/openstruct/to_s_spec.rb8
-rw-r--r--spec/ruby/library/optionparser/order_spec.rb28
-rw-r--r--spec/ruby/library/optionparser/parse_spec.rb28
-rw-r--r--spec/ruby/library/pathname/absolute_spec.rb22
-rw-r--r--spec/ruby/library/pathname/empty_spec.rb32
-rw-r--r--spec/ruby/library/pathname/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/pathname/glob_spec.rb57
-rw-r--r--spec/ruby/library/pathname/hash_spec.rb14
-rw-r--r--spec/ruby/library/pathname/join_spec.rb40
-rw-r--r--spec/ruby/library/pathname/new_spec.rb30
-rw-r--r--spec/ruby/library/pathname/parent_spec.rb18
-rw-r--r--spec/ruby/library/pathname/pathname_spec.rb30
-rw-r--r--spec/ruby/library/pathname/realdirpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/realpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/relative_path_from_spec.rb51
-rw-r--r--spec/ruby/library/pathname/relative_spec.rb22
-rw-r--r--spec/ruby/library/pathname/root_spec.rb26
-rw-r--r--spec/ruby/library/pathname/sub_spec.rb15
-rw-r--r--spec/ruby/library/pp/pp_spec.rb23
-rw-r--r--spec/ruby/library/prime/each_spec.rb167
-rw-r--r--spec/ruby/library/prime/instance_spec.rb21
-rw-r--r--spec/ruby/library/prime/int_from_prime_division_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/each_prime_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/from_prime_division_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/prime_division_spec.rb19
-rw-r--r--spec/ruby/library/prime/integer/prime_spec.rb17
-rw-r--r--spec/ruby/library/prime/next_spec.rb7
-rw-r--r--spec/ruby/library/prime/prime_division_spec.rb25
-rw-r--r--spec/ruby/library/prime/prime_spec.rb17
-rw-r--r--spec/ruby/library/prime/shared/next.rb8
-rw-r--r--spec/ruby/library/prime/succ_spec.rb7
-rw-r--r--spec/ruby/library/rbconfig/rbconfig_spec.rb84
-rw-r--r--spec/ruby/library/rbconfig/sizeof/limits_spec.rb40
-rw-r--r--spec/ruby/library/rbconfig/sizeof/sizeof_spec.rb30
-rw-r--r--spec/ruby/library/rbconfig/unicode_emoji_version_spec.rb22
-rw-r--r--spec/ruby/library/rbconfig/unicode_version_spec.rb28
-rw-r--r--spec/ruby/library/readline/basic_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/basic_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_quote_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_append_character_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_case_fold_spec.rb18
-rw-r--r--spec/ruby/library/readline/completion_proc_spec.rb22
-rw-r--r--spec/ruby/library/readline/constants_spec.rb18
-rw-r--r--spec/ruby/library/readline/emacs_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/readline/filename_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/history/append_spec.rb28
-rw-r--r--spec/ruby/library/readline/history/delete_at_spec.rb47
-rw-r--r--spec/ruby/library/readline/history/each_spec.rb31
-rw-r--r--spec/ruby/library/readline/history/element_reference_spec.rb42
-rw-r--r--spec/ruby/library/readline/history/element_set_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/empty_spec.rb13
-rw-r--r--spec/ruby/library/readline/history/history_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/length_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/pop_spec.rb32
-rw-r--r--spec/ruby/library/readline/history/push_spec.rb26
-rw-r--r--spec/ruby/library/readline/history/shared/size.rb14
-rw-r--r--spec/ruby/library/readline/history/shift_spec.rb32
-rw-r--r--spec/ruby/library/readline/history/size_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/to_s_spec.rb9
-rw-r--r--spec/ruby/library/readline/readline_spec.rb33
-rw-r--r--spec/ruby/library/readline/spec_helper.rb11
-rw-r--r--spec/ruby/library/readline/vi_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/resolv/fixtures/hosts1
-rw-r--r--spec/ruby/library/resolv/get_address_spec.rb19
-rw-r--r--spec/ruby/library/resolv/get_addresses_spec.rb12
-rw-r--r--spec/ruby/library/resolv/get_name_spec.rb18
-rw-r--r--spec/ruby/library/resolv/get_names_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/clone_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/element_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/equal_value_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/hash_spec.rb16
-rw-r--r--spec/ruby/library/rexml/attribute/initialize_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attribute/inspect_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attribute/namespace_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attribute/node_type_spec.rb13
-rw-r--r--spec/ruby/library/rexml/attribute/prefix_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/remove_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/to_s_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/to_string_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/value_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/write_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/xpath_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attributes/add_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/append_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/delete_all_spec.rb34
-rw-r--r--spec/ruby/library/rexml/attributes/delete_spec.rb30
-rw-r--r--spec/ruby/library/rexml/attributes/each_attribute_spec.rb25
-rw-r--r--spec/ruby/library/rexml/attributes/each_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attributes/element_reference_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/element_set_spec.rb28
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_ns_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attributes/initialize_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/length_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/namespaces_spec.rb9
-rw-r--r--spec/ruby/library/rexml/attributes/prefixes_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attributes/shared/add.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/shared/length.rb13
-rw-r--r--spec/ruby/library/rexml/attributes/size_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/to_a_spec.rb22
-rw-r--r--spec/ruby/library/rexml/cdata/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/cdata/initialize_spec.rb27
-rw-r--r--spec/ruby/library/rexml/cdata/shared/to_s.rb11
-rw-r--r--spec/ruby/library/rexml/cdata/to_s_spec.rb10
-rw-r--r--spec/ruby/library/rexml/cdata/value_spec.rb10
-rw-r--r--spec/ruby/library/rexml/document/add_element_spec.rb34
-rw-r--r--spec/ruby/library/rexml/document/add_spec.rb60
-rw-r--r--spec/ruby/library/rexml/document/clone_spec.rb23
-rw-r--r--spec/ruby/library/rexml/document/doctype_spec.rb18
-rw-r--r--spec/ruby/library/rexml/document/encoding_spec.rb25
-rw-r--r--spec/ruby/library/rexml/document/expanded_name_spec.rb19
-rw-r--r--spec/ruby/library/rexml/document/new_spec.rb39
-rw-r--r--spec/ruby/library/rexml/document/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/document/root_spec.rb15
-rw-r--r--spec/ruby/library/rexml/document/stand_alone_spec.rb22
-rw-r--r--spec/ruby/library/rexml/document/version_spec.rb17
-rw-r--r--spec/ruby/library/rexml/document/write_spec.rb38
-rw-r--r--spec/ruby/library/rexml/document/xml_decl_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/add_attribute_spec.rb44
-rw-r--r--spec/ruby/library/rexml/element/add_attributes_spec.rb25
-rw-r--r--spec/ruby/library/rexml/element/add_element_spec.rb41
-rw-r--r--spec/ruby/library/rexml/element/add_namespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/add_text_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/attribute_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/attributes_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/cdatas_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/clone_spec.rb32
-rw-r--r--spec/ruby/library/rexml/element/comments_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/delete_attribute_spec.rb42
-rw-r--r--spec/ruby/library/rexml/element/delete_element_spec.rb52
-rw-r--r--spec/ruby/library/rexml/element/delete_namespace_spec.rb28
-rw-r--r--spec/ruby/library/rexml/element/document_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_attribute_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_text_spec.rb34
-rw-r--r--spec/ruby/library/rexml/element/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/get_text_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_attributes_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/has_elements_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_text_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/inspect_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/instructions_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/namespace_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/namespaces_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/new_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/next_element_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/element/prefixes_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/previous_element_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/raw_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/root_spec.rb31
-rw-r--r--spec/ruby/library/rexml/element/text_spec.rb49
-rw-r--r--spec/ruby/library/rexml/element/texts_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/whitespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/node/each_recursive_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/find_first_recursive_spec.rb28
-rw-r--r--spec/ruby/library/rexml/node/index_in_parent_spec.rb18
-rw-r--r--spec/ruby/library/rexml/node/next_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/parent_spec.rb23
-rw-r--r--spec/ruby/library/rexml/node/previous_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/shared/each_element.rb36
-rw-r--r--spec/ruby/library/rexml/shared/elements_to_a.rb34
-rw-r--r--spec/ruby/library/rexml/text/append_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/comparison_spec.rb28
-rw-r--r--spec/ruby/library/rexml/text/empty_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/indent_text_spec.rb26
-rw-r--r--spec/ruby/library/rexml/text/inspect_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/new_spec.rb51
-rw-r--r--spec/ruby/library/rexml/text/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/normalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/read_with_substitution_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/to_s_spec.rb20
-rw-r--r--spec/ruby/library/rexml/text/unnormalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/value_spec.rb40
-rw-r--r--spec/ruby/library/rexml/text/wrap_spec.rb23
-rw-r--r--spec/ruby/library/rexml/text/write_with_substitution_spec.rb36
-rw-r--r--spec/ruby/library/ripper/lex_spec.rb23
-rw-r--r--spec/ruby/library/ripper/sexp_spec.rb13
-rw-r--r--spec/ruby/library/rubygems/gem/bin_path_spec.rb34
-rw-r--r--spec/ruby/library/scanf/io/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/io/fixtures/date.txt4
-rw-r--r--spec/ruby/library/scanf/io/fixtures/helloworld.txt1
-rw-r--r--spec/ruby/library/scanf/io/scanf_spec.rb38
-rw-r--r--spec/ruby/library/scanf/io/shared/block_scanf.rb28
-rw-r--r--spec/ruby/library/scanf/string/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/string/scanf_spec.rb56
-rw-r--r--spec/ruby/library/scanf/string/shared/block_scanf.rb25
-rw-r--r--spec/ruby/library/securerandom/base64_spec.rb55
-rw-r--r--spec/ruby/library/securerandom/bytes_spec.rb8
-rw-r--r--spec/ruby/library/securerandom/hex_spec.rb54
-rw-r--r--spec/ruby/library/securerandom/random_bytes_spec.rb53
-rw-r--r--spec/ruby/library/securerandom/random_number_spec.rb97
-rw-r--r--spec/ruby/library/set/add_spec.rb27
-rw-r--r--spec/ruby/library/set/append_spec.rb7
-rw-r--r--spec/ruby/library/set/case_compare_spec.rb12
-rw-r--r--spec/ruby/library/set/case_equality_spec.rb7
-rw-r--r--spec/ruby/library/set/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/compare_by_identity_spec.rb143
-rw-r--r--spec/ruby/library/set/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/disjoint_spec.rb23
-rw-r--r--spec/ruby/library/set/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/each_spec.rb26
-rw-r--r--spec/ruby/library/set/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/enumerable/to_set_spec.rb21
-rw-r--r--spec/ruby/library/set/eql_spec.rb15
-rw-r--r--spec/ruby/library/set/equal_value_spec.rb33
-rw-r--r--spec/ruby/library/set/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/filter_spec.rb8
-rw-r--r--spec/ruby/library/set/fixtures/set_like.rb31
-rw-r--r--spec/ruby/library/set/flatten_merge_spec.rb23
-rw-r--r--spec/ruby/library/set/flatten_spec.rb53
-rw-r--r--spec/ruby/library/set/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/include_spec.rb7
-rw-r--r--spec/ruby/library/set/initialize_spec.rb48
-rw-r--r--spec/ruby/library/set/inspect_spec.rb7
-rw-r--r--spec/ruby/library/set/intersect_spec.rb23
-rw-r--r--spec/ruby/library/set/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/keep_if_spec.rb38
-rw-r--r--spec/ruby/library/set/length_spec.rb7
-rw-r--r--spec/ruby/library/set/map_spec.rb7
-rw-r--r--spec/ruby/library/set/member_spec.rb7
-rw-r--r--spec/ruby/library/set/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/pretty_print_spec.rb17
-rw-r--r--spec/ruby/library/set/proper_subset_spec.rb41
-rw-r--r--spec/ruby/library/set/proper_superset_spec.rb41
-rw-r--r--spec/ruby/library/set/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/select_spec.rb6
-rw-r--r--spec/ruby/library/set/shared/add.rb14
-rw-r--r--spec/ruby/library/set/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/shared/include.rb29
-rw-r--r--spec/ruby/library/set/shared/inspect.rb15
-rw-r--r--spec/ruby/library/set/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/shared/length.rb6
-rw-r--r--spec/ruby/library/set/shared/select.rb42
-rw-r--r--spec/ruby/library/set/shared/union.rb15
-rw-r--r--spec/ruby/library/set/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/add_spec.rb42
-rw-r--r--spec/ruby/library/set/sortedset/append_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/case_equality_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/classify_spec.rb30
-rw-r--r--spec/ruby/library/set/sortedset/clear_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/collect_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/constructor_spec.rb18
-rw-r--r--spec/ruby/library/set/sortedset/delete_if_spec.rb41
-rw-r--r--spec/ruby/library/set/sortedset/delete_spec.rb40
-rw-r--r--spec/ruby/library/set/sortedset/difference_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/divide_spec.rb37
-rw-r--r--spec/ruby/library/set/sortedset/each_spec.rb29
-rw-r--r--spec/ruby/library/set/sortedset/empty_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/eql_spec.rb19
-rw-r--r--spec/ruby/library/set/sortedset/equal_value_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/exclusion_spec.rb21
-rw-r--r--spec/ruby/library/set/sortedset/filter_spec.rb12
-rw-r--r--spec/ruby/library/set/sortedset/flatten_merge_spec.rb11
-rw-r--r--spec/ruby/library/set/sortedset/flatten_spec.rb47
-rw-r--r--spec/ruby/library/set/sortedset/hash_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/include_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/initialize_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/inspect_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/intersection_spec.rb14
-rw-r--r--spec/ruby/library/set/sortedset/keep_if_spec.rb34
-rw-r--r--spec/ruby/library/set/sortedset/length_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/map_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/member_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/merge_spec.rb22
-rw-r--r--spec/ruby/library/set/sortedset/minus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/plus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_cycle_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/proper_subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/proper_superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/reject_spec.rb45
-rw-r--r--spec/ruby/library/set/sortedset/replace_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/select_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/shared/add.rb14
-rw-r--r--spec/ruby/library/set/sortedset/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/sortedset/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/include.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/length.rb6
-rw-r--r--spec/ruby/library/set/sortedset/shared/select.rb35
-rw-r--r--spec/ruby/library/set/sortedset/shared/union.rb15
-rw-r--r--spec/ruby/library/set/sortedset/size_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/subtract_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/to_a_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/union_spec.rb14
-rw-r--r--spec/ruby/library/set/subset_spec.rb41
-rw-r--r--spec/ruby/library/set/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/superset_spec.rb41
-rw-r--r--spec/ruby/library/set/to_a_spec.rb8
-rw-r--r--spec/ruby/library/set/to_s_spec.rb11
-rw-r--r--spec/ruby/library/set/union_spec.rb11
-rw-r--r--spec/ruby/library/shellwords/shellwords_spec.rb34
-rw-r--r--spec/ruby/library/singleton/allocate_spec.rb8
-rw-r--r--spec/ruby/library/singleton/clone_spec.rb8
-rw-r--r--spec/ruby/library/singleton/dump_spec.rb14
-rw-r--r--spec/ruby/library/singleton/dup_spec.rb8
-rw-r--r--spec/ruby/library/singleton/fixtures/classes.rb18
-rw-r--r--spec/ruby/library/singleton/instance_spec.rb30
-rw-r--r--spec/ruby/library/singleton/load_spec.rb21
-rw-r--r--spec/ruby/library/singleton/new_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/afamily_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/bind_spec.rb28
-rw-r--r--spec/ruby/library/socket/addrinfo/canonname_spec.rb27
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_from_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_to_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/family_addrinfo_spec.rb115
-rw-r--r--spec/ruby/library/socket/addrinfo/foreach_spec.rb9
-rw-r--r--spec/ruby/library/socket/addrinfo/getaddrinfo_spec.rb91
-rw-r--r--spec/ruby/library/socket/addrinfo/getnameinfo_spec.rb42
-rw-r--r--spec/ruby/library/socket/addrinfo/initialize_spec.rb591
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_sockaddr_spec.rb50
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_spec.rb65
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_address_spec.rb66
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_port_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_spec.rb64
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_unpack_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_loopback_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_multicast_spec.rb29
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_private_spec.rb47
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_linklocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_loopback_spec.rb45
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_global_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_linklocal_spec.rb19
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_nodelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_orglocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_sitelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_multicast_spec.rb48
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_sitelocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_to_ipv4_spec.rb71
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unique_local_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unspecified_spec.rb15
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4compat_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4mapped_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/listen_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_dump_spec.rb84
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_load_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/pfamily_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/protocol_spec.rb24
-rw-r--r--spec/ruby/library/socket/addrinfo/shared/to_sockaddr.rb51
-rw-r--r--spec/ruby/library/socket/addrinfo/socktype_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/tcp_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/to_s_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/to_sockaddr_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/udp_spec.rb36
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_path_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_spec.rb71
-rw-r--r--spec/ruby/library/socket/ancillarydata/cmsg_is_spec.rb33
-rw-r--r--spec/ruby/library/socket/ancillarydata/data_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/family_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/initialize_spec.rb284
-rw-r--r--spec/ruby/library/socket/ancillarydata/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/ancillarydata/ip_pktinfo_spec.rb145
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_addr_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_ifindex_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_spec.rb89
-rw-r--r--spec/ruby/library/socket/ancillarydata/level_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/type_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/unix_rights_spec.rb61
-rw-r--r--spec/ruby/library/socket/basicsocket/close_read_spec.rb43
-rw-r--r--spec/ruby/library/socket/basicsocket/close_write_spec.rb48
-rw-r--r--spec/ruby/library/socket/basicsocket/connect_address_spec.rb154
-rw-r--r--spec/ruby/library/socket/basicsocket/do_not_reverse_lookup_spec.rb103
-rw-r--r--spec/ruby/library/socket/basicsocket/for_fd_spec.rb38
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeereid_spec.rb36
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeername_spec.rb25
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockname_spec.rb28
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockopt_spec.rb188
-rw-r--r--spec/ruby/library/socket/basicsocket/ioctl_spec.rb42
-rw-r--r--spec/ruby/library/socket/basicsocket/read_nonblock_spec.rb44
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_nonblock_spec.rb70
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_spec.rb159
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_nonblock_spec.rb209
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_spec.rb197
-rw-r--r--spec/ruby/library/socket/basicsocket/send_spec.rb212
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_nonblock_spec.rb113
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_spec.rb111
-rw-r--r--spec/ruby/library/socket/basicsocket/setsockopt_spec.rb336
-rw-r--r--spec/ruby/library/socket/basicsocket/shutdown_spec.rb155
-rw-r--r--spec/ruby/library/socket/basicsocket/write_nonblock_spec.rb43
-rw-r--r--spec/ruby/library/socket/constants/constants_spec.rb108
-rw-r--r--spec/ruby/library/socket/fixtures/classes.rb164
-rw-r--r--spec/ruby/library/socket/fixtures/send_io.txt1
-rw-r--r--spec/ruby/library/socket/ipsocket/addr_spec.rb105
-rw-r--r--spec/ruby/library/socket/ipsocket/getaddress_spec.rb25
-rw-r--r--spec/ruby/library/socket/ipsocket/peeraddr_spec.rb117
-rw-r--r--spec/ruby/library/socket/ipsocket/recvfrom_spec.rb123
-rw-r--r--spec/ruby/library/socket/option/bool_spec.rb27
-rw-r--r--spec/ruby/library/socket/option/initialize_spec.rb83
-rw-r--r--spec/ruby/library/socket/option/inspect_spec.rb19
-rw-r--r--spec/ruby/library/socket/option/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/option/linger_spec.rb76
-rw-r--r--spec/ruby/library/socket/option/new_spec.rb35
-rw-r--r--spec/ruby/library/socket/shared/pack_sockaddr.rb99
-rw-r--r--spec/ruby/library/socket/shared/partially_closable_sockets.rb13
-rw-r--r--spec/ruby/library/socket/shared/socketpair.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_loop_spec.rb84
-rw-r--r--spec/ruby/library/socket/socket/accept_nonblock_spec.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_spec.rb121
-rw-r--r--spec/ruby/library/socket/socket/bind_spec.rb146
-rw-r--r--spec/ruby/library/socket/socket/connect_nonblock_spec.rb149
-rw-r--r--spec/ruby/library/socket/socket/connect_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/for_fd_spec.rb30
-rw-r--r--spec/ruby/library/socket/socket/getaddrinfo_spec.rb373
-rw-r--r--spec/ruby/library/socket/socket/gethostbyaddr_spec.rb124
-rw-r--r--spec/ruby/library/socket/socket/gethostbyname_spec.rb135
-rw-r--r--spec/ruby/library/socket/socket/gethostname_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/getifaddrs_spec.rb117
-rw-r--r--spec/ruby/library/socket/socket/getnameinfo_spec.rb147
-rw-r--r--spec/ruby/library/socket/socket/getservbyname_spec.rb32
-rw-r--r--spec/ruby/library/socket/socket/getservbyport_spec.rb23
-rw-r--r--spec/ruby/library/socket/socket/initialize_spec.rb87
-rw-r--r--spec/ruby/library/socket/socket/ip_address_list_spec.rb50
-rw-r--r--spec/ruby/library/socket/socket/ipv6only_bang_spec.rb20
-rw-r--r--spec/ruby/library/socket/socket/listen_spec.rb66
-rw-r--r--spec/ruby/library/socket/socket/local_address_spec.rb43
-rw-r--r--spec/ruby/library/socket/socket/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_spec.rb92
-rw-r--r--spec/ruby/library/socket/socket/remote_address_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/socket_spec.rb38
-rw-r--r--spec/ruby/library/socket/socket/socketpair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sysaccept_spec.rb91
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_loop_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/tcp_spec.rb70
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_on_spec.rb47
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_spec.rb57
-rw-r--r--spec/ruby/library/socket/socket/udp_server_recv_spec.rb35
-rw-r--r--spec/ruby/library/socket/socket/udp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/unix_server_loop_spec.rb58
-rw-r--r--spec/ruby/library/socket/socket/unix_server_socket_spec.rb48
-rw-r--r--spec/ruby/library/socket/socket/unix_spec.rb45
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_in_spec.rb46
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_un_spec.rb26
-rw-r--r--spec/ruby/library/socket/spec_helper.rb13
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_nonblock_spec.rb85
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_spec.rb119
-rw-r--r--spec/ruby/library/socket/tcpserver/gets_spec.rb16
-rw-r--r--spec/ruby/library/socket/tcpserver/initialize_spec.rb101
-rw-r--r--spec/ruby/library/socket/tcpserver/listen_spec.rb22
-rw-r--r--spec/ruby/library/socket/tcpserver/new_spec.rb131
-rw-r--r--spec/ruby/library/socket/tcpserver/sysaccept_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/gethostbyname_spec.rb119
-rw-r--r--spec/ruby/library/socket/tcpsocket/initialize_spec.rb61
-rw-r--r--spec/ruby/library/socket/tcpsocket/local_address_spec.rb73
-rw-r--r--spec/ruby/library/socket/tcpsocket/new_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/open_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/partially_closable_spec.rb21
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_nonblock_spec.rb34
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_spec.rb28
-rw-r--r--spec/ruby/library/socket/tcpsocket/remote_address_spec.rb72
-rw-r--r--spec/ruby/library/socket/tcpsocket/setsockopt_spec.rb45
-rw-r--r--spec/ruby/library/socket/tcpsocket/shared/new.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/bind_spec.rb83
-rw-r--r--spec/ruby/library/socket/udpsocket/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/udpsocket/initialize_spec.rb40
-rw-r--r--spec/ruby/library/socket/udpsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/udpsocket/local_address_spec.rb80
-rw-r--r--spec/ruby/library/socket/udpsocket/new_spec.rb34
-rw-r--r--spec/ruby/library/socket/udpsocket/open_spec.rb13
-rw-r--r--spec/ruby/library/socket/udpsocket/recvfrom_nonblock_spec.rb95
-rw-r--r--spec/ruby/library/socket/udpsocket/remote_address_spec.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/send_spec.rb154
-rw-r--r--spec/ruby/library/socket/udpsocket/write_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/accept_nonblock_spec.rb92
-rw-r--r--spec/ruby/library/socket/unixserver/accept_spec.rb117
-rw-r--r--spec/ruby/library/socket/unixserver/for_fd_spec.rb23
-rw-r--r--spec/ruby/library/socket/unixserver/initialize_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixserver/listen_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixserver/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/shared/new.rb22
-rw-r--r--spec/ruby/library/socket/unixserver/sysaccept_spec.rb52
-rw-r--r--spec/ruby/library/socket/unixsocket/addr_spec.rb36
-rw-r--r--spec/ruby/library/socket/unixsocket/initialize_spec.rb38
-rw-r--r--spec/ruby/library/socket/unixsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/unixsocket/local_address_spec.rb96
-rw-r--r--spec/ruby/library/socket/unixsocket/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixsocket/open_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/pair_spec.rb39
-rw-r--r--spec/ruby/library/socket/unixsocket/partially_closable_spec.rb25
-rw-r--r--spec/ruby/library/socket/unixsocket/path_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/peeraddr_spec.rb30
-rw-r--r--spec/ruby/library/socket/unixsocket/recv_io_spec.rb87
-rw-r--r--spec/ruby/library/socket/unixsocket/recvfrom_spec.rb98
-rw-r--r--spec/ruby/library/socket/unixsocket/remote_address_spec.rb45
-rw-r--r--spec/ruby/library/socket/unixsocket/send_io_spec.rb58
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/new.rb24
-rw-r--r--spec/ruby/library/socket/unixsocket/socketpair_spec.rb40
-rw-r--r--spec/ruby/library/stringio/append_spec.rb88
-rw-r--r--spec/ruby/library/stringio/binmode_spec.rb23
-rw-r--r--spec/ruby/library/stringio/bytes_spec.rb13
-rw-r--r--spec/ruby/library/stringio/chars_spec.rb13
-rw-r--r--spec/ruby/library/stringio/close_read_spec.rb31
-rw-r--r--spec/ruby/library/stringio/close_spec.rb23
-rw-r--r--spec/ruby/library/stringio/close_write_spec.rb31
-rw-r--r--spec/ruby/library/stringio/closed_read_spec.rb12
-rw-r--r--spec/ruby/library/stringio/closed_spec.rb16
-rw-r--r--spec/ruby/library/stringio/closed_write_spec.rb12
-rw-r--r--spec/ruby/library/stringio/codepoints_spec.rb12
-rw-r--r--spec/ruby/library/stringio/each_byte_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_char_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_codepoint_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_line_spec.rb19
-rw-r--r--spec/ruby/library/stringio/each_spec.rb19
-rw-r--r--spec/ruby/library/stringio/eof_spec.rb11
-rw-r--r--spec/ruby/library/stringio/external_encoding_spec.rb25
-rw-r--r--spec/ruby/library/stringio/fcntl_spec.rb8
-rw-r--r--spec/ruby/library/stringio/fileno_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fixtures/classes.rb15
-rw-r--r--spec/ruby/library/stringio/flush_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fsync_spec.rb9
-rw-r--r--spec/ruby/library/stringio/getbyte_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getc_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getch_spec.rb44
-rw-r--r--spec/ruby/library/stringio/getpass_spec.rb11
-rw-r--r--spec/ruby/library/stringio/gets_spec.rb246
-rw-r--r--spec/ruby/library/stringio/initialize_spec.rb222
-rw-r--r--spec/ruby/library/stringio/inspect_spec.rb19
-rw-r--r--spec/ruby/library/stringio/internal_encoding_spec.rb10
-rw-r--r--spec/ruby/library/stringio/isatty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/length_spec.rb7
-rw-r--r--spec/ruby/library/stringio/lineno_spec.rb30
-rw-r--r--spec/ruby/library/stringio/lines_spec.rb21
-rw-r--r--spec/ruby/library/stringio/open_spec.rb207
-rw-r--r--spec/ruby/library/stringio/path_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pid_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pos_spec.rb28
-rw-r--r--spec/ruby/library/stringio/print_spec.rb102
-rw-r--r--spec/ruby/library/stringio/printf_spec.rb70
-rw-r--r--spec/ruby/library/stringio/putc_spec.rb88
-rw-r--r--spec/ruby/library/stringio/puts_spec.rb170
-rw-r--r--spec/ruby/library/stringio/read_nonblock_spec.rb42
-rw-r--r--spec/ruby/library/stringio/read_spec.rb62
-rw-r--r--spec/ruby/library/stringio/readbyte_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readchar_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readline_spec.rb130
-rw-r--r--spec/ruby/library/stringio/readlines_spec.rb100
-rw-r--r--spec/ruby/library/stringio/readpartial_spec.rb80
-rw-r--r--spec/ruby/library/stringio/reopen_spec.rb298
-rw-r--r--spec/ruby/library/stringio/rewind_spec.rb24
-rw-r--r--spec/ruby/library/stringio/seek_spec.rb67
-rw-r--r--spec/ruby/library/stringio/set_encoding_spec.rb20
-rw-r--r--spec/ruby/library/stringio/shared/codepoints.rb45
-rw-r--r--spec/ruby/library/stringio/shared/each.rb115
-rw-r--r--spec/ruby/library/stringio/shared/each_byte.rb48
-rw-r--r--spec/ruby/library/stringio/shared/each_char.rb36
-rw-r--r--spec/ruby/library/stringio/shared/eof.rb24
-rw-r--r--spec/ruby/library/stringio/shared/getc.rb43
-rw-r--r--spec/ruby/library/stringio/shared/isatty.rb5
-rw-r--r--spec/ruby/library/stringio/shared/length.rb5
-rw-r--r--spec/ruby/library/stringio/shared/read.rb121
-rw-r--r--spec/ruby/library/stringio/shared/readchar.rb29
-rw-r--r--spec/ruby/library/stringio/shared/sysread.rb15
-rw-r--r--spec/ruby/library/stringio/shared/tell.rb12
-rw-r--r--spec/ruby/library/stringio/shared/write.rb91
-rw-r--r--spec/ruby/library/stringio/size_spec.rb7
-rw-r--r--spec/ruby/library/stringio/string_spec.rb50
-rw-r--r--spec/ruby/library/stringio/stringio_spec.rb8
-rw-r--r--spec/ruby/library/stringio/sync_spec.rb19
-rw-r--r--spec/ruby/library/stringio/sysread_spec.rb48
-rw-r--r--spec/ruby/library/stringio/syswrite_spec.rb19
-rw-r--r--spec/ruby/library/stringio/tell_spec.rb7
-rw-r--r--spec/ruby/library/stringio/truncate_spec.rb70
-rw-r--r--spec/ruby/library/stringio/tty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/ungetbyte_spec.rb6
-rw-r--r--spec/ruby/library/stringio/ungetc_spec.rb72
-rw-r--r--spec/ruby/library/stringio/write_nonblock_spec.rb19
-rw-r--r--spec/ruby/library/stringio/write_spec.rb19
-rw-r--r--spec/ruby/library/stringscanner/append_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/beginning_of_line_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/bol_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/check_spec.rb16
-rw-r--r--spec/ruby/library/stringscanner/check_until_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/clear_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/concat_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/dup_spec.rb39
-rw-r--r--spec/ruby/library/stringscanner/element_reference_spec.rb60
-rw-r--r--spec/ruby/library/stringscanner/empty_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/eos_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/exist_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/get_byte_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/getbyte_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/getch_spec.rb35
-rw-r--r--spec/ruby/library/stringscanner/initialize_spec.rb27
-rw-r--r--spec/ruby/library/stringscanner/inspect_spec.rb20
-rw-r--r--spec/ruby/library/stringscanner/match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/matched_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/matched_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/must_C_version_spec.rb8
-rw-r--r--spec/ruby/library/stringscanner/peek_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/peep_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/pointer_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/pos_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/post_match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/pre_match_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/reset_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/rest_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/rest_spec.rb48
-rw-r--r--spec/ruby/library/stringscanner/restsize_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/scan_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/scan_spec.rb97
-rw-r--r--spec/ruby/library/stringscanner/scan_until_spec.rb23
-rw-r--r--spec/ruby/library/stringscanner/search_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/bol.rb25
-rw-r--r--spec/ruby/library/stringscanner/shared/concat.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/eos.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range.rb24
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range_matched.rb24
-rw-r--r--spec/ruby/library/stringscanner/shared/get_byte.rb29
-rw-r--r--spec/ruby/library/stringscanner/shared/matched_size.rb21
-rw-r--r--spec/ruby/library/stringscanner/shared/peek.rb49
-rw-r--r--spec/ruby/library/stringscanner/shared/pos.rb52
-rw-r--r--spec/ruby/library/stringscanner/shared/rest_size.rb18
-rw-r--r--spec/ruby/library/stringscanner/shared/terminate.rb8
-rw-r--r--spec/ruby/library/stringscanner/skip_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/skip_until_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/string_spec.rb40
-rw-r--r--spec/ruby/library/stringscanner/terminate_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/unscan_spec.rb28
-rw-r--r--spec/ruby/library/syslog/alert_spec.rb10
-rw-r--r--spec/ruby/library/syslog/close_spec.rb58
-rw-r--r--spec/ruby/library/syslog/constants_spec.rb41
-rw-r--r--spec/ruby/library/syslog/crit_spec.rb10
-rw-r--r--spec/ruby/library/syslog/debug_spec.rb10
-rw-r--r--spec/ruby/library/syslog/emerg_spec.rb16
-rw-r--r--spec/ruby/library/syslog/err_spec.rb10
-rw-r--r--spec/ruby/library/syslog/facility_spec.rb48
-rw-r--r--spec/ruby/library/syslog/ident_spec.rb35
-rw-r--r--spec/ruby/library/syslog/info_spec.rb10
-rw-r--r--spec/ruby/library/syslog/inspect_spec.rb39
-rw-r--r--spec/ruby/library/syslog/instance_spec.rb13
-rw-r--r--spec/ruby/library/syslog/log_spec.rb56
-rw-r--r--spec/ruby/library/syslog/mask_spec.rb113
-rw-r--r--spec/ruby/library/syslog/notice_spec.rb10
-rw-r--r--spec/ruby/library/syslog/open_spec.rb92
-rw-r--r--spec/ruby/library/syslog/opened_spec.rb39
-rw-r--r--spec/ruby/library/syslog/options_spec.rb48
-rw-r--r--spec/ruby/library/syslog/reopen_spec.rb10
-rw-r--r--spec/ruby/library/syslog/shared/log.rb39
-rw-r--r--spec/ruby/library/syslog/shared/reopen.rb40
-rw-r--r--spec/ruby/library/syslog/warning_spec.rb10
-rw-r--r--spec/ruby/library/tempfile/_close_spec.rb21
-rw-r--r--spec/ruby/library/tempfile/callback_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/close_spec.rb57
-rw-r--r--spec/ruby/library/tempfile/delete_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/initialize_spec.rb46
-rw-r--r--spec/ruby/library/tempfile/length_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/open_spec.rb97
-rw-r--r--spec/ruby/library/tempfile/path_spec.rb26
-rw-r--r--spec/ruby/library/tempfile/shared/length.rb21
-rw-r--r--spec/ruby/library/tempfile/shared/unlink.rb12
-rw-r--r--spec/ruby/library/tempfile/size_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/unlink_spec.rb7
-rw-r--r--spec/ruby/library/thread/queue_spec.rb8
-rw-r--r--spec/ruby/library/thread/sizedqueue_spec.rb8
-rw-r--r--spec/ruby/library/time/httpdate_spec.rb21
-rw-r--r--spec/ruby/library/time/iso8601_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc2822_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc822_spec.rb7
-rw-r--r--spec/ruby/library/time/shared/rfc2822.rb65
-rw-r--r--spec/ruby/library/time/shared/xmlschema.rb53
-rw-r--r--spec/ruby/library/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/time/to_datetime_spec.rb27
-rw-r--r--spec/ruby/library/time/to_time_spec.rb15
-rw-r--r--spec/ruby/library/time/xmlschema_spec.rb7
-rw-r--r--spec/ruby/library/timeout/error_spec.rb8
-rw-r--r--spec/ruby/library/timeout/timeout_spec.rb42
-rw-r--r--spec/ruby/library/tmpdir/dir/mktmpdir_spec.rb117
-rw-r--r--spec/ruby/library/tmpdir/dir/tmpdir_spec.rb10
-rw-r--r--spec/ruby/library/uri/decode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/decode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/eql_spec.rb10
-rw-r--r--spec/ruby/library/uri/equality_spec.rb46
-rw-r--r--spec/ruby/library/uri/escape/decode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/encode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/extract_spec.rb86
-rw-r--r--spec/ruby/library/uri/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/uri/fixtures/normalization.rb54
-rw-r--r--spec/ruby/library/uri/ftp/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/merge_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/new2_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/path_spec.rb26
-rw-r--r--spec/ruby/library/uri/ftp/set_typecode_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/to_s_spec.rb15
-rw-r--r--spec/ruby/library/uri/ftp/typecode_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/absolute_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/build2_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/coerce_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_ary_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/default_port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/eql_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/equal_value_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/fragment_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/hash_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/host_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/merge_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/minus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/normalize_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/opaque_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/password_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/path_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/plus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/query_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/registry_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/relative_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_from_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/scheme_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/select_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_fragment_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_host_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_opaque_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_password_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_path_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_port_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_query_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_scheme_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_user_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_userinfo_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/use_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/user_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/userinfo_spec.rb10
-rw-r--r--spec/ruby/library/uri/http/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/http/request_uri_spec.rb16
-rw-r--r--spec/ruby/library/uri/join_spec.rb59
-rw-r--r--spec/ruby/library/uri/ldap/attributes_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/dn_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/extensions_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/filter_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/scope_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/set_attributes_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_dn_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_extensions_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_filter_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_scope_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/build_spec.rb92
-rw-r--r--spec/ruby/library/uri/mailto/headers_spec.rb10
-rw-r--r--spec/ruby/library/uri/mailto/set_headers_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/set_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_mailtext_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_rfc822text_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_spec.rb10
-rw-r--r--spec/ruby/library/uri/merge_spec.rb20
-rw-r--r--spec/ruby/library/uri/normalize_spec.rb35
-rw-r--r--spec/ruby/library/uri/parse_spec.rb203
-rw-r--r--spec/ruby/library/uri/parser/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/extract_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/join_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/make_regexp_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/parse_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/plus_spec.rb459
-rw-r--r--spec/ruby/library/uri/regexp_spec.rb18
-rw-r--r--spec/ruby/library/uri/route_from_spec.rb23
-rw-r--r--spec/ruby/library/uri/route_to_spec.rb26
-rw-r--r--spec/ruby/library/uri/select_spec.rb27
-rw-r--r--spec/ruby/library/uri/set_component_spec.rb45
-rw-r--r--spec/ruby/library/uri/shared/eql.rb17
-rw-r--r--spec/ruby/library/uri/shared/extract.rb83
-rw-r--r--spec/ruby/library/uri/shared/join.rb56
-rw-r--r--spec/ruby/library/uri/shared/parse.rb199
-rw-r--r--spec/ruby/library/uri/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/uri_spec.rb29
-rw-r--r--spec/ruby/library/uri/util/make_components_hash_spec.rb6
-rw-r--r--spec/ruby/library/weakref/__getobj___spec.rb17
-rw-r--r--spec/ruby/library/weakref/allocate_spec.rb8
-rw-r--r--spec/ruby/library/weakref/fixtures/classes.rb24
-rw-r--r--spec/ruby/library/weakref/new_spec.rb13
-rw-r--r--spec/ruby/library/weakref/send_spec.rb37
-rw-r--r--spec/ruby/library/weakref/weakref_alive_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/fixtures/classes.rb22
-rw-r--r--spec/ruby/library/win32ole/fixtures/event.xml4
-rw-r--r--spec/ruby/library/win32ole/win32ole/_getproperty_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/_invoke_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/codepage_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole/connect_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole/const_load_spec.rb32
-rw-r--r--spec/ruby/library/win32ole/win32ole/constants_spec.rb42
-rw-r--r--spec/ruby/library/win32ole/win32ole/create_guid_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/invoke_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/locale_spec.rb29
-rw-r--r--spec/ruby/library/win32ole/win32ole/new_spec.rb25
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_func_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_get_methods_spec.rb16
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_help_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_obj_help_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_put_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/setproperty_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/ole_method.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/setproperty.rb23
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/on_event_spec.rb70
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/dispid_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_interface_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpcontext_spec.rb26
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpfile_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpstring_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invkind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invoke_kind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/offset_vtbl_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/params_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_vtype_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/shared/name.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_opt_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/visible_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/default_spec.rb31
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/input_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/optional_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/retval_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/shared/name.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/guid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpcontext_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpfile_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpstring_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/major_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/minor_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/new_spec.rb40
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_classes_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_methods_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progids_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/shared/name.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/src_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typekind_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typelibs_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/variables_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/visible_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_detail_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/shared/name.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/value_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/variable_kind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/varkind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/visible_spec.rb18
-rw-r--r--spec/ruby/library/yaml/dump_spec.rb56
-rw-r--r--spec/ruby/library/yaml/dump_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/fixtures/common.rb10
-rw-r--r--spec/ruby/library/yaml/fixtures/example_class.rb7
-rw-r--r--spec/ruby/library/yaml/fixtures/strings.rb36
-rw-r--r--spec/ruby/library/yaml/fixtures/test_yaml.yml2
-rw-r--r--spec/ruby/library/yaml/load_file_spec.rb13
-rw-r--r--spec/ruby/library/yaml/load_spec.rb137
-rw-r--r--spec/ruby/library/yaml/load_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_file_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_spec.rb22
-rw-r--r--spec/ruby/library/yaml/shared/each_document.rb18
-rw-r--r--spec/ruby/library/yaml/to_yaml_spec.rb106
-rw-r--r--spec/ruby/library/zlib/adler32_spec.rb46
-rw-r--r--spec/ruby/library/zlib/crc32_spec.rb54
-rw-r--r--spec/ruby/library/zlib/crc_table_spec.rb75
-rw-r--r--spec/ruby/library/zlib/deflate/deflate_spec.rb128
-rw-r--r--spec/ruby/library/zlib/deflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/deflate/params_spec.rb17
-rw-r--r--spec/ruby/library/zlib/deflate/set_dictionary_spec.rb14
-rw-r--r--spec/ruby/library/zlib/deflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/gunzip_spec.rb14
-rw-r--r--spec/ruby/library/zlib/gzip_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipfile/close_spec.rb21
-rw-r--r--spec/ruby/library/zlib/gzipfile/closed_spec.rb16
-rw-r--r--spec/ruby/library/zlib/gzipfile/comment_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipfile/orig_name_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_byte_spec.rb51
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_line_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/eof_spec.rb54
-rw-r--r--spec/ruby/library/zlib/gzipreader/getc_spec.rb39
-rw-r--r--spec/ruby/library/zlib/gzipreader/gets_spec.rb22
-rw-r--r--spec/ruby/library/zlib/gzipreader/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/pos_spec.rb24
-rw-r--r--spec/ruby/library/zlib/gzipreader/read_spec.rb66
-rw-r--r--spec/ruby/library/zlib/gzipreader/readpartial_spec.rb17
-rw-r--r--spec/ruby/library/zlib/gzipreader/rewind_spec.rb47
-rw-r--r--spec/ruby/library/zlib/gzipreader/shared/each.rb49
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetbyte_spec.rb120
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetc_spec.rb284
-rw-r--r--spec/ruby/library/zlib/gzipwriter/append_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipwriter/mtime_spec.rb38
-rw-r--r--spec/ruby/library/zlib/gzipwriter/write_spec.rb36
-rw-r--r--spec/ruby/library/zlib/inflate/append_spec.rb60
-rw-r--r--spec/ruby/library/zlib/inflate/finish_spec.rb28
-rw-r--r--spec/ruby/library/zlib/inflate/inflate_spec.rb152
-rw-r--r--spec/ruby/library/zlib/inflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/inflate/set_dictionary_spec.rb20
-rw-r--r--spec/ruby/library/zlib/inflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zlib_version_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zstream/adler_spec.rb11
-rw-r--r--spec/ruby/library/zlib/zstream/avail_in_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/avail_out_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/data_type_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/flush_next_out_spec.rb14
-rw-r--r--spec/ruby/optional/capi/README13
-rw-r--r--spec/ruby/optional/capi/array_spec.rb497
-rw-r--r--spec/ruby/optional/capi/basic_object_spec.rb24
-rw-r--r--spec/ruby/optional/capi/bignum_spec.rb224
-rw-r--r--spec/ruby/optional/capi/boolean_spec.rb33
-rw-r--r--spec/ruby/optional/capi/class_spec.rb448
-rw-r--r--spec/ruby/optional/capi/complex_spec.rb45
-rw-r--r--spec/ruby/optional/capi/constants_spec.rb325
-rw-r--r--spec/ruby/optional/capi/data_spec.rb45
-rw-r--r--spec/ruby/optional/capi/encoding_spec.rb651
-rw-r--r--spec/ruby/optional/capi/enumerator_spec.rb66
-rw-r--r--spec/ruby/optional/capi/exception_spec.rb103
-rw-r--r--spec/ruby/optional/capi/ext/.gitignore9
-rw-r--r--spec/ruby/optional/capi/ext/array_spec.c301
-rw-r--r--spec/ruby/optional/capi/ext/basic_object_spec.c19
-rw-r--r--spec/ruby/optional/capi/ext/bignum_spec.c106
-rw-r--r--spec/ruby/optional/capi/ext/boolean_spec.c33
-rw-r--r--spec/ruby/optional/capi/ext/class_id_under_autoload_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/class_spec.c194
-rw-r--r--spec/ruby/optional/capi/ext/class_under_autoload_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/complex_spec.c45
-rw-r--r--spec/ruby/optional/capi/ext/constants_spec.c178
-rw-r--r--spec/ruby/optional/capi/ext/data_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/encoding_spec.c370
-rw-r--r--spec/ruby/optional/capi/ext/enumerator_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/exception_spec.c54
-rw-r--r--spec/ruby/optional/capi/ext/file_spec.c29
-rw-r--r--spec/ruby/optional/capi/ext/fixnum_spec.c26
-rw-r--r--spec/ruby/optional/capi/ext/float_spec.c47
-rw-r--r--spec/ruby/optional/capi/ext/gc_spec.c66
-rw-r--r--spec/ruby/optional/capi/ext/globals_spec.c127
-rw-r--r--spec/ruby/optional/capi/ext/hash_spec.c160
-rw-r--r--spec/ruby/optional/capi/ext/integer_spec.c41
-rw-r--r--spec/ruby/optional/capi/ext/io_spec.c258
-rw-r--r--spec/ruby/optional/capi/ext/kernel_spec.c377
-rw-r--r--spec/ruby/optional/capi/ext/language_spec.c42
-rw-r--r--spec/ruby/optional/capi/ext/marshal_spec.c24
-rw-r--r--spec/ruby/optional/capi/ext/module_spec.c155
-rw-r--r--spec/ruby/optional/capi/ext/module_under_autoload_spec.c15
-rw-r--r--spec/ruby/optional/capi/ext/mutex_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/numeric_spec.c130
-rw-r--r--spec/ruby/optional/capi/ext/object_spec.c462
-rw-r--r--spec/ruby/optional/capi/ext/proc_spec.c73
-rw-r--r--spec/ruby/optional/capi/ext/range_spec.c50
-rw-r--r--spec/ruby/optional/capi/ext/rational_spec.c54
-rw-r--r--spec/ruby/optional/capi/ext/rbasic_spec.c94
-rw-r--r--spec/ruby/optional/capi/ext/regexp_spec.c61
-rw-r--r--spec/ruby/optional/capi/ext/rubyspec.h59
-rw-r--r--spec/ruby/optional/capi/ext/st_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/string_spec.c570
-rw-r--r--spec/ruby/optional/capi/ext/struct_spec.c85
-rw-r--r--spec/ruby/optional/capi/ext/symbol_spec.c105
-rw-r--r--spec/ruby/optional/capi/ext/thread_spec.c150
-rw-r--r--spec/ruby/optional/capi/ext/time_spec.c81
-rw-r--r--spec/ruby/optional/capi/ext/tracepoint_spec.c49
-rw-r--r--spec/ruby/optional/capi/ext/typed_data_spec.c183
-rw-r--r--spec/ruby/optional/capi/ext/util_spec.c123
-rw-r--r--spec/ruby/optional/capi/file_spec.rb89
-rw-r--r--spec/ruby/optional/capi/fixnum_spec.rb101
-rw-r--r--spec/ruby/optional/capi/fixtures/class.rb91
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_at.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_from.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_object.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/encoding.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/foo.rb1
-rw-r--r--spec/ruby/optional/capi/fixtures/module.rb35
-rw-r--r--spec/ruby/optional/capi/fixtures/module_autoload.rb4
-rw-r--r--spec/ruby/optional/capi/fixtures/path_to_class.rb6
-rw-r--r--spec/ruby/optional/capi/fixtures/proc.rb20
-rw-r--r--spec/ruby/optional/capi/float_spec.rb43
-rw-r--r--spec/ruby/optional/capi/gc_spec.rb87
-rw-r--r--spec/ruby/optional/capi/globals_spec.rb243
-rw-r--r--spec/ruby/optional/capi/hash_spec.rb274
-rw-r--r--spec/ruby/optional/capi/integer_spec.rb290
-rw-r--r--spec/ruby/optional/capi/io_spec.rb377
-rw-r--r--spec/ruby/optional/capi/kernel_spec.rb626
-rw-r--r--spec/ruby/optional/capi/language_spec.rb37
-rw-r--r--spec/ruby/optional/capi/marshal_spec.rb46
-rw-r--r--spec/ruby/optional/capi/module_spec.rb378
-rw-r--r--spec/ruby/optional/capi/mutex_spec.rb89
-rw-r--r--spec/ruby/optional/capi/numeric_spec.rb502
-rw-r--r--spec/ruby/optional/capi/object_spec.rb980
-rw-r--r--spec/ruby/optional/capi/proc_spec.rb135
-rw-r--r--spec/ruby/optional/capi/rake_helper.rb22
-rw-r--r--spec/ruby/optional/capi/range_spec.rb95
-rw-r--r--spec/ruby/optional/capi/rational_spec.rb57
-rw-r--r--spec/ruby/optional/capi/rbasic_spec.rb22
-rw-r--r--spec/ruby/optional/capi/regexp_spec.rb83
-rw-r--r--spec/ruby/optional/capi/shared/rbasic.rb83
-rw-r--r--spec/ruby/optional/capi/spec_helper.rb144
-rw-r--r--spec/ruby/optional/capi/st_spec.rb41
-rw-r--r--spec/ruby/optional/capi/string_spec.rb1119
-rw-r--r--spec/ruby/optional/capi/struct_spec.rb211
-rw-r--r--spec/ruby/optional/capi/symbol_spec.rb172
-rw-r--r--spec/ruby/optional/capi/thread_spec.rb145
-rw-r--r--spec/ruby/optional/capi/time_spec.rb296
-rw-r--r--spec/ruby/optional/capi/tracepoint_spec.rb56
-rw-r--r--spec/ruby/optional/capi/typed_data_spec.rb77
-rw-r--r--spec/ruby/optional/capi/util_spec.rb326
-rw-r--r--spec/ruby/security/cve_2010_1330_spec.rb21
-rw-r--r--spec/ruby/security/cve_2011_4815_spec.rb47
-rw-r--r--spec/ruby/security/cve_2013_4164_spec.rb19
-rw-r--r--spec/ruby/security/cve_2014_8080_spec.rb35
-rw-r--r--spec/ruby/security/cve_2017_17742_spec.rb34
-rw-r--r--spec/ruby/security/cve_2018_16396_spec.rb25
-rw-r--r--spec/ruby/security/cve_2018_6914_spec.rb55
-rw-r--r--spec/ruby/security/cve_2018_8778_spec.rb12
-rw-r--r--spec/ruby/security/cve_2018_8779_spec.rb30
-rw-r--r--spec/ruby/security/cve_2018_8780_spec.rb43
-rw-r--r--spec/ruby/security/cve_2019_8321_spec.rb22
-rw-r--r--spec/ruby/security/cve_2019_8322_spec.rb23
-rw-r--r--spec/ruby/security/cve_2019_8323_spec.rb38
-rw-r--r--spec/ruby/security/cve_2019_8325_spec.rb38
-rw-r--r--spec/ruby/security/cve_2020_10663_spec.rb41
-rw-r--r--spec/ruby/shared/basicobject/method_missing.rb124
-rw-r--r--spec/ruby/shared/basicobject/send.rb128
-rw-r--r--spec/ruby/shared/enumerable/minmax.rb24
-rw-r--r--spec/ruby/shared/enumerator/enum_for.rb57
-rw-r--r--spec/ruby/shared/enumerator/with_index.rb33
-rw-r--r--spec/ruby/shared/enumerator/with_object.rb42
-rw-r--r--spec/ruby/shared/fiber/resume.rb58
-rw-r--r--spec/ruby/shared/file/blockdev.rb9
-rw-r--r--spec/ruby/shared/file/chardev.rb9
-rw-r--r--spec/ruby/shared/file/directory.rb66
-rw-r--r--spec/ruby/shared/file/executable.rb48
-rw-r--r--spec/ruby/shared/file/executable_real.rb46
-rw-r--r--spec/ruby/shared/file/exist.rb24
-rw-r--r--spec/ruby/shared/file/file.rb45
-rw-r--r--spec/ruby/shared/file/grpowned.rb39
-rw-r--r--spec/ruby/shared/file/identical.rb51
-rw-r--r--spec/ruby/shared/file/owned.rb3
-rw-r--r--spec/ruby/shared/file/pipe.rb3
-rw-r--r--spec/ruby/shared/file/readable.rb33
-rw-r--r--spec/ruby/shared/file/readable_real.rb23
-rw-r--r--spec/ruby/shared/file/setgid.rb2
-rw-r--r--spec/ruby/shared/file/setuid.rb2
-rw-r--r--spec/ruby/shared/file/size.rb124
-rw-r--r--spec/ruby/shared/file/socket.rb3
-rw-r--r--spec/ruby/shared/file/sticky.rb29
-rw-r--r--spec/ruby/shared/file/symlink.rb46
-rw-r--r--spec/ruby/shared/file/world_readable.rb49
-rw-r--r--spec/ruby/shared/file/world_writable.rb49
-rw-r--r--spec/ruby/shared/file/writable.rb28
-rw-r--r--spec/ruby/shared/file/writable_real.rb33
-rw-r--r--spec/ruby/shared/file/zero.rb68
-rw-r--r--spec/ruby/shared/hash/key_error.rb23
-rw-r--r--spec/ruby/shared/io/putc.rb57
-rw-r--r--spec/ruby/shared/kernel/equal.rb54
-rw-r--r--spec/ruby/shared/kernel/object_id.rb80
-rw-r--r--spec/ruby/shared/kernel/raise.rb97
-rw-r--r--spec/ruby/shared/math/atanh.rb44
-rw-r--r--spec/ruby/shared/process/abort.rb36
-rw-r--r--spec/ruby/shared/process/exit.rb114
-rw-r--r--spec/ruby/shared/process/fork.rb90
-rw-r--r--spec/ruby/shared/queue/clear.rb12
-rw-r--r--spec/ruby/shared/queue/close.rb14
-rw-r--r--spec/ruby/shared/queue/closed.rb12
-rw-r--r--spec/ruby/shared/queue/deque.rb85
-rw-r--r--spec/ruby/shared/queue/empty.rb12
-rw-r--r--spec/ruby/shared/queue/enque.rb18
-rw-r--r--spec/ruby/shared/queue/length.rb9
-rw-r--r--spec/ruby/shared/queue/num_waiting.rb16
-rw-r--r--spec/ruby/shared/rational/Rational.rb143
-rw-r--r--spec/ruby/shared/rational/abs.rb11
-rw-r--r--spec/ruby/shared/rational/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/shared/rational/ceil.rb45
-rw-r--r--spec/ruby/shared/rational/coerce.rb34
-rw-r--r--spec/ruby/shared/rational/comparison.rb95
-rw-r--r--spec/ruby/shared/rational/denominator.rb14
-rw-r--r--spec/ruby/shared/rational/div.rb54
-rw-r--r--spec/ruby/shared/rational/divide.rb71
-rw-r--r--spec/ruby/shared/rational/divmod.rb42
-rw-r--r--spec/ruby/shared/rational/equal_value.rb39
-rw-r--r--spec/ruby/shared/rational/exponent.rb178
-rw-r--r--spec/ruby/shared/rational/fdiv.rb5
-rw-r--r--spec/ruby/shared/rational/floor.rb45
-rw-r--r--spec/ruby/shared/rational/hash.rb9
-rw-r--r--spec/ruby/shared/rational/inspect.rb14
-rw-r--r--spec/ruby/shared/rational/marshal_dump.rb5
-rw-r--r--spec/ruby/shared/rational/marshal_load.rb5
-rw-r--r--spec/ruby/shared/rational/minus.rb48
-rw-r--r--spec/ruby/shared/rational/modulo.rb43
-rw-r--r--spec/ruby/shared/rational/multiply.rb62
-rw-r--r--spec/ruby/shared/rational/numerator.rb10
-rw-r--r--spec/ruby/shared/rational/plus.rb48
-rw-r--r--spec/ruby/shared/rational/quo.rb5
-rw-r--r--spec/ruby/shared/rational/remainder.rb5
-rw-r--r--spec/ruby/shared/rational/round.rb106
-rw-r--r--spec/ruby/shared/rational/to_f.rb10
-rw-r--r--spec/ruby/shared/rational/to_i.rb12
-rw-r--r--spec/ruby/shared/rational/to_r.rb11
-rw-r--r--spec/ruby/shared/rational/to_s.rb14
-rw-r--r--spec/ruby/shared/rational/truncate.rb45
-rw-r--r--spec/ruby/shared/sizedqueue/enque.rb50
-rw-r--r--spec/ruby/shared/sizedqueue/max.rb47
-rw-r--r--spec/ruby/shared/sizedqueue/new.rb18
-rw-r--r--spec/ruby/shared/sizedqueue/num_waiting.rb12
-rw-r--r--spec/ruby/shared/string/end_with.rb54
-rw-r--r--spec/ruby/shared/string/start_with.rb72
-rw-r--r--spec/ruby/shared/string/times.rb80
-rw-r--r--spec/ruby/shared/time/strftime_for_date.rb273
-rw-r--r--spec/ruby/shared/time/strftime_for_time.rb173
-rw-r--r--spec/ruby/spec_helper.rb32
-rw-r--r--sprintf.c651
-rw-r--r--st.c2899
-rw-r--r--strftime.c311
-rw-r--r--string.c6198
-rw-r--r--struct.c700
-rw-r--r--symbol.c812
-rw-r--r--symbol.h67
-rw-r--r--template/Doxyfile.tmpl123
-rw-r--r--template/GNUmakefile.in9
-rw-r--r--template/Makefile.in687
-rw-r--r--template/builtin_binary.inc.tmpl30
-rw-r--r--template/call_iseq_optimized.inc.tmpl68
-rw-r--r--template/configure-ext.mk.tmpl45
-rw-r--r--template/depend.tmpl2
-rw-r--r--template/encdb.h.tmpl37
-rw-r--r--template/extinit.c.tmpl17
-rw-r--r--template/exts.mk.tmpl171
-rw-r--r--template/fake.rb.in66
-rw-r--r--template/id.c.tmpl18
-rw-r--r--template/id.h.tmpl77
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/limits.c.tmpl97
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/prelude.c.tmpl179
-rwxr-xr-xtemplate/ruby-gdb.in6
-rwxr-xr-xtemplate/ruby-lldb.in6
-rw-r--r--template/ruby-runner.h.in9
-rw-r--r--template/ruby.pc.in5
-rw-r--r--template/sizes.c.tmpl28
-rw-r--r--template/transdb.h.tmpl21
-rw-r--r--template/unicode_norm_gen.tmpl43
-rw-r--r--template/verconf.h.tmpl16
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_extract.rb40
-rw-r--r--test/-ext-/array/test_resize.rb3
-rw-r--r--test/-ext-/array/test_to_ary_concat.rb20
-rw-r--r--test/-ext-/bignum/test_big2str.rb7
-rw-r--r--test/-ext-/bignum/test_bigzero.rb9
-rw-r--r--test/-ext-/bignum/test_div.rb7
-rw-r--r--test/-ext-/bignum/test_mul.rb15
-rw-r--r--test/-ext-/bignum/test_pack.rb3
-rw-r--r--test/-ext-/bignum/test_str2big.rb7
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb13
-rw-r--r--test/-ext-/class/test_class2name.rb1
-rw-r--r--test/-ext-/debug/test_debug.rb17
-rw-r--r--test/-ext-/debug/test_profile_frames.rb76
-rw-r--r--test/-ext-/exception/test_data_error.rb3
-rw-r--r--test/-ext-/exception/test_enc_raise.rb3
-rw-r--r--test/-ext-/exception/test_ensured.rb3
-rw-r--r--test/-ext-/exception/test_exception_at_throwing.rb18
-rw-r--r--test/-ext-/file/test_stat.rb1
-rw-r--r--test/-ext-/float/test_nextafter.rb1
-rw-r--r--test/-ext-/funcall/test_funcall.rb11
-rw-r--r--test/-ext-/funcall/test_passing_block.rb44
-rw-r--r--test/-ext-/gvl/test_last_thread.rb22
-rw-r--r--test/-ext-/gvl/test_ubf_async_safe.rb20
-rw-r--r--test/-ext-/hash/test_delete.rb3
-rw-r--r--test/-ext-/integer/test_integer.rb26
-rw-r--r--test/-ext-/integer/test_my_integer.rb48
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb102
-rw-r--r--test/-ext-/iter/test_iter_break.rb1
-rw-r--r--test/-ext-/iter/test_yield_block.rb13
-rw-r--r--test/-ext-/load/script.rb2
-rw-r--r--test/-ext-/load/test_dot_dot.rb3
-rw-r--r--test/-ext-/load/test_protect.rb14
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb24
-rw-r--r--test/-ext-/marshal/test_usrmarshal.rb1
-rw-r--r--test/-ext-/method/test_arity.rb5
-rw-r--r--test/-ext-/num2int/test_num2int.rb46
-rw-r--r--test/-ext-/path_to_class/test_path_to_class.rb3
-rw-r--r--test/-ext-/popen_deadlock/test_popen_deadlock.rb36
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb13
-rw-r--r--test/-ext-/proc/test_bmethod.rb5
-rw-r--r--test/-ext-/rational/test_rat.rb39
-rw-r--r--test/-ext-/st/test_foreach.rb1
-rw-r--r--test/-ext-/st/test_numhash.rb1
-rw-r--r--test/-ext-/st/test_update.rb1
-rw-r--r--test/-ext-/string/test_capacity.rb59
-rw-r--r--test/-ext-/string/test_coderange.rb3
-rw-r--r--test/-ext-/string/test_cstr.rb51
-rw-r--r--test/-ext-/string/test_ellipsize.rb5
-rw-r--r--test/-ext-/string/test_enc_associate.rb18
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb12
-rw-r--r--test/-ext-/string/test_external_new.rb17
-rw-r--r--test/-ext-/string/test_fstring.rb74
-rw-r--r--test/-ext-/string/test_interned_str.rb12
-rw-r--r--test/-ext-/string/test_modify_expand.rb15
-rw-r--r--test/-ext-/string/test_nofree.rb9
-rw-r--r--test/-ext-/string/test_normalize.rb22
-rw-r--r--test/-ext-/string/test_qsort.rb3
-rw-r--r--test/-ext-/string/test_rb_str_dup.rb16
-rw-r--r--test/-ext-/string/test_set_len.rb12
-rw-r--r--test/-ext-/struct/test_duplicate.rb4
-rw-r--r--test/-ext-/struct/test_len.rb10
-rw-r--r--test/-ext-/struct/test_member.rb5
-rw-r--r--test/-ext-/symbol/noninterned_name.rb17
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb84
-rw-r--r--test/-ext-/symbol/test_type.rb15
-rw-r--r--test/-ext-/test_bug-14834.rb12
-rw-r--r--test/-ext-/test_bug-3571.rb3
-rw-r--r--test/-ext-/test_bug-3662.rb10
-rw-r--r--test/-ext-/test_bug-5832.rb3
-rw-r--r--test/-ext-/test_enumerator_kw.rb11
-rw-r--r--test/-ext-/test_notimplement.rb44
-rw-r--r--test/-ext-/test_printf.rb16
-rw-r--r--test/-ext-/test_random.rb27
-rw-r--r--test/-ext-/test_recursion.rb1
-rw-r--r--test/-ext-/test_scan_args.rb259
-rw-r--r--test/-ext-/thread_fd_close/test_thread_fd_close.rb25
-rw-r--r--test/-ext-/time/test_new.rb44
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb25
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb17
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb36
-rw-r--r--test/-ext-/win32/test_console_attr.rb18
-rw-r--r--test/-ext-/win32/test_dln.rb15
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb1
-rw-r--r--test/base64/test_base64.rb15
-rw-r--r--test/benchmark/test_benchmark.rb9
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1066
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb77
-rw-r--r--test/bigdecimal/test_bigmath.rb1
-rw-r--r--test/bigdecimal/test_ractor.rb23
-rw-r--r--test/bigdecimal/testbase.rb1
-rw-r--r--test/cgi/test_cgi_cookie.rb118
-rw-r--r--test/cgi/test_cgi_core.rb85
-rw-r--r--test/cgi/test_cgi_header.rb31
-rw-r--r--test/cgi/test_cgi_modruby.rb11
-rw-r--r--test/cgi/test_cgi_multipart.rb31
-rw-r--r--test/cgi/test_cgi_session.rb55
-rw-r--r--test/cgi/test_cgi_tag_helper.rb16
-rw-r--r--test/cgi/test_cgi_util.rb141
-rw-r--r--test/cgi/update_env.rb9
-rw-r--r--test/coverage/test_coverage.rb751
-rw-r--r--test/csv/base.rb8
-rw-r--r--test/csv/helper.rb42
-rw-r--r--test/csv/interface/test_delegation.rb47
-rw-r--r--test/csv/interface/test_read.rb339
-rw-r--r--test/csv/interface/test_read_write.rb115
-rw-r--r--test/csv/interface/test_write.rb174
-rw-r--r--test/csv/parse/test_column_separator.rb40
-rw-r--r--test/csv/parse/test_convert.rb110
-rw-r--r--test/csv/parse/test_each.rb23
-rw-r--r--test/csv/parse/test_general.rb259
-rw-r--r--test/csv/parse/test_header.rb335
-rw-r--r--test/csv/parse/test_invalid.rb39
-rw-r--r--test/csv/parse/test_liberal_parsing.rb160
-rw-r--r--test/csv/parse/test_quote_char_nil.rb93
-rw-r--r--test/csv/parse/test_rewind.rb40
-rw-r--r--test/csv/parse/test_row_separator.rb16
-rw-r--r--test/csv/parse/test_skip_lines.rb118
-rw-r--r--test/csv/parse/test_strip.rb83
-rw-r--r--test/csv/parse/test_unconverted_fields.rb117
-rwxr-xr-xtest/csv/test_csv_parsing.rb221
-rwxr-xr-xtest/csv/test_csv_writing.rb97
-rw-r--r--[-rwxr-xr-x]test/csv/test_data_converters.rb235
-rw-r--r--[-rwxr-xr-x]test/csv/test_encodings.rb79
-rw-r--r--[-rwxr-xr-x]test/csv/test_features.rb182
-rwxr-xr-xtest/csv/test_headers.rb297
-rwxr-xr-xtest/csv/test_interface.rb368
-rw-r--r--[-rwxr-xr-x]test/csv/test_row.rb118
-rw-r--r--[-rwxr-xr-x]test/csv/test_table.rb286
-rw-r--r--test/csv/ts_all.rb20
-rw-r--r--test/csv/write/test_converters.rb53
-rw-r--r--test/csv/write/test_force_quotes.rb78
-rw-r--r--test/csv/write/test_general.rb246
-rw-r--r--test/csv/write/test_quote_empty.rb70
-rw-r--r--test/date/test_date.rb18
-rw-r--r--test/date/test_date_arith.rb32
-rw-r--r--test/date/test_date_attr.rb24
-rw-r--r--test/date/test_date_base.rb442
-rw-r--r--test/date/test_date_compat.rb1
-rw-r--r--test/date/test_date_conv.rb44
-rw-r--r--test/date/test_date_marshal.rb22
-rw-r--r--test/date/test_date_new.rb117
-rw-r--r--test/date/test_date_parse.rb196
-rw-r--r--test/date/test_date_ractor.rb27
-rw-r--r--test/date/test_date_strftime.rb25
-rw-r--r--test/date/test_date_strptime.rb20
-rw-r--r--test/date/test_switch_hitter.rb81
-rw-r--r--test/dbm/test_dbm.rb11
-rw-r--r--test/did_you_mean/core_ext/test_name_error_extension.rb48
-rw-r--r--test/did_you_mean/edit_distance/test_jaro_winkler.rb36
-rw-r--r--test/did_you_mean/fixtures/book.rb4
-rw-r--r--test/did_you_mean/fixtures/mini_dir.yml15
-rw-r--r--test/did_you_mean/fixtures/rspec_dir.yml112
-rw-r--r--test/did_you_mean/helper.rb29
-rw-r--r--test/did_you_mean/spell_checking/test_class_name_check.rb81
-rw-r--r--test/did_you_mean/spell_checking/test_key_name_check.rb54
-rw-r--r--test/did_you_mean/spell_checking/test_method_name_check.rb147
-rw-r--r--test/did_you_mean/spell_checking/test_require_path_check.rb32
-rw-r--r--test/did_you_mean/spell_checking/test_uncorrectable_name_check.rb15
-rw-r--r--test/did_you_mean/spell_checking/test_variable_name_check.rb140
-rw-r--r--test/did_you_mean/test_spell_checker.rb77
-rw-r--r--test/did_you_mean/test_tree_spell_checker.rb170
-rw-r--r--test/did_you_mean/test_verbose_formatter.rb23
-rw-r--r--test/did_you_mean/tree_spell/change_word.rb61
-rw-r--r--test/did_you_mean/tree_spell/human_typo.rb69
-rw-r--r--test/did_you_mean/tree_spell/test_change_word.rb38
-rw-r--r--test/did_you_mean/tree_spell/test_human_typo.rb24
-rw-r--r--test/digest/digest/foo.rb1
-rw-r--r--test/digest/test_digest.rb26
-rw-r--r--test/digest/test_digest_extend.rb5
-rw-r--r--test/digest/test_ractor.rb101
-rw-r--r--test/drb/drbtest.rb186
-rw-r--r--test/drb/ignore_test_drb.rb1
-rw-r--r--test/drb/test_acl.rb102
-rw-r--r--test/drb/test_drb.rb225
-rw-r--r--test/drb/test_drbobject.rb69
-rw-r--r--test/drb/test_drbssl.rb56
-rw-r--r--test/drb/test_drbunix.rb27
-rw-r--r--test/drb/ut_array.rb1
-rw-r--r--test/drb/ut_array_drbssl.rb3
-rw-r--r--test/drb/ut_array_drbunix.rb1
-rw-r--r--test/drb/ut_drb.rb24
-rw-r--r--test/drb/ut_drb_drbssl.rb3
-rw-r--r--test/drb/ut_drb_drbunix.rb1
-rw-r--r--test/drb/ut_eq.rb1
-rw-r--r--test/drb/ut_eval.rb36
-rw-r--r--test/drb/ut_large.rb27
-rw-r--r--test/drb/ut_port.rb1
-rw-r--r--test/drb/ut_safe1.rb1
-rw-r--r--test/drb/ut_timerholder.rb103
-rw-r--r--test/dtrace/dummy.rb1
-rw-r--r--test/dtrace/helper.rb131
-rw-r--r--test/dtrace/test_array_create.rb9
-rw-r--r--test/dtrace/test_cmethod.rb1
-rw-r--r--test/dtrace/test_function_entry.rb10
-rw-r--r--test/dtrace/test_gc.rb1
-rw-r--r--test/dtrace/test_hash_create.rb7
-rw-r--r--test/dtrace/test_load.rb1
-rw-r--r--test/dtrace/test_method_cache.rb9
-rw-r--r--test/dtrace/test_object_create_start.rb1
-rw-r--r--test/dtrace/test_raise.rb1
-rw-r--r--test/dtrace/test_require.rb7
-rw-r--r--test/dtrace/test_singleton_function.rb10
-rw-r--r--test/dtrace/test_string.rb7
-rw-r--r--test/erb/test_erb.rb345
-rw-r--r--test/erb/test_erb_command.rb21
-rw-r--r--test/erb/test_erb_m17n.rb3
-rw-r--r--test/etc/test_etc.rb45
-rw-r--r--test/excludes/TestException.rb8
-rw-r--r--test/excludes/TestIO_Console.rb2
-rw-r--r--test/excludes/TestISeq.rb1
-rw-r--r--test/excludes/TestThread.rb2
-rw-r--r--test/excludes/_appveyor/TestArray.rb7
-rw-r--r--test/fiber/http.rb53
-rw-r--r--test/fiber/scheduler.rb210
-rw-r--r--test/fiber/test_backtrace.rb22
-rw-r--r--test/fiber/test_enumerator.rb51
-rw-r--r--test/fiber/test_io.rb100
-rw-r--r--test/fiber/test_mutex.rb220
-rw-r--r--test/fiber/test_process.rb51
-rw-r--r--test/fiber/test_ractor.rb23
-rw-r--r--test/fiber/test_scheduler.rb90
-rw-r--r--test/fiber/test_sleep.rb71
-rw-r--r--test/fiber/test_thread.rb108
-rw-r--r--test/fiddle/helper.rb76
-rw-r--r--test/fiddle/test_c_struct_entry.rb131
-rw-r--r--test/fiddle/test_c_union_entity.rb16
-rw-r--r--test/fiddle/test_closure.rb32
-rw-r--r--test/fiddle/test_cparser.rb341
-rw-r--r--test/fiddle/test_fiddle.rb1
-rw-r--r--test/fiddle/test_func.rb68
-rw-r--r--test/fiddle/test_function.rb85
-rw-r--r--test/fiddle/test_handle.rb99
-rw-r--r--test/fiddle/test_import.rb379
-rw-r--r--test/fiddle/test_memory_view.rb115
-rw-r--r--test/fiddle/test_pinned.rb27
-rw-r--r--test/fiddle/test_pointer.rb111
-rw-r--r--test/fileutils/clobber.rb1
-rw-r--r--test/fileutils/fileasserts.rb1
-rw-r--r--test/fileutils/test_dryrun.rb3
-rw-r--r--test/fileutils/test_fileutils.rb424
-rw-r--r--test/fileutils/test_nowrite.rb3
-rw-r--r--test/fileutils/test_verbose.rb3
-rw-r--r--test/fileutils/visibility_tests.rb5
-rw-r--r--test/fixtures/fake_sorted_set_gem/sorted_set.rb9
-rw-r--r--test/gdbm/test_gdbm.rb23
-rw-r--r--test/io/console/test_io_console.rb306
-rw-r--r--test/io/nonblock/test_flush.rb23
-rw-r--r--test/io/wait/test_io_wait.rb81
-rw-r--r--test/io/wait/test_io_wait_uncommon.rb78
-rw-r--r--test/io/wait/test_ractor.rb22
-rw-r--r--test/irb/test_cmd.rb429
-rw-r--r--test/irb/test_color.rb218
-rw-r--r--test/irb/test_color_printer.rb68
-rw-r--r--test/irb/test_completion.rb70
-rw-r--r--test/irb/test_context.rb597
-rw-r--r--test/irb/test_history.rb211
-rw-r--r--test/irb/test_init.rb83
-rw-r--r--test/irb/test_option.rb4
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb14
-rw-r--r--test/irb/test_ruby_lex.rb586
-rw-r--r--test/irb/test_workspace.rb111
-rw-r--r--test/irb/yamatanooroti/test_rendering.rb165
-rw-r--r--test/json/fixtures/fail1.json1
-rw-r--r--test/json/fixtures/fail29.json1
-rw-r--r--test/json/fixtures/fail30.json1
-rw-r--r--test/json/fixtures/fail31.json1
-rw-r--r--test/json/fixtures/fail32.json1
-rw-r--r--test/json/fixtures/obsolete_fail1.json1
-rw-r--r--test/json/json_addition_test.rb199
-rw-r--r--test/json/json_common_interface_test.rb169
-rw-r--r--test/json/json_encoding_test.rb107
-rw-r--r--test/json/json_ext_parser_test.rb15
-rw-r--r--test/json/json_fixtures_test.rb40
-rw-r--r--test/json/json_generator_test.rb399
-rw-r--r--test/json/json_generic_object_test.rb82
-rw-r--r--test/json/json_parser_test.rb497
-rw-r--r--test/json/json_string_matching_test.rb38
-rw-r--r--test/json/ractor_test.rb30
-rw-r--r--test/json/setup_variant.rb11
-rw-r--r--test/json/test_helper.rb17
-rwxr-xr-xtest/json/test_json.rb557
-rwxr-xr-xtest/json/test_json_addition.rb196
-rw-r--r--test/json/test_json_encoding.rb65
-rwxr-xr-xtest/json/test_json_fixtures.rb35
-rwxr-xr-xtest/json/test_json_generate.rb322
-rw-r--r--test/json/test_json_generic_object.rb75
-rw-r--r--test/json/test_json_string_matching.rb39
-rwxr-xr-xtest/json/test_json_unicode.rb72
-rw-r--r--test/lib/envutil.rb604
-rw-r--r--test/lib/find_executable.rb21
-rw-r--r--test/lib/jit_support.rb93
-rw-r--r--test/lib/leakchecker.rb167
-rw-r--r--test/lib/memory_status.rb111
-rw-r--r--test/lib/minitest/autorun.rb13
-rw-r--r--test/lib/minitest/benchmark.rb417
-rw-r--r--test/lib/minitest/mock.rb195
-rw-r--r--test/lib/minitest/unit.rb1419
-rw-r--r--test/lib/profile_test_all.rb90
-rw-r--r--test/lib/test/unit.rb896
-rw-r--r--test/lib/test/unit/assertions.rb501
-rw-r--r--test/lib/test/unit/parallel.rb190
-rw-r--r--test/lib/test/unit/testcase.rb34
-rw-r--r--test/lib/tracepointchecker.rb118
-rw-r--r--test/lib/with_different_ofs.rb5
-rw-r--r--test/logger/helper.rb13
-rw-r--r--test/logger/test_logdevice.rb565
-rw-r--r--test/logger/test_logger.rb157
-rw-r--r--test/logger/test_logperiod.rb80
-rw-r--r--test/logger/test_severity.rb15
-rw-r--r--test/matrix/test_matrix.rb263
-rw-r--r--test/matrix/test_vector.rb120
-rw-r--r--test/minitest/metametameta.rb69
-rw-r--r--test/minitest/test_minitest_benchmark.rb130
-rw-r--r--test/minitest/test_minitest_mock.rb403
-rw-r--r--test/minitest/test_minitest_unit.rb1803
-rw-r--r--test/misc/test_ruby_mode.rb182
-rw-r--r--test/mkmf/base.rb30
-rw-r--r--test/mkmf/test_config.rb1
-rw-r--r--test/mkmf/test_constant.rb1
-rw-r--r--test/mkmf/test_convertible.rb1
-rw-r--r--test/mkmf/test_find_executable.rb34
-rw-r--r--test/mkmf/test_flags.rb3
-rw-r--r--test/mkmf/test_framework.rb9
-rw-r--r--test/mkmf/test_have_func.rb3
-rw-r--r--test/mkmf/test_have_library.rb1
-rw-r--r--test/mkmf/test_have_macro.rb1
-rw-r--r--test/mkmf/test_install.rb30
-rw-r--r--test/mkmf/test_libs.rb1
-rw-r--r--test/mkmf/test_mkmf.rb15
-rw-r--r--test/mkmf/test_signedness.rb1
-rw-r--r--test/mkmf/test_sizeof.rb1
-rw-r--r--test/monitor/test_monitor.rb148
-rw-r--r--test/net/fixtures/Makefile (renamed from test/net/imap/Makefile)0
-rw-r--r--test/net/fixtures/cacert.pem24
-rw-r--r--test/net/fixtures/dhparams.pem29
-rw-r--r--test/net/fixtures/server.crt82
-rw-r--r--test/net/fixtures/server.key28
-rw-r--r--test/net/ftp/test_buffered_socket.rb10
-rw-r--r--test/net/ftp/test_ftp.rb2072
-rw-r--r--test/net/ftp/test_mlsx_entry.rb98
-rw-r--r--test/net/http/test_buffered_io.rb1
-rw-r--r--test/net/http/test_http.rb401
-rw-r--r--test/net/http/test_http_request.rb34
-rw-r--r--test/net/http/test_httpheader.rb110
-rw-r--r--test/net/http/test_httpresponse.rb79
-rw-r--r--test/net/http/test_httpresponses.rb1
-rw-r--r--test/net/http/test_https.rb213
-rw-r--r--test/net/http/test_https_proxy.rb1
-rw-r--r--test/net/http/utils.rb29
-rw-r--r--test/net/imap/cacert.pem66
-rw-r--r--test/net/imap/server.crt48
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb397
-rw-r--r--test/net/imap/test_imap_response_parser.rb81
-rw-r--r--test/net/pop/test_pop.rb30
-rw-r--r--test/net/protocol/test_protocol.rb100
-rw-r--r--test/net/smtp/test_response.rb5
-rw-r--r--test/net/smtp/test_smtp.rb242
-rw-r--r--test/net/smtp/test_ssl_socket.rb16
-rw-r--r--test/net/smtp/test_sslcontext.rb129
-rw-r--r--test/net/smtp/test_starttls.rb122
-rw-r--r--test/nkf/test_kconv.rb9
-rw-r--r--test/nkf/test_nkf.rb1
-rw-r--r--test/objspace/test_objspace.rb463
-rw-r--r--test/open-uri/test_open-uri.rb178
-rw-r--r--test/open-uri/test_ssl.rb431
-rw-r--r--test/openssl/fixtures/pkey/dh-1.pem13
-rw-r--r--test/openssl/fixtures/pkey/dh1024.pem5
-rw-r--r--test/openssl/fixtures/pkey/dsa1024.pem12
-rw-r--r--test/openssl/fixtures/pkey/dsa256.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa512.pem8
-rw-r--r--test/openssl/fixtures/pkey/p256.pem5
-rw-r--r--test/openssl/fixtures/pkey/rsa-1.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-2.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-3.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa1024.pem15
-rw-r--r--test/openssl/fixtures/pkey/rsa2048.pem27
-rw-r--r--test/openssl/test_asn1.rb833
-rw-r--r--test/openssl/test_bn.rb304
-rw-r--r--test/openssl/test_buffering.rb28
-rw-r--r--test/openssl/test_cipher.rb534
-rw-r--r--test/openssl/test_config.rb197
-rw-r--r--test/openssl/test_digest.rb135
-rw-r--r--test/openssl/test_engine.rb116
-rw-r--r--test/openssl/test_fips.rb22
-rw-r--r--test/openssl/test_hmac.rb65
-rw-r--r--test/openssl/test_kdf.rb183
-rw-r--r--test/openssl/test_ns_spki.rb14
-rw-r--r--test/openssl/test_ocsp.rb312
-rw-r--r--test/openssl/test_ossl.rb65
-rw-r--r--test/openssl/test_pair.rb425
-rw-r--r--test/openssl/test_partial_record_read.rb34
-rw-r--r--test/openssl/test_pkcs12.rb168
-rw-r--r--test/openssl/test_pkcs5.rb97
-rw-r--r--test/openssl/test_pkcs7.rb56
-rw-r--r--test/openssl/test_pkey.rb28
-rw-r--r--test/openssl/test_pkey_dh.rb68
-rw-r--r--test/openssl/test_pkey_dsa.rb305
-rw-r--r--test/openssl/test_pkey_ec.rb502
-rw-r--r--test/openssl/test_pkey_rsa.rb538
-rw-r--r--test/openssl/test_random.rb19
-rw-r--r--test/openssl/test_ssl.rb1544
-rw-r--r--test/openssl/test_ssl_session.rb454
-rw-r--r--test/openssl/test_ts.rb680
-rw-r--r--test/openssl/test_x509attr.rb94
-rw-r--r--test/openssl/test_x509cert.rb242
-rw-r--r--test/openssl/test_x509crl.rb142
-rw-r--r--test/openssl/test_x509ext.rb63
-rw-r--r--test/openssl/test_x509name.rb174
-rw-r--r--test/openssl/test_x509req.rb70
-rw-r--r--test/openssl/test_x509store.rb106
-rw-r--r--test/openssl/ut_eof.rb133
-rw-r--r--test/openssl/utils.rb552
-rw-r--r--test/optparse/test_acceptable.rb57
-rw-r--r--test/optparse/test_autoconf.rb10
-rw-r--r--test/optparse/test_bash_completion.rb6
-rw-r--r--test/optparse/test_cclass.rb18
-rw-r--r--test/optparse/test_did_you_mean.rb52
-rw-r--r--test/optparse/test_getopts.rb1
-rw-r--r--test/optparse/test_kwargs.rb40
-rw-r--r--test/optparse/test_noarg.rb22
-rw-r--r--test/optparse/test_optarg.rb14
-rw-r--r--test/optparse/test_optparse.rb44
-rw-r--r--test/optparse/test_placearg.rb14
-rw-r--r--test/optparse/test_reqarg.rb18
-rw-r--r--test/optparse/test_summary.rb12
-rw-r--r--test/optparse/test_zsh_completion.rb3
-rw-r--r--test/ostruct/test_ostruct.rb211
-rw-r--r--test/pathname/test_pathname.rb285
-rw-r--r--test/pathname/test_ractor.rb22
-rw-r--r--test/psych/handlers/test_recorder.rb1
-rw-r--r--test/psych/helper.rb48
-rw-r--r--test/psych/json/test_stream.rb1
-rw-r--r--test/psych/nodes/test_enumerable.rb1
-rw-r--r--test/psych/test_alias_and_anchor.rb13
-rw-r--r--test/psych/test_array.rb15
-rw-r--r--test/psych/test_boolean.rb1
-rw-r--r--test/psych/test_class.rb5
-rw-r--r--test/psych/test_coder.rb156
-rw-r--r--test/psych/test_date_time.rb34
-rw-r--r--test/psych/test_deprecated.rb131
-rw-r--r--test/psych/test_document.rb3
-rw-r--r--test/psych/test_emitter.rb31
-rw-r--r--test/psych/test_encoding.rb26
-rw-r--r--test/psych/test_exception.rb101
-rw-r--r--test/psych/test_hash.rb88
-rw-r--r--test/psych/test_json_tree.rb1
-rw-r--r--test/psych/test_marshalable.rb13
-rw-r--r--test/psych/test_merge_keys.rb35
-rw-r--r--test/psych/test_nil.rb5
-rw-r--r--test/psych/test_null.rb1
-rw-r--r--test/psych/test_numeric.rb1
-rw-r--r--test/psych/test_object.rb5
-rw-r--r--test/psych/test_object_references.rb13
-rw-r--r--test/psych/test_omap.rb5
-rw-r--r--test/psych/test_parser.rb79
-rw-r--r--test/psych/test_psych.rb260
-rw-r--r--test/psych/test_ractor.rb50
-rw-r--r--test/psych/test_safe_load.rb110
-rw-r--r--test/psych/test_scalar.rb6
-rw-r--r--test/psych/test_scalar_scanner.rb37
-rw-r--r--test/psych/test_serialize_subclasses.rb5
-rw-r--r--test/psych/test_set.rb7
-rw-r--r--test/psych/test_stream.rb17
-rw-r--r--test/psych/test_string.rb95
-rw-r--r--test/psych/test_struct.rb7
-rw-r--r--test/psych/test_symbol.rb1
-rw-r--r--test/psych/test_tainted.rb130
-rw-r--r--test/psych/test_to_yaml_properties.rb63
-rw-r--r--test/psych/test_tree_builder.rb15
-rw-r--r--test/psych/test_yaml.rb48
-rw-r--r--test/psych/test_yaml_special_cases.rb130
-rw-r--r--test/psych/test_yamldbm.rb2
-rw-r--r--test/psych/test_yamlstore.rb48
-rw-r--r--test/psych/visitors/test_depth_first.rb1
-rw-r--r--test/psych/visitors/test_emitter.rb1
-rw-r--r--test/psych/visitors/test_to_ruby.rb29
-rw-r--r--test/psych/visitors/test_yaml_tree.rb46
-rw-r--r--test/racc/assets/cadenza.y170
-rw-r--r--test/racc/assets/cast.y926
-rw-r--r--test/racc/assets/chk.y126
-rw-r--r--test/racc/assets/conf.y16
-rw-r--r--test/racc/assets/csspool.y729
-rw-r--r--test/racc/assets/digraph.y29
-rw-r--r--test/racc/assets/echk.y118
-rw-r--r--test/racc/assets/edtf.y583
-rw-r--r--test/racc/assets/err.y60
-rw-r--r--test/racc/assets/error_recovery.y35
-rw-r--r--test/racc/assets/expect.y7
-rw-r--r--test/racc/assets/firstline.y4
-rw-r--r--test/racc/assets/huia.y318
-rw-r--r--test/racc/assets/ichk.y102
-rw-r--r--test/racc/assets/ifelse.y14
-rw-r--r--test/racc/assets/intp.y546
-rw-r--r--test/racc/assets/journey.y47
-rw-r--r--test/racc/assets/liquor.y313
-rw-r--r--test/racc/assets/machete.y423
-rw-r--r--test/racc/assets/macruby.y2197
-rw-r--r--test/racc/assets/mailp.y437
-rw-r--r--test/racc/assets/mediacloth.y599
-rw-r--r--test/racc/assets/mof.y649
-rw-r--r--test/racc/assets/namae.y302
-rw-r--r--test/racc/assets/nasl.y626
-rw-r--r--test/racc/assets/newsyn.y25
-rw-r--r--test/racc/assets/noend.y4
-rw-r--r--test/racc/assets/nokogiri-css.y255
-rw-r--r--test/racc/assets/nonass.y41
-rw-r--r--test/racc/assets/normal.y27
-rw-r--r--test/racc/assets/norule.y4
-rw-r--r--test/racc/assets/nullbug1.y25
-rw-r--r--test/racc/assets/nullbug2.y15
-rw-r--r--test/racc/assets/opal.y1807
-rw-r--r--test/racc/assets/opt.y123
-rw-r--r--test/racc/assets/percent.y35
-rw-r--r--test/racc/assets/php_serialization.y98
-rw-r--r--test/racc/assets/recv.y97
-rw-r--r--test/racc/assets/riml.y665
-rw-r--r--test/racc/assets/rrconf.y14
-rw-r--r--test/racc/assets/ruby18.y1943
-rw-r--r--test/racc/assets/ruby19.y2174
-rw-r--r--test/racc/assets/ruby20.y2350
-rw-r--r--test/racc/assets/ruby21.y2359
-rw-r--r--test/racc/assets/ruby22.y2381
-rw-r--r--test/racc/assets/scan.y72
-rw-r--r--test/racc/assets/syntax.y50
-rw-r--r--test/racc/assets/tp_plus.y622
-rw-r--r--test/racc/assets/twowaysql.y278
-rw-r--r--test/racc/assets/unterm.y5
-rw-r--r--test/racc/assets/useless.y12
-rw-r--r--test/racc/assets/yyerr.y46
-rw-r--r--test/racc/bench.y36
-rw-r--r--test/racc/helper.rb115
-rw-r--r--test/racc/infini.y8
-rw-r--r--test/racc/regress/README.txt7
-rw-r--r--test/racc/regress/cadenza796
-rw-r--r--test/racc/regress/cast3428
-rw-r--r--test/racc/regress/csspool2314
-rw-r--r--test/racc/regress/edtf1794
-rw-r--r--test/racc/regress/huia1392
-rw-r--r--test/racc/regress/journey222
-rw-r--r--test/racc/regress/liquor885
-rw-r--r--test/racc/regress/machete833
-rw-r--r--test/racc/regress/mediacloth1463
-rw-r--r--test/racc/regress/mof1368
-rw-r--r--test/racc/regress/namae634
-rw-r--r--test/racc/regress/nasl2058
-rw-r--r--test/racc/regress/nokogiri-css836
-rw-r--r--test/racc/regress/opal6431
-rw-r--r--test/racc/regress/php_serialization336
-rw-r--r--test/racc/regress/riml3283
-rw-r--r--test/racc/regress/ruby186344
-rw-r--r--test/racc/regress/ruby227460
-rw-r--r--test/racc/regress/tp_plus1933
-rw-r--r--test/racc/regress/twowaysql556
-rw-r--r--test/racc/scandata/brace7
-rw-r--r--test/racc/scandata/gvar1
-rw-r--r--test/racc/scandata/normal4
-rw-r--r--test/racc/scandata/percent18
-rw-r--r--test/racc/scandata/slash10
-rw-r--r--test/racc/src.intp34
-rw-r--r--test/racc/start.y20
-rw-r--r--test/racc/test_chk_y.rb52
-rw-r--r--test/racc/test_grammar_file_parser.rb15
-rw-r--r--test/racc/test_racc_command.rb339
-rw-r--r--test/racc/test_scan_y.rb52
-rw-r--r--test/racc/testscanner.rb51
-rw-r--r--test/rake/file_creation.rb34
-rw-r--r--test/rake/helper.rb129
-rw-r--r--test/rake/support/rakefile_definitions.rb478
-rw-r--r--test/rake/support/ruby_runner.rb34
-rw-r--r--test/rake/test_private_reader.rb42
-rw-r--r--test/rake/test_rake.rb40
-rw-r--r--test/rake/test_rake_application.rb643
-rw-r--r--test/rake/test_rake_application_options.rb466
-rw-r--r--test/rake/test_rake_backtrace.rb119
-rw-r--r--test/rake/test_rake_clean.rb61
-rw-r--r--test/rake/test_rake_cpu_counter.rb68
-rw-r--r--test/rake/test_rake_definitions.rb84
-rw-r--r--test/rake/test_rake_directory_task.rb76
-rw-r--r--test/rake/test_rake_dsl.rb40
-rw-r--r--test/rake/test_rake_early_time.rb31
-rw-r--r--test/rake/test_rake_extension.rb59
-rw-r--r--test/rake/test_rake_file_creation_task.rb56
-rw-r--r--test/rake/test_rake_file_list.rb655
-rw-r--r--test/rake/test_rake_file_list_path_map.rb8
-rw-r--r--test/rake/test_rake_file_task.rb197
-rw-r--r--test/rake/test_rake_file_utils.rb309
-rw-r--r--test/rake/test_rake_ftp_file.rb74
-rw-r--r--test/rake/test_rake_functional.rb482
-rw-r--r--test/rake/test_rake_invocation_chain.rb64
-rw-r--r--test/rake/test_rake_late_time.rb18
-rw-r--r--test/rake/test_rake_linked_list.rb84
-rw-r--r--test/rake/test_rake_makefile_loader.rb46
-rw-r--r--test/rake/test_rake_multi_task.rb64
-rw-r--r--test/rake/test_rake_name_space.rb57
-rw-r--r--test/rake/test_rake_package_task.rb79
-rw-r--r--test/rake/test_rake_path_map.rb168
-rw-r--r--test/rake/test_rake_path_map_explode.rb34
-rw-r--r--test/rake/test_rake_path_map_partial.rb18
-rw-r--r--test/rake/test_rake_pathname_extensions.rb15
-rw-r--r--test/rake/test_rake_pseudo_status.rb21
-rw-r--r--test/rake/test_rake_rake_test_loader.rb20
-rw-r--r--test/rake/test_rake_reduce_compat.rb26
-rw-r--r--test/rake/test_rake_require.rb40
-rw-r--r--test/rake/test_rake_rules.rb388
-rw-r--r--test/rake/test_rake_scope.rb44
-rw-r--r--test/rake/test_rake_task.rb393
-rw-r--r--test/rake/test_rake_task_argument_parsing.rb119
-rw-r--r--test/rake/test_rake_task_arguments.rb127
-rw-r--r--test/rake/test_rake_task_lib.rb9
-rw-r--r--test/rake/test_rake_task_manager.rb178
-rw-r--r--test/rake/test_rake_task_manager_argument_resolution.rb19
-rw-r--r--test/rake/test_rake_task_with_arguments.rb172
-rw-r--r--test/rake/test_rake_test_task.rb146
-rw-r--r--test/rake/test_rake_thread_pool.rb145
-rw-r--r--test/rake/test_rake_top_level_functions.rb71
-rw-r--r--test/rake/test_rake_win32.rb72
-rw-r--r--test/rake/test_thread_history_display.rb101
-rw-r--r--test/rake/test_trace_output.rb52
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text2
-rw-r--r--test/rdoc/helper.rb5
-rw-r--r--test/rdoc/support/formatter_test_case.rb764
-rw-r--r--test/rdoc/support/test_case.rb228
-rw-r--r--test/rdoc/support/text_formatter_test_case.rb115
-rw-r--r--test/rdoc/test_rdoc_alias.rb1
-rw-r--r--test/rdoc/test_rdoc_any_method.rb67
-rw-r--r--test/rdoc/test_rdoc_attr.rb6
-rw-r--r--test/rdoc/test_rdoc_class_module.rb56
-rw-r--r--test/rdoc/test_rdoc_code_object.rb18
-rw-r--r--test/rdoc/test_rdoc_comment.rb25
-rw-r--r--test/rdoc/test_rdoc_constant.rb9
-rw-r--r--test/rdoc/test_rdoc_context.rb114
-rw-r--r--test/rdoc/test_rdoc_context_section.rb37
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb33
-rw-r--r--test/rdoc/test_rdoc_encoding.rb101
-rw-r--r--test/rdoc/test_rdoc_extend.rb1
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb37
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb47
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb3
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb3
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb3
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb3
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb12
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb11
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb5
-rw-r--r--test/rdoc/test_rdoc_include.rb1
-rw-r--r--test/rdoc/test_rdoc_markdown.rb103
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb13
-rw-r--r--test/rdoc/test_rdoc_markup.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb76
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb11
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb5
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb60
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb76
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb24
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb18
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb196
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb124
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb24
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb7
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb3
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb3
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb1
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb1
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb1
-rw-r--r--test/rdoc/test_rdoc_options.rb124
-rw-r--r--test/rdoc/test_rdoc_parser.rb32
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb143
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb176
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb3
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb3
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb1294
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb3
-rw-r--r--test/rdoc/test_rdoc_rd.rb3
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb5
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb3
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb3
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb224
-rw-r--r--test/rdoc/test_rdoc_require.rb7
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb252
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb17
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb421
-rw-r--r--test/rdoc/test_rdoc_ruby_token.rb19
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb106
-rw-r--r--test/rdoc/test_rdoc_servlet.rb60
-rw-r--r--test/rdoc/test_rdoc_single_class.rb3
-rw-r--r--test/rdoc/test_rdoc_stats.rb3
-rw-r--r--test/rdoc/test_rdoc_store.rb70
-rw-r--r--test/rdoc/test_rdoc_task.rb20
-rw-r--r--test/rdoc/test_rdoc_text.rb74
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb40
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb67
-rw-r--r--test/rdoc/test_rdoc_top_level.rb6
-rw-r--r--test/rdoc/xref_data.rb59
-rw-r--r--test/rdoc/xref_test_case.rb27
-rw-r--r--test/readline/helper.rb24
-rw-r--r--test/readline/test_readline.rb544
-rw-r--r--test/readline/test_readline_history.rb193
-rw-r--r--test/reline/helper.rb113
-rw-r--r--test/reline/test_config.rb325
-rw-r--r--test/reline/test_history.rb301
-rw-r--r--test/reline/test_key_actor_emacs.rb2315
-rw-r--r--test/reline/test_key_actor_vi.rb1455
-rw-r--r--test/reline/test_key_stroke.rb49
-rw-r--r--test/reline/test_kill_ring.rb268
-rw-r--r--test/reline/test_macro.rb39
-rw-r--r--test/reline/test_reline.rb319
-rw-r--r--test/reline/test_string_processing.rb77
-rw-r--r--test/reline/test_unicode.rb16
-rw-r--r--test/reline/test_within_pipe.rb75
-rwxr-xr-xtest/reline/yamatanooroti/multiline_repl74
-rw-r--r--test/reline/yamatanooroti/termination_checker.rb30
-rw-r--r--test/reline/yamatanooroti/test_rendering.rb742
-rw-r--r--test/resolv/test_addr.rb34
-rw-r--r--test/resolv/test_dns.rb242
-rw-r--r--test/resolv/test_mdns.rb27
-rw-r--r--test/resolv/test_resource.rb5
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin50154 -> 0 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin161690 -> 0 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/utf16.xmlbin207464 -> 0 bytes-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb50
-rw-r--r--test/rexml/parse/test_document_type_declaration.rb49
-rw-r--r--test/rexml/parse/test_notation_declaration.rb99
-rw-r--r--test/rexml/parser/test_sax2.rb202
-rw-r--r--test/rexml/parser/test_tree.rb42
-rw-r--r--test/rexml/parser/test_ultra_light.rb69
-rw-r--r--test/rexml/rexml_test_utils.rb6
-rw-r--r--test/rexml/test_attributes.rb222
-rw-r--r--test/rexml/test_attributes_mixin.rb31
-rw-r--r--test/rexml/test_changing_encoding.rb44
-rw-r--r--test/rexml/test_comment.rb25
-rw-r--r--test/rexml/test_contrib.rb584
-rw-r--r--test/rexml/test_core.rb1467
-rw-r--r--test/rexml/test_doctype.rb106
-rw-r--r--test/rexml/test_document.rb415
-rw-r--r--test/rexml/test_elements.rb118
-rw-r--r--test/rexml/test_encoding.rb107
-rw-r--r--test/rexml/test_entity.rb205
-rw-r--r--test/rexml/test_functions.rb224
-rw-r--r--test/rexml/test_functions_number.rb34
-rw-r--r--test/rexml/test_jaxen.rb129
-rw-r--r--test/rexml/test_light.rb106
-rw-r--r--test/rexml/test_lightparser.rb15
-rw-r--r--test/rexml/test_listener.rb130
-rw-r--r--test/rexml/test_martin_fowler.rb39
-rw-r--r--test/rexml/test_namespace.rb40
-rw-r--r--test/rexml/test_order.rb109
-rw-r--r--test/rexml/test_preceding_sibling.rb40
-rw-r--r--test/rexml/test_pullparser.rb102
-rw-r--r--test/rexml/test_rexml_issuezilla.rb18
-rw-r--r--test/rexml/test_sax.rb286
-rw-r--r--test/rexml/test_stream.rb129
-rw-r--r--test/rexml/test_text.rb21
-rw-r--r--test/rexml/test_ticket_80.rb58
-rw-r--r--test/rexml/test_validation_rng.rb792
-rw-r--r--test/rexml/test_xml_declaration.rb35
-rw-r--r--test/rexml/xpath/test_attribute.rb29
-rw-r--r--test/rexml/xpath/test_axis_preceding_sibling.rb39
-rw-r--r--test/rexml/xpath/test_base.rb1089
-rw-r--r--test/rexml/xpath/test_node.rb42
-rw-r--r--test/rexml/xpath/test_predicate.rb82
-rw-r--r--test/rexml/xpath/test_text.rb74
-rw-r--r--test/rinda/test_rinda.rb189
-rw-r--r--test/rinda/test_tuplebag.rb1
-rw-r--r--test/ripper/assert_parse_files.rb32
-rw-r--r--test/ripper/dummyparser.rb72
-rw-r--r--test/ripper/test_files.rb23
-rw-r--r--test/ripper/test_files_ext.rb8
-rw-r--r--test/ripper/test_files_lib.rb14
-rw-r--r--test/ripper/test_files_sample.rb8
-rw-r--r--test/ripper/test_files_test.rb8
-rw-r--r--test/ripper/test_files_test_1.rb9
-rw-r--r--test/ripper/test_files_test_2.rb9
-rw-r--r--test/ripper/test_filter.rb14
-rw-r--r--test/ripper/test_lexer.rb230
-rw-r--r--test/ripper/test_parser_events.rb492
-rw-r--r--test/ripper/test_ripper.rb84
-rw-r--r--test/ripper/test_scanner_events.rb192
-rw-r--r--test/ripper/test_sexp.rb466
-rw-r--r--test/rss/dot.pngbin111 -> 0 bytes-rw-r--r--test/rss/rss-assertions.rb2090
-rw-r--r--test/rss/rss-testcase.rb478
-rw-r--r--test/rss/test_1.0.rb307
-rw-r--r--test/rss/test_2.0.rb411
-rw-r--r--test/rss/test_accessor.rb103
-rw-r--r--test/rss/test_atom.rb683
-rw-r--r--test/rss/test_content.rb104
-rw-r--r--test/rss/test_dublincore.rb269
-rw-r--r--test/rss/test_image.rb214
-rw-r--r--test/rss/test_inherit.rb40
-rw-r--r--test/rss/test_itunes.rb347
-rw-r--r--test/rss/test_maker_0.9.rb474
-rw-r--r--test/rss/test_maker_1.0.rb516
-rw-r--r--test/rss/test_maker_2.0.rb757
-rw-r--r--test/rss/test_maker_atom_entry.rb393
-rw-r--r--test/rss/test_maker_atom_feed.rb454
-rw-r--r--test/rss/test_maker_content.rb47
-rw-r--r--test/rss/test_maker_dc.rb149
-rw-r--r--test/rss/test_maker_image.rb62
-rw-r--r--test/rss/test_maker_itunes.rb469
-rw-r--r--test/rss/test_maker_slash.rb37
-rw-r--r--test/rss/test_maker_sy.rb44
-rw-r--r--test/rss/test_maker_taxo.rb81
-rw-r--r--test/rss/test_maker_trackback.rb41
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb83
-rw-r--r--test/rss/test_parser.rb64
-rw-r--r--test/rss/test_parser_1.0.rb528
-rw-r--r--test/rss/test_parser_2.0.rb122
-rw-r--r--test/rss/test_parser_atom_entry.rb163
-rw-r--r--test/rss/test_parser_atom_feed.rb276
-rw-r--r--test/rss/test_setup_maker_0.9.rb246
-rw-r--r--test/rss/test_setup_maker_1.0.rb550
-rw-r--r--test/rss/test_setup_maker_2.0.rb308
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb409
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb445
-rw-r--r--test/rss/test_setup_maker_itunes.rb143
-rw-r--r--test/rss/test_setup_maker_slash.rb38
-rw-r--r--test/rss/test_slash.rb64
-rw-r--r--test/rss/test_syndication.rb125
-rw-r--r--test/rss/test_taxonomy.rb172
-rw-r--r--test/rss/test_to_s.rb676
-rw-r--r--test/rss/test_trackback.rb135
-rw-r--r--test/rss/test_version.rb9
-rw-r--r--test/rss/test_xml-stylesheet.rb108
-rw-r--r--test/ruby/allpairs.rb1
-rw-r--r--test/ruby/beginmainend.rb5
-rw-r--r--test/ruby/bug-11928.rb14
-rw-r--r--test/ruby/bug-13526.rb22
-rw-r--r--test/ruby/enc/test_big5.rb1
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb307
-rw-r--r--test/ruby/enc/test_case_mapping.rb231
-rw-r--r--test/ruby/enc/test_case_options.rb81
-rw-r--r--test/ruby/enc/test_cesu8.rb109
-rw-r--r--test/ruby/enc/test_cp949.rb1
-rw-r--r--test/ruby/enc/test_emoji.rb1
-rw-r--r--test/ruby/enc/test_emoji_breaks.rb122
-rw-r--r--test/ruby/enc/test_euc_jp.rb1
-rw-r--r--test/ruby/enc/test_euc_kr.rb1
-rw-r--r--test/ruby/enc/test_euc_tw.rb1
-rw-r--r--test/ruby/enc/test_gb18030.rb1
-rw-r--r--test/ruby/enc/test_gbk.rb1
-rw-r--r--test/ruby/enc/test_grapheme_breaks.rb95
-rw-r--r--test/ruby/enc/test_iso_8859.rb7
-rw-r--r--test/ruby/enc/test_koi8.rb1
-rw-r--r--test/ruby/enc/test_regex_casefold.rb120
-rw-r--r--test/ruby/enc/test_shift_jis.rb1
-rw-r--r--test/ruby/enc/test_utf16.rb113
-rw-r--r--test/ruby/enc/test_utf32.rb69
-rw-r--r--test/ruby/enc/test_windows_1251.rb1
-rw-r--r--test/ruby/enc/test_windows_1252.rb1
-rw-r--r--test/ruby/endblockwarn_rb12
-rw-r--r--test/ruby/lbtest.rb6
-rw-r--r--test/ruby/marshaltestlib.rb5
-rw-r--r--test/ruby/sentence.rb3
-rw-r--r--test/ruby/test_alias.rb103
-rw-r--r--test/ruby/test_argf.rb794
-rw-r--r--test/ruby/test_arithmetic_sequence.rb491
-rw-r--r--test/ruby/test_arity.rb45
-rw-r--r--test/ruby/test_array.rb1289
-rw-r--r--test/ruby/test_assignment.rb58
-rw-r--r--test/ruby/test_ast.rb348
-rw-r--r--test/ruby/test_autoload.rb288
-rw-r--r--test/ruby/test_backtrace.rb170
-rw-r--r--test/ruby/test_basicinstructions.rb39
-rw-r--r--test/ruby/test_beginendblock.rb211
-rw-r--r--test/ruby/test_bignum.rb289
-rw-r--r--test/ruby/test_call.rb77
-rw-r--r--test/ruby/test_case.rb24
-rw-r--r--test/ruby/test_class.rb375
-rw-r--r--test/ruby/test_clone.rb36
-rw-r--r--test/ruby/test_comparable.rb59
-rw-r--r--test/ruby/test_complex.rb438
-rw-r--r--test/ruby/test_complex2.rb1
-rw-r--r--test/ruby/test_complexrational.rb27
-rw-r--r--test/ruby/test_condition.rb1
-rw-r--r--test/ruby/test_const.rb55
-rw-r--r--test/ruby/test_continuation.rb27
-rw-r--r--test/ruby/test_default_gems.rb16
-rw-r--r--test/ruby/test_defined.rb136
-rw-r--r--test/ruby/test_dir.rb372
-rw-r--r--test/ruby/test_dir_m17n.rb137
-rw-r--r--test/ruby/test_econv.rb40
-rw-r--r--test/ruby/test_encoding.rb52
-rw-r--r--test/ruby/test_enum.rb676
-rw-r--r--test/ruby/test_enumerator.rb282
-rw-r--r--test/ruby/test_env.rb243
-rw-r--r--test/ruby/test_eval.rb110
-rw-r--r--test/ruby/test_exception.rb705
-rw-r--r--test/ruby/test_fiber.rb306
-rw-r--r--test/ruby/test_file.rb174
-rw-r--r--test/ruby/test_file_exhaustive.rb1386
-rw-r--r--test/ruby/test_fixnum.rb40
-rw-r--r--test/ruby/test_flip.rb34
-rw-r--r--test/ruby/test_float.rb321
-rw-r--r--test/ruby/test_fnmatch.rb38
-rw-r--r--test/ruby/test_frozen_error.rb57
-rw-r--r--test/ruby/test_gc.rb173
-rw-r--r--test/ruby/test_gc_compact.rb155
-rw-r--r--test/ruby/test_hash.rb766
-rw-r--r--test/ruby/test_ifunless.rb3
-rw-r--r--test/ruby/test_inlinecache.rb110
-rw-r--r--test/ruby/test_integer.rb519
-rw-r--r--test/ruby/test_integer_comb.rb99
-rw-r--r--test/ruby/test_io.rb1242
-rw-r--r--test/ruby/test_io_m17n.rb193
-rw-r--r--test/ruby/test_iseq.rb491
-rw-r--r--test/ruby/test_iterator.rb43
-rw-r--r--test/ruby/test_jit.rb1224
-rw-r--r--test/ruby/test_jit_debug.rb17
-rw-r--r--test/ruby/test_key_error.rb42
-rw-r--r--test/ruby/test_keyword.rb3762
-rw-r--r--test/ruby/test_lambda.rb134
-rw-r--r--test/ruby/test_lazy_enumerator.rb199
-rw-r--r--test/ruby/test_literal.rb163
-rw-r--r--test/ruby/test_m17n.rb143
-rw-r--r--test/ruby/test_m17n_comb.rb34
-rw-r--r--test/ruby/test_marshal.rb349
-rw-r--r--test/ruby/test_math.rb152
-rw-r--r--test/ruby/test_memory_view.rb341
-rw-r--r--test/ruby/test_metaclass.rb1
-rw-r--r--test/ruby/test_method.rb647
-rw-r--r--test/ruby/test_method_cache.rb65
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb11
-rw-r--r--test/ruby/test_module.rb1183
-rw-r--r--test/ruby/test_name_error.rb156
-rw-r--r--test/ruby/test_nomethod_error.rb109
-rw-r--r--test/ruby/test_not.rb3
-rw-r--r--test/ruby/test_notimp.rb84
-rw-r--r--test/ruby/test_numeric.rb366
-rw-r--r--test/ruby/test_object.rb255
-rw-r--r--test/ruby/test_objectspace.rb124
-rw-r--r--test/ruby/test_optimization.rb609
-rw-r--r--test/ruby/test_pack.rb152
-rw-r--r--test/ruby/test_parse.rb895
-rw-r--r--test/ruby/test_path.rb12
-rw-r--r--test/ruby/test_pattern_matching.rb1505
-rw-r--r--test/ruby/test_pipe.rb20
-rw-r--r--test/ruby/test_primitive.rb81
-rw-r--r--test/ruby/test_proc.rb509
-rw-r--r--test/ruby/test_process.rb718
-rw-r--r--test/ruby/test_rand.rb422
-rw-r--r--test/ruby/test_range.rb534
-rw-r--r--test/ruby/test_rational.rb439
-rw-r--r--test/ruby/test_rational2.rb1
-rw-r--r--test/ruby/test_readpartial.rb5
-rw-r--r--test/ruby/test_refinement.rb1229
-rw-r--r--test/ruby/test_regexp.rb371
-rw-r--r--test/ruby/test_require.rb363
-rw-r--r--test/ruby/test_require_lib.rb28
-rw-r--r--test/ruby/test_rubyoptions.rb614
-rw-r--r--test/ruby/test_rubyvm.rb5
-rw-r--r--test/ruby/test_rubyvm_mjit.rb91
-rw-r--r--test/ruby/test_settracefunc.rb1095
-rw-r--r--test/ruby/test_signal.rb137
-rw-r--r--test/ruby/test_sleep.rb1
-rw-r--r--test/ruby/test_sprintf.rb137
-rw-r--r--test/ruby/test_sprintf_comb.rb1
-rw-r--r--test/ruby/test_stack.rb82
-rw-r--r--test/ruby/test_string.rb1323
-rw-r--r--test/ruby/test_stringchar.rb1
-rw-r--r--test/ruby/test_struct.rb124
-rw-r--r--test/ruby/test_super.rb182
-rw-r--r--test/ruby/test_symbol.rb333
-rw-r--r--test/ruby/test_syntax.rb1253
-rw-r--r--test/ruby/test_system.rb42
-rw-r--r--test/ruby/test_thread.rb651
-rw-r--r--test/ruby/test_thread_cv.rb245
-rw-r--r--test/ruby/test_thread_queue.rb631
-rw-r--r--test/ruby/test_threadgroup.rb2
-rw-r--r--test/ruby/test_time.rb266
-rw-r--r--test/ruby/test_time_tz.rb451
-rw-r--r--test/ruby/test_trace.rb12
-rw-r--r--test/ruby/test_transcode.rb216
-rw-r--r--test/ruby/test_undef.rb3
-rw-r--r--test/ruby/test_unicode_escape.rb20
-rw-r--r--test/ruby/test_variable.rb131
-rw-r--r--test/ruby/test_vm_dump.rb21
-rw-r--r--test/ruby/test_weakmap.rb65
-rw-r--r--test/ruby/test_whileuntil.rb3
-rw-r--r--test/ruby/test_yield.rb24
-rw-r--r--test/ruby/ut_eof.rb1
-rw-r--r--test/rubygems/alternate_cert.pem19
-rw-r--r--test/rubygems/alternate_cert_32.pem19
-rw-r--r--test/rubygems/bad_rake.rb1
-rw-r--r--test/rubygems/bogussources.rb1
-rw-r--r--test/rubygems/ca_cert.pem139
-rw-r--r--test/rubygems/child_cert.pem20
-rw-r--r--test/rubygems/child_cert_32.pem20
-rw-r--r--test/rubygems/client.pem148
-rw-r--r--test/rubygems/data/null-required-ruby-version.gemspec.rzbin0 -> 403 bytes-rw-r--r--test/rubygems/data/null-required-rubygems-version.gemspec.rzbin0 -> 421 bytes-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin554 -> 504 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem52
-rw-r--r--test/rubygems/expired_cert.pem17
-rw-r--r--test/rubygems/fake_certlib/openssl.rb1
-rw-r--r--test/rubygems/fix_openssl_warnings.rb12
-rw-r--r--test/rubygems/foo/discover.rb1
-rw-r--r--test/rubygems/future_cert.pem17
-rw-r--r--test/rubygems/future_cert_32.pem17
-rw-r--r--test/rubygems/good_rake.rb1
-rw-r--r--test/rubygems/grandchild_cert.pem20
-rw-r--r--test/rubygems/grandchild_cert_32.pem20
-rw-r--r--test/rubygems/helper.rb1595
-rw-r--r--test/rubygems/installer_test_case.rb247
-rw-r--r--test/rubygems/invalid_issuer_cert.pem20
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem20
-rw-r--r--test/rubygems/invalid_signer_cert.pem19
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem19
-rw-r--r--test/rubygems/invalidchild_cert.pem20
-rw-r--r--test/rubygems/invalidchild_cert_32.pem20
-rw-r--r--test/rubygems/package/tar_test_case.rb139
-rw-r--r--test/rubygems/packages/ascii_binder-0.1.10.1.gembin0 -> 244736 bytes-rw-r--r--test/rubygems/packages/ill-formatted-platform-1.0.0.10.gembin0 -> 10240 bytes-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb1
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb1
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb1
-rw-r--r--test/rubygems/private3072_key.pem40
-rw-r--r--test/rubygems/private_ec_key.pem9
-rw-r--r--test/rubygems/public3072_cert.pem25
-rw-r--r--test/rubygems/public_cert.pem20
-rw-r--r--test/rubygems/public_cert_32.pem19
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb3
-rw-r--r--test/rubygems/rubygems_plugin.rb8
-rw-r--r--test/rubygems/sff/discover.rb1
-rw-r--r--test/rubygems/simple_gem.rb5
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec2
-rw-r--r--test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspec (renamed from test/rubygems/specifications/foo-0.0.1.gemspec)bin269 -> 269 bytes-rw-r--r--test/rubygems/specifications/rubyforge-0.0.1.gemspec12
-rw-r--r--test/rubygems/ssl_cert.pem95
-rw-r--r--test/rubygems/ssl_key.pem38
-rw-r--r--test/rubygems/test_bundled_ca.rb44
-rw-r--r--test/rubygems/test_config.rb21
-rw-r--r--test/rubygems/test_deprecate.rb99
-rw-r--r--test/rubygems/test_gem.rb1478
-rw-r--r--test/rubygems/test_gem_available_set.rb17
-rw-r--r--test/rubygems/test_gem_bundler_version_finder.rb146
-rw-r--r--test/rubygems/test_gem_command.rb181
-rw-r--r--test/rubygems/test_gem_command_manager.rb87
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb645
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb291
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb17
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb182
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb79
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb84
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb58
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb60
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb36
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb35
-rw-r--r--test/rubygems/test_gem_commands_info_command.rb43
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb709
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb7
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb8
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb19
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb67
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb28
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb240
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb308
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb270
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb561
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb6
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb18
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb423
-rw-r--r--test/rubygems/test_gem_commands_signin_command.rb130
-rw-r--r--test/rubygems/test_gem_commands_signout_command.rb30
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb264
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb94
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb12
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb341
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb41
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb349
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb19
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb115
-rw-r--r--test/rubygems/test_gem_config_file.rb93
-rw-r--r--test/rubygems/test_gem_dependency.rb64
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb479
-rw-r--r--test/rubygems/test_gem_dependency_list.rb69
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb8
-rw-r--r--test/rubygems/test_gem_doctor.rb98
-rw-r--r--test/rubygems/test_gem_ext_builder.rb164
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb47
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb45
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb140
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb104
-rw-r--r--test/rubygems/test_gem_gem_runner.rb53
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb108
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb6
-rw-r--r--test/rubygems/test_gem_indexer.rb117
-rw-r--r--test/rubygems/test_gem_install_update_options.rb113
-rw-r--r--test/rubygems/test_gem_installer.rb1630
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb11
-rw-r--r--test/rubygems/test_gem_name_tuple.rb6
-rw-r--r--test/rubygems/test_gem_package.rb534
-rw-r--r--test/rubygems/test_gem_package_old.rb115
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb93
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb6
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb40
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb146
-rw-r--r--test/rubygems/test_gem_package_task.rb67
-rw-r--r--test/rubygems/test_gem_path_support.rb90
-rw-r--r--test/rubygems/test_gem_platform.rb105
-rw-r--r--test/rubygems/test_gem_rdoc.rb157
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb818
-rw-r--r--test/rubygems/test_gem_request.rb253
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb48
-rw-r--r--test/rubygems/test_gem_request_set.rb204
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb280
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb878
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb543
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb306
-rw-r--r--test/rubygems/test_gem_requirement.rb161
-rw-r--r--test/rubygems/test_gem_resolver.rb216
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb41
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb123
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb32
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb39
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb6
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb14
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb6
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb8
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb13
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb10
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb17
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb7
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb74
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb8
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb12
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb23
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb6
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb10
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb12
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb6
-rw-r--r--test/rubygems/test_gem_security.rb108
-rw-r--r--test/rubygems/test_gem_security_policy.rb131
-rw-r--r--test/rubygems/test_gem_security_signer.rb55
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb24
-rw-r--r--test/rubygems/test_gem_server.rb254
-rw-r--r--test/rubygems/test_gem_silent_ui.rb22
-rw-r--r--test/rubygems/test_gem_source.rb78
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb25
-rw-r--r--test/rubygems/test_gem_source_git.rb63
-rw-r--r--test/rubygems/test_gem_source_installed.rb28
-rw-r--r--test/rubygems/test_gem_source_list.rb11
-rw-r--r--test/rubygems/test_gem_source_local.rb20
-rw-r--r--test/rubygems/test_gem_source_lock.rb40
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb24
-rw-r--r--test/rubygems/test_gem_source_subpath_problem.rb49
-rw-r--r--test/rubygems/test_gem_source_vendor.rb20
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb39
-rw-r--r--test/rubygems/test_gem_specification.rb1999
-rw-r--r--test/rubygems/test_gem_stream_ui.rb58
-rw-r--r--test/rubygems/test_gem_stub_specification.rb138
-rw-r--r--test/rubygems/test_gem_text.rb24
-rw-r--r--test/rubygems/test_gem_uninstaller.rb275
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb6
-rw-r--r--test/rubygems/test_gem_uri.rb39
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb6
-rw-r--r--test/rubygems/test_gem_util.rb73
-rw-r--r--test/rubygems/test_gem_validator.rb13
-rw-r--r--test/rubygems/test_gem_version.rb136
-rw-r--r--test/rubygems/test_gem_version_option.rb23
-rw-r--r--test/rubygems/test_kernel.rb76
-rw-r--r--test/rubygems/test_project_sanity.rb20
-rw-r--r--test/rubygems/test_remote_fetch_error.rb19
-rw-r--r--test/rubygems/test_require.rb786
-rw-r--r--test/rubygems/test_rubygems.rb44
-rw-r--r--test/rubygems/utilities.rb371
-rw-r--r--test/rubygems/wrong_key_cert.pem19
-rw-r--r--test/rubygems/wrong_key_cert_32.pem19
-rw-r--r--test/runner.rb48
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb303
-rw-r--r--test/scanf/test_scanfblocks.rb81
-rw-r--r--test/scanf/test_scanfio.rb20
-rw-r--r--test/sdbm/test_sdbm.rb541
-rw-r--r--test/shell/test_command_processor.rb68
-rw-r--r--test/socket/test_addrinfo.rb45
-rw-r--r--test/socket/test_ancdata.rb2
-rw-r--r--test/socket/test_basicsocket.rb123
-rw-r--r--test/socket/test_nonblock.rb108
-rw-r--r--test/socket/test_socket.rb156
-rw-r--r--test/socket/test_sockopt.rb2
-rw-r--r--test/socket/test_tcp.rb66
-rw-r--r--test/socket/test_udp.rb48
-rw-r--r--test/socket/test_unix.rb65
-rw-r--r--test/stringio/test_ractor.rb23
-rw-r--r--test/stringio/test_stringio.rb345
-rw-r--r--test/strscan/test_ractor.rb28
-rw-r--r--test/strscan/test_stringscanner.rb363
-rw-r--r--test/syslog/test_syslog_logger.rb16
-rw-r--r--test/test_abbrev.rb1
-rw-r--r--test/test_cmath.rb16
-rw-r--r--test/test_delegate.rb166
-rw-r--r--test/test_extlibs.rb81
-rw-r--r--test/test_find.rb41
-rw-r--r--test/test_forwardable.rb185
-rw-r--r--test/test_ipaddr.rb128
-rw-r--r--test/test_mathn.rb119
-rw-r--r--test/test_mutex_m.rb36
-rw-r--r--test/test_observer.rb66
-rw-r--r--test/test_open3.rb84
-rw-r--r--test/test_pp.rb78
-rw-r--r--test/test_prettyprint.rb14
-rw-r--r--test/test_prime.rb241
-rw-r--r--test/test_pstore.rb24
-rw-r--r--test/test_pty.rb8
-rw-r--r--test/test_rbconfig.rb10
-rw-r--r--test/test_securerandom.rb106
-rw-r--r--test/test_set.rb354
-rw-r--r--test/test_shellwords.rb100
-rw-r--r--test/test_singleton.rb13
-rw-r--r--test/test_sorted_set.rb45
-rw-r--r--test/test_syslog.rb16
-rw-r--r--test/test_tempfile.rb130
-rw-r--r--test/test_time.rb102
-rw-r--r--test/test_timeout.rb24
-rw-r--r--test/test_tmpdir.rb81
-rw-r--r--test/test_tracer.rb186
-rw-r--r--test/test_tsort.rb2
-rw-r--r--test/test_unicode_normalize.rb54
-rw-r--r--test/test_weakref.rb3
-rw-r--r--test/test_win32api.rb23
-rw-r--r--test/testunit/test4test_hideskip.rb9
-rw-r--r--test/testunit/test4test_redefinition.rb13
-rw-r--r--test/testunit/test4test_sorting.rb17
-rw-r--r--test/testunit/test_assertion.rb8
-rw-r--r--test/testunit/test_hideskip.rb16
-rw-r--r--test/testunit/test_parallel.rb191
-rw-r--r--test/testunit/test_rake_integration.rb35
-rw-r--r--test/testunit/test_redefinition.rb15
-rw-r--r--test/testunit/test_sorting.rb17
-rw-r--r--test/testunit/tests_for_parallel/ptest_first.rb7
-rw-r--r--test/testunit/tests_for_parallel/ptest_forth.rb29
-rw-r--r--test/testunit/tests_for_parallel/ptest_second.rb11
-rw-r--r--test/testunit/tests_for_parallel/ptest_third.rb10
-rw-r--r--test/testunit/tests_for_parallel/runner.rb13
-rw-r--r--test/thread/test_cv.rb221
-rw-r--r--test/thread/test_queue.rb280
-rw-r--r--test/thread/test_sync.rb63
-rw-r--r--test/uri/test_common.rb15
-rw-r--r--test/uri/test_file.rb67
-rw-r--r--test/uri/test_ftp.rb1
-rw-r--r--test/uri/test_generic.rb265
-rw-r--r--test/uri/test_http.rb6
-rw-r--r--test/uri/test_ldap.rb5
-rw-r--r--test/uri/test_mailto.rb74
-rw-r--r--test/uri/test_parser.rb43
-rw-r--r--test/uri/test_ws.rb71
-rw-r--r--test/webrick/test_cgi.rb151
-rw-r--r--test/webrick/test_cookie.rb131
-rw-r--r--test/webrick/test_filehandler.rb309
-rw-r--r--test/webrick/test_htmlutils.rb20
-rw-r--r--test/webrick/test_httpauth.rb198
-rw-r--r--test/webrick/test_httpproxy.rb284
-rw-r--r--test/webrick/test_httprequest.rb411
-rw-r--r--test/webrick/test_httpresponse.rb149
-rw-r--r--test/webrick/test_httpserver.rb412
-rw-r--r--test/webrick/test_httputils.rb100
-rw-r--r--test/webrick/test_httpversion.rb40
-rw-r--r--test/webrick/test_server.rb131
-rw-r--r--test/webrick/test_utils.rb64
-rw-r--r--test/webrick/utils.rb70
-rw-r--r--test/webrick/webrick.cgi36
-rw-r--r--test/win32ole/available_ole.rb41
-rw-r--r--test/win32ole/err_in_callback.rb1
-rw-r--r--test/win32ole/test_err_in_callback.rb1
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb1
-rw-r--r--test/win32ole/test_nil2vtempty.rb1
-rw-r--r--test/win32ole/test_ole_methods.rb3
-rw-r--r--test/win32ole/test_propertyputref.rb1
-rw-r--r--test/win32ole/test_thread.rb3
-rw-r--r--test/win32ole/test_win32ole.rb60
-rw-r--r--test/win32ole/test_win32ole_event.rb103
-rw-r--r--test/win32ole/test_win32ole_method.rb14
-rw-r--r--test/win32ole/test_win32ole_method_event.rb36
-rw-r--r--test/win32ole/test_win32ole_param.rb54
-rw-r--r--test/win32ole/test_win32ole_param_event.rb30
-rw-r--r--test/win32ole/test_win32ole_record.rb128
-rw-r--r--test/win32ole/test_win32ole_type.rb53
-rw-r--r--test/win32ole/test_win32ole_type_event.rb44
-rw-r--r--test/win32ole/test_win32ole_typelib.rb1
-rw-r--r--test/win32ole/test_win32ole_variable.rb1
-rw-r--r--test/win32ole/test_win32ole_variant.rb13
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb1
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb1
-rw-r--r--test/win32ole/test_word.rb26
-rw-r--r--test/xmlrpc/data/blog.xml18
-rw-r--r--test/xmlrpc/data/bug_bool.expected3
-rw-r--r--test/xmlrpc/data/bug_bool.xml8
-rw-r--r--test/xmlrpc/data/bug_cdata.expected3
-rw-r--r--test/xmlrpc/data/bug_cdata.xml8
-rw-r--r--test/xmlrpc/data/bug_covert.expected10
-rw-r--r--test/xmlrpc/data/bug_covert.xml6
-rw-r--r--test/xmlrpc/data/datetime_iso8601.xml8
-rw-r--r--test/xmlrpc/data/fault.xml16
-rw-r--r--test/xmlrpc/data/value.expected7
-rw-r--r--test/xmlrpc/data/value.xml22
-rw-r--r--test/xmlrpc/data/xml1.expected243
-rw-r--r--test/xmlrpc/data/xml1.xml1
-rw-r--r--test/xmlrpc/htpasswd2
-rw-r--r--test/xmlrpc/test_client.rb322
-rw-r--r--test/xmlrpc/test_cookie.rb96
-rw-r--r--test/xmlrpc/test_datetime.rb161
-rw-r--r--test/xmlrpc/test_features.rb50
-rw-r--r--test/xmlrpc/test_marshal.rb110
-rw-r--r--test/xmlrpc/test_parser.rb93
-rw-r--r--test/xmlrpc/test_webrick_server.rb135
-rw-r--r--test/xmlrpc/webrick_testing.rb55
-rw-r--r--test/yaml/test_store.rb180
-rw-r--r--test/zlib/test_zlib.rb376
-rw-r--r--thread.c4072
-rw-r--r--thread_pthread.c2104
-rw-r--r--thread_pthread.h97
-rw-r--r--thread_sync.c1625
-rw-r--r--thread_win32.c306
-rw-r--r--thread_win32.h31
-rw-r--r--time.c2833
-rw-r--r--timev.h33
-rw-r--r--tool/asm_parse.rb2
-rwxr-xr-xtool/bisect.sh44
-rw-r--r--tool/bundler/rubocop_gems.rb11
-rw-r--r--tool/bundler/rubocop_gems.rb.lock63
-rw-r--r--tool/bundler/standard_gems.rb11
-rw-r--r--tool/bundler/standard_gems.rb.lock69
-rw-r--r--tool/bundler/test_gems.rb12
-rw-r--r--tool/bundler/test_gems.rb.lock44
-rwxr-xr-xtool/change_maker.rb34
-rwxr-xr-xtool/checksum.rb72
-rw-r--r--tool/colors3
-rwxr-xr-xtool/darwin-cc6
-rw-r--r--tool/downloader.rb301
-rw-r--r--tool/enc-emoji-citrus-gen.rb4
-rwxr-xr-xtool/enc-unicode.rb344
-rw-r--r--tool/eval.rb5
-rwxr-xr-xtool/expand-config.rb32
-rwxr-xr-xtool/extlibs.rb338
-rw-r--r--tool/fake.rb54
-rwxr-xr-xtool/fetch-bundled_gems.rb27
-rwxr-xr-xtool/file2lastrev.rb112
-rwxr-xr-xtool/format-release245
-rw-r--r--tool/gem-unpack.rb19
-rwxr-xr-xtool/gen-mailmap.rb47
-rwxr-xr-xtool/gen_dummy_probes.rb24
-rwxr-xr-xtool/gen_ruby_tapset.rb14
-rw-r--r--tool/generic_erb.rb41
-rwxr-xr-xtool/git-refresh46
-rw-r--r--tool/gperf.sed22
-rwxr-xr-xtool/id2token.rb6
-rwxr-xr-xtool/ifchange53
-rwxr-xr-xtool/insns2vm.rb18
-rw-r--r--tool/install-sh6
-rwxr-xr-xtool/instruction.rb1343
-rw-r--r--tool/jisx0208.rb84
-rwxr-xr-xtool/leaked-globals66
-rw-r--r--tool/lib/-test-/integer.rb14
-rw-r--r--tool/lib/colorize.rb55
-rw-r--r--tool/lib/envutil.rb365
-rw-r--r--tool/lib/find_executable.rb22
-rw-r--r--tool/lib/gc_compact_checker.rb10
-rw-r--r--tool/lib/iseq_loader_checker.rb81
-rw-r--r--tool/lib/jisx0208.rb86
-rw-r--r--tool/lib/leakchecker.rb299
-rw-r--r--tool/lib/memory_status.rb149
-rw-r--r--tool/lib/minitest/README.txt (renamed from test/lib/minitest/README.txt)0
-rw-r--r--tool/lib/minitest/autorun.rb14
-rw-r--r--tool/lib/minitest/benchmark.rb418
-rw-r--r--tool/lib/minitest/mock.rb196
-rw-r--r--tool/lib/minitest/unit.rb1479
-rw-r--r--tool/lib/profile_test_all.rb91
-rw-r--r--tool/lib/test/unit.rb1293
-rw-r--r--tool/lib/test/unit/assertions.rb317
-rw-r--r--tool/lib/test/unit/core_assertions.rb796
-rw-r--r--tool/lib/test/unit/parallel.rb209
-rw-r--r--tool/lib/test/unit/testcase.rb32
-rw-r--r--tool/lib/tracepointchecker.rb126
-rw-r--r--tool/lib/vcs.rb696
-rw-r--r--tool/lib/vpath.rb (renamed from tool/vpath.rb)0
-rw-r--r--tool/lib/webrick.rb232
-rw-r--r--tool/lib/webrick/.document6
-rw-r--r--tool/lib/webrick/accesslog.rb157
-rw-r--r--tool/lib/webrick/cgi.rb313
-rw-r--r--tool/lib/webrick/compat.rb36
-rw-r--r--tool/lib/webrick/config.rb158
-rw-r--r--tool/lib/webrick/cookie.rb172
-rw-r--r--tool/lib/webrick/htmlutils.rb30
-rw-r--r--tool/lib/webrick/httpauth.rb96
-rw-r--r--tool/lib/webrick/httpauth/authenticator.rb117
-rw-r--r--tool/lib/webrick/httpauth/basicauth.rb116
-rw-r--r--tool/lib/webrick/httpauth/digestauth.rb395
-rw-r--r--tool/lib/webrick/httpauth/htdigest.rb132
-rw-r--r--tool/lib/webrick/httpauth/htgroup.rb97
-rw-r--r--tool/lib/webrick/httpauth/htpasswd.rb158
-rw-r--r--tool/lib/webrick/httpauth/userdb.rb53
-rw-r--r--tool/lib/webrick/httpproxy.rb354
-rw-r--r--tool/lib/webrick/httprequest.rb636
-rw-r--r--tool/lib/webrick/httpresponse.rb564
-rw-r--r--tool/lib/webrick/https.rb152
-rw-r--r--tool/lib/webrick/httpserver.rb294
-rw-r--r--tool/lib/webrick/httpservlet.rb23
-rw-r--r--tool/lib/webrick/httpservlet/abstract.rb152
-rw-r--r--tool/lib/webrick/httpservlet/cgi_runner.rb47
-rw-r--r--tool/lib/webrick/httpservlet/cgihandler.rb126
-rw-r--r--tool/lib/webrick/httpservlet/erbhandler.rb88
-rw-r--r--tool/lib/webrick/httpservlet/filehandler.rb552
-rw-r--r--tool/lib/webrick/httpservlet/prochandler.rb47
-rw-r--r--tool/lib/webrick/httpstatus.rb194
-rw-r--r--tool/lib/webrick/httputils.rb512
-rw-r--r--tool/lib/webrick/httpversion.rb76
-rw-r--r--tool/lib/webrick/log.rb156
-rw-r--r--tool/lib/webrick/server.rb381
-rw-r--r--tool/lib/webrick/ssl.rb215
-rw-r--r--tool/lib/webrick/utils.rb265
-rw-r--r--tool/lib/webrick/version.rb18
-rw-r--r--tool/lib/zombie_hunter.rb10
-rw-r--r--tool/m4/_colorize_result_prepare.m433
-rw-r--r--tool/m4/ac_msg_result.m45
-rw-r--r--tool/m4/colorize_result.m49
-rw-r--r--tool/m4/ruby_append_option.m45
-rw-r--r--tool/m4/ruby_append_options.m47
-rw-r--r--tool/m4/ruby_check_builtin_func.m410
-rw-r--r--tool/m4/ruby_check_builtin_setjmp.m427
-rw-r--r--tool/m4/ruby_check_printf_prefix.m429
-rw-r--r--tool/m4/ruby_check_setjmp.m417
-rw-r--r--tool/m4/ruby_check_signedness.m45
-rw-r--r--tool/m4/ruby_check_sizeof.m4108
-rw-r--r--tool/m4/ruby_check_sysconf.m413
-rw-r--r--tool/m4/ruby_cppoutfile.m418
-rw-r--r--tool/m4/ruby_decl_attribute.m445
-rw-r--r--tool/m4/ruby_default_arch.m411
-rw-r--r--tool/m4/ruby_define_if.m412
-rw-r--r--tool/m4/ruby_defint.m440
-rw-r--r--tool/m4/ruby_dtrace_available.m420
-rw-r--r--tool/m4/ruby_dtrace_postprocess.m430
-rw-r--r--tool/m4/ruby_func_attribute.m47
-rw-r--r--tool/m4/ruby_mingw32.m424
-rw-r--r--tool/m4/ruby_prepend_option.m45
-rw-r--r--tool/m4/ruby_prog_gnu_ld.m410
-rw-r--r--tool/m4/ruby_replace_funcs.m413
-rw-r--r--tool/m4/ruby_replace_type.m458
-rw-r--r--tool/m4/ruby_rm_recursive.m418
-rw-r--r--tool/m4/ruby_setjmp_type.m452
-rw-r--r--tool/m4/ruby_stack_grow_direction.m430
-rw-r--r--tool/m4/ruby_try_cflags.m412
-rw-r--r--tool/m4/ruby_try_cxxflags.m417
-rw-r--r--tool/m4/ruby_try_ldflags.m415
-rw-r--r--tool/m4/ruby_type_attribute.m48
-rw-r--r--tool/m4/ruby_universal_arch.m490
-rw-r--r--tool/m4/ruby_werror_flag.m418
-rwxr-xr-xtool/make-snapshot516
-rw-r--r--tool/make_hgraph.rb95
-rwxr-xr-xtool/mdoc2man.rb60
-rwxr-xr-xtool/merger.rb444
-rw-r--r--tool/mjit_archflag.sh40
-rw-r--r--tool/mjit_tabs.rb65
-rw-r--r--tool/mk_builtin_loader.rb361
-rwxr-xr-xtool/mkconfig.rb194
-rwxr-xr-xtool/mkrunnable.rb39
-rwxr-xr-xtool/node_name.rb12
-rw-r--r--tool/parse.rb3
-rw-r--r--tool/prereq.status44
-rwxr-xr-xtool/pure_parser.rb24
-rwxr-xr-xtool/rbinstall.rb638
-rwxr-xr-xtool/rbuninstall.rb22
-rwxr-xr-xtool/redmine-backporter.rb365
-rwxr-xr-xtool/release.sh47
-rwxr-xr-xtool/releng/gen-mail.rb50
-rwxr-xr-xtool/releng/gen-release-note.rb36
-rwxr-xr-xtool/releng/update-www-meta.rb213
-rwxr-xr-xtool/rmdirs3
-rw-r--r--tool/ruby_vm/controllers/application_controller.rb25
-rw-r--r--tool/ruby_vm/helpers/c_escape.rb128
-rw-r--r--tool/ruby_vm/helpers/dumper.rb113
-rw-r--r--tool/ruby_vm/helpers/scanner.rb53
-rw-r--r--tool/ruby_vm/loaders/insns_def.rb100
-rw-r--r--tool/ruby_vm/loaders/opt_insn_unif_def.rb34
-rw-r--r--tool/ruby_vm/loaders/opt_operand_def.rb56
-rw-r--r--tool/ruby_vm/loaders/vm_opts_h.rb37
-rw-r--r--tool/ruby_vm/models/attribute.rb59
-rwxr-xr-xtool/ruby_vm/models/bare_instructions.rb240
-rw-r--r--tool/ruby_vm/models/c_expr.rb41
-rw-r--r--tool/ruby_vm/models/instructions.rb22
-rw-r--r--tool/ruby_vm/models/instructions_unifications.rb43
-rw-r--r--tool/ruby_vm/models/operands_unifications.rb142
-rw-r--r--tool/ruby_vm/models/trace_instructions.rb71
-rw-r--r--tool/ruby_vm/models/typemap.rb62
-rw-r--r--tool/ruby_vm/scripts/converter.rb29
-rw-r--r--tool/ruby_vm/scripts/insns2vm.rb93
-rw-r--r--tool/ruby_vm/tests/.gitkeep0
-rw-r--r--tool/ruby_vm/views/_attributes.erb35
-rw-r--r--tool/ruby_vm/views/_c_expr.erb17
-rw-r--r--tool/ruby_vm/views/_comptime_insn_stack_increase.erb62
-rw-r--r--tool/ruby_vm/views/_copyright.erb31
-rw-r--r--tool/ruby_vm/views/_insn_entry.erb76
-rw-r--r--tool/ruby_vm/views/_insn_len_info.erb21
-rw-r--r--tool/ruby_vm/views/_insn_name_info.erb38
-rw-r--r--tool/ruby_vm/views/_insn_operand_info.erb46
-rw-r--r--tool/ruby_vm/views/_insn_sp_pc_dependency.erb27
-rw-r--r--tool/ruby_vm/views/_insn_type_chars.erb13
-rw-r--r--tool/ruby_vm/views/_leaf_helpers.erb55
-rw-r--r--tool/ruby_vm/views/_mjit_compile_getinlinecache.erb31
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn.erb92
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn_body.erb129
-rw-r--r--tool/ruby_vm/views/_mjit_compile_invokebuiltin.erb29
-rw-r--r--tool/ruby_vm/views/_mjit_compile_ivar.erb101
-rw-r--r--tool/ruby_vm/views/_mjit_compile_pc_and_sp.erb38
-rw-r--r--tool/ruby_vm/views/_mjit_compile_send.erb117
-rw-r--r--tool/ruby_vm/views/_notice.erb22
-rw-r--r--tool/ruby_vm/views/_sp_inc_helpers.erb37
-rw-r--r--tool/ruby_vm/views/_trace_instruction.erb16
-rw-r--r--tool/ruby_vm/views/insns.inc.erb26
-rw-r--r--tool/ruby_vm/views/insns_info.inc.erb22
-rw-r--r--tool/ruby_vm/views/mjit_compile.inc.erb110
-rw-r--r--tool/ruby_vm/views/opt_sc.inc.erb40
-rw-r--r--tool/ruby_vm/views/optinsn.inc.erb71
-rw-r--r--tool/ruby_vm/views/optunifs.inc.erb21
-rw-r--r--tool/ruby_vm/views/vm.inc.erb30
-rw-r--r--tool/ruby_vm/views/vmtc.inc.erb21
-rwxr-xr-xtool/rubytest.rb30
-rw-r--r--tool/run-gcov.rb54
-rw-r--r--tool/run-lcov.rb164
-rwxr-xr-xtool/runruby.rb110
-rw-r--r--tool/search-cgvars.rb55
-rwxr-xr-xtool/strip-rdoc.rb3
-rw-r--r--tool/sync_default_gems.rb538
-rw-r--r--tool/test-bundled-gems.rb57
-rw-r--r--tool/test-coverage.rb118
-rw-r--r--tool/test/minitest/metametameta.rb71
-rw-r--r--tool/test/minitest/test_minitest_benchmark.rb131
-rw-r--r--tool/test/minitest/test_minitest_mock.rb404
-rw-r--r--tool/test/minitest/test_minitest_unit.rb1793
-rw-r--r--tool/test/runner.rb23
-rw-r--r--tool/test/test_jisx0208.rb2
-rw-r--r--tool/test/testunit/test4test_hideskip.rb10
-rw-r--r--tool/test/testunit/test4test_redefinition.rb14
-rw-r--r--tool/test/testunit/test4test_sorting.rb18
-rw-r--r--tool/test/testunit/test_assertion.rb29
-rw-r--r--tool/test/testunit/test_hideskip.rb21
-rw-r--r--tool/test/testunit/test_parallel.rb204
-rw-r--r--tool/test/testunit/test_redefinition.rb16
-rw-r--r--tool/test/testunit/test_sorting.rb18
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_first.rb8
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_forth.rb30
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_second.rb12
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_third.rb11
-rw-r--r--tool/test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--tool/test/webrick/.htaccess (renamed from test/webrick/.htaccess)0
-rw-r--r--tool/test/webrick/test_cgi.rb170
-rw-r--r--tool/test/webrick/test_config.rb17
-rw-r--r--tool/test/webrick/test_cookie.rb141
-rw-r--r--tool/test/webrick/test_do_not_reverse_lookup.rb71
-rw-r--r--tool/test/webrick/test_filehandler.rb402
-rw-r--r--tool/test/webrick/test_htgroup.rb19
-rw-r--r--tool/test/webrick/test_htmlutils.rb21
-rw-r--r--tool/test/webrick/test_httpauth.rb366
-rw-r--r--tool/test/webrick/test_httpproxy.rb466
-rw-r--r--tool/test/webrick/test_httprequest.rb488
-rw-r--r--tool/test/webrick/test_httpresponse.rb282
-rw-r--r--tool/test/webrick/test_https.rb112
-rw-r--r--tool/test/webrick/test_httpserver.rb543
-rw-r--r--tool/test/webrick/test_httpstatus.rb35
-rw-r--r--tool/test/webrick/test_httputils.rb101
-rw-r--r--tool/test/webrick/test_httpversion.rb41
-rw-r--r--tool/test/webrick/test_server.rb191
-rw-r--r--tool/test/webrick/test_ssl_server.rb67
-rw-r--r--tool/test/webrick/test_utils.rb110
-rw-r--r--tool/test/webrick/utils.rb82
-rw-r--r--tool/test/webrick/webrick.cgi38
-rw-r--r--tool/test/webrick/webrick.rhtml4
-rw-r--r--tool/test/webrick/webrick_long_filename.cgi (renamed from test/webrick/webrick_long_filename.cgi)0
-rw-r--r--tool/transcode-tblgen.rb96
-rw-r--r--tool/transform_mjit_header.rb326
-rwxr-xr-xtool/travis_retry.sh13
-rw-r--r--tool/update-bundled_gems.rb14
-rwxr-xr-xtool/update-deps68
-rw-r--r--tool/vcs.rb256
-rw-r--r--tool/vtlh.rb2
-rwxr-xr-xtool/ytab.sed61
-rw-r--r--trace_point.rb348
-rw-r--r--transcode.c186
-rw-r--r--transcode_data.h35
-rw-r--r--transient_heap.c989
-rw-r--r--transient_heap.h65
-rw-r--r--util.c3522
-rw-r--r--util/remove_openssl.rb55
-rw-r--r--variable.c2934
-rw-r--r--variable.h22
-rw-r--r--version.c79
-rw-r--r--version.h71
-rw-r--r--vm.c3501
-rw-r--r--vm_args.c704
-rw-r--r--vm_backtrace.c748
-rw-r--r--vm_callinfo.h455
-rw-r--r--vm_core.h1945
-rw-r--r--vm_debug.h91
-rw-r--r--vm_dump.c671
-rw-r--r--vm_eval.c2077
-rw-r--r--vm_exec.c90
-rw-r--r--vm_exec.h88
-rw-r--r--vm_insnhelper.c5684
-rw-r--r--vm_insnhelper.h262
-rw-r--r--vm_method.c2304
-rw-r--r--vm_opts.h47
-rw-r--r--vm_sync.c299
-rw-r--r--vm_sync.h138
-rw-r--r--vm_trace.c1375
-rw-r--r--vsnprintf.c83
-rw-r--r--warning.rb53
-rw-r--r--win32/.document1
-rw-r--r--win32/Makefile.sub571
-rw-r--r--win32/README.win32100
-rwxr-xr-xwin32/configure.bat55
-rw-r--r--win32/dir.h25
-rw-r--r--win32/file.c301
-rw-r--r--win32/file.h48
-rwxr-xr-xwin32/ifchange.bat35
-rwxr-xr-xwin32/mkexports.rb15
-rwxr-xr-xwin32/resource.rb3
-rwxr-xr-xwin32/rm.bat2
-rwxr-xr-xwin32/rmdirs.bat1
-rwxr-xr-x[-rw-r--r--]win32/rtname.cmd33
-rw-r--r--win32/setup.mak144
-rw-r--r--win32/stub.c42
-rw-r--r--win32/win32.c2950
10964 files changed, 979498 insertions, 556009 deletions
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei. All rights reserved.
+;;
+;; This file is a part of the programming language Ruby. Permission is hereby
+;; granted, to either redistribute and/or modify this file, provided that the
+;; conditions mentioned in the file COPYING are met. Consult the file for
+;; details.
+
+((nil .
+ ((indent-tabs-mode . nil)
+ (require-final-newline . t)
+ (tab-width . 8)
+ (show-trailing-whitespace . t)
+ (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+ ((buffer-file-coding-system . us-ascii)
+ (indent-tabs-mode . t)
+ (change-log-indent-text . 2)
+ (add-log-time-format . (lambda (&optional x y)
+ (let* ((time (or x (current-time)))
+ (system-time-locale "C")
+ (diff (+ (cadr time) 32400))
+ (lo (% diff 65536))
+ (hi (+ (car time) (/ diff 65536))))
+ (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index 9a5067bc52..8616203552 100644
--- a/.document
+++ b/.document
@@ -5,9 +5,22 @@
# Process all the C source files
*.c
+*.y
# prelude
prelude.rb
+rbconfig.rb
+array.rb
+ast.rb
+dir.rb
+gc.rb
+integer.rb
+io.rb
+kernel.rb
+pack.rb
+trace_point.rb
+warning.rb
+ractor.rb
# the lib/ directory (which has its own .document file)
lib
@@ -16,13 +29,18 @@ lib
ext
# rdoc files
-ChangeLog
+NEWS.md
-NEWS
+README.md
+README.ja.md
-README
-README.EXT
-README.EXT.ja
-README.ja
+COPYING
+COPYING.ja
+CONTRIBUTING.md
+
+LEGAL
+
+# win32/README.win32 linked from README.md
+win32
doc
diff --git a/.editorconfig b/.editorconfig
index 67abf4b978..4633a7acae 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -2,15 +2,29 @@ root = true
[*]
end_of_line = lf
+indent_size = 4
+indent_style = space
insert_final_newline = true
-trim_trailing_whitespace = true
tab_width = 8
-indent_style = tab
-indent_size = 4
+trim_trailing_whitespace = true
-[**.bat]
+[*.bat]
end_of_line = crlf
-[**.rb]
-indent_style = space
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index d1279ea046..49380951b8 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,3 +1,5 @@
+set startup-with-shell off
+
define hook-run
set $color_type = 0
set $color_highlite = 0
@@ -63,7 +65,15 @@ define rp
else
if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
printf "%sT_OBJECT%s: ", $color_type, $color_end
- print (struct RObject *)($arg0)
+ print ((struct RObject *)($arg0))->basic
+ if ($flags & ROBJECT_EMBED)
+ print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+ else
+ print (((struct RObject *)($arg0))->as.heap)
+ if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+ print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+ end
+ end
else
if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
@@ -89,14 +99,15 @@ define rp
set $regsrc = ((struct RRegexp*)($arg0))->src
set $rsflags = ((struct RBasic*)$regsrc)->flags
printf "%sT_REGEXP%s: ", $color_type, $color_end
+ set $len = ($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.len : \
+ (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
set print address off
- output (char *)(($rsflags & RUBY_FL_USER1) ? \
+ output *(char *)(($rsflags & RUBY_FL_USER1) ? \
((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary)
+ ((struct RString*)$regsrc)->as.ary) @ $len
set print address on
- printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ printf " len:%ld ", $len
if $flags & RUBY_FL_USER6
printf "(none) "
end
@@ -117,7 +128,7 @@ define rp
if ($len == 0)
printf "{(empty)} "
else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
printf " "
end
else
@@ -125,7 +136,7 @@ define rp
printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
if ($flags & RUBY_FL_USER2)
printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
printf " "
else
printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
@@ -133,7 +144,7 @@ define rp
if ($len == 0)
printf "{(empty)} "
else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
printf " "
end
end
@@ -145,34 +156,27 @@ define rp
else
if ($flags & RUBY_T_MASK) == RUBY_T_HASH
printf "%sT_HASH%s: ", $color_type, $color_end,
- if ((struct RHash *)($arg0))->ntbl
- printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+ if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+ printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
+ else
+ printf "li len=%ld bound=%ld ", \
+ ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+ ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
end
print (struct RHash *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
- printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
- (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
((struct RStruct *)($arg0))->as.heap.len)
+ printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
print (struct RStruct *)($arg0)
- x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ((struct RStruct *)($arg0))->as.ary : \
- ((struct RStruct *)($arg0))->as.heap.ptr)
+ output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ((struct RStruct *)($arg0))->as.ary : \
+ ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
else
if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
- printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
- (($flags & RUBY_FL_USER1) != 0), \
- (($flags & RUBY_FL_USER2) ? \
- ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
- ((struct RBignum*)($arg0))->as.heap.len)
- if $flags & RUBY_FL_USER2
- printf "(embed) "
- end
- print (struct RBignum *)($arg0)
- x/xw (($flags & RUBY_FL_USER2) ? \
- ((struct RBignum*)($arg0))->as.ary : \
- ((struct RBignum*)($arg0))->as.heap.digits)
+ rp_bignum $arg0
else
if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
printf "%sT_RATIONAL%s: ", $color_type, $color_end
@@ -245,6 +249,12 @@ define rp
printf "%sT_UNDEF%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
else
+ if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+ printf "%sT_IMEMO%s(", $color_type, $color_end
+ output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
+ printf "): "
+ rp_imemo $arg0
+ else
if ($flags & RUBY_T_MASK) == RUBY_T_NODE
printf "%sT_NODE%s(", $color_type, $color_end
output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
@@ -255,6 +265,10 @@ define rp
printf "%sT_ZOMBIE%s: ", $color_type, $color_end
print (struct RData *)($arg0)
else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+ printf "%sT_MOVED%s: ", $color_type, $color_end
+ print *(struct RMoved *)$arg0
+ else
printf "%sunknown%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
end
@@ -289,6 +303,8 @@ define rp
end
end
end
+ end
+ end
end
document rp
Print a Ruby's VALUE.
@@ -320,6 +336,9 @@ define rp_id
if $id == idLTLT
printf "(:<<)\n"
else
+ if $id == idGTGT
+ printf "(:>>)\n"
+ else
if $id == idLE
printf "(:<=)\n"
else
@@ -347,6 +366,18 @@ define rp_id
if $id == idASET
printf "(:[]=)\n"
else
+ if $id == idCOLON2
+ printf "(:'::')\n"
+ else
+ if $id == idANDOP
+ printf "(:&&)\n"
+ else
+ if $id == idOROP
+ printf "(:||)\n"
+ else
+ if $id == idANDDOT
+ printf "(:&.)\n"
+ else
if $id <= tLAST_OP_ID
printf "O"
else
@@ -378,12 +409,13 @@ define rp_id
end
end
printf "(%ld): ", $id
- set $str = lookup_id_str($id)
- if $str
- rp_string $str
- else
- echo undef\n
- end
+ print_id $id
+ echo \n
+ end
+ end
+ end
+ end
+ end
end
end
end
@@ -406,16 +438,35 @@ document rp_id
Print an ID.
end
-define rp_string
+define output_string
set $flags = ((struct RBasic*)($arg0))->flags
- set print address off
- output (char *)(($flags & RUBY_FL_USER1) ? \
+ set $len = ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ output *(char *)(($flags & RUBY_FL_USER1) ? \
((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
- set print address on
- printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ else
+ output ""
+ end
+end
+
+define print_string
+ set $flags = ((struct RBasic*)($arg0))->flags
+ set $len = ($flags & RUBY_FL_USER1) ? \
((struct RString*)($arg0))->as.heap.len : \
(($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ end
+end
+
+define rp_string
+ output_string $arg0
+ printf " bytesize:%ld ", $len
if !($flags & RUBY_FL_USER1)
printf "(embed) "
else
@@ -446,20 +497,109 @@ document rp_string
Print the content of a String.
end
+define rp_bignum
+ set $flags = ((struct RBignum*)($arg0))->basic.flags
+ set $len = (($flags & RUBY_FL_USER2) ? \
+ ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+ ((struct RBignum*)($arg0))->as.heap.len)
+ printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+ (($flags & RUBY_FL_USER1) != 0), $len
+ if $flags & RUBY_FL_USER2
+ printf "(embed) "
+ end
+ print (struct RBignum *)($arg0)
+ set $ptr = (($flags & RUBY_FL_USER2) ? \
+ ((struct RBignum*)($arg0))->as.ary : \
+ ((struct RBignum*)($arg0))->as.heap.digits)
+ set $len = $len-1
+ printf "0x%x", $ptr[$len]
+ while $len > 0
+ set $len = $len-1
+ set $val = $ptr[$len]
+ set $w = sizeof($ptr[0])
+ printf "_"
+ if $w > 8
+ printf "%.32x", $val
+ else
+ if $w > 4
+ printf "%.16x", $val
+ else
+ if $w > 2
+ printf "%.8x", $val
+ else
+ if $w > 1
+ printf "%.4x", $val
+ else
+ printf "%.2x", $val
+ end
+ end
+ end
+ end
+ end
+ printf "\n"
+end
+document rp_bignum
+ Print the content of a Bignum.
+end
+
define rp_class
printf "(struct RClass *) %p", (void*)$arg0
- if ((struct RClass *)($arg0))->ptr.origin != $arg0
- printf " -> %p", ((struct RClass *)($arg0))->ptr.origin
+ if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
+ printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
end
printf "\n"
rb_classname $arg0
- print *(struct RClass *)($arg0)
+ print/x *(struct RClass *)($arg0)
print *((struct RClass *)($arg0))->ptr
end
document rp_class
Print the content of a Class/Module.
end
+define rp_imemo
+ set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
+ if $flags == imemo_cref
+ printf "(rb_cref_t *) %p\n", (void*)$arg0
+ print *(rb_cref_t *)$arg0
+ else
+ if $flags == imemo_svar
+ printf "(struct vm_svar *) %p\n", (void*)$arg0
+ print *(struct vm_svar *)$arg0
+ else
+ if $flags == imemo_throw_data
+ printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+ print *(struct vm_throw_data *)$arg0
+ else
+ if $flags == imemo_ifunc
+ printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+ print *(struct vm_ifunc *)$arg0
+ else
+ if $flags == imemo_memo
+ printf "(struct MEMO *) %p\n", (void*)$arg0
+ print *(struct MEMO *)$arg0
+ else
+ if $flags == imemo_ment
+ printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+ print *(rb_method_entry_t *)$arg0
+ else
+ if $flags == imemo_iseq
+ printf "(rb_iseq_t *) %p\n", (void*)$arg0
+ print *(rb_iseq_t *)$arg0
+ else
+ printf "(struct RIMemo *) %p\n", (void*)$arg0
+ print *(struct RIMemo *)$arg0
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp_imemo
+ Print the content of a memo
+end
+
define nd_type
print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
end
@@ -569,12 +709,6 @@ define nd_cval
rp ($arg0).u3.value
end
-
-define nd_cnt
- printf "%su3.cnt%s: ", $color_highlite, $color_end
- p ($arg0).u3.cnt
-end
-
define nd_tbl
printf "%su1.tbl%s: ", $color_highlite, $color_end
p ($arg0).u1.tbl
@@ -613,12 +747,6 @@ define nd_lit
rp ($arg0).u1.value
end
-
-define nd_frml
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
define nd_rest
printf "%su2.argc%s: ", $color_highlite, $color_end
p ($arg0).u2.argc
@@ -645,12 +773,6 @@ define nd_args
rp ($arg0).u3.node
end
-
-define nd_noex
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
define nd_defn
printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
@@ -668,17 +790,6 @@ define nd_new
end
-define nd_cfnc
- printf "%su1.cfunc%s: ", $color_highlite, $color_end
- p ($arg0).u1.cfunc
-end
-
-define nd_argc
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-
define nd_cname
printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
@@ -740,7 +851,7 @@ end
define nd_tree
set $buf = (struct RString *)rb_str_buf_new(0)
- call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
+ call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
printf "%s\n", $buf->as.heap.ptr
end
@@ -811,8 +922,7 @@ end
define rb_classname
# up to 128bit int
- set $rb_classname_permanent = "0123456789ABCDEF"
- set $rb_classname = classname($arg0, $rb_classname_permanent)
+ set $rb_classname = rb_mod_name($arg0)
if $rb_classname != RUBY_Qnil
rp $rb_classname
else
@@ -861,7 +971,7 @@ define iseq
end
define rb_ps
- rb_ps_vm ruby_current_vm
+ rb_ps_vm ruby_current_vm_ptr
end
document rb_ps
Dump all threads and their callstacks
@@ -869,36 +979,307 @@ end
define rb_ps_vm
print $ps_vm = (rb_vm_t*)$arg0
- set $ps_threads = (st_table*)$ps_vm->living_threads
- if $ps_threads->entries_packed
- set $ps_threads_i = 0
- while $ps_threads_i < $ps_threads->num_entries
- set $ps_threads_key = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].key
- set $ps_threads_val = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].val
- rb_ps_thread $ps_threads_key $ps_threads_val
- set $ps_threads_i = $ps_threads_i + 1
- end
- else
- set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
- while $ps_threads_ptr
- set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
- set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
- rb_ps_thread $ps_threads_key $ps_threads_val
- set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+ set $ps_thread_ln = $ps_vm->living_threads.n.next
+ set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+ while 1
+ set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+ set $ps_thread = (VALUE)($ps_thread_th->self)
+ rb_ps_thread $ps_thread
+ if $ps_thread_ln == $ps_thread_ln_last
+ loop_break
end
+ set $ps_thread_ln = $ps_thread_ln->next
end
end
document rb_ps_vm
Dump all threads in a (rb_vm_t*) and their callstacks
end
-define rb_ps_thread
- set $ps_thread = (struct RTypedData*)$arg0
- set $ps_thread_id = $arg1
- print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+define print_lineno
+ set $cfp = $arg0
+ set $iseq = $cfp->iseq
+ set $pos = $cfp->pc - $iseq->body->iseq_encoded
+ if $pos != 0
+ set $pos = $pos - 1
+ end
+
+ set $index = 0
+ set $size = $iseq->body->insns_info.size
+ set $table = $iseq->body->insns_info.body
+ set $positions = $iseq->body->insns_info.positions
+ #printf "size: %d\n", $size
+ if $size == 0
+ else
+ if $size == 1
+ printf "%d", $table[0].line_no
+ else
+ if $positions
+ # get_insn_info_linear_search
+ set $index = 1
+ while $index < $size
+ #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+ if $positions[$index] > $pos
+ loop_break
+ end
+ set $index = $index + 1
+ if $positions[$index] == $pos
+ loop_break
+ end
+ end
+ else
+ # get_insn_info_succinct_bitvector
+ set $sd = $iseq->body->insns_info.succ_index_table
+ set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+ if $pos < $immediate_table_size
+ set $i = $pos / 9
+ set $j = $pos % 9
+ set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+ else
+ set $block_index = ($pos - $immediate_table_size) / 512
+ set $block = &$sd->succ_part[$block_index]
+ set $block_bit_index = ($pos - $immediate_table_size) % 512
+ set $small_block_index = $block_bit_index / 64
+ set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+ set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+ set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+ set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+ set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+ set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+ set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+ set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+ set $index = $block->rank + $small_block_popcount + $popcnt
+ end
+ end
+ printf "%d", $table[$index-1].line_no
+ end
+ end
+end
+
+define check_method_entry
+ set $imemo = (struct RBasic *)$arg0
+ if $imemo != RUBY_Qfalse
+ set $type = ($imemo->flags >> 12) & 0x07
+ if $type == imemo_ment
+ set $me = (rb_callable_method_entry_t *)$imemo
+ else
+ if $type == imemo_svar
+ set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+ check_method_entry $imemo
+ end
+ end
+ end
+end
+
+define print_id
+ set $id = $arg0
+ # rb_id_to_serial
+ if $id > tLAST_OP_ID
+ set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+ else
+ set $serial = (rb_id_serial_t)$id
+ end
+ if $serial && $serial <= ruby_global_symbols.last_id
+ set $idx = $serial / ID_ENTRY_UNIT
+ set $ids = (struct RArray *)ruby_global_symbols.ids
+ set $flags = $ids->basic.flags
+ if ($flags & RUBY_FL_USER1)
+ set $idsptr = $ids->as.ary
+ set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ else
+ set $idsptr = $ids->as.heap.ptr
+ set $idslen = $ids->as.heap.len
+ end
+ if $idx < $idslen
+ set $t = 0
+ set $ary = (struct RArray *)$idsptr[$idx]
+ if $ary != RUBY_Qnil
+ set $flags = $ary->basic.flags
+ if ($flags & RUBY_FL_USER1)
+ set $aryptr = $ary->as.ary
+ set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ else
+ set $aryptr = $ary->as.heap.ptr
+ set $arylen = $ary->as.heap.len
+ end
+ set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
+ if $result != RUBY_Qnil
+ print_string $result
+ else
+ echo undef
+ end
+ end
+ end
+ end
+end
+
+define print_pathobj
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ print_string $arg0
+ end
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if $flags & RUBY_FL_USER1
+ set $str = ((struct RArray*)($arg0))->as.ary[0]
+ else
+ set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+ end
+ print_string $str
+ end
end
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define rb_ps_thread
+ set $ps_thread = (struct RTypedData*)$arg0
+ set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+ printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+ $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+ set $cfp = $ps_thread_th->ec->cfp
+ set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+ while $cfp < $cfpend
+ if $cfp->iseq
+ if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+ printf "%d:ifunc ", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $cfp->iseq.body
+ set print symbol-filename off
+ printf "\n"
+ else
+ if $cfp->pc
+ set $location = $cfp->iseq->body->location
+ printf "%d:", $cfpend-$cfp
+ print_pathobj $location.pathobj
+ printf ":"
+ print_lineno $cfp
+ printf ":in `"
+ print_string $location.label
+ printf "'\n"
+ else
+ printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+ end
+ end
+ else
+ # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+ set $ep = $cfp->ep
+ if ($ep[0] & 0xffff0001) == 0x55550001
+ #define VM_ENV_FLAG_LOCAL 0x02
+ #define VM_ENV_PREV_EP(ep) GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+ set $me = 0
+ set $env_specval = $ep[-1]
+ set $env_me_cref = $ep[-2]
+ while ($env_specval & 0x02) != 0
+ check_method_entry $env_me_cref
+ if $me != 0
+ loop_break
+ end
+ set $ep = $ep[0]
+ set $env_specval = $ep[-1]
+ set $env_me_cref = $ep[-2]
+ end
+ if $me == 0
+ check_method_entry $env_me_cref
+ end
+ printf "%d:", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $me->def->body.cfunc.func
+ set print symbol-filename off
+ set $mid = $me->def->original_id
+ printf ":in `"
+ print_id $mid
+ printf "'\n"
+ else
+ printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+ end
+ end
+ set $cfp = $cfp + 1
+ end
+end
+
+define rb_count_objects
+ set $objspace = ruby_current_vm_ptr->objspace
+ set $counts_00 = 0
+ set $counts_01 = 0
+ set $counts_02 = 0
+ set $counts_03 = 0
+ set $counts_04 = 0
+ set $counts_05 = 0
+ set $counts_06 = 0
+ set $counts_07 = 0
+ set $counts_08 = 0
+ set $counts_09 = 0
+ set $counts_0a = 0
+ set $counts_0b = 0
+ set $counts_0c = 0
+ set $counts_0d = 0
+ set $counts_0e = 0
+ set $counts_0f = 0
+ set $counts_10 = 0
+ set $counts_11 = 0
+ set $counts_12 = 0
+ set $counts_13 = 0
+ set $counts_14 = 0
+ set $counts_15 = 0
+ set $counts_16 = 0
+ set $counts_17 = 0
+ set $counts_18 = 0
+ set $counts_19 = 0
+ set $counts_1a = 0
+ set $counts_1b = 0
+ set $counts_1c = 0
+ set $counts_1d = 0
+ set $counts_1e = 0
+ set $counts_1f = 0
+ set $total = 0
+ set $i = 0
+ while $i < $objspace->heap_pages.allocated_pages
+ printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+ set $page = $objspace->heap_pages.sorted[$i]
+ set $p = $page->start
+ set $pend = $p + $page->total_slots
+ while $p < $pend
+ set $flags = $p->as.basic.flags & 0x1f
+ eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+ set $p = $p + 1
+ end
+ set $total = $total + $page->total_slots
+ set $i = $i + 1
+ end
+ printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+ printf "T_OBJECT: %d\n", $counts_01
+ printf "T_CLASS: %d\n", $counts_02
+ printf "T_MODULE: %d\n", $counts_03
+ printf "T_FLOAT: %d\n", $counts_04
+ printf "T_STRING: %d\n", $counts_05
+ printf "T_REGEXP: %d\n", $counts_06
+ printf "T_ARRAY: %d\n", $counts_07
+ printf "T_HASH: %d\n", $counts_08
+ printf "T_STRUCT: %d\n", $counts_09
+ printf "T_BIGNUM: %d\n", $counts_0a
+ printf "T_FILE: %d\n", $counts_0b
+ printf "T_DATA: %d\n", $counts_0c
+ printf "T_MATCH: %d\n", $counts_0d
+ printf "T_COMPLEX: %d\n", $counts_0e
+ printf "T_RATIONAL: %d\n", $counts_0f
+ #printf "UNKNOWN_10: %d\n", $counts_10
+ printf "T_NIL: %d\n", $counts_11
+ printf "T_TRUE: %d\n", $counts_12
+ printf "T_FALSE: %d\n", $counts_13
+ printf "T_SYMBOL: %d\n", $counts_14
+ printf "T_FIXNUM: %d\n", $counts_15
+ printf "T_UNDEF: %d\n", $counts_16
+ #printf "UNKNOWN_17: %d\n", $counts_17
+ #printf "UNKNOWN_18: %d\n", $counts_18
+ #printf "UNKNOWN_19: %d\n", $counts_19
+ printf "T_IMEMO: %d\n", $counts_1a
+ printf "T_NODE: %d\n", $counts_1b
+ printf "T_ICLASS: %d\n", $counts_1c
+ printf "T_ZOMBIE: %d\n", $counts_1d
+ #printf "UNKNOWN_1E: %d\n", $counts_1e
+ printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+ Counts all objects grouped by type.
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-master/wiki/MachineInstructionsTraceWithGDB
define trace_machine_instructions
set logging on
set height 0
@@ -914,3 +1295,57 @@ define SDR
call rb_vmdebug_stack_dump_raw_current()
end
+define rbi
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+ p *(LABEL*)$arg0
+ else
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+ p *(INSN*)$arg0
+ else
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+ p *(ADJUST*)$arg0
+ else
+ print *$arg0
+ end
+ end
+ end
+end
+
+define dump_node
+ set $str = rb_parser_dump_tree($arg0, 0)
+ set $flags = ((struct RBasic*)($str))->flags
+ printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)$str)->as.heap.ptr : \
+ ((struct RString*)$str)->as.ary)
+end
+
+define print_flags
+ printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+ printf "RUBY_FL_PROMOTED0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
+ printf "RUBY_FL_PROMOTED1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
+ printf "RUBY_FL_FINALIZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+ printf "RUBY_FL_TAINT : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_TAINT ? "1" : "0"
+ printf "RUBY_FL_UNTRUSTED : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_UNTRUSTED ? "1" : "0"
+ printf "RUBY_FL_EXIVAR : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+ printf "RUBY_FL_FREEZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+ printf "RUBY_FL_USER0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+ printf "RUBY_FL_USER1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+ printf "RUBY_FL_USER2 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+ printf "RUBY_FL_USER3 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+ printf "RUBY_FL_USER4 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+ printf "RUBY_FL_USER5 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+ printf "RUBY_FL_USER6 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+ printf "RUBY_FL_USER7 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+ printf "RUBY_FL_USER8 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+ printf "RUBY_FL_USER9 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+ printf "RUBY_FL_USER10 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+ printf "RUBY_FL_USER11 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+ printf "RUBY_FL_USER12 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+ printf "RUBY_FL_USER13 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+ printf "RUBY_FL_USER14 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+ printf "RUBY_FL_USER15 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+ printf "RUBY_FL_USER16 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+ printf "RUBY_FL_USER17 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+ printf "RUBY_FL_USER18 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..d0c2d266b4
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,8 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
new file mode 100644
index 0000000000..7196708b21
--- /dev/null
+++ b/.github/codeql/codeql-config.yml
@@ -0,0 +1,4 @@
+name: "CodeQL config for the Ruby language"
+
+paths-ignore:
+ - '/ext/**/*/conftest.c'
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..16d1e4a85a
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,47 @@
+name: BASERUBY Check
+
+on: [push, pull_request]
+
+jobs:
+ baseruby:
+ name: BASERUBY
+ runs-on: ubuntu-20.04
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ strategy:
+ matrix:
+ ruby:
+ - ruby-2.2
+# - ruby-2.3
+# - ruby-2.4
+# - ruby-2.5
+# - ruby-2.6
+ - ruby-2.7
+
+ steps:
+ - uses: actions/checkout@v2
+ - uses: ruby/setup-ruby@v1
+ with:
+ ruby-version: ${{ matrix.ruby }}
+ bundler: none
+ - run: echo "make=make -sj$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: sudo apt-get install build-essential autoconf bison
+ - run: ./autogen.sh
+ - run: ./configure --disable-install-doc
+ - run: $make update-unicode
+ - run: $make common-srcs
+ - run: $make incs
+ - run: $make all
+ - run: $make test
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / BASERUBY @ ${{ matrix.ruby }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..26d2ca473d
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,45 @@
+name: Check Dependencies
+on: [push, pull_request]
+jobs:
+ update-deps:
+ strategy:
+ matrix:
+ os: [ubuntu-20.04, macos-latest]
+ fail-fast: true
+ runs-on: ${{ matrix.os }}
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
+ if: "contains(matrix.os, 'ubuntu')"
+ - name: Install libraries
+ run: |
+ brew update
+ brew install gdbm gmp libffi openssl@1.1 zlib autoconf automake libtool readline
+ if: "contains(matrix.os, 'macos')"
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ - uses: actions/checkout@v2
+ - run: ./autogen.sh
+ - name: Run configure
+ run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+ - run: make all golf
+ - run: ruby tool/update-deps --fix
+ - run: git diff --no-ext-diff --ignore-submodules --exit-code
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / Dependencies need to update",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
new file mode 100644
index 0000000000..576341bf88
--- /dev/null
+++ b/.github/workflows/check_misc.yml
@@ -0,0 +1,17 @@
+name: Miscellaneous checks
+on: [push, pull_request]
+
+jobs:
+ checks:
+ runs-on: ubuntu-20.04
+ steps:
+ - uses: actions/checkout@v2
+ - name: Check if C-sources are US-ASCII
+ run: |
+ ! grep -r -n '[^ -~]' *.[chy] include internal win32/*.[ch]
+ - name: Check for header macros
+ run: |
+ ! for header in ruby/*.h; do \
+ git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null || echo $header
+ done | grep -F .
+ working-directory: include
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
new file mode 100644
index 0000000000..2dc47c0683
--- /dev/null
+++ b/.github/workflows/codeql-analysis.yml
@@ -0,0 +1,43 @@
+name: "Code scanning - action"
+
+on:
+ push:
+ pull_request:
+ schedule:
+ - cron: '0 12 * * 4'
+
+jobs:
+ CodeQL-Build:
+
+ # CodeQL runs on ubuntu-20.04 and windows-latest
+ runs-on: ubuntu-20.04
+
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
+
+ - name: Checkout repository
+ uses: actions/checkout@v2
+ with:
+ fetch-depth: 2
+
+ - run: git checkout HEAD^2
+ if: ${{ github.event_name == 'pull_request' }}
+
+ - name: Remove an obsolete rubygems vendored file
+ run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
+
+ - name: Initialize CodeQL
+ uses: github/codeql-action/init@v2
+ with:
+ languages: cpp
+ config-file: ./.github/codeql/codeql-config.yml
+
+ - name: Autobuild
+ uses: github/codeql-action/autobuild@v2
+
+ - name: Perform CodeQL Analysis
+ uses: github/codeql-action/analyze@v2
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..47b73fb907
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,245 @@
+name: Compilations
+
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**.md'
+ - '**.rdoc'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**.md'
+ - '**.rdoc'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+# Github actions does not support YAML anchors. This creative use of
+# environment variables (plus the "echo $GITHUB_ENV" hack) is to reroute that
+# restriction.
+env:
+ default_cc: clang-14
+ append_cc: ''
+ crosshost: ''
+
+ # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+ # to optimize binaries. Also Github Actions run on relatively modern CPUs
+ # compared to, say, GCC 4 or Clang 3. We don't specify `-march=native`
+ # because compilers tend not understand what the CPU is.
+ optflags: '-O1'
+
+ # -g0 disables backtraces when SEGV. Do not set that.
+ debugflags: '-ggdb3'
+
+ default_configure: >-
+ --enable-debug-env
+ --disable-install-doc
+ --with-ext=-test-/cxxanyargs,+
+ append_configure: >-
+ --without-valgrind
+ --without-jemalloc
+ --without-gmp
+
+ UPDATE_UNICODE: >-
+ UNICODE_FILES=.
+ UNICODE_PROPERTY_FILES=.
+ UNICODE_AUXILIARY_FILES=.
+ UNICODE_EMOJI_FILES=.
+ CONFIGURE_TTY: never
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUBY_DEBUG: ci rgengc
+ RUBY_TESTOPTS: >-
+ -q
+ --color=always
+ --tty=no
+
+jobs:
+ compile:
+ strategy:
+ fail-fast: false
+ matrix:
+ entry:
+ - { key: default_cc, name: gcc-11, value: gcc-11, container: gcc-11 }
+ - { key: default_cc, name: gcc-10, value: gcc-10, container: gcc-10 }
+ - { key: default_cc, name: gcc-9, value: gcc-9, container: gcc-9 }
+ - { key: default_cc, name: gcc-8, value: gcc-8, container: gcc-8 }
+ - { key: default_cc, name: gcc-7, value: gcc-7, container: gcc-7 }
+ - { key: default_cc, name: gcc-6, value: gcc-6, container: gcc-6 }
+ - { key: default_cc, name: gcc-5, value: gcc-5, container: gcc-5 }
+ - { key: default_cc, name: gcc-4.8, value: gcc-4.8, container: gcc-4.8 }
+ - key: default_cc
+ name: 'gcc-11 LTO'
+ value: 'gcc-11 -O2 -flto=auto -ffat-lto-objects'
+ container: gcc-11
+ shared: '--disable-shared'
+ # check: true
+ - { key: default_cc, name: clang-14, value: clang-14, container: clang-14 }
+ - { key: default_cc, name: clang-13, value: clang-13, container: clang-13 }
+ - { key: default_cc, name: clang-12, value: clang-12, container: clang-12 }
+ - { key: default_cc, name: clang-11, value: clang-11, container: clang-11 }
+ - { key: default_cc, name: clang-10, value: clang-10, container: clang-10 }
+ - { key: default_cc, name: clang-9, value: clang-9, container: clang-9 }
+ - { key: default_cc, name: clang-8, value: clang-8, container: clang-8 }
+ - { key: default_cc, name: clang-7, value: clang-7, container: clang-7 }
+ - { key: default_cc, name: clang-6.0, value: clang-6.0, container: clang-6.0 }
+ - { key: default_cc, name: clang-5.0, value: clang-5.0, container: clang-5.0 }
+ - { key: default_cc, name: clang-4.0, value: clang-4.0, container: clang-4.0 }
+ - { key: default_cc, name: clang-3.9, value: clang-3.9, container: clang-3.9 }
+ - key: default_cc
+ name: 'clang-14 LTO'
+ value: 'clang-14 -O2 -flto=auto'
+ container: clang-14
+ shared: '--disable-shared'
+ # check: true
+
+ - { key: crosshost, name: aarch64-linux-gnu, value: aarch64-linux-gnu, container: crossbuild-essential-arm64 }
+# - { key: crosshost, name: arm-linux-gnueabi, value: arm-linux-gnueabi }
+# - { key: crosshost, name: arm-linux-gnueabihf, value: arm-linux-gnueabihf }
+# - { key: crosshost, name: i686-w64-mingw32, value: i686-w64-mingw32 }
+# - { key: crosshost, name: powerpc-linux-gnu, value: powerpc-linux-gnu }
+ - { key: crosshost, name: powerpc64le-linux-gnu, value: powerpc64le-linux-gnu, container: crossbuild-essential-ppc64el }
+ - { key: crosshost, name: s390x-linux-gnu, value: s390x-linux-gnu, container: crossbuild-essential-s390x }
+ - { key: crosshost, name: x86_64-w64-mingw32, value: x86_64-w64-mingw32, container: mingw-w64 }
+
+ - { key: append_cc, name: c99, value: '-std=c99 -Werror=pedantic -pedantic-errors' }
+# - { key: append_cc, name: c11, value: '-std=c11 -Werror=pedantic -pedantic-errors' }
+# - { key: append_cc, name: c17, value: '-std=c17 -Werror=pedantic -pedantic-errors' }
+# - { key: append_cc, name: c2x, value: '-std=c2x -Werror=pedantic -pedantic-errors' }
+ - { key: CXXFLAGS, name: c++98, value: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }
+# - { key: CXXFLAGS, name: c++11, value: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }
+# - { key: CXXFLAGS, name: c++14, value: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }
+# - { key: CXXFLAGS, name: c++17, value: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }
+ - { key: CXXFLAGS, name: c++2a, value: '-std=c++2a -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }
+
+ - { key: optflags, name: '-O0', value: '-O0 -march=x86-64 -mtune=generic' }
+# - { key: optflags, name: '-O3', value: '-O3 -march=x86-64 -mtune=generic', check: true }
+
+ - { key: append_configure, name: gmp, value: '--with-gmp' }
+ - { key: append_configure, name: jemalloc, value: '--with-jemalloc' }
+ - { key: append_configure, name: valgrind, value: '--with-valgrind' }
+ - { key: append_configure, name: 'coroutine=ucontext', value: '--with-coroutine=ucontext' }
+ - { key: append_configure, name: 'coroutine=copy', value: '--with-coroutine=copy' }
+ - { key: append_configure, name: disable-jit-support, value: '--disable-jit-support' }
+ - { key: append_configure, name: disable-dln, value: '--disable-dln' }
+ - { key: append_configure, name: disable-rubygems, value: '--disable-rubygems' }
+
+ - { key: cppflags, name: OPT_THREADED_CODE=1, value: '-DOPT_THREADED_CODE=1' }
+ - { key: cppflags, name: OPT_THREADED_CODE=2, value: '-DOPT_THREADED_CODE=2' }
+ - { key: cppflags, name: OPT_THREADED_CODE=3, value: '-DOPT_THREADED_CODE=3' }
+
+ - { key: cppflags, name: NDEBUG, value: '-DNDEBUG' }
+ - { key: cppflags, name: RUBY_DEBUG, value: '-DRUBY_DEBUG' }
+# - { key: cppflags, name: ARRAY_DEBUG, value: '-DARRAY_DEBUG' }
+# - { key: cppflags, name: BIGNUM_DEBUG, value: '-DBIGNUM_DEBUG' }
+# - { key: cppflags, name: CCAN_LIST_DEBUG, value: '-DCCAN_LIST_DEBUG' }
+# - { key: cppflags, name: CPDEBUG=-1, value: '-DCPDEBUG=-1' }
+# - { key: cppflags, name: ENC_DEBUG, value: '-DENC_DEBUG' }
+# - { key: cppflags, name: GC_DEBUG, value: '-DGC_DEBUG' }
+# - { key: cppflags, name: HASH_DEBUG, value: '-DHASH_DEBUG' }
+# - { key: cppflags, name: ID_TABLE_DEBUG, value: '-DID_TABLE_DEBUG' }
+# - { key: cppflags, name: RGENGC_DEBUG=-1, value: '-DRGENGC_DEBUG=-1' }
+# - { key: cppflags, name: SYMBOL_DEBUG, value: '-DSYMBOL_DEBUG' }
+# - { key: cppflags, name: THREAD_DEBUG=-1, value: '-DTHREAD_DEBUG=-1' }
+
+# - { key: cppflags, name: RGENGC_CHECK_MODE, value: '-DRGENGC_CHECK_MODE' }
+# - { key: cppflags, name: TRANSIENT_HEAP_CHECK_MODE, value: '-DTRANSIENT_HEAP_CHECK_MODE' }
+# - { key: cppflags, name: VM_CHECK_MODE, value: '-DVM_CHECK_MODE' }
+
+ - { key: cppflags, name: USE_EMBED_CI=0, value: '-DUSE_EMBED_CI=0' }
+ - { key: cppflags, name: USE_FLONUM=0, value: '-DUSE_FLONUM=0' }
+# - { key: cppflags, name: USE_GC_MALLOC_OBJ_INFO_DETAILS, value: '-DUSE_GC_MALLOC_OBJ_INFO_DETAILS' }
+ - { key: cppflags, name: USE_LAZY_LOAD, value: '-DUSE_LAZY_LOAD' }
+# - { key: cppflags, name: USE_RINCGC=0, value: '-DUSE_RINCGC=0' }
+# - { key: cppflags, name: USE_SYMBOL_GC=0, value: '-DUSE_SYMBOL_GC=0' }
+# - { key: cppflags, name: USE_THREAD_CACHE=0, value: '-DUSE_THREAD_CACHE=0' }
+# - { key: cppflags, name: USE_TRANSIENT_HEAP=0, value: '-DUSE_TRANSIENT_HEAP=0' }
+# - { key: cppflags, name: USE_RUBY_DEBUG_LOG=1, value: '-DUSE_RUBY_DEBUG_LOG=1' }
+
+ - { key: cppflags, name: DEBUG_FIND_TIME_NUMGUESS, value: '-DDEBUG_FIND_TIME_NUMGUESS' }
+ - { key: cppflags, name: DEBUG_INTEGER_PACK, value: '-DDEBUG_INTEGER_PACK' }
+# - { key: cppflags, name: ENABLE_PATH_CHECK, value: '-DENABLE_PATH_CHECK' }
+
+ - { key: cppflags, name: GC_DEBUG_STRESS_TO_CLASS, value: '-DGC_DEBUG_STRESS_TO_CLASS' }
+# - { key: cppflags, name: GC_ENABLE_LAZY_SWEEP=0, value: '-DGC_ENABLE_LAZY_SWEEP=0' }
+# - { key: cppflags, name: GC_PROFILE_DETAIL_MEMOTY, value: '-DGC_PROFILE_DETAIL_MEMOTY' }
+# - { key: cppflags, name: GC_PROFILE_MORE_DETAIL, value: '-DGC_PROFILE_MORE_DETAIL' }
+
+# - { key: cppflags, name: CALC_EXACT_MALLOC_SIZE, value: '-DCALC_EXACT_MALLOC_SIZE' }
+# - { key: cppflags, name: MALLOC_ALLOCATED_SIZE_CHECK, value: '-DMALLOC_ALLOCATED_SIZE_CHECK' }
+
+# - { key: cppflags, name: IBF_ISEQ_ENABLE_LOCAL_BUFFER, value: '-DIBF_ISEQ_ENABLE_LOCAL_BUFFER' }
+
+# - { key: cppflags, name: RGENGC_ESTIMATE_OLDMALLOC, value: '-DRGENGC_ESTIMATE_OLDMALLOC' }
+# - { key: cppflags, name: RGENGC_FORCE_MAJOR_GC, value: '-DRGENGC_FORCE_MAJOR_GC' }
+# - { key: cppflags, name: RGENGC_OBJ_INFO, value: '-DRGENGC_OBJ_INFO' }
+# - { key: cppflags, name: RGENGC_OLD_NEWOBJ_CHECK, value: '-DRGENGC_OLD_NEWOBJ_CHECK' }
+# - { key: cppflags, name: RGENGC_PROFILE, value: '-DRGENGC_PROFILE' }
+
+# - { key: cppflags, name: VM_DEBUG_BP_CHECK, value: '-DVM_DEBUG_BP_CHECK' }
+# - { key: cppflags, name: VM_DEBUG_VERIFY_METHOD_CACHE, value: '-DVM_DEBUG_VERIFY_METHOD_CACHE' }
+
+ - { key: cppflags, name: MJIT_FORCE_ENABLE, value: '-DMJIT_FORCE_ENABLE' }
+ - { key: cppflags, name: YJIT_FORCE_ENABLE, value: '-DYJIT_FORCE_ENABLE' }
+
+ name: ${{ matrix.entry.name }}
+ runs-on: ubuntu-latest
+ container:
+ image: ghcr.io/ruby/ruby-ci-image:${{ matrix.entry.container || 'clang-14' }}
+ options: --user root
+ if: ${{ !startsWith(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: id
+ working-directory:
+ - run: mkdir build
+ working-directory:
+ - name: setenv
+ run: |
+ echo "${{ matrix.entry.key }}=${{ matrix.entry.value }}" >> $GITHUB_ENV
+ echo "GNUMAKEFLAGS=-sj$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - uses: actions/checkout@v3
+ with:
+ path: src
+ - uses: actions/cache@v3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: >
+ ../src/configure -C ${default_configure} ${append_configure}
+ ${{ matrix.entry.key == 'crosshost' && '--host="${crosshost}"' || '--with-gcc="${default_cc} ${append_cc}"' }}
+ ${{ matrix.entry.shared || '--enable-shared' }}
+ - run: make extract-extlibs
+ - run: make incs
+ - run: make
+# - run: make leaked-globals
+ - run: make test
+ - run: make install
+ if: ${{ matrix.entry.check }}
+ - run: make test-tool
+ if: ${{ matrix.entry.check }}
+ - run: make test-all TESTS='-- ruby -ext-'
+ if: ${{ matrix.entry.check }}
+ - run: make test-spec
+ if: ${{ matrix.entry.check }}
+
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.entry.name }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..1da94630fe
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,66 @@
+name: macOS
+on: [push, pull_request]
+jobs:
+ make:
+ runs-on: macos-latest
+ strategy:
+ matrix:
+ test_task: [ "check" ] #, "test-bundler-parallel", "test-bundled-gems" ] matrix tests has unknown issues
+ fail-fast: false
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Disable Firewall
+ run: |
+ sudo /usr/libexec/ApplicationFirewall/socketfilterfw --setglobalstate off
+ sudo /usr/libexec/ApplicationFirewall/socketfilterfw --getglobalstate
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ - uses: actions/checkout@v2
+ with:
+ path: src
+ - name: Install libraries
+ run: |
+ export WAITS='5 60'
+ tool/travis_retry.sh brew update
+ tool/travis_retry.sh brew install gdbm gmp libffi openssl@1.1 zlib autoconf automake libtool readline
+ working-directory: src
+ - name: Set ENV
+ run: |
+ echo "JOBS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --with-openssl-dir=$(brew --prefix openssl@1.1) --with-readline-dir=$(brew --prefix readline)
+ - run: make $JOBS incs
+ - run: make $JOBS
+ - run: make leaked-globals
+ if: matrix.test_task == 'check'
+ - run: make prepare-gems
+ if: matrix.test_task == 'check'
+ - run: make $JOBS -s ${{ matrix.test_task }}
+ timeout-minutes: 60
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: "rexml"
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..a5d64c7b2d
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,141 @@
+name: MinGW
+on: [push, pull_request]
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+ make:
+ runs-on: windows-2022
+ name: ${{ github.workflow }} (${{ matrix.msystem }})
+ env:
+ MSYSTEM: MINGW64
+ MSYSTEM_PREFIX: /mingw64
+ MSYS2_ARCH: x86_64
+ CHOST: "x86_64-w64-mingw32"
+ CFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe -fstack-protector-strong"
+ CXXFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe"
+ CPPFLAGS: "-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048"
+ LDFLAGS: "-pipe -fstack-protector-strong"
+ UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ strategy:
+ matrix:
+ test_task: [ "check" ] # to make job names consistent
+ fail-fast: false
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --system core.autocrlf false
+ git config --system core.eol lf
+ git config --system advice.detachedHead 0
+ - uses: actions/checkout@v2
+ with:
+ path: src
+ - name: Set up Ruby & MSYS2
+ uses: ruby/setup-ruby@v1
+ with:
+ ruby-version: 2.6
+ mingw: _upgrade_ gdbm gmp libffi libyaml openssl ragel readline
+ msys2: automake1.16 bison
+ - name: where check
+ run: |
+ # show where
+ Write-Host
+ $where = 'gcc.exe', 'ragel.exe', 'make.exe', 'bison.exe', 'libcrypto-1_1-x64.dll', 'libssl-1_1-x64.dll'
+ foreach ($e in $where) {
+ $rslt = where.exe $e 2>&1 | Out-String
+ if ($rslt.contains($e)) { Write-Host $rslt }
+ else { Write-Host "`nCan't find $e" }
+ }
+
+ - name: autogen
+ run: |
+ ./autogen.sh
+ working-directory: src
+ shell: sh
+
+ - name: configure
+ run: |
+ # Actions uses UTF8, causes test failures, similar to normal OS setup
+ $PSDefaultParameterValues['*:Encoding'] = 'utf8'
+ [Console]::OutputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ [Console]::InputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ $config_args = "--build=$env:CHOST --host=$env:CHOST --target=$env:CHOST"
+ Write-Host $config_args
+ sh -c "../src/configure --disable-install-doc --prefix=/. $config_args"
+ # Write-Host "-------------------------------------- config.log"
+ # Get-Content ./config.log | foreach {Write-Output $_}
+
+ - name: update
+ run: |
+ $jobs = [int](2 * $env:NUMBER_OF_PROCESSORS)
+ make -j $jobs incs
+
+ - name: download gems
+ run: |
+ $jobs = [int](2 * $env:NUMBER_OF_PROCESSORS)
+ make -j $jobs update-gems
+
+ - name: make all
+ timeout-minutes: 40
+ run: |
+ $jobs = [int](2 * $env:NUMBER_OF_PROCESSORS)
+ make -j $jobs
+
+ - name: make install
+ run: |
+ # Actions uses UTF8, causes test failures, similar to normal OS setup
+ $PSDefaultParameterValues['*:Encoding'] = 'utf8'
+ [Console]::OutputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ [Console]::InputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ make DESTDIR=../install install-nodoc
+
+ - name: test
+ timeout-minutes: 5
+ run: |
+ make test
+
+ - name: test-all
+ timeout-minutes: 60
+ run: |
+ # Actions uses UTF8, causes test failures, similar to normal OS setup
+ $PSDefaultParameterValues['*:Encoding'] = 'utf8'
+ [Console]::OutputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ [Console]::InputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ $jobs = [int](1.5 * $env:NUMBER_OF_PROCESSORS)
+ if ($env:BUNDLER_VERSION) { Remove-Item env:\BUNDLER_VERSION }
+ make test-all TESTOPTS="-j $jobs --retry --job-status=normal --show-skip --timeout-scale=1.5"
+
+ - name: test-spec
+ timeout-minutes: 10
+ working-directory: src/spec/ruby
+ run: |
+ $env:Path = "$pwd/../../../install/bin;$env:Path"
+ # Actions uses UTF8, causes test failures, similar to normal OS setup
+ $PSDefaultParameterValues['*:Encoding'] = 'utf8'
+ [Console]::OutputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ [Console]::InputEncoding = [System.Text.Encoding]::GetEncoding("IBM437")
+ ruby -v
+ ruby ../mspec/bin/mspec -I../../tool/lib -j
+
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} ${{ matrix.msystem }} / ${{ matrix.test_task }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/mjit.yml b/.github/workflows/mjit.yml
new file mode 100644
index 0000000000..8dcbcf7760
--- /dev/null
+++ b/.github/workflows/mjit.yml
@@ -0,0 +1,77 @@
+name: MJIT
+on: [push, pull_request]
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [check] # to make job names consistent
+ jit_opts: [--jit-wait]
+ fail-fast: false
+ runs-on: ubuntu-20.04
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ env:
+ TESTOPTS: '-q --tty=no'
+ RUN_OPTS: '--disable-gems ${{ matrix.jit_opts }} --jit-debug=-ggdb3'
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ - uses: actions/checkout@v2
+ with:
+ path: src
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc cppflags=-DVM_CHECK_MODE
+ - run: make incs
+ - run: make
+ - run: sudo make -s install
+ - run: sudo apt-get install gdb # used by test / test-all failure
+ - name: Run test
+ run: |
+ ulimit -c unlimited
+ make -s test RUN_OPTS="$RUN_OPTS"
+ timeout-minutes: 60
+ # - name: Run test-all
+ # run: |
+ # ulimit -c unlimited
+ # make -s test-all RUN_OPTS="$RUN_OPTS"
+ # timeout-minutes: 60
+ - name: Run test-spec
+ run: |
+ ulimit -c unlimited
+ make -s test-spec RUN_OPTS="$RUN_OPTS"
+ timeout-minutes: 60
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.jit_opts }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..bf053cdd05
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,41 @@
+name: Rubyspec Version Guards Check
+
+on: [push, pull_request]
+
+jobs:
+ rubyspec:
+ name: Rubyspec
+ runs-on: ubuntu-20.04
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ strategy:
+ matrix:
+ # Specs from ruby/spec should still run on all supported Ruby versions.
+ # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+ ruby:
+ - ruby-2.5
+# - ruby-2.6
+ - ruby-2.7
+ - ruby-3.0
+
+ steps:
+ - uses: actions/checkout@v2
+ - uses: ruby/setup-ruby@v1
+ with:
+ ruby-version: ${{ matrix.ruby }}
+ bundler: none
+ - run: gem install webrick
+ - run: ruby ../mspec/bin/mspec
+ working-directory: spec/ruby
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / rubyspec @ ${{ matrix.ruby }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..93187699be
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,87 @@
+name: Ubuntu
+on: [push, pull_request]
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [ "check", "test-bundler-parallel", "test-bundled-gems", "test-all TESTS=--repeat-count=2" ]
+ os:
+ - ubuntu-20.04
+# - ubuntu-18.04
+# - ubuntu-16.04
+ debug: ["", "-DRUBY_DEBUG"]
+ exclude:
+ - test_task: test-bundler-parallel
+ os: ubuntu-16.04
+ - test_task: test-bundled-gems
+ os: ubuntu-16.04
+ - test_task: "test-all TESTS=--repeat-count=2"
+ os: ubuntu-16.04
+ - os: ubuntu-16.04
+ debug: -DRUBY_DEBUG
+ - test_task: "test-all TESTS=--repeat-count=2"
+ debug: -DRUBY_DEBUG
+ fail-fast: false
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUBY_DEBUG: ci
+ runs-on: ${{ matrix.os }}
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ - uses: actions/checkout@v2
+ with:
+ path: src
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - name: Set ENV
+ run: |
+ echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc cppflags=${{ matrix.debug }}
+ - run: make $JOBS incs
+ - run: make $JOBS
+ - run: make leaked-globals
+ if: matrix.test_task == 'check'
+ - run: make prepare-gems
+ if: matrix.test_task == 'check'
+ - name: Create dummy files in build dir
+ run: |
+ ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+ if: matrix.test_task == 'check'
+ - run: make $JOBS -s ${{ matrix.test_task }}
+ timeout-minutes: 30
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.debug }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..98e59ae188
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,80 @@
+name: Windows
+on: [push, pull_request]
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [test]
+ os: [windows-2019]
+ vs: [2019]
+ fail-fast: false
+ runs-on: ${{ matrix.os }}
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ VCVARS: C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - run: md build
+ working-directory:
+ - uses: actions/cache@v2
+ with:
+ path: C:\vcpkg\downloads
+ key: ${{ runner.os }}-vcpkg-download-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-vcpkg-download-${{ matrix.os }}-
+ ${{ runner.os }}-vcpkg-download-
+ - name: Install libraries with vcpkg
+ run: |
+ vcpkg --triplet x64-windows install readline zlib
+ - uses: actions/cache@v2
+ with:
+ path: C:\Users\runneradmin\AppData\Local\Temp\chocolatey
+ key: ${{ runner.os }}-chocolatey-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-chocolatey-${{ matrix.os }}-
+ ${{ runner.os }}-chocolatey-
+ - name: Install libraries with chocolatey
+ run: |
+ choco install --no-progress openssl
+ choco install --no-progress winflexbison3 --version=2.5.18.20190508
+ - name: git config
+ run: |
+ git config --system advice.detachedHead 0
+ - uses: actions/checkout@v2
+ with:
+ path: src
+ - name: Configure
+ run: |
+ call "%VCVARS%"
+ ../src/win32/configure.bat --disable-install-doc --without-ext=+,dbm,gdbm --enable-bundled-libffi --with-opt-dir=C:/vcpkg/installed/x64-windows --with-openssl-dir="C:/Program Files/OpenSSL-Win64"
+ - name: nmake
+ run: |
+ call "%VCVARS%"
+ set YACC=win_bison
+ echo on
+ nmake incs
+ nmake extract-extlibs
+ nmake
+ - name: nmake test
+ timeout-minutes: 30
+ run: |
+ call "%VCVARS%"
+ nmake ${{ matrix.test_task }}
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / ${{ matrix.test_task }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref }}".split('/').reverse()[0]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: failure() && github.event_name == 'push'
+
+defaults:
+ run:
+ working-directory: build
+ shell: cmd
diff --git a/.gitignore b/.gitignore
index a9104e9ed5..8d11d7278a 100644
--- a/.gitignore
+++ b/.gitignore
@@ -1,44 +1,69 @@
*-*-*.def
+*-*-*.exp
+*-*-*.lib
*.a
*.bak
+*.bc
+*.bundle
*.dSYM
*.dmyh
*.dylib
*.elc
+*.i
*.inc
*.log
*.o
+*.obj
+*.old
*.orig
+*.pch
+*.pdb
+*.rbinc
*.rej
+*.s
*.sav
+*.sl
+*.so
*.swp
+*.yarb
*~
-.*-*
.*.list
.*.time
.DS_Store
+.bundle
.ccmalloc
.ext
.pc
.ppack
.svn
+.time
+.ruby-version
Makefile
-Makefile.old
+cygruby*.def
extconf.h
y.output
y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+lcov*.info
# /
/*-fake.rb
+/*.dll
+/*.exe
+/*.res
/*.pc
+/*.rc
/*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
/COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
+/ChangeLog
/Doxyfile
/GNUmakefile
-/GNUmakefile.old
/README.atheos
/README.fat-patch
/README.v6
@@ -46,6 +71,7 @@ y.tab.c
/archive
/autom4te*.cache
/automake
+/benchmark/benchmark-driver
/beos
/bmlog-*
/breakpoints.gdb
@@ -56,6 +82,8 @@ y.tab.c
/config.status.lineno
/configure
/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
/coverage/.last_run.json
/coverage/.resultset.json*
/coverage/assets
@@ -67,6 +95,9 @@ y.tab.c
/goruby
/id.[ch]
/largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
/lex.c
/libruby*.*
/miniprelude.c
@@ -82,40 +113,74 @@ y.tab.c
/ppack
/prelude.c
/preview
+/probes.dmyh
/probes.h
/rbconfig.rb
/rename2.h
/repack
/revision.h
+/revision.tmp
/riscos
/rubicon
/ruby
+/ruby-runner
+/ruby-runner.h
/ruby-man.rd.gz
+/run.gdb
/sizes.c
+/static-ruby
/test.rb
+/test-coverage.dat
/tmp
/transdb.h
/uncommon.mk
/verconf.h
+/verconf.mk
/web
/yasmdata.rb
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+
# /benchmark/
+/benchmark/bm_require.data
/benchmark/bmx_*.rb
/benchmark/fasta.output.*
/benchmark/wc.input
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/jis/props.h
/enc/unicode/data
+# /coroutine/
+!/coroutine/**/*.s
+
# /enc/trans/
/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+
+# /exe/
+/exe/goruby
+/exe/ruby
# /ext/
/ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
# /ext/etc/
/ext/etc/constdefs.h
@@ -125,9 +190,11 @@ y.tab.c
# /ext/rbconfig/
/ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
# /ext/ripper/
/ext/ripper/eventids1.c
+/ext/ripper/.eventids2-check
/ext/ripper/eventids2table.c
/ext/ripper/ripper.*
/ext/ripper/ids1
@@ -138,15 +205,17 @@ y.tab.c
/ext/socket/constdefs.h
/ext/socket/constdefs.c
-# /ext/tk/
-/ext/tk/config_list
-
# /gems
/gems/*.gem
+/gems/src
+/gems/*-*
-# /spec/
-/spec/mspec
-/spec/rubyspec
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /spec/bundler
+/.rspec_status
# /tool/
/tool/config.guess
@@ -154,4 +223,8 @@ y.tab.c
# /win32/
/win32/*.ico
-/win32/.time
+
+# MJIT
+/rb_mjit_header.h
+/mjit_config.h
+/include/ruby-*/*/rb_mjit_min_header-*.h
diff --git a/.indent.pro b/.indent.pro
deleted file mode 100644
index 6a207a0554..0000000000
--- a/.indent.pro
+++ /dev/null
@@ -1,21 +0,0 @@
--bap
--nbbb
--nbc
--br
--nbs
--ncdb
--ce
--cli0.5
--ndj
--ei
--nfc1
--i4
--l120
--lp
--npcs
--psl
--sc
--sob
-
--TID
--TVALUE
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
index 0052fdfc41..d480307dd6 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -1,3 +1,4 @@
+# -*- YAML -*-
# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
#
# This file is a part of the programming language Ruby. Permission is hereby
@@ -16,83 +17,275 @@
#
# is also a good place to look at.
-# Language specification.
language: c
-sudo: false
-
-# Compilers. Several compilers are provided in Travis, so we try them all.
-# The value set here is visible via $CC environment variable.
-compiler:
- - gcc
-
-os:
- - linux
-
-# Dependencies. Some header files are missing in a Travis' worker VM, so we
-# have to install them. The "1.9.1" here is OK. It is the most adopted
-# version string for Debian/Ubuntu, and no dependencies have been changed so
-# far since the 1.9.1 release.
-before_install:
- - "CONFIG_FLAG="
- - "JOBS='-j 4'"
-
-# Script is where the test runs. Note we just do "make test", not other tests
-# like test-all, test-rubyspec. This is because they take too much time,
-# enough for Travis to shut down the VM as being stalled.
+
+os: linux
+
+dist: xenial
+
+git:
+ quiet: true
+
+cache:
+ ccache: true
+ directories:
+ - $HOME/config_2nd
+ - $HOME/.downloaded-cache
+
+env:
+ global:
+ # Reset timestamps early
+ - _=$(touch NEWS && find . -type f -exec touch -r NEWS {} +)
+ - CONFIGURE_TTY=no
+ - CCACHE_COMPILERCHECK=none
+ - CCACHE_NOCOMPRESS=1
+ - CCACHE_MAXSIZE=512Mi
+ - NPROC="`nproc`"
+ # JOBS and SETARCH are overridden when necessary; see below.
+ - JOBS=-j$((1+${NPROC}))
+ - SETARCH=
+ - RUBY_PREFIX=/tmp/ruby-prefix
+ - GEMS_FOR_TEST='timezone tzinfo'
+ - UPDATE_UNICODE="UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+ - BEFORE_INSTALL=true
+ # https://github.com/travis-ci/travis-build/blob/e411371dda21430a60f61b8f3f57943d2fe4d344/lib/travis/build/bash/travis_apt_get_options.bash#L7
+ - travis_apt_get_options='--allow-downgrades --allow-remove-essential --allow-change-held-packages'
+ - travis_apt_get_options="-yq --no-install-suggests --no-install-recommends $travis_apt_get_options"
+
+.org.ruby-lang.ci.matrix-definitions:
+
+ - &make-test-only
+ script:
+ - $SETARCH make -s test TESTOPTS="${TESTOPTS=$JOBS -q --tty=no}"
+
+ - &gcc-8
+ compiler: gcc-8
+ # # Not using addon to control retries
+ # addons:
+ # apt:
+ # sources:
+ # - ubuntu-toolchain-r-test
+ before_install:
+ - bash -cx "${BEFORE_INSTALL}"
+ - tool/travis_retry.sh sudo -E apt-add-repository -y "ppa:ubuntu-toolchain-r/test"
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - >-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
+ ccache
+ gcc-8
+ g++-8
+ libffi-dev
+ libgdbm-dev
+ libncurses5-dev
+ libncursesw5-dev
+ libreadline6-dev
+ libssl-dev
+ libyaml-dev
+ openssl
+ zlib1g-dev
+
+ - &clang-8
+ compiler: clang-8
+ addons:
+ apt:
+ # Not doing this manually unlike other sources, because it has been stable.
+ sources:
+ - llvm-toolchain-xenial-8
+ config:
+ retries: true
+ before_install:
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - >-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
+ clang-8
+ llvm-8-tools
+ libffi-dev
+ libgdbm-dev
+ libncurses5-dev
+ libncursesw5-dev
+ libreadline6-dev
+ libssl-dev
+ libyaml-dev
+ openssl
+ zlib1g-dev
+
+ # --------
+
+ - &x86_64-linux
+ name: x86_64-linux
+ <<: *gcc-8
+
+ - &arm64-linux
+ name: arm64-linux
+ arch: arm64
+ <<: *gcc-8
+
+ - &s390x-linux
+ name: s390x-linux
+ arch: s390x
+ <<: *gcc-8
+
+ - &i686-linux
+ name: i686-linux
+ compiler: gcc-8
+ env:
+ - GCC_FLAGS=-m32
+ - CXX='g++-8 -m32'
+ - debugflags=-g0
+ - SETARCH='setarch i686 --verbose --3gb'
+ # # Not using addon to control retries
+ # addons:
+ # apt:
+ # sources:
+ # - ubuntu-toolchain-r-test
+ before_install:
+ - tool/travis_retry.sh sudo -E apt-add-repository -y "ppa:ubuntu-toolchain-r/test"
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - >-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
+ gcc-8-multilib
+ g++-8
+ g++-8-multilib
+ libstdc++-8-dev:i386
+ libffi-dev:i386
+ libffi6:i386
+ libgdbm-dev:i386
+ libgdbm3:i386
+ libncurses5-dev:i386
+ libncurses5:i386
+ libncursesw5-dev:i386
+ libreadline6-dev:i386
+ libreadline6:i386
+ libssl-dev:i386
+ libssl1.0.0:i386
+ linux-libc-dev:i386
+ zlib1g-dev:i386
+ zlib1g:i386
+
+ - &arm32-linux
+ name: arm32-linux
+ arch: arm64
+ # https://packages.ubuntu.com/xenial/crossbuild-essential-armhf
+ compiler: arm-linux-gnueabihf-gcc
+ env:
+ - debugflags=-g0
+ - SETARCH='setarch linux32 --verbose --32bit'
+ before_install:
+ - sudo dpkg --add-architecture armhf
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - >-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
+ ccache
+ crossbuild-essential-armhf
+ libc6:armhf
+ libstdc++-5-dev:armhf
+ libffi-dev:armhf
+ libffi6:armhf
+ libgdbm-dev:armhf
+ libgdbm3:armhf
+ libncurses5-dev:armhf
+ libncurses5:armhf
+ libncursesw5-dev:armhf
+ libreadline6-dev:armhf
+ libreadline6:armhf
+ libssl-dev:armhf
+ libssl1.0.0:armhf
+ linux-libc-dev:armhf
+ zlib1g-dev:armhf
+ zlib1g:armhf
+
+matrix:
+ include:
+ # Build every commit:
+ - <<: *i686-linux
+ # Build every commit (Allowed Failures):
+ - <<: *arm32-linux
+ - <<: *arm64-linux
+ - <<: *s390x-linux
+ allow_failures:
+ - name: arm32-linux
+ - name: arm64-linux
+ - name: s390x-linux
+ fast_finish: true
+
before_script:
- - "uname -a"
- - "uname -r"
- - "rm -fr .ext autom4te.cache"
- - "echo $TERM"
- - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
- - "autoconf"
- - "mkdir config_1st config_2nd"
- - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
- - "cp -pr config.status .ext/include config_1st"
- - "make reconfig"
- - "cp -pr config.status .ext/include config_2nd"
- - "diff -ru config_1st config_2nd"
- - "make after-update BASERUBY=ruby"
- - "make -s $JOBS"
- - "make update-rubyspec"
+ - rm -fr .ext autom4te.cache
+ - |-
+ [ -d ~/.downloaded-cache ] ||
+ mkdir ~/.downloaded-cache
+ - ln -s ~/.downloaded-cache
+ - "> config.status"
+ - "> .rbconfig.time"
+ - sed -f tool/prereq.status template/Makefile.in common.mk > Makefile
+ - make touch-unicode-files
+ - make -s $JOBS $UPDATE_UNICODE up
+ - make -s $JOBS srcs
+ - rm -f config.status Makefile rbconfig.rb .rbconfig.time
+ - |-
+ if [ -d ~/config_2nd ]; then
+ cp -pr ~/config_2nd build
+ else
+ mkdir build
+ fi
+ - mkdir config_1st config_2nd
+ - chmod -R a-w .
+ - chmod -R u+w build config_1st config_2nd
+ - cd build
+ - |-
+ case "$CC" in
+ gcc*) CC="ccache $CC${GCC_FLAGS:+ }$GCC_FLAGS -fno-diagnostics-color";;
+ clang*) CC="ccache $CC${GCC_FLAGS:+ }$GCC_FLAGS -fno-color-diagnostics";;
+ esac
+ - |-
+ [ ! -f config.cache ] ||
+ [ "$CC" = "`sed -n s/^ac_cv_prog_CC=//p config.cache`" ] ||
+ (set -x; exec rm config.cache)
+ - $SETARCH ../configure -C --disable-install-doc --prefix=$RUBY_PREFIX $CONFIG_FLAG
+ - cp -pr config.cache config.status .ext/include ../config_1st
+ - $SETARCH make reconfig
+ - cp -pr config.cache config.status .ext/include ../config_2nd
+ - (cd .. && exec diff -ru config_1st config_2nd)
+ - chmod u+w ..
+ - rm -rf ~/config_2nd
+ - mv ../config_2nd ~
+ - chmod u-w ..
+ - $SETARCH make -s $JOBS
+ - make -s install
+ - |-
+ [ -z "${GEMS_FOR_TEST}" ] ||
+ $RUBY_PREFIX/bin/gem install --no-document $GEMS_FOR_TEST
+ - echo "raise 'do not load ~/.irbrc in test'" > ~/.irbrc
+
script:
- - "make test TESTOPTS=--color=never"
- - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
- - "make test-rubyspec MSPECOPT=-fm"
+ - $SETARCH make -s test -o showflags TESTOPTS="${TESTOPTS=$JOBS -q --tty=no}"
+ - travis_wait 50 $SETARCH make -s test-all -o exts TESTOPTS="${TESTOPTS} ${TEST_ALL_OPTS}" RUBYOPT="-w"
+ - $SETARCH make -s test-spec MSPECOPT=-ff # not using `-j` because sometimes `mspec -j` silently dies
+ - $SETARCH make -s -o showflags leaked-globals
# Branch matrix. Not all branches are Travis-ready so we limit branches here.
branches:
only:
- - trunk
- - ruby_2_1
- - ruby_2_2
- - ruby_2_3
- - /^feature\//
- - /^bug\//
+ - master
+ - ruby_2_4
+ - ruby_2_5
+ - ruby_2_6
+ - ruby_2_7
# We want to be notified when something happens.
notifications:
irc:
channels:
- - "irc.freenode.org#ruby-core"
- - "irc.freenode.org#ruby-ja"
+ - "chat.freenode.net#ruby-core"
on_success: change # [always|never|change] # default: always
on_failure: always # [always|never|change] # default: always
template:
- "%{message} by @%{author}: See %{build_url}"
- # Update ruby-head installed on Travis CI so other projects can test against it.
webhooks:
urls:
- - "https://rubies.travis-ci.org/rebuild/ruby-head"
- on_success: always
- on_failure: never
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
+ - secure: mRsoS/UbqDkKkW5p3AEqM27d4SZnV6Gsylo3bm8T/deltQzTsGzZwrm7OIBXZv0UFZdE68XmPlyHfZFLSP2V9QZ7apXMf9/vw0GtcSe1gchtnjpAPF6lYBn7nMCbVPPx9cS0dwL927fjdRM1vj7IKZ2bk4F0lAJ25R25S6teqdk= # ruby-lang slack: ruby/simpler-alerts-bot (travis)
+ on_success: never
+ on_failure: always
+
+ email:
+ - ko1c-failure@atdot.net
diff --git a/BSDL b/BSDL
index a009caefea..66d93598aa 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
+ notice, this list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/COPYING b/COPYING
index a1f19ff99d..48e5a96de7 100644
--- a/COPYING
+++ b/COPYING
@@ -2,55 +2,55 @@ Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
You can redistribute it and/or modify it under either the terms of the
2-clause BSDL (see the file BSDL), or the conditions below:
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
- a) place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
- b) use the modified software only within your corporation or
- organization.
+ b. use the modified software only within your corporation or
+ organization.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 3. You may distribute the software in object code or binary form,
- provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+ provided that you do at least ONE of the following:
- a) distribute the binaries and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
+ a. distribute the binaries and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
- b) accompany the distribution with the machine-readable source of
- the software.
+ b. accompany the distribution with the machine-readable source of
+ the software.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under these terms.
- For the list of those files and their copying conditions, see the
- file LEGAL.
+ For the list of those files and their copying conditions, see the
+ file LEGAL.
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
+5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index e50d01c8d1..230376bc60 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -2,50 +2,50 @@
ã¾ãŸã¯ä»¥ä¸‹ã«ç¤ºã™æ¡ä»¶ã§æœ¬ãƒ—ログラムをå†é…布ã§ãã¾ã™
2-clause BSDLã«ã¤ã„ã¦ã¯BSDLファイルをå‚ç…§ã—ã¦ä¸‹ã•ã„.
- 1. 複製ã¯åˆ¶é™ãªã自由ã§ã™ï¼Ž
+1. 複製ã¯åˆ¶é™ãªã自由ã§ã™ï¼Ž
- 2. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムã®ã‚½ãƒ¼ã‚¹ã‚’
- 自由ã«å¤‰æ›´ã§ãã¾ã™ï¼Ž
+2. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムã®ã‚½ãƒ¼ã‚¹ã‚’
+ 自由ã«å¤‰æ›´ã§ãã¾ã™ï¼Ž
- (a) ãƒãƒƒãƒˆãƒ‹ãƒ¥ãƒ¼ã‚ºã«ãƒã‚¹ãƒˆã—ãŸã‚Šï¼Œä½œè€…ã«å¤‰æ›´ã‚’é€ä»˜ã™ã‚‹
- ãªã©ã®æ–¹æ³•ã§ï¼Œå¤‰æ›´ã‚’公開ã™ã‚‹ï¼Ž
+ a. ãƒãƒƒãƒˆãƒ‹ãƒ¥ãƒ¼ã‚ºã«ãƒã‚¹ãƒˆã—ãŸã‚Šï¼Œä½œè€…ã«å¤‰æ›´ã‚’é€ä»˜ã™ã‚‹
+ ãªã©ã®æ–¹æ³•ã§ï¼Œå¤‰æ›´ã‚’公開ã™ã‚‹ï¼Ž
- (b) 変更ã—ãŸæœ¬ãƒ—ãƒ­ã‚°ãƒ©ãƒ ã‚’è‡ªåˆ†ã®æ‰€å±žã™ã‚‹çµ„織内部ã ã‘ã§
- 使ã†ï¼Ž
+ b. 変更ã—ãŸæœ¬ãƒ—ãƒ­ã‚°ãƒ©ãƒ ã‚’è‡ªåˆ†ã®æ‰€å±žã™ã‚‹çµ„織内部ã ã‘ã§
+ 使ã†ï¼Ž
- (c) 変更点を明示ã—ãŸã†ãˆï¼Œã‚½ãƒ•トウェアã®åå‰ã‚’変更ã™ã‚‹ï¼Ž
- ãã®ã‚½ãƒ•トウェアをé…布ã™ã‚‹æ™‚ã«ã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラ
- ãƒ ã‚‚åŒæ™‚ã«é…布ã™ã‚‹ï¼Žã¾ãŸã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラムã®ã‚½ãƒ¼
- スã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
+ c. 変更点を明示ã—ãŸã†ãˆï¼Œã‚½ãƒ•トウェアã®åå‰ã‚’変更ã™ã‚‹ï¼Ž
+ ãã®ã‚½ãƒ•トウェアをé…布ã™ã‚‹æ™‚ã«ã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラ
+ ãƒ ã‚‚åŒæ™‚ã«é…布ã™ã‚‹ï¼Žã¾ãŸã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラムã®ã‚½ãƒ¼
+ スã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (d) ãã®ä»–ã®å¤‰æ›´æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
+ d. ãã®ä»–ã®å¤‰æ›´æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
- 3. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムをコンパイ
- ルã—ãŸã‚ªãƒ–ジェクトコードや実行形å¼ã§ã‚‚é…布ã§ãã¾ã™ï¼Ž
+3. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムをコンパイ
+ ルã—ãŸã‚ªãƒ–ジェクトコードや実行形å¼ã§ã‚‚é…布ã§ãã¾ã™ï¼Ž
- (a) ãƒã‚¤ãƒŠãƒªã‚’å—ã‘å–ã£ãŸäººãŒã‚½ãƒ¼ã‚¹ã‚’入手ã§ãるよã†ã«ï¼Œ
- ソースã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
+ a. ãƒã‚¤ãƒŠãƒªã‚’å—ã‘å–ã£ãŸäººãŒã‚½ãƒ¼ã‚¹ã‚’入手ã§ãるよã†ã«ï¼Œ
+ ソースã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (b) 機械å¯èª­ãªã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’添付ã™ã‚‹ï¼Ž
+ b. 機械å¯èª­ãªã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’添付ã™ã‚‹ï¼Ž
- (c) 変更を行ã£ãŸãƒã‚¤ãƒŠãƒªã¯åå‰ã‚’変更ã—ãŸã†ãˆï¼Œã‚ªãƒªã‚¸ãƒŠ
- ルã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
+ c. 変更を行ã£ãŸãƒã‚¤ãƒŠãƒªã¯åå‰ã‚’変更ã—ãŸã†ãˆï¼Œã‚ªãƒªã‚¸ãƒŠ
+ ルã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (d) ãã®ä»–ã®é…布æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
+ d. ãã®ä»–ã®é…布æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
- 4. ä»–ã®ãƒ—ログラムã¸ã®å¼•用ã¯ã„ã‹ãªã‚‹ç›®çš„ã§ã‚れ自由ã§ã™ï¼ŽãŸ
- ã ã—,本プログラムã«å«ã¾ã‚Œã‚‹ä»–ã®ä½œè€…ã«ã‚ˆã‚‹ã‚³ãƒ¼ãƒ‰ã¯ï¼Œã
- れãžã‚Œã®ä½œè€…ã®æ„å‘ã«ã‚ˆã‚‹åˆ¶é™ãŒåŠ ãˆã‚‰ã‚Œã‚‹å ´åˆãŒã‚りã¾ã™ï¼Ž
+4. ä»–ã®ãƒ—ログラムã¸ã®å¼•用ã¯ã„ã‹ãªã‚‹ç›®çš„ã§ã‚れ自由ã§ã™ï¼ŽãŸ
+ ã ã—,本プログラムã«å«ã¾ã‚Œã‚‹ä»–ã®ä½œè€…ã«ã‚ˆã‚‹ã‚³ãƒ¼ãƒ‰ã¯ï¼Œã
+ れãžã‚Œã®ä½œè€…ã®æ„å‘ã«ã‚ˆã‚‹åˆ¶é™ãŒåŠ ãˆã‚‰ã‚Œã‚‹å ´åˆãŒã‚りã¾ã™ï¼Ž
- ãれらファイルã®ä¸€è¦§ã¨ãれãžã‚Œã®é…布æ¡ä»¶ãªã©ã«ä»˜ã„ã¦ã¯
- LEGALファイルをå‚ç…§ã—ã¦ãã ã•ã„.
+ ãれらファイルã®ä¸€è¦§ã¨ãれãžã‚Œã®é…布æ¡ä»¶ãªã©ã«ä»˜ã„ã¦ã¯
+ LEGALファイルをå‚ç…§ã—ã¦ãã ã•ã„.
- 5. 本プログラムã¸ã®å…¥åŠ›ã¨ãªã‚‹ã‚¹ã‚¯ãƒªãƒ—トãŠã‚ˆã³ï¼Œæœ¬ãƒ—ログラ
- ムã‹ã‚‰ã®å‡ºåŠ›ã®æ¨©åˆ©ã¯æœ¬ãƒ—ログラムã®ä½œè€…ã§ã¯ãªã,ãれãž
- れã®å…¥å‡ºåŠ›ã‚’ç”Ÿæˆã—ãŸäººã«å±žã—ã¾ã™ï¼Žã¾ãŸï¼Œæœ¬ãƒ—ログラムã«
- 組ã¿è¾¼ã¾ã‚Œã‚‹ãŸã‚ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¤ã„ã¦ã‚‚åŒæ§˜ã§ã™ï¼Ž
+5. 本プログラムã¸ã®å…¥åŠ›ã¨ãªã‚‹ã‚¹ã‚¯ãƒªãƒ—トãŠã‚ˆã³ï¼Œæœ¬ãƒ—ログラ
+ ムã‹ã‚‰ã®å‡ºåŠ›ã®æ¨©åˆ©ã¯æœ¬ãƒ—ログラムã®ä½œè€…ã§ã¯ãªã,ãれãž
+ れã®å…¥å‡ºåŠ›ã‚’ç”Ÿæˆã—ãŸäººã«å±žã—ã¾ã™ï¼Žã¾ãŸï¼Œæœ¬ãƒ—ログラムã«
+ 組ã¿è¾¼ã¾ã‚Œã‚‹ãŸã‚ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¤ã„ã¦ã‚‚åŒæ§˜ã§ã™ï¼Ž
- 6. 本プログラムã¯ç„¡ä¿è¨¼ã§ã™ï¼Žä½œè€…ã¯æœ¬ãƒ—ログラムをサãƒãƒ¼ãƒˆ
- ã™ã‚‹æ„å¿—ã¯ã‚りã¾ã™ãŒï¼Œãƒ—ログラム自身ã®ãƒã‚°ã‚ã‚‹ã„ã¯æœ¬ãƒ—
- ログラムã®å®Ÿè¡Œãªã©ã‹ã‚‰ç™ºç”Ÿã™ã‚‹ã„ã‹ãªã‚‹æå®³ã«å¯¾ã—ã¦ã‚‚責
- 任をæŒã¡ã¾ã›ã‚“.
+6. 本プログラムã¯ç„¡ä¿è¨¼ã§ã™ï¼Žä½œè€…ã¯æœ¬ãƒ—ログラムをサãƒãƒ¼ãƒˆ
+ ã™ã‚‹æ„å¿—ã¯ã‚りã¾ã™ãŒï¼Œãƒ—ログラム自身ã®ãƒã‚°ã‚ã‚‹ã„ã¯æœ¬ãƒ—
+ ログラムã®å®Ÿè¡Œãªã©ã‹ã‚‰ç™ºç”Ÿã™ã‚‹ã„ã‹ãªã‚‹æå®³ã«å¯¾ã—ã¦ã‚‚責
+ 任をæŒã¡ã¾ã›ã‚“.
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index 2cfdb2c2f5..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,14285 +0,0 @@
-Tue Apr 26 13:38:31 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * README.EXT{,.ja}: `nul` should be uppercase.
- change 'nul' => 'NUL'. [Fix GH-1172]
- derived from a patch by craft4coder <yooobuntu@163.com>
-
- * doc/extension.rdoc: Improvements to english grammers.
- [Bug #12246][ruby-core:74792][ci skip]
- derived from a patch by Marcus Stollsteimer <sto.mar@web.de>
-
-Tue Apr 26 13:25:25 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * encoding.c: Fix return value of `Encoding::ISO8859_1.name`
- [Bug #12313][ruby-core:75147][ci skip]
- * ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
-
-Tue Apr 26 13:22:45 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in: add missing -lm for AIX.
-
-Tue Apr 26 13:22:45 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in: don't use the system-provided round(3) on AIX.
- In AIX, round(0.49999999999999994) returns 1.0.
- Use round() in numeric.c instead.
-
-Tue Apr 26 13:18:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c: cygwin does not use w32_cmdvector, command line can be
- other than UTF-8. [ruby-dev:49519] [Bug #12184]
-
-Tue Apr 26 13:16:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval_jump.c (exec_end_procs_chain): restore previous error info
- for each end procs. [ruby-core:75038] [Bug #12302]
-
-Fri Apr 22 18:36:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (new_label_body): initialize bit fields, since
- compile_data_alloc does not clear the memory. [Bug #12082]
-
-Fri Apr 22 18:36:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_optimize): disable tail call optimization in
- rescued, rescue, and ensure blocks.
- [ruby-core:73871] [Bug #12082]
-
-Fri Apr 22 18:34:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
- comments. [ruby-core:74838] [Bug #12256]
-
-Fri Apr 22 18:30:50 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
- Renamed files, wrong method names or argument types; the example
- GetDBM macro is now updated to the current version of the actual
- code.
- patches are derived from Marcus Stollsteimer in [ruby-core:74690].
- [Bug #12228]
-
-Fri Apr 22 18:22:15 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
- [Bug #12202] [ruby-core:74802]
-
-Fri Apr 22 18:22:15 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
- patched by Anton Sivakov [Bug #12201] [Bug #12202]
-
-Fri Apr 22 18:16:51 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/securerandom.rb (gen_random): to avoid blocking on Windows.
- On Windows OpenSSL RAND_bytes (underlying implementation is
- RAND_poll in crypto/rand/rand_win.c) may be blocked at
- NetStatisticsGet.
- https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
- Instead of this, use Random.raw_seed directory (whose implementation
- CryptGenRandom is one of the source of
- entropy of RAND_poll on Windows).
- https://wiki.openssl.org/index.php/Random_Numbers
- Note: CryptGenRandom function is PRNG and doesn't check its entropy,
- so it won't block. [Bug #12139]
- https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
- https://tools.ietf.org/html/rfc4086#section-7.1.3
- https://eprint.iacr.org/2007/419.pdf
- http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
-
-Fri Apr 22 18:13:22 2016 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
- https://github.com/rubygems/rubygems/pull/1554
- [Bug #12193][ruby-core:74431]
-
-Fri Apr 22 16:37:14 2016 multisnow <infinity.blick.winkel@gmail.com>
-
- * ext/openssl/extconf.rb: check RAND_edg to support libressl.
-
- * ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
- is available. [Fix GH-829]
-
-Fri Apr 22 16:24:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_lgamma_r_m0): fix the condition for
- lgamma_r(-0.0). [Bug #12249]
-
-Fri Apr 22 16:24:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
- returns negative infinity. [Bug #12249]
-
- * math.c (ruby_lgamma_r): define by the configured result.
-
-Fri Apr 22 16:24:00 2016 cremno phobia <cremno@mail.ru>
-
- * math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
- since msvcrt does not provide it.
-
- * missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
- [ruby-core:74823] [Bug #12249]
-
-Fri Apr 22 16:24:00 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
- cf. [Bug #12249]
-
-Fri Apr 22 16:24:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
- [ruby-core:74817] [Bug #12249]
-
-Fri Apr 22 16:00:50 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * defs/keywords (alias, undef): symbol literals are allowed.
-
- * parse.y (parse_percent): should parse symbol literals for alias
- and undef. [ruby-dev:47681] [Bug #8851]
-
-Fri Apr 22 15:47:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * struct.c (struct_make_members_list): extract making member name
- list from char* va_list, with creating symbols without
- intermediate IDs.
-
-Fri Apr 22 15:19:01 2016 Joe Swatosh <joe.swatosh@gmail.com>
-
- * ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
- API names. [ruby-core:74863] [Bug #12264]
-
-Fri Apr 22 15:13:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_core.h (rb_vm_struct): make at_exit a single linked list but
- not RArray, not to mark the registered functions by the write
- barrier. based on the patches by Evan Phoenix.
- [ruby-core:73908] [Bug #12095]
-
-Fri Apr 22 15:08:27 2016 Benoit Daloze <eregontp@gmail.com>
-
- * thread.c (update_coverage): Do not track coverage in loaded files
- after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
-
- * ext/coverage/coverage.c (coverage_clear_result_i): document.
-
-Fri Apr 22 14:56:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
- of DateTime. [ruby-core:74729] [Bug #12233]
-
-Fri Apr 22 14:48:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parse_ident): allow keyword arguments just after a
- method where the same name local variable is defined.
- [ruby-core:73816] [Bug#12073]
-
-Fri Apr 22 14:34:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (setup_exception): set the cause only if it is explicitly
- given or not set yet. [Bug #12068]
-
-Fri Apr 22 14:13:28 2016 sorah (Shota Fukumori) <her@sorah.jp>
-
- * lib/forwardable.rb: Convert given accessors to String.
-
- r53381 changed to accept only Symbol or String for accessors, but
- there are several rubygems that pass classes (e.g. Array,
- Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
- returns its class name. After r53381 given accessors are checked
- with define_method, but it accepts only Symbol or String, otherwise
- raises TypeError.
-
- def_delegator Foo, :some_method
-
- This change is to revert unexpected incompatibility. But this behavior
- may change in the future.
-
-Fri Apr 22 14:13:28 2016 Elliot Winkler <elliot.winkler@gmail.com>
-
- * lib/forwardable.rb (def_instance_delegator) fix delegating to
- 'args' and 'block', clashing with local variables in generated
- methods. [ruby-core:72579] [Bug #11916]
-
- * lib/forwardable.rb (def_single_delegator): ditto.
-
-Fri Apr 22 13:41:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (compile_massign_lhs): when index ends with splat,
- append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
- splats the last argument only. [ruby-core:72777] [Bug #11970]
-
-Thu Mar 31 05:06:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): fix buffer overflow, length must be
- greater than precision. reported by William Bowling <will AT
- wbowling.info>.
-
-Thu Mar 31 04:49:05 2016 Kimura Wataru <kimuraw@i.nifty.jp>
-
- * test/ruby/test_io.rb: handled rlimit value same as r52277
- [Bug #11852][ruby-dev:49446]
-
-Wed Mar 30 06:37:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/extlibs.rb (do_patch): let "patch" command change the
- working directory and open the patch file there, instead of
- spawn options, so that proper error message will be shown by the
- command not just "chdir" or "open".
-
-Wed Mar 30 06:11:36 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * thread_pthread.c (reserve_stack): fix reserving position where
- the stack growing bottom to top. [Bug #12118]
-
-Wed Mar 30 06:04:18 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * .travis.yml: removed commented-out code.
-
-Wed Mar 30 06:04:18 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * .travis.yml: removed osx code. follow up with r53517
-
-Wed Mar 30 06:04:18 2016 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * .travis.yml: update libssl before running tests.
- Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for figuring out the
- travis settings!
-
-Wed Mar 30 06:04:18 2016 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: removed Ruby 1.9.3 build on Travis CI
-
-Wed Mar 30 06:04:18 2016 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: Remove redundant configuration option.
- [fix GH-809] Patch by @gxworld
-
-Wed Mar 30 05:15:04 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
- function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
- even if it is disabled by OpenSSL configuration.
- [ruby-core:74384] [Bug #12182]
-
- * ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
-
- * test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
-
-Wed Mar 30 05:13:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
- missing mandatory arguments. [ruby-core:74540] [Bug #12215]
-
-Tue Mar 29 02:22:35 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/uri/mailto.rb: raising URI::InvalidComponentError instead
- of failing with undefined method `split' for nil:NilClass for
- mailto: URIs without opaque part. [Bug #10738]
- * test/uri/testuri.rb: Test for above
-
-Tue Mar 29 02:08:40 2016 Koichi Sasada <ko1@atdot.net>
-
- * signal.c: should also clear ruby_disable_gc.
- [Bug #11692]
-
-Tue Mar 29 02:04:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
- cannot enclose non-identifier characters.
- a patch by Sebastian S in [ruby-core:74278]. [Bug#12170]
-
-Tue Mar 29 02:02:53 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/-ext-/float/test_nextafter.rb: In AIX,
- nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
- but they should return -0.0 and +0.0, respectively. This is
- a known bug in nextafter(3) on AIX, so skip related tests.
-
-Tue Mar 29 01:56:24 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * lib/rubygems/installer.rb: merge partially r49511.
- cherry picking https://github.com/rubygems/rubygems/commit/f9232680
- [Bug #12066]
-
-Tue Mar 29 01:41:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (enc_succ_alnum_char): try to skip an invalid character
- gap between GREEK CAPITAL RHO and SIGMA.
- [ruby-core:74478] [Bug #12204]
-
-Tue Mar 29 01:27:52 2016 Victor Nawothnig <Victor.Nawothnig@gmail.com>
-
- * parse.y (parse_numvar): NTH_REF must be less than a half of
- INT_MAX, as it is left-shifted to be ORed with back-ref flag.
- [ruby-core:74444] [Bug#12192] [Fix GH-1296]
-
-Tue Mar 29 01:24:55 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/JIS: update Unicode's notice. [Bug #11844]
-
-Tue Mar 29 01:22:39 2016 Eric Hodel <drbrain@segment7.net>
-
- * marshal.c (r_object0): raise ArgumentError when linking to undefined
- object.
-
-Tue Mar 29 01:22:39 2016 Eric Hodel <drbrain@segment7.net>
-
- * marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
-
-Tue Mar 29 01:20:37 2016 Eric Wong <e@80x24.org>
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
- [ruby-core:73803] [Bug #12069]
-
-Tue Mar 29 01:07:36 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * insns.def (opt_mod): show its method name on ZeroDivisionError.
- [Bug #12158]
-
-Tue Mar 29 01:05:28 2016 Anthony Dmitriyev <antstorm@gmail.com>
-
- * net/ftp.rb: add NullSocket#closed? to fix closing not opened
- connection. [Fix GH-1232]
-
-Tue Mar 29 01:02:49 2016 Koichi ITO <koic.ito@gmail.com>
-
- * variable.c: Added documentation about order of `Module#constants`
- [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
-
-Tue Mar 29 00:56:10 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/ruby/test_process.rb (test_execopts_gid): Skip a test
- that is known to fail on AIX. AIX allows setgid to
- a supplementary group, but Ruby does not allow the "-e"
- option when setgid'ed, so the test does not work as intended.
-
-Tue Mar 29 00:53:26 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
- IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
- on AIX, so skip related tests.
-
-Tue Mar 29 00:44:55 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
- The fifth argument to getsockopt(2) should be modified to
- indicate the actual size of the value on return,
- but not in AIX. This is a know bug. Skip related tests.
- * test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
- ditto.
- * test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
- * test/socket/test_basicsocket.rb (test_getsockopt): ditto.
- * test/socket/test_sockopt.rb (test_bool): ditto.
-
-Tue Mar 29 00:43:40 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
- Skip two tests on AIX because zconf.h in zlib does not correctly
- recognize _LARGE_FILES in AIX. The problem was already reported
- to zlib, and skip these tests until it is fixed.
-
-Tue Mar 29 00:42:10 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_lock): skip
- this test on AIX. The issue is the same as on Solaris.
- [ruby-dev:47631]
-
-Tue Mar 29 00:33:06 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * thread_pthread.c (getstack): __pi_stacksize returned by
- pthread_getthrds_np() is wrong on AIX. Use
- __pi_stackend - __pi_stackaddr instead.
-
-Tue Mar 29 00:06:58 2016 Alex Boyd <alex@opengroove.org>
-
- * lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
- [fix GH-1205][ruby-core:72773][Bug #11969]
-
-Tue Mar 29 00:00:27 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
- [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
-
-
-Mon Mar 28 23:58:27 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
- [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
-
-
-Mon Mar 28 23:57:33 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
- [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
-
-
-Mon Mar 28 23:56:17 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
- [Bug #11886] The patch provided by Akira Matsuda.
-
- * ext/tk/sample/*.rb: ditto.
-
-Mon Mar 28 23:20:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
- which is always a shared object and is not used by others.
- [ruby-dev:48629] [Bug #10384]
-
-Mon Mar 28 23:15:54 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
- and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
- [ruby-core:72736] [Bug #11962]
-
-Thu Mar 24 20:39:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c (inspect_tcpi_msec): more accurate condition
- for TCPI msec member inspection function.
- [ruby-core:74388] [Bug #12185]
-
-Thu Mar 10 00:22:25 2016 Naotoshi Seo <sonots@gmail.com>
-
- * lib/logger.rb: Remove block from Logger.add as it's not needed
- patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
-
-Thu Mar 10 00:17:57 2016 Zachary Scott <zzak@ruby-lang.org>
-
- * re.c: Remove deprecated kcode argument from Regexp.new and compile
- patch provided by Dylan Pulliam [Bug #11495]
-
-Thu Mar 10 00:17:57 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * re.c: Update documentation for Regexp class.
- [fix GH-937][ci skip] Patch by @davydovanton
-
-Thu Mar 10 00:04:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (sock_gethostname): support unlimited size
- hostname.
-
-Wed Mar 9 22:59:43 2016 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/xmlrpc/client.rb: Support SSL options in async methods of
- XMLRPC::Client.
- [Bug #11489]
- Reported by Aleksandar Kostadinov. Thanks!!!
-
-Wed Mar 9 22:46:56 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * marshal.c (r_object0): honor Marshal.load post proc
- value for TYPE_LINK. by Hiroshi Nakamura <nahi@ruby-lang.org>
- https://github.com/ruby/ruby/pull/1204 fix GH-1204
-
-Wed Mar 9 22:26:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c (sockopt_bool): relax boolean size to be one
- too not only sizeof(int). Winsock getsockopt() returns a single
- byte as a boolean socket option. [ruby-core:72730] [Bug #11958]
-
-Wed Mar 9 05:14:20 2016 Eric Wong <e@80x24.org>
-
- * io.c (io_getpartial): remove unused kwarg from template
- * test/ruby/test_io.rb (test_readpartial_bad_args): new
- [Bug #11885]
-
-Wed Mar 9 05:14:20 2016 Eric Wong <e@80x24.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_read_internal):
- do not process kwargs in blocking mode
- * test/openssl/test_ssl.rb: test sysread
-
-Wed Mar 9 04:21:02 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * process.c (rb_execarg_parent_start1): need to convert the encoding to
- ospath's one.
-
-Wed Mar 9 04:21:02 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
- reported by naruse via twitter.
-
- * process.c (rb_execarg_addopt): need to convert the encoding to
- ospath's one.
-
-Wed Mar 9 04:15:20 2016 Eric Wong <e@80x24.org>
-
- * ext/stringio/stringio.c (strio_binmode): implement to set encoding
- * test/stringio/test_stringio.rb (test_binmode): new test
- [ruby-core:72699] [Bug #11945]
-
-Wed Mar 9 03:53:37 2016 Tadashi Saito <tad.a.digger@gmail.com>
-
- * compile.c, cont.c, doc, man: fix common misspelling.
- [ruby-core:72466] [Bug #11870]
-
-Wed Mar 9 03:51:48 2016 Eric Wong <e@80x24.org>
-
- * ext/socket/init.c (rsock_init_sock): reject reserved FDs
- [ruby-core:72445] [Bug #11862]
-
-Wed Mar 9 03:41:27 2016 Eric Wong <e@80x24.org>
-
- * ext/socket/init.c (rsock_init_sock): check FD after validating
- * test/socket/test_basicsocket.rb (test_for_fd): new
- [ruby-core:72418] [Bug #11854]
-
-Wed Mar 9 03:34:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (reg_names_iter): should consider encoding of regexp.
- [ruby-core:72185] [Bug #11825]
-
-Wed Feb 24 08:18:18 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * enc/windows_1250.c: Should not use C++ style comments (C99 feature).
- [Bug #11843]
-
-Tue Feb 23 03:43:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_2.c, enc/windows_1250.c: separate Windows-1250
- from ISO-8859-2 to fix 0x80..0x9e range (from Kimihito Matsui)
-
-Tue Feb 23 03:43:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/windows_1252.c: separate from ISO-8859-1 to fix 0x80..0x9e
- range. [ruby-core:64049] [Bug #10097]
-
-Tue Feb 23 03:43:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_13.c: Added three missing lower/upper-case
- character pairs (from Kimihito Matsui)
-
-Tue Feb 23 03:43:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_4.c: Added missing lower/upper-case character
- pair (U+014A and U+014B, LATIN CAPITAL/SMALL LETTER ENG)
- (from Kimihito Matsui)
-
-Mon Feb 15 02:05:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_scrub): the result should be infected by the
- original string.
-
-Mon Feb 15 02:05:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (rb_econv_substr_append, econv_primitive_convert):
- the result should be infected by the original string.
-
-Mon Feb 15 02:05:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h: add raw FL macros, which assume always the
- argument object is not a special constant.
-
- * internal.h (STR_EMBED_P, STR_SHARED_P): valid only for T_STRING.
-
- * string.c: deal with taint flags directly across String instances.
-
-Mon Feb 15 01:20:08 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (regexp): set_yylval_num sets u1, should use nd_tag
- instead of nd_state. [ruby-core:72638] [Bug #11932]
-
-Tue Jan 26 21:52:16 2016 Joseph Tibbertsma <josephtibbertsma@gmail.com>
-
- * gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
- [Fix GH-1221]
-
-Mon Jan 18 00:34:41 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_insnhelper.c (vm_call_method): should not set fastpath
- with keyword arguments for VM_METHOD_TYPE_ATTRSET type methods.
-
- Normally, we can not use keyword arguments for this kind of methods,
- (obj.foo = 1), but we can set alias names for them.
- [Bug #11657]
-
- * test/ruby/test_keyword.rb: add a test for this fix.
-
-Wed Dec 23 06:05:50 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yylex): allow here documents in labeled
- argument. [ruby-core:72396] [Bug #11849]
-
-Wed Dec 23 05:52:06 2015 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * test/ruby/test_syntax.rb: fix typo in test
-
-Wed Dec 23 05:52:06 2015 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * parse.y (parse_percent): Allow %-literals in labeled arg as
- r51624 did for parentheses.
- Fixes [ruby-core:72084] [Bug #11812].
-
-Mon Dec 21 05:05:54 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * cont.c: fix a double word typo.
- [Bug #11313][ruby-core:69749]
-
-Mon Dec 21 05:04:18 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/tk/lib/multi-tk.rb: fix typos.
- [Bug #11764][ruby-core:71800]
-
-Wed Dec 16 21:10:19 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/fiddle/handle.c: check tainted string arguments.
- Patch provided by tenderlove and nobu.
-
- * test/fiddle/test_handle.rb (class TestHandle): add test for above.
-
-Wed Dec 16 02:38:19 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (parse_mode_enc): fix buffer overflow.
-
-Sat Dec 12 17:19:27 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * doc/NEWS-0.2.2: add description about incompatible change in Hash
- duplicated key overriding policy. [Bug #10315] [Bug #11501]
-
-Fri Dec 11 22:41:15 2015 Eric Wong <e@80x24.org>
-
- * insns.def (opt_case_dispatch): avoid converting Infinity
- * test/ruby/test_optimization.rb (test_opt_case_dispatch_inf): new
- [ruby-dev:49423] [Bug #11804]'
-
-Thu Dec 10 00:23:07 2015 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in: pthread_getattr_np is broken on AIX.
- More specifically, the stack address and size returned are
- not correct.
-
-Thu Dec 10 00:19:18 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk (update-gems): use BASERUBY instead of RUNRUBY.
-
-Wed Dec 9 01:49:13 2015 Eric Wong <e@80x24.org>
-
- * insns.def (opt_case_dispatch): check Float#=== redefinition
- * test/ruby/test_optimization.rb (test_opt_case_dispatch): new
- [ruby-core:71920] [Bug #11784]
-
-Wed Dec 9 01:46:23 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby_atomic.h (ATOMIC_SIZE_CAS): fix the argument order of
- InterlockedCompareExchange64. new value and then old value is
- the last.
-
-Wed Dec 9 01:28:54 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * encoding.c (enc_m_loader): defer finding encoding object not to
- be infected by marshal source. [ruby-core:71793] [Bug #11760]
-
- * marshal.c (r_object0): enable compatible loader on USERDEF
- class. the loader function is called with the class itself,
- instead of an allocated object, and the loaded data.
-
- * marshal.c (compat_allocator_table): initialize
- compat_allocator_tbl on demand.
-
- * object.c (rb_undefined_alloc): extract from rb_obj_alloc.
-
-Wed Dec 9 01:24:57 2015 Rei Odaira <Rei.Odaira@gmail.com>
-
- * ext/-test-/file/fs.c: need to include sys/statvfs.h
- to use statvfs().
-
- * ext/-test-/file/extconf.rb: check the existence of
- sys/statvfs.h
-
-Fri Dec 4 04:46:33 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): fix wrong shifting position in
- Rational conversion when not at the beginning of the result.
- [ruby-core:71806] [Bug #11766]
-
-Fri Dec 4 02:42:37 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * range.c (range_to_s): should be infected by the receiver.
- str2 infects by appending. [ruby-core:71811] [Bug #11767]
-
-Wed Dec 2 03:17:01 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/readline/extconf.rb: call dir_config("libedit")
- if --enable-libedit is spcified. [Bug #11751]
- patched by John Hein
-
-Wed Dec 2 02:59:42 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_here_document): store dispatched result of
- on_tstring_content at the last fragment of a here document.
-
-Tue Dec 1 02:52:17 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * test/ruby/test_gc.rb: merge partially r52391 to get rid of CI error.
-
-Tue Dec 1 02:27:41 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_each_codepoint): raise an exception at incomplete
- character before EOF when conversion takes place. [Bug #11444]
-
-Sun Nov 29 18:02:44 2015 Shugo Maeda <shugo@ruby-lang.org>
-
- * io.c (argf_getpartial): should not resize str if the second
- argument is not given.
- [ruby-core:71668] [Bug #11738]
-
-Sun Nov 29 17:48:39 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (local_var_list_add): skip internal local variable
- name by its type but not if it has a name. internal local
- variable names are just unique per frame, not globally.
- [ruby-core:71437] [Bug #11674]
-
-Sun Nov 29 17:13:16 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_each_codepoint): read more data when read partially.
- [ruby-core:70379] [Bug #11444]
-
-Sun Nov 29 16:46:25 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/net/http.rb: set hostname before call ossl_ssl_set_session.
- [Bug #11401][ruby-core:70152][fix GH-964] Patch by @mkarnebeek
-
-Sun Nov 29 16:33:30 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (rb_econv_open0): rb_econv_t::source_encoding_name
- and rb_econv_t::destination_encoding_name should refer static
- strings always or NULL. [ruby-core:70247] [Bug #11416]
-
-Sun Nov 29 16:11:32 2015 Eric Wong <e@80x24.org>
-
- * iseq.c (iseq_data_to_ary): dump kw_arg as symbol
- * test/-ext-/iseq_load/test_iseq_load.rb: test kw_arg roundtrip
- [ruby-core:69891] [Bug #11338]
-
-Sun Nov 29 02:55:56 2015 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * gc.c (__has_feature): move into internal.h.
-
- * internal.h (__has_feature): ditto.
-
- * internal.h (__has_extension): new macro.
-
- * internal.h (STATIC_ASSERT): use _Static_assert with
- clang. [ruby-core:69931] [Bug #11343]
-
-Sat Nov 28 06:28:55 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (literal_concat_gen, evstr2dstr_gen): keep literal
- encoding beginning with an interpolation same as the source file
- encoding. [ruby-core:70703] [Bug #11519]
-
-Sat Nov 28 06:12:32 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/openssl/ossl_ssl.c (ssl_npn_select_cb): explicitly raise error
- in ext/openssl instead of OpenSSL itself because LibreSSL
- silently truncate the selected protocol name by casting the length
- from int to unsigned char. [Bug #11369]
- Patch by Jeremy Evans <merch-redmine@jeremyevans.net>
-
-Sat Nov 28 05:50:58 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (send_internal): set method_missing_reason before
- invoking overriding method_missing method so that the default
- method_missing can achieve it properly.
- [ruby-core:68515] [Bug #10969]
-
-Sat Nov 28 05:47:27 2015 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/ruby/test_symbol.rb (test_symbol_fstr_leak): add a warm-up
- code and check RSS to avoid false positive on AIX and false
- negative on Mac OS X. [Bug #10686]
-
-Sat Nov 28 05:47:27 2015 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/ruby/test_symbol.rb: avoid a false positive in AIX.
-
-Sat Nov 28 05:35:28 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * test/objspace/test_objspace.rb
- (test_trace_object_allocations_start_stop_clear): clear object
- allocation table first to get rid of erroneous detection for obj3.
- [ruby-dev:49095] [Bug #11271]
-
-Sat Nov 28 05:21:06 2015 Koichi Sasada <ko1@atdot.net>
-
- * insns.def (defined): skip respond_to_missing? when
- a method is available.
- [Bug #11211]
-
- * test/ruby/test_defined.rb: add a test for this fix.
-
-Wed Nov 25 01:05:29 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/digest/sha1/sha1ossl.c: fix defs.h path to catch up changes in
- r52739.[Bug #3231]
-
- * ext/digest/rmd160/rmd160ossl.c: ditto.
-
-Wed Nov 25 00:54:15 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (kwd_append): fix segv after invalid keyword argument,
- preceding keyword list is NULL when syntax error is there.
- [ruby-core:71356] [Bug #11663]
-
-Wed Nov 25 00:47:07 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/ipaddr.rb, test/test_ipaddr.rb: Reject invalid address contained
- EOL string. Patch by @kachick [fix GH-942][Bug #11513]
-
-Wed Nov 25 00:32:44 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_build_from_ary_body): register cdhash to the
- iseq constant body instead of compile time mark array, not to
- get GCed. [ruby-core:70708] [Feature #8543]
-
-Wed Nov 25 00:14:28 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/digest/*/*.[ch]: include ruby.h before digest.h to avoid
- includeing ext/digest/extconf.h. [Bug #3231]
- https://msdn.microsoft.com/library/36k2cdd4.aspx
-
- * ext/digest/*/extconf.rb: remove ext/digest from include search path
- to avoid confusion of cl.exe.
-
- * ext/digest/*/*.[ch]: explicitly specify def.h's path.
-
-Wed Nov 25 00:03:42 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * Added missing reference of GitHub
-
-Wed Nov 25 00:03:42 2015 Trevor Rowe <trevorrowe@gmail.com>
-
- * lib/net/http.rb: Fixed regression for Net::HTTP::PUT with "Expect-100"
- header. [fix GH-949]
- * test/net/http/test_http.rb: added test.
-
-Mon Nov 23 00:19:51 2015 Koichi Sasada <ko1@atdot.net>
-
- * vm_insnhelper.c (vm_invoke_block): we should not expect ci->argc is
- stable after invoking a block. [Bug #11451]
-
- * test/ruby/test_yield.rb: add a test. This test script is given by
- Alex Dowad.
-
-Thu Nov 19 01:06:07 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (rb_load_internal0): stop separating exits at loading
- from exits from execution. TAG_FATAL is the only case that
- `errinfo` is a Fixnum, and should continue to exit by JUMP_TAG
- but not raising as an ordinary exception.
- [ruby-core:70169] [Bug #11404]
-
-Thu Nov 19 01:06:07 2015 Alex Dowad <alexinbeijing@gmail.com>
-
- * load.c (rb_load_internal0): extra check before returning
- TAG_RAISE when a non-local transfer of control happens while
- loading and parsing a Ruby source file.
- [ruby-core:70169] [Bug #11404]
-
-Thu Nov 19 01:06:07 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (rb_load_internal0): do not raise any exceptions but
- return the result tag state.
-
- * load.c (rb_load_protect): reduce nested EXEC_TAGs.
-
-Thu Nov 19 00:41:09 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/euc_jp.c (mbc_case_fold): check given string is valid or not,
- and if invalid, return 1. [Bug #11486]
-
-Thu Nov 19 00:15:23 2015 Zachary Scott <zzak@ruby-lang.org>
-
- * ext/openssl/ossl_pkey.c: Merge ruby/openssl@b9ea8ef [Bug #10735]
-
-Thu Nov 19 00:01:14 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (argf_next_argv): check ARGV element type, and try
- conversion if necessary. [ruby-core:71140] [Bug #11610]
-
-Wed Nov 18 23:29:32 2015 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_method_tab): Only add SSLv3 support
- if the SSL library supports it. Thanks Kurt Roeckx <kurt@roeckx.be>
- [Bug #11376]
-
- * ext/openssl/extconf.rb: check for SSLv3 support in the SSL
- implementation.
-
- * test/openssl/test_ssl.rb (class OpenSSL): Skip tests that need SSLv3
- if there is no support.
-
-Mon Nov 16 03:39:59 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * tool/runruby.rb: rubyspec now requires other FDs not to be closed
- since 7b6ce1fee.
-
-Sun Nov 8 23:30:56 2015 Koichi Sasada <ko1@atdot.net>
-
- * vm_trace.c (rb_threadptr_exec_event_hooks_orig):
- maintain trace_running counter on internal events.
-
- This patch is made by Takashi Kokubun <takashikkbn@gmail.com>.
- [Bug #11603] https://github.com/ruby/ruby/pull/1059
-
-Sun Nov 1 03:52:41 2015 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * test/openssl/test_ssl_session.rb: Fix tests so that they take in to
- account OpenSSL installations that have SSLv3 disabled by default.
- Thanks Jeremy Evans <code@jeremyevans.net> for the patches.
- [Bug #11366] [Bug #11367]
-
-Sun Nov 1 03:40:43 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
- fix test failure with OpenSSL disabled SSLv3 protocol.
- [ruby-core:63772] [Bug #10046]
-
-Tue Oct 27 23:58:32 2015 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (hook_before_rewind): prevent kicking :return event while
- finishing vm_exec func because invoke_block_from_c() kick a :return
- event for bmethods.
- [Bug #11492]
-
- * test/ruby/test_settracefunc.rb: add a test.
-
-Tue Oct 27 23:38:26 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check for libunwind.h, which is not available in
- very old OS X SDK. [ruby-core:71080] [Bug #11591]
-
-Tue Oct 27 23:32:51 2015 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/drb/test_drb.rb: Run Rinda/DRb tests on localhost. [Fix GH-1027]
- patch by voxik.
-
- * test/rinda/test_rinda.rb: ditto
-
-Tue Oct 6 01:29:02 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (IS_BEG): include labeled argument state, which was
- EXPR_LABELARG. [ruby-dev:49221] [Bug #11456]
-
-Tue Oct 6 01:29:02 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y: fix syntax error at do-block after a conditional
- operator. separate label-allowed and after-a-label states from
- others as bit flags. [ruby-dev:48790] [Bug #10653]
-
-Mon Oct 5 03:29:23 2015 Tanaka Akira <akr@fsij.org>
-
- * enum.c (nmin_filter): Fix limit value.
- patch by Helder Pereira.
- [Bug #11471] [ruby-core:70477]
-
-Wed Sep 30 03:44:36 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rss/rss.rb (Time#w3cdtf): fix zero-trimmed width of fraction
- digits. [ruby-core:70667] [Bug #11509]
-
-Wed Sep 30 03:34:25 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_memsearch_wchar, rb_memsearch_qchar): test matching
- till the end of string. [ruby-core:70592] [Bug #11488]
-
- * test/ruby/test_m17n.rb (test_include?, test_index): add tests by
- Tom Stuart.
-
-Wed Sep 30 03:24:29 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * thread_pthread.c (reserve_stack): ensure the memory is really
- allocated. [Bug #11457]
-
-Tue Aug 25 01:01:01 2015 Koichi Sasada <ko1@atdot.net>
-
- * insns.def (defineclass): introduce an ad-hoc patch to avoid
- an issue reported on [Bug #10871].
-
- This patch does not fix completely. For example, method definition
- in a block (like 1.times{def ...; end}) still causes same issue.
- To solve all, we need a huge patch and it seems difficult for
- stable branch.
-
- Use Ruby 2.3 and later to solve this issue completely.
- (See [Bug #10943])
-
-Tue Aug 18 22:52:50 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/downloader.rb: support old versions of ruby.
-
- * tool/downloader.rb: now can download gems by http if openssl is not
- available (this may be danger!)
-
-Tue Aug 18 20:10:13 2015 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (Init_Numeric): Fix document for Float::MIN and
- Float::EPSILON.
-
-Mon Aug 17 23:07:47 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb: bump version to 2.4.5.1. this version fixed
- CVE-2015-3900.
- * lib/rubygems/remote_fetcher.rb: ditto.
- * test/rubygems/test_gem_remote_fetcher.rb: added testcase for CVE-2015-3900
-
-Mon Aug 17 23:00:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/lib/win32/registry.rb (API#SetValue): data size should
- be in bytes, not in chars. [ruby-core:70365] [Bug #11439]
-
-Mon Aug 17 23:00:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/lib/win32/registry.rb (API#SetValue): add terminator
- size, not 1 byte. [ruby-core:70365] [Bug #11439]
-
-Sun Aug 16 03:14:04 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_memsearch): should match only char boundaries in wide
- character encodings. [ruby-core:70220] [Bug #11413]
-
-Sun Aug 16 03:00:44 2015 Eric Wong <e@80x24.org>
-
- * symbol.h (struct RSymbol): add hashval field
- * symbol.c (dsymbol_alloc): setup hashval field once
- * hash.c (rb_any_hash): return RSymbol->hashval directly
- * common.mk: hash.o depends on symbol.h
- Thanks to Bruno Escherl <bruno@escherl.net> for the bug report
- [ruby-core:70129] [Bug #11396]
-
-Fri Aug 14 16:30:43 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (rb_econv_set_replacement): target encoding name can
- be empty now. [ruby-core:69841] [Bug #11324]
-
-Fri Aug 14 15:24:12 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_any_hash): fix Float hash. rb_dbl_hash() returns a
- Fixnum, but not a long. [Bug #9381]
-
-Fri Aug 14 15:09:34 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/json/parser/parser.rl: raise with messages in UTF-8
- encoding. [ruby-core:67386] [Bug #10705]
-
-Fri Aug 14 00:44:34 2015 Eric Wong <e@80x24.org>
-
- * io.c (rb_io_oflags_modestr): handle O_TRUNC correctly
- * test/ruby/test_io.rb (test_reopen_stdio): new test
- Patch-by: cremno phobia <cremno@mail.ru>
- [ruby-core:69779] [Bug #11319]
-
-Thu Aug 13 01:25:26 2015 Benoit Daloze <eregontp@gmail.com>
-
- * lib/net/ftp.rb (makeport): close the TCPServer
- when sending the port fails.
-
- * test/net/ftp/test_ftp.rb: test for above.
-
-Thu Aug 13 01:03:13 2015 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * lib/net/http/response.rb (Net::HTTPResponse::Inflater#finish):
- fix a bug that empty gzipped response body causes Zlib::BufError.
- [ruby-core:68846] [Bug #11058]
-
- * test/net/http/test_httpresponse.rb: tests for the above.
-
-Thu Aug 13 01:03:13 2015 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * lib/net/http/response.rb (Net::HTTPResponse#inflater):
- fix TypeError. An exception object might be nil.
- [ruby-core:68846] [Bug #11058]
-
-Thu Aug 13 00:03:24 2015 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * .travis.yml: update libssl before running tests.
- Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for figuring out the
- travis settings!
-
-Thu Aug 13 00:03:24 2015 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * ext/openssl/lib/openssl/ssl.rb (module OpenSSL): raise a more
- helpful exception when verifying the peer connection and an
- anonymous cipher has been selected. [ruby-core:68330] [Bug #10910]
- Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for the patch.
-
- * test/openssl/test_ssl.rb (class OpenSSL): test for change
-
-Wed Aug 12 23:57:01 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
- ruby itself (including numeric.c) is built with strict compile
- options including -std=iso9899:1999, but ext/date is not.
- By the way -std=iso9899:1999 is not only a warning option but also
- changes behavior like MACRO definitions for example INFINITY.
- gcc on Solaris affect this.
-
-Wed Aug 12 23:53:39 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (waitpid): return immediately if interrupted.
- reported by <takkanm AT gmail.com> [ruby-dev:49176] [Bug #11340]
-
-Wed Aug 12 01:05:58 2015 Jeremy Evans <merch-redmine@jeremyevans.net>
-
- * test/openssl/test_ssl.rb: Fix LocalJumpErrors being raised
- in OpenSSL tests. [ruby-core:70020][Bug #11368]
-
-Wed Aug 12 00:54:29 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_repeated_permutation): fix buffer size, ALLOCV_N
- already multiplies element size.
-
-Tue Aug 11 01:51:53 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * lib/timeout.rb (ExitException): leave Timeout::ExitException as an
- alias of Timeout::Error for backward compatibility in stable branch.
- [ruby-dev:49179] [Bug #11344]
-
-Tue Aug 11 01:51:53 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/timeout.rb (ExitException): removed internal exception class
- and use Timeout::Error instead, as using throw/catch to isolate
- each timeouts now. [ruby-dev:49179] [Bug #11344]
-
-Tue Aug 11 01:37:28 2015 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/net/http/test_httpresponse.rb
- (HTTPResponseTest#test_read_body_content_encoding_deflate_uppercase):
- fix a failure without zlib.
-
-Tue Aug 11 01:37:28 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/response.rb (inflater): CONTENT_ENCODING can be upper
- case. [ruby-core:69670] [Bug #11285] patched by Andy Chu
-
-Tue Aug 11 01:21:49 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (m_core_hash_merge_ptr): copy the arguments to the machine
- stack before rewinding the control frame pointer and leaving the
- arguments outside valid region of the value stack.
- [ruby-core:69969] [Bug #11352]
-
- * vm.c (REWIND_CFP): keep the arguments region inside the valid
- value stack. [ruby-core:69969] [Bug #11352]
-
-Tue Aug 11 01:11:02 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_reverse): reversed string is not a substring,
- and should not set coderange of the original string.
- [ruby-dev:49189] [Bug #11387]
-
-Tue Aug 11 00:42:53 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (lambda_body): pop cmdarg stack for lookahead
- token. [ruby-core:70067] [Bug #11380]
-
-Tue Aug 11 00:21:56 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
- but it is a dummy.
-
- * ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
-
- * ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
-
- * ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
- related macros.
-
-Tue Aug 4 04:11:34 2015 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (strptime): Support %s.%N.
- [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
-
-Tue Aug 4 03:43:15 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (load_transcoder_entry): fix transcoder loading race
- condition, by waiting in require. [ruby-dev:49106] [Bug #11277]
-
-Tue Aug 4 03:13:59 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (ary_ensure_room_for_push): check if array size will
- exceed maximum size to get rid of buffer overflow.
- [ruby-dev:49043] [Bug #11235]
-
- * array.c (ary_ensure_room_for_unshift, rb_ary_splice): ditto.
-
-Sat Jul 4 23:08:32 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_load_ok): try opening file without gvl not to
- lock entire process. [Bug #11060]
-
-Sat Jul 4 05:00:48 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (pkg_config): split --libs if --libs-only-l option
- is not available. patch in [ruby-core:69428] by Hans Mackowiak.
- [ruby-core:69421] [Bug #11201]
-
-Sat Jul 4 04:46:51 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_compile_each): out of range NTH_REF is always
- nil.
-
- * parse.y (parse_numvar): check overflow of NTH_REF and range.
- [ruby-core:69393] [Bug #11192]
-
- * util.c (ruby_scan_digits): make public and add length parameter.
-
-Sat Jul 4 04:35:51 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_method_call_status): resolve refined method entry
- to check if undefined. [ruby-core:69064] [Bug #11117]
-
-Sat Jul 4 04:35:51 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_method_call_status): undefined refined method is
- not callable unless using. [ruby-core:69064] [Bug #11117]
-
-Wed Jul 1 04:16:56 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.gemspec: Fix require paths for released gem.
- [fix GH-929] Patch by @voxik
- * ext/io/console/io-console.gemspec: ditto.
-
-Wed Jul 1 04:15:38 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/zlib/zlib.c: Fix indentation for rdoc.
- [Bug #11221][ruby-core:69465]
-
-Sat Jun 27 22:51:59 2015 Shota Fukumori <her@sorah.jp>
-
- * ext/objspace/objspace_dump.c(dump_object): Return empty JSON object when
- passed object is a special const, instead of SEGV.
- Based patch by Kohei Suzuki (eagletmt). [ruby-core:69692] [Bug #11291]
-
- * test/objspace/test_objspace.rb(test_dump_special_consts): Test for above fix.
-
-
-Wed Jun 17 02:53:59 2015 Koichi Sasada <ko1@atdot.net>
-
- * test/objspace/test_objspace.rb (test_dump_flags): relax pattern
- because long_lived flag and marked flag can be false at major GC.
- [Bug #10852]
-
-Mon Jun 15 03:24:23 2015 Koichi Sasada <ko1@atdot.net>
-
- * vm_insnhelper.c (lep_svar_set): add WBs.
-
-Fri Jun 12 01:39:49 2015 Eric Wong <e@80x24.org>
-
- * ext/socket/ancdata.c: use RB_GC_GUARD instead of volatile
- [ruby-core:69419] [Feature #11198]
-
-Fri Jun 12 01:16:13 2015 Eric Wong <e@80x24.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
- ossl_asn1_decode_all): use RB_GC_GUARD instead of volatile
- [ruby-core:69371] [Bug #11185]
-
-Fri Jun 12 01:14:00 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * win32/win32.c (setup_overlapped): seek to the file end only when
- writing (mode:a), not reading (mode:a+, read).
-
-Fri Jun 12 01:11:52 2015 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * load.c (loaded_feature_path): stop returning false negatives for
- filenames which are trailing substrings of file extensions. For
- example, 'b', which a trailing substring of ".rb" should not return
- false. [Bug #11155][ruby-core:69206]
-
- * test/ruby/test_autoload.rb: test for fix
-
-Sun May 24 03:56:27 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (r_symreal): register symbol names as strings first so
- that r_symlink always returns valid names.
- [ruby-core:68587] [Bug #10991]
-
- * marshal.c (r_ivar, r_object0): now need to intern symbol names.
-
- * marshal.c (r_object0): compare with symbol names.
-
-Sun May 24 03:53:07 2015 Eric Wong <e@80x24.org>
-
- * ext/socket/ancdata.c (bsock_recvmsg_internal): GC guard
- [Bug #11123]
-
-Sun May 24 03:44:42 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * range.c (linear_object_p, range_include): test if covered for
- linear objects. [ruby-core:69052] [Bug #11113]
-
-Sun May 24 03:41:45 2015 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (body_ext_mpart): should work even if body-fld-dsp
- is omitted. [ruby-core:69093] [Bug #11128]
-
-Sun May 24 03:37:14 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * string.c: added documentation for character sequence \' with String#sub
- [Bug #11132][ruby-core:69121][fix GH-900][ci skip] Patch by @shishir127
-
-Sun May 24 03:32:53 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * rational.c: Added documentation for rational literal.
- [Bug #11075][fix GH-885][ci skip] Patch by @shishir127
-
-Sun May 24 03:06:20 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/ipsocket.c (init_inetsock_internal): preserve errno
- before other library calls and use rb_syserr_fail.
- [ruby-core:68531] [Bug #10975]
-
-Sun May 24 03:01:17 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
- conflict on cygwin. [ruby-core:68877] [Bug #11065]
-
-Sun May 24 02:44:53 2015 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (vm_exec): check other events when RETURN is thrown.
- [Bug #10724]
-
- * test/ruby/test_settracefunc.rb: add a test.
-
-Sun May 24 02:21:47 2015 Masahiro Tomita <tommy@tmtm.org>
-
- * ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
- addrinfo. [ruby-dev:48923] [Bug #11051]
-
-Sun May 24 02:17:05 2015 Kenta Murata <mrkn@cookpad.com>
-
- * bigdecimal: conform to ruby's license. [ruby-core:68466] [Bug #10952]
-
-Sun May 24 02:06:34 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/-test-/file/fs.c (get_fsname): try magic number only if
- f_type is included. [ruby-dev:48913] [Bug #11000]
-
-Sun May 24 02:06:34 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/-test-/file/fs.c (get_fsname): return filesystem name by
- statfs/statvfs. [ruby-core:68624] [Bug #10998]
-
-Sun May 24 02:02:00 2015 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_symbol.rb: fix syntax error.
-
-Sun May 24 02:02:00 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_any_hash): Symbols are compared by the identities
- always. [ruby-core:68767] [Bug #11035]
-
-Sun May 24 02:01:07 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_any_hash): use same hash values with Float#hash so
- that -0.0 and +0.0 will be identical.
- [ruby-core:68541] [Bug #10979]
-
-Thu May 21 01:34:48 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (id2ref): prohibit from accessing internal objects.
- [ruby-core:68348] [Bug #10918]
-
-Thu May 21 01:32:02 2015 Rei Odaira <Rei.Odaira@gmail.com>
-
- * ext/pty/pty.c: AIX supports autopush.
- Patch by Perry Smith [ruby-core:58539] [Bug #9144]
-
-Thu May 21 01:07:41 2015 Misumi Rize <r@ayase-e.li>
-
- * vm_insnhelper.c (vm_throw_start): search the target to break
- from a block with nested rescue, from the nested blocks.
- [ruby-core:67765] [Bug #10775] [Fix GH-820]
-
-Thu May 21 00:55:45 2015 Koichi Sasada <ko1@atdot.net>
-
- * vm_args.c: protect value stack from calling other methods
- during complex parameter setting process (splat, kw, and so on).
- [Bug #11027]
-
- * vm_core.h: remove rb_thead_t::mark_stack_len.
- With this modification, we don't need to use th->mark_stack_len.
-
- * test/ruby/test_keyword.rb: add a test.
-
- * cont.c (cont_capture): catch up this fix.
-
- * vm.c (rb_thread_mark): ditto.
-
-Thu May 21 00:07:54 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_obj_instance_eval, rb_obj_instance_exec): allow
- symbols to just instance_eval/exec, except for definition of
- singletons. [ruby-core:68961] [Bug #11086]
-
-Wed May 20 04:33:50 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (STR_SET_EMBED): clear NOFREE flag at embedding as
- embedded strings no longer refer static strings.
- [ruby-core:68436] [Bug #10942]
-
-Wed May 20 03:46:11 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (need_normalization): use getattrlist() if fgetattrlist()
- is unavailable, on OSX 10.5. [ruby-core:68829] [Bug #11054]
-
-Wed May 20 03:25:34 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (proc_binding): replicate env from method object, and
- allocate the local variable area for the iseq local table.
- [ruby-core:68673] [Bug #11012]
-
-Wed May 20 03:25:34 2015 Koichi Sasada <ko1@atdot.net>
-
- * proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
-
- * vm.c: ditto.
-
- * vm_dump.c: ditto.
-
- * vm_insnhelper.c: ditto.
-
- * vm_core.h: use RB_TYPE_P() instead of BUILTIN_TYPE().
-
-Wed May 20 03:10:49 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * benchmark/bm_hash_aref_flo.rb: make more realistic data.
- [ruby-core:68632] [[Bug #10999]
-
-Wed May 20 02:49:49 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (respond_to_missing_p): check if the receiver responds to
- the given method by respond_to_missing?.
-
- * proc.c (mnew_missing): create Method object for method_missing.
- [ruby-core:68564] [Bug #10985]
-
-Wed May 20 02:16:05 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * dir.c (replace_real_basename): need to check the return value of
- GLOB_REALLOC().
-
-Wed May 20 02:16:05 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * dir.c (replace_real_basename): shouldn't create Ruby object before
- the object system is loaded.
- [ruby-core:68430] [Bug #10941]
-
-Wed May 20 01:58:12 2015 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
- (Resolv::DNS::Name#initialize): Normalize labels as
- Resolv::DNS::Label::Str objects.
-
-Wed May 20 01:47:23 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (rb_iseq_compile_with_option): check source type, must be
- an IO or a String. [ruby-core:69219] [Bug #11159]
-
-Fri May 15 05:01:25 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
- as the keys are unique fstrings, to get rid of running hash and
- compare methods and causing new object allocation during garbage
- collection phase. [ruby-dev:48891] [Bug #10933]
-
-Thu May 14 00:50:40 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (lambda): push and reset cmdarg_stack in lambda body.
- [ruby-core:69017] [Bug #11107]
-
-Thu May 14 00:39:29 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dln.c (dln_load): check if a different libruby is loaded by the
- extension library, and then bail out to get rid of very frequent
- reported stale bug reports.
-
-Thu May 14 00:29:44 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/fileutils.rb (FileUtils#mv): show the exact target path in
- the error message instead of the destination parent directory
- name. patched by Joao Britto <jabcalves AT gmail.com> at
- [ruby-core:68706]. [Bug #11021]
-
-Thu May 14 00:19:04 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (reserve_stack): keep sp safe zone to get rid
- of crash by -fstack-check. [ruby-core:68740] [Bug #11030]
-
-Tue Apr 14 23:33:39 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check also procstat_getvmmap, which is not
- available on FreeBSD 9. [ruby-core:68468] [Bug #10954]
-
- * vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
- procstat_getvmmap is not available.
-
-Mon Apr 13 22:11:21 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
- following RFC 6125. with the patch provided by Tony Arcieri and
- Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
- * test/openssl/test_ssl.rb: add tests for above.
-
-Mon Apr 13 13:03:33 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * lib/securerandom.rb: skip Win32 libraries in SecureRandom if
- OpenSSL::Random is available.
- https://github.com/ruby/ruby/pull/848 [Bug #10948] [Bug #10995]
-
-Mon Apr 13 00:49:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (arg): fix segfault by null caused by syntax error.
- [ruby-core:68851] [Bug #10957]
-
-Mon Apr 13 00:49:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): empty parentheses at cmdarg can be null.
- [ruby-core:68477] [Bug #10957]
-
-Mon Apr 13 00:44:12 2015 Eric Wong <e@80x24.org>
-
- * ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
- Thanks to Yura Sokolov <funny.falcon@gmail.com>
- [ruby-core:68369] [Bug#10923]
- * test/io/wait/test_io_wait.rb (test_nread_buffered):
- fix broken test
-
-Mon Apr 13 00:16:32 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (vm_call_super): search next super class from the
- original class, to get rid of infinite recursion with
- prepending. a patch by Seiei Higa <hanachin AT gmail.com> at
- [ruby-core:68434]. [ruby-core:68093] [Bug #10847]
-
-Mon Apr 13 00:09:48 2015 Koichi Sasada <ko1@atdot.net>
-
- * class.c (rb_prepend_module): need a WB for klass -> origin.
-
-Sun Apr 12 23:53:33 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/extconf.rb: needs --enable-shared when linked to
- libruby or fiddle.so. since --with-static-linked-ext does no
- longer link extensions to ruby program with --enable-shared, the
- only combination needs --enable-static is --disable-shared and
- --with-static-linked-ext. [ruby-dev:48901] [Bug #10960]
-
-Sun Apr 12 23:53:33 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/extconf.rb: make PIC objects if it will be linked as
- a shared object eventually. [ruby-core:67128]
-
-Sun Mar 22 12:39:17 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * spec/default.mspec: use default configuration file name.
- https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
-
-Sun Mar 22 12:39:17 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * spec/default.mspec: remove specific version number.
- https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
-
-Sun Mar 22 12:39:17 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * common.mk: use ruby organization for rubyspec.
-
-Thu Feb 26 15:48:41 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/win32/Win32API.rb (initialize): accept both a string and an array
- for the arguments of the imported function.
- reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
-
-Wed Feb 25 15:36:26 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/merger.rb: support 2.1+ versioning scheme.
-
-Tue Feb 24 17:41:27 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (time_zone_name): should be US-ASCII only if all 7-bits,
- otherwise locale encoding. [ruby-core:68230] [Bug #10887]
-
-Tue Feb 24 17:41:27 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (time_zone_name): should be US-ASCII only if all 7-bits,
- otherwise locale encoding. [ruby-core:68230] [Bug #10887]
-
-Tue Feb 24 17:41:27 2015 Benoit Daloze <eregontp@gmail.com>
-
- * time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
-
- * test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
-
-Tue Feb 24 16:37:26 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (chompped_length): enable smart chomp for all non-dummy
- encoding strings, not only default_rs.
- [ruby-core:68258] [Bug #10893]
-
-Tue Feb 24 16:31:53 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_split_m): raise ArgumentError at broken string
- not RegexpError, as Regexp is not involved in.
- [ruby-core:68229] [Bug #10886]
-
-Tue Feb 24 14:00:46 2015 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_objspace_call_finalizer): control GC execution during
- force firnalizations at the end of interpreter process.
- [Bug #10768]
-
- 1) Prohibit incremental GC while running Ruby-level finalizers
- to avoid any danger.
- 2) Prohibit GC while invoking T_DATA/T_FILE data structure
- because these operations break object relations consistency.
-
- This patch can introduce another memory consuming issue because
- Ruby-level finalizers can run after (2), GC is disabled.
- However, basically object consistency was broken at (2) as I
- described above. So that running Ruby-level finalizers contains
- danger originally. Because of this point, I need to suggest to
- remove these 3 lines (invoking remaining finalizers). And add a
- rule to add that finalizers should not add new finalizers, or
- say there is no guarantee to invoke finalizers that added by
- another finalizer.
-
-Tue Feb 24 14:00:46 2015 Aman Gupta <ruby@tmm1.net>
-
- * gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
- during rb_objspace_free. Adds extra protection for r46340.
- Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
- * gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
- finalizers have run. We already call gc_rest() before invoking
- finalizers, but finalizer can allocate new objects and start new GC
- cycle, so we call gc_rest() again after finalizers are complete.
-
-Tue Feb 24 10:30:59 2015 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
- of original crefs. It fixes segmentation fault when calling
- refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
-
- * vm_core.h, class.c: change accordingly.
-
- * test/ruby/test_refinement.rb: add a test for above.
-
-Sun Feb 22 21:20:37 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (match_aref): RMatch::regexp is Qnil after matching by a
- string since r45451. [ruby-core:68209] [Bug #10877]
-
-Sun Feb 22 17:11:25 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (probes.stamp): rebuild dtrace dependent objects
- only when `dtrace -G` modifies its input files.
-
-Sun Feb 22 17:11:25 2015 Naohisa Goto <ngotogenome@gmail.com>
-
- * common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
- in common.mk (in which OBJ is defined) because of Makefile include
- and parse order. This partly reverts r49419.
- [ruby-dev:48849] [Bug #10808]
-
- * Makefile.in (ruby-glommed.o): ditto.
-
- * Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
- it is included in $(OBJS) since r49451.
-
- * Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
-
-Sun Feb 22 02:16:40 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_identical_p): fix handle leak, ensure to close
- the handle of the first argument.
-
-Sat Feb 21 13:48:11 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (different_device_p): compare by volume serial
- numbers, not by path names. [ruby-core:68162] [Bug #10865]
-
-Sat Feb 21 13:48:11 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (wrename): return EXDEV if moving a directory to
- another drive, since MoveFileExW does not set proper error code.
- [ruby-core:68162] [Bug #10865]
-
-Sat Feb 21 12:46:51 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/file.c (rb_file_expand_path_internal): neither the drive
- of base directory nor the current drive are involved in the
- result if different than the drive of path.
- [ruby-core:68130] [Bug #10858]
-
-Sat Feb 21 12:46:51 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/file.c (rb_file_expand_path_internal): do not make invalid
- (or ADS) path if the path has a drive letter, the result also
- should have be under it. [ruby-core:68130] [Bug #10858]
-
-Sat Feb 21 12:45:54 2015 Matt Hoyle <matt@deployable.co>
-
- * ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
- to 'exponent'. [ruby-core:67980] [Bug #10823] [Fix GH-825]
-
-Fri Feb 20 17:47:20 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
- list to get rid of inadvertent creation by variable keyword
- arguments. [ruby-core:68031] [Bug #10831]
-
-Fri Feb 20 15:08:17 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (has_magic): always get long path name on Windows even if
- no tilde is there. [ruby-core:68011] [Bug #10819]
-
- * dir.c (replace_real_basename): FindFirstFile ignore redirection
- character, check if exists before call it. cf. [Bug #8597]
-
-Fri Feb 20 15:08:17 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): obtain real name with FindFirstFile API
- instead of matchin all entries, on Windows.
- [ruby-core:67954] [Bug #10819]
-
-Fri Feb 20 14:32:14 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (dir_initialize): workaround of opendir failure at symlink
- directories on Windows via CIFS.
-
-Thu Feb 19 17:05:47 2015 Shugo Maeda <shugo@ruby-lang.org>
-
- * class.c (rb_obj_singleton_methods): should use RTEST() to convert
- VALUE to int.
-
-Thu Feb 19 16:14:04 2015 Shugo Maeda <shugo@ruby-lang.org>
-
- * class.c (method_entry_i, class_instance_method_list,
- rb_obj_singleton_methods): should not include methods of
- superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
-
-Thu Feb 19 16:14:04 2015 Shugo Maeda <shugo@ruby-lang.org>
-
- * vm_method.c (remove_method): When remove refined
- method, raise a NameError if the method is not
- defined in refined class.
-
- But if the method is defined in refined class,
- it should keep refined method and remove original
- method.
-
- Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
-
-Thu Feb 19 16:07:03 2015 Seiei Higa <hanachin@gmail.com>
-
- * proc.c (rb_obj_singleton_method): Kernel#singleton_method should
- not use refinements, as well as Kernel#method.
- [ruby-core:67603] [Bug #10744]
-
-Thu Feb 19 15:32:26 2015 Dave Stevens <dave@crowdlab.com>
-
- * string.c (str_make_independent_expand): terminate String when
- moved from heap to embedded. [Fix GH-821].
-
-Thu Feb 19 13:35:21 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
- macro `DEBUG` is defined. based on the patch by Owen Rodley in
- [ruby-core:67987]. [Bug #10825]
-
-Tue Feb 17 18:57:13 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
- returned by Kernel#instance_variables are Symbols now.
- [ruby-core:68128] [Bug #10857]
-
-Tue Feb 17 15:39:01 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
- versions of RegDeleteValue and RegDeleteKey.
- [ruby-core:67958] [Bug #10820]
-
-Tue Feb 17 11:50:06 2015 Yusuke Endoh <mame@tsg.ne.jp>
-
- * string.c (str_discard): does not free for STR_NOFREE string.
- [Bug #10853][ruby-core:68110]
-
- * bootstraptest/test_string.rb: test for above.
-
-Sun Feb 15 13:15:46 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
- get rid of GHOST vulnerability on very old platforms.
-
- * ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
- check for the canonnical name.
-
-Sat Feb 14 13:27:41 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
- convert String method name into a Symbol, as method_missing
- method expects its first argument to be a Symbol. [Bug #10828]
-
- * vm_insnhelper.c (ci_missing_reason): return the reason of method
- missing in call info.
-
- * vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
- proper missing reason. [Bug #10828]
-
-Sat Feb 14 13:27:41 2015 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
-
-Sat Feb 14 08:53:50 2015 Shugo Maeda <shugo@ruby-lang.org>
-
- * class.c (method_entry_i, class_instance_method_list,
- rb_obj_singleton_methods): should not include methods of
- superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
-
-Fri Feb 13 13:59:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
- interference by modifying global variables in have_devel? method.
- [ruby-core:67962] [Bug #10821]
-
-Fri Feb 13 03:13:05 2015 Scott Francis <scott.francis@shopify.com>
-
- * thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
- Linux, by reserving the stack virtual address space at process
- start up so that it will not clash with the heap space.
- [Fix GH-822]
-
-Fri Feb 6 12:05:13 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * thread.c: Improve documentation for Thread#value
- [Bug #10694][ruby-core:67324][ci skip]
-
-Fri Feb 6 12:02:05 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
- workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
- [ruby-core:67789] [Bug #10780]
-
-Fri Feb 6 01:03:38 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (w_object, marshal_dump): use indetity tables for
- arbitrary VALUE keys, because of performance of FLONUM.
- [Bug #10761]
-
- * marshal.c (obj_alloc_by_klass, marshal_load): ditto.
-
-Fri Feb 6 01:03:38 2015 Eric Wong <e@80x24.org>
-
- * benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
-
-Fri Feb 6 01:03:38 2015 Eric Wong <e@80x24.org>
-
- * st.c (st_numhash): mix float value for flonum
- * hash.c (rb_any_hash): ditto
- * benchmark/bm_hash_aref_flo.rb: new benchmark
- * benchmark/bm_hash_ident_flo.rb: ditto
- [Bug #10761]
-
-Thu Feb 5 16:30:09 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (gettable_gen): disable warnings of possible reference
- to a local variable defined in a past scope.
- [ruby-core:67162] [Bug #10661]
-
-Mon Jan 26 15:35:16 2015 Seiei Higa <hanachin@gmail.com>
-
- * vm_method.c (check_definition): Module#public_method_defined?,
- Module#private_method_defined?, Module#protected_method_defined?
- should not use refinements. [ruby-core:67656] [Bug #10753]
-
-Thu Jan 22 11:47:31 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * doc/syntax/literals.rdoc (Symbols): now Symbols created by
- interpolation can be garbage collected. patch by Yihang Ho in
- [ruby-core:67194]. [Bug #10671]
-
-Thu Jan 22 11:45:32 2015 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
- change throw mechanism (not save target ep, but save target cfp).
- It fixes `unexpected break' bug that occurs when
- TracePoint#binding is called.
- [ruby-dev:48797] [Bug #10689]
-
- * test/ruby/test_settracefunc.rb: add a test.
-
-Tue Jan 20 14:05:08 2015 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
- variable is passed by reference. [ruby-dev:48803] [Bug #10697]
-
-Mon Jan 19 15:45:33 2015 Seiei Higa <hanachin@gmail.com>
-
- * vm_method.c (rb_method_entry): if no super class, no original
- method entry. [ruby-core:67389] [Bug #10707]
-
-Mon Jan 19 12:03:59 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_dump.c (rb_vm_bugreport): check by configured result instead
- of system name for old FreeBSD. based on a patch by Steve Wills
- at [ruby-core:67655]. [Bug #10752]
-
-Mon Jan 19 12:00:51 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: get rid of pattern substitution, which is not
- supported by ash, and ash on NetBSD parses whole source first
- and fails to start. [ruby-dev:48823] [Bug #10750]
-
-Mon Jan 19 11:57:14 2015 Vit Ondruch <vondruch@redhat.com>
-
- * configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
- which causes a syntax error with autoconf 2.63.
- [ruby-core:67429] [Bug #10716]
-
-Mon Jan 19 11:44:52 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
- CR. should check if substitution occurred too.
- [ruby-dev:48813] [Bug #10732]
-
-Sun Jan 18 00:59:41 2015 Eric Wong <e@80x24.org>
-
- * numeric.c (bit_coerce): use original value for error message
- [ruby-core:67405] [Bug #10711]
- * test/ruby/test_numeric.rb (test_coerce): check error message
-
-Sun Jan 18 00:53:38 2015 Seiei Higa <hanachin@gmail.com>
-
- * vm_method.c (rb_alias): raise a NameError when creating alias to
- a refined method if the original method of the refined method is
- not defined. [ruby-core:67523] [Bug #10731]
-
-Sat Jan 17 22:25:50 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
- decomposed. [Bug #10704]
-
- * dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
- perform in an upper layer than file systems on OSX, as all path
- names are always decomposed regardless of file system types.
-
-Sat Jan 17 17:56:45 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (assocs, assoc): eliminate splatting empty literal
- hashes. [ruby-core:67446] [Bug #10719]
-
- * compile.c (compile_array_): supprt splatted hash in hash type.
-
-Sat Jan 17 16:49:49 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/readline/readline.c (readline_s_refresh_line): initialize
- before rl_refresh_line(), as some function make the internal
- state non-clean but rl_refresh_line() does not re-initialize it.
- [ruby-core:43957] [Bug #6232]
-
-Sat Jan 17 16:47:20 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval_error.c (error_print): pos and len parameters of rb_str_substr()
- are counted by characters, not bytes. use rb_str_subseq() instead.
- [Bug #10727] [ruby-core:67473]
-
-Sat Jan 17 16:35:59 2015 Seiei Higa <hanachin@gmail.com>
-
- * vm_method.c (rb_export_method): bail out if the original method
- is undefined when the method is refined.
- [ruby-core:67387] [Bug #10706]
-
-Sat Jan 17 16:16:14 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): match in case-folding only if the directory
- resides on a case-insensitve file system, on OSX.
- [ruby-core:67364] [Bug #10700]
-
-Sat Jan 17 02:04:01 2015 Eric Wong <e@80x24.org>
-
- * lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
- [ruby-core:67411] [Bug #10712]
-
-Sat Jan 17 01:57:57 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/zlib/zlib.c: fix document of method signatures.
- [Bug #10668][ruby-core:67186][ci skip]
-
-Sat Jan 17 01:52:42 2015 Tanaka Akira <akr@fsij.org>
-
- * time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
- VTM_ISDST_INITVAL. This bug is introduced at packing struct
- vtm (r45155).
- [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
-
-Fri Jan 16 21:17:34 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_io.rb: added timeout for AIX environment.
- [ruby-core:62983][Bug #9917]
-
-Fri Jan 16 18:25:57 2015 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
- objects. Label#Str#== is case-insensitive.
-
-Fri Jan 16 18:25:57 2015 Ben Miller <bmiller@rackspace.com>
-
- * lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
- comparison should be case-insensitive as well.
- [ruby-core:66498] [Bug #10550]
-
-Fri Jan 16 18:25:57 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/resolv.rb (Resolv::DNS::Name): names with different dots
- should be different.
-
-Fri Jan 16 17:34:57 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (f_label): return tLABEL value as it is.
- [ruby-core:67315] [Bug #10693]
-
-Fri Jan 16 16:49:04 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/net/http.rb (Net::HTTP#send_request): there is no response body
- with HEAD request. Patch by @rodrigosaito [fix GH-520]
-
-Fri Jan 16 16:49:04 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/net/http/test_http.rb (_test_send_request__HEAD): Added
- failing test for send_request with HEAD method.
-
-Fri Jan 16 14:56:08 2015 Eric Wong <e@80x24.org>
-
- * symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
- * test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
- [ruby-core:67268] [Bug #10686]
-
-Fri Jan 16 14:20:52 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_args.c (keyword_hash_p): fix non-symbol keys hash.
- rb_extract_keywords() returns 0 not Qnil when no symbol keys is
- included.
-
-Fri Jan 16 11:06:17 2015 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/unicode_normalize.rb: typo fix. [ci skip]
- [ruby-dev:48794][misc #10675]
- included. [ruby-core:67264] [Bug #10685]
-Fri Jan 16 11:04:35 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (unescape_nonascii): append excape sequence as-is not
- unescaped character, to get rid of unexpected meta-character.
- [ruby-core:67193] [Bug #10670]
-
-Sat Jan 3 21:17:58 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_thread_variable_get): fix dynamic symbol keys.
- rb_check_id() returns non-zero only for static symbols, whereas
- thread local variable keys can be dynamic symbols.
- [ruby-core:67185] [Bug #10667]
-
-Thu Jan 1 08:29:55 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
- always. [ruby-core:67153] [Bug #10657]
-
-Wed Dec 31 15:26:46 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
- keywords bits arguments should be unique. since internal IDs
- depend on the local variable index in the current scope, new ID
- should be made before popping those vtables.
- [ruby-core:67157] [Bug #10659]
-
-Wed Dec 31 14:11:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
- of tcllib. Patch by @zalt50 [fix GH-787]
-
-Wed Dec 31 13:26:22 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_vm_living_threads_insert): preserve order
- [Bug #10660] [ruby-core:67154] [ruby-core:67159]
-
-Fri Dec 26 15:42:27 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
- [Bug #10647] [ruby-dev:48787]
-
-Thu Dec 25 17:42:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/console/console.c (console_dev): send the given arguments
- to the opened console. as a special case, do nothing if :close
- is given.
-
- * test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
- console.
-
-Thu Dec 25 17:37:47 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
- Fix SEGV during finilize of WeakRef on Solaris (though the SEGV
- could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
-
-Thu Dec 25 17:31:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (NET_LUID): include winsock2.h instead of windows.h.
- patch by Jon Forums in [ruby-core:67125]. [Bug #10640]
-
-Thu Dec 25 16:01:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_expand_path_internal): drop characters ignored
- by filesystem on Mac OS X.
-
-Thu Dec 25 15:36:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (replace_real_basename): get the real name and replace the
- base name with it by getattrlist(2) if available.
- suggested by Matthew Draper at [ruby-core:67116]. [Bug #10015]
-
- * dir.c (glob_helper): get the real name of the whole path, not
- only the last name.
-
-Thu Dec 25 13:59:17 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (NET_LUID): include also ifdef.h as a workaround of
- a bug in mingw-w64 header. [ruby-core:67103] [Bug #10640]
-
-Thu Dec 25 12:47:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (gettable_gen): warn possible reference to a local
- variable defined in a past scope.
-
-Thu Dec 25 10:09:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/console/console.c (console_dev): id_console is not a
- constant name, use rb_const_remove() to get rid of NameError.
-
-Thu Dec 25 09:18:55 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/resolv/test_dns.rb (TestResolvDNS#test_query_ipv4_address):
- set timeout for recvfrom because if client thread is crashed, it
- waits infinity.
-
-Thu Dec 25 08:42:11 2014 Eric Wong <e@80x24.org>
-
- * lib/uri/generic.rb (split_userinfo): fstring for 1-byte split
- (set_port): reduce bytecode size
- (check_path): reduce garbage via opt_str_freeze
- (query=): ditto
- (fragment=): ditto
- [misc #10628]
- * lib/uri/rfc3986_parser.rb (regexp): cache as attr
- (initialize): setup and freeze regexp attr once
- (split): reduce bytecode size, use opt_str_freeze
- (parse): minor bytecode and garbage reduction
- (default_regexp): rename for initialize
-
-Wed Dec 24 20:38:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_make_pattern): restrict searching case-insensitive
- name from the filesystem to only last part, for the performance.
- [ruby-core:63591] [Bug #10015]
-
-Wed Dec 24 18:21:27 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: remove unused rb_objspace_t::rgengc::old_objects_at_gc_start.
-
-Wed Dec 24 13:25:22 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/redmine-backporter.rb: require view_changesets permission.
-
-Wed Dec 24 13:00:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/downloader.rb (Downloader.download): fix the exception to
- re-raise. initialize methods of subclasses of Exception may
- have different parameters. [ruby-core:67086] [Bug #10639]
-
-Wed Dec 24 12:16:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.h (rb_data_type_t): revert r48647 and revise parent member.
- [ruby-core:66969] [Bug #10621]
-
-Wed Dec 24 05:40:52 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/downloader.rb: use config.guess in gcc repo.
-
-Wed Dec 24 11:50:19 2014 Koichi Sasada <ko1@atdot.net>
-
- * hash.c (rb_hash_delete): return Qnil if there are no corresponding
- entry. [Bug #10623]
-
- * hash.c (rb_hash_delete_entry): try delete and return Qundef if there
- are no corresponding entry.
-
- * internal.h: add rb_hash_delete_entry()'s declaration.
-
- * symbol.c: use rb_hash_delete_entry().
-
- * thread.c: use rb_hash_delete_entry().
-
- * ext/-test-/hash/delete.c: use rb_hash_delete_entry().
-
-Wed Dec 24 09:35:11 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/fiddle/extconf.rb: remove ffitarget.h generated by configure on
- mswin, because it's not normal file (cygwin's symlink) and have
- system attribute.
-
-Wed Dec 24 05:40:52 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/downloader.rb: support ruby 1.8.
-
-Wed Dec 24 02:44:06 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/response.rb (Net::HTTPResponse): require one or more
- spaces [Bug #10591].
- by leriksen <leif.eriksen.au@gmail.com>
- https://github.com/ruby/ruby/pull/782 fix GH-782
- NOTE: graph.facebook.com returns without SP Reason-Phrase.
-
-Wed Dec 24 02:12:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/make-snapshot (package): VCS#branch_list expects glob a
- pattern string but not a regexp. based on the patch by Vit
- Ondruch. in [ruby-core:67064]. [Bug #10636]
-
- * tool/vcs.rb (VCS::SVN#branch_list): strip newlines.
-
- * tool/vcs.rb (VCS::GIT.get_revisions): retrieve modified time
- from toplevel log too.
-
- * tool/vcs.rb (VCS::GIT#branch_list): yield for each lines.
-
-Wed Dec 24 00:23:13 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/extlibs.rb (do_extract): the pipe should be binmode.
-
-Wed Dec 24 00:21:44 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * Makefile.in, common.mk: move common-srcs to Makefile.in because
- it breaks build on mswin.
-
-Wed Dec 24 00:04:45 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/open-uri.rb (OpenURI.open_http): accept multiple certs path in
- ssl_ca_certs.
-
- * tool/downloader.rb: use certs of rubygems for downloading gems.
-
-Tue Dec 23 22:39:11 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/extlibs: libffi-3.2.1 and patch for mswin.
-
-Tue Dec 23 22:04:38 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#query=): don't escape [\]^
- on both rfc2396 and rfc3986. [Bug #10619]
-
-Tue Dec 23 16:03:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/lib/win32/registry.rb (Win32::Registry::Error#initialize):
- try en_US message if the default message cannot be encoded to
- locale. [ruby-core:65295] [Bug #10300]
-
-Tue Dec 23 11:42:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_update_long): update huge
- data gradually not to exceed INT_MAX. workaround of OpenSSL API
- limitation. [ruby-core:67043] [Bug #10633]
-
-Mon Dec 22 21:30:16 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * test/win32ole/test_win32ole_event.rb: some tests are
- executed on standard Windows OS without ADO.
-
-Mon Dec 22 14:08:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (received_signal): fix condition to define.
- [ruby-core:67032] [Bug #10629]
-
-Sun Dec 21 10:51:51 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * test/win32ole/test_win32ole_event.rb: test_s_new_exception is
- executed on standard Windows OS without ADO.
-
-Sun Dec 21 08:35:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (jemalloc): fix option argument, should use
- `$withval` but not `yes` always. [ruby-core:66994] [Bug #10625]
-
- * configure.in (jemalloc): defer adding the liner option to get
- rid of linking contest against jemalloc, so that it works
- without runtime dynamic load path.
-
-Sat Dec 20 17:49:03 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/tmpdir.rb (Dir.mktmpdir): Accept nil again, as Ruby 2.1.
- [ruby-core:66943] [Bug #10616] Fixed by Alex Slynko.
-
-Sat Dec 20 11:22:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/depend, ext/fiddle/extconf.rb: try to build bundled
- libffi if existing.
-
-Sat Dec 20 05:21:00 2014 Eric Wong <e@80x24.org>
-
- * test/test_weakref.rb (test_repeated_object_leak): increase timeout
- [Bug #10618]
-
-Fri Dec 19 22:33:13 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: Use $(hdrdir) if possible.
-
-Fri Dec 19 22:10:00 2014 Kenta Murata <mrkn@cookpad.com>
-
- * ext/bigdecimal/depend: Fix dependencies to make bigdecimal
- installable by rubygems.
-
- * ext/bigdecimal/bigdecimal.gemspec: version 1.2.6.
-
-Fri Dec 19 20:00:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (PRIsVALUE): put a space after string
- literals not to be confused with C++11 string literal suffix.
- https://github.com/ruby/ruby/commit/a9f3eb7#commitcomment-9040169
-
-Fri Dec 19 15:36:02 2014 Simon Genier <simon.genier@shopify.com>
-
- * hash.c (hash_equal): prefer true than the result of implicit
- conversion from int returned by rb_eql() to VALUE. [Fix GH-789]
-
-Thu Dec 18 17:45:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_binary_elf): get rid of -e option of cat
- which is not available on BusyBox, use tr instead.
- [ruby-core:64824] [Bug #10210]
-
-Thu Dec 18 14:25:17 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * signal.c (ruby_signal): since SIGKILL is not supported by MSVCRT,
- should be treated before calling signal(3).
- [Bug #10615]
-
-Wed Dec 17 12:20:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (rb_method_for_self_aref, rb_method_for_self_aset):
- move from iseq.c to build from node instead of arrays.
-
-Wed Dec 17 10:50:09 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/gdbm/test_gdbm.rb: Added test for each_key called without a block.
- Patch by @joeyates [fix GH-783]
-
-Wed Dec 17 10:18:42 2014 Koichi Sasada <ko1@atdot.net>
-
- * compile.c (iseq_compile_each): check
- iseq->compile_data->option->specialized_instruction for opt_* insn.
-
- * test/ruby/test_iseq.rb: check no specialized_instructions option.
-
-Wed Dec 17 09:48:57 2014 Eric Wong <e@80x24.org>
-
- * compile.c (iseq_compile_each): only emit opt_str_freeze,
- opt_aref_with, and opt_aset_with insn when no block is given
- [Bug #10557] [ruby-core:66595]
- * test/ruby/test_optimization.rb (test_block_given_aset_aref):
- new test for bug thanks to Bartosz Kopinski.
- (test_string_freeze): additional assertion for object_id
-
-Wed Dec 17 01:06:47 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/win32/lib/Win32API.rb (Win32API#call): need to splat. hmm, when
- was this broken?
-
-Tue Dec 16 15:18:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (rb_method_for_self_aref, rb_method_for_self_aset): call
- accessor functions directly, not to be affected by [] and []=
- methods. [ruby-core:66846] [Bug #10601]
-
- * struct.c (define_aref_method, define_aset_method): ditto.
-
- * vm_insnhelper.c (rb_vm_opt_struct_aref, rb_vm_opt_struct_aset):
- direct accessors of Struct.
-
-Tue Dec 16 12:01:29 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
- extend timeout seconds to 60 for RGENGC_CHECK_MODE > 0 environment.
-
-Tue Dec 16 08:53:12 2014 Eric Wong <e@80x24.org>
-
- * tool/vcs.rb: fix Ruby 1.8 compatibility harder
-
-Tue Dec 16 07:37:18 2014 Eric Wong <e@80x24.org>
-
- * gc.c (GC_HEAP_FREE_SLOTS): move definition to match use order
- (RUBY_GC_HEAP_GROWTH_SLOTS): s/factor/number of slots/
-
- * man/ruby.1: add section for GC environment variables
- [Feature #10197]
-
-Tue Dec 16 05:41:46 2014 Eric Wong <e@80x24.org>
-
- * tool/vcs.rb: fix Ruby 1.8 compatibility
-
-Mon Dec 15 17:51:28 2014 Koichi Sasada <ko1@atdot.net>
-
- * ext/objspace/objspace.c: ObjectSpace.memsize_of(obj) returns
- with sizeof(RVALUE). [Bug #8984]
-
- * gc.c (obj_memsize_of): ditto.
-
- * NEWS: add a NEWS entry.
-
- * test/objspace/test_objspace.rb: catch up this fix.
-
- * test/ruby/test_file_exhaustive.rb: ditto.
-
-Mon Dec 15 16:19:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_enc_str_coderange): dummy wchar, non-endianness
- encoding string cannot be ascii only.
- [ruby-core:66835] [Bug #10598]
-
-Sun Dec 14 20:11:42 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): restore current_arg so that circular
- reference after a method definition is also warned.
- [ruby-core:61299] [Bug #9593]
-
-Sat Dec 13 20:41:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_trace.c (rb_postponed_job_flush): mask signal trap interrupt
- too to defer handling after finalizers finished.
- [ruby-core:66825] [Bug #10595]
-
-Sat Dec 13 18:33:25 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_pkey_ec.rb: ignored tests with old OpenSSL.
-
-Sat Dec 13 18:01:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (check_stack_overflow): check sp also on i386/x86_64
- FreeBSD.
-
-Sat Dec 13 09:58:41 2014 Eric Wong <e@80x24.org>
-
- * gc.c (define_final0): avoid duplicate blocks
- [Bug #10537]
- * test/test_weakref.rb (test_repeated_object_leak): new test
-
-Sat Dec 13 04:59:20 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bin/erb (ERB::Main#run): get rid of shadowing outer local
- variables. [ruby-core:65772] [Feature #10395]
-
-Fri Dec 12 21:56:44 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * gems/bundled_gems: Upgrade to test-unit 3.0.8. assert_throw and
- assert_nothing_thrown in test-unit 3.0.7 were broken by
- UncaughtThrowError change introduced in Ruby 2.2.0
- preview2. These assertions in test-unit 3.0.8 work well with
- UncaughtThrowError in Ruby 2.2.0 preview2.
-
-Fri Dec 12 19:48:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bin/erb (ARGV.switch, ERB::Main#run): allow variables to be set
- from the command line. [ruby-core:65772] [Feature #10395]
-
-Fri Dec 12 19:31:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/erb.rb (ERB#lineno): accessor for line number to eval.
-
- * lib/erb.rb (ERB#location=): setter of file name and line number.
-
-Fri Dec 12 13:09:13 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_latest_gc_info): return :state field to show current
- GC state (none/marking/sweeping).
- [Feature #10590]
-
-Fri Dec 12 10:49:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_crypt): check arguments more strictly.
- * crypt() is not for wide char strings
- * salt bytes should not be NUL
-
-Fri Dec 12 08:16:01 2014 Matt Hoyle <matt@deployable.co>
-
- * io.c (io_read) Fix spelling in docco for read. [Fix GH-781]
- try > tries
-
-Thu Dec 11 19:06:01 2014 Koichi Sasada <ko1@atdot.net>
-
- * class.c (class_alloc): Start from age == 2.
- Class and Module objects can be living long life.
-
- * iseq.c: Same for ISeq objects.
-
- * gc.c (RVALUE_AGE_RESET): added.
-
- * gc.c (newobj_of): allow to generate (age != 0) objects.
-
- * gc.c (rb_copy_wb_protected_attribute): reset age for wb unprotected
- objects.
-
- * include/ruby/ruby.h: add RUBY_TYPED_PROMOTED1 as an unrecommended
- flag.
-
-Thu Dec 11 05:37:52 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/prime.rb: Remove useless loop and block capture.
- See [#10354]
-
-Thu Dec 11 04:27:24 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: introduce new field
- rb_thread_t::local_storage_recursive_hash_for_trace to store
- recursive hash to avoid creating new recursive (nested) hashes
- for each trace events.
- [Bug #10511]
-
- * vm_trace.c (rb_threadptr_exec_event_hooks_orig): use it.
-
- * cont.c: catch up this fix.
-
- * vm.c (rb_thread_mark): ditto.
-
-Wed Dec 10 13:39:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * struct.c (define_aref_method, define_aset_method): use iseq
- VALUE instead of rb_iseq_t to prevent from GC, as RB_GC_GUARD
- makes sense only for local variables. [Feature #10575]
-
-Wed Dec 10 09:38:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (exec_recursive): use the same last method name as
- recursive_push in the error message when recursive_pop failed.
- [ruby-core:66742] [Bug #10579]
-
-Wed Dec 10 02:48:46 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/net/http/test_https.rb
- (TestNetHTTPS#test_certificate_verify_failure): on Windows,
- Errno::ECONNRESET will be raised when the verify is failure at the
- client side, and it'll be eaten by WEBrick.
-
- * test/open-uri/test_ssl.rb (TestOpenURISSL#test_validation_failure):
- ditto.
-
-Wed Dec 10 00:42:13 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (rb_method_for_self_aref, rb_method_for_self_aset):
- new methods to generate bytecode for struct.c
- [Feature #10575]
- * struct.c (rb_struct_ref, rb_struct_set): remove
- (define_aref_method, define_aset_method): new functions
- (setup_struct): use new functions
- * test/ruby/test_struct.rb: add test for struct >10 members
- * benchmark/bm_vm2_struct_big_aref_hi.rb: new benchmark
- * benchmark/bm_vm2_struct_big_aref_lo.rb: ditto
- * benchmark/bm_vm2_struct_big_aset.rb: ditto
- * benchmark/bm_vm2_struct_small_aref.rb: ditto
- * benchmark/bm_vm2_struct_small_aset.rb: ditto
-
-Tue Dec 9 20:24:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * string.c: [DOC] Add missing documentation around String#chomp.
- Patch by @stderr [ci skip][fix GH-780]
-
-Tue Dec 9 18:20:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c: [DOC] Revise documentation by Marcus Stollsteimer at
- [ruby-core:66368]. [Bug #10526]
-
- * #inspect: be more specific about generated string, remove
- obsolete example.
- * #nil?: use code examples instead of different call-seq's.
- * #tap: clarify what is yielded.
- * Integer(): be more specific about to_int and to_i, remove
- reference to Ruby 1.8.
- * Array(): fix error.
- * Class: fix variable name style and indentation in example.
- * improve consistency, fix typos and formatting.
-
-Tue Dec 9 12:48:32 2014 Josef Simanek <josef.simanek@gmail.com>
-
- * vm_eval.c (rb_eval_string_wrap): [DOC] Fix `rb_eval_string_wrap`
- documentation. It is referencing `require` instead of `load`.
- The former does not have the optional argument. [Fix GH-779]
-
-Tue Dec 9 10:16:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_frame_last_func): return the most recent frame method
- name.
-
- * thread.c (recursive_list_access): use the last method name,
- instead of the current method name which can be unset in some
- cases, not to use a symbol by the invalid ID.
- [ruby-core:66742] [Bug #10579]
-
-Sun Dec 7 19:36:12 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * ext/socket/basicsocket.c, ext/socket/sockssocket.c:
- remove code for $SAFE=4.
-
-Sun Dec 7 10:20:55 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc: Update to RDoc 4.2.0.
- * test/rdoc: ditto.
-
-Sun Dec 7 09:52:30 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems: Update to RubyGems 2.4.5.
- * test/rubygems: ditto.
-
-Sat Dec 6 10:05:08 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb: Fix undefined variable usage & refactor/DRY
- code. Patch by @aledovsky. [Fixes GH-770]
-
- * test/net/test_imap.rb: related test.
-
-Sat Dec 6 10:09:44 2014 Eric Wong <e@80x24.org>
-
- * thread.c (do_select): rename parameters to avoid shadowing
-
-Sat Dec 6 09:22:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rake: Update to rake 10.4.2
- * test/rake: ditto.
-
-Sat Dec 6 06:48:03 2014 Eric Wong <e@80x24.org>
-
- * compile.c (rb_iseq_build_from_ary): remove misc handling
-
-Sat Dec 6 06:14:23 2014 Vit Ondruch <vondruch@redhat.com>
-
- * configure.in (RUBY_LIB_VERSION): Fix --with-ruby-version
- configuration option. get rid of quoting in config.status.
-
- * template/verconf.h.tmpl: quote RUBY_LIB_VERSION here.
- [ruby-core:66724] [Bug #10572]
-
-Sat Dec 6 04:33:52 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/pp.rb (File::Stat#pretty_print): some platforms (such as Windows)
- does not have major/minor parts of device.
-
-Fri Dec 5 22:43:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/psych/lib/psych.rb: bump version to 2.0.8
- * ext/psych/psych.gemspec: ditto.
- * ext/psych/psych_emitter.c: ditto.
- * ext/psych/psych_parser.c: ditto.
-
-Fri Dec 5 17:09:09 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c (inet_ntop): link aliased inet_ntop in
- libruby on mswin not rb_w32_inet_ntop which fails to link for
- unknown reason.
-
-Fri Dec 5 11:09:54 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (prepare_iseq_build): remove unused block_opt param
- (rb_iseq_new_with_bopt_and_opt): remove
- (rb_iseq_new_with_opt): inline removed function
- (rb_iseq_new_with_bopt): remove
- (iseq_load): adjust prepare_iseq_build call
- [Feature #10565]
-
-Fri Dec 5 09:46:05 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yylex): fix lex_state after tLABEL_END, should
- be EXPR_LABELARG to be followed by "paren with arg".
- [ruby-core:66705] [Feature #4935]
-
-Fri Dec 5 02:27:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: as all extension objects including initializations
- of ext and enc should be linked to libruby if enable-shared,
- EXTOBJS should not be linked to main programs.
- [ruby-core:66675] [Bug #10566]
-
-Thu Dec 4 07:06:02 2014 Eric Wong <e@80x24.org>
-
- * compile.c (rb_iseq_build_from_exception): entry->sp is unsigned
- (iseq_build_callinfo_from_hash): account for kw_arg
- (iseq_build_from_ary_body): update for r35459
- (CHECK_STRING, CHECK_INTEGER): remove unused checks
- (int_param): new function for checking new `params' hash
- (iseq_build_kw): new function for loading rb_iseq_param_keyword
- (rb_iseq_build_from_ary): account for `misc' entry and general
- structure changes
- [Feature #8543]
- * iseq.c (CHECK_HASH): new macro (for `misc' and `param' entries)
- (iseq_load): account for `misc' and `params' hashes
- (iseq_data_to_ary): add final opt to arg_opt_labels,
- fix kw support, account for unsigned entry->sp
- * ext/-test-/iseq_load/iseq_load.c: new ext for test
- * ext/-test-/iseq_load/extconf.rb: ditto
- * test/-ext-/iseq_load/test_iseq_load.rb: new test
-
-Thu Dec 4 06:56:57 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (iseq_free): avoid segfault on incomplete iseq
- * test/ruby/test_syntax.rb (test_invalid_next): new test
- for syntax error, not segfault
-
-Thu Dec 4 04:20:34 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (ruby_require_internal): ignore error detail, just return
- an error.
-
-Wed Dec 3 17:13:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * encoding.c (load_encoding): use rb_require_internal instead of
- calling rb_require_safe with protection.
-
-Wed Dec 3 16:47:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (register_init_ext, ruby_init_ext): defer running the
- registered initialization function until required, not to enable
- extensions which have global effects just by loading, e.g.,
- mathn/complex and mathn/rational. fix `make test` with
- --with-static-linked-ext.
-
- * enc/encinit.c.erb (Init_enc): initialize encdb and transdb
- directly.
-
-Wed Dec 3 14:51:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (ruby_require_internal): separate from rb_require_safe,
- not to raise exceptions.
-
- * ruby.c (process_options): remove unnatural encoding search.
-
-Wed Dec 3 14:34:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (setup_fake_str): fake string does not share another
- string, but just should not free.
-
-Wed Dec 3 11:14:14 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (w32_spawn): `v2` is used not only for `shell` but also
- `cmd`, so must not free before using `cmd`.
- [ruby-core:66648] [Bug #10563]
-
-Wed Dec 3 09:48:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/racc/cparse/cparse.c (cparse_params_type): use typed data.
-
-Tue Dec 2 21:33:56 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: use typed data for com_hash.
-
-Tue Dec 2 15:30:30 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * array.c (rb_ary_plus): in documentation, added note about
- inefficiency of repeated += operations.
-
-Tue Dec 2 07:20:21 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (iseq_data_to_ary): keep hidden variables
- Thanks to wanabe [ruby-core:66566]
-
-Tue Dec 2 06:46:57 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych.rb: bumping version
-
- * ext/psych/psych.gemspec: ditto
-
-Tue Dec 2 06:34:08 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/to_ruby.rb: support objects that are
- marshalable, but inherit from basic object.
- Thanks Sean Griffin <sean@thoughtbot.com>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
-
- * test/psych/test_marshalable.rb: test for fix
-
-Tue Dec 2 06:32:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (ripper_flush_string_content): preserve the dispatched
- results at tSTRING_CONTENT. [ruby-dev:48714] [Bug #10437]
-
- * parse.y (regexp_contents): check in ripper only if the whole
- content is a single regexp without interpolation.
- [ruby-dev:48714] [Bug #10437]
-
-Tue Dec 2 06:30:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_reg_region_copy): new function to try with GC if copy
- failed and return the error.
-
-Tue Dec 2 04:43:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (CHECK_REGION_COPIED): onig_region_copy() can fail when
- memory exhausted but returns nothing, so check by if allocated.
-
-Tue Dec 2 02:53:00 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (magic_comment_encoding): enable in ripper, since the
- encoding is necessary to parse non-default encoding scripts.
-
-Tue Dec 2 02:30:25 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic.build):
- use hostname= to detect and wrap IPv6 hosts.
- Build is accepting URI components and users may not expect
- that a host component needs to be wrapped with square brackets
- since it's not providing a URI.
- Note: initialize with arg_check => true does not wrap IPv6 hosts.
- by Joe Rafaniello <jrafanie@redhat.com>
- https://github.com/ruby/ruby/pull/765 fix GH-765
-
- * test/uri/test_generic.rb: Add more tests
-
-Mon Dec 1 20:01:12 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: use typed data for WIN32OLE.
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_event.c: ditto.
-
-Mon Dec 1 17:20:42 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/Makefile.sub (verconf.h): so depends on verconf.mk, which
- is rebuilt by setup.mak.
-
-Mon Dec 1 11:05:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * proc.c: fix grammar by @BenMorganIO [fix GH-764][ci skip]
-
-Mon Dec 1 10:49:53 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * man/rake.1: Update latest man content by @aledovsky
- [fix GH-771][ci skip]
-
-Mon Dec 1 10:42:31 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * doc/syntax/refinements.rdoc: refinements are no longer experimental.
- patch by @gaurish [fix GH-775][ci skip]
-
-Sun Nov 30 20:05:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (regexp_contents): fix a typo. pointed out by wanabe.
- [ruby-dev:48741] [Bug #10543]
-
-Sun Nov 30 18:55:32 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
- Don't raise Interrupt.
-
-Sun Nov 30 17:11:05 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking): Use
- assert_separately.
-
-Sun Nov 30 00:02:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_options, ruby_script): transcode script name and
- program name to locale encoding as well as argv.
- [ruby-dev:48752] [Bug #10555]
-
- * ruby.c (translit_char_bin): should not use code page dependent
- CharNext on UTF-8 string. [ruby-dev:48752] [Bug #10555]
-
-Sat Nov 29 16:53:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (ruby_set_argv): convert argv from UTF-8.
-
- * win32/win32.c (rb_w32_sysinit, cmdglob, w32_cmdvector): convert
- wide char command line to UTF-8 argv, and glob in UTF-8 so that
- metacharacters would match multibyte characters.
- [ruby-dev:48752] [Bug #10555]
-
-Sat Nov 29 10:49:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (win32_direct_conv, rb_w32_readdir): convert UTF-8
- and filesystem code page by using Win32 API directly.
-
-Sat Nov 29 09:37:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (syserr_initialize): simplify message building and get
- rid of potential invalid byte sequence.
-
-Sat Nov 29 06:09:44 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval_error.c (error_print): respect the encoding of the message.
-
- * io.c (rb_write_error_str): use rb_w32_write_console() on Windows
- if stderr is a tty.
-
-Fri Nov 28 05:10:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (--with-setup): add option to select ext/Setup file.
-
-Fri Nov 28 05:02:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dmyenc.c (Init_enc): separate from dmyext.c for statically
- linked extension excluding encoding libraries.
-
-Thu Nov 27 21:58:30 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk (miniprelude.c): It does not depend on prelude.rb now.
-
-Thu Nov 27 21:49:49 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: List up files built always in the source directory
- and source files built always in the build directory.
-
-Thu Nov 27 21:24:55 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: add obsolete callcc.
-
-Thu Nov 27 19:59:49 2014 Koichi Sasada <ko1@atdot.net>
-
- * compile.c (iseq_compile_each): remove duplicated line event.
- [Bug #10449]
-
- * test/ruby/test_settracefunc.rb: add and fix tests.
-
-Thu Nov 27 19:04:50 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_args.c: fix backtrace location for keyword related exceptions.
-
- For example, the following program
- def foo(k1: 1); end # line 1
- foo(k2: 2) # line 2
- causes "unknown keyword: k2 (ArgumentError)".
-
- Before this patch, the backtrace location is only line 2.
- However, error should be located at line 1 (over line 2 in
- stack trace). This patch fix this problem.
-
- * class.c (rb_keyword_error_new): separate exception creation logic
- from rb_keyword_error(), to use in vm_args.c.
-
- * vm_insnhelper.c (rb_arg_error_new): rename to rb_arity_error_new().
-
- * vm_args.c (argument_arity_error): rename to argument_arity_error().
-
- * vm_args.c (argument_kw_error): added to fix backtrace.
-
- * test/ruby/test_keyword.rb: add tests.
-
-Thu Nov 27 17:31:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (prelude.c): no longer depends on miniruby, since not
- depending on rbconfig.rb.
-
-Thu Nov 27 17:12:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (miniprelude.c): miniruby needs no preludes.
-
-Thu Nov 27 17:10:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/prelude.c.tmpl: no code if no prelude code is given.
-
-Thu Nov 27 13:11:00 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (objspace_malloc_increase): enable lazy sweep on GC by malloc()
- (malloc_increase) to make GC incrementally.
-
- This change can increase memory consumption. Report us if you find
- any problem.
-
-Thu Nov 27 12:46:38 2014 Tanaka Akira <akr@fsij.org>
-
- * time.c (time_s_mkutc): [DOC] Time.utc's 10 arguments form
- doesn't examine wday, yday, isdst and tz.
- (time_s_mktime): [DOC] Time.mktime's 10 arguments form
- doesn't examine wday, yday and tz.
- Suggested by naruse.
-
-Thu Nov 27 11:45:33 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (iseq_data_to_ary): add missing GC guard
-
-Thu Nov 27 10:51:59 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: add rb_thread_t::local_storage_recursive_hash
- to speed up Thread#[:__recursive_key__] access.
- [Bug #10511]
-
- * thread.c (threadptr_local_aref): add fast path for
- :__recursive_data__.
-
- * thread.c (threadptr_recursive_hash, threadptr_recursive_hash_set):
- add special accessor for recursive hash.
-
- * cont.c: store/restore local_storage_recursive_hash.
-
- * vm.c: init and mark local_storage_recursive_hash.
-
- * vm_trace.c (rb_threadptr_exec_event_hooks_orig): clear and restore
- local_storage_recursive_hash directly.
-
-Thu Nov 27 07:11:00 2014 Eric Wong <e@80x24.org>
-
- * compile.c (iseq_calc_param_size): hoist out of iseq_set_arguments
-
-Wed Nov 26 22:28:12 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_get_kwargs, rb_extract_keywords): export
- keyword argument functions.
-
-Wed Nov 26 21:18:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/inlinetest.rb: removed unused test helper.
-
-Wed Nov 26 20:47:28 2014 Masaya Tarui <tarui@ruby-lang.org>
-
- * ext/continuation/continuation.c (Init_continuation): obsolete callcc.
- first step of [Feature #10548].
-
-Wed Nov 26 19:57:54 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_gc.rb (test_latest_gc_info): do test separately
- to avoid mysterious behavior.
-
-Wed Nov 26 19:54:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (constat_reset): do nothing on non-standard
- console emulators. [ruby-core:66471] [Bug #10546]
-
-Wed Nov 26 19:44:13 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/tsort.rb: Returns an enumerator if no block is given.
- [ruby-core:66270] [Feature #10508] Proposed by Andrey Savchenko.
-
-Wed Nov 26 17:25:45 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (f_label, f_kw, formal_argument_gen): ignore invalid
- formal argument in keyword argument definition.
- [ruby-dev:48742] [Bug #10545]
-
-Wed Nov 26 15:32:06 2014 Koichi Sasada <ko1@atdot.net>
-
- * compile.c (iseq_set_sequence): use "nop" insn instead of
- "jump to next insn".
- https://bugs.ruby-lang.org/issues/8543#change-50085
-
-Wed Nov 26 11:01:35 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (iseq_s_compile_file): close IO when done
-
-Wed Nov 26 06:06:23 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk: encdb.h and transdb.h depends on $(PREP).
- So prebuild files for them in tarball are useless.
-
-Wed Nov 26 02:08:44 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/make-snapshot: Don't generate enc/trans/newline.c in tarball.
-
-Wed Nov 26 00:41:44 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk (prereq): Don't depends on prelude.c and golf_prelude.c.
- Since they depend on $(PREP) which is miniruby, they are rebuilt
- after miniruby is built, even if tarball contains them.
-
-Wed Nov 26 00:20:48 2014 Tanaka Akira <akr@fsij.org>
-
- * template/prelude.c.tmpl: Don't expand RbConfig::Config[...].
- It is not used now.
-
- * common.mk: prelude.c and golf_prelude.c doesn't depend on rbconfig.
-
-Tue Nov 25 17:07:06 2014 Koichi Sasada <ko1@atdot.net>
-
- * NEWS: add an "Implementation changes" section.
-
-Tue Nov 25 16:09:28 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/net/http.rb: Do not attempt SSL session resumption when the
- session is expired. [Bug #10533]
-
-Tue Nov 25 15:59:46 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rake: Update to rake 10.4.0
- * test/rake: ditto.
- * NEWS: ditto.
-
- * test/lib/minitest/unit.rb: Add compatibility shim for minitest 5.
- This only provides minitest 5 unit test naming compatibility.
-
-Tue Nov 25 15:26:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/vcs.rb (get_revisions): use Time.new instead of Time.mktime
- which does not accept UTC offset, and offset manually for older
- versions than 1.9.
-
-Tue Nov 25 12:14:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (Init_process): initialize static IDs before constant
- definitions. [ruby-core:66445]
-
-Tue Nov 25 10:32:23 2014 Eric Wong <e@80x24.org>
-
- * compile.c (iseq_build_callinfo_from_hash): hoist out
- (iseq_build_from_ary_body): shorten callinfo case
-
-Mon Nov 24 23:03:21 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * gems/bundled_gems: Update to test-unit 3.0.7.
-
-Mon Nov 24 12:44:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (check_exec_redirect_fd, check_exec_redirect),
- (rb_execarg_addopt): get rid of inadvertent ID pindown.
-
-Mon Nov 24 02:03:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_setter): preserve encoding of global variable
- name in error message.
-
-Mon Nov 24 02:03:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (rb_insn_operand_intern): preserve encoding of method
- name in CALL_INFO at disassembling.
-
-Mon Nov 24 02:02:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (must_respond_to): preserve encodings of variable name and
- class name in warning message.
-
-Sun Nov 23 10:46:23 2014 Eric Wong <e@80x24.org>
-
- * internal.h (struct rb_execarg): 160 => 144 bytes on x86-64
- * ruby.c (struct load_file_arg): 48 => 40 bytes on x86-64
- * vm_args.c (struct args_info): ditto
-
-Sun Nov 23 07:46:54 2014 Andy Maloney <asmaloney@gmail.com>
-
- * io.c (rb_io_sysread): Remove redundant assignment of 'n'.
- [Fix GH-767]
-
-Sat Nov 22 09:48:33 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/make-snapshot: Specify PWD macro for make.
- PWD environment variable may not exist.
-
-Fri Nov 21 11:58:58 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * lib/resolv.rb: fall back if canonicalization fails.
- Thanks Vit Ondruch for the patch! [ruby-core:65836]
-
- * test/resolv/test_dns.rb: test for patch
-
-Sat Nov 22 01:11:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_mod_const_get, rb_mod_const_defined): ditto.
-
- * variable.c (rb_const_missing, rb_mod_const_missing): call
- const_missing without new ID to get rid of inadvertent ID
- creation.
-
-Fri Nov 21 19:32:57 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (ext/ripper/ripper.c): revert about srcdir and top_srcdir.
-
- * common.mk (ext/ripper/ripper.c): use $(PWD) for Unix,
- $(MAKEDIR) for Windows.
-
-Fri Nov 21 18:12:37 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: Refactored.
-
-Fri Nov 21 14:25:40 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (top_srcdir): added because lacking this macro
- causes build error at r48526.
-
-Fri Nov 21 12:00:58 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps (in_makefile): Use FILES_NEED_VPATH and
- FILES_CONFUSING.
-
- * ext/objspace/extconf.rb: Add VPATH for id.h
-
-Fri Nov 21 09:10:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (ext/ripper/ripper.c): fix dependencies for the case
- to make ripper.y and id.h under the build directory.
-
-Fri Nov 21 08:42:21 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (ext/ripper/ripper.c): id.h in VPATH may exist in the build
- directory.
-
- * common.mk (ext/ripper/ripper.c): $(RM) was not defined.
-
-Fri Nov 21 00:36:09 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/openssl/lib/openssl/x509.rb
- (OpenSSL::X509::Name::RFC2253DN::StringChar): get rid of a false
- positive assertion in ripper's test.
-
-Fri Nov 21 00:29:51 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/net/imap.rb (Net::IMAP::ResponseParser::BEG_REGEXP): no need to
- use embed string.
-
-Fri Nov 21 00:19:17 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/uri/mailto.rb (URI::MailTo::EMAIL_REGEXP): should escape `#`.
-
-Thu Nov 20 23:17:11 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: Insert all dependencies found by compiler.
-
-Thu Nov 20 15:51:01 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/depend (nkf.o): add nkf.c as dependency.
- bsdmake tries to make nkf.o with nkf-utf8/nkf.c without this.
-
-Thu Nov 20 08:54:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (struct parser_params): reduce size by reordering
- members and an unused member.
-
-Thu Nov 20 02:44:27 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Vector#independent? and associated class method
- patch by gogo tanaka [#10451]
-
-Thu Nov 20 02:32:34 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add Vector#angle_with
- Patch by Egunov Dmitriy [#10442]
-
-Thu Nov 20 02:10:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (ripper_flush_string_content, parser_parse_string):
- preserve parsed string content. [ruby-dev:48714] [Bug #10437]
-
- * parse.y (ripper_new_yylval): abstract function to create ripper
- wrapper, and make it able to hold another object.
-
-Thu Nov 20 01:00:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (reg_named_capture_assign_gen): use predefined ID
- instead of rb_intern.
-
-Thu Nov 20 00:54:57 2014 Tanaka Akira <akr@fsij.org>
-
- * internal.h (ruby_init_setproctitle): Declare here.
-
-Thu Nov 20 00:26:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_here_document): append byte sequence directly to
- the delayed content instead of creating an intermediate string
- object.
-
-Wed Nov 19 21:11:01 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (ext/json/parser/parser.c): don't touch parse.c,
- ruby repo is a downstream.
-
-Wed Nov 19 20:38:11 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (ext/ripper/ripper.c): use $(PWD) to get
- <build-directory>/ext/ripper.
-
-Wed Nov 19 18:12:17 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/downloader.rb (RubyGems.download): Don't download gem if the
- version is already downloaded. A gem file is versioned and
- it must be identical if the version is the same.
-
-Wed Nov 19 17:59:25 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (ext/ripper/ripper.c): pass build directory as VPATH.
-
- * ext/ripper/depend (.y.c): use VPATH for y.tab.c.
-
-Wed Nov 19 10:07:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/prelude.c.tmpl (Prelude#translate): strip VPATH prefix
- from prelude names, so that srcdir differences do not make the
- generated code different.
-
-Wed Nov 19 07:45:11 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_write): should set the error of
- GetOverlappedResult()'s, not WriteFile()'s (it's always
- ERROR_IO_PENDING, of course).
-
-Tue Nov 18 14:16:47 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_record): add information for debug print.
-
-Wed Nov 19 04:49:07 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * debug.c (set_debug_option): need the declaration.
-
- * debug.c (set_debug_option): use the same macro with the implementation
- at win32/win32.c.
-
-Wed Nov 19 04:16:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (symbol_list): fix the node type of literal symbol list
- with no interpolation. [ruby-core:66343]
-
-Wed Nov 19 00:26:15 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: Sort dependencies.
-
-Wed Nov 19 00:24:18 2014 Tanaka Akira <akr@fsij.org>
-
- * enc/encdb.c: Include internal.h.
-
-Tue Nov 18 23:23:45 2014 Tanaka Akira <akr@fsij.org>
-
- * internal.h: Gather declarations in non-header files.
-
-Tue Nov 18 23:45:52 2014 Tanaka Akira <akr@fsij.org>
-
- * debug.c (SET_WHEN): Don't declare debug variables here.
- ruby_initial_gc_stress_ptr is changed int* to VALUE* at r41406.
-
- * internal.h (ruby_initial_gc_stress_ptr): Declared.
- (ruby_enable_coredump): Ditto.
-
-Tue Nov 18 18:06:43 2014 Tanaka Akira <akr@fsij.org>
-
- * include/ruby/io.h (FMODE_WSPLIT): Removed. The write() system call
- is not required to split. It was useful to avoid whole process
- blocking in Ruby 1.8 but not useful since write() is invoked without
- GVL.
- (FMODE_WSPLIT_INITIALIZED): Ditto.
-
- * io.c (wsplit_p): Removed.
- (io_writable_length): Removed.
- (rb_fcntl): Don't update the removed flags.
-
-Tue Nov 18 03:23:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (check_setter_id): show the original argument instead
- of nil on TypeError.
-
-Tue Nov 18 03:20:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.h (is_{local,global,instance,attrset,const,class,junk}_sym):
- fix ID type names.
-
-Mon Nov 17 20:17:59 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_event.c: use typed data.
-
-Mon Nov 17 12:54:56 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rubygems/*, test/rubygems/*: Update to RubyGems 2.4.4
- master (2f6e42e).
-
-Mon Nov 17 06:13:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (proc_binding): use the original iseq on a binding from
- proc from method object to get the location.
-
-Sun Nov 16 19:38:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_current_receiver): new function to return the
- receiver in the current control frame. [Feature #10195]
-
-Sun Nov 16 19:11:04 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/timeout.rb (Timeout::ExitException#exception): rescue
- UncaughtThrowError which is specific for throw, instead of
- ArgumentError.
-
-Sun Nov 16 18:22:18 2014 Eric Wong <e@80x24.org>
-
- * tool/update-deps: warning to disable ccache
-
-Sun Nov 16 13:11:35 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk (CCAN_LIST_INCLUDES): Unused variable removed.
- (ENCODING_H_INCLUDES): Ditto.
- (PROBES_H_INCLUDES): Ditto.
- (VM_CORE_H_INCLUDES): Ditto.
-
-Sun Nov 16 11:07:25 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_io.rb (test_readpartial_locktmp):
- remove unnecessary begin/end
-
-Sun Nov 16 00:45:23 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk: Specify dependencies for generated C sources.
-
-Sat Nov 15 23:10:45 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk: No need to declare dependencies which
- will be detected by inference rules.
-
-Sat Nov 15 20:34:23 2014 Tanaka Akira <akr@fsij.org>
-
- * internal.h: Include ruby.h and ruby/encoding.h to be
- includable without prior inclusion.
-
-Sat Nov 15 20:46:44 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb
- (REXMLTests::TestDocument::EntityExpansionLimitTest):
- Group tests by general entity and parameter entity.
-
-Sat Nov 15 20:43:31 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb
- (REXMLTests::TestDocument::EntityExpansionLimitTest): Define
- test XML in each test method because (1) each XML in used only
- one test and (2) related data and code should be close.
-
-Sat Nov 15 20:39:06 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb
- (REXMLTests::TestDocument::EntityExpansionLimitTest): Use
- one test method for one test.
-
-Sat Nov 15 20:16:59 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb
- (REXMLTests::TestDocument::EntityExpansionLimitTest): Use
- setup and teardown instead of ensure in test.
-
-Sat Nov 15 20:11:34 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb (REXMLTests::TestDocument): Group
- entity expansion limit related tests.
-
-Sat Nov 15 20:09:00 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb (REXMLTests::TestDocument::BomTest):
- Fix wrong parent class. It doesn't need inherit tests in
- TestDocument class.
-
-Sat Nov 15 19:48:59 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (depend_rules): support comments during a line.
-
- * lib/mkmf.rb (depend_rules): apply RULE_SUBST even if the dependency
- file contains path.
-
-Sat Nov 15 19:25:46 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk: Remove comments in Dependency lines.
- Notified by usa.
-
- * enc/depend: Ditto.
-
- * ext/**/depend: Ditto.
-
-Sat Nov 15 16:28:05 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_throw_obj): throw UncaughtThrowError instead of
- ArgumentError. [Feature #10480]
-
-Sat Nov 15 14:13:38 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: Extend to fix dependencies.
-
- * common.mk: Dependencies updated by tool/update-deps.
-
- * enc/depend: Ditto.
-
- * ext/**/depend: Ditto.
-
-Fri Nov 14 17:36:48 2014 Tanaka Akira <akr@fsij.org>
-
- * tool/update-deps: Support GNU Make 4.0.
-
-Fri Nov 14 16:59:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (default_proc_for_compat_func): check arguments number and
- type, and get rid of reentering this default proc.
-
-Fri Nov 14 16:33:06 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): support compatible layer for
- GC.stat(symbol) type access.
-
-Fri Nov 14 16:19:08 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): add compatible layer.
- From Ruby 2.2, keys of GC.stat are changed [Feature #9924].
- To provide compatible layer, GC.stat add a default_proc
- (if default_proc of given Hash object is not set).
-
- At first use of this compatible layer of interpreter process,
- show a warning message like that:
- program: GC.stat[:total_allocated_object]
- warning message: "warning: GC.stat keys were changed from Ruby
- 2.1. In this case, you refer to obsolete `total_allocated_object'
- (new key is `total_allocated_objects').
- Please check <https://bugs.ruby-lang.org/issues/9924>
- for more information."
-
- Please correct my English message :)
-
- * hash.c (rb_hash_set_default_proc): export (in internal).
-
- * internal.h: ditto.
-
-Fri Nov 14 10:41:25 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: guard by #if/#endif with GC_ENABLE_INCREMENTAL_MARK
- to hide unused codes.
-
- * gc.c: similar to GC_ENABLE_LAZY_SWEEP.
-
-Fri Nov 14 10:23:35 2014 Eric Wong <e@80x24.org>
-
- * vm_eval.c (rb_eval_cmd): use pre-defined idCall
-
-Fri Nov 14 09:25:44 2014 Eric Wong <e@80x24.org>
-
- * vm_eval.c (rb_yield_splat): add missing GC guard
- [Bug #10509]
-
-Fri Nov 14 08:12:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gc.c: fix build error caused by implicit conversion with clang.
-
-Fri Nov 14 06:54:06 2014 Eric Wong <e@80x24.org>
-
- * insns.def (opt_succ): remove Time#succ optimization
- [Feature #10501]
-
-Fri Nov 14 05:29:46 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: refactoring.
-
- * gc.c: use GC_ENABLE_INCREMENTAL_MARK instead of USE_RINCGC.
-
- * gc.c (gc_start): check FORCE_MAJOR_GC.
-
-Fri Nov 14 04:51:18 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: Tuning RincGC parameters.
-
- Before this patch, gc_marks_step() marks (white -> grey) fixed
- number objects. However, this strategy does not fit practical
- cases, for example too slow to make progress.
-
- This patch changes this strategy how many objects the
- gc_marks_step() should handle.
-
- We can estimate how many times gc_marks_step() is called during
- this major marking (== C) with the free slot number in pooled
- pages. We also can estimate the living object number (== L)
- using last marked_slots value. We can solve this problem (how
- many objects should be process in gc_marks_step()) by L/C.
-
- * gc.c (rb_objspace_t): add rb_objspace_t::rincgc::pooled_slots and
- step_slots.
-
-Fri Nov 14 01:26:47 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (search_response): parse MODSEQ in SEARCH
- responses properly. [ruby-core:64203] [Bug #10112]
-
-Fri Nov 14 01:03:17 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/envutil.rb: Moved from test/ruby/.
-
- * test/lib/find_executable.rb: Ditto.
-
- * test/lib/memory_status.rb: Ditto.
-
- * test/lib/test/unit.rb: require envutil.
-
- * test/: Don't require envutil in test files.
-
-Thu Nov 13 21:59:58 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * lib/rexml/document.rb: add REXML::Document#document.
- reported by Tomas Hoger <thoger@redhat.com> and patched by nahi.
-
-Thu Nov 13 21:51:56 2014 Tanaka Akira <akr@fsij.org>
-
- * test/monitor/test_monitor.rb: Use assert_join_threads.
-
-Thu Nov 13 21:45:13 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl: Don't specify port number.
-
-Thu Nov 13 21:22:35 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl/ssl_server.rb: Unused file removed.
- It is not used since r16111, Ruby 1.9.1.
-
-Thu Nov 13 18:50:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_ensure): remove obsolete prot_tag comment. patch by
- Jack Danger at [ruby-core:66238]. [misc #10502]
-
-Thu Nov 13 18:10:38 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (rb_vm_make_proc_lambda): similar to rb_vm_make_proc() with
- is_lambda argument.
-
-Thu Nov 13 12:11:18 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_fstat{,i64}): speed up. adjusting
- timestamps in this function is to get rid of the side effect of
- ENV["TZ"]. then, if ENV["TZ"] is not set, no need to adjust.
- this change makes File#stat about 60% faster.
-
-Thu Nov 13 11:56:12 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * st.c: include "internal.h" for STATIC_ASSERT.
-
-Thu Nov 13 03:56:38 2014 Eric Wong <e@80x24.org>
-
- * gc.c (struct heap_page): trivial packing
- 304 => 296 bytes on x86-64
-
-Wed Nov 12 22:50:12 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gems/bundled_gems: Update to test-unit 3.0.6 and minitest 5.4.3.
-
-Wed Nov 12 22:30:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rubygems/*: Update to RubyGems 2.4.3 master (7b1f684).
-
-Wed Nov 12 00:26:37 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_object.rb: Specify an exception class for rescue clause.
-
- * test/dbm/test_dbm.rb: Ditto.
-
- * test/gdbm/test_gdbm.rb: Ditto.
-
- * test/sdbm/test_sdbm.rb: Ditto.
-
-Tue Nov 11 23:43:51 2014 Tanaka Akira <akr@fsij.org>
-
- * test/fileutils/test_fileutils.rb: Use assert_join_threads.
-
-Tue Nov 11 22:51:14 2014 Tanaka Akira <akr@fsij.org>
-
- * test/resolv/test_dns.rb: Use assert_join_threads.
-
-Tue Nov 11 22:33:08 2014 Tanaka Akira <akr@fsij.org>
-
- * test/net/pop/test_pop.rb: Use assert_join_threads.
-
-Tue Nov 11 22:07:20 2014 Tanaka Akira <akr@fsij.org>
-
- * test/net/http/test_https_proxy.rb: Use assert_join_threads.
-
-Tue Nov 11 18:09:11 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/prelude.c.tmpl: move from tool/compile_prelude.rb and
- expand by generic_erb.rb.
-
-Tue Nov 11 13:01:31 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/rubygems/commands/contents_command.rb (files_in_default_gem):
- remove useless sort. show_files will sort the result and
- another branch, files_in_gem, doesn't sort.
- it should be removed for consistency.
-
- * test/rubygems/test_gem_commands_contents_command.rb
- (test_execute_default_gem): adjust the sort algorithm with
- Gem::Commands::ContentsCommand#show_files, which sort items
- as array of [prefix, basename] not strings.
-
-Tue Nov 11 10:37:09 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (sym_equal): use rb_obj_equal().
- rb_obj_equal() is specially optimized in
- opt_eq_func()@vm_insnhelper.c.
-
- This fix is made from this discussion:
- https://www.omniref.com/ruby/2.1.4/symbols/Symbol/%3D%3D#line=8361.
-
-Tue Nov 11 09:38:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rdoc/known_classes.rb: reverted regression changes of
- rdoc known class.
-
-Tue Nov 11 00:21:50 2014 Tanaka Akira <akr@fsij.org>
-
- * test/net/imap/test_imap.rb: Don't ignore exceptions on server
- threads.
-
-Mon Nov 10 23:34:13 2014 Tanaka Akira <akr@fsij.org>
-
- * test/net/ftp/test_ftp.rb (create_ftp_server): Don't ignore
- exceptions on server thread.
- Delete read_timeout method call to fix NoMethodError.
-
-Mon Nov 10 20:20:53 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_read): retry with reduced length if cannot to
- write any data but no error occurs.
-
-Mon Nov 10 20:04:16 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/server.rb: Setup shutdown pipe in listen method.
-
-Mon Nov 10 19:37:09 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c, include/win32/win32.h (rb_w32_set_nonblock): new
- function to support nonblock-mode of pipes.
-
- * win32/win32.c (rb_w32_read): nonblock-mode pipe returns ERROR_NO_DATA
- if there is no data, but also returns it if remote-end is closed.
-
- * win32/win32.c (rb_w32_write): if cannot to write any data, it may be
- blocking.
-
- * io.c (rb_io_set_nonblock): use rb_w32_set_nonblock for Windows.
-
- * ext/io/nonblock/nonblock.c (rb_io_nonblock_set): use ruby's API when
- setting nonblock-mode.
-
- * test/ruby/test_io.rb: test nonblock pipes on Windows.
-
-Mon Nov 10 17:24:34 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (etc_getlogin): set login name encoding properly.
- [ruby-core:66163] [Bug #10493]
-
-Mon Nov 10 16:20:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rubygems/*.rb: Update to RubyGems master(3e36528).
-
-Mon Nov 10 16:09:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (rb_f_kill): [DOC] mention known signal list.
- [ruby-core:66162] [Bug #10492]
-
-Mon Nov 10 14:17:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rdoc/*.rb: Update to RDoc 4.2.0.alpha(579a11c)
-
-Mon Nov 10 12:44:39 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/server.rb: Less instance variables.
-
-Mon Nov 10 12:19:43 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/server.rb (shutdown): Use close() on @shutdown_pipe_w to
- notify readability on the read side of the pipe.
- write_nonblock() is not usable for pipe on Windows.
- (cleanup_shutdown_pipe): Rescue IOError for @shutdown_pipe_w.close.
-
-Mon Nov 10 07:31:59 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/server.rb (initialize): Initialize shutdown pipe here
- to avoid race condition.
- (cleanup_shutdown_pipe): New private method.
- (cleanup_listener): Extracted from shutdown method.
- Call this method from start method to avoid race condition.
-
-Mon Nov 10 05:57:53 2014 Tanaka Akira <akr@fsij.org>
-
- * test/webrick/webrick.cgi: Don't use debug mode.
-
- * test/webrick/webrick_long_filename.cgi: Ditto.
-
-Sun Nov 9 23:25:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (vm_call_super): allow bound proc method to call super
- method.
-
- * vm_insnhelper.c (vm_yield_with_cfunc): push defined class and
- bound proc method entry to the control frame.
-
-Sun Nov 9 22:46:13 2014 Tanaka Akira <akr@fsij.org>
-
- * test/open-uri: Test server log in server thread.
-
- * test/webrick: Ditto.
-
-Sun Nov 9 22:28:34 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/httpstatus.rb: require webrick/accesslog for AccessLog.
-
-Sun Nov 9 21:03:59 2014 Tanaka Akira <akr@fsij.org>
-
- * test/webrick: Fix the argument order of assert_equal.
-
-Sun Nov 9 20:29:01 2014 Tanaka Akira <akr@fsij.org>
-
- * test/webrick: Store log in an array.
-
- * test/net/http: Ditto.
-
- * test/open-uri: Ditto.
-
-Sun Nov 9 18:35:36 2014 Tanaka Akira <akr@fsij.org>
-
- * test/xmlrpc: Refine log test.
-
-Sun Nov 9 18:33:33 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: Replaced if-else by
- case in self.normalized? in parallel to r48309.
-
-Sun Nov 9 18:07:00 2014 Tanaka Akira <akr@fsij.org>
-
- * test/xmlrpc: Use assert_join_threads.
-
-Sun Nov 9 14:06:13 2014 Tanaka Akira <akr@fsij.org>
-
- * test/xmlrpc: Test webrick error log is empty.
-
-Sun Nov 9 13:47:02 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (is_incremental_marking): use #if/#else because
- rb_objspace_t::flags::during_incremental_marking is not defined
- when GC_ENABLE_INCREMENTAL_MARK is 0.
-
- * gc.c (will_be_incremental_marking, is_full_marking): similar fix.
-
-Sun Nov 9 12:16:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/securerandom.rb (SecureRandom.gen_random): separate
- implementation details and select at the load time.
-
-Sun Nov 9 12:09:38 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/lib/win32/registry.rb (Win32::Registry::API#Enum{Value,Key):
- ditto.
-
-Sun Nov 9 11:48:40 2014 Tanaka Akira <akr@fsij.org>
-
- * test/net/http: Examine webrick log.
-
-Sun Nov 9 11:45:19 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gems/bundled_gems: upgraded to test-unit 3.0.5.
-
-Sun Nov 9 11:40:50 2014 Tanaka Akira <akr@fsij.org>
-
- * defs/known_errors.def: More errors for FreeBSD.
-
-Sun Nov 9 11:25:11 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * gems/bundled_gems: upgraded to power_assert 0.2.0.
-
-Sun Nov 9 10:31:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/securerandom.rb: set the script encoding to make a string
- literal in SecureRandom::Kernel32.last_error_message single byte
- encoding so msg[] works in bytes, since FormatMessage() returns
- the size in TCHARs, not in characters.
-
-Sun Nov 9 09:50:22 2014 Tanaka Akira <akr@fsij.org>
-
- * test/webrick: Refine log tests.
-
-Sun Nov 9 08:58:05 2014 Tanaka Akira <akr@fsij.org>
-
- * defs/known_errors.def (EHWPOISON): New errno symbol.
- It is defined by glibc-2.16.
-
-Sun Nov 9 05:00:23 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/securerandom.rb (initialize): call the special method for Win32
- before checking `/dev/urandom` because we know windows doesn't have it.
-
-Sun Nov 9 04:01:46 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/securerandom.rb (SecureRandom::AdvApi32): split from `initialize`.
- thanks @zzak to remember it.
-
-Sun Nov 9 02:05:33 2014 Tanaka Akira <akr@fsij.org>
-
- * test/net/http/utils.rb: Don't connect to spawned server
- before actual test.
-
-Sun Nov 9 01:51:50 2014 Benoit Daloze <eregontp@gmail.com>
-
- * object.c (Module#const_defined?): [DOC] Revise the documentation.
- Patch by Xavier Noria.
- [Fixes GH-754] https://github.com/ruby/ruby/pull/754
-
-Sun Nov 9 00:37:44 2014 Tanaka Akira <akr@fsij.org>
-
- * test/webrick: Examine log and use assert_join_threads.
-
-Fri Nov 7 00:00:12 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * template/unicode_norm_gen.tmpl: expand kompatible_table so that
- recursive expansion is not needed at runtime.
-
-Thu Nov 6 23:58:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (pack_pack): escape unprintable characters and preserve
- the encoding of warning message.
-
-Thu Nov 6 23:55:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (sym_printable): QUOTE() should not raise an exception
- even on invalid byte sequence.
-
-Thu Nov 6 21:44:36 2014 Tanaka Akira <akr@fsij.org>
-
- * test/test_unicode_normalize.rb: Rename TestNormalize to
- TestUnicodeNormalize.
- Define constants under TestUnicodeNormalize.
-
-Thu Nov 6 21:22:59 2014 Tanaka Akira <akr@fsij.org>
-
- * test/open-uri/test_open-uri.rb: Check empty webrick log.
-
-Thu Nov 6 19:27:34 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (unescape_nonascii): cast -1 for the case char is unsigned char.
- If char is signed char, for example gcc for ARM or ppc64, it caused
- infinite loop.
- http://kmuto.jp/build-ruby/arm/ruby-trunk/log/20141106T013005Z.fail.html.gz
- http://rubyci.blob.core.windows.net/f19p8/ruby-trunk/log/20141106T090217Z.fail.html.gz
-
-Thu Nov 6 09:53:18 2014 Eric Wong <e@80x24.org>
-
- * lib/uri/rfc2396_parser.rb (initialize): reduce bytecode size
- 2088 => 1332 bytes on 32-bit x86
-
-Thu Nov 6 08:49:49 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: Comment clarification.
-
-Wed Nov 5 23:43:24 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * compile.c (compile_data_alloc): add padding when strict alignment
- is required for memory access. Currently, the padding is enabled
- only when the CPU is 32-bit SPARC and the compiler is GCC.
- [Bug #9681] [ruby-core:61715]
-
- * compile.c (STRICT_ALIGNMENT): defined if strict alignment is required
-
- * compile.c (ALIGNMENT_SIZE, ALIGNMENT_SIZE_MASK, PADDING_SIZE_MAX):
- new macros for alignment word size, bit mask, max size of padding.
-
- * compile.c (calc_padding): new function to calculate padding size.
-
-Wed Nov 5 23:24:45 2014 Tanaka Akira <akr@fsij.org>
-
- * test/open-uri/test_open-uri.rb: Don't ignore webrick's log.
-
-Wed Nov 5 19:20:08 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/server.rb: Stop listener loop properly.
- [ruby-core:66085] [Bug #10478] Fixed by Charles Nutter.
-
-Wed Nov 5 17:20:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/intern.h (rb_disable_super, rb_enable_super): warn
- as deprecated at build time, instead of ignoring silently or
- warning at runtime only.
-
-Wed Nov 5 16:55:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (rb_f_lambda): remove deprecated function, which has been
- unavailable from extension libraries.
-
-Wed Nov 5 16:26:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/intern.h (rb_clear_cache): mark as deprecated, not
- only warnings at runtime.
-
-Wed Nov 5 15:05:12 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_{,l,r}strip_bang): rb_str_subseq() will not
- NUL-terminate the result string, in the future, so it will not
- be needed in other cases.
-
-Wed Nov 5 14:11:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (lib/unicode_normalize/tables.rb): do nothing unless
- BASERUBY is available. MINIRUBY cannot load extension libraries,
- so cannot update Unicode data.
-
-Wed Nov 5 12:13:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_lstrip, rb_str_strip): reduce memory copy by
- copying necessary part only.
-
- * string.c (rb_str_strip_bang, rb_str_strip): ditto.
-
-Wed Nov 5 12:13:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_lstrip, rb_str_strip): reduce memory copy by
- copying necessary part only.
-
- * string.c (rb_str_strip_bang, rb_str_strip): ditto.
-
-Wed Nov 5 10:54:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_lstrip_bang, rb_str_rstrip_bang): terminate
- wchar strings with wchar 0.
-
-Tue Nov 4 21:23:22 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/win32/lib/Win32API.rb: Fiddle::Importer is defined in
- fiddle/import.rb and it's not loaded implicitly.
-
- * ext/win32/lib/Win32API.rb (Win32API#initialize): `import` is a string.
-
- * ext/win32/lib/Win32API.rb (Win32API#initialize):
- Fiddle::Importer::CALL_TYPE_TO_ABI is private constant.
-
-Tue Nov 4 21:20:07 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/securerandom.rb (SecureRandom.random_bytes): use fiddle directly
- instead of using Win32API.
-
-Tue Nov 4 21:04:30 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/rubygems/test_gem_request_set_lockfile.rb
- (test_relative_path_from): driveletter support.
-
-Tue Nov 4 16:23:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/rubygems/test_gem_remote_fetcher.rb (RemoteFetcherCleanup):
- close all pooled connections for each tests to fix leaked file
- descriptors.
-
-Tue Nov 4 12:51:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (PRIsVALUE), vsnprintf.c (BSD_vfprintf): add
- RUBY_PRI_VALUE_MARK to reduce danger of accidental conflict with
- plain "%i". binary incompatible with extension libraries using
- PRIsVALUE and built for 2.1 and earlier. [EXPERIMENTAL]
-
-Tue Nov 4 12:33:44 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * object.c: fix document of Kernel#String by @suzukaze
- [fix GH-743][ci skip]
-
-Tue Nov 4 12:21:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/csv.rb: added documentation for skip_blanks option by @decasia
- [fix GH-744][ci skip]
-
-Tue Nov 4 12:09:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/open3.rb: fix code formatting in documentation by @JoshCheek
- [fix GH-747][ci skip]
-
-Tue Nov 4 08:57:37 2014 Eric Wong <e@80x24.org>
-
- * encoding.c (enc_memsize): remove unnecessary function
- [ruby-core:65304]
-
-Mon Nov 3 18:09:39 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl/utils.rb: The default of :ignore_listener_error is
- changed to false.
-
-Mon Nov 3 14:42:37 2014 Koichi Sasada <ko1@atdot.net>
-
- * iseq.c (iseq_free): resolve memory leak.
-
-Mon Nov 3 13:49:18 2014 Koichi Sasada <ko1@atdot.net>
-
- * iseq.c (iseq_memsize): catch up recent changes.
-
-Mon Nov 3 13:38:28 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: change semantics of opt_num and opt_table.
- `opt_num' was the number of optional parameters + 1.
- `opt_table' has "opt_num" entries.
-
- Change them to:
- `opt_num' is the number of optional parameters.
- `opt_table' has "opt_num + 1" entries.
-
- This change simplify parameter fitting logics.
-
- * compile.c: catch up this change.
-
- * iseq.c: ditto.
-
- * proc.c: ditto.
-
- * vm_args.c: ditto.
-
-Mon Nov 3 11:47:44 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * NEWS: added period into Matrix section. [ci skip]
- [misc #10446][ruby-core:65987]
-
-Mon Nov 3 09:43:30 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * vm_args.c: fixed build error with clang
-
-Mon Nov 3 09:32:46 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/rfc3986_parser.rb (URI::RFC3986_Parser::RFC3986_URI):
- allow '[' and ']' for URI input (and escape). [Bug #10402]
-
- * lib/uri/generic.rb (URI#query=): escape '[', '\', and ']'.
-
-Mon Nov 3 07:49:34 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: change iseq parameter data structure.
- https://bugs.ruby-lang.org/issues/10440#change-49694
-
- * change terminology `arg' to `param'.
- * move rb_iseq_t::arg_* to rb_iseq_t::param.
- * move rb_iseq_t::arg_size to rb_iseq_t::param::size.
- * move rb_iseq_t::argc to rb_iseq_t::param::lead_num.
- * move rb_iseq_t::arg_opts to rb_iseq_t::param::opt_num.
- * move rb_iseq_t::arg_rest to rb_iseq_t::param::rest_start.
- * move rb_iseq_t::arg_post_num to rb_iseq_t::param::post_num.
- * move rb_iseq_t::arg_post_start to rb_iseq_t::param::post_start.
- * move rb_iseq_t::arg_block to rb_iseq_t::param::block_start.
- * move rb_iseq_t::arg_keyword* to rb_iseq_t::param::keyword.
- rb_iseq_t::param::keyword is allocated only when keyword
- parameters are available.
- * introduce rb_iseq_t::param::flags to represent parameter
- availability. For example, rb_iseq_t::param::flags::has_kw
- represents that this iseq has keyword parameters and
- rb_iseq_t::param::keyword is allocated.
- We don't need to compare with -1 to check availability.
- * remove rb_iseq_t::arg_simple.
-
- * compile.c: catch up this change.
-
- * iseq.c: ditto.
-
- * proc.c: ditto.
-
- * vm.c, vm_args.c, vm_dump.c, vm_insnhelper.c: ditto.
-
- * iseq.c (iseq_data_to_ary): support keyword argument.
-
-Mon Nov 3 03:39:04 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_method.rb: r48239 makes this test green.
-
-Mon Nov 03 03:02:38 2014 Koichi Sasada <ko1@atdot.net>
-
- * rewrite method/block parameter fitting logic to optimize
- keyword arguments/parameters and a splat argument.
- [Feature #10440] (Details are described in this ticket)
-
- Most of complex part is moved to vm_args.c.
-
- Now, ISeq#to_a does not catch up new instruction format.
-
- * vm_core.h: change iseq data structures.
-
- * introduce rb_call_info_kw_arg_t to represent keyword arguments.
- * add rb_call_info_t::kw_arg.
- * rename rb_iseq_t::arg_post_len to rb_iseq_t::arg_post_num.
- * rename rb_iseq_t::arg_keywords to arg_keyword_num.
- * rename rb_iseq_t::arg_keyword to rb_iseq_t::arg_keyword_bits.
- to represent keyword bitmap parameter index.
- This bitmap parameter shows that which keyword parameters are given
- or not given (0 for given).
- It is referred by `checkkeyword' instruction described bellow.
- * rename rb_iseq_t::arg_keyword_check to rb_iseq_t::arg_keyword_rest
- to represent keyword rest parameter index.
- * add rb_iseq_t::arg_keyword_default_values to represent default
- keyword values.
- * rename VM_CALL_ARGS_SKIP_SETUP to VM_CALL_ARGS_SIMPLE
- to represent
- (ci->flag & (SPLAT|BLOCKARG)) &&
- ci->blockiseq == NULL &&
- ci->kw_arg == NULL.
-
- * vm_insnhelper.c, vm_args.c: rewrite with refactoring.
-
- * rewrite splat argument code.
- * rewrite keyword arguments/parameters code.
- * merge method and block parameter fitting code into one code base.
-
- * vm.c, vm_eval.c: catch up these changes.
-
- * compile.c (new_callinfo): callinfo requires kw_arg parameter.
-
- * compile.c (compile_array_): check the last argument Hash object or
- not. If Hash object and all keys are Symbol literals, they are
- compiled to keyword arguments.
-
- * insns.def (checkkeyword): add new instruction.
- This instruction check the availability of corresponding keyword.
-
- For example, a method "def foo k1: 'v1'; end" is compiled to the
- following instructions.
-
- 0000 checkkeyword 2, 0 # check k1 is given.
- 0003 branchif 9 # if given, jump to address #9
- 0005 putstring "v1"
- 0007 setlocal_OP__WC__0 3 # k1 = 'v1'
- 0009 trace 8
- 0011 putnil
- 0012 trace 16
- 0014 leave
-
- * insns.def (opt_send_simple): removed and add new instruction
- "opt_send_without_block".
-
- * parse.y (new_args_tail_gen): reorder variables.
- Before this patch, a method "def foo(k1: 1, kr1:, k2: 2, **krest, &b)"
- has parameter variables "k1, kr1, k2, &b, internal_id, krest",
- but this patch reorders to "kr1, k1, k2, internal_id, krest, &b".
- (locate a block variable at last)
-
- * parse.y (vtable_pop): added.
- This function remove latest `n' variables from vtable.
-
- * iseq.c: catch up iseq data changes.
-
- * proc.c: ditto.
-
- * class.c (keyword_error): export as rb_keyword_error().
-
- * common.mk: depend vm_args.c for vm.o.
-
- * hash.c (rb_hash_has_key): export.
-
- * internal.h: ditto.
-
-Mon Nov 3 02:35:32 2014 Koichi Sasada <ko1@atdot.net>
-
- * sample/simple-bench.rb: added to measure performance of simple
- lines.
-
-Mon Nov 3 02:33:43 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (obj_info): show T_STRING more details.
-
-Sun Nov 2 01:30:32 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl/test_ssl.rb: Don't ignore errors on listener threads,
- as much as possible.
-
- * test/openssl/test_ssl_session.rb: Ditto.
-
- * test/openssl/test_partial_record_read.rb: Ditto.
-
-Sat Nov 1 23:11:05 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl/utils.rb (start_server): Don't close sockets before
- threads finished.
-
-Sat Nov 1 22:06:24 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl/test_ssl_session.rb (test_ctx_client_session_cb): Don't
- ignore errors of SSL accept.
- (test_ctx_server_session_cb): Ditto.
-
- * test/openssl/utils.rb (server_loop): Add ignore_ssl_accept_error
- argument.
- (start_server): Refine threads waits.
-
- * test/ruby/envutil.rb (assert_join_threads): Show a thread before
- backtrace.
-
-Sat Nov 1 20:40:18 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl/utils.rb (start_server, server_loop): Use a
- pipe to stop server instead of shutdown/close a listening socket.
-
-Sat Nov 1 19:24:59 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/envutil.rb (assert_join_threads): New assertion to
- join multiple threads without exceptions.
-
-Sat Nov 1 17:09:32 2014 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (bary_mul_balance_with_mulfunc): Fix free work area
- location.
- [ruby-dev:48723] [Bug #10464]
- [ruby-core:66044] [Bug #10465]
- Reported by Kohji Nishihama.
-
-Sat Nov 1 15:45:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parse_atmark): mere atmark and two atmarks without
- succeeding identifiers are invalid as instance/class variable
- names.
-
-Sat Nov 1 06:31:41 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_variant.c: use typed data.
-
-Fri Oct 31 13:55:28 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/dl/*: remove DL as it is replaced by Fiddle.
- [Feature #5458] Thanks to Jonan Scheffler <jonanscheffler@gmail.com>
- for this patch
-
- * test/dl/*: ditto.
-
-Fri Oct 31 15:26:02 2014 Charles Oliver Nutter <headius@headius.com>
-
- * test/openssl/test_ssl.rb: Add certificate verification chain
- test from JRuby community.
-
-Fri Oct 31 18:58:02 2014 Charles Oliver Nutter <headius@headius.com>
-
- * test/psych/test_emitter.rb: Fix line_width test...initial value
- is impl-specific and attr assignment always returns LHS.
-
-Fri Oct 31 22:19:30 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/digest/lib/digest.rb (Digest()): This function should now be
- thread-safe. If you have a problem with regard to on-demand
- loading under a multi-threaded environment, preload "digest/*"
- modules on boot or use this method instead of directly
- referencing Digest::*. [Bug #9494]
- cf. https://github.com/aws/aws-sdk-ruby/issues/525
-
-Fri Oct 31 21:33:17 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * test/digest/test_digest.rb: Drop #!. This no longer runs
- stand-alone because it depends on ruby/envutil.
-
-Fri Oct 31 17:22:19 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/setup.mak: $(APPEND) with some arguments insert a space before
- the arguments, so it causes error if the arguments are expected to be
- a macro definition. this fix resolve the build error introduced at
- r48210.
-
-Fri Oct 31 16:47:35 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/syslog/lib/syslog/logger.rb (Syslog::Logger::VERSION): Bump
- the VERSION to 2.1.0. [ruby-core:64483] [Bug #10159]
-
-Fri Oct 31 16:33:46 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/net/imap.rb (Net::IMAP#fetch): [DOC] Document that
- Net::IMAP#fetch will return nil instead of an empty array.
-
-Fri Oct 31 12:54:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (.unicode-tables.time): needs Unicode files always,
- and should update after downloading these files.
- [ruby-core:66026] [Bug #10461]
-
-Fri Oct 31 10:16:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: reverted r48199, it's unrelated configuration.
-
-Fri Oct 31 09:58:14 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_unicode_normalize.rb: added unicode version number to
- test data location.
-
-Fri Oct 31 09:56:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .gitignore: ignored unicode data with version directories.
-
-Fri Oct 31 09:35:30 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: tweak build scripts for unicode_normalize.rb.
-
-Thu Oct 30 18:47:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk: fix for the case ALWAYS_UPDATE_UNICODE=no
-
-Thu Oct 30 13:23:23 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: changed Unicode data download location
- from latest Unicode version to Unicode 7.0.0.
-
-Thu Oct 30 11:16:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_callee_setup_arg{_complex,}): try conversion
- by to_ary for a lambda, as well as a proc.
- [ruby-core:65887] [Bug #9605]
-
-Wed Oct 29 21:13:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (gettable_gen): warn circular argument reference, for
- transition from 2.1 and earlier. [ruby-core:65990] [Bug #10314]
-
-Wed Oct 29 20:41:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_params): remove unused member `cur_mid`.
- this has been taken over by `in_def` since 1.6.
-
-Wed Oct 29 14:44:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (rb_f_load): path name needs to be transcoded to OS path
- encoding. [ruby-list:49994]
-
-Wed Oct 29 11:48:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (__builtin_setjmp): disable with gcc/clang earlier
- than 4.3 on Mac OS X. [ruby-core:65174] [Bug #10272]
-
-Wed Oct 29 11:43:43 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Generalize Vector#cross_product to arbitrary
- dimensions
- based on a patch by gogo tanaka [#10074]
-
-Wed Oct 29 11:43:11 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add Matrix#adjucate
- patch by gogo tanaka [#10056]
-
-Wed Oct 29 11:42:33 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add aliases for Vector#cross & dot
- patch by gogo tanaka [#10352]
-
-Wed Oct 29 10:00:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gems/bundled_gems: Update latest version of bundled gems.
-
-Tue Oct 28 16:52:07 2014 Eric Wong <e@80x24.org>
-
- * signal.c (install_sighandler): remove rb_disable_interrupt and
- rb_enable_interrupt calls
- (init_sigchld): ditto
- (Init_signal): disable and enable interrupt once around all
- install_sighandler and init_sigchld to reduce syscalls at start
- [Feature #9345] [ruby-core:59480]
-
-Tue Oct 28 16:22:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_options, load_file_internal2): should not
- require other files when dump option is given.
- [ruby-dev:48712] [Bug #10435]
-
-Tue Oct 28 14:51:38 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: remove apple-gcc4.2 from CC candidates.
-
-Mon Oct 27 20:13:37 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/rexml/entity.rb: keep the entity size within the limitation.
- reported by Willis Vandevanter <will@silentrobots.com> and
- patched by nahi.
-
-Mon Oct 27 17:17:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (method_proc): the receiver of binding from method should
- be same as the receiver of the method.
- [ruby-core:65917] [Bug #10432]
-
-Mon Oct 27 16:26:37 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_super.rb: add a test to check block passing.
-
-Mon Oct 27 15:59:26 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: is_incremental_marking(), will_be_incremental_marking():
- use `&&' with GC_ENABLE_INCREMENTAL_MARK instead of using
- #if/#else/#endif.
-
-Mon Oct 27 13:40:11 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (gc_sweep_rest): sweep rest pages regardless of whether
- lazy sweep is enabled or not. based on the patch by Masahiro
- Ide at [ruby-dev:48706]. [Bug #10431]
-
-Mon Oct 27 11:18:32 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
- reduce garbage during forks
-
-Sun Oct 25 12:26:26 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * template/insns.inc.tmpl, insns_info.inc.tmpl, known_errors.inc.tmpl,
- minsns.inc.tmpl: fixed path of generating script.
-
-Sun Oct 26 12:24:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/ripper/lib/ripper/sexp.rb (Ripper.sexp, Ripper.sexp_raw):
- return nil on error. [ruby-dev:48678] [Bug #10405]
-
-Sun Oct 25 11:24:24 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: improved comment.
-
-Sun Oct 26 07:40:11 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_val2variant, ole_invoke): refactoring.
- use ole_variant2variant to convert WIN32OLE_VARIANT object to
- VARIANT object.
-
- * ext/win32ole/win32ole_variant.c: refactoring. add
- ole_variant2variant.
- * ext/win32ole/win32ole_variant.h: ditto.
-
-Sat Oct 25 22:28:17 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c (io_binwrite_string): Test writev() failure.
-
-Sat Oct 25 20:19:19 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test-unicode_normalize.rb: added test_us_ascii.
-
-Sat Oct 25 20:09:09 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: added US_ASCII
- as trivially supported encoding (is always normalized,
- and may appear mixed in with UTF-8 or other Unicode
- encodings).
-
-Sat Oct 25 20:01:01 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test-unicode_normalize.rb: added
- test_raise_exception_for_non_unicode_encoding.
-
-Sat Oct 25 19:30:30 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test-unicode_normalize.rb: removed unused function.
-
-Sat Oct 25 18:41:41 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * template/unicode_norm_gen.tmpl: Adjusted name of generating file.
-
-Fri Oct 24 22:49:42 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yylex): dispatch newline and space at fluent
- interface, so that the following identifier does not include the
- space. [ruby-dev:48684] [Bug #10411]
-
-Fri Oct 24 20:41:36 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * signal.c (check_reserved_signal_): fix write count since r47991.
-
-Thu Oct 23 21:42:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_hash_delete): now does not call the block given to
- the current method. [ruby-core:65861] [Bug #10413]
-
-Thu Oct 23 19:13:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_method.c (rb_method_entry_make): warn redefinition only for
- already defined methods, but not for undefined methods.
- [ruby-dev:48691] [Bug #10421]
-
-Thu Oct 23 17:19:04 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/source.rb (REXML::IOSource#encoding_updated): Fix a
- bug that can't parse XML correctly when
- Encoding.default_internal is different with XML
- encoding. REXML::Source converts XML encoding on read. So IO
- should not convert XML encoding.
- Based on patch by NAKAMURA Usaku.
- [ruby-dev:48686] [Bug #10418]
-
- * test/rexml/test_encoding.rb
- (REXMLTests::EncodingTester#test_parse_utf16_with_utf8_default_internal):
- Add the for the above case.
-
-Thu Oct 23 16:29:02 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_encoding.rb
- (REXMLTests::EncodingTester#test_parse_utf16): Use meaningful
- test name. "ticket" in the old test name means the ticket in
- REXML's issue tracker. The REXML's issue tracker was gone. So
- "ticket" is meaningless.
-
- * test/rexml/data/ticket_110_utf16.xml: Rename to ...
- * test/rexml/data/utf16.xml: ... this.
-
-Thu Oct 23 16:18:11 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_encoding.rb
- (REXMLTests::EncodingTester#test_ticket_110): Fix expected and
- actual order.
- Patch by NAKAMURA Usaku. Thanks!!!
-
-Thu Oct 23 10:47:16 2014 Eric Wong <e@80x24.org>
-
- * insns.def (getlocal,setlocal): add comment to def/opt_operand.def
-
-Thu Oct 23 10:22:41 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
- use IO#wait_readable instead of timeout
-
-Thu Oct 23 10:22:24 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
- ensure exit! during fork failure
-
-Thu Oct 23 10:21:21 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * NEWS: Added String#unicode_normalize(|!|d?) [ci skip]
-
-Thu Oct 23 03:41:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (unknown_keyword_error): delete expected keywords
- directly from raw table, so that the given block is not called.
- [ruby-core:65837] [Bug #10413]
-
-Thu Oct 23 02:33:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (update-unicode): invert dependency to run every times.
- [ruby-core:65842] [Bug #10415]
-
- * common.mk (after-update): update files under source tree.
- [ruby-core:65840] [Bug #10414]
-
-Wed Oct 22 22:38:59 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/openssl/lib/openssl/ssl.rb (DEFAULT_PARAMS): override
- options even if OpenSSL::SSL::OP_NO_SSLv3 is not defined.
- this is pointed out by Stephen Touset. [ruby-core:65711] [Bug #9424]
-
-Wed Oct 22 21:31:56 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk (prelude.c): add dependency to LIB_SRCS because
- enc/prelude.rb requires lib/unicode_normalize.rb, and it's also
- requires lib/unicode_normalize/tables.rb (=LIB_SRCS).
-
-Wed Oct 22 21:09:51 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * configure.in (nacl_cv_cpu_nick): fix typo in PNaCl.
- (XCFLAGS) Add -isystem flag to pnacl and nacl-newlib
- (CXX): added
-
- * nacl/GNUmakefile.in (CXX): Added
- (PPROGRAM): Use clang++ instead of clang because libnacl_io
- depends on c++ std lib.
-
-Wed Oct 22 21:07:32 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * common.mk (build-ext): avoid trying to build dynamic libraries
- if configured --with-static-linked-ext.
-
-Wed Oct 22 20:33:33 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Fixed grammar in comment [ci skip]
-
-Wed Oct 22 19:18:18 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/unicode_norm_gen.rb: Fixed escaping of backslash and
- double quote ('\\\&' -> "\\\\\\\&"; double quoted string
- is needed to make \& mean last match; double double
- backslashes are needed because of two layers of escaping).
-
-Wed Oct 22 18:13:29 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/test-unicode_normalize.rb: as often said, ruby is sometimes built
- at non-srcdir.
-
-Wed Oct 22 18:12:12 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test-unicode_normalize.rb: Adjusted path for test
- data file (now ../enc/unicode/data/NormalizationTest.txt).
-
-Wed Oct 22 18:07:07 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test-unicode_normalize.rb: Removed explicit require,
- changed method names, adjusted copyright.
-
-Wed Oct 22 18:00:00 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test-unicode_normalize.rb: Importing from
- https://github.com/duerst/eprun/blob/master/test/test_normalize.rb.
- (removing trailing whitespace, fixing EOLs and adding EOL property)
-
-Wed Oct 22 08:21:09 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * nacl/pepper_main.c (Instance_DidCreate): mount devfs and rebind fd 0
- .. 2 so that stderr goes to the console of the browser.
-
-Wed Oct 22 03:47:43 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/etc/etc.c (etc_nprocessors_affin): maximum "n" should be 16384.
-
-Wed Oct 22 03:37:00 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/etc/etc.c (etc_nprocessors_affin): minor spell fix.
-
-Wed Oct 22 03:33:58 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/etc/etc.c (etc_nprocessors_affin): optimize memory usage a
- bit. Typical rubyist never use 8k cpus machine.
-
-Wed Oct 22 00:01:09 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * configure.in (XCFLAGS): Add include path for NaCl libraries.
- (XLDFLAGS): ditto.
- (NACL_LIB_PATH): new substitution
-
- * nacl/nacl-config.rb: support NACL_LIB_PATH
-
- * nacl/package.rb: ditto.
-
- * nacl/pepper_main.c: replace old implementations with nacl_io.
-
- * nacl/GNUmakefile.in: link nacl_io to pepper_ruby
-
- * ruby.c (rb_load_file): remove __attribute__((weak)) because the old
- override hack was replaced with nacl_io.
-
- * file.c (rb_file_load_ok): ditto.
-
-Tue Oct 21 17:32:32 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Adding explicit creation of directory
- enc/unicode/data because git doesn't handle empty
- directories. [patch by Masahiro Ide, filed with r48073]
-
-Tue Oct 21 17:12:12 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/tables.rb: Committing to make version
- update easier and more predictable, and reducing compilation
- time.
-
-Tue Oct 21 15:56:56 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: Added comment to point to
- relevant portion of Unicode standard for Hangul (de)composition
- identifiers and algorithm.
-
-Tue Oct 21 11:49:16 2014 Andreas Schwab <schwab@suse.de>
-
- * gc.c (mark_current_machine_context) [__mc68000__]: Update stack
- marking.
- (rb_gc_mark_machine_stack) [__mc68000__]: Also handle it here.
-
-Mon Oct 20 23:59:38 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * enc/prelude.rb: we sometimes run ruby without library path (especially
- for test), so should permit to run ruby if unicode_normalize.rb is
- missing.
-
-Mon Oct 20 23:57:58 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk (lib/unicode_normalize/tables.rb): enable running (n)make
- in non-srcdir.
-
-Mon Oct 20 23:58:04 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/downloader.rb: add -a option to always download regardless
- existing files.
-
-Mon Oct 20 23:18:18 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb: no need to convert path separator for COPY because it's
- ruby -run cp and it can treat '/' on any platform.
-
-Mon Oct 20 19:54:54 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * config.mk: Added missing data files as targets for
- prerequisite update_unicode.
-
-Mon Oct 20 19:06:06 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: revert r48046. The s in sIndex
- is not hungarian notation. The variable name sIndex is
- directly taken from the relevant part of the Unicode
- Standard, where it is written SIndex and stands for
- 'syllable index'. See pp. 144/145 of
- http://www.unicode.org/versions/Unicode7.0.0/ch03.pdf.
-
-Mon Oct 20 12:46:46 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: removing unnecessary 'self'.
-
-Mon Oct 20 12:37:37 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: change method names
- in commented-out code. Followup to r48027.
-
-Mon Oct 20 02:23:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_ivar_get), vm_insnhelper.c (vm_getivar): improve
- instance variable retrieval performance by checking ruby_verbose
- before call of rb_warning and evaluation of its argument.
- [ruby-core:65786] [Feature #10396]
-
-Sun Oct 19 23:31:29 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * lib/unicode_normalize.rb: (unicode_normalize!): change method name.
- catch up the method name change at r48014. [Feature #10084]
-
-Sun Oct 19 20:05:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/tk/lib/tkextlib/tile/treeview.rb: fix syntax error.
-
-Sun Oct 19 18:39:39 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/prelude.rb: Added automatic loading of
- lib/unicode_normalize.rb. This makes sure that all
- the methods that are available on String are
- available without explicit require.
-
-Sun Oct 19 18:35:35 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: Added a missing
- file extension in require statement.
-
-Sun Oct 19 18:13:13 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Added a rule to generate
- lib/unicode_normalize/tables.rb. This rule still
- needs to be integrated into the overall make process.
-
-Sun Oct 19 17:53:53 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Changed to dynamic
- loading of actual normalization code and tables.
-
-Sun Oct 19 17:37:37 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Small documentation fix.
-
-Sun Oct 19 17:26:26 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Added documentation.
-
-Sun Oct 19 11:09:09 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/unicode_norm_gen.rb, lib/unicode_normalize.rb:
- File name change from lib/unicode_normalize/normalize_tables.rb
- to lib/unicode_normalize/tables.rb.
-
-Sun Oct 19 10:12:12 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Changing method names, see
- https://bugs.ruby-lang.org/issues/10084#note-7
-
-Sun Oct 19 10:10:10 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Changing module name.
-
-Sun Oct 19 10:08:08 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Changing require statement,
- adjusting copyright.
-
-Sun Oct 19 10:04:04 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize.rb: Importing from
- https://github.com/duerst/eprun/blob/master/lib/string_normalize.rb.
- (removing trailing whitespace, fixing EOLs and adding EOL property)
-
-Sun Oct 19 09:56:56 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/unicode_norm_gen.rb: Changed module name.
-
-Sun Oct 19 09:48:48 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: Changed module name,
- adjusted copyright.
-
-Sun Oct 19 09:38:38 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/normalize.rb: Importing from
- https://github.com/duerst/eprun/blob/master/lib/normalize.rb.
-
-Sat Oct 18 20:40:52 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * vm_core.h, proc.c, vm_backtrace.c, vm_trace.c:
- remove rb_binding_new_with_cfp, and use rb_vm_make_binding instead.
-
-Sat Oct 18 20:38:48 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * vm_core.h, vm.c, proc.c: fix GC mark miss on bindings.
- [ruby-dev:48616] [Bug #10368]
-
- * test/ruby/test_eval.rb: add a test code.
-
-Fri Oct 17 22:47:11 2014 Tanaka Akira <akr@fsij.org>
-
- * pack.c (pack_unpack): Add casts for char references for 'u'.
- Fix line ending recognition algorithm.
-
-Fri Oct 17 21:49:52 2014 Tanaka Akira <akr@fsij.org>
-
- * pack.c (pack_unpack): Add casts for char references for 'b' and 'h'.
-
-Fri Oct 17 17:50:10 2014 Tanaka Akira <akr@fsij.org>
-
- * Avoid undefined behaviors found by gcc -fsanitize=undefined.
- gcc (Debian 4.9.1-16) 4.9.1
-
- * string.c (rb_str_sum): Avoid undefined behavior.
-
-Fri Oct 17 17:43:50 2014 Tanaka Akira <akr@fsij.org>
-
- * Avoid undefined behaviors found by gcc -fsanitize=undefined.
- gcc (Debian 4.9.1-16) 4.9.1
-
- * include/ruby/ruby.h (INT2FIX): Avoid undefined behavior.
-
- * node.h (nd_set_line): Ditto.
-
- * pack.c (encodes): Ditto.
- (pack_unpack): Ditto.
-
- * regint.h (BIT_STATUS_AT): Ditto.
- (BS_BIT): Ditto.
-
- * time.c (time_mdump): Ditto.
- (time_mload): Ditto.
-
- * vm_core.h (VM_FRAME_MAGIC_MASK): Ditto.
-
- * vm_trace.c (recalc_add_ruby_vm_event_flags): Ditto.
-
-Fri Oct 17 15:06:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (unescape_nonascii): make dynamically compiled US-ASCII
- regexps ASCII-8BIT encoding if binary (hexadecimal, control,
- meta) escapes are contained, as well as literal regexps.
- [ruby-dev:48626] [Bug #10382]
-
-Fri Oct 17 03:05:08 2014 Eric Wong <e@80x24.org>
-
- * test/-ext-/bug_reporter/test_bug_reporter.rb
- (test_bug_reporter_add): revert r47972
- * test/ruby/test_rubyoptions.rb (test_segv_test): revert r47971
- [ruby-core:65764]
-
-Thu Oct 16 23:17:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (rb_sigaltstack_size): double default size to get rid
- of heap corruption by alternate stack overflow in SEGV handler.
- typically happened at fprintf() in control_frame_dump().
-
-Thu Oct 16 22:43:12 2014 Tanaka Akira <akr@fsij.org>
-
- * vm_backtrace.c (id2str): Fix a variable name.
- [ruby-dev:48642] [Bug #10389]
-
-Thu Oct 16 20:01:26 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/envutil.rb (assert_pattern_list): Show number of matched
- patterns and characters.
-
-Thu Oct 16 16:26:09 2014 Eric Wong <e@80x24.org>
-
- * cont.c (fiber_store): fix WIN32 fibers
- [ruby-core:65745] [ruby-core:65758]
-
-Thu Oct 16 15:05:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_here_document): do not append already appended
- and disposed code fragment. [ruby-dev:48647] [Bug #10392]
-
-Thu Oct 16 10:35:33 2014 Eric Wong <e@80x24.org>
-
- * test/-ext-/bug_reporter/test_bug_reporter.rb
- (test_bug_reporter_add): fix race
-
-Thu Oct 16 10:09:02 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_rubyoptions.rb (test_segv_test): fix race
-
-Thu Oct 16 09:17:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cont.c (rb_fiber_t): fix compile error caused by move to
- vm_core.h at r47964. [Feature #10341]
-
-Thu Oct 16 08:58:11 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
- avoid killing wrong parent
-
-Thu Oct 16 08:40:04 2014 Eric Wong <e@80x24.org>
-
- * cont.c (fiber_store): restore references to next_fib (fix typo)
-
-Thu Oct 16 08:26:08 2014 Eric Wong <e@80x24.org>
-
- * cont.c (fiber_store): remove references to nextfib
- fix build when FIBER_USE_NATIVE is 0
-
-Thu Oct 16 06:51:35 2014 Knut Franke <Knut.Franke@gmx.de>
-
- * vm_core.h: declare rb_fiber_t typedef
- (rb_thread_t): fiber and root_fiber become rb_fiber_t * (from VALUE)
- * vm.c (rb_thread_mark): use rb_fiber_mark_self
- * cont.c (rb_fiber_t): prev becomes rb_fiber_t * (from VALUE)
- (cont_mark, cont_free): simplify conditions
- (rb_fiber_mark_self): new function
- (fiber_mark): use rb_fiber_mark_self
- (cont_save_thread, cont_restore_thread): inline
- (cont_restore_thread): simplify
- (fiber_setcontext): simplify conditions
- (rb_cont_call): remove dereference
- (fiber_t_alloc): update for rb_fiber_t->prev type change
- (rb_fiber_start): ditto
- (fiber_current): extract from rb_fiber_current
- (return_fiber): move, simplify type checks
- (rb_fiber_current): use fiber_current
- (fiber_store): simplify type checks
- (fiber_switch): ditto, simplify call to fiber_setcontext,
- use fiber_current
- (rb_fiber_transfer): update for type changes
- (rb_fiber_terminate): move, use fiber_switch
- (rb_fiber_resume): update for type changes
- (rb_fiber_reset_root_local_storage): ditto
- (rb_fiber_yield): use rb_fiber_switch instead of rb_fiber_transfer
- (rb_fiber_m_transfer): ditto
- [ruby-core:65518] [Feature #10341]
-
-Thu Oct 16 06:25:29 2014 Knut Franke <Knut.Franke@gmx.de>
-
- * cont.c (rb_context_t): comment on saved_thread
- (cont_save_thread): sparse copy
- (cont_init): copy extra fields
- (fiber_init): use current thread VM stack size
- [ruby-core:65518] [Feature #10341]
-
-Thu Oct 16 06:13:09 2014 Knut Franke <Knut.Franke@gmx.de>
-
- * cont.c (cont_capture): remove unnecessary variable
- [ruby-core:65518] [Feature #10341]
-
-Thu Oct 16 05:02:31 2014 Knut Franke <Knut.Franke@gmx.de>
-
- * cont.c (fiber_store, fiber_switch): simplify
- [ruby-core:65518] [Feature #10341]
-
-Thu Oct 16 04:28:41 2014 Knut Franke <Knut.Franke@gmx.de>
-
- * cont.c (rb_fiber_t): remove prev_fiber/next_fiber
- (fiber_link_join, fiber_link_remove): remove functions
- (fiber_free, fiber_init, root_fiber_alloc):
- remove references to removed fields and functions
- [ruby-core:65518] [Feature #10341]
-
-Wed Oct 15 22:08:37 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/etc/etc.c (etc_nprocessors_affin): Test CPU_ALLOC availability.
- CentOS 5 don't have CPU_ALLOC().
-
-Wed Oct 15 18:26:19 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * ext/etc/etc.c (etc_nprocessors_affinity): use sched_getaffinity
- for getting precious number of available cpus.
-
- * ext/etc/etc.c (etc_nprocessors): use etc_nprocessors_affinity if
- possible.
-
- [Feature #10267] etc-nprocessors-kosaki2.patch
-
-Wed Oct 15 17:53:28 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/envutil.rb (assert_pattern_list) Renamed from
- assert_regexp_list.
- Show multiline string in multi lines.
-
- * test/-ext-/bug_reporter/test_bug_reporter.rb: Use
- assert_pattern_list.
-
-Wed Oct 15 12:26:58 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/envutil.rb (assert_regexp_list): New assertion method.
-
- * test/ruby/test_rubyoptions.rb: Use assert_regexp_list.
-
-Wed Oct 15 07:21:09 2014 Tanaka Akira <akr@fsij.org>
-
- * enum.c: min(n) drops elements bigger than the n-th maximum element.
- (struct nmin_data): New field to record the n-th maximum element, limit
- (nmin_filter): Update limit field.
- (nmin_i): Drop too big elements.
- (nmin_run): Initialize limit field.
-
-Wed Oct 15 07:00:14 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_optimization.rb (test_string_size): new test
-
-Wed Oct 15 06:51:13 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_optimization.rb (test_string_eq_neq): new test
- (test_string_ltlt): ditto
-
-Wed Oct 15 06:50:29 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_optimization.rb (test_hash_aset_with):
- assert assignment
-
-Wed Oct 15 04:56:27 2014 Zachary Scott <e@zzak.io>
-
- * gc.c (rb_obj_id): [DOC] Fix typo, clean up sentence, and wrap cols
-
-Wed Oct 15 04:53:30 2014 Zachary Scott <e@zzak.io>
-
- * error.c: [DOC] Fix case of type in exception message by @tricknotes
- [Fixes GH-740] https://github.com/ruby/ruby/pull/740
-
- * object.c: ditto
-
-Tue Oct 14 21:39:16 2014 Vit Ondruch <vondruch@redhat.com>
-
- * tool/rbinstall.rb (gem): Fix permissions of bundled gems
- specification files. [ruby-core:65700] [Bug #10383]
-
-Tue Oct 14 19:15:31 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_record.c: use typed data.
-
-Tue Oct 14 16:23:12 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.c (global_symbols): make ids two-dimensional array of
- strings and symbols, for write-barrier.
-
- * symbol.c (global_symbols): make IDs immortal always, instead
- of treating dynamic symbols as IDs.
-
- * iseq.c, marshal.c, string.c: use rb_str_intern instead of
- rb_str_dynamic_intern.
-
- * symbol.c (rb_str_intern): rename rb_str_dynamic_intern.
-
-Tue Oct 14 10:19:10 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_optimization.rb (test_string_freeze): new test
- (test_hash_aref_with): ditto
- (test_hash_aset_with): ditto
-
-Tue Oct 14 01:27:54 2014 Tanaka Akira <akr@fsij.org>
-
- * enum.c (nmin_run): max(n) and max_by(n) returns an array in
- descending order.
- [ruby-core:65452] Suggested by David Grayson.
-
-Mon Oct 13 20:44:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (update-gems): chdir to the target directory and then
- add the tool directory to load paths, for older BASERUBY.
- [Bug #10372][ruby-core:65630]
-
-Mon Oct 13 17:53:01 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/xmlrpc/parser.rb: added new parser class using libxml-ruby gem.
- [Feature #9379][ruby-core:59633]
- * lib/xmlrpc/config.rb: ditto.
-
-Mon Oct 13 16:32:56 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/find.rb (Find.find): Call to_path for arguments to obtain
- strings.
- [ruby-core:63713] [Bug #10035] Reported by Herwin.
-
-Mon Oct 13 15:42:25 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * common.mk: use relative load path for bundled_gems directory.
- [Bug #10372][ruby-core:65630]
-
-Mon Oct 13 08:44:06 2014 Zachary Scott <e@zzak.io>
-
- * README.EXT: [DOC] fix example missing typedef with patch by
- @steveklabnik [Fixes GH-739] https://github.com/ruby/ruby/pull/739
-
- * README.EXT.ja: ditto.
-
-Mon Oct 13 06:52:09 2014 Eric Wong <e@80x24.org>
-
- * array.c (ary_recycle_hash): add RB_GC_GUARD
- (rb_ary_diff): remove volatile
- [Bug #10369]
-
-Mon Oct 13 03:20:23 2014 Zachary Scott <e@zzak.io>
-
- * ext/date/date_core.c: [DOC] Clean up whitespace, examples, and typos
- in date_core based on a patch by @vipulnsward [Fixes GH-724]
- https://github.com/ruby/ruby/pull/724
-
-Mon Oct 13 02:39:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (remove_duplicate_keys): should not simply eliminate all
- value nodes, which may have side effects.
- [ruby-core:65625] [Bug #10315]
-
-Sun Oct 12 10:39:16 2014 Zachary Scott <e@zzak.io>
-
- * vm.c: [DOC] fix typo by @yui-knk [Fixes GH-738]
- https://github.com/ruby/ruby/pull/738
-
-Sun Oct 12 09:24:15 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/test/unit.rb: Hide skips by default.
-
-Sun Oct 12 01:37:11 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * file.c: include sys/time.h only if HAVE_SYS_TIME_H
-
-Sat Oct 11 22:29:40 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * file.c (HAVE_UTIMENSAT): disabled for NativeClient.
- Fixes build error.
-
-Sat Oct 11 22:11:58 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * ext/extmk.rb: generates the rule for extinit.$(OBJEXT).
- extinit.$(OBJEXT) used to be generated by the builtin rule, thus
- didn't accept custom $(CC) and caused linkage error for cross
- compiling.
-
-Sat Oct 11 18:46:50 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * include/ruby/intern.h (rb_fd_select): declare struct timeval, or the
- struct gets local to the function in C99.
-
- * file.c (#include): add nacl/stat.h for PNaCl.
- (utimes): added a declaration for PNaCl.
- (stat_atimespec): stat::st_atimensec is long long but
- timespec::tv_nsec is long in PNaCl.
- (stat_mtimespec, stat_ctimespec): ditto.
- (rb_group_member): disable getgroups unless HAVE_GETGROUPS.
- (eaccess): unify the fallback to generic defined(USE_GETEUID).
-
- * io.c: include sys/time.h for struct timeval.
- (rb_close_before_exec): nothing we can do if F_GETFD is not
- available.
- (ioctl): pnacl newlib actually doesn't have ioctl.
-
- * process.c (maxgroups): it is used iff
- defined(_SC_NGROUPS_MAX) || defined(NGROUPS_MAX) but not
- defined(HAVE_GETGROUPS) || defined(HAVE_SETGROUPS).
- (obj2gid): fail unless the object is a Fixnum if getgrnam is not
- available.
- (disable_child_handler_fork_child): sigaction is not available in
- PNaCl newlib.
-
- * configure.in (warnflags, strict_warnflags): avoid -ansi for strlcpy.
- (rb_cv_gcc_atomic_builtins): also check
- __atomic_or_etch because it is used in ruby_atomic.h.
- (rb_cv_gcc_sync_builtins): ditto.
- (HAVE_GETGRNAM): added.
-
-Sat Oct 11 15:32:08 2014 Eric Wong <e@80x24.org>
-
- * compile.c (iseq_build_from_ary_exception): move RB_GC_GUARD
- (iseq_build_from_ary_body): use PRIsVALUE instead of RB_GC_GUARD
-
-Sat Oct 11 14:57:08 2014 Eric Wong <e@80x24.org>
-
- * string.c (rb_str_intern): remove unnecessary RB_GC_GUARD
-
-Sat Oct 11 13:47:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (remove_duplicate_keys): remove duplicate literal keys,
- i.e., symbols and strings. [ruby-core:65368] [Bug #10315]
-
- * vm.c (kwmerge_i): override existing keys by new keys.
- [ruby-core:65368] [Bug #10315]
-
- * parse.y (assocs): concatenate splatted literal hashes. the
- former key has precedence even if duplicated literal keys
- follow. [ruby-core:65368] [Bug #10315]
-
-Sat Oct 11 12:27:03 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * configure.in (RUBY_NACL): automatically locate pnacl-clang.
- (RUBY_PLATFORM): pnacl instead of le32-nacl.
-
-Sat Oct 11 11:27:14 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * io.c: fix issues in the last two commits. don't disable cloexec for
- platforms other than NativeClient.
-
- * ChangeLog: ditto. add entries for the last two commits.
-
-Sat Oct 11 11:12:00 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * signal.c (install_signalhandler, init_sigchld): allow failure because it
- always fails with ENOSYS on NaCl.
-
-Sat Oct 11 11:11:53 2014 Yuki Yugui Sonoda <yugui@yugui.jp>
-
- * configure.in (RUBY_NACL and others): merge patch from naclports. Supports PNaCl.
-
- * dln.c: ditto. replace the old hacky dynamic loading over HTTP with nacl_io.
-
- * file.c: ditto. tentatively use access(2) instead of eaccess.
- (rb_file_load_ok): weaken with attribute but not by postprocess.
-
- * io.c: ditto.
- (socket.h): now NaCl has socket.h
- (flock): disable here instead of nacl/ioctl.h
-
- * nacl/GNUmakefile.in: ditto.
- (CC, LD, NM, AR, AS, RANLIB, OBJDUMP, OBJCOPY):
- respect path to them if they are absolute.
- This helps naclports to build ruby in their source tree.
- (PROGRAM_NMF, .SUFFIXES): support .pnexe for PNaCl.
- (ruby.o, file.o): move the hack to attributes in ruby.c and file.c
-
- * nacl/ioctl.h: ditto. removed. move the hack to io.c.
-
- * nacl/nacl-config.rb: ditto. support arm, pnacl and others.
-
- * nacl/pepper_main.c: ditto. support build in a naclports tree.
-
- * ruby.c (rb_load_file): ditto. weaken with attribute but not by postprocess.
-
-Sat Oct 11 09:32:00 2014 Zachary Scott <e@zzak.io>
-
- * ext/socket/unixsocket.c: [DOC] Fix example to render in HTML
- properly, with a patch by @eval [Fixes GH-733]
- https://github.com/ruby/ruby/pull/733
-
-Sat Oct 11 04:14:41 2014 Kir Shatrov <shatrov@me.com>
-
- * lib/open-uri.rb (OpenURI::Options): add :open_timeout default
- * (def OpenURI.open_http): check :open_timeout option
- * (module OpenURI): rdoc for :open_timeout
- * test/open-uri/test_open-uri.rb (test_open_timeout): new test
- [Feature #10361]
-
-Fri Oct 10 11:27:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/io.h (rb_io_mode_flags, rb_io_modenum_flags):
- deprecate old macros for compatibility for ruby 1.8 and older.
-
-Thu Oct 9 23:31:47 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * bignum.c (absint_numwords_generic): set an array element after
- definition of a variable to fix compile error with older version
- of fcc (Fujitsu C Compiler) 5.6 on Solaris 10 on Sparc.
- [Bug #10350] [ruby-dev:48608]
-
-Thu Oct 9 16:15:26 2014 Eric Wong <e@80x24.org>
-
- * ext/-test-/st/foreach/extconf.rb: new file
- * ext/-test-/st/foreach/foreach.c: ditto
- * test/-ext-/st/test_foreach.rb: ditto
- [Feature #10321]
-
-Thu Oct 9 12:40:28 2014 Eric Wong <e@80x24.org>
-
- * benchmark/bm_hash_aref_sym*.rb: force static symbols
-
-Thu Oct 9 12:38:28 2014 Eric Wong <e@80x24.org>
-
- * hash.c (rb_any_hash): remove unnecessary dsym check
-
-Thu Oct 9 07:20:30 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * missing/setproctitle.c: Avoid invalidating argv[1], argv[2],
- etc. until the first call to Process.setproctitle, because
- the ps command of AIX refers to the argv array.
- [Bug #10090]
-
-Thu Oct 9 00:53:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (dir_s_aref): fix rdoc. `Dir.glob` allows an array but
- `Dir[]` not. the former accepts an optional parameter `flags`,
- while the latter accepts arbitrary number of arguments but no
- `flags`. [ruby-core:65265] [Bug #10294]
-
-Wed Oct 8 21:44:10 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_variable.c: use typed data.
-
-Wed Oct 8 16:36:47 2014 gogo tanaka <mail@tanakakazuki.com>
-
- * test/ruby/test_syntax.rb: added syntax tests of underscore
- arguments. [Feature #10340][ruby-core:65496]
-
-Wed Oct 8 07:42:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI#inspect): remove Object id.
- URI is considered that it doesn't require id.
-
-Wed Oct 8 05:22:42 2014 Eric Wong <e@80x24.org>
-
- * ext/etc/etc.c (etc_systmpdir): set default tmplen correctly
- Fixup r47826
-
-Wed Oct 8 05:16:32 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add @- and @+ for Matrix and Vector.
- patch by gogo tanaka [#10068] [#10069]
-
-Wed Oct 8 04:58:48 2014 John Bachir <j@jjb.cc>
-
- * bootstraptest/test_io.rb (assert_finish):
- normalize rescue for Timeout::Error
- * lib/net/ftp.rb (Net#read_timeout): ditto for doc
- * lib/resolv.rb (Resolv::ResolvTimeout): ditto for subclass
- * lib/webrick/httprequest.rb (_read_data): ditto for rescue
- * sample/timeout.rb (p timeout): ditto for call
- * test/drb/drbtest.rb (test_06_timeout): ditto
- * test/ruby/test_readpartial.rb (test_open_pipe): ditto
- * test/thread/test_queue.rb (test_queue_thread_raise): ditto
- * thread.c (rb_thread_s_handle_interrupt): ditto for doc
- [ruby-core:65481] [misc #10339]
-
-Wed Oct 8 04:38:29 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/ruby/test_process.rb (TestProcess#test_setsid): AIX
- does not allow Process::getsid(pid) when pid is in a
- different session.
-
-Wed Oct 8 04:33:04 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_encoding):
- On AIX, locale_charmap is ISO-8859-1 with LANG=C. This means
- the source encoding of stdin is ISO-8859-1, so "invalid
- multibyte char" error does not occur.
-
-Wed Oct 8 04:30:29 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add Matrix#laplace_expansion.
- patch by gogo tanaka [#10073]
-
-Wed Oct 8 04:29:21 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add Vector.basis.
- Based on patch by gogo tanaka [#10072]
-
-Tue Oct 7 23:40:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (rb_f_kill): get rid of deadlock as unhandled and
- discarded signals do not make interrupt_cond signaled.
- based on the patch by Kazuki Tsujimoto at [ruby-dev:48606].
- [Bug #9820]
-
-Tue Oct 7 22:43:44 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_method.c: use typed data.
-
-Tue Oct 7 21:47:05 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_param.c: refactoring.
-
-Tue Oct 7 21:40:17 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_method.c: refactoring. add
- olemethod_data_get_struct to wrap Data_Get_Struct.
- * ext/win32ole/win32ole_method.h: ditto.
-
- * ext/win32ole/win32ole_param.c (oleparam_ole_param):
- call olemethod_data_get_struct instead of Data_Get_Struct.
-
-Tue Oct 7 11:17:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (etc_systmpdir): try user temporary directory by
- confstr() on Mac OS X.
- c.f. http://www.opensource.apple.com/source/ruby/ruby-104/patches/ext_etc_etc.c.diff
-
-Tue Oct 7 10:48:17 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (struct stat.st_size): prefer off_t over int, long,
- and so on. inspired by
- http://www.opensource.apple.com/source/ruby/ruby-104/patches/config.h.ed
-
-Tue Oct 7 10:37:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_UNIVERSAL_ARCH): fix missing quoting
- brackets. incorporated from
- http://www.opensource.apple.com/source/ruby/ruby-104/patches/configure.diff
-
-Mon Oct 6 23:34:42 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_param.c: use typed data.
-
-Mon Oct 6 22:37:09 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.h (struct RSymbol): move from internal.h.
-
-Mon Oct 6 21:43:03 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * error.c: update exception tree. [DOC]
- reported by @hemge via twitter.
-
-Mon Oct 6 18:43:03 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in: Fix typo. [Bug #9914]
-
-Mon Oct 6 16:23:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (rb_f_kill): should not ignore signal unless the
- default handler is registered. [ruby-dev:48592] [Bug #9820]
-
-Mon Oct 6 16:07:11 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_string.rb (test_LSHIFT_neary_long_max): enable
- only on platforms where string size range is smaller than memory
- space. this test does not make sense but just wastes memory and
- time on other platforms, as it is hardly possible that a string
- size becomes neary LONG_MAX if long size equals pointer size.
- [ruby-core:65410] [Bug #10325]
-
-Mon Oct 6 11:21:21 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/unicode_norm_gen.rb: Adding/tweaking comments.
-
-Mon Oct 6 10:57:57 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/unicode_norm_gen.rb: Adjusted directory paths.
-
-Mon Oct 6 10:27:27 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/unicode_norm_gen.rb: Data generation script imported from
- https://github.com/duerst/eprun/blob/master/lib/generate.rb
-
-Mon Oct 6 10:15:15 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Adjust example in documentation for
- Downloader.download.
-
-Mon Oct 6 10:07:07 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize: New folder for Unicode normalization
- functionality
-
-Sun Oct 5 11:04:13 2014 Luiz Angelo Daros de Luca <luizluca@gmail.com>
-
- * ext/digest/{md5,rmd160,sha1,sha2}/extconf.rb: configure OpenSSL
- only if bundled libraries is not used, so that OpenSSL is not
- linked unnecessarily. [ruby-core:65404] [Bug #10324]
-
-Sun Oct 5 10:39:11 2014 Luiz Angelo Daros de Luca <luizluca@gmail.com>
-
- * ext/digest/rmd160/extconf.rb: fix transform function name to
- check. [ruby-core:65091] [Bug #10252]
-
-Sun Oct 5 05:46:00 2014 Eric Wong <e@80x24.org>
-
- * ext/zlib/zlib.c (zstream_mark, zstream_free): update signature
- (gzfile_mark, gzfile_free): ditto
- (zstream_memsize): new function for rb_data_type->dsize
- (gzfile_memsize): ditto
- (zstream_data_type, gzfile_data_type): new data types
- (zstream_new): Data_Make_Struct => TypedData_Make_Struct
- (gzfile_new): ditto
- (get_zstream, get_gzfile): Data_Get_Struct => TypedData_Get_Struct
- (rb_zstream_flush_next_in): ditto
- (rb_zstream_flush_next_out): ditto
- (rb_zstream_avail_out): ditto
- (rb_zstream_avail_in): ditto
- (rb_zstream_closed_p): ditto
- (rb_deflate_initialize): ditto
- (rb_deflate_init_copy): ditto
- (rb_inflate_initialize): ditto
- (gzfile_ensure_close): ditto
- (rb_gzfile_closed_p): ditto
- (rb_gzfile_path): ditto
- (rb_gzwriter_initialize): ditto
- (rb_gzreader_initialize): ditto
- (rb_gzreader_unused): ditto
- [ruby-core:65377] [Feature #10319]
-
-Sat Oct 4 16:24:41 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/test_syslog.rb (TestSyslog#test_log): In AIX, each output
- line of LOG_PERROR to stderr has an additional empty line appended,
- so skip that line.
-
-Sat Oct 4 16:05:49 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/socket/test_unix.rb (TestSocket_UNIXSocket#test_too_long_path):
- sockaddr_un.sun_path in AIX is defined as char[1024],
- so "a" * 300 is not too long. "a" * 3000 would be enough.
-
-Sat Oct 4 09:12:03 2014 Zachary Scott <e@zzak.io>
-
- * ext/win32ole/sample/example*.rb: Add wait input to quit for examples
- with patch provided by @windwiny [Fixes GH-705]
- https://github.com/ruby/ruby/pull/705
-
-Sat Oct 4 09:08:18 2014 Zachary Scott <e@zzak.io>
-
- * ext/win32ole/win32ole.c: [DOC] Fix typo in :nodoc: reported by
- @windwiny to [Fix GH-705] https://github.com/ruby/ruby/pull/705
-
- * ext/pty/pty.c: ditto
-
-Sat Oct 4 08:59:45 2014 Zachary Scott <e@zzak.io>
-
- * ext/openssl/ossl_rand.c: [DOC] Add call signature for pseudo_bytes
- and random_bytes, wrap lines at 80 chars, and remove useless
- comments.
-
-Sat Oct 4 08:49:34 2014 Zachary Scott <e@zzak.io>
-
- * ext/openssl/ossl_rand.c: [DOC] Add rdoc for method descriptions
- By @vipulnsward [Fixes GH-657] https://github.com/ruby/ruby/pull/657
-
-Sat Oct 4 08:23:48 2014 Zachary Scott <e@zzak.io>
-
- * ext/openssl/ossl_rand.c: Use rb_define_module_function instead of
- macro. [Fixes GH-686] https://github.com/ruby/ruby/pull/686
-
-Sat Oct 4 06:04:56 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_method.c(olemethod_set_member): remove
- redundant NULL check.
- * ext/win32ole/win32ole_type.c(oletype_set_member): ditto.
-
-Sat Oct 4 00:25:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: removed needless preparation for gcc.
-
-Fri Oct 3 23:41:20 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: enabled gcc build with osx on travis.
-
-Fri Oct 3 23:22:23 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * template/fake.rb.in: fix make install failure due to MSYS path
- with mingw on MSYS environment.
- [ruby-core:64965] [Bug #10230]
-
-Fri Oct 3 21:02:32 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_io.rb (TestIO#test_advise): avoid to infinite loop.
-
-Fri Oct 3 19:26:01 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: enabled test results of linux.
-
-Fri Oct 3 18:52:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_io.rb (TestIO#test_advise): added workaround of fadvise(2)
- with tmpfs and old linux kernel. [ruby-core:65355][Bug #10313]
-
-Fri Oct 3 18:22:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: Disabled to generate document on travis.
- Reduce test running time.
-
-Fri Oct 3 12:42:15 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add hstack & vstack methods.
- Based on a patch by creasywuqiong. [Fix GH-344]
-
-Fri Oct 3 12:37:48 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Fix Matrix.rows copy bug.
- Patch by Arron Mabrey. [Fix GH-707]
-
-Fri Oct 3 06:06:28 2014 Eric Wong <e@80x24.org>
-
- * st.c (next_pow2): new function (from old bignum.c)
- (new_size): use next_pow2 function
-
-Fri Oct 3 05:58:58 2014 Eric Wong <e@80x24.org>
-
- * vm_trace.c (rb_tp_t): pack 56 => 48 bytes on 64-bit
-
-Thu Oct 2 18:41:45 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/etc/etc.c (etc_nprocessors): Windows support.
- see [Feature #10267]
-
-Thu Oct 2 12:21:52 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/etc/etc.c (etc_nprocessors): New method.
- Accepted by matz at RubyKaigi 2014.
- [ruby-core:65142] [Feature #10267]
-
-Thu Oct 2 07:56:49 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (rb_iseq_line_trace_each): explicit cast
- Fix https://travis-ci.org/ruby/ruby/jobs/36814282
-
-Thu Oct 2 05:40:05 2014 Eric Wong <e@80x24.org>
-
- * ruby.h: set rb_event_flag_t to uint32_t
- [ruby-core:65315] [misc #10249]
-
-Thu Oct 2 05:32:17 2014 Eric Wong <e@80x24.org>
-
- * io.c (fptr_finalize): free memory before GC sweep
- [ruby-core:65269] [Feature #10295]
-
-Thu Oct 2 05:27:24 2014 Eric Wong <e@80x24.org>
-
- * marshal.c (w_class): check dump_arg->compat_tbl before lookup
- (w_object): lazy init ->compat_tbl before insert
- (obj_alloc_by_class): ditto
- (clear_dump_arg): free only non-NULL ->compat_tbl
- (clear_load_arg): ditto for ->compat_tbl
- (marshal_dump): ->compat_tbl defaults to zero
- (marshal_load): ditto for ->compat_tbl
- (r_entry0): check l->compat_tbl before lookup
- (r_fixup_compat): ditto
- [ruby-core:65305] [Feature #10302]
-
-Wed Oct 1 21:14:34 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_type.c: use typed data.
-
-Wed Oct 1 18:15:42 2014 Nolan Evans <nolane@gmail.com>
-
- * compile.c: remove commented out code.
-
-Wed Oct 1 17:38:53 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/fileutils/test_fileutils.rb: AIX does not allow
- a sticky bit on a regular file.
-
-Wed Oct 1 17:31:41 2014 Eric Hodel <drbrain@segment7.net>
-
- * NEWS: Add RubyGems update.
-
-Wed Oct 1 17:28:58 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems: Update to RubyGems 2.4.2.
- * test/rubygems: ditto.
-
-Tue Sep 30 22:25:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_data_type): separate ripper data type for from
- parser.
-
-Tue Sep 30 18:46:31 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_typelib.c: use typed data.
-
-Tue Sep 30 09:51:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * common.mk: fixed broken reference of update-config_files task
-
-Mon Sep 29 22:54:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/file.c (append_wstr): set expanded length, not length of
- appended string. fix "probable buffer overflow" bug.
- [ruby-core:65317] [Bug #10304]
-
- * string.c (str_make_independent_expand): drop NOFREE flag after
- reallocation, static buffer is not pointed anymore.
- [ruby-core:65317] [Bug #10304]
-
-Sun Sep 28 23:59:17 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * gc.c (rb_gcdebug_print_obj_condition): use RVALUE_REMEMBERED
- because GET_HEAP_REMEMBERSET_BITS is obsoleted.
-
-Sun Sep 28 11:14:14 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Created new target update-unicode to download
- some Unicode data files.
-
-Fri Sep 26 15:03:19 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * lib/uri/rfc3986_parser.rb: raise URI::InvalidURIError when
- uri doesn't respond to #to_str. [ruby-core:64453] [Bug #10150]
-
- * test/uri/test_parser.rb: test for above.
-
-Sat Sep 27 10:31:48 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * gems/bundled_gems: upgraded to power_assert 0.1.4.
-
-Fri Sep 26 12:52:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_write): ASCII-8BIT StringIO
- should be writable any encoding strings, without conversion.
- [ruby-core:65240] [Bug #10285]
-
-Fri Sep 26 05:21:01 2014 Eric Wong <e@80x24.org>
-
- * object.c (rb_class_real): do not dereference 0 VALUE
-
- * test/ruby/test_module.rb (test_inspect_segfault):
- Test case and bug report by Thomas Stratmann.
- [ruby-core:65214] [Bug #10282]
-
-Fri Sep 26 05:12:10 2014 Eric Wong <e@80x24.org>
-
- * man/ruby.1: document stack size env variables
- [Feature #10197]
-
-Thu Sep 25 19:37:34 2014 Eric Wong <e@80x24.org>
-
- * io.c (free_io_buffer): new function for a common pattern
- (clear_readconv): use free_io_buffer
- (rb_io_fptr_finalize): ditto
-
-Thu Sep 25 07:51:07 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * lib/matrix.rb: Fix docs. Patched by Ben Woodall. [GH-726]
-
-Wed Sep 24 19:04:04 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/data: New directory for downloaded Unicode
- data files.
-
-Wed Sep 24 18:59:59 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Adjusting example for
- Downloader.download to implementation changes in r47693.
-
-Wed Sep 24 18:06:06 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Removing unused method
- Downloader.download_if_modified_since.
- (if ever used, just replace with Downloader.download)
-
-Wed Sep 24 17:59:59 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Fixing raise after return.
-
-Wed Sep 24 17:55:55 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Made Unicode data file location available
- via :unicode Symbol.
-
-Wed Sep 24 10:45:45 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Small fix to documentation comment.
-
-Tue Sep 23 22:00:20 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parse_ident): just after a label, new expression should
- start, cannot be a modifier. [ruby-core:65211] [Bug #10279]
-
-Tue Sep 23 16:07:07 2014 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: added Downloader.download_if_modified_since
- to reduce downloads of large files that change only rarely.
- [ruby-core:65164] [CommonRuby - Feature #10084]
-
-Tue Sep 23 11:55:09 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: added rubyspec into travis tasks and eliminate to stdout.
-
-Mon Sep 22 20:00:29 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * test/win32ole/test_win32ole_variant.rb
- (test_conversion_time2date_with_msec): test by using only
- assert_in_delta to avoid to fail when converting Time object with
- 999999999 nanoseconds into VT_DATE Variant.
-
-Mon Sep 22 19:49:12 2014 Zachary Scott <e@zzak.io>
-
- * doc/syntax/methods.rdoc: [DOC] [] and []= methods by @process
- [Fixes GH-662] https://github.com/ruby/ruby/pull/662
-
-Mon Sep 22 18:21:35 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: Only osx build is enabled. linux builds is random failure
- and test results of major linux is covered by rubyci.
-
-Mon Sep 22 12:10:29 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_time_tz.rb: Fix test error with tzdata-2014g.
- [ruby-core:65058] [Bug #10245] Reported by Vit Ondruch.
-
-Mon Sep 22 09:28:43 2014 Eric Wong <e@80x24.org>
-
- * ext/socket/ancdata.c ({send,recv}msg_args_struct): 24 => 16 bytes
- * ext/socket/init.c (connect_arg): ditto
- * ext/socket/raddrinfo.c (getnameinfo_arg): 56 => 48 bytes
- (reductions only for 64-bit systems)
-
-Mon Sep 22 02:04:25 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/drb/drb.rb: Support graceful shutdown.
- (DRbTCPSocket#initialize): Create a pipe for shutdown notification.
- (DRbTCPSocket#close): Invoke close_shutdown_pipe.
- (DRbTCPSocket#close_shutdown_pipe): New private method.
- (DRbTCPSocket#accept): Use accept_or_shutdown.
- (DRbTCPSocket#accept_or_shutdown): New private method which returns
- nil on shutdown.
- (DRbServer#stop_service): Use shutdown instead of Thread#kill.
- (DRbServer#run): Break infinite loop when main_loop returns nil.
- (DRbServer#main_loop): @protocol.accept may return nil.
-
- * lib/drb/ssl.rb: Follow above change.
-
- * lib/drb/unix.rb: Ditto.
-
-Sun Sep 21 13:54:36 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * time.c: raise exception when minutes of utc_offset is out of 00-59.
- patch is from Kenichi Kamiya.
- [ruby-dev:47539] [Bug #8679]
-
- * test/ruby/test_time.rb: test for above.
- patch is from Kenichi Kamiya.
-
-Sun Sep 21 19:04:08 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * st.c (do_hash_bin): unused macro.
-
-Sun Sep 21 18:45:01 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * parse.y (parser_class_nest): unused variable after YARV
- merged (r11439).
-
-Sun Sep 21 18:14:03 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * st.c (numberof): unused. internal.h has same macro.
-
- * node.c (F_CUSTOM2): unused.
-
-Sun Sep 21 14:11:23 2014 Tanaka Akira <akr@fsij.org>
-
- * thread_pthread.c (native_set_thread_name): New function to
- set thread name visible with ps command on GNU/Linux.
- Ex. ps -o %c -L
-
- * thread.c (thread_start_func_2): Call native_set_thread_name at
- beginning.
- (rb_thread_inspect_msg): Extract from rb_thread_inspect.
-
-Sun Sep 21 12:49:11 2014 Eric Wong <e@80x24.org>
-
- * iseq.c (rb_iseq_defined_string): trim redundant semi-colon
-
-Sun Sep 21 12:19:29 2014 Eric Wong <e@80x24.org>
-
- * file.c (rb_find_file_ext_safe): clear tmp buffer on failure
- (rb_find_file_safe): ditto
-
-Sat Sep 20 04:42:18 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * lib/csv.rb: avoid unnecessary object allocations.
- patch is from Andrew Vit. [ruby-core:63215] [Feature #9952]
-
-Sun Sep 21 12:10:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rexml/**/*.rb: removed commented-out code.
-
-Sat Sep 20 03:46:58 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * array.c: use rb_equal_opt() for performance improvement.
- [ruby-core:64954] [Feature #10227]
-
-Sun Sep 21 11:16:56 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (rbtime2vtdate, vtdate2rbtime): fix
- the bug in conversion of milliseconds. [Bug #10258]
-
- * test/win32ole/test_win32ole_variant.rb
- (test_conversion_dbl2date_with_msec,
- test_conversion_time2date_with_msec): use assert_in_delta instead
- of assert_equal to treat an acceptable error range.
-
-Sun Sep 21 11:03:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (ruby_signal): although "EINVAL from sigaction(2) is
- not a bug", but even it is a failure. pointed at toRuby/guRuby
- in RubyHiroba.
-
-Sat Sep 20 03:00:26 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * lib/tempfile.rb: define parameters appropriately and some
- refactoring.
-
- * lib/tmpdir.rb: ditto.
-
-Sat Sep 20 23:58:21 2014 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_chunk): Deprecate the state management.
- (enum_slice_before): Ditto.
-
-Sat Sep 20 15:39:11 2014 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_slice_when): New method: Enumerable#slice_when.
- (slicewhen_i): New function.
- (slicewhen_ii): New function.
-
- * enumerator.c (InitVM_Enumerator): New method:
- Enumerator::Lazy#slice_when.
-
- [ruby-core:62499] [Feature #9826]
-
-Sat Sep 20 11:55:19 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .travis.yml: added new configurations for osx on travis ci.
- [fix GH-723]
- * test/ruby/test_object.rb: tweaked to memory leak limit for osx build.
-
-Sat Sep 20 10:48:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (assoc): allow quoted ID as a key of a hash literal.
- [ruby-core:34453] [Feature #4276]
-
-Sat Sep 20 10:23:00 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_set_arguments): store local variable IDs in
- temporary list as Symbols. previously these are stored as
- Fixnums to prevent from GC, but IDs of dynamic symbols can
- exceed Fixnum range and cause RangeError at inverting from
- Fixnum. [ruby-dev:48564] [Bug #10266]
-
-Sat Sep 20 10:02:51 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#pretty_print):
- New method.
- (OpenSSL::X509::Certificate#pretty_print): Ditto.
-
- * ext/openssl/lib/openssl/bn.rb (OpenSSL::BN#pretty_print): Ditto.
-
-Sat Sep 20 07:55:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (eval_string_with_cref): fix super from eval with
- scope. set klass in the current control frame to the class of
- the receiver in the context to be evaluated, this class/module
- must match the actual receiver to call super.
- [ruby-core:65122] [Bug #10263]
-
-Fri Sep 19 20:06:00 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.c (rb_str_dynamic_intern): check if the stem ID of
- attrset ID is already registered as a static ID.
- [ruby-dev:48559] [Bug #10259]
-
-Fri Sep 19 15:48:09 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (VCSUP): nothing to do if this worktree is not
- under any VCS (it means that the worktree may be from the release
- package).
-
-Fri Sep 19 10:47:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_math.rb (TestMath#assert_infinity): Float#finite?
- returns true also for NaN, so use Float#infinite? instead.
- [ruby-core:65117] [Feature #10261]
-
-Fri Sep 19 05:36:16 2014 Eric Wong <e@80x24.org>
-
- * NEWS: note --with-jemalloc option [ci skip]
-
-Thu Sep 18 16:26:27 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/rubygems/test_gem_commands_setup_command.rb: @ui uses StringIO
- as its streams, and Encoding.default_external does not effect to
- StringIOs already exist. so, we need to set external_encoding of
- @ui.outs directly. this problem (test failure) does not appear in
- the environments default_external is us-ascii or utf-8.
-
-Thu Sep 18 15:02:15 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/rubygems/test_gem_specification.rb: '/' is not always the root.
-
-Thu Sep 18 09:36:37 2014 Scott Francis <scott.francis@shopify.com>
-
- * vm_method.c (Init_Method): make global method cache size
- configurable by environment variable
- "RUBY_GLOBAL_METHOD_CACHE_SIZE" [Fix GH-719]
-
-Thu Sep 18 07:03:36 2014 Eric Wong <e@80x24.org>
-
- * test/-ext-/string/test_modify_expand.rb: increase limit
- for {je,tc}malloc [Bug #10236]
-
-Thu Sep 18 06:41:18 2014 Eric Wong <e@80x24.org>
-
- * ext/zlib/zlib.c (struct gzfile): pack (288 => 272 bytes) on 64-bit
-
-Thu Sep 18 05:44:05 2014 Eric Wong <e@80x24.org>
-
- * ext/socket/init.c (rsock_connect): refactor for blocking
- (wait_connectable): clear error before wait
- [Bug #9356]
-
-Wed Sep 17 23:12:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/rfc3986_parser.rb: specify a regexp for :OPAQUE; generic.rb
- assumes it is present, and will refuse all values otherwise.
- by Matthew Draper <matthew@trebex.net>
- https://github.com/ruby/ruby/pull/718 fix GH-718
-
-Wed Sep 17 16:22:58 2014 Eric Wong <e@80x24.org>
-
- * ext/zlib/zlib.c (zlib_mem_alloc): check overflow
-
-Wed Sep 17 11:33:35 2014 Laurent Arnoud <laurent@spkdev.net>
-
- * test/fiddle/test_import.rb (Fiddle::TestImport#test_sizeof):
- added test for long long [fix GH-716]
-
-Wed Sep 17 11:09:21 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * tool/rbinstall.rb: fixed invalid options with latest rubygems.
- https://github.com/rubygems/rubygems/issues/1013
-
-Tue Sep 16 19:19:00 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * benchmark/bm_app_aobench.rb: update outdated links to the
- original program. [ruby-dev:48550] [Feature #10247]
-
-Tue Sep 16 01:06:40 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * reg*.c: Merge Onigmo 5.15.0 38a870960aa7370051a3544
-
-Mon Sep 15 16:21:10 2014 Eric Wong <e@80x24.org>
-
- * io.c (struct io_advise_struct): 32 => 24 bytes on 64-bit
- * io.c (struct io_internal_writev_struct): 24 => 16 bytes on 64-bit
- * process.c (struct waitpid_arg): ditto
-
-Mon Sep 15 10:29:25 2014 Natalie Weizenbaum <nweiz@google.com>
-
- * ext/pathname/lib/pathname.rb (SAME_PATHS):
- Pathname#relative_path_from uses String#casecmp to compare strings
- on case-insensitive filesystem platforms (e.g., Windows). This can
- return nil for strings with different encodings, and the code
- previously assumed that it always returned a Fixnum. [Fix GH-713]
-
-Mon Sep 15 09:43:18 2014 Sho Hashimoto <sho.hsmt@gmail.com>
-
- * ext/fiddle/lib/fiddle/import.rb (Fiddle::Importer#sizeof): fix typo,
- SIZEOF_LONG_LON. [Fix GH-714]
-
-Mon Sep 15 08:13:40 2014 Matthew Draper <matthew@trebex.net>
-
- * sprintf.c (rb_str_format): rational 'f' format works for more
- values. [fix GH-717]
-
-Sun Sep 14 16:57:27 2014 Eric Wong <e@80x24.org>
-
- * template/vm.inc.tmpl: "insns.c" => "insns.def"
- * tool/instruction.rb: typo fix
-
-Sun Sep 14 12:29:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_tracer.rb: fixed testcase for rubygems update.
-
-Sun Sep 14 12:29:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rubygems: Update to RubyGems 2.4.1 master(713ab65)
- Complete history at:
- https://github.com/rubygems/rubygems/blob/master/History.txt#L3-L216
-
- * test/rubygems: ditto.
-
-Sun Sep 14 11:03:24 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych.rb: update version
- * ext/psych/psych.gemspec: ditto
-
-Sun Sep 14 08:43:37 2014 Eric Wong <e@80x24.org>
-
- * ccan/container_of/container_of.h (container_of_or_null): added
- [ccan 7ec5b8e06b2fd5fa98b1fcde1158c286d2d429d8] (David Gibson)
-
-Sun Sep 14 08:41:44 2014 Eric Wong <e@80x24.org>
-
- * ccan/list/list.h (list_del_init, list_node_init): new functions
- for multiple list_del() calls
- [ccan ec8654d94d3c5c47aa5f82698f7e8048c79765b1] (Rusty Russell)
-
-Sat Sep 13 22:19:26 2014 Bernard Potocki <bernard.potocki@imanel.org>
-
- * hash.c (rb_hash_aset): fix misleading example which may suggest
- that Hash.store will return self instead of value - Hash#store
- is returning value and update itself, as well as Hash#[]=.
- [Fix GH-715]
-
-Sat Sep 13 15:16:31 2014 Eric Wong <e@80x24.org>
-
- * class.c: use ALLOC(rb_subclass_entry_t)
-
-Sat Sep 13 14:14:00 2014 Eric Wong <e@80x24.org>
-
- * process.c (free_exec_arg): remove
- (memsize_exec_arg): ptr is never NULL
- (exec_arg_data_type): use RUBY_TYPED_DEFAULT_FREE
-
- * variable.c (autoload_i_free): remove
- (autoload_data_i_type): use RUBY_TYPED_DEFAULT_FREE
- (autoload_memsize): ptr is never NULL
-
- * vm_backtrace.c (location_free): remove
- (location_mark): ptr is never NULL
- (location_data_type): use RUBY_TYPED_DEFAULT_FREE
- (backtrace_mark): ditto
- (backtrace_free): ditto
-
-Sat Sep 13 13:43:07 2014 Eric Wong <e@80x24.org>
-
- * doc/NEWS-2.0.0: fix typo for default RUBY_FIBER_MACHINE_STACK_SIZE
- [ci skip]
-
-Sat Sep 13 11:16:58 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_event.c(ev_advise, ole_event_free,
- fev_s_allocate, fev_unadvise): avoid segmentation fault when COM
- server freed before calling Unadvise from WIN32OLE_EVENT object.
- * ext/win32ole/win32ole.c: ditto.
-
-Sat Sep 13 09:47:44 2014 Eric Wong <e@80x24.org>
-
- * man/ruby.1: use https for *.ruby-lang.org links
-
-Sat Sep 13 06:31:23 2014 Eric Wong <e@80x24.org>
-
- * vm.c (thread_alloc): remove needless volatile
-
-Sat Sep 13 06:13:55 2014 Eric Wong <e@80x24.org>
-
- * proc.c (proc_free): remove, use RUBY_TYPED_DEFAULT_FREE
- (proc_mark, proc_memsize): remove needless branching
-
- * vm.c (env_free): remove, use RUBY_TYPED_DEFAULT_FREE
- (env_mark, env_memsize): remove needless branching
-
-Sat Sep 13 05:52:15 2014 Eric Wong <e@80x24.org>
-
- * proc.c (rb_proc_alloc): inline and move to vm.c
- (rb_proc_wrap): new wrapper function used by rb_proc_alloc
- (proc_dup): simplify alloc + copy + wrap operation
- [ruby-core:64994]
-
- * vm.c (rb_proc_alloc): new inline function
- (rb_vm_make_proc): call rb_proc_alloc
-
- * vm_core.h: remove rb_proc_alloc, add rb_proc_wrap
-
- * benchmark/bm_vm2_newlambda.rb: short test to show difference
-
-Sat Sep 13 04:40:04 2014 Eric Wong <e@80x24.org>
-
- * process.c (Init_process): subclass Thread as Process::Waiter
- (rb_detach_process): use Process::Waiter instead of singleton class
- Thanks to headius and nobu. [Bug #10231]
-
- * test/ruby/test_process.rb (test_process_detach): new test
-
- * inits.c (rb_call_inits): call Init_Thread before Init_process to
- ensure Process::Waiter may be a subclass of Thread
-
-Fri Sep 12 18:14:28 2014 Eric Wong <e@80x24.org>
-
- * vm.c (env_alloc): inline to avoid extra zeroing
- tiny speedup [ruby-core:64980]
-
-Fri Sep 12 17:13:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_method.c (rb_method_entry_make, remove_method): ditto.
-
-Fri Sep 12 14:39:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gems/bundled_gems: Upgraded to test-unit-3.0.1 and minitest-5.4.1
-
-Fri Sep 12 06:55:40 2014 Eric Wong <e@80x24.org>
-
- * string.c (Init_frozen_strings): use st_init_table_with_size
-
-Fri Sep 12 06:15:37 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (sym_find): remove Symbol.find because we have Symbol GC now.
- https://bugs.ruby-lang.org/projects/ruby/wiki/DevelopersMeeting20140904Japan
- If you still want this, request again on Redmine. [Feature #7854]
- https://bugs.ruby-lang.org/issues/7854
-
- * ext/-test-/symbol/init.c (sym_find): moved from string.c for tests.
-
-Fri Sep 12 04:24:03 2014 Eric Wong <e@80x24.org>
-
- * insns.def (once): define and use fake RUNNING_THREAD_ONCE_DONE
- pointer to indicate is->once.running_thread is done.
-
- * vm_core.h (iseq_inline_storage_entry): remove done field,
- allowing the union to be reduced from 24=>16 bytes on 64-bit
- [Feature #10187]
-
-Thu Sep 11 20:10:00 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (rb_thread_mark): use rb_gc_mark_values() to mark VM stack.
-
-Thu Sep 11 19:50:57 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (rb_vm_register_special_exception): make new function to
- make and register special exceptions.
-
- * vm.c (rb_vm_mark): do not need to mark special exceptions
- because they are registered by rb_gc_register_mark_object().
-
- * eval.c (Init_eval): use rb_vm_register_special_exception().
-
- * gc.c (Init_GC): ditto.
-
- * proc.c (Init_Proc): ditto.
-
- * thread.c (Init_Thread): ditto.
-
-Thu Sep 11 19:32:30 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_gc_mark_values): added.
- This function is similar to rb_gc_mark_locations(), but not
- conservative.
-
- * internal.h: ditto.
-
- * vm.c (env_mark): use rb_gc_mark_values() because env values should
- be Ruby VALUEs.
-
-Thu Sep 11 19:16:39 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_mark_ptr): rename to gc_mark_set.
-
- * gc.c (gc_mark): add gc_mark_ptr() to skip is_markable_object()
- check. gc_mark_maybe() can use gc_mark_ptr() directly because
- passed pointer is checked by is_pointer_to_heap().
-
-Thu Sep 11 18:40:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .gitignore: ignored temporary files and coverage results.
-
-Thu Sep 11 18:15:30 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .gitignore: ignored only simplecov.
- * coverage/README: Added coverage docs.
-
-Thu Sep 11 17:25:31 2014 Koichi Sasada <ko1@atdot.net>
-
- * include/ruby/ruby.h, gc.c: add new internal events
- RUBY_INTERNAL_EVENT_GC_ENTER and
- RUBY_INTERNAL_EVENT_GC_EXIT.
-
- When invoking GC process, GC_ENTER event is called.
- When exiting from GC process, GC_EXIT event is called.
-
- Incremental GC (incremental marking and lazy sweep) can call
- these events many times.
-
- For example (minor marking):
- (1) GC_ENTER
- - (2) GC_START (minor GC)
- (minor marking)
- - (3) GC_END_MARK
- (start lazy sweep)
- (4) GC_EXIT
- (ruby process)
- (5) GC_ENTER
- (lazy sweep)
- (6) GC_EXIT
- (ruby process)
- (... repeat (5), (6))
- (7) GC_ENTER
- (finish lazy sweep)
- - (8) GC_END_SWEEP
- (9) GC_EXIT
-
- 2nd example (incremental major marking):
- (1) GC_ENTER
- - (2) GC_START (minor GC)
- (start incremental marking)
- (3) GC_EXIT
- (ruby process)
- (4) GC_ENTER
- (incremental marking)
- (5) GC_EXIT
- (ruby process)
- (... repeat (4), (5))
- (6) GC_ENTER
- (finish incremental marking)
- - (7) GC_END_MARK
- (start lazy sweep)
- (8) GC_EXIT
- (ruby process)
- (9) GC_ENTER
- (lazy sweep)
- (10) GC_EXIT
- (ruby process)
- (... repeat (9), (10))
- (11) GC_ENTER
- (finish lazy marking)
- - (12) GC_STOP_SWEEP
- (13) GC_EXIT
-
- These internal events enable to measure GC pause time completely.
-
-Thu Sep 11 17:04:54 2014 Eric Wong <e@80x24.org>
-
- * lib/benchmark.rb: remove CLOCK_MONOTONIC_RAW support
- Thanks to Vit Ondruch for reporting the issue on ARM.
- [Bug #10202]
-
-Thu Sep 11 14:31:57 2014 Koichi Sasada <ko1@atdot.net>
-
- * include/ruby/ruby.h: freeze nil/true/false.
- [Feature #8923]
-
- * gc.c (should_be_finalizable): check frozen after checkin FL_ABLE.
-
- * object.c (rb_obj_taint): check
- OBJ_TAINTABLE(obj).
-
- * object.c (rb_obj_freeze): remove immediate_frozen_tbl
- because all of immediate values are frozen. YAY!
-
- * object.c (rb_obj_frozen_p): ditto.
-
- * test/ruby/test_eval.rb: skip instance_variable_set for
- frozen objects.
-
- * test/ruby/test_weakmap.rb: check ArgumentError instead of
- RuntimeError.
-
-Thu Sep 11 10:03:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rdoc.rb, lib/rdoc, test/rdoc: Update to RDoc 4.2.0.alpha(21b241a)
-
-Wed Sep 10 17:52:25 2014 Koichi Sasada <ko1@atdot.net>
-
- * compile.c (rb_vm_addr2insn): rename to rb_vm_insn_addr2insn
- to clear what address.
-
-Wed Sep 10 16:22:26 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_gc.rb: fix condition.
-
-Wed Sep 10 15:29:46 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_call_info_t): ci->flag becomes 32-bit unsigned int
- ci->index becomes a 32-bit signed int (from signed long).
- Reorder for better packing on 64-bit, giving an 8 byte reduction
- from 104 to 96 bytes for each ci.
- [Feature #10187]
-
- * compile.c (new_callinfo, setup_args, iseq_compile_each,
- iseq_build_from_ary_body): adjust for type changes
-
- * vm_insnhelper.c (vm_getivar): ditto
-
-Wed Sep 10 15:07:35 2014 Eric Wong <e@80x24.org>
-
- * compile.c (rb_iseq_translate_threaded_code):
- modify in-place w/o copy
- (rb_vm_addr2insn): new function for debug
- (rb_iseq_original_iseq): ditto
- (iseq_set_sequence): assign iseq_encoded directly
- [Feature #10185]
-
- * vm_core (rb_iseq_t): move original ->iseq to bottom
-
- * iseq.c (iseq_free, iseq_free): adjust for new layout
- (rb_iseq_disasm): use original iseq for dump
- (iseq_data_to_ary): ditto
- (rb_iseq_line_trace_each): ditto
- (rb_iseq_build_for_ruby2cext): use iseq_encoded directly
-
- * vm_dump.c (rb_vmdebug_debug_print_pre): use original iseq
-
-Wed Sep 10 15:00:11 2014 Eric Wong <e@80x24.org>
-
- * time.c (time_mark): remove NULL check
- (time_memsize): ditto
- (time_free): remove, use RUBY_TYPED_DEFAULT_FREE instead
- [Feature #10219]
-
-Wed Sep 10 14:14:57 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk (encs enc trans libencs libenc libtrans): force to run
- enk.mk because common.mk does not know the dependency, but enk.mk
- knows. [ruby-dev:48530] [Bug #10220]
-
-Wed Sep 10 11:59:10 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat): update rdoc.
-
-Wed Sep 10 11:52:08 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): rename:
- * malloc_increase -> malloc_increase_bytes
- * malloc_limit -> malloc_increase_bytes_limit
- * oldmalloc_increase -> oldmalloc_increase_bytes
- * oldmalloc_limit -> oldmalloc_increase_bytes_limit
- ref: [Feature #9924]
-
-Wed Sep 10 11:45:40 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): rename `heap_used' to `heap_allocated_pages'.
- ref: [Feature #9924]
-
- * test/ruby/test_gc.rb: add constraints test for gc stat information.
-
-Wed Sep 10 11:31:16 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): rename:
- * remembered_shady_object -> remembered_wb_unprotected_objects
- * remembered_shady_object_limit -> remembered_wb_unprotected_objects_limit
- * old_object -> old_objects
- * old_object_limit -> old_objects_limit
- ref: [Feature #9924]
-
-Wed Sep 10 11:12:25 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): support:
- * total_allocated_pages
- * total_freed_pages
- ref: [Feature #9924]
-
-Wed Sep 10 10:48:04 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_gc.rb: catch up last fix.
-
-Wed Sep 10 10:36:08 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (objspace_total_slot): rename objspace_available_slots.
-
- * gc.c (objspace_live_slot, objspace_free_slot): rename
- ..._slot() to ..._slots().
-
- * gc.c (objspace_free_slot): should subtract heap_pages_final_slots.
-
- * gc.c (gc_stat_internal):
- * add `heap_available_slots' field
- * rename heap_live_slot to heap_live_slots
- * rename heap_free_slot to heap_free_slots
- ref: [Feature #9924]
-
-Wed Sep 10 07:22:53 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: refactoring for RGENGC_PROFILE > 0.
-
- * rename rb_objspace_t::profile::..._count
- to rb_objspace_t::profile::total_..._count
- * rename promote_infant_types to promote_types
-
- * gc.c (gc_remember_unprotected): count remembered shady objects here.
-
-Wed Sep 10 03:12:12 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * gc.c (init_mark_stack): MEMZERO() receive type as 2nd argument instead
- of size.
- Coverity Scan found this bug.
-
-Tue Sep 9 21:55:39 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/sample/excel2.rb: remove some commented-out code.
- rotate graph more slowly to see graph clearly.
-
-Tue Sep 9 19:52:33 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename rb_objspace_t::marked_objects to marked_slots.
-
- * gc.c (gc_marks_start): should be clear first.
-
- * gc.c (gc_marks_start): remembered shady objects are also marked.
-
- * gc.c (gc_stat_internal): add heap_marked_slots.
-
-Tue Sep 9 18:58:48 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename
- * total_allocated_object_num -> total_allocated_objects
- * total_allocated_object_num_at_gc_start -> total_allocated_objects_at_gc_start
- * total_freed_object_num -> total_freed_objects
-
- * gc.c (gc_stat_internal):
- * rename total_allocated_object -> total_allocated_objects
- * rename total_freed_object -> total_freed_objects
-
-Tue Sep 9 18:51:36 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): fix symbol names
- * heap_final_slot -> heap_final_slots
- * heap_swept_slot -> heap_swept_slots
-
-Tue Sep 9 18:18:07 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_objspace_t::heap_pages): rename field names:
- * used -> allocated_pages
- * increment -> allocatable_pages
- * length -> sorted_length
- And remove unused `limit' field.
-
- * gc.c: rename macros:
- * heap_pages_used -> heap_allocated_pages
- * heap_pages_length -> heap_pages_sorted_length
- * heap_pages_increment -> heap_allocatable_pages
-
- * gc.c (gc_stat_internal): fix symbol names
- * heap_used -> heap_allocated_pages
- * heap_eden_page_length -> heap_eden_pages
- * heap_tomb_page_length -> heap_tomb_pages
- * heap_increment -> heap_allocatable_pages
- * heap_length -> heap_sorted_length
-
- ref: [Feature #9924]
- https://docs.google.com/spreadsheets/d/11Ua4uBr6o0k-nORrZLEIIUkHJ9JRzRR0NyZfrhEEnc8/edit?usp=sharing
- Yellow color fields in this table are changed.
-
- * test/ruby/test_gc.rb: catch up this change.
-
-Tue Sep 9 14:56:03 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: continue layout changing.
-
- newobj_of() also touch:
- (4) increment total_allocated_object_num
- (5) check hook_events
-
- And gather fields related to marking phase.
-
-Tue Sep 9 14:21:50 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: fix layout of rb_objspace_t to improve cache locality.
-
- newobj_of() accesses:
- (1) rb_objspace_t::flags
- (2) rb_objspace_t::eden_heap::freelist
- (3) and rb_objspace_t::eden_heap::free_pages if freelist is NULL.
-
-Tue Sep 9 14:09:36 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: move rb_objspace_t::flags::gc_stressful after during_gc
- to make accessing both parameters easy.
-
- * gc.c (heap_get_freeobj): add LIKELY() hint.
-
- * gc.c (heap_get_freeobj_from_next_freepage): ditto.
-
- * gc.c (newobj_of): check both parameters at once for exceptional
- case.
-
-Tue Sep 9 13:51:32 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: add rb_objspace_t::flags::gc_stressful and
- ruby_gc_stressful macro.
- Rename objspace->gc_stress to objspace->gc_stress_mode.
-
- If objspace->gc_stress_mode is true (!nil and !false) then
- ruby_gc_stressful becomes TRUE.
-
- ruby_gc_stressful will speedup newobj_of() slightly.
-
- * gc.c: initialize ruby_gc_stress(full|_mode) by gc_params.gc_stress
- even if ENABLE_VM_OBJSPACE is false.
-
-Tue Sep 9 13:05:50 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: remove ruby_disable_gc_stress and add ruby_disable_gc
- to speed-up newobj_of().
-
- * gc.c (ready_to_gc): check ruby_disable_gc.
-
- * signal.c: use ruby_disable_gc.
-
-Tue Sep 9 12:11:41 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename gc_stat entries and check stat transition.
-
-Tue Sep 9 12:06:03 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_sweep_rest): remove wrong modification of during_gc flag.
-
-Tue Sep 9 11:39:41 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: pack boolean values into rb_objspace_t::flags with bit fields
- to improve cache locality.
-
-Tue Sep 9 11:11:05 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_object.rb: extend timeout.
-
-Tue Sep 9 09:02:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (MakeMakefile#pkg_config): append --cflags to also
- $CXXFLAGS, as they are often used by C++ compiler.
- [ruby-core:54532] [Bug #8315]
-
-Tue Sep 9 07:03:22 2014 Eric Wong <e@80x24.org>
-
- * compile.c: remove needless SYM2ID <-> ID2SYM conversions
- [misc #10207]
-
-Tue Sep 9 05:48:42 2014 Eric Wong <e@80x24.org>
-
- * symbol.c (rb_intern_cstr_without_pindown): check dsymbol on return
- This is not a complete fix for bug 10206, but seems to reduce
- that crash and also looks correct.
-
-Tue Sep 9 04:36:24 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_env_t): use flexible array
- This reduces allocations and speeds up the lambda calculus
- fizzbuzz (bm_app_lc_fizzbuzz.rb) benchmark [ruby-core:64858]
- * proc.c (get_local_variable_ptr): deconst to adjust for flex array
- * vm.c (env_mark, env_free, env_memsize): remove check for env->env
- * vm.c (env_alloc): single allocation for flex array
- * vm.c (vm_make_env_each): adjust env_alloc call
-
-Mon Sep 8 16:08:22 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/bm_app_lc_fizzbuzz.rb: should skip output on benchmark.
-
-Mon Sep 8 16:04:02 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/bm_app_lc_fizzbuzz.rb: `answer.to_a' does not return
- a string, but an array.
-
-Mon Sep 8 13:18:37 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/bm_app_lc_fizzbuzz.rb: added.
-
- This program is described closely in "Understanding Computation"
- chapter 6 by Tom Stuart. <http://computationbook.com/>
-
- Japanese translation will be published soon.
- <http://www.oreilly.co.jp/books/9784873116976/>
-
-Mon Sep 8 12:01:39 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: add incremental GC algorithm. [Feature #10137]
-
- Please refer this ticket for details.
-
- This change also introduces the following changes.
-
- * Remove RGENGC_AGE2_PROMOTION and introduce object age (0 to 3).
- Age can be count with FL_PROMOTE0 and FL_PROMOTE1 flags in
- RBasic::flags (2 bit). Age == 3 objects become old objects.
- * WB_PROTECTED flag in RBasic to WB_UNPROTECTED bitmap.
- * LONG_LIVED bitmap to represent living objects while minor GCs
- It specifies (1) Old objects and (2) remembered shady objects.
- * Introduce rb_objspace_t::marked_objects which counts marked
- objects in current marking phase. marking count is needed to
- introduce incremental marking.
- * rename mark related function and sweep related function to
- gc_(marks|sweep)_(start|finish|step|rest|continue).
- * rename rgengc_report() to gc_report().
- * Add obj_info() function to get cstr of object details.
- * Add MEASURE_LINE() macro to measure execution time of specific line.
- * and many small fixes.
-
- * include/ruby/ruby.h: add flag USE_RINCGC.
- Now USE_RINCGC can be set only with USE_RGENGC.
-
- * include/ruby/ruby.h: introduce FL_PROMOTED0 and add FL_PROMOTED1
- to count object age.
-
- * include/ruby/ruby.h: rewrite write barriers for incremental marking.
-
- * debug.c: catch up flag name changes.
-
- * internal.h: add rb_gc_writebarrier_remember() instead of
- rb_gc_writebarrier_remember_promoted().
-
- * array.c (ary_memcpy0): use rb_gc_writebarrier_remember().
-
- * array.c (rb_ary_modify): ditto.
-
- * hash.c (rb_hash_keys): ditto.
-
- * hash.c (rb_hash_values): ditto.
-
- * object.c (init_copy): use rb_copy_wb_protected_attribute() because
- FL_WB_PROTECTED is moved from RBasic::flags.
-
- * test/objspace/test_objspace.rb: catch up ObjectSpace.dump() changes.
-
-Sun Sep 7 12:47:06 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c: PTHREAD_CANCEL_DISABLE is not defined on Android.
-
-Sat Sep 6 20:59:06 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (has_privilege): The gid zero is not a privilege.
-
-Sat Sep 6 20:19:16 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (struct child_handler_disabler_state): cancelstate field
- added.
- (disable_child_handler_before_fork): Record cancelstate.
- (disable_child_handler_fork_parent): Restore cancelstate.
-
-Sat Sep 6 19:27:10 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (struct child_handler_disabler_state): Defined.
-
-Sat Sep 6 18:31:32 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rake.rb, lib/rake/*, test/rake/*: Update latest rake master(e47d023)
-
-Sat Sep 6 16:38:08 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_variant.c (ole_val2variant_err,
- ole_val2variantdata, Init_win32ole_variant): support VT_ERROR
- variant with error code. add WIN32OLE_VARIANT::NoParam.
- * test/win32ole/test_win32ole_variant.rb(test_c_noparam,
- test_vt_error_noparam): ditto.
- * ext/win32ole/win32ole.c: ditto.
-
-Sat Sep 6 11:08:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (arg_ambiguous_gen): fix warning message, "even" does
- not mean the number of spaces here. state the place to put a
- space and the operator. [ruby-core:64790] [Bug #10204]
-
-Sat Sep 6 08:44:40 2014 Zachary Scott <e@zzak.io>
-
- * lib/rdoc/generator/template/darkfish/js/jquery.js: Backport
- rdoc/rdoc@74f60fcb04fee1778fe2694d1a0ea6513f8e67b7
-
-Sat Sep 6 08:10:44 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_io.rb (test_readpartial_locktmp): use IO#nonblock=
- Old fcntl invocation may drop necessary flags on some platforms.
-
-Sat Sep 6 07:46:51 2014 Eric Wong <e@80x24.org>
-
- * test/ruby/test_io.rb (test_readpartial_locktmp): avoid EBADF
- [ruby-core:64773] [ruby-core:64775]
-
-Sat Sep 6 01:34:31 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (rb_f_exec): Call before_exec_async_signal_safe and
- after_exec_async_signal_safe around rb_exec_async_signal_safe.
- (rb_exec_async_signal_safe): Don't call
- before_exec_async_signal_safe and after_exec_async_signal_safe.
- (rb_exec_without_timer_thread): Call before_exec and
- after_exec.
- (disable_child_handler_fork_child): Make SIGPIPE handler SIG_DFL.
-
-Sat Sep 6 00:49:41 2014 Tanaka Akira <akr@fsij.org>
-
- * signal.c (ruby_signal): Don't set SA_SIGINFO for SIG_IGN and
- SIG_DFL.
-
-Fri Sep 5 21:45:33 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (disable_child_handler_before_fork): New function.
- (disable_child_handler_fork_parent): Ditto.
- (disable_child_handler_fork_child): Ditto.
- (retry_fork_async_signal_safe): Call above functions to disable
- signal handlers in child process.
-
-Fri Sep 5 21:02:54 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (handle_fork_error): Make try_gc_p argument volatile to
- suppress "clobbered" warning.
-
-Fri Sep 5 20:48:06 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (handle_fork_error): Don't need state_p argument.
-
-Fri Sep 5 20:35:52 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (has_privilege): Fix a return value.
-
-Fri Sep 5 19:00:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/shellwords.rb: proofreading documentation.
- [Bug #10155][ruby-core:64471]
-
-Fri Sep 5 18:34:33 2014 Laurent Arnoud <laurent@spkdev.net>
-
- * test/csv/test_row.rb: Added some missing tests in CSV.
- [fix GH-710]
- * test/csv/test_table.rb: ditto.
-
-Fri Sep 5 12:57:52 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (has_privilege): Refine uid/gid check.
-
-Fri Sep 5 12:40:55 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in: Check sys/id.h, getuidx and getgidx for AIX.
-
- * process.c (getresuid): Defined for AIX.
- (getresgid): Ditto
- AIX don't have getresuid/getresgid but getuidx/getgidx.
-
-Fri Sep 5 12:28:21 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (has_privilege): Fix assignments.
-
-Fri Sep 5 11:10:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rdoc/generator/pot/po.rb: fixed broken tests for trailing whitespace.
- * test/rdoc/test_rdoc_generator_pot.rb: ditto.
- * test/rdoc/test_rdoc_generator_pot_po.rb: ditto.
-
-Fri Sep 5 10:41:07 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/rdoc/test_rdoc_rdoc.rb (TestRDocRDoc#test_parse_file_encoding):
- typofix.
-
-Fri Sep 5 10:39:14 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rdoc.rb, lib/rdoc, test/rdoc: Update to RDoc 4.2.0.alpha(313287)
-
-Fri Sep 5 06:04:22 2014 Eric Wong <e@80x24.org>
-
- * vm.c: remove unused USE_THREAD_RECYCLE [misc #10198]
-
-Fri Sep 5 00:29:08 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in (dirfd): Check function.
-
- * dir.c (dir_fileno): New method.
- [ruby-dev:48265] [Feature #9880]
-
-Thu Sep 4 23:39:52 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (has_privilege): New function.
- (retry_fork_async_signal_safe): Don't use vfork() for privileged
- process.
-
- * configure.in (getresuid): Check function.
- (getresgid): Ditto.
-
-Thu Sep 4 20:22:14 2014 Laurent Arnoud <laurent@spkdev.net>
-
- * test/pathname/test_pathname.rb: added testcase for Pathname#mountpoint?.
- [fix GH-709]
-
-Thu Sep 4 20:09:21 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * symbian/*: removed Symbian support.
- [Feature #10199][ruby-core:64725]
- * dln.c: ditto.
- * include/ruby/defines.h: ditto.
- * thread_pthread.c: ditto.
- * vm.c: ditto.
-
-Thu Sep 4 17:44:40 2014 Koichi Sasada <ko1@atdot.net>
-
- * dir.c (glob_helper): use #ifdef instead of #if.
- gcc's -Wundef option shows warning for undefined macro.
-
- * numeric.c (flo_is_finite_p): ditto.
-
- * vm_dump.c (rb_vmdebug_thread_dump_state): ditto.
-
- * vm_core.h: define VM_DEBUG_VERIFY_METHOD_CACHE to 0.
-
-Thu Sep 4 03:57:46 2014 Eric Wong <e@80x24.org>
-
- * man/ruby.1: spelling fix ("bellow" => "below") [ci-skip]
-
-Thu Sep 4 03:52:16 2014 Eric Wong <e@80x24.org>
-
- * man/ruby.1: add trailing slash to URLs [ci-skip]
-
-Wed Sep 3 19:10:28 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (before_fork_ruby): Renamed from before_fork.
- (after_fork_ruby): Renamed from after_fork.
-
-Wed Sep 3 18:56:05 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (forked_child): Removed.
-
-Wed Sep 3 16:56:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_obj_copy_ivar): allocate no memory for empty
- instance variables. [ruby-core:64700] [Bug #10191]
-
-Wed Sep 3 12:05:17 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (retry_fork_async_signal_safe): Use vfork() if available.
- vfork() is still faster than fork() especially when the parent
- process uses big memory.
-
- ruby -rbenchmark -e 'a = "a" * 1_000_000_000; puts Benchmark.measure { system("true") }'
- fork: 0.000000 0.010000 0.010000 ( 0.014968)
- vfork: 0.000000 0.000000 0.000000 ( 0.000912)
- on Debian sid.
-
-Wed Sep 3 11:33:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_pkey_rsa.rb (OpenSSL#test_sign_verify_memory_leak):
- added timeout into testcase for low performance environment.
- [Bug #9984][ruby-core:63367]
-
-Wed Sep 3 07:50:15 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in: Use AC_FUNC_FORK.
-
- * io.c: Use HAVE_WORKING_FORK instead of HAVE_FORK.
-
- * process.c: Ditto.
-
-Wed Sep 3 00:12:44 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (retry_fork_async_signal_safe): Don't return on in child
- process.
-
-Tue Sep 2 23:47:35 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (retry_fork_async_signal_safe): Specialized version of
- retry_fork respect to rb_fork_async_signal_safe.
- (retry_fork_ruby): Specialized version of retry_fork respect to
- rb_fork_ruby.
- (rb_fork_ruby): Removed.
-
-Tue Sep 2 23:26:26 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (send_child_error): Simplified.
- (recv_child_error): Ditto.
-
-Tue Sep 2 22:56:25 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (rb_fork_async_signal_safe): Inline rb_fork_internal.
- (rb_fork_ruby): Ditto.
- (rb_fork_internal): Removed.
- (chfunc_protect): Removed.
-
-Tue Sep 2 22:43:52 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_io.rb (test_new_with_block): Set autoclose to avoid
- EBADF.
-
-Tue Sep 2 22:01:51 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * Makefile.in (update-coverage): Remove a never executed line.
-
-Tue Sep 2 19:48:26 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (handle_fork_error): Extracted from retry_fork.
-
-Tue Sep 2 17:02:53 2014 Vit Ondruch <v.ondruch@tiscali.cz>
-
- * tool/rbinstall.rb: fixed error of local installation.
- [Bug #10192][ruby-core:64702]
-
-Tue Sep 2 16:58:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/runner.rb: reporting test coverage for test-all with COVERAGE env.
- [Feature #10189][ruby-core:64681][fix GH-708]
- * Makefile.in: added task for coverage report.
- * common.mk: added definition of forked simplecov url.
- * .gitignore: ignored coverage directory.
-
-Mon Sep 1 20:11:02 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (rbtime2vtdate): try to convert millisecond
- of Time object to millisecond of VT_DATE VARIANT.
- * test/win32ole/test_win32ole_variant.rb
- (test_conversion_time2date_with_msec): ditto.
-
-Sun Aug 31 16:58:49 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/benchmark.rb: Fix a syntax error.
-
-Sun Aug 31 08:46:44 2014 Eric Wong <e@80x24.org>
-
- * ext/zlib/zlib.c (gzfile_reset): preserve ZSTREAM_FLAG_GZFILE
- [Bug #10101]
-
- * test/zlib/test_zlib.rb (test_rewind): test each_byte
-
-Sat Aug 30 19:22:47 2014 Eric Wong <e@80x24.org>
-
- * symbol.c (rb_sym2id): do not return garbage object
-
-Sat Aug 30 06:39:48 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: fix NameError dumping and
- loading. Fixes GH #85. Thanks @brentdax for the patch!
- * test/psych/test_exception.rb: test for fix
-
-Sat Aug 30 06:23:40 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/scalar_scanner.rb: fix loading strings that
- look like integers but have a newline. Fixes GH #189
- * test/psych/test_string.rb: test for fix
-
-Sat Aug 30 06:10:39 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/to_ruby.rb: merge keys with a hash
- should merge the hash in to the parent.
- * test/psych/test_merge_keys.rb: test for change. Fixes GH #202
-
-Sat Aug 30 06:00:26 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/to_ruby.rb: quoted "<<" strings
- should not be treated as merge keys.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: hashes with keys
- containing "<<" should roundtrip.
- * test/psych/test_merge_keys.rb: test for change. Fixes GH #203
-
-Fri Aug 29 17:56:44 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/net/imap/test_imap_response_parser.rb: removed needless code.
-
-Fri Aug 29 17:36:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/rinda/test_rinda.rb: removed useless assignment variables.
- * test/rss/rss-assertions.rb: ditto.
- * test/rss/test_maker_itunes.rb: ditto.
-
-Fri Aug 29 16:18:26 2014 Eric Wong <e@80x24.org>
-
- * string.c: revert part of r47311, add rb_vm_fstring_table(),
- remove vm_core.h dependency. [ruby-core:64627]
-
-Fri Aug 29 15:17:13 2014 Eric Wong <e@80x24.org>
-
- * string.c: remove static frozen_strings
- * string.c (Init_frozen_strings): new function
- * string.c (rb_fstring): remove check for frozen strings,
- use per-VM table
- * string.c (rb_str_free): use per-VM table
- * string.c (Init_String): use per-VM table
- * vm_core.h (rb_vm_t): add frozen_strings table
- * internal.h (Init_frozen_strings): new function prototype
- * eval.c (ruby_setup): call Init_frozen_strings
- [Feature #10182]
-
-Wed Aug 27 23:10:24 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * lib/tempfile.rb: remove "require 'thread'". its features are no
- longer used.
-
-Wed Aug 27 21:19:40 2014 gogo tanaka <mail@tanakakazuki.com>
-
- * lib/drb/acl.rb: Removed meaningless #to_s methods in interpolation.
- [Feature #10174][ruby-core:64584]
- * lib/erb.rb: ditto.
- * lib/observer.rb: ditto.
- * lib/rake/invocation_chain.rb: ditto.
- * lib/rubygems/command_manager.rb: ditto.
- * lib/rubygems/config_file.rb: ditto.
- * lib/uri/common.rb: ditto.
-
-Wed Aug 27 21:08:20 2014 gogo tanaka <mail@tanakakazuki.com>
-
- * lib/drb/drb.rb: use attr_reader instead of Module#attr.
- [Feature #10172][ruby-core:64582]
- * lib/irb/ruby-token.rb: ditto.
- * lib/net/telnet.rb: ditto.
- * lib/rdoc/ruby_token.rb: ditto.
- * lib/thwait.rb: ditto.
-
-Wed Aug 27 19:52:33 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (vtdate2rbtime): try to convert millisecond
- of VT_DATE VARIANT to nsec of Time object.
- * test/win32ole/test_win32ole_variant.rb
- (test_conversion_dbl2date_with_msec): ditto.
-
-Wed Aug 27 09:57:29 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_complex.rb: removed unreachable code.
- * test/ruby/test_rational.rb: ditto.
-
-Wed Aug 27 07:59:17 2014 Eric Wong <e@80x24.org>
-
- * compile.c (iseq_set_sequence): check for multiplication overflow
-
-Tue Aug 26 22:07:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_complex.rb: cherry-picked working assertions from r47251.
- * test/ruby/test_rational.rb: cherry-picked working assertions from r47263.
-
-Tue Aug 26 21:07:56 2014 gogo tanaka <mail@tanakakazuki.com>
-
- * lib/mathn.rb (Fixnum#**, Bignum#**, Float#**, Rational#**):
- remove as these are now built-in. [ruby-core:63973] [Bug #10086]
-
-Tue Aug 26 20:46:55 2014 Tanaka Akira <akr@fsij.org>
-
- * time.c (rb_time_unmagnify_to_float): Avoid double rounding.
- Reported by Tsuyoshi Sawada.
- https://bugs.ruby-lang.org/issues/10135#note-1
-
-Tue Aug 26 17:12:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_close): ignore only "closed stream" IOError and
- NoMethodError, do not swallow other exceptions at the end of
- block. [ruby-core:64463] [Bug #10153]
-
-Tue Aug 26 13:46:33 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * template/fake.rb.in: fix failed to make install when @srcdir@ is
- absolute path.
-
-Tue Aug 26 13:43:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_range.rb: added workaround for VERBOSE message.
-
-Tue Aug 26 12:38:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_mathn.rb: added workaround for VERBOSE messages.
-
-Tue Aug 26 11:44:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/shell/process-controller.rb: removed commented-out code.
-
-Tue Aug 26 11:39:01 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/thwait.rb (ThreadsWait): removed needless constant.
-
-Tue Aug 26 09:27:10 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/mathn.rb: mathn library is deprecated on ruby 2.2.
- [Feature #10169][ruby-core:64553]
-
-Tue Aug 26 09:25:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/mathn.rb: removed commented-out code.
-
-Mon Aug 25 20:15:50 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c(fole_s_connect, fole_initialize): raise a
- security error with the tainted string object.
- * ext/win32ole/win32ole_event.c(ev_advise): ditto.
- * test/win32ole/test_win32ole.rb(test_s_new_exc_svr_tainted,
- test_s_new_exc_host_tainted): ditto.
- * test/win32ole/test_win32ole_event.rb(test_s_new_exc_tainted): ditto.
-
-Mon Aug 25 12:56:54 2014 Ivan Korunkov <ivankorunkov@ya.ru>
-
- * lib/logger.rb (format_datetime): use "%6N" to show microsecond.
- [Fix GH-704]
-
-Mon Aug 25 11:02:07 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_iseq_location_t): change first_lineno type to VALUE
- * iseq.c (rb_iseq_build_for_ruby2cext): update based on argument
-
-Sun Aug 24 16:14:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/e2mmap.rb: remove needless instance variables.
- * lib/irb.rb: ditto.
- * lib/irb/**/*.rb: ditto.
- * lib/shell.rb: ditto.
-
-Sun Aug 24 12:44:26 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_complex.rb: removed needless conditions.
- * test/ruby/test_rational.rb: ditto.
-
-Sun Aug 24 11:47:39 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_rational.rb: fixed indent.
-
-Sun Aug 24 11:44:11 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_rational.rb: remove commented-out code.
-
-Sun Aug 24 11:09:29 2014 Eric Wong <e@80x24.org>
-
- * lib/benchmark.rb (measure): reduce allocations as in r47260
-
-Sun Aug 24 10:35:54 2014 Pete Higgins <pete@peterhiggins.org>
-
- * lib/benchmark.rb (module Benchmark): define BENCHMARK_CLOCK
- (realtime): use Process.clock_gettime(BENCHMARK_CLOCK)
- Reduces allocations to improve performance [Feature #10165]
-
- * test/benchmark/test_benchmark.rb (test_realtime_output): new test
-
-Fri Aug 22 20:23:54 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (rb_fstring): fix condition (easy to cause infinite loop!).
-
-Fri Aug 22 20:07:43 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (rb_fstring, fstr_update_callback): simply delete garbage
- key first.
-
- Garbage keys can be swept by lazy sweeping invoked by creating new
- fstring. So that simply do:
- (1) delete garbage key and return `fstr_update_callback' immediately
- (2) try again `fstr_update_callback()' to create a new fstr.
-
- This bug can be cause memory corruption, reported by
- http://u64.rubyci.org/~chkbuild/ruby-trunk/log/20140821T220302Z.fail.html.gz
-
-Fri Aug 22 19:30:39 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_complex.rb: removed commented-out code.
-
-Fri Aug 22 19:25:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_complex.rb: fixed broken tests. Math is not
- compatible CMath now.
-
-Fri Aug 22 15:36:09 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (Doxyfile): revert r43888, not to require preinstalled
- ruby. [ruby-core:64488] [Bug #10161]
-
-Fri Aug 22 12:32:15 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/shell.rb: removed commented-out code.
- * lib/shell/builtin-command.rb: ditto.
- * lib/shell/command-processor.rb: ditto.
-
-Fri Aug 22 12:21:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/complex.rb: removed deprecated library.
- * lib/rational.rb: ditto.
-
-Fri Aug 22 11:38:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/prettyprint.rb: removed PrettyPrint#first?
- because it is obsoleted method since Ruby 1.8.2
-
-Thu Aug 21 17:10:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (constat_attr): manage reverse video internally
- since Windows console window does not manage it. based on the
- patch by white leaf in [ruby-dev:48483]. [Bug #10158]
-
-Thu Aug 21 14:45:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/e2mmap.rb: removed commented-out code.
-
-Thu Aug 21 13:23:34 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rinda/ring.rb: split executable code into sample directory.
- * sample/rinda-ring.rb: ditto.
-
-Thu Aug 21 13:21:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/drb/acl.rb: split executable code into sample directory.
- * sample/drb/acl.rb: ditto.
-
-Thu Aug 21 12:55:35 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * .gitignore: ignored temporary file for Changelog.
- http://mkosaki.blog46.fc2.com/blog-entry-1284.html
-
-Thu Aug 21 12:40:22 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/net/imap.rb: split executable code into sample directory.
- * sample/net-imap.rb: ditto.
-
-Thu Aug 21 12:23:56 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/net/imap.rb: removed commented-out code.
-
-Wed Aug 20 17:27:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_TRY_CFLAGS, RUBY_TRY_LDFLAGS),
- (RUBY_CHECK_BUILTIN_SETJMP, RUBY_SETJMP_TYPE),
- (RUBY_STACK_GROW_DIRECTION): quote defun names, for some
- versions of autoconf possibly. [ruby-core:64473] [Bug #10156]
-
-Tue Aug 19 22:28:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): fix condition to round.
- [ruby-core:64454] [Bug #10151]
-
-Tue Aug 19 22:22:45 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/trans/euckr-tbl.rb (EUCKR_TO_UCS_TBL): add missing euro and
- registered signs. [ruby-core:64452] [Bug #10149]
-
-Tue Aug 19 13:59:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compar.c (rb_cmperr): preserve encodings of arguments in the
- message.
-
-Tue Aug 19 10:13:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/thread/thread.c (get_array): check instance variables are
- initialized properly. [ruby-core:63826][Bug #10062]
-
-Mon Aug 18 17:06:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): support rational 'f' format.
- [ruby-core:64382] [Bug #10136]
-
-Mon Aug 18 08:03:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * spec/default.mspec: use 2.2 definition.
-
-Sun Aug 17 19:41:40 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * gc.c (obj_memsize_of): don't calculate memsize of T_NODE
- when called from check_gen_consistency. It fixes segmentation
- fault on RGENGC_CHECK_MODE >= 1 introduced by r47188.
-
-Sun Aug 17 17:08:12 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_invoke): use RHASH_SIZE instead of
- calling Hash#length method.
-
-Sat Aug 16 19:32:06 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_event.c (evs_length): use RARRAY_LEN instead
- of calling Array#length method.
-
-Sat Aug 16 10:20:17 2014 Eric Wong <e@80x24.org>
-
- * time.c (time_timespec): fix tv_nsec overflow
- [Bug #10144]
-
-Fri Aug 15 20:34:17 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_EVENT src from
- win32ole.c.
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_event.c: ditto.
- * ext/win32ole/win32ole_event.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Fri Aug 15 19:38:00 2014 Koichi Sasada <ko1@atdot.net>
-
- * iseq.c (rb_iseq_clone): Should not insert write barrier from
- non-RVALUE data (to non-RVALUE data, of course).
-
- Ruby 2.1 also has a same problem.
-
-Fri Aug 15 19:34:33 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (setup_fake_str): fake strings should not set class by
- RBASIC_SET_CLASS() because it insert write barriers to fake
- (non-RVALUE) structure.
-
- It can cause unexpected behaviour.
-
- Ruby 2.1 also have a same problem (setup_fake_str() in parse.y).
-
- * symbol.c (setup_fake_str): ditto.
-
-Fri Aug 15 19:27:25 2014 Koichi Sasada <ko1@atdot.net>
-
- * array.c (rb_ary_tmp_new_fill): added.
- This function creates internal use only array (which is completely
- hided by ObjectSpace.each_object) with filling nil.
-
- Otherwise, it can be includes strange VALUEs.
-
- * internal.h: added.
-
- * node.h: use rb_ary_tmp_new_fill() for MEMO.
-
-Fri Aug 15 10:13:37 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/gserver.rb: removed unmaintained code.
- [ruby-core:40313][Feature #5480]
- * lib/xmlrpc/httpserver.rb: ditto.
-
-Fri Aug 15 09:22:12 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_thread_struct): reorder to pack
- * cont.c (rb_context_struct, rb_fiber_struct): ditto
- On x86-64, these changes reduces:
- rb_thread_struct to 1000 bytes (from 1016)
- rb_context_struct to 1288 bytes (from 1312)
- rb_fiber_struct to 2272 bytes (from 2304)
-
-Fri Aug 15 09:06:31 2014 Eric Wong <e@80x24.org>
-
- * thread_pthread.h: define RB_NATIVETHREAD_LOCK_INIT and
- RB_NATIVETHREAD_COND_INIT macros
-
- * thread_pthread.c (native_mutex_lock, native_mutex_unlock,
- native_mutex_trylock, native_mutex_initialize,
- native_mutex_destroy, native_cond_wait):
- use rb_nativethread_lock_t instead of pthread_mutex_t
- [Feature #10134]
-
- * thread_pthread.c (native_mutex_debug): make argument type-agnostic
- to avoid later cast.
-
- * thread_pthread.c (register_cached_thread_and_wait):
- replace PTHREAD_COND_INITIALIZER with RB_NATIVETHREAD_COND_INIT,
- use native_mutex_{lock,unlock}
-
- * thread_pthread.c (use_cached_thread):
- use native_mutex_{lock,unlock}
-
- * thread_pthread.c (native_sleep):
- use rb_nativethread_lock_t to match th->interrupt_lock,
- use native_mutex_{lock,unlock}
-
- * thread_pthread.c (timer_thread_lock): use rb_nativethread_lock_t type
-
-Fri Aug 15 08:10:29 2014 Eric Wong <e@80x24.org>
-
- * cont.c (cont_mark): fix typo in unused path [ci skip]
-
-Fri Aug 15 06:00:56 2014 Eric Wong <e@80x24.org>
-
- * vm.c (rb_thread_mark): update comment about marking `me'
- [ruby-core:64340] [ruby-core:64341]
-
-Fri Aug 15 05:53:59 2014 Eric Wong <e@80x24.org>
-
- * README.EXT: preliminary documentation for RB_GC_GUARD
- [Bug #10100] [ruby-core:60741]
-
-Thu Aug 14 00:26:19 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_RECORD src from
- win32ole.c
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_record.c: ditto.
- * ext/win32ole/win32ole_record.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Wed Aug 13 21:41:04 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_VARIANT src from
- win32ole.c.
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_variant.c: ditto.
- * ext/win32ole/win32ole_variant.c: ditto.
- * ext/win32ole/depend: ditto.
-
-Wed Aug 13 20:09:37 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: remove unused variable.
-
-Wed Aug 13 19:31:27 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_search_handler_method, rescue_callback,
- folerecord_inspect): use PRIsVALUE in rb_sprintf.
-
- * ext/win32ole/win32ole_param.c (foleparam_inspect): ditto.
-
- * ext/win32ole/win32ole_variable.c (folevariable_inspect): use
- PRIsVALUE in rb_sprintf, use rb_inspect.
-
-Wed Aug 13 11:54:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/irb/completion.rb: reverted r47163.
- because another case can't be show completion target.
-
-Wed Aug 13 11:17:00 2014 Shimpei Makimoto <github@makimoto.org>
-
- * lib/irb.rb: Prevent irb from crashing when exception with
- nil backtrace is raised.
- [fix GH-434][ruby-core:58078][Bug #9063]
- * test/irb/test_raise_no_backtrace_exception.rb: ditto.
-
-Wed Aug 13 11:08:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/irb/completion.rb: fixed broken completion list with
- String including spaces. Contributed from @dunric. [fix GH-465]
-
-Wed Aug 13 00:07:01 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_PARAM src from win32ole.c
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_param.c: ditto.
- * ext/win32ole/win32ole_param.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Tue Aug 12 23:17:47 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: refactoring. move some methods
- into win32ole_type.c / win32ole_method.c
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_method.c: ditto.
- * ext/win32ole/win32ole_method.h: ditto.
- * ext/win32ole/win32ole_type.h: ditto.
- * ext/win32ole/win32ole_type.h: ditto.
-
-Tue Aug 12 22:59:48 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: refactoring. move
- ole_typelib_from_itypeinfo into win32ole_typelib.c.
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_typelib.h: ditto.
- * ext/win32ole/win32ole_typelib.h: ditto.
-
-Tue Aug 12 21:49:40 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_create_dcom): use the converted
- result if the argument can be converted to a string, to get rid
- of invalid access. Thanks to nobu. [ruby-dev:48467] [Bug #10127]
-
-Tue Aug 12 14:22:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * configure.in: ignored working directory same as prefix value.
- [ruby-core:54999] [Bug #8409]
-
-Tue Aug 12 13:34:25 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/fileutils.rb: enable to remove with non-owner directory.
- [ruby-dev:45976] [Bug #6756]
- * test/fileutils/test_fileutils.rb: add testcase for #6756.
-
-Tue Aug 12 12:57:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * vm_exec.c: improve performance in ppc64 arch.
- [ruby-core:63437] [Feature #9997]
-
-Tue Aug 12 12:14:52 2014 Akira Matsuda <ronnie@dio.jp>
-
- * lib/fileutils.rb: fix typo.
- [ruby-dev:47831] [Bug #9180]
-
-Tue Aug 12 10:10:42 2014 Eric Wong <e@80x24.org>
-
- * vm_method.c (release_method_definition): use rb_free_method_entry
-
-Tue Aug 12 06:16:09 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_METHOD src from
- win32ole.c.
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_method.c: ditto.
- * ext/win32ole/win32ole_method.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Mon Aug 11 22:19:15 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_variable.c (folevariable_inspect): refactoring.
-
-Mon Aug 11 20:47:27 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_VARIABLE src from
- win32ole.c
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_variable.c: ditto.
- * ext/win32ole/win32ole_variable.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Mon Aug 11 16:17:21 2014 Tony Miller <mcfiredrill@gmail.com>
-
- * dir.c (rb_dir_exists_p): [DOC] Document that Dir.exists? is
- deprecated. [ruby-core:64135] [Bug #10102]
-
-Mon Aug 11 11:26:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/tempfile.rb: start rdoc parsing inside singleton class
- definition to include the document there.
- [ruby-core:64157] [Bug #10105]
-
-Sun Aug 10 12:22:43 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_type.c: refactoring.
-
-Sun Aug 10 10:34:00 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/cgi/session/pstore.rb: separated sample code.
- * lib/open3.rb: ditto.
-
-Sun Aug 10 10:03:24 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/irb/ext/multi-irb.rb: removed commented-out code.
-
-Sat Aug 9 11:02:07 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/irb.rb: removed commented-out code.
- * lib/irb/**/*.rb: ditto.
-
-Sat Aug 9 10:35:30 2014 Laurent Arnoud <laurent@spkdev.net>
-
- * lib/cmath.rb: fixed indent. [fix GH-696]
- * lib/drb/ssl.rb: ditto.
- * lib/irb/**/*.rb: ditto.
-
-Sat Aug 9 10:28:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/minitest/test_minitest_unit.rb: removed obsoleted condition
- for Ruby 1.8.
- * test/ruby/test_time_tz.rb: ditto.
-
-Sat Aug 9 10:18:00 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/cgi/test_cgi_core.rb: removed obsoleted condition for Ruby 1.8.
- * test/cgi/test_cgi_header.rb: ditto.
- * test/cgi/test_cgi_multipart.rb: ditto.
- * test/cgi/test_cgi_tag_helper.rb: ditto.
-
-Sat Aug 9 00:34:37 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE_TYPE src from win32ole.c.
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_type.c: ditto.
- * ext/win32ole/win32ole_type.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Fri Aug 8 01:53:37 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * lib/securerandom.rb: use OpenSSL::BN for performance improvement.
-
- * benchmark/bm_securerandom.rb: benchmark script.
-
-Fri Aug 8 17:19:57 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/open-uri.rb: remove needless condition for old ruby version.
- * test/open-uri/test_open-uri.rb: ditto.
-
-Fri Aug 8 16:40:59 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/irb/init.rb: removed unreachable code.
-
-Fri Aug 8 16:34:22 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/drb/drb.rb: removed unreachable code.
-
-Fri Aug 8 14:33:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/webrick/httpproxy.rb: remove needless condition
- for old ruby version.
-
-Fri Aug 8 01:07:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yylex): fix invalid char in eval, should raise
- an syntax error too, as well as directly coded.
- [ruby-core:64243] [Bug #10117]
-
-Thu Aug 7 23:25:29 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * lib/open3.rb: avoid unnecessary write if stdin_data is empty.
-
-Thu Aug 7 21:42:49 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole_typelib.c (foletypelib_version): return
- version string.
-
- * test/win32ole/test_win32ole_typelib.rb (test_version): ditto.
-
-Thu Aug 7 15:13:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/cgi.rb: remove needless condition for old ruby version.
-
-Thu Aug 7 06:04:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yyerror): preserve source code encoding in
- syntax error messages. [ruby-core:64228] [Bug #10114]
-
-Wed Aug 6 20:56:02 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate src of WIN32OLE_TYPELIB from
- win32ole.c
-
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_typelib.c: ditto.
- * ext/win32ole/win32ole_typelib.h: ditto.
- * ext/win32ole/depend: ditto.
-
-Wed Aug 6 20:44:07 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * enum.c (enum_one): [DOC] Move enum.one? documentation before the
- relevant method. Submitted by @vipulnsward. [Fixes GH-687]
- https://github.com/ruby/ruby/pull/687
-
-Wed Aug 6 20:25:47 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/set.rb (Set#replace): Check if an object given is enumerable
- before clearing self. Reported by yui-knk. [GH-675]
- https://github.com/ruby/ruby/pull/675
-
-Wed Aug 6 20:07:26 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (olerecord_ivar_set): remove rb_str_subseq.
-
-Wed Aug 6 19:09:27 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/set.rb (Set): Implement Set#clone by splitting
- initialize_copy into initialize_dup and initialize_clone.
- Submitted by yui-knk. [Fixes GH-661]
- https://github.com/ruby/ruby/pull/661
-
-Wed Aug 6 18:42:58 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate src of WIN32OLERuntimeError
- from win32ole.c.
-
- * ext/win32ole/win32ole.h: ditto
- * ext/win32ole/depend: ditto.
- * ext/win32ole/win32ole_error.c: ditto.
- * ext/win32ole/win32ole_error.h: ditto.
-
-Wed Aug 6 04:33:58 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTP.proxy_uri): use initializer instead
- of parser to handle IPv6 address. [Bug #9129]
-
-Wed Aug 6 04:16:05 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/requests.rb (Net::HTTP::Options::RESPONSE_HAS_BODY):
- OPTIONS requests may have response bodies. [Feature #8429]
- http://tools.ietf.org/html/rfc7231#section-4.3.7
-
-Wed Aug 6 03:18:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/generic_request.rb (Net::HTTP::GenericRequest#exec):
- handle req['host'] in update_uri.
-
- * lib/net/http/generic_request.rb
- (Net::HTTP::GenericRequest#update_uri):
- use req['host'] if it is explicitly set. Even if URI is given,
- it is already used for the initial value of req['host'].
- Therefore overwritten value should be respected. [Bug #10054]
-
-Wed Aug 6 03:17:34 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/generic_request.rb
- (Net::HTTP::GenericRequest#update_uri):
- handle scheme, host, and port to reflect connection to @uri.
-
- * lib/net/http.rb (Net::HTTP#begin_transport): move trivial handling
- to Net::HTTP::GenericRequest#update_uri.
-
-
-Wed Aug 6 02:16:43 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/generic_request.rb
- (Net::HTTP::GenericRequest#initialize):
- optimize object allocation.
-
-Wed Aug 6 01:16:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#path_query): remove a private method.
-
-Wed Aug 6 01:15:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#normalize!): use String#empty?
-
- * lib/uri/generic.rb (URI::Generic#path_query): optimized.
-
- * lib/uri/generic.rb (URI::Generic#to_s): optimized.
-
-Wed Aug 6 00:15:10 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/http.rb (URI::HTTP#request_uri): optimized.
- decrease object allocation, and ensure always create at least one new
- object for return value.
-
-Wed Aug 6 03:41:21 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/to_ruby.rb: backwards compatibility for
- hashes emitted by Syck. Github #198
- * test/psych/test_hash.rb: test for change.
-
-Tue Aug 5 19:27:59 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_invoke): skip VariantClear when
- argument is VT_RECORD variant.
-
-Tue Aug 5 15:52:51 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gems/bundled_gems: Upgrade to test-unit-3.0.0 and minitest-5.4.0.
-
-Mon Aug 4 21:50:09 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * test/win32ole/test_win32ole_record.rb: add for WIN32OLE_RECORD
- test(need .NET Framework 3.5 to run test).
-
-Mon Aug 4 19:49:34 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_invoke): call rb_hash_foreach instead
- of rb_block_call.
-
- * ext/win32ole/win32ole.c: add comment for rdoc of WIN32OLE_VARIANT
- class.
-
-Mon Aug 4 09:12:47 2014 Eric Wong <e@80x24.org>
-
- * variable.c: cleanup to use rb_const_lookup
- [Feature #10107]
-
- * vm_insnhelper.c: ditto
-
-Sun Aug 3 10:55:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/encoding.h (rb_check_symbol_cstr): ditto.
-
-Sun Aug 3 10:43:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_call_method): unusable super class should cause
- method missing when BasicObject is refined but not been using.
- [ruby-core:64166] [Bug #10106]
-
-Sat Aug 2 23:47:45 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: separate WIN32OLE::VARIANT src file
- from win32ole.c
- * ext/win32ole/win32ole.h: ditto.
- * ext/win32ole/win32ole_variant_m.c: ditto.
- * ext/win32ole/win32ole_variant_m.h: ditto.
- * ext/win32ole/depend: ditto.
- * ext/.document: ditto.
-
-Sat Aug 2 14:34:58 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: add comments for rdoc.
-
-Sat Aug 2 10:26:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_obj_itself): new method Object#itself. based on the
- patch by Rafael Franca in [ruby-core:64156].
- [EXPERIMENTAL] this method may be renamed due to compatibilities.
- [ruby-core:44704] [Feature #6373]
-
-Fri Aug 1 22:30:40 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (folerecord_initialize): accept
- only 2 arguments. The 2nd argument should be WIN32OLE object or
- WIN32OLE_RECORD object.
-
-Fri Aug 1 20:17:33 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): call
- folerecord_s_allocate instead of WIN32OLE_RECORD.new.
-
-Fri Aug 1 18:39:57 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/date/test_date.rb: remove commented-out code.
- * test/date/test_date_arith.rb: ditto.
- * test/date/test_date_attr.rb: ditto.
- * test/date/test_date_parse.rb: ditto.
-
-Fri Aug 1 16:35:32 2014 Evan Miller <evan@squareup.com>
-
- * numeric.c (flodivmod): all results are NaN if divisor is NaN.
- [fix GH-692]
-
-Thu Aug 01 07:28:12 2014 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c: [DOC] Add description of
- `BigDecimal.new` exceptions. Patched by @joker1007 and
- @prathamesh-sonpatki [Fixes GH-690]
- https://github.com/ruby/ruby/pull/690
-
-Thu Jul 31 22:20:12 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: add WIN32OLE_RECORD#inspect.
-
-Thu Jul 31 20:35:32 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: add
- WIN32OLE_RECORD#ole_instance_variable_set and
- WIN32OLE_RECORD#ole_instance_variable_get
-
-Wed Jul 30 23:28:10 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * sprintf.c (rb_str_format): like r47006, get rid of
- function calls in RSTRING_PTR().
-
-Wed Jul 30 22:10:29 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * process.c (rlimit_resource_type, rlimit_resource_value):
- get rid of inadvertent dynamic symbol pin-down.
-
- * re.c (match_backref_number): ditto.
-
- * signal.c (esignal_init, rb_f_kill, trap_signm): ditto.
-
- * transcode.c (econv_opts): ditto.
-
- * vm_trace.c (symbol2event_flag): ditto.
-
-Wed Jul 30 21:29:39 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_invoke): pass WIN32OLE_RECORD variant
- by reference when invoke OLE methods at first.
-
- * ext/win32ole/win32ole.c (olerecord_set_ivar): release
- IRecordInfo interface before setting another IRecordInfo interface.
-
-Wed Jul 30 13:17:35 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: remove unused macros.
-
-Tue Jul 29 22:21:37 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (hash2olerec): ignore WIN32OLE_RECORD
- instance variable if the variable is nil.
-
-Tue Jul 29 19:43:27 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (folerecord_method_missing): refactoring.
- divide functionality of folerecord_method_missing into
- olerecord_ivar_set and olerecord_ivar_get.
-
-Mon Jul 28 20:20:08 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win23ole.c (folerecord_method_missing): support
- setter of member of WIN32OLE_RECORD object.
-
-Mon Jul 28 06:37:19 2014 Zachary Scott <e@zzak.io>
-
- * vm_eval.c: [DOC] Fix rdoc formatting of patch from [Bug #9551]
-
-Mon Jul 28 06:34:43 2014 Zachary Scott <e@zzak.io>
-
- * vm_eval.c: [DOC] [Bug #9551] Improve clarity of Kernel::catch
- documentation, patch by Jesse Sielaff.
-
-Mon Jul 28 06:24:54 2014 Zachary Scott <e@zzak.io>
-
- * lib/uri/common.rb: [DOC] [Bug #9563] Recommend using URI.escape
- before parsing a uri to avoid invalid characters. Reported by
- Evgeniy Serykh.
-
-Mon Jul 28 05:55:56 2014 Zachary Scott <e@zzak.io>
-
- * time.c: [DOC] Clarify %Y in strftime, which can accept any digits
- and will output at least 4 digits as the year. Reported by Yury
- Trofimenko [Bug #10049]
-
- * lib/time.rb: ditto
-
-Mon Jul 28 05:32:06 2014 Zachary Scott <e@zzak.io>
-
- * lib/uri/common.rb: [DOC] [Bug #10075] Clarify how URI.join arguments
- are handled by RFC3986, originally reported by John Feminella.
-
-Mon Jul 28 05:21:41 2014 Zachary Scott <e@zzak.io>
-
- * file.c: [DOC] Clarify how File.file? handles symbolic links. Also
- cleaned up the rdoc style for this method, more to follow.
- Originally reported by Michael Renner [Bug #10067]
-
-Mon Jul 28 05:12:22 2014 Zachary Scott <e@zzak.io>
-
- * time.c: [DOC] Remove dead link and old bug report, which hasn't been
- reproduced in a few years. Reported by Federico Builes [Bug #10071]
-
-Mon Jul 28 04:39:58 2014 Zachary Scott <e@zzak.io>
-
- * ext/zlib/zlib.c: [DOC] Remove default value of Zlib constants, as
- they may change in the implementation without notice. Patched by
- @robin850 [Fixes GH-682] https://github.com/ruby/ruby/pull/682
-
-Mon Jul 28 04:35:35 2014 Zachary Scott <e@zzak.io>
-
- * ext/openssl/ossl_hmac.c: Fix NO_HMAC warning [Fixes GH-665]
- Patched by @vipulnsward https://github.com/ruby/ruby/pull/665
-
-Sun Jul 27 19:49:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/cgi/core.rb: remove unused variables.
- * lib/erb.rb: ditto.
- * lib/mkmf.rb: ditto.
- * lib/net/http/response.rb: ditto.
- * lib/optparse/version.rb: ditto.
- * lib/prime.rb: ditto.
- * lib/racc/parser.rb: ditto.
- * lib/rexml/document.rb: ditto.
- * lib/rexml/dtd/dtd.rb: ditto.
- * lib/rexml/element.rb: ditto.
- * lib/rexml/functions.rb: ditto.
- * lib/rexml/parsers/xpathparser.rb: ditto.
-
-Sun Jul 27 05:11:21 2014 Zachary Scott <e@zzak.io>
-
- * lib/irb.rb: [DOC] PROMPT_I cannot be nil, patch by @hgillane
- Fixes documenting-ruby/ruby#37
- https://github.com/documenting-ruby/ruby/pull/37
-
-Sun Jul 27 02:41:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/shell/command-processor.rb: remove unused variable.
- * lib/shell/system-command.rb: ditto.
- * lib/tmpdir.rb: ditto.
- * lib/uri/generic.rb: ditto.
-
-Sun Jul 27 02:08:31 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/weakref.rb: split executable code into sample directory.
- * sample/weakref.rb: ditto.
-
-Sun Jul 27 02:06:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/delegate.rb: split executable code into sample directory.
- * sample/delegate.rb: ditto.
-
-Sun Jul 27 01:46:34 2014 Zachary Scott <e@zzak.io>
-
- * proc.c (method_super_method): [DOC] Method#super_method
-
-Sun Jul 27 01:22:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (method_super_method): new method Method#super_method,
- which returns a method object of the method to be called by
- `super` in the receiver method object.
- [ruby-core:62202] [Feature #9781]
-
-Sat Jul 26 17:22:14 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * ext/objspace/objspace_dump.c (dump_append): avoid fflush.
-
- because dump_append_string_value() iterates over each chars,
- fflush()-ing here effectively issues system calls on every single
- bytes exist in a ruby process.
-
-Sat Jul 26 16:55:18 2014 Eric Wong <e@80x24.org>
-
- * iseq.h (struct iseq_compile_data_storage): reduce overhead
- to 16 bytes (from 32) on 64-bit
-
-Sat Jul 26 16:28:06 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (struct rb_iseq_struct): reduce to 280 bytes
- (from 288 bytes) on 64-bit
-
-Sat Jul 26 06:44:43 2014 Eric Wong <e@80x24.org>
-
- * parse.y (struct parse_params): shrink to 320 to 304 bytes on 64-bit
-
-Sat Jul 26 05:58:35 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/ruby.h (ZALLOC, ZALLOC_N): implement
- (Data_Make_Struct, TypedData_Make_Struct):
- ZALLOC replaces ALLOC+memset
- [ruby-core:63951][Feature #10082]
- * compile.c (iseq_seq_sequence): ZALLOC_N replaces ALLOC_N+MEMZERO
- * cont.c (fiber_t_alloc): ZALLOC replaces ALLOC+MEMZERO
- * io.c (rb_io_reopen): ditto
- * iseq.c (prepare_iseq_build): ditto
- * parse.y (new_args_tail_gen, parser_new, ripper_s_allocate): ditto
- * re.c (match_alloc): ditto
- * variable.c (rb_const_set): ditto
- * ext/socket/raddrinfo.c (get_addrinfo): ditto
- * ext/strscan/strscan.c (strscan_s_allocate): ditto
- * gc.c (rb_objspace_alloc): calloc replaces malloc+MEMZERO
-
-Sat Jul 26 05:54:54 2014 Eric Wong <e@80x24.org>
-
- * symbol.c (dsymbol_check): remove unneeded semi-colon
-
-Fri Jul 25 14:07:27 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: change objspace::rgengc::parent_object_is_old (boolean)
- to objspace::rgengc::parent_object (VALUE).
- Use Qfalse or RVALUE pointer instead of FALSE and TRUE.
-
- * gc.c (gc_marks_body): should clear parent_object just before
- gc_mark_roots() because there are no parents objects
- for root objects.
-
-Fri Jul 25 13:45:39 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_gc_writebarrier_remember_promoted): should remember only
- OLD objects on RGENGC_AGE2_PROMOTION.
-
-Fri Jul 25 13:42:02 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_mark_stacked_objects): fix error message.
-
-Fri Jul 25 13:18:00 2014 Will Farrington <wfarrington@digitalocean.com>
-
- * ext/socket/socket.c (sock_gethostname): Use NI_MAXHOST to support
- hostnames longer than 64 characters if the system supports it.
- [fixes GH-683]
-
-Fri Jul 25 12:21:11 2014 Santiago Pastorino <santiago@wyeworks.com>
-
- * compile.c (defined_expr): make the condition if the receiver
- is explicit or implicit cleaner. [fix GH-681]
-
-Fri Jul 25 03:53:52 2014 Eric Hodel <drbrain@segment7.net>
-
- * doc/keywords.rdoc: [DOC] Describe each keyword.
-
-Thu Jul 24 22:40:24 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (Init_win32ole): add WIN32OLE_RECORD#initialize
- method.
-
- * ext/win32ole/win32ole.c (ole_val2variant): convert WIN32OLE_RECORD
- object to VT_RECORD variant.
-
-Thu Jul 24 20:10:59 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: fix major GC flags.
- * add GPR_FLAG_MAJOR_BY_FORCE, which indicates
- major GC by METHOD, CAPI and so on (see GC_BY).
- * remove GPR_FLAG_MAJOR_BY_RESCAN because not used.
- * remove GPR_FLAG_MAJOR_BY_STRESS, use FORCE instead.
-
- * test/ruby/test_gc.rb: catch up.
-
-Thu Jul 24 15:55:02 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * include/ruby/io.h (struct rb_io_buffer_t): PACKED_STRUCT should not
- be used for platform-specific optimization. PACKED_STRUCT_UNALIGNED
- should be used. [ruby-core:63988] [Bug #10088]
-
-Thu Jul 24 04:42:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/benchmark.rb: split executable code into sample directory.
- * sample/benchmark.rb: ditto.
-
-Thu Jul 24 04:36:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/tempfile.rb: split executable code into sample directory.
- * sample/tempfile.rb: ditto.
-
-Thu Jul 24 04:29:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/pstore.rb: split executable code into sample directory.
- * sample/pstore.rb: ditto.
-
-Wed Jul 23 23:50:11 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/defines.h, siphash.c, st.c (UNALIGNED_WORD_ACCESS):
- add PowerPC64 too, which is capable to access unaligned words.
- patched by Gustavo Frederico Temple Pedrosa in [ruby-core:63937].
- [Feature #10081]
-
- * regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): ditto.
-
-Wed Jul 23 04:04:38 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/drb/extserv.rb: remove duplicate code with sample directory.
- contributed from @vipulnsward. [fix GH-679]
-
-Tue Jul 22 12:56:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_count): fix wrong single-byte optimization.
- 7bit ascii can be a trailing byte in Shift_JIS.
- [ruby-dev:48442] [Bug #10078]
-
-Tue Jul 22 01:48:38 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/io.h (rb_io_buffer_t): fix packing on gcc
- r46892 caused packing to be a no-op on gcc (4.7.2-5, Debian)
- [Bug #10079][ruby-core:63912]
-
-Mon Jul 21 15:55:42 2014 fuji70 <fujifuji70@gmail.com>
-
- * lib/optparse.rb (getopts): print default values and descriptions
- in the help message. [fix GH-676]
-
-Sun Jul 20 14:26:27 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_proc_t): reduce to 64 bytes from 72 on 64-bit
-
-Sun Jul 20 13:50:34 2014 Eric Wong <e@80x24.org>
-
- * transcode.c (rb_econv_t): reduce to 184 bytes from 200 on 64-bit
-
-Sun Jul 20 12:44:23 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/io.h (rb_io_buffer_t): pack structure
- Reduces rb_io_t from 200 to 192 bytes, allowing rb_io_t to
- occupy one less cache line.
- [Feature #10050]
-
-Sun Jul 20 12:41:53 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/io.h (rb_io_t): shrink to 200 bytes from 216 on 64-bit
- This puts us within 8 bytes of being three cache lines instead of
- four lines on x86-64. This breaks the ABI.
- [Feature #10050]
-
-Sun Jul 20 12:36:46 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/oniguruma.h (struct re_pattern_buffer): shrink to 448
- bytes from 464 bytes on 64-bit. This breaks the ABI.
- [Feature #10034]
-
-Sun Jul 20 01:06:06 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/openssl/ossl.c: use encryptor instead of encrypter in doc.
- contributed from @vipulnsward. [fix GH-663]
-
-Sun Jul 20 00:32:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_initialize): [DOC] fix rdoc of append mode. it does
- not move the pointer at open. [ruby-core:63747] [Bug #10039]
-
-Sat Jul 19 12:40:50 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_compile_each): allow to access private attribute
- reader in op_assign. [ruby-core:63817] [Bug #10060]
-
-Sat Jul 19 11:56:36 2014 Grey Baker <greysteil@gmail.com>
-
- * lib/time.rb (Time#apply_offset): Guards against a `nil` return
- value from `Time.month_days` when offsetting date. Out of range
- values are then caught when `Time.utc` is called (as usual).
-
- Previously a `nil` return value from `Time.month_days` would
- have the `<` operator called on it, and raise `NoMethodError`.
- [fix GH-667]
-
- * lib/rdoc/parser/changelog.rb (RDoc#parse_entries): fix dirty hack.
-
-Sat Jul 19 06:19:01 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: refactoring.
-
-Fri Jul 18 22:34:41 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (folevariant_initialize): WIN32OLE_VARIANT
- does not support VT_RECORD. VT_RECORD should be supported in
- WIN32OLE_RECORD.
-
- * test/win32ole/test_win32ole_variant.rb (test_s_new_vt_record_exc):
- ditto.
-
-Fri Jul 18 19:54:03 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (folevariant_initialize): remove unnecessary
- code.
-
-Fri Jul 18 19:11:03 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix/eigenvalue_decomposition: Style fix
- Patch by Gogo Tanaka [#10058]
-
-Fri Jul 18 19:03:53 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Avoid using `and`.
- Patch by gogo tanaka [#10058]
-
-Fri Jul 18 17:41:54 2014 GoGo tanaka <qlli.illb@gmail.com>
-
- * test/matrix/test_matrix.rb: Add tests for Matrix class.
- [Feature #10057][ruby-core:63809]
-
-Fri Jul 18 10:14:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/fileutils.rb: added missing options of FileUtils.touch by @Domon.
- [fix GH-669]
-
-Thu Jul 17 19:57:27 2014 Herwin <herwin@quarantainenet.nl>
-
- * ext/thread/thread.c (rb_szqueue_push): add optional parameter,
- non_block defaulted to false. [ruby-core:63794] [Feature #10052]
-
-Wed Jul 16 23:01:43 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): support array of
- VT_RECORD variant.
-
-Wed Jul 16 20:21:49 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * vm_core.h (struct rb_iseq_struct): stack_max is changed to int
- because all calculations related to stack_max in compile.c
- (iseq_set_sequence) and vm_insnhelper.c (vm_push_frame) are
- conducted by using int. This partly reverts r23945.
- * vm_insnhelper.c (vm_push_frame): ditto. This reverts r42401.
-
-Wed Jul 16 19:55:32 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * vm_core.h (struct rb_iseq_struct): temporal workaround of [Bug 10037].
- Add padding on big-endian 64-bit architecture (e.g. sparc64).
-
-Wed Jul 16 19:32:23 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (fole_record_method_missing): call
- rb_hash_fetch instead of rb_hash_aref.
-
-Wed Jul 16 18:08:47 2014 Koichi Sasada <ko1@atdot.net>
-
- * iseq.c (rb_iseq_defined_string): use rb_gc_mark_object() instead of
- marking from vm_mark().
-
- * vm.c (rb_vm_mark): ditto.
-
-Wed Jul 16 18:03:50 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_mark_roots): call rb_vm_mark directly.
-
- * vm.c: remove mark function for RubyVM object because
- RubyVM object marked manually.
-
-Wed Jul 16 12:25:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c: Merge Onigmo 5.14.1 25a8a69fc05ae3b56a09.
- this includes Support for Unicode 7.0 [Bug #9092].
-
-Tue Jul 15 23:59:27 2014 Jared Jennings <jared.jennings.ctr@us.af.mil>
-
- * ext/digest: make built-in digest function implementations
- indicate success or failure of init and final functions.
- [ruby-core:61614] [Bug #9659]
-
- * ext/digest/digest.c: expect digest init and finish functions to
- indicate success or failure; raise exception on failure.
- [ruby-core:61614] [Bug #9659]
-
-Tue Jul 15 20:31:40 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: modify document for WIN32OLE_RECORD.
-
-Tue Jul 15 12:42:23 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * defs/default_gems: change version definition file of rake.
-
-Tue Jul 15 12:00:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rake.rb, lib/rake/*.rb: Upgrade to rake-10.3.2
- [fix GH-668]
- * test/rake/*.rb: ditto.
-
-Mon Jul 14 19:14:51 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: modify WIN32OLE class document and
- add comment for constants of WIN32OLE.
-
-Mon Jul 14 16:38:45 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (struct rb_iseq_struct): reduce to 288 bytes
- on x86-64 (from 296 bytes)
-
-Mon Jul 14 16:07:25 2014 Eric Wong <e@80x24.org>
-
- * iseq.h (struct iseq_catch_table_entry): shrink to 32 bytes
- on x86-64 (from 48 bytes)
-
-Mon Jul 14 16:04:41 2014 Eric Wong <e@80x24.org>
-
- * iseq.h (struct iseq_catch_table): new flexible array struct
- (iseq_catch_table_bytes): allocated size function
- * vm_core.h (struct rb_iseq_struct): update catch_table member
- This reduces the struct from 304 to 296 bytes on x86-64.
- * compile.c (iseq_set_exception_table): update for struct changes
- * iseq.c (iseq_free): ditto
- * iseq.c (iseq_memsize): ditto
- * iseq.c (rb_iseq_disasm): ditto
- * iseq.c (iseq_data_to_ary): ditto
- * iseq.c (rb_iseq_build_for_ruby2cext): ditto (untested)
- * vm.c (vm_exec): ditto
- * vm_core.h (struct rb_iseq_struct): ditto
- * vm_insnhelper.c (vm_throw): ditto
-
-Sun Jul 13 17:49:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/openssl/ossl_cipher.c: Fix call to ciphers class method and
- spell out `encryption` by @vipulnsward [fix GH-664]
-
-Sun Jul 13 17:31:51 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/gdbm/gdbm.c: fix wrong arguments in GetDBM2 macro.
- * ext/sdbm/init.c: ditto.
-
-Sun Jul 13 17:25:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/dbm/dbm.c: fix wrong arguments in GetDBM2 macro by @v2e4lisp.
- [fix GH-655]
-
-Sun Jul 13 16:44:56 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (struct rb_call_info_struct): improve packing
- This reduces the struct from 112 to 104 bytes on x86-64.
-
-Sun Jul 13 15:53:25 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (struct rb_iseq_struct): stack_max is uint32_t
- This reduces the struct from 312 to 304 bytes on x86-64.
-
-Sun Jul 13 10:56:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_broken_backtrace): exit with failure
- normally, no needs to abort. [ruby-core:63678] [Bug #10008]
-
-Sat Jul 12 15:10:22 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (fole_record_method_missing): correct
- fields Hash key.
-
-Sat Jul 12 04:17:40 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * lib/net/smtp.rb (Net::SMTP#data): enable buffering while
- 'data' send for optimizing Net::SMTP#send_message.
- [ruby-dev:48329] [misc #9981]
- patch by Masahiro Tomita.
-
-Sat Jul 12 01:13:45 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * test/ruby/envutil.rb (assert_no_memory_leak): On Solaris 9 or later,
- if possible, execute child ruby with environment variables
- LD_PRELOAD=libumem.so UMEM_OPTIONS="backend=mmap". With these
- variables, freed memory is immediately returned to the OS.
- [Bug #10020] [ruby-dev:48391]
-
-Fri Jul 11 20:49:10 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: add WIN32OLE_RECORD class to support
- VT_RECORD OLE variables.
-
-Fri Jul 11 17:15:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/abbrev.rb: remove executable.
-
-Fri Jul 11 16:45:39 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/fileutils.rb: handle ENOENT error with symlink targeted to
- non-exists file. [ruby-dev:45933] [Bug #6716]
-
-Fri Jul 11 15:59:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * array.c: Clarify documentation for Array#insert.
- [ruby-core:62934] [Bug #9901]
-
-Fri Jul 11 15:39:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * io.c: Improve Documentation by @dapplebeforedawn.
- [fix GH-658] [ruby-core:63579] [Bug #10012]
-
-Fri Jul 11 14:19:14 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Fix sign for cross_product [#9499]
-
-Fri Jul 11 11:11:50 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/prepare_so_k_nucleotide.rb: use require_relative.
-
- * benchmark/prepare_so_reverse_complement.rb: ditto.
-
-Fri Jul 11 10:09:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (encodes): fix buffer overrun by tail_lf. Thanks to
- Mamoru Tasaka and Tomas Hoger. [ruby-core:63604] [Bug #10019]
-
-Thu Jul 10 23:51:36 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * hash.c (ruby_setenv): Fix TestEnv#test_aset failure on Solaris 9.
- When name contains '=', ruby_setenv raises Errno::EINVAL.
- That is the same behavior as Solaris 10.
- NULL check for malloc return value is also added.
-
-Thu Jul 10 15:02:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_callee_setup_keyword_arg): adjust VM stack
- pointer to get rid of overwriting splat arguments by arguments
- for `to_hash` conversion. [ruby-core:63593] [Bug #10016]
-
-Thu Jul 10 01:09:57 2014 Koichi Sasada <ko1@atdot.net>
-
- * symbol.c: remove rb_gc_mark_symbols().
-
- fstrings referred by static symbols and pinned dynamic symbols
- are registered by rb_gc_register_mark_object().
-
- fstrings referred by dynamic symbols (not pinned symbols)
- are referred from global_symbols.dsymbol_fstr_hash (Hash object).
-
- Note that fstrings referred from dynamic symbols must live logger
- than symbol objects themselves because rb_gc_free_dsymbol() uses
- fstrings to remove from symbol tables.
- This is why we can not mark fstrings from dynamic symbols.
-
- This technique reduces root objects for GC marking.
-
- * gc.c (gc_mark_roots): ditto.
-
- * internal.h: ditto.
-
-Thu Jul 10 00:24:18 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * common.mk (DTRACE_DEPENDENT_OBJS): fix build failure on Solaris
- introduced in r46768. Object files containing dtrace probes should
- be listed in DTRACE_DEPENDENT_OBJS.
-
-Wed Jul 9 17:07:28 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.c, symbol.h: Symbol class implementation and internals,
- split from parse.y.
-
-Wed Jul 9 14:45:39 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y: change Symbol <-> ID relationship to avoid
- exposing IDs from collectable symbols.
- [Bug #10014]
-
- Now, rb_check_id() returns 0 if corresponding symbol is
- pinned dynamic symbol.
-
- There is remaining intern_cstr_without_pindown(), it can return
- IDs from collectable symbols. We must be careful to use it
- (only used in parse.y). I think it should be removed if
- it does not have impact for performance.
-
- * parse.y:
- add:
- * STATIC_SYM2ID()
- * STATIC_ID2SYM()
- rename:
- * rb_pin_dynamic_symbol() -> dsymbol_pindown()
-
- * internal.h:
- remove:
- * rb_check_id_without_pindown()
- * rb_sym2id_without_pindown()
- add:
- * rb_check_symbol()
- * rb_check_symbol_cstr()
-
- * load.c: use rb_check_id() or rb_check_id_cstr().
-
- * object.c: ditto.
-
- * struct.c: ditto.
-
- * thread.c: ditto.
-
- * vm_method.c: ditto.
-
- * string.c (sym_find): use only rb_check_symbol().
-
- * sprintf.c (rb_str_format): use rb_check_symbol_cstr().
-
-Wed Jul 9 12:21:55 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y (symbols_i): delete garbage symbols for Symbol.all_symbols.
-
-Wed Jul 9 05:49:08 2014 Eric Wong <e@80x24.org>
-
- * thread_pthread.h (struct rb_global_vm_lock_struct):
- do not expose pthread type for lock
-
-Wed Jul 9 05:41:40 2014 Eric Wong <e@80x24.org>
-
- * thread_pthread.h: remove unneeded semaphore.h include
-
-Wed Jul 9 00:12:28 2014 Keiju Ishitsuka <keiju@ishitsuka.com>
-
- * lib/irb/ruby-lex.rb: fix counting indent in identify_string_dvar.
-
-Tue Jul 8 16:58:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/memory_status.rb (Memory::PSCMD): use ps command which
- outputs expected result. [ruby-dev:48370] [Bug #10010]
-
-Tue Jul 8 14:45:17 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y (dsymbol_alloc): set global_symbols.minor_marked to 0.
-
- * parse.y (dsymbol_check): set RSYMBOL(sym)->fstr to 0
- because we should not touch fstr after that.
-
- * parse.y (rb_gc_free_dsymbol): skip deleting str and sym
- from tables if fstr == 0.
-
-Mon Jul 7 14:31:52 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y: remove global_symbols::pinned_dsym
- (and ::pinned_dsym_minor_marked).
-
- Mark pinned dsymbols by rb_gc_register_mark_object() because
- they are immortal.
-
- * parse.y (rb_gc_free_dsymbol): rename parameter name `ptr' to `sym'.
-
-Mon Jul 7 12:45:51 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: revert miss-commit.
-
-Mon Jul 7 12:40:59 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y: need to use updated (re-created) symbols.
-
-Mon Jul 7 11:02:55 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/mkconfig.rb: remove not to require rbconfig/obsolete.rb.
-
- * lib/rbconfig/obsolete.rb: removed.
-
-Mon Jul 7 10:52:03 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y: do not use rb_gc_resurrect(), but create a new dynamic
- symbol for garbage dynamic symbol.
-
- * common.mk: use gc.h by parse.y.
-
-Mon Jul 7 02:18:42 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (fstr_update_callback): do not use rb_gc_resurrect()
- any more.
-
- Make new frozen string and replace with garbage frozen string.
-
- * common.mk: use gc.h from string.c.
-
-Mon Jul 7 00:36:13 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename is_dying_object() to is_garbage_object().
-
- * gc.h: rb_objspace_garbage_object_p() as an exported function.
-
-Sun Jul 6 21:30:35 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (is_dying_object): fix missed condition.
-
- * gc.c (is_live_object): move frequent path first.
-
-Sun Jul 6 21:00:11 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename is_dead_object() to is_dying_object().
- This function is not opposite against is_live_object()
- because is_dying_object() does *not* check object type.
-
- * gc.c (is_dying_object): change condition.
-
- * gc.c (is_live_object): use T_NONE instead of 0.
-
- * gc.c (rb_objspace_dying_object_p): added.
-
-Sun Jul 6 13:37:27 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_gc_register_mark_object): change data structure.
- From single array, to array of arrays. Each array only has 1024
- entries.
-
- * vm.c (Init_vm_objects): change default capa from 1 to 128.
-
-Sat Jul 5 05:05:53 2014 Vipul A M <vipulnsward@gmail.com>
-
- * lib/irb/locale.rb (IRB::Locale#modifier): fix wrong attr_reader
- `modifieer` => `modifier` from irb locale. [fix GH-656]
-
-Fri Jul 4 20:45:26 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y: rename symbols::sym_id to symbols::str_id.
- This table is not {Symbol => ID} table, but
- {String => ID} table.
-
- * parse.y (lookup_sym_id): also rename lookup_sym_id() to
- lookup_str_id() because key is not Symbol, but String.
-
-Fri Jul 4 18:42:04 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y (must_be_dynamic_symbol): fix missed-condition.
-
-Fri Jul 4 18:38:11 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y (rb_pin_dynamic_symbol): should be `static' function.
-
-Fri Jul 4 18:03:35 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y (must_be_dynamic_symbol): refactoring.
- * add `inline'.
- * use UNLIKELY().
- * check only DYNAMIC_SYM_P(), otherwise it is a bug.
- * lookup_id_str() is not needed in second condition.
-
-Fri Jul 4 11:53:56 2014 Koichi Sasada <ko1@atdot.net>
-
- * parse.y: remove unused code
- surrounded by `#if ENABLE_SELECTOR_NAMESPACE'
-
-Fri Jul 4 10:08:24 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/rubygems/test_gem_package.rb: avoid tempfile leaks using Tempfile#close!
- * test/rubygems/test_gem_request_set.rb: ditto.
- * test/rubygems/test_gem_request_set_gem_dependency_api.rb: ditto.
-
-Fri Jul 4 04:42:05 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/response.rb (Net::Inflater#inflate_adapter):
- prevent automatic encoding conversion.
-
-Fri Jul 4 04:39:52 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/net/http/response.rb (Net::HTTPResponse.each_response_header):
- raise first exception even if inflate_body_io.finish raises error.
- when begin block raises error, finish usually raises error too.
-
-Fri Jul 4 02:56:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#query=): remove validation, just
- escape. [Feature #2542]
-
- * lib/uri/generic.rb (URI::Generic#fragment=): ditto.
-
- * lib/uri/generic.rb (URI::Generic#check_query): removed.
-
- * lib/uri/generic.rb (URI::Generic#set_query): ditto.
-
- * lib/uri/generic.rb (URI::Generic#check_fragment): ditto.
-
- * lib/uri/generic.rb (URI::Generic#set_fragment): ditto.
-
-Thu Jul 3 12:40:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (--with-static-linked-ext): fix for extensions to
- be linked statically.
-
- * Makefile.in, common.mk: use ENCSTATIC for enc directory.
-
- * ext/extmk.rb: supply dependencies of statically linked extension
- libraries.
-
-Wed Jul 2 15:45:49 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_heap_lazy_sweep): simplify logic.
-
- * gc.c (gc_page_sweep): return TRUE if empty slots are available.
-
-Wed Jul 2 09:48:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * logger.rb: removed unmaintained code.
- [Feature #9860][ruby-core:62724]
- * test/logger/test_application.rb: ditto.
-
-Wed Jul 2 03:20:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
-
- * node.c (dump_node): handle nd_value == (NODE *)-1 to mean this
- keyword argument is required
-
-Wed Jul 2 02:57:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (rb_vm_env_local_variables): returns array of local
- variable name symbols in the environment by envval.
-
- * proc.c (bind_local_variables): use rb_vm_env_local_variables.
-
-Wed Jul 2 02:23:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (bind_receiver): new method to return the bound receiver
- of the binding object. [ruby-dev:47613] [Feature #8779]
-
-Wed Jul 2 02:14:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (bind_local_variables): update env from envval for each
- iterations. [ruby-dev:48351] [Bug #10001]
-
-Tue Jul 1 23:46:34 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * NEWS: [DOC] mention about Binding#local_variables, introduced at
- r44392 (see [Feature #8773]).
-
-Tue Jul 1 23:30:51 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * numeric.c (num_step_scan_args): table argument of rb_get_kwargs() is
- array of IDs, not Symbols. [ruby-dev:48353] [Bug #9811]
-
-Tue Jul 1 16:18:22 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/digest/lib/digest/hmac.rb, test/digest/test_digest_hmac.rb:
- Digest::HMAC is finally removed as previously noticed.
- [fix GH-648]
-
-Tue Jul 1 11:13:43 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/date/lib/date/format.rb: removed empty file by @vipulnsward.
- * ext/date/lib/date.rb: removed needless require.
- [fix GH-647]
-
-Mon Jun 30 16:42:52 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_stat_internal): return size_t value instead of VALUE
- and remove `out' parameter.
-
- * gc.c: add braces for `if' statements.
-
- * gc.c (gc_stat_internal): fix comment.
-
-Mon Jun 30 15:07:34 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: support `USE_RGENGC == 0'.
-
- * test/ruby/test_gc.rb: ditto.
-
-Mon Jun 30 11:36:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * file.c: [DOC] document File.join returns a string.
- Contributed by @dapplebeforedawn. [fix GH-646]
-
-Sat Jun 28 22:57:01 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/pathname/pathname.c (path_birthtime): Windows support.
- see [Feature #9857] [ruby-dev:48339]
-
-Sat Jun 28 22:44:16 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/pathname.c (path_birthtime): New method,
- Pathname#birthtime.
- Proposed by Kazuhiro NISHIYAMA. [ruby-dev:48232] [Feature #9857]
-
-Sat Jun 28 20:29:03 2014 Simon Baird <simon.baird@gmail.com>
-
- * ext/bigdecimal/lib/bigdecimal/math.rb (BigMath#PI): change error
- message about zero or negative precision for clarity and
- consistency with other methods. [GH-644]
-
-Sat Jun 28 15:32:57 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/utils.rb (create_listeners): Close socket objects.
-
-Sat Jun 28 13:58:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (setup_exception): should not overwrite SystemStackError
- backtrace if set already. [ruby-core:63377] [Feature #6216]
-
- * eval.c (setup_exception): get rid of method calls before raising
- stack overflow, not to cause stack overflow again.
-
- * defs/id.def: add IDs for backtraces.
-
-Sat Jun 28 04:08:22 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/mailto.rb: update to latest specs, RFC 6068 and HTML5.
-
- * lib/uri/mailto.rb (HEADER_PATTERN): removed.
-
- * lib/uri/mailto.rb (HEADER_REGEXP): use RFC 6068 hfields.
-
- * lib/uri/mailto.rb (EMAIL_REGEXP): use HTML5 email regexp.
-
- * lib/uri/mailto.rb (URI::MailTo.build): support multiple to addresses.
-
- * lib/uri/mailto.rb (URI::MailTo#initialize): Support multiple to
- addresses. Don't check with regexp, only split.
-
- * lib/uri/mailto.rb (URI::MailTo#check_to): verify by matching
- URI path-rootless and HTML5 email regexp with unescaped one.
-
- * lib/uri/mailto.rb (URI::MailTo#check_headers): verify only by
- HEADER_REGEXP.
-
- * lib/uri/mailto.rb (URI::MailTo#set_headers): don't check by
- HEADER_REGEXP, only split it.
-
-Sat Jun 28 00:35:10 2014 Lauri Tirkkonen <lotheac@iki.fi>
-
- * tool/mkconfig.rb: fix empty RbConfig::CONFIG["prefix"] when
- configured --with-rubyarchprefix, remove prefix from rubyarchdir
- after expansion for the case it does not start with '$(prefix)'.
- [fix GH-643]
-
-Fri Jun 27 15:20:12 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rubygems/test_case.rb: rescue Gem::LoadError in Gem::TestCase.
- because it's effected by removing minitest from stdlib.
-
-Fri Jun 27 12:29:37 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/rubygems/specification.rb: fixed broken condition caused
- by removing YAML::ENGINE.
- * lib/rubygems/package/old.rb: ditto.
-
-Fri Jun 27 05:33:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_shift): fix memory leak on Windows, free environment
- strings block always. [ruby-dev:48332] [Bug #9983]
-
-Fri Jun 27 03:41:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (GETASTER): should not use the numbered argument to be
- formatted, raise ArgumentError instead.
- [ruby-dev:48330] [Bug #9982]
-
-Thu Jun 26 18:18:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/with_different_ofs.rb: move into test library directory.
- * test/csv/base.rb: fix require path for with_different_ofs.rb.
- * test/digest/test_digest_extend.rb: ditto.
-
-Thu Jun 26 18:06:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/profile_test_all.rb: move into test library directory.
- * test/runner.rb: fix require path for profile_test_all.rb.
-
-Thu Jun 26 17:57:57 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/webrick/httpproxy.rb: remove useless assigned variables.
- * lib/webrick/httpservlet/cgihandler.rb: ditto.
- * lib/webrick/httpservlet/erbhandler.rb: ditto.
- * lib/webrick/server.rb: ditto.
-
-Thu Jun 26 08:28:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_select): fix memory leak and crash on Windows, make
- keys array first instead of iterating on environ directly.
- [ruby-dev:48325] [Bug #9978]
-
-Thu Jun 26 02:45:04 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval_error.c (error_print): put a newline after an anonymous
- exception class name.
-
-Wed Jun 25 22:31:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (ruby_setenv): fix memory leak on Windows, free
- environment strings block after check for the size.
- [ruby-dev:48323] [Bug #9977]
-
-Wed Jun 25 15:44:12 2014 Eric Wong <e@80x24.org>
-
- * ccan/container_of/container_of.h (container_off_var):
- avoid warning with -Wcast-qual
- [ccan ba5ad771af4aa9e085498de6c3c665c52694460f (Rusty Russell)]
-
-Wed Jun 25 10:19:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_aset, env_has_key, env_assoc, env_has_value),
- (env_rassoc, env_key): prohibit tainted strings if $SAFE is
- non-zero. [Bug #9976]
-
-Tue Jun 24 14:46:17 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/gserver.rb: remove redundant use of to_s in interpolation.
- * lib/logger.rb: ditto.
- * lib/optparse.rb: ditto.
- * lib/rbconfig/obsolete.rb: ditto.
- * lib/resolv.rb: ditto.
- * lib/webrick/httpresponse.rb: ditto.
-
-Tue Jun 24 10:50:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_path_str_new): make PATH environment variable
- string, to be frozen.
-
-Tue Jun 24 10:40:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * tool/make-snapshot: download bundle gems when package making.
- [Feature #9852][ruby-core:62676]
- * gems/bundled_gems: listed bundled gems for Ruby 2.2.
-
-Tue Jun 24 10:20:35 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * tool/downloader.rb: make Downloader class to general download utility.
- It can be used without config.guess and config.sub.
- * tool/get-config_files: ditto.
- * tool/make-snapshot: ditto.
-
-Tue Jun 24 06:17:52 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * eval.c (setup_exception): "mesg == sysstack_error" and
- sysstack_error_p(mesg) are duplicated.
- r46502 seems to want to use latter.
-
-Tue Jun 24 06:15:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/tk/tcltklib.c: fix format specifiers for VALUE and
- Tcl_Interp*. [ruby-core:63283] [Bug #9972]
-
-Tue Jun 24 05:40:41 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-
- * nacl/nacl-config.rb: Use File.exist? instead of executable?
- for irt_core. Recent nacl_sdk has non-executable irt_core.
- Patch by Shinichiro Hamaji.
- [Fixes GH-529] https://github.com/ruby/ruby/pull/529
-
-Mon Jun 23 18:44:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * tool/config_files.rb: rename class ConfigFiles to Downloader.
- * tool/get-config_files: ditto.
- * tool/make-snapshot: ditto.
-
-Mon Jun 23 18:03:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * tool/rbinstall.rb: support to install bundle gems.
-
-Mon Jun 23 17:33:11 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/net/imap.rb (Net::IMAP#fetch): [DOC] Describe how a range in
- +set+ is interpreted, and mention -1 which can be used for '*'.
-
-Mon Jun 23 16:22:50 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * include/ruby/ruby.h (struct RHash): no longer. [Feature #9889]
-
- * include/ruby/ruby.h (RHASH): ditto.
-
- * include/ruby/ruby.h (RHASH_ITER_LEV): deprecated. Will be deleted later.
-
- * include/ruby/ruby.h (RHASH_IFNONE): ditto.
-
- * internal.h (struct RHash): moved here.
-
- * internal.h (RHASH): ditto.
-
- * hash.c (rb_hash_iter_lev): do not use this.
-
- * hash.c (rb_hash_ifnone): ditto.
-
-Mon Jun 23 13:30:11 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * include/ruby/ruby.h (struct RComplex): no longer. [Feature #9888]
-
- * include/ruby/ruby.h (RCOMPLEX): ditto.
-
- * include/ruby/ruby.h (RCOMPLEX_SET_REAL): deprecated. Will be deleted later.
-
- * include/ruby/ruby.h (RCOMPLEX_SET_IMAG): ditto.
-
- * internal.h (struct RFloat): moved here.
-
- * internal.h (RCOMPLEX): ditto.
-
- * complex.c (rb_complex_set_real): do not use this.
-
- * complex.c (rb_complex_set_imag): ditto.
-
-Mon Jun 23 13:10:15 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * include/ruby/ruby.h (struct RFloat): no longer. [Feature #9863]
-
- * include/ruby/ruby.h (RFLOAT): ditto.
-
- * internal.h (struct RFloat): moved here.
-
- * internal.h (RFLOAT): ditto.
-
-Mon Jun 23 12:01:42 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (check_port): allow strings for port= as
- described in rdoc.
-
- * lib/uri/rfc3986_parser.rb (regexp): implementation detail of above.
-
-Mon Jun 23 11:35:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (setup_exception): set backtrace in system stack error
- other than the pre-allocated sysstack_error. [Feature #6216]
-
- * proc.c (Init_Proc): freeze the pre-allocated sysstack_error.
-
- * vm_insnhelper.c (vm_stackoverflow): raise new instance for each
- times without calling any methods to keep the backtrace with no
- further stack overflow.
-
- * object.c (rb_obj_copy_ivar): extract function to copy instance
- variables only for T_OBJECT from init_copy.
-
-Mon Jun 23 11:11:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (check_stack_overflow): drop the last tag too close to
- the fault page, to get rid of stack overflow deadlock.
- [Bug #9971]
-
-Sun Jun 22 09:11:15 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb: remove registry.
- 'registry' is not used and RFC3986 doesn't use it.
-
-Sun Jun 22 09:10:09 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/rfc3986_parser.rb: raise exception when given a URI string
- has non ASCII in order to keep the regexp compiled for US-ASCII.
-
-Sun Jun 22 09:05:42 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/common.rb (URI::REGEXP): move to lib/uri/rfc2396_parser.rb.
-
- * lib/uri/common.rb (URI::Parser): ditto.
-
- * lib/uri/common.rb (URI.split): use RFC3986_Parser. [Feature #2542]
-
- * lib/uri/common.rb (URI.parse): ditto.
-
- * lib/uri/common.rb (URI.join): ditto.
-
- * lib/uri/common.rb (URI.extract): deprecated.
-
- * lib/uri/common.rb (URI.regexp): ditto.
-
- * lib/uri/rfc2396_parser.rb: added.
-
- * lib/uri/rfc3986_parser.rb: added.
-
-Sun Jun 22 09:04:50 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/mailto.rb (initialize): as previous commit, fix arg_check
-
-Sun Jun 22 09:01:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/ftp.rb (initialize): argument checking flag is arg_check,
- but arg[-1] is fragment.
-
- * lib/uri/ftp.rb (initialize): explicitly specify arguments.
-
-Sat Jun 21 12:50:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/extconf.rb: supply 0 to fill RUBY_LIBFFI_MODVERSION
- with 3-digit. libffi 3.1 returns just 2-digit.
- [ruby-core:62920] [Bug #9897]
-
-Sat Jun 21 07:06:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * encoding.c (enc_find): [DOC] never accepted a symbol.
- [ruby-dev:48308] [Bug #9966]
-
-Fri Jun 20 17:15:43 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/lib/tracepointchecker.rb: add to check TracePoint healthiness.
-
- * test/runner.rb: use it.
-
-Fri Jun 20 07:26:44 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_settracefunc.rb: rewrite tests with
- assert_consistent_call_return().
-
- assert_consistent_call_return() is also modified to check
- consistency.
-
-Fri Jun 20 07:07:28 2014 Koichi Sasada <ko1@atdot.net>
-
- * compile.c (rb_iseq_compile_node): put start label of block after
- trace (b_call).
- [Bug #9964]
-
- * test/ruby/test_settracefunc.rb: add a test.
-
- added assert_consistent_call_return() method check call/return
- consistency.
-
-Fri Jun 20 05:26:27 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_eval.c (rb_catch_protect): fix same problem of [Bug #9961].
-
- * vm_eval.c (rb_iterate): ditto.
-
-Thu Jun 19 21:41:30 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (rb_vm_rewind_cfp): add new function to rewind specified cfp
- with invoking RUBY_EVENT_C_RETURN.
- [Bug #9961]
-
- * vm_core.h: ditto.
-
- * eval.c (rb_protect): use it.
-
- * eval.c (rb_rescue2): ditto.
-
- * vm_eval.c (rb_iterate): ditto.
-
- * test/ruby/test_settracefunc.rb: add a test.
-
- * vm_core.h (rb_vm_rewind_cfp): add the prototype declaration.
-
-Thu Jun 19 19:47:21 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (invoke_block_from_c): move call/return event timing for
- bmethod. It can invoke inconsistent call event if this call raises
- argument error.
- [Bug #9959]
-
- * vm_insnhelper.c (vm_call_bmethod_body): ditto.
-
- * test/ruby/test_settracefunc.rb: add a test.
-
-Thu Jun 19 18:14:47 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: add VM_FRAME_MAGIC_RESCUE to recognize normal block or
- rescue clause.
-
- * vm.c (vm_exec): use VM_FRAME_MAGIC_RESCUE on at rescue/ensure.
-
- * test/ruby/test_settracefunc.rb: should not invoke b_return at rescue
- clause.
- [Bug #9957]
-
- * vm_dump.c (control_frame_dump): check VM_FRAME_MAGIC_RESCUE.
-
- * vm_dump.c (vm_stack_dump_each): ditto.
-
-Thu Jun 19 13:39:11 2014 Arne Brasseur <arne@arnebrasseur.net>
-
- * proc.c (rb_method_curry): Implement Method#curry, which delegates
- to to_proc.curry. [ruby-core:62212] [Feature #9783]
-
-Tue Jun 17 16:41:49 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/ftp.rb (gets, readline): read lines without LF properly.
- [ruby-core:63205] [Bug #9949]
-
- * test/net/ftp/test_buffered_socket.rb: related test.
-
-Tue Jun 17 12:35:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (extract_raise_opts): pass unknown options to the
- exception, so that exception class can receive a hash argument.
- [ruby-core:63203] [Feature #8257]
-
-Tue Jun 17 12:24:57 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (obj_memsize_of): memsize_of(T_ZOMBIE) returns 0, not a rb_bug.
- ObjectSpace.count_objects_size() uses memsize_of(T_ZOMBIE).
-
- This bug introduced at r46348.
-
-Mon Jun 16 19:00:11 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/runner.rb: failure message should be passed as an argument.
-
-Mon Jun 16 18:42:57 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/runner.rb: capture TracePoint stat before setup and compare
- it after teardown.
-
-Mon Jun 16 14:33:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (open): use UTF-8 version function to support
- non-ascii path properly. [ruby-core:63185] [Bug #9946]
-
-Sat Jun 14 10:54:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rcombinate0): remove recursion, by looping with indexes
- stored in `p`.
-
- * array.c (rpermute0): remove recursion, by looping with indexes
- stored in `p`.
-
- * array.c (permute0): remove recursion, by looping with indexes
- stored in `p`. [ruby-core:63103] [Bug #9932]
-
-Sat Jun 14 10:52:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_resize): update capa only when buffer get
- reallocated.
- http://d.hatena.ne.jp/nagachika/20140613/ruby_trunk_changes_46413_46420#r46413
-
-Sat Jun 14 08:28:59 2014 Zachary Scott <e@zzak.io>
-
- * man/rake.1: [DOC] Update links for Rake, patch by @hsbt [Bug #9904]
- [Fixes GH-628] https://github.com/ruby/ruby/pull/628
-
-Fri Jun 13 17:58:58 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_trace.c: add new method TracePoint.stat to debug
- TracePoint mechanism.
-
- Ruby users should not use this method. So I don't note this method
- in the NEWS file.
-
- * test/runner.rb: detect zombie active TracePoints with
- TracePoint.stat.
-
-Fri Jun 13 17:46:31 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm_trace.c: clear and restore recursive checking thread local data
- to avoid unexpected throw from TracePoint.
- [Bug #9940]
-
- * test/ruby/test_settracefunc.rb: add a test.
-
- * thread.c: added
- * rb_threadptr_reset_recursive_data(rb_thread_t *th);
- * rb_threadptr_restore_recursive_data(rb_thread_t *th, VALUE old);
-
- * vm_core.h: ditto.
-
-Fri Jun 13 17:33:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_combination): iterate on a shared copy, and use
- array of indexes instead of array of chosen objects.
- [ruby-core:63149] [Bug #9939]
-
- * array.c (yield_indexed_values): extract from permute0(),
- rpermute0(), and rcombinate0().
-
-Fri Jun 13 13:42:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_permutation): `p` is the array of size `r`, as
- commented at permute0(). since `n >= r` here, buffer overflow
- never happened, just reduce unnecessary allocation though.
-
-Thu Jun 12 20:32:28 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_resize): should consider the capacity instead
- of the old length, as pointed out by nagachika.
-
-Thu Jun 12 18:31:01 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/net/http/responses.rb: added Net::HTTPPermanentRedirect(308)
- Contributed by @yorkie [fix GH-638]
-
-Thu Jun 12 13:27:38 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_freeze): shrink the buffer before freezing, as
- pointed out by Eric Wong at [ruby-core:63119].
-
-Thu Jun 12 13:09:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (expand_path): shrink expanded path which no longer needs
- rooms to append. [ruby-core:63114] [Bug #9934]
-
-Wed Jun 11 17:37:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_scalar_pthread_t): pthread_t is not required
- to be a scalar type.
-
- * thread.c (fill_thread_id_string, thread_id_str): dump pthread_t
- in hexadecimal form if it is not a scalar type, assume it can be
- represented in a pointer form otherwise. based on the patch by
- Rei Odaira at [ruby-core:62867]. [ruby-core:62857] [Bug #9884]
-
- * thread_pthread.c (Init_native_thread, thread_start_func_1),
- (native_thread_create): set thread_id_str if needed.
-
- * vm_core.h (rb_thread_t): add thread_id_string if needed.
-
-Wed Jun 11 01:53:22 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: invoke GC before memory allocation (xmalloc/xrealloc)
- when GC.stress = true.
- [Bug #9859]
-
- * test/ruby/test_gc.rb: add a test.
-
-Tue Jun 10 13:20:14 2014 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
-
- * lib/cgi/core.rb: Provide a mechanism to specify the
- max_multipart_length of multipart data.
- [Feature #8370] patch by Leif Eriksen <leif.eriksen.au@gmail.com>
-
-Tue Jun 10 10:57:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/csv.rb (CSV#<<): honor explicitly given encoding. based on
- the patch by DAISUKE TANIWAKI <daisuketaniwaki AT gmail.com> at
- [ruby-core:62113]. [Bug #9766]
-
-Mon Jun 9 20:40:48 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: change full GC timing to keep lower memory usage.
-
- Extend heap only at
- (1) after major GC
- or
- (2) after several (two times, at current) minor GC
-
- Details in https://bugs.ruby-lang.org/issues/9607#note-9
- [Bug #9607]
-
-Mon Jun 9 16:01:41 2014 Masahiro Ide <imasahiro9@gmail.com>
-
- * gc.c (gcdebug_sentinel): fix typo, "sentinel" not "sential".
- [fix GH-634]
-
-Mon Jun 9 00:04:25 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (posix_fadvise): disable use of posix_fadvise
- itself on 32-bit AIX. [ruby-core:62968] [Bug #9914]
-
-Sun Jun 8 23:28:00 2014 <kanemoto@ruby-lang.org>
-
- * io.c (rb_io_advise): AIX currently does not support a 32-bit call to
- posix_fadvise() if _LARGE_FILES is defined. Patch by Rei Odaira.
- [ruby-core:62968] [Bug #9914]
-
-Sun Jun 8 04:52:40 2014 Jun Hiroe <Jun.Hiroe@gmail.com>
-
- * string.c (rb_str_slice_bang): [DOC] update return value against
- a fixnum, which has changed because of M17N. [fix GH-631]
-
-Sat Jun 7 22:13:42 2014 Benoit Daloze <eregontp@gmail.com>
-
- * numeric.c (do_coerce): Add a warning when an exception is raised
- or an invalid value is returned in #coerce called by
- numeric comparison operators and the exception
- thrown by the caller has no information on the failure.
- In the next release such exception should not be rescued or
- should be the cause of the caller exception. nil is accepted
- as the "no possible coercion" return value. See #7688.
-
- * test/ruby/test_numeric.rb: Add corresponding test.
-
-Sat Jun 7 18:15:33 2014 Benoit Daloze <eregontp@gmail.com>
-
- * numeric.c (bit_coerce): remove constant parameter `err'
- (always TRUE) of bit_coerce().
-
-Sat Jun 7 16:01:57 2014 Yutaka Kanemoto <kanemoto@ruby-lang.org>
-
- * cont.c (rb_fiber_struct): keep context.uc_stack.ss_sp and context.uc_stack.ss_size
- for later use. Patch by Rei Odaira. [ruby-core:62945] [Bug #9905]
-
-Sat Jun 7 12:51:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (read_all): truncate the buffer before appending read data,
- instead of truncating before reading.
- [ruby-core:55951] [Bug #8625]
-
-Sat Jun 7 12:28:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/digest/digest.c (rb_digest_instance_equal): no need to call
- `to_s` twice. [Bug #9913]
-
-Sat Jun 7 11:35:01 2014 Tanaka Akira <akr@fsij.org>
-
- * object.c (rb_mod_initialize_clone): Override Kernel#initialize_clone
- to avoid an exception on Class.new.freeze.clone.to_s.
- Reported by Andrew Grimm. [ruby-core:41858] [Bug #5828]
-
-Sat Jun 7 06:03:11 2014 Benoit Daloze <eregontp@gmail.com>
-
- * ext/digest/digest.c (rb_digest_instance_equal):
- fix #== for non-string arguments. [ruby-core:62967] [Bug #9913]
-
- * test/digest/test_digest.rb: add test for above.
-
-Fri Jun 6 22:19:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (private_recv_p): check by node type, instead of a
- magic number.
-
- * node.h (NODE_PRIVATE_RECV), parse.y (attrset_gen): remove
-
-Fri Jun 6 17:07:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_compile_each), parse.y (new_attr_op_assign_gen):
- allow op assign to a private attribute.
- [ruby-core:62949] [Bug #9907]
-
-Fri Jun 6 13:39:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_setstrbuf, io_read): should not shorten the given buffer until
- read succeeds. [ruby-core:55951] [Bug #8625]
-
-Fri Jun 6 07:41:41 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: dump empty symbols with a
- tag so that they can be parsed on input. [Bug #9873] [ruby-core:62825]
- * test/psych/test_symbol.rb: test for change
-
-Thu Jun 5 16:08:39 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_page_sweep): refactoring.
-
- * gc.c (gc_page_sweep): should not set, but add final_slots into
- sweep_page->final_slots.
-
-Thu Jun 5 14:36:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (jemalloc): check for the header regardless drop-in
- libjemalloc is found, for `malloc_conf` declaration.
-
- * version.c (ruby_show_version): show `malloc_conf` if set.
- [Feature #9113]
-
- * configure.in (with-jemalloc): also check for header, for ABIs
- which JEMALLOC_MANGLE is needed, i.e., Mach-O and PE-COFF
- platforms. [ruby-core:62939] [Feature #9113]
-
- * include/ruby/missing.h: include alternative malloc header to
- replace memory management functions.
-
- * dln.c, io.c, parse.y, st.c: undef malloc family before
- re-definition to suppress warnings.
-
-Thu Jun 5 12:52:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * man/ruby.1: remove rubyforge entry.
-
-Thu Jun 5 12:45:32 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * misc/README: use github link instead of rubyforge.
-
-Thu Jun 5 10:03:29 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (obj_free): check also FL_PROMOTED bit by RVALUE_OLD_P().
-
-Thu Jun 5 03:45:28 2014 Eric Wong <e@80x24.org>
-
- * configure.in: add --with-jemalloc option
- [ruby-core:62912]
-
-Wed Jun 4 22:28:14 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: introduce RZombie to manage zombie objects.
- Rewrite finalizing logics with this type.
-
- * gc.c (gc_verify_internal_consistency): verify zombie (finalizing)
- objects count.
-
-Wed Jun 4 22:09:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (match_aref, rb_reg_regsub): consider encoding of captured
- names, encoding-incompatible should not match.
- [ruby-dev:48278] [Bug #9903]
-
-Wed Jun 4 21:23:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (match_aref): should not ignore name after NUL byte.
- [ruby-dev:48275] [Bug #9902]
-
-Wed Jun 4 04:08:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (core_hash_merge_kwd): should return the result hash, which
- may be converted from and differ from the given argument.
- [ruby-core:62921] [Bug #9898]
-
-Tue Jun 3 23:32:34 2014 Tanaka Akira <akr@fsij.org>
-
- * ruby.c (load_file_internal2): Extracted from load_file_internal.
- (load_file_internal): Invoke load_file_internal2 using rb_protect.
- Close an opened FD if load_file_internal2 raises an exception.
-
-Tue Jun 3 19:11:45 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_objspace_free): should not rest_sweep() here.
- Some data structures are already freed.
-
-Tue Jun 3 18:43:51 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_gc.rb: allocate more objects to invoke GC by newobj.
- GC allows extending pages depends on heap_increment.
-
-Tue Jun 3 18:01:27 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_gc_call_finalizer_at_exit): add
- gc_verify_internal_consistency() when RGENGC_CHECK_MODE >= 2.
-
-Tue Jun 3 17:54:21 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: change the counting method for young objects.
- clear counter at the beginning of every GC and
- count promoted (infant->young) objects.
-
- Some promotions (infant->young) are transition of promoting to old
- objects. We should not count such promotions.
-
- With this technique, we don't need to check young objects
- at obj_free().
-
-Tue Jun 3 16:38:19 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: add verifying counters code in gc_verify_internal_consistency().
- gc_verify_internal_consistency() counts all
- - live objects
- - young objects (if age2 promotion)
- - old objects
- in all pages and compares with objspace managing counters.
-
- * gc.c (gc_after_sweep): do gc_verify_internal_consistency()
- when RGENGC_CHECK_MODE >= 2.
-
-Tue Jun 3 13:14:04 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (body_type_1part): Gmail IMAP reports a body
- type as "MIXED" followed immediately by params
- [ruby-core:62864] [Bug #9885]
- Patch by @rayners (David Raynes). [Fixes GH-622]
- https://github.com/ruby/ruby/pull/622
-
-Tue Jun 3 13:18:24 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (objspace_live_slot): live slot count should not include final
- slot (contains T_ZOMBIE) count.
-
-Tue Jun 3 13:03:21 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (obj_free): fix spacing.
-
-Tue Jun 3 12:59:32 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (check_gen_consistency): fix error message.
-
-Tue Jun 3 12:40:23 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: count old/young objects more correctly.
-
- * gc.c (RVALUE_DEMOTE_FROM_OLD): decrement old object count.
-
- * gc.c (RVALUE_DEMOTE_FROM_YOUNG): decrement young object count.
-
- * gc.c (rb_gc_resurrect): increment old object count.
-
- * gc.c (gc_marks_body): should not add old object count.
- This code is completely my misunderstanding.
-
- * gc.c (rb_gc_force_recycle): decrement young or old object count
- correctly.
-
-Tue Jun 3 12:26:47 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/memory_status.rb: add $LOAD_PATH to load test/unit
- correctly for fiddle/import unavailable environments.
-
-Tue Jun 3 09:45:13 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/openssl/test_ssl.rb (OpenSSL::TestSSL#test_verify_result):
- shouldn't use same server for respective tests, because the 1st
- test sometimes kills the server main loop silently.
- [Bug #9881] [ruby-dev:48266]
-
-Tue Jun 3 01:34:59 2014 Zachary Scott <e@zzak.io>
-
- * README.EXT: [DOC] Add rb_call_super when subclassing from @robin850
- [Fixes GH-623] https://github.com/ruby/ruby/pull/623
-
-Mon Jun 2 17:14:49 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (ruby_vm_destruct): remove useless call of
- rb_gc_force_recycle().
-
- At this line, a VM object is already freed
- (is changed to T_NONE) by rb_gc_call_finalizer_at_exit().
-
-Mon Jun 2 15:50:24 2014 Koichi Sasada <ko1@atdot.net>
-
- * eval.c (rb_using_refinement): add write-barriers for
- cref->nd_refinements.
-
-Mon Jun 2 12:26:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * CONTRIBUTING.md: added contributing guide for github. [fix GH-625]
-
-Mon Jun 2 07:30:33 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/envutil.rb (default_warning): New method.
-
- * test/ruby/test_autoload.rb: Use EnvUtil.default_warning.
-
-Mon Jun 2 07:05:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/encoding.h: constify `rb_encoding` arguments.
-
- * include/ruby/oniguruma.h: constify `OnigEncoding` arguments.
-
-Sun Jun 1 12:05:10 2014 Tanaka Akira <akr@fsij.org>
-
- * test/drb: Wrap tests definitions by DRbTests module. This makes
- several tests (ACLEntryTest, TestBug4409, etc.) easier to understand
- that they are tests for DRb.
-
-Sun Jun 1 11:36:25 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/rinda/ring.rb (RingFinger#make_socket): Close the socket on
- exception.
-
-Sun Jun 1 06:55:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (intern_str): dynamic attrset ID is registered by
- `rb_id_attrset()` already, so no further registration is needed.
- [ruby-core:62861]
-
-Sun Jun 1 04:52:47 2014 Zachary Scott <e@zzak.io>
-
- * lib/English.rb: [DOC] $LOADED_FEATURES moved to load.c [Fixes GH-620]
- Patch submitted by @leafac in https://github.com/ruby/ruby/pull/620
- * doc/globals.rdoc: Added $LOADED_FEATURES to list
-
-Sat May 31 22:30:14 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/leakchecker.rb: Leak checker extracted from
- test/lib/minitest/unit.rb.
-
-Sat May 31 21:15:43 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * thread.c (rb_thread_atfork_internal): My compiler complains
- about this variable being used before initialized. I looked at
- the code and expanded the macro and turned out it was actually
- USED for pointer arithmetic, not dereferenced. So this was
- never a serious bug. But is annoying indeed to see warnings
- every time. I added `=0` and all went healthy.
-
- * configure.in: Also, I found that the problematic macro expansion
- only happens when we lack __typeof__ C extension, which shall
- not be the case of my compiler. I added AC_C_TYPEOF to kick ass.
-
-Sat May 31 16:32:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/ipaddr.rb: extracted inline tests into test dir.
- * test/test_ipaddr.rb: ditto.
-
-Sat May 31 16:29:21 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/digest/lib/digest/hmac.rb: extracted inline tests into test dir.
- * test/digest/test_digest_hmac.rb: ditto.
-
-Sat May 31 16:02:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_syslog.rb: remove executable.
-
-Sat May 31 08:58:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/unicode.c (init_case_fold_table): no longer need to
- initialize tables at runtime.
-
- * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
- lookup case unfolding table 3.
-
- * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
- lookup case unfolding table 2.
-
- * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
- lookup case unfolding table 1.
-
- * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
- lookup case folding table.
-
- * enc/unicode/case-folding.rb (print_table): merge non-locale and
- locale tables, and reduce initializing loops.
-
- * enc/unicode/case-folding.rb (CaseFolding): modularize, and add
- --output-file option.
-
- * enc/unicode/case-folding.rb: script to convert CaseFolding.txt,
- translated from CaseFolding.py.
-
-Sat May 31 08:31:41 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Check Tempfile leaks for each test method
- again.
-
-Sat May 31 03:50:50 2014 Zachary Scott <e@zzak.io>
-
- * lib/delegate.rb: [DOC] Document raise in Delegator class
- Patch by @lucasmazza. [Fixes GH-621]
- https://github.com/ruby/ruby/pull/621
-
-Fri May 30 21:23:26 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/server.rb: Use a pipe to detect server shutdown.
- shutdown() or close() for listening socket is not a reliable.
- Actually, both doesn't work (doesn't wake up select()) on
- DragonFly BSD 3.6.2.
-
- * test/webrick/utils.rb: :ShutdownSocketWithoutClose is not required
- now to immediate server shutdown detection.
- This fixes fd leaks.
-
- * test/net/http/utils.rb: Ditto.
-
-Fri May 30 20:58:37 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb (check_fd_leak): Sort the inspected
- objects list for a FD.
-
-Fri May 30 18:06:55 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb (check_fd_leak): Try GC to delete leaked
- FDs.
-
-Fri May 30 12:05:59 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * test/lib/test/unit/parallel.rb (_run_suite): orig_stdout may be nil
- though I don't know the reason.
-
-Fri May 30 11:33:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_substr): need to reset code range for shared
- string too, not only copied string.
- [ruby-core:62842] [Bug #9882]
-
-Fri May 30 10:22:21 2014 Mark Lorenz <mlorenz@covermymeds.com>
-
- * lib/erb.rb (result): [DOC] no longer accepts a Proc, as
- Kernel.eval does not. [fix GH-619]
-
-Fri May 30 07:25:46 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/-test-/dir: Dir#fileno implemented.
-
- * test/lib/minitest/unit.rb (find_fds): Don't return the fd used to
- scan /proc/$$/fd.
-
-Fri May 30 04:48:00 2014 Eric Wong <e@80x24.org>
-
- * parse.y (rb_gc_mark_parser): remove, empty since r8758
- * internal.h: ditto, not usable from extensions since 2.0.0
- * gc.c (gc_mark_roots): remove checkpoint for parser
-
-Thu May 29 23:27:50 2014 Rei Odaira <Rei.Odaira@gmail.com>
-
- * signal.c (ruby_signal): should return either `old.sa_sigaction`
- or `old.sa_handler`, depending on whether `SA_SIGINFO` is set in
- `old.sa_flags`, because they may not be a union.
- [ruby-core:62836] [Bug #9878]
-
-Thu May 29 23:11:20 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c (pipe_open): Close pipes when rb_execarg_fixup() raises
- an exception.
- (rb_execarg_fixup_v): New function.
-
-Thu May 29 22:18:57 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb (capture_subprocess_io): Close fds.
-
-Thu May 29 19:47:08 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c (rb_io_s_pipe): Close pipes if io_encoding_set() raises an
- exception.
- (io_encoding_set_v): New function.
-
-Thu May 29 19:42:49 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/csv.rb (CSV.open): Close the opened file when an exception
- occur.
-
-Thu May 29 19:31:10 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): Close a socket
- if any exception occur.
-
-Thu May 29 05:05:29 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/ruby.h: Hide Symbol internals.
- (struct RSymbol): moved to internal.h
- (RSYMBOL): ditto
-
-Thu May 29 00:28:56 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/unixsocket.c (rsock_init_unixsock): Open a socket
- after path length check.
- This fixes a fd leak by TestSocket_UNIXSocket#test_too_long_path.
-
-Wed May 28 23:04:35 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_io.rb (test_flush_in_finalizer1): Use
- ObjectSpace.each_object to close files.
- GC.start is not reliable.
-
-Wed May 28 19:00:31 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/net/imap.rb (Net::IMAP#initialize): Close the opened socket when
- any exception occur.
- This fixes a fd leak by IMAPTest#test_imaps_post_connection_check
- which start_tls_session() raises an exception.
-
-Wed May 28 18:06:13 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_close): Fix sync_close to work
- when SSL is not started.
- This fix the fd leak by test_https_proxy_authentication in
- test/net/http/test_https_proxy.rb.
-
-Wed May 28 10:29:28 2014 Eric Wong <e@80x24.org>
-
- * vm.c (rb_vm_living_threads_foreach): remove function
- [ruby-core:62745]
- * thread.c (terminate_i): remove
- * thread.c (terminate_all): implement (inlines old terminate_i)
- * thread.c (rb_thread_terminate_all): use terminate_all
- * thread.c (rb_thread_fd_close_i): remove
- * thread.c (rb_thread_fd_close): iterate inline
- * thread.c (thread_list_i): remove
- * thread.c (rb_thread_list): iterate inline
- * thread.c (rb_thread_atfork_internal): iterate inline
- * thread.c (terminate_atfork_i): update types to remove casts
- * thread.c (terminate_atfork_before_exec_i): ditto
- * thread.c (struct thgroup_list_params): remove definition
- * thread.c (thgroup_list_i): remove
- * thread.c (thgroup_list): iterate inline
- * thread.c (check_deadlock_i): remove
- * thread.c (debug_deadlock_check): implement (inlines check_deadlock_i)
- * thread.c (debug_i): remove
- * thread.c (rb_check_deadlock): iterate inline
- * vm.c (vm_mark_each_thread_func): remove
- * vm.c (rb_vm_mark): iterate inline
- * vm_core.h (rb_vm_living_threads_remove): remove
- * vm_trace.c (clear_trace_func_i): remove
- * vm_trace.c (rb_clear_trace_func): iterate inline
-
-Wed May 28 09:30:51 2014 Eric Wong <e@80x24.org>
-
- * signal.c (signal_exec): ignore immediate cmd for SIG_IGN
- * signal.c (trap_handler): set cmd to true for SIG_IGN
- * signal.c (trap): handle nil and true values for oldcmd
- [Bug #9835]
-
-Wed May 28 01:02:54 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/tempfile.rb (Tempfile#inspect): Show "(closed)" if the tempfile
- is closed.
-
-Wed May 28 00:38:09 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Use Tempfile#close! instead of
- Tempfile#unlink to close file descriptors.
-
- * test/openssl/test_config.rb: Ditto.
-
- * test/ruby/test_io.rb: Ditto.
-
-Wed May 28 00:06:18 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/net/ftp.rb (transfercmd): Close TCP server socket even if an
- exception occur.
-
-Tue May 27 23:50:07 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/cgi/core.rb: Use Tempfile#close! instead of Tempfile#unlink
- to close file descriptors.
-
-Tue May 27 23:06:46 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_number_literal_suffix): refine error message for
- extra dot and digits.
-
-Tue May 27 22:44:20 2014 Tanaka Akira <akr@fsij.org>
-
- * test/rexml: Avoid fd leaks.
-
-Tue May 27 22:24:25 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb: Indent.
-
-Tue May 27 22:15:29 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_document.rb: Wrap by REXMLTests module.
-
-Tue May 27 22:11:10 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_encoding_2.rb: Remove a needless file.
-
-Tue May 27 22:10:30 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_contrib.rb: Indent.
-
-Tue May 27 21:28:16 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/socket/ifaddr.c (ifaddr_inspect_flags): support IFF_SIMPLEX.
-
-Tue May 27 21:03:03 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/: Use REXMLTests as wrapping module for REXML tests.
- I avoid using the same module for library in test because
- it provides "include REXML" environment in test. Normally,
- users don't use REXML on "include REXML" environment. So I
- don't want to write tests on "include REXML" environment.
-
-Tue May 27 20:59:37 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_comment.rb: Remove needless REXML module wrapping.
-
-Tue May 27 20:56:49 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/openssl/test_pkcs7.rb: Fix inverted expected and actual values.
-
-Tue May 27 20:26:06 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_io.rb (test_flush_in_finalizer1): some opened fds are
- remain before GC, so unlink the tempfile is failed.
-
-Tue May 27 19:07:26 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c (rb_io_autoclose_p): Don't raise on frozen IO.
-
- * test/lib/minitest/unit.rb: IO#autoclose? may raise IOError.
-
-Tue May 27 19:01:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_pair.rb: Modify TestSSL#test_read_and_write
- to handle partial sysreads. [Bug #7398][ruby-core:49563]
- * test/openssl/test_ssl.rb: ditto.
-
-Tue May 27 18:46:23 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_pkcs7.rb: Add tests for PKCS7#type= and add_data.
- [Feature #7399][ruby-core:49565]
-
-Tue May 27 17:45:09 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_hmac.rb (test_binary_update): Added Test for
- HMAC signing with UTF-8 String. [Bug #7512][ruby-core:50559]
-
-Tue May 27 17:10:14 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/runner.rb: fixed randomly test failure.
- [Bug #6573][ruby-core:45563]
-
-Tue May 27 16:58:12 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_timeout.rb (test_timeout): inverted test condition.
- [Bug #8523]
-
-Tue May 27 12:24:22 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Show leaked file descriptors.
-
-Tue May 27 11:12:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_fileno, rb_io_inspect): non-modification does not
- error on frozen IO. [ruby-dev:48241] [Bug #9865]
-
-Tue May 27 00:00:21 2014 yui-knk <spiketeika@gmail.com>
-
- * insns.def (defineclass): fix typo in the instruction comment.
- [fix GH-618]
-
-Mon May 26 16:33:15 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_file.rb: skip the test of atime on Windows, because
- Windows delays updating atime about 1 hour.
- see more details:
- http://msdn.microsoft.com/en-us/library/windows/desktop/ms724290%28v=vs.85%29.aspx
-
-Mon May 26 12:25:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optionparser.rb, lib/optparse.rb (OptParse): aliases.
- [ruby-core:62751] [Feature #9864]
-
-Mon May 26 07:59:34 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Show Finished threads line-by-line.
-
-Mon May 26 01:39:02 2014 Zachary Scott <e@zzak.io>
-
- * lib/csv.rb: Reject nil as data source for CSV.new, patch by @Peeja.
- [Fixes GH-580] https://github.com/ruby/ruby/pull/580
-
-Mon May 26 01:07:51 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Show leaked threads and tempfiles
- line-by-line.
-
-Sun May 25 23:02:06 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb (MiniTest::Assertions#diff): Remove
- tempfiles.
-
-Sun May 25 22:42:27 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Check tempfile leak for each test class.
-
-Sun May 25 20:31:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_cv_func_{getcontext,setcontext}): do not
- disable ucontext.h entirely, but disable use of functions only.
- `ucontext_t` is necessary in the signal handler now.
-
-Sun May 25 20:00:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (check_stack_overflow): revert part of r46100, the
- previous condition was correct, and fix compilation error on
- other architecture linux. [ruby-core:62746] [Bug #9862]
-
-Sun May 25 17:09:13 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Less ObjectSpace.each_object(Tempfile)
- invocation.
-
-Sun May 25 16:54:06 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Use Thread.list instead of
- ObjectSpace.each_object(Thread).
-
-Sun May 25 15:53:54 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/rinda/ring.rb (Rinda::RingServer#shutdown): Join the killed
- threads.
-
-Sun May 25 15:26:17 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/utils.rb: Override the inspect method of the thread
- used in WEBrick::Utils::TimeoutHandler.
-
-Sun May 25 14:22:30 2014 Tanaka Akira <akr@fsij.org>
-
- * test/openssl: Join threads.
-
-Sun May 25 12:46:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_bug_context): new function to report bug with
- context.
-
- * vm_dump.c (rb_vm_bugreport): accepts `ucontext_t` argument to
- dump machine registers. based on [GH-584].
-
- * signal.c (sigbus, sigsegv): dump machine registers if available.
-
-Sun May 25 12:32:42 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Sort leaked threads and tempfiles.
-
-Sun May 25 12:15:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (check_stack_overflow): fix condition to use ucontext
- register, mcontext_t dereference, and its member names, on Mac
- OS X.
-
-Sun May 25 11:58:26 2014 Zachary Scott <e@zzak.io>
-
- * enumerator.c: [DOC] Fix example to show Enumerator#peek behavior
- Patch by Erik Hollembeak [Bug #9814]
-
-Sun May 25 11:56:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vsnprintf.c (BSD_vfprintf): fix string width when precision is
- given. as the result of `memchr` is NULL or its offset from the
- start cannot exceed the size, the comparison was always false.
- [ruby-core:62737] [Bug #9861]
-
-Sun May 25 11:32:42 2014 Zachary Scott <e@zzak.io>
-
- * lib/yaml.rb: Remove Psych::EngineManager [Bug #8344]
- * test/psych/*: ditto.
-
-Sun May 25 10:34:15 2014 Zachary Scott <e@zzak.io>
-
- * doc/regexp.rdoc: [DOC] Clarify whitespace matching by @allolex
- [Fixes GH-606] https://github.com/ruby/ruby/pull/606
-
-Sun May 25 10:19:34 2014 Zachary Scott <e@zzak.io>
-
- * enum.c: [DOC] Use #find in example to clarify alias by @rachellogie
- Patch submitted via documenting-ruby/ruby#34
-
-Sun May 25 10:16:43 2014 Zachary Scott <e@zzak.io>
-
- * cont.c: [DOC] Fix rdoc in example for Fiber#transfer by @majjoha
- Patch submitted via documenting-ruby/ruby#33
-
-Sun May 25 10:01:11 2014 Zachary Scott <e@zzak.io>
-
- * lib/irb.rb: [DOC] Fixed syntax error in example by @jasdeepsingh.
- Patch submitted via documenting-ruby/ruby#32
-
-Sun May 25 09:58:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/fileutils/test_fileutils.rb (test_chown_R): Add tests for
- chown_R. [Feature #9383][ruby-core:59641]
-
-Sun May 25 09:57:09 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/fileutils/test_fileutils.rb: Added recursively chown tests.
- [Feature #9303][ruby-core:59325]
-
-Sun May 25 09:41:56 2014 Zachary Scott <e@zzak.io>
-
- * class.c: [DOC] Fixed grammar and examples of instance_methods.
- By @alex-frost via documenting-ruby/ruby#31
-
-Sun May 25 09:40:44 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb: Show leaked threads and tempfiles.
-
-Sun May 25 08:54:38 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/openssl/test_partial_record_read.rb: Testing read_nonblock on
- a partial TLS record results in IO::WaitReadable by @mohamedhafez.
- [fix GH-547]
-
-Sun May 25 08:43:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * lib/logger.rb: refactored to include Logger::Period.
-
-Sun May 25 06:50:19 2014 Zachary Scott <e@zzak.io>
-
- * vm_eval.c: [DOC] Improve instance_eval description when given a
- block or String arguments. By @nathanl via documenting-ruby/ruby#28
-
-Sun May 25 06:29:39 2014 Zachary Scott <e@zzak.io>
-
- * array.c: [DOC] Clarify default argument for Array.new.
- By @Elffers [Fixes GH-610]
-
-Sat May 24 22:37:20 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * array.c: [DOC] Add more documents to shuffle! and shuffle.
- Contributed by @JuanitoFatas [ci skip][fix GH-612]
-
-Sat May 24 22:28:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/lib/minitest/.document: removed unused configuration.
-
-Sat May 24 19:08:47 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/spec.rb: Unused file removed.
-
- * test/lib/minitest/autorun.rb: Don't require minitest/spec.
-
- * test/lib/minitest/benchmark.rb: Ditto.
-
-Sat May 24 18:45:30 2014 Tanaka Akira <akr@fsij.org>
-
- * test/benchmark/test_benchmark.rb: Use test/unit.
-
-Sat May 24 16:20:59 2014 Eric Wong <e@80x24.org>
-
- * process.c (proc_getgroups, proc_setgroups): use ALLOCV_N
- [Bug #9856]
-
-Sat May 24 15:49:39 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/unit.rb (parallelize_me!): Removed.
- This fixes the line-by-line structure of the test result in verbose
- mode. [ruby-core:54905]
-
- * test/lib/minitest/parallel_each.rb: Removed.
-
- * test/minitest/test_minitest_mock.rb: Don't call parallelize_me!.
-
- * test/minitest/test_minitest_spec.rb: Ditto.
-
- * test/minitest/test_minitest_unit.rb: Ditto.
- Tests for parallel feature removed.
-
-Sat May 24 15:29:10 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest/hell.rb: Unused file removed.
-
- * test/lib/minitest/pride.rb: Ditto.
-
-Sat May 24 15:05:32 2014 yui-knk <spiketeika@gmail.com>
-
- * enumerator.c (yielder_yield_push): Insert a break after the
- method return value. [fix GH-617]
-
-Sat May 24 14:59:12 2014 Tanaka Akira <akr@fsij.org>
-
- * test/lib/minitest: Remove comments not appropriate now.
-
- * test/minitest: Ditto.
-
-Sat May 24 14:02:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * NEWS: added minitest changes.
-
-Sat May 24 13:42:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/lib/test/unit/test-unit.gemspec: removed needless gemspec file.
-
-Sat May 24 09:39:06 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * defs/default_gems: removed minitest entry.
-
-Sat May 24 06:17:33 2014 Ryan Davis <ryand-ruby@zenspider.com>
-
- * lib/minitest: minitest 4.7.5 removed. Need to support proper
- gem packaging / installation before minitest 5 can be added.
-
-Sat May 24 05:54:06 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/mkconstants.rb: More constants
-
-Sat May 24 00:25:34 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * NEWS: add information of incompatibility about Prime.prime?
- * lib/prime.rb: fix docs.
-
-Fri May 23 21:36:28 2014 Josh Goebel <dreamer3@gmail.com>
-
- * net/protocol.rb (using_each_crlf_line): fix SMTP dot-stuffing
- for messages not ending with a new-line.
- [ruby-core:61441] [Bug #9627] [fix GH-616]
-
-Fri May 23 03:48:08 2014 Eric Wong <e@80x24.org>
-
- * gc.c (rb_free_m_tbl): mark function as static
-
- * method.h (rb_free_m_tbl): remove prototype
-
-Thu May 22 22:58:27 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/mkconstants.rb: More TCP option constants.
- Describe Linux and glibc versions.
-
-Thu May 22 20:38:10 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * file.c (stat_birthtime): add birthtime support [Feature #9647]
-
- * file.c (rb_stat_birthtime): add File::Stat.birthtime
-
- * file.c (rb_file_s_birthtime): add File.birthtime
-
- * file.c (rb_file_birthtime): add File#birthtime
-
- * configure.in: check struct stat.st_birthtimespec.
-
-Thu May 22 19:38:14 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * file.c: remove IO::Statfs because of reject. [Feature #9772]
-
-Thu May 22 14:02:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/jis/props.kwd: constify character property tables of JIS
- based encodings by perfect hash.
-
- * enc/euc_jp.c, enc/shift_jis.c: use character property functions.
-
-Wed May 21 12:21:10 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c: Fix compilation error on Android.
- Bionic doesn't define TCP state constants.
-
-Wed May 21 11:42:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: workaround for Info.plist to get rid of `dsymutil`
- crash by wrong files in parent directories.
- [ruby-core:62594] [Bug #9840]
-
-Tue May 20 20:57:34 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_dir.rb (test_glob): added testcase of double
- slash path.
-
-Tue May 20 04:58:54 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/extconf.rb: Don't check fields of struct tcp_info if the
- structure is not available.
-
-Mon May 19 23:13:33 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c (inspect_tcp_info): Permit longer data. (glibc
- 2.7 adds tcpi_rcv_rtt, tcpi_rcv_space and tcpi_total_retrans to
- struct tcp_info.)
-
-Mon May 19 20:49:07 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c (inspect_tcp_info): New function to inspect
- struct tcp_info.
- (sockopt_inspect): Use inspect_tcp_info.
-
- * ext/socket/extconf.rb: Check tcp_info related things.
-
- * ext/socket/rubysocket.h: Include netinet/tcp_fsm.h if available.
-
-Mon May 19 19:36:39 2014 Tanaka Akira <akr@fsij.org>
-
- * test/dbm/test_dbm.rb: Use Etc.uname.
-
- * test/gdbm/test_gdbm.rb: Ditto.
-
-Mon May 19 16:54:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (etc_uname): add support for Windows using
- GetVersionExW(), GetSystemInfo(), and GetComputerNameExW() with
- `ComputerNameDnsHostname`. [Feature #9842]
-
-Mon May 19 16:29:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_pat_search): advance by byte offset but not by char
- offset. [ruby-core:62669] [Bug #9849]
-
-Mon May 19 14:06:18 2014 Shota Fukumori <her@sorah.jp>
-
- * bin/testrb: Removed. Forgot to remove in r45971.
- [Feature #9711] [ruby-core:62620]
-
-Sun May 18 16:42:08 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_m17n_comb.rb (test_str_crypt): Use Etc.confstr to
- detect the glibc version.
- libc.so is not an executable on Debian GNU/kFreeBSD 7.0 (wheezy).
-
-Sun May 18 12:15:54 2014 Jonathan Mukai-Heidt <johnnymukai@gmail.com>
-
- * io.c (argf_each_line, argf_inplace_mode_set): [DOC] Update ARGF
- documentation examples. `ARGF.lines` has been deprecated in
- favor of `ARGF.each_line`. [Fixes GH-615]
-
-Sun May 18 11:59:25 2014 Tanaka Akira <akr@fsij.org>
-
- * missing/nextafter.c: Include ruby/missing.h.
-
-Sun May 18 11:09:28 2014 Tanaka Akira <akr@fsij.org>
-
- * win32/Makefile.sub: Add nextafter.obj to MISSING.
-
-Sun May 18 10:46:04 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/etc/etc.c: Etc.sysconf, Etc.confstr and IO#pathconf implemented.
-
- * ext/etc/extconf.rb: Check sysconf(), confstr() and fpathconf().
-
- * ext/etc/mkconstants.rb: New file.
-
- [ruby-core:62600] [Feature #9842]
-
-Sun May 18 09:58:17 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/etc/etc.c: Etc.uname method implemented.
-
- * ext/etc/extconf.rb: Check uname() function.
-
- [ruby-core:62139] [Feature #9770]
-
-Sun May 18 09:16:33 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in: Check nextafter() availability.
-
- * include/ruby/missing.h (nextafter): New optional declaration.
-
- * missing/nextafter.c: New file.
-
- * numeric.c: Float#next_float and Float#prev_float implemented.
-
- [ruby-core:62562] [Feature #9834]
-
-Sun May 18 09:02:17 2014 Tanaka Akira <akr@fsij.org>
-
- * enum.c: Enumerable#slice_after implemented.
-
- * enumerator.c: Enumerator::Lazy#slice_after implemented.
-
- Requested by Tsuyoshi Sawada. [ruby-core:58123] [Feature #9071]
-
-Sun May 18 08:22:25 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_setstrbuf): always check if the buffer is modifiable.
- [ruby-core:62643] [Bug #9847]
-
-Sun May 18 01:21:23 2014 Tanaka Akira <akr@fsij.org>
-
- * include/ruby/ruby.h: Hide Rational internal.
- (RRational): Moved to internal.h
- (RRATIONAL): Ditto.
- (RRATIONAL_SET_NUM): Moved to rational.c.
- (RRATIONAL_SET_DEN): Ditto.
-
- * rational.c (rb_rational_num): New function.
- (rb_rational_den): Ditto.
-
- * include/ruby/intern.h (rb_rational_num): Declared.
- (rb_rational_den): Ditto.
-
- * ext/bigdecimal/bigdecimal.c: Follow the above change.
-
- * ext/date/date_core.c: Ditto.
-
- [ruby-core:60665] [Feature #9513]
-
-Sat May 17 17:04:32 2014 Shota Fukumori <her@sorah.jp>
-
- * NEWS: Add news about removal of lib/test/**/*.rb.
-
-Sat May 17 16:57:33 2014 Shota Fukumori <her@sorah.jp>
-
- * lib/test: Removed because ruby's test cases now independent to
- lib/test by r45970. [Feature #9711] [ruby-core:62620]
-
- I'm still considering about the future of lib/minitest, lib/test.
- (bundling gems?)
-
-Sat May 17 15:06:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/runner.rb: remove dependency test-unit and minitest
- from stdlib when running with test-all.
- [Feature #9711][ruby-core:61890]
- * test/testunit/*.rb: ditto.
- * test/lib: ditto.
-
-Sat May 17 11:02:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): try match PLAIN as well as ALPHA, which are
- separated by previous commits. [ruby-core:61552] [Bug #9648]
-
- * dir.c (glob_make_pattern): set PLAIN for non-magical path to
- skip parts which not need to glob.
- [ruby-core:61552] [Bug #9648]
-
- * dir.c (has_magic): return ALPHA at alphabetical name regardless
- FNM_CASEFOLD flag.
-
- * dir.c (glob_helper): fix conditions for ALPHA.
- [ruby-core:61552] [Bug #9648]
-
-Sat May 17 01:49:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): reduce matching at non-magical path on
- Windows.
-
-Sat May 17 01:49:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_pattern_type): separate names with alphabet but no
- magical from plain.
-
- * dir.c (glob_helper): match plain names as-is to treat super-root
- same as the root. [ruby-core:61552] [Bug #9648]
-
-Fri May 16 17:38:22 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_marks, gc_marks_body): increase the counter of young objects
- at the major GC because AGE2Promotion changes all old objects into
- young objects at major GC.
-
-Fri May 16 17:26:24 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_before_sweep): heap_pages_swept_slots should contains
- heap_pages_increment.
-
- For example, GC by exceeding malloc_limit can remain
- heap_pages_increment.
-
-Thu May 15 21:18:43 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * configure.in: enable SSE2 on mingw. target='i386-pc-mingw32'.
- [ruby-core:62095] [Bug #8358]
-
-Thu May 15 21:04:06 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * lib/test/unit/parallel.rb: fix test-all parallel failure if a test
- is skipped after raise.
- DL::TestFunc#test_sinf is skipped after raise on mingw ruby.
- But it causes Marshal.load failure due to undefined class/module
- DL::DLError when doing test-all parallel and test-all doesn't
- complete. We create new MiniTest::Skip object to avoid Marshal.load
- failure.
- [ruby-core:62133] [Bug #9767]
-
- * test/testunit/test_parallel.rb (TestParallel): add a test.
-
- * test/testunit/tests_for_parallel/ptest_forth.rb: ditto.
-
-Thu May 15 18:57:23 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (garbage_collect_body): move gc_heap_prepare_minimum_pages()
- from gc_sweep().
-
-Thu May 15 18:51:25 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (heap_extend_pages): calculate next growing heap size.
-
- * gc.c (heap_set_increment): accept addition pages instead of
- minimum pages.
-
- * gc.c (gc_after_sweep): use heap_etend_pages().
-
- * gc.c (gc_heap_prepare_minimum_pages): add only 1 page.
-
- * gc.c (heap_ready_to_gc): add only 1 page.
-
-Thu May 15 18:42:49 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: introduce macros to remove magic number.
-
- GC_HEAP_FREE_SLOTS_MIN_RATIO = 0.3: guarantee minimum empty slots
- ratio after sweep.
- GC_HEAP_FREE_SLOTS_MAX_RATIO = 0.8: allow to free pages 0.2 (= 1-0.8)
- of current existing slots.
-
-Thu May 15 17:32:51 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * thread_win32.c (rb_w32_stack_overflow_handler): use Structured
- Exception Handling by AddVectoredExceptionHandler() for machine
- stack overflow on mingw.
- This would be equivalent to the handling using __try and __except
- on mswin introduced by r43748.
-
-Wed May 14 19:31:03 2014 Koichi Sasada <ko1@atdot.net>
-
- * ext/openssl/depend: remove dependency from internal headers.
- [Feature #9612]
-
- * ext/openssl/ossl.c (ossl_fips_mode_set): ditto.
-
- * ext/coverage/depend: ditto.
-
- * include/ruby/thread_native.h: added.
-
- This header file only provides wrapper functions to control
- native threads. These wrapper functions are used by MRI
- implementation.
-
- * vm_core.h: use include/ruby/thread_native.h.
-
- * thread.c: ditto.
-
- * thread_pthread.h: ditto.
-
- * thread_win32.h: ditto.
-
- * thread_native.h: removed.
-
-Wed May 14 18:03:28 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: enable RGENGC_AGE2_PROMOTION.
-
-Wed May 14 18:02:30 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rgengc_rememberset_mark): promote remembered object earlier.
-
-Mon May 12 23:57:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_atan2_inf_c99): check whether runtime atan2
- handles Inf as C99. [ruby-core:62536] [Bug #9831]
-
-Mon May 12 20:33:01 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in: Invoke AC_REPLACE_FUNCS for each function.
-
-Mon May 12 19:52:11 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: count young object correctly and show it in GC.stat
- on RGENGC_AGE2_PROMOTION.
-
- * gc.c (RVALUE_PROMOTE_YOUNG): decrement young object count on
- YOUNG->OLD.
-
- * gc.c (obj_free): decrement young object count when young object
- freed.
-
- * gc.c (gc_marks): should not clear young object count.
-
- * gc.c (gc_stat_internal): GC.stat :young_object information.
-
-Mon May 12 01:30:59 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/ifaddr.c (IS_IFADDRS): Unused macro removed.
-
- * ext/strscan/strscan.c (BUFSIZE): Ditto.
-
- * ext/zlib/zlib.c (OBJ_IS_FREED): Ditto.
-
-Sun May 11 22:27:18 2014 Tanaka Akira <akr@fsij.org>
-
- * compile.c (BUFSIZE): Unused macro removed.
-
- * vm.c (BUFSIZE): Ditto.
-
- * pack.c (INT64toNUM): Ditto.
- (UINT64toNUM): Ditto.
- (BYTEWIDTH): Ditto.
-
- * time.c (lshift): Ditto.
- (UINT64toNUM): Ditto.
- (id_lshift): Unused variable removed.
-
-Sun May 11 21:23:27 2014 Tanaka Akira <akr@fsij.org>
-
- * pack.c (swaps): Unused macro removed.
- (swapi): Ditto.
- (swapl): Ditto.
- (swapll): Ditto.
-
-Sun May 11 08:02:49 2014 Eric Wong <e@80x24.org>
-
- * vm_core.h (rb_vm_t): list_head and counter for living_threads
- (rb_thread_t): vmlt_node for living_threads linkage
- (rb_vm_living_threads_init): new function wrapper
- (rb_vm_living_threads_insert): ditto
- (rb_vm_living_threads_remove): ditto
- * vm.c (rb_vm_living_threads_foreach): new function wrapper
- * thread.c (terminate_i, thread_start_func_2, thread_create_core,
- thread_fd_close_i, thread_fd_close): update to use new APIs
- * vm.c (vm_mark_each_thread_func, rb_vm_mark, ruby_vm_destruct,
- vm_memsize, vm_init2, Init_VM): ditto
- * vm_trace.c (clear_trace_func_i, rb_clear_trace_func): ditto
- * benchmark/bm_vm_thread_close.rb: added to show improvement
- * ccan/build_assert/build_assert.h: added as a dependency of list.h
- * ccan/check_type/check_type.h: ditto
- * ccan/container_of/container_of.h: ditto
- * ccan/licenses/BSD-MIT: ditto
- * ccan/licenses/CC0: ditto
- * ccan/str/str.h: ditto (stripped of unused macros)
- * ccan/list/list.h: ditto
- * common.mk: add CCAN_LIST_INCLUDES
- [ruby-core:61871][Feature #9632 (part 1)]
-
-Sun May 11 01:10:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (rb_f_kill): directly enqueue an ignored signal to self,
- except for SIGSEGV and SIGBUS. [ruby-dev:48203] [Bug #9820]
-
-Sat May 10 22:37:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (push_glob): match in UTF-8 on Mac OS X.
- [ruby-dev:48213] [Bug #9825]
-
-Sat May 10 13:32:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (thread_start_func_2): stop if forked in a sub-thread,
- the thread has become the main thread.
- [ruby-core:62070] [Bug #9751]
-
-Sat May 10 09:32:19 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * man/ruby.1: remove deadlink. [ruby-core:62145][Bug #9773]
-
-Sat May 10 08:47:36 2014 Tanaka Akira <akr@fsij.org>
-
- * signal.c (trap): Return "SYSTEM_DEFAULT" if SIG_DFL is set.
-
-Fri May 9 14:27:05 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_SETJMP_TYPE): check for setjmp type after
- CCDLFLAGS is appended to CFLAGS, since __builtin_setjmp can be
- affected. [ruby-core:62469] [Bug #9818]
-
-Fri May 9 03:59:06 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * lib/delegate.rb: Fix example of using delegator.
- patched from Andrey Koleshko. [Fixes GH-505]
-
-Fri May 9 03:42:43 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * lib/shell.rb: add documentation in lib/shell.rb
- patched from reprah. [Fixes GH-516]
-
-Fri May 9 03:28:04 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * lib/fileutils.rb: show fileutils require at top.
- patched from Richard Schneeman. [Fixes GH-604]
-
-Fri May 9 03:07:09 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * lib/prime.rb (Prime#prime?): negative numbers can't be primes
- by definition. reported by Ivan Kataitsev. [Bug #7395]
- * test/test_prime.rb: add test.
-
-Thu May 8 14:34:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_mod_init_copy): always clear instance variable,
- constant and method tables first, regardless the source tables.
- [ruby-dev:48182] [Bug #9813]
-
-Thu May 8 10:53:14 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: OpenBSD needs to include sys/param.h before include
- sys/mount.h. [ruby-dev:48167]
-
-Thu May 8 10:17:04 2014 Karsten Sperling <karsten@sperling.co.nz>
-
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): stop
- handling requests on shutdown, even if the socket is readable
- and IO.select() returns true. [Fixes GH-607]
-
- * lib/webrick/server.rb (WEBrick::GenericServer#start): IO.select()
- raises ENOTSOCK on shutdown on Windows.
-
-Wed May 7 21:45:00 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#accept):
- Consider Socket#accept as well as TCPServer#accept.
- Reported by Sam Stelfox. [ruby-core:62064] [Bug #9750]
-
-Wed May 7 17:24:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (num_step_scan_args): check keyword arguments and fail
- if they conflict with positional arguments.
- [ruby-dev:48177] [Bug #9811]
-
-Wed May 7 12:06:14 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: remove debug output and output results into
- specified file.
-
-Wed May 7 11:55:40 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: add '--rawdata-output=[FILE] option to output
- raw results into FILE.
-
-Wed May 7 11:25:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_f_local_variables): exclude variables hidden by
- shadowing. [ruby-core:60501] [Bug #9486]
-
- * vm.c (collect_local_variables_in_iseq): ditto.
-
-Tue May 6 23:29:05 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (new_bv_gen): no duplicated names, if already added in
- shadowing_lvar().
-
- * parse.y (local_tbl_gen): remove local variables duplicated with
- arguments.
- [ruby-core:60501] [Bug #9486]
-
-Tue May 6 18:48:50 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.make_time): Adjust the time zone of "now".
-
-Tue May 6 18:33:12 2014 Tadayoshi Funaba <tadf@dotrb.org>
-
- * io.c (io_{read,write}_nonblock): use rb_get_kwargs instead of
- rb_hash_aref.
-
-Tue May 6 18:03:05 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.make_time): Argument validation code moved from
- Time.parse and Time.strptime.
-
-Tue May 6 17:27:06 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.parse): [DOC] Fix an example in the documentation
- to use EST.
- Reported by Marcus Stollsteimer.
- [ruby-core:60778] [Bug #9521] and [ruby-core:61718] [Bug #9682]
-
-Tue May 6 04:31:48 2014 Tadayoshi Funaba <tadf@dotrb.org>
-
- * file.c (rb_f_test): removed meaningless "case 'a'".
-
-Tue May 6 01:28:14 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/open-uri.rb (OpenURI.open_uri): Call StringIO#close only if
- the StringIO object is not closed yet.
- Reported by Jordi Massaguer Pla. [ruby-core:42538] [Bug #6010]
-
-Tue May 6 01:08:01 2014 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: define File::NULL if not defined and /dev/null
- is available to run benchmark driver on ruby 1.9.2.
-
-Mon May 5 23:53:24 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/mkconstants.rb: Add IP_TRANSPARENT.
- IP_TRANSPARENT is provieded since glibc-2.12.
- Reported by Eliezer Croitoru. [ruby-core:50372] [Bug #7476]
-
-Mon May 5 22:29:47 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (check_exec_redirect): Open the file in write mode for
- redirect from [:out, :err].
- Proposed and implemented by Yusuke Endoh.
- [ruby-dev:41430] [Feature #3348]
-
-Mon May 5 21:52:35 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/lib/pathname.rb (cleanpath_aggressive): make all
- separators File::SEPARATOR from File::ALT_SEPARATOR.
- Reported by Daniel Rikowski.
- Fixed by Nobuyoshi Nakada. [Bug #9618]
-
- * ext/pathname/lib/pathname.rb (cleanpath_conservative): ditto.
-
-Mon May 5 21:48:04 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/pathname/lib/pathname.rb (Pathname#/): Aliased to Pathname#+.
- Suggested by Alexey Muranov. [ruby-core:61432] [Feature #9625]
-
-Mon May 5 17:26:09 2014 Tadayoshi Funaba <tadf@dotrb.org>
-
- * math.c (rb_math_sqrt): omitted exporting an unused function,
- anyway.
- * internal.h: follows the above change.
-
-Mon May 5 11:44:03 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.strptime): Raise ArgumentError if Date._strptime
- doesn't extract date information.
- Reported by tadayoshi funaba. [ruby-core:62349]
-
-Mon May 5 01:12:27 2014 Tadayoshi Funaba <tadf@dotrb.org>
-
- * ext/date/date_core.c (rt_rewrite_frags): a new feature (not a
- bug fix) of strptime. applies offset even if the given date is
- not local time (%s and %Q). This is an exceptional feature and
- I do NOT recommend to use this at all. Thank you git community.
-
-Sun May 4 20:51:32 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.force_zone!): Use usual local time if it has
- expected offset from UTC.
-
-Sun May 4 17:58:12 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.force_zone!): New private method.
- (Time.make_time): Use Time.force_zone!.
- (Time.strptime): Ditto.
- (Time.rfc2822): Ditto.
- (Time.xmlschema): Ditto.
-
- * lib/rss/rss.rb (Time.w3cdtf): Use Time.force_zone!.
-
-Sun May 4 10:22:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * math.c (math_atan2): return values like as expected by C99 if
- both two arguments are infinity. based on the patch by cremno
- phobia <cremno AT mail.ru> in [ruby-core:62310]. [Feature #9799]
-
-Sun May 4 03:46:42 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.httpdate): Always return a UTC Time object.
-
-Sun May 4 03:26:39 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.make_time): Refactored.
-
-Sun May 4 02:53:17 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.rfc2822): Fix year completion.
- Produce fixed-offset time object if appropriate.
- (Time.xmlschema): Produce fixed-offset time object if appropriate.
-
-Sat May 3 23:52:20 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (make_time): Produce fixed-offset time object if
- appropriate.
- (Time.strptime): Use d[:zone] instead of d[:offset].
-
- * lib/rss/rss.rb (Time.w3cdtf): Produce fixed-offset time object if
- appropriate.
-
-Sat May 3 20:21:38 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/time.rb (Time.strptime): Use d[:offset] if d[:seconds] is not
- given.
- Reported by tadayoshi funaba. [ruby-core:62322]
-
-Sat May 3 04:04:16 2014 Eric Wong <e@80x24.org>
-
- * complex.c (parse_comp): replace ALLOCA_N with ALLOCV_N/ALLOCV_END
- [Bug #9608]
- * rational.c (read_digits): ditto
-
-Sat May 3 00:06:30 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * file.c (HAVE_STRUCT_STATVFS_F_BASETYPE): File::Statfs#fstypename
- is supported on AIX, HP-UX, and Solaris, by using the value of
- struct statvfs.f_basetype.
-
- * configure.in (HAVE_STRUCT_STATVFS_F_BASETYPE): check struct
- statvfs.f_basetype which is available on AIX, HP-UX, and Solaris.
-
-Fri May 2 21:04:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (next_id): no reason to set ID_STATIC_SYM here, as ID
- returned by rb_intern3 can be a dynamic symbol and the static
- symbol flag is set otherwise. [Bug #9787]
-
-Fri May 2 11:32:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_io.rb (test_seek, test_seek_symwhence): defer
- File::Statfs#type call which may not be implemented, to mitigate
- errors on platforms where SEEK_DATA is available but f_type in
- struct statfs is not. [ruby-dev:48154] [Bug #9789]
-
-Fri May 2 10:37:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (rb_id_attrset): turn dynamically interned Symbol into
- an ID, since rb_str_dynamic_intern returns a Symbol but not an
- ID. [ruby-core:62226] [Bug #9787]
-
-Thu May 1 22:19:34 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * file.c: Change AND condition to nested condition.
-
-Thu May 1 00:36:26 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * file.c (FSTATFS): check availability of struct statfs and
- struct statvfs in addition to fstatfs(2) and fstatvfs(2).
- This fixes error in Solaris. [Bug #9788] [ruby-dev:48145]
-
-Wed Apr 30 19:46:23 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * gc.c (gc_after_sweep): suppress unnecessary expanding heap.
- Tomb heap pages are freed pages here, so expanding heap is
- not required.
-
-Wed Apr 30 17:58:40 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (invoke_block_from_c): add VM_FRAME_FLAG_BMETHOD to record
- it is bmethod frame.
-
- * vm.c (vm_exec): invoke RUBY_EVENT_RETURN event if rollbacked frame
- is VM_FRAME_FLAG_BMETHOD.
- [Bug #9759]
-
- * test/ruby/test_settracefunc.rb: add a test for TracePoint/set_trace_func.
-
- * vm_core.h: rename rb_thread_t::passed_me to
- rb_thread_t::passed_bmethod_me to clarify the usage.
-
- * vm_insnhelper.c (vm_call_bmethod_body): use renamed member.
-
-Wed Apr 30 17:06:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (rb_id_attrset): pin down dynamic symbol only. it is
- possible that attrset ID can be registered as a static symbol
- after the corresponding attrget ID has been registered as a
- dynamic, and then the latter may be collected.
- [ruby-core:62226] [Bug #9787]
-
-Tue Apr 29 14:17:57 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/tmpdir.rb: Rescue LoadError on etc.so for miniruby.
- Revert r45707, r45711, r45717.
-
-Tue Apr 29 12:50:02 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/fileutils.rb: Don't need to define fu_get_gid and fu_get_gid in
- rescue LoadError on 'etc'.
-
-Tue Apr 29 10:21:38 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * parse.y (symbols_i): like r45492, call rb_gc_resurrect().
-
-Tue Apr 29 04:29:05 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * file.c (HAVE_STRUCT_STATFS_T_F_FSTYPENAME): Add new macro for
- statfs_t.
- * file.c (HAVE_STRUCT_STATFS_T_F_TYPE): ditto.
-
- * file.c (rb_io_statfs): check FSTATFS macro only instead of
- HAVE_FSTATFS and HAVE_FSTATVFS.
-
- * file.c (statfs_type): use new macro.
- * file.c (statfs_fstypename): ditto.
- * file.c (statfs_inspect): ditto.
-
-Tue Apr 29 00:20:26 2014 Rajarshi Das <rajarshid@cybage.com>
-
- * bootstraptest/test_literal.rb: fix typo of "dynamic". [ci skip]
-
- * regexp.rdoc: fix typo of "organized". [ci skip]
-
- * lib/session.rb: fix typo of "recognized". [ci skip]
-
-Mon Apr 28 21:40:27 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (HAVE_STRUCT_STATFS_F_TYPE): check struct statfs.f_type
- to support OpenBSD.
-
- * file.c (statfs_type): use above macro to switch.
-
- * file.c (statfs_inspect): ditto.
-
-Mon Apr 28 18:06:08 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: check struct statvfs and struct statvfs.f_fstypename.
-
- * configure.in: on NetBSD fstatfs is obsoleted.
-
- * file.c: support NetBSD for File::Statfs.
-
-Mon Apr 28 17:42:42 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * gc.c: This argument must be a pointer.
-
-Mon Apr 28 17:40:15 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * gc.c: Fix typos. These are undefined variables.
-
-Sun Apr 27 19:39:42 2014 Tadayoshi Funaba <tadf@dotrb.org>
-
- * ext/date/date_strptime.c (date__strptime_internal): do not
- overwrite century.
-
-Sat Apr 26 11:50:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/ruby/test_enum.rb (test_flat_map): Added test for flat_map.
- Contribute from @igaiga. [fix GH-598]
-
-Sat Apr 26 10:55:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (compile_array_): make copy a first hash not to modify
- the argument itself. keyword splat should be non-destructive.
- [ruby-core:62161] [Bug #9776]
-
-Sat Apr 26 08:05:36 2014 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_process.rb (test_rlimit_nofile): Don't limit
- RLIMIT_NOFILE too small.
- This fix sporadic "[ASYNC BUG] thread_timer: select" on GNU/Linux.
-
-Fri Apr 25 22:54:34 2014 Naohisa Goto <ngotogenome@gmail.com>
-
- * lib/fileutils.rb (rmdir): rescue Errno::EEXIST in addition to
- ENOTEMPTY (and ENOENT), because SUSv3 describes that "If the
- directory is not an empty directory, rmdir() shall fail and set
- errno to [EEXIST] or [ENOTEMPTY]" and Solaris uses EEXIST.
- [Bug #9571] [ruby-dev:48017]
-
-Fri Apr 25 19:16:30 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/webrick/utils.rb: Don't rescue LoadError for 'etc' extension.
-
-Fri Apr 25 14:55:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_func___builtin_unreachable): try with an
- external variable not only by a warning, which might not be
- shown due to the optimization. [ruby-core:61647] [Bug #9665]
-
-Fri Apr 25 13:11:49 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: NetBSD's ksh, used by configure, needs escapes.
-
-Fri Apr 25 12:51:08 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: correct pthread_setname_np's prototype on NetBSD.
- [Bug #9586]
-
-Thu Apr 24 23:17:25 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/fileutils.rb (fu_get_uid, fu_get_gid): Etc.getpwnam/getgrnam may
- returns nil.
-
- * lib/webrick/utils.rb (su): ditto.
-
-Thu Apr 24 22:55:22 2014 Tanaka Akira <akr@fsij.org>
-
- * bootstraptest/test_io.rb: Add etc.so to $" before require 'tmpdir'.
-
-Thu Apr 24 21:09:55 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * man/ruby.1: fix broken link.
-
-Thu Apr 24 20:53:02 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/tmpdir.rb: Don't need to rescue LoadError for etc.so.
-
-Thu Apr 24 17:39:53 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * file.c (statfs_inspect): suppress warnings.
- assume those values won't be larger than LONG_LONG_MAX.
-
-Thu Apr 24 11:53:28 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_initialize): SYMID on a value
- other than Symbol is an undefined behavior. fix up r31699.
- [ruby-core:62142] [Bug #9771]
-
-Thu Apr 24 11:21:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (rb_sym2id, rb_sym2id_without_pindown): return 0 for
- non-symbol values, for the time being.
-
-Thu Apr 24 05:50:13 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * parse.y (dsym_node_gen): like r45492, call rb_gc_resurrect().
-
-Wed Apr 23 20:36:22 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/etc/extconf.rb: Build ext/etc unconditionally.
-
-Wed Apr 23 14:10:50 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * file.c (statfs_fsid): remove statfs.f_fsid because it doesn't return
- meaningful value portably. http://togetter.com/li/658517
-
-Wed Apr 23 11:03:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_write): use rb_str_append to
- reuse coderange bits other than ASCII-8BIT, and keep
- taintedness. [ruby-dev:48118] [Bug #9769]
-
-Wed Apr 23 00:43:00 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c, include/ruby/win32.h (ustatfs): implementation of
- statfs(2) clone. [EXPERIMENTAL]
-
- * file.c (rb_io_statfs): use above function.
-
- * configure.in, win32/Makefile.sub (struct statfs): available.
-
-Tue Apr 22 23:56:24 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (rb_io_stafs): use statfs(2) if fstatfs(2) is unavailable.
-
- * configure.in (fstatfs): check it.
-
-Tue Apr 22 22:15:51 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (rb_io_statfs): need to define even if the system doesn't have
- fstatfs(2).
-
- * test/ruby/test_file.rb (TestFile#test_statfs): skip if IO#stafs is not
- implemented.
-
-Tue Apr 22 19:32:48 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * file.c: newly added a class File::Statfs. (experimental)
-
-Tue Apr 22 08:22:33 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (objspace_malloc_increase): don't cause GC by malloc_increase
- when memop type is MEMOP_TYPE_REALLOC.
-
- GC at realloc is not well maintained.
- We need a time to make it safe.
- [ruby-dev:48117]
-
-Tue Apr 22 06:54:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (objspace_malloc_increase): run full mark if 0x04 bit is
- set in ruby_gc_stress. [ruby-core:62103] [Feature #9761]
-
- * gc.c (objspace_malloc_increase): run GC after realloc not only
- malloc and calloc by GC.stress. [ruby-core:62103] [Feature #9761]
-
-Mon Apr 21 19:12:20 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_coderange_scan_restartable): coderange is always
- ENC_CODERANGE_VALID if the string is ASCII-8BIT and already has a non
- ASCII character.
-
-Mon Apr 21 19:02:44 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (coderange_scan): remove useless condition `p < e` after
- search_nonascii.
-
- * string.c (rb_str_coderange_scan_restartable): ditto.
-
-Mon Apr 21 18:55:21 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/-test-/string/coderange.c: add Bug::String.new#coderange_scan
- to explicitly scan coderange.
-
-Mon Apr 21 18:19:35 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (coderange_scan): remove unused logic.
-
- * string.c (rb_str_coderange_scan_restartable): ditto.
-
-Mon Apr 21 14:11:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_putc): fix for non-ascii
- encoding, like as IO#putc. [ruby-dev:48114] [Bug #9765]
-
-Sun Apr 20 12:57:15 2014 Masaya Tarui <tarui@ruby-lang.org>
-
- * st.c (st_foreach_check): change start point of search at check
- from top to current. [ruby-dev:48047] [Bug #9646]
-
-Sun Apr 20 08:41:33 2014 Andrew DeMaria <ademariad@gmail.com>
-
- * lib/mkmf.rb (link_command, libpathflag, create_makefile): prefer
- user specified `$LIBPATH` than `$DEFLIBPATH`. [ruby-core:62100]
- [ruby-trunk - Bug #9760]
-
-Sun Apr 20 06:01:18 2014 Eric Wong <e@80x24.org>
-
- * gc.c (rb_gc_writebarrier): drop special case for big hash/array
- [Bug #9518]
-
-Sat Apr 19 15:38:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): flush cmdarg flags inside left-paren in a
- command argument, to allow parenthesed do-block as an argument
- without arguments parentheses. [ruby-core:61950] [Bug #9726]
-
-Sat Apr 19 10:07:24 2014 Tanaka Akira <akr@fsij.org>
-
- * internal.h (struct RBignum): Use size_t for len.
-
- * include/ruby/intern.h (rb_big_new): Use size_t instead of long to
- specify the size of bignum.
- (rb_big_resize): Ditto.
-
- * bignum.c: Follow above changes.
-
- * rational.c: Follow above changes.
-
- * marshal.c: Follow above changes.
-
-Sat Apr 19 00:32:07 2014 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_num2long): Returns a long.
- (rb_num2ulong): Returns a unsigned long.
-
- * bignum.c (rb_big2long): Returns a long.
- (rb_big2ulong): Returns a unsigned long.
-
- * include/ruby/intern.h: Follow above changes.
-
- * include/ruby/ruby.h: Follow above changes.
- (rb_num2long_inline): No need to cast.
- (rb_num2ulong_inline): Ditto.
-
-Sat Apr 19 00:17:20 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (SHARABLE_SUBSTRING_P): predicate if substring can be
- shared with the original string. true if just at the end of the
- original string, for the time being. all substring will be able to
- be shared in the future.
-
-Fri Apr 18 21:48:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_new_frozen): consider the shared string at
- middle.
-
- * string.c (rb_str_subseq, rb_str_substr, str_byte_substr): share
- middle of a string.
-
-Fri Apr 18 15:40:05 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c: use uintptr_t instead of VALUE because they are not ruby
- object.
-
-Fri Apr 18 14:51:42 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c: check str_strlen's argument, and add comment or
- use NULL if simply it uses str's enc.
-
-Fri Apr 18 14:32:40 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (str_strlen): use enc_strlen if the coderange is known.
-
-Fri Apr 18 14:21:21 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (enc_strlen): move UTF-8 optimization from str_strlen to
- enc_strlen.
-
-Fri Apr 18 08:50:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_getcwd_malloc): check if getcwd allocates
- buffer if NULL is given [ruby-core:62072] [Bug #9752]
-
-Thu Apr 17 16:28:10 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * prelude.rb: [DOC] Update Thread::exclusive docs by @stevenharman.
-
-Thu Apr 17 10:03:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/fileutils.rb (FileUtils#copy_entry): update rdoc about
- preserve option and permissions, following r31123.
- [ruby-core:62065] [Bug #9748]
-
-Wed Apr 16 23:47:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c (dont_recycle_block_arg): fix condition to recycle block
- argument. lambda with rest can get internal array directly.
- [ruby-core:62060] [Bug #9749]
-
-Wed Apr 16 09:51:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/openssl/ossl_pkey.c (ossl_pkey_verify): as EVP_VerifyFinal()
- finalizes only a copy of the digest context, the context must be
- cleaned up after initialization by EVP_MD_CTX_cleanup() or a
- memory leak will occur. [ruby-core:62038] [Bug #9743]
-
-Tue Apr 15 19:36:42 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * include/ruby/win32.h (rb_w32_cmdvector): removed.
-
- * win32/win32.c (rb_w32_sysinit): use WCHAR version of GetCommandLine()
- internally.
-
- * win32/win32.c (w32_cmdvector): renamed from rb_w32_cmdvector. use
- WCHAR* instead of char* internally.
-
- these changes are expected to not changing the behavior yet.
-
-Tue Apr 15 19:26:05 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/extmk.rb: Re-generate extmk.mk and dummy makefiles only if
- really required.
- This fixes a problem to run multiple test-all concurrently as:
- make test-all & make test-all & make test-all & ...
-
-Tue Apr 15 12:49:53 2014 Sam Rawlins <sam.rawlins@gmail.com>
-
- * enum.c (enum_each_slice, enum_each_cons): make more efficient by
- allocating less and recycling block argument arrays if possible.
- [Fixes GH-596]
-
-Mon Apr 14 18:44:45 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): get base addrs in fill_lines to use it
- with dladdr_fbases introduced at r45563.
- it didn't get before if the executable is not pie.
-
-Mon Apr 14 18:05:48 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (main_exe_path): support FreeBSD.
- At least sh, csh, tcsh, bash, and zsh sets realpath of the main
- executable for dladdr, but gdb doesn't.
-
-Mon Apr 14 17:20:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (umethod_bind): use the ancestor iclass instead of new
- iclass to get rid of infinite recursion, if the defined module
- is already included. [ruby-core:62014] [Bug #9721]
-
-Sun Apr 13 12:46:58 2014 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (SIZEOF_BDIGIT): Renamed from SIZEOF_BDIGITS.
-
- * internal.h: Ditto.
-
- * marshal.c: Ditto.
-
- * rational.c: Ditto.
-
-Sun Apr 13 10:18:09 2014 Tanaka Akira <akr@fsij.org>
-
- * common.mk: Unused target, $(MKMAIN_CMD), removed.
-
- * Makefile.in (MKMAIN_CMD): Unused macro removed.
-
- * win32/Makefile.sub (MKMAIN_CMD): Ditto.
-
-Sat Apr 12 22:11:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (sym_to_proc), proc.c (rb_block_clear_env_self): clear
- caller's self which is useless, so that it can get collected.
- [Fixes GH-592]
-
-Sat Apr 12 09:26:48 2014 Eric Hodel <drbrain@segment7.net>
-
- * ext/openssl/ossl_ocsp.c: [DOC] Document OpenSSL::OCSP.
-
-Fri Apr 11 18:52:38 2014 Koichi Sasada <ko1@atdot.net>
-
- * array.c (ARY_SET): added.
-
- ARY_SET() is same functionality of RARRAY_ASET(), but
- it has an assertion (`ary' doesn't have shared array).
-
-Fri Apr 11 16:54:26 2014 Koichi Sasada <ko1@atdot.net>
-
- * array.c: make shared arrays WB-protected objects.
-
- Shared arrays were WB-unprotected object because
- sharing array can modify shared array's buffer
- if it occupied shared array.
-
- [sharing array (ary)] -> [shared array (shared)] -> <buff>
- | A
- +---------------------------------------+
- write `buff' with WB(ary, &buff[i], obj)
- -> if `ary' and `shared' are old, then only `ary'
- will be remembered.
- -> traverse from `ary'. But `shared' is old, so
- that written `obj' is not marked.
-
- It cause WB miss so that shared arrays were WB-unprotected.
- (WB-unprotected objects are marked everytime if it is living)
-
- This patch insert WB() for `shared' if it is needed.
-
-Fri Apr 11 15:05:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (rb_method_call_with_block, umethod_bind): call with
- IClass including the module for a module instance method.
- [ruby-core:61936] [Bug #9721]
-
- * vm_insnhelper.c (vm_search_super_method): allow bound
- UnboundMethod case.
-
-Fri Apr 11 12:02:30 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (rb_dump_backtrace_with_lines): set base address
- which is retrieved from dladdr to dladdr_fbases, to skip already
- parsed objects.
-
-Fri Apr 11 12:44:50 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (ary_reject): may be turned into a shared array during
- the given block. [ruby-dev:48101] [Bug #9727]
-
-Thu Apr 10 23:41:21 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/net/ftp.rb (Net::FTP#login): [DOC] The default password for
- anonymous login was changed to "anonymous@" in r25313.
-
-Thu Apr 10 19:22:58 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_array.rb: remove useless `assert'.
-
-Thu Apr 10 19:11:11 2014 Koichi Sasada <ko1@atdot.net>
-
- * array.c (rb_ary_modify): remember shared array owner if a shared
- array owner is promoted and a shared array is not promoted.
-
- Now, shared array is WB-unprotected so that shared arrays are not
- promoted. All objects referred from shared array should be marked
- correctly.
-
- [ruby-core:61919] [ruby-trunk - Bug #9718]
-
- * test/ruby/test_array.rb: add a test for above.
-
-Thu Apr 10 18:57:12 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_verify_internal_consistency): move lines and enable
- allrefs_dump() on RGENGC_CHECK_MODE >= 4.
-
-Thu Apr 10 15:01:06 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (append_obj): clear allocated memory.
-
- * addr2line.c (rb_dump_backtrace_with_lines): free `base_addrs'.
-
-Thu Apr 10 14:40:18 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_gc_writebarrier_unprotect_promoted): disable to dump debug
- message when RGENGC_CHECK_MODE == 0.
-
-Thu Apr 10 08:13:47 2014 Tanaka Akira <akr@fsij.org>
-
- * signal.c (check_stack_overflow): Don't use ucontext_t if ucontext.h
- is not available.
- Fixes build on Android (x86).
-
-Wed Apr 9 23:22:44 2014 Tanaka Akira <akr@fsij.org>
-
- * gc.c (mark_current_machine_context): Call SET_STACK_END.
- This reverts a hunk of r40703 by ko1.
- This fixes [ruby-dev:48098] [Bug #9717].
-
-Wed Apr 9 21:02:04 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (OBJ2UID1): Defined even if getpwnam_r is not usable.
- (OBJ2GID1): Defined even if getgrnam_r is not usable.
- This fixes compilation error on Android.
-
-Wed Apr 9 15:16:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * encoding.c (rb_enc_default_internal): fix rdoc. `__FILE__` is
- in filesystem encoding but not `default_internal`.
- [ruby-core:61894] [Bug #9713]
-
-Wed Apr 9 14:43:00 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_gc.rb: more long timeout.
- This test failed under RGENGC_CHECK_MODE >= 2.
-
-Wed Apr 9 13:07:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: get rid of __builtin_setjmp/__builtin_longjmp on
- x64-mingw, which causes SEGV with callcc.
- [ruby-core:61887] [Bug #9710]
-
-Wed Apr 9 12:44:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (str_buf_cat): should round up the capacity by 4KiB,
- but not number of rooms. [ruby-core:61886] [Bug #9709]
-
-Tue Apr 8 22:55:32 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/mkmf.rb (MakeMakefile#dir_config): [DOC] Improve
- documentation.
-
-Tue Apr 8 22:31:44 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename `RGENGC_THREEGEN' to `RGENGC_AGE2_PROMOTION'.
-
- * gc.c (rgengc_rememberset_mark): don't promote, but remain in
- remember set for infant objects.
-
- * gc.c (RVALUE_PROMOTE_INFANT, RVALUE_PROMOTE_YOUNG): count numbers
- in these functions.
-
-Mon Apr 7 21:11:49 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/socket.c (sock_s_getnameinfo): Save errno for EAI_SYSTEM.
- Reported by Saravana kumar. [ruby-core:61820] [Bug #9697]
- Fixed by Heesob Park. [ruby-core:61868]
-
-Mon Apr 7 07:20:23 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/xmlrpc/client.rb (do_rpc): don't check body length.
- If HTTP content-encoding is used, the length may be different.
- [Bug #8182] [ruby-core:53811]
-
-Mon Apr 7 02:39:48 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/matrix.rb: Add Matrix#cofactor [fix GH-568]
- Add first_minor [fix GH-568]
- Handle empty diagonal matrix case [fix GH-576]
- Patches by gogotanaka
-
-Sun Apr 6 08:52:50 2014 Bugra Barin <bugrabarin@hotmail.com>
-
- * dln.c (dln_load): use wchar version to load a library in
- non-ascii path on Windows. based on the patch by Bugra Barin
- <bugrabarin AT hotmail.com> in [ruby-core:61845]. [Bug #9699]
-
-Sat Apr 5 19:36:33 2014 Tadayoshi Funaba <tadf@dotrb.org>
-
- * ext/date/date_core.c (d_lite_cmp): should compare with #<.
-
-Sat Apr 5 00:31:21 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/readline/extconf.rb (rl_hook_func_t): check pointer type.
- [ruby-dev:48089] [Bug #9702]
-
-Fri Apr 4 07:13:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_cv_func___builtin_setjmp): should not skip
- flags restoration in RUBY_WERROR_FLAG by `break`.
- [ruby-dev:48086] [Bug #9698]
-
-Wed Apr 2 21:50:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_cv_func___builtin_setjmp): __builtin_longjmp()
- in Apple LLVM 5.1 (LLVM 3.4svn) uses `void**`, not `jmp_buf`.
- [Bug #9692]
-
-Wed Apr 2 20:57:15 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c, gc.h (rb_objspace_each_objects_without_setup):
- Add a new (hidden) C-API to iterate objspace snapshot.
-
- This API is not safe to call any C-APIs in a given callback
- function. Be careful to use this C-API.
-
-Wed Apr 2 17:43:17 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_cv_func___builtin_setjmp): gcc 4.9 disallows a
- variable as the second argument of __builtin_longjmp().
- [ruby-core:61800] [Bug #9692]
-
-Wed Apr 2 15:12:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * common.mk: Use redmine-2.x url for DeveloperHowto wiki.
- [ruby-core:60657] [Bug #9511]
-
-Wed Apr 2 11:46:29 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/pathname/lib/pathname.rb (Pathname#join): Fix error with
- empty args. Reported by ko1 via IRC.
-
- * test/pathname/test_pathname.rb (TestPathname#test_join): Add the
- test for above case.
-
-Tue Apr 1 11:39:57 2014 James Edward Gray II <james@graysoftinc.com>
-
- * lib/csv.rb: Symbol HeaderConverter: strip leading/trailing space.
- Reported by Skye Shaw
- [Fixes GH-575]
-
-Tue Apr 1 11:34:04 2014 James Edward Gray II <james@graysoftinc.com>
-
- * lib/csv.rb: Don't attempt to convert nil headers.
- Reported by Skye Shaw
-
-Tue Apr 1 17:29:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/config_files.rb (ConfigFiles.download): show failed URI.
- [ruby-core:61792] [Bug #9690]
-
-Tue Apr 1 12:06:49 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (rb_dump_backtrace_with_lines): don't depend hard coded
- symbol '_start'.
-
- * addr2line.c (fill_lines): instead of above, get a dynamic symbol
- in the main executable and use it to know the base address.
-
- * addr2line.c (follow_debuglink0): use obj_info_t instead of
- line_info_t to handle object related data.
-
- * addr2line.c (main_exe_path): defined for Linux.
-
-Tue Apr 1 08:58:39 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * parse.y (rb_str_dynamic_intern): set mark bit if dynamic symbol
- is before sweeping.
-
-Tue Apr 1 07:37:00 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): use dynsym, which is used for dynamic
- linking and always exists, if there's no symtab.
-
-Tue Apr 1 07:27:15 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_dump.c (rb_print_backtrace): current implementation
- uses dladdr to get the path of objects.
-
-Mon Mar 31 23:57:45 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/readline/extconf.rb: fix typo, `$defs` not `$DEFS`.
- [ruby-core:61756] [Bug #9578]
-
-Mon Mar 31 17:23:50 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/memory_status.rb: require envutil before accessing EnvUtil
- module. reported by ko1 via twitter.
-
-Mon Mar 31 10:28:01 2014 Eric Wong <e@80x24.org>
-
- * st.c (st_init_table_with_size): update comment
- [Feature #9425]
-
-Sun Mar 30 23:39:26 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_accept, open_ifs_socket, socketpair_internal):
- reset inherit flag of socket to avoid unintentional inheritance of
- socket. note that the return value of SetHandleInformation() is not
- verified intentionally because old Windows may return an error.
- [Bug #9688] [ruby-core:61754]
-
-Sat Mar 29 13:04:22 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_before_sweep): cap `malloc_limit' to
- gc_params.malloc_limit_max. It can grow and grow with such case:
- `loop{"a" * (1024 ** 2)}'
- [Bug #9687]
-
- This issue is pointed by Tim Robertson.
- http://www.omniref.com/blog/blog/2014/03/27/ruby-garbage-collection-still-not-ready-for-production/
-
-Fri Mar 28 19:32:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * struct.c (not_a_member): extract name error and use same error
- messages. based on the patch by Marcus Stollsteimer <sto.mar AT
- web.de> at [ruby-core:61721]. [Bug #9684]
-
-Fri Mar 28 09:21:54 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/psych/psych.gemspec: update gemspec for psych-2.0.5
-
-Fri Mar 28 09:11:06 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * ext/psych/lib/psych.rb: Merge psych-2.0.5. bump version to
- libyaml-0.1.6 for CVE-2014-2525.
- * ext/psych/yaml/config.h: ditto.
- * ext/psych/yaml/scanner.c: ditto.
- * ext/psych/yaml/yaml_private.h: ditto.
-
-Thu Mar 27 18:58:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (match_regexp): set regexp for MatchData from string.
-
- * re.c (rb_backref_set_string): create MatchData from string and
- set backref.
-
- * string.c (rb_pat_search, rb_str_sub, rb_str_sub_bang, str_gsub),
- (scan_once, rb_str_scan, rb_str_partition): use rb_str_index
- instead of rb_reg_search() when pattern is a String. based on
- the patch by Sam Rawlins <sam.rawlins@gmail.com> [Fixes GH-579]
-
-Thu Mar 27 11:58:55 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): check shdr[i].sh_type because even if
- .symtab section exists, the section's type can be SHT_NOBITS and
- actual data doesn't exist in the file.
- revert r45441.
-
-Wed Mar 26 14:57:35 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * parse.y: inline must be static (for mswin).
- fixed build error introduced at r45426.
-
-Wed Mar 26 14:33:00 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * internal.h (USE_SYMBOL_GC): enable Symbol GC by default (USE_SYMBOL_GC == 1).
-
-Tue Mar 25 22:57:11 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * parse.y: support Symbol GC. [ruby-trunk Feature #9634]
- See this ticket about Symbol GC.
-
- * include/ruby/ruby.h:
- Declare few functions.
- * rb_sym2id: almost same as old SYM2ID but support dynamic symbols.
- * rb_id2sym: almost same as old ID2SYM but support dynamic symbols.
- * rb_sym2str: almost same as `rb_id2str(SYM2ID(sym))` but not
- pin down a dynamic symbol.
- Declare a new struct.
- * struct RSymbol: represents a dynamic symbol as object in
- Ruby's heaps.
- Add few macros.
- * STATIC_SYM_P: check a static symbol.
- * DYNAMIC_SYM_P: check a dynamic symbol.
- * RSYMBOL: cast to RSymbol
-
- * gc.c: declare RSymbol. support T_SYMBOL.
-
- * internal.h: Declare few functions.
- * rb_gc_free_dsymbol: free up a dynamic symbol. GC call this
- function at a sweep phase.
- * rb_str_dynamic_intern: convert a string to a dynamic symbol.
- * rb_check_id_without_pindown: not pinning function.
- * rb_sym2id_without_pindown: ditto.
- * rb_check_id_cstr_without_pindown: ditto.
-
- * string.c (Init_String): String#intern and String#to_sym use
- rb_str_dynamic_intern.
-
- * template/id.h.tmpl: use LSB of ID as a flag for determining a
- static symbol, so we shift left other ruby_id_types.
-
- * string.c: use rb_sym2str instead `rb_id2str(SYM2ID(sym))` to
- avoid pinning.
-
- * load.c: use xx_without_pindown function at creating temporary ID
- to avoid pinning.
-
- * object.c: ditto.
-
- * sprintf.c: ditto.
-
- * struct.c: ditto.
-
- * thread.c: ditto.
-
- * variable.c: ditto.
-
- * vm_method.c: ditto.
-
-Wed Mar 26 13:25:54 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): loop reverse order not to overwrite
- the basis of base addresses comparison.
-
- * addr2line.c: use uintptr_t instead of intptr_t for pointers.
-
- * addr2line.c (rb_dump_backtrace_with_lines): don't use syms.
-
- * vm_dump.c (rb_print_backtrace): ditto.
-
- * addr2line.h: ditto.
-
-Wed Mar 26 11:20:50 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (w_object): internal objects are not dumpable.
- [ruby-core:61677] [Bug #9674]
-
- * ext/thread/thread.c (undumpable): ConditionVariable and Queue
- are not dumpable. [ruby-core:61677] [Bug #9674]
-
-Wed Mar 26 10:36:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (follow_debuglink): show message if it closes opened
- (and maybe used) elf binary.
-
-Wed Mar 26 10:34:25 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_line): pass and use offset instead of
- curobj_baseaddr.
-
-Wed Mar 26 09:07:48 2014 Yutaka Kanemoto <kanemoto@ruby-lang.org>
-
- * configure.in: add --disable-pie. [Feature #9673]
-
-Wed Mar 26 08:47:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): don't run fill_lines multiple times.
-
-Wed Mar 26 08:45:00 2014 Sam Rawlins <sam.rawlins@gmail.com>
-
- * internal.h: add prototype for rb_reg_search0
-
- * re.c: rename rb_reg_search to rb_reg_search0, add set_backref_str
- argument to allow callers to indicate that they don't require the
- backref string to be allocated.
-
- * string.c: don't allocate backref str if replacement string is provided
-
- [GH-578] [Bug #9676] [ruby-core:61682]
-
-Wed Mar 26 08:29:43 2014 mo khan <mo@mokhan.ca>
-
- * lib/rubygems.rb: fix spelling of Jim Weirich. [Fixes GH-577]
-
-Wed Mar 26 01:55:45 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (rb_dump_backtrace_with_lines): a function to get must
- be a function in the main executable, whose absolute path is not
- available by dladdr, and ruby get it by /proc/self/exe on Linux.
-
-Wed Mar 26 01:34:50 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): skip if path is NULL.
-
-Tue Mar 25 23:57:17 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yylex): only a newline after label should be
- significant. [ruby-core:61658] [Bug #9669]
-
-Tue Mar 25 23:32:25 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/pathname/lib/pathname.rb (Pathname#join): remove unnecessary
- unshift.
-
- * test/pathname/test_pathname.rb (TestPathname#test_join): add tests.
-
-Tue Mar 25 16:47:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (lex_state_e, parser_params, f_arglist, parser_yylex):
- separate EXPR_LABELARG from EXPR_BEG and let newline significant,
- so that required keyword argument can place at the end of
- argument list without parentheses. [ruby-core:61658] [Bug #9669]
-
-Mon Mar 24 22:19:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (ripper_initialize): filename can not be modified.
-
-Mon Mar 24 15:19:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (rb_dump_backtrace_with_lines): fetch path of the
- executable from /proc/self/exe on Linux.
-
-Mon Mar 24 14:14:37 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * gc.c: Fix up default GC params by @csfrancis [fix GH-556]
-
-Mon Mar 24 13:13:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (parse_debug_line_cu): explicitly specify signed char
- because DWARF's line_Base is signed char and char maybe unsigned.
- patched by Rei Odaira. [ruby-dev:48068] [Bug #9654]
-
-Sun Mar 23 11:03:50 2014 Kohei Suzuki <eagletmt@gmail.com>
-
- * vm_method.c (rb_method_entry_get_without_cache): me->klass is 0
- for a method aliased in a module. [ruby-core:61636] [Bug #9663]
-
-Sun Mar 23 08:12:27 2014 Eric Wong <e@80x24.org>
-
- * st.c (hash_pos): use bitwise AND to avoid slow modulo op
- (new_size): power-of-two sizes for hash_pos change
- (st_numhash): adjust for common keys due to lack of prime modulo
- [Feature #9425]
- * hash.c (rb_any_hash): right shift for symbols
- * benchmark/bm_hash_aref_miss.rb: added to show improvement
- * benchmark/bm_hash_aref_sym_long.rb: ditto
- * benchmark/bm_hash_aref_str.rb: ditto
- * benchmark/bm_hash_aref_sym.rb: ditto
- * benchmark/bm_hash_ident_num.rb: added to prevent regression
- * benchmark/bm_hash_ident_obj.rb: ditto
- * benchmark/bm_hash_ident_str.rb: ditto
- * benchmark/bm_hash_ident_sym.rb: ditto
-
-Sat Mar 22 22:56:45 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): compare the file names of object in which
- symbols exist. [Bug #9654] [ruby-dev:48058]
-
-Sat Mar 22 06:46:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/cgi/util.rb (escape_html, unescape_html): make synonyms
- aliases instead of wrapper methods.
-
- * lib/cgi/util.rb (escape_element, unescape_element): ditto.
- [Fixes GH-573]
-
-Fri Mar 21 21:57:34 2014 Akinori MUSHA <knu@iDaemons.org>
-
- * configure.in: Fix a build problem with clang and --with-opt-dir.
- If ruby is configured with --with-opt-dir=dir when using clang
- as compiler, a warning `clang: warning: argument unused during
- compilation: '-I dir'` is emitted almost every time clang
- compiles a file. Unfortunately, RUBY_CHECK_PRINTF_PREFIX takes
- any output from the compiler as fatal error, and the check thus
- fails due to the warning. This is an attempt to fix the problem
- by adding a flag -Qunused-arguments to CFLAGS locally in the
- function to suppress the warning. [ruby-dev:48062] [Bug #9658]
- [Fixes GH-571] https://github.com/ruby/ruby/pull/571
-
-Fri Mar 21 16:31:56 2014 Zachary Scott <e@zzak.io>
-
- * gc.c: [DOC] Fix call-seq for GC.start by @jasonrclark [Fixes GH-572]
- https://github.com/ruby/ruby/pull/572
-
-Thu Mar 20 11:37:28 2014 James Edward Gray II <james@graysoftinc.com>
-
- * lib/csv.rb: Fixed a broken regular expression that was causing
- CSV to miss escaping some special meaning characters when used
- in parsing.
- Reported by David Unric
- [ruby-core:54986] [Bug #8405]
-
-Thu Mar 20 16:53:07 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (objspace_malloc_increase): should not invoke
- garbage_collect_with_gvl() here on non-ruby threads.
-
- Should just ignore the malloc_increase.
-
- This issue is pointed by Eric Wong [ruby-core:61519].
-
-Thu Mar 20 13:05:16 2014 Koichi Sasada <ko1@atdot.net>
-
- * struct.c (rb_struct_alloc): use RARRAY_CONST_PTR() instead of
- RARRAY_PTR().
-
-Thu Mar 20 12:59:39 2014 Koichi Sasada <ko1@atdot.net>
-
- * include/ruby/intern.h (rb_obj_call_init, rb_class_new_instance):
- constify a parameter (VALUE *).
- I believe this incompatibility doesn't break any code.
- However, if you have trouble, please tell us.
-
- * eval.c, object.c: ditto.
-
-Thu Mar 20 12:31:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_method.c (rb_method_entry_get_without_cache): get rid of
- infinite recursion at aliases in a subclass and a superclass.
- return actually defined class for other than singleton class.
- [ruby-core:60431] [Bug #9475]
-
-Wed Mar 19 17:13:06 2014 Eric Wong <e@80x24.org>
-
- * time.c (time_mload): freeze and preserve marshal-loaded time zone
- * test/ruby/test_time.rb: add test for GC on loaded object
- [Bug #9652]
-
-Tue Mar 18 23:20:12 2014 Shota Fukumori <her@sorah.jp>
-
- * vm_eval.c (eval_string_with_cref): Unify to use NIL_P.
-
-Tue Mar 18 22:03:41 2014 Shota Fukumori <her@sorah.jp>
-
- * vm_eval.c (eval_string_with_cref): Use file path even if scope is
- given. Related to [ruby-core:56099] [Bug #8662] and r42103.
-
-Mon Mar 17 13:17:47 2014 Koichi Sasada <ko1@atdot.net>
-
- * enumerator.c (enumerator_block_call): use RARRAY_CONST_PTR()
- instead of RARRAY_PTR().
-
- * io.c (rb_io_s_popen): ditto.
-
- * numeric.c (num_step_size): ditto.
-
- * vm_eval.c (rb_apply): ditto.
-
- * vm_eval.c (rb_eval_cmd): ditto.
-
-Mon Mar 17 10:11:59 2014 Eric Wong <e@80x24.org>
-
- * variable.c (rb_const_set): delete existing entry on redefinition
- [Bug #9645]
- * test/ruby/test_const.rb (test_redefinition): test for leak
-
-Sun Mar 16 21:33:01 2014 Zachary Scott <e@zzak.io>
-
- * lib/time.rb: [DOC] Fix timezone in example of Time.parse [Bug #9521]
- Based on patch by @stomar
-
-Sun Mar 16 13:21:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (DLDFLAGS): insert a space between option and its
- argument for non-GCC compilers. [ruby-core:61429] [Bug #9624]
-
-Sun Mar 16 08:05:06 2014 Eric Wong <e@80x24.org>
-
- * gc.c (objspace_xcalloc): fix GC accounting
-
-Sun Mar 16 06:33:35 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): return address is just after calling
- address. Therefore noreturn function with tail call's return
- address may be in another function.
-
-Sun Mar 16 05:51:55 2014 Zachary Scott <e@zzak.io>
-
- * lib/gserver.rb: [DOC] Fixed typo in example by @stomar [Bug #9543]
-
-Sat Mar 15 18:54:03 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * ext/.document: remove refinement from documentable directories.
-
-Sat Mar 15 11:02:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (DLDFLAGS): check for each options to control
- symbol resolution. [ruby-core:61429] [Bug #9624]
-
-Sat Mar 15 07:02:35 2014 Eric Wong <e@80x24.org>
-
- * st.c (st_update): remove unnecessary assignment
-
-Fri Mar 14 14:58:38 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c (fill_lines): fetch symbol names from ELF binary's
- symbol table if it is built with cc -g and not stripped.
- Now ruby can show static symbols on Linux though glibc's
- backtrace_symbols(3) don't show them.
-
- * addr2line.c (rb_dump_backtrace_with_lines): use dladdr(3) to
- detect what object file declares the symbol because
- dl_iterate_phdr can't detect the main executable file
- and codes on the stack.
- NOTE: signal trampolines sometimes on the user stack. (FreeBSD)
-
- * addr2line.c (rb_dump_backtrace_with_lines): stop showing
- backtrace if the function's name is main.
- NOTE: FreeBSD's backtrace (libexecinfo) shows _start and
- an additional address. Why it doesn't remove them on dladdr phase
- is, dladdr may fail to detect the main function but detect
- as _start function. Therefore it must be after scanning
- the symbol table and getting correct name.
-
-
-Fri Mar 14 12:07:46 2014 Zachary Scott <e@zzak.io>
-
- * doc/syntax/literals.rdoc: [DOC] Single quote strings allows escape
- of backslash as well, patch by @idupree [Fixes GH-553]
- https://github.com/ruby/ruby/pull/553
-
-Fri Mar 14 01:18:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (invoke_block_from_c): add splattable argument.
-
- * vm.c (vm_invoke_proc): disallow to splat when directly invoked.
-
- * vm_insnhelper.c (vm_callee_setup_arg_complex, vm_callee_setup_arg):
- relax arity check of yielded lambda. [ruby-core:61340] [Bug #9605]
-
- * test/ruby/test_yield.rb (TestRubyYieldGen#emu_bind_params): no
- longer raise ArgumentError when splatting to lambda.
-
-Thu Mar 13 23:51:02 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/-test-/win32/dln/libdlntest.c (dlntest_ordinal): no need to
- specify export in the source file because .def file do it.
- get rid of warning on linking.
-
-Wed Mar 12 11:19:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_callee_setup_arg): disable fastpath if splat
- argument, since argc may differ for each calls.
- [ruby-core:61422] [Bug #9622]
-
- * vm_insnhelper.c (vm_callee_setup_arg): turn a macro into an
- inline function.
-
-Wed Mar 12 07:26:05 2014 Eric Wong <e@80x24.org>
-
- * insns.def (opt_regexpmatch2): respect redefined match op
- Thanks to Sam Rawlins for the fix.
- * test/ruby/test_string.rb: test based on Tsuyoshi Sawada's report
- [Bug #9581]
-
-Tue Mar 11 22:31:25 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * ext/.document: add objspace/objspace_dump.c to document file.
-
-Tue Mar 11 22:22:38 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * test/objspace/test_objspace.rb (TestObjSpace#test_dump_uninitialized_file):
- remove dependency on json library.
-
-Tue Mar 11 10:55:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * README.EXT{,.ja} (Appendix B): update contents of `ruby_options`
- and replace `ruby_run` with `ruby_run_node`. based on the patch
- by Kaneko Yuichiro at [ruby-dev:48030] [Bug #9619].
-
-Tue Mar 11 06:54:00 2014 Scott Francis <scott.francis@shopify.com>
-
- * ext/objspace/objspace_dump.c: Check fptr before trying to dump RFILE
- object fd. [GH-562]
-
- * test/objspace/test_objspace.rb: add test
-
-Tue Mar 11 02:04:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_dump.c (rb_vm_bugreport): show vm maps on FreeBSD.
-
- * vm_dump.c (procstat_vm): copied from FreeBSD.
- http://svnweb.freebsd.org/base/head/usr.bin/procstat/procstat_vm.c?revision=261780
-
-Mon Mar 10 12:14:26 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: always check dladdr(1).
-
- * addr2line.c (fill_lines): show the line number in C backtrace if
- ruby is built without --enable-shared (PIE) on Linux.
- patch is originally by Shinichiro Hamaji
- https://twitter.com/shinh/status/441957774264504321
- NOTE: ld doesn't insert __executable_start for PIE.
- dladdr(3)'s argument must be a function pointer.
-
-Mon Mar 10 10:51:17 2014 ksss <co000ri@gmail.com>
-
- * test/ruby/test_enumerator.rb (test_iterators): fix test for hash
- iterators. [Fixes GH-558]
-
-Sun Mar 9 14:14:49 2014 Eric Wong <e@80x24.org>
-
- * class.c (rb_class_subclass_add): use xmalloc
- * class.c (rb_module_add_to_subclasses_list): ditto
- * class.c (rb_class_remove_from_super_subclasses): use xfree
- * class.c (rb_class_remove_from_module_subclasses): ditto
- [Bug #9616]
-
-Sun Mar 9 13:51:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/fiddle/function.c (function_call): fix memory leak when an
- exception occurs at argument conversion or the function call.
-
-Sun Mar 9 06:42:40 2014 Eric Wong <e@80x24.org>
-
- * variable.c (struct global_variable): shrink by 8 bytes on 64-bit
-
-Sat Mar 8 17:42:51 2014 Eric Wong <e@80x24.org>
-
- * vm.c (add_opt_method): cleanup to use rb_method_entry_at
-
-Sat Mar 8 13:46:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/dl/cptr.c (dlptr_free), ext/dl/handle.c (dlhandle_free),
- ext/fiddle/handle.c (fiddle_handle_free),
- ext/fiddle/pointer.c (fiddle_ptr_free): fix memory leak.
- based on the patch Heesob Park at [ruby-dev:48021] [Bug #9599].
-
-Sat Mar 8 13:30:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (obj2uid, obj2gid): now getpwnam_r() and getgrnam_r()
- may need larger buffers than sysconf values, so retry with
- expanding the buffer when ERANGE is returned.
- [ruby-core:61325] [Bug #9600]
-
-Fri Mar 7 19:29:13 2014 Eric Wong <e@80x24.org>
-
- * vm_eval.c (vm_call0_body): use RARRAY_CONST_PTR
- (check_funcall_exec): ditto
- [ruby-core:61360]
-
-Fri Mar 7 19:14:11 2014 Eric Wong <e@80x24.org>
-
- * vm_eval.c (vm_call0_body): fix RB_GC_GUARD location
- (check_funcall_exec): ditto
- [Bug #9609]
-
-Fri Mar 7 14:48:17 2014 Narihiro Nakamura <authornari@gmail.com>
-
- * parse.y (ENC_SINGLE): Unused macro removed.
-
-Fri Mar 7 12:06:19 2014 Martin Bosslet <Martin.Bosslet@gmail.com>
-
- * test/openssl/test_ssl.rb: Reuse TLS default options from
- OpenSSL::SSL::SSLContext::DEFAULT_PARAMS.
-
-Thu Mar 6 15:15:24 2014 Zachary Scott <e@zzak.io>
-
- * doc/syntax/assignment.rdoc: [DOC] Fix assignment directions
- By @idupree [Fixes GH-555] https://github.com/ruby/ruby/pull/555
-
-Thu Mar 6 15:07:18 2014 Zachary Scott <e@zzak.io>
-
- * doc/syntax/methods.rdoc: [DOC] Fix example for block arguments
- By @idupree [Fixes GH-554] https://github.com/ruby/ruby/pull/554
-
-Thu Mar 6 10:33:31 2014 Martin Bosslet <Martin.Bosslet@gmail.com>
-
- * lib/openssl/ssl.rb: Explicitly whitelist the default
- SSL/TLS ciphers. Forbid SSLv2 and SSLv3, disable
- compression by default.
- Reported by Jeff Hodges.
- [ruby-core:59829] [Bug #9424]
-
-Wed Mar 5 15:56:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (f_arg_asgn): define optional arguments as argument
- variables in the rhs default expressions.
- [ruby-core:61299] [Bug #9593]
-
-Wed Mar 5 11:58:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/openssl/ossl.c (ossl_make_error): check NULL for unknown
- error reasons with old OpenSSL, and insert a colon iff formatted
- message is not empty.
-
-Wed Mar 5 00:42:00 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * ext/pathname/lib/pathname.rb (Pathname#find): add "ignore_error"
- keyword argument defaulted to true as well as Find#find.
-
-Tue Mar 4 23:00:18 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_eval.rb (TestEval#make_test_binding): renamed.
- it's not test method.
-
-Tue Mar 4 20:50:59 2014 Masaya Tarui <tarui@ruby-lang.org>
-
- * st.c (st_foreach): fix type of hash. not st_data_t but st_index_t.
-
-Tue Mar 4 19:41:40 2014 Tanaka Akira <akr@fsij.org>
-
- * Makefile.in: ".DEFAULT" target removed because it is not for
- specifying default target.
-
-Tue Mar 4 00:25:35 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * lib/find.rb (Find#find): should pass ignore_error option to enumerators.
-
-Mon Mar 3 13:27:35 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/test_find.rb (TestFind#test_unsearchable_dir): ruby cannot make
- directory unreachable by owner on Windows.
-
-Mon Mar 3 08:10:04 2014 Eric Wong <e@80x24.org>
-
- * vm_method.c (rb_method_entry_get_without_cache): disable GMC
- writing if GMC is disabled.
- [ruby-core:61218]
-
-Mon Mar 3 07:47:17 2014 Eric Wong <e@80x24.org>
-
- * README.EXT: wrap GetDBM with do/while(0)
- * README.EXT.ja: ditto
- * ext/dbm/dbm.c: ditto, likewise for GetDBM2
- * ext/gdbm/gdbm.c: ditto
- * ext/sdbm/init.c: ditto
- [ruby-core:61217]
-
-Mon Mar 3 07:17:31 2014 Zachary Scott <e@zzak.io>
-
- * NEWS: [DOC] Update doc regarding filesystem load when flushing IO
-
-Mon Mar 3 04:37:50 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * io.c (rb_io_fsync): need to fsync even if on Windows. fixed mistake
- of r45254 and r45256.
-
-Mon Mar 3 04:21:34 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/win32ole: get rid of warnings (unused variable).
-
-Mon Mar 3 02:53:53 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * io.c (rb_io_flush_raw): [EXPERIMENTAL] remove force syncing for Win32
- to speed up IO. this may break some tests, and they'll be fixed
- later.
- [ruby-core:58570] [Bug #9153]
-
-Mon Mar 3 00:17:43 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_backtrace.rb: get rid of warnings. unused variable,
- shadowing.
-
-Sun Mar 2 11:15:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/find.rb (Find#find): add "ignore_error" keyword argument
- defaulted to true. [ruby-core:51025] [Feature #7596]
-
-Sun Mar 2 11:13:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/readline/extconf.rb (rl_hook_func_t): define as Function for
- very old readline versions. [ruby-core:61209] [Bug #9578]
-
-Sun Mar 2 10:47:58 2014 Eric Wong <e@80x24.org>
-
- * load.c (ruby_init_ext): make idempotent to suppress warnings
-
-Sat Mar 1 19:51:42 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/open3.rb (Open3.capture3): Ignore Errno::EPIPE for writing
- stdin_data.
- (Open3.capture2): Ditto.
- (Open3.capture2e): Ditto.
-
-Sat Mar 1 19:06:47 2014 Eric Wong <e@80x24.org>
-
- * gc.c (ruby_gc_set_params): simplify condition
-
-Sat Mar 1 16:18:40 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/readline/readline.c (Init_readline): Use rl_hook_func_t instead
- of Function to support readline-6.3. (rl_hook_func_t is available
- since readline-4.2.)
- Reported by Dmitry Medvinsky. [ruby-core:61141] [Bug #9578]
-
-Sat Mar 1 16:05:58 2014 Eric Wong <e@80x24.org>
-
- * gc.c (ruby_gc_set_params): fix building without RGenGC
-
-Sat Mar 1 11:08:00 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: support dumping Encoding
- objects.
-
- * ext/psych/lib/psych/visitors/to_ruby.rb: support loading Encoding
- objects.
-
- * test/psych/test_encoding.rb: add test
-
- * ext/psych/lib/psych.rb: add version
-
-Sat Mar 1 10:52:34 2014 Zachary Scott <e@zzak.io>
-
- * README.EXT.ja: [DOC] Fix typo "macro macro" @utenmiki [Fixes GH-551]
- https://github.com/ruby/ruby/pull/551
-
-Fri Feb 28 11:16:55 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * numeric.c: Fix Numeric#step with 0 unit [Bug #9575]
-
-Thu Feb 27 17:59:01 2014 Zachary Scott <e@zzak.io>
-
- * lib/optparse.rb: [DOC] Add example of generating help with optparse.
- Patch by @joelmccracken documenting-ruby/ruby#19
- https://github.com/documenting-ruby/ruby/pull/19
-
-Thu Feb 27 12:10:09 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (ruby_num_interval_step_size): check signs and get rid
- of implementation dependent behavior of negative division.
- [ruby-core:61106] [Bug #9570]
-
-Thu Feb 27 03:55:45 2014 Zachary Scott <e@zzak.io>
-
- * thread.c: [DOC] Typo in comment for _FORTIFY_SOURCE [Fixes GH-548]
- Patch by @qnet-herwin https://github.com/ruby/ruby/pull/548
-
-Wed Feb 26 18:43:43 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (heap_pages_free_unused_pages): check tomb page availability
- at first.
- And return immediately if we don't touch sorted list any more.
-
-Wed Feb 26 14:10:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (setup_exception): preserve exception class name encoding
- in debug mode messages.
-
- * eval.c (setup_exception): preserve errinfo across calling #to_s
- method on the exception. [ruby-core:61091] [Bug #9568]
-
-Wed Feb 26 01:29:27 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (sym_find): Add Symbol.find(str), which returns whether given
- string is defined as symbol or not. [Feature #7854]
-
-Tue Feb 25 22:52:02 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/dl/dl.c (rb_dl_realloc): use NUM2SIZET instead of NUM2INT.
-
- * ext/fiddle/fiddle.c (rb_fiddle_realloc): ditto.
-
-Tue Feb 25 22:49:30 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/dl/dl.c (rb_dl_malloc): use NUM2SIZET instead of NUM2INT.
- Coverity Scan found this bug.
-
- * ext/fiddle/fiddle.c (rb_fiddle_malloc): ditto.
-
-Tue Feb 25 12:06:13 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * win32/Makefile.sub: define PACKED_STRUCT.
-
-Mon Feb 24 21:41:56 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * README.md, README.ja.md: removed (wrong) mode setting for emacs.
-
-Mon Feb 24 20:05:41 2014 Eric Wong <e@80x24.org>
-
- * configure.in: define PACKED_STRUCT_UNALIGNED for x86*
- * timev.h (struct vtm): use PACKED_STRUCT_UNALIGNED
- * time.c (struct time_object): ditto
- [Bug #9558] non-x86 cannot safely access unaligned addresses
-
-Mon Feb 24 18:10:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/fiddle/test_function.rb: remove unused variables.
- * test/fileutils/test_fileutils.rb: ditto.
- * test/io/console/test_io_console.rb: ditto.
-
-Mon Feb 24 12:37:51 2014 Eric Wong <e@80x24.org>
-
- * configure.in: use -Wno-packed-bitfield-compat for GCC 4.4+
- use __attribute__((packed)) if available
- * timev.h: shrink and pack struct vtm
- * time.c: pack struct time_object and adjust/introduce helpers
- [ruby-core:60794]
-
-Sun Feb 23 17:55:50 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/xmltokens.rb: Add missing non ASCII valid characters
- to element name characters. Now, REXML name tokens exactly
- match "[5] Name" in the XML spec and "[4] NCName" in the
- Namespaces in XML spec. See comment about the details.
- [Bug #9539] [ruby-core:60901]
- Reported by Mario Barcala. Thanks!!!
-
- * test/rexml/xpath/test_node.rb: Add tests for the above case.
-
-Sun Feb 23 12:18:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/raddrinfo.c (inet_pton): use rb_w32_inet_pton, instead of
- inet_pton directly, which is unavailable on older version Windows.
-
- * include/ruby/win32.h, win32/win32.c (rb_w32_inet_pton): add a
- wrapper function for inet_pton minimum supported client is
- Vista, as well as inet_ntop.
-
-Sun Feb 23 11:33:25 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/net/imap/test_imap.rb: remove unused variables.
- * test/net/imap/test_imap_response_parser.rb: ditto.
- * test/net/pop/test_pop.rb: ditto.
-
-Sun Feb 23 02:19:51 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb (bind_random_port): Rescue EPERM for FreeBSD which
- security.mac.portacl.port_high is changed.
- See mac_portacl(4) for details.
- Reported by Jakub Szafranski. [ruby-core:60917] [Bug #9544]
-
-Sat Feb 22 23:17:01 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/xpath_parser.rb: Fix indent.
-
-Sat Feb 22 23:15:35 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/xpath/test_attribute.rb: Simplify.
-
-Sat Feb 22 20:28:47 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/redmine-backporter.rb: more friendly.
-
-Sat Feb 22 20:24:43 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/test_xpath*.rb: Move to ...
- * test/rexml/xpath/*.rb: ... here.
-
-Sat Feb 22 20:04:41 2014 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rexml/listener.rb: Untabify.
-
-Sat Feb 22 19:07:31 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/io/console/console.c (console_dev): need read access for conout$
- because some functions need it. [Bug#9554]
-
-Sat Feb 22 18:40:58 2014 Eric Wong <e@80x24.org>
-
- * .gitignore: ignore benchmark files
-
-Sat Feb 22 01:22:24 2014 Yusuke Endoh <mame@tsg.ne.jp>
-
- * bignum.c (bary_mul_precheck): fix a copy-paste error.
- Coverity Scan found this bug.
-
-Sat Feb 22 00:58:51 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/socket/raddrinfo.c (rb_getaddrinfo): second argument of
- MEMZERO is type. Coverity Scan found this bug.
-
-Fri Feb 21 23:47:24 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * ext/socket/init.c (wait_connectable): break if the socket is
- writable to avoid infinite loops on FreeBSD and other platforms
- which conforms to SUSv3. This problem cannot be reproduced with
- loopback interfaces, so it's hard to write test code.
- rsock_connect() and wait_connectable() are overly complicated, so
- they should be refactored, but I commit this fix as a workaround
- for the release of Ruby 1.9.3 scheduled on Feb 24.
- [ruby-core:60940] [Bug #9547]
-
-Fri Feb 21 23:03:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/redmine-backporter.rb: added to handle redmine tickets.
-
-Fri Feb 21 20:42:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_mod_init_copy): do nothing if copying self.
- [ruby-dev:47989] [Bug #9535]
-
- * hash.c (rb_hash_initialize_copy): ditto.
-
-Fri Feb 21 16:45:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/logger.rb (next_rotate_time, previous_period_end): consider
- DST change.
-
- * lib/logger.rb (Logger::LogDevice#check_shift_log): compare the
- current time with the time for the next rotation to fix rotation
- miss when date changed between the comparison and log writing.
- based on the patch by megayu <yuhg2310 AT gmail.com>.
- [Fixes GH-539]
-
-Fri Feb 21 10:39:33 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/monitor/test_monitor.rb: remove unused variables.
- * test/resolv/test_dns.rb: ditto.
- * test/rexml/test_functions.rb: ditto.
- * test/rss/test_setup_maker_itunes.rb: ditto.
-
-Fri Feb 21 09:48:56 2014 Eric Wong <e@80x24.org>
-
- * ext/socket/ancdata.c (bsock_sendmsg_internal): only retry on error
- (bsock_recvmsg_internal): ditto
- * test/socket/test_unix.rb: test above for infinite loop
-
-Fri Feb 21 08:27:19 2014 Eric Wong <e@80x24.org>
-
- * include/ruby/ruby.h (RB_GC_GUARD):
- use rb_gc_guarded_ptr_val on non-GCC/MSC
- * gc.c (rb_gc_guarded_ptr_val): rename and adjust argument.
- RB_GC_GUARD should be robust enough for any compiler.
- [ruby-core:60816] [Bug #7805]
-
-Thu Feb 20 22:21:26 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/raddrinfo.c (numeric_getaddrinfo): Use xcalloc.
- Suggested by Eric Wong.
- https://bugs.ruby-lang.org/issues/9525#note-14
-
-Thu Feb 20 11:21:13 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * hash.c (rb_hash_flatten): fix behavior of flatten(-1).
- [ruby-dev:47988] [Bug #9533]
-
- * test/ruby/test_array.rb: test for above.
-
-Wed Feb 19 18:57:02 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket: Bypass getaddrinfo() if node and serv are numeric.
- Reporeted by Naotoshi Seo. [ruby-core:60801] [Bug #9525]
-
- * ext/socket/extconf.rb: Detect struct sockaddr_in6.sin6_len.
-
- * ext/socket/sockport.h (SET_SIN6_LEN): New macro.
- (INIT_SOCKADDR_IN6): Ditto.
-
- * ext/socket/rubysocket.h (struct rb_addrinfo): Add
- allocated_by_malloc field.
-
- * ext/socket/raddrinfo.c (numeric_getaddrinfo): New function.
- (rb_getaddrinfo): Call numeric_getaddrinfo at first.
- (rb_freeaddrinfo): Free struct addrinfo properly when it is
- allocated by numeric_getaddrinfo.
-
-Wed Feb 19 18:31:48 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket: Wrap struct addrinfo by struct rb_addrinfo.
-
-Wed Feb 19 17:47:01 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/ipsocket.c (ip_s_getaddress): Don't access freed memory.
-
-Wed Feb 19 11:39:41 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: it must see rb_cv_broken_memmem not rb_cv_func_memmem.
-
-Tue Feb 18 23:18:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/socket/test_socket.rb: unix socket is required by test case.
-
-Tue Feb 18 20:48:38 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/socket/test_addrinfo.rb: remove unused variables.
- * test/socket/test_nonblock.rb: ditto.
- * test/socket/test_socket.rb: ditto.
- * test/socket/test_unix.rb: ditto.
- * test/testunit/test_parallel.rb: ditto.
- * test/webrick/test_filehandler.rb: ditto.
- * test/xmlrpc/test_features.rb: ditto.
- * test/zlib/test_zlib.rb: ditto.
-
-Tue Feb 18 14:27:18 2014 Shota Fukumori <her@sorah.jp>
-
- * lib/test/unit.rb: Requires minitest < 5.0.0 if Gem is available.
-
-Tue Feb 18 14:24:07 2014 Shota Fukumori <her@sorah.jp>
-
- * lib/test/unit/test-unit.gemspec: Add minitest < 5.0.0 dependency
-
- * tool/rbinstall.rb: Add empty implementations for `add_dependency`,
- `add_runtime_dependency`, `add_development_dependency` for
- Gem::Specification.
-
-Tue Feb 18 12:06:39 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in (FILE_COUNT): Removed. (win32.c defines it in itself.)
- (FILE_READPTR): Ditto.
-
-Tue Feb 18 09:35:44 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test/psych/test_string.rb: remove unused variables.
- * test/test/psych/test_yaml.rb: ditto.
-
-Mon Feb 17 21:31:31 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_gc.rb: ignore warning messages for running with -w
- option such as chkbuild.
-
-Mon Feb 17 20:00:27 2014 Tanaka Akira <akr@fsij.org>
-
- * internal.h: Move BDIGIT and related definitions from
- include/ruby/defines.h.
-
-Mon Feb 17 17:41:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (marshal_dump, marshal_load): do not recycle wrapper
- objects, to prevent from segfault with continuation.
- [ruby-dev:47970] [Bug #9523]
-
-Mon Feb 17 15:43:59 2014 Zachary Scott <e@zzak.io>
-
- * doc/keywords.rdoc: [DOC] Add keywords doc by documenting-ruby/ruby#29
- https://github.com/documenting-ruby/ruby/pull/29
-
-Mon Feb 17 12:31:31 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (get_envparam_double): fix a warning message.
-
-Mon Feb 17 12:09:52 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: introduce new environment variable
- "RUBY_GC_HEAP_OLDOBJECT_LIMIT_FACTOR" to control major/minor GC
- frequency.
-
- Do full GC when the number of old objects is more than R * N
- where R is this factor and
- N is the number of old objects just after last full GC.
-
- * test/ruby/test_gc.rb: add a test.
-
-Mon Feb 17 11:28:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_pty.rb: ignore warnings to unused variables.
-
-Mon Feb 17 11:27:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_find.rb: remove unused variables.
-
-Sun Feb 17 02:12:00 2014 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_initialize): Insert GC guard.
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_global_new): ditto.
-
-Sun Feb 16 15:53:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/test_securerandom.rb: File.exists? is deprecated. use File.exist?
-
-Sun Feb 16 15:05:00 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/pathname/test_pathname.rb: File.exists? is deprecated. use File.exist?
-
-Sun Feb 16 15:00:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-
- * test/net/ftp/test_ftp.rb: remove unused variables.
- * test/logger/test_logger.rb: ditto.
-
-Sun Feb 16 14:52:46 2014 Eric Wong <e@80x24.org>
-
- * dir.c (dir_s_glob): RB_GC_GUARD instead of volatile
-
-Sun Feb 16 14:33:52 2014 Tanaka Akira <akr@fsij.org>
-
- * include/ruby/ruby.h (RBIGNUM_SIGN): Defined for compatibility.
- (RBIGNUM_POSITIVE_P): Ditto.
- (RBIGNUM_NEGATIVE_P): Ditto.
-
-Sun Feb 16 12:46:47 2014 Eric Wong <e@80x24.org>
-
- * io.c (rb_f_backquote): trade volatile for manual recycle
- rb_gc_force_recycle ensures object is visible until recycle
-
-Sun Feb 16 11:55:14 2014 Eric Wong <e@80x24.org>
-
- * marshal.c (marshal_dump): use rb_gc_force_recycle for GC-safety
- (marshal_load): ditto
- [ruby-core:60730] [Bug #7805]
-
-Sun Feb 16 08:11:23 2014 Zachary Scott <e@zzak.io>
-
- * README.EXT.ja: [DOC] Fix typo by @utenmiki [Fixes GH-534]
- https://github.com/ruby/ruby/pull/534
-
-Sun Feb 16 07:48:20 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/bigdecimal/bigdecimal.c (BIGNUM_ZERO_P): Unused macro removed.
-
-Sun Feb 16 06:12:23 2014 Tanaka Akira <akr@fsij.org>
-
- * internal.h: Rename macro names: RBIGNUM_FOO to BIGNUM_FOO.
- (BIGNUM_EMBED_LEN_NUMBITS): Renamed from RBIGNUM_EMBED_LEN_NUMBITS.
- (BIGNUM_EMBED_LEN_MAX): Renamed from RBIGNUM_EMBED_LEN_MAX.
- (BIGNUM_SIGN_BIT): Renamed from RBIGNUM_SIGN_BIT.
- (BIGNUM_SIGN): Renamed from RBIGNUM_SIGN.
- (BIGNUM_SET_SIGN): Renamed from RBIGNUM_SET_SIGN.
- (BIGNUM_POSITIVE_P): Renamed from RBIGNUM_POSITIVE_P.
- (BIGNUM_NEGATIVE_P): Renamed from RBIGNUM_NEGATIVE_P.
- (BIGNUM_EMBED_FLAG): Renamed from RBIGNUM_EMBED_FLAG.
- (BIGNUM_EMBED_LEN_MASK): Renamed from RBIGNUM_EMBED_LEN_MASK.
- (BIGNUM_EMBED_LEN_SHIFT): Renamed from RBIGNUM_EMBED_LEN_SHIFT.
- (BIGNUM_LEN): Renamed from RBIGNUM_LEN.
- (RBIGNUM_DIGITS): Renamed from RBIGNUM_DIGITS.
- (BIGNUM_LENINT): Renamed from RBIGNUM_LENINT.
-
- * bignum.c: Follow the above change.
-
- * gc.c: Ditto.
-
- * marshal.c: Ditto.
-
- * math.c: Ditto.
-
- * numeric.c: Ditto.
-
- * random.c: Ditto.
-
- * rational.c: Ditto.
-
- * sprintf.c: Ditto.
-
- * ext/-test-/bignum/bigzero.c: Ditto.
-
- * ext/-test-/bignum/intpack.c: Ditto.
-
- * ext/bigdecimal/bigdecimal.c: Ditto.
-
-Sat Feb 15 20:48:49 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in (FILE_READEND): Don't detect it because it is not used.
-
-Sat Feb 15 13:22:28 2014 Eric Wong <e@80x24.org>
-
- * probes_helper.h (RUBY_DTRACE_HOOK): correct type for _id
-
-Sat Feb 15 11:47:47 2014 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (rb_big_cmp): Avoid bignum allocation for comparison
- between bignum and fixnum.
-
-Sat Feb 15 10:55:12 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * ext/-test-/win32/fd_setsize/depend: fix wrong dependencies.
- [ruby-dev:47253]
-
-Sat Feb 15 00:38:54 2014 Tanaka Akira <akr@fsij.org>
-
- * enum.c: Enumerable#{min,min_by,max,max_by} extended to take an
- optional argument.
- (nmin_cmp): New function.
- (nmin_block_cmp): Ditto
- (nmin_filter): Ditto.
- (nmin_i): Ditto.
- (nmin_run): Ditto.
- (enum_min): Call nmin_run if the optional argument is given.
- (nmin_max): Ditto.
- (nmin_min_by): Ditto.
- (nmin_max_by): Ditto.
-
- * range.c: Range#{min,max} extended to take an optional argument.
- (range_min): Call range_first if the optional argument is given.
- (range_max): Call rb_call_super if the optional argument is given.
-
- [ruby-core:57111] [Feature #8887]
-
-Sat Feb 15 00:27:46 2014 Tanaka Akira <akr@fsij.org>
-
- * include/ruby/ruby.h,
- internal.h,
- ext/-test-/bignum/bigzero.c: Hide a Bignum definition.
- [ruby-core:42891] [Feature #6083]
-
-Sat Feb 15 00:13:14 2014 Tanaka Akira <akr@fsij.org>
-
- * include/ruby/intern.h,
- include/ruby/io.h,
- include/ruby/ruby.h,
- include/ruby/win32.h,
- include/ruby/backward/rubysig.h,
- bignum.c,
- gc.c,
- io.c,
- process.c,
- safe.c,
- struct.c,
- thread.c,
- ext/socket/rubysocket.h,
- ext/-test-/old_thread_select: Remove deprecated definitions
- [ruby-core:60581] [Feature #9502]
-
-Fri Feb 14 18:38:46 2014 Eric Wong <e@80x24.org>
-
- * string.c (rb_str_format_m): trade volatile for RB_GC_GUARD
- RB_GC_GUARD meaning is clear and has better code generation.
- [ruby-core:60688]
-
-Thu Feb 13 23:30:30 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * vm_insnhelper.c (vm_call_method): should check ci->me->flag of
- a refining method in case the method is private.
- [ruby-core:60111] [Bug #9452]
-
- * vm_method.c (make_method_entry_refined): set me->flag of a refined
- method entry to NOEX_PUBLIC in case the original method is private
- and it is refined as a public method. The original flag is stored
- in me->def->body.orig_me, so it's OK to make a refined method
- entry public. [ruby-core:60111] [Bug #9452]
-
- * test/ruby/test_refinement.rb: related tests.
-
-Thu Feb 13 18:38:15 2014 Eric Wong <e@80x24.org>
-
- * re.c (rb_reg_raise): remove volatile
- Unnecessary since r41597
-
-Thu Feb 13 18:28:51 2014 Eric Wong <e@80x24.org>
-
- * re.c (rb_reg_regcomp): remove volatile
- Unnecessary since r13261
-
-Thu Feb 13 16:54:32 2014 Zachary Scott <e@zzak.io>
-
- * test/ruby/test_array.rb: Ensure flatten! is used for test_flatten
- Patch by @ksss [Fixes GH-530] https://github.com/ruby/ruby/pull/530
-
-Thu Feb 13 15:43:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (IDSET_ATTRSET_FOR_INTERN): fix off-by-one bug.
-
- * parse.y (rb_enc_symname_type): junk ID succeeded by '=' is also
- attrset ID. [ruby-core:60668] [Bug #8756]
-
-Thu Feb 13 11:06:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check if pthread_setname_np is available.
-
- * thread_pthread.c: pthread_setname_np is not available on old
- Darwins. [ruby-core:60524] [Bug #9492]
-
-Thu Feb 13 00:56:59 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * configure.in: revert r44922. I should have used AC_CHECK_FUNCS()
- to just define a symbol if the function is available.
-
-Thu Feb 13 00:20:58 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * configure.in: use AC_CHECK_FUNC instead of AC_CHECK_FUNCS
- if available.
-
-Thu Feb 13 00:15:10 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * configure.in: fix to undefine HAVE_MEMMEM correctly if it is broken.
-
-Tue Feb 11 23:54:40 2014 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (rb_big_cmp): Specialize a comparison to zero.
-
- * ext/bigdecimal/bigdecimal.c (is_negative): Use rb_big_cmp instead of
- RBIGNUM_NEGATIVE_P.
- (BigMath_s_log): Ditto.
-
-Tue Feb 11 22:59:10 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/openssl/ossl_bn.c (ossl_bn_initialize): Use rb_integer_pack.
- Fix SEGV by OpenSSL::BN.new(1 << (2**34)).
-
-Tue Feb 11 17:00:38 2014 Zachary Scott <e@zzak.io>
-
- * ext/tk/README.tcltklib: [DOC] Fix typo by @xta [Fixes GH-532]
-
-Sun Feb 9 13:59:29 2014 Tanaka Akira <akr@fsij.org>
-
- * configure.in: Fix compilation error.
- https://bugs.ruby-lang.org/issues/8358#note-16
-
-Sun Feb 9 05:20:24 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (rb_cv_gnu_qsort_r): use compile error "conflicting
- types for 'qsort_r'" instead of AC_RUN_IFELSE.
-
-Sun Feb 9 04:07:34 2014 Zachary Scott <e@zzak.io>
-
- * lib/yaml.rb: [DOC] Add links to syck and psych on github [Bug #9501]
- Based on a patch by Giorgos Tsiftsis
-
-Sun Feb 9 02:13:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (OBJ_TAINTABLE, OBJ_TAINT, OBJ_INFECT),
- marshal.c (r_entry0): all Numerics never be tainted now.
- [ruby-core:57346] [Bug #8945]
-
-Sat Feb 8 23:40:35 2014 Vit Ondruch <vondruch@redhat.com>
-
- * configure.in: add quoting brackets and append wildcard for the
- rest after target_cpu, to properly detect platform for SSE2
- instructions. [ruby-core:60576] [Bug #8358]
-
-Sat Feb 8 21:44:07 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * configure.in: check qsort_r(3) and whether it is GNU version.
- BSD version has different prototype.
-
- * util.h: use qsort_r() as ruby_qsort() if it is GNU version.
-
- * util.c: define ruby_qsort() if needed.
-
-Sat Feb 8 16:34:36 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb (Resolv::DNS::Message::MessageDecoder#get_labels):
- Make it iterative.
-
-Sat Feb 8 15:54:12 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c, gc.h (rb_objspace_marked_object_p): added.
- This function *ONLY* works just after marking phase,
- before any sweeping.
- This function is highly depending current GC implementation
- and can be removed future version.
-
-Sat Feb 8 15:41:37 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb: Don't set CLOEXEC flag explicitly. (Ruby set it by
- default.)
-
-Sat Feb 8 15:27:02 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb (Resolv::DNS::Message::MessageDecoder): Raise
- DecodeError if no data before the limit.
- Reported by Will Bryant. [ruby-core:60557] [Bug #9498]
-
-Sat Feb 8 15:11:21 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c (SMALLBUF): Unused macro removed.
-
-Fri Feb 7 23:37:49 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb: Ignore name servers which cause EAFNOSUPPORT on
- socket creation.
- Reported by Bjoern Rennhak. [ruby-core:60442] [Bug #9477]
-
-Fri Feb 7 21:58:48 2014 Zachary Scott <e@zzak.io>
-
- * lib/open-uri.rb: [DOC] use lower case version of core classes, same
- as commit r44878, based on patch by Jonathan Jackson [Bug #9483]
-
-Fri Feb 7 21:54:53 2014 Zachary Scott <e@zzak.io>
-
- * ext/ripper/lib/ripper/lexer.rb: [DOC] use lower case version of core
- classes when referring to return value, since we aren't directly
- talking about the class. Patch by Jonathan Jackson [Bug #9483]
-
-Fri Feb 7 05:28:38 2014 Eric Wong <e@80x24.org>
-
- * constant.h: reduce rb_const_entry_t size on 64-bit
- Patch by Adam Avilla [ruby-core:60542] [Feature #9496]
-
-Thu Feb 6 15:27:46 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (get_envparam_int): correct warning messages.
-
- * gc.c (get_envparam_double): ditto.
-
-Thu Feb 6 15:17:30 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (get_envparam_int): don't accept a value equals to lowerbound
- (changed by last commit) because "" or "foo" (not a number) strings
- are parsed as 0. They should be rejected.
-
- * gc.c (get_envparam_double): ditto.
-
-Thu Feb 6 09:00:35 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (ruby_gc_set_params): if RUBY_GC_OLDMALLOC_LIMIT is provided,
- then set objspace->rgengc.oldmalloc_increase_limit.
- Without this fix, the env variable RUBY_GC_OLDMALLOC_LIMIT
- does not work.
-
- * gc.c (get_envparam_int): accept a value equals to lowerbound.
-
- * gc.c (get_envparam_double): ditto.
-
-Thu Feb 6 08:23:28 2014 Eric Wong <e@80x24.org>
-
- * ext/thread/thread.c (rb_szqueue_max_set): use correct queue and
- limit wakeups. [Bug #9343][ruby-core:60517]
- * test/thread/test_queue.rb (test_sized_queue_assign_max):
- test for bug
-
-Thu Feb 6 07:18:01 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems: Update to RubyGems 2.2.2. Complete history at:
-
- http://rubygems.rubyforge.org/rubygems-update/History_txt.html#label-2.2.2+%2F+2014-02-05
-
- * test/rubygems: ditto.
-
-Wed Feb 5 20:56:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (to_be_skipped_id): ignore anonymous attributes.
-
- * pack.c (Init_pack): use anonymous ID so that associated objects
- do not appear in the packed result.
-
- * parse.y (rb_make_internal_id): return an anonymous ID for
- internal use.
-
-Wed Feb 5 14:41:56 2014 Koichi Sasada <ko1@atdot.net>
-
- * vsnprintf.c: remove duplicated def of `UNINITIALIZED_VAR()'.
-
-Wed Feb 5 14:40:16 2014 Koichi Sasada <ko1@atdot.net>
-
- * ext/objspace/objspace_dump.c (dump_object): use STR_SHARED_P()
- instead of removed STR_NOCAPA_P() macro.
-
-Wed Feb 5 13:51:33 2014 Koichi Sasada <ko1@atdot.net>
-
- * internal.h, vm_core.h: move LIKELY/UNLIKELY/UNINITIALIZED_VAR()
- macros from vm_core.h to internal.h.
-
- * string.c: remove dependency to "vm_core.h".
-
- * common.mk: ditto.
-
-Wed Feb 5 13:29:01 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (rb_str_free): use FL_TEST(str, STR_SHARED) directly
- because str is not embed.
-
- * string.c (str_replace): remove `FL_SET(str, STR_SHARED)' line
- because STR_SET_SHARED() set STR_SHARED.
-
-Wed Feb 5 13:18:08 2014 Koichi Sasada <ko1@atdot.net>
-
- * internal.h: remove macros STR_NOCAPA and STR_NOCAPA_P().
-
- * string.c (rb_str_resize): remove `STR_SET_NOEMBED(str)' because
- str_make_independent_expand() set NOEMBED flag.
-
- * string.c (rb_str_resize): remove `STR_NOCAPA_P(str)' check because
- `str' is independent (not shared).
-
-Wed Feb 5 12:54:25 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c: refactoring, especially about string flags.
-
- * string.c (STR_UNSET_NOCAPA): removed.
- Use FL_UNSET() with STR_SHARED.
-
- * string.c (rb_str_capacity): check STR_SHARED directly
- because it is not a embed string.
-
- * string.c (rb_str_modify_expand): ditto.
-
- * string.c (rb_str_shared_replace): use STR_SET_SHARED().
-
- * string.c (str_make_independent_expand): remove STR_UNSET_NOCAPA()
- because `str' is not shared string.
-
-Wed Feb 5 12:11:04 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (RESIZE_CAPA): should not resize shared string.
-
-Wed Feb 5 11:46:42 2014 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_mark_children): STR_ASSOC is no longer available.
- Reported by @nagachika.
- http://d.hatena.ne.jp/nagachika/20140204
-
-Wed Feb 5 11:27:22 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c (rb_str_new_frozen): refactoring code.
- * Move code from str_new_frozen_with_klass() (and remove it)
- * `aux.shared' should not be 0 for STR_SHARED strings.
-
-Wed Feb 5 04:23:41 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych.rb: New release of psych.
- * ext/psych/psych.gemspec: ditto
-
-Wed Feb 5 04:16:41 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/yaml/emitter.c: merge libyaml 0.1.5
- * ext/psych/yaml/loader.c: ditto
- * ext/psych/yaml/parser.c: ditto
- * ext/psych/yaml/reader.c: ditto
- * ext/psych/yaml/scanner.c: ditto
- * ext/psych/yaml/writer.c: ditto
- * ext/psych/yaml/yaml_private.h: ditto
-
-Tue Feb 4 19:10:29 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c: use long allocator names instead of numbered
- allocator names.
- * rb_str_new2 -> rb_str_new_cstr
- * rb_str_new4 -> rb_str_new_frozen
- * rb_str_new5 -> rb_str_new_with_class
- * str_new3 -> str_new_shared
- * str_new4 -> str_new_frozen_with_klass
-
-Tue Feb 4 17:20:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): return the filename with actual cases on
- the filesystem if it is case-insensitive. [ruby-core:42469]
- [Feature #5994]
-
-Tue Feb 4 16:16:58 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c: use STR_SHARED instead of ELTS_SHARED.
- (same value, but more clear meaning)
-
-Tue Feb 4 16:09:14 2014 Koichi Sasada <ko1@atdot.net>
-
- * string.c: remove STR_ASSOC related code.
- By r44804, string objects can not have STR_ASSOC flag.
-
- * internal.h: ditto.
-
- * ext/objspace/objspace_dump.c (dump_object): ditto.
-
-Tue Feb 4 14:07:20 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (str_associate, str_associated): keep associated objects
- in an instance variables, instead of in the internal structure.
-
- * string.c (rb_str_associate, rb_str_associated): deprecate.
-
-Tue Feb 4 12:55:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_modify_expand): enable capacity and disable
- association with packed objects when setting capa, so that
- pack("p") string fails to unpack properly after modified.
-
-Tue Feb 4 12:45:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_make_pattern): all alphabets are magic characters on
- case-insensitive filesystems. [ruby-core:42469] [Feature #5994]
-
-Tue Feb 4 09:47:57 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems: Update to RubyGems 2.2.2 prerelease to check fixes to
- CI.
- * test/rubygems: ditto.
-
-Mon Feb 3 12:04:47 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * error.c: [DOC] Exception#cause may return nil. [ci skip]
-
-Sun Feb 2 05:48:42 2014 Eric Wong <e@80x24.org>
-
- * io.c (rb_io_syswrite): add RB_GC_GUARD
- [Bug #9472][ruby-core:60407]
-
-Sat Feb 1 15:09:16 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_typedesc2val): add VT_RECORD case.
-
-Sat Feb 1 06:38:51 2014 Zachary Scott <e@zzak.io>
-
- * lib/drb/drb.rb: [DOC] Add note about start_service for each process
- Based on a patch by @rosenfeld [Fixes GH-514] [ci skip]
- https://github.com/ruby/ruby/pull/514
-
-Sat Feb 1 06:30:20 2014 Zachary Scott <e@zzak.io>
-
- * error.c: [DOC] Document Exception#cause by @jasonrclark [ci skip]
- [Fixes GH-519] https://github.com/ruby/ruby/pull/519
-
-Sat Feb 1 06:10:49 2014 Zachary Scott <e@zzak.io>
-
- * lib/securerandom.rb: [DOC] Add note on require for examples
- Based on a patch by @schneems [Fixes GH-518] [ci skip]
- https://github.com/ruby/ruby/pull/518
-
-Sat Feb 1 06:04:56 2014 Zachary Scott <e@zzak.io>
-
- * numeric.c: [DOC] Fix typo in example for #step [ci skip]
- Patch by @ksss [Fixes GH-522] https://github.com/ruby/ruby/pull/522
-
-Fri Jan 31 17:01:47 2014 Eric Wong <e@80x24.org>
-
- * ext/socket/init.c (rsock_socket0): split out SOCK_CLOEXEC version
- * ext/socket/socket.c (rsock_socketpair0): ditto
- [ruby-core:60377]
-
-Fri Jan 31 03:48:40 2014 Eric Wong <e@80x24.org>
-
- * benchmark/driver: avoid large alloc in driver process
- [ruby-core:59869] [Bug #9430]
-
-Thu Jan 30 14:45:49 2014 Shugo Maeda <shugo@ruby-lang.org>
-
- * configure.in: use $@ instead of $(.TARGET) because .TARGET is not
- supported by GNU make.
-
-Thu Jan 30 08:26:21 2014 Yusuke Endoh <mame@tsg.ne.jp>
-
- * ext/fiddle/closure.c: use sizeof(*pcl) for correct sizeof value.
- [ruby-core:57599] [Bug #8978].
-
-Wed Jan 29 20:08:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (nogvl_copy_stream_sendfile): check socket on other than
- linux, as sendfile(2) on non-socket fd works only on linux.
- [Feature #9427]
-
-Wed Jan 29 18:09:48 2014 Eric Wong <e@80x24.org>
-
- * io.c (nogvl_copy_stream_sendfile): remove socket check
- [ruby-core:59856][Feature #9427]
-
-Wed Jan 29 04:29:54 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/openssl/ossl_ssl.c: pass read_nonblock options to underlying IO
- when SSL session has not been started.
-
- * test/openssl/test_ssl.rb: test for change.
-
-Wed Jan 29 03:49:36 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/fiddle/closure.c: use sizeof(*pcl) for correct sizeof value.
- [ruby-core:57599] [Bug #8978]. Thanks mame!
-
-Wed Jan 29 03:36:42 2014 Eric Wong <e@80x24.org>
-
- * doc/contributing.rdoc: allow/encourage other git hosts
- [ruby-core:59807][misc #9421]
-
-Tue Jan 28 23:36:01 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket: Avoid redundant fcntl/fstat syscalls for cloexec
- sockets.
- Patch by Eric Wong. [ruby-core:59429] [Feature #9330]
-
-Tue Jan 28 20:51:07 2014 Tanaka Akira <akr@fsij.org>
-
- * process.c (READ_FROM_CHILD): Apply the last hunk of
- 0001-process.c-avoid-EINTR-from-Process.spawn.patch written by
- Eric Wong in [Bug #8770].
-
-Tue Jan 28 16:31:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (ruby_init_stack, ruby_stack_overflowed_p):
- place get_stack above others to get stack boundary information.
- [ruby-core:60113] [Bug #9454]
-
-Tue Jan 28 15:27:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
-
- * thread_pthread.c: rlimit is only available on Linux.
- At least r44712 breaks FreeBSD.
- [ruby-core:60113] [Bug #9454]
-
-Tue Jan 28 15:17:59 2014 Zachary Scott <e@zzak.io>
-
- * lib/set.rb: [DOC] Add examples for Set#intersect? and Set#disjoint?
- Patch by xavier nayrac [Bug #9331] [ci skip]
-
-Tue Jan 28 15:12:22 2014 Zachary Scott <e@zzak.io>
-
- * ext/zlib/zlib.c (rb_zlib_adler32): [DOC] Add example for adler32
- Patch by Vajrasky Kok [Bug #9307] [ci skip]
-
-Tue Jan 28 08:56:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
-
- * compile.c (iseq_build_from_ary_body): Use :blockptr instead of :block
- as hash key when loading serialized instruction sequences from arrays.
- [Bug #9455] [ruby-core:60146]
-
-Mon Jan 27 21:52:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c: get current main thread stack size, which may
- be expanded than allocated size at initialization, by rlimit().
- [ruby-core:60113] [Bug #9454]
-
-Sat Jan 25 22:17:02 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * README.ja.md, README.md: update the controller address of
- mailing lists.
-
-Sat Jan 25 14:50:42 2014 Eric Wong <normalperson@yhbt.net>
-
- * process.c (send_child_error): retry write on EINTR to fix
- occasional Errno::EINTR from Process.spawn.
-
- * process.c (recv_child_error): retry read on EINTR to fix
- occasional Errno::EINTR from Process.spawn.
-
-Sat Jan 25 14:21:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_compile_each): result of assignment should be
- its rhs instead of returned value from a method.
- [ruby-core:60071] [Bug #9448]
-
-Sat Jan 25 11:16:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_extract_keywords): treat nil keyword_hash same as 0,
- for the case rb_scan_args returns nil if no keyword hash.
-
-Fri Jan 24 15:13:20 2014 Zachary Scott <e@zzak.io>
-
- * lib/racc/rdoc/grammar.en.rdoc: [DOC] Correct grammar and typos
- Patch by Giorgos Tsiftsis [Bug #9429] [ci skip]
-
-Thu Jan 23 20:20:17 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/envutil.rb: try to wait a bit (0.1sec) when ruby process
- exits by signals because some SEGV tests fail because of not enough
- error output.
-
-Thu Jan 23 20:06:27 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_settracefunc.rb: check the target thread.
-
-Thu Jan 23 19:59:16 2014 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_settracefunc.rb: check the target thread.
-
-Thu Jan 23 14:26:44 2014 Zachary Scott <e@zzak.io>
-
- * lib/fileutils.rb: [DOC] Fix typo in options_of() example [Bug #9392]
- Patch by Giorgos Tsiftsis
-
-Thu Jan 23 13:56:16 2014 Zachary Scott <e@zzak.io>
-
- * README -> README.md: [DOC] Format README with Markdown [Bug #9255]
- * README.ja -> README.ja.md: ditto
-
-Wed Jan 22 15:59:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/thread/thread.c (Init_thread): ConditionVariable and Queue
- are not able to copy. [ruby-core:59961] [Bug #9440]
-
-Tue Jan 21 20:14:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (rb_thread_create_timer_thread): fix for platforms
- where PTHREAD_STACK_MIN is a dynamic value and not a compile-time
- constant. [ruby-dev:47911] [Bug #9436]
-
-Tue Jan 21 17:55:09 2014 Zachary Scott <e@zzak.io>
-
- * lib/uri/common.rb: [DOC] Use static w3.org uri [ci skip]
- Patch by @ykzts [Fix GH-484] https://github.com/ruby/ruby/pull/484
-
-Tue Jan 21 16:43:22 2014 Zachary Scott <e@zzak.io>
-
- * enum.c: [DOC] Add simple example of Enumerable#zip [ci skip]
- Patch by @nruth on documenting-ruby/ruby#22
- https://github.com/documenting-ruby/ruby/pull/22
-
-Tue Jan 21 16:26:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (rb_thread_create_timer_thread): expand timer
- thread stack size to get rid of segfault on FreeBSD/powerpc64.
- based on the patch by Steve Wills at [ruby-core:59923].
- [ruby-core:56590] [Bug #8783]
-
-Tue Jan 21 04:31:23 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c: Use "int" for IP_MULTICAST_LOOP and
- IP_MULTICAST_TTL on Mac OS X and Windows.
-
-Tue Jan 21 00:39:15 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c: Use "byte" as default argument for
- IP_MULTICAST_LOOP and IP_MULTICAST_TTL socket option to follow
- the original multicast implementation.
-
-Mon Jan 20 20:20:27 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c: Use preprocessor macros to avoid repeated
- conditionals.
-
-Mon Jan 20 13:55:03 2014 Zachary Scott <e@zzak.io>
-
- * lib/rubygems/version.rb: [DOC] Use gender-neutral pronouns [ci skip]
- * lib/rubygems/security.rb: ditto
-
-Sun Jan 19 06:38:48 2014 Benoit Daloze <eregontp@gmail.com>
-
- * compar.c (cmp_equal): warn for this release and still rescue
- standard exceptions for a nicer transition. See #7688.
- Partly reverts r44502.
-
- * test/ruby/test_comparable.rb: adapt assertion to match new behavior.
-
-Sun Jan 19 06:27:18 2014 Benoit Daloze <eregontp@gmail.com>
-
- * test/ruby/test_comparable.rb: specify behavior for the different
- kind of exceptions rescued (or not) by Comparable#==.
-
-Sat Jan 18 23:12:19 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket: Avoid unnecessary ppoll/select on Linux.
- Patch by Eric Wong. [ruby-core:57950] [Bug #9039]
-
-Sat Jan 18 22:57:44 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/resolv.rb (Resolv::DNS::Resource::TXT#data): Return concatenated
- string.
- Patch by Ryan Brunner. [ruby-core:58220] [Bug #9093]
-
-Sat Jan 18 22:35:15 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c (rb_update_max_fd): Return immediately if the given fd is small
- enough.
-
-Sat Jan 18 22:25:53 2014 Tanaka Akira <akr@fsij.org>
-
- * io.c: Test O_CLOEXEC only once.
- Patch by Eric Wong. [ruby-core:59419] [Feature #9328]
-
-Sat Jan 18 21:24:49 2014 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/option.c: IP_MULTICAST_LOOP and IP_MULTICAST_TTL socket
- option takes a byte on OpenBSD.
- Fixed by Jeremy Evans. [ruby-core:59496] [Bug #9350]
-
-Sat Jan 18 21:19:04 2014 Tanaka Akira <akr@fsij.org>
-
- * lib/open-uri.rb: Make proxy disabling working again.
- Fixed by Christophe Philemotte. [ruby-core:59650] [Bug #9385]
-
-Fri Jan 17 20:05:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/delegate.rb (Delegator): keep source information methods
- which start and end with '__'. [ruby-core:59718] [Bug #9403]
-
-Fri Jan 17 17:58:04 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_mod_s_constants): return its own constants for other
- than Module itself. [ruby-core:59763] [Bug #9413]
-
-Tue Jan 16 00:17:00 2014 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.gemspec: bigdecimal version 1.2.5.
-
-Wed Jan 15 20:30:31 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * io.c (io_binwrite): use writev(2) to avoid double write if available.
-
- * configure.in: check writev(2)
-
-Wed Jan 15 14:04:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (get_encoding): respect BOM on pseudo encodings.
- [ruby-dev:47895] [Bug #9415]
-
-Wed Jan 15 14:03:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (get_actual_encoding): get actual encoding according to
- the BOM if exists.
-
- * string.c (rb_str_inspect): use according encoding, instead of
- pseudo encodings, UTF-{16,32}. [ruby-core:59757] [Bug #8940]
-
-Tue Jan 14 21:07:22 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * ext/thread/thread.c (rb_szqueue_clear): notify SZQUEUE_WAITERS
- on SizedQueue#clear. [ruby-core:59462] [Bug #9342]
-
- * test/thread/test_queue.rb: add test. the patch is from
- Justin Collins.
-
-Tue Jan 14 15:58:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (CLASS_NAME): macro to wrap
- depending on PRIsVALUE for 1.9. [Backport #9406]
-
- * ext/bigdecimal/bigdecimal.c (DECIMAL_SIZE_OF_BITS): fallback
- definition for 2.1 or older. [ruby-core:59750] [Backport #9406]
-
-Tue Jan 14 11:28:44 2014 Yuki Yugui Sonoda <yugui@google.com>
-
- * vm_exec.c (cfp): Fixes a SEGV issue in r44554.
- r11 can be broken by subroutine and sometimes causes SEGV at
- runtime. Use r13 instead.
-
-Tue Jan 14 02:20:00 2014 Kenta Murata <mrkn@mrkn.jp>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_divide): Add an additional
- digit for the quotient to be compatible with bigdecimal 1.2.1 and
- the former. [ruby-core:59365] [#9316] [#9305]
-
- * test/bigdecimal/test_bigdecimal.rb: tests for the above change.
-
- * ext/bigdecimal/bigdecimal.gemspec: bigdecimal version 1.2.4.
-
-Mon Jan 13 14:55:31 2014 Zachary Scott <e@zzak.io>
-
- * lib/xmlrpc/client.rb: [DOC] Remove note about SSL package on RAA
- Since RAA has been deprecated, and the SSL package has been replaced
- with net/https this statement is entirely false and should be
- deleted. [Bug #9152]
-
-Mon Jan 13 14:47:07 2014 Zachary Scott <e@zzak.io>
-
- * lib/net/smtp.rb: [DOC] Remove dead link to RAA by Giorgos Tsiftsis
- Fixes the following bugs: [Bug #9152] [Bug #9268] [Bug #9394]
- * lib/open-uri.rb: ditto
-
-Mon Jan 13 14:25:55 2014 Zachary Scott <e@zzak.io>
-
- * ext/openssl/ossl_pkey_dh.c: Fixed typo by Sandor Szuecs [Bug #9243]
-
-Mon Jan 13 12:03:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
-
- * ext/thread/thread.c (rb_szqueue_push): check GET_SZQUEUE_WAITERS
- instead of GET_QUEUE_WAITERS to prevent deadlock. Patch by Eric Wong.
- [Bug #9302] [ruby-core:59324]
-
- * test/thread/test_queue.rb: add test
-
-Sun Jan 12 16:41:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (iseq_load): keep type_map to get rid of memory leak.
- based on a patch by Eric Wong at [ruby-core:59699]. [Bug #9399]
-
-Sun Jan 12 09:21:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/util.h (DECIMAL_SIZE_OF_BITS): a preprocessor
- constant macro to approximate decimal representation size of n-bits
- integer.
-
- * iseq.c (register_label): use DECIMAL_SIZE_OF_BITS for better
- approximation.
-
- * ext/bigdecimal/bigdecimal.c (BigMath_s_log): ditto.
-
- * common.mk (iseq.o), ext/bigdecimal/depend (bigdecimal.o): add
- dependency to ruby/util.h for DECIMAL_SIZE_OF_BITS.
-
-Fri Jan 10 16:27:20 2014 Yuki Yugui Sonoda <yugui@google.com>
-
- * vm_exec.c (cfp): Avoid generating invalid binary for
- NativeClient.
- r15 on x86_64 is reserved by NativeClient. So r15 to cfp used to
- generate invalid binary under some combinations of compiler
- optimization flags.
-
-Fri Jan 10 18:01:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_search_super_method): allow bound method from a
- module, yet another method transplanting.
-
-Fri Jan 10 13:34:04 2014 Aman Gupta <ruby@tmm1.net>
-
- * insns.def (opt_aref_with): new instruction to optimize Hash#[],
- removing any allocation overhead when used with a string literal
- key. Patch by normalperson (Eric Wong). [ruby-core:59640] [Bug #9382]
- * insns.def (opt_aset_with): new instruction to optimize Hash#[]=
- * compile.c (iseq_compile_each): compiler shortcuts for new
- instructions
- * hash.c (static VALUE rb_hash_compare_by_id_p): fix documentation for
- Hash#compare_by_identity to reflect frozen string sharing
- * test/ruby/test_hash.rb (class TestHash): test for new behavior
-
-Fri Jan 10 06:23:21 2014 Benoit Daloze <eregontp@gmail.com>
-
- * range.c (Range#size): [DOC] improve description and add examples.
- Patch by @skade. [Fixes GH-501]
-
-Fri Jan 10 00:47:52 2014 Josef Stribny <strzibny@gmail.com>
-
- * ext/tk/extconf.rb: fix to pass arrays instead of strings to
- libpathflag. patch at [ruby-core:59665]. [Bug #9386]
-
-Thu Jan 9 20:49:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: -mstackrealign is necessary for -msse2 working.
- [ruby-core:54716] [Bug #8349]
-
- * configure.in: use SSE2 instructions to drop unexpected precisions on
- other than mingw. [ruby-core:59472] [Bug #8358]
-
-Thu Jan 9 20:31:10 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * hash.c (rb_objid_hash): should return `long'. brushup r44534.
-
- * object.c (rb_obj_hash): follow above change.
-
-Thu Jan 9 19:12:37 2014 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (rb_vm_pop_cfunc_frame): added. It cares c_return event.
- The patch base by drkaes (Stefan Kaes).
- [Bug #9321]
-
- * variable.c (rb_mod_const_missing): use rb_vm_pop_cfunc_frame()
- instead of rb_frame_pop().
-
- * vm_eval.c (raise_method_missing): ditto.
-
- * vm_eval.c (rb_iterate): ditto.
-
- * internal.h (rb_vm_pop_cfunc_frame): add decl.
-
- * test/ruby/test_settracefunc.rb: add tests.
- provided by drkaes (Stefan Kaes).
-
- * vm.c, eval.c, include/ruby/intern.h (rb_frame_pop):
- move definition of rb_frame_pop() and deprecate it.
- It doesn't care about `return' events.
-
-Thu Jan 9 17:40:28 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * hash.c (rb_any_hash): should treat the return value of rb_objid_hash()
- as `long', because ruby assumes the hash value of the object id of
- an object is `long'.
- this fixes test failures on mswin64 introduced at r44525.
-
-Thu Jan 9 09:55:20 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb: dumping strings with
- quotes should not have changed. [ruby-core:59316] [Bug #9300]
-
- * ext/psych/lib/psych.rb: fixed missing require.
-
- * test/psych/test_string.rb: test
-
-Thu Jan 9 09:51:00 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-
- * ext/psych/lib/psych/visitors/to_ruby.rb: anonymous structs
- should be able to roundtrip. Thanks @splattael!
-
- * test/psych/test_object_references.rb: test for change
-
-Wed Jan 8 22:53:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_search_super_method): when super called in a
- bound UnboundMethod generated from a module, no superclass is
- found since the current defined class is the module, then call
- method_missing in that case. [ruby-core:59619] [Bug #9377]
-
-Wed Jan 8 15:55:21 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_objid_hash): return hash value from object ID with a
- salt, extract from rb_any_hash().
-
- * object.c (rb_obj_hash): return same value as rb_any_hash().
- fix r44125. [ruby-core:59638] [Bug #9381]
-
-Wed Jan 8 13:12:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/timeout.rb (Timeout::ExitException.catch): pass arguments
- for new instance.
-
- * lib/timeout.rb (Timeout::ExitException#exception): fallback to
- Timeout::Error if couldn't throw. [ruby-dev:47872] [Bug #9380]
-
- * lib/timeout.rb (Timeout#timeout): initialize ExitException with
- message for the fallback case.
-
-Tue Jan 7 12:43:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/timeout.rb (Timeout#timeout): should not rescue ordinarily
- raised ExitException, which should not be thrown.
-
- * lib/timeout.rb (Timeout::ExitException.catch): set @thread only if
- it ought to be caught.
-
- * lib/timeout.rb (Timeout#timeout): when a custom exception is given,
- no instance is needed to be caught, so defer creating new instance
- until it is raised. [ruby-core:59511] [Bug #9354]
-
-Tue Jan 7 10:16:02 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems: Update to RubyGems master 21e409d / RubyGems 2.2.1.
-
- See http://rubygems.rubyforge.org/rubygems-update/History_txt.html
- for a list of bug fixes.
-
- * test/rubygems: ditto.
-
-Tue Jan 7 10:10:46 2014 Eric Wong <e@80x24.org>
-
- * ext/json/generator/depend: add build dependencies for json extension
- [Bug #9374] [ruby-core:59609]
- * ext/json/parser/depend: ditto
-
-Tue Jan 7 04:35:46 2014 Aman Gupta <ruby@tmm1.net>
-
- * array.c (ary_add_hash): Fix consistency issue between Array#uniq and
- Array#uniq! [Bug #9340] [ruby-core:59457]
- * test/ruby/test_array.rb (class TestArray): regression test for above.
-
-Mon Jan 6 21:28:48 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * .gitignore: ignore *-fake.rb generated even when CROSS_COMPILING = no
- since r42862.
-
-Sun Jan 5 20:14:14 2014 Benoit Daloze <eregontp@gmail.com>
-
- * compar.c (cmp_equal): remove error hiding in Comparable#==.
- Comparable#== no longer rescues exceptions silently.
- This was the cause of quite a couple bugs. See #7688. [EXPERIMENTAL]
-
- * test/ruby/test_comparable.rb: adapt assertion to match new behavior.
-
- * lib/rdoc/method_attr.rb: fix bugs discovered by this change.
-
- * test/rdoc/test_rdoc_normal_class.rb: fix bugs in tests.
-
-Sat Jan 4 22:44:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
-
- * struct.c (rb_struct_set): return assigned value from setter method
- rather than struct object. [Bug #9353] [ruby-core:59509]
-
- * test/ruby/test_struct.rb (test_setter_method_returns_value): add test
-
-Sat Jan 4 21:44:31 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/ruby/test_gc.rb (TestGc#test_latest_gc_info): use
- GC.stat(:key) instead of GC.stat.
-
-Sat Jan 4 19:15:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (rsock_syserr_fail_host_port): use format flags,
- '+' to inspect, ' ' to quote unprintables.
-
- * ext/socket/socket.c (rsock_syserr_fail_path): ditto.
-
- * ext/socket/socket.c (rsock_syserr_fail_raddrinfo): ditto.
-
- * ext/socket/socket.c (rsock_syserr_fail_host_port): add errno
- argument version and use rb_syserr_fail_str() instead of
- rb_sys_fail_str() with restoring errno.
-
- * ext/socket/socket.c (rsock_syserr_fail_path): ditto, and
- rb_syserr_fail().
-
- * ext/socket/socket.c (rsock_sys_fail_sockaddr): ditto, use
- rsock_syserr_fail_raddrinfo().
-
- * ext/socket/socket.c (rsock_sys_fail_raddrinfo): ditto.
-
- * ext/socket/socket.c (setup_domain_and_type): ditto.
-
-Sat Jan 4 17:18:58 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * vm.c (RubyVM::OPTS): get rid of a garbage character.
-
-Sat Jan 4 10:17:54 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rinda/ring.rb (Rinda::RingFinger#make_socket): Use
- ipv4_multicast_ttl option for portability.
-
-Sat Jan 4 10:15:47 2014 Eric Hodel <drbrain@segment7.net>
-
- * lib/rinda/ring.rb (Rinda::RingFinger#make_socket): Use
- ipv4_multicast_loop option for portability. Patch by Jeremy Evans.
- [ruby-trunk - Bug #9351]
-
-Fri Jan 3 19:09:00 2014 Eric Wong <normalperson@yhbt.net>
-
- * ext/socket/socket.c (rsock_sys_fail_host_port): save and restore errno
- before calling rb_sys_fail_str to prevent [BUG] errno == 0.
- Patch by Eric Wong. [ruby-core:59498] [Bug #9352]
-
- * ext/socket/socket.c (rsock_sys_fail_path): ditto
- * ext/socket/socket.c (rsock_sys_fail_sockaddr): ditto
- * ext/socket/socket.c (rsock_sys_fail_raddrinfo): ditto
- * ext/socket/socket.c (rsock_sys_fail_raddrinfo_or_sockaddr): ditto
-
-Fri Jan 3 10:43:57 2014 Aman Gupta <ruby@tmm1.net>
-
- * test/net/imap/cacert.pem: generate new CA cert, since the last one
- expired. [Bug #9341] [ruby-core:59459]
- * test/net/imap/server.crt: new server cert signed with updated CA.
- * test/net/imap/Makefile: add `make regen_certs` to automate this
- process.
-
-Fri Jan 3 00:09:54 2014 Benoit Daloze <eregontp@gmail.com>
-
- * ext/bigdecimal: update class method call style from :: to .
- in documentation and usage.
-
- * ext/bigdecimal/lib/bigdecimal/math.rb: [DOC] fix examples values.
- Computations were made using ruby 2.0.0p247 to ensure
- no effect of the recent BigDecimal bug.
-
- * ext/bigdecimal/sample/nlsolve.rb: fix indent.
-
-Thu Jan 2 16:07:21 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * io.c (io_fwrite): freeze converted str.
-
-Thu Jan 2 04:15:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_longjmp): remove an extra modifier from the forward
- declaration to match the actual definition. [ruby-core:59451]
- [Bug #9338]
-
-Thu Jan 2 01:23:30 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * vm_eval.c (method_missing): use ALLOCV_N() instead of
- ALLOCA_N() and rb_ary_tmp_new().
-
-Thu Jan 2 00:53:16 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * array.c (rb_ary_zip): use ALLOCV_N() instead of ALLOCA_N().
-
-Thu Jan 2 00:04:29 2014 Masaki Matsushita <glass.saga@gmail.com>
-
- * hash.c (rb_hash_keys): make rb_hash_keys() static.
- it is no longer used from array.c since r43969.
- the patch is from normalperson (Eric Wong).
- [ruby-core:59449] [Feature #9336]
-
- * internal.h: remove definition of rb_hash_keys().
-
-Wed Jan 1 18:19:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: reset LDFLAGS and DLDFLAGS for opt-dir again after
- LIBPATHFLAG and RPATHFLAG are set. [ruby-dev:47868] [Bug #9317]
-
-Wed Jan 1 11:12:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: use SSE2 instructions for drop unexpected
- precisions. [ruby-core:54738] [Bug #8358]
-
-Tue Dec 31 23:49:07 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_f_raise): add cause: optional keyword argument.
- [ruby-core:58610] [Feature #8257] [EXPERIMENTAL]
-
-Tue Dec 31 21:44:17 2013 Akio Tajima <artonx@yahoo.co.jp>
-
- * win32/Makefile.sub: remove HAVE_FSEEKO because fseeko removed from win32/win32.c
- Fixed [Bug #9333].
-
-Tue Dec 31 21:02:27 2013 Masaki Matsushita <glass.saga@gmail.com>
-
- * io.c (io_fwrite): allocate frozen str only when str is not converted.
-
-Tue Dec 31 15:44:48 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (RbConfig): expand RUBY_SO_NAME for extensions
- backward compatibility. [ruby-core:59426] [Bug #9329]
-
-Mon Dec 30 23:33:07 2013 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-
- * variable.c: [DOC] adding extra example in docs.
- patched by Steve Klabnik. [Bug #9210]
-
-Mon Dec 30 18:34:18 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * encoding.c (must_encindex, rb_enc_from_index, rb_obj_encoding): mask
- encoding index and ignore dummy flags. [ruby-core:59354] [Bug #9314]
-
-Mon Dec 30 16:11:52 2013 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * tool/make-snapshot: needs CXXFLAGS. [ruby-core:59393][Bug #9320]
-
-Sun Dec 29 18:36:54 2013 Shota Fukumori <her@sorah.jp>
-
- * lib/mkmf.rb (configuration): Make CXXFLAGS customizable.
- Patch by Kohei Suzuki (eagletmt). [Fixes GH-492]
-
-Sun Dec 29 12:11:11 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (mnew_from_me): keep iclass as-is, to make inheritance
- chain consistent. [ruby-core:59358] [Bug #9315]
-
- * proc.c (method_owner): return the original defined_class from
- prepended iclass, instead.
-
-Sun Dec 29 08:47:24 2013 Lucas Allan Amorim <lucas.allan@gmail.com>
-
- * test/ruby/test_sprintf.rb (test_hash): Added tests for sprintf
- with a hash as parameter. [Fixes GH-491]
-
-Sun Dec 29 07:27:51 2013 Benoit Daloze <eregontp@gmail.com>
-
- * compar.c (cmp_eq_recursive): Fix the return value, the value for
- failed #<=> should be nil. It was raising a NoMethodError for
- the test case TestComparable#test_no_cmp (undefined method `>'
- for false:FalseClass). Yet one more reason for #7688.
-
-Sat Dec 28 22:21:59 2013 Benoit Daloze <eregontp@gmail.com>
-
- * object.c (Kernel#<=>) surround Comparable operators with <code> tags.
- The #== method was hidden in ri/rdoc's output and was highlighting
- the line instead.
-
-Sat Dec 28 17:24:00 2013 DV Suresh <e@dvsuresh.me>
-
- * benchmark/bm_so_meteor_contest.rb: [DOC] Fix a few typos
- * ext/fiddle/lib/fiddle/import.rb: ditto
- * ext/psych/lib/psych.rb: ditto
- * ext/psych/lib/psych/nodes/sequence.rb: ditto
- * ext/tk/lib/multi-tk.rb: ditto
- * ext/tk/lib/tcltk.rb: ditto
-
-Sat Dec 28 00:42:37 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (local_push_gen, local_pop_gen): save cmdarg_stack to
- isolate command argument state from outer scope.
- [ruby-core:59342] [Bug #9308]
-
-Fri Dec 27 13:25:03 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/{setup.mak,Makefile.sub}: update fake.rb like
- template/fake.rb.in.
-
-Thu Dec 26 16:10:41 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (fake.rb): should depend on version.h because
- if RUBY_VERSION is updated, fake.rb need to say the new version
- to avoid install error in rbconfig.rb.
-
-Thu Dec 26 14:25:03 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (HASH_REJECT_COPY_EXTRA_STATES): turn off the old
- behavior, copying extra states by accident.
-
-Thu Dec 26 10:49:14 2013 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * version.h (RUBY_VERSION): 2.2.0 development has started.
-
-Thu Dec 26 10:27:53 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/merger.rb (tag): support 2.1.1 semi-automatic tagging and 2.2.0
- explicit tagging.
-
-Thu Dec 26 06:35:25 2013 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * proc.c: Having any mandatory keyword argument increases min arity
- [#9299]
-
-Thu Dec 26 06:27:08 2013 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * proc.c: Having optional keyword arguments makes maximum arity +1,
- not unlimited [#8072]
-
-Thu Dec 26 01:09:57 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/release.sh: make symbolic links.
-
-Thu Dec 26 00:45:33 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/make-snapshot: support new version scheme.
-
-Wed Dec 25 22:44:14 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_set_arguments): set arg_keyword_check from
- nd_cflag, which is set by parser. internal ID is used for
- unnamed keyword rest argument, which should be separated from no
- keyword check.
-
- * iseq.c (rb_iseq_parameters): if no keyword check, keyword rest is
- present.
-
- * parse.y (new_args_tail_gen): set keywords check to nd_cflag, which
- equals to that keyword rest is not present.
-
-Wed Dec 25 22:32:19 2013 Zachary Scott <e@zzak.io>
-
- * lib/abbrev.rb: [DOC] rdoc format patch by Giorgos Tsiftsis [Bug #9146]
-
-Wed Dec 25 20:30:10 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (rb_iseq_parameters): push argument type symbol only for
- unnamed rest keywords argument.
-
-Wed Dec 25 20:28:48 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (rb_iseq_min_max_arity): maximum argument is unlimited if
- having rest keywords argument. [ruby-core:53298] [Bug #8072]
-
-Wed Dec 25 18:29:22 2013 Koichi Sasada <ko1@atdot.net>
-
- * vm_insnhelper.c (argument_error): insert dummy frame to make
- a backtrace object intead of modify backtrace string array.
- [Bug #9295]
-
- * test/ruby/test_backtrace.rb: add a test for this patch.
- fix test to compare a result of Exception#backtrace with
- a result of Exception#backtrace_locations.
-
-Wed Dec 25 13:00:54 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: let mingw do something black-magic, and check if
- _gmtime64_s() is available actually.
-
- * win32/win32.c (gmtime_s, localtime_s): use _gmtime64_s() and
- _localtime64_s() if available, not depending on very confusing
- mingw variants macros. based on the patch by phasis68 (Heesob
- Park) at [ruby-core:58764]. [ruby-core:58391] [Bug #9119]
-
-Wed Dec 25 12:33:41 2013 Yusuke Endoh <mame@tsg.ne.jp>
-
- * sample/trick2013/: added the award-winning entries of TRICK 2013.
- See https://github.com/tric/trick2013 for the contest outline.
- (Matz has approved the attachment.)
-
-Wed Dec 25 10:42:02 2013 Yamashita Yuu <yamashita@geishatokyo.com>
-
- * ext/openssl/ossl_ssl.c (Init_ossl_ssl): Declare a constant
- `OP_MSIE_SSLV2_RSA_PADDING` only if the macro is defined. The
- `SSL_OP_MSIE_SSLV2_RSA_PADDING` has been removed from latest
- snapshot of OpenSSL 1.0.1. [Fixes GH-488]
-
-Wed Dec 25 01:03:00 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (bind_local_variables): allowing binding to list its
- local variables. patch by Jack Danger Canty <jackdanger AT
- squareup.com> at [ruby-core:56543]. [Feature #8773]
-
-Tue Dec 24 23:20:38 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/fileutils/fileasserts.rb (assert_ownership_user): new
- assertion for user ownership.
-
- * test/fileutils/test_fileutils.rb (test_chown_error),
- (test_chown_without_permission, test_chown_with_root):
- based on the patch by vajrasky (Vajrasky Kok) at
- [ruby-core:59298]. [Feature #9292]
-
-Tue Dec 24 16:28:05 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (rb_mod_define_method): consider visibility only if self
- in the caller is same as the receiver, otherwise make public as
- well as old behavior. [ruby-core:57747] [Bug #9005]
- [ruby-core:58497] [Bug #9141]
-
- * vm.c (rb_vm_cref_in_context): return ruby level cref if self is
- same.
-
-Tue Dec 24 14:13:14 2013 Koichi Sasada <ko1@atdot.net>
-
- * README.EXT: add a refer to URL.
-
-Tue Dec 24 13:48:45 2013 Koichi Sasada <ko1@atdot.net>
-
- * README.EXT: add a document about RGenGC.
- Reviewed by havenwood.
- [misc #8962]
-
- * README.EXT.ja: ditto.
-
-Tue Dec 24 12:11:43 2013 Koichi Sasada <ko1@atdot.net>
-
- * include/ruby/ruby.h (RARRAY_ASET): try to avoid compiler warning.
- [Bug #9287]
-
-Tue Dec 24 05:04:56 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/fileutils/test_fileutils.rb (setup): should not call
- Process.groups for Windows. get rid of many errors introduced by
- r44364.
-
-Mon Dec 23 18:37:16 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/fileutils/fileasserts.rb (assert_ownership_group): new
- assertion for group ownership.
-
- * test/fileutils/test_fileutils.rb (test_chown{,_verbose,_noop}):
- based on the patch by vajrasky (Vajrasky Kok) at
- [ruby-core:59281]. [Feature #9286]
-
-Mon Dec 23 15:53:45 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (HAS_EXTRA_STATES): warn extra states only when something
- differ. [ruby-core:59254] [Bug #9275]
-
-Mon Dec 23 12:42:13 2013 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * array.c: Have to_h raise on elements that are not key-value pairs
- [#9239]
-
- * enum.c: ditto
-
-Mon Dec 23 05:01:55 2013 Zachary Scott <e@zzak.io>
-
- * doc/syntax/methods.rdoc: [DOC] Added example for underscore
- conventions in method names. Also added doc to clarify encoding
- character set support for Ruby programs and elaborated on defining
- predicate and bang methods. Based on a patch by @gaurish
- [Fixes GH-477] https://github.com/ruby/ruby/pull/477
-
-Mon Dec 23 03:18:09 2013 Zachary Scott <e@zzak.io>
-
- * doc/ChangeLog-1.9.3: [DOC] Fix typos by @dvsuresh
- [Fixes GH-485] https://github.com/ruby/ruby/pull/485
- * ext/openssl/ossl_config.c: ditto
- * lib/rss/utils.rb, lib/time.rb: ditto
- * test/ruby/envutil.rb: ditto
-
-Sun Dec 22 23:56:56 2013 Zachary Scott <e@zzak.io>
-
- * lib/{rake,rdoc,rss}/*, test/rexml/test_listener.rb: [DOC] Fix typos
- by @dvsuresh [Fixes GH-486] https://github.com/ruby/ruby/pull/486
-
-Sun Dec 22 11:08:47 2013 Eric Hodel <drbrain@segment7.net>
-
- * test/rubygems/test_gem_ext_builder.rb: Fix warning due to ambiguous
- expression.
-
-Sun Dec 22 11:05:53 2013 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems/commands/install_command.rb: Restore gem install
- --ignore-dependencies for remote gems
- * test/rubygems/test_gem_commands_install_command.rb: Test for the
- above.
-
-Sun Dec 22 10:23:40 2013 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc.rb: Set RDoc to release version.
-
-Sun Dec 22 10:19:07 2013 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems.rb: Set RubyGems to release version.
-
-Sun Dec 22 10:16:08 2013 Eric Hodel <drbrain@segment7.net>
-
- * lib/rubygems.rb (module Gem): Fix comment for
- Gem::load_path_insert_index.
-
-Sun Dec 22 04:07:55 2013 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (ruby_gc_set_params): don't show obsolete warnings for
- RUBY_FREE_MIN/RUBY_HEAP_MIN_SLOTS if
- RUBY_GC_HEAP_FREE_SLOTS/RUBY_GC_HEAP_INIT_SLOTS are given.
- [Bug #9276]
-
-Sat Dec 21 13:00:20 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c: remove unnecessary the source path from EEXIST error
- messages and show the destination path only. [ruby-core:59202]
- [Feature #9263]
-
-Sat Dec 21 12:37:19 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/resolv.rb (Resolv::Hosts#lazy_initialize): should not
- consider encodings in hosts file. [ruby-core:59239] [Bug #9273]
-
- * lib/resolv.rb (Resolv::Config.parse_resolv_conf): ditto.
-
-Sat Dec 21 05:43:27 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/make-snapshot: replace RUBY_PATCHLEVEL_STR in version.h to
- show users that this ruby is a preview/rc version.
-
-Sat Dec 21 05:03:49 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (fake.rb): fixed wrong RUBY_PLATFORM, to correctly
- install win32.h.
- [ruby-core:58801][Bug #9199] reported by arton.
-
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-coding: us-ascii
-add-log-time-format: (lambda ()
- (let* ((time (current-time))
- (system-time-locale "C")
- (diff (+ (cadr time) 32400))
- (lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
- (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
-vim: tabstop=8 shiftwidth=2
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
index b97a08d928..35a8e75876 100644
--- a/KNOWNBUGS.rb
+++ b/KNOWNBUGS.rb
@@ -1,5 +1,7 @@
#
-# This test file concludes tests which point out known bugs.
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
# So all tests will cause failure.
#
-
diff --git a/LEGAL b/LEGAL
index 24e36e6231..2a7964e771 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,116 +1,342 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
+[addr2line.c]
- These files are licensed under the CC0.
+ A part of this file is from FreeBSD.
- http://creativecommons.org/choose/zero/
+ >>>
+ Copyright (c) 1986, 1988, 1991, 1993::
+ The Regents of the University of California. All rights reserved.
-ccan/list/list.h
+ (c) UNIX System Laboratories, Inc.
- This file is licensed under the MIT License.
+ All or some portions of this file are derived from material licensed
+ to the University of California by American Telephone and Telegraph
+ Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ the permission of UNIX System Laboratories, Inc.
- Permission is hereby granted, free of charge, to any person obtaining a copy
- of this software and associated documentation files (the "Software"), to deal
- in the Software without restriction, including without limitation the rights
- to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
- copies of the Software, and to permit persons to whom the Software is
- furnished to do so, subject to the following conditions:
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 4. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
- The above copyright notice and this permission notice shall be included in
- all copies or substantial portions of the Software.
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
- THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
- When this software is partly used or it is distributed with Ruby,
- this of Ruby follows the license of Ruby.
-
-configure:
+ @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+ These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+ This file is licensed under the {MIT License}[rdoc-label:label-MIT+License].
+
+[coroutine]
+
+ Unless otherwise specified, these files are licensed under the
+ {MIT License}[rdoc-label:label-MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+ Onigmo (Oniguruma-mod) LICENSE
+
+ >>>
+ Copyright (c) 2002-2009:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ Copyright (c) 2011-2014:: K.Takata <kentkt AT csc DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ Oniguruma LICENSE
+
+ >>>
+ Copyright (c) 2002-2009:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ * https://github.com/k-takata/Onigmo/
+ * https://github.com/kkos/oniguruma
+ * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+ When this software is partly used or it is distributed with Ruby,
+ this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+ >>>
+ Copyright (c) 2006-2007:: Byte <byte AT mail DOT kna DOT ru>
+ K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+ >>>
+ Copyright (c) 2002-2007:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+ These files have this explanatory texts.
+
+ >>>
+ This mapping data was created from files provided by Unicode, Inc.
+ (The Unicode Consortium). The files were used to create a product supporting
+ Unicode, as explicitly permitted in the files' copyright notices.
+ Please note that Unicode, Inc. never made any claims as to fitness of these
+ files for any particular purpose, and has ceased to publish the files many
+ years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ © 2015 Unicode®, Inc.
+
+ For terms of use, see http://www.unicode.org/terms_of_use.html
+
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001:: I'O, All Rights Reserved.
+ Copyright (C) 2006:: Project X0213, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001:: I'O, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+ >>>
+ Copyright (C) 2001-2005:: International Business Machines
+ Corporation and others. All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+ >>>
+ Copyright (C) 2001-2002:: International Business Machines
+ Corporation and others. All Rights Reserved.
+
+
+[configure]
This file is free software.
- Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-tool/config.guess:
-tool/config.sub:
+[aclocal.m4]
+
+ This file is free software.
+
+ >>>
+ Copyright (C) 1996-2020:: Free Software Foundation, Inc.
+
+ This file is free software; the Free Software Foundation
+ gives unlimited permission to copy and/or distribute it,
+ with or without modifications, as long as this notice is preserved.
+
+[tool/config.guess]
+[tool/config.sub]
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
- Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
- Free Software Foundation, Inc.
+ >>>
+ Copyright 1992-2018:: Free Software Foundation, Inc.
This file is free software; you can redistribute it and/or modify it
under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
+ the Free Software Foundation; either version 3 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful, but
@@ -119,54 +345,57 @@ tool/config.sub:
General Public License for more details.
You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ along with this program; if not, see <https://www.gnu.org/licenses/>.
As a special exception to the GNU General Public License, if you
distribute this file as part of a program that contains a
configuration script generated by Autoconf, you may include it under
- the same distribution terms that you use for the rest of that program.
+ the same distribution terms that you use for the rest of that
+ program. This Exception is an additional permission under section 7
+ of the GNU General Public License, version 3 ("GPLv3").
-parse.c:
+[parse.c]
+[parse.h]
- This file is licensed under the GPL, but is incorporated into Ruby and
+ These files are licensed under the GPL, but are incorporated into Ruby and
redistributed under the terms of the Ruby license, as permitted by the
exception to the GPL below.
- Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
- Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2, or (at your option)
- any later version.
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
+ You should have received a copy of the GNU General Public License
+ along with this program. If not, see <http://www.gnu.org/licenses/>.
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 51 Franklin Street, Fifth Floor,
- Boston, MA 02110-1301, USA. */
+ As a special exception, you may create a larger work that contains
+ part or all of the Bison parser skeleton and distribute that work
+ under terms of your choice, so long as that work isn't itself a
+ parser generator using the skeleton or a modified version thereof
+ as a parser skeleton. Alternatively, if you modify or redistribute
+ the parser skeleton itself, you may (at your option) remove this
+ special exception, which will cause the skeleton and the resulting
+ Bison output files to be licensed under the GNU General Public
+ License without this special exception.
- /* As a special exception, you may create a larger work that contains
- part or all of the Bison parser skeleton and distribute that work
- under terms of your choice, so long as that work isn't itself a
- parser generator using the skeleton or a modified version thereof
- as a parser skeleton. Alternatively, if you modify or redistribute
- the parser skeleton itself, you may (at your option) remove this
- special exception, which will cause the skeleton and the resulting
- Bison output files to be licensed under the GNU General Public
- License without this special exception.
+ This special exception was added by the Free Software Foundation in
+ version 2.2 of Bison.
- This special exception was added by the Free Software Foundation in
- version 2.2 of Bison. */
+[missing/dtoa.c]
-util.c (partly):
+ This file is under these licenses.
- Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+ >>>
+ Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
Permission to use, copy, modify, and distribute this software for any
purpose without fee is hereby granted, provided that this entire notice
@@ -179,71 +408,73 @@ util.c (partly):
REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-win32/win32.[ch]:
+ >>>
+ Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
You can apply the Artistic License to these files. (or GPL,
alternatively)
- Copyright (c) 1993, Intergraph Corporation
+ >>>
+ Copyright (c) 1993:: Intergraph Corporation
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
-util.c (partly):
-
- Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-random.c
+[missing/mt19937.c]
This file is under the new-style BSD license.
- A C-program for MT19937, with initialization improved 2002/2/10.
- Coded by Takuji Nishimura and Makoto Matsumoto.
+ >>>
+ A C-program for MT19937, with initialization improved 2002/2/10.::
+ Coded by Takuji Nishimura and Makoto Matsumoto.
This is a faster version by taking Shawn Cokus's optimization,
Matthe Bellew's simplification, Isaku Wada's real version.
Before using, initialize the state by using init_genrand(seed)
or init_by_array(init_key, key_length).
- Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
- All rights reserved.
+ Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- 3. The names of its contributors may not be used to endorse or promote
- products derived from this software without specific prior written
- permission.
+ 3. The names of its contributors may not be used to endorse or promote
+ products derived from this software without specific prior written
+ permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -262,44 +493,15 @@ random.c
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
-vm_dump.c:procstat_vm
-
- * Copyright (c) 2007 Robert N. M. Watson
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- * notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- * $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-
-vsnprintf.c:
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
+ The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
- This code is derived from software contributed to Berkeley by
- Chris Torek.
+[missing/procstat_vm.c]
+
+ This file is under the new-style BSD license.
+
+ >>>
+ Copyright (c) 2007:: Robert N. M. Watson
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -309,14 +511,11 @@ vsnprintf.c:
2. Redistributions in binary form must reproduce the above copyright
notice, this list of conditions and the following disclaimer in the
documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
@@ -325,146 +524,104 @@ vsnprintf.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
- IMPORTANT NOTE:
- --------------
- From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
- paragraph 3 above is now null and void.
-
-st.[ch]:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strstr.c:
-missing/strtol.c:
-missing/tgamma.c:
-ext/digest/sha1/sha1.[ch]:
+ $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+[vsnprintf.c]
+
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
+
+ >>>
+ Copyright (c) 1990, 1993::
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Chris Torek.
+
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/dup2.c]
+[missing/erf.c]
+[missing/finite.c]
+[missing/hypot.c]
+[missing/isinf.c]
+[missing/isnan.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
These files are all under public domain.
-missing/crypt.c:
+[missing/crypt.c]
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
- Copyright (c) 1989, 1993
- The Regents of the University of California. All rights reserved.
+ >>>
+ Copyright (c) 1989, 1993::
+ The Regents of the University of California. All rights reserved.
This code is derived from software contributed to Berkeley by
Tom Truscott.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
+[missing/setproctitle.c]
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
-missing/setproctitle.c
+ >>>
+ Copyright 2003:: Damien Miller
+ Copyright (c) 1983, 1995-1997:: Eric P. Allman
+ Copyright (c) 1988, 1993::
+ The Regents of the University of California. All rights reserved.
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
+[missing/strlcat.c]
+[missing/strlcpy.c]
- Copyright 2003 Damien Miller
- Copyright (c) 1983, 1995-1997 Eric P. Allman
- Copyright (c) 1988, 1993
- The Regents of the University of California. All rights reserved.
+ These files are under an ISC-style license.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
+ >>>
+ Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
+ Permission to use, copy, modify, and distribute this software for any
+ purpose with or without fee is hereby granted, provided that the above
+ copyright notice and this permission notice appear in all copies.
-missing/strlcat.c
-missing/strlcpy.c
+ THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+ WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+ MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+ ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+ WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+ ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+ OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
- These files are under the new-style BSD license.
-
- Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. The name of the author may not be used to endorse or promote products
- derived from this software without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
- INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
- AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL
- THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
- EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
- PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
- OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
- WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
- OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
- ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-missing/langinfo.c
+[missing/langinfo.c]
This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
Ruby uses a modified version. The file contains the following
author/copyright notice:
- Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
- Permission to use, copy, modify, and distribute this software
- for any purpose and without fee is hereby granted. The author
- disclaims all warranties with regard to this software.
+ >>>
+ Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+ Permission to use, copy, modify, and distribute this software
+ for any purpose and without fee is hereby granted. The author
+ disclaims all warranties with regard to this software.
-ext/digest/md5/md5.[ch]:
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
These files are under the following license. Ruby uses modified
versions of them.
- Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
+ >>>
+ Copyright (C) 1999, 2000:: Aladdin Enterprises. All rights reserved.
This software is provided 'as-is', without any express or implied
warranty. In no event will the authors be held liable for any damages
@@ -485,23 +642,27 @@ ext/digest/md5/md5.[ch]:
L. Peter Deutsch
ghost@aladdin.com
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
These files have the following copyright information, and by the
author we are allowed to use it under the new-style BSD license.
- AUTHOR: Antoon Bosselaers, ESAT-COSIC
+ >>>
+ AUTHOR:: Antoon Bosselaers, ESAT-COSIC
(Arranged for libc by Todd C. Miller)
- DATE: 1 March 1996
+ DATE:: 1 March 1996
- Copyright (c) Katholieke Universiteit Leuven
+ Copyright (c):: Katholieke Universiteit Leuven
1996, All Rights Reserved
-ext/digest/sha2/sha2.[ch]:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
These files are under the new-style BSD license.
- Copyright 2000 Aaron D. Gifford. All rights reserved.
+ >>>
+ Copyright 2000:: Aaron D. Gifford. All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -527,29 +688,123 @@ ext/digest/sha2/sha2.[ch]:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
+[ext/json/generator/generator.c]
+
+ The file contains the following copyright notice.
+
+ >>>
+ Copyright 2001-2004:: Unicode, Inc.
+
+ Disclaimer::
+
+ This source code is provided as is by Unicode, Inc. No claims are
+ made as to fitness for any particular purpose. No warranties of any
+ kind are expressed or implied. The recipient agrees to determine
+ applicability of information provided. If this file has been
+ purchased on magnetic or optical media from Unicode, Inc., the
+ sole remedy for any claim will be exchange of defective media
+ within 90 days of receipt.
+
+ Limitations on Rights to Redistribute This Code::
+
+ Unicode, Inc. hereby grants the right to freely use the information
+ supplied in this file in the creation of products supporting the
+ Unicode Standard, and to make copies of this file in any form
+ for internal or external distribution as long as this notice
+ remains attached.
+
+[ext/nkf/nkf-utf8/config.h]
+[ext/nkf/nkf-utf8/nkf.c]
+[ext/nkf/nkf-utf8/utf8tbl.c]
These files are under the following license. So to speak, it is
copyrighted semi-public-domain software.
- Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
- Everyone is permitted to do anything on this program
- including copying, modifying, improving,
- as long as you don't try to pretend that you wrote it.
- i.e., the above copyright notice has to appear in all copies.
- Binary distribution requires original version messages.
- You don't have to ask before copying, redistribution or publishing.
- THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+ >>>
+ Copyright (C) 1987:: Fujitsu LTD. (Itaru ICHIKAWA)
+
+ Everyone is permitted to do anything on this program
+ including copying, modifying, improving,
+ as long as you don't try to pretend that you wrote it.
+ i.e., the above copyright notice has to appear in all copies.
+ Binary distribution requires original version messages.
+ You don't have to ask before copying, redistribution or publishing.
+ THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+[ext/psych]
+[test/psych]
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+ The files under these directories are under the following license, except for
+ ext/psych/yaml.
+
+ >>>
+ Copyright 2009:: Aaron Patterson, et al.
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the 'Software'), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+[ext/psych/yaml]
+
+ The files under this directory are under the following license.
+
+ >>>
+ Copyright (c) 2006:: Kirill Simonov
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the "Software"), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+[ext/pty/pty.c]
+
+ >>>
+ C) Copyright 1998:: by Akinori Ito.
+
+ This software may be redistributed freely for this purpose, in full
+ or in part, provided that this entire copyright notice is included
+ on any copies of this software and applications and derivations thereof.
+
+ This software is provided on an "as is" basis, without warranty of any
+ kind, either expressed or implied, as to any matter including, but not
+ limited to warranty of fitness of purpose, or merchantability, or
+ results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
These files are under the new-style BSD license.
- Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+ >>>
+ Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
All rights reserved.
Redistribution and use in source and binary forms, with or without
@@ -576,17 +831,221 @@ ext/socket/getnameinfo.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
You can apply the Artistic License to this file. (or GPL,
alternatively)
- (c) 1995 Microsoft Corporation. All rights reserved.
+ >>>
+ (c) 1995:: Microsoft Corporation. All rights reserved.
Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
- Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+ Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
<gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the README file
of the Perl distribution.
+
+ The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+ This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+ The files under these directories are under the following license.
+
+ >>>
+ Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+ Permission is hereby granted, free of charge, to any person
+ obtaining a copy of this software and associated documentation
+ files (the "Software"), to deal in the Software without
+ restriction, including without limitation the rights to use,
+ copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the
+ Software is furnished to do so, subject to the following
+ conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+ OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+ HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+ WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+ FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+ OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+ RubyGems is under the following license.
+
+ >>>
+ RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+ Weirich and others. You can redistribute it and/or modify it under
+ either the terms of the {MIT license}[rdoc-label:label-MIT+License], or the conditions
+ below:
+
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
+
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
+
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
+
+ b. use the modified software only within your corporation or
+ organization.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 3. You may distribute the software in object code or executable
+ form, provided that you do at least ONE of the following:
+
+ a. distribute the executables and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
+
+ b. accompany the distribution with the machine-readable source of
+ the software.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial).
+
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
+
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[lib/bundler.gemspec]
+[spec/bundler]
+[man/bundle-*,gemfile.*]
+
+ Bundler is under the following license.
+
+ >>>
+ Portions copyright (c) 2010:: Andre Arko
+ Portions copyright (c) 2009:: Engine Yard
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+ did_you_mean is under the following license.
+
+ >>>
+ Copyright (c) 2014-2016 Yuki Nishijima
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+ These files are very old copy of then-called "The Great Computer Language
+ Shootout". LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+ site has been lost. Upstream diverged to delete several benchmarks listed
+ above.
+
+== MIT License
+>>>
+ Permission is hereby granted, free of charge, to any person obtaining
+ a copy of this software and associated documentation files (the
+ "Software"), to deal in the Software without restriction, including
+ without limitation the rights to use, copy, modify, merge, publish,
+ distribute, sublicense, and/or sell copies of the Software, and to
+ permit persons to whom the Software is furnished to do so, subject to
+ the following conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+ MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+ LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+ OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+ WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ IMPORTANT NOTE::
+
+ From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+ paragraph 3 above is now null and void.
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 7da2488b46..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,506 +0,0 @@
-SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
-
-CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
- $(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
- $(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-
-#### End of system configuration section. ####
-
-MAJOR= @MAJOR@
-MINOR= @MINOR@
-TEENY= @TEENY@
-
-LIBRUBY_A = @LIBRUBY_A@
-LIBRUBY_SO = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY = @LIBRUBY@
-LIBRUBYARG = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
- eval.$(OBJEXT) \
- gc.$(OBJEXT) \
- hash.$(OBJEXT) \
- load.$(OBJEXT) \
- object.$(OBJEXT) \
- parse.$(OBJEXT) \
- string.$(OBJEXT) \
- symbol.$(OBJEXT) \
- vm.$(OBJEXT)
-
-THREAD_MODEL = @THREAD_MODEL@
-
-PREP = @PREP@
-ARCHFILE = @ARCHFILE@
-SETUP =
-EXTSTATIC = @EXTSTATIC@
-ENCSTATIC = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS = @MKDIR_P@
-CP = cp
-MV = mv
-RM = rm -f
-RMDIR = @RMDIR@
-RMDIRS = @RMDIRS@
-RMALL = @RMALL@
-NM = @NM@
-AR = @AR@
-ARFLAGS = rcu
-RANLIB = @RANLIB@
-AS = @AS@
-ASFLAGS = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP = @OBJDUMP@
-OBJCOPY = @OBJCOPY@
-VCS = @VCS@
-VCSUP = @VCSUP@
-DTRACE = @DTRACE@
-DTRACE_EXT = @DTRACE_EXT@
-DTRACE_OBJ = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT = @OBJEXT@
-ASMEXT = S
-DLEXT = @DLEXT@
-MANTYPE = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C = newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C = prelude.c
-RBCONFIG = .rbconfig.time
-
-SRC_FILE = $<
-OS_SRC_FILE = $<
-DEST_FILE = $@
-OS_DEST_FILE = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
- @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(INITOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
- @$(RM) $@
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
- $(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
- @$(RM) $@
- $(ECHO) linking static-library $@
- $(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
- @-$(RANLIB) $@ 2> /dev/null || true
- $(ECHO) verifying static-library $@
- @$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
- @$(RM) conftest$(EXEEXT) conftest.c
-
-$(LIBRUBY_SO):
- @-$(PRE_LIBRUBY_UPDATE)
- $(ECHO) linking shared-library $@
- $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
- -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
- $(Q) $(POSTLINK)
- @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
- File.symlink "$(LIBRUBY_SO)", link}' \
- $(LIBRUBY_ALIASES) || true
-$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
- @./config.status --file=$@:$(srcdir)/template/fake.rb.in
- @chmod +x $@
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
- @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
- $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
- $(ECHO) installing cross-compiling stuff
- $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
- $(Q) $(BASERUBY) -p \
- -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
- -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
- rbconfig.rb > fake-rbconfig.rb
- $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
- $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
- @$(RM) fake.rb fake-rbconfig.rb
- $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
- $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
- $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
- @[ -f $@ ] && mv $@ $@.old
- MAKE=$(MAKE) $(SHELL) ./config.status $@
- @cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
- { \
- echo "all:; -@rm -f conftest.mk"; \
- echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
- echo ".force:"; \
- } > conftest.mk || exit 1; \
- $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
- { echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
- sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/configure $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status: $(srcdir)/configure $(srcdir)/enc/Makefile.in \
- $(srcdir)/include/ruby/version.h
- @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
- set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/configure: $(srcdir)/configure.in
- $(CHDIR) $(srcdir) && exec $(AUTOCONF)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
- @\
- if cmp -s $(srcdir)/defs/lex.c.src $?; then \
- [ $(Q) ] && echo copying $@ || set -x; \
- $(CP) $(srcdir)/lex.c.blt $@; \
- else \
- [ $(Q) ] && echo generating $@ || set -x; \
- gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(srcdir)/defs/lex.c.src && \
- $(CP) $@ $(srcdir)/lex.c.blt; \
- fi
-
-NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
-
-enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
- $(MAKEDIRS) $(@D)
- @set +e; \
- if cmp -s $(?:.kwd=.src) $?; then \
- set -x; \
- $(CP) $(?:.kwd=.h.blt) $@; \
- else \
- trap '$(RM) $@-1.h $@-2.h' 0 && \
- set -x; \
- sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
- sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
- diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(?:.kwd=.src) && \
- $(CP) $@ $(?:.kwd=.h.blt); \
- fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
- $(MAKEDIRS) $(@D)
- @set +e; \
- if cmp -s $(?:.kwd=.src) $?; then \
- set -x; \
- $(CP) $(?:.kwd=.h.blt) $@; \
- else \
- set -x; \
- gperf $(JIS_PROPS_OPTIONS) $? | \
- sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
- $(CP) $? $(?:.kwd=.src) && \
- $(CP) $@ $(?:.kwd=.h.blt); \
- fi
-
-.c.@OBJEXT@:
- @$(ECHO) compiling $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
- @$(ECHO) assembling $<
- $(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
- @$(ECHO) translating $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
- @$(ECHO) preprocessing $<
- $(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
- @$(ECHO) translating probes $<
- $(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
- $(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/PROBES_H/g' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
- $(Q) $(RM) $@.tmp
-
-.dmyh.h:
- @$(ECHO) copying dummy $(DEST_FILE)
- $(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
- $(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
- $(RM) $(DTRACE_REBUILD_OBJS) $@; \
- $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
- $(MAKE) $(DTRACE_REBUILD_OBJS); \
- fi
- $(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d probes.stamp
- @$(ECHO) processing probes in object files
- $(Q) $(RM) $@
- $(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
- @$(ECHO) generating a glommed object with DTrace probes for static library
- $(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
- $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
- enc/encinit.c enc/encinit.$(OBJEXT)
- -$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
- $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
- -$(Q)$(RM) run.gdb
- -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
- -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
- @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
- test "$$#" = 0 && set .; \
- set dummy `\
- find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
- `; shift; \
- cd ..; \
- for dir do \
- echo $(@:-ext=)ing "$$dir"; \
- (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
- case "$@" in \
- *distclean-ext*|*realclean-ext*) \
- $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
- esac; \
- done
- -$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
- -$(Q)$(RM) ext/extinit.c
- -$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
- @test -f "$(ENC_MK)" || exit 0; \
- echo $(@:-enc=ing) encodings; \
- exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(ECHO) compiling $@
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-up::
- @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-after-update:: update-config_files common-srcs
-
-update-mspec:
- @$(CHDIR) $(srcdir); \
- if [ -d spec/mspec ]; then \
- cd spec/mspec; \
- echo updating mspec ...; \
- exec git pull; \
- else \
- echo retrieving mspec ...; \
- exec git clone $(MSPEC_GIT_URL) spec/mspec; \
- fi
-
-update-rubyspec: update-mspec
- @$(CHDIR) $(srcdir); \
- if [ -d spec/rubyspec ]; then \
- cd spec/rubyspec; \
- echo updating rubyspec ...; \
- exec git pull; \
- else \
- echo retrieving rubyspec ...; \
- exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
- fi
-
-test-rubyspec-precheck:
- @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
-
-update-coverage:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/simplecov ]; then \
- cd coverage/simplecov; \
- echo updating simplecov ...; \
- exec git pull; \
- else \
- echo retrieving simplecov ...; \
- exec git clone $(SIMPLECOV_GIT_URL) coverage/simplecov; \
- fi
-
-INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
- vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
- $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
- $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
- $(ECHO) generating $@
- $(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
- @$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
- sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
- -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 5ac07db507..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,363 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.2.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with. For a full list of changes
-with all sufficient information, see the ChangeLog file.
-
-== Changes since the 2.1.0 release
-
-=== Language changes
-
-* nil/true/false
- * nil/true/false objects are frozen. [Feature #8923]
-
-* Hash literal
- * Symbol key followed by a colon can be quoted. [Feature #4276]
-
-* default argument
- fixed a very longstanding bug that an optional argument was not
- accessible in its default value expression. [Bug #9593]
-
-=== Core classes updates (outstanding ones only)
-
-* Binding
- * New methods:
- * Binding#local_variables
- * Binding#receiver
-
-* Dir
- * New methods:
- * Dir#fileno
-
-* Enumerable
- * New methods:
- * Enumerable#slice_after
- * Enumerable#slice_when
- * Extended methods:
- * min, min_by, max and max_by supports optional argument to return
- multiple elements.
-
-* Float
- * New methods:
- * Float#next_float
- * Float#prev_float
-
-* File
- * New methods:
- * File.birthtime
- * File#birthtime
-
-* File::Stat
- * New methods:
- * File::Stat#birthtime
-
-* GC
- * GC.latest_gc_info returns :state to represent current GC status.
- * Improvements
- * Introduce incremental marking for major GC. [Feature #10137]
-
-* IO
- * Improvements
- * IO#nonblock_read and IO#nonblock_write for pipes on Windows are supported.
-
-* Kernel
- * New methods:
- * Kernel#itself
- * Improvements
- * Kernel#throw raises UncaughtThrowError, subclass of ArgumentError when
- there is no corresponding catch block, instead of ArgumentError.
-
-* Process
- * Extended method:
- * Process execution methods such as Process.spawn opens the file in write
- mode for redirect from [:out, :err].
-
-* String
- * New methods:
- * String#unicode_normalize
- * String#unicode_normalize!
- * String#unicode_normalized?
-
-* Symbol
- * Improvements
- * Most symbols which are returned by String#to_sym and
- String#intern are GC-able.
-
-* Method
- * New methods:
- * Method#curry([arity]) returns a curried Proc.
- * Method#super_method returns a Method of superclass, which would be called
- when super is used.
-
-=== Core classes compatibility issues (excluding feature bug fixes)
-
-* Enumerable
- * Enumerable#slice_before's state management deprecated.
- * Enumerable#chunk's state management deprecated.
-
-* GC
- * incompatible changes:
- * Rename GC.stat entries. [Feature #9924]
- See https://docs.google.com/spreadsheets/d/11Ua4uBr6o0k-nORrZLEIIUkHJ9JRzRR0NyZfrhEEnc8/edit?usp=sharing
-
-* Hash
- * incompatible changes:
- * Change overriding policy for duplicated key. [Bug #10315]
- { **hash1, **hash2 } contains values of hash2 for duplicated keys.
-
-* IO
- * incompatible changes:
- * When flushing file IO with IO#flush, you cannot assume that the metadata
- of the file is updated immediately. On some platforms (especially
- Windows), it is delayed until the filesystem load is decreased.
- Use IO#fsync if you want to guarantee updating metadata.
- * IO#each_codepoint raises an exception at incomplete character
- before EOF when conversion takes place. [Bug #11444]
-
-* Math
- * incompatible changes:
- * Math.log now raises Math::DomainError instead of returning NaN if the
- base is less than 0, and returns NaN instead of -infinity if both of
- two arguments are 0.
- * Math.atan2 now returns values like as expected by C99 if both two
- arguments are infinity.
-
-* Proc
- * incompatible changes:
- * ArgumentError is no longer raised when lambda Proc is passed as a
- block, and the number of yielded arguments does not match the formal
- arguments of the lambda, if just an array is yielded and its length
- matches.
-
-* Process
- * Process execution methods such as Process.spawn opens the file in write
- mode for redirect from [:out, :err].
- Before Ruby 2.2, it was opened in read mode.
-
-=== Stdlib updates (outstanding ones only)
-
-* Continuation
- * callcc is obsolete. use Fiber instead.
-
-* Digest
-
- * Digest() should now be thread-safe. If you have a problem with
- regard to on-demand loading under a multi-threaded environment,
- preload "digest/*" modules on boot or use this method instead of
- directly referencing Digest::*.
- * Digest::HMAC has been removed just as previously noticed.
-
-* DL
- * DL has been removed from stdlib. Please use Fiddle instead!
-
-* Etc
- * New methods:
- * Etc.uname
- * Etc.sysconf
- * Etc.confstr
- * IO#pathconf
- * Etc.nprocessors
-
-* Find, Pathname
- * Extended methods:
- * find method accepts "ignore_error" keyword argument.
-
-* Matrix
- * New methods:
- * Matrix#first_minor(row, column) returns the submatrix obtained
- by deleting the specified row and column.
- * Matrix#cofactor(row, column) returns the (row, column) cofactor
- which is obtained by multiplying the first minor by (-1)**(row + column).
- * Matrix#adjugate returns the adjugate of the matrix.
- * hstack and vstack are new instance and class methods to stack matrices
- horizontally and vertically.
- * Matrix#laplace_expansion(row_or_column: num) returns the laplace_expansion
- along the +num+ -th row or column.
- * Vector.basis(size:, index:) returns the specified basis vector.
- * Unary - and + added for Vector and Matrix.
- * Vector#cross_product generalized to arbitrary dimensions.
- * Vector#dot and #cross are aliases for #inner_product and #cross_product.
- * Vector#angle_with returns the angle with its argument
- * New instance and class method independent? to test linear independence.
-
-* Pathname
- * Pathname#/ is aliased to Pathname#+.
- * New methods:
- * Pathname#birthtime
-
-* Rake
- * Updated to Rake 10.4.0. For full release notes see:
-
- http://docs.seattlerb.org/rake/History_rdoc.html#label-10.4.0
-
-* RubyGems
- * Updated to RubyGems 2.4.2. For full release notes see:
-
- http://docs.seattlerb.org/rubygems/History_txt.html#label-2.4.2+%2F+2014-10-01
-
-* TSort
- * TSort.tsort_each, TSort.each_strongly_connected_component and
- TSort.each_strongly_connected_component_from returns an enumerator if
- no block given.
-
-* XMLRPC
- * Added new parser class named LibXMLStreamParser.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* lib/mathn.rb
- * Show deprecated warning [Feature #10169]
-
-* ext/date/lib/date/format.rb
- * Removed because it's empty file.
-
-* Digest
- * Digest::HMAC has finally ceased to exist. Use OpenSSL::HMAC or an external gem instead.
-
-* time.rb
- * Time.parse, Time.strptime, Time.rfc2822, Time.xmlschema may produce
- fixed-offset Time objects.
- It is happen when usual localtime doesn't preserve the offset from UTC.
- * Time.httpdate produces always UTC Time object.
- * Time.strptime raises ArgumentError when no date information.
-
-* lib/rational.rb
- * Removed because it is deprecated from 2009.
-
-* lib/complex.rb
- * Removed because it is deprecated from 2009.
-
-* lib/prettyprint.rb
- * Removed PrettyPrint#first?
-
-* lib/minitest/*.rb
- * Removed because it conflicts to minitest 5. [Feature #9711]
-
-* lib/test/**/*.rb
- * Removed because it conflicts to minitest 5, and it was just an wrapper
- of minitest 4. [Feature #9711]
-
-* lib/uri
- * support RFC 3986. [Feature #2542]
-
-* GServer
- * GServer is extracted to gserver gem. It's unmaintain code.
-
-* Logger
- * Logger::Application is extracted to logger-application gem. It's unmaintain code.
-
-* ObjectSpace (after requiring "objspace")
- * ObjectSpace.memsize_of(obj) returns a size includes sizeof(RVALUE).
- [Bug #8984]
-
-* Prime
- * incompatible changes:
- * Prime.prime? now returns false for negative numbers. This method
- should not be used to know the number is composite or not. [Bug #7395]
-
-* Psych
- * Removed Psych::EngineManager [Bug #8344]
-
-=== Built-in global variables compatibility issues
-
-=== C API updates
-
-* Deprecated APIs removed. [Feature #9502]
-
- Check_SafeStr -> SafeStringValue
- rb_check_safe_str -> SafeStringValue
- rb_quad_pack -> rb_integer_pack
- rb_quad_unpack -> rb_integer_unpack
- rb_read_check : access struct FILE internal. no replacement.
- rb_struct_iv_get : internal function. no replacement.
- struct rb_blocking_region_buffer : internal type. no replacement.
- rb_thread_blocking_region_begin -> rb_thread_call_without_gvl family
- rb_thread_blocking_region_end -> rb_thread_call_without_gvl family
- TRAP_BEG -> rb_thread_call_without_gvl family
- TRAP_END -> rb_thread_call_without_gvl family
- rb_thread_select -> rb_thread_fd_select
- struct rb_exec_arg : internal type. no replacement.
- rb_exec : internal function. no replacement.
- rb_exec_arg_addopt : internal function. no replacement.
- rb_exec_arg_fixup : internal function. no replacement.
- rb_exec_arg_init : internal function. no replacement.
- rb_exec_err : internal function. no replacement.
- rb_fork : internal function. no replacement.
- rb_fork_err : internal function. no replacement.
- rb_proc_exec_n : internal function. no replacement.
- rb_run_exec_options : internal function. no replacement.
- rb_run_exec_options_err : internal function. no replacement.
- rb_thread_blocking_region -> rb_thread_call_without_gvl family
- rb_thread_polling -> rb_thread_wait_for
- rb_big2str0 : internal function. no replacement.
- rb_big2ulong_pack -> rb_integer_pack
- rb_gc_set_params : internal function. no replacement.
- rb_io_mode_flags -> rb_io_modestr_fmode
- rb_io_modenum_flags -> rb_io_oflags_fmode
-
-* struct RBignum is hidden. [Feature #6083]
- Use rb_integer_pack and rb_integer_unpack instead.
-
-* struct RRational is hidden. [Feature #9513]
- Use rb_rational_num and rb_rational_den instead.
-
-* rb_big_new and rb_big_resize takes a size_t instead of long.
-
-* rb_num2long returns a long instead of SIGNED_VALUE.
-
-* rb_num2ulong returns an unsigned long instead of VALUE.
-
-* st hash table uses power-of-two sizes for speed [Feature #9425].
- Lookups are 10-25% faster if using appropriate hash functions.
- However, weaknesses in hash distribution can no longer be masked
- by prime number-sized tables, so extensions may need to tweak
- hash functions to ensure good distribution.
-
-* rb_sym2str() added. This is almost same as `rb_id2str(SYM2ID(sym))`
- but not pinning a dynamic symbol.
-
-* rb_str_cat_cstr() added. This is same as `rb_str_cat2()`.
-
-* `rb_str_substr()` and `rb_str_subseq()` will share middle of a string,
- but not only the end of a string, in the future. Therefore, result
- strings may not be NUL-terminated, `StringValueCStr()` is needed
- calling to obtain a NUL-terminated C string.
-
-* rb_tracepoint_new() supports new internal events accessible only from C:
- * RUBY_INTERNAL_EVENT_GC_ENTER
- * RUBY_INTERNAL_EVENT_GC_EXIT
- r47528
-
-* rb_hash_delete() now does not call the block given to the current method.
-
-* rb_extract_keywords() and rb_get_kwargs() exported. See README.EXT
- for details.
-
-=== Build system updates
-
-* jemalloc is optionally supported via `./configure --with-jemalloc`
- jemalloc may be suitable when system malloc is slow or prone
- to fragmentation. [Feature #9113]
-
-=== Implementation changes
-
-* GC
- * Most symbols which are returned by String#to_sym and
- String#intern are GC-able [Feature #9634]
- * Introduce incremental marking for major GC. [Feature #10137]
- * Enable lazy sweep on GC caused by malloc().
-
-* VM
- * Use frozen string literals for Hash#[] and Hash#[]=
- * Fast keyword arguments passing [Feature #10440]
- * Allow to receive huge splatted array by a rest argument
- [Feature #10440]
-
-* Process
- * Process creation methods, such as spawn(), uses vfork() system call.
- vfork() is faster than fork() when the parent process uses huge memory.
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..2dcfacb6e2
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,820 @@
+# NEWS for Ruby 3.0.0
+
+This document is a list of user visible feature changes
+since the **2.7.0** release, except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or reference
+information is supplied with. For a full list of changes with all
+sufficient information, see the ChangeLog file or Redmine
+(e.g. `https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER`).
+
+## Language changes
+
+* Keyword arguments are now separated from positional arguments.
+ Code that resulted in deprecation warnings in Ruby 2.7 will now
+ result in ArgumentError or different behavior. [[Feature #14183]]
+
+* Procs accepting a single rest argument and keywords are no longer
+ subject to autosplatting. This now matches the behavior of Procs
+ accepting a single rest argument and no keywords.
+ [[Feature #16166]]
+
+ ```ruby
+ pr = proc{|*a, **kw| [a, kw]}
+
+ pr.call([1])
+ # 2.7 => [[1], {}]
+ # 3.0 => [[[1]], {}]
+
+ pr.call([1, {a: 1}])
+ # 2.7 => [[1], {:a=>1}] # and deprecation warning
+ # 3.0 => [[[1, {:a=>1}]], {}]
+ ```
+
+* Arguments forwarding (`...`) now supports leading arguments.
+ [[Feature #16378]]
+
+ ```ruby
+ def method_missing(meth, ...)
+ send(:"do_#{meth}", ...)
+ end
+ ```
+
+* Pattern matching (`case/in`) is no longer experimental. [[Feature #17260]]
+
+* One-line pattern matching is redesigned. [EXPERIMENTAL]
+
+ * `=>` is added. It can be used like a rightward assignment.
+ [[Feature #17260]]
+
+ ```ruby
+ 0 => a
+ p a #=> 0
+
+ {b: 0, c: 1} => {b:}
+ p b #=> 0
+ ```
+
+ * `in` is changed to return `true` or `false`. [[Feature #17371]]
+
+ ```ruby
+ # version 3.0
+ 0 in 1 #=> false
+
+ # version 2.7
+ 0 in 1 #=> raise NoMatchingPatternError
+ ```
+
+* Find-pattern is added. [EXPERIMENTAL]
+ [[Feature #16828]]
+
+ ```ruby
+ case ["a", 1, "b", "c", 2, "d", "e", "f", 3]
+ in [*pre, String => x, String => y, *post]
+ p pre #=> ["a", 1]
+ p x #=> "b"
+ p y #=> "c"
+ p post #=> [2, "d", "e", "f", 3]
+ end
+ ```
+
+* Endless method definition is added. [EXPERIMENTAL]
+ [[Feature #16746]]
+
+ ```ruby
+ def square(x) = x * x
+ ```
+
+* Interpolated String literals are no longer frozen when
+ `# frozen-string-literal: true` is used. [[Feature #17104]]
+
+* Magic comment `shareable_constant_value` added to freeze constants.
+ See {Magic Comments}[rdoc-ref:doc/syntax/comments.rdoc@Magic+Comments] for more details.
+ [[Feature #17273]]
+
+* A {static analysis}[rdoc-label:label-Static+analysis] foundation is
+ introduced.
+ * {RBS}[rdoc-label:label-RBS] is introduced. It is a type definition
+ language for Ruby programs.
+ * {TypeProf}[rdoc-label:label-TypeProf] is experimentally bundled. It is a
+ type analysis tool for Ruby programs.
+
+* Deprecation warnings are no longer shown by default (since Ruby 2.7.2).
+ Turn them on with `-W:deprecated` (or with `-w` to show other warnings too).
+ [[Feature #16345]]
+
+* $SAFE and $KCODE are now normal global variables with no special behavior.
+ C-API methods related to $SAFE have been removed.
+ [[Feature #16131]] [[Feature #17136]]
+
+* yield in singleton class definitions in methods is now a SyntaxError
+ instead of a warning. yield in a class definition outside of a method
+ is now a SyntaxError instead of a LocalJumpError. [[Feature #15575]]
+
+* When a class variable is overtaken by the same definition in an
+ ancestor class/module, a RuntimeError is now raised (previously,
+ it only issued a warning in verbose mode). Additionally, accessing a
+ class variable from the toplevel scope is now a RuntimeError.
+ [[Bug #14541]]
+
+* Assigning to a numbered parameter is now a SyntaxError instead of
+ a warning.
+
+## Command line options
+
+### `--help` option
+
+When the environment variable `RUBY_PAGER` or `PAGER` is present and has
+a non-empty value, and the standard input and output are tty, the `--help`
+option shows the help message via the pager designated by the value.
+[[Feature #16754]]
+
+### `--backtrace-limit` option
+
+The `--backtrace-limit` option limits the maximum length of a backtrace.
+[[Feature #8661]]
+
+## Core classes updates
+
+Outstanding ones only.
+
+* Array
+
+ * The following methods now return Array instances instead of
+ subclass instances when called on subclass instances:
+ [[Bug #6087]]
+
+ * Array#drop
+ * Array#drop_while
+ * Array#flatten
+ * Array#slice!
+ * Array#slice / Array#[]
+ * Array#take
+ * Array#take_while
+ * Array#uniq
+ * Array#*
+
+ * Can be sliced with Enumerator::ArithmeticSequence
+
+ ```ruby
+ dirty_data = ['--', 'data1', '--', 'data2', '--', 'data3']
+ dirty_data[(1..).step(2)] # take each second element
+ # => ["data1", "data2", "data3"]
+ ```
+
+* Binding
+
+ * Binding#eval when called with one argument will use "(eval)"
+ for `__FILE__` and 1 for `__LINE__` in the evaluated code.
+ [[Bug #4352]] [[Bug #17419]]
+
+* ConditionVariable
+
+ * ConditionVariable#wait may now invoke the `block`/`unblock` scheduler
+ hooks in a non-blocking context. [[Feature #16786]]
+
+* Dir
+
+ * Dir.glob and Dir.[] now sort the results by default, and
+ accept the `sort:` keyword option. [[Feature #8709]]
+
+* ENV
+
+ * ENV.except has been added, which returns a hash excluding the
+ given keys and their values. [[Feature #15822]]
+
+ * Windows: Read ENV names and values as UTF-8 encoded Strings
+ [[Feature #12650]]
+
+* Encoding
+
+ * Added new encoding IBM720. [[Feature #16233]]
+
+ * Changed default for Encoding.default_external to UTF-8 on Windows
+ [[Feature #16604]]
+
+* Fiber
+
+ * Fiber.new(blocking: true/false) allows you to create non-blocking
+ execution contexts. [[Feature #16786]]
+
+ * Fiber#blocking? tells whether the fiber is non-blocking. [[Feature #16786]]
+
+ * Fiber#backtrace and Fiber#backtrace_locations provide per-fiber backtrace.
+ [[Feature #16815]]
+
+ * The limitation of Fiber#transfer is relaxed. [[Bug #17221]]
+
+* GC
+
+ * GC.auto_compact= and GC.auto_compact have been added to control
+ when compaction runs. Setting `auto_compact=` to true will cause
+ compaction to occur during major collections. At the moment,
+ compaction adds significant overhead to major collections, so please
+ test first! [[Feature #17176]]
+
+* Hash
+
+ * Hash#transform_keys and Hash#transform_keys! now accept a hash that maps
+ keys to new keys. [[Feature #16274]]
+
+ * Hash#except has been added, which returns a hash excluding the
+ given keys and their values. [[Feature #15822]]
+
+* IO
+
+ * IO#nonblock? now defaults to `true`. [[Feature #16786]]
+
+ * IO#wait_readable, IO#wait_writable, IO#read, IO#write and other
+ related methods (e.g. IO#puts, IO#gets) may invoke the scheduler hook
+ `#io_wait(io, events, timeout)` in a non-blocking execution context.
+ [[Feature #16786]]
+
+* Kernel
+
+ * Kernel#clone when called with the `freeze: false` keyword will call
+ `#initialize_clone` with the `freeze: false` keyword.
+ [[Bug #14266]]
+
+ * Kernel#clone when called with the `freeze: true` keyword will call
+ `#initialize_clone` with the `freeze: true` keyword, and will
+ return a frozen copy even if the receiver is unfrozen.
+ [[Feature #16175]]
+
+ * Kernel#eval when called with two arguments will use "(eval)"
+ for `__FILE__` and 1 for `__LINE__` in the evaluated code.
+ [[Bug #4352]]
+
+ * Kernel#lambda now warns if called without a literal block.
+ [[Feature #15973]]
+
+ * Kernel.sleep invokes the scheduler hook `#kernel_sleep(...)` in a
+ non-blocking execution context. [[Feature #16786]]
+
+* Module
+
+ * Module#include and Module#prepend now affect classes and modules
+ that have already included or prepended the receiver, mirroring the
+ behavior if the arguments were included in the receiver before
+ the other modules and classes included or prepended the receiver.
+ [[Feature #9573]]
+
+ ```ruby
+ class C; end
+ module M1; end
+ module M2; end
+ C.include M1
+ M1.include M2
+ p C.ancestors #=> [C, M1, M2, Object, Kernel, BasicObject]
+ ```
+
+ * Module#public, Module#protected, Module#private, Module#public_class_method,
+ Module#private_class_method, toplevel "private" and "public" methods
+ now accept single array argument with a list of method names. [[Feature #17314]]
+
+ * Module#attr_accessor, Module#attr_reader, Module#attr_writer and Module#attr
+ methods now return an array of defined method names as symbols.
+ [[Feature #17314]]
+
+ * Module#alias_method now returns the defined alias as a symbol.
+ [[Feature #17314]]
+
+* Mutex
+
+ * `Mutex` is now acquired per-`Fiber` instead of per-`Thread`. This change
+ should be compatible for essentially all usages and avoids blocking when
+ using a scheduler. [[Feature #16792]]
+
+* Proc
+
+ * Proc#== and Proc#eql? are now defined and will return true for
+ separate Proc instances if the procs were created from the same block.
+ [[Feature #14267]]
+
+* Queue / SizedQueue
+
+ * Queue#pop, SizedQueue#push and related methods may now invoke the
+ `block`/`unblock` scheduler hooks in a non-blocking context.
+ [[Feature #16786]]
+
+* Ractor
+
+ * New class added to enable parallel execution. See rdoc-ref:ractor.md for
+ more details.
+
+* Random
+
+ * `Random::DEFAULT` now refers to the `Random` class instead of being a `Random` instance,
+ so it can work with `Ractor`.
+ [[Feature #17322]]
+
+ * `Random::DEFAULT` is deprecated since its value is now confusing and it is no longer global,
+ use `Kernel.rand`/`Random.rand` directly, or create a `Random` instance with `Random.new` instead.
+ [[Feature #17351]]
+
+
+* String
+
+ * The following methods now return or yield String instances
+ instead of subclass instances when called on subclass instances:
+ [[Bug #10845]]
+
+ * String#*
+ * String#capitalize
+ * String#center
+ * String#chomp
+ * String#chop
+ * String#delete
+ * String#delete_prefix
+ * String#delete_suffix
+ * String#downcase
+ * String#dump
+ * String#each_char
+ * String#each_grapheme_cluster
+ * String#each_line
+ * String#gsub
+ * String#ljust
+ * String#lstrip
+ * String#partition
+ * String#reverse
+ * String#rjust
+ * String#rpartition
+ * String#rstrip
+ * String#scrub
+ * String#slice!
+ * String#slice / String#[]
+ * String#split
+ * String#squeeze
+ * String#strip
+ * String#sub
+ * String#succ / String#next
+ * String#swapcase
+ * String#tr
+ * String#tr_s
+ * String#upcase
+
+* Symbol
+
+ * Symbol#to_proc now returns a lambda Proc. [[Feature #16260]]
+
+ * Symbol#name has been added, which returns the name of the symbol
+ if it is named. The returned string is frozen. [[Feature #16150]]
+
+* Fiber
+
+ * Introduce Fiber.set_scheduler for intercepting blocking operations and
+ Fiber.scheduler for accessing the current scheduler. See
+ rdoc-ref:fiber.md for more details about what operations are supported and
+ how to implement the scheduler hooks. [[Feature #16786]]
+
+ * Fiber.blocking? tells whether the current execution context is
+ blocking. [[Feature #16786]]
+
+ * Thread#join invokes the scheduler hooks `block`/`unblock` in a
+ non-blocking execution context. [[Feature #16786]]
+
+* Thread
+
+ * Thread.ignore_deadlock accessor has been added for disabling the
+ default deadlock detection, allowing the use of signal handlers to
+ break deadlock. [[Bug #13768]]
+
+* Warning
+
+ * Warning#warn now supports a category keyword argument.
+ [[Feature #17122]]
+
+## Stdlib updates
+
+Outstanding ones only.
+
+* BigDecimal
+
+ * Update to BigDecimal 3.0.0
+
+ * This version is Ractor compatible.
+
+* Bundler
+
+ * Update to Bundler 2.2.3
+
+* CGI
+
+ * Update to 0.2.0
+
+ * This version is Ractor compatible.
+
+* CSV
+
+ * Update to CSV 3.1.9
+
+* Date
+
+ * Update to Date 3.1.1
+
+ * This version is Ractor compatible.
+
+* Digest
+
+ * Update to Digest 3.0.0
+
+ * This version is Ractor compatible.
+
+* Etc
+
+ * Update to Etc 1.2.0
+
+ * This version is Ractor compatible.
+
+* Fiddle
+
+ * Update to Fiddle 1.0.5
+
+* IRB
+
+ * Update to IRB 1.2.6
+
+* JSON
+
+ * Update to JSON 2.5.0
+
+ * This version is Ractor compatible.
+
+* Set
+
+ * Update to set 1.0.0
+
+ * SortedSet has been removed for dependency and performance reasons.
+
+ * Set#join is added as a shorthand for `.to_a.join`.
+
+ * Set#<=> is added.
+
+* Socket
+
+ * Add :connect_timeout to TCPSocket.new [[Feature #17187]]
+
+* Net::HTTP
+
+ * Net::HTTP#verify_hostname= and Net::HTTP#verify_hostname have been
+ added to skip hostname verification. [[Feature #16555]]
+
+ * Net::HTTP.get, Net::HTTP.get_response, and Net::HTTP.get_print
+ can take the request headers as a Hash in the second argument when the
+ first argument is a URI. [[Feature #16686]]
+
+* Net::SMTP
+
+ * Add SNI support.
+
+ * Net::SMTP.start arguments are keyword arguments.
+
+ * TLS should not check the host name by default.
+
+* OpenStruct
+
+ * Initialization is no longer lazy. [[Bug #12136]]
+
+ * Builtin methods can now be overridden safely. [[Bug #15409]]
+
+ * Implementation uses only methods ending with `!`.
+
+ * Ractor compatible.
+
+ * Improved support for YAML. [[Bug #8382]]
+
+ * Use officially discouraged. Read OpenStruct@Caveats section.
+
+* Pathname
+
+ * Ractor compatible.
+
+* Psych
+
+ * Update to Psych 3.3.0
+
+ * This version is Ractor compatible.
+
+* Reline
+
+ * Update to Reline 0.1.5
+
+* RubyGems
+
+ * Update to RubyGems 3.2.3
+
+* StringIO
+
+ * Update to StringIO 3.0.0
+
+ * This version is Ractor compatible.
+
+* StringScanner
+
+ * Update to StringScanner 3.0.0
+
+ * This version is Ractor compatible.
+
+## Compatibility issues
+
+Excluding feature bug fixes.
+
+* Regexp literals and all Range objects are frozen. [[Feature #8948]] [[Feature #16377]] [[Feature #15504]]
+
+ ```ruby
+ /foo/.frozen? #=> true
+ (42...).frozen? # => true
+ ```
+
+* EXPERIMENTAL: Hash#each consistently yields a 2-element array. [[Bug #12706]]
+
+ * Now `{ a: 1 }.each(&->(k, v) { })` raises an ArgumentError
+ due to lambda's arity check.
+
+* When writing to STDOUT redirected to a closed pipe, no broken pipe
+ error message will be shown now. [[Feature #14413]]
+
+* `TRUE`/`FALSE`/`NIL` constants are no longer defined.
+
+* Integer#zero? overrides Numeric#zero? for optimization. [[Misc #16961]]
+
+* Enumerable#grep and Enumerable#grep_v when passed a Regexp and no block no longer modify
+ Regexp.last_match. [[Bug #17030]]
+
+* Requiring 'open-uri' no longer redefines `Kernel#open`.
+ Call `URI.open` directly or `use URI#open` instead. [[Misc #15893]]
+
+* SortedSet has been removed for dependency and performance reasons.
+
+## Stdlib compatibility issues
+
+* Default gems
+
+ * The following libraries are promoted to default gems from stdlib.
+
+ * English
+ * abbrev
+ * base64
+ * drb
+ * debug
+ * erb
+ * find
+ * net-ftp
+ * net-http
+ * net-imap
+ * net-protocol
+ * open-uri
+ * optparse
+ * pp
+ * prettyprint
+ * resolv-replace
+ * resolv
+ * rinda
+ * set
+ * securerandom
+ * shellwords
+ * tempfile
+ * tmpdir
+ * time
+ * tsort
+ * un
+ * weakref
+
+ * The following extensions are promoted to default gems from stdlib.
+
+ * digest
+ * io-nonblock
+ * io-wait
+ * nkf
+ * pathname
+ * syslog
+ * win32ole
+
+* Bundled gems
+
+ * net-telnet and xmlrpc have been removed from the bundled gems.
+ If you are interested in maintaining them, please comment on
+ your plan to https://github.com/ruby/xmlrpc
+ or https://github.com/ruby/net-telnet.
+
+* SDBM has been removed from the Ruby standard library. [[Bug #8446]]
+
+ * The issues of sdbm will be handled at https://github.com/ruby/sdbm
+
+* WEBrick has been removed from the Ruby standard library. [[Feature #17303]]
+
+ * The issues of WEBrick will be handled at https://github.com/ruby/webrick
+
+## C API updates
+
+* C API functions related to $SAFE have been removed.
+ [[Feature #16131]]
+
+* C API header file `ruby/ruby.h` was split. [[GH-2991]]
+
+ This should have no impact on extension libraries,
+ but users might experience slow compilations.
+
+* Memory view interface [EXPERIMENTAL]
+
+ * The memory view interface is a C-API set to exchange a raw memory area,
+ such as a numeric array or a bitmap image, between extension libraries.
+ The extension libraries can share also the metadata of the memory area
+ that consists of the shape, the element format, and so on.
+ Using these kinds of metadata, the extension libraries can share even
+ a multidimensional array appropriately.
+ This feature is designed by referring to Python's buffer protocol.
+ [[Feature #13767]] [[Feature #14722]]
+
+* Ractor related C APIs are introduced (experimental) in "include/ruby/ractor.h".
+
+## Implementation improvements
+
+* New method cache mechanism for Ractor. [[Feature #16614]]
+
+ * Inline method caches pointed from ISeq can be accessed by multiple Ractors
+ in parallel and synchronization is needed even for method caches. However,
+ such synchronization can be overhead so introducing new inline method cache
+ mechanisms, (1) Disposable inline method cache (2) per-Class method cache
+ and (3) new invalidation mechanism. (1) can avoid per-method call
+ synchronization because it only uses atomic operations.
+ See the ticket for more details.
+
+* The number of hashes allocated when using a keyword splat in
+ a method call has been reduced to a maximum of 1, and passing
+ a keyword splat to a method that accepts specific keywords
+ does not allocate a hash.
+
+* `super` is optimized when the same type of method is called in the previous call
+ if it's not refinements or an attr reader or writer.
+
+### JIT
+
+* Performance improvements of JIT-ed code
+
+ * Microarchitectural optimizations
+
+ * Native functions shared by multiple methods are deduplicated on JIT compaction.
+
+ * Decrease code size of hot paths by some optimizations and partitioning cold paths.
+
+ * Instance variables
+
+ * Eliminate some redundant checks.
+
+ * Skip checking a class and a object multiple times in a method when possible.
+
+ * Optimize accesses in some core classes like Hash and their subclasses.
+
+ * Method inlining support for some C methods
+
+ * `Kernel`: `#class`, `#frozen?`
+
+ * `Integer`: `#-@`, `#~`, `#abs`, `#bit_length`, `#even?`, `#integer?`, `#magnitude`,
+ `#odd?`, `#ord`, `#to_i`, `#to_int`, `#zero?`
+
+ * `Struct`: reader methods for 10th or later members
+
+ * Constant references are inlined.
+
+ * Always generate appropriate code for `==`, `nil?`, and `!` calls depending on
+ a receiver class.
+
+ * Reduce the number of PC accesses on branches and method returns.
+
+ * Optimize C method calls a little.
+
+* Compilation process improvements
+
+ * It does not keep temporary files in /tmp anymore.
+
+ * Throttle GC and compaction of JIT-ed code.
+
+ * Avoid GC-ing JIT-ed code when not necessary.
+
+ * GC-ing JIT-ed code is executed in a background thread.
+
+ * Reduce the number of locks between Ruby and JIT threads.
+
+## Static analysis
+
+### RBS
+
+* RBS is a new language for type definition of Ruby programs.
+ It allows writing types of classes and modules with advanced
+ types including union types, overloading, generics, and
+ _interface types_ for duck typing.
+
+* Ruby ships with type definitions for core/stdlib classes.
+
+* `rbs` gem is bundled to load and process RBS files.
+
+### TypeProf
+
+* TypeProf is a type analysis tool for Ruby code based on abstract interpretation.
+
+ * It reads non-annotated Ruby code, tries inferring its type signature, and prints
+ the analysis result in RBS format.
+
+ * Though it supports only a subset of the Ruby language yet, we will continuously
+ improve the coverage of language features, analysis performance, and usability.
+
+```ruby
+# test.rb
+def foo(x)
+ if x > 10
+ x.to_s
+ else
+ nil
+ end
+end
+
+foo(42)
+```
+
+```
+$ typeprof test.rb
+# Classes
+class Object
+ def foo : (Integer) -> String?
+end
+```
+
+## Miscellaneous changes
+
+* Methods using `ruby2_keywords` will no longer keep empty keyword
+ splats, those are now removed just as they are for methods not
+ using `ruby2_keywords`.
+
+* When an exception is caught in the default handler, the error
+ message and backtrace are printed in order from the innermost.
+ [[Feature #8661]]
+
+* Accessing an uninitialized instance variable no longer emits a
+ warning in verbose mode. [[Feature #17055]]
+
+[Bug #4352]: https://bugs.ruby-lang.org/issues/4352
+[Bug #6087]: https://bugs.ruby-lang.org/issues/6087
+[Bug #8382]: https://bugs.ruby-lang.org/issues/8382
+[Bug #8446]: https://bugs.ruby-lang.org/issues/8446
+[Feature #8661]: https://bugs.ruby-lang.org/issues/8661
+[Feature #8709]: https://bugs.ruby-lang.org/issues/8709
+[Feature #8948]: https://bugs.ruby-lang.org/issues/8948
+[Feature #9573]: https://bugs.ruby-lang.org/issues/9573
+[Bug #10845]: https://bugs.ruby-lang.org/issues/10845
+[Bug #12136]: https://bugs.ruby-lang.org/issues/12136
+[Feature #12650]: https://bugs.ruby-lang.org/issues/12650
+[Bug #12706]: https://bugs.ruby-lang.org/issues/12706
+[Feature #13767]: https://bugs.ruby-lang.org/issues/13767
+[Bug #13768]: https://bugs.ruby-lang.org/issues/13768
+[Feature #14183]: https://bugs.ruby-lang.org/issues/14183
+[Bug #14266]: https://bugs.ruby-lang.org/issues/14266
+[Feature #14267]: https://bugs.ruby-lang.org/issues/14267
+[Feature #14413]: https://bugs.ruby-lang.org/issues/14413
+[Bug #14541]: https://bugs.ruby-lang.org/issues/14541
+[Feature #14722]: https://bugs.ruby-lang.org/issues/14722
+[Bug #15409]: https://bugs.ruby-lang.org/issues/15409
+[Feature #15504]: https://bugs.ruby-lang.org/issues/15504
+[Feature #15575]: https://bugs.ruby-lang.org/issues/15575
+[Feature #15822]: https://bugs.ruby-lang.org/issues/15822
+[Misc #15893]: https://bugs.ruby-lang.org/issues/15893
+[Feature #15921]: https://bugs.ruby-lang.org/issues/15921
+[Feature #15973]: https://bugs.ruby-lang.org/issues/15973
+[Feature #16131]: https://bugs.ruby-lang.org/issues/16131
+[Feature #16150]: https://bugs.ruby-lang.org/issues/16150
+[Feature #16166]: https://bugs.ruby-lang.org/issues/16166
+[Feature #16175]: https://bugs.ruby-lang.org/issues/16175
+[Feature #16233]: https://bugs.ruby-lang.org/issues/16233
+[Feature #16260]: https://bugs.ruby-lang.org/issues/16260
+[Feature #16274]: https://bugs.ruby-lang.org/issues/16274
+[Feature #16345]: https://bugs.ruby-lang.org/issues/16345
+[Feature #16377]: https://bugs.ruby-lang.org/issues/16377
+[Feature #16378]: https://bugs.ruby-lang.org/issues/16378
+[Feature #16555]: https://bugs.ruby-lang.org/issues/16555
+[Feature #16604]: https://bugs.ruby-lang.org/issues/16604
+[Feature #16614]: https://bugs.ruby-lang.org/issues/16614
+[Feature #16686]: https://bugs.ruby-lang.org/issues/16686
+[Feature #16746]: https://bugs.ruby-lang.org/issues/16746
+[Feature #16754]: https://bugs.ruby-lang.org/issues/16754
+[Feature #16786]: https://bugs.ruby-lang.org/issues/16786
+[Feature #16792]: https://bugs.ruby-lang.org/issues/16792
+[Feature #16815]: https://bugs.ruby-lang.org/issues/16815
+[Feature #16828]: https://bugs.ruby-lang.org/issues/16828
+[Misc #16961]: https://bugs.ruby-lang.org/issues/16961
+[Bug #17030]: https://bugs.ruby-lang.org/issues/17030
+[Feature #17055]: https://bugs.ruby-lang.org/issues/17055
+[Feature #17104]: https://bugs.ruby-lang.org/issues/17104
+[Feature #17122]: https://bugs.ruby-lang.org/issues/17122
+[Feature #17136]: https://bugs.ruby-lang.org/issues/17136
+[Feature #17176]: https://bugs.ruby-lang.org/issues/17176
+[Feature #17187]: https://bugs.ruby-lang.org/issues/17187
+[Bug #17221]: https://bugs.ruby-lang.org/issues/17221
+[Feature #17260]: https://bugs.ruby-lang.org/issues/17260
+[Feature #17273]: https://bugs.ruby-lang.org/issues/17273
+[Feature #17303]: https://bugs.ruby-lang.org/issues/17303
+[Feature #17314]: https://bugs.ruby-lang.org/issues/17314
+[Feature #17322]: https://bugs.ruby-lang.org/issues/17322
+[Feature #17351]: https://bugs.ruby-lang.org/issues/17351
+[Feature #17371]: https://bugs.ruby-lang.org/issues/17371
+[Bug #17419]: https://bugs.ruby-lang.org/issues/17419
+[GH-2991]: https://github.com/ruby/ruby/pull/2991
diff --git a/README.EXT b/README.EXT
index 3e010c3002..48b8d964c4 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1,1731 +1 @@
-# README.EXT - -*- RDoc -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-This document explains how to make extension libraries for Ruby.
-
-= Basic Knowledge
-
-In C, variables have types and data do not have types. In contrast,
-Ruby variables do not have a static type, and data themselves have
-types, so data will need to be converted between the languages.
-
-Data in Ruby are represented by the C type `VALUE'. Each VALUE data
-has its data type.
-
-To retrieve C data from a VALUE, you need to:
-
-1. Identify the VALUE's data type
-2. Convert the VALUE into C data
-
-Converting to the wrong data type may cause serious problems.
-
-== Data Types
-
-The Ruby interpreter has the following data types:
-
-T_NIL :: nil
-T_OBJECT :: ordinary object
-T_CLASS :: class
-T_MODULE :: module
-T_FLOAT :: floating point number
-T_STRING :: string
-T_REGEXP :: regular expression
-T_ARRAY :: array
-T_HASH :: associative array
-T_STRUCT :: (Ruby) structure
-T_BIGNUM :: multi precision integer
-T_FIXNUM :: Fixnum(31bit or 63bit integer)
-T_COMPLEX :: complex number
-T_RATIONAL :: rational number
-T_FILE :: IO
-T_TRUE :: true
-T_FALSE :: false
-T_DATA :: data
-T_SYMBOL :: symbol
-
-In addition, there are several other types used internally:
-
-T_ICLASS :: included module
-T_MATCH :: MatchData object
-T_UNDEF :: undefined
-T_NODE :: syntax tree node
-T_ZOMBIE :: object awaiting finalization
-
-Most of the types are represented by C structures.
-
-== Check Data Type of the VALUE
-
-The macro TYPE() defined in ruby.h shows the data type of the VALUE.
-TYPE() returns the constant number T_XXXX described above. To handle
-data types, your code will look something like this:
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* process Fixnum */
- break;
- case T_STRING:
- /* process String */
- break;
- case T_ARRAY:
- /* process Array */
- break;
- default:
- /* raise exception */
- rb_raise(rb_eTypeError, "not valid value");
- break;
- }
-
-There is the data type check function
-
- void Check_Type(VALUE value, int type)
-
-which raises an exception if the VALUE does not have the type
-specified.
-
-There are also faster check macros for fixnums and nil.
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-== Convert VALUE into C Data
-
-The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
-respectively. They are singletons for the data type.
-The equivalent C constants are: Qnil, Qfalse, Qtrue.
-Note that Qfalse is false in C also (i.e. 0), but not Qnil.
-
-The T_FIXNUM data is a 31bit or 63bit length fixed integer.
-This size depends on the size of long: if long is 32bit then
-T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
-T_FIXNUM can be converted to a C integer by using the
-FIX2INT() macro or FIX2LONG(). Though you have to check that the
-data is really FIXNUM before using them, they are faster. FIX2LONG()
-never raises exceptions, but FIX2INT() raises RangeError if the
-result is bigger or smaller than the size of int.
-There are also NUM2INT() and NUM2LONG() which converts any Ruby
-numbers into C integers. These macros include a type check,
-so an exception will be raised if the conversion failed. NUM2DBL()
-can be used to retrieve the double float value in the same way.
-
-You can use the macros
-StringValue() and StringValuePtr() to get a char* from a VALUE.
-StringValue(var) replaces var's value with the result of "var.to_str()".
-StringValuePtr(var) does the same replacement and returns char*
-representation of var. These macros will skip the replacement if var
-is a String. Notice that the macros take only the lvalue as their
-argument, to change the value of var in place.
-
-You can also use the macro named StringValueCStr(). This is just
-like StringValuePtr(), but always add NUL character at the end of
-the result. If the result contains NUL character, this macro causes
-the ArgumentError exception.
-StringValuePtr() doesn't guarantee the existence of a NUL at the end
-of the result, and the result may contain NUL.
-
-Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has the corresponding
-structure can be cast to retrieve the pointer to the struct. The
-casting macro will be of the form RXXXX for each data type; for
-instance, RARRAY(obj). See "ruby.h". However, we do not recommend
-to access RXXXX data directly because these data structures are complex.
-Use corresponding rb_xxx() functions to access the internal struct.
-For example, to access an entry of array, use rb_ary_entry(ary, offset)
-and rb_ary_store(ary, offset, obj).
-
-There are some accessing macros for structure members, for example
-`RSTRING_LEN(str)' to get the size of the Ruby String object. The
-allocated region can be accessed by `RSTRING_PTR(str)'.
-
-Notice: Do not change the value of the structure directly, unless you
-are responsible for the result. This ends up being the cause of
-interesting bugs.
-
-== Convert C Data into VALUE
-
-To convert C data to Ruby values:
-
-FIXNUM ::
-
- left shift 1 bit, and turn on its least significant bit (LSB).
-
-Other pointer values::
-
- cast to VALUE.
-
-You can determine whether a VALUE is a pointer or not by checking its LSB.
-
-Notice: Ruby does not allow arbitrary pointer values to be a VALUE. They
-should be pointers to the structures which Ruby knows about. The known
-structures are defined in <ruby.h>.
-
-To convert C numbers to Ruby values, use these macros:
-
-INT2FIX() :: for integers within 31bits.
-INT2NUM() :: for arbitrary sized integers.
-
-INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
-range, but is a bit slower.
-
-== Manipulating Ruby Data
-
-As I already mentioned, it is not recommended to modify an object's
-internal structure. To manipulate objects, use the functions supplied
-by the Ruby interpreter. Some (not all) of the useful functions are
-listed below:
-
-=== String Functions
-
-rb_str_new(const char *ptr, long len) ::
-
- Creates a new Ruby string.
-
-rb_str_new2(const char *ptr) ::
-rb_str_new_cstr(const char *ptr) ::
-
- Creates a new Ruby string from a C string. This is equivalent to
- rb_str_new(ptr, strlen(ptr)).
-
-rb_str_new_literal(const char *ptr) ::
-
- Creates a new Ruby string from a C string literal.
-
-rb_tainted_str_new(const char *ptr, long len) ::
-
- Creates a new tainted Ruby string. Strings from external data
- sources should be tainted.
-
-rb_tainted_str_new2(const char *ptr) ::
-rb_tainted_str_new_cstr(const char *ptr) ::
-
- Creates a new tainted Ruby string from a C string.
-
-rb_sprintf(const char *format, ...) ::
-rb_vsprintf(const char *format, va_list ap) ::
-
- Creates a new Ruby string with printf(3) format.
-
- Note: In the format string, "%"PRIsVALUE can be used for Object#to_s
- (or Object#inspect if '+' flag is set) output (and related argument
- must be a VALUE). Since it conflicts with "%i", for integers in
- format strings, use "%d".
-
-rb_str_cat(VALUE str, const char *ptr, long len) ::
-
- Appends len bytes of data from ptr to the Ruby string.
-
-rb_str_cat2(VALUE str, const char* ptr) ::
-rb_str_cat_cstr(VALUE str, const char* ptr) ::
-
- Appends C string ptr to Ruby string str. This function is
- equivalent to rb_str_cat(str, ptr, strlen(ptr)).
-
-rb_str_catf(VALUE str, const char* format, ...) ::
-rb_str_vcatf(VALUE str, const char* format, va_list ap) ::
-
- Appends C string format and successive arguments to Ruby string
- str according to a printf-like format. These functions are
- equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
- rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
-
-rb_enc_str_new(const char *ptr, long len, rb_encoding *enc) ::
-rb_enc_str_new_cstr(const char *ptr, rb_encoding *enc) ::
-
- Creates a new Ruby string with the specified encoding.
-
-rb_enc_str_new_literal(const char *ptr) ::
-
- Creates a new Ruby string from a C string literal with the specified
- encoding.
-
-rb_usascii_str_new(const char *ptr, long len) ::
-rb_usascii_str_new_cstr(const char *ptr) ::
-
- Creates a new Ruby string with encoding US-ASCII.
-
-rb_usascii_str_new_literal(const char *ptr) ::
-
- Creates a new Ruby string from a C string literal with encoding
- US-ASCII.
-
-rb_utf8_str_new(const char *ptr, long len) ::
-rb_utf8_str_new_cstr(const char *ptr) ::
-
- Creates a new Ruby string with encoding UTF-8.
-
-rb_utf8_str_new_literal(const char *ptr) ::
-
- Creates a new Ruby string from a C string literal with encoding
- UTF-8.
-
-rb_str_resize(VALUE str, long len) ::
-
- Resizes a Ruby string to len bytes. If str is not modifiable, this
- function raises an exception. The length of str must be set in
- advance. If len is less than the old length the content beyond
- len bytes is discarded, else if len is greater than the old length
- the content beyond the old length bytes will not be preserved but
- will be garbage. Note that RSTRING_PTR(str) may change by calling
- this function.
-
-rb_str_set_len(VALUE str, long len) ::
-
- Sets the length of a Ruby string. If str is not modifiable, this
- function raises an exception. This function preserves the content
- up to len bytes, regardless RSTRING_LEN(str). len must not exceed
- the capacity of str.
-
-=== Array Functions
-
-rb_ary_new() ::
-
- Creates an array with no elements.
-
-rb_ary_new2(long len) ::
-rb_ary_new_capa(long len) ::
-
- Creates an array with no elements, allocating internal buffer
- for len elements.
-
-rb_ary_new3(long n, ...) ::
-rb_ary_new_from_args(long n, ...) ::
-
- Creates an n-element array from the arguments.
-
-rb_ary_new4(long n, VALUE *elts) ::
-rb_ary_new_from_values(long n, VALUE *elts) ::
-
- Creates an n-element array from a C array.
-
-rb_ary_to_ary(VALUE obj) ::
-
- Converts the object into an array.
- Equivalent to Object#to_ary.
-
-There are many functions to operate an array. They may dump core if other
-types are given.
-
-rb_ary_aref(argc, VALUE *argv, VALUE ary) ::
-
- Equivalent to Array#[].
-
-rb_ary_entry(VALUE ary, long offset) ::
-
- ary[offset]
-
-rb_ary_store(VALUE ary, long offset, VALUE obj) ::
-
- ary[offset] = obj
-
-rb_ary_subseq(VALUE ary, long beg, long len) ::
-
- ary[beg, len]
-
-rb_ary_push(VALUE ary, VALUE val) ::
-rb_ary_pop(VALUE ary) ::
-rb_ary_shift(VALUE ary) ::
-rb_ary_unshift(VALUE ary, VALUE val) ::
-
-rb_ary_cat(VALUE ary, const VALUE *ptr, long len) ::
-
- Appends len elements of objects from ptr to the array.
-
-= Extending Ruby with C
-
-== Adding New Features to Ruby
-
-You can add new features (classes, methods, etc.) to the Ruby
-interpreter. Ruby provides APIs for defining the following things:
-
-* Classes, Modules
-* Methods, Singleton Methods
-* Constants
-
-=== Class and Module Definition
-
-To define a class or module, use the functions below:
-
- VALUE rb_define_class(const char *name, VALUE super)
- VALUE rb_define_module(const char *name)
-
-These functions return the newly created class or module. You may
-want to save this reference into a variable to use later.
-
-To define nested classes or modules, use the functions below:
-
- VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
- VALUE rb_define_module_under(VALUE outer, const char *name)
-
-=== Method and Singleton Method Definition
-
-To define methods or singleton methods, use these functions:
-
- void rb_define_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, const char *name,
- VALUE (*func)(), int argc)
-
-The `argc' represents the number of the arguments to the C function,
-which must be less than 17. But I doubt you'll need that many.
-
-If `argc' is negative, it specifies the calling sequence, not number of
-the arguments.
-
-If argc is -1, the function will be called as:
-
- VALUE func(int argc, VALUE *argv, VALUE obj)
-
-where argc is the actual number of arguments, argv is the C array of
-the arguments, and obj is the receiver.
-
-If argc is -2, the arguments are passed in a Ruby array. The function
-will be called like:
-
- VALUE func(VALUE obj, VALUE args)
-
-where obj is the receiver, and args is the Ruby array containing
-actual arguments.
-
-There are some more functions to define methods. One takes an ID
-as the name of method to be defined. See also ID or Symbol below.
-
- void rb_define_method_id(VALUE klass, ID name,
- VALUE (*func)(ANYARGS), int argc)
-
-There are two functions to define private/protected methods:
-
- void rb_define_private_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
- void rb_define_protected_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
-At last, rb_define_module_function defines a module function,
-which are private AND singleton methods of the module.
-For example, sqrt is a module function defined in the Math module.
-It can be called in the following way:
-
- Math.sqrt(4)
-
-or
-
- include Math
- sqrt(4)
-
-To define module functions, use:
-
- void rb_define_module_function(VALUE module, const char *name,
- VALUE (*func)(), int argc)
-
-In addition, function-like methods, which are private methods defined
-in the Kernel module, can be defined using:
-
- void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-To define an alias for the method,
-
- void rb_define_alias(VALUE module, const char* new, const char* old);
-
-To define a reader/writer for an attribute,
-
- void rb_define_attr(VALUE klass, const char *name, int read, int write)
-
-To define and undefine the `allocate' class method,
-
- void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
- void rb_undef_alloc_func(VALUE klass);
-
-func has to take the klass as the argument and return a newly
-allocated instance. This instance should be as empty as possible,
-without any expensive (including external) resources.
-
-If you are overriding an existing method of any ancestor of your class,
-you may rely on:
-
- VALUE rb_call_super(int argc, const VALUE *argv)
-
-To achieve the receiver of the current scope (if no other way is
-available), you can use:
-
- VALUE rb_current_receiver(void)
-
-=== Constant Definition
-
-We have 2 functions to define constants:
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
- void rb_define_global_const(const char *name, VALUE val)
-
-The former is to define a constant under specified class/module. The
-latter is to define a global constant.
-
-== Use Ruby Features from C
-
-There are several ways to invoke Ruby's features from C code.
-
-=== Evaluate Ruby Programs in a String
-
-The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program. This function will do the job:
-
- VALUE rb_eval_string(const char *str)
-
-Evaluation is done under the current context, thus current local variables
-of the innermost method (which is defined by Ruby) can be accessed.
-
-Note that the evaluation can raise an exception. There is a safer
-function:
-
- VALUE rb_eval_string_protect(const char *str, int *state)
-
-It returns nil when an error occurred. Moreover, *state is zero if str was
-successfully evaluated, or nonzero otherwise.
-
-=== ID or Symbol
-
-You can invoke methods directly, without parsing the string. First I
-need to explain about ID. ID is the integer number to represent
-Ruby's identifiers such as variable names. The Ruby data type
-corresponding to ID is Symbol. It can be accessed from Ruby in the
-form:
-
- :Identifier
-
-or
-
- :"any kind of string"
-
-You can get the ID value from a string within C code by using
-
- rb_intern(const char *name)
- rb_intern_str(VALUE name)
-
-You can retrieve ID from Ruby object (Symbol or String) given as an
-argument by using
-
- rb_to_id(VALUE symbol)
- rb_check_id(volatile VALUE *name)
- rb_check_id_cstr(const char *name, long len, rb_encoding *enc)
-
-These functions try to convert the argument to a String if it was not
-a Symbol nor a String. The second function stores the converted
-result into *name, and returns 0 if the string is not a known symbol.
-After this function returned a non-zero value, *name is always a
-Symbol or a String, otherwise it is a String if the result is 0.
-The third function takes NUL-terminated C string, not Ruby VALUE.
-
-You can retrieve Symbol from Ruby object (Symbol or String) given as
-an argument by using
-
- rb_to_symbol(VALUE name)
- rb_check_symbol(volatile VALUE *namep)
- rb_check_symbol_cstr(const char *ptr, long len, rb_encoding *enc)
-
-These functions are similar to above functions except that these
-return a Symbol instead of an ID.
-
-You can convert C ID to Ruby Symbol by using
-
- VALUE ID2SYM(ID id)
-
-and to convert Ruby Symbol object to ID, use
-
- ID SYM2ID(VALUE symbol)
-
-=== Invoke Ruby Method from C
-
-To invoke methods directly, you can use the function below
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-This function invokes a method on the recv, with the method name
-specified by the symbol mid.
-
-=== Accessing the Variables and Constants
-
-You can access class variables and instance variables using access
-functions. Also, global variables can be shared between both
-environments. There's no way to access Ruby's local variables.
-
-The functions to access/modify instance variables are below:
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id must be the symbol, which can be retrieved by rb_intern().
-
-To access the constants of the class/module:
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-See also Constant Definition above.
-
-= Information Sharing Between Ruby and C
-
-=== Ruby Constants That Can Be Accessed From C
-
-As stated in section 1.3,
-the following Ruby constants can be referred from C.
-
- Qtrue
- Qfalse
-
-Boolean values. Qfalse is false in C also (i.e. 0).
-
- Qnil
-
-Ruby nil in C scope.
-
-== Global Variables Shared Between C and Ruby
-
-Information can be shared between the two environments using shared global
-variables. To define them, you can use functions listed below:
-
- void rb_define_variable(const char *name, VALUE *var)
-
-This function defines the variable which is shared by both environments.
-The value of the global variable pointed to by `var' can be accessed
-through Ruby's global variable named `name'.
-
-You can define read-only (from Ruby, of course) variables using the
-function below.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-You can defined hooked variables. The accessor functions (getter and
-setter) are called on access to the hooked variables.
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
-If you need to supply either setter or getter, just supply 0 for the
-hook you don't need. If both hooks are 0, rb_define_hooked_variable()
-works just like rb_define_variable().
-
-The prototypes of the getter and setter functions are as follows:
-
- VALUE (*getter)(ID id, VALUE *var);
- void (*setter)(VALUE val, ID id, VALUE *var);
-
-
-Also you can define a Ruby global variable without a corresponding C
-variable. The value of the variable will be set/get only by hooks.
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
-The prototypes of the getter and setter functions are as follows:
-
- VALUE (*getter)(ID id);
- void (*setter)(VALUE val, ID id);
-
-
-== Encapsulate C Data into a Ruby Object
-
-To wrap and objectify a C pointer as a Ruby object (so called
-DATA), use Data_Wrap_Struct().
-
- Data_Wrap_Struct(klass, mark, free, sval)
-
-Data_Wrap_Struct() returns a created DATA object. The klass argument
-is the class for the DATA object. The mark argument is the function
-to mark Ruby objects pointed by this data. The free argument is the
-function to free the pointer allocation. If this is -1, the pointer
-will be just freed. The functions mark and free will be called from
-garbage collector.
-
-These mark / free functions are invoked during GC execution. No
-object allocations are allowed during it, so do not allocate ruby
-objects inside them.
-
-You can allocate and wrap the structure in one step.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro returns an allocated Data object, wrapping the pointer to
-the structure, which is also allocated. This macro works like:
-
- (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-
-Arguments klass, mark, and free work like their counterparts in
-Data_Wrap_Struct(). A pointer to the allocated structure will be
-assigned to sval, which should be a pointer of the type specified.
-
-To retrieve the C pointer from the Data object, use the macro
-Data_Get_Struct().
-
- Data_Get_Struct(obj, type, sval)
-
-A pointer to the structure will be assigned to the variable sval.
-
-See the example below for details.
-
-= Example - Creating the dbm Extension
-
-OK, here's the example of making an extension library. This is the
-extension to access DBMs. The full source is included in the ext/
-directory in the Ruby's source tree.
-
-== Make the Directory
-
- % mkdir ext/dbm
-
-Make a directory for the extension library under ext directory.
-
-== Design the Library
-
-You need to design the library features, before making it.
-
-== Write the C Code
-
-You need to write C code for your extension library. If your library
-has only one source file, choosing ``LIBRARY.c'' as a file name is
-preferred. On the other hand, in case your library has multiple source
-files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
-with an intermediate file ``LIBRARY.o'' on some platforms.
-Note that some functions in mkmf library described below generate
-a file ``conftest.c'' for checking with compilation. You shouldn't
-choose ``conftest.c'' as a name of a source file.
-
-Ruby will execute the initializing function named ``Init_LIBRARY'' in
-the library. For example, ``Init_dbm()'' will be executed when loading
-the library.
-
-Here's the example of an initializing function.
-
- void
- Init_dbm(void)
- {
- /* define DBM class */
- VALUE cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM includes Enumerable module */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM has class method open(): arguments are received as C array */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM instance method close(): no args */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM instance method []: 1 argument */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-
- /* ... */
-
- /* ID for a instance variable to store DBM data */
- id_dbm = rb_intern("dbm");
- }
-
-The dbm extension wraps the dbm struct in the C environment using
-Data_Make_Struct.
-
- struct dbmdata {
- int di_size;
- DBM *di_dbm;
- };
-
- obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
-
-This code wraps the dbmdata structure into a Ruby object. We avoid
-wrapping DBM* directly, because we want to cache size information.
-
-To retrieve the dbmdata structure from a Ruby object, we define the
-following macro:
-
- #define GetDBM(obj, dbmp) do {\
- Data_Get_Struct((obj), struct dbmdata, (dbmp));\
- if ((dbmp) == 0) closed_dbm();\
- if ((dbmp)->di_dbm == 0) closed_dbm();\
- } while (0)
-
-This sort of complicated macro does the retrieving and close checking for
-the DBM.
-
-There are three kinds of way to receive method arguments. First,
-methods with a fixed number of arguments receive arguments like this:
-
- static VALUE
- fdbm_delete(VALUE obj, VALUE keystr)
- {
- /* ... */
- }
-
-The first argument of the C function is the self, the rest are the
-arguments to the method.
-
-Second, methods with an arbitrary number of arguments receive
-arguments like this:
-
- static VALUE
- fdbm_s_open(int argc, VALUE *argv, VALUE klass)
- {
- /* ... */
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- /* ... */
- }
-
-The first argument is the number of method arguments, the second
-argument is the C array of the method arguments, and the third
-argument is the receiver of the method.
-
-You can use the function rb_scan_args() to check and retrieve the
-arguments. The third argument is a string that specifies how to
-capture method arguments and assign them to the following VALUE
-references.
-
-
-The following is an example of a method that takes arguments by Ruby's
-array:
-
- static VALUE
- thread_initialize(VALUE thread, VALUE args)
- {
- /* ... */
- }
-
-The first argument is the receiver, the second one is the Ruby array
-which contains the arguments to the method.
-
-*Notice*: GC should know about global variables which refer to Ruby's objects,
-but are not exported to the Ruby world. You need to protect them by
-
- void rb_global_variable(VALUE *var)
-
-== Prepare extconf.rb
-
-If the file named extconf.rb exists, it will be executed to generate
-Makefile.
-
-extconf.rb is the file for checking compilation conditions etc. You
-need to put
-
- require 'mkmf'
-
-at the top of the file. You can use the functions below to check
-various conditions.
-
- have_macro(macro[, headers[, opt]]): check whether macro is defined
- have_library(lib[, func[, headers[, opt]]]): check whether library containing function exists
- find_library(lib[, func, *paths]): find library from paths
- have_func(func[, headers[, opt]): check whether function exists
- have_var(var[, headers[, opt]]): check whether variable exists
- have_header(header[, preheaders[, opt]]): check whether header file exists
- find_header(header, *paths): find header from paths
- have_framework(fw): check whether framework exists (for MacOS X)
- have_struct_member(type, member[, headers[, opt]]): check whether struct has member
- have_type(type[, headers[, opt]]): check whether type exists
- find_type(type, opt, *headers): check whether type exists in headers
- have_const(const[, headers[, opt]]): check whether constant is defined
- check_sizeof(type[, headers[, opts]]): check size of type
- check_signedness(type[, headers[, opts]]): check signedness of type
- convertible_int(type[, headers[, opts]]): find convertible integer type
- find_executable(bin[, path]): find executable file path
- create_header(header): generate configured header
- create_makefile(target[, target_prefix]): generate Makefile
-
-See MakeMakefile for full documentation of these functions.
-
-The value of the variables below will affect the Makefile.
-
- $CFLAGS: included in CFLAGS make variable (such as -O)
- $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
- $LDFLAGS: included in LDFLAGS make variable (such as -L)
- $objs: list of object file names
-
-Normally, the object files list is automatically generated by searching
-source files, but you must define them explicitly if any sources will
-be generated while building.
-
-If a compilation condition is not fulfilled, you should not call
-``create_makefile''. The Makefile will not be generated, compilation will
-not be done.
-
-== Prepare Depend (Optional)
-
-If the file named depend exists, Makefile will include that file to
-check dependencies. You can make this file by invoking
-
- % gcc -MM *.c > depend
-
-It's harmless. Prepare it.
-
-== Generate Makefile
-
-Try generating the Makefile by:
-
- ruby extconf.rb
-
-If the library should be installed under vendor_ruby directory
-instead of site_ruby directory, use --vendor option as follows.
-
- ruby extconf.rb --vendor
-
-You don't need this step if you put the extension library under the ext
-directory of the ruby source tree. In that case, compilation of the
-interpreter will do this step for you.
-
-== Run make
-
-Type
-
- make
-
-to compile your extension. You don't need this step either if you have
-put the extension library under the ext directory of the ruby source tree.
-
-== Debug
-
-You may need to rb_debug the extension. Extensions can be linked
-statically by adding the directory name in the ext/Setup file so that
-you can inspect the extension with the debugger.
-
-== Done! Now You Have the Extension Library
-
-You can do anything you want with your library. The author of Ruby
-will not claim any restrictions on your code depending on the Ruby API.
-Feel free to use, modify, distribute or sell your program.
-
-= Appendix A. Ruby Source Files Overview
-
-== Ruby Language Core
-
-class.c :: classes and modules
-error.c :: exception classes and exception mechanism
-gc.c :: memory management
-load.c :: library loading
-object.c :: objects
-variable.c :: variables and constants
-
-== Ruby Syntax Parser
-
-parse.y :: grammar definition
-parse.c :: automatically generated from parse.y
-keywords :: reserved keywords
-lex.c :: automatically generated from keywords
-
-== Ruby Evaluator (a.k.a. YARV)
-
- compile.c
- eval.c
- eval_error.c
- eval_jump.c
- eval_safe.c
- insns.def : definition of VM instructions
- iseq.c : implementation of VM::ISeq
- thread.c : thread management and context switching
- thread_win32.c : thread implementation
- thread_pthread.c : ditto
- vm.c
- vm_dump.c
- vm_eval.c
- vm_exec.c
- vm_insnhelper.c
- vm_method.c
-
- opt_insns_unif.def : instruction unification
- opt_operand.def : definitions for optimization
-
- -> insn*.inc : automatically generated
- -> opt*.inc : automatically generated
- -> vm.inc : automatically generated
-
-== Regular Expression Engine (Oniguruma)
-
- regex.c
- regcomp.c
- regenc.c
- regerror.c
- regexec.c
- regparse.c
- regsyntax.c
-
-== Utility Functions
-
-debug.c :: debug symbols for C debugger
-dln.c :: dynamic loading
-st.c :: general purpose hash table
-strftime.c :: formatting times
-util.c :: misc utilities
-
-== Ruby Interpreter Implementation
-
- dmyext.c
- dmydln.c
- dmyencoding.c
- id.c
- inits.c
- main.c
- ruby.c
- version.c
-
- gem_prelude.rb
- prelude.rb
-
-== Class Library
-
-array.c :: Array
-bignum.c :: Bignum
-compar.c :: Comparable
-complex.c :: Complex
-cont.c :: Fiber, Continuation
-dir.c :: Dir
-enum.c :: Enumerable
-enumerator.c :: Enumerator
-file.c :: File
-hash.c :: Hash
-io.c :: IO
-marshal.c :: Marshal
-math.c :: Math
-numeric.c :: Numeric, Integer, Fixnum, Float
-pack.c :: Array#pack, String#unpack
-proc.c :: Binding, Proc
-process.c :: Process
-random.c :: random number
-range.c :: Range
-rational.c :: Rational
-re.c :: Regexp, MatchData
-signal.c :: Signal
-sprintf.c :: String#sprintf
-string.c :: String
-struct.c :: Struct
-time.c :: Time
-
-defs/known_errors.def :: Errno::* exception classes
--> known_errors.inc :: automatically generated
-
-== Multilingualization
-
-encoding.c :: Encoding
-transcode.c :: Encoding::Converter
-enc/*.c :: encoding classes
-enc/trans/* :: codepoint mapping tables
-
-== goruby Interpreter Implementation
-
- goruby.c
- golf_prelude.rb : goruby specific libraries.
- -> golf_prelude.c : automatically generated
-
-
-= Appendix B. Ruby Extension API Reference
-
-== Types
-
-VALUE ::
-
- The type for the Ruby object. Actual structures are defined in ruby.h,
- such as struct RString, etc. To refer the values in structures, use
- casting macros like RSTRING(obj).
-
-== Variables and Constants
-
-Qnil::
- nil object
-
-Qtrue::
- true object (default true value)
-
-Qfalse::
- false object
-
-== C Pointer Wrapping
-
-Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval) ::
-
- Wrap a C pointer into a Ruby object. If object has references to other
- Ruby objects, they should be marked by using the mark function during
- the GC process. Otherwise, mark should be 0. When this object is no
- longer referred by anywhere, the pointer will be discarded by free
- function.
-
-Data_Make_Struct(klass, type, mark, free, sval) ::
-
- This macro allocates memory using malloc(), assigns it to the variable
- sval, and returns the DATA encapsulating the pointer to memory region.
-
-Data_Get_Struct(data, type, sval) ::
-
- This macro retrieves the pointer value from DATA, and assigns it to
- the variable sval.
-
-== Checking Data Types
-
-TYPE(value) ::
-
- Internal type (T_NIL, T_FIXNUM, etc.)
-
-FIXNUM_P(value) ::
-
- Is +value+ a Fixnum?
-
-NIL_P(value) ::
-
- Is +value+ nil?
-
-void Check_Type(VALUE value, int type) ::
-
- Ensures +value+ is of the given internal +type+ or raises a TypeError
-
-SaveStringValue(value) ::
-
- Checks that +value+ is a String and is not tainted
-
-== Data Type Conversion
-
-FIX2INT(value), INT2FIX(i) ::
-
- Fixnum <-> integer
-
-FIX2LONG(value), LONG2FIX(l) ::
-
- Fixnum <-> long
-
-NUM2INT(value), INT2NUM(i) ::
-
- Numeric <-> integer
-
-NUM2UINT(value), UINT2NUM(ui) ::
-
- Numeric <-> unsigned integer
-
-NUM2LONG(value), LONG2NUM(l) ::
-
- Numeric <-> long
-
-NUM2ULONG(value), ULONG2NUM(ul) ::
-
- Numeric <-> unsigned long
-
-NUM2LL(value), LL2NUM(ll) ::
-
- Numeric <-> long long
-
-NUM2ULL(value), ULL2NUM(ull) ::
-
- Numeric <-> unsigned long long
-
-NUM2OFFT(value), OFFT2NUM(off) ::
-
- Numeric <-> off_t
-
-NUM2SIZET(value), SIZET2NUM(size) ::
-
- Numeric <-> size_t
-
-NUM2SSIZET(value), SSIZET2NUM(ssize) ::
-
- Numeric <-> ssize_t
-
-rb_integer_pack(value, words, numwords, wordsize, nails, flags), rb_integer_unpack(words, numwords, wordsize, nails, flags) ::
-
- Numeric <-> Arbitrary size integer buffer
-
-NUM2DBL(value) ::
-
- Numeric -> double
-
-rb_float_new(f) ::
-
- double -> Float
-
-RSTRING_LEN(str) ::
-
- String -> length of String data in bytes
-
-RSTRING_PTR(str) ::
-
- String -> pointer to String data
- Note that the result pointer may not be NUL-terminated
-
-StringValue(value) ::
-
- Object with #to_str -> String
-
-StringValuePtr(value) ::
-
- Object with #to_str -> pointer to String data
-
-StringValueCStr(value) ::
-
- Object with #to_str -> pointer to String data without NUL bytes
- It is guaranteed that the result data is NUL-terminated
-
-rb_str_new2(s) ::
-
- char * -> String
-
-== Defining Classes and Modules
-
-VALUE rb_define_class(const char *name, VALUE super) ::
-
- Defines a new Ruby class as a subclass of super.
-
-VALUE rb_define_class_under(VALUE module, const char *name, VALUE super) ::
-
- Creates a new Ruby class as a subclass of super, under the module's
- namespace.
-
-VALUE rb_define_module(const char *name) ::
-
- Defines a new Ruby module.
-
-VALUE rb_define_module_under(VALUE module, const char *name) ::
-
- Defines a new Ruby module under the module's namespace.
-
-void rb_include_module(VALUE klass, VALUE module) ::
-
- Includes module into class. If class already includes it, just ignored.
-
-void rb_extend_object(VALUE object, VALUE module) ::
-
- Extend the object with the module's attributes.
-
-== Defining Global Variables
-
-void rb_define_variable(const char *name, VALUE *var) ::
-
- Defines a global variable which is shared between C and Ruby. If name
- contains a character which is not allowed to be part of the symbol,
- it can't be seen from Ruby programs.
-
-void rb_define_readonly_variable(const char *name, VALUE *var) ::
-
- Defines a read-only global variable. Works just like
- rb_define_variable(), except the defined variable is read-only.
-
-void rb_define_virtual_variable(const char *name, VALUE (*getter)(), void (*setter)()) ::
-
- Defines a virtual variable, whose behavior is defined by a pair of C
- functions. The getter function is called when the variable is
- referenced. The setter function is called when the variable is set to a
- value. The prototype for getter/setter functions are:
-
- VALUE getter(ID id)
- void setter(VALUE val, ID id)
-
- The getter function must return the value for the access.
-
-void rb_define_hooked_variable(const char *name, VALUE *var, VALUE (*getter)(), void (*setter)()) ::
-
- Defines hooked variable. It's a virtual variable with a C variable.
- The getter is called as
-
- VALUE getter(ID id, VALUE *var)
-
- returning a new value. The setter is called as
-
- void setter(VALUE val, ID id, VALUE *var)
-
- GC requires C global variables which hold Ruby values to be marked.
-
-void rb_global_variable(VALUE *var)
-
- Tells GC to protect these variables.
-
-== Constant Definition
-
-void rb_define_const(VALUE klass, const char *name, VALUE val) ::
-
- Defines a new constant under the class/module.
-
-void rb_define_global_const(const char *name, VALUE val) ::
-
- Defines a global constant. This is just the same as
-
- rb_define_const(rb_cObject, name, val)
-
-== Method Definition
-
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
-
- Defines a method for the class. func is the function pointer. argc
- is the number of arguments. if argc is -1, the function will receive
- 3 arguments: argc, argv, and self. if argc is -2, the function will
- receive 2 arguments, self and args, where args is a Ruby array of
- the method arguments.
-
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
-
- Defines a private method for the class. Arguments are same as
- rb_define_method().
-
-rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
-
- Defines a singleton method. Arguments are same as rb_define_method().
-
-rb_scan_args(int argc, VALUE *argv, const char *fmt, ...) ::
-
- Retrieve argument from argc and argv to given VALUE references
- according to the format string. The format can be described in ABNF
- as follows:
-
- scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
-
- param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec /
- pre-opt-post-arg-spec
- pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
- post-arg-spec := sym-for-variable-length-args
- [num-of-trailing-mandatory-args]
- pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args
- num-of-trailing-mandatory-args
- option-hash-arg-spec := sym-for-option-hash-arg
- block-arg-spec := sym-for-block-arg
-
- num-of-leading-mandatory-args := DIGIT ; The number of leading
- ; mandatory arguments
- num-of-optional-args := DIGIT ; The number of optional
- ; arguments
- sym-for-variable-length-args := "*" ; Indicates that variable
- ; length arguments are
- ; captured as a ruby array
- num-of-trailing-mandatory-args := DIGIT ; The number of trailing
- ; mandatory arguments
- sym-for-option-hash-arg := ":" ; Indicates that an option
- ; hash is captured if the last
- ; argument is a hash or can be
- ; converted to a hash with
- ; #to_hash. When the last
- ; argument is nil, it is
- ; captured if it is not
- ; ambiguous to take it as
- ; empty option hash; i.e. '*'
- ; is not specified and
- ; arguments are given more
- ; than sufficient.
- sym-for-block-arg := "&" ; Indicates that an iterator
- ; block should be captured if
- ; given
-
- For example, "12" means that the method requires at least one
- argument, and at most receives three (1+2) arguments. So, the format
- string must be followed by three variable references, which are to be
- assigned to captured arguments. For omitted arguments, variables are
- set to Qnil. NULL can be put in place of a variable reference, which
- means the corresponding captured argument(s) should be just dropped.
-
- The number of given arguments, excluding an option hash or iterator
- block, is returned.
-
-int rb_get_kwargs(VALUE keyword_hash, const ID *table, int required, int optional, VALUE *values)
-
- Retrieves argument VALUEs bound to keywords, which directed by +table+
- into +values+. First +required+ number of IDs referred by +table+ are
- mandatory, and succeeding +optional+ (- +optional+ - 1 if
- +optional+ is negative) number of IDs are optional. If a
- mandatory key is not contained in +keyword_hash+, raises "missing
- keyword" +ArgumentError+. If an optional key is not present in
- +keyword_hash+, the corresponding element in +values+ is not changed.
- If +optional+ is negative, rest of +keyword_hash+ are stored in the
- next to optional +values+ as a new Hash, otherwise raises "unknown
- keyword" +ArgumentError+.
-
-VALUE rb_extract_keywords(VALUE *original_hash)
-
- Extracts pairs whose key is a symbol into a new hash from a hash
- object referred by +original_hash+. If the original hash contains
- non-symbol keys, then they are copied to another hash and the new hash
- is stored through +original_hash+, else 0 is stored.
-
-== Invoking Ruby method
-
-VALUE rb_funcall(VALUE recv, ID mid, int narg, ...) ::
-
- Invokes a method. To retrieve mid from a method name, use rb_intern().
- Able to call even private/protected methods.
-
-VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv) ::
-VALUE rb_funcallv(VALUE recv, ID mid, int argc, VALUE *argv) ::
-
- Invokes a method, passing arguments as an array of values.
- Able to call even private/protected methods.
-
-VALUE rb_funcallv_public(VALUE recv, ID mid, int argc, VALUE *argv) ::
-
- Invokes a method, passing arguments as an array of values.
- Able to call only public methods.
-
-VALUE rb_eval_string(const char *str) ::
-
- Compiles and executes the string as a Ruby program.
-
-ID rb_intern(const char *name) ::
-
- Returns ID corresponding to the name.
-
-char *rb_id2name(ID id) ::
-
- Returns the name corresponding ID.
-
-char *rb_class2name(VALUE klass) ::
-
- Returns the name of the class.
-
-int rb_respond_to(VALUE obj, ID id) ::
-
- Returns true if the object responds to the message specified by id.
-
-== Instance Variables
-
-VALUE rb_iv_get(VALUE obj, const char *name) ::
-
- Retrieve the value of the instance variable. If the name is not
- prefixed by `@', that variable shall be inaccessible from Ruby.
-
-VALUE rb_iv_set(VALUE obj, const char *name, VALUE val) ::
-
- Sets the value of the instance variable.
-
-== Control Structure
-
-VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv, VALUE (*func) (ANYARGS), VALUE data2) ::
-
- Calls a method on the recv, with the method name specified by the
- symbol mid, with argc arguments in argv, supplying func as the
- block. When func is called as the block, it will receive the value
- from yield as the first argument, and data2 as the second argument.
- When yielded with multiple values (in C, rb_yield_values(),
- rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
- whereas yielded values can be gotten via argc/argv of the third/fourth
- arguments.
-
-[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-
- Calls the function func1, supplying func2 as the block. func1 will be
- called with the argument arg1. func2 receives the value from yield as
- the first argument, arg2 as the second argument.
-
- When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
- This function is obsolete since 1.9; use rb_block_call instead.
-
-VALUE rb_yield(VALUE val) ::
-
- Evaluates the block with value val.
-
-VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-
- Calls the function func1, with arg1 as the argument. If an exception
- occurs during func1, it calls func2 with arg2 as the argument. The
- return value of rb_rescue() is the return value from func1 if no
- exception occurs, from func2 otherwise.
-
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-
- Calls the function func1 with arg1 as the argument, then calls func2
- with arg2 if execution terminated. The return value from
- rb_ensure() is that of func1 when no exception occurred.
-
-VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state) ::
-
- Calls the function func with arg as the argument. If no exception
- occurred during func, it returns the result of func and *state is zero.
- Otherwise, it returns Qnil and sets *state to nonzero. If state is
- NULL, it is not set in both cases.
- You have to clear the error info with rb_set_errinfo(Qnil) when
- ignoring the caught exception.
-
-void rb_jump_tag(int state) ::
-
- Continues the exception caught by rb_protect() and rb_eval_string_protect().
- state must be the returned value from those functions. This function
- never return to the caller.
-
-void rb_iter_break() ::
-
- Exits from the current innermost block. This function never return to
- the caller.
-
-void rb_iter_break_value(VALUE value) ::
-
- Exits from the current innermost block with the value. The block will
- return the given argument value. This function never return to the
- caller.
-
-== Exceptions and Errors
-
-void rb_warn(const char *fmt, ...) ::
-
- Prints a warning message according to a printf-like format.
-
-void rb_warning(const char *fmt, ...) ::
-
- Prints a warning message according to a printf-like format, if
- $VERBOSE is true.
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...) ::
-
- Raises RuntimeError. The fmt is a format string just like printf().
-
-void rb_raise(VALUE exception, const char *fmt, ...) ::
-
- Raises a class exception. The fmt is a format string just like printf().
-
-void rb_fatal(const char *fmt, ...) ::
-
- Raises a fatal error, terminates the interpreter. No exception handling
- will be done for fatal errors, but ensure blocks will be executed.
-
-void rb_bug(const char *fmt, ...) ::
-
- Terminates the interpreter immediately. This function should be
- called under the situation caused by the bug in the interpreter. No
- exception handling nor ensure execution will be done.
-
-Note: In the format string, "%"PRIsVALUE can be used for Object#to_s
-(or Object#inspect if '+' flag is set) output (and related argument
-must be a VALUE). Since it conflicts with "%i", for integers in
-format strings, use "%d".
-
-== Initialize and Start the Interpreter
-
-The embedding API functions are below (not needed for extension libraries):
-
-void ruby_init() ::
-
- Initializes the interpreter.
-
-void *ruby_options(int argc, char **argv) ::
-
- Process command line arguments for the interpreter.
- And compiles the Ruby source to execute.
- It returns an opaque pointer to the compiled source
- or an internal special value.
-
-int ruby_run_node(void *n) ::
-
- Runs the given compiled source and exits this process.
- It returns EXIT_SUCCESS if successfully runs the source.
- Otherwise, it returns other value.
-
-void ruby_script(char *name) ::
-
- Specifies the name of the script ($0).
-
-== Hooks for the Interpreter Events
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events,
- VALUE data)
-
-Adds a hook function for the specified interpreter events.
-events should be OR'ed value of:
-
- RUBY_EVENT_LINE
- RUBY_EVENT_CLASS
- RUBY_EVENT_END
- RUBY_EVENT_CALL
- RUBY_EVENT_RETURN
- RUBY_EVENT_C_CALL
- RUBY_EVENT_C_RETURN
- RUBY_EVENT_RAISE
- RUBY_EVENT_ALL
-
-The definition of rb_event_hook_func_t is below:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
- VALUE self, ID id, VALUE klass)
-
-The third argument `data' to rb_add_event_hook() is passed to the hook
-function as the second argument, which was the pointer to the current
-NODE in 1.8. See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-Removes the specified hook function.
-
-== Macros for Compatibility
-
-Some macros to check API compatibilities are available by default.
-
-NORETURN_STYLE_NEW ::
-
- Means that NORETURN macro is functional style instead of prefix.
-
-HAVE_RB_DEFINE_ALLOC_FUNC ::
-
- Means that function rb_define_alloc_func() is provided, that means the
- allocation framework is used. This is same as the result of
- have_func("rb_define_alloc_func", "ruby.h").
-
-HAVE_RB_REG_NEW_STR ::
-
- Means that function rb_reg_new_str() is provided, that creates Regexp
- object from String object. This is same as the result of
- have_func("rb_reg_new_str", "ruby.h").
-
-HAVE_RB_IO_T ::
-
- Means that type rb_io_t is provided.
-
-USE_SYMBOL_AS_METHOD_NAME ::
-
- Means that Symbols will be returned as method names, e.g.,
- Module#methods, #singleton_methods and so on.
-
-HAVE_RUBY_*_H ::
-
- Defined in ruby.h and means corresponding header is available. For
- instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
- mere st.h.
-
-RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ::
-
- Means that rb_add_event_hook() takes the third argument `data', to be
- passed to the given event hook function.
-
-= Appendix C. Functions available for use in extconf.rb
-
-See documentation for {mkmf}[rdoc-ref:MakeMakefile].
-
-= Appendix D. Generational GC
-
-Ruby 2.1 introduced a generational garbage collector (called RGenGC).
-RGenGC (mostly) keeps compatibility.
-
-Generally, the use of the technique called write barriers is required in
-extension libraries for generational GC
-(http://en.wikipedia.org/wiki/Garbage_collection_%28computer_science%29).
-RGenGC works fine without write barriers in extension libraries.
-
-If your library adheres to the following tips, performance can
-be further improved. Especially, the "Don't touch pointers directly" section is
-important.
-
-== Incompatibility
-
-You can't write RBASIC(obj)->klass field directly because it is const
-value now.
-
-Basically you should not write this field because MRI expects it to be
-an immutable field, but if you want to do it in your extension you can
-use the following functions:
-
-VALUE rb_obj_hide(VALUE obj) ::
-
- Clear RBasic::klass field. The object will be an internal object.
- ObjectSpace::each_object can't find this object.
-
-VALUE rb_obj_reveal(VALUE obj, VALUE klass) ::
-
- Reset RBasic::klass to be klass.
- We expect the `klass' is hidden class by rb_obj_hide().
-
-== Write barriers
-
-RGenGC doesn't require write barriers to support generational GC.
-However, caring about write barrier can improve the performance of
-RGenGC. Please check the following tips.
-
-=== Don't touch pointers directly
-
-In MRI (include/ruby/ruby.h), some macros to acquire pointers to the
-internal data structures are supported such as RARRAY_PTR(),
-RSTRUCT_PTR() and so on.
-
-DO NOT USE THESE MACROS and instead use the corresponding C-APIs such as
-rb_ary_aref(), rb_ary_store() and so on.
-
-=== Consider whether to insert write barriers
-
-You don't need to care about write barriers if you only use built-in
-types.
-
-If you support T_DATA objects, you may consider using write barriers.
-
-Inserting write barriers into T_DATA objects only works with the
-following type objects: (a) long-lived objects, (b) when a huge number
-of objects are generated and (c) container-type objects that have
-references to other objects. If your extension provides such a type of
-T_DATA objects, consider inserting write barriers.
-
-(a): short-lived objects don't become old generation objects.
-(b): only a few oldgen objects don't have performance impact.
-(c): only a few references don't have performance impact.
-
-Inserting write barriers is a very difficult hack, it is easy to
-introduce critical bugs. And inserting write barriers has several areas
-of overhead. Basically we don't recommend you insert write barriers.
-Please carefully consider the risks.
-
-=== Combine with built-in types
-
-Please consider utilizing built-in types. Most built-in types support
-write barrier, so you can use them to avoid manually inserting write
-barriers.
-
-For example, if your T_DATA has references to other objects, then you
-can move these references to Array. A T_DATA object only has a reference
-to an array object. Or you can also use a Struct object to gather a
-T_DATA object (without any references) and an that Array contains
-references.
-
-With use of such techniques, you don't need to insert write barriers
-anymore.
-
-=== Insert write barriers
-
-[AGAIN] Inserting write barriers is a very difficult hack, and it is
-easy to introduce critical bugs. And inserting write barriers has
-several areas of overhead. Basically we don't recommend you insert write
-barriers. Please carefully consider the risks.
-
-Before inserting write barriers, you need to know about RGenGC algorithm
-(gc.c will help you). Macros and functions to insert write barriers are
-available in in include/ruby/ruby.h. An example is available in iseq.c.
-
-For a complete guide for RGenGC and write barriers, please refer to
-<https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/RGenGC>.
-
-= Appendix E. RB_GC_GUARD to protect from premature GC
-
-C Ruby currently uses conservative garbage collection, thus VALUE
-variables must remain visible on the stack or registers to ensure any
-associated data remains usable. Optimizing C compilers are not designed
-with conservative garbage collection in mind, so they may optimize away
-the original VALUE even if the code depends on data associated with that
-VALUE.
-
-The following example illustrates the use of RB_GC_GUARD to ensure
-the contents of sptr remain valid while the second invocation of
-rb_str_new_cstr is running.
-
- VALUE s, w;
- const char *sptr;
-
- s = rb_str_new_cstr("hello world!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!");
- sptr = RSTRING_PTR(s);
- w = rb_str_new_cstr(sptr + 6); /* Possible GC invocation */
-
- RB_GC_GUARD(s); /* ensure s (and thus sptr) do not get GC-ed */
-
-In the above example, RB_GC_GUARD must be placed _after_ the last use of
-sptr. Placing RB_GC_GUARD before dereferencing sptr would be of no use.
-RB_GC_GUARD is only effective on the VALUE data type, not converted C
-data types.
-
-RB_GC_GUARD would not be necessary at all in the above example if
-non-inlined function calls are made on the `s' VALUE after sptr is
-dereferenced. Thus, in the above example, calling any un-inlined
-function on `s' such as:
-
- rb_str_modify(s);
-
-Will ensure `s' stays on the stack or register to prevent a
-GC invocation from prematurely freeing it.
-
-Using the RB_GC_GUARD macro is preferable to using the "volatile"
-keyword in C. RB_GC_GUARD has the following advantages:
-
-1) the intent of the macro use is clear
-
-2) RB_GC_GUARD only affects its call site, "volatile" generates some
- extra code every time the variable is used, hurting optimization.
-
-3) "volatile" implementations may be buggy/inconsistent in some
- compilers and architectures. RB_GC_GUARD is customizable for broken
- systems/compilers without those without negatively affecting other
- systems.
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
+Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
index b662d4dfdb..f884ecbb0e 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -1,1720 +1 @@
-# README.EXT.ja - -*- RDoc -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-Rubyã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã®ä½œã‚Šæ–¹ã‚’説明ã—ã¾ã™ï¼Ž
-
-= 基礎知識
-
-Cã®å¤‰æ•°ã«ã¯åž‹ãŒã‚り,データã«ã¯åž‹ãŒã‚りã¾ã›ã‚“.ã§ã™ã‹ã‚‰ï¼ŒãŸ
-ã¨ãˆã°ãƒã‚¤ãƒ³ã‚¿ã‚’intã®å¤‰æ•°ã«ä»£å…¥ã™ã‚‹ã¨ï¼Œãã®å€¤ã¯æ•´æ•°ã¨ã—ã¦å–
-り扱ã‚れã¾ã™ï¼Žé€†ã«Rubyã®å¤‰æ•°ã«ã¯åž‹ãŒãªã,データã«åž‹ãŒã‚りã¾
-ã™ï¼Žã“ã®é•ã„ã®ãŸã‚,Cã¨Rubyã¯ç›¸äº’ã«å¤‰æ›ã—ãªã‘れã°ï¼ŒãŠäº’ã„ã®
-データをアクセスã§ãã¾ã›ã‚“.
-
-Rubyã®ãƒ‡ãƒ¼ã‚¿ã¯VALUEã¨ã„ã†Cã®åž‹ã§è¡¨ç¾ã•れã¾ã™ï¼ŽVALUEåž‹ã®ãƒ‡ãƒ¼
-ã‚¿ã¯ãã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—を自分ã§çŸ¥ã£ã¦ã„ã¾ã™ï¼Žã“ã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã¨
-ã„ã†ã®ã¯ãƒ‡ãƒ¼ã‚¿(オブジェクト)ã®å®Ÿéš›ã®æ§‹é€ ã‚’æ„味ã—ã¦ã„ã¦ï¼ŒRuby
-ã®ã‚¯ãƒ©ã‚¹ã¨ã¯ã¾ãŸé•ã£ãŸã‚‚ã®ã§ã™ï¼Ž
-
-VALUEã‹ã‚‰Cã«ã¨ã£ã¦æ„味ã®ã‚るデータをå–り出ã™ãŸã‚ã«ã¯
-
-1. VALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—を知る
-2. VALUEã‚’Cã®ãƒ‡ãƒ¼ã‚¿ã«å¤‰æ›ã™ã‚‹
-
-ã®ä¸¡æ–¹ãŒå¿…è¦ã§ã™ï¼Ž(1)を忘れるã¨é–“é•ã£ãŸãƒ‡ãƒ¼ã‚¿ã®å¤‰æ›ãŒè¡Œã‚れ
-ã¦ï¼Œæœ€æ‚ªãƒ—ログラムãŒcore dumpã—ã¾ã™ï¼Ž
-
-== データタイプ
-
-Rubyã«ã¯ãƒ¦ãƒ¼ã‚¶ãŒä½¿ã†å¯èƒ½æ€§ã®ã‚る以下ã®ã‚¿ã‚¤ãƒ—ãŒã‚りã¾ã™ï¼Ž
-
-T_NIL :: nil
-T_OBJECT :: 通常ã®ã‚ªãƒ–ジェクト
-T_CLASS :: クラス
-T_MODULE :: モジュール
-T_FLOAT :: æµ®å‹•å°æ•°ç‚¹æ•°
-T_STRING :: 文字列
-T_REGEXP :: æ­£è¦è¡¨ç¾
-T_ARRAY :: é…列
-T_HASH :: 連想é…列
-T_STRUCT :: (Rubyã®)構造体
-T_BIGNUM :: 多å€é•·æ•´æ•°
-T_FIXNUM :: Fixnum(31bitã¾ãŸã¯63bité•·æ•´æ•°)
-T_COMPLEX :: 複素数
-T_RATIONAL :: æœ‰ç†æ•°
-T_FILE :: 入出力
-T_TRUE :: 真
-T_FALSE :: å½
-T_DATA :: データ
-T_SYMBOL :: シンボル
-
-ãã®ä»–ã«å†…部ã§åˆ©ç”¨ã•れã¦ã„る以下ã®ã‚¿ã‚¤ãƒ—ãŒã‚りã¾ã™ï¼Ž
-
- T_ICLASS
- T_MATCH
- T_UNDEF
- T_NODE
- T_ZOMBIE
-
-ã»ã¨ã‚“ã©ã®ã‚¿ã‚¤ãƒ—ã¯Cã®æ§‹é€ ä½“ã§å®Ÿè£…ã•れã¦ã„ã¾ã™ï¼Ž
-
-== VALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹
-
-ruby.hã§ã¯TYPE()ã¨ã„ã†ãƒžã‚¯ãƒ­ãŒå®šç¾©ã•れã¦ã„ã¦ï¼ŒVALUEã®ãƒ‡ãƒ¼ã‚¿
-タイプを知るã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼ŽTYPE()マクロã¯ä¸Šã§ç´¹ä»‹ã—ãŸT_XXXX
-ã®å½¢å¼ã®å®šæ•°ã‚’è¿”ã—ã¾ã™ï¼ŽVALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã«å¿œã˜ã¦å‡¦ç†ã™ã‚‹
-å ´åˆã«ã¯ï¼ŒTYPE()ã®å€¤ã§åˆ†å²ã™ã‚‹ã“ã¨ã«ãªã‚Šã¾ã™ï¼Ž
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* FIXNUMã®å‡¦ç† */
- break;
- case T_STRING:
- /* 文字列ã®å‡¦ç† */
- break;
- case T_ARRAY:
- /* é…列ã®å‡¦ç† */
- break;
- default:
- /* 例外を発生ã•ã›ã‚‹ */
- rb_raise(rb_eTypeError, "not valid value");
- break;
- }
-
-ãれã¨ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã‚’ãƒã‚§ãƒƒã‚¯ã—ã¦ï¼Œæ­£ã—ããªã‘れã°ä¾‹å¤–を発生ã™
-る関数ãŒç”¨æ„ã•れã¦ã„ã¾ã™ï¼Ž
-
- void Check_Type(VALUE value, int type)
-
-ã“ã®é–¢æ•°ã¯valueãŒtypeã§ç„¡ã‘れã°ï¼Œä¾‹å¤–を発生ã•ã›ã¾ã™ï¼Žå¼•æ•°ã¨
-ã—ã¦ä¸Žãˆã‚‰ã‚ŒãŸVALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ãŒæ­£ã—ã„ã‹ã©ã†ã‹ãƒã‚§ãƒƒã‚¯ã™
-ã‚‹ãŸã‚ã«ã¯ï¼Œã“ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
-FIXNUMã¨NILã«é–¢ã—ã¦ã¯ã‚ˆã‚Šé«˜é€Ÿãªåˆ¤åˆ¥ãƒžã‚¯ãƒ­ãŒç”¨æ„ã•れã¦ã„ã¾ã™ï¼Ž
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-== VALUEã‚’Cã®ãƒ‡ãƒ¼ã‚¿ã«å¤‰æ›ã™ã‚‹
-
-データタイプãŒT_NIL,T_FALSE,T_TRUEã§ã‚る時,データã¯ãれãž
-れnil,false,trueã§ã™ï¼Žã“ã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã®ã‚ªãƒ–ジェクトã¯ã²ã¨
-ã¤ãšã¤ã—ã‹å­˜åœ¨ã—ã¾ã›ã‚“.
-
-データタイプãŒT_FIXNUMã®æ™‚,ã“れã¯31bitã¾ãŸã¯63bitã®ã‚µã‚¤ã‚ºã‚’
-æŒã¤æ•´æ•°ã§ã™ï¼Žlongã®ã‚µã‚¤ã‚ºãŒ32bitã®ãƒ—ラットフォームã§ã‚れã°
-31bitã«ï¼Œlongã®ã‚µã‚¤ã‚ºãŒ64bitã®ãƒ—ラットフォームã§ã‚れã°63bit
-ã«ãªã‚Šã¾ã™. FIXNUM ã‚’ C ã®æ•´æ•°ã«å¤‰æ›ã™ã‚‹ãŸã‚ã«ã¯ãƒžã‚¯ãƒ­
-「FIX2INT()ã€ã¾ãŸã¯ã€ŒFIX2LONG()ã€ã‚’使ã„ã¾ã™ï¼Žã“れらã®ãƒžã‚¯ãƒ­
-を使用ã™ã‚‹éš›ã«ã¯äº‹å‰ã«ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ãŒFIXNUMã§ã‚ã‚‹ã“ã¨ã‚’確èªã™
-ã‚‹å¿…è¦ãŒã‚りã¾ã™ãŒï¼Œæ¯”較的高速ã«å¤‰æ›ã‚’行ã†ã“ã¨ãŒã§ãã¾ã™ï¼Žã¾
-ãŸï¼Œã€ŒFIX2LONG()ã€ã¯ä¾‹å¤–を発生ã—ã¾ã›ã‚“ãŒï¼Œã€ŒFIX2INT()ã€ã¯å¤‰
-æ›çµæžœãŒintã®ã‚µã‚¤ã‚ºã«åŽã¾ã‚‰ãªã„å ´åˆã«ã¯ä¾‹å¤–を発生ã—ã¾ã™ï¼Ž
-ãれã‹ã‚‰ï¼ŒFIXNUMã«é™ã‚‰ãšRubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ•´æ•°ã«å¤‰æ›ã™ã‚‹
-「NUM2INT()ã€ãŠã‚ˆã³ã€ŒNUM2LONG()ã€ã¨ã„ã†ãƒžã‚¯ãƒ­ãŒã‚りã¾ã™ï¼Žã“
-れらã®ãƒžã‚¯ãƒ­ã¯ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã®ãƒã‚§ãƒƒã‚¯ç„¡ã—ã§ä½¿ãˆã¾ã™
-(æ•´æ•°ã«å¤‰æ›ã§ããªã„å ´åˆã«ã¯ä¾‹å¤–ãŒç™ºç”Ÿã™ã‚‹)ï¼ŽåŒæ§˜ã«ãƒã‚§ãƒƒã‚¯ç„¡ã—
-ã§ä½¿ãˆã‚‹å¤‰æ›ãƒžã‚¯ãƒ­ã¯doubleã‚’å–り出ã™ã€ŒNUM2DBL()ã€ãŒã‚りã¾ã™ï¼Ž
-
-char* ã‚’å–り出ã™å ´åˆï¼Œ StringValue() 㨠StringValuePtr()
-を使ã„ã¾ã™ï¼Ž
-StringValue(var) 㯠var ㌠String
-ã§ã‚れã°ä½•ã‚‚ã›ãšï¼Œãã†ã§ãªã‘れ㰠var ã‚’ var.to_str() ã®çµæžœ
-ã«ç½®ãæ›ãˆã‚‹ãƒžã‚¯ãƒ­ï¼ŒStringValuePtr(var) ã¯åŒæ§˜ã« var ã‚’
-String ã«ç½®ãæ›ãˆã¦ã‹ã‚‰ var ã®ãƒã‚¤ãƒˆåˆ—表ç¾ã«å¯¾ã™ã‚‹ char* ã‚’
-è¿”ã™ãƒžã‚¯ãƒ­ã§ã™ï¼Žvar ã®å†…å®¹ã‚’ç›´æŽ¥ç½®ãæ›ãˆã‚‹å‡¦ç†ãŒå…¥ã‚‹ã®ã§ï¼Œ
-var 㯠lvalue ã§ã‚ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Ž
-ã¾ãŸï¼ŒStringValuePtr() ã«é¡žä¼¼ã—㟠StringValueCStr() ã¨ã„ã†ãƒž
-クロもã‚りã¾ã™ï¼ŽStringValueCStr(var) 㯠var ã‚’ String ã«ç½®ã
-æ›ãˆã¦ã‹ã‚‰ var ã®æ–‡å­—列表ç¾ã«å¯¾ã™ã‚‹ char* ã‚’è¿”ã—ã¾ã™ï¼Žè¿”ã•れ
-ã‚‹æ–‡å­—åˆ—ã®æœ«å°¾ã«ã¯ NUL 文字ãŒä»˜åŠ ã•れã¾ã™ï¼ŽãªãŠï¼Œé€”中㫠NUL
-文字ãŒå«ã¾ã‚Œã‚‹å ´åˆã¯ ArgumentError ãŒç™ºç”Ÿã—ã¾ã™ï¼Ž
-一方,StringValuePtr() ã§ã¯ï¼Œæœ«å°¾ã« NUL 文字ãŒã‚ã‚‹ä¿è¨¼ã¯ãªã,
-途中㫠NUL 文字ãŒå«ã¾ã‚Œã¦ã„ã‚‹å¯èƒ½æ€§ã‚‚ã‚りã¾ã™ï¼Ž
-
-ãれ以外ã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã¯å¯¾å¿œã™ã‚‹Cã®æ§‹é€ ä½“ãŒã‚りã¾ã™ï¼Žå¯¾å¿œã™
-る構造体ã®ã‚ã‚‹VALUEã¯ãã®ã¾ã¾ã‚­ãƒ£ã‚¹ãƒˆ(型変æ›)ã™ã‚Œã°æ§‹é€ ä½“ã®
-ãƒã‚¤ãƒ³ã‚¿ã«å¤‰æ›ã§ãã¾ã™ï¼Ž
-
-構造体ã¯ã€Œstruct RXxxxxã€ã¨ã„ã†åå‰ã§ruby.hã§å®šç¾©ã•れã¦ã„ã¾
-ã™ï¼Žä¾‹ãˆã°æ–‡å­—列ã¯ã€Œstruct RStringã€ã§ã™ï¼Žå®Ÿéš›ã«ä½¿ã†å¯èƒ½æ€§ãŒ
-ã‚ã‚‹ã®ã¯æ–‡å­—列ã¨é…列ãらã„ã ã¨æ€ã„ã¾ã™ï¼Ž
-
-ruby.hã§ã¯æ§‹é€ ä½“ã¸ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ãƒžã‚¯ãƒ­ã‚‚「RXXXXX()ã€(全部大文
-å­—ã«ã—ãŸã‚‚ã®)ã¨ã„ã†åå‰ã§æä¾›ã•れã¦ã„ã¾ã™(例: RSTRING()).ãŸ
-ã ã—ã€æ§‹é€ ä½“ã¸ã®ç›´æŽ¥ã®ã‚¢ã‚¯ã‚»ã‚¹ã¯ã§ãã‚‹ã ã‘é¿ã‘,対応ã™ã‚‹
-rb_xxxx() ã¨ã„ã£ãŸé–¢æ•°ã‚’使ã†ã‚ˆã†ã«ã—ã¦ä¸‹ã•ã„.例ãˆã°ï¼Œé…列ã®
-è¦ç´ ã¸ã‚¢ã‚¯ã‚»ã‚¹ã™ã‚‹å ´åˆã¯ï¼Œrb_ary_entry(ary, offset),
-rb_ary_store(ary, offset, obj) を利用ã™ã‚‹ã‚ˆã†ã«ã—ã¦ä¸‹ã•ã„.
-
-構造体ã‹ã‚‰ãƒ‡ãƒ¼ã‚¿ã‚’å–り出ã™ãƒžã‚¯ãƒ­ãŒæä¾›ã•れã¦ã„ã¾ã™ï¼Žæ–‡å­—列
-strã®é•·ã•ã‚’å¾—ã‚‹ãŸã‚ã«ã¯ã€ŒRSTRING_LEN(str)ã€ã¨ã—,文字列strã‚’
-char*ã¨ã—ã¦å¾—ã‚‹ãŸã‚ã«ã¯ã€ŒRSTRING_PTR(str)ã€ã¨ã—ã¾ã™ï¼Ž
-
-Rubyã®æ§‹é€ ä½“を直接アクセスã™ã‚‹æ™‚ã«æ°—ã‚’ã¤ã‘ãªã‘れã°ãªã‚‰ãªã„ã“
-ã¨ã¯ï¼Œé…åˆ—ã‚„æ–‡å­—åˆ—ã®æ§‹é€ ä½“ã®ä¸­èº«ã¯å‚ç…§ã™ã‚‹ã ã‘ã§ï¼Œç›´æŽ¥å¤‰æ›´ã—
-ãªã„ã“ã¨ã§ã™ï¼Žç›´æŽ¥å¤‰æ›´ã—ãŸå ´åˆï¼Œã‚ªãƒ–ジェクトã®å†…å®¹ã®æ•´åˆæ€§ãŒ
-ã¨ã‚Œãªããªã£ã¦ï¼Œæ€ã‚ã¬ãƒã‚°ã®åŽŸå› ã«ãªã‚Šã¾ã™ï¼Ž
-
-== Cã®ãƒ‡ãƒ¼ã‚¿ã‚’VALUEã«å¤‰æ›ã™ã‚‹
-
-VALUEã®å®Ÿéš›ã®æ§‹é€ ã¯
-
-FIXNUMã®å ´åˆ ::
-
- 1bit左シフトã—ã¦ï¼ŒLSBã‚’ç«‹ã¦ã‚‹ï¼Ž
-
-ãã®ä»–ã®ãƒã‚¤ãƒ³ã‚¿ã®å ´åˆ ::
-
- ãã®ã¾ã¾VALUEã«ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ï¼Ž
-
-ã¨ãªã£ã¦ã„ã¾ã™ï¼Žã‚ˆã£ã¦ï¼ŒLSBã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚Œã°VALUEãŒFIXNUMã‹ã©
-ã†ã‹ã‚ã‹ã‚‹ã‚ã‘ã§ã™(ãƒã‚¤ãƒ³ã‚¿ã®LSBãŒç«‹ã£ã¦ã„ãªã„ã“ã¨ã‚’仮定ã—ã¦
-ã„ã‚‹).
-
-ã§ã™ã‹ã‚‰ï¼ŒFIXNUM以外ã®Rubyã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆã®æ§‹é€ ä½“ã¯å˜ã«VALUE
-ã«ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ã ã‘ã§VALUEã«å¤‰æ›å‡ºæ¥ã¾ã™ï¼ŽãŸã ã—,任æ„ã®æ§‹é€ 
-体ãŒVALUEã«ã‚­ãƒ£ã‚¹ãƒˆå‡ºæ¥ã‚‹ã‚ã‘ã§ã¯ã‚りã¾ã›ã‚“.キャストã™ã‚‹ã®
-ã¯Rubyã®çŸ¥ã£ã¦ã„る構造体(ruby.hã§å®šç¾©ã•れã¦ã„ã‚‹struct RXxxx
-ã®ã‚‚ã®)ã ã‘ã§ã™ï¼Ž
-
-FIXNUMã«é–¢ã—ã¦ã¯å¤‰æ›ãƒžã‚¯ãƒ­ã‚’経由ã™ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼ŽCã®æ•´æ•°
-ã‹ã‚‰VALUEã«å¤‰æ›ã™ã‚‹ãƒžã‚¯ãƒ­ã¯ä»¥ä¸‹ã®ã‚‚ã®ãŒã‚りã¾ã™ï¼Žå¿…è¦ã«å¿œã˜
-ã¦ä½¿ã„分ã‘ã¦ãã ã•ã„.
-
-INT2FIX() :: ã‚‚ã¨ã®æ•´æ•°ãŒ31bitã¾ãŸã¯63bit以内ã«åŽã¾ã‚‹è‡ªä¿¡
- ãŒã‚る時
-INT2NUM() :: ä»»æ„ã®æ•´æ•°ã‹ã‚‰VALUEã¸
-
-INT2NUM()ã¯æ•´æ•°ãŒFIXNUMã®ç¯„囲ã«åŽã¾ã‚‰ãªã„å ´åˆï¼ŒBignumã«å¤‰æ›
-ã—ã¦ãれã¾ã™(ãŒï¼Œå°‘ã—é…ã„).
-
-== Rubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ“作ã™ã‚‹
-
-先程も述ã¹ãŸé€šã‚Šï¼ŒRubyã®æ§‹é€ ä½“をアクセスã™ã‚‹æ™‚ã«å†…å®¹ã®æ›´æ–°ã‚’
-行ã†ã“ã¨ã¯å‹§ã‚られã¾ã›ã‚“.ã§ï¼ŒRubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ“作ã™ã‚‹æ™‚ã«ã¯
-RubyãŒç”¨æ„ã—ã¦ã„る関数を用ã„ã¦ãã ã•ã„.
-
-ã“ã“ã§ã¯ã‚‚ã£ã¨ã‚‚使ã‚れるã§ã‚ã‚ã†æ–‡å­—列ã¨é…列ã®ç”Ÿæˆ/æ“作を行
-ã†é–¢æ•°ã‚’ã‚ã’ã¾ã™(全部ã§ã¯ãªã„ã§ã™).
-
-=== 文字列ã«å¯¾ã™ã‚‹é–¢æ•°
-
-rb_str_new(const char *ptr, long len) ::
-
- æ–°ã—ã„Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
-rb_str_new2(const char *ptr)
-rb_str_new_cstr(const char *ptr)
-
- Cã®æ–‡å­—列ã‹ã‚‰Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Žã“ã®é–¢æ•°ã®æ©Ÿèƒ½ã¯
- rb_str_new(ptr, strlen(ptr))ã¨åŒç­‰ã§ã‚る.
-
-rb_str_new_literal(const char *ptr)
-
- Cã®ãƒªãƒ†ãƒ©ãƒ«æ–‡å­—列ã‹ã‚‰Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
-rb_tainted_str_new(const char *ptr, long len)
-
- 汚染マークãŒä»˜åŠ ã•ã‚ŒãŸæ–°ã—ã„Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Žå¤–部
- ã‹ã‚‰ã®ãƒ‡ãƒ¼ã‚¿ã«åŸºã¥ã文字列ã«ã¯æ±šæŸ“マークãŒä»˜åŠ ã•れるã¹ã
- ã§ã‚る.
-
-rb_tainted_str_new2(const char *ptr)
-rb_tainted_str_new_cstr(const char *ptr)
-
- Cã®æ–‡å­—列ã‹ã‚‰æ±šæŸ“マークãŒä»˜åŠ ã•れãŸRubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
-rb_sprintf(const char *format, ...)
-rb_vsprintf(const char *format, va_list ap)
-
- Cã®æ–‡å­—列formatã¨ç¶šã引数をprintf(3)ã®ãƒ•ォーマットã«ã—ãŸãŒã£ã¦
- æ•´å½¢ã—,Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
- 注æ„: "%"PRIsVALUEãŒObject#to_s('+'ãƒ•ãƒ©ã‚°ãŒæŒ‡å®šã•れã¦ã„ã‚‹
- ã¨ãã¯Object#inspect)を使ã£ãŸVALUEã®å‡ºåŠ›ã«åˆ©ç”¨ã§ãる.ã“れ
- ã¯"%i"ã¨è¡çªã™ã‚‹ãŸã‚,整数ã«ã¯"%d"を使用ã™ã‚‹ã“ã¨ï¼Ž
-
-rb_str_cat(VALUE str, const char *ptr, long len)
-
- Rubyã®æ–‡å­—列strã«lenãƒã‚¤ãƒˆã®æ–‡å­—列ptrを追加ã™ã‚‹ï¼Ž
-
-rb_str_cat2(VALUE str, const char* ptr)
-rb_str_cat_cstr(VALUE str, const char* ptr)
-
- Rubyã®æ–‡å­—列strã«Cã®æ–‡å­—列ptrを追加ã™ã‚‹ï¼Žã“ã®é–¢æ•°ã®æ©Ÿèƒ½ã¯
- rb_str_cat(str, ptr, strlen(ptr))ã¨åŒç­‰ã§ã‚る.
-
-rb_str_catf(VALUE str, const char* format, ...)
-rb_str_vcatf(VALUE str, const char* format, va_list ap)
-
- Cã®æ–‡å­—列formatã¨ç¶šã引数をprintf(3)ã®ãƒ•ォーマットã«ã—ãŸãŒã£ã¦
- æ•´å½¢ã—,Rubyã®æ–‡å­—列strã«è¿½åŠ ã™ã‚‹ï¼Žã“ã®é–¢æ•°ã®æ©Ÿèƒ½ã¯ï¼Œãれãžã‚Œ
- rb_str_cat2(str, rb_sprintf(format, ...)) ã‚„
- rb_str_cat2(str, rb_vsprintf(format, ap)) ã¨åŒç­‰ã§ã‚る.
-
-rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
-rb_enc_str_new_cstr(const char *ptr, rb_encoding *enc)
-
- 指定ã•れãŸã‚¨ãƒ³ã‚³ãƒ¼ãƒ‡ã‚£ãƒ³ã‚°ã§Rubyã®æ–‡å­—列を生æˆã™ã‚‹.
-
-rb_enc_str_new_literal(const char *ptr)
-
- Cã®ãƒªãƒ†ãƒ©ãƒ«æ–‡å­—列ã‹ã‚‰æŒ‡å®šã•れãŸã‚¨ãƒ³ã‚³ãƒ¼ãƒ‡ã‚£ãƒ³ã‚°ã§Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
-rb_usascii_str_new(const char *ptr, long len)
-rb_usascii_str_new_cstr(const char *ptr)
-
- エンコーディングãŒUS-ASCIIã®Rubyã®æ–‡å­—列を生æˆã™ã‚‹.
-
-rb_usascii_str_new_literal(const char *ptr)
-
- Cã®ãƒªãƒ†ãƒ©ãƒ«æ–‡å­—列ã‹ã‚‰ã‚¨ãƒ³ã‚³ãƒ¼ãƒ‡ã‚£ãƒ³ã‚°ãŒUS-ASCIIã®Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
-rb_utf8_str_new(const char *ptr, long len)
-rb_utf8_str_new_cstr(const char *ptr)
-
- エンコーディングãŒUTF-8ã®Rubyã®æ–‡å­—列を生æˆã™ã‚‹.
-
-rb_utf8_str_new_literal(const char *ptr)
-
- Cã®ãƒªãƒ†ãƒ©ãƒ«æ–‡å­—列ã‹ã‚‰ã‚¨ãƒ³ã‚³ãƒ¼ãƒ‡ã‚£ãƒ³ã‚°ãŒUTF-8ã®Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
-
-rb_str_resize(VALUE str, long len)
-
- Rubyã®æ–‡å­—列ã®ã‚µã‚¤ã‚ºã‚’lenãƒã‚¤ãƒˆã«å¤‰æ›´ã™ã‚‹ï¼Žstrã®é•·ã•ã¯å‰
- 以ã¦ã‚»ãƒƒãƒˆã•れã¦ã„ãªã‘れã°ãªã‚‰ãªã„.lenãŒå…ƒã®é•·ã•よりも短
- ã„æ™‚ã¯ï¼Œlenãƒã‚¤ãƒˆã‚’è¶ŠãˆãŸéƒ¨åˆ†ã®å†…å®¹ã¯æ¨ã¦ã‚‰ã‚Œã‚‹ï¼ŽlenãŒå…ƒ
- ã®é•·ã•ã‚ˆã‚Šã‚‚é•·ã„æ™‚ã¯ï¼Œå…ƒã®é•·ã•ã‚’è¶ŠãˆãŸéƒ¨åˆ†ã®å†…容ã¯ä¿å­˜ã•
- れãªã„ã§ã‚´ãƒŸã«ãªã‚‹ã ã‚ã†ï¼Žã“ã®é–¢æ•°ã®å‘¼ã³å‡ºã—ã«ã‚ˆã£ã¦
- RSTRING_PTR(str)ãŒå¤‰æ›´ã•れるã‹ã‚‚ã—れãªã„ã“ã¨ã«æ³¨æ„.
-
-rb_str_set_len(VALUE str, long len)
-
- Rubyã®æ–‡å­—列ã®ã‚µã‚¤ã‚ºã‚’lenãƒã‚¤ãƒˆã«ã‚»ãƒƒãƒˆã™ã‚‹ï¼ŽstrãŒå¤‰æ›´å¯
- 能ã§ãªã‘れã°ä¾‹å¤–ãŒç™ºç”Ÿã™ã‚‹ï¼ŽRSTRING_LEN(str)ã¨ã¯ç„¡é–¢ä¿‚ã«ï¼Œ
- lenãƒã‚¤ãƒˆã¾ã§ã®å†…容ã¯ä¿å­˜ã•れる.lenã¯strã®å®¹é‡ã‚’è¶Šãˆã¦ã„
- ã¦ã¯ãªã‚‰ãªã„.
-
-
-== é…列ã«å¯¾ã™ã‚‹é–¢æ•°
-
-rb_ary_new()
-
- è¦ç´ ãŒ0ã®é…列を生æˆã™ã‚‹ï¼Ž
-
-rb_ary_new2(long len)
-rb_ary_new_capa(long len)
-
- è¦ç´ ãŒ0ã®é…列を生æˆã™ã‚‹ï¼Žlenè¦ç´ åˆ†ã®é ˜åŸŸã‚’ã‚らã‹ã˜ã‚割り
- 当ã¦ã¦ãŠã.
-
-rb_ary_new3(long n, ...)
-rb_ary_new_from_args(long n, ...)
-
- å¼•æ•°ã§æŒ‡å®šã—ãŸnè¦ç´ ã‚’å«ã‚€é…列を生æˆã™ã‚‹ï¼Ž
-
-rb_ary_new4(long n, VALUE *elts)
-rb_ary_new_from_values(long n, VALUE *elts)
-
- é…列ã§ä¸ŽãˆãŸnè¦ç´ ã®é…列を生æˆã™ã‚‹ï¼Ž
-
-rb_ary_to_ary(VALUE obj)
-
- オブジェクトをé…列ã«å¤‰æ›ã™ã‚‹.
- Object#to_aryã¨åŒç­‰ã§ã‚ã‚‹.
-
-ä»–ã«ã‚‚é…列をæ“作ã™ã‚‹é–¢æ•°ãŒå¤šæ•°ã‚ã‚‹. ã“れらã¯
-引数aryã«é…列を渡ã•ãªã‘れã°ãªã‚‰ãªã„. ã•ã‚‚ãªã„ã¨
-コアをåã.
-
-rb_ary_aref(argc, VALUE *argv, VALUE ary)
-
- Array#[]ã¨åŒç­‰.
-
-rb_ary_entry(VALUE ary, long offset)
-
- ary[offset]
-
-rb_ary_store(VALUE ary, long offset, VALUE obj) ::
-
- ary[offset] = obj
-
-rb_ary_subseq(VALUE ary, long beg, long len)
-
- ary[beg, len]
-
-rb_ary_push(VALUE ary, VALUE val)
-rb_ary_pop(VALUE ary)
-rb_ary_shift(VALUE ary)
-rb_ary_unshift(VALUE ary, VALUE val)
-
-rb_ary_cat(VALUE ary, const VALUE *ptr, long len)
-
- é…列aryã«ptrã‹ã‚‰len個ã®ã‚ªãƒ–ジェクトを追加ã™ã‚‹ï¼Ž
-
-= Rubyã®æ©Ÿèƒ½ã‚’使ã†
-
-原ç†çš„ã«Rubyã§æ›¸ã‘ã‚‹ã“ã¨ã¯Cã§ã‚‚書ã‘ã¾ã™ï¼ŽRubyãã®ã‚‚ã®ãŒCã§è¨˜
-è¿°ã•れã¦ã„ã‚‹ã‚“ã§ã™ã‹ã‚‰ï¼Œå½“ç„¶ã¨ã„ãˆã°å½“ç„¶ãªã‚“ã§ã™ã‘ã©ï¼Žã“ã“ã§
-ã¯Rubyã®æ‹¡å¼µã«ä½¿ã†ã“ã¨ãŒå¤šã„ã ã‚ã†ã¨äºˆæ¸¬ã•れる機能を中心ã«ç´¹
-介ã—ã¾ã™ï¼Ž
-
-== Rubyã«æ©Ÿèƒ½ã‚’追加ã™ã‚‹
-
-Rubyã§æä¾›ã•れã¦ã„る関数を使ãˆã°Rubyã‚¤ãƒ³ã‚¿ãƒ—ãƒªã‚¿ã«æ–°ã—ã„æ©Ÿèƒ½
-を追加ã™ã‚‹ã“ã¨ãŒã§ãã¾ã™ï¼ŽRubyã§ã¯ä»¥ä¸‹ã®æ©Ÿèƒ½ã‚’追加ã™ã‚‹é–¢æ•°ãŒ
-æä¾›ã•れã¦ã„ã¾ã™ï¼Ž
-
-* クラス,モジュール
-* メソッド,特異メソッドãªã©
-* 定数
-
-ã§ã¯é †ã«ç´¹ä»‹ã—ã¾ã™ï¼Ž
-
-=== クラス/モジュール定義
-
-クラスやモジュールを定義ã™ã‚‹ãŸã‚ã«ã¯ï¼Œä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
- VALUE rb_define_class(const char *name, VALUE super)
- VALUE rb_define_module(const char *name)
-
-ã“れらã®é–¢æ•°ã¯æ–°ã—ã定義ã•れãŸã‚¯ãƒ©ã‚¹ã‚„モジュールを返ã—ã¾ã™ï¼Ž
-メソッドや定数ã®å®šç¾©ã«ã“れらã®å€¤ãŒå¿…è¦ãªã®ã§ï¼Œã»ã¨ã‚“ã©ã®å ´åˆ
-ã¯æˆ»ã‚Šå€¤ã‚’å¤‰æ•°ã«æ ¼ç´ã—ã¦ãŠãå¿…è¦ãŒã‚ã‚‹ã§ã—ょã†ï¼Ž
-
-クラスやモジュールを他ã®ã‚¯ãƒ©ã‚¹ã®å†…部ã«ãƒã‚¹ãƒˆã—ã¦å®šç¾©ã™ã‚‹æ™‚ã«
-ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
- VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
- VALUE rb_define_module_under(VALUE outer, const char *name)
-
-=== メソッド/特異メソッド定義
-
-メソッドや特異メソッドを定義ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
- void rb_define_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, const char *name,
- VALUE (*func)(), int argc)
-
-
-念ã®ãŸã‚説明ã™ã‚‹ã¨ã€Œç‰¹ç•°ãƒ¡ã‚½ãƒƒãƒ‰ã€ã¨ã¯ï¼Œãã®ç‰¹å®šã®ã‚ªãƒ–ジェク
-トã«å¯¾ã—ã¦ã ã‘有効ãªãƒ¡ã‚½ãƒƒãƒ‰ã§ã™ï¼ŽRubyã§ã¯ã‚ˆãSmalltalkã«ãŠ
-ã‘るクラスメソッドã¨ã—ã¦ï¼Œã‚¯ãƒ©ã‚¹ã«å¯¾ã™ã‚‹ç‰¹ç•°ãƒ¡ã‚½ãƒƒãƒ‰ãŒä½¿ã‚れ
-ã¾ã™ï¼Ž
-
-ã“れらã®é–¢æ•°ã® argcã¨ã„ã†å¼•æ•°ã¯Cã®é–¢æ•°ã¸æ¸¡ã•ã‚Œã‚‹å¼•æ•°ã®æ•°(ã¨
-å½¢å¼)を決ã‚ã¾ã™ï¼ŽargcãŒ0ä»¥ä¸Šã®æ™‚ã¯é–¢æ•°ã«å¼•ãæ¸¡ã™å¼•æ•°ã®æ•°ã‚’æ„
-味ã—ã¾ã™ï¼Ž16個以上ã®å¼•æ•°ã¯ä½¿ãˆã¾ã›ã‚“(ãŒï¼Œè¦ã‚Šã¾ã›ã‚“よã­ï¼Œã
-ã‚“ãªã«).実際ã®é–¢æ•°ã«ã¯å…ˆé ­ã®å¼•æ•°ã¨ã—ã¦selfãŒä¸Žãˆã‚‰ã‚Œã¾ã™ã®
-ã§ï¼ŒæŒ‡å®šã—ãŸæ•°ã‚ˆã‚Š1多ã„引数をæŒã¤ã“ã¨ã«ãªã‚Šã¾ã™ï¼Ž
-
-argcãŒè² ã®æ™‚ã¯å¼•æ•°ã®æ•°ã§ã¯ãªã,形å¼ã‚’指定ã—ãŸã“ã¨ã«ãªã‚Šã¾ã™ï¼Ž
-argcãŒ-1ã®æ™‚ã¯å¼•æ•°ã‚’é…列ã«å…¥ã‚Œã¦æ¸¡ã•れã¾ã™ï¼ŽargcãŒ-2ã®æ™‚ã¯å¼•
-æ•°ã¯Rubyã®é…列ã¨ã—ã¦æ¸¡ã•れã¾ã™ï¼Ž
-
-メソッドを定義ã™ã‚‹é–¢æ•°ã¯ã¾ã ã„ãã¤ã‹ã‚りã¾ã™. ã²ã¨ã¤ã¯ãƒ¡ã‚½ãƒƒãƒ‰
-åã¨ã—ã¦IDã‚’å–りã¾ã™. IDã«ã¤ã„ã¦ã¯2.2.2ã‚’å‚ç…§.
-
- void rb_define_method_id(VALUE klass, ID name,
- VALUE (*func)(ANYARGS), int argc)
-
-private/protectedãªãƒ¡ã‚½ãƒƒãƒ‰ã‚’定義ã™ã‚‹ãµãŸã¤ã®é–¢æ•°ãŒã‚りã¾ã™.
-
- void rb_define_private_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
- void rb_define_protected_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
-privateメソッドã¨ã¯é–¢æ•°å½¢å¼ã§ã—ã‹å‘¼ã³å‡ºã™ã“ã¨ã®å‡ºæ¥ãªã„メソッ
-ドã§ã™ï¼Ž
-
-最後ã«ï¼Œ rb_define_module関数ã¯ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«é–¢æ•°ã‚’定義ã—ã¾ã™ï¼Ž
-モジュール関数ã¨ã¯ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã®ç‰¹ç•°ãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚ã‚Šï¼ŒåŒæ™‚ã«
-privateメソッドã§ã‚‚ã‚ã‚‹ã‚‚ã®ã§ã™ï¼Žä¾‹ã‚’ã‚ã’ã‚‹ã¨Mathモジュール
-ã®sqrt()ãªã©ãŒã‚ã’られã¾ã™ï¼Žã“ã®ãƒ¡ã‚½ãƒƒãƒ‰ã¯
-
- Math.sqrt(4)
-
-ã¨ã„ã†å½¢å¼ã§ã‚‚
-
- include Math
- sqrt(4)
-
-ã¨ã„ã†å½¢å¼ã§ã‚‚使ãˆã¾ã™ï¼Žãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«é–¢æ•°ã‚’定義ã™ã‚‹é–¢æ•°ã¯ä»¥ä¸‹ã®
-通りã§ã™ï¼Ž
-
- void rb_define_module_function(VALUE module, const char *name,
- VALUE (*func)(), int argc)
-
-関数的メソッド(Kernelモジュールã®private method)を定義ã™ã‚‹ãŸ
-ã‚ã®é–¢æ•°ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
-
- void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-
-メソッドã®åˆ¥åを定義ã™ã‚‹ãŸã‚ã®é–¢æ•°ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
-
- void rb_define_alias(VALUE module, const char* new, const char* old);
-
-属性ã®å–得・設定メソッドを定義ã™ã‚‹ã«ã¯
-
- void rb_define_attr(VALUE klass, const char *name, int read, int write)
-
-クラスメソッドallocateを定義ã—ãŸã‚Šå‰Šé™¤ã—ãŸã‚Šã™ã‚‹ãŸã‚ã®é–¢æ•°ã¯
-以下ã®é€šã‚Šã§ã™ï¼Ž
-
- void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
- void rb_undef_alloc_func(VALUE klass);
-
-funcã¯ã‚¯ãƒ©ã‚¹ã‚’引数ã¨ã—ã¦å—ã‘å–ã£ã¦ï¼Œæ–°ã—ã割り当ã¦ã‚‰ã‚ŒãŸã‚¤ãƒ³
-スタンスを返ã•ãªãã¦ã¯ãªã‚Šã¾ã›ã‚“.ã“ã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹ã¯ï¼Œå¤–部リ
-ソースãªã©ã‚’å«ã¾ãªã„,ã§ãã‚‹ã ã‘「空ã€ã®ã¾ã¾ã«ã—ã¦ãŠã„ãŸã»ã†
-ãŒã‚ˆã„ã§ã—ょã†ï¼Ž
-
-継承ã—ãŸã‚¯ãƒ©ã‚¹ã«ã‚る既存ã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’オーãƒãƒ¼ãƒ©ã‚¤ãƒ‰ã—ã¦ã„ã‚‹ãª
-ら,オーãƒãƒ¼ãƒ©ã‚¤ãƒ‰ã•れãŸãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使
-ã„ã¾ã™ï¼Ž
-
- VALUE rb_call_super(int argc, const VALUE *argv)
-
-ç¾åœ¨ã®ã‚¹ã‚³ãƒ¼ãƒ—ã®ãƒ¬ã‚·ãƒ¼ãƒã¯(ä»–ã«æ–¹æ³•ãŒãªã‘れã°),以下ã®é–¢æ•°ã§
-å¾—ã‚‹ã“ã¨ãŒã§ãã¾ã™ï¼Ž
-
- VALUE rb_current_receiver(void)
-
-=== 定数定義
-
-拡張ライブラリãŒå¿…è¦ãªå®šæ•°ã¯ã‚らã‹ã˜ã‚定義ã—ã¦ãŠã„ãŸæ–¹ãŒè‰¯ã„
-ã§ã—ょã†ï¼Žå®šæ•°ã‚’定義ã™ã‚‹é–¢æ•°ã¯äºŒã¤ã‚りã¾ã™ï¼Ž
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
- void rb_define_global_const(const char *name, VALUE val)
-
-å‰è€…ã¯ç‰¹å®šã®ã‚¯ãƒ©ã‚¹/モジュールã«å±žã™ã‚‹å®šæ•°ã‚’定義ã™ã‚‹ã‚‚ã®ï¼Œå¾Œ
-者ã¯ã‚°ãƒ­ãƒ¼ãƒãƒ«ãªå®šæ•°ã‚’定義ã™ã‚‹ã‚‚ã®ã§ã™ï¼Ž
-
-== Rubyã®æ©Ÿèƒ½ã‚’Cã‹ã‚‰å‘¼ã³å‡ºã™
-
-æ—¢ã«ã€Ž1.5 Rubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ“作ã™ã‚‹ã€ã§ä¸€éƒ¨ç´¹ä»‹ã—ãŸã‚ˆã†ãªé–¢æ•°ã‚’
-使ãˆã°ï¼ŒRubyã®æ©Ÿèƒ½ã‚’実ç¾ã—ã¦ã„る関数を直接呼ã³å‡ºã™ã“ã¨ãŒå‡ºæ¥
-ã¾ã™ï¼Ž
-
-# ã“ã®ã‚ˆã†ãªé–¢æ•°ã®ä¸€è¦§è¡¨ã¯ã„ã¾ã®ã¨ã“ã‚ã‚りã¾ã›ã‚“.ソースを見
-# ã‚‹ã—ã‹ãªã„ã§ã™ã­ï¼Ž
-
-ãれ以外ã«ã‚‚Rubyã®æ©Ÿèƒ½ã‚’呼ã³å‡ºã™æ–¹æ³•ã¯ã„ãã¤ã‹ã‚りã¾ã™ï¼Ž
-
-=== Rubyã®ãƒ—ログラムをevalã™ã‚‹
-
-Cã‹ã‚‰Rubyã®æ©Ÿèƒ½ã‚’呼ã³å‡ºã™ã‚‚ã£ã¨ã‚‚ç°¡å˜ãªæ–¹æ³•ã¨ã—ã¦ï¼Œæ–‡å­—列ã§
-与ãˆã‚‰ã‚ŒãŸRubyã®ãƒ—ログラムを評価ã™ã‚‹ä»¥ä¸‹ã®é–¢æ•°ãŒã‚りã¾ã™ï¼Ž
-
- VALUE rb_eval_string(const char *str)
-
-ã“ã®è©•価ã¯ç¾åœ¨ã®ç’°å¢ƒã§è¡Œã‚れã¾ã™ï¼Žã¤ã¾ã‚Šï¼Œç¾åœ¨ã®ãƒ­ãƒ¼ã‚«ãƒ«å¤‰æ•°
-ãªã©ã‚’å—ã‘ç¶™ãŽã¾ã™ï¼Ž
-
-評価ã¯ä¾‹å¤–を発生ã™ã‚‹ã‹ã‚‚ã—れãªã„ã“ã¨ã«æ³¨æ„ã—ã¾ã—ょã†. より安全
-ãªé–¢æ•°ã‚‚ã‚りã¾ã™.
-
- VALUE rb_eval_string_protect(const char *str, int *state)
-
-ã“ã®é–¢æ•°ã¯ã‚¨ãƒ©ãƒ¼ãŒç™ºç”Ÿã™ã‚‹ã¨nilã‚’è¿”ã—ã¾ã™ï¼Žãã—ã¦ï¼ŒæˆåŠŸæ™‚ã«ã¯
-*stateã¯ã‚¼ãƒ­ã«ï¼Œã•ã‚‚ãªãã°éžã‚¼ãƒ­ã«ãªã‚Šã¾ã™ï¼Ž
-
-=== IDã¾ãŸã¯ã‚·ãƒ³ãƒœãƒ«
-
-Cã‹ã‚‰æ–‡å­—列を経由ã›ãšã«Rubyã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™ã“ã¨ã‚‚ã§ãã¾
-ã™ï¼Žãã®å‰ã«ï¼ŒRubyインタプリタ内ã§ãƒ¡ã‚½ãƒƒãƒ‰ã‚„変数åを指定ã™ã‚‹
-時ã«ä½¿ã‚れã¦ã„ã‚‹IDã«ã¤ã„ã¦èª¬æ˜Žã—ã¦ãŠãã¾ã—ょã†ï¼Ž
-
-IDã¨ã¯å¤‰æ•°å,メソッドåã‚’è¡¨ã™æ•´æ•°ã§ã™ï¼ŽRubyã®ä¸­ã§ã¯
-
- :識別å­
-
-ã¾ãŸã¯
-
- :"ä»»æ„ã®æ–‡å­—列"
-
-ã§ã‚¢ã‚¯ã‚»ã‚¹ã§ãã¾ã™ï¼ŽCã‹ã‚‰ã“ã®æ•´æ•°ã‚’å¾—ã‚‹ãŸã‚ã«ã¯é–¢æ•°
-
- rb_intern(const char *name)
- rb_intern_str(VALUE name)
-
-を使ã„ã¾ã™ï¼ŽRubyã‹ã‚‰å¼•æ•°ã¨ã—ã¦ä¸Žãˆã‚‰ã‚ŒãŸã‚·ãƒ³ãƒœãƒ«(ã¾ãŸã¯æ–‡å­—
-列)ã‚’IDã«å¤‰æ›ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
- rb_to_id(VALUE symbol)
- rb_check_id(volatile VALUE *name)
- rb_check_id_cstr(const char *name, long len, rb_encoding *enc)
-
-ã‚‚ã—引数ãŒã‚·ãƒ³ãƒœãƒ«ã§ã‚‚文字列ã§ã‚‚ãªã‘れã°ï¼Œto_strãƒ¡ã‚½ãƒƒãƒ‰ã§æ–‡
-字列ã«å¤‰æ›ã—よã†ã¨ã—ã¾ã™ï¼Žç¬¬äºŒã®é–¢æ•°ã¯ãã®å¤‰æ›çµæžœã‚’*nameã«ä¿
-å­˜ã—,ãã®åå‰ãŒæ—¢çŸ¥ã®ã‚·ãƒ³ãƒœãƒ«ã§ãªã„å ´åˆã¯0ã‚’è¿”ã—ã¾ã™ï¼Žã“ã®é–¢
-æ•°ãŒ0以外を返ã—ãŸå ´åˆã¯*nameã¯å¸¸ã«ã‚·ãƒ³ãƒœãƒ«ã‹æ–‡å­—列ã§ã‚り,0ã‚’
-è¿”ã—ãŸå ´åˆã¯å¸¸ã«æ–‡å­—列ã§ã™ï¼Žç¬¬ä¸‰ã®é–¢æ•°ã¯Rubyã®æ–‡å­—列ã§ã¯ãªã
-NUL終端ã•れãŸCã®æ–‡å­—列を使ã„ã¾ã™ï¼Ž
-
-Rubyã‹ã‚‰å¼•æ•°ã¨ã—ã¦ä¸Žãˆã‚‰ã‚ŒãŸã‚·ãƒ³ãƒœãƒ«(ã¾ãŸã¯æ–‡å­—列)をシンボル
-ã«å¤‰æ›ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
- rb_to_symbol(VALUE name)
- rb_check_symbol(volatile VALUE *namep)
- rb_check_symbol_cstr(const char *ptr, long len, rb_encoding *enc)
-
-ã“れらã®é–¢æ•°ã¯ï¼ŒIDã®ä»£ã‚りã«ã‚·ãƒ³ãƒœãƒ«ã‚’è¿”ã™ã“ã¨ã‚’除ã‘ã°ä¸Šè¨˜ã®
-関数ã¨åŒã˜ã§ã™ï¼Ž
-
-=== Cã‹ã‚‰Rubyã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™
-
-Cã‹ã‚‰æ–‡å­—列を経由ã›ãšã«Rubyã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™ãŸã‚ã«ã¯ä»¥ä¸‹
-ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-ã“ã®é–¢æ•°ã¯ã‚ªãƒ–ジェクトrecvã®midã§æŒ‡å®šã•れるメソッドを呼ã³å‡º
-ã—ã¾ã™ï¼Žãã®ä»–ã«å¼•æ•°ã®æŒ‡å®šã®ä»•æ–¹ãŒé•ã†ä»¥ä¸‹ã®é–¢æ•°ã‚‚ã‚りã¾ã™ï¼Ž
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
- VALUE rb_funcallv(VALUE recv, ID mid, int argc, VALUE *argv)
- VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-applyã«ã¯å¼•æ•°ã¨ã—ã¦Rubyã®é…列を与ãˆã¾ã™ï¼Ž
-
-=== 変数/定数をå‚ç…§/æ›´æ–°ã™ã‚‹
-
-Cã‹ã‚‰é–¢æ•°ã‚’使ã£ã¦å‚照・更新ã§ãã‚‹ã®ã¯ï¼Œå®šæ•°ï¼Œã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰
-æ•°ã§ã™ï¼Žå¤§åŸŸå¤‰æ•°ã¯ä¸€éƒ¨ã®ã‚‚ã®ã¯Cã®å¤§åŸŸå¤‰æ•°ã¨ã—ã¦ã‚¢ã‚¯ã‚»ã‚¹ã§ã
-ã¾ã™ï¼Žãƒ­ãƒ¼ã‚«ãƒ«å¤‰æ•°ã‚’å‚ç…§ã™ã‚‹æ–¹æ³•ã¯å…¬é–‹ã—ã¦ã„ã¾ã›ã‚“.
-
-オブジェクトã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã‚’å‚照・更新ã™ã‚‹é–¢æ•°ã¯ä»¥ä¸‹ã®é€š
-りã§ã™ï¼Ž
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-idã¯rb_intern()ã§å¾—られるもã®ã‚’使ã£ã¦ãã ã•ã„.
-
-定数をå‚ç…§ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã£ã¦ãã ã•ã„.
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-定数を新ã—ã定義ã™ã‚‹ãŸã‚ã«ã¯ã€Ž2.1.3 定数定義ã€ã§ç´¹ä»‹ã•
-れã¦ã„る関数を使ã£ã¦ãã ã•ã„.
-
-= Rubyã¨Cã¨ã®æƒ…報共有
-
-C言語ã¨Rubyã®é–“ã§æƒ…報を共有ã™ã‚‹æ–¹æ³•ã«ã¤ã„ã¦è§£èª¬ã—ã¾ã™ï¼Ž
-
-== Cã‹ã‚‰å‚ç…§ã§ãã‚‹Rubyã®å®šæ•°
-
-以下ã®Rubyã®å®šæ•°ã¯Cã®ãƒ¬ãƒ™ãƒ«ã‹ã‚‰å‚ç…§ã§ãã¾ã™ï¼Ž
-
- Qtrue
- Qfalse
-
-真å½å€¤ï¼ŽQfalseã¯C言語ã§ã‚‚å½ã¨ã¿ãªã•れã¾ã™(ã¤ã¾ã‚Š0).
-
- Qnil
-
-C言語ã‹ã‚‰è¦‹ãŸã€Œnilã€ï¼Ž
-
-== Cã¨Rubyã§å…±æœ‰ã•れる大域変数
-
-Cã¨Rubyã§å¤§åŸŸå¤‰æ•°ã‚’使ã£ã¦æƒ…報を共有ã§ãã¾ã™ï¼Žå…±æœ‰ã§ãる大域
-変数ã«ã¯ã„ãã¤ã‹ã®ç¨®é¡žãŒã‚りã¾ã™ï¼Žãã®ãªã‹ã§ã‚‚ã£ã¨ã‚‚良ã使ã‚
-ã‚Œã‚‹ã¨æ€ã‚れるã®ã¯rb_define_variable()ã§ã™ï¼Ž
-
- void rb_define_variable(const char *name, VALUE *var)
-
-ã“ã®é–¢æ•°ã¯Rubyã¨Cã¨ã§å…±æœ‰ã™ã‚‹å¤§åŸŸå¤‰æ•°ã‚’定義ã—ã¾ã™ï¼Žå¤‰æ•°åãŒ
-`$'ã§å§‹ã¾ã‚‰ãªã„時ã«ã¯è‡ªå‹•çš„ã«è¿½åŠ ã•れã¾ã™ï¼Žã“ã®å¤‰æ•°ã®å€¤ã‚’変
-æ›´ã™ã‚‹ã¨è‡ªå‹•çš„ã«Rubyã®å¯¾å¿œã™ã‚‹å¤‰æ•°ã®å€¤ã‚‚変ã‚りã¾ã™ï¼Ž
-
-ã¾ãŸRubyå´ã‹ã‚‰ã¯æ›´æ–°ã§ããªã„変数もã‚りã¾ã™ï¼Žã“ã®read onlyã®
-変数ã¯ä»¥ä¸‹ã®é–¢æ•°ã§å®šç¾©ã—ã¾ã™ï¼Ž
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-ã“れら変数ã®ä»–ã«hookã‚’ã¤ã‘ãŸå¤§åŸŸå¤‰æ•°ã‚’定義ã§ãã¾ã™ï¼Žhook付ã
-ã®å¤§åŸŸå¤‰æ•°ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’用ã„ã¦å®šç¾©ã—ã¾ã™ï¼Žhook付ã大域変数ã®
-値ã®å‚照や設定ã¯hookã§è¡Œã†å¿…è¦ãŒã‚りã¾ã™ï¼Ž
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
-ã“ã®é–¢æ•°ã¯Cã®é–¢æ•°ã«ã‚ˆã£ã¦hookã®ã¤ã‘られãŸå¤§åŸŸå¤‰æ•°ã‚’定義ã—ã¾
-ã™ï¼Žå¤‰æ•°ãŒå‚ç…§ã•ã‚ŒãŸæ™‚ã«ã¯é–¢æ•°getterãŒï¼Œå¤‰æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•れ
-ãŸæ™‚ã«ã¯é–¢æ•°setterãŒå‘¼ã°ã‚Œã‚‹ï¼Žhookを指定ã—ãªã„å ´åˆã¯getterã‚„
-setterã«0を指定ã—ã¾ã™ï¼Ž
-# getterã‚‚setterã‚‚0ãªã‚‰ã°rb_define_variable()ã¨åŒã˜ã«ãªã‚‹ï¼Ž
-
-getterã¨setterã®ä»•æ§˜ã¯æ¬¡ã®é€šã‚Šã§ã™ï¼Ž
-
- VALUE (*getter)(ID id, VALUE *var);
- void (*setter)(VALUE val, ID id, VALUE *var);
-
-
-ãれã‹ã‚‰ï¼Œå¯¾å¿œã™ã‚‹Cã®å¤‰æ•°ã‚’æŒãŸãªã„Rubyã®å¤§åŸŸå¤‰æ•°ã‚’定義ã™ã‚‹
-ã“ã¨ã‚‚ã§ãã¾ã™. ãã®å¤‰æ•°ã®å€¤ã¯ãƒ•ック関数ã®ã¿ã«ã‚ˆã£ã¦å–得・設定
-ã•れã¾ã™.
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
-ã“ã®é–¢æ•°ã«ã‚ˆã£ã¦å®šç¾©ã•れãŸRubyã®å¤§åŸŸå¤‰æ•°ãŒå‚ç…§ã•ã‚ŒãŸæ™‚ã«ã¯
-getterãŒï¼Œå¤‰æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•ã‚ŒãŸæ™‚ã«ã¯setterãŒå‘¼ã°ã‚Œã¾ã™ï¼Ž
-
-getterã¨setterã®ä»•様ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
-
- (*getter)(ID id);
- (*setter)(VALUE val, ID id);
-
-== Cã®ãƒ‡ãƒ¼ã‚¿ã‚’Rubyオブジェクトã«ã™ã‚‹
-
-Cã®ä¸–界ã§å®šç¾©ã•れãŸãƒ‡ãƒ¼ã‚¿(構造体)ã‚’Rubyã®ã‚ªãƒ–ジェクトã¨ã—ã¦
-å–り扱ã„ãŸã„å ´åˆãŒã‚りãˆã¾ã™ï¼Žã“ã®ã‚ˆã†ãªå ´åˆã«ã¯ï¼ŒDataã¨ã„ã†
-Rubyオブジェクトã«Cã®æ§‹é€ ä½“(ã¸ã®ãƒã‚¤ãƒ³ã‚¿)ã‚’ãã‚‹ã‚€ã“ã¨ã§Ruby
-オブジェクトã¨ã—ã¦å–り扱ãˆã‚‹ã‚ˆã†ã«ãªã‚Šã¾ã™ï¼Ž
-
-Dataオブジェクトを生æˆã—ã¦æ§‹é€ ä½“ã‚’Rubyオブジェクトã«ã‚«ãƒ—セル
-化ã™ã‚‹ãŸã‚ã«ã¯ï¼Œä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ã‚’使ã„ã¾ã™ï¼Ž
-
- Data_Wrap_Struct(klass, mark, free, sval)
-
-ã“ã®ãƒžã‚¯ãƒ­ã®æˆ»ã‚Šå€¤ã¯ç”Ÿæˆã•れãŸDataオブジェクトã§ã™ï¼Ž
-
-klassã¯ã“ã®Dataオブジェクトã®ã‚¯ãƒ©ã‚¹ã§ã™ï¼Žmarkã¯ã“ã®æ§‹é€ ä½“ãŒ
-Rubyã®ã‚ªãƒ–ジェクトã¸ã®å‚ç…§ãŒã‚る時ã«ä½¿ã†é–¢æ•°ã§ã™ï¼Žãã®ã‚ˆã†ãª
-å‚ç…§ã‚’å«ã¾ãªã„時ã«ã¯0を指定ã—ã¾ã™ï¼Ž
-
-# ãã®ã‚ˆã†ãªå‚ç…§ã¯å‹§ã‚られã¾ã›ã‚“.
-
-freeã¯ã“ã®æ§‹é€ ä½“ãŒã‚‚ã†ä¸è¦ã«ãªã£ãŸæ™‚ã«å‘¼ã°ã‚Œã‚‹é–¢æ•°ã§ã™ï¼Žã“ã®
-関数ãŒã‚¬ãƒ¼ãƒ™ãƒ¼ã‚¸ã‚³ãƒ¬ã‚¯ã‚¿ã‹ã‚‰å‘¼ã°ã‚Œã¾ã™ï¼Žã“れãŒ-1ã®å ´åˆã¯ï¼Œå˜
-ç´”ã«é–‹æ”¾ã•れã¾ã™ï¼Ž
-
-markãŠã‚ˆã³free関数ã¯GC実行中ã«å‘¼ã³å‡ºã•れã¾ã™.
-ãªãŠ, GC実行中ã¯Rubyオブジェクトã®ã‚¢ãƒ­ã‚±ãƒ¼ã‚·ãƒ§ãƒ³ã¯ç¦æ­¢ã•れã¾
-ã™. よã£ã¦, markãŠã‚ˆã³free関数ã§Rubyオブジェクトã®ã‚¢ãƒ­ã‚±ãƒ¼ã‚·
-ョンã¯è¡Œã‚ãªã„ã§ãã ã•ã„.
-
-Cã®æ§‹é€ ä½“ã®å‰²å½“ã¨Dataオブジェクトã®ç”Ÿæˆã‚’åŒæ™‚ã«è¡Œã†ãƒžã‚¯ãƒ­ã¨
-ã—ã¦ä»¥ä¸‹ã®ã‚‚ã®ãŒæä¾›ã•れã¦ã„ã¾ã™ï¼Ž
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-ã“ã®ãƒžã‚¯ãƒ­ã®æˆ»ã‚Šå€¤ã¯ç”Ÿæˆã•れãŸDataオブジェクトã§ã™ï¼Žã“ã®ãƒžã‚¯
-ロã¯ä»¥ä¸‹ã®å¼ã®ã‚ˆã†ã«åƒãã¾ã™:
-
- (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-
-klass, mark, freeã¯Data_Wrap_Structã¨åŒã˜åƒãã‚’ã—ã¾ã™ï¼Žtype
-ã¯å‰²ã‚Šå½“ã¦ã‚‹C構造体ã®åž‹ã§ã™ï¼Žå‰²ã‚Šå½“ã¦ã‚‰ã‚ŒãŸæ§‹é€ ä½“ã¯å¤‰æ•°sval
-ã«ä»£å…¥ã•れã¾ã™ï¼Žã“ã®å¤‰æ•°ã®åž‹ã¯ (type*) ã§ã‚ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Ž
-
-Dataオブジェクトã‹ã‚‰ãƒã‚¤ãƒ³ã‚¿ã‚’å–り出ã™ã®ã¯ä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ã‚’用ã„
-ã¾ã™ï¼Ž
-
- Data_Get_Struct(obj, type, sval)
-
-Cã®æ§‹é€ ä½“ã¸ã®ãƒã‚¤ãƒ³ã‚¿ã¯å¤‰æ•°svalã«ä»£å…¥ã•れã¾ã™ï¼Ž
-
-ã“れらã®Dataã®ä½¿ã„æ–¹ã¯ã¡ã‚‡ã£ã¨åˆ†ã‹ã‚Šã«ãã„ã®ã§ï¼Œå¾Œã§èª¬æ˜Žã™ã‚‹
-例題をå‚ç…§ã—ã¦ãã ã•ã„.
-
-= 例題 - dbmパッケージを作る
-
-ã“ã“ã¾ã§ã®èª¬æ˜Žã§ã¨ã‚Šã‚ãˆãšæ‹¡å¼µãƒ©ã‚¤ãƒ–ãƒ©ãƒªã¯ä½œã‚Œã‚‹ã¯ãšã§ã™ï¼Ž
-Rubyã®extディレクトリã«ã™ã§ã«å«ã¾ã‚Œã¦ã„ã‚‹dbmライブラリを例ã«
-ã—ã¦æ®µéšŽçš„ã«èª¬æ˜Žã—ã¾ã™ï¼Ž
-
-== ディレクトリを作る
-
- % mkdir ext/dbm
-
-Ruby 1.1ã‹ã‚‰ã¯ä»»æ„ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã§ãƒ€ã‚¤ãƒŠãƒŸãƒƒã‚¯ãƒ©ã‚¤ãƒ–ラリを作
-ã‚‹ã“ã¨ãŒã§ãるよã†ã«ãªã‚Šã¾ã—ãŸï¼ŽRubyã«é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹å ´åˆã«
-ã¯Rubyを展開ã—ãŸãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã®ä¸‹ï¼Œextディレクトリã®ä¸­ã«æ‹¡å¼µ
-ライブラリ用ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’作る必è¦ãŒã‚りã¾ã™ï¼Žåå‰ã¯é©å½“ã«
-é¸ã‚“ã§æ§‹ã„ã¾ã›ã‚“.
-
-== 設計ã™ã‚‹
-
-ã¾ã‚,当然ãªã‚“ã§ã™ã‘ã©ï¼Œã©ã†ã„ã†æ©Ÿèƒ½ã‚’実ç¾ã™ã‚‹ã‹ã©ã†ã‹ã¾ãšè¨­
-計ã™ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Žã©ã‚“ãªã‚¯ãƒ©ã‚¹ã‚’ã¤ãã‚‹ã‹ï¼Œãã®ã‚¯ãƒ©ã‚¹ã«ã¯
-ã©ã‚“ãªãƒ¡ã‚½ãƒƒãƒ‰ãŒã‚ã‚‹ã‹ï¼Œã‚¯ãƒ©ã‚¹ãŒæä¾›ã™ã‚‹å®šæ•°ãªã©ã«ã¤ã„ã¦è¨­è¨ˆ
-ã—ã¾ã™ï¼Ž
-
-== Cコードを書ã
-
-拡張ライブラリ本体ã¨ãªã‚‹C言語ã®ã‚½ãƒ¼ã‚¹ã‚’書ãã¾ã™ï¼ŽC言語ã®ã‚½ãƒ¼
-スãŒã²ã¨ã¤ã®æ™‚ã«ã¯ã€Œãƒ©ã‚¤ãƒ–ラリå.cã€ã‚’é¸ã¶ã¨è‰¯ã„ã§ã—ょã†ï¼ŽC
-言語ã®ã‚½ãƒ¼ã‚¹ãŒè¤‡æ•°ã®å ´åˆã«ã¯é€†ã«ã€Œãƒ©ã‚¤ãƒ–ラリå.cã€ã¨ã„ã†ãƒ•ã‚¡
-イルåã¯é¿ã‘ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Žã‚ªãƒ–ジェクトファイルã¨ãƒ¢ã‚¸ãƒ¥ãƒ¼
-ãƒ«ç”Ÿæˆæ™‚ã«ä¸­é–“çš„ã«ç”Ÿæˆã•れる「ライブラリå.oã€ã¨ã„ã†ãƒ•ァイル
-ã¨ãŒè¡çªã™ã‚‹ã‹ã‚‰ã§ã™ï¼Žã¾ãŸï¼Œå¾Œè¿°ã™ã‚‹ mkmf ライブラリã®ã„ãã¤
-ã‹ã®é–¢æ•°ãŒã‚³ãƒ³ãƒ‘イルをè¦ã™ã‚‹ãƒ†ã‚¹ãƒˆã®ãŸã‚ã«ã€Œconftest.cã€ã¨ã„
-ã†ãƒ•ァイルåを使用ã™ã‚‹ã“ã¨ã«æ³¨æ„ã—ã¦ãã ã•ã„.ソースファイル
-åã¨ã—ã¦ã€Œconftest.cã€ã‚’使用ã—ã¦ã¯ãªã‚Šã¾ã›ã‚“.
-
-Rubyã¯æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリをロードã™ã‚‹æ™‚ã«ã€ŒInit_ライブラリåã€ã¨
-ã„ã†é–¢æ•°ã‚’自動的ã«å®Ÿè¡Œã—ã¾ã™ï¼Ždbmライブラリã®å ´åˆã€ŒInit_dbmã€
-ã§ã™ï¼Žã“ã®é–¢æ•°ã®ä¸­ã§ã‚¯ãƒ©ã‚¹ï¼Œãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ï¼Œãƒ¡ã‚½ãƒƒãƒ‰ï¼Œå®šæ•°ãªã©ã®
-定義を行ã„ã¾ã™ï¼Ždbm.cã‹ã‚‰ä¸€éƒ¨å¼•用ã—ã¾ã™ï¼Ž
-
- void
- Init_dbm(void)
- {
- /* DBMクラスを定義ã™ã‚‹ */
- VALUE cDBM = rb_define_class("DBM", rb_cObject);
- /* DBMã¯Enumerableモジュールをインクルードã™ã‚‹ */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBMクラスã®ã‚¯ãƒ©ã‚¹ãƒ¡ã‚½ãƒƒãƒ‰open(): 引数ã¯Cã®é…列ã§å—ã‘ã‚‹ */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBMクラスã®ãƒ¡ã‚½ãƒƒãƒ‰close(): 引数ã¯ãªã— */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBMクラスã®ãƒ¡ã‚½ãƒƒãƒ‰[]: 引数ã¯1個 */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-
- /* ... */
-
- /* DBMデータを格ç´ã™ã‚‹ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°åã®ãŸã‚ã®ID */
- id_dbm = rb_intern("dbm");
- }
-
-DBMライブラリã¯dbmã®ãƒ‡ãƒ¼ã‚¿ã¨å¯¾å¿œã™ã‚‹ã‚ªãƒ–ジェクトã«ãªã‚‹ã¯ãšã§
-ã™ã‹ã‚‰ï¼ŒCã®ä¸–界ã®dbmã‚’Rubyã®ä¸–界ã«å–り込む必è¦ãŒã‚りã¾ã™ï¼Ž
-
-dbm.cã§ã¯Data_Make_Structを以下ã®ã‚ˆã†ã«ä½¿ã£ã¦ã„ã¾ã™ï¼Ž
-
- struct dbmdata {
- int di_size;
- DBM *di_dbm;
- };
-
-
- obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
-
-ã“ã“ã§ã¯dbmstruct構造体ã¸ã®ãƒã‚¤ãƒ³ã‚¿ã‚’Dataã«ã‚«ãƒ—セル化ã—ã¦ã„
-ã¾ã™ï¼ŽDBM*を直接カプセル化ã—ãªã„ã®ã¯close()ã—ãŸæ™‚ã®å‡¦ç†ã‚’考
-ãˆã¦ã®ã“ã¨ã§ã™ï¼Ž
-
-Dataオブジェクトã‹ã‚‰dbmstruct構造体ã®ãƒã‚¤ãƒ³ã‚¿ã‚’å–り出ã™ãŸã‚
-ã«ä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ã‚’使ã£ã¦ã„ã¾ã™ï¼Ž
-
- #define GetDBM(obj, dbmp) do {\
- Data_Get_Struct((obj), struct dbmdata, (dbmp));\
- if ((dbmp) == 0) closed_dbm();\
- if ((dbmp)->di_dbm == 0) closed_dbm();\
- } while (0)
-
-ã¡ã‚‡ã£ã¨è¤‡é›‘ãªãƒžã‚¯ãƒ­ã§ã™ãŒï¼Œè¦ã™ã‚‹ã«dbmdata構造体ã®ãƒã‚¤ãƒ³ã‚¿
-ã®å–り出ã—ã¨ï¼Œcloseã•れã¦ã„ã‚‹ã‹ã©ã†ã‹ã®ãƒã‚§ãƒƒã‚¯ã‚’ã¾ã¨ã‚ã¦ã„
-ã‚‹ã ã‘ã§ã™ï¼Ž
-
-DBMクラスã«ã¯ãŸãã•んメソッドãŒã‚りã¾ã™ãŒï¼Œåˆ†é¡žã™ã‚‹ã¨3種類ã®
-引数ã®å—ã‘æ–¹ãŒã‚りã¾ã™ï¼Žã²ã¨ã¤ã¯å¼•æ•°ã®æ•°ãŒå›ºå®šã®ã‚‚ã®ã§ï¼Œä¾‹ã¨
-ã—ã¦ã¯deleteメソッドãŒã‚りã¾ã™ï¼Ždeleteメソッドを実装ã—ã¦ã„ã‚‹
-fdbm_delete()ã¯ã“ã®ã‚ˆã†ã«ãªã£ã¦ã„ã¾ã™ï¼Ž
-
- static VALUE
- fdbm_delete(VALUE obj, VALUE keystr)
- {
- /* ... */
- }
-
-å¼•æ•°ã®æ•°ãŒå›ºå®šã®ã‚¿ã‚¤ãƒ—ã¯ç¬¬1引数ãŒself,第2引数以é™ãŒãƒ¡ã‚½ãƒƒãƒ‰
-ã®å¼•æ•°ã¨ãªã‚Šã¾ã™ï¼Ž
-
-å¼•æ•°ã®æ•°ãŒä¸å®šã®ã‚‚ã®ã¯Cã®é…列ã§å—ã‘ã‚‹ã‚‚ã®ã¨Rubyã®é…列ã§å—ã‘
-ã‚‹ã‚‚ã®ã¨ãŒã‚りã¾ã™ï¼Ždbmライブラリã®ä¸­ã§ï¼ŒCã®é…列ã§å—ã‘ã‚‹ã‚‚ã®
-ã¯DBMã®ã‚¯ãƒ©ã‚¹ãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚ã‚‹open()ã§ã™ï¼Žã“れを実装ã—ã¦ã„ã‚‹é–¢
-æ•°fdbm_s_open()ã¯ã“ã†ãªã£ã¦ã„ã¾ã™ï¼Ž
-
- static VALUE
- fdbm_s_open(int argc, VALUE *argv, VALUE klass)
- {
- /* ... */
-
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
-
- /* ... */
- }
-
-ã“ã®ã‚¿ã‚¤ãƒ—ã®é–¢æ•°ã¯ç¬¬1引数ãŒä¸Žãˆã‚‰ã‚ŒãŸå¼•æ•°ã®æ•°ï¼Œç¬¬2引数ãŒä¸Žãˆ
-られãŸå¼•æ•°ã®å…¥ã£ã¦ã„ã‚‹é…列ã«ãªã‚Šã¾ã™ï¼Žselfã¯ç¬¬3引数ã¨ã—ã¦ä¸Ž
-ãˆã‚‰ã‚Œã¾ã™ï¼Ž
-
-ã“ã®é…列ã§ä¸Žãˆã‚‰ã‚ŒãŸå¼•æ•°ã‚’è§£æžã™ã‚‹ãŸã‚ã®é–¢æ•°ãŒopen()ã§ã‚‚使ã‚
-れã¦ã„ã‚‹rb_scan_args()ã§ã™ï¼Žç¬¬3å¼•æ•°ã«æŒ‡å®šã—ãŸãƒ•ォーマットã«å¾“
-ã„,第4変数以é™ã«æŒ‡å®šã—ãŸVALUEã¸ã®å‚ç…§ã«å€¤ã‚’代入ã—ã¦ãれã¾
-ã™ï¼Ž
-
-
-引数をRubyã®é…列ã¨ã—ã¦å—ã‘å–るメソッドã®ä¾‹ã«ã¯
-Thread#initializeãŒã‚りã¾ã™ï¼Žå®Ÿè£…ã¯ã“ã†ã§ã™ï¼Ž
-
- static VALUE
- thread_initialize(VALUE thread, VALUE args)
- {
- /* ... */
- }
-
-第1引数ã¯self,第2引数ã¯Rubyã®é…列ã§ã™ï¼Ž
-
-*注æ„事項*
-
-Rubyã¨å…±æœ‰ã¯ã—ãªã„ãŒRubyã®ã‚ªãƒ–ジェクトを格ç´ã™ã‚‹å¯èƒ½æ€§ã®ã‚ã‚‹
-Cã®å¤§åŸŸå¤‰æ•°ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã£ã¦Rubyインタプリタã«å¤‰æ•°ã®å­˜åœ¨
-ã‚’æ•™ãˆã¦ã‚ã’ã¦ãã ã•ã„.ã§ãªã„ã¨GCã§ãƒˆãƒ©ãƒ–ルを起ã“ã—ã¾ã™ï¼Ž
-
- void rb_global_variable(VALUE *var)
-
-== extconf.rbを用æ„ã™ã‚‹
-
-Makefileを作る場åˆã®é››åž‹ã«ãªã‚‹extconf.rbã¨ã„ã†ãƒ•ァイルを作り
-ã¾ã™ï¼Žextconf.rbã¯ãƒ©ã‚¤ãƒ–ラリã®ã‚³ãƒ³ãƒ‘イルã«å¿…è¦ãªæ¡ä»¶ã®ãƒã‚§ãƒƒ
-クãªã©ã‚’行ã†ã“ã¨ãŒç›®çš„ã§ã™ï¼Žã¾ãšï¼Œ
-
- require 'mkmf'
-
-ã‚’extconf.rbã®å…ˆé ­ã«ç½®ãã¾ã™ï¼Žextconf.rbã®ä¸­ã§ã¯ä»¥ä¸‹ã®Rubyé–¢
-数を使ã†ã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼Ž
-
- have_library(lib, func): ライブラリã®å­˜åœ¨ãƒã‚§ãƒƒã‚¯
- have_func(func, header): 関数ã®å­˜åœ¨ãƒã‚§ãƒƒã‚¯
- have_header(header): ヘッダファイルã®å­˜åœ¨ãƒã‚§ãƒƒã‚¯
- create_makefile(target[, target_prefix]): Makefileã®ç”Ÿæˆ
-
-以下ã®å¤‰æ•°ã‚’使ã†ã“ã¨ãŒã§ãã¾ã™ï¼Ž
-
- $CFLAGS: コンパイル時ã«è¿½åŠ çš„ã«æŒ‡å®šã™ã‚‹ãƒ•ラグ(-Oãªã©)
- $CPPFLAGS: プリプロセッサã«è¿½åŠ çš„ã«æŒ‡å®šã™ã‚‹ãƒ•ラグ(-Iã‚„-Dãªã©)
- $LDFLAGS: リンク時ã«è¿½åŠ çš„ã«æŒ‡å®šã™ã‚‹ãƒ•ラグ(-Lãªã©)
- $objs: リンクã•れるオブジェクトファイルåã®ãƒªã‚¹ãƒˆ
-
-オブジェクトファイルã®ãƒªã‚¹ãƒˆã¯ï¼Œé€šå¸¸ã¯ã‚½ãƒ¼ã‚¹ãƒ•ァイルを検索ã—
-ã¦è‡ªå‹•çš„ã«ç”Ÿæˆã•れã¾ã™ãŒï¼Œmakeã®é€”中ã§ã‚½ãƒ¼ã‚¹ã‚’生æˆã™ã‚‹ã‚ˆã†ãª
-å ´åˆã¯æ˜Žç¤ºçš„ã«æŒ‡å®šã™ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Ž
-
-ライブラリをコンパイルã™ã‚‹æ¡ä»¶ãŒæƒã‚ãšï¼Œãã®ãƒ©ã‚¤ãƒ–ラリをコン
-パイルã—ãªã„時ã«ã¯create_makefileを呼ã°ãªã‘れã°Makefileã¯ç”Ÿ
-æˆã•れãšï¼Œã‚³ãƒ³ãƒ‘イルも行ã‚れã¾ã›ã‚“.
-
-== dependを用æ„ã™ã‚‹
-
-ã‚‚ã—,ディレクトリã«dependã¨ã„ã†ãƒ•ァイルãŒå­˜åœ¨ã™ã‚Œã°ï¼Œ
-MakefileãŒä¾å­˜é–¢ä¿‚ã‚’ãƒã‚§ãƒƒã‚¯ã—ã¦ãれã¾ã™ï¼Ž
-
- % gcc -MM *.c > depend
-
-ãªã©ã§ä½œã‚‹ã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼Žã‚ã£ã¦æã¯ç„¡ã„ã§ã—ょã†ï¼Ž
-
-== Makefileを生æˆã™ã‚‹
-
-Makefileを実際ã«ç”Ÿæˆã™ã‚‹ãŸã‚ã«ã¯
-
- ruby extconf.rb
-
-ã¨ã—ã¾ã™ï¼Žextconf.rbã« require 'mkmf' ã®è¡ŒãŒãªã„å ´åˆã«ã¯ã‚¨ãƒ©ãƒ¼
-ã«ãªã‚Šã¾ã™ã®ã§ï¼Œå¼•数を追加ã—ã¦
-
- ruby -r mkmf extconf.rb
-
-ã¨ã—ã¦ãã ã•ã„.
-
-site_ruby ディレクトリã§ãªã,
-vendor_ruby ディレクトリã«ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«ã™ã‚‹å ´åˆã«ã¯
-以下ã®ã‚ˆã†ã« --vendor オプションを加ãˆã¦ãã ã•ã„.
-
- ruby extconf.rb --vendor
-
-ディレクトリをext以下ã«ç”¨æ„ã—ãŸå ´åˆã«ã¯Ruby全体ã®makeã®æ™‚ã«
-自動的ã«MakefileãŒç”Ÿæˆã•れã¾ã™ã®ã§ï¼Œã“ã®ã‚¹ãƒ†ãƒƒãƒ—ã¯ä¸è¦ã§ã™ï¼Ž
-
-== makeã™ã‚‹
-
-動的リンクライブラリを生æˆã™ã‚‹å ´åˆã«ã¯ãã®å ´ã§makeã—ã¦ãã ã•
-ã„.必è¦ã§ã‚れ㰠make install ã§ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«ã•れã¾ã™ï¼Ž
-
-ext以下ã«ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’用æ„ã—ãŸå ´åˆã¯ï¼ŒRubyã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã§
-makeを実行ã™ã‚‹ã¨Makefileを生æˆã‹ã‚‰make,必è¦ã«ã‚ˆã£ã¦ã¯ãã®ãƒ¢
-ジュールã®Rubyã¸ã®ãƒªãƒ³ã‚¯ã¾ã§è‡ªå‹•çš„ã«å®Ÿè¡Œã—ã¦ãれã¾ã™ï¼Ž
-extconf.rbã‚’æ›¸ãæ›ãˆã‚‹ãªã©ã—ã¦Makefileã®å†ç”ŸæˆãŒå¿…è¦ãªæ™‚ã¯ã¾
-ãŸRubyディレクトリã§makeã—ã¦ãã ã•ã„.
-
-拡張ライブラリã¯make installã§Rubyライブラリã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã®
-下ã«ã‚³ãƒ”ーã•れã¾ã™ï¼Žã‚‚ã—æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã¨å”調ã—ã¦ä½¿ã†Rubyã§è¨˜
-è¿°ã•れãŸãƒ—ログラムãŒã‚り,Rubyライブラリã«ç½®ããŸã„å ´åˆã«ã¯ï¼Œ
-拡張ライブラリ用ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã®ä¸‹ã« lib ã¨ã„ã†ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒª
-を作り,ãã“ã« æ‹¡å¼µå­ .rb ã®ãƒ•ァイルを置ã„ã¦ãŠã‘ã°åŒæ™‚ã«ã‚¤ãƒ³
-ストールã•れã¾ã™ï¼Ž
-
-== デãƒãƒƒã‚°
-
-ã¾ã‚,デãƒãƒƒã‚°ã—ãªã„ã¨å‹•ã‹ãªã„ã§ã—ょã†ã­ï¼Žext/Setupã«ãƒ‡ã‚£ãƒ¬
-クトリåを書ãã¨é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹ã®ã§ãƒ‡ãƒãƒƒã‚¬ãŒä½¿ãˆã‚‹ã‚ˆã†ã«ãª
-りã¾ã™ï¼Žãã®åˆ†ã‚³ãƒ³ãƒ‘イルãŒé…ããªã‚Šã¾ã™ã‘ã©ï¼Ž
-
-== ã§ãã‚ãŒã‚Š
-
-後ã¯ã“ã£ãり使ã†ãªã‚Šï¼Œåºƒã公開ã™ã‚‹ãªã‚Šï¼Œå£²ã‚‹ãªã‚Šï¼Œã”自由ã«ãŠ
-使ã„ãã ã•ã„.Rubyã®ä½œè€…ã¯æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«é–¢ã—ã¦ä¸€åˆ‡ã®æ¨©åˆ©ã‚’
-主張ã—ã¾ã›ã‚“.
-
-= Appendix A. Rubyã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®åˆ†é¡ž
-
-Rubyã®ã‚½ãƒ¼ã‚¹ã¯ã„ãã¤ã‹ã«åˆ†é¡žã™ã‚‹ã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼Žã“ã®ã†ã¡ã‚¯ãƒ©
-スライブラリã®éƒ¨åˆ†ã¯åŸºæœ¬çš„ã«æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã¨åŒã˜ä½œã‚Šæ–¹ã«ãªã£
-ã¦ã„ã¾ã™ï¼Žã“れらã®ã‚½ãƒ¼ã‚¹ã¯ä»Šã¾ã§ã®èª¬æ˜Žã§ã»ã¨ã‚“ã©ç†è§£ã§ãã‚‹ã¨
-æ€ã„ã¾ã™ï¼Ž
-
-== Ruby言語ã®ã‚³ã‚¢
-
-class.c :: クラスã¨ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«
-error.c :: 例外クラスã¨ä¾‹å¤–機構
-gc.c :: 記憶領域管ç†
-load.c :: ライブラリã®ãƒ­ãƒ¼ãƒ‰
-object.c :: オブジェクト
-variable.c :: 変数ã¨å®šæ•°
-
-== Rubyã®æ§‹æ–‡è§£æžå™¨
-
- parse.y : å­—å¥è§£æžå™¨ã¨æ§‹æ–‡å®šç¾©
- -> parse.c : 自動生æˆ
- defs/keywords : 予約語
- -> lex.c : 自動生æˆ
-
-== Rubyã®è©•価器 (通称YARV)
- compile.c
- eval.c
- eval_error.c
- eval_jump.c
- eval_safe.c
- insns.def : 仮想機械語ã®å®šç¾©
- iseq.c : VM::ISeqã®å®Ÿè£…
- thread.c : スレッド管ç†ã¨ã‚³ãƒ³ãƒ†ã‚­ã‚¹ãƒˆåˆ‡ã‚Šæ›¿ãˆ
- thread_win32.c : スレッド実装
- thread_pthread.c : åŒä¸Š
- vm.c
- vm_dump.c
- vm_eval.c
- vm_exec.c
- vm_insnhelper.c
- vm_method.c
-
- defs/opt_insns_unif.def : 命令èžåˆ
- defs/opt_operand.def : 最é©åŒ–ã®ãŸã‚ã®å®šç¾©
-
- -> insn*.inc : 自動生æˆ
- -> opt*.inc : 自動生æˆ
- -> vm.inc : 自動生æˆ
-
-== æ­£è¦è¡¨ç¾ã‚¨ãƒ³ã‚¸ãƒ³ (鬼車)
-
- regex.c
- regcomp.c
- regenc.c
- regerror.c
- regexec.c
- regparse.c
- regsyntax.c
-
-== ユーティリティ関数
-
-debug.c :: Cデãƒãƒƒã‚¬ç”¨ã®ãƒ‡ãƒãƒƒã‚°ã‚·ãƒ³ãƒœãƒ«
-dln.c :: 動的ローディング
-st.c :: 汎用ãƒãƒƒã‚·ãƒ¥è¡¨
-strftime.c :: 時刻整形
-util.c :: ãã®ä»–ã®ãƒ¦ãƒ¼ãƒ†ã‚£ãƒªãƒ†ã‚£
-
-== Rubyコマンドã®å®Ÿè£…
-
- dmyext.c
- dmydln.c
- dmyencoding.c
- id.c
- inits.c
- main.c
- ruby.c
- version.c
-
- gem_prelude.rb
- prelude.rb
-
-== クラスライブラリ
-
-array.c :: Array
-bignum.c :: Bignum
-compar.c :: Comparable
-complex.c :: Complex
-cont.c :: Fiber, Continuation
-dir.c :: Dir
-enum.c :: Enumerable
-enumerator.c :: Enumerator
-file.c :: File
-hash.c :: Hash
-io.c :: IO
-marshal.c :: Marshal
-math.c :: Math
-numeric.c :: Numeric, Integer, Fixnum, Float
-pack.c :: Array#pack, String#unpack
-proc.c :: Binding, Proc
-process.c :: Process
-random.c :: 乱数
-range.c :: Range
-rational.c :: Rational
-re.c :: Regexp, MatchData
-signal.c :: Signal
-sprintf.c :: String#sprintf
-string.c :: String
-struct.c :: Struct
-time.c :: Time
-defs/known_errors.def :: 例外クラス Errno::*
--> known_errors.inc :: 自動生æˆ
-
-== 多言語化
-
-encoding.c :: Encoding
-transcode.c :: Encoding::Converter
-enc/*.c :: エンコーディングクラス群
-enc/trans/* :: コードãƒã‚¤ãƒ³ãƒˆå¯¾å¿œè¡¨
-
-== gorubyコマンドã®å®Ÿè£…
-
- goruby.c
- golf_prelude.rb : goruby固有ã®ãƒ©ã‚¤ãƒ–ラリ
- -> golf_prelude.c : 自動生æˆ
-
-= Appendix B. 拡張用関数リファレンス
-
-C言語ã‹ã‚‰Rubyã®æ©Ÿèƒ½ã‚’利用ã™ã‚‹APIã¯ä»¥ä¸‹ã®é€šã‚Šã§ã‚る.
-
-== åž‹
-
-VALUE ::
-
- Rubyオブジェクトを表ç¾ã™ã‚‹åž‹ï¼Žå¿…è¦ã«å¿œã˜ã¦ã‚­ãƒ£ã‚¹ãƒˆã—ã¦ç”¨ã„る.
- 組ã¿è¾¼ã¿åž‹ã‚’表ç¾ã™ã‚‹Cã®åž‹ã¯ruby.hã«è¨˜è¿°ã—ã¦ã‚ã‚‹Rã§å§‹ã¾ã‚‹æ§‹é€ 
- 体ã§ã‚る.VALUE型をã“れらã«ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ãŸã‚ã«Rã§å§‹ã¾ã‚‹æ§‹é€ ä½“
- åã‚’å…¨ã¦å¤§æ–‡å­—ã«ã—ãŸåå‰ã®ãƒžã‚¯ãƒ­ãŒç”¨æ„ã•れã¦ã„る.
-
-== 変数・定数
-
-Qnil ::
-
- 定数: nilオブジェクト
-
-Qtrue ::
-
- 定数: trueオブジェクト(真ã®ãƒ‡ãƒ•ォルト値)
-
-Qfalse ::
-
- 定数: falseオブジェクト
-
-== Cデータã®ã‚«ãƒ—セル化
-
-Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval) ::
-
- Cã®ä»»æ„ã®ãƒã‚¤ãƒ³ã‚¿ã‚’カプセル化ã—ãŸRubyオブジェクトを返ã™ï¼Žã“
- ã®ãƒã‚¤ãƒ³ã‚¿ãŒRubyã‹ã‚‰ã‚¢ã‚¯ã‚»ã‚¹ã•れãªããªã£ãŸæ™‚,freeã§æŒ‡å®šã—ãŸ
- 関数ãŒå‘¼ã°ã‚Œã‚‹ï¼Žã¾ãŸï¼Œã“ã®ãƒã‚¤ãƒ³ã‚¿ã®æŒ‡ã™ãƒ‡ãƒ¼ã‚¿ãŒä»–ã®Rubyオブ
- ジェクトを指ã—ã¦ã„ã‚‹å ´åˆï¼Œmarkã«æŒ‡å®šã™ã‚‹é–¢æ•°ã§ãƒžãƒ¼ã‚¯ã™ã‚‹å¿…è¦
- ãŒã‚る.
-
-Data_Make_Struct(klass, type, mark, free, sval) ::
-
- typeåž‹ã®ãƒ¡ãƒ¢ãƒªã‚’mallocã—,変数svalã«ä»£å…¥ã—ãŸå¾Œï¼Œãれをカプセ
- ル化ã—ãŸãƒ‡ãƒ¼ã‚¿ã‚’è¿”ã™ãƒžã‚¯ãƒ­ï¼Ž
-
-Data_Get_Struct(data, type, sval) ::
-
- dataã‹ã‚‰typeåž‹ã®ãƒã‚¤ãƒ³ã‚¿ã‚’å–り出ã—変数svalã«ä»£å…¥ã™ã‚‹ãƒžã‚¯ãƒ­ï¼Ž
-
-== åž‹ãƒã‚§ãƒƒã‚¯
-
- TYPE(value)
- FIXNUM_P(value)
- NIL_P(value)
- void Check_Type(VALUE value, int type)
- SafeStringValue(value)
-
-== 型変æ›
-
- FIX2INT(value), INT2FIX(i)
- FIX2LONG(value), LONG2FIX(l)
- NUM2INT(value), INT2NUM(i)
- NUM2UINT(value), UINT2NUM(ui)
- NUM2LONG(value), LONG2NUM(l)
- NUM2ULONG(value), ULONG2NUM(ul)
- NUM2LL(value), LL2NUM(ll)
- NUM2ULL(value), ULL2NUM(ull)
- NUM2OFFT(value), OFFT2NUM(off)
- NUM2SIZET(value), SIZET2NUM(size)
- NUM2SSIZET(value), SSIZET2NUM(ssize)
- rb_integer_pack(value, words, numwords, wordsize, nails, flags), rb_integer_unpack(words, numwords, wordsize, nails, flags)
- NUM2DBL(value)
- rb_float_new(f)
- RSTRING_LEN(str)
- RSTRING_PTR(str)
- StringValue(value)
- StringValuePtr(value)
- StringValueCStr(value)
- rb_str_new2(s)
-
-== クラス/モジュール定義
-
-VALUE rb_define_class(const char *name, VALUE super) ::
-
- superã®ã‚µãƒ–クラスã¨ã—ã¦æ–°ã—ã„Rubyクラスを定義ã™ã‚‹ï¼Ž
-
-VALUE rb_define_class_under(VALUE module, const char *name, VALUE super) ::
-
- superã®ã‚µãƒ–クラスã¨ã—ã¦æ–°ã—ã„Rubyクラスを定義ã—,moduleã®
- 定数ã¨ã—ã¦å®šç¾©ã™ã‚‹ï¼Ž
-
-VALUE rb_define_module(const char *name) ::
-
- æ–°ã—ã„Rubyモジュールを定義ã™ã‚‹ï¼Ž
-
-VALUE rb_define_module_under(VALUE module, const char *name) ::
-
- æ–°ã—ã„Rubyモジュールを定義ã—,moduleã®å®šæ•°ã¨ã—ã¦å®šç¾©ã™ã‚‹ï¼Ž
-
-void rb_include_module(VALUE klass, VALUE module) ::
-
- モジュールをインクルードã™ã‚‹ï¼ŽclassãŒã™ã§ã«moduleをインク
- ルードã—ã¦ã„る時ã«ã¯ä½•ã‚‚ã—ãªã„(多é‡ã‚¤ãƒ³ã‚¯ãƒ«ãƒ¼ãƒ‰ã®ç¦æ­¢).
-
-void rb_extend_object(VALUE object, VALUE module) ::
-
- オブジェクトをモジュール(ã§å®šç¾©ã•れã¦ã„るメソッド)ã§æ‹¡å¼µã™ã‚‹ï¼Ž
-
-== 大域変数定義
-
-void rb_define_variable(const char *name, VALUE *var) ::
-
- Rubyã¨Cã¨ã§å…±æœ‰ã™ã‚‹ã‚°ãƒ­ãƒ¼ãƒãƒ«å¤‰æ•°ã‚’定義ã™ã‚‹ï¼Žå¤‰æ•°åãŒ`$'ã§
- å§‹ã¾ã‚‰ãªã„時ã«ã¯è‡ªå‹•çš„ã«è¿½åŠ ã•れる.nameã¨ã—ã¦Rubyã®è­˜åˆ¥å­
- ã¨ã—ã¦è¨±ã•れãªã„文字(例ãˆã°` ')ã‚’å«ã‚€å ´åˆã«ã¯Rubyプログラ
- ムã‹ã‚‰ã¯è¦‹ãˆãªããªã‚‹ï¼Ž
-
-void rb_define_readonly_variable(const char *name, VALUE *var) ::
-
- Rubyã¨Cã¨ã§å…±æœ‰ã™ã‚‹read onlyã®ã‚°ãƒ­ãƒ¼ãƒãƒ«å¤‰æ•°ã‚’定義ã™ã‚‹ï¼Ž
- read onlyã§ã‚ã‚‹ã“ã¨ä»¥å¤–ã¯rb_define_variable()ã¨åŒã˜ï¼Ž
-
-void rb_define_virtual_variable(const char *name, VALUE (*getter)(), void (*setter)()) ::
-
- 関数ã«ã‚ˆã£ã¦å®Ÿç¾ã•れるRuby変数を定義ã™ã‚‹ï¼Žå¤‰æ•°ãŒå‚ç…§ã•れãŸ
- 時ã«ã¯getterãŒï¼Œå¤‰æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•ã‚ŒãŸæ™‚ã«ã¯setterãŒå‘¼ã°ã‚Œ
- る.
-
-void rb_define_hooked_variable(const char *name, VALUE *var, VALUE (*getter)(), void (*setter)()) ::
-
- 関数ã«ã‚ˆã£ã¦hookã®ã¤ã‘られãŸã‚°ãƒ­ãƒ¼ãƒãƒ«å¤‰æ•°ã‚’定義ã™ã‚‹ï¼Žå¤‰æ•°
- ãŒå‚ç…§ã•ã‚ŒãŸæ™‚ã«ã¯getterãŒï¼Œé–¢æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•ã‚ŒãŸæ™‚ã«ã¯
- setterãŒå‘¼ã°ã‚Œã‚‹ï¼Žgetterã‚„setterã«0を指定ã—ãŸæ™‚ã«ã¯hookã‚’
- 指定ã—ãªã„ã®ã¨åŒã˜äº‹ã«ãªã‚‹ï¼Ž
-
-void rb_global_variable(VALUE *var)
-
- GCã®ãŸã‚,Rubyプログラムã‹ã‚‰ã¯ã‚¢ã‚¯ã‚»ã‚¹ã•れãªã„ãŒ, Rubyオブ
- ジェクトをå«ã‚€å¤§åŸŸå¤‰æ•°ã‚’マークã™ã‚‹ï¼Ž
-
-== 定数
-
-void rb_define_const(VALUE klass, const char *name, VALUE val) ::
-
- 定数を定義ã™ã‚‹ï¼Ž
-
-void rb_define_global_const(const char *name, VALUE val) ::
-
- 大域定数を定義ã™ã‚‹ï¼Ž
-
- rb_define_const(rb_cObject, name, val)
-
- ã¨åŒã˜æ„味.
-
-== メソッド定義
-
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
-
- メソッドを定義ã™ã‚‹ï¼Žargcã¯selfを除ãå¼•æ•°ã®æ•°ï¼ŽargcãŒ-1ã®æ™‚,
- 関数ã«ã¯å¼•æ•°ã®æ•°(selfã‚’å«ã¾ãªã„)を第1引数, 引数ã®é…列を第2
- 引数ã¨ã™ã‚‹å½¢å¼ã§ä¸Žãˆã‚‰ã‚Œã‚‹(第3引数ã¯self).argcãŒ-2ã®æ™‚,
- 第1引数ãŒself, 第2引数ãŒargs(argsã¯å¼•æ•°ã‚’å«ã‚€Rubyã®é…列)ã¨
- ã„ã†å½¢å¼ã§ä¸Žãˆã‚‰ã‚Œã‚‹ï¼Ž
-
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
-
- privateメソッドを定義ã™ã‚‹ï¼Žå¼•æ•°ã¯rb_define_method()ã¨åŒã˜ï¼Ž
-
-rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
-
- 特異メソッドを定義ã™ã‚‹ï¼Žå¼•æ•°ã¯rb_define_method()ã¨åŒã˜ï¼Ž
-
-rb_scan_args(int argc, VALUE *argv, const char *fmt, ...) ::
-
- argc, argvå½¢å¼ã§ä¸Žãˆã‚‰ã‚ŒãŸæŒ‡å®šã•れãŸãƒ•ォーマットã«å¾“ã£ã¦å¼•
- 数を分解ã—,続ãVALUEã¸ã®å‚ç…§ã«ã‚»ãƒƒãƒˆã—ã¾ã™ï¼Žã“ã®ãƒ•ォーマッ
- トã¯ï¼ŒABNFã§è¨˜è¿°ã™ã‚‹ã¨ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
-
- scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
-
- param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec /
- pre-opt-post-arg-spec
- pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
- post-arg-spec := sym-for-variable-length-args
- [num-of-trailing-mandatory-args]
- pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args
- num-of-trailing-mandatory-args
- option-hash-arg-spec := sym-for-option-hash-arg
- block-arg-spec := sym-for-block-arg
-
- num-of-leading-mandatory-args := DIGIT ; 先頭ã«ç½®ã‹ã‚Œã‚‹çœç•¥ä¸èƒ½ãªå¼•æ•°ã®æ•°
- num-of-optional-args := DIGIT ; ç¶šã„ã¦ç½®ã‹ã‚Œã‚‹çœç•¥å¯èƒ½ãªå¼•æ•°ã®æ•°
- sym-for-variable-length-args := "*" ; ç¶šã„ã¦ç½®ã‹ã‚Œã‚‹å¯å¤‰é•·å¼•æ•°ã‚’
- ; Rubyã®é…列ã§å–å¾—ã™ã‚‹ãŸã‚ã®æŒ‡å®š
- num-of-trailing-mandatory-args := DIGIT ; 終端ã«ç½®ã‹ã‚Œã‚‹çœç•¥ä¸èƒ½ãªå¼•æ•°ã®æ•°
- sym-for-option-hash-arg := ":" ; オプションãƒãƒƒã‚·ãƒ¥ã‚’å–å¾—ã™ã‚‹
- ; ãŸã‚ã®æŒ‡å®š; çœç•¥ä¸èƒ½ãªå¼•æ•°ã®
- ; 数よりも多ãã®å¼•æ•°ãŒæŒ‡å®šã•れ,
- ; 最後ã®å¼•æ•°ãŒãƒãƒƒã‚·ãƒ¥ï¼ˆã¾ãŸã¯
- ; #to_hashã§å¤‰æ›å¯èƒ½ï¼‰ã®å ´åˆã«
- ; å–å¾—ã•れる.最後ã®å¼•æ•°ãŒnilã®
- ; å ´åˆï¼Œå¯å¤‰é•·å¼•数指定ãŒãªã,
- ; çœç•¥ä¸èƒ½å¼•æ•°ã®æ•°ã‚ˆã‚Šã‚‚多ãã®
- ; å¼•æ•°ãŒæŒ‡å®šã•れãŸå ´åˆã«å–å¾—ã•れる
- sym-for-block-arg := "&" ; イテレータブロックをå–å¾—ã™ã‚‹ãŸã‚ã®
- ; 指定
-
- フォーマットãŒ"12"ã®å ´åˆï¼Œå¼•æ•°ã¯æœ€ä½Ž1ã¤ã§ï¼Œ3ã¤(1+2)ã¾ã§è¨±ã•
- れるã¨ã„ã†æ„味ã«ãªã‚Šã¾ã™ï¼Žå¾“ã£ã¦ï¼Œãƒ•ォーマット文字列ã«ç¶šã„
- ã¦3ã¤ã®VALUEã¸ã®å‚ç…§ã‚’ç½®ãå¿…è¦ãŒã‚りã¾ã™ï¼Žãれらã«ã¯å–å¾—ã—ãŸ
- 変数ãŒã‚»ãƒƒãƒˆã•れã¾ã™ï¼Žå¤‰æ•°ã¸ã®å‚ç…§ã®ä»£ã‚りã«NULLを指定ã™ã‚‹
- ã“ã¨ã‚‚ã§ã,ãã®å ´åˆã¯å–å¾—ã—ãŸå¼•æ•°ã®å€¤ã¯æ¨ã¦ã‚‰ã‚Œã¾ã™ï¼ŽãªãŠï¼Œ
- çœç•¥å¯èƒ½å¼•æ•°ãŒçœç•¥ã•ã‚ŒãŸæ™‚ã®å¤‰æ•°ã®å€¤ã¯nil(C言語ã®ãƒ¬ãƒ™ãƒ«ã§ã¯
- Qnil)ã«ãªã‚Šã¾ã™ï¼Ž
-
- 返り値ã¯ä¸Žãˆã‚‰ã‚ŒãŸå¼•æ•°ã®æ•°ã§ã™ï¼Žã‚ªãƒ—ションãƒãƒƒã‚·ãƒ¥ãŠã‚ˆã³ã‚¤
- ãƒ†ãƒ¬ãƒ¼ã‚¿ãƒ–ãƒ­ãƒƒã‚¯ã¯æ•°ãˆã¾ã›ã‚“.
-
-int rb_get_kwargs(VALUE keyword_hash, const ID *table, int required, int optional, VALUE *values)
-
- ã‚­ãƒ¼ãƒ¯ãƒ¼ãƒ‰ã§æŒ‡å®šã•れãŸå€¤ã‚’tableã«ã—ãŸãŒã£ã¦å–り出ã—ã¾ã™ï¼Ž
- tableã®æœ€åˆã®required個ã®IDã¯å¿…須キーワードを表ã—,続ã
- optional (optionalãŒè² ã®å ´åˆã¯-optional-1) 個ã®IDã¯çœç•¥å¯èƒ½
- キーワードã§ã™ï¼Žå¿…須キーワードãŒkeyword_hash中ã«ãªã„å ´åˆï¼Œ
- "missing keyword"ArgumentErrorãŒç™ºç”Ÿã—ã¾ã™ï¼Žçœç•¥å¯èƒ½ã‚­ãƒ¼ãƒ¯ãƒ¼
- ドãŒãªã„å ´åˆã¯ï¼Œvalues中ã®å¯¾å¿œã™ã‚‹è¦ç´ ã¯å¤‰æ›´ã•れã¾ã›ã‚“.
- keyword_hashã«ä½¿ç”¨ã•れãªã„è¦ç´ ãŒã‚ã‚‹å ´åˆã¯ï¼ŒoptionalãŒè² ãªã‚‰
- æ–°ã—ã„Hashã¨ã—ã¦çœç•¥å¯èƒ½å¼•æ•°ã®æ¬¡ã«ä¿å­˜ã•れã¾ã™ãŒï¼Œãã†ã§ãªã‘
- れã°"unknown keyword"ArgumentErrorãŒç™ºç”Ÿã—ã¾ã™ï¼Ž
-
-VALUE rb_extract_keywords(VALUE *original_hash)
-
- original_hashã§å‚ç…§ã•れるHashオブジェクトã‹ã‚‰ï¼ŒSymbolã§ã‚ã‚‹
- キーã¨ãã®å€¤ã‚’æ–°ã—ã„Hashã«å–り出ã—ã¾ã™ï¼Žoriginal_hashã®æŒ‡ã™
- å…ˆã«ã¯ï¼Œå…ƒã®HashãŒSymbol以外ã®ã‚­ãƒ¼ã‚’å«ã‚“ã§ã„ãŸå ´åˆã¯ãれらãŒ
- コピーã•れãŸåˆ¥ã®æ–°ã—ã„Hash,ãã†ã§ãªã‘れã°0ãŒä¿å­˜ã•れã¾ã™ï¼Ž
-
-== Rubyメソッド呼ã³å‡ºã—
-
-VALUE rb_funcall(VALUE recv, ID mid, int narg, ...) ::
-
- メソッド呼ã³å‡ºã—.文字列ã‹ã‚‰midã‚’å¾—ã‚‹ãŸã‚ã«ã¯rb_intern()ã‚’
- 使ã†ï¼Ž
- private/protectedãªãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚‚呼ã³å‡ºã›ã‚‹ï¼Ž
-
-VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv) ::
-VALUE rb_funcallv(VALUE recv, ID mid, int argc, VALUE *argv) ::
-
- メソッド呼ã³å‡ºã—.引数をargc, argvå½¢å¼ã§æ¸¡ã™ï¼Ž
- private/protectedãªãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚‚呼ã³å‡ºã›ã‚‹ï¼Ž
-
-VALUE rb_funcallv_public(VALUE recv, ID mid, int argc, VALUE *argv) ::
-
- メソッド呼ã³å‡ºã—.
- publicãªãƒ¡ã‚½ãƒƒãƒ‰ã—ã‹å‘¼ã¹ãªã„.
-
-VALUE rb_eval_string(const char *str)
-
- 文字列をRubyスクリプトã¨ã—ã¦ã‚³ãƒ³ãƒ‘イル・実行ã™ã‚‹ï¼Ž
-
-ID rb_intern(const char *name) ::
-
- 文字列ã«å¯¾å¿œã™ã‚‹IDã‚’è¿”ã™ï¼Ž
-
-char *rb_id2name(ID id) ::
-
- IDã«å¯¾å¿œã™ã‚‹æ–‡å­—列を返ã™(デãƒãƒƒã‚°ç”¨).
-
-char *rb_class2name(VALUE klass) ::
-
- クラスã®åå‰ã‚’è¿”ã™(デãƒãƒƒã‚°ç”¨).クラスãŒåå‰ã‚’æŒãŸãªã„時ã«
- ã¯, 祖先をé¡ã£ã¦åå‰ã‚’æŒã¤ã‚¯ãƒ©ã‚¹ã®åå‰ã‚’è¿”ã™ï¼Ž
-
-int rb_respond_to(VALUE obj, ID id) ::
-
- objãŒidã§ç¤ºã•れるメソッドをæŒã¤ã‹ã©ã†ã‹ã‚’è¿”ã™ï¼Ž
-
-== インスタンス変数
-
-VALUE rb_iv_get(VALUE obj, const char *name) ::
-
- objã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã®å€¤ã‚’得る.`@'ã§å§‹ã¾ã‚‰ãªã„インスタン
- ス変数㯠Rubyプログラムã‹ã‚‰ã‚¢ã‚¯ã‚»ã‚¹ã§ããªã„「隠れãŸã€ã‚¤ãƒ³
- スタンス変数ã«ãªã‚‹ï¼Žå®šæ•°ã¯å¤§æ–‡å­—ã®åå‰ã‚’æŒã¤ã‚¯ãƒ©ã‚¹(ã¾ãŸã¯
- モジュール)ã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã¨ã—ã¦å®Ÿè£…ã•れã¦ã„る.
-
-VALUE rb_iv_set(VALUE obj, const char *name, VALUE val) ::
-
- objã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã‚’valã«ã‚»ãƒƒãƒˆã™ã‚‹ï¼Ž
-
-== 制御構造
-
-VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv, VALUE (*func) (ANYARGS), VALUE data2) ::
-
- funcをブロックã¨ã—ã¦è¨­å®šã—,objをレシーãƒï¼Œargcã¨argvを引数
- ã¨ã—ã¦midメソッドを呼ã³å‡ºã™ï¼Žfuncã¯ç¬¬ä¸€å¼•æ•°ã«yieldã•れãŸå€¤ï¼Œ
- 第二引数ã«data2ã‚’å—ã‘å–る.複数ã®å€¤ãŒyieldã•れãŸå ´åˆ(Cã§ã¯
- rb_yield_values()ã¨rb_yield_values2(), rb_yield_splat()),
- data2ã¯Arrayã¨ã—ã¦ãƒ‘ックã•れã¦ã„る.第三, 第四引数ã®argcã¨
- argvã«ã‚ˆã£ã¦yieldã•れãŸå€¤ã‚’å–り出ã™ã“ã¨ãŒã§ãる.
-
-[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-
- func2をブロックã¨ã—ã¦è¨­å®šã—, func1をイテレータã¨ã—ã¦å‘¼ã¶ï¼Ž
- func1ã«ã¯ arg1ãŒå¼•æ•°ã¨ã—ã¦æ¸¡ã•れ, func2ã«ã¯ç¬¬1引数ã«ã‚¤ãƒ†ãƒ¬ãƒ¼
- ã‚¿ã‹ã‚‰ä¸Žãˆã‚‰ã‚ŒãŸå€¤, 第2引数ã«arg2ãŒæ¸¡ã•れる.
-
- 1.9ã§rb_iterateを使ã†å ´åˆã¯, func1ã®ä¸­ã§Rubyレベルã®ãƒ¡ã‚½ãƒƒãƒ‰
- を呼ã³å‡ºã•ãªã‘れã°ãªã‚‰ãªã„.
- 1.9ã§obsoleteã¨ãªã£ãŸ. 代ã‚りã«rb_block_callãŒç”¨æ„ã•れãŸ.
-
-VALUE rb_yield(VALUE val) ::
-
- valを値ã¨ã—ã¦ã‚¤ãƒ†ãƒ¬ãƒ¼ã‚¿ãƒ–ロックを呼ã³å‡ºã™ï¼Ž
-
-VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-
- 関数func1ã‚’arg1を引数ã«å‘¼ã³å‡ºã™ï¼Žfunc1ã®å®Ÿè¡Œä¸­ã«ä¾‹å¤–ãŒç™ºç”Ÿ
- ã—ãŸæ™‚ã«ã¯ func2ã‚’arg2を引数ã¨ã—ã¦å‘¼ã¶ï¼Žæˆ»ã‚Šå€¤ã¯ä¾‹å¤–ãŒç™ºç”Ÿ
- ã—ãªã‹ã£ãŸæ™‚ã¯func1ã®æˆ»ã‚Šå€¤, 例外ãŒç™ºç”Ÿã—ãŸæ™‚ã«ã¯func2ã®æˆ»
- り値ã§ã‚る.
-
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-
- 関数func1ã‚’arg1を引数ã¨ã—ã¦å®Ÿè¡Œã—, 実行終了後(ãŸã¨ãˆä¾‹å¤–ãŒ
- 発生ã—ã¦ã‚‚) func2ã‚’arg2を引数ã¨ã—ã¦å®Ÿè¡Œã™ã‚‹ï¼Žæˆ»ã‚Šå€¤ã¯func1
- ã®æˆ»ã‚Šå€¤ã§ã‚ã‚‹(例外ãŒç™ºç”Ÿã—ãŸæ™‚ã¯æˆ»ã‚‰ãªã„).
-
-VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state) ::
-
- 関数funcã‚’argを引数ã¨ã—ã¦å®Ÿè¡Œã—, 例外ãŒç™ºç”Ÿã—ãªã‘れã°ãã®æˆ»
- り値を返ã™ï¼Žä¾‹å¤–ãŒç™ºç”Ÿã—ãŸå ´åˆã¯, *stateã«éž0をセットã—ã¦
- Qnilã‚’è¿”ã™ï¼Ž
- rb_jump_tag()を呼ã°ãšã«æ•æ‰ã—ãŸä¾‹å¤–を無視ã™ã‚‹å ´åˆã«ã¯ï¼Œ
- rb_set_errinfo(Qnil)ã§ã‚¨ãƒ©ãƒ¼æƒ…報をクリアã—ãªã‘れã°ãªã‚‰ãªã„.
-
-void rb_jump_tag(int state) ::
-
- rb_protect()ã‚„rb_eval_string_protect()ã§æ•æ‰ã•れãŸä¾‹å¤–ã‚’å†
- é€ã™ã‚‹ï¼Žstateã¯ãれらã®é–¢æ•°ã‹ã‚‰è¿”ã•れãŸå€¤ã§ãªã‘れã°ãªã‚‰ãªã„.
- ã“ã®é–¢æ•°ã¯ç›´æŽ¥ã®å‘¼ã³å‡ºã—å…ƒã«æˆ»ã‚‰ãªã„.
-
-void rb_iter_break() ::
-
- ç¾åœ¨ã®æœ€ã‚‚内å´ã®ãƒ–ロックを終了ã™ã‚‹ï¼Žã“ã®é–¢æ•°ã¯ç›´æŽ¥ã®å‘¼ã³å‡º
- ã—å…ƒã«æˆ»ã‚‰ãªã„.
-
-void rb_iter_break_value(VALUE value) ::
-
- ç¾åœ¨ã®æœ€ã‚‚内å´ã®ãƒ–ロックをvalueã§çµ‚了ã™ã‚‹ï¼Žãƒ–ロックã¯å¼•æ•°ã§
- 与ãˆã‚‰ã‚ŒãŸvalueã‚’è¿”ã™ï¼Žã“ã®é–¢æ•°ã¯ç›´æŽ¥ã®å‘¼ã³å‡ºã—å…ƒã«æˆ»ã‚‰ãªã„.
-
-== 例外・エラー
-
-void rb_warning(const char *fmt, ...) ::
-
- rb_verboseæ™‚ã«æ¨™æº–エラー出力ã«è­¦å‘Šæƒ…報を表示ã™ã‚‹ï¼Žå¼•æ•°ã¯
- printf()ã¨åŒã˜ï¼Ž
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...) ::
-
- RuntimeError例外を発生ã•ã›ã‚‹ï¼Žå¼•æ•°ã¯printf()ã¨åŒã˜ï¼Ž
-
-void rb_raise(VALUE exception, const char *fmt, ...) ::
-
- exceptionã§æŒ‡å®šã—ãŸä¾‹å¤–を発生ã•ã›ã‚‹ï¼Žfmt以下ã®å¼•æ•°ã¯
- printf()ã¨åŒã˜ï¼Ž
-
-void rb_fatal(const char *fmt, ...) ::
-
- 致命的例外を発生ã•ã›ã‚‹ï¼Žé€šå¸¸ã®ä¾‹å¤–処ç†ã¯è¡Œãªã‚れãš, インター
- プリタãŒçµ‚了ã™ã‚‹(ãŸã ã—ensureã§æŒ‡å®šã•れãŸã‚³ãƒ¼ãƒ‰ã¯çµ‚了å‰ã«
- 実行ã•れる).
-
-void rb_bug(const char *fmt, ...) ::
-
- インタープリタãªã©ãƒ—ログラムã®ãƒã‚°ã§ã—ã‹ç™ºç”Ÿã™ã‚‹ã¯ãšã®ãªã„
- 状æ³ã®æ™‚呼ã¶ï¼Žã‚¤ãƒ³ã‚¿ãƒ¼ãƒ—リタã¯ã‚³ã‚¢ãƒ€ãƒ³ãƒ—ã—ç›´ã¡ã«çµ‚了ã™ã‚‹ï¼Ž
- 例外処ç†ã¯ä¸€åˆ‡è¡Œãªã‚れãªã„.
-
-注æ„: "%"PRIsVALUEãŒObject#to_s('+'ãƒ•ãƒ©ã‚°ãŒæŒ‡å®šã•れã¦ã„ã‚‹ã¨
-ãã¯Object#inspect)を使ã£ãŸVALUEã®å‡ºåŠ›ã«åˆ©ç”¨ã§ãる.ã“れã¯
-"%i"ã¨è¡çªã™ã‚‹ãŸã‚,整数ã«ã¯"%d"を使用ã™ã‚‹ã“ã¨ï¼Ž
-
-== Rubyã®åˆæœŸåŒ–・実行
-
-Rubyをアプリケーションã«åŸ‹ã‚込む場åˆã«ã¯ä»¥ä¸‹ã®ã‚¤ãƒ³ã‚¿ãƒ•ェース
-を使ã†ï¼Žé€šå¸¸ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¯å¿…è¦ãªã„.
-
-void ruby_init() ::
-
- Rubyインタプリタã®åˆæœŸåŒ–を行ãªã†ï¼Ž
-
-void *ruby_options(int argc, char **argv) ::
-
- Rubyインタプリタã®ã‚³ãƒžãƒ³ãƒ‰ãƒ©ã‚¤ãƒ³å¼•æ•°ã®å‡¦ç†ã‚’行ãªã„,
- Rubyã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’コンパイルã™ã‚‹ï¼Ž
- コンパイルã•れãŸã‚½ãƒ¼ã‚¹ã¸ã®ãƒã‚¤ãƒ³ã‚¿ï¼Œã‚‚ã—ãã¯ç‰¹æ®Šå€¤ã‚’è¿”ã™.
-
-int ruby_run_node(void *n) ::
-
- コンパイルã•れãŸã‚³ãƒ¼ãƒ‰ã‚’実行ã™ã‚‹ï¼Ž
- å®Ÿè¡Œã«æˆåŠŸã—ãŸå ´åˆã¯EXIT_SUCCESSを,エラーãŒèµ·ã“ã£ãŸã¨ãã¯ãれ以外を返ã™ï¼Ž
-
-void ruby_script(char *name) ::
-
- Rubyã®ã‚¹ã‚¯ãƒªãƒ—トå($0)を設定ã™ã‚‹ï¼Ž
-
-== インタプリタã®ã‚¤ãƒ™ãƒ³ãƒˆã®ãƒ•ック
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events,
- VALUE data)
-
-指定ã•れãŸã‚¤ãƒ³ã‚¿ãƒ—リタã®ã‚¤ãƒ™ãƒ³ãƒˆã«å¯¾ã™ã‚‹ãƒ•ック関数を追加ã—ã¾ã™ï¼Ž
-eventsã¯ä»¥ä¸‹ã®å€¤ã®orã§ãªã‘れã°ãªã‚Šã¾ã›ã‚“:
-
- RUBY_EVENT_LINE
- RUBY_EVENT_CLASS
- RUBY_EVENT_END
- RUBY_EVENT_CALL
- RUBY_EVENT_RETURN
- RUBY_EVENT_C_CALL
- RUBY_EVENT_C_RETURN
- RUBY_EVENT_RAISE
- RUBY_EVENT_ALL
-
-rb_event_hook_func_tã®å®šç¾©ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
- VALUE self, ID id, VALUE klass)
-
-rb_add_event_hook() ã®ç¬¬3引数 data ã¯ï¼Œãƒ•ック関数ã®ç¬¬2引数ã¨
-ã—ã¦æ¸¡ã•れã¾ã™ï¼Žã“れã¯1.8ã§ã¯ç¾åœ¨ã®NODEã¸ã®ãƒã‚¤ãƒ³ã‚¿ã§ã—ãŸï¼Žä»¥
-下㮠RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ã‚‚å‚ç…§ã—ã¦ãã ã•ã„.
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-指定ã•れãŸãƒ•ック関数を削除ã—ã¾ã™ï¼Ž
-
-== äº’æ›æ€§ã®ãŸã‚ã®ãƒžã‚¯ãƒ­
-
-APIã®äº’æ›æ€§ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ãŸã‚ã«ä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ãŒãƒ‡ãƒ•ォルトã§å®šç¾©ã•れã¦ã„ã¾ã™ï¼Ž
-
-NORETURN_STYLE_NEW ::
-
- NORETURN マクロãŒé–¢æ•°åž‹ãƒžã‚¯ãƒ­ã¨ã—ã¦å®šç¾©ã•れã¦ã„ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
-
-HAVE_RB_DEFINE_ALLOC_FUNC ::
-
- rb_define_alloc_func() é–¢æ•°ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨ï¼Œã¤ã¾ã‚Š
- allocation framework ãŒä½¿ã‚れるã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
- have_func("rb_define_alloc_func", "ruby.h")
- ã®çµæžœã¨åŒã˜ï¼Ž
-
-HAVE_RB_REG_NEW_STR ::
-
- Stringオブジェクトã‹ã‚‰Regexpオブジェクトを作る
- rb_reg_new_str() é–¢æ•°ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
- have_func("rb_reg_new_str", "ruby.h").
- ã®çµæžœã¨åŒã˜ï¼Ž
-
-HAVE_RB_IO_T ::
-
- rb_io_t åž‹ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
-
-USE_SYMBOL_AS_METHOD_NAME ::
-
- メソッドåã‚’è¿”ã™ãƒ¡ã‚½ãƒƒãƒ‰ï¼ŒModule#methods, #singleton_methods
- ãªã©ãŒSymbolã‚’è¿”ã™ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
-
-HAVE_RUBY_*_H ::
-
- ruby.h ã§å®šç¾©ã•れã¦ã„る.対応ã™ã‚‹ãƒ˜ãƒƒãƒ€ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨
- ã‚’æ„味ã™ã‚‹ï¼ŽãŸã¨ãˆã°ï¼ŒHAVE_RUBY_ST_H ãŒå®šç¾©ã•れã¦ã„ã‚‹å ´åˆã¯
- å˜ãªã‚‹ st.h ã§ã¯ãªã ruby/st.h を使用ã™ã‚‹ï¼Ž
-
-RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ::
-
- rb_add_event_hook() ãŒãƒ•ãƒƒã‚¯é–¢æ•°ã«æ¸¡ã™ data を第3引数ã¨ã—ã¦
- å—ã‘å–ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
-
-= Appendix C. extconf.rbã§ä½¿ãˆã‚‹é–¢æ•°ãŸã¡
-
-extconf.rbã®ä¸­ã§ã¯åˆ©ç”¨å¯èƒ½ãªã‚³ãƒ³ãƒ‘イルæ¡ä»¶ãƒã‚§ãƒƒã‚¯ã®é–¢æ•°ã¯ä»¥
-下ã®é€šã‚Šã§ã‚る.
-
-have_macro(macro, headers) ::
-
- ヘッダファイルheaderをインクルードã—ã¦ãƒžã‚¯ãƒ­macroãŒå®šç¾©ã•
- れã¦ã„ã‚‹ã‹ã©ã†ã‹ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒžã‚¯ãƒ­ãŒå®šç¾©ã•れã¦ã„る時true
- ã‚’è¿”ã™ï¼Ž
-
-have_library(lib, func) ::
-
- 関数funcを定義ã—ã¦ã„るライブラリlibã®å­˜åœ¨ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Ž
- ãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œ-llibã‚’$libsã«è¿½åŠ ã—,trueã‚’è¿”ã™ï¼Ž
-
-find_library(lib, func, path...) ::
-
- 関数funcを定義ã—ã¦ã„るライブラリlibã®å­˜åœ¨ã‚’ -Lpath を追加
- ã—ãªãŒã‚‰ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œ-llibã‚’$libsã«
- 追加ã—,trueã‚’è¿”ã™ï¼Ž
-
-have_func(func, header) ::
-
- ヘッダファイルheaderをインクルードã—ã¦é–¢æ•°funcã®å­˜åœ¨ã‚’ãƒã‚§
- ックã™ã‚‹ï¼ŽfuncãŒæ¨™æº–ã§ã¯ãƒªãƒ³ã‚¯ã•れãªã„ライブラリ内ã®ã‚‚ã®ã§
- ã‚る時ã«ã¯å…ˆã«have_libraryã§ãã®ãƒ©ã‚¤ãƒ–ラリをãƒã‚§ãƒƒã‚¯ã—ã¦ãŠ
- ã事.ãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
- `HAVE_{FUNC}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
-
-have_var(var, header) ::
-
- ヘッダファイルheaderをインクルードã—ã¦å¤‰æ•°varã®å­˜åœ¨ã‚’ãƒã‚§ãƒƒ
- クã™ã‚‹ï¼ŽvarãŒæ¨™æº–ã§ã¯ãƒªãƒ³ã‚¯ã•れãªã„ライブラリ内ã®ã‚‚ã®ã§ã‚
- る時ã«ã¯å…ˆã«have_libraryã§ãã®ãƒ©ã‚¤ãƒ–ラリをãƒã‚§ãƒƒã‚¯ã—ã¦ãŠã
- 事.ãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
- `HAVE_{VAR}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
-
-have_header(header) ::
-
- ヘッダファイルã®å­˜åœ¨ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œ
- プリプロセッサマクロ `HAVE_{HEADER_H}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
- (スラッシュやドットã¯ã‚¢ãƒ³ãƒ€ãƒ¼ã‚¹ã‚³ã‚¢ã«ç½®æ›ã•れる)
-
-find_header(header, path...) ::
-
- ヘッダファイルheaderã®å­˜åœ¨ã‚’ -Ipath を追加ã—ãªãŒã‚‰ãƒã‚§ãƒƒã‚¯
- ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
- `HAVE_{HEADER_H}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
- (スラッシュやドットã¯ã‚¢ãƒ³ãƒ€ãƒ¼ã‚¹ã‚³ã‚¢ã«ç½®æ›ã•れる)
-
-have_struct_member(type, member[, header[, opt]]) ::
-
- ヘッダファイルheaderをインクルードã—ã¦åž‹typeãŒå®šç¾©ã•れ,
- ãªãŠã‹ã¤ãƒ¡ãƒ³ãƒmemberãŒå­˜åœ¨ã™ã‚‹ã‹ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«
- æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ `HAVE_{TYPE}_{MEMBER}` ã‚’
- 定義ã—,trueã‚’è¿”ã™ï¼Ž
-
-have_type(type, header, opt) ::
-
- ヘッダファイルheaderをインクルードã—ã¦åž‹typeãŒå­˜åœ¨ã™ã‚‹ã‹ã‚’
- ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
- `HAVE_TYPE_{TYPE}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
-
-check_sizeof(type, header) ::
-
- ヘッダファイルheaderをインクルードã—ã¦åž‹typeã®charå˜ä½ã‚µã‚¤
- ズを調ã¹ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
- `SIZEOF_{TYPE}` を定義ã—,ãã®ã‚µã‚¤ã‚ºã‚’è¿”ã™ï¼Žå®šç¾©ã•れã¦ã„ãª
- ã„ã¨ãã¯nilã‚’è¿”ã™ï¼Ž
-
-create_makefile(target[, target_prefix]) ::
-
- 拡張ライブラリ用ã®Makefileを生æˆã™ã‚‹ï¼Žã“ã®é–¢æ•°ã‚’呼ã°ãªã‘れ
- ã°ãã®ãƒ©ã‚¤ãƒ–ラリã¯ã‚³ãƒ³ãƒ‘イルã•れãªã„.targetã¯ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«å
- を表ã™ï¼Ž
-
-find_executable(command, path) ::
-
- コマンドcommandã‚’File::PATH_SEPARATORã§åŒºåˆ‡ã‚‰ã‚ŒãŸãƒ‘スåã®
- リストpathã‹ã‚‰æŽ¢ã™ï¼ŽpathãŒnilã¾ãŸã¯çœç•¥ã•れãŸå ´åˆã¯ï¼Œç’°å¢ƒ
- 変数PATHã®å€¤ã‚’使用ã™ã‚‹ï¼Žå®Ÿè¡Œå¯èƒ½ãªã‚³ãƒžãƒ³ãƒ‰ãŒè¦‹ã¤ã‹ã£ãŸå ´åˆ
- ã¯ãƒ‘スをå«ã‚€ãƒ•ァイルå,見ã¤ã‹ã‚‰ãªã‹ã£ãŸå ´åˆã¯nilã‚’è¿”ã™ï¼Ž
-
-with_config(withval[, default=nil]) ::
-
- コマンドライン上ã®--with-<withval>ã§æŒ‡å®šã•れãŸã‚ªãƒ—ション値
- を得る.
-
-enable_config(config, *defaults) ::
-disable_config(config, *defaults) ::
-
- コマンドライン上ã®--enable-<config>ã¾ãŸã¯
- --disable-<config>ã§æŒ‡å®šã•れãŸçœŸå½å€¤ã‚’得る.
- --enable-<config>ãŒæŒ‡å®šã•れã¦ã„ãŸå ´åˆã¯true,
- --disable-<config>ãŒæŒ‡å®šã•れã¦ã„ãŸå ´åˆã¯falseã‚’è¿”ã™ï¼Ž
- ã©ã¡ã‚‰ã‚‚指定ã•れã¦ã„ãªã„å ´åˆã¯ï¼Œãƒ–ロックã¤ãã§å‘¼ã³å‡ºã•れã¦
- ã„ã‚‹å ´åˆã¯*defaultsã‚’yieldã—ãŸçµæžœï¼Œãƒ–ロックãªã—ãªã‚‰
- *defaultsã‚’è¿”ã™ï¼Ž
-
-dir_config(target[, default_dir]) ::
-dir_config(target[, default_include, default_lib]) ::
-
- コマンドライン上ã®--with-<target>-dir, --with-<target>-include,
- --with-<target>-libã®ã„ãšã‚Œã‹ã§æŒ‡å®šã•れるディレクトリを
- $CFLAGS ã‚„ $LDFLAGS ã«è¿½åŠ ã™ã‚‹ï¼Ž--with-<target>-dir=/pathã¯
- --with-<target>-include=/path/include --with-<target>-lib=/path/lib
- ã¨ç­‰ä¾¡ã§ã‚る.追加ã•れ㟠include ディレクトリ㨠lib ディレ
- クトリã®é…列を返ã™ï¼Ž ([include_dir, lib_dir])
-
-pkg_config(pkg, option=nil) ::
-
- pkg-configコマンドã‹ã‚‰ãƒ‘ッケージpkgã®æƒ…報を [cflags, ldflags, libs]
- ã®é…列ã¨ã—ã¦å¾—る.$CFLAGS, $LDFLAGS, $libs ã«ã¯ãれãžã‚Œã®å€¤ãŒ
- 追加ã•れる.
-
- pkg-configã®å®Ÿéš›ã®ã‚³ãƒžãƒ³ãƒ‰ã¯ï¼Œä»¥ä¸‹ã®é †ã§è©¦ã•れる.
-
- 1. コマンドラインã§--with-{pkg}-config={command}オプションãŒ
- 指定ã•れãŸå ´åˆ: {command} {option}
- 2. {pkg}-config {option}
- 3. pkg-config {option} {pkg}
-
- optionãŒæŒ‡å®šã•れãŸå ´åˆã¯ï¼Œä¸Šè¨˜ã®é…列ã®ä»£ã‚りã«ãã®ã‚ªãƒ—ションを
- 指定ã—ã¦å¾—られãŸå‡ºåŠ›ã‚’stripã—ãŸã‚‚ã®ã‚’è¿”ã™ï¼Ž
-
-= Appendix D. 世代別GC
-
-Ruby 2.1ã‹ã‚‰ä¸–代別GCã«å¯¾å¿œã—ã¾ã—ãŸï¼Žæˆ‘々ã¯ã“れをRGenGCã¨å‘¼ã‚“ã§ã„ã¾ã™ï¼Ž
-RGenGCã¯ï¼ŒéŽåŽ»ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ï¼ˆã»ã¼ï¼‰äº’æ›æ€§ã‚’ä¿ã¤ã‚ˆã†ã«é–‹ç™ºã•れã¦ã„ã‚‹
-ãŸã‚,拡張ライブラリå´ã®å¯¾å¿œã¯ã»ã¼ä¸è¦ã§ã™ï¼Ž
-
-ãŸã ã—,対応をã™ã‚‹ã“ã¨ã§æ€§èƒ½ã‚’å‘上ã™ã‚‹ã“ã¨ãŒã§ãã‚‹å¯èƒ½æ€§ãŒã‚りã¾ã™ï¼Žã‚‚ã—
-拡張ライブラリã«é«˜ã„性能ãŒå¿…è¦ã§ã‚ã‚‹å ´åˆã¯å¯¾å¿œã‚’検討ã—ã¦ä¸‹ã•ã„.
-
-ã¨ãã«RARRAY_PTR()/RHASH_TBL()ã®ã‚ˆã†ãªãƒžã‚¯ãƒ­ã‚’用ã„ã¦ãƒã‚¤ãƒ³ã‚¿ã«ç›´æŽ¥ã‚¢ã‚¯ã‚»
-スã™ã‚‹ã‚ˆã†ãªã‚³ãƒ¼ãƒ‰ã¯æ›¸ã‹ãªã„よã†ã«ã—ã¦ä¸‹ã•ã„.代ã‚りã«ï¼Œrb_ary_aref(),
-rb_ary_store() ãªã©ã®ï¼Œé©åˆ‡ãª API 関数を利用ã™ã‚‹ã‚ˆã†ã«ã—ã¦ä¸‹ã•ã„.
-
-ãã®ã»ã‹ï¼Œå¯¾å¿œã«ã¤ã„ã¦ã®è©³ç´°ã¯ README.EXT ã®ã€ŒAppendix D. Generational
-GCã€ã‚’å‚ç…§ã—ã¦ä¸‹ã•ã„.
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
+doc/extension.ja.rdocã«ç§»å‹•ã—ã¾ã—ãŸ
diff --git a/README.ja.md b/README.ja.md
index 1e9bae7e0c..6663b94680 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,3 +1,11 @@
+[![Build Status](https://travis-ci.org/ruby/ruby.svg?branch=master)](https://travis-ci.org/ruby/ruby)
+[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Actions Status](https://github.com/ruby/ruby/workflows/macOS/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"macOS")
+[![Actions Status](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+
# Rubyã¨ã¯
Rubyã¯ã‚·ãƒ³ãƒ—ルã‹ã¤å¼·åŠ›ãªã‚ªãƒ–ジェクト指å‘スクリプト言語ã§ã™ï¼Ž Rubyã¯ç´”粋ãªã‚ªãƒ–ジェクト指å‘言語ã¨ã—ã¦è¨­è¨ˆã•れã¦ã„ã‚‹ã®ã§ï¼Œ
@@ -10,83 +18,86 @@ Rubyã¯ãƒ†ã‚­ã‚¹ãƒˆå‡¦ç†é–¢ä¿‚ã®èƒ½åŠ›ãªã©ã«å„ªã‚Œï¼ŒPerlã¨åŒã˜ãらã„
* ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•
* 普通ã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(クラス,メソッドコールãªã©)
-* 特殊ãªã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(Mixin, 特異メソッドãªã©)
+* 特殊ãªã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(Mixin,特異メソッドãªã©)
* 演算å­ã‚ªãƒ¼ãƒãƒ¼ãƒ­ãƒ¼ãƒ‰
* ä¾‹å¤–å‡¦ç†æ©Ÿèƒ½
* イテレータã¨ã‚¯ãƒ­ãƒ¼ã‚¸ãƒ£
* ガーベージコレクタ
* ダイナミックローディング (アーキテクãƒãƒ£ã«ã‚ˆã‚‹)
-* ç§»æ¤æ€§ãŒé«˜ã„.多ãã®Unix-like/POSIX互æ›ãƒ—ラットフォーム上ã§å‹•ãã ã‘ã§ãªã,Windows, Mac OS
- X,BeOSãªã©ã®ä¸Šã§ã‚‚å‹•ã cf.
- http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+* ç§»æ¤æ€§ãŒé«˜ã„.多ãã®Unix-like/POSIX互æ›ãƒ—ラットフォーム上ã§å‹•ãã ã‘ã§ãªã,Windows, macOS,
+ Haikuãªã©ã®ä¸Šã§ã‚‚å‹•ã cf.
+ https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
## 入手法
-### FTPã§
+サードパーティーツールを使ã£ãŸæ–¹æ³•ã‚’å«ã‚€Rubyã®ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«æ–¹æ³•ã®ä¸€è¦§ã¯
+
+https://www.ruby-lang.org/ja/downloads/
+
+ã‚’å‚ç…§ã—ã¦ãã ã•ã„.
+
+### Git
-以下ã®å ´æ‰€ã«ãŠã„ã¦ã‚りã¾ã™ï¼Ž
+ミラーをGitHubã«å…¬é–‹ã—ã¦ã„ã¾ã™ï¼Ž 以下ã®ã‚³ãƒžãƒ³ãƒ‰ã§ãƒªãƒã‚¸ãƒˆãƒªã‚’å–å¾—ã§ãã¾ã™ï¼Ž
-ftp://ftp.ruby-lang.org/pub/ruby/
+ $ git clone https://github.com/ruby/ruby.git
-### Subversionã§
+ä»–ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
-開発先端ã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§å–å¾—ã§ãã¾ã™ï¼Ž
+ $ git ls-remote https://github.com/ruby/ruby.git
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+Rubyリãƒã‚¸ãƒˆãƒªã®æœ¬æ¥ã®master㯠https://git.ruby-lang.org/ruby.git ã«ã‚りã¾ã™ï¼Ž
+コミッタã¯ã“ã¡ã‚‰ã‚’使ã„ã¾ã™ï¼Ž
-ä»–ã«é–‹ç™ºä¸­ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+### Subversion
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+å¤ã„Rubyã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§ã‚‚å–å¾—ã§ãã¾ã™ï¼Ž
-### Gitã§
+ $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
-Subversionã®ãƒŸãƒ©ãƒ¼ã‚’GitHubã«å…¬é–‹ã—ã¦ã„ã¾ã™ï¼Ž 以下ã®ã‚³ãƒžãƒ³ãƒ‰ã§ãƒªãƒã‚¸ãƒˆãƒªã‚’å–å¾—ã§ãã¾ã™ï¼Ž
+ä»–ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+
+ $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
- $ git clone git://github.com/ruby/ruby.git
## ホームページ
Rubyã®ãƒ›ãƒ¼ãƒ ãƒšãƒ¼ã‚¸ã®URLã¯
-http://www.ruby-lang.org/
+https://www.ruby-lang.org/
ã§ã™ï¼Ž
## メーリングリスト
-Rubyã®ãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆãŒã‚りã¾ã™ã€‚å‚åŠ å¸Œæœ›ã®æ–¹ã¯
-
-mailto:ruby-list-request@ruby-lang.org
-
-ã¾ã§æœ¬æ–‡ã«
+Rubyã®ãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆãŒã‚りã¾ã™ï¼Žå‚åŠ å¸Œæœ›ã®æ–¹ã¯ [ruby-list-request@ruby-lang.org] ã¾ã§æœ¬æ–‡ã«
subscribe
-ã¨æ›¸ã„ã¦é€ã£ã¦ä¸‹ã•ã„。
-
-Ruby開発者å‘ã‘メーリングリストもã‚りã¾ã™ã€‚ã“ã¡ã‚‰ã§ã¯rubyã®ãƒã‚°ã€å°†æ¥ã®ä»•様拡張ãªã©å®Ÿè£…上ã®å•題ã«ã¤ã„ã¦è­°è«–ã•れã¦ã„ã¾ã™ã€‚ å‚åŠ å¸Œæœ›ã®æ–¹ã¯
+ã¨æ›¸ã„ã¦é€ã£ã¦ä¸‹ã•ã„.
-mailto:ruby-dev-request@ruby-lang.org
-
-ã¾ã§ruby-listã¨åŒæ§˜ã®æ–¹æ³•ã§ãƒ¡ãƒ¼ãƒ«ã—ã¦ãã ã•ã„。
+Ruby開発者å‘ã‘メーリングリストもã‚りã¾ã™ï¼Žã“ã¡ã‚‰ã§ã¯rubyã®ãƒã‚°ï¼Œå°†æ¥ã®ä»•様拡張ãªã©å®Ÿè£…上ã®å•題ã«ã¤ã„ã¦è­°è«–ã•れã¦ã„ã¾ã™ï¼Ž
+å‚åŠ å¸Œæœ›ã®æ–¹ã¯ [ruby-dev-request@ruby-lang.org] ã¾ã§ruby-listã¨åŒæ§˜ã®æ–¹æ³•ã§ãƒ¡ãƒ¼ãƒ«ã—ã¦ãã ã•ã„.
Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆã¨æ•°å­¦é–¢ä¿‚ã®è©±é¡Œã«ã¤ã„ã¦è©±ã—åˆã†ruby-mathメーリングリストã¨
-英語ã§rubyã«ã¤ã„ã¦è©±ã—åˆã†ruby-talkメーリングリストもã‚りã¾ã™ã€‚å‚加方法ã¯ã©ã‚Œã‚‚åŒã˜ã§ã™ã€‚
+英語ã§rubyã«ã¤ã„ã¦è©±ã—åˆã†ruby-talkメーリングリストもã‚りã¾ã™ï¼Žå‚加方法ã¯ã©ã‚Œã‚‚åŒã˜ã§ã™ï¼Ž
+
+[ruby-list-request@ruby-lang.org]: mailto:ruby-list-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+[ruby-dev-request@ruby-lang.org]: mailto:ruby-dev-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
## コンパイル・インストール
ä»¥ä¸‹ã®æ‰‹é †ã§è¡Œã£ã¦ãã ã•ã„.
-1. ã‚‚ã— `configure` ファイルãŒè¦‹ã¤ã‹ã‚‰ãªã„ã€ã‚‚ã—ã㯠`configure.in` よりå¤ã„よã†ãªã‚‰ã€ `autoconf` を実行ã—ã¦
- æ–°ã—ã `configure` を生æˆã™ã‚‹
+1. (Gitリãƒã‚¸ãƒˆãƒªã‹ã‚‰å–å¾—ã—ãŸã‚½ãƒ¼ã‚¹ã‚’ビルドã™ã‚‹å ´åˆ) `./autogen.sh` を実行ã—ã¦æ–°ã—ã `configure` を生æˆã™ã‚‹
2. `configure` を実行ã—㦠`Makefile` ãªã©ã‚’生æˆã™ã‚‹
環境ã«ã‚ˆã£ã¦ã¯ãƒ‡ãƒ•ォルトã®Cコンパイラ用オプションãŒä»˜ãã¾ã™ï¼Ž `configure` オプション㧠`optflags=..`
`warnflags=..` ç­‰ã§ä¸Šæ›¸ãã§ãã¾ã™ï¼Ž
-3. (å¿…è¦ãªã‚‰ã°)`defines.h` を編集ã™ã‚‹
+3. (å¿…è¦ãªã‚‰ã°)`include/ruby/defines.h` を編集ã™ã‚‹
多分,必è¦ç„¡ã„ã¨æ€ã„ã¾ã™ï¼Ž
@@ -95,7 +106,8 @@ Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extメーリングリスãƒ
`ext/Setup` ã«è¨˜è¿°ã—ãŸãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã¯é™çš„ã«ãƒªãƒ³ã‚¯ã•れã¾ã™ï¼Ž
ダイナミックローディングをサãƒãƒ¼ãƒˆã—ã¦ã„ãªã„アーキテクãƒãƒ£ã§ã¯ `Setup` ã®1行目ã®ã€Œ`option nodynamic`ã€ã¨ã„ã†è¡Œã®ã‚³
- メントを外ã™å¿…è¦ãŒã‚りã¾ã™ï¼Žã¾ãŸï¼Œã“ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ã§æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’利用ã™ã‚‹ãŸã‚ã«ã¯ï¼Œã‚らã‹ã˜ã‚é™çš„ã«ãƒªãƒ³ã‚¯ã‚’ã—ã¦ãŠãå¿…è¦ãŒã‚りã¾ã™ï¼Ž
+ メントを外ã™å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+ ã¾ãŸï¼Œã“ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ã§æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’利用ã™ã‚‹ãŸã‚ã«ã¯ï¼Œã‚らã‹ã˜ã‚é™çš„ã«ãƒªãƒ³ã‚¯ã‚’ã—ã¦ãŠãå¿…è¦ãŒã‚りã¾ã™ï¼Ž
5. `make` を実行ã—ã¦ã‚³ãƒ³ãƒ‘イルã™ã‚‹
@@ -109,20 +121,17 @@ Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extメーリングリスãƒ
* `${DESTDIR}${prefix}/bin`
* `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFOR
- M}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib`
* `${DESTDIR}${prefix}/lib/ruby`
* `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
* `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib/ruby/site_ruby`
* `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${P
- LATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
* `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/$
- {PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
* `${DESTDIR}${prefix}/share/man/man1`
* `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
@@ -147,17 +156,25 @@ UNIXã§ã‚れ㰠`configure` ãŒã»ã¨ã‚“ã©ã®å·®ç•°ã‚’å¸åŽã—ã¦ãれるã¯
ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ãŒ`setjmp()`ã¾ãŸã¯`getcontext()`ã«ã‚ˆã£ã¦å…¨ã¦ã®ãƒ¬ã‚¸ã‚¹ã‚¿ã‚’ `jmp_buf` ã‚„ `ucontext_t`
ã«æ ¼ç´ã™ã‚‹ã“ã¨ã¨ï¼Œ `jmp_buf` ã‚„ `ucontext_t` ã¨ã‚¹ã‚¿ãƒƒã‚¯ãŒ32bitアラインメントã•れã¦ã„ã‚‹ã“ã¨ã‚’仮定
ã—ã¦ã„ã¾ã™ï¼Žç‰¹ã«å‰è€…ãŒæˆç«‹ã—ãªã„å ´åˆã®å¯¾å¿œã¯éžå¸¸ã«å›°é›£ã§ã—ょã†ï¼Ž 後者ã®è§£æ±ºã¯æ¯”較的簡å˜ã§ï¼Œ `gc.c` ã§ã‚¹ã‚¿ãƒƒã‚¯ã‚’マークã—ã¦ã„ã‚‹
-部分ã«ã‚¢ãƒ©ã‚¤ãƒ³ãƒ¡ãƒ³ãƒˆã®ãƒã‚¤ãƒˆæ•°ã ã‘ãšã‚‰ã—ã¦ãƒžãƒ¼ã‚¯ã™ã‚‹ã‚³ãƒ¼ãƒ‰ã‚’追加ã™ã‚‹ã ã‘ã§æ¸ˆã¿ã¾ã™ï¼Ž`defined(_\*mc68000*\_)`ã§æ‹¬ã‚‰ã‚Œã¦ã„
+部分ã«ã‚¢ãƒ©ã‚¤ãƒ³ãƒ¡ãƒ³ãƒˆã®ãƒã‚¤ãƒˆæ•°ã ã‘ãšã‚‰ã—ã¦ãƒžãƒ¼ã‚¯ã™ã‚‹ã‚³ãƒ¼ãƒ‰ã‚’追加ã™ã‚‹ã ã‘ã§æ¸ˆã¿ã¾ã™ï¼Ž`defined(__mc68000__)`ã§æ‹¬ã‚‰ã‚Œã¦ã„
る部分をå‚考ã«ã—ã¦ãã ã•ã„.
レジスタウィンドウをæŒã¤CPUã§ã¯ï¼Œãƒ¬ã‚¸ã‚¹ã‚¿ã‚¦ã‚£ãƒ³ãƒ‰ã‚¦ã‚’スタックã«ãƒ•ラッシュã™ã‚‹ã‚¢ã‚»ãƒ³ãƒ–ラコードを追加ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
## é…布æ¡ä»¶
-`COPYING.ja` ファイルをå‚ç…§ã—ã¦ãã ã•ã„。
+[COPYING.ja](COPYING.ja) ファイルをå‚ç…§ã—ã¦ãã ã•ã„.
+
+## フィードãƒãƒƒã‚¯
+
+Rubyã«é–¢ã™ã‚‹è³ªå•㯠Ruby-Talk(英語)や Ruby-List(日本語) (https://www.ruby-lang.org/ja/community/mailing-lists) や,
+stackoverflow (https://ja.stackoverflow.com/) ãªã©ã®Webã‚µã‚¤ãƒˆã«æŠ•ç¨¿ã—ã¦ãã ã•ã„.
+
+ãƒã‚°å ±å‘Šã¯ https://bugs.ruby-lang.org ã§å—ã‘付ã‘ã¦ã„ã¾ã™ï¼Ž
+
## 著者
-コメント,ãƒã‚°ãƒ¬ãƒãƒ¼ãƒˆãã®ä»–㯠mailto:matz@ruby-lang.org ã¾ã§ï¼Ž
----
-created at: Thu Aug 3 11:57:36 JST 1995
+Rubyã®ã‚ªãƒªã‚¸ãƒŠãƒ«ç‰ˆã¯ï¼Œ1995å¹´ã«ã¾ã¤ã‚‚ã¨ã‚†ãã²ã‚æ°ã«ã‚ˆã£ã¦è¨­è¨ˆãƒ»é–‹ç™ºã•れã¾ã—ãŸï¼Ž
+
+<mailto:matz@ruby-lang.org>
diff --git a/README.md b/README.md
index c6498a8cca..bd7c7813a7 100644
--- a/README.md
+++ b/README.md
@@ -1,87 +1,96 @@
+[![Build Status](https://travis-ci.org/ruby/ruby.svg?branch=master)](https://travis-ci.org/ruby/ruby)
+[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Actions Status](https://github.com/ruby/ruby/workflows/macOS/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"macOS")
+[![Actions Status](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+
# What's Ruby
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming. It has many features to process text files and to do system
-management tasks (as in Perl). It is simple, straight-forward, and
-extensible.
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
## Features of Ruby
* Simple Syntax
-* **Normal** Object-Oriented features(ex. class, method calls)
-* **Advanced** Object-Oriented features(ex. Mix-in, Singleton-method)
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
* Operator Overloading
* Exception Handling
* Iterators and Closures
* Garbage Collection
-* Dynamic Loading of Object files(on some architecture)
+* Dynamic Loading of Object Files (on some architectures)
* Highly Portable (works on many Unix-like/POSIX compatible platforms as
- well as Windows, Mac OS X, BeOS etc.) cf.
- http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+ well as Windows, macOS, etc.) cf.
+ https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#label-Platform+Maintainers
## How to get Ruby
-For a complete list of ways to install Ruby, including using third party tools
+For a complete list of ways to install Ruby, including using third-party tools
like rvm, see:
-http://www.ruby-lang.org/en/downloads/
+https://www.ruby-lang.org/en/downloads/
+
+### Git
-The Ruby distribution files can be found in the following FTP site:
+The mirror of the Ruby source tree can be checked out with the following command:
-ftp://ftp.ruby-lang.org/pub/ruby/
+ $ git clone https://github.com/ruby/ruby.git
-The trunk of the Ruby source tree can be checked out with the following
-command:
+There are some other branches under development. Try the following command
+to see the list of branches:
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+ $ git ls-remote https://github.com/ruby/ruby.git
-Or if you are using git then use the following command:
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
- $ git clone git://github.com/ruby/ruby.git
+### Subversion
-There are some other branches under development. Try the following command
-and see the list of branches:
+Stable branches for older Ruby versions can be checked out with also the
+following command:
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+ $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
-Or if you are using git then use the following command:
+Try the following command to see the list of branches:
- $ git ls-remote git://github.com/ruby/ruby.git
+ $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
-## Ruby home-page
-The URL of the Ruby home-page is:
+## Ruby home page
-http://www.ruby-lang.org/
+https://www.ruby-lang.org/
## Mailing list
-There is a mailing list to talk about Ruby. To subscribe this list, please
-send the following phrase
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
subscribe
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
+in the mail body (not subject) to the address [ruby-talk-request@ruby-lang.org].
-## How to compile and install
+[ruby-talk-request@ruby-lang.org]: mailto:ruby-talk-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
-This is what you need to do to compile and install Ruby:
+## How to compile and install
-1. If you want to use Microsoft Visual C++ to compile ruby, read
- win32/README.win32 instead of this document.
+1. If you want to use Microsoft Visual C++ to compile Ruby, read
+ [win32/README.win32](win32/README.win32) instead of this document.
-2. If `./configure` does not exist or is older than configure.in, run
- autoconf to (re)generate configure.
+2. Run `./autogen.sh` to generate configure, when you build the source checked
+ out from the Git repository.
-3. Run `./configure`, which will generate config.h and Makefile.
+3. Run `./configure`, which will generate `config.h` and `Makefile`.
Some C compiler flags may be added by default depending on your
- environment. Specify `optflags=..` and `warnflags=..` as necessary to
+ environment. Specify `optflags=..` and `warnflags=..` as necessary to
override them.
-4. Edit `defines.h` if you need. Usually this step will not be needed.
+4. Edit `include/ruby/defines.h` if you need. Usually this step will not be needed.
5. Remove comment mark(`#`) before the module names from `ext/Setup` (or add
module names if not present), if you want to link modules statically.
@@ -94,31 +103,31 @@ This is what you need to do to compile and install Ruby:
6. Run `make`.
+ * On Mac, set RUBY\_CODESIGN environment variable with a signing identity.
+ It uses the identity to sign `ruby` binary. See also codesign(1).
+
7. Optionally, run '`make check`' to check whether the compiled Ruby
interpreter works well. If you see the message "`check succeeded`", your
- ruby works as it should (hopefully).
+ Ruby works as it should (hopefully).
-8. Run '`make install`'
+8. Run '`make install`'.
- This command will create following directories and install files onto
+ This command will create the following directories and install files into
them.
* `${DESTDIR}${prefix}/bin`
* `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFOR
- M}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib`
* `${DESTDIR}${prefix}/lib/ruby`
* `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
* `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib/ruby/site_ruby`
* `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${P
- LATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
* `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/$
- {PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
* `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
* `${DESTDIR}${prefix}/share/man/man1`
* `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
@@ -130,32 +139,35 @@ This is what you need to do to compile and install Ruby:
**NOTE**: teeny of the API version may be different from one of Ruby's
program version
- You may have to be a super user to install ruby.
+ You may have to be a super user to install Ruby.
-
-If you fail to compile ruby, please send the detailed error report with the
+If you fail to compile Ruby, please send the detailed error report with the
error log and machine/OS type, to help others.
Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make
-distclean-ext`' to remove old configuration after installing them in such
-case.
+external libraries and/or headers, then you will need to run '`make distclean-ext`'
+to remove old configuration after installing them in such case.
## Copying
-See the file `COPYING`.
+See the file [COPYING](COPYING).
## Feedback
Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
+(https://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(https://stackoverflow.com).
+
+Bugs should be reported at https://bugs.ruby-lang.org. Read [HowToReport] for more information.
+
+[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+
+## Contributing
-Bug reports should be filed at http://bugs.ruby-lang.org
+See the file [CONTRIBUTING.md](CONTRIBUTING.md)
## The Author
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
-<mailto:matz@ruby-lang.org>
+<matz@ruby-lang.org>
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000000..e69de29bb2
--- /dev/null
+++ b/aclocal.m4
diff --git a/addr2line.c b/addr2line.c
index c8faf48d62..0029cffbca 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,14 +8,26 @@
**********************************************************************/
-#include "ruby/config.h"
+#if defined(__clang__)
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
#include "ruby/missing.h"
#include "addr2line.h"
#include <stdio.h>
#include <errno.h>
-#ifdef USE_ELF
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
#include <fcntl.h>
#include <limits.h>
@@ -28,19 +40,11 @@
#include <sys/stat.h>
#include <unistd.h>
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
/* Make alloca work the best possible way. */
#ifdef __GNUC__
-# ifndef atarist
-# ifndef alloca
-# define alloca __builtin_alloca
-# endif
-# endif /* atarist */
+# ifndef alloca
+# define alloca __builtin_alloca
+# endif
#else
# ifdef HAVE_ALLOCA_H
# include <alloca.h>
@@ -59,24 +63,20 @@ void *alloca();
# include <dlfcn.h>
#endif
-#define DW_LNS_copy 0x01
-#define DW_LNS_advance_pc 0x02
-#define DW_LNS_advance_line 0x03
-#define DW_LNS_set_file 0x04
-#define DW_LNS_set_column 0x05
-#define DW_LNS_negate_stmt 0x06
-#define DW_LNS_set_basic_block 0x07
-#define DW_LNS_const_add_pc 0x08
-#define DW_LNS_fixed_advance_pc 0x09
-#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
-#define DW_LNS_set_isa 0x0c /* DWARF3 */
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence 0x01
-#define DW_LNE_set_address 0x02
-#define DW_LNE_define_file 0x03
-#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+# include <elf_abi.h>
+# else
+# include <elf.h>
+# endif
#ifndef ElfW
# if SIZEOF_VOIDP == 8
@@ -92,13 +92,44 @@ void *alloca();
# define ELF_ST_TYPE ELF32_ST_TYPE
# endif
#endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+ /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+# include <zlib.h>
+# define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
#ifndef PATH_MAX
#define PATH_MAX 4096
#endif
-int kprintf(const char *fmt, ...);
+#define DW_LNS_copy 0x01
+#define DW_LNS_advance_pc 0x02
+#define DW_LNS_advance_line 0x03
+#define DW_LNS_set_file 0x04
+#define DW_LNS_set_column 0x05
+#define DW_LNS_negate_stmt 0x06
+#define DW_LNS_set_basic_block 0x07
+#define DW_LNS_const_add_pc 0x08
+#define DW_LNS_fixed_advance_pc 0x09
+#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
+#define DW_LNS_set_isa 0x0c /* DWARF3 */
-typedef struct {
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence 0x01
+#define DW_LNE_set_address 0x02
+#define DW_LNE_define_file 0x03
+#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
+
+PRINTF_ARGS(static int kprintf(const char *fmt, ...), 1, 2);
+
+typedef struct line_info {
const char *dirname;
const char *filename;
const char *path; /* object path */
@@ -107,19 +138,56 @@ typedef struct {
uintptr_t base_addr;
uintptr_t saddr;
const char *sname; /* function name */
+
+ struct line_info *next;
} line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
+
+struct dwarf_section {
+ char *ptr;
+ size_t size;
+ uint64_t flags;
+};
+
+typedef struct obj_info {
const char *path; /* object path */
- int fd;
- void *mapped;
+ char *mapped;
size_t mapped_size;
+ void *uncompressed;
uintptr_t base_addr;
- obj_info_t *next;
+ uintptr_t vmaddr;
+ struct dwarf_section debug_abbrev;
+ struct dwarf_section debug_info;
+ struct dwarf_section debug_line;
+ struct dwarf_section debug_ranges;
+ struct dwarf_section debug_str;
+ struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 5
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+ struct dwarf_section *ary[] = {
+ &obj->debug_abbrev,
+ &obj->debug_info,
+ &obj->debug_line,
+ &obj->debug_ranges,
+ &obj->debug_str
+ };
+ if (n < 0 || DWARF_SECTION_COUNT <= n) {
+ abort();
+ }
+ return ary[n];
+}
+
+struct debug_section_definition {
+ const char *name;
+ struct dwarf_section *dwarf;
};
/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
+static char binary_filename[PATH_MAX + 1];
static unsigned long
uleb128(char **p)
@@ -179,8 +247,7 @@ get_nth_dirname(unsigned long dir, char *p)
}
static void
-fill_filename(int file, char *include_directories, char *filenames,
- line_info_t *line)
+fill_filename(int file, char *include_directories, char *filenames, line_info_t *line, obj_info_t *obj)
{
int i;
char *p = filenames;
@@ -190,8 +257,8 @@ fill_filename(int file, char *include_directories, char *filenames,
filename = p;
if (!*p) {
/* Need to output binary file name? */
- kprintf("Unexpected file number %d in %s\n",
- file, binary_filename);
+ kprintf("Unexpected file number %d in %s at %tx\n",
+ file, binary_filename, filenames - obj->mapped);
return;
}
while (*p) p++;
@@ -215,100 +282,128 @@ fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
obj_info_t *obj, line_info_t *lines, int offset)
{
int i;
- addr += obj->base_addr;
+ addr += obj->base_addr - obj->vmaddr;
for (i = offset; i < num_traces; i++) {
uintptr_t a = (uintptr_t)traces[i];
/* We assume one line code doesn't result >100 bytes of native code.
We may want more reliable way eventually... */
if (addr < a && a < addr + 100) {
- fill_filename(file, include_directories, filenames, &lines[i]);
+ fill_filename(file, include_directories, filenames, &lines[i], obj);
lines[i].line = line;
}
}
}
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- char *p, *cu_end, *cu_start, *include_directories, *filenames;
- unsigned long unit_length;
- int default_is_stmt, line_base;
- unsigned int header_length, minimum_instruction_length, line_range,
- opcode_base;
- /* unsigned char *standard_opcode_lengths; */
-
- /* The registers. */
- unsigned long addr = 0;
- unsigned int file = 1;
- unsigned int line = 1;
- /* unsigned int column = 0; */
- int is_stmt;
- /* int basic_block = 0; */
- /* int end_sequence = 0; */
- /* int prologue_end = 0; */
- /* int epilogue_begin = 0; */
- /* unsigned int isa = 0; */
-
- p = *debug_line;
+struct LineNumberProgramHeader {
+ uint64_t unit_length;
+ uint16_t version;
+ uint8_t format; /* 4 or 8 */
+ uint64_t header_length;
+ uint8_t minimum_instruction_length;
+ uint8_t maximum_operations_per_instruction;
+ uint8_t default_is_stmt;
+ int8_t line_base;
+ uint8_t line_range;
+ uint8_t opcode_base;
+ /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+ const char *include_directories;
+ const char *filenames;
+ const char *cu_start;
+ const char *cu_end;
+};
- unit_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
- if (unit_length == 0xffffffff) {
- unit_length = *(unsigned long *)p;
- p += sizeof(unsigned long);
+static int
+parse_debug_line_header(const char **pp, struct LineNumberProgramHeader *header)
+{
+ const char *p = *pp;
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
}
- cu_end = p + unit_length;
-
- /*dwarf_version = *(unsigned short *)p;*/
- p += 2;
+ header->cu_end = p + header->unit_length;
- header_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
+ header->version = *(uint16_t *)p;
+ p += sizeof(uint16_t);
+ if (header->version > 4) return -1;
- cu_start = p + header_length;
+ header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+ p += header->format;
+ header->cu_start = p + header->header_length;
- minimum_instruction_length = *(unsigned char *)p;
- p++;
+ header->minimum_instruction_length = *(uint8_t *)p++;
- is_stmt = default_is_stmt = *(unsigned char *)p;
- p++;
-
- line_base = *(signed char *)p;
- p++;
-
- line_range = *(unsigned char *)p;
- p++;
+ if (header->version >= 4) {
+ /* maximum_operations_per_instruction = *(uint8_t *)p; */
+ if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+ p++;
+ }
- opcode_base = *(unsigned char *)p;
- p++;
+ header->default_is_stmt = *(uint8_t *)p++;
+ header->line_base = *(int8_t *)p++;
+ header->line_range = *(uint8_t *)p++;
+ header->opcode_base = *(uint8_t *)p++;
+ /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+ p += header->opcode_base - 1;
- /* standard_opcode_lengths = (unsigned char *)p - 1; */
- p += opcode_base - 1;
+ header->include_directories = p;
- include_directories = p;
+ /* temporary measure for compress-debug-sections */
+ if (p >= header->cu_end) return -1;
/* skip include directories */
while (*p) {
- while (*p) p++;
+ p = memchr(p, '\0', header->cu_end - p);
+ if (!p) return -1;
p++;
}
p++;
- filenames = p;
+ header->filenames = p;
+
+ *pp = header->cu_start;
+
+ return 0;
+}
+
+static int
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ const char *p = (const char *)*debug_line;
+ struct LineNumberProgramHeader header;
+
+ /* The registers. */
+ unsigned long addr = 0;
+ unsigned int file = 1;
+ unsigned int line = 1;
+ /* unsigned int column = 0; */
+ int is_stmt;
+ /* int basic_block = 0; */
+ /* int end_sequence = 0; */
+ /* int prologue_end = 0; */
+ /* int epilogue_begin = 0; */
+ /* unsigned int isa = 0; */
- p = cu_start;
+ if (parse_debug_line_header(&p, &header))
+ return -1;
+ is_stmt = header.default_is_stmt;
#define FILL_LINE() \
do { \
fill_line(num_traces, traces, addr, file, line, \
- include_directories, filenames, \
+ (char *)header.include_directories, \
+ (char *)header.filenames, \
obj, lines, offset); \
/*basic_block = prologue_end = epilogue_begin = 0;*/ \
} while (0)
- while (p < cu_end) {
+ while (p < header.cu_end) {
unsigned long a;
unsigned char op = *p++;
switch (op) {
@@ -316,19 +411,19 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
FILL_LINE();
break;
case DW_LNS_advance_pc:
- a = uleb128(&p);
+ a = uleb128((char **)&p);
addr += a;
break;
case DW_LNS_advance_line: {
- long a = sleb128(&p);
+ long a = sleb128((char **)&p);
line += a;
break;
}
case DW_LNS_set_file:
- file = (unsigned int)uleb128(&p);
+ file = (unsigned int)uleb128((char **)&p);
break;
case DW_LNS_set_column:
- /*column = (unsigned int)*/(void)uleb128(&p);
+ /*column = (unsigned int)*/(void)uleb128((char **)&p);
break;
case DW_LNS_negate_stmt:
is_stmt = !is_stmt;
@@ -337,12 +432,13 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
/*basic_block = 1; */
break;
case DW_LNS_const_add_pc:
- a = ((255 - opcode_base) / line_range) *
- minimum_instruction_length;
+ a = ((255UL - header.opcode_base) / header.line_range) *
+ header.minimum_instruction_length;
addr += a;
break;
case DW_LNS_fixed_advance_pc:
- a = *(unsigned char *)p++;
+ a = *(uint16_t *)p;
+ p += sizeof(uint16_t);
addr += a;
break;
case DW_LNS_set_prologue_end:
@@ -352,7 +448,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
/* epilogue_begin = 1; */
break;
case DW_LNS_set_isa:
- /* isa = (unsigned int)*/(void)uleb128(&p);
+ /* isa = (unsigned int)*/(void)uleb128((char **)&p);
break;
case 0:
a = *(unsigned char *)p++;
@@ -365,7 +461,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
file = 1;
line = 1;
/* column = 0; */
- is_stmt = default_is_stmt;
+ is_stmt = header.default_is_stmt;
/* end_sequence = 0; */
/* isa = 0; */
break;
@@ -379,7 +475,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
break;
case DW_LNE_set_discriminator:
/* TODO:currently ignore */
- uleb128(&p);
+ uleb128((char **)&p);
break;
default:
kprintf("Unknown extended opcode: %d in %s\n",
@@ -387,33 +483,34 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
}
break;
default: {
- unsigned long addr_incr;
- unsigned long line_incr;
- a = op - opcode_base;
- addr_incr = (a / line_range) * minimum_instruction_length;
- line_incr = line_base + (a % line_range);
- addr += (unsigned int)addr_incr;
- line += (unsigned int)line_incr;
+ uint8_t adjusted_opcode = op - header.opcode_base;
+ uint8_t operation_advance = adjusted_opcode / header.line_range;
+ /* NOTE: this code doesn't support VLIW */
+ addr += operation_advance * header.minimum_instruction_length;
+ line += header.line_base + (adjusted_opcode % header.line_range);
FILL_LINE();
}
}
}
- *debug_line = p;
+ *debug_line = (char *)p;
+ return 0;
}
-static void
+static int
parse_debug_line(int num_traces, void **traces,
char *debug_line, unsigned long size,
obj_info_t *obj, line_info_t *lines, int offset)
{
char *debug_line_end = debug_line + size;
while (debug_line < debug_line_end) {
- parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+ if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
+ return -1;
}
if (debug_line != debug_line_end) {
kprintf("Unexpected size of .debug_line in %s\n",
binary_filename);
}
+ return 0;
}
/* read file and fill lines */
@@ -422,22 +519,38 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
obj_info_t **objp, line_info_t *lines, int offset);
static void
-append_obj(obj_info_t **objp) {
+append_obj(obj_info_t **objp)
+{
obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
if (*objp) (*objp)->next = newobj;
*objp = newobj;
}
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ * - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ * - /usr/bin/ruby.debug
+ * - /usr/bin/.debug/ruby.debug
+ * - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
obj_info_t **objp, line_info_t *lines, int offset)
{
- /* Ideally we should check 4 paths to follow gnu_debuglink,
- but we handle only one case for now as this format is used
- by some linux distributions. See GDB's info for detail. */
static const char global_debug_dir[] = "/usr/lib/debug";
- char *p, *subdir;
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
obj_info_t *o1 = *objp, *o2;
+ size_t len;
p = strrchr(binary_filename, '/');
if (!p) {
@@ -445,11 +558,44 @@ follow_debuglink(char *debuglink, int num_traces, void **traces,
}
p[1] = '\0';
- subdir = (char *)alloca(strlen(binary_filename) + 1);
- strcpy(subdir, binary_filename);
- strcpy(binary_filename, global_debug_dir);
- strlcat(binary_filename, subdir, PATH_MAX);
- strlcat(binary_filename, debuglink, PATH_MAX);
+ len = strlen(binary_filename);
+ if (len >= PATH_MAX - global_debug_dir_len)
+ len = PATH_MAX - global_debug_dir_len - 1;
+ memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ len += global_debug_dir_len;
+ strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+ append_obj(objp);
+ o2 = *objp;
+ o2->base_addr = o1->base_addr;
+ o2->path = o1->path;
+ fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
+ obj_info_t *o1 = *objp, *o2;
+ size_t i;
+
+ if (PATH_MAX < global_debug_dir_len + 1 + build_id_size * 2 + 6) return;
+
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ p = binary_filename + global_debug_dir_len;
+ for (i = 0; i < build_id_size; i++) {
+ static const char tbl[] = "0123456789abcdef";
+ unsigned char n = build_id[i];
+ *p++ = tbl[n / 16];
+ *p++ = tbl[n % 16];
+ if (i == 0) *p++ = '/';
+ }
+ strcpy(p, ".debug");
append_obj(objp);
o2 = *objp;
@@ -457,6 +603,1054 @@ follow_debuglink(char *debuglink, int num_traces, void **traces,
o2->path = o1->path;
fill_lines(num_traces, traces, 0, objp, lines, offset);
}
+#endif
+
+enum
+{
+ DW_TAG_compile_unit = 0x11,
+ DW_TAG_inlined_subroutine = 0x1d,
+ DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+ DW_AT_sibling = 0x01,
+ DW_AT_location = 0x02,
+ DW_AT_name = 0x03,
+ /* Reserved 0x04 */
+ /* Reserved 0x05 */
+ /* Reserved 0x06 */
+ /* Reserved 0x07 */
+ /* Reserved 0x08 */
+ DW_AT_ordering = 0x09,
+ /* Reserved 0x0a */
+ DW_AT_byte_size = 0x0b,
+ /* Reserved 0x0c */
+ DW_AT_bit_size = 0x0d,
+ /* Reserved 0x0e */
+ /* Reserved 0x0f */
+ DW_AT_stmt_list = 0x10,
+ DW_AT_low_pc = 0x11,
+ DW_AT_high_pc = 0x12,
+ DW_AT_language = 0x13,
+ /* Reserved 0x14 */
+ DW_AT_discr = 0x15,
+ DW_AT_discr_value = 0x16,
+ DW_AT_visibility = 0x17,
+ DW_AT_import = 0x18,
+ DW_AT_string_length = 0x19,
+ DW_AT_common_reference = 0x1a,
+ DW_AT_comp_dir = 0x1b,
+ DW_AT_const_value = 0x1c,
+ DW_AT_containing_type = 0x1d,
+ DW_AT_default_value = 0x1e,
+ /* Reserved 0x1f */
+ DW_AT_inline = 0x20,
+ DW_AT_is_optional = 0x21,
+ DW_AT_lower_bound = 0x22,
+ /* Reserved 0x23 */
+ /* Reserved 0x24 */
+ DW_AT_producer = 0x25,
+ /* Reserved 0x26 */
+ DW_AT_prototyped = 0x27,
+ /* Reserved 0x28 */
+ /* Reserved 0x29 */
+ DW_AT_return_addr = 0x2a,
+ /* Reserved 0x2b */
+ DW_AT_start_scope = 0x2c,
+ /* Reserved 0x2d */
+ DW_AT_bit_stride = 0x2e,
+ DW_AT_upper_bound = 0x2f,
+ /* Reserved 0x30 */
+ DW_AT_abstract_origin = 0x31,
+ DW_AT_accessibility = 0x32,
+ DW_AT_address_class = 0x33,
+ DW_AT_artificial = 0x34,
+ DW_AT_base_types = 0x35,
+ DW_AT_calling_convention = 0x36,
+ DW_AT_count = 0x37,
+ DW_AT_data_member_location = 0x38,
+ DW_AT_decl_column = 0x39,
+ DW_AT_decl_file = 0x3a,
+ DW_AT_decl_line = 0x3b,
+ DW_AT_declaration = 0x3c,
+ DW_AT_discr_list = 0x3d,
+ DW_AT_encoding = 0x3e,
+ DW_AT_external = 0x3f,
+ DW_AT_frame_base = 0x40,
+ DW_AT_friend = 0x41,
+ DW_AT_identifier_case = 0x42,
+ /* Reserved 0x43 */
+ DW_AT_namelist_item = 0x44,
+ DW_AT_priority = 0x45,
+ DW_AT_segment = 0x46,
+ DW_AT_specification = 0x47,
+ DW_AT_static_link = 0x48,
+ DW_AT_type = 0x49,
+ DW_AT_use_location = 0x4a,
+ DW_AT_variable_parameter = 0x4b,
+ DW_AT_virtuality = 0x4c,
+ DW_AT_vtable_elem_location = 0x4d,
+ DW_AT_allocated = 0x4e,
+ DW_AT_associated = 0x4f,
+ DW_AT_data_location = 0x50,
+ DW_AT_byte_stride = 0x51,
+ DW_AT_entry_pc = 0x52,
+ DW_AT_use_UTF8 = 0x53,
+ DW_AT_extension = 0x54,
+ DW_AT_ranges = 0x55,
+ DW_AT_trampoline = 0x56,
+ DW_AT_call_column = 0x57,
+ DW_AT_call_file = 0x58,
+ DW_AT_call_line = 0x59,
+ DW_AT_description = 0x5a,
+ DW_AT_binary_scale = 0x5b,
+ DW_AT_decimal_scale = 0x5c,
+ DW_AT_small = 0x5d,
+ DW_AT_decimal_sign = 0x5e,
+ DW_AT_digit_count = 0x5f,
+ DW_AT_picture_string = 0x60,
+ DW_AT_mutable = 0x61,
+ DW_AT_threads_scaled = 0x62,
+ DW_AT_explicit = 0x63,
+ DW_AT_object_pointer = 0x64,
+ DW_AT_endianity = 0x65,
+ DW_AT_elemental = 0x66,
+ DW_AT_pure = 0x67,
+ DW_AT_recursive = 0x68,
+ DW_AT_signature = 0x69,
+ DW_AT_main_subprogram = 0x6a,
+ DW_AT_data_bit_offset = 0x6b,
+ DW_AT_const_expr = 0x6c,
+ DW_AT_enum_class = 0x6d,
+ DW_AT_linkage_name = 0x6e,
+ DW_AT_string_length_bit_size = 0x6f,
+ DW_AT_string_length_byte_size = 0x70,
+ DW_AT_rank = 0x71,
+ DW_AT_str_offsets_base = 0x72,
+ DW_AT_addr_base = 0x73,
+ DW_AT_rnglists_base = 0x74,
+ /* Reserved 0x75 */
+ DW_AT_dwo_name = 0x76,
+ DW_AT_reference = 0x77,
+ DW_AT_rvalue_reference = 0x78,
+ DW_AT_macros = 0x79,
+ DW_AT_call_all_calls = 0x7a,
+ DW_AT_call_all_source_calls = 0x7b,
+ DW_AT_call_all_tail_calls = 0x7c,
+ DW_AT_call_return_pc = 0x7d,
+ DW_AT_call_value = 0x7e,
+ DW_AT_call_origin = 0x7f,
+ DW_AT_call_parameter = 0x80,
+ DW_AT_call_pc = 0x81,
+ DW_AT_call_tail_call = 0x82,
+ DW_AT_call_target = 0x83,
+ DW_AT_call_target_clobbered = 0x84,
+ DW_AT_call_data_location = 0x85,
+ DW_AT_call_data_value = 0x86,
+ DW_AT_noreturn = 0x87,
+ DW_AT_alignment = 0x88,
+ DW_AT_export_symbols = 0x89,
+ DW_AT_deleted = 0x8a,
+ DW_AT_defaulted = 0x8b,
+ DW_AT_loclists_base = 0x8c,
+ DW_AT_lo_user = 0x2000,
+ DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+ DW_FORM_addr = 0x01,
+ /* Reserved 0x02 */
+ DW_FORM_block2 = 0x03,
+ DW_FORM_block4 = 0x04,
+ DW_FORM_data2 = 0x05,
+ DW_FORM_data4 = 0x06,
+ DW_FORM_data8 = 0x07,
+ DW_FORM_string = 0x08,
+ DW_FORM_block = 0x09,
+ DW_FORM_block1 = 0x0a,
+ DW_FORM_data1 = 0x0b,
+ DW_FORM_flag = 0x0c,
+ DW_FORM_sdata = 0x0d,
+ DW_FORM_strp = 0x0e,
+ DW_FORM_udata = 0x0f,
+ DW_FORM_ref_addr = 0x10,
+ DW_FORM_ref1 = 0x11,
+ DW_FORM_ref2 = 0x12,
+ DW_FORM_ref4 = 0x13,
+ DW_FORM_ref8 = 0x14,
+ DW_FORM_ref_udata = 0x15,
+ DW_FORM_indirect = 0x16,
+ DW_FORM_sec_offset = 0x17,
+ DW_FORM_exprloc = 0x18,
+ DW_FORM_flag_present = 0x19,
+ DW_FORM_strx = 0x1a,
+ DW_FORM_addrx = 0x1b,
+ DW_FORM_ref_sup4 = 0x1c,
+ DW_FORM_strp_sup = 0x1d,
+ DW_FORM_data16 = 0x1e,
+ DW_FORM_line_strp = 0x1f,
+ DW_FORM_ref_sig8 = 0x20,
+ DW_FORM_implicit_const = 0x21,
+ DW_FORM_loclistx = 0x22,
+ DW_FORM_rnglistx = 0x23,
+ DW_FORM_ref_sup8 = 0x24,
+ DW_FORM_strx1 = 0x25,
+ DW_FORM_strx2 = 0x26,
+ DW_FORM_strx3 = 0x27,
+ DW_FORM_strx4 = 0x28,
+ DW_FORM_addrx1 = 0x29,
+ DW_FORM_addrx2 = 0x2a,
+ DW_FORM_addrx3 = 0x2b,
+ DW_FORM_addrx4 = 0x2c
+};
+
+enum {
+ VAL_none = 0,
+ VAL_cstr = 1,
+ VAL_data = 2,
+ VAL_uint = 3,
+ VAL_int = 4
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+ obj_info_t *obj;
+ char *file;
+ char *current_cu;
+ uint64_t current_low_pc;
+ char *debug_line_cu_end;
+ char *debug_line_files;
+ char *debug_line_directories;
+ char *p;
+ char *cu_end;
+ char *pend;
+ char *q0;
+ char *q;
+ int format; // 4 or 8
+ uint8_t address_size;
+ int level;
+ char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+ ptrdiff_t pos;
+ int tag;
+ int has_children;
+} DIE;
+
+typedef struct {
+ union {
+ char *ptr;
+ uint64_t uint64;
+ int64_t int64;
+ } as;
+ uint64_t off;
+ uint64_t at;
+ uint64_t form;
+ size_t size;
+ int type;
+} DebugInfoValue;
+
+/* TODO: Big Endian */
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+ return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+ return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+ return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 1);
+ return *p;
+}
+
+static uint16_t
+read_uint16(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 2);
+ return get_uint16(p);
+}
+
+static uint32_t
+read_uint24(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 3);
+ return (*p << 16) | get_uint16(p+1);
+}
+
+static uint32_t
+read_uint32(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 4);
+ return get_uint32(p);
+}
+
+static uint64_t
+read_uint64(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 8);
+ return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+ return get_uint64(p);
+#else
+ return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+ if (reader->format == 4) {
+ return read_uint32(&reader->p);
+ } else { /* 64 bit */
+ return read_uint64(&reader->p);
+ }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+ return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+ return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+ reader->file = obj->mapped;
+ reader->obj = obj;
+ reader->p = obj->debug_info.ptr;
+ reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+ reader->debug_line_cu_end = obj->debug_line.ptr;
+ reader->current_low_pc = 0;
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+ uint64_t prev = 0;
+ char *p = reader->q0;
+ for (;;) {
+ uint64_t abbrev_number = uleb128(&p);
+ if (abbrev_number <= prev) break;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ reader->abbrev_table[abbrev_number] = p;
+ }
+ prev = abbrev_number;
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ /* skip content */
+ for (;;) {
+ uint64_t at = uleb128(&p);
+ uint64_t form = uleb128(&p);
+ if (!at && !form) break;
+ }
+ }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader)
+{
+ const char *p;
+ struct LineNumberProgramHeader header;
+
+ p = (const char *)reader->debug_line_cu_end;
+ if (parse_debug_line_header(&p, &header))
+ return -1;
+
+ reader->debug_line_cu_end = (char *)header.cu_end;
+ reader->debug_line_directories = (char *)header.include_directories;
+ reader->debug_line_files = (char *)header.filenames;
+
+ return 0;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+ v->as.uint64 = n;
+ v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+ v->as.int64 = n;
+ v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, char *s)
+{
+ v->as.ptr = s;
+ v->off = 0;
+ v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, char *s, uint64_t off)
+{
+ v->as.ptr = s;
+ v->off = off;
+ v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, char *s)
+{
+ v->as.ptr = s;
+ v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+ if (v->as.ptr) {
+ return v->as.ptr + v->off;
+ } else {
+ return NULL;
+ }
+}
+
+static void
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v)
+{
+ switch (form) {
+ case DW_FORM_addr:
+ if (reader->address_size == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->address_size == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+ break;
+ case DW_FORM_block2:
+ v->size = read_uint16(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block4:
+ v->size = read_uint32(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_data4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_data8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_string:
+ v->size = strlen(reader->p);
+ set_cstr_value(v, reader->p);
+ reader->p += v->size + 1;
+ break;
+ case DW_FORM_block:
+ v->size = uleb128(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block1:
+ v->size = read_uint8(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_flag:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_sdata:
+ set_int_value(v, read_sleb128(reader));
+ break;
+ case DW_FORM_strp:
+ set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+ break;
+ case DW_FORM_udata:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_addr:
+ if (reader->address_size == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->address_size == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+ break;
+ case DW_FORM_ref1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_ref2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_ref4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_ref8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_ref_udata:
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_indirect:
+ /* TODO: read the referred value */
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_sec_offset:
+ set_uint_value(v, read_uint(reader)); /* offset */
+ /* addrptr: debug_addr */
+ /* lineptr: debug_line */
+ /* loclist: debug_loclists */
+ /* loclistptr: debug_loclists */
+ /* macptr: debug_macro */
+ /* rnglist: debug_rnglists */
+ /* rnglistptr: debug_rnglists */
+ /* stroffsetsptr: debug_str_offsets */
+ break;
+ case DW_FORM_exprloc:
+ v->size = (size_t)read_uleb128(reader);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_flag_present:
+ set_uint_value(v, 1);
+ break;
+ case DW_FORM_strx:
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_addrx:
+ /* TODO: read .debug_addr */
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_ref_sup4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_strp_sup:
+ set_uint_value(v, read_uint(reader));
+ /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+ break;
+ case DW_FORM_data16:
+ v->size = 16;
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_line_strp:
+ set_uint_value(v, read_uint(reader));
+ /* *p = reader->file + reader->line->sh_offset + ret; */
+ break;
+ case DW_FORM_ref_sig8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_implicit_const:
+ set_int_value(v, sleb128(&reader->q));
+ break;
+ case DW_FORM_loclistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_rnglistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_sup8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_strx1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_strx2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_strx3:
+ set_uint_value(v, read_uint24(&reader->p));
+ break;
+ case DW_FORM_strx4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_addrx1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_addrx2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_addrx3:
+ set_uint_value(v, read_uint24(&reader->p));
+ break;
+ case DW_FORM_addrx4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case 0:
+ goto fail;
+ break;
+ }
+ return;
+
+ fail:
+ fprintf(stderr, "%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+ exit(1);
+}
+
+/* find abbrev in current compilation unit */
+static char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number)
+{
+ char *p;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ return reader->abbrev_table[abbrev_number];
+ }
+ p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+ /* skip 255th record */
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ /* skip content */
+ for (;;) {
+ uint64_t at = uleb128(&p);
+ uint64_t form = uleb128(&p);
+ if (!at && !form) break;
+ }
+ for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+ if (n == 0) {
+ fprintf(stderr,"%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+ exit(1);
+ }
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ /* skip content */
+ for (;;) {
+ uint64_t at = uleb128(&p);
+ uint64_t form = uleb128(&p);
+ if (!at && !form) break;
+ }
+ }
+ return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n)
+{
+ size_t i;
+ fprintf(stderr, " 0 1 2 3 4 5 6 7 8 9 A B C D E F\n");
+ for (i=0; i < n; i++){
+ switch (i & 15) {
+ case 0:
+ fprintf(stderr, "%02zd: %02X ", i/16, p[i]);
+ break;
+ case 15:
+ fprintf(stderr, "%02X\n", p[i]);
+ break;
+ default:
+ fprintf(stderr, "%02X ", p[i]);
+ break;
+ }
+ }
+ if ((i & 15) != 15) {
+ fprintf(stderr, "\n");
+ }
+}
+#define hexdump(p,n) hexdump0((const unsigned char *)p, n)
+
+static void
+div_inspect(DebugInfoValue *v)
+{
+ switch (v->type) {
+ case VAL_uint:
+ fprintf(stderr,"%d: type:%d size:%zx v:%lx\n",__LINE__,v->type,v->size,v->as.uint64);
+ break;
+ case VAL_int:
+ fprintf(stderr,"%d: type:%d size:%zx v:%ld\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+ break;
+ case VAL_cstr:
+ fprintf(stderr,"%d: type:%d size:%zx v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+ break;
+ case VAL_data:
+ fprintf(stderr,"%d: type:%d size:%zx v:\n",__LINE__,v->type,v->size);
+ hexdump(v->as.ptr, 16);
+ break;
+ }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die)
+{
+ uint64_t abbrev_number = uleb128(&reader->p);
+ if (abbrev_number == 0) {
+ reader->level--;
+ return NULL;
+ }
+
+ reader->q = di_find_abbrev(reader, abbrev_number);
+
+ die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+ die->tag = (int)uleb128(&reader->q); /* tag */
+ die->has_children = *reader->q++; /* has_children */
+ if (die->has_children) {
+ reader->level++;
+ }
+ return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp)
+{
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return NULL;
+ vp->at = at;
+ vp->form = form;
+ debug_info_reader_read_value(reader, form, vp);
+ return vp;
+}
+
+static void
+di_skip_records(DebugInfoReader *reader)
+{
+ for (;;) {
+ DebugInfoValue v = {{}};
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return;
+ debug_info_reader_read_value(reader, form, &v);
+ }
+}
+
+typedef struct {
+ uint64_t low_pc;
+ uint64_t high_pc;
+ uint64_t ranges;
+ bool low_pc_set;
+ bool high_pc_set;
+ bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v)
+{
+ switch (v->at) {
+ case DW_AT_low_pc:
+ ptr->low_pc = v->as.uint64;
+ ptr->low_pc_set = true;
+ break;
+ case DW_AT_high_pc:
+ if (v->form == DW_FORM_addr) {
+ ptr->high_pc = v->as.uint64;
+ }
+ else {
+ ptr->high_pc = ptr->low_pc + v->as.uint64;
+ }
+ ptr->high_pc_set = true;
+ break;
+ case DW_AT_ranges:
+ ptr->ranges = v->as.uint64;
+ ptr->ranges_set = true;
+ break;
+ }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ exit(1);
+ }
+ if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ else if (ptr->ranges_set) {
+ /* TODO: support base address selection entry */
+ char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ if (from == UINTPTR_MAX) {
+ /* base address selection entry */
+ base = to;
+ }
+ else if (base + from <= addr && addr < base + to) {
+ return from;
+ }
+ }
+ }
+ else if (ptr->low_pc_set) {
+ if (ptr->low_pc == addr) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ return false;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ fprintf(stderr,"low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+ exit(1);
+ }
+ fprintf(stderr,"low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+ }
+ else if (ptr->ranges_set) {
+ char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ fprintf(stderr,"low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ fprintf(stderr,"%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+ }
+ fprintf(stderr,"\n");
+ }
+ else if (ptr->low_pc_set) {
+ fprintf(stderr,"low_pc:%"PRIx64"\n",ptr->low_pc);
+ }
+ else {
+ fprintf(stderr,"empty\n");
+ }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader)
+{
+ uint64_t unit_length;
+ uint16_t version;
+ uint64_t debug_abbrev_offset;
+ reader->format = 4;
+ reader->current_cu = reader->p;
+ unit_length = read_uint32(&reader->p);
+ if (unit_length == 0xffffffff) {
+ unit_length = read_uint64(&reader->p);
+ reader->format = 8;
+ }
+ reader->cu_end = reader->p + unit_length;
+ version = read_uint16(&reader->p);
+ if (version > 5) {
+ return -1;
+ }
+ else if (version == 5) {
+ /* unit_type = */ read_uint8(&reader->p);
+ reader->address_size = read_uint8(&reader->p);
+ debug_abbrev_offset = read_uint(reader);
+ }
+ else {
+ debug_abbrev_offset = read_uint(reader);
+ reader->address_size = read_uint8(&reader->p);
+ }
+ reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+ reader->level = 0;
+ di_read_debug_abbrev_cu(reader);
+ if (di_read_debug_line_cu(reader)) return -1;
+
+#if defined(__GNUC__) && !defined(__clang__) && !defined(__INTEL_COMPILER_BUILD_DATE)
+ /* Though DWARF specifies "the applicable base address defaults to the base
+ address of the compilation unit", but GCC seems to use zero as default */
+#else
+ do {
+ DIE die;
+
+ if (!di_read_die(reader, &die)) continue;
+
+ if (die.tag != DW_TAG_compile_unit) {
+ di_skip_records(reader);
+ break;
+ }
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_low_pc:
+ reader->current_low_pc = v.as.uint64;
+ break;
+ }
+ }
+ } while (0);
+#endif
+ return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t abstract_origin, line_info_t *line)
+{
+ char *p = reader->p;
+ char *q = reader->q;
+ int level = reader->level;
+ DIE die;
+
+ reader->p = reader->current_cu + abstract_origin;
+ if (!di_read_die(reader, &die)) goto finish;
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_name:
+ line->sname = get_cstr_value(&v);
+ break;
+ }
+ }
+
+ finish:
+ reader->p = p;
+ reader->q = q;
+ reader->level = level;
+}
+
+static void
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+ line_info_t *lines, int offset) {
+ while (reader->p < reader->cu_end) {
+ DIE die;
+ ranges_t ranges = {};
+ line_info_t line = {};
+
+ if (!di_read_die(reader, &die)) continue;
+ /* fprintf(stderr,"%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+ if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+ skip_die:
+ di_skip_records(reader);
+ continue;
+ }
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ /* ptrdiff_t pos = reader->p - reader->p0; */
+ if (!di_read_record(reader, &v)) break;
+ /* fprintf(stderr,"\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+ /* div_inspect(&v); */
+ switch (v.at) {
+ case DW_AT_name:
+ line.sname = get_cstr_value(&v);
+ break;
+ case DW_AT_call_file:
+ fill_filename((int)v.as.uint64, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj);
+ break;
+ case DW_AT_call_line:
+ line.line = (int)v.as.uint64;
+ break;
+ case DW_AT_low_pc:
+ case DW_AT_high_pc:
+ case DW_AT_ranges:
+ ranges_set(&ranges, &v);
+ break;
+ case DW_AT_declaration:
+ goto skip_die;
+ case DW_AT_inline:
+ /* 1 or 3 */
+ break; /* goto skip_die; */
+ case DW_AT_abstract_origin:
+ read_abstract_origin(reader, v.as.uint64, &line);
+ break; /* goto skip_die; */
+ }
+ }
+ /* ranges_inspect(reader, &ranges); */
+ /* fprintf(stderr,"%d:%tx: %x ",__LINE__,diepos,die.tag); */
+ for (int i=offset; i < num_traces; i++) {
+ uintptr_t addr = (uintptr_t)traces[i];
+ uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+ uintptr_t saddr = ranges_include(reader, &ranges, offset);
+ if (saddr) {
+ /* fprintf(stderr, "%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+ if (lines[i].sname) {
+ line_info_t *lp = malloc(sizeof(line_info_t));
+ memcpy(lp, &lines[i], sizeof(line_info_t));
+ lines[i].next = lp;
+ lp->dirname = line.dirname;
+ lp->filename = line.filename;
+ lp->line = line.line;
+ lp->saddr = 0;
+ }
+ lines[i].path = reader->obj->path;
+ lines[i].base_addr = line.base_addr;
+ lines[i].sname = line.sname;
+ lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+ }
+ }
+ }
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+ *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+ ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+ unsigned long destsize = chdr->ch_size;
+ int ret = 0;
+
+ if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+ /* unsupported compression type */
+ return 0;
+ }
+
+ *ptr = malloc(destsize);
+ if (!*ptr) return 0;
+ ret = uncompress((Bytef *)*ptr, &destsize,
+ (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+ shdr->sh_size - sizeof(ElfW(Chdr)));
+ if (ret != Z_OK) goto fail;
+ return destsize;
+
+fail:
+ free(*ptr);
+ *ptr = NULL;
+#endif
+ return 0;
+}
/* read file and fill lines */
static uintptr_t
@@ -465,10 +1659,10 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
{
int i, j;
char *shstr;
- char *section_name;
ElfW(Ehdr) *ehdr;
ElfW(Shdr) *shdr, *shstr_shdr;
- ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+ ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+ ElfW(Shdr) *note_gnu_build_id = NULL;
int fd;
off_t filesize;
char *file;
@@ -504,6 +1698,7 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
kprintf("mmap: %s\n", strerror(e));
goto fail;
}
+ close(fd);
ehdr = (ElfW(Ehdr) *)file;
if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
@@ -511,11 +1706,8 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
* Huh? Maybe filename was overridden by setproctitle() and
* it match non-elf file.
*/
- close(fd);
goto fail;
}
-
- obj->fd = fd;
obj->mapped = file;
obj->mapped_size = (size_t)filesize;
@@ -525,7 +1717,7 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
shstr = file + shstr_shdr->sh_offset;
for (i = 0; i < ehdr->e_shnum; i++) {
- section_name = shstr + shdr[i].sh_name;
+ char *section_name = shstr + shdr[i].sh_name;
switch (shdr[i].sh_type) {
case SHT_STRTAB:
if (!strcmp(section_name, ".strtab")) {
@@ -543,13 +1735,40 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
/* if (!strcmp(section_name, ".dynsym")) */
dynsym_shdr = shdr + i;
break;
+ case SHT_NOTE:
+ if (!strcmp(section_name, ".note.gnu.build-id")) {
+ note_gnu_build_id = shdr + i;
+ }
+ break;
case SHT_PROGBITS:
- if (!strcmp(section_name, ".debug_line")) {
- debug_line_shdr = shdr + i;
- }
- else if (!strcmp(section_name, ".gnu_debuglink")) {
+ if (!strcmp(section_name, ".gnu_debuglink")) {
gnu_debuglink_shdr = shdr + i;
}
+ else {
+ const char *debug_section_names[] = {
+ ".debug_abbrev",
+ ".debug_info",
+ ".debug_line",
+ ".debug_ranges",
+ ".debug_str"
+ };
+
+ for (j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(section_name, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + shdr[i].sh_offset;
+ s->size = shdr[i].sh_size;
+ s->flags = shdr[i].sh_flags;
+ if (s->flags & SHF_COMPRESSED) {
+ s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+ if (!s->size) goto fail;
+ }
+ break;
+ }
+ }
break;
}
}
@@ -561,20 +1780,22 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
char *strtab = file + dynstr_shdr->sh_offset;
ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- Dl_info info;
- void *h, *s;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
- h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
- if (!h) continue;
- s = dlsym(h, strtab + sym->st_name);
- if (!s) continue;
- if (dladdr(s, &info)) {
- dladdr_fbase = (uintptr_t)info.dli_fbase;
- break;
- }
- }
+ void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+ if (handle) {
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ Dl_info info;
+ void *s;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+ s = dlsym(handle, strtab + sym->st_name);
+ if (s && dladdr(s, &info)) {
+ obj->base_addr = dladdr_fbase;
+ dladdr_fbase = (uintptr_t)info.dli_fbase;
+ break;
+ }
+ }
+ dlclose(handle);
+ }
if (ehdr->e_type == ET_EXEC) {
obj->base_addr = 0;
}
@@ -585,33 +1806,48 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
}
}
- if (!symtab_shdr) {
- symtab_shdr = dynsym_shdr;
- strtab_shdr = dynstr_shdr;
- }
-
- if (symtab_shdr && strtab_shdr) {
- char *strtab = file + strtab_shdr->sh_offset;
- ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
- int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
- for (i = offset; i < num_traces; i++) {
- uintptr_t d = (uintptr_t)traces[i] - saddr;
- if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
- continue;
- /* fill symbol name and addr from .symtab */
- lines[i].sname = strtab + sym->st_name;
- lines[i].saddr = saddr;
- lines[i].path = obj->path;
- lines[i].base_addr = obj->base_addr;
- }
- }
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ i = 0;
+ while (reader.p < reader.pend) {
+ /* fprintf(stderr, "%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+ if (di_read_cu(&reader)) goto use_symtab;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+ else {
+ /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+ if (!symtab_shdr) {
+ /* This file doesn't have symtab, use dynsym instead */
+ symtab_shdr = dynsym_shdr;
+ strtab_shdr = dynstr_shdr;
+ }
+
+ if (symtab_shdr && strtab_shdr) {
+ char *strtab = file + strtab_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+ int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t d = (uintptr_t)traces[i] - saddr;
+ if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+ lines[i].saddr = saddr;
+ lines[i].path = obj->path;
+ lines[i].base_addr = obj->base_addr;
+ }
+ }
+ }
}
- if (!debug_line_shdr) {
+ if (!obj->debug_line.ptr) {
/* This file doesn't have .debug_line section,
let's check .gnu_debuglink section instead. */
if (gnu_debuglink_shdr && check_debuglink) {
@@ -619,18 +1855,244 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
num_traces, traces,
objp, lines, offset);
}
+ if (note_gnu_build_id && check_debuglink) {
+ ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+ const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+ follow_debuglink_build_id(build_id, nhdr->n_descsz,
+ num_traces, traces,
+ objp, lines, offset);
+ }
goto finish;
}
- parse_debug_line(num_traces, traces,
- file + debug_line_shdr->sh_offset,
- debug_line_shdr->sh_size,
- obj, lines, offset);
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
finish:
return dladdr_fbase;
fail:
return (uintptr_t)-1;
}
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+# ifdef __LP64__
+# define LP(x) x##_64
+# else
+# define LP(x) x
+# endif
+ int fd;
+ off_t filesize;
+ char *file, *p = NULL;
+ obj_info_t *obj = *objp;
+ struct LP(mach_header) *header;
+ uintptr_t dladdr_fbase = 0;
+
+ {
+ char *s = binary_filename;
+ char *base = strrchr(binary_filename, '/')+1;
+ size_t max = PATH_MAX;
+ size_t size = strlen(binary_filename);
+ size_t basesize = size - (base - binary_filename);
+ s += size;
+ max -= size;
+ p = s;
+ size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+ if (size == 0) goto fail;
+ s += size;
+ max -= size;
+ if (max <= basesize) goto fail;
+ memcpy(s, base, basesize);
+ s[basesize] = 0;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ *p = 0; /* binary_filename becomes original file name */
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ goto fail;
+ }
+ }
+ }
+
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
+ }
+ close(fd);
+
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
+
+ header = (struct LP(mach_header) *)file;
+ if (header->magic == LP(MH_MAGIC)) {
+ /* non universal binary */
+ p = file;
+ }
+ else if (header->magic == FAT_CIGAM) {
+ struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+ struct fat_header *fat = (struct fat_header *)file;
+ char *q = file + sizeof(*fat);
+ uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+ /* fprintf(stderr,"%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+ for (uint32_t i = 0; i < nfat_arch; i++) {
+ struct fat_arch *arch = (struct fat_arch *)q;
+ cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+ cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+ uint32_t offset = __builtin_bswap32(arch->offset);
+ /* fprintf(stderr,"%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+ if (mhp->cputype == cputype &&
+ (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+ p = file + offset;
+ file = p;
+ header = (struct LP(mach_header) *)p;
+ if (header->magic == LP(MH_MAGIC)) {
+ goto found_mach_header;
+ }
+ break;
+ }
+ q += sizeof(*arch);
+ }
+ kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+ else {
+ kprintf("'%s' is not a "
+# ifdef __LP64__
+ "64"
+# else
+ "32"
+# endif
+ "-bit Mach-O file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+found_mach_header:
+ p += sizeof(*header);
+
+ for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+ struct load_command *lcmd = (struct load_command *)p;
+ switch (lcmd->cmd) {
+ case LP(LC_SEGMENT):
+ {
+ static const char *debug_section_names[] = {
+ "__debug_abbrev",
+ "__debug_info",
+ "__debug_line",
+ "__debug_ranges",
+ "__debug_str"
+ };
+ struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+ if (strcmp(scmd->segname, "__TEXT") == 0) {
+ obj->vmaddr = scmd->vmaddr;
+ }
+ else if (strcmp(scmd->segname, "__DWARF") == 0) {
+ p += sizeof(struct LP(segment_command));
+ for (uint64_t i = 0; i < scmd->nsects; i++) {
+ struct LP(section) *sect = (struct LP(section) *)p;
+ p += sizeof(struct LP(section));
+ for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(sect->sectname, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + sect->offset;
+ s->size = sect->size;
+ s->flags = sect->flags;
+ if (s->flags & SHF_COMPRESSED) {
+ goto fail;
+ }
+ break;
+ }
+ }
+ }
+ }
+ break;
+
+ case LC_SYMTAB:
+ {
+ struct symtab_command *cmd = (struct symtab_command *)lcmd;
+ struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+ char *strtab = file + cmd->stroff, *sname = 0;
+ uint32_t j;
+ uintptr_t saddr = 0;
+ /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, p); */
+ for (j = 0; j < cmd->nsyms; j++) {
+ uintptr_t symsize, d;
+ struct LP(nlist) *e = &nl[j];
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ if (e->n_type != N_FUN) continue;
+ if (e->n_sect) {
+ saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+ sname = strtab + e->n_un.n_strx;
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ continue;
+ }
+ for (int k = offset; k < num_traces; k++) {
+ d = (uintptr_t)traces[k] - saddr;
+ symsize = e->n_value;
+ /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+ if (lines[k].line > 0 || d > (uintptr_t)symsize)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[k].sname) lines[k].sname = sname;
+ lines[k].saddr = saddr;
+ lines[k].path = obj->path;
+ lines[k].base_addr = obj->base_addr;
+ }
+ }
+ }
+ }
+ p += lcmd->cmdsize;
+ }
+
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ while (reader.p < reader.pend) {
+ if (di_read_cu(&reader)) goto fail;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
+}
+#endif
#define HAVE_MAIN_EXE_PATH
#if defined(__FreeBSD__)
@@ -642,17 +2104,22 @@ fail:
* and returns strlen(binary_filename).
* it is NUL terminated.
*/
-#if defined(__linux__)
-ssize_t
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
main_exe_path(void)
{
-# define PROC_SELF_EXE "/proc/self/exe"
+# if defined(__linux__)
+# define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+# define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+ if (len < 0) return 0;
binary_filename[len] = 0;
return len;
}
#elif defined(__FreeBSD__)
-ssize_t
+static ssize_t
main_exe_path(void)
{
int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
@@ -665,10 +2132,66 @@ main_exe_path(void)
len--; /* sysctl sets strlen+1 */
return len;
}
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(void)
+{
+ int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+ if (len == 0) return 0;
+ binary_filename[len] = 0;
+ return len;
+}
#else
#undef HAVE_MAIN_EXE_PATH
#endif
+static void
+print_line0(line_info_t *line, void *address)
+{
+ uintptr_t addr = (uintptr_t)address;
+ uintptr_t d = addr - line->saddr;
+ if (!address) {
+ /* inlined */
+ if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+ }
+ }
+ else if (!line->path) {
+ kprintf("[0x%"PRIxPTR"]\n", addr);
+ }
+ else if (!line->saddr || !line->sname) {
+ kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+ }
+ else if (line->line <= 0) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+ d, addr);
+ }
+ else if (!line->filename) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+ d, addr, line->line);
+ }
+ else if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+ d, addr, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+ d, addr, line->filename, line->line);
+ }
+}
+
+static void
+print_line(line_info_t *line, void *address)
+{
+ print_line0(line, address);
+ if (line->next) {
+ print_line(line->next, NULL);
+ }
+}
+
void
rb_dump_backtrace_with_lines(int num_traces, void **traces)
{
@@ -720,8 +2243,11 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
path = info.dli_fname;
obj->path = path;
lines[i].path = path;
- strcpy(binary_filename, path);
- fill_lines(num_traces, traces, 1, &obj, lines, i);
+ lines[i].sname = info.dli_sname;
+ lines[i].saddr = (uintptr_t)info.dli_saddr;
+ strlcpy(binary_filename, path, PATH_MAX);
+ if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
+ break;
}
next_line:
continue;
@@ -729,46 +2255,36 @@ next_line:
/* output */
for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
- uintptr_t addr = (uintptr_t)traces[i];
- uintptr_t d = addr - line->saddr;
- if (!line->path) {
- kprintf("[0x%lx]\n", addr);
- }
- else if (!line->saddr || !line->sname) {
- kprintf("%s [0x%lx]\n", line->path, addr);
- }
- else if (line->line <= 0) {
- kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
- d, addr);
- }
- else if (!line->filename) {
- kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
- d, addr, line->line);
- }
- else if (line->dirname && line->dirname[0]) {
- kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
- d, addr, line->dirname, line->filename, line->line);
- }
- else {
- kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
- d, addr, line->filename, line->line);
- }
+ print_line(&lines[i], traces[i]);
+
/* FreeBSD's backtrace may show _start and so on */
- if (line->sname && strcmp("main", line->sname) == 0)
+ if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
break;
}
/* free */
while (obj) {
obj_info_t *o = obj;
- obj = o->next;
- if (o->fd) {
- munmap(o->mapped, o->mapped_size);
- close(o->fd);
+ for (i=0; i < DWARF_SECTION_COUNT; i++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+ if (s->flags & SHF_COMPRESSED) {
+ free(s->ptr);
+ }
+ }
+ if (obj->mapped_size) {
+ munmap(obj->mapped, obj->mapped_size);
}
+ obj = o->next;
free(o);
}
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = lines[i].next;
+ while (line) {
+ line_info_t *l = line;
+ line = line->next;
+ free(l);
+ }
+ }
free(lines);
free(dladdr_fbases);
}
@@ -812,10 +2328,9 @@ next_line:
#include <stdarg.h>
#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-extern int rb_toupper(int c);
-#define toupper(c) rb_toupper(c)
+static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
#define hex2ascii(hex) (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static const char hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
static inline int imax(int a, int b) { return (a > b ? a : b); }
static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
@@ -829,7 +2344,7 @@ static void putce(int c)
(void)ret;
}
-int
+static int
kprintf(const char *fmt, ...)
{
va_list ap;
diff --git a/addr2line.h b/addr2line.h
index d99f010934..f09b665800 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,3 +1,5 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
/**********************************************************************
addr2line.h -
@@ -8,10 +10,7 @@
**********************************************************************/
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
void
rb_dump_backtrace_with_lines(int num_traces, void **traces);
diff --git a/appveyor.yml b/appveyor.yml
new file mode 100644
index 0000000000..78e3102008
--- /dev/null
+++ b/appveyor.yml
@@ -0,0 +1,104 @@
+---
+version: '{build}'
+init:
+ - git config --global user.name git
+ - git config --global user.email svn-admin@ruby-lang.org
+clone_depth: 10
+platform:
+ - x64
+environment:
+ ruby_version: "24-%Platform%"
+ matrix:
+ - build: vs
+ vs: 120
+ ssl: OpenSSL
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+ GEMS_FOR_TEST: ""
+ - build: vs
+ vs: 140
+ ssl: OpenSSL-v111
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+ GEMS_FOR_TEST: ""
+ RELINE_TEST_ENCODING: "Windows-31J"
+ UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+cache:
+ - c:\Tools\vcpkg\installed\
+for:
+-
+ matrix:
+ only:
+ - build: vs
+ install:
+ - ver
+ - chcp
+ - SET BITS=%Platform:x86=32%
+ - SET BITS=%BITS:x=%
+ - SET OPENSSL_DIR=C:\%ssl%-Win%BITS%
+ - cd C:\Tools\vcpkg
+ - git pull -q
+ - .\bootstrap-vcpkg.bat
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - vcpkg --triplet %Platform%-windows install libffi libyaml zlib
+ - set PATH=c:\Tools\vcpkg\installed\%Platform%-windows\bin;%PATH%
+ - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
+ - SET vcvars
+ - '"%vcvars%" %Platform:x64=amd64%'
+ - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+ - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
+ - ruby --version
+ - 'cl'
+ - echo> Makefile srcdir=.
+ - echo>> Makefile MSC_VER=0
+ - echo>> Makefile RT=none
+ - echo>> Makefile RT_VER=0
+ - echo>> Makefile BUILTIN_ENCOBJS=nul
+ - type win32\Makefile.sub >> Makefile
+ - nmake %mflags% touch-unicode-files
+ - nmake %mflags% %UPDATE_UNICODE% incs
+ - nmake %mflags% extract-extlibs
+ - del Makefile
+ - mkdir \usr\local\bin
+ - mkdir \usr\local\include
+ - mkdir \usr\local\lib
+ - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
+ - attrib +r /s /d
+ - mkdir %Platform%-mswin_%vs%
+ build_script:
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - cd %Platform%-mswin_%vs%
+ - >-
+ ..\win32\configure.bat
+ --without-ext=+,dbm,gdbm,readline
+ --with-opt-dir="/usr/local;c:/Tools/vcpkg/installed/%Platform%-windows"
+ --with-openssl-dir=%OPENSSL_DIR:\=/%
+ - nmake -l
+ - nmake install-nodoc
+ - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
+ - if not "%GEMS_FOR_TEST%" == "" \usr\bin\gem install --no-document %GEMS_FOR_TEST%
+ - \usr\bin\ruby -ropenssl -e "puts 'Build ' + OpenSSL::OPENSSL_VERSION, 'Runtime ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
+ test_script:
+ - set /a JOBS=%NUMBER_OF_PROCESSORS%
+ - nmake -l "TESTOPTS=-v -q" btest
+ - nmake -l "TESTOPTS=-v -q" test-basic
+ - nmake -l "TESTOPTS=-v --timeout-scale=3.0 --excludes=../test/excludes/_appveyor -j%JOBS% --exclude readline --exclude win32ole --exclude test_bignum --exclude test_syntax --exclude test_open-uri --exclude test_bundled_ca" test-all
+ # separately execute tests without -j which may crash worker with -j.
+ - nmake -l "TESTOPTS=-v --timeout-scale=3.0 --excludes=../test/excludes/_appveyor" test-all TESTS="../test/win32ole ../test/ruby/test_bignum.rb ../test/ruby/test_syntax.rb ../test/open-uri/test_open-uri.rb ../test/rubygems/test_bundled_ca.rb"
+ - nmake -l test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
+notifications:
+ - provider: Webhook
+ method: POST
+ url:
+ secure: CcFlJNDJ/a6to7u3Z4Fnz6dScEPNx7hTha2GkSRlV+1U6dqmxY/7uBcLXYb9gR3jfQk6w+2o/HrjNAyXMNGU/JOka3s2WRI4VKitzM+lQ08owvJIh0R7LxrGH0J2e81U # ruby-lang slack: ruby/simpler-alerts-bot
+ body: >-
+ {{^isPullRequest}}
+ {
+ "ci": "AppVeyor CI",
+ "env": "Visual Studio 2013 / 2015",
+ "url": "{{buildUrl}}",
+ "commit": "{{commitId}}",
+ "branch": "{{branch}}"
+ }
+ {{/isPullRequest}}
+ on_build_success: false
+ on_build_failure: true
+ on_build_status_changed: false
diff --git a/array.c b/array.c
index c255e096ed..b48a6431e7 100644
--- a/array.c
+++ b/array.c
@@ -11,45 +11,87 @@
**********************************************************************/
+#include "debug_counter.h"
+#include "id.h"
#include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
#include "probes.h"
-#include "id.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/util.h"
+#include "transient_heap.h"
+#include "builtin.h"
-#ifndef ARRAY_DEBUG
+#if !ARRAY_DEBUG
+# undef NDEBUG
# define NDEBUG
#endif
-#include <assert.h>
+#include "ruby_assert.h"
VALUE rb_cArray;
-static ID id_cmp, id_div, id_power;
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
#define ARY_DEFAULT_SIZE 16
#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
-# define ARY_SHARED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+ return RB_TYPE_P(ary, T_ARRAY);
+}
+
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_not_be_shared_and_embedded(VALUE ary)
+{
+ return !FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG);
+}
+
+#define ARY_SHARED_P(ary) \
+ (assert(should_be_T_ARRAY((VALUE)(ary))), \
+ assert(should_not_be_shared_and_embedded((VALUE)ary)), \
+ FL_TEST_RAW((ary),ELTS_SHARED)!=0)
+
+#define ARY_EMBED_P(ary) \
+ (assert(should_be_T_ARRAY((VALUE)(ary))), \
+ assert(should_not_be_shared_and_embedded((VALUE)ary)), \
+ FL_TEST_RAW((ary), RARRAY_EMBED_FLAG) != 0)
#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (assert(!ARY_EMBED_P(a)), assert(!ARY_SHARED_ROOT_P(a)), \
+ RARRAY(a)->as.heap.aux.capa)
+
#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
#define ARY_EMBED_LEN(a) \
(assert(ARY_EMBED_P(a)), \
(long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
(RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (assert(should_be_T_ARRAY((VALUE)(a))), \
+ !FL_TEST_RAW((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
#define FL_SET_EMBED(a) do { \
assert(!ARY_SHARED_P(a)); \
FL_SET((a), RARRAY_EMBED_FLAG); \
+ RARY_TRANSIENT_UNSET(a); \
+ ary_verify(a); \
} while (0)
+
#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
#define FL_SET_SHARED(ary) do { \
assert(!ARY_EMBED_P(ary)); \
@@ -98,7 +140,7 @@ static ID id_cmp, id_div, id_power;
} while (0)
#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
- ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+ ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
#define ARY_SET_CAPA(ary, n) do { \
assert(!ARY_EMBED_P(ary)); \
assert(!ARY_SHARED_P(ary)); \
@@ -106,33 +148,116 @@ static ID id_cmp, id_div, id_power;
RARRAY(ary)->as.heap.aux.capa = (n); \
} while (0)
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SHARED_ROOT(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared_root)
#define ARY_SET_SHARED(ary, value) do { \
const VALUE _ary_ = (ary); \
const VALUE _value_ = (value); \
assert(!ARY_EMBED_P(_ary_)); \
assert(ARY_SHARED_P(_ary_)); \
assert(ARY_SHARED_ROOT_P(_value_)); \
- RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+ RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared_root, _value_); \
} while (0)
#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
+#define ARY_SHARED_ROOT_P(ary) (assert(should_be_T_ARRAY((VALUE)(ary))), \
+ FL_TEST_RAW((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_ROOT_REFCNT(ary) \
(assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
assert(ARY_SHARED_ROOT_P(ary)); \
RARRAY(ary)->as.heap.aux.capa = (value); \
} while (0)
#define FL_SET_SHARED_ROOT(ary) do { \
assert(!ARY_EMBED_P(ary)); \
+ assert(!RARRAY_TRANSIENT_P(ary)); \
FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
} while (0)
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+ assert(!ARY_SHARED_P(a));
+ assert(!OBJ_FROZEN(a));
+
+ RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+ assert(RB_TYPE_P(ary, T_ARRAY));
+
+ if (FL_TEST(ary, ELTS_SHARED)) {
+ VALUE root = RARRAY(ary)->as.heap.aux.shared_root;
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ const VALUE *root_ptr = RARRAY_CONST_PTR_TRANSIENT(root);
+ long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+ assert(FL_TEST(root, RARRAY_SHARED_ROOT_FLAG));
+ assert(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+ ary_verify(root);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ assert(!RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_SHARED_P(ary));
+ assert(RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX);
+ }
+ else {
+#if 1
+ const VALUE *ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ long i, len = RARRAY_LEN(ary);
+ volatile VALUE v;
+ if (len > 1) len = 1; /* check only HEAD */
+ for (i=0; i<len; i++) {
+ v = ptr[i]; /* access check */
+ }
+ v = v;
+#endif
+ }
+
+#if USE_TRANSIENT_HEAP
+ if (RARRAY_TRANSIENT_P(ary)) {
+ assert(rb_transient_heap_managed_ptr_p(RARRAY_CONST_PTR_TRANSIENT(ary)));
+ }
+#endif
+
+ rb_transient_heap_verify();
+
+ return ary;
+}
void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_ary_verify(VALUE ary)
+{
+ ary_verify(ary);
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+ return (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
{
while (size--) {
*mem++ = Qnil;
@@ -142,7 +267,7 @@ rb_mem_clear(register VALUE *mem, register long size)
static void
ary_mem_clear(VALUE ary, long beg, long size)
{
- RARRAY_PTR_USE(ary, ptr, {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
rb_mem_clear(ptr + beg, size);
});
}
@@ -158,7 +283,7 @@ memfill(register VALUE *mem, register long size, register VALUE val)
static void
ary_memfill(VALUE ary, long beg, long size, VALUE val)
{
- RARRAY_PTR_USE(ary, ptr, {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
memfill(ptr + beg, size, val);
RB_OBJ_WRITTEN(ary, Qundef, val);
});
@@ -167,28 +292,22 @@ ary_memfill(VALUE ary, long beg, long size, VALUE val)
static void
ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
{
-#if 1
assert(!ARY_SHARED_P(buff_owner_ary));
if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
- rb_gc_writebarrier_remember(buff_owner_ary);
- RARRAY_PTR_USE(ary, ptr, {
- MEMCPY(ptr+beg, argv, VALUE, argc);
- });
+ rb_gc_writebarrier_remember(buff_owner_ary);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMCPY(ptr+beg, argv, VALUE, argc);
+ });
}
else {
- int i;
- RARRAY_PTR_USE(ary, ptr, {
- for (i=0; i<argc; i++) {
- RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
- }
- });
+ int i;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ for (i=0; i<argc; i++) {
+ RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+ }
+ });
}
-#else
- /* giveup write barrier (traditional way) */
- RARRAY_PTR(buff_owner_ary);
- MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
}
static void
@@ -197,49 +316,175 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
ary_memcpy0(ary, beg, argc, argv, ary);
}
+static VALUE *
+ary_heap_alloc(VALUE ary, size_t capa)
+{
+ VALUE *ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * capa);
+
+ if (ptr != NULL) {
+ RARY_TRANSIENT_SET(ary);
+ }
+ else {
+ RARY_TRANSIENT_UNSET(ary);
+ ptr = ALLOC_N(VALUE, capa);
+ }
+
+ return ptr;
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ /* ignore it */
+ }
+ else {
+ ruby_sized_xfree((void *)ptr, size);
+ }
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+}
+
+static void
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+ size_t old_capa = ARY_HEAP_CAPA(ary);
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ if (new_capa <= old_capa) {
+ /* do nothing */
+ }
+ else {
+ VALUE *new_ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * new_capa);
+
+ if (new_ptr == NULL) {
+ new_ptr = ALLOC_N(VALUE, new_capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+
+ MEMCPY(new_ptr, ARY_HEAP_PTR(ary), VALUE, old_capa);
+ ARY_SET_PTR(ary, new_ptr);
+ }
+ }
+ else {
+ SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, old_capa);
+ }
+ ary_verify(ary);
+}
+
+#if USE_TRANSIENT_HEAP
+static inline void
+rb_ary_transient_heap_evacuate_(VALUE ary, int transient, int promote)
+{
+ if (transient) {
+ VALUE *new_ptr;
+ const VALUE *old_ptr = ARY_HEAP_PTR(ary);
+ long capa = ARY_HEAP_CAPA(ary);
+ long len = ARY_HEAP_LEN(ary);
+
+ if (ARY_SHARED_ROOT_P(ary)) {
+ capa = len;
+ }
+
+ assert(ARY_OWNS_HEAP_P(ary));
+ assert(RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_PTR_USING_P(ary));
+
+ if (promote) {
+ new_ptr = ALLOC_N(VALUE, capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ new_ptr = ary_heap_alloc(ary, capa);
+ }
+
+ MEMCPY(new_ptr, old_ptr, VALUE, capa);
+ /* do not use ARY_SET_PTR() because they assert !frozen */
+ RARRAY(ary)->as.heap.ptr = new_ptr;
+ }
+
+ ary_verify(ary);
+}
+
+void
+rb_ary_transient_heap_evacuate(VALUE ary, int promote)
+{
+ rb_ary_transient_heap_evacuate_(ary, RARRAY_TRANSIENT_P(ary), promote);
+}
+
+void
+rb_ary_detransient(VALUE ary)
+{
+ assert(RARRAY_TRANSIENT_P(ary));
+ rb_ary_transient_heap_evacuate_(ary, TRUE, TRUE);
+}
+#else
+void
+rb_ary_detransient(VALUE ary)
+{
+ /* do nothing */
+}
+#endif
+
static void
ary_resize_capa(VALUE ary, long capacity)
{
assert(RARRAY_LEN(ary) <= capacity);
assert(!OBJ_FROZEN(ary));
assert(!ARY_SHARED_P(ary));
+
if (capacity > RARRAY_EMBED_LEN_MAX) {
if (ARY_EMBED_P(ary)) {
long len = ARY_EMBED_LEN(ary);
- VALUE *ptr = ALLOC_N(VALUE, (capacity));
+ VALUE *ptr = ary_heap_alloc(ary, capacity);
+
MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
FL_UNSET_EMBED(ary);
ARY_SET_PTR(ary, ptr);
ARY_SET_HEAP_LEN(ary, len);
}
else {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+ ary_heap_realloc(ary, capacity);
}
- ARY_SET_CAPA(ary, (capacity));
+ ARY_SET_CAPA(ary, capacity);
}
else {
if (!ARY_EMBED_P(ary)) {
- long len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
+ long len = ARY_HEAP_LEN(ary);
+ long old_capa = ARY_HEAP_CAPA(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
- if (len > capacity) len = capacity;
+ if (len > capacity) len = capacity;
MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+ ary_heap_free_ptr(ary, ptr, old_capa);
+
FL_SET_EMBED(ary);
ARY_SET_LEN(ary, len);
- ruby_xfree((VALUE *)ptr);
}
}
+
+ ary_verify(ary);
}
static inline void
ary_shrink_capa(VALUE ary)
{
long capacity = ARY_HEAP_LEN(ary);
- long old_capa = RARRAY(ary)->as.heap.aux.capa;
+ long old_capa = ARY_HEAP_CAPA(ary);
assert(!ARY_SHARED_P(ary));
assert(old_capa >= capacity);
- if (old_capa > capacity)
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+ if (old_capa > capacity) ary_heap_realloc(ary, capacity);
+
+ ary_verify(ary);
}
static void
@@ -255,19 +500,21 @@ ary_double_capa(VALUE ary, long min)
}
new_capa += min;
ary_resize_capa(ary, new_capa);
+
+ ary_verify(ary);
}
static void
-rb_ary_decrement_share(VALUE shared)
+rb_ary_decrement_share(VALUE shared_root)
{
- if (shared) {
- long num = ARY_SHARED_NUM(shared) - 1;
+ if (shared_root) {
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root) - 1;
if (num == 0) {
- rb_ary_free(shared);
- rb_gc_force_recycle(shared);
+ rb_ary_free(shared_root);
+ rb_gc_force_recycle(shared_root);
}
else if (num > 0) {
- ARY_SET_SHARED_NUM(shared, num);
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num);
}
}
}
@@ -275,8 +522,8 @@ rb_ary_decrement_share(VALUE shared)
static void
rb_ary_unshare(VALUE ary)
{
- VALUE shared = RARRAY(ary)->as.heap.aux.shared;
- rb_ary_decrement_share(shared);
+ VALUE shared_root = RARRAY(ary)->as.heap.aux.shared_root;
+ rb_ary_decrement_share(shared_root);
FL_UNSET_SHARED(ary);
}
@@ -289,65 +536,77 @@ rb_ary_unshare_safe(VALUE ary)
}
static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_increment_share(VALUE shared_root)
{
- long num = ARY_SHARED_NUM(shared);
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root);
if (num >= 0) {
- ARY_SET_SHARED_NUM(shared, num + 1);
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
}
- return shared;
+ return shared_root;
}
static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
{
- rb_ary_increment_share(shared);
+ rb_ary_increment_share(shared_root);
FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, shared);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, shared_root);
}
static inline void
rb_ary_modify_check(VALUE ary)
{
rb_check_frozen(ary);
+ ary_verify(ary);
}
void
-rb_ary_modify(VALUE ary)
+rb_ary_cancel_sharing(VALUE ary)
{
- rb_ary_modify_check(ary);
if (ARY_SHARED_P(ary)) {
- long shared_len, len = RARRAY_LEN(ary);
- VALUE shared = ARY_SHARED(ary);
+ long shared_len, len = RARRAY_LEN(ary);
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+ ary_verify(shared_root);
+
if (len <= RARRAY_EMBED_LEN_MAX) {
- const VALUE *ptr = ARY_HEAP_PTR(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
FL_UNSET_SHARED(ary);
FL_SET_EMBED(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
- rb_ary_decrement_share(shared);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+ rb_ary_decrement_share(shared_root);
ARY_SET_EMBED_LEN(ary, len);
}
- else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
- long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
- FL_UNSET_SHARED(ary);
- ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
- ARY_SET_CAPA(ary, shared_len);
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+shift, VALUE, len);
- });
- FL_SET_EMBED(shared);
- rb_ary_decrement_share(shared);
- }
+ else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+ long shift = RARRAY_CONST_PTR_TRANSIENT(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root);
+ FL_UNSET_SHARED(ary);
+ ARY_SET_PTR(ary, RARRAY_CONST_PTR_TRANSIENT(shared_root));
+ ARY_SET_CAPA(ary, shared_len);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+shift, VALUE, len);
+ });
+ FL_SET_EMBED(shared_root);
+ rb_ary_decrement_share(shared_root);
+ }
else {
- VALUE *ptr = ALLOC_N(VALUE, len);
- MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+ VALUE *ptr = ary_heap_alloc(ary, len);
+ MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
rb_ary_unshare(ary);
ARY_SET_CAPA(ary, len);
ARY_SET_PTR(ary, ptr);
}
- rb_gc_writebarrier_remember(ary);
+ rb_gc_writebarrier_remember(ary);
}
+ ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+ rb_ary_modify_check(ary);
+ rb_ary_cancel_sharing(ary);
}
static VALUE
@@ -362,11 +621,14 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
}
if (ARY_SHARED_P(ary)) {
if (new_len > RARRAY_EMBED_LEN_MAX) {
- VALUE shared = ARY_SHARED(ary);
- if (ARY_SHARED_OCCUPIED(shared)) {
- if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
rb_ary_modify_check(ary);
- return shared;
+
+ ary_verify(ary);
+ ary_verify(shared_root);
+ return shared_root;
}
else {
/* if array is shared, then it is likely it participate in push/shift pattern */
@@ -375,28 +637,37 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
if (new_len > capa - (capa >> 6)) {
ary_double_capa(ary, new_len);
}
+ ary_verify(ary);
return ary;
}
}
}
+ ary_verify(ary);
+ rb_ary_modify(ary);
+ }
+ else {
+ rb_ary_modify_check(ary);
}
- rb_ary_modify(ary);
capa = ARY_CAPA(ary);
if (new_len > capa) {
ary_double_capa(ary, new_len);
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.freeze -> ary
+ * array.freeze -> self
*
- * Calls Object#freeze on +ary+ to prevent any further
- * modification. A RuntimeError will be raised if a modification
- * attempt is made.
+ * Freezes +self+; returns +self+:
+ * a = []
+ * a.frozen? # => false
+ * a.freeze
+ * a.frozen? # => true
*
+ * An attempt to modify a frozen \Array raises FrozenError.
*/
VALUE
@@ -405,21 +676,6 @@ rb_ary_freeze(VALUE ary)
return rb_obj_freeze(ary);
}
-/*
- * call-seq:
- * ary.frozen? -> true or false
- *
- * Return +true+ if this array is frozen (or temporarily frozen
- * while being sorted). See also Object#frozen?
- */
-
-static VALUE
-rb_ary_frozen_p(VALUE ary)
-{
- if (OBJ_FROZEN(ary)) return Qtrue;
- return Qfalse;
-}
-
/* This can be used to take a snapshot of an array (with
e.g. rb_ary_replace) and check later whether the array has been
modified from the snapshot. The snapshot is cheap, though if
@@ -432,7 +688,7 @@ rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
{
if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
- RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
+ RARRAY(ary1)->as.heap.aux.shared_root == RARRAY(ary2)->as.heap.aux.shared_root &&
RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
return Qtrue;
}
@@ -453,10 +709,7 @@ ary_alloc(VALUE klass)
static VALUE
empty_ary_alloc(VALUE klass)
{
- if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
- RUBY_DTRACE_ARRAY_CREATE(0, rb_sourcefile(), rb_sourceline());
- }
-
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
return ary_alloc(klass);
}
@@ -472,13 +725,11 @@ ary_new(VALUE klass, long capa)
rb_raise(rb_eArgError, "array size too big");
}
- if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
- RUBY_DTRACE_ARRAY_CREATE(capa, rb_sourcefile(), rb_sourceline());
- }
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
ary = ary_alloc(klass);
if (capa > RARRAY_EMBED_LEN_MAX) {
- ptr = ALLOC_N(VALUE, capa);
+ ptr = ary_heap_alloc(ary, capa);
FL_UNSET_EMBED(ary);
ARY_SET_PTR(ary, ptr);
ARY_SET_CAPA(ary, capa);
@@ -519,12 +770,70 @@ VALUE
return ary;
}
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
+{
+ VALUE ary;
+
+ ary = ary_new(klass, n);
+ if (n > 0 && elts) {
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
+ }
+
+ return ary;
+}
+
VALUE
rb_ary_new_from_values(long n, const VALUE *elts)
{
+ return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
+
+static VALUE
+ec_ary_alloc(rb_execution_context_t *ec, VALUE klass)
+{
+ RB_EC_NEWOBJ_OF(ec, ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+ /* Created array is:
+ * FL_SET_EMBED((VALUE)ary);
+ * ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ */
+ return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+ VALUE ary,*ptr;
+
+ if (capa < 0) {
+ rb_raise(rb_eArgError, "negative array size (or size too big)");
+ }
+ if (capa > ARY_MAX_SIZE) {
+ rb_raise(rb_eArgError, "array size too big");
+ }
+
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+ ary = ec_ary_alloc(ec, klass);
+
+ if (capa > RARRAY_EMBED_LEN_MAX) {
+ ptr = ary_heap_alloc(ary, capa);
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_CAPA(ary, capa);
+ ARY_SET_HEAP_LEN(ary, 0);
+ }
+
+ return ary;
+}
+
+VALUE
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
+{
VALUE ary;
- ary = rb_ary_new2(n);
+ ary = ec_ary_new(ec, rb_cArray, n);
if (n > 0 && elts) {
ary_memcpy(ary, 0, n, elts);
ARY_SET_LEN(ary, n);
@@ -536,7 +845,9 @@ rb_ary_new_from_values(long n, const VALUE *elts)
VALUE
rb_ary_tmp_new(long capa)
{
- return ary_new(0, capa);
+ VALUE ary = ary_new(0, capa);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ return ary;
}
VALUE
@@ -545,6 +856,7 @@ rb_ary_tmp_new_fill(long capa)
VALUE ary = ary_new(0, capa);
ary_memfill(ary, 0, capa, Qnil);
ARY_SET_LEN(ary, capa);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
return ary;
}
@@ -552,7 +864,29 @@ void
rb_ary_free(VALUE ary)
{
if (ARY_OWNS_HEAP_P(ary)) {
- ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ if (USE_DEBUG_COUNTER &&
+ !ARY_SHARED_ROOT_P(ary) &&
+ ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+ }
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_transient);
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+ ary_heap_free(ary);
+ }
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_embed);
+ }
+
+ if (ARY_SHARED_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared);
+ }
+ if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
}
}
@@ -560,7 +894,7 @@ RUBY_FUNC_EXPORTED size_t
rb_ary_memsize(VALUE ary)
{
if (ARY_OWNS_HEAP_P(ary)) {
- return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+ return ARY_CAPA(ary) * sizeof(VALUE);
}
else {
return 0;
@@ -572,39 +906,52 @@ ary_discard(VALUE ary)
{
rb_ary_free(ary);
RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
+ RBASIC(ary)->flags &= ~(RARRAY_EMBED_LEN_MASK | RARRAY_TRANSIENT_FLAG);
}
static VALUE
ary_make_shared(VALUE ary)
{
assert(!ARY_EMBED_P(ary));
+ ary_verify(ary);
+
if (ARY_SHARED_P(ary)) {
- return ARY_SHARED(ary);
+ return ARY_SHARED_ROOT(ary);
}
else if (ARY_SHARED_ROOT_P(ary)) {
return ary;
}
else if (OBJ_FROZEN(ary)) {
+ rb_ary_transient_heap_evacuate(ary, TRUE);
ary_shrink_capa(ary);
FL_SET_SHARED_ROOT(ary);
- ARY_SET_SHARED_NUM(ary, 1);
+ ARY_SET_SHARED_ROOT_REFCNT(ary, 1);
return ary;
}
else {
long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+ const VALUE *ptr;
NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
- FL_UNSET_EMBED(shared);
+ VALUE vshared = (VALUE)shared;
+
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ ptr = ARY_HEAP_PTR(ary);
- ARY_SET_LEN((VALUE)shared, capa);
- ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
- ary_mem_clear((VALUE)shared, len, capa - len);
- FL_SET_SHARED_ROOT(shared);
- ARY_SET_SHARED_NUM((VALUE)shared, 1);
+ FL_UNSET_EMBED(vshared);
+ ARY_SET_LEN(vshared, capa);
+ ARY_SET_PTR(vshared, ptr);
+ ary_mem_clear(vshared, len, capa - len);
+ FL_SET_SHARED_ROOT(vshared);
+ ARY_SET_SHARED_ROOT_REFCNT(vshared, 1);
FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, (VALUE)shared);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, vshared);
+ OBJ_FREEZE(vshared);
+
+ ary_verify(vshared);
+ ary_verify(ary);
+
+ return vshared;
}
}
@@ -615,7 +962,7 @@ ary_make_substitution(VALUE ary)
if (len <= RARRAY_EMBED_LEN_MAX) {
VALUE subst = rb_ary_new2(len);
- ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+ ary_memcpy(subst, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_EMBED_LEN(subst, len);
return subst;
}
@@ -630,35 +977,37 @@ rb_assoc_new(VALUE car, VALUE cdr)
return rb_ary_new3(2, car, cdr);
}
-static VALUE
-to_ary(VALUE ary)
+VALUE
+rb_to_array_type(VALUE ary)
{
- return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
}
+#define to_ary rb_to_array_type
VALUE
rb_check_array_type(VALUE ary)
{
- return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_check_to_array(VALUE ary)
+{
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
}
/*
* call-seq:
- * Array.try_convert(obj) -> array or nil
+ * Array.try_convert(object) -> object, new_array, or nil
*
- * Tries to convert +obj+ into an array, using +to_ary+ method. Returns the
- * converted array or +nil+ if +obj+ cannot be converted for any reason.
- * This method can be used to check if an argument is an array.
+ * If +object+ is an \Array object, returns +object+.
*
- * Array.try_convert([1]) #=> [1]
- * Array.try_convert("1") #=> nil
+ * Otherwise if +object+ responds to <tt>:to_ary</tt>,
+ * calls <tt>object.to_ary</tt> and returns the result.
*
- * if tmp = Array.try_convert(arg)
- * # the argument is an array
- * elsif tmp = String.try_convert(arg)
- * # the argument is a string
- * end
+ * Returns +nil+ if +object+ does not respond to <tt>:to_ary</tt>
*
+ * Raises an exception unless <tt>object.to_ary</tt> returns an \Array object.
*/
static VALUE
@@ -669,58 +1018,46 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
/*
* call-seq:
- * Array.new(size=0, default=nil)
- * Array.new(array)
- * Array.new(size) {|index| block }
- *
- * Returns a new array.
- *
- * In the first form, if no arguments are sent, the new array will be empty.
- * When a +size+ and an optional +default+ are sent, an array is created with
- * +size+ copies of +default+. Take notice that all elements will reference the
- * same object +default+.
- *
- * The second form creates a copy of the array passed as a parameter (the
- * array is generated by calling to_ary on the parameter).
- *
- * first_array = ["Matz", "Guido"]
- *
- * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
- *
- * first_array.equal? second_array #=> false
- *
- * In the last form, an array of the given size is created. Each element in
- * this array is created by passing the element's index to the given block
- * and storing the return value.
- *
- * Array.new(3){ |index| index ** 2 }
- * # => [0, 1, 4]
- *
- * == Common gotchas
- *
- * When sending the second parameter, the same object will be used as the
- * value for all the array elements:
- *
- * a = Array.new(2, Hash.new)
- * # => [{}, {}]
- *
- * a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
- * a[1]['cat'] = 'Felix'
- * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- * Since all the Array elements store the same hash, changes to one of them
- * will affect them all.
- *
- * If multiple copies are what you want, you should use the block
- * version which uses the result of that block each time an element
- * of the array needs to be initialized:
- *
- * a = Array.new(2) { Hash.new }
- * a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {}]
- *
+ * Array.new -> new_empty_array
+ * Array.new(array) -> new_array
+ * Array.new(size) -> new_array
+ * Array.new(size, default_value) -> new_array
+ * Array.new(size) {|index| ... } -> new_array
+ *
+ * Returns a new \Array.
+ *
+ * With no block and no arguments, returns a new empty \Array object.
+ *
+ * With no block and a single \Array argument +array+,
+ * returns a new \Array formed from +array+:
+ * a = Array.new([:foo, 'bar', 2])
+ * a.class # => Array
+ * a # => [:foo, "bar", 2]
+ *
+ * With no block and a single \Integer argument +size+,
+ * returns a new \Array of the given size
+ * whose elements are all +nil+:
+ * a = Array.new(3)
+ * a # => [nil, nil, nil]
+ *
+ * With no block and arguments +size+ and +default_value+,
+ * returns an \Array of the given size;
+ * each element is that same +default_value+:
+ * a = Array.new(3, 'x')
+ * a # => ['x', 'x', 'x']
+ *
+ * With a block and argument +size+,
+ * returns an \Array of the given size;
+ * the block is called with each successive integer +index+;
+ * the element for that +index+ is the return value from the block:
+ * a = Array.new(3) {|index| "Element #{index}" }
+ * a # => ["Element 0", "Element 1", "Element 2"]
+ *
+ * Raises ArgumentError if +size+ is negative.
+ *
+ * With a block and no argument,
+ * or a single argument +0+,
+ * ignores the block and returns a new empty \Array.
*/
static VALUE
@@ -731,8 +1068,8 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
rb_ary_modify(ary);
if (argc == 0) {
- if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
- ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
+ if (ARY_OWNS_HEAP_P(ary) && ARY_HEAP_PTR(ary) != NULL) {
+ ary_heap_free(ary);
}
rb_ary_unshare_safe(ary);
FL_SET_EMBED(ary);
@@ -783,7 +1120,7 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
/*
* Returns a new array populated with the given objects.
*
- * Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ * Array.[]( 1, 'a', /^A/) # => [1, "a", /^A/]
* Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
* [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
*/
@@ -839,7 +1176,7 @@ ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
if (len <= RARRAY_EMBED_LEN_MAX) {
VALUE result = ary_alloc(klass);
- ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+ ary_memcpy(result, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary) + offset);
ARY_SET_EMBED_LEN(result, len);
return result;
}
@@ -848,20 +1185,69 @@ ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
FL_UNSET_EMBED(result);
shared = ary_make_shared(ary);
- ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+ ARY_SET_PTR(result, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_LEN(result, RARRAY_LEN(ary));
rb_ary_set_shared(result, shared);
ARY_INCREASE_PTR(result, offset);
ARY_SET_LEN(result, len);
+
+ ary_verify(shared);
+ ary_verify(result);
return result;
}
}
static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+ assert(offset >= 0);
+ assert(len >= 0);
+ assert(offset+len <= RARRAY_LEN(ary));
+ assert(step != 0);
+
+ const VALUE *values = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long orig_len = len;
+
+ if ((step > 0 && step >= len) || (step < 0 && (step < -len))) {
+ VALUE result = ary_new(klass, 1);
+ VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+ RB_OBJ_WRITE(result, ptr, values[offset]);
+ ARY_SET_EMBED_LEN(result, 1);
+ return result;
+ }
+
+ long ustep = (step < 0) ? -step : step;
+ len = (len + ustep - 1) / ustep;
+
+ long i;
+ long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+ VALUE result = ary_new(klass, len);
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+ for (i = 0; i < len; ++i) {
+ RB_OBJ_WRITE(result, ptr+i, values[j]);
+ j += step;
+ }
+ ARY_SET_EMBED_LEN(result, len);
+ }
+ else {
+ RARRAY_PTR_USE_TRANSIENT(result, ptr, {
+ for (i = 0; i < len; ++i) {
+ RB_OBJ_WRITE(result, ptr+i, values[j]);
+ j += step;
+ }
+ });
+ ARY_SET_LEN(result, len);
+ }
+
+ return result;
+}
+
+static VALUE
ary_make_shared_copy(VALUE ary)
{
- return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
}
enum ary_take_pos_flags
@@ -873,13 +1259,17 @@ enum ary_take_pos_flags
static VALUE
ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
{
- VALUE nv;
long n;
long len;
long offset = 0;
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
+ argc = rb_check_arity(argc, 0, 1);
+ /* the case optional argument is omitted should be handled in
+ * callers of this function. if another arity case is added,
+ * this arity check needs to rewrite. */
+ RUBY_ASSERT_ALWAYS(argc == 1);
+
+ n = NUM2LONG(argv[0]);
len = RARRAY_LEN(ary);
if (n > len) {
n = len;
@@ -895,26 +1285,28 @@ ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos
/*
* call-seq:
- * ary << obj -> ary
- *
- * Append---Pushes the given object on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together.
+ * array << object -> self
*
- * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
+ * Appends +object+ to +self+; returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a << :baz # => [:foo, "bar", 2, :baz]
*
+ * Appends +object+ as one element, even if it is another \Array:
+ * a = [:foo, 'bar', 2]
+ * a1 = a << [3, 4]
+ * a1 # => [:foo, "bar", 2, [3, 4]]
*/
VALUE
rb_ary_push(VALUE ary, VALUE item)
{
- long idx = RARRAY_LEN(ary);
+ long idx = RARRAY_LEN((ary_verify(ary), ary));
VALUE target_ary = ary_ensure_room_for_push(ary, 1);
- RARRAY_PTR_USE(ary, ptr, {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
RB_OBJ_WRITE(target_ary, &ptr[idx], item);
});
ARY_SET_LEN(ary, idx + 1);
+ ary_verify(ary);
return ary;
}
@@ -930,18 +1322,22 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
/*
* call-seq:
- * ary.push(obj, ... ) -> ary
- *
- * Append --- Pushes the given object(s) on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together. See also Array#pop for the opposite
- * effect.
- *
- * a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
- * #=> ["a", "b", "c", "d", "e", "f"]
- * [1, 2, 3,].push(4).push(5)
- * #=> [1, 2, 3, 4, 5]
+ * array.push(*objects) -> self
+ *
+ * Appends trailing elements.
+ *
+ * Appends each argument in +objects+ to +self+; returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a.push(:baz, :bat) # => [:foo, "bar", 2, :baz, :bat]
+ *
+ * Appends each argument as one element, even if it is another \Array:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.push([:baz, :bat], [:bam, :bad])
+ * a1 # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ * Array#append is an alias for \Array#push.
+ *
+ * Related: #pop, #shift, #unshift.
*/
static VALUE
@@ -965,25 +1361,36 @@ rb_ary_pop(VALUE ary)
}
--n;
ARY_SET_LEN(ary, n);
+ ary_verify(ary);
return RARRAY_AREF(ary, n);
}
/*
* call-seq:
- * ary.pop -> obj or nil
- * ary.pop(n) -> new_ary
+ * array.pop -> object or nil
+ * array.pop(n) -> new_array
+ *
+ * Removes and returns trailing elements.
*
- * Removes the last element from +self+ and returns it, or
- * +nil+ if the array is empty.
+ * When no argument is given and +self+ is not empty,
+ * removes and returns the last element:
+ * a = [:foo, 'bar', 2]
+ * a.pop # => 2
+ * a # => [:foo, "bar"]
*
- * If a number +n+ is given, returns an array of the last +n+ elements
- * (or less) just like <code>array.slice!(-n, n)</code> does. See also
- * Array#push for the opposite effect.
+ * Returns +nil+ if the array is empty.
*
- * a = [ "a", "b", "c", "d" ]
- * a.pop #=> "d"
- * a.pop(2) #=> ["b", "c"]
- * a #=> ["a"]
+ * When a non-negative \Integer argument +n+ is given and is in range,
+ * removes and returns the last +n+ elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.pop(2) # => ["bar", 2]
+ *
+ * If +n+ is positive and out of range,
+ * removes and returns all elements:
+ * a = [:foo, 'bar', 2]
+ * a.pop(50) # => [:foo, "bar", 2]
+ *
+ * Related: #push, #shift, #unshift.
*/
static VALUE
@@ -998,6 +1405,7 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
rb_ary_modify_check(ary);
result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+ ary_verify(ary);
return result;
}
@@ -1012,10 +1420,11 @@ rb_ary_shift(VALUE ary)
top = RARRAY_AREF(ary, 0);
if (!ARY_SHARED_P(ary)) {
if (len < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE(ary, ptr, {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
MEMMOVE(ptr, ptr+1, VALUE, len-1);
}); /* WB: no new reference */
ARY_INCREASE_LEN(ary, -1);
+ ary_verify(ary);
return top;
}
assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
@@ -1023,36 +1432,45 @@ rb_ary_shift(VALUE ary)
ARY_SET(ary, 0, Qnil);
ary_make_shared(ary);
}
- else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
- RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+ else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, ptr[0] = Qnil);
}
ARY_INCREASE_PTR(ary, 1); /* shift ptr */
ARY_INCREASE_LEN(ary, -1);
+ ary_verify(ary);
+
return top;
}
/*
* call-seq:
- * ary.shift -> obj or nil
- * ary.shift(n) -> new_ary
+ * array.shift -> object or nil
+ * array.shift(n) -> new_array
+ *
+ * Removes and returns leading elements.
+ *
+ * When no argument is given, removes and returns the first element:
+ * a = [:foo, 'bar', 2]
+ * a.shift # => :foo
+ * a # => ['bar', 2]
*
- * Removes the first element of +self+ and returns it (shifting all
- * other elements down by one). Returns +nil+ if the array
- * is empty.
+ * Returns +nil+ if +self+ is empty.
*
- * If a number +n+ is given, returns an array of the first +n+ elements
- * (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- * containing only the remainder elements, not including what was shifted to
- * +new_ary+. See also Array#unshift for the opposite effect.
+ * When positive \Integer argument +n+ is given, removes the first +n+ elements;
+ * returns those elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.shift(2) # => [:foo, 'bar']
+ * a # => [2]
*
- * args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
+ * If +n+ is as large as or larger than <tt>self.length</tt>,
+ * removes all elements; returns those elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.shift(3) # => [:foo, 'bar', 2]
*
- * args = [ "-m", "-q", "filename" ]
- * args.shift(2) #=> ["-m", "-q"]
- * args #=> ["filename"]
+ * If +n+ is zero, returns a new empty \Array; +self+ is unmodified.
+ *
+ * Related: #push, #pop, #unshift.
*/
static VALUE
@@ -1068,44 +1486,80 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
rb_ary_modify_check(ary);
result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
n = RARRAY_LEN(result);
- if (ARY_SHARED_P(ary)) {
- if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
- ary_mem_clear(ary, 0, n);
- }
- ARY_INCREASE_PTR(ary, n);
+ rb_ary_behead(ary,n);
+
+ return result;
+}
+
+static VALUE
+behead_shared(VALUE ary, long n)
+{
+ assert(ARY_SHARED_P(ary));
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+ ary_mem_clear(ary, 0, n);
+ }
+ ARY_INCREASE_PTR(ary, n);
+ ARY_INCREASE_LEN(ary, -n);
+ ary_verify(ary);
+ return ary;
+}
+
+static VALUE
+behead_transient(VALUE ary, long n)
+{
+ rb_ary_modify_check(ary);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
+ }); /* WB: no new reference */
+ ARY_INCREASE_LEN(ary, -n);
+ ary_verify(ary);
+ return ary;
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_behead(VALUE ary, long n)
+{
+ if (n <= 0) {
+ return ary;
+ }
+ else if (ARY_SHARED_P(ary)) {
+ return behead_shared(ary, n);
+ }
+ else if (RARRAY_LEN(ary) >= ARY_DEFAULT_SIZE) {
+ ary_make_shared(ary);
+ return behead_shared(ary, n);
}
else {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary)-n);
- }); /* WB: no new reference */
+ return behead_transient(ary, n);
}
- ARY_INCREASE_LEN(ary, -n);
+}
- return result;
+static VALUE
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+ if (head - sharedp < argc) {
+ long room = capa - len - argc;
+
+ room -= room >> 4;
+ MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+ head = sharedp + argc + room;
+ }
+ ARY_SET_PTR(ary, head - argc);
+ assert(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+ ary_verify(ary);
+ return ARY_SHARED_ROOT(ary);
}
static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+ary_modify_for_unshift(VALUE ary, int argc)
{
long len = RARRAY_LEN(ary);
long new_len = len + argc;
long capa;
const VALUE *head, *sharedp;
- if (len > ARY_MAX_SIZE - argc) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
- }
-
- if (ARY_SHARED_P(ary)) {
- VALUE shared = ARY_SHARED(ary);
- capa = RARRAY_LEN(shared);
- if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
- head = RARRAY_CONST_PTR(ary);
- sharedp = RARRAY_CONST_PTR(shared);
- goto makeroom_if_need;
- }
- }
-
rb_ary_modify(ary);
capa = ARY_CAPA(ary);
if (capa - (capa >> 6) <= new_len) {
@@ -1114,45 +1568,69 @@ ary_ensure_room_for_unshift(VALUE ary, int argc)
/* use shared array for big "queues" */
if (new_len > ARY_DEFAULT_SIZE * 4) {
- /* make a room for unshifted items */
+ ary_verify(ary);
+
+ /* make a room for unshifted items */
capa = ARY_CAPA(ary);
ary_make_shared(ary);
- head = sharedp = RARRAY_CONST_PTR(ary);
- goto makeroom;
- makeroom_if_need:
- if (head - sharedp < argc) {
- long room;
- makeroom:
- room = capa - new_len;
- room -= room >> 4;
- MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
- head = sharedp + argc + room;
- }
- ARY_SET_PTR(ary, head - argc);
- assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
- return ARY_SHARED(ary);
+ head = sharedp = RARRAY_CONST_PTR_TRANSIENT(ary);
+ return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
}
else {
/* sliding items */
- RARRAY_PTR_USE(ary, ptr, {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
MEMMOVE(ptr + argc, ptr, VALUE, len);
});
+ ary_verify(ary);
return ary;
}
}
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+ long len = RARRAY_LEN(ary);
+ long new_len = len + argc;
+
+ if (len > ARY_MAX_SIZE - argc) {
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ }
+ else if (! ARY_SHARED_P(ary)) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ long capa = RARRAY_LEN(shared_root);
+
+ if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else if (new_len > capa) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else {
+ const VALUE * head = RARRAY_CONST_PTR_TRANSIENT(ary);
+ void *sharedp = (void *)RARRAY_CONST_PTR_TRANSIENT(shared_root);
+
+ rb_ary_modify_check(ary);
+ return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+ }
+ }
+}
+
/*
* call-seq:
- * ary.unshift(obj, ...) -> ary
+ * array.unshift(*objects) -> self
*
- * Prepends objects to the front of +self+, moving other elements upwards.
- * See also Array#shift for the opposite effect.
+ * Prepends the given +objects+ to +self+:
+ * a = [:foo, 'bar', 2]
+ * a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
*
- * a = [ "b", "c", "d" ]
- * a.unshift("a") #=> ["a", "b", "c", "d"]
- * a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
+ * Array#prepend is an alias for Array#unshift.
+ *
+ * Related: #push, #pop, #shift.
*/
static VALUE
@@ -1193,14 +1671,11 @@ rb_ary_elt(VALUE ary, long offset)
VALUE
rb_ary_entry(VALUE ary, long offset)
{
- if (offset < 0) {
- offset += RARRAY_LEN(ary);
- }
- return rb_ary_elt(ary, offset);
+ return rb_ary_entry_internal(ary, offset);
}
VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
{
VALUE klass;
long alen = RARRAY_LEN(ary);
@@ -1211,96 +1686,172 @@ rb_ary_subseq(VALUE ary, long beg, long len)
if (alen < len || alen < beg + len) {
len = alen - beg;
}
- klass = rb_obj_class(ary);
+ klass = rb_cArray;
if (len == 0) return ary_new(klass, 0);
+ if (step == 0)
+ rb_raise(rb_eArgError, "slice step cannot be zero");
+ if (step == 1)
+ return ary_make_partial(ary, klass, beg, len);
+ else
+ return ary_make_partial_step(ary, klass, beg, len, step);
+}
- return ary_make_partial(ary, klass, beg, len);
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+ return rb_ary_subseq_step(ary, beg, len, 1);
}
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
/*
* call-seq:
- * ary[index] -> obj or nil
- * ary[start, length] -> new_ary or nil
- * ary[range] -> new_ary or nil
- * ary.slice(index) -> obj or nil
- * ary.slice(start, length) -> new_ary or nil
- * ary.slice(range) -> new_ary or nil
- *
- * Element Reference --- Returns the element at +index+, or returns a
- * subarray starting at the +start+ index and continuing for +length+
- * elements, or returns a subarray specified by +range+ of indices.
- *
- * Negative indices count backward from the end of the array (-1 is the last
- * element). For +start+ and +range+ cases the starting index is just before
- * an element. Additionally, an empty array is returned when the starting
- * index for an element range is at the end of the array.
- *
- * Returns +nil+ if the index (or starting index) are out of range.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a[2] + a[0] + a[1] #=> "cab"
- * a[6] #=> nil
- * a[1, 2] #=> [ "b", "c" ]
- * a[1..3] #=> [ "b", "c", "d" ]
- * a[4..7] #=> [ "e" ]
- * a[6..10] #=> nil
- * a[-3, 3] #=> [ "c", "d", "e" ]
- * # special cases
- * a[5] #=> nil
- * a[6, 1] #=> nil
- * a[5, 1] #=> []
- * a[5..10] #=> []
- *
+ * array[index] -> object or nil
+ * array[start, length] -> object or nil
+ * array[range] -> object or nil
+ * array[aseq] -> object or nil
+ * array.slice(index) -> object or nil
+ * array.slice(start, length) -> object or nil
+ * array.slice(range) -> object or nil
+ * array.slice(aseq) -> object or nil
+ *
+ * Returns elements from +self+; does not modify +self+.
+ *
+ * When a single \Integer argument +index+ is given, returns the element at offset +index+:
+ * a = [:foo, 'bar', 2]
+ * a[0] # => :foo
+ * a[2] # => 2
+ * a # => [:foo, "bar", 2]
+ *
+ * If +index+ is negative, counts relative to the end of +self+:
+ * a = [:foo, 'bar', 2]
+ * a[-1] # => 2
+ * a[-2] # => "bar"
+ *
+ * If +index+ is out of range, returns +nil+.
+ *
+ * When two \Integer arguments +start+ and +length+ are given,
+ * returns a new \Array of size +length+ containing successive elements beginning at offset +start+:
+ * a = [:foo, 'bar', 2]
+ * a[0, 2] # => [:foo, "bar"]
+ * a[1, 2] # => ["bar", 2]
+ *
+ * If <tt>start + length</tt> is greater than <tt>self.length</tt>,
+ * returns all elements from offset +start+ to the end:
+ * a = [:foo, 'bar', 2]
+ * a[0, 4] # => [:foo, "bar", 2]
+ * a[1, 3] # => ["bar", 2]
+ * a[2, 2] # => [2]
+ *
+ * If <tt>start == self.size</tt> and <tt>length >= 0</tt>,
+ * returns a new empty \Array.
+ *
+ * If +length+ is negative, returns +nil+.
+ *
+ * When a single \Range argument +range+ is given,
+ * treats <tt>range.min</tt> as +start+ above
+ * and <tt>range.size</tt> as +length+ above:
+ * a = [:foo, 'bar', 2]
+ * a[0..1] # => [:foo, "bar"]
+ * a[1..2] # => ["bar", 2]
+ *
+ * Special case: If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ * If <tt>range.end</tt> is negative, calculates the end index from the end:
+ * a = [:foo, 'bar', 2]
+ * a[0..-1] # => [:foo, "bar", 2]
+ * a[0..-2] # => [:foo, "bar"]
+ * a[0..-3] # => [:foo]
+ *
+ * If <tt>range.start</tt> is negative, calculates the start index from the end:
+ * a = [:foo, 'bar', 2]
+ * a[-1..2] # => [2]
+ * a[-2..2] # => ["bar", 2]
+ * a[-3..2] # => [:foo, "bar", 2]
+ *
+ * If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ * a = [:foo, 'bar', 2]
+ * a[4..1] # => nil
+ * a[4..0] # => nil
+ * a[4..-1] # => nil
+ *
+ * When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ * returns an Array of elements corresponding to the indexes produced by
+ * the sequence.
+ * a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ * a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ * Unlike slicing with range, if the start or the end of the arithmetic sequence
+ * is larger than array size, throws RangeError.
+ * a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ * a[(1..11).step(2)]
+ * # RangeError (((1..11).step(2)) out of range)
+ * a[(7..).step(2)]
+ * # RangeError (((7..).step(2)) out of range)
+ *
+ * If given a single argument, and its type is not one of the listed, tries to
+ * convert it to Integer, and raises if it is impossible:
+ * a = [:foo, 'bar', 2]
+ * # Raises TypeError (no implicit conversion of Symbol into Integer):
+ * a[:foo]
+ *
+ * Array#slice is an alias for Array#[].
*/
VALUE
rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
{
- VALUE arg;
- long beg, len;
-
+ rb_check_arity(argc, 1, 2);
if (argc == 2) {
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- if (beg < 0) {
- beg += RARRAY_LEN(ary);
- }
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_aref2(ary, argv[0], argv[1]);
}
- if (argc != 1) {
- rb_scan_args(argc, argv, "11", NULL, NULL);
+ return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+ long beg = NUM2LONG(b);
+ long len = NUM2LONG(e);
+ if (beg < 0) {
+ beg += RARRAY_LEN(ary);
}
- arg = argv[0];
+ return rb_ary_subseq(ary, beg, len);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+ long beg, len, step;
+
/* special case - speeding up */
if (FIXNUM_P(arg)) {
return rb_ary_entry(ary, FIX2LONG(arg));
}
- /* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+ /* check if idx is Range or ArithmeticSequence */
+ switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
case Qfalse:
- break;
+ break;
case Qnil:
- return Qnil;
+ return Qnil;
default:
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_subseq_step(ary, beg, len, step);
}
+
return rb_ary_entry(ary, NUM2LONG(arg));
}
/*
* call-seq:
- * ary.at(index) -> obj or nil
- *
- * Returns the element at +index+. A negative index counts from the end of
- * +self+. Returns +nil+ if the index is out of range. See also
- * Array#[].
+ * array.at(index) -> object
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.at(0) #=> "a"
- * a.at(-1) #=> "e"
+ * Returns the element at \Integer offset +index+; does not modify +self+.
+ * a = [:foo, 'bar', 2]
+ * a.at(0) # => :foo
+ * a.at(2) # => 2
*/
-static VALUE
+VALUE
rb_ary_at(VALUE ary, VALUE pos)
{
return rb_ary_entry(ary, NUM2LONG(pos));
@@ -1308,19 +1859,33 @@ rb_ary_at(VALUE ary, VALUE pos)
/*
* call-seq:
- * ary.first -> obj or nil
- * ary.first(n) -> new_ary
+ * array.first -> object or nil
+ * array.first(n) -> new_array
+ *
+ * Returns elements from +self+; does not modify +self+.
+ *
+ * When no argument is given, returns the first element:
+ * a = [:foo, 'bar', 2]
+ * a.first # => :foo
+ * a # => [:foo, "bar", 2]
+ *
+ * If +self+ is empty, returns +nil+.
*
- * Returns the first element, or the first +n+ elements, of the array.
- * If the array is empty, the first form returns +nil+, and the
- * second form returns an empty array. See also Array#last for
- * the opposite effect.
+ * When non-negative \Integer argument +n+ is given,
+ * returns the first +n+ elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.first(2) # => [:foo, "bar"]
*
- * a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(2) #=> ["q", "r"]
+ * If <tt>n >= array.size</tt>, returns all elements:
+ * a = [:foo, 'bar', 2]
+ * a.first(50) # => [:foo, "bar", 2]
+ *
+ * If <tt>n == 0</tt> returns an new empty \Array:
+ * a = [:foo, 'bar', 2]
+ * a.first(0) # []
+ *
+ * Related: #last.
*/
-
static VALUE
rb_ary_first(int argc, VALUE *argv, VALUE ary)
{
@@ -1335,17 +1900,32 @@ rb_ary_first(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.last -> obj or nil
- * ary.last(n) -> new_ary
+ * array.last -> object or nil
+ * array.last(n) -> new_array
+ *
+ * Returns elements from +self+; +self+ is not modified.
+ *
+ * When no argument is given, returns the last element:
+ * a = [:foo, 'bar', 2]
+ * a.last # => 2
+ * a # => [:foo, "bar", 2]
*
- * Returns the last element(s) of +self+. If the array is empty,
- * the first form returns +nil+.
+ * If +self+ is empty, returns +nil+.
*
- * See also Array#first for the opposite effect.
+ * When non-negative \Innteger argument +n+ is given,
+ * returns the last +n+ elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.last(2) # => ["bar", 2]
*
- * a = [ "w", "x", "y", "z" ]
- * a.last #=> "z"
- * a.last(2) #=> ["y", "z"]
+ * If <tt>n >= array.size</tt>, returns all elements:
+ * a = [:foo, 'bar', 2]
+ * a.last(50) # => [:foo, "bar", 2]
+ *
+ * If <tt>n == 0</tt>, returns an new empty \Array:
+ * a = [:foo, 'bar', 2]
+ * a.last(0) # []
+ *
+ * Related: #first.
*/
VALUE
@@ -1363,25 +1943,35 @@ rb_ary_last(int argc, const VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.fetch(index) -> obj
- * ary.fetch(index, default) -> obj
- * ary.fetch(index) { |index| block } -> obj
- *
- * Tries to return the element at position +index+, but throws an IndexError
- * exception if the referenced +index+ lies outside of the array bounds. This
- * error can be prevented by supplying a second argument, which will act as a
- * +default+ value.
- *
- * Alternatively, if a block is given it will only be executed when an
- * invalid +index+ is referenced. Negative values of +index+ count from the
- * end of the array.
- *
- * a = [ 11, 22, 33, 44 ]
- * a.fetch(1) #=> 22
- * a.fetch(-1) #=> 44
- * a.fetch(4, 'cat') #=> "cat"
- * a.fetch(100) { |i| puts "#{i} is out of bounds" }
- * #=> "100 is out of bounds"
+ * array.fetch(index) -> element
+ * array.fetch(index, default_value) -> element
+ * array.fetch(index) {|index| ... } -> element
+ *
+ * Returns the element at offset +index+.
+ *
+ * With the single \Integer argument +index+,
+ * returns the element at offset +index+:
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1) # => "bar"
+ *
+ * If +index+ is negative, counts from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a.fetch(-1) # => 2
+ * a.fetch(-2) # => "bar"
+ *
+ * With arguments +index+ and +default_value+,
+ * returns the element at offset +index+ if index is in range,
+ * otherwise returns +default_value+:
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1, nil) # => "bar"
+ *
+ * With argument +index+ and a block,
+ * returns the element at offset +index+ if index is in range
+ * (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ * a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
*/
static VALUE
@@ -1414,36 +2004,44 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.find_index(obj) -> int or nil
- * ary.find_index { |item| block } -> int or nil
- * ary.find_index -> Enumerator
- * ary.index(obj) -> int or nil
- * ary.index { |item| block } -> int or nil
- * ary.index -> Enumerator
+ * array.index(object) -> integer or nil
+ * array.index {|element| ... } -> integer or nil
+ * array.index -> new_enumerator
+ *
+ * Returns the index of a specified element.
+ *
+ * When argument +object+ is given but no block,
+ * returns the index of the first element +element+
+ * for which <tt>object == element</tt>:
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.index('bar') # => 1
+ *
+ * Returns +nil+ if no such element found.
*
- * Returns the _index_ of the first object in +ary+ such that the object is
- * <code>==</code> to +obj+.
+ * When both argument +object+ and a block are given,
+ * calls the block with each successive element;
+ * returns the index of the first element for which the block returns a truthy value:
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.index {|element| element == 'bar' } # => 1
*
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+. Returns +nil+ if no
- * match is found.
+ * Returns +nil+ if the block never returns a truthy value.
*
- * See also Array#rindex.
+ * When neither an argument nor a block is given, returns a new Enumerator:
+ * a = [:foo, 'bar', 2]
+ * e = a.index
+ * e # => #<Enumerator: [:foo, "bar", 2]:index>
+ * e.each {|element| element == 'bar' } # => 1
*
- * An Enumerator is returned if neither a block nor argument is given.
+ * Array#find_index is an alias for Array#index.
*
- * a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
- * a.index { |x| x == "b" } #=> 1
+ * Related: #rindex.
*/
static VALUE
rb_ary_index(int argc, VALUE *argv, VALUE ary)
{
- const VALUE *ptr;
VALUE val;
- long i, len;
+ long i;
if (argc == 0) {
RETURN_ENUMERATOR(ary, 0, 0);
@@ -1458,52 +2056,49 @@ rb_ary_index(int argc, VALUE *argv, VALUE ary)
val = argv[0];
if (rb_block_given_p())
rb_warn("given block not used");
- len = RARRAY_LEN(ary);
- ptr = RARRAY_CONST_PTR(ary);
- for (i=0; i<len; i++) {
- VALUE e = ptr[i];
- switch (rb_equal_opt(e, val)) {
- case Qundef:
- if (!rb_equal(e, val)) break;
- case Qtrue:
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
return LONG2NUM(i);
- case Qfalse:
- continue;
}
- len = RARRAY_LEN(ary);
- ptr = RARRAY_CONST_PTR(ary);
}
return Qnil;
}
/*
* call-seq:
- * ary.rindex(obj) -> int or nil
- * ary.rindex { |item| block } -> int or nil
- * ary.rindex -> Enumerator
+ * array.rindex(object) -> integer or nil
+ * array.rindex {|element| ... } -> integer or nil
+ * array.rindex -> new_enumerator
+ *
+ * Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ * When argument +object+ is given but no block, returns the index of the last such element found:
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rindex('bar') # => 3
*
- * Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ * Returns +nil+ if no such object found.
*
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+, starting from the last
- * object.
+ * When a block is given but no argument, calls the block with each successive element;
+ * returns the index of the last element for which the block returns a truthy value:
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rindex {|element| element == 'bar' } # => 3
*
- * Returns +nil+ if no match is found.
+ * Returns +nil+ if the block never returns a truthy value.
*
- * See also Array#index.
+ * When neither an argument nor a block is given, returns a new \Enumerator:
*
- * If neither block nor argument is given, an Enumerator is returned instead.
+ * a = [:foo, 'bar', 2, 'bar']
+ * e = a.rindex
+ * e # => #<Enumerator: [:foo, "bar", 2, "bar"]:rindex>
+ * e.each {|element| element == 'bar' } # => 3
*
- * a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
- * a.rindex { |x| x == "b" } #=> 3
+ * Related: #index.
*/
static VALUE
rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
{
- const VALUE *ptr;
VALUE val;
long i = RARRAY_LEN(ary), len;
@@ -1522,21 +2117,14 @@ rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
val = argv[0];
if (rb_block_given_p())
rb_warn("given block not used");
- ptr = RARRAY_CONST_PTR(ary);
while (i--) {
- VALUE e = ptr[i];
- switch (rb_equal_opt(e, val)) {
- case Qundef:
- if (!rb_equal(e, val)) break;
- case Qtrue:
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
return LONG2NUM(i);
- case Qfalse:
- continue;
}
- if (i > (len = RARRAY_LEN(ary))) {
- i = len;
- }
- ptr = RARRAY_CONST_PTR(ary);
+ if (i > RARRAY_LEN(ary)) {
+ break;
+ }
}
return Qnil;
}
@@ -1551,10 +2139,10 @@ rb_ary_to_ary(VALUE obj)
}
static void
-rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
{
- long rlen;
long olen;
+ long rofs;
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
olen = RARRAY_LEN(ary);
@@ -1569,14 +2157,11 @@ rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
len = olen - beg;
}
- if (rpl == Qundef) {
- rlen = 0;
- }
- else {
- rpl = rb_ary_to_ary(rpl);
- rlen = RARRAY_LEN(rpl);
- olen = RARRAY_LEN(ary); /* ary may be resized in rpl.to_ary too */
+ {
+ const VALUE *optr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
}
+
if (beg >= olen) {
VALUE target_ary;
if (beg > ARY_MAX_SIZE - rlen) {
@@ -1586,7 +2171,8 @@ rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
len = beg + rlen;
ary_mem_clear(ary, olen, beg - olen);
if (rlen > 0) {
- ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ ary_memcpy0(ary, beg, rlen, rptr, target_ary);
}
ARY_SET_LEN(ary, len);
}
@@ -1603,16 +2189,23 @@ rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
}
if (len != rlen) {
- RARRAY_PTR_USE(ary, ptr,
- MEMMOVE(ptr + beg + rlen, ptr + beg + len,
- VALUE, olen - (beg + len)));
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+ VALUE, olen - (beg + len)));
ARY_SET_LEN(ary, alen);
}
if (rlen > 0) {
- MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ /* give up wb-protected ary */
+ RB_OBJ_WB_UNPROTECT_FOR(ARRAY, ary);
+
+ /* do not use RARRAY_PTR() because it can causes GC.
+ * ary can contain T_NONE object because it is not cleared.
+ */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg, rptr, VALUE, rlen));
}
}
- RB_GC_GUARD(rpl);
}
void
@@ -1668,47 +2261,128 @@ rb_ary_resize(VALUE ary, long len)
}
else {
if (olen > len + ARY_DEFAULT_SIZE) {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
+ ary_heap_realloc(ary, len);
ARY_SET_CAPA(ary, len);
}
ARY_SET_HEAP_LEN(ary, len);
}
+ ary_verify(ary);
return ary;
}
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+ rb_ary_store(ary, key, val);
+ return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+ VALUE rpl = rb_ary_to_ary(val);
+ rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR_TRANSIENT(rpl), RARRAY_LEN(rpl));
+ RB_GC_GUARD(rpl);
+ return val;
+}
+
/*
* call-seq:
- * ary[index] = obj -> obj
- * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
- * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
- *
- * Element Assignment --- Sets the element at +index+, or replaces a subarray
- * from the +start+ index for +length+ elements, or replaces a subarray
- * specified by the +range+ of indices.
- *
- * If indices are greater than the current capacity of the array, the array
- * grows automatically. Elements are inserted into the array at +start+ if
- * +length+ is zero.
- *
- * Negative indices will count backward from the end of the array. For
- * +start+ and +range+ cases the starting index is just before an element.
- *
- * An IndexError is raised if a negative index points past the beginning of
- * the array.
- *
- * See also Array#push, and Array#unshift.
- *
- * a = Array.new
- * a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
- * a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- * a[1..2] = [ 1, 2 ] #=> ["a", 1, 2, nil, "4"]
- * a[0, 2] = "?" #=> ["?", 2, nil, "4"]
- * a[0..2] = "A" #=> ["A", "4"]
- * a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A", nil]
- * a[1..-1] = [] #=> ["A"]
- * a[0, 0] = [ 1, 2 ] #=> [1, 2, "A"]
- * a[3, 0] = "B" #=> [1, 2, "A", "B"]
+ * array[index] = object -> object
+ * array[start, length] = object -> object
+ * array[range] = object -> object
+ *
+ * Assigns elements in +self+; returns the given +object+.
+ *
+ * When \Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ * If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ * a = [:foo, 'bar', 2]
+ * a[0] = 'foo' # => "foo"
+ * a # => ["foo", "bar", 2]
+ *
+ * If +index+ is greater than <tt>self.length</tt>, extends the array:
+ * a = [:foo, 'bar', 2]
+ * a[7] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ * If +index+ is negative, counts backwards from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a[-1] = 'two' # => "two"
+ * a # => [:foo, "bar", "two"]
+ *
+ * When \Integer arguments +start+ and +length+ are given and +object+ is not an \Array,
+ * removes <tt>length - 1</tt> elements beginning at offset +start+,
+ * and assigns +object+ at offset +start+:
+ * a = [:foo, 'bar', 2]
+ * a[0, 2] = 'foo' # => "foo"
+ * a # => ["foo", 2]
+ *
+ * If +start+ is negative, counts backwards from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a[-2, 2] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ * extends the array with +nil+, assigns +object+ at offset +start+,
+ * and ignores +length+:
+ * a = [:foo, 'bar', 2]
+ * a[6, 50] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ * If +length+ is zero, shifts elements at and following offset +start+
+ * and assigns +object+ at offset +start+:
+ * a = [:foo, 'bar', 2]
+ * a[1, 0] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ *
+ * If +length+ is too large for the existing array, does not extend the array:
+ * a = [:foo, 'bar', 2]
+ * a[1, 5] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * When \Range argument +range+ is given and +object+ is an \Array,
+ * removes <tt>length - 1</tt> elements beginning at offset +start+,
+ * and assigns +object+ at offset +start+:
+ * a = [:foo, 'bar', 2]
+ * a[0..1] = 'foo' # => "foo"
+ * a # => ["foo", 2]
+ *
+ * if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a[-2..2] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * If the array length is less than <tt>range.begin</tt>,
+ * assigns +object+ at offset <tt>range.begin</tt>, and ignores +length+:
+ * a = [:foo, 'bar', 2]
+ * a[6..50] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ * If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ * and assigns +object+ at offset +start+:
+ * a = [:foo, 'bar', 2]
+ * a[1..0] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ *
+ * If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ * retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ * a = [:foo, 'bar', 2]
+ * a[1..-1] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ * a = [:foo, 'bar', 2]
+ * a[1..-2] = 'foo' # => "foo"
+ * a # => [:foo, "foo", 2]
+ * a = [:foo, 'bar', 2]
+ * a[1..-3] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ * a = [:foo, 'bar', 2]
+ *
+ * If <tt>range.end</tt> is too large for the existing array,
+ * replaces array elements, but does not extend the array with +nil+ values:
+ * a = [:foo, 'bar', 2]
+ * a[1..5] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
*/
static VALUE
@@ -1716,45 +2390,55 @@ rb_ary_aset(int argc, VALUE *argv, VALUE ary)
{
long offset, beg, len;
+ rb_check_arity(argc, 2, 3);
+ rb_ary_modify_check(ary);
if (argc == 3) {
- rb_ary_modify_check(ary);
beg = NUM2LONG(argv[0]);
len = NUM2LONG(argv[1]);
- rb_ary_splice(ary, beg, len, argv[2]);
- return argv[2];
+ return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
}
- rb_check_arity(argc, 2, 2);
- rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
offset = FIX2LONG(argv[0]);
- goto fixnum;
+ return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
}
if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
/* check if idx is Range */
- rb_ary_splice(ary, beg, len, argv[1]);
- return argv[1];
+ return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
}
offset = NUM2LONG(argv[0]);
-fixnum:
- rb_ary_store(ary, offset, argv[1]);
- return argv[1];
+ return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
}
/*
* call-seq:
- * ary.insert(index, obj...) -> ary
- *
- * Inserts the given values before the element with the given +index+.
+ * array.insert(index, *objects) -> self
*
- * Negative indices count backwards from the end of the array, where +-1+ is
- * the last element. If a negative index is used, the given values will be
- * inserted after that element, so using an index of +-1+ will insert the
- * values at the end of the array.
+ * Inserts given +objects+ before or after the element at \Integer index +offset+;
+ * returns +self+.
*
- * a = %w{ a b c d }
- * a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
- * a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ * When +index+ is non-negative, inserts all given +objects+
+ * before the element at offset +index+:
+ * a = [:foo, 'bar', 2]
+ * a.insert(1, :bat, :bam) # => [:foo, :bat, :bam, "bar", 2]
+ *
+ * Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
+ * a = [:foo, 'bar', 2]
+ * a.insert(5, :bat, :bam)
+ * a # => [:foo, "bar", 2, nil, nil, :bat, :bam]
+ *
+ * Does nothing if no objects given:
+ * a = [:foo, 'bar', 2]
+ * a.insert(1)
+ * a.insert(50)
+ * a.insert(-50)
+ * a # => [:foo, "bar", 2]
+ *
+ * When +index+ is negative, inserts all given +objects+
+ * _after_ the element at offset <tt>index+self.size</tt>:
+ * a = [:foo, 'bar', 2]
+ * a.insert(-2, :bat, :bam)
+ * a # => [:foo, "bar", :bat, :bam, 2]
*/
static VALUE
@@ -1764,15 +2448,20 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
rb_ary_modify_check(ary);
- if (argc == 1) return ary;
pos = NUM2LONG(argv[0]);
+ if (argc == 1) return ary;
if (pos == -1) {
pos = RARRAY_LEN(ary);
}
- if (pos < 0) {
+ else if (pos < 0) {
+ long minpos = -RARRAY_LEN(ary) - 1;
+ if (pos < minpos) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ pos, minpos);
+ }
pos++;
}
- rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+ rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
return ary;
}
@@ -1787,28 +2476,48 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.each { |item| block } -> ary
- * ary.each -> Enumerator
+ * array.each {|element| ... } -> self
+ * array.each -> Enumerator
+ *
+ * Iterates over array elements.
*
- * Calls the given block once for each element in +self+, passing that element
- * as a parameter.
+ * When a block given, passes each successive array element to the block;
+ * returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a.each {|element| puts "#{element.class} #{element}" }
*
- * An Enumerator is returned if no block is given.
+ * Output:
+ * Symbol foo
+ * String bar
+ * Integer 2
*
- * a = [ "a", "b", "c" ]
- * a.each {|x| print x, " -- " }
+ * Allows the array to be modified during iteration:
+ * a = [:foo, 'bar', 2]
+ * a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
*
- * produces:
+ * Output:
+ * foo
+ * bar
*
- * a -- b -- c --
+ * When no block given, returns a new \Enumerator:
+ * a = [:foo, 'bar', 2]
+ * e = a.each
+ * e # => #<Enumerator: [:foo, "bar", 2]:each>
+ * a1 = e.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ * Symbol foo
+ * String bar
+ * Integer 2
+ *
+ * Related: #each_index, #reverse_each.
*/
VALUE
-rb_ary_each(VALUE array)
+rb_ary_each(VALUE ary)
{
long i;
- volatile VALUE ary = array;
-
+ ary_verify(ary);
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
for (i=0; i<RARRAY_LEN(ary); i++) {
rb_yield(RARRAY_AREF(ary, i));
@@ -1818,20 +2527,41 @@ rb_ary_each(VALUE array)
/*
* call-seq:
- * ary.each_index { |index| block } -> ary
- * ary.each_index -> Enumerator
+ * array.each_index {|index| ... } -> self
+ * array.each_index -> Enumerator
+ *
+ * Iterates over array indexes.
+ *
+ * When a block given, passes each successive array index to the block;
+ * returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a.each_index {|index| puts "#{index} #{a[index]}" }
*
- * Same as Array#each, but passes the +index+ of the element instead of the
- * element itself.
+ * Output:
+ * 0 foo
+ * 1 bar
+ * 2 2
*
- * An Enumerator is returned if no block is given.
+ * Allows the array to be modified during iteration:
+ * a = [:foo, 'bar', 2]
+ * a.each_index {|index| puts index; a.clear if index > 0 }
*
- * a = [ "a", "b", "c" ]
- * a.each_index {|x| print x, " -- " }
+ * Output:
+ * 0
+ * 1
*
- * produces:
+ * When no block given, returns a new \Enumerator:
+ * a = [:foo, 'bar', 2]
+ * e = a.each_index
+ * e # => #<Enumerator: [:foo, "bar", 2]:each_index>
+ * a1 = e.each {|index| puts "#{index} #{a[index]}"}
*
- * 0 -- 1 -- 2 --
+ * Output:
+ * 0 foo
+ * 1 bar
+ * 2 2
+ *
+ * Related: #each, #reverse_each.
*/
static VALUE
@@ -1848,17 +2578,40 @@ rb_ary_each_index(VALUE ary)
/*
* call-seq:
- * ary.reverse_each { |item| block } -> ary
- * ary.reverse_each -> Enumerator
- *
- * Same as Array#each, but traverses +self+ in reverse order.
- *
- * a = [ "a", "b", "c" ]
- * a.reverse_each {|x| print x, " " }
- *
- * produces:
- *
- * c b a
+ * array.reverse_each {|element| ... } -> self
+ * array.reverse_each -> Enumerator
+ *
+ * Iterates backwards over array elements.
+ *
+ * When a block given, passes, in reverse order, each element to the block;
+ * returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a.reverse_each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ * Integer 2
+ * String bar
+ * Symbol foo
+ *
+ * Allows the array to be modified during iteration:
+ * a = [:foo, 'bar', 2]
+ * a.reverse_each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *
+ * Output:
+ * 2
+ * bar
+ *
+ * When no block given, returns a new \Enumerator:
+ * a = [:foo, 'bar', 2]
+ * e = a.reverse_each
+ * e # => #<Enumerator: [:foo, "bar", 2]:reverse_each>
+ * a1 = e.each {|element| puts "#{element.class} #{element}" }
+ * Output:
+ * Integer 2
+ * String bar
+ * Symbol foo
+ *
+ * Related: #each, #each_index.
*/
static VALUE
@@ -1881,12 +2634,9 @@ rb_ary_reverse_each(VALUE ary)
/*
* call-seq:
- * ary.length -> int
+ * array.length -> an_integer
*
- * Returns the number of elements in +self+. May be zero.
- *
- * [ 1, 2, 3, 4, 5 ].length #=> 5
- * [].length #=> 0
+ * Returns the count of elements in +self+.
*/
static VALUE
@@ -1898,11 +2648,10 @@ rb_ary_length(VALUE ary)
/*
* call-seq:
- * ary.empty? -> true or false
- *
- * Returns +true+ if +self+ contains no elements.
+ * array.empty? -> true or false
*
- * [].empty? #=> true
+ * Returns +true+ if the count of elements in +self+ is zero,
+ * +false+ otherwise.
*/
static VALUE
@@ -1918,15 +2667,18 @@ rb_ary_dup(VALUE ary)
{
long len = RARRAY_LEN(ary);
VALUE dup = rb_ary_new2(len);
- ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+ ary_memcpy(dup, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_LEN(dup, len);
+
+ ary_verify(ary);
+ ary_verify(dup);
return dup;
}
VALUE
rb_ary_resurrect(VALUE ary)
{
- return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
}
extern VALUE rb_output_fs;
@@ -1951,7 +2703,7 @@ recursive_join(VALUE obj, VALUE argp, int recur)
return Qnil;
}
-static void
+static long
ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
{
long i;
@@ -1960,10 +2712,39 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
for (i=0; i<max; i++) {
val = RARRAY_AREF(ary, i);
+ if (!RB_TYPE_P(val, T_STRING)) break;
if (i > 0 && !NIL_P(sep))
rb_str_buf_append(result, sep);
rb_str_buf_append(result, val);
- if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+ }
+ return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+ rb_str_buf_append(dst, src);
+ if (*first) {
+ rb_enc_copy(dst, src);
+ *first = FALSE;
+ }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+ if (val == ary) {
+ rb_raise(rb_eArgError, "recursive array join");
+ }
+ else {
+ VALUE args[4];
+
+ *first = FALSE;
+ args[0] = val;
+ args[1] = sep;
+ args[2] = result;
+ args[3] = (VALUE)first;
+ rb_exec_recursive(recursive_join, obj, (VALUE)args);
}
}
@@ -1978,44 +2759,19 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
val = RARRAY_AREF(ary, i);
if (RB_TYPE_P(val, T_STRING)) {
- str_join:
- rb_str_buf_append(result, val);
- *first = FALSE;
+ ary_join_1_str(result, val, first);
}
else if (RB_TYPE_P(val, T_ARRAY)) {
- obj = val;
- ary_join:
- if (val == ary) {
- rb_raise(rb_eArgError, "recursive array join");
- }
- else {
- VALUE args[4];
-
- args[0] = val;
- args[1] = sep;
- args[2] = result;
- args[3] = (VALUE)first;
- rb_exec_recursive(recursive_join, obj, (VALUE)args);
- }
+ ary_join_1_ary(val, ary, sep, result, val, first);
}
- else {
- tmp = rb_check_string_type(val);
- if (!NIL_P(tmp)) {
- val = tmp;
- goto str_join;
- }
- tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
- if (!NIL_P(tmp)) {
- obj = val;
- val = tmp;
- goto ary_join;
- }
- val = rb_obj_as_string(val);
- if (*first) {
- rb_enc_copy(result, val);
- *first = FALSE;
- }
- goto str_join;
+ else if (!NIL_P(tmp = rb_check_string_type(val))) {
+ ary_join_1_str(result, tmp, first);
+ }
+ else if (!NIL_P(tmp = rb_check_array_type(val))) {
+ ary_join_1_ary(val, ary, sep, result, tmp, first);
+ }
+ else {
+ ary_join_1_str(result, rb_obj_as_string(val), first);
}
}
}
@@ -2024,11 +2780,9 @@ VALUE
rb_ary_join(VALUE ary, VALUE sep)
{
long len = 1, i;
- int taint = FALSE;
VALUE val, tmp, result;
if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
- if (OBJ_TAINTED(ary)) taint = TRUE;
if (!NIL_P(sep)) {
StringValue(sep);
@@ -2040,10 +2794,11 @@ rb_ary_join(VALUE ary, VALUE sep)
if (NIL_P(tmp) || tmp != val) {
int first;
- result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+ long n = RARRAY_LEN(ary);
+ if (i > n) i = n;
+ result = rb_str_buf_new(len + (n-i)*10);
rb_enc_associate(result, rb_usascii_encoding());
- if (taint) OBJ_TAINT(result);
- ary_join_0(ary, sep, i, result);
+ i = ary_join_0(ary, sep, i, result);
first = i == 0;
ary_join_1(ary, ary, sep, i, result, &first);
return result;
@@ -2052,8 +2807,9 @@ rb_ary_join(VALUE ary, VALUE sep)
len += RSTRING_LEN(tmp);
}
- result = rb_str_buf_new(len);
- if (taint) OBJ_TAINT(result);
+ result = rb_str_new(0, len);
+ rb_str_set_len(result, 0);
+
ary_join_0(ary, sep, RARRAY_LEN(ary), result);
return result;
@@ -2061,24 +2817,38 @@ rb_ary_join(VALUE ary, VALUE sep)
/*
* call-seq:
- * ary.join(separator=$,) -> str
- *
- * Returns a string created by converting each element of the array to
- * a string, separated by the given +separator+.
- * If the +separator+ is +nil+, it uses current $,.
- * If both the +separator+ and $, are nil, it uses empty string.
- *
- * [ "a", "b", "c" ].join #=> "abc"
- * [ "a", "b", "c" ].join("-") #=> "a-b-c"
+ * array.join ->new_string
+ * array.join(separator = $,) -> new_string
+ *
+ * Returns the new \String formed by joining the array elements after conversion.
+ * For each element +element+
+ * - Uses <tt>element.to_s</tt> if +element+ is not a <tt>kind_of?(Array)</tt>.
+ * - Uses recursive <tt>element.join(separator)</tt> if +element+ is a <tt>kind_of?(Array)</tt>.
+ *
+ * With no argument, joins using the output field separator, <tt>$,</tt>:
+ * a = [:foo, 'bar', 2]
+ * $, # => nil
+ * a.join # => "foobar2"
+ *
+ * With \string argument +separator+, joins using that separator:
+ * a = [:foo, 'bar', 2]
+ * a.join("\n") # => "foo\nbar\n2"
+ *
+ * Joins recursively for nested Arrays:
+ * a = [:foo, [:bar, [:baz, :bat]]]
+ * a.join # => "foobarbazbat"
*/
-
static VALUE
rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
{
VALUE sep;
- rb_scan_args(argc, argv, "01", &sep);
- if (NIL_P(sep)) sep = rb_output_fs;
+ if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+ sep = rb_output_fs;
+ if (!NIL_P(sep)) {
+ rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+ }
+ }
return rb_ary_join(ary, sep);
}
@@ -2086,7 +2856,6 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
static VALUE
inspect_ary(VALUE ary, VALUE dummy, int recur)
{
- int tainted = OBJ_TAINTED(ary);
long i;
VALUE s, str;
@@ -2094,24 +2863,24 @@ inspect_ary(VALUE ary, VALUE dummy, int recur)
str = rb_str_buf_new2("[");
for (i=0; i<RARRAY_LEN(ary); i++) {
s = rb_inspect(RARRAY_AREF(ary, i));
- if (OBJ_TAINTED(s)) tainted = TRUE;
if (i > 0) rb_str_buf_cat2(str, ", ");
else rb_enc_copy(str, s);
rb_str_buf_append(str, s);
}
rb_str_buf_cat2(str, "]");
- if (tainted) OBJ_TAINT(str);
return str;
}
/*
* call-seq:
- * ary.inspect -> string
- * ary.to_s -> string
+ * array.inspect -> new_string
*
- * Creates a string representation of +self+.
+ * Returns the new \String formed by calling method <tt>#inspect</tt>
+ * on each array element:
+ * a = [:foo, 'bar', 2]
+ * a.inspect # => "[:foo, \"bar\", 2]"
*
- * [ "a", "b", "c" ].to_s #=> "[\"a\", \"b\", \"c\"]"
+ * Array#to_s is an alias for Array#inspect.
*/
static VALUE
@@ -2129,11 +2898,20 @@ rb_ary_to_s(VALUE ary)
/*
* call-seq:
- * ary.to_a -> ary
- *
- * Returns +self+.
- *
- * If called on a subclass of Array, converts the receiver to an Array object.
+ * to_a -> self or new_array
+ *
+ * When +self+ is an instance of \Array, returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a.to_a # => [:foo, "bar", 2]
+ *
+ * Otherwise, returns a new \Array containing the elements of +self+:
+ * class MyArray < Array; end
+ * a = MyArray.new(['foo', 'bar', 'two'])
+ * a.instance_of?(Array) # => false
+ * a.kind_of?(Array) # => true
+ * a1 = a.to_a
+ * a1 # => ["foo", "bar", "two"]
+ * a1.class # => Array # Not MyArray
*/
static VALUE
@@ -2149,25 +2927,40 @@ rb_ary_to_a(VALUE ary)
/*
* call-seq:
- * ary.to_h -> hash
- *
- * Returns the result of interpreting <i>ary</i> as an array of
- * <tt>[key, value]</tt> pairs.
- *
- * [[:foo, :bar], [1, 2]].to_h
- * # => {:foo => :bar, 1 => 2}
+ * array.to_h -> new_hash
+ * array.to_h {|item| ... } -> new_hash
+ *
+ * Returns a new \Hash formed from +self+.
+ *
+ * When a block is given, calls the block with each array element;
+ * the block must return a 2-element \Array whose two elements
+ * form a key-value pair in the returned \Hash:
+ * a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ * h = a.to_h {|item| [item, item] }
+ * h # => {"foo"=>"foo", :bar=>:bar, 1=>1, [2, 3]=>[2, 3], {:baz=>4}=>{:baz=>4}}
+ *
+ * When no block is given, +self+ must be an \Array of 2-element sub-arrays,
+ * each sub-array is formed into a key-value pair in the new \Hash:
+ * [].to_h # => {}
+ * a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ * h = a.to_h
+ * h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
*/
static VALUE
rb_ary_to_h(VALUE ary)
{
long i;
- VALUE hash = rb_hash_new();
+ VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+ int block_given = rb_block_given_p();
+
for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE key_value_pair = rb_check_array_type(rb_ary_elt(ary, i));
+ const VALUE e = rb_ary_elt(ary, i);
+ const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+ const VALUE key_value_pair = rb_check_array_type(elt);
if (NIL_P(key_value_pair)) {
- rb_raise(rb_eTypeError, "wrong element type %s at %ld (expected array)",
- rb_builtin_class_name(rb_ary_elt(ary, i)), i);
+ rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+ rb_obj_class(elt), i);
}
if (RARRAY_LEN(key_value_pair) != 2) {
rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
@@ -2180,7 +2973,7 @@ rb_ary_to_h(VALUE ary)
/*
* call-seq:
- * ary.to_ary -> ary
+ * array.to_ary -> self
*
* Returns +self+.
*/
@@ -2209,9 +3002,9 @@ rb_ary_reverse(VALUE ary)
rb_ary_modify(ary);
if (len > 1) {
- RARRAY_PTR_USE(ary, p1, {
- p2 = p1 + len - 1; /* points last item */
- ary_reverse(p1, p2);
+ RARRAY_PTR_USE_TRANSIENT(ary, p1, {
+ p2 = p1 + len - 1; /* points last item */
+ ary_reverse(p1, p2);
}); /* WB: no new reference */
}
return ary;
@@ -2219,13 +3012,11 @@ rb_ary_reverse(VALUE ary)
/*
* call-seq:
- * ary.reverse! -> ary
- *
- * Reverses +self+ in place.
+ * array.reverse! -> self
*
- * a = [ "a", "b", "c" ]
- * a.reverse! #=> ["c", "b", "a"]
- * a #=> ["c", "b", "a"]
+ * Reverses +self+ in place:
+ * a = ['foo', 'bar', 'two']
+ * a.reverse! # => ["two", "bar", "foo"]
*/
static VALUE
@@ -2236,12 +3027,12 @@ rb_ary_reverse_bang(VALUE ary)
/*
* call-seq:
- * ary.reverse -> new_ary
+ * array.reverse -> new_array
*
- * Returns a new array containing +self+'s elements in reverse order.
- *
- * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
- * [ 1 ].reverse #=> [1]
+ * Returns a new \Array with the elements of +self+ in reverse order.
+ * a = ['foo', 'bar', 'two']
+ * a1 = a.reverse
+ * a1 # => ["two", "bar", "foo"]
*/
static VALUE
@@ -2251,8 +3042,8 @@ rb_ary_reverse_m(VALUE ary)
VALUE dup = rb_ary_new2(len);
if (len > 0) {
- const VALUE *p1 = RARRAY_CONST_PTR(ary);
- VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+ const VALUE *p1 = RARRAY_CONST_PTR_TRANSIENT(ary);
+ VALUE *p2 = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(dup) + len - 1;
do *p2-- = *p1++; while (--len > 0);
}
ARY_SET_LEN(dup, RARRAY_LEN(ary));
@@ -2265,73 +3056,127 @@ rotate_count(long cnt, long len)
return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
}
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+ if (cnt == 1) {
+ VALUE tmp = *ptr;
+ memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+ *(ptr + len - 1) = tmp;
+ } else if (cnt == len - 1) {
+ VALUE tmp = *(ptr + len - 1);
+ memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+ *ptr = tmp;
+ } else {
+ --len;
+ if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+ if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+ if (len > 0) ary_reverse(ptr, ptr + len);
+ }
+}
+
VALUE
rb_ary_rotate(VALUE ary, long cnt)
{
rb_ary_modify(ary);
if (cnt != 0) {
- VALUE *ptr = RARRAY_PTR(ary);
- long len = RARRAY_LEN(ary);
-
- if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
- --len;
- if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
- if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
- if (len > 0) ary_reverse(ptr, ptr + len);
- return ary;
- }
+ long len = RARRAY_LEN(ary);
+ if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+ return ary;
+ }
}
-
return Qnil;
}
/*
* call-seq:
- * ary.rotate!(count=1) -> ary
- *
- * Rotates +self+ in place so that the element at +count+ comes first, and
- * returns +self+.
- *
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of the array where +-1+ is the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate! #=> ["b", "c", "d", "a"]
- * a #=> ["b", "c", "d", "a"]
- * a.rotate!(2) #=> ["d", "a", "b", "c"]
- * a.rotate!(-3) #=> ["a", "b", "c", "d"]
+ * array.rotate! -> self
+ * array.rotate!(count) -> self
+ *
+ * Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ * When no argument given, rotates the first element to the last position:
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rotate! # => ["bar", 2, "bar", :foo]
+ *
+ * When given a non-negative \Integer +count+,
+ * rotates +count+ elements from the beginning to the end:
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(2)
+ * a # => [2, :foo, "bar"]
+ *
+ * If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(20)
+ * a # => [2, :foo, "bar"]
+ *
+ * If +count+ is zero, returns +self+ unmodified:
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(0)
+ * a # => [:foo, "bar", 2]
+ *
+ * When given a negative Integer +count+, rotates in the opposite direction,
+ * from end to beginning:
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(-2)
+ * a # => ["bar", 2, :foo]
+ *
+ * If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(-5)
+ * a # => ["bar", 2, :foo]
*/
static VALUE
rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
{
- long n = 1;
-
- switch (argc) {
- case 1: n = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
+ long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
rb_ary_rotate(ary, n);
return ary;
}
/*
* call-seq:
- * ary.rotate(count=1) -> new_ary
- *
- * Returns a new array by rotating +self+ so that the element at +count+ is
- * the first element of the new array.
- *
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of +self+ where +-1+ is the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate #=> ["b", "c", "d", "a"]
- * a #=> ["a", "b", "c", "d"]
- * a.rotate(2) #=> ["c", "d", "a", "b"]
- * a.rotate(-3) #=> ["b", "c", "d", "a"]
+ * array.rotate -> new_array
+ * array.rotate(count) -> new_array
+ *
+ * Returns a new \Array formed from +self+ with elements
+ * rotated from one end to the other.
+ *
+ * When no argument given, returns a new \Array that is like +self+,
+ * except that the first element has been rotated to the last position:
+ * a = [:foo, 'bar', 2, 'bar']
+ * a1 = a.rotate
+ * a1 # => ["bar", 2, "bar", :foo]
+ *
+ * When given a non-negative \Integer +count+,
+ * returns a new \Array with +count+ elements rotated from the beginning to the end:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(2)
+ * a1 # => [2, :foo, "bar"]
+ *
+ * If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(20)
+ * a1 # => [2, :foo, "bar"]
+ *
+ * If +count+ is zero, returns a copy of +self+, unmodified:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(0)
+ * a1 # => [:foo, "bar", 2]
+ *
+ * When given a negative \Integer +count+, rotates in the opposite direction,
+ * from end to beginning:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(-2)
+ * a1 # => ["bar", 2, :foo]
+ *
+ * If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(-5)
+ * a1 # => ["bar", 2, :foo]
*/
static VALUE
@@ -2339,19 +3184,14 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
{
VALUE rotated;
const VALUE *ptr;
- long len, cnt = 1;
-
- switch (argc) {
- case 1: cnt = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
+ long len;
+ long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
len = RARRAY_LEN(ary);
rotated = rb_ary_new2(len);
if (len > 0) {
cnt = rotate_count(cnt, len);
- ptr = RARRAY_CONST_PTR(ary);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
len -= cnt;
ary_memcpy(rotated, 0, len, ptr + cnt);
ary_memcpy(rotated, len, cnt, ptr);
@@ -2362,26 +3202,9 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
struct ary_sort_data {
VALUE ary;
- int opt_methods;
- int opt_inited;
-};
-
-enum {
- sort_opt_Fixnum,
- sort_opt_String,
- sort_optimizable_count
+ struct cmp_opt_data cmp_opt;
};
-#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
-
-#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
-#define SORT_OPTIMIZABLE(data, type) \
- (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
- ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
- (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
- rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
- ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
-
static VALUE
sort_reentered(VALUE ary)
{
@@ -2397,9 +3220,12 @@ sort_1(const void *ap, const void *bp, void *dummy)
struct ary_sort_data *data = dummy;
VALUE retval = sort_reentered(data->ary);
VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ VALUE args[2];
int n;
- retval = rb_yield_values(2, a, b);
+ args[0] = a;
+ args[1] = b;
+ retval = rb_yield_values2(2, args);
n = rb_cmpint(retval, a, b);
sort_reentered(data->ary);
return n;
@@ -2413,14 +3239,17 @@ sort_2(const void *ap, const void *bp, void *dummy)
VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
int n;
- if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
+ if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Integer)) {
if ((long)a > (long)b) return 1;
if ((long)a < (long)b) return -1;
return 0;
}
- if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+ if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
return rb_str_cmp(a, b);
}
+ if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(data->cmp_opt, Float)) {
+ return rb_float_cmp(a, b);
+ }
retval = rb_funcallv(a, id_cmp, 1, &b);
n = rb_cmpint(retval, a, b);
@@ -2431,23 +3260,38 @@ sort_2(const void *ap, const void *bp, void *dummy)
/*
* call-seq:
- * ary.sort! -> ary
- * ary.sort! { |a, b| block } -> ary
- *
- * Sorts +self+ in place.
- *
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
- *
- * The block must implement a comparison between +a+ and +b+, and return
- * +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
- * if +b+ follows +a+.
- *
- * See also Enumerable#sort_by.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort! #=> ["a", "b", "c", "d", "e"]
- * a.sort! { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * array.sort! -> self
+ * array.sort! {|a, b| ... } -> self
+ *
+ * Returns +self+ with its elements sorted in place.
+ *
+ * With no block, compares elements using operator <tt><=></tt>
+ * (see Comparable):
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort!
+ * a # => ["a", "b", "c", "d", "e"]
+ *
+ * With a block, calls the block with each element pair;
+ * for each element pair +a+ and +b+, the block should return an integer:
+ * - Negative when +b+ is to follow +a+.
+ * - Zero when +a+ and +b+ are equivalent.
+ * - Positive when +a+ is to follow +b+.
+ *
+ * Example:
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort! {|a, b| a <=> b }
+ * a # => ["a", "b", "c", "d", "e"]
+ * a.sort! {|a, b| b <=> a }
+ * a # => ["e", "d", "c", "b", "a"]
+ *
+ * When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ * and may be unstable:
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort! {|a, b| 0 }
+ * a # => ["d", "e", "c", "a", "b"]
*/
VALUE
@@ -2459,21 +3303,20 @@ rb_ary_sort_bang(VALUE ary)
VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
struct ary_sort_data data;
long len = RARRAY_LEN(ary);
-
RBASIC_CLEAR_CLASS(tmp);
data.ary = tmp;
- data.opt_methods = 0;
- data.opt_inited = 0;
+ data.cmp_opt.opt_methods = 0;
+ data.cmp_opt.opt_inited = 0;
RARRAY_PTR_USE(tmp, ptr, {
- ruby_qsort(ptr, len, sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
+ ruby_qsort(ptr, len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
}); /* WB: no new reference */
rb_ary_modify(ary);
if (ARY_EMBED_P(tmp)) {
if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
}
- FL_SET_EMBED(ary);
ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
}
@@ -2492,44 +3335,61 @@ rb_ary_sort_bang(VALUE ary)
rb_ary_unshare(ary);
}
else {
- ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ ary_heap_free(ary);
}
- ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+ ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
ARY_SET_HEAP_LEN(ary, len);
- ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+ ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
}
/* tmp was lost ownership for the ptr */
FL_UNSET(tmp, FL_FREEZE);
FL_SET_EMBED(tmp);
ARY_SET_EMBED_LEN(tmp, 0);
FL_SET(tmp, FL_FREEZE);
- }
+ }
/* tmp will be GC'ed. */
RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.sort -> new_ary
- * ary.sort { |a, b| block } -> new_ary
- *
- * Returns a new array created by sorting +self+.
- *
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
- *
- * The block must implement a comparison between +a+ and +b+, and return
- * +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
- * if +b+ follows +a+.
- *
- *
- * See also Enumerable#sort_by.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * array.sort -> new_array
+ * array.sort {|a, b| ... } -> new_array
+ *
+ * Returns a new \Array whose elements are those from +self+, sorted.
+ *
+ * With no block, compares elements using operator <tt><=></tt>
+ * (see Comparable):
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort
+ * a1 # => ["a", "b", "c", "d", "e"]
+ *
+ * With a block, calls the block with each element pair;
+ * for each element pair +a+ and +b+, the block should return an integer:
+ * - Negative when +b+ is to follow +a+.
+ * - Zero when +a+ and +b+ are equivalent.
+ * - Positive when +a+ is to follow +b+.
+ *
+ * Example:
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort {|a, b| a <=> b }
+ * a1 # => ["a", "b", "c", "d", "e"]
+ * a2 = a.sort {|a, b| b <=> a }
+ * a2 # => ["e", "d", "c", "b", "a"]
+ *
+ * When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ * and may be unstable:
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort {|a, b| 0 }
+ * a1 # => ["c", "e", "b", "d", "a"]
+ *
+ * Related: Enumerable#sort_by.
*/
VALUE
@@ -2540,62 +3400,122 @@ rb_ary_sort(VALUE ary)
return ary;
}
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
/*
* call-seq:
- * ary.bsearch {|x| block } -> elem
+ * array.bsearch {|element| ... } -> object
+ * array.bsearch -> new_enumerator
+ *
+ * Returns an element from +self+ selected by a binary search.
+ * +self+ should be sorted, but this is not checked.
*
* By using binary search, finds a value from this array which meets
- * the given condition in O(log n) where n is the size of the array.
- *
- * You can use this method in two use cases: a find-minimum mode and
- * a find-any mode. In either case, the elements of the array must be
- * monotone (or sorted) with respect to the block.
- *
- * In find-minimum mode (this is a good choice for typical use case),
- * the block must return true or false, and there must be an index i
- * (0 <= i <= ary.size) so that:
- *
- * - the block returns false for any element whose index is less than
- * i, and
- * - the block returns true for any element whose index is greater
- * than or equal to i.
- *
- * This method returns the i-th element. If i is equal to ary.size,
- * it returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * ary.bsearch {|x| x >= 4 } #=> 4
- * ary.bsearch {|x| x >= 6 } #=> 7
- * ary.bsearch {|x| x >= -1 } #=> 0
- * ary.bsearch {|x| x >= 100 } #=> nil
- *
- * In find-any mode (this behaves like libc's bsearch(3)), the block
- * must return a number, and there must be two indices i and j
- * (0 <= i <= j <= ary.size) so that:
- *
- * - the block returns a positive number for ary[k] if 0 <= k < i,
- * - the block returns zero for ary[k] if i <= k < j, and
- * - the block returns a negative number for ary[k] if
- * j <= k < ary.size.
- *
- * Under this condition, this method returns any element whose index
- * is within i...j. If i is equal to j (i.e., there is no element
- * that satisfies the block), this method returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * # try to find v such that 4 <= v < 8
- * ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- * # try to find v such that 8 <= v < 10
- * ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- * You must not mix the two modes at a time; the block must always
- * return either true/false, or always return a number. It is
- * undefined which value is actually picked up at each iteration.
+ * the given condition in <tt>O(log n)</tt> where +n+ is the size of the array.
+ *
+ * There are two search modes:
+ * - <b>Find-minimum mode</b>: the block should return +true+ or +false+.
+ * - <b>Find-any mode</b>: the block should return a numeric value.
+ *
+ * The block should not mix the modes by and sometimes returning +true+ or +false+
+ * and sometimes returning a numeric value, but this is not checked.
+ *
+ * <b>Find-Minimum Mode</b>
+ *
+ * In find-minimum mode, the block always returns +true+ or +false+.
+ * The further requirement (though not checked) is that
+ * there are no indexes +i+ and +j+ such that:
+ * - <tt>0 <= i < j <= self.size</tt>.
+ * - The block returns +true+ for <tt>self[i]</tt> and +false+ for <tt>self[j]</tt>.
+ *
+ * In find-minimum mode, method bsearch returns the first element for which the block returns true.
+ *
+ * Examples:
+ * a = [0, 4, 7, 10, 12]
+ * a.bsearch {|x| x >= 4 } # => 4
+ * a.bsearch {|x| x >= 6 } # => 7
+ * a.bsearch {|x| x >= -1 } # => 0
+ * a.bsearch {|x| x >= 100 } # => nil
+ *
+ * Less formally: the block is such that all +false+-evaluating elements
+ * precede all +true+-evaluating elements.
+ *
+ * These make sense as blocks in find-minimum mode:
+ * a = [0, 4, 7, 10, 12]
+ * a.map {|x| x >= 4 } # => [false, true, true, true, true]
+ * a.map {|x| x >= 6 } # => [false, false, true, true, true]
+ * a.map {|x| x >= -1 } # => [true, true, true, true, true]
+ * a.map {|x| x >= 100 } # => [false, false, false, false, false]
+ *
+ * This would not make sense:
+ * a = [0, 4, 7, 10, 12]
+ * a.map {|x| x == 7 } # => [false, false, true, false, false]
+ *
+ * <b>Find-Any Mode</b>
+ *
+ * In find-any mode, the block always returns a numeric value.
+ * The further requirement (though not checked) is that
+ * there are no indexes +i+ and +j+ such that:
+ * - <tt>0 <= i < j <= self.size</tt>.
+ * - The block returns a negative value for <tt>self[i]</tt>
+ * and a positive value for <tt>self[j]</tt>.
+ * - The block returns a negative value for <tt>self[i]</tt> and zero <tt>self[j]</tt>.
+ * - The block returns zero for <tt>self[i]</tt> and a positive value for <tt>self[j]</tt>.
+ *
+ * In find-any mode, method bsearch returns some element
+ * for which the block returns zero, or +nil+ if no such element is found.
+ *
+ * Examples:
+ * a = [0, 4, 7, 10, 12]
+ * a.bsearch {|element| 7 <=> element } # => 7
+ * a.bsearch {|element| -1 <=> element } # => nil
+ * a.bsearch {|element| 5 <=> element } # => nil
+ * a.bsearch {|element| 15 <=> element } # => nil
+ *
+ * Less formally: the block is such that:
+ * - All positive-evaluating elements precede all zero-evaluating elements.
+ * - All positive-evaluating elements precede all negative-evaluating elements.
+ * - All zero-evaluating elements precede all negative-evaluating elements.
+ *
+ * These make sense as blocks in find-any mode:
+ * a = [0, 4, 7, 10, 12]
+ * a.map {|element| 7 <=> element } # => [1, 1, 0, -1, -1]
+ * a.map {|element| -1 <=> element } # => [-1, -1, -1, -1, -1]
+ * a.map {|element| 5 <=> element } # => [1, 1, -1, -1, -1]
+ * a.map {|element| 15 <=> element } # => [1, 1, 1, 1, 1]
+ *
+ * This would not make sense:
+ * a = [0, 4, 7, 10, 12]
+ * a.map {|element| element <=> 7 } # => [-1, -1, 0, 1, 1]
+ *
+ * Returns an enumerator if no block given:
+ * a = [0, 4, 7, 10, 12]
+ * a.bsearch # => #<Enumerator: [0, 4, 7, 10, 12]:bsearch>
*/
static VALUE
rb_ary_bsearch(VALUE ary)
{
+ VALUE index_result = rb_ary_bsearch_index(ary);
+
+ if (FIXNUM_P(index_result)) {
+ return rb_ary_entry(ary, FIX2LONG(index_result));
+ }
+ return index_result;
+}
+
+/*
+ * call-seq:
+ * array.bsearch_index {|element| ... } -> integer or nil
+ * array.bsearch_index -> new_enumerator
+ *
+ * Searches +self+ as described at method #bsearch,
+ * but returns the _index_ of the found element instead of the element itself.
+ */
+
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
+{
long low = 0, high = RARRAY_LEN(ary), mid;
int smaller = 0, satisfied = 0;
VALUE v, val;
@@ -2606,8 +3526,8 @@ rb_ary_bsearch(VALUE ary)
val = rb_ary_entry(ary, mid);
v = rb_yield(val);
if (FIXNUM_P(v)) {
- if (FIX2INT(v) == 0) return val;
- smaller = FIX2INT(v) < 0;
+ if (v == INT2FIX(0)) return INT2FIX(mid);
+ smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
}
else if (v == Qtrue) {
satisfied = 1;
@@ -2618,16 +3538,16 @@ rb_ary_bsearch(VALUE ary)
}
else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
const VALUE zero = INT2FIX(0);
- switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, INT2FIX(0))) {
- case 0: return val;
- case 1: smaller = 1; break;
- case -1: smaller = 0;
+ switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+ case 0: return INT2FIX(mid);
+ case 1: smaller = 1; break;
+ case -1: smaller = 0;
}
}
else {
- rb_raise(rb_eTypeError, "wrong argument type %s"
- " (must be numeric, true, false or nil)",
- rb_obj_classname(v));
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+ " (must be numeric, true, false or nil)",
+ rb_obj_class(v));
}
if (smaller) {
high = mid;
@@ -2636,9 +3556,8 @@ rb_ary_bsearch(VALUE ary)
low = mid + 1;
}
}
- if (low == RARRAY_LEN(ary)) return Qnil;
if (!satisfied) return Qnil;
- return rb_ary_entry(ary, low);
+ return INT2FIX(low);
}
@@ -2650,14 +3569,26 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
/*
* call-seq:
- * ary.sort_by! { |obj| block } -> ary
- * ary.sort_by! -> Enumerator
+ * array.sort_by! {|element| ... } -> self
+ * array.sort_by! -> new_enumerator
*
- * Sorts +self+ in place using a set of keys generated by mapping the
- * values in +self+ through the given block.
+ * Sorts the elements of +self+ in place,
+ * using an ordering determined by the block; returns self.
*
- * If no block is given, an Enumerator is returned instead.
+ * Calls the block with each successive element;
+ * sorts elements based on the values returned from the block.
*
+ * For duplicates returned by the block, the ordering is indeterminate, and may be unstable.
+ *
+ * This example sorts strings based on their sizes:
+ * a = ['aaaa', 'bbb', 'cc', 'd']
+ * a.sort_by! {|element| element.size }
+ * a # => ["d", "cc", "bbb", "aaaa"]
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = ['aaaa', 'bbb', 'cc', 'd']
+ * a.sort_by! # => #<Enumerator: ["aaaa", "bbb", "cc", "d"]:sort_by!>
*/
static VALUE
@@ -2675,23 +3606,21 @@ rb_ary_sort_by_bang(VALUE ary)
/*
* call-seq:
- * ary.collect { |item| block } -> new_ary
- * ary.map { |item| block } -> new_ary
- * ary.collect -> Enumerator
- * ary.map -> Enumerator
- *
- * Invokes the given block once for each element of +self+.
- *
- * Creates a new array containing the values returned by the block.
+ * array.map {|element| ... } -> new_array
+ * array.map -> new_enumerator
*
- * See also Enumerable#collect.
+ * Calls the block, if given, with each element of +self+;
+ * returns a new \Array whose elements are the return values from the block:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map {|element| element.class }
+ * a1 # => [Symbol, String, Integer]
*
- * If no block is given, an Enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map
+ * a1 # => #<Enumerator: [:foo, "bar", 2]:map>
*
- * a = [ "a", "b", "c", "d" ]
- * a.collect { |x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
- * a.map.with_index{ |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- * a #=> ["a", "b", "c", "d"]
+ * Array#collect is an alias for Array#map.
*/
static VALUE
@@ -2703,7 +3632,7 @@ rb_ary_collect(VALUE ary)
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
collect = rb_ary_new2(RARRAY_LEN(ary));
for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+ rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
}
return collect;
}
@@ -2711,23 +3640,20 @@ rb_ary_collect(VALUE ary)
/*
* call-seq:
- * ary.collect! {|item| block } -> ary
- * ary.map! {|item| block } -> ary
- * ary.collect! -> Enumerator
- * ary.map! -> Enumerator
+ * array.map! {|element| ... } -> self
+ * array.map! -> new_enumerator
*
- * Invokes the given block once for each element of +self+, replacing the
- * element with the value returned by the block.
+ * Calls the block, if given, with each element;
+ * replaces the element with the block's return value:
+ * a = [:foo, 'bar', 2]
+ * a.map! { |element| element.class } # => [Symbol, String, Integer]
*
- * See also Enumerable#collect.
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map!
+ * a1 # => #<Enumerator: [:foo, "bar", 2]:map!>
*
- * If no block is given, an Enumerator is returned instead.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.map! {|x| x + "!" }
- * a #=> [ "a!", "b!", "c!", "d!" ]
- * a.collect!.with_index {|x, i| x[0...i] }
- * a #=> ["", "b", "c!", "d!"]
+ * Array#collect! is an alias for Array#map!.
*/
static VALUE
@@ -2769,47 +3695,98 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
return result;
}
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+ long beg, len;
+ if (FIXNUM_P(idx)) {
+ beg = FIX2LONG(idx);
+ }
+ /* check if idx is Range */
+ else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+ if (len > 0) {
+ const VALUE *const src = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long end = beg + len;
+ const long prevlen = RARRAY_LEN(result);
+ if (beg < olen) {
+ rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+ }
+ if (end > olen) {
+ rb_ary_store(result, prevlen + len - 1, Qnil);
+ }
+ }
+ return result;
+ }
+ else {
+ beg = NUM2LONG(idx);
+ }
+ return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
/*
* call-seq:
- * ary.values_at(selector, ...) -> new_ary
+ * array.values_at(*indexes) -> new_array
+ *
+ * Returns a new \Array whose elements are the elements
+ * of +self+ at the given \Integer +indexes+.
+ *
+ * For each positive +index+, returns the element at offset +index+:
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, 2) # => [:foo, 2]
*
- * Returns an array containing the elements in +self+ corresponding to the
- * given +selector+(s).
+ * The given +indexes+ may be in any order, and may repeat:
+ * a = [:foo, 'bar', 2]
+ * a.values_at(2, 0, 1, 0, 2) # => [2, :foo, "bar", :foo, 2]
*
- * The selectors may be either integer indices or ranges.
+ * Assigns +nil+ for an +index+ that is too large:
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, 3, 1, 3) # => [:foo, nil, "bar", nil]
*
- * See also Array#select.
+ * Returns a new empty \Array if no arguments given.
*
- * a = %w{ a b c d e f }
- * a.values_at(1, 3, 5) # => ["b", "d", "f"]
- * a.values_at(1, 3, 5, 7) # => ["b", "d", "f", nil]
- * a.values_at(-1, -2, -2, -7) # => ["f", "e", "e", nil]
- * a.values_at(4..6, 3...6) # => ["e", "f", nil, "d", "e", "f"]
+ * For each negative +index+, counts backward from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a.values_at(-1, -3) # => [2, :foo]
+ *
+ * Assigns +nil+ for an +index+ that is too small:
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, -5, 1, -6, 2) # => [:foo, nil, "bar", nil, 2]
+ *
+ * The given +indexes+ may have a mixture of signs:
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, -2, 1, -1) # => [:foo, "bar", "bar", 2]
*/
static VALUE
rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
{
- return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+ long i, olen = RARRAY_LEN(ary);
+ VALUE result = rb_ary_new_capa(argc);
+ for (i = 0; i < argc; ++i) {
+ append_values_at_single(result, ary, olen, argv[i]);
+ }
+ RB_GC_GUARD(ary);
+ return result;
}
/*
* call-seq:
- * ary.select { |item| block } -> new_ary
- * ary.select -> Enumerator
- *
- * Returns a new array containing all elements of +ary+
- * for which the given +block+ returns a true value.
+ * array.select {|element| ... } -> new_array
+ * array.select -> new_enumerator
*
- * If no block is given, an Enumerator is returned instead.
+ * Calls the block, if given, with each element of +self+;
+ * returns a new \Array containing those elements of +self+
+ * for which the block returns a truthy value:
+ * a = [:foo, 'bar', 2, :bam]
+ * a1 = a.select {|element| element.to_s.start_with?('b') }
+ * a1 # => ["bar", :bam]
*
- * [1,2,3,4,5].select { |num| num.even? } #=> [2, 4]
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select # => #<Enumerator: [:foo, "bar", 2, :bam]:select>
*
- * a = %w{ a b c d e f }
- * a.select { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
- *
- * See also Enumerable#select.
+ * Array#filter is an alias for Array#select.
*/
static VALUE
@@ -2828,58 +3805,98 @@ rb_ary_select(VALUE ary)
return result;
}
+struct select_bang_arg {
+ VALUE ary;
+ long len[2];
+};
+
+static VALUE
+select_bang_i(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long i1, i2;
+
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (!RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ arg->len[1] = ++i2;
+ }
+ return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+select_bang_ensure(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long len = RARRAY_LEN(ary);
+ long i1 = arg->len[0], i2 = arg->len[1];
+
+ if (i2 < len && i2 < i1) {
+ long tail = 0;
+ rb_ary_modify(ary);
+ if (i1 < len) {
+ tail = len - i1;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+ });
+ }
+ ARY_SET_LEN(ary, i2 + tail);
+ }
+ return ary;
+}
+
/*
* call-seq:
- * ary.select! {|item| block } -> ary or nil
- * ary.select! -> Enumerator
+ * array.select! {|element| ... } -> self or nil
+ * array.select! -> new_enumerator
*
- * Invokes the given block passing in successive elements from +self+,
- * deleting elements for which the block returns a +false+ value.
+ * Calls the block, if given with each element of +self+;
+ * removes from +self+ those elements for which the block returns +false+ or +nil+.
*
- * If changes were made, it will return +self+, otherwise it returns +nil+.
+ * Returns +self+ if any elements were removed:
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
*
- * See also Array#keep_if
+ * Returns +nil+ if no elements were removed.
*
- * If no block is given, an Enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select! # => #<Enumerator: [:foo, "bar", 2, :bam]:select!>
*
+ * Array#filter! is an alias for Array#select!.
*/
static VALUE
rb_ary_select_bang(VALUE ary)
{
- long i1, i2;
+ struct select_bang_arg args;
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (!RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- i2++;
- }
- if (i1 == i2) return Qnil;
- if (i2 < i1)
- ARY_SET_LEN(ary, i2);
- return ary;
+ args.ary = ary;
+ args.len[0] = args.len[1] = 0;
+ return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
}
/*
* call-seq:
- * ary.keep_if { |item| block } -> ary
- * ary.keep_if -> Enumerator
- *
- * Deletes every element of +self+ for which the given block evaluates to
- * +false+.
+ * array.keep_if {|element| ... } -> self
+ * array.keep_if -> new_enumeration
*
- * See also Array#select!
+ * Retains those elements for which the block returns a truthy value;
+ * deletes all other elements; returns +self+:
+ * a = [:foo, 'bar', 2, :bam]
+ * a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
*
- * If no block is given, an Enumerator is returned instead.
- *
- * a = %w{ a b c d e f }
- * a.keep_if { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2, :bam]
+ * a.keep_if # => #<Enumerator: [:foo, "bar", 2, :bam]:keep_if>
*/
static VALUE
@@ -2905,22 +3922,34 @@ ary_resize_smaller(VALUE ary, long len)
/*
* call-seq:
- * ary.delete(obj) -> item or nil
- * ary.delete(obj) { block } -> item or result of block
- *
- * Deletes all items from +self+ that are equal to +obj+.
- *
- * Returns the last deleted item, or +nil+ if no matching item is found.
- *
- * If the optional code block is given, the result of the block is returned if
- * the item is not found. (To remove +nil+ elements and get an informative
- * return value, use Array#compact!)
- *
- * a = [ "a", "b", "b", "b", "c" ]
- * a.delete("b") #=> "b"
- * a #=> ["a", "c"]
- * a.delete("z") #=> nil
- * a.delete("z") { "not found" } #=> "not found"
+ * array.delete(obj) -> deleted_object
+ * array.delete(obj) {|nosuch| ... } -> deleted_object or block_return
+ *
+ * Removes zero or more elements from +self+; returns +self+.
+ *
+ * When no block is given,
+ * removes from +self+ each element +ele+ such that <tt>ele == obj</tt>;
+ * returns the last deleted element:
+ * s1 = 'bar'; s2 = 'bar'
+ * a = [:foo, s1, 2, s2]
+ * a.delete('bar') # => "bar"
+ * a # => [:foo, 2]
+ *
+ * Returns +nil+ if no elements removed.
+ *
+ * When a block is given,
+ * removes from +self+ each element +ele+ such that <tt>ele == obj</tt>.
+ *
+ * If any such elements are found, ignores the block
+ * and returns the last deleted element:
+ * s1 = 'bar'; s2 = 'bar'
+ * a = [:foo, s1, 2, s2]
+ * deleted_obj = a.delete('bar') {|obj| fail 'Cannot happen' }
+ * a # => [:foo, 2]
+ *
+ * If no such elements are found, returns the block's return value:
+ * a = [:foo, 'bar', 2]
+ * a.delete(:nosuch) {|obj| "#{obj} not found" } # => "nosuch not found"
*/
VALUE
@@ -2950,6 +3979,7 @@ rb_ary_delete(VALUE ary, VALUE item)
ary_resize_smaller(ary, i2);
+ ary_verify(ary);
return v;
}
@@ -2990,27 +4020,33 @@ rb_ary_delete_at(VALUE ary, long pos)
rb_ary_modify(ary);
del = RARRAY_AREF(ary, pos);
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
});
ARY_INCREASE_LEN(ary, -1);
-
+ ary_verify(ary);
return del;
}
/*
* call-seq:
- * ary.delete_at(index) -> obj or nil
+ * array.delete_at(index) -> deleted_object or nil
+ *
+ * Deletes an element from +self+, per the given \Integer +index+.
*
- * Deletes the element at the specified +index+, returning that element, or
- * +nil+ if the +index+ is out of range.
+ * When +index+ is non-negative, deletes the element at offset +index+:
+ * a = [:foo, 'bar', 2]
+ * a.delete_at(1) # => "bar"
+ * a # => [:foo, 2]
*
- * See also Array#slice!
+ * If index is too large, returns +nil+.
*
- * a = ["ant", "bat", "cat", "dog"]
- * a.delete_at(2) #=> "cat"
- * a #=> ["ant", "bat", "dog"]
- * a.delete_at(99) #=> nil
+ * When +index+ is negative, counts backward from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a.delete_at(-2) # => "bar"
+ * a # => [:foo, 2]
+ *
+ * If +index+ is too small (far from zero), returns nil.
*/
static VALUE
@@ -3019,66 +4055,118 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+ const long orig_len = RARRAY_LEN(ary);
+
+ if (len < 0) {
+ return Qnil;
+ }
+ else if (pos < -orig_len) {
+ return Qnil;
+ }
+ else if (pos < 0) {
+ pos += orig_len;
+ }
+ else if (orig_len < pos) {
+ return Qnil;
+ }
+ if (orig_len < pos + len) {
+ len = orig_len - pos;
+ }
+ if (len == 0) {
+ return rb_ary_new2(0);
+ }
+ else {
+ VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR_TRANSIENT(ary)+pos);
+ rb_ary_splice(ary, pos, len, 0, 0);
+ return arg2;
+ }
+}
+
/*
* call-seq:
- * ary.slice!(index) -> obj or nil
- * ary.slice!(start, length) -> new_ary or nil
- * ary.slice!(range) -> new_ary or nil
- *
- * Deletes the element(s) given by an +index+ (optionally up to +length+
- * elements) or by a +range+.
- *
- * Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- * range.
- *
- * a = [ "a", "b", "c" ]
- * a.slice!(1) #=> "b"
- * a #=> ["a", "c"]
- * a.slice!(-1) #=> "c"
- * a #=> ["a"]
- * a.slice!(100) #=> nil
- * a #=> ["a"]
+ * array.slice!(n) -> object or nil
+ * array.slice!(start, length) -> new_array or nil
+ * array.slice!(range) -> new_array or nil
+ *
+ * Removes and returns elements from +self+.
+ *
+ * When the only argument is an \Integer +n+,
+ * removes and returns the _nth_ element in +self+:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1) # => "bar"
+ * a # => [:foo, 2]
+ *
+ * If +n+ is negative, counts backwards from the end of +self+:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(-1) # => 2
+ * a # => [:foo, "bar"]
+ *
+ * If +n+ is out of range, returns +nil+.
+ *
+ * When the only arguments are Integers +start+ and +length+,
+ * removes +length+ elements from +self+ beginning at offset +start+;
+ * returns the deleted objects in a new Array:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(0, 2) # => [:foo, "bar"]
+ * a # => [2]
+ *
+ * If <tt>start + length</tt> exceeds the array size,
+ * removes and returns all elements from offset +start+ to the end:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1, 50) # => ["bar", 2]
+ * a # => [:foo]
+ *
+ * If <tt>start == a.size</tt> and +length+ is non-negative,
+ * returns a new empty \Array.
+ *
+ * If +length+ is negative, returns +nil+.
+ *
+ * When the only argument is a \Range object +range+,
+ * treats <tt>range.min</tt> as +start+ above and <tt>range.size</tt> as +length+ above:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1..2) # => ["bar", 2]
+ * a # => [:foo]
+ *
+ * If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ * If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ * If <tt>range.end</tt> is negative, counts backwards from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(0..-2) # => [:foo, "bar"]
+ * a # => [2]
+ *
+ * If <tt>range.start</tt> is negative,
+ * calculates the start index backwards from the end of the array:
+ * a = [:foo, 'bar', 2]
+ * a.slice!(-2..2) # => ["bar", 2]
+ * a # => [:foo]
*/
static VALUE
rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
{
- VALUE arg1, arg2;
- long pos, len, orig_len;
+ VALUE arg1;
+ long pos, len;
rb_ary_modify_check(ary);
+ rb_check_arity(argc, 1, 2);
+ arg1 = argv[0];
+
if (argc == 2) {
pos = NUM2LONG(argv[0]);
len = NUM2LONG(argv[1]);
- delete_pos_len:
- if (len < 0) return Qnil;
- orig_len = RARRAY_LEN(ary);
- if (pos < 0) {
- pos += orig_len;
- if (pos < 0) return Qnil;
- }
- else if (orig_len < pos) return Qnil;
- if (orig_len < pos + len) {
- len = orig_len - pos;
- }
- if (len == 0) return rb_ary_new2(0);
- arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
- RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
- rb_ary_splice(ary, pos, len, Qundef);
- return arg2;
- }
-
- if (argc != 1) {
- /* error report */
- rb_scan_args(argc, argv, "11", NULL, NULL);
+ return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
}
- arg1 = argv[0];
if (!FIXNUM_P(arg1)) {
switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
case Qtrue:
/* valid range */
- goto delete_pos_len;
+ return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
case Qnil:
/* invalid range */
return Qnil;
@@ -3098,7 +4186,8 @@ ary_reject(VALUE orig, VALUE result)
for (i = 0; i < RARRAY_LEN(orig); i++) {
VALUE v = RARRAY_AREF(orig, i);
- if (!RTEST(rb_yield(v))) {
+
+ if (!RTEST(rb_yield(v))) {
rb_ary_push(result, v);
}
}
@@ -3106,59 +4195,73 @@ ary_reject(VALUE orig, VALUE result)
}
static VALUE
-ary_reject_bang(VALUE ary)
+reject_bang_i(VALUE a)
{
- long i;
- VALUE result = Qnil;
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long i1, i2;
- rb_ary_modify_check(ary);
- for (i = 0; i < RARRAY_LEN(ary); ) {
- VALUE v = RARRAY_AREF(ary, i);
- if (RTEST(rb_yield(v))) {
- rb_ary_delete_at(ary, i);
- result = ary;
- }
- else {
- i++;
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
}
+ arg->len[1] = ++i2;
}
- return result;
+ return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+ary_reject_bang(VALUE ary)
+{
+ struct select_bang_arg args;
+ rb_ary_modify_check(ary);
+ args.ary = ary;
+ args.len[0] = args.len[1] = 0;
+ return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
}
/*
* call-seq:
- * ary.reject! { |item| block } -> ary or nil
- * ary.reject! -> Enumerator
+ * array.reject! {|element| ... } -> self or nil
+ * array.reject! -> new_enumerator
*
- * Equivalent to Array#delete_if, deleting elements from +self+ for which the
- * block evaluates to +true+, but returns +nil+ if no changes were made.
+ * Removes each element for which the block returns a truthy value.
*
- * The array is changed instantly every time the block is called, not after
- * the iteration is over.
+ * Returns +self+ if any elements removed:
+ * a = [:foo, 'bar', 2, 'bat']
+ * a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
*
- * See also Enumerable#reject and Array#delete_if.
+ * Returns +nil+ if no elements removed.
*
- * If no block is given, an Enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a.reject! # => #<Enumerator: [:foo, "bar", 2]:reject!>
*/
static VALUE
rb_ary_reject_bang(VALUE ary)
{
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
return ary_reject_bang(ary);
}
/*
* call-seq:
- * ary.reject {|item| block } -> new_ary
- * ary.reject -> Enumerator
- *
- * Returns a new array containing the items in +self+ for which the given
- * block is not +true+.
- *
- * See also Array#delete_if
- *
- * If no block is given, an Enumerator is returned instead.
+ * array.reject {|element| ... } -> new_array
+ * array.reject -> new_enumerator
+ *
+ * Returns a new \Array whose elements are all those from +self+
+ * for which the block returns +false+ or +nil+:
+ * a = [:foo, 'bar', 2, 'bat']
+ * a1 = a.reject {|element| element.to_s.start_with?('b') }
+ * a1 # => [:foo, 2]
+ *
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a.reject # => #<Enumerator: [:foo, "bar", 2]:reject>
*/
static VALUE
@@ -3174,25 +4277,23 @@ rb_ary_reject(VALUE ary)
/*
* call-seq:
- * ary.delete_if { |item| block } -> ary
- * ary.delete_if -> Enumerator
+ * array.delete_if {|element| ... } -> self
+ * array.delete_if -> Enumerator
*
- * Deletes every element of +self+ for which block evaluates to +true+.
+ * Removes each element in +self+ for which the block returns a truthy value;
+ * returns +self+:
+ * a = [:foo, 'bar', 2, 'bat']
+ * a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
*
- * The array is changed instantly every time the block is called, not after
- * the iteration is over.
- *
- * See also Array#reject!
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * scores = [ 97, 42, 75 ]
- * scores.delete_if {|score| score < 80 } #=> [97]
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a.delete_if # => #<Enumerator: [:foo, "bar", 2]:delete_if>
*/
static VALUE
rb_ary_delete_if(VALUE ary)
{
+ ary_verify(ary);
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
ary_reject_bang(ary);
return ary;
@@ -3202,7 +4303,8 @@ static VALUE
take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
{
VALUE *args = (VALUE *)cbarg;
- if (args[1]-- == 0) rb_iter_break();
+ if (args[1] == 0) rb_iter_break();
+ else args[1]--;
if (argc > 1) val = rb_ary_new4(argc, argv);
rb_ary_push(args[0], val);
return Qnil;
@@ -3226,26 +4328,51 @@ take_items(VALUE obj, long n)
/*
* call-seq:
- * ary.zip(arg, ...) -> new_ary
- * ary.zip(arg, ...) { |arr| block } -> nil
- *
- * Converts any arguments to arrays, then merges elements of +self+ with
- * corresponding elements from each argument.
- *
- * This generates a sequence of <code>ary.size</code> _n_-element arrays,
- * where _n_ is one more than the count of arguments.
- *
- * If the size of any argument is less than the size of the initial array,
- * +nil+ values are supplied.
- *
- * If a block is given, it is invoked for each output +array+, otherwise an
- * array of arrays is returned.
- *
- * a = [ 4, 5, 6 ]
- * b = [ 7, 8, 9 ]
- * [1, 2, 3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- * [1, 2].zip(a, b) #=> [[1, 4, 7], [2, 5, 8]]
- * a.zip([1, 2], [8]) #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ * array.zip(*other_arrays) -> new_array
+ * array.zip(*other_arrays) {|other_array| ... } -> nil
+ *
+ * When no block given, returns a new \Array +new_array+ of size <tt>self.size</tt>
+ * whose elements are Arrays.
+ *
+ * Each nested array <tt>new_array[n]</tt> is of size <tt>other_arrays.size+1</tt>,
+ * and contains:
+ * - The _nth_ element of +self+.
+ * - The _nth_ element of each of the +other_arrays+.
+ *
+ * If all +other_arrays+ and +self+ are the same size:
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3]
+ * c = [:c0, :c1, :c2, :c3]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
+ *
+ * If any array in +other_arrays+ is smaller than +self+,
+ * fills to <tt>self.size</tt> with +nil+:
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2]
+ * c = [:c0, :c1]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, nil], [:a3, nil, nil]]
+ *
+ * If any array in +other_arrays+ is larger than +self+,
+ * its trailing elements are ignored:
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3, :b4]
+ * c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
+ *
+ * When a block is given, calls the block with each of the sub-arrays (formed as above); returns nil
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3]
+ * c = [:c0, :c1, :c2, :c3]
+ * a.zip(b, c) {|sub_array| p sub_array} # => nil
+ *
+ * Output:
+ * [:a0, :b0, :c0]
+ * [:a1, :b1, :c1]
+ * [:a2, :b2, :c2]
+ * [:a3, :b3, :c3]
*/
static VALUE
@@ -3308,15 +4435,12 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.transpose -> new_ary
- *
- * Assumes that +self+ is an array of arrays and transposes the rows and
- * columns.
- *
- * a = [[1,2], [3,4], [5,6]]
- * a.transpose #=> [[1, 3, 5], [2, 4, 6]]
+ * array.transpose -> new_array
*
- * If the length of the subarrays don't match, an IndexError is raised.
+ * Transposes the rows and columns in an \Array of Arrays;
+ * the nested Arrays must all be the same size:
+ * a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ * a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
*/
static VALUE
@@ -3349,15 +4473,11 @@ rb_ary_transpose(VALUE ary)
/*
* call-seq:
- * ary.replace(other_ary) -> ary
- * ary.initialize_copy(other_ary) -> ary
+ * array.replace(other_array) -> self
*
- * Replaces the contents of +self+ with the contents of +other_ary+,
- * truncating or expanding if necessary.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
- * a #=> ["x", "y", "z"]
+ * Replaces the content of +self+ with the content of +other_array+; returns +self+:
+ * a = [:foo, 'bar', 2]
+ * a.replace(['foo', :bar, 3]) # => ["foo", :bar, 3]
*/
VALUE
@@ -3368,104 +4488,245 @@ rb_ary_replace(VALUE copy, VALUE orig)
if (copy == orig) return copy;
if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
- VALUE shared = 0;
+ VALUE shared_root = 0;
if (ARY_OWNS_HEAP_P(copy)) {
- RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+ ary_heap_free(copy);
}
else if (ARY_SHARED_P(copy)) {
- shared = ARY_SHARED(copy);
+ shared_root = ARY_SHARED_ROOT(copy);
FL_UNSET_SHARED(copy);
}
FL_SET_EMBED(copy);
- ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
- if (shared) {
- rb_ary_decrement_share(shared);
+ ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR_TRANSIENT(orig));
+ if (shared_root) {
+ rb_ary_decrement_share(shared_root);
}
ARY_SET_LEN(copy, RARRAY_LEN(orig));
}
else {
- VALUE shared = ary_make_shared(orig);
+ VALUE shared_root = ary_make_shared(orig);
if (ARY_OWNS_HEAP_P(copy)) {
- RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+ ary_heap_free(copy);
}
else {
rb_ary_unshare_safe(copy);
}
FL_UNSET_EMBED(copy);
- ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- rb_ary_set_shared(copy, shared);
+ ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+ ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+ rb_ary_set_shared(copy, shared_root);
}
+ ary_verify(copy);
return copy;
}
/*
* call-seq:
- * ary.clear -> ary
- *
- * Removes all elements from +self+.
+ * array.clear -> self
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.clear #=> [ ]
+ * Removes all elements from +self+:
+ * a = [:foo, 'bar', 2]
+ * a.clear # => []
*/
VALUE
rb_ary_clear(VALUE ary)
{
rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
if (ARY_SHARED_P(ary)) {
if (!ARY_EMBED_P(ary)) {
rb_ary_unshare(ary);
FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
}
}
- else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ else {
+ ARY_SET_LEN(ary, 0);
+ if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ }
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.fill(obj) -> ary
- * ary.fill(obj, start [, length]) -> ary
- * ary.fill(obj, range ) -> ary
- * ary.fill { |index| block } -> ary
- * ary.fill(start [, length] ) { |index| block } -> ary
- * ary.fill(range) { |index| block } -> ary
- *
- * The first three forms set the selected elements of +self+ (which
- * may be the entire array) to +obj+.
- *
- * A +start+ of +nil+ is equivalent to zero.
- *
- * A +length+ of +nil+ is equivalent to the length of the array.
- *
- * The last three forms fill the array with the value of the given block,
- * which is passed the absolute index of each element to be filled.
- *
- * Negative values of +start+ count from the end of the array, where +-1+ is
- * the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.fill("x") #=> ["x", "x", "x", "x"]
- * a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
- * a.fill("y", 0..1) #=> ["y", "y", "z", "z"]
- * a.fill { |i| i*i } #=> [0, 1, 4, 9]
- * a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
+ * array.fill(obj) -> self
+ * array.fill(obj, start) -> self
+ * array.fill(obj, start, length) -> self
+ * array.fill(obj, range) -> self
+ * array.fill {|index| ... } -> self
+ * array.fill(start) {|index| ... } -> self
+ * array.fill(start, length) {|index| ... } -> self
+ * array.fill(range) {|index| ... } -> self
+ *
+ * Replaces specified elements in +self+ with specified objects; returns +self+.
+ *
+ * With argument +obj+ and no block given, replaces all elements with that one object:
+ * a = ['a', 'b', 'c', 'd']
+ * a # => ["a", "b", "c", "d"]
+ * a.fill(:X) # => [:X, :X, :X, :X]
+ *
+ * With arguments +obj+ and \Integer +start+, and no block given,
+ * replaces elements based on the given start.
+ *
+ * If +start+ is in range (<tt>0 <= start < array.size</tt>),
+ * replaces all elements from offset +start+ through the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 2) # => ["a", "b", :X, :X]
+ *
+ * If +start+ is too large (<tt>start >= array.size</tt>), does nothing:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 4) # => ["a", "b", "c", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5) # => ["a", "b", "c", "d"]
+ *
+ * If +start+ is negative, counts from the end (starting index is <tt>start + array.size</tt>):
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -2) # => ["a", "b", :X, :X]
+ *
+ * If +start+ is too small (less than and far from zero), replaces all elements:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -6) # => [:X, :X, :X, :X]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -50) # => [:X, :X, :X, :X]
+ *
+ * With arguments +obj+, \Integer +start+, and \Integer +length+, and no block given,
+ * replaces elements based on the given +start+ and +length+.
+ *
+ * If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 1, 1) # => ["a", :X, "c", "d"]
+ *
+ * If +start+ is negative, counts from the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -2, 1) # => ["a", "b", :X, "d"]
+ *
+ * If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5, 0) # => ["a", "b", "c", "d", nil]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5, 2) # => ["a", "b", "c", "d", nil, :X, :X]
+ *
+ * If +length+ is zero or negative, replaces no elements:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 1, 0) # => ["a", "b", "c", "d"]
+ * a.fill(:X, 1, -1) # => ["a", "b", "c", "d"]
+ *
+ * With arguments +obj+ and \Range +range+, and no block given,
+ * replaces elements based on the given range.
+ *
+ * If the range is positive and ascending (<tt>0 < range.begin <= range.end</tt>),
+ * replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (1..1)) # => ["a", :X, "c", "d"]
+ *
+ * If <tt>range.first</tt> is negative, replaces no elements:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-1..1)) # => ["a", "b", "c", "d"]
+ *
+ * If <tt>range.last</tt> is negative, counts from the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (0..-2)) # => [:X, :X, :X, "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (1..-2)) # => ["a", :X, :X, "d"]
+ *
+ * If <tt>range.last</tt> and <tt>range.last</tt> are both negative,
+ * both count from the end of the array:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-1..-1)) # => ["a", "b", "c", :X]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-2..-2)) # => ["a", "b", :X, "d"]
+ *
+ * With no arguments and a block given, calls the block with each index;
+ * replaces the corresponding element with the block's return value:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ * With argument +start+ and a block given, calls the block with each index
+ * from offset +start+ to the end; replaces the corresponding element
+ * with the block's return value:
+ *
+ * If start is in range (<tt>0 <= start < array.size</tt>),
+ * replaces from offset +start+ to the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "new_3"]
+ *
+ * If +start+ is too large(<tt>start >= array.size</tt>), does nothing:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ * If +start+ is negative, counts from the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "new_3"]
+ *
+ * If start is too small (<tt>start <= -array.size</tt>, replaces all elements:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-6) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-50) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ * With arguments +start+ and +length+, and a block given,
+ * calls the block for each index specified by start length;
+ * replaces the corresponding element with the block's return value.
+ *
+ * If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1, 1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ * If start is negative, counts from the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2, 1) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
+ *
+ * If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(5, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(5, 2) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil, "new_5", "new_6"]
+ *
+ * If +length+ is zero or less, replaces no elements:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ * a.fill(1, -1) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ *
+ * With arguments +obj+ and +range+, and a block given,
+ * calls the block with each index in the given range;
+ * replaces the corresponding element with the block's return value.
+ *
+ * If the range is positive and ascending (<tt>range 0 < range.begin <= range.end</tt>,
+ * replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1..1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ * If +range.first+ is negative, does nothing:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-1..1) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ * If <tt>range.last</tt> is negative, counts from the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(0..-2) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1..-2) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "d"]
+ *
+ * If <tt>range.first</tt> and <tt>range.last</tt> are both negative,
+ * both count from the end:
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-1..-1) { |index| "new_#{index}" } # => ["a", "b", "c", "new_3"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2..-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
*/
static VALUE
rb_ary_fill(int argc, VALUE *argv, VALUE ary)
{
- VALUE item, arg1, arg2;
+ VALUE item = Qundef, arg1, arg2;
long beg = 0, end = 0, len = 0;
- int block_p = FALSE;
if (rb_block_given_p()) {
- block_p = TRUE;
rb_scan_args(argc, argv, "02", &arg1, &arg2);
argc += 1; /* hackish */
}
@@ -3507,7 +4768,7 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
ARY_SET_LEN(ary, end);
}
- if (block_p) {
+ if (item == Qundef) {
VALUE v;
long i;
@@ -3525,25 +4786,14 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary + other_ary -> new_ary
- *
- * Concatenation --- Returns a new array built by concatenating the
- * two arrays together to produce a third array.
- *
- * [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
- * a = [ "a", "b", "c" ]
- * c = a + [ "d", "e", "f" ]
- * c #=> [ "a", "b", "c", "d", "e", "f" ]
- * a #=> [ "a", "b", "c" ]
+ * array + other_array -> new_array
*
- * Note that
- * x += y
- * is the same as
- * x = x + y
- * This means that it produces a new array. As a consequence,
- * repeated use of <code>+=</code> on arrays can be quite inefficient.
+ * Returns a new \Array containing all elements of +array+
+ * followed by all elements of +other_array+:
+ * a = [0, 1] + [2, 3]
+ * a # => [0, 1, 2, 3]
*
- * See also Array#concat.
+ * Related: #concat.
*/
VALUE
@@ -3558,53 +4808,72 @@ rb_ary_plus(VALUE x, VALUE y)
len = xlen + ylen;
z = rb_ary_new2(len);
- ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
- ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+ ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR_TRANSIENT(x));
+ ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR_TRANSIENT(y));
ARY_SET_LEN(z, len);
return z;
}
+static VALUE
+ary_append(VALUE x, VALUE y)
+{
+ long n = RARRAY_LEN(y);
+ if (n > 0) {
+ rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR_TRANSIENT(y), n);
+ }
+ RB_GC_GUARD(y);
+ return x;
+}
+
/*
* call-seq:
- * ary.concat(other_ary) -> ary
- *
- * Appends the elements of +other_ary+ to +self+.
+ * array.concat(*other_arrays) -> self
*
- * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- * a = [ 1, 2, 3 ]
- * a.concat( [ 4, 5 ] )
- * a #=> [ 1, 2, 3, 4, 5 ]
- *
- * See also Array#+.
+ * Adds to +array+ all elements from each \Array in +other_arrays+; returns +self+:
+ * a = [0, 1]
+ * a.concat([2, 3], [4, 5]) # => [0, 1, 2, 3, 4, 5]
*/
-VALUE
-rb_ary_concat(VALUE x, VALUE y)
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
{
- rb_ary_modify_check(x);
- y = to_ary(y);
- if (RARRAY_LEN(y) > 0) {
- rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+ rb_ary_modify_check(ary);
+
+ if (argc == 1) {
+ rb_ary_concat(ary, argv[0]);
}
- return x;
+ else if (argc > 1) {
+ int i;
+ VALUE args = rb_ary_tmp_new(argc);
+ for (i = 0; i < argc; i++) {
+ rb_ary_concat(args, argv[i]);
+ }
+ ary_append(ary, args);
+ }
+
+ ary_verify(ary);
+ return ary;
}
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+ return ary_append(x, to_ary(y));
+}
/*
* call-seq:
- * ary * int -> new_ary
- * ary * str -> new_string
- *
- * Repetition --- With a String argument, equivalent to
- * <code>ary.join(str)</code>.
- *
- * Otherwise, returns a new array built by concatenating the +int+ copies of
- * +self+.
- *
+ * array * n -> new_array
+ * array * string_separator -> new_string
*
- * [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- * [ 1, 2, 3 ] * "," #=> "1,2,3"
+ * When non-negative argument \Integer +n+ is given,
+ * returns a new \Array built by concatenating the +n+ copies of +self+:
+ * a = ['x', 'y']
+ * a * 3 # => ["x", "y", "x", "y", "x", "y"]
*
+ * When \String argument +string_separator+ is given,
+ * equivalent to <tt>array.join(string_separator)</tt>:
+ * [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {:foo=>0}"
*/
static VALUE
@@ -3621,7 +4890,7 @@ rb_ary_times(VALUE ary, VALUE times)
len = NUM2LONG(times);
if (len == 0) {
- ary2 = ary_new(rb_obj_class(ary), 0);
+ ary2 = ary_new(rb_cArray, 0);
goto out;
}
if (len < 0) {
@@ -3632,45 +4901,37 @@ rb_ary_times(VALUE ary, VALUE times)
}
len *= RARRAY_LEN(ary);
- ary2 = ary_new(rb_obj_class(ary), len);
+ ary2 = ary_new(rb_cArray, len);
ARY_SET_LEN(ary2, len);
- ptr = RARRAY_CONST_PTR(ary);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
t = RARRAY_LEN(ary);
if (0 < t) {
ary_memcpy(ary2, 0, t, ptr);
while (t <= len/2) {
- ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+ ary_memcpy(ary2, t, t, RARRAY_CONST_PTR_TRANSIENT(ary2));
t *= 2;
}
if (t < len) {
- ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+ ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR_TRANSIENT(ary2));
}
}
out:
- OBJ_INFECT(ary2, ary);
-
return ary2;
}
/*
* call-seq:
- * ary.assoc(obj) -> new_ary or nil
- *
- * Searches through an array whose elements are also arrays comparing +obj+
- * with the first element of each contained array using <code>obj.==</code>.
+ * array.assoc(obj) -> found_array or nil
*
- * Returns the first contained array that matches (that is, the first
- * associated array), or +nil+ if no match is found.
+ * Returns the first element in +self+ that is an \Array
+ * whose first element <tt>==</tt> +obj+:
+ * a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ * a.assoc(4) # => [4, 5, 6]
*
- * See also Array#rassoc
+ * Returns +nil+ if no such element is found.
*
- * s1 = [ "colors", "red", "blue", "green" ]
- * s2 = [ "letters", "a", "b", "c" ]
- * s3 = "foo"
- * a = [ s1, s2, s3 ]
- * a.assoc("letters") #=> [ "letters", "a", "b", "c" ]
- * a.assoc("foo") #=> nil
+ * Related: #rassoc.
*/
VALUE
@@ -3690,20 +4951,16 @@ rb_ary_assoc(VALUE ary, VALUE key)
/*
* call-seq:
- * ary.rassoc(obj) -> new_ary or nil
- *
- * Searches through the array whose elements are also arrays.
+ * array.rassoc(obj) -> found_array or nil
*
- * Compares +obj+ with the second element of each contained array using
- * <code>obj.==</code>.
+ * Returns the first element in +self+ that is an \Array
+ * whose second element <tt>==</tt> +obj+:
+ * a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ * a.rassoc(4) # => [2, 4]
*
- * Returns the first contained array that matches +obj+.
+ * Returns +nil+ if no such element is found.
*
- * See also Array#assoc.
- *
- * a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- * a.rassoc("two") #=> [2, "two"]
- * a.rassoc("four") #=> nil
+ * Related: #assoc.
*/
VALUE
@@ -3730,6 +4987,7 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
if (recur) return Qtrue; /* Subtle! */
+ /* rb_equal() can evacuate ptrs */
p1 = RARRAY_CONST_PTR(ary1);
p2 = RARRAY_CONST_PTR(ary2);
len1 = RARRAY_LEN(ary1);
@@ -3742,8 +5000,8 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
return Qfalse;
if (len1 < i)
return Qtrue;
- p1 = RARRAY_CONST_PTR(ary1) + i;
- p2 = RARRAY_CONST_PTR(ary2) + i;
+ p1 = RARRAY_CONST_PTR(ary1) + i;
+ p2 = RARRAY_CONST_PTR(ary2) + i;
}
else {
return Qfalse;
@@ -3757,16 +5015,19 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
/*
* call-seq:
- * ary == other_ary -> bool
+ * array == other_array -> true or false
*
- * Equality --- Two arrays are equal if they contain the same number of
- * elements and if each element is equal to (according to Object#==) the
- * corresponding element in +other_ary+.
+ * Returns +true+ if both <tt>array.size == other_array.size</tt>
+ * and for each index +i+ in +array+, <tt>array[i] == other_array[i]</tt>:
+ * a0 = [:foo, 'bar', 2]
+ * a1 = [:foo, 'bar', 2.0]
+ * a1 == a0 # => true
+ * [] == [] # => true
*
- * [ "a", "c" ] == [ "a", "c", 7 ] #=> false
- * [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
- * [ "a", "c", 7 ] == [ "a", "d", "f" ] #=> false
+ * Otherwise, returns +false+.
*
+ * This method is different from method Array#eql?,
+ * which compares elements using <tt>Object#eql?</tt>.
*/
static VALUE
@@ -3780,7 +5041,7 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
return rb_equal(ary2, ary1);
}
if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
}
@@ -3799,10 +5060,18 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
/*
* call-seq:
- * ary.eql?(other) -> true or false
+ * array.eql? other_array -> true or false
+ *
+ * Returns +true+ if +self+ and +other_array+ are the same size,
+ * and if, for each index +i+ in +self+, <tt>self[i].eql? other_array[i]</tt>:
+ * a0 = [:foo, 'bar', 2]
+ * a1 = [:foo, 'bar', 2]
+ * a1.eql?(a0) # => true
*
- * Returns +true+ if +self+ and +other+ are the same object,
- * or are both arrays with the same content (according to Object#eql?).
+ * Otherwise, returns +false+.
+ *
+ * This method is different from method {Array#==}[#method-i-3D-3D],
+ * which compares using method <tt>Object#==</tt>.
*/
static VALUE
@@ -3811,20 +5080,19 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
if (ary1 == ary2) return Qtrue;
if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
}
/*
* call-seq:
- * ary.hash -> fixnum
- *
- * Compute a hash-code for this array.
+ * array.hash -> integer
*
- * Two arrays with the same content will have the same hash code (and will
- * compare using #eql?).
+ * Returns the integer hash value for +self+.
*
- * See also Object#hash.
+ * Two arrays with the same content will have the same hash code (and will compare using eql?):
+ * [0, 1, 2].hash == [0, 1, 2].hash # => true
+ * [0, 1, 2].hash == [0, 1, 3].hash # => false
*/
static VALUE
@@ -3841,19 +5109,17 @@ rb_ary_hash(VALUE ary)
h = rb_hash_uint(h, NUM2LONG(n));
}
h = rb_hash_end(h);
- return LONG2FIX(h);
+ return ST2FIX(h);
}
/*
* call-seq:
- * ary.include?(object) -> true or false
- *
- * Returns +true+ if the given +object+ is present in +self+ (that is, if any
- * element <code>==</code> +object+), otherwise returns +false+.
+ * array.include?(obj) -> true or false
*
- * a = [ "a", "b", "c" ]
- * a.include?("b") #=> true
- * a.include?("z") #=> false
+ * Returns +true+ if for some index +i+ in +self+, <tt>obj == self[i]</tt>;
+ * otherwise +false+:
+ * [0, 1, 2].include?(2) # => true
+ * [0, 1, 2].include?(3) # => false
*/
VALUE
@@ -3864,17 +5130,27 @@ rb_ary_includes(VALUE ary, VALUE item)
for (i=0; i<RARRAY_LEN(ary); i++) {
e = RARRAY_AREF(ary, i);
- switch (rb_equal_opt(e, item)) {
- case Qundef:
- if (rb_equal(e, item)) return Qtrue;
- break;
- case Qtrue:
+ if (rb_equal(e, item)) {
return Qtrue;
}
}
return Qfalse;
}
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+ long i;
+ VALUE e;
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (rb_eql(item, e)) {
+ return Qtrue;
+ }
+ }
+ return Qfalse;
+}
static VALUE
recursive_cmp(VALUE ary1, VALUE ary2, int recur)
@@ -3898,32 +5174,24 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
/*
* call-seq:
- * ary <=> other_ary -> -1, 0, +1 or nil
- *
- * Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- * array is less than, equal to, or greater than +other_ary+.
- *
- * Each object in each array is compared (using the <=> operator).
- *
- * Arrays are compared in an "element-wise" manner; the first element of +ary+
- * is compared with the first one of +other_ary+ using the <=> operator, then
- * each of the second elements, etc...
- * As soon as the result of any such comparison is non zero (i.e. the two
- * corresponding elements are not equal), that result is returned for the
- * whole array comparison.
+ * array <=> other_array -> -1, 0, or 1
*
- * If all the elements are equal, then the result is based on a comparison of
- * the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- * and only if, they have the same length and the value of each element is
- * equal to the value of the corresponding element in the other array.
+ * Returns -1, 0, or 1 as +self+ is less than, equal to, or greater than +other_array+.
+ * For each index +i+ in +self+, evaluates <tt>result = self[i] <=> other_array[i]</tt>.
*
- * +nil+ is returned if the +other_ary+ is not an array or if the comparison
- * of two elements returned +nil+.
+ * Returns -1 if any result is -1:
+ * [0, 1, 2] <=> [0, 1, 3] # => -1
*
- * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
- * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
- * [ 1, 2 ] <=> [ 1, :two ] #=> nil
+ * Returns 1 if any result is 1:
+ * [0, 1, 2] <=> [0, 1, 1] # => 1
*
+ * When all results are zero:
+ * - Returns -1 if +array+ is smaller than +other_array+:
+ * [0, 1, 2] <=> [0, 1, 2, 3] # => -1
+ * - Returns 1 if +array+ is larger than +other_array+:
+ * [0, 1, 2] <=> [0, 1] # => 1
+ * - Returns 0 if +array+ and +other_array+ are the same size:
+ * [0, 1, 2] <=> [0, 1, 2] # => 0
*/
VALUE
@@ -3950,17 +5218,16 @@ ary_add_hash(VALUE hash, VALUE ary)
for (i=0; i<RARRAY_LEN(ary); i++) {
VALUE elt = RARRAY_AREF(ary, i);
- if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
- rb_hash_aset(hash, elt, elt);
- }
+ rb_hash_add_new_element(hash, elt, elt);
}
return hash;
}
static inline VALUE
-ary_tmp_hash_new(void)
+ary_tmp_hash_new(VALUE ary)
{
- VALUE hash = rb_hash_new();
+ long size = RARRAY_LEN(ary);
+ VALUE hash = rb_hash_new_with_size(size);
RBASIC_CLEAR_CLASS(hash);
return hash;
@@ -3969,7 +5236,7 @@ ary_tmp_hash_new(void)
static VALUE
ary_make_hash(VALUE ary)
{
- VALUE hash = ary_tmp_hash_new();
+ VALUE hash = ary_tmp_hash_new(ary);
return ary_add_hash(hash, ary);
}
@@ -3980,9 +5247,7 @@ ary_add_hash_by(VALUE hash, VALUE ary)
for (i = 0; i < RARRAY_LEN(ary); ++i) {
VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
- if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
- rb_hash_aset(hash, k, v);
- }
+ rb_hash_add_new_element(hash, k, v);
}
return hash;
}
@@ -3990,36 +5255,34 @@ ary_add_hash_by(VALUE hash, VALUE ary)
static VALUE
ary_make_hash_by(VALUE ary)
{
- VALUE hash = ary_tmp_hash_new();
+ VALUE hash = ary_tmp_hash_new(ary);
return ary_add_hash_by(hash, ary);
}
static inline void
ary_recycle_hash(VALUE hash)
{
- if (RHASH(hash)->ntbl) {
- st_table *tbl = RHASH(hash)->ntbl;
- RHASH(hash)->ntbl = 0;
+ assert(RBASIC_CLASS(hash) == 0);
+ if (RHASH_ST_TABLE_P(hash)) {
+ st_table *tbl = RHASH_ST_TABLE(hash);
st_free_table(tbl);
+ RHASH_ST_CLEAR(hash);
}
- RB_GC_GUARD(hash);
}
/*
* call-seq:
- * ary - other_ary -> new_ary
- *
- * Array Difference
- *
- * Returns a new array that is a copy of the original array, removing any
- * items that also appear in +other_ary+. The order is preserved from the
- * original array.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * array - other_array -> new_array
*
- * [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
+ * Returns a new \Array containing only those elements from +array+
+ * that are not found in \Array +other_array+;
+ * items are compared using <tt>eql?</tt>;
+ * the order from +array+ is preserved:
+ * [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1] # => [0, 2, 3]
+ * [0, 1, 2, 3] - [3, 0] # => [1, 2]
+ * [0, 1, 2] - [4] # => [0, 1, 2]
*
- * If you need set-like behavior, see the library class Set.
+ * Related: Array#difference.
*/
static VALUE
@@ -4029,11 +5292,21 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2));
+ ary2 = to_ary(ary2);
ary3 = rb_ary_new();
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ VALUE elt = rb_ary_elt(ary1, i);
+ if (rb_ary_includes_by_eql(ary2, elt)) continue;
+ rb_ary_push(ary3, elt);
+ }
+ return ary3;
+ }
+
+ hash = ary_make_hash(ary2);
for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
+ if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
ary_recycle_hash(hash);
@@ -4042,18 +5315,70 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
/*
* call-seq:
- * ary & other_ary -> new_ary
+ * array.difference(*other_arrays) -> new_array
*
- * Set Intersection --- Returns a new array containing elements common to the
- * two arrays, excluding any duplicates. The order is preserved from the
- * original array.
+ * Returns a new \Array containing only those elements from +self+
+ * that are not found in any of the Arrays +other_arrays+;
+ * items are compared using <tt>eql?</tt>; order from +self+ is preserved:
+ * [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ * [0, 1, 2, 3].difference([3, 0], [1, 3]) # => [2]
+ * [0, 1, 2].difference([4]) # => [0, 1, 2]
*
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * Returns a copy of +self+ if no arguments given.
*
- * [ 1, 1, 3, 5 ] & [ 1, 2, 3 ] #=> [ 1, 3 ]
- * [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ] #=> [ 'a', 'b' ]
+ * Related: Array#-.
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE ary_diff;
+ long i, length;
+ volatile VALUE t0;
+ bool *is_hash = ALLOCV_N(bool, t0, argc);
+ ary_diff = rb_ary_new();
+ length = RARRAY_LEN(ary);
+
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+ if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+ }
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ int j;
+ VALUE elt = rb_ary_elt(ary, i);
+ for (j = 0; j < argc; j++) {
+ if (is_hash[j]) {
+ if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
+ break;
+ }
+ else {
+ if (rb_ary_includes_by_eql(argv[j], elt)) break;
+ }
+ }
+ if (j == argc) rb_ary_push(ary_diff, elt);
+ }
+
+ ALLOCV_END(t0);
+
+ return ary_diff;
+}
+
+
+/*
+ * call-seq:
+ * array & other_array -> new_array
*
- * See also Array#uniq.
+ * Returns a new \Array containing each element found in both +array+ and \Array +other_array+;
+ * duplicates are omitted; items are compared using <tt>eql?</tt>:
+ * [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ * [0, 1, 0, 1] & [0, 1] # => [0, 1]
+ *
+ * Preserves order from +array+:
+ * [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ * Related: Array#intersection.
*/
@@ -4061,20 +5386,29 @@ static VALUE
rb_ary_and(VALUE ary1, VALUE ary2)
{
VALUE hash, ary3, v;
- st_table *table;
st_data_t vv;
long i;
ary2 = to_ary(ary2);
ary3 = rb_ary_new();
- if (RARRAY_LEN(ary2) == 0) return ary3;
+ if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ if (!rb_ary_includes_by_eql(ary2, v)) continue;
+ if (rb_ary_includes_by_eql(ary3, v)) continue;
+ rb_ary_push(ary3, v);
+ }
+ return ary3;
+ }
+
hash = ary_make_hash(ary2);
- table = rb_hash_tbl_raw(hash);
for (i=0; i<RARRAY_LEN(ary1); i++) {
v = RARRAY_AREF(ary1, i);
vv = (st_data_t)v;
- if (st_delete(table, &vv, 0)) {
+ if (rb_hash_stlike_delete(hash, &vv, 0)) {
rb_ary_push(ary3, v);
}
}
@@ -4083,6 +5417,37 @@ rb_ary_and(VALUE ary1, VALUE ary2)
return ary3;
}
+/*
+ * call-seq:
+ * array.intersection(*other_arrays) -> new_array
+ *
+ * Returns a new \Array containing each element found both in +self+
+ * and in all of the given Arrays +other_arrays+;
+ * duplicates are omitted; items are compared using <tt>eql?</tt>:
+ * [0, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ * [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ * Preserves order from +self+:
+ * [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#&.
+ */
+
+static VALUE
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result = rb_ary_dup(ary);
+ int i;
+
+ for (i = 0; i < argc; i++) {
+ result = rb_ary_and(result, argv[i]);
+ }
+
+ return result;
+}
+
static int
ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
{
@@ -4091,40 +5456,465 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
return ST_CONTINUE;
}
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE elt = rb_ary_elt(ary, i);
+ if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+ rb_ary_push(ary_union, elt);
+ }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary2); i++) {
+ VALUE elt = RARRAY_AREF(ary2, i);
+ if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+ RB_OBJ_WRITTEN(hash, Qundef, elt);
+ }
+ }
+}
+
/*
* call-seq:
- * ary | other_ary -> new_ary
- *
- * Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- * excluding any duplicates and preserving the order from the original array.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * array | other_array -> new_array
*
- * [ "a", "b", "c" ] | [ "c", "d", "a" ] #=> [ "a", "b", "c", "d" ]
+ * Returns the union of +array+ and \Array +other_array+;
+ * duplicates are removed; order is preserved;
+ * items are compared using <tt>eql?</tt>:
+ * [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ * [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ * [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
*
- * See also Array#uniq.
+ * Related: Array#union.
*/
static VALUE
rb_ary_or(VALUE ary1, VALUE ary2)
{
VALUE hash, ary3;
- long i;
ary2 = to_ary(ary2);
+ if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ ary3 = rb_ary_new();
+ rb_ary_union(ary3, ary1);
+ rb_ary_union(ary3, ary2);
+ return ary3;
+ }
+
hash = ary_make_hash(ary1);
+ rb_ary_union_hash(hash, ary2);
- for (i=0; i<RARRAY_LEN(ary2); i++) {
- VALUE elt = RARRAY_AREF(ary2, i);
- if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
- RB_OBJ_WRITTEN(hash, Qundef, elt);
- }
- }
ary3 = rb_hash_values(hash);
ary_recycle_hash(hash);
return ary3;
}
+/*
+ * call-seq:
+ * array.union(*other_arrays) -> new_array
+ *
+ * Returns a new \Array that is the union of +self+ and all given Arrays +other_arrays+;
+ * duplicates are removed; order is preserved; items are compared using <tt>eql?</tt>:
+ * [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ * [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ * [0, 1, 2, 3].union([3, 2], [1, 0]) # => [0, 1, 2, 3]
+ *
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#|.
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+ int i;
+ long sum;
+ VALUE hash, ary_union;
+
+ sum = RARRAY_LEN(ary);
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ sum += RARRAY_LEN(argv[i]);
+ }
+
+ if (sum <= SMALL_ARRAY_LEN) {
+ ary_union = rb_ary_new();
+
+ rb_ary_union(ary_union, ary);
+ for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+ return ary_union;
+ }
+
+ hash = ary_make_hash(ary);
+ for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+ ary_union = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary_union;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+ RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+ VALUE v;
+ for (; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(FIXNUM_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (FIXNUM_P(v)) {
+ if ((long)vmax < (long)v) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (RB_FLOAT_TYPE_P(v)) {
+ if (rb_float_cmp(vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(STRING_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (STRING_P(v)) {
+ if (rb_str_cmp(vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+/*
+ * call-seq:
+ * array.max -> element
+ * array.max {|a, b| ... } -> element
+ * array.max(n) -> new_array
+ * array.max(n) {|a, b| ... } -> new_array
+ *
+ * Returns one of the following:
+ * - The maximum-valued element from +self+.
+ * - A new \Array of maximum-valued elements selected from +self+.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer.
+ *
+ * With no argument and no block, returns the element in +self+
+ * having the maximum value per method <tt><=></tt>:
+ * [0, 1, 2].max # => 2
+ *
+ * With an argument \Integer +n+ and no block, returns a new \Array with at most +n+ elements,
+ * in descending order per method <tt><=></tt>:
+ * [0, 1, 2, 3].max(3) # => [3, 2, 1]
+ * [0, 1, 2, 3].max(6) # => [3, 2, 1]
+ *
+ * When a block is given, the block must return an \Integer.
+ *
+ * With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ * returns the element having the maximum value per the block:
+ * ['0', '00', '000'].max {|a, b| a.size <=> b.size } # => "000"
+ *
+ * With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ * in descending order per the block:
+ * ['0', '00', '000'].max(2) {|a, b| a.size <=> b.size } # => ["000", "00"]
+ */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+ struct cmp_opt_data cmp_opt = { 0, 0 };
+ VALUE result = Qundef, v;
+ VALUE num;
+ long i;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+ return rb_nmin_run(ary, num, 0, 1, 1);
+
+ const long n = RARRAY_LEN(ary);
+ if (rb_block_given_p()) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+ result = v;
+ }
+ }
+ }
+ else if (n > 0) {
+ result = RARRAY_AREF(ary, 0);
+ if (n > 1) {
+ if (FIXNUM_P(result) && CMP_OPTIMIZABLE(cmp_opt, Integer)) {
+ return ary_max_opt_fixnum(ary, 1, result);
+ }
+ else if (STRING_P(result) && CMP_OPTIMIZABLE(cmp_opt, String)) {
+ return ary_max_opt_string(ary, 1, result);
+ }
+ else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(cmp_opt, Float)) {
+ return ary_max_opt_float(ary, 1, result);
+ }
+ else {
+ return ary_max_generic(ary, 1, result);
+ }
+ }
+ }
+ if (result == Qundef) return Qnil;
+ return result;
+}
+
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+ RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+ VALUE v;
+ for (; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+ vmin = v;
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(FIXNUM_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (FIXNUM_P(a)) {
+ if ((long)vmin > (long)a) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (RB_FLOAT_TYPE_P(a)) {
+ if (rb_float_cmp(vmin, a) > 0) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(STRING_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (STRING_P(a)) {
+ if (rb_str_cmp(vmin, a) > 0) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+/*
+ * call-seq:
+ * array.min -> element
+ * array.min { |a, b| ... } -> element
+ * array.min(n) -> new_array
+ * array.min(n) { |a, b| ... } -> new_array
+ *
+ * Returns one of the following:
+ * - The minimum-valued element from +self+.
+ * - A new \Array of minimum-valued elements selected from +self+.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer.
+ *
+ * With no argument and no block, returns the element in +self+
+ * having the minimum value per method <tt><=></tt>:
+ * [0, 1, 2].min # => 0
+ *
+ * With \Integer argument +n+ and no block, returns a new \Array with at most +n+ elements,
+ * in ascending order per method <tt><=></tt>:
+ * [0, 1, 2, 3].min(3) # => [0, 1, 2]
+ * [0, 1, 2, 3].min(6) # => [0, 1, 2, 3]
+ *
+ * When a block is given, the block must return an Integer.
+ *
+ * With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ * returns the element having the minimum value per the block:
+ * ['0', '00', '000'].min { |a, b| a.size <=> b.size } # => "0"
+ *
+ * With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ * in ascending order per the block:
+ * [0, 1, 2, 3].min(3) # => [0, 1, 2]
+ * [0, 1, 2, 3].min(6) # => [0, 1, 2, 3]
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+ struct cmp_opt_data cmp_opt = { 0, 0 };
+ VALUE result = Qundef, v;
+ VALUE num;
+ long i;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+ return rb_nmin_run(ary, num, 0, 0, 1);
+
+ const long n = RARRAY_LEN(ary);
+ if (rb_block_given_p()) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+ result = v;
+ }
+ }
+ }
+ else if (n > 0) {
+ result = RARRAY_AREF(ary, 0);
+ if (n > 1) {
+ if (FIXNUM_P(result) && CMP_OPTIMIZABLE(cmp_opt, Integer)) {
+ return ary_min_opt_fixnum(ary, 1, result);
+ }
+ else if (STRING_P(result) && CMP_OPTIMIZABLE(cmp_opt, String)) {
+ return ary_min_opt_string(ary, 1, result);
+ }
+ else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(cmp_opt, Float)) {
+ return ary_min_opt_float(ary, 1, result);
+ }
+ else {
+ return ary_min_generic(ary, 1, result);
+ }
+ }
+ }
+ if (result == Qundef) return Qnil;
+ return result;
+}
+
+/*
+ * call-seq:
+ * array.minmax -> [min_val, max_val]
+ * array.minmax {|a, b| ... } -> [min_val, max_val]
+ *
+ * Returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, either per method <tt><=></tt> or per a given block:.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer;
+ * returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, per method <tt><=></tt>:
+ * [0, 1, 2].minmax # => [0, 2]
+ *
+ * When a block is given, the block must return an \Integer;
+ * the block is called <tt>self.size-1</tt> times to compare elements;
+ * returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, per the block:
+ * ['0', '00', '000'].minmax {|a, b| a.size <=> b.size } # => ["0", "000"]
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+ if (rb_block_given_p()) {
+ return rb_call_super(0, NULL);
+ }
+ return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
static int
push_value(st_data_t key, st_data_t val, st_data_t ary)
{
@@ -4134,29 +5924,31 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
/*
* call-seq:
- * ary.uniq! -> ary or nil
- * ary.uniq! { |item| ... } -> ary or nil
- *
- * Removes duplicate elements from +self+.
+ * array.uniq! -> self or nil
+ * array.uniq! {|element| ... } -> self or nil
*
- * If a block is given, it will use the return value of the block for
- * comparison.
+ * Removes duplicate elements from +self+, the first occurrence always being retained;
+ * returns +self+ if any elements removed, +nil+ otherwise.
*
- * It compares values using their #hash and #eql? methods for efficiency.
+ * With no block given, identifies and removes elements using method <tt>eql?</tt>
+ * to compare.
*
- * Returns +nil+ if no changes are made (that is, no duplicates are found).
+ * Returns +self+ if any elements removed:
+ * a = [0, 0, 1, 1, 2, 2]
+ * a.uniq! # => [0, 1, 2]
*
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! # => ["a", "b", "c"]
+ * Returns +nil+ if no elements removed.
*
- * b = [ "a", "b", "c" ]
- * b.uniq! # => nil
+ * With a block given, calls the block for each element;
+ * identifies (using method <tt>eql?</tt>) and removes
+ * elements for which the block returns duplicate values.
*
- * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ * Returns +self+ if any elements removed:
+ * a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ * a.uniq! {|element| element.size } # => ['a', 'aa', 'aaa']
*
+ * Returns +nil+ if no elements removed.
*/
-
static VALUE
rb_ary_uniq_bang(VALUE ary)
{
@@ -4182,7 +5974,7 @@ rb_ary_uniq_bang(VALUE ary)
FL_SET_EMBED(ary);
}
ary_resize_capa(ary, hash_size);
- st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+ rb_hash_foreach(hash, push_value, ary);
ary_recycle_hash(hash);
return ary;
@@ -4190,21 +5982,22 @@ rb_ary_uniq_bang(VALUE ary)
/*
* call-seq:
- * ary.uniq -> new_ary
- * ary.uniq { |item| ... } -> new_ary
- *
- * Returns a new array by removing duplicate values in +self+.
- *
- * If a block is given, it will use the return value of the block for comparison.
- *
- * It compares values using their #hash and #eql? methods for efficiency.
- *
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq # => ["a", "b", "c"]
- *
- * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
+ * array.uniq -> new_array
+ * array.uniq {|element| ... } -> new_array
+ *
+ * Returns a new \Array containing those elements from +self+ that are not duplicates,
+ * the first occurrence always being retained.
+ *
+ * With no block given, identifies and omits duplicates using method <tt>eql?</tt>
+ * to compare.
+ * a = [0, 0, 1, 1, 2, 2]
+ * a.uniq # => [0, 1, 2]
+ *
+ * With a block given, calls the block for each element;
+ * identifies (using method <tt>eql?</tt>) and omits duplicate values,
+ * that is, those elements for which the block returns the same value:
+ * a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ * a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
*/
static VALUE
@@ -4212,9 +6005,11 @@ rb_ary_uniq(VALUE ary)
{
VALUE hash, uniq;
- if (RARRAY_LEN(ary) <= 1)
- return rb_ary_dup(ary);
- if (rb_block_given_p()) {
+ if (RARRAY_LEN(ary) <= 1) {
+ hash = 0;
+ uniq = rb_ary_dup(ary);
+ }
+ else if (rb_block_given_p()) {
hash = ary_make_hash_by(ary);
uniq = rb_hash_values(hash);
}
@@ -4222,22 +6017,20 @@ rb_ary_uniq(VALUE ary)
hash = ary_make_hash(ary);
uniq = rb_hash_values(hash);
}
- RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
- ary_recycle_hash(hash);
+ if (hash) {
+ ary_recycle_hash(hash);
+ }
return uniq;
}
/*
* call-seq:
- * ary.compact! -> ary or nil
- *
- * Removes +nil+ elements from the array.
+ * array.compact! -> self or nil
*
- * Returns +nil+ if no changes were made, otherwise returns the array.
+ * Removes all +nil+ elements from +self+.
*
- * [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- * [ "a", "b", "c" ].compact! #=> nil
+ * Returns +self+ if any elements removed, otherwise +nil+.
*/
static VALUE
@@ -4247,14 +6040,14 @@ rb_ary_compact_bang(VALUE ary)
long n;
rb_ary_modify(ary);
- p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+ p = t = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary); /* WB: no new reference */
end = p + RARRAY_LEN(ary);
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- n = p - RARRAY_CONST_PTR(ary);
+ n = p - RARRAY_CONST_PTR_TRANSIENT(ary);
if (RARRAY_LEN(ary) == n) {
return Qnil;
}
@@ -4265,12 +6058,11 @@ rb_ary_compact_bang(VALUE ary)
/*
* call-seq:
- * ary.compact -> new_ary
- *
- * Returns a copy of +self+ with all +nil+ elements removed.
+ * array.compact -> new_array
*
- * [ "a", nil, "b", nil, "c", nil ].compact
- * #=> [ "a", "b", "c" ]
+ * Returns a new \Array containing all non-+nil+ elements from +self+:
+ * a = [nil, 0, nil, 1, nil, 2, nil]
+ * a.compact # => [0, 1, 2]
*/
static VALUE
@@ -4283,23 +6075,26 @@ rb_ary_compact(VALUE ary)
/*
* call-seq:
- * ary.count -> int
- * ary.count(obj) -> int
- * ary.count { |item| block } -> int
+ * array.count -> an_integer
+ * array.count(obj) -> an_integer
+ * array.count {|element| ... } -> an_integer
*
- * Returns the number of elements.
+ * Returns a count of specified elements.
*
- * If an argument is given, counts the number of elements which equal +obj+
- * using <code>==</code>.
+ * With no argument and no block, returns the count of all elements:
+ * [0, 1, 2].count # => 3
+ * [].count # => 0
*
- * If a block is given, counts the number of elements for which the block
- * returns a true value.
+ * With argument +obj+, returns the count of elements <tt>eql?</tt> to +obj+:
+ * [0, 1, 2, 0].count(0) # => 2
+ * [0, 1, 2].count(3) # => 0
*
- * ary = [1, 2, 4, 2]
- * ary.count #=> 4
- * ary.count(2) #=> 2
- * ary.count { |x| x%2 == 0 } #=> 3
+ * With no argument and a block given, calls the block with each element;
+ * returns the count of elements for which the block returns a truthy value:
+ * [0, 1, 2, 3].count {|element| element > 1} # => 2
*
+ * With argument +obj+ and a block given, issues a warning, ignores the block,
+ * and returns the count of elements <tt>eql?</tt> to +obj+:
*/
static VALUE
@@ -4307,7 +6102,7 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
{
long i, n = 0;
- if (argc == 0) {
+ if (rb_check_arity(argc, 0, 1) == 0) {
VALUE v;
if (!rb_block_given_p())
@@ -4319,9 +6114,8 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
}
}
else {
- VALUE obj;
+ VALUE obj = argv[0];
- rb_scan_args(argc, argv, "1", &obj);
if (rb_block_given_p()) {
rb_warn("given block not used");
}
@@ -4334,37 +6128,71 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
}
static VALUE
-flatten(VALUE ary, int level, int *modified)
+flatten(VALUE ary, int level)
{
- long i = 0;
- VALUE stack, result, tmp, elt;
- st_table *memo;
+ long i;
+ VALUE stack, result, tmp = 0, elt, vmemo;
+ st_table *memo = 0;
st_data_t id;
- stack = ary_new(0, ARY_DEFAULT_SIZE);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ elt = RARRAY_AREF(ary, i);
+ tmp = rb_check_array_type(elt);
+ if (!NIL_P(tmp)) {
+ break;
+ }
+ }
+ if (i == RARRAY_LEN(ary)) {
+ return ary;
+ }
+
result = ary_new(0, RARRAY_LEN(ary));
- memo = st_init_numtable();
- st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
- *modified = 0;
+ ary_memcpy(result, 0, i, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(result, i);
+
+ stack = ary_new(0, ARY_DEFAULT_SIZE);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i + 1));
+
+ if (level < 0) {
+ vmemo = rb_hash_new();
+ RBASIC_CLEAR_CLASS(vmemo);
+ memo = st_init_numtable();
+ rb_hash_st_table_set(vmemo, memo);
+ st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+ st_insert(memo, (st_data_t)tmp, (st_data_t)Qtrue);
+ }
+
+ ary = tmp;
+ i = 0;
while (1) {
while (i < RARRAY_LEN(ary)) {
elt = RARRAY_AREF(ary, i++);
+ if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+ rb_ary_push(result, elt);
+ continue;
+ }
tmp = rb_check_array_type(elt);
if (RBASIC(result)->klass) {
+ if (memo) {
+ RB_GC_GUARD(vmemo);
+ st_clear(memo);
+ }
rb_raise(rb_eRuntimeError, "flatten reentered");
}
- if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
+ if (NIL_P(tmp)) {
rb_ary_push(result, elt);
}
else {
- *modified = 1;
- id = (st_data_t)tmp;
- if (st_lookup(memo, id, 0)) {
- st_free_table(memo);
- rb_raise(rb_eArgError, "tried to flatten recursive array");
+ if (memo) {
+ id = (st_data_t)tmp;
+ if (st_is_member(memo, id)) {
+ st_clear(memo);
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ st_insert(memo, id, (st_data_t)Qtrue);
}
- st_insert(memo, id, (st_data_t)Qtrue);
rb_ary_push(stack, ary);
rb_ary_push(stack, LONG2NUM(i));
ary = tmp;
@@ -4374,37 +6202,49 @@ flatten(VALUE ary, int level, int *modified)
if (RARRAY_LEN(stack) == 0) {
break;
}
- id = (st_data_t)ary;
- st_delete(memo, &id, 0);
+ if (memo) {
+ id = (st_data_t)ary;
+ st_delete(memo, &id, 0);
+ }
tmp = rb_ary_pop(stack);
i = NUM2LONG(tmp);
ary = rb_ary_pop(stack);
}
- st_free_table(memo);
+ if (memo) {
+ st_clear(memo);
+ }
- RBASIC_SET_CLASS(result, rb_class_of(ary));
+ RBASIC_SET_CLASS(result, rb_cArray);
return result;
}
/*
* call-seq:
- * ary.flatten! -> ary or nil
- * ary.flatten!(level) -> ary or nil
- *
- * Flattens +self+ in place.
- *
- * Returns +nil+ if no modifications were made (i.e., the array contains no
- * subarrays.)
- *
- * The optional +level+ argument determines the level of recursion to flatten.
- *
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten! #=> [1, 2, 3, 4, 5]
- * a.flatten! #=> nil
- * a #=> [1, 2, 3, 4, 5]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ * array.flatten! -> self or nil
+ * array.flatten!(level) -> self or nil
+ *
+ * Replaces each nested \Array in +self+ with the elements from that \Array;
+ * returns +self+ if any changes, +nil+ otherwise.
+ *
+ * With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(1) # => [0, 1, [2, 3], 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(2) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(3) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten!(1) # => nil
+ *
+ * With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten! # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten! # => nil
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(-1) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(-2) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten!(-1) # => nil
*/
static VALUE
@@ -4413,14 +6253,13 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
int mod = 0, level = -1;
VALUE result, lv;
- rb_scan_args(argc, argv, "01", &lv);
+ lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
rb_ary_modify_check(ary);
if (!NIL_P(lv)) level = NUM2INT(lv);
if (level == 0) return Qnil;
- result = flatten(ary, level, &mod);
- if (mod == 0) {
- ary_discard(result);
+ result = flatten(ary, level);
+ if (result == ary) {
return Qnil;
}
if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
@@ -4432,89 +6271,68 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.flatten -> new_ary
- * ary.flatten(level) -> new_ary
- *
- * Returns a new array that is a one-dimensional flattening of +self+
- * (recursively).
- *
- * That is, for every element that is an array, extract its elements into
- * the new array.
- *
- * The optional +level+ argument determines the level of recursion to
- * flatten.
- *
- * s = [ 1, 2, 3 ] #=> [1, 2, 3]
- * t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
- * a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten(1) #=> [1, 2, 3, [4, 5]]
+ * array.flatten -> new_array
+ * array.flatten(level) -> new_array
+ *
+ * Returns a new \Array that is a recursive flattening of +self+:
+ * - Each non-Array element is unchanged.
+ * - Each \Array is replaced by its individual elements.
+ *
+ * With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(0) # => [0, [1, [2, 3], 4], 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(1) # => [0, 1, [2, 3], 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(2) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(3) # => [0, 1, 2, 3, 4, 5]
+ *
+ * With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten # => [0, 1, 2]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(-1) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(-2) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten(-1) # => [0, 1, 2]
*/
static VALUE
rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
{
- int mod = 0, level = -1;
- VALUE result, lv;
+ int level = -1;
+ VALUE result;
- rb_scan_args(argc, argv, "01", &lv);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return ary_make_shared_copy(ary);
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+ level = NUM2INT(argv[0]);
+ if (level == 0) return ary_make_shared_copy(ary);
+ }
- result = flatten(ary, level, &mod);
- OBJ_INFECT(result, ary);
+ result = flatten(ary, level);
+ if (result == ary) {
+ result = ary_make_shared_copy(ary);
+ }
return result;
}
-#define OPTHASH_GIVEN_P(opts) \
- (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
-/*
- * call-seq:
- * ary.shuffle! -> ary
- * ary.shuffle!(random: rng) -> ary
- *
- * Shuffles elements in +self+ in place.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle! #=> [2, 3, 1]
- * a #=> [2, 3, 1]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
- */
-
static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
{
- VALUE opts, randgen = rb_cRandom;
long i, len;
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
- rb_check_arity(argc, 0, 0);
rb_ary_modify(ary);
i = len = RARRAY_LEN(ary);
RARRAY_PTR_USE(ary, ptr, {
while (i) {
long j = RAND_UPTO(i);
VALUE tmp;
- if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
- rb_raise(rb_eRuntimeError, "modified during shuffle");
+ if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR_TRANSIENT(ary)) {
+ rb_raise(rb_eRuntimeError, "modified during shuffle");
}
tmp = ptr[--i];
ptr[i] = ptr[j];
@@ -4524,76 +6342,24 @@ rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
return ary;
}
-
-/*
- * call-seq:
- * ary.shuffle -> new_ary
- * ary.shuffle(random: rng) -> new_ary
- *
- * Returns a new array with elements of +self+ shuffled.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle #=> [2, 3, 1]
- * a #=> [1, 2, 3]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
- */
-
static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
{
ary = rb_ary_dup(ary);
- rb_ary_shuffle_bang(argc, argv, ary);
+ rb_ary_shuffle_bang(ec, ary, randgen);
return ary;
}
-
-/*
- * call-seq:
- * ary.sample -> obj
- * ary.sample(random: rng) -> obj
- * ary.sample(n) -> new_ary
- * ary.sample(n, random: rng) -> new_ary
- *
- * Choose a random element or +n+ random elements from the array.
- *
- * The elements are chosen by using random and unique indices into the array
- * in order to ensure that an element doesn't repeat itself unless the array
- * already contained duplicate elements.
- *
- * If the array is empty the first form returns +nil+ and the second form
- * returns an empty array.
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- * a.sample #=> 7
- * a.sample(4) #=> [6, 4, 2, 5]
- */
-
-
static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+rb_ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
{
- VALUE nv, result;
- VALUE opts, randgen = rb_cRandom;
+ VALUE result;
long n, len, i, j, k, idx[10];
long rnds[numberof(idx)];
+ long memo_threshold;
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
len = RARRAY_LEN(ary);
- if (argc == 0) {
+ if (!to_array) {
if (len < 2)
i = 0;
else
@@ -4601,7 +6367,6 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
return rb_ary_elt(ary, i);
}
- rb_scan_args(argc, argv, "1", &nv);
n = NUM2LONG(nv);
if (n < 0) rb_raise(rb_eArgError, "negative sample number");
if (n > len) n = len;
@@ -4623,7 +6388,7 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
return rb_ary_new_capa(0);
case 1:
i = rnds[0];
- return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+ return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
case 2:
i = rnds[0];
j = rnds[1];
@@ -4640,6 +6405,11 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
}
return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
}
+ memo_threshold =
+ len < 2560 ? len / 128 :
+ len < 5120 ? len / 64 :
+ len < 10240 ? len / 32 :
+ len / 16;
if (n <= numberof(idx)) {
long sorted[numberof(idx)];
sorted[0] = idx[0] = rnds[0];
@@ -4653,12 +6423,44 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
sorted[j] = idx[i] = k;
}
result = rb_ary_new_capa(n);
- RARRAY_PTR_USE(result, ptr_result, {
+ RARRAY_PTR_USE_TRANSIENT(result, ptr_result, {
for (i=0; i<n; i++) {
ptr_result[i] = RARRAY_AREF(ary, idx[i]);
}
});
}
+ else if (n <= memo_threshold / 2) {
+ long max_idx = 0;
+#undef RUBY_UNTYPED_DATA_WARNING
+#define RUBY_UNTYPED_DATA_WARNING 0
+ VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
+ st_table *memo = st_init_numtable_with_size(n);
+ DATA_PTR(vmemo) = memo;
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ long r = RAND_UPTO(len-i) + i;
+ ptr_result[i] = r;
+ if (r > max_idx) max_idx = r;
+ }
+ len = RARRAY_LEN(ary);
+ if (len <= max_idx) n = 0;
+ else if (n > len) n = len;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr_ary, {
+ for (i=0; i<n; i++) {
+ long j2 = j = ptr_result[i];
+ long i2 = i;
+ st_data_t value;
+ if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+ if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+ st_insert(memo, (st_data_t)j, (st_data_t)i2);
+ ptr_result[i] = ptr_ary[j2];
+ }
+ });
+ });
+ DATA_PTR(vmemo) = 0;
+ st_free_table(memo);
+ }
else {
result = rb_ary_dup(ary);
RBASIC_CLEAR_CLASS(result);
@@ -4687,47 +6489,55 @@ rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
n = RARRAY_AREF(args, 0);
}
if (RARRAY_LEN(self) == 0) return INT2FIX(0);
- if (n == Qnil) return DBL2NUM(INFINITY);
+ if (n == Qnil) return DBL2NUM(HUGE_VAL);
mul = NUM2LONG(n);
if (mul <= 0) return INT2FIX(0);
n = LONG2FIX(mul);
- return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+ return rb_fix_mul_fix(rb_ary_length(self), n);
}
/*
* call-seq:
- * ary.cycle(n=nil) { |obj| block } -> nil
- * ary.cycle(n=nil) -> Enumerator
- *
- * Calls the given block for each element +n+ times or forever if +nil+ is
- * given.
- *
- * Does nothing if a non-positive number is given or the array is empty.
- *
- * Returns +nil+ if the loop has finished without getting interrupted.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = ["a", "b", "c"]
- * a.cycle { |x| puts x } # print, a, b, c, a, b, c,.. forever.
- * a.cycle(2) { |x| puts x } # print, a, b, c, a, b, c.
- *
+ * array.cycle {|element| ... } -> nil
+ * array.cycle(count) {|element| ... } -> nil
+ * array.cycle -> new_enumerator
+ * array.cycle(count) -> new_enumerator
+ *
+ * When called with positive \Integer argument +count+ and a block,
+ * calls the block with each element, then does so again,
+ * until it has done so +count+ times; returns +nil+:
+ * output = []
+ * [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ * output # => [0, 1, 0, 1]
+ *
+ * If +count+ is zero or negative, does not call the block:
+ * [0, 1].cycle(0) {|element| fail 'Cannot happen' } # => nil
+ * [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
+ *
+ * When a block is given, and argument is omitted or +nil+, cycles forever:
+ * # Prints 0 and 1 forever.
+ * [0, 1].cycle {|element| puts element }
+ * [0, 1].cycle(nil) {|element| puts element }
+ *
+ * When no block is given, returns a new \Enumerator:
+ *
+ * [0, 1].cycle(2) # => #<Enumerator: [0, 1]:cycle(2)>
+ * [0, 1].cycle # => # => #<Enumerator: [0, 1]:cycle>
+ * [0, 1].cycle.first(5) # => [0, 1, 0, 1, 0]
*/
-
static VALUE
rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
{
long n, i;
- VALUE nv = Qnil;
- rb_scan_args(argc, argv, "01", &nv);
+ rb_check_arity(argc, 0, 1);
RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
- if (NIL_P(nv)) {
+ if (argc == 0 || NIL_P(argv[0])) {
n = -1;
}
else {
- n = NUM2LONG(nv);
+ n = NUM2LONG(argv[0]);
if (n <= 0) return Qnil;
}
@@ -4739,8 +6549,6 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
return Qnil;
}
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
#define tmpary(n) rb_ary_tmp_new(n)
#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
@@ -4753,11 +6561,9 @@ static int
yield_indexed_values(const VALUE values, const long r, const long *const p)
{
const VALUE result = rb_ary_new2(r);
- VALUE *const result_array = RARRAY_PTR(result);
- const VALUE *const values_array = RARRAY_CONST_PTR(values);
long i;
- for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+ for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
ARY_SET_LEN(result, r);
rb_yield(result);
return !RBASIC(values)->klass;
@@ -4766,8 +6572,8 @@ yield_indexed_values(const VALUE values, const long r, const long *const p)
/*
* Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
*
- * When we have a complete permutation of array indexes, copy the values
- * at those indexes into a new array and yield that array.
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
*
* n: the size of the set
* r: the number of elements in each permutation
@@ -4812,15 +6618,21 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
/*
* Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
*/
static VALUE
descending_factorial(long from, long how_many)
{
- VALUE cnt = LONG2FIX(how_many >= 0);
- while (how_many-- > 0) {
- VALUE v = LONG2FIX(from--);
- cnt = rb_funcallv(cnt, '*', 1, &v);
+ VALUE cnt;
+ if (how_many > 0) {
+ cnt = LONG2FIX(from);
+ while (--how_many > 0) {
+ long v = --from;
+ cnt = rb_int_mul(cnt, LONG2FIX(v));
+ }
+ }
+ else {
+ cnt = LONG2FIX(how_many == 0);
}
return cnt;
}
@@ -4828,16 +6640,23 @@ descending_factorial(long from, long how_many)
static VALUE
binomial_coefficient(long comb, long size)
{
- VALUE r, v;
+ VALUE r;
+ long i;
if (comb > size-comb) {
comb = size-comb;
}
if (comb < 0) {
return LONG2FIX(0);
}
- r = descending_factorial(size, comb);
- v = descending_factorial(comb, comb);
- return rb_funcallv(r, id_div, 1, &v);
+ else if (comb == 0) {
+ return LONG2FIX(1);
+ }
+ r = LONG2FIX(size);
+ for (i = 1; i < comb; ++i) {
+ r = rb_int_mul(r, LONG2FIX(size - i));
+ r = rb_int_idiv(r, LONG2FIX(i + 1));
+ }
+ return r;
}
static VALUE
@@ -4851,42 +6670,78 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.permutation { |p| block } -> ary
- * ary.permutation -> Enumerator
- * ary.permutation(n) { |p| block } -> ary
- * ary.permutation(n) -> Enumerator
- *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
- *
- * If +n+ is not specified, yield all permutations of all elements.
- *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(1).to_a #=> [[1],[2],[3]]
- * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(0).to_a #=> [[]] # one permutation of length 0
- * a.permutation(4).to_a #=> [] # no permutations of length 4
+ * array.permutation {|element| ... } -> self
+ * array.permutation(n) {|element| ... } -> self
+ * array.permutation -> new_enumerator
+ * array.permutation(n) -> new_enumerator
+ *
+ * When invoked with a block, yield all permutations of elements of +self+; returns +self+.
+ * The order of permutations is indeterminate.
+ *
+ * When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ * are given, calls the block with all +n+-tuple permutations of +self+.
+ *
+ * Example:
+ * a = [0, 1, 2]
+ * a.permutation(2) {|permutation| p permutation }
+ * Output:
+ * [0, 1]
+ * [0, 2]
+ * [1, 0]
+ * [1, 2]
+ * [2, 0]
+ * [2, 1]
+ * Another example:
+ * a = [0, 1, 2]
+ * a.permutation(3) {|permutation| p permutation }
+ * Output:
+ * [0, 1, 2]
+ * [0, 2, 1]
+ * [1, 0, 2]
+ * [1, 2, 0]
+ * [2, 0, 1]
+ * [2, 1, 0]
+ *
+ * When +n+ is zero, calls the block once with a new empty \Array:
+ * a = [0, 1, 2]
+ * a.permutation(0) {|permutation| p permutation }
+ * Output:
+ * []
+ *
+ * When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ * does not call the block:
+ * a = [0, 1, 2]
+ * a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ * a.permutation(4) {|permutation| fail 'Cannot happen' }
+ *
+ * When a block given but no argument,
+ * behaves the same as <tt>a.permutation(a.size)</tt>:
+ * a = [0, 1, 2]
+ * a.permutation {|permutation| p permutation }
+ * Output:
+ * [0, 1, 2]
+ * [0, 2, 1]
+ * [1, 0, 2]
+ * [1, 2, 0]
+ * [2, 0, 1]
+ * [2, 1, 0]
+ *
+ * Returns a new \Enumerator if no block given:
+ * a = [0, 1, 2]
+ * a.permutation # => #<Enumerator: [0, 1, 2]:permutation>
+ * a.permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
*/
static VALUE
rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
{
- VALUE num;
long r, n, i;
n = RARRAY_LEN(ary); /* Array length */
RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
- rb_scan_args(argc, argv, "01", &num);
- r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
+ r = n;
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+ r = NUM2LONG(argv[0]); /* Permutation size from argument */
if (r < 0 || n < r) {
/* no permutations: yield nothing */
@@ -4901,7 +6756,7 @@ rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
}
else { /* this is the general case */
volatile VALUE t0;
- long *p = (long*)ALLOCV(t0, r*sizeof(long)+n*sizeof(char));
+ long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
char *used = (char*)(p + r);
VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
RBASIC_CLEAR_CLASS(ary0);
@@ -4947,27 +6802,44 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.combination(n) { |c| block } -> ary
- * ary.combination(n) -> Enumerator
- *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3, 4]
- * a.combination(1).to_a #=> [[1],[2],[3],[4]]
- * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- * a.combination(4).to_a #=> [[1,2,3,4]]
- * a.combination(0).to_a #=> [[]] # one combination of length 0
- * a.combination(5).to_a #=> [] # no combinations of length 5
- *
+ * array.combination(n) {|element| ... } -> self
+ * array.combination(n) -> new_enumerator
+ *
+ * Calls the block, if given, with combinations of elements of +self+;
+ * returns +self+. The order of combinations is indeterminate.
+ *
+ * When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ * are given, calls the block with all +n+-tuple combinations of +self+.
+ *
+ * Example:
+ * a = [0, 1, 2]
+ * a.combination(2) {|combination| p combination }
+ * Output:
+ * [0, 1]
+ * [0, 2]
+ * [1, 2]
+ *
+ * Another example:
+ * a = [0, 1, 2]
+ * a.combination(3) {|combination| p combination }
+ * Output:
+ * [0, 1, 2]
+ *
+ * When +n+ is zero, calls the block once with a new empty \Array:
+ * a = [0, 1, 2]
+ * a1 = a.combination(0) {|combination| p combination }
+ * Output:
+ * []
+ *
+ * When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ * does not call the block:
+ * a = [0, 1, 2]
+ * a.combination(-1) {|combination| fail 'Cannot happen' }
+ * a.combination(4) {|combination| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ * a = [0, 1, 2]
+ * a.combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
*/
static VALUE
@@ -4985,7 +6857,7 @@ rb_ary_combination(VALUE ary, VALUE num)
rb_yield(rb_ary_new2(0));
}
else if (n == 1) {
- for (i = 0; i < len; i++) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
}
}
@@ -5006,8 +6878,8 @@ rb_ary_combination(VALUE ary, VALUE num)
* Compute repeated permutations of +r+ elements of the set
* <code>[0..n-1]</code>.
*
- * When we have a complete repeated permutation of array indexes, copy the
- * values at those indexes into a new array and yield that array.
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
*
* n: the size of the set
* r: the number of elements in each permutation
@@ -5042,39 +6914,71 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
{
long n = RARRAY_LEN(ary);
long k = NUM2LONG(RARRAY_AREF(args, 0));
- VALUE v;
if (k < 0) {
return LONG2FIX(0);
}
-
- v = LONG2NUM(k);
- return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+ if (n <= 0) {
+ return LONG2FIX(!k);
+ }
+ return rb_int_positive_pow(n, (unsigned long)k);
}
/*
* call-seq:
- * ary.repeated_permutation(n) { |p| block } -> ary
- * ary.repeated_permutation(n) -> Enumerator
- *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2]
- * a.repeated_permutation(1).to_a #=> [[1], [2]]
- * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
- * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
+ * array.repeated_permutation(n) {|permutation| ... } -> self
+ * array.repeated_permutation(n) -> new_enumerator
+ *
+ * Calls the block with each repeated permutation of length +n+ of the elements of +self+;
+ * each permutation is an \Array;
+ * returns +self+. The order of the permutations is indeterminate.
+ *
+ * When a block and a positive \Integer argument +n+ are given, calls the block with each
+ * +n+-tuple repeated permutation of the elements of +self+.
+ * The number of permutations is <tt>self.size**n</tt>.
+ *
+ * +n+ = 1:
+ * a = [0, 1, 2]
+ * a.repeated_permutation(1) {|permutation| p permutation }
+ * Output:
+ * [0]
+ * [1]
+ * [2]
+ *
+ * +n+ = 2:
+ * a.repeated_permutation(2) {|permutation| p permutation }
+ * Output:
+ * [0, 0]
+ * [0, 1]
+ * [0, 2]
+ * [1, 0]
+ * [1, 1]
+ * [1, 2]
+ * [2, 0]
+ * [2, 1]
+ * [2, 2]
+ *
+ * If +n+ is zero, calls the block once with an empty \Array.
+ *
+ * If +n+ is negative, does not call the block:
+ * a.repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ * a = [0, 1, 2]
+ * a.repeated_permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
+ *
+ * Using Enumerators, it's convenient to show the permutations and counts
+ * for some values of +n+:
+ * e = a.repeated_permutation(0)
+ * e.size # => 1
+ * e.to_a # => [[]]
+ * e = a.repeated_permutation(1)
+ * e.size # => 3
+ * e.to_a # => [[0], [1], [2]]
+ * e = a.repeated_permutation(2)
+ * e.size # => 9
+ * e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
*/
-
static VALUE
rb_ary_repeated_permutation(VALUE ary, VALUE num)
{
@@ -5144,29 +7048,55 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.repeated_combination(n) { |c| block } -> ary
- * ary.repeated_combination(n) -> Enumerator
- *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
- * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
- *
+ * array.repeated_combination(n) {|combination| ... } -> self
+ * array.repeated_combination(n) -> new_enumerator
+ *
+ * Calls the block with each repeated combination of length +n+ of the elements of +self+;
+ * each combination is an \Array;
+ * returns +self+. The order of the combinations is indeterminate.
+ *
+ * When a block and a positive \Integer argument +n+ are given, calls the block with each
+ * +n+-tuple repeated combination of the elements of +self+.
+ * The number of combinations is <tt>(n+1)(n+2)/2</tt>.
+ *
+ * +n+ = 1:
+ * a = [0, 1, 2]
+ * a.repeated_combination(1) {|combination| p combination }
+ * Output:
+ * [0]
+ * [1]
+ * [2]
+ *
+ * +n+ = 2:
+ * a.repeated_combination(2) {|combination| p combination }
+ * Output:
+ * [0, 0]
+ * [0, 1]
+ * [0, 2]
+ * [1, 1]
+ * [1, 2]
+ * [2, 2]
+ *
+ * If +n+ is zero, calls the block once with an empty \Array.
+ *
+ * If +n+ is negative, does not call the block:
+ * a.repeated_combination(-1) {|combination| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ * a = [0, 1, 2]
+ * a.repeated_combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
+ *
+ * Using Enumerators, it's convenient to show the combinations and counts
+ * for some values of +n+:
+ * e = a.repeated_combination(0)
+ * e.size # => 1
+ * e.to_a # => [[]]
+ * e = a.repeated_combination(1)
+ * e.size # => 3
+ * e.to_a # => [[0], [1], [2]]
+ * e = a.repeated_combination(2)
+ * e.size # => 6
+ * e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
*/
static VALUE
@@ -5184,7 +7114,7 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
rb_yield(rb_ary_new2(0));
}
else if (n == 1) {
- for (i = 0; i < len; i++) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
}
}
@@ -5206,23 +7136,51 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
/*
* call-seq:
- * ary.product(other_ary, ...) -> new_ary
- * ary.product(other_ary, ...) { |p| block } -> ary
- *
- * Returns an array of all combinations of elements from all arrays.
- *
- * The length of the returned array is the product of the length of +self+ and
- * the argument arrays.
- *
- * If given a block, #product will yield all combinations and return +self+
- * instead.
- *
- * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
- * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- * [1,2].product() #=> [[1],[2]]
- * [1,2].product([]) #=> []
+ * array.product(*other_arrays) -> new_array
+ * array.product(*other_arrays) {|combination| ... } -> self
+ *
+ * Computes and returns or yields all combinations of elements from all the Arrays,
+ * including both +self+ and +other_arrays+.
+ * - The number of combinations is the product of the sizes of all the arrays,
+ * including both +self+ and +other_arrays+.
+ * - The order of the returned combinations is indeterminate.
+ *
+ * When no block is given, returns the combinations as an \Array of Arrays:
+ * a = [0, 1, 2]
+ * a1 = [3, 4]
+ * a2 = [5, 6]
+ * p = a.product(a1)
+ * p.size # => 6 # a.size * a1.size
+ * p # => [[0, 3], [0, 4], [1, 3], [1, 4], [2, 3], [2, 4]]
+ * p = a.product(a1, a2)
+ * p.size # => 12 # a.size * a1.size * a2.size
+ * p # => [[0, 3, 5], [0, 3, 6], [0, 4, 5], [0, 4, 6], [1, 3, 5], [1, 3, 6], [1, 4, 5], [1, 4, 6], [2, 3, 5], [2, 3, 6], [2, 4, 5], [2, 4, 6]]
+ *
+ * If any argument is an empty \Array, returns an empty \Array.
+ *
+ * If no argument is given, returns an \Array of 1-element Arrays,
+ * each containing an element of +self+:
+ * a.product # => [[0], [1], [2]]
+ *
+ * When a block is given, yields each combination as an \Array; returns +self+:
+ * a.product(a1) {|combination| p combination }
+ * Output:
+ * [0, 3]
+ * [0, 4]
+ * [1, 3]
+ * [1, 4]
+ * [2, 3]
+ * [2, 4]
+ *
+ * If any argument is an empty \Array, does not call the block:
+ * a.product(a1, a2, []) {|combination| fail 'Cannot happen' }
+ *
+ * If no argument is given, yields each element of +self+ as a 1-element \Array:
+ * a.product {|combination| p combination }
+ * Output:
+ * [0]
+ * [1]
+ * [2]
*/
static VALUE
@@ -5230,15 +7188,14 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
{
int n = argc+1; /* How many arrays we're operating on */
volatile VALUE t0 = tmpary(n);
- volatile VALUE t1 = tmpbuf(n, sizeof(int));
+ volatile VALUE t1 = Qundef;
VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
- int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+ int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
VALUE result = Qnil; /* The array we'll be returning, when no block given */
long i,j;
long resultlen = 1;
RBASIC_CLEAR_CLASS(t0);
- RBASIC_CLEAR_CLASS(t1);
/* initialize the arrays of arrays */
ARY_SET_LEN(t0, n);
@@ -5309,24 +7266,25 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
}
done:
tmpary_discard(t0);
- tmpbuf_discard(t1);
+ ALLOCV_END(t1);
return NIL_P(result) ? ary : result;
}
/*
* call-seq:
- * ary.take(n) -> new_ary
- *
- * Returns first +n+ elements from the array.
- *
- * If a negative number is given, raises an ArgumentError.
- *
- * See also Array#drop
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take(3) #=> [1, 2, 3]
- *
+ * array.take(n) -> new_array
+ *
+ * Returns a new \Array containing the first +n+ element of +self+,
+ * where +n+ is a non-negative \Integer;
+ * does not modify +self+.
+ *
+ * Examples:
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.take(1) # => [0]
+ * a.take(2) # => [0, 1]
+ * a.take(50) # => [0, 1, 2, 3, 4, 5]
+ * a # => [0, 1, 2, 3, 4, 5]
*/
static VALUE
@@ -5341,19 +7299,22 @@ rb_ary_take(VALUE obj, VALUE n)
/*
* call-seq:
- * ary.take_while { |arr| block } -> new_ary
- * ary.take_while -> Enumerator
- *
- * Passes elements to the block until the block returns +nil+ or +false+, then
- * stops iterating and returns an array of all prior elements.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#drop_while
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take_while { |i| i < 3 } #=> [1, 2]
- *
+ * array.take_while {|element| ... } -> new_array
+ * array.take_while -> new_enumerator
+ *
+ * Returns a new \Array containing zero or more leading elements of +self+;
+ * does not modify +self+.
+ *
+ * With a block given, calls the block with each successive element of +self+;
+ * stops if the block returns +false+ or +nil+;
+ * returns a new Array containing those elements for which the block returned a truthy value:
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.take_while {|element| element < 3 } # => [0, 1, 2]
+ * a.take_while {|element| true } # => [0, 1, 2, 3, 4, 5]
+ * a # => [0, 1, 2, 3, 4, 5]
+ *
+ * With no block given, returns a new \Enumerator:
+ * [0, 1].take_while # => #<Enumerator: [0, 1]:take_while>
*/
static VALUE
@@ -5370,18 +7331,17 @@ rb_ary_take_while(VALUE ary)
/*
* call-seq:
- * ary.drop(n) -> new_ary
- *
- * Drops first +n+ elements from +ary+ and returns the rest of the elements in
- * an array.
- *
- * If a negative number is given, raises an ArgumentError.
+ * array.drop(n) -> new_array
*
- * See also Array#take
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop(3) #=> [4, 5, 0]
+ * Returns a new \Array containing all but the first +n+ element of +self+,
+ * where +n+ is a non-negative \Integer;
+ * does not modify +self+.
*
+ * Examples:
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ * a.drop(1) # => [1, 2, 3, 4, 5]
+ * a.drop(2) # => [2, 3, 4, 5]
*/
static VALUE
@@ -5400,20 +7360,20 @@ rb_ary_drop(VALUE ary, VALUE n)
/*
* call-seq:
- * ary.drop_while { |arr| block } -> new_ary
- * ary.drop_while -> Enumerator
- *
- * Drops elements up to, but not including, the first element for which the
- * block returns +nil+ or +false+ and returns an array containing the
- * remaining elements.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#take_while
+ * array.drop_while {|element| ... } -> new_array
+ * array.drop_while -> new_enumerator
+
+ * Returns a new \Array containing zero or more trailing elements of +self+;
+ * does not modify +self+.
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
+ * With a block given, calls the block with each successive element of +self+;
+ * stops if the block returns +false+ or +nil+;
+ * returns a new Array _omitting_ those elements for which the block returned a truthy value:
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.drop_while {|element| element < 3 } # => [3, 4, 5]
*
+ * With no block given, returns a new \Enumerator:
+ * [0, 1].drop_while # => # => #<Enumerator: [0, 1]:drop_while>
*/
static VALUE
@@ -5430,20 +7390,53 @@ rb_ary_drop_while(VALUE ary)
/*
* call-seq:
- * ary.any? [{ |obj| block }] -> true or false
- *
- * See also Enumerable#any?
+ * array.any? -> true or false
+ * array.any? {|element| ... } -> true or false
+ * array.any?(obj) -> true or false
+ *
+ * Returns +true+ if any element of +self+ meets a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has any truthy element,
+ * +false+ otherwise:
+ * [nil, 0, false].any? # => true
+ * [nil, false].any? # => false
+ * [].any? # => false
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns any truthy value, +false+ otherwise:
+ * [0, 1, 2].any? {|element| element > 1 } # => true
+ * [0, 1, 2].any? {|element| element > 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if +obj+.<tt>===</tt> any element,
+ * +false+ otherwise:
+ * ['food', 'drink'].any?(/foo/) # => true
+ * ['food', 'drink'].any?(/bar/) # => false
+ * [].any?(/foo/) # => false
+ * [0, 1, 2].any?(1) # => true
+ * [0, 1, 2].any?(3) # => false
+ *
+ * Related: Enumerable#any?
*/
static VALUE
-rb_ary_any_p(VALUE ary)
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
{
long i, len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
+ rb_check_arity(argc, 0, 1);
if (!len) return Qfalse;
- if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+ }
}
else {
for (i = 0; i < RARRAY_LEN(ary); ++i) {
@@ -5454,12 +7447,407 @@ rb_ary_any_p(VALUE ary)
}
/*
- * Arrays are ordered, integer-indexed collections of any object.
+ * call-seq:
+ * array.all? -> true or false
+ * array.all? {|element| ... } -> true or false
+ * array.all?(obj) -> true or false
+ *
+ * Returns +true+ if all elements of +self+ meet a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ contains only truthy elements,
+ * +false+ otherwise:
+ * [0, 1, :foo].all? # => true
+ * [0, nil, 2].all? # => false
+ * [].all? # => true
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns only truthy values, +false+ otherwise:
+ * [0, 1, 2].all? { |element| element < 3 } # => true
+ * [0, 1, 2].all? { |element| element < 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> every element, +false+ otherwise:
+ * ['food', 'fool', 'foot'].all?(/foo/) # => true
+ * ['food', 'drink'].all?(/bar/) # => false
+ * [].all?(/foo/) # => true
+ * [0, 0, 0].all?(0) # => true
+ * [0, 1, 2].all?(1) # => false
+ *
+ * Related: Enumerable#all?
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * array.none? -> true or false
+ * array.none? {|element| ... } -> true or false
+ * array.none?(obj) -> true or false
+ *
+ * Returns +true+ if no element of +self+ meet a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ * +false+ otherwise:
+ * [nil, false].none? # => true
+ * [nil, 0, false].none? # => false
+ * [].none? # => true
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns no truthy value, +false+ otherwise:
+ * [0, 1, 2].none? {|element| element > 3 } # => true
+ * [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> no element, +false+ otherwise:
+ * ['food', 'drink'].none?(/bar/) # => true
+ * ['food', 'drink'].none?(/foo/) # => false
+ * [].none?(/foo/) # => true
+ * [0, 1, 2].none?(3) # => true
+ * [0, 1, 2].none?(1) # => false
+ *
+ * Related: Enumerable#none?
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * array.one? -> true or false
+ * array.one? {|element| ... } -> true or false
+ * array.one?(obj) -> true or false
+ *
+ * Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ * +false+ otherwise:
+ * [nil, 0].one? # => true
+ * [0, 0].one? # => false
+ * [nil, nil].one? # => false
+ * [].one? # => false
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ * [0, 1, 2].one? {|element| element > 0 } # => false
+ * [0, 1, 2].one? {|element| element > 1 } # => true
+ * [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> exactly one element,
+ * +false+ otherwise:
+ * [0, 1, 2].one?(0) # => true
+ * [0, 0, 1].one?(0) # => false
+ * [1, 1, 2].one?(0) # => false
+ * ['food', 'drink'].one?(/bar/) # => false
+ * ['food', 'drink'].one?(/foo/) # => true
+ * [].one?(/foo/) # => false
+ *
+ * Related: Enumerable#one?
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+ VALUE result = Qfalse;
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qfalse;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * array.dig(index, *identifiers) -> object
+ *
+ * Finds and returns the object in nested objects
+ * that is specified by +index+ and +identifiers+.
+ * The nested objects may be instances of various classes.
+ * See {Dig Methods}[rdoc-ref:doc/dig_methods.rdoc].
+ *
+ * Examples:
+ * a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ * a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ * a.dig(1, 2) # => [:bat, :bam]
+ * a.dig(1, 2, 0) # => :bat
+ * a.dig(1, 2, 3) # => nil
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+ rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+ self = rb_ary_at(self, *argv);
+ if (!--argc) return self;
+ ++argv;
+ return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+ if (n != 0)
+ v = rb_fix_plus(LONG2FIX(n), v);
+ if (r != Qundef) {
+ v = rb_rational_plus(r, v);
+ }
+ else if (!n && z) {
+ v = rb_fix_plus(LONG2FIX(0), v);
+ }
+ return v;
+}
+
+/*
+ * call-seq:
+ * array.sum(init = 0) -> object
+ * array.sum(init = 0) {|element| ... } -> object
+ *
+ * When no block is given, returns the object equivalent to:
+ * sum = init
+ * array.each {|element| sum += element }
+ * sum
+ * For example, <tt>[e1, e2, e3].sum</tt> returns </tt>init + e1 + e2 + e3</tt>.
+ *
+ * Examples:
+ * a = [0, 1, 2, 3]
+ * a.sum # => 6
+ * a.sum(100) # => 106
+ *
+ * The elements need not be numeric, but must be <tt>+</tt>-compatible
+ * with each other and with +init+:
+ * a = ['abc', 'def', 'ghi']
+ * a.sum('jkl') # => "jklabcdefghi"
+ *
+ * When a block is given, it is called with each element
+ * and the block's return value (instead of the element itself) is used as the addend:
+ * a = ['zero', 1, :two]
+ * s = a.sum('Coerced and concatenated: ') {|element| element.to_s }
+ * s # => "Coerced and concatenated: zero1two"
+ *
+ * Notes:
+ * - Array#join and Array#flatten may be faster than Array#sum
+ * for an \Array of Strings or an \Array of Arrays.
+ * - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE e, v, r;
+ long i, n;
+ int block_given;
+
+ v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+ block_given = rb_block_given_p();
+
+ if (RARRAY_LEN(ary) == 0)
+ return v;
+
+ n = 0;
+ r = Qundef;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ if (FIXNUM_P(e)) {
+ n += FIX2LONG(e); /* should not overflow long type */
+ if (!FIXABLE(n)) {
+ v = rb_big_plus(LONG2NUM(n), v);
+ n = 0;
+ }
+ }
+ else if (RB_TYPE_P(e, T_BIGNUM))
+ v = rb_big_plus(e, v);
+ else if (RB_TYPE_P(e, T_RATIONAL)) {
+ if (r == Qundef)
+ r = e;
+ else
+ r = rb_rational_plus(r, e);
+ }
+ else
+ goto not_exact;
+ }
+ v = finish_exact_sum(n, r, v, argc!=0);
+ return v;
+
+ not_exact:
+ v = finish_exact_sum(n, r, v, i!=0);
+
+ if (RB_FLOAT_TYPE_P(e)) {
+ /*
+ * Kahan-Babuska balancing compensated summation algorithm
+ * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+ */
+ double f, c;
+ double x, t;
+
+ f = NUM2DBL(v);
+ c = 0.0;
+ goto has_float_value;
+ for (; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ if (RB_FLOAT_TYPE_P(e))
+ has_float_value:
+ x = RFLOAT_VALUE(e);
+ else if (FIXNUM_P(e))
+ x = FIX2LONG(e);
+ else if (RB_TYPE_P(e, T_BIGNUM))
+ x = rb_big2dbl(e);
+ else if (RB_TYPE_P(e, T_RATIONAL))
+ x = rb_num2dbl(e);
+ else
+ goto not_float;
+
+ if (isnan(f)) continue;
+ if (isnan(x)) {
+ f = x;
+ continue;
+ }
+ if (isinf(x)) {
+ if (isinf(f) && signbit(x) != signbit(f))
+ f = NAN;
+ else
+ f = x;
+ continue;
+ }
+ if (isinf(f)) continue;
+
+ t = f + x;
+ if (fabs(f) >= fabs(x))
+ c += ((f - t) + x);
+ else
+ c += ((x - t) + f);
+ f = t;
+ }
+ f += c;
+ return DBL2NUM(f);
+
+ not_float:
+ v = DBL2NUM(f);
+ }
+
+ goto has_some_value;
+ for (; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ has_some_value:
+ v = rb_funcall(v, idPLUS, 1, e);
+ }
+ return v;
+}
+
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+ return ary;
+}
+
+/*
+ * An \Array is an ordered, integer-indexed collection of objects,
+ * called _elements_. Any object may be an \Array element.
+ *
+ * == \Array Indexes
+ *
+ * \Array indexing starts at 0, as in C or Java.
+ *
+ * A positive index is an offset from the first element:
+ * - Index 0 indicates the first element.
+ * - Index 1 indicates the second element.
+ * - ...
+ *
+ * A negative index is an offset, backwards, from the end of the array:
+ * - Index -1 indicates the last element.
+ * - Index -2 indicates the next-to-last element.
+ * - ...
*
- * Array indexing starts at 0, as in C or Java. A negative index is assumed
- * to be relative to the end of the array---that is, an index of -1 indicates
- * the last element of the array, -2 is the next to last element in the
- * array, and so on.
+ * A non-negative index is <i>in range</i> if it is smaller than
+ * the size of the array. For a 3-element array:
+ * - Indexes 0 through 2 are in range.
+ * - Index 3 is out of range.
+ *
+ * A negative index is <i>in range</i> if its absolute value is
+ * not larger than the size of the array. For a 3-element array:
+ * - Indexes -1 through -3 are in range.
+ * - Index -4 is out of range.
*
* == Creating Arrays
*
@@ -5486,11 +7874,12 @@ rb_ary_any_p(VALUE ary)
* This method is safe to use with mutable objects such as hashes, strings or
* other arrays:
*
- * Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
+ * Array.new(4) {Hash.new} #=> [{}, {}, {}, {}]
+ * Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
*
* This is also a quick way to build up multi-dimensional arrays:
*
- * empty_table = Array.new(3) { Array.new(3) }
+ * empty_table = Array.new(3) {Array.new(3)}
* #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
*
* An array can also be created by using the Array() method, provided by
@@ -5637,7 +8026,7 @@ rb_ary_any_p(VALUE ary)
* Note that this operation leaves the array unchanged.
*
* arr = [1, 2, 3, 4, 5]
- * arr.each { |a| print a -= 10, " " }
+ * arr.each {|a| print a -= 10, " "}
* # prints: -9 -8 -7 -6 -5
* #=> [1, 2, 3, 4, 5]
*
@@ -5646,15 +8035,15 @@ rb_ary_any_p(VALUE ary)
*
* words = %w[first second third fourth fifth sixth]
* str = ""
- * words.reverse_each { |word| str += "#{word} " }
+ * words.reverse_each {|word| str += "#{word} "}
* p str #=> "sixth fifth fourth third second first "
*
* The #map method can be used to create a new array based on the original
* array, but with the values modified by the supplied block:
*
- * arr.map { |a| 2*a } #=> [2, 4, 6, 8, 10]
+ * arr.map {|a| 2*a} #=> [2, 4, 6, 8, 10]
* arr #=> [1, 2, 3, 4, 5]
- * arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ * arr.map! {|a| a**2} #=> [1, 4, 9, 16, 25]
* arr #=> [1, 4, 9, 16, 25]
*
* == Selecting Items from an Array
@@ -5668,9 +8057,9 @@ rb_ary_any_p(VALUE ary)
* === Non-destructive Selection
*
* arr = [1, 2, 3, 4, 5, 6]
- * arr.select { |a| a > 3 } #=> [4, 5, 6]
- * arr.reject { |a| a < 3 } #=> [3, 4, 5, 6]
- * arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ * arr.select {|a| a > 3} #=> [4, 5, 6]
+ * arr.reject {|a| a < 3} #=> [3, 4, 5, 6]
+ * arr.drop_while {|a| a < 4} #=> [4, 5, 6]
* arr #=> [1, 2, 3, 4, 5, 6]
*
* === Destructive Selection
@@ -5681,21 +8070,17 @@ rb_ary_any_p(VALUE ary)
* Similar to #select vs. #reject, #delete_if and #keep_if have the exact
* opposite result when supplied with the same block:
*
- * arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ * arr.delete_if {|a| a < 4} #=> [4, 5, 6]
* arr #=> [4, 5, 6]
*
* arr = [1, 2, 3, 4, 5, 6]
- * arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ * arr.keep_if {|a| a < 4} #=> [1, 2, 3]
* arr #=> [1, 2, 3]
- *
*/
void
Init_Array(void)
{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
@@ -5710,7 +8095,6 @@ Init_Array(void)
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
- rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -5722,18 +8106,23 @@ Init_Array(void)
rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
rb_define_method(rb_cArray, "first", rb_ary_first, -1);
rb_define_method(rb_cArray, "last", rb_ary_last, -1);
- rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+ rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+ rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+ rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+ rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+ rb_define_alias(rb_cArray, "append", "push");
rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+ rb_define_alias(rb_cArray, "prepend", "unshift");
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
- rb_define_alias(rb_cArray, "size", "length");
+ rb_define_method(rb_cArray, "size", rb_ary_length, 0);
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
rb_define_method(rb_cArray, "index", rb_ary_index, -1);
@@ -5752,6 +8141,8 @@ Init_Array(void)
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "select", rb_ary_select, 0);
rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -5780,6 +8171,10 @@ Init_Array(void)
rb_define_method(rb_cArray, "&", rb_ary_and, 1);
rb_define_method(rb_cArray, "|", rb_ary_or, 1);
+ rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+ rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+ rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
@@ -5787,9 +8182,6 @@ Init_Array(void)
rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
rb_define_method(rb_cArray, "count", rb_ary_count, -1);
- rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
- rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
- rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -5802,10 +8194,15 @@ Init_Array(void)
rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
- rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+ rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+ rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+ rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+ rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+ rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+ rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+ rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
- id_cmp = rb_intern("<=>");
- id_random = rb_intern("random");
- id_div = rb_intern("div");
- id_power = rb_intern("**");
+ rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
}
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..a43a3b27b1
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,61 @@
+class Array
+ # call-seq:
+ # array.shuffle!(random: Random) -> array
+ #
+ # Shuffles the elements of +self+ in place.
+ # a = [1, 2, 3] #=> [1, 2, 3]
+ # a.shuffle! #=> [2, 3, 1]
+ # a #=> [2, 3, 1]
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
+ def shuffle!(random: Random)
+ Primitive.rb_ary_shuffle_bang(random)
+ end
+
+ # call-seq:
+ # array.shuffle(random: Random) -> new_ary
+ #
+ # Returns a new array with elements of +self+ shuffled.
+ # a = [1, 2, 3] #=> [1, 2, 3]
+ # a.shuffle #=> [2, 3, 1]
+ # a #=> [1, 2, 3]
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ def shuffle(random: Random)
+ Primitive.rb_ary_shuffle(random)
+ end
+
+ # call-seq:
+ # array.sample(random: Random) -> object
+ # array.sample(n, random: Random) -> new_ary
+ #
+ # Returns random elements from +self+.
+ #
+ # When no arguments are given, returns a random element from +self+:
+ # a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ # a.sample # => 3
+ # a.sample # => 8
+ # If +self+ is empty, returns +nil+.
+ #
+ # When argument +n+ is given, returns a new \Array containing +n+ random
+ # elements from +self+:
+ # a.sample(3) # => [8, 9, 2]
+ # a.sample(6) # => [9, 6, 10, 3, 1, 4]
+ # Returns no more than <tt>a.size</tt> elements
+ # (because no new duplicates are introduced):
+ # a.sample(a.size * 2) # => [6, 4, 1, 8, 5, 9, 10, 2, 3, 7]
+ # But +self+ may contain duplicates:
+ # a = [1, 1, 1, 2, 2, 3]
+ # a.sample(a.size * 2) # => [1, 1, 3, 2, 1, 2]
+ # Returns a new empty \Array if +self+ is empty.
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ # a.sample(random: Random.new(1)) #=> 6
+ # a.sample(4, random: Random.new(1)) #=> [6, 10, 9, 2]
+ def sample(n = (ary = false), random: Random)
+ Primitive.rb_ary_sample(random, n, ary)
+ end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..2af0b3e530
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,699 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/parse.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+
+struct ASTNodeData {
+ rb_ast_t *ast;
+ const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ rb_gc_mark((VALUE)data->ast);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ return rb_ast_memsize(data->ast);
+}
+
+static const rb_data_type_t rb_node_type = {
+ "AST/node",
+ {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+ 0, 0,
+ RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, rb_ast_t *ast, const NODE *node)
+{
+ struct ASTNodeData *data;
+
+ TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+ data->ast = ast;
+ data->node = node;
+}
+
+static VALUE
+ast_new_internal(rb_ast_t *ast, const NODE *node)
+{
+ VALUE obj;
+
+ obj = rb_ast_node_alloc(rb_cNode);
+ setup_node(obj, ast, node);
+
+ return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str);
+static VALUE rb_ast_parse_file(VALUE path);
+static VALUE rb_ast_parse_array(VALUE array);
+
+static VALUE
+ast_parse_new(void)
+{
+ return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(rb_ast_t *ast)
+{
+ if (!ast->body.root) {
+ rb_ast_dispose(ast);
+ rb_exc_raise(GET_EC()->errinfo);
+ }
+
+ return ast_new_internal(ast, (NODE *)ast->body.root);
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str)
+{
+ return rb_ast_parse_str(str);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str)
+{
+ rb_ast_t *ast = 0;
+
+ StringValue(str);
+ ast = rb_parser_compile_string_path(ast_parse_new(), Qnil, str, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path)
+{
+ return rb_ast_parse_file(path);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path)
+{
+ VALUE f;
+ rb_ast_t *ast = 0;
+ rb_encoding *enc = rb_utf8_encoding();
+
+ FilePathValue(path);
+ f = rb_file_open_str(path, "r");
+ rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+ ast = rb_parser_compile_file_path(ast_parse_new(), Qnil, f, 1);
+ rb_io_close(f);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+lex_array(VALUE array, int index)
+{
+ VALUE str = rb_ary_entry(array, index);
+ if (!NIL_P(str)) {
+ StringValue(str);
+ if (!rb_enc_asciicompat(rb_enc_get(str))) {
+ rb_raise(rb_eArgError, "invalid source encoding");
+ }
+ }
+ return str;
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array)
+{
+ rb_ast_t *ast = 0;
+
+ array = rb_check_array_type(array);
+ ast = rb_parser_compile_generic(ast_parse_new(), lex_array, Qnil, array, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE node_children(rb_ast_t*, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+ VALUE ary;
+ long i;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ if (nd_node_id(data->node) == node_id) return self;
+
+ ary = node_children(data->ast, data->node);
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE child = RARRAY_AREF(ary, i);
+
+ if (CLASS_OF(child) == rb_cNode) {
+ VALUE result = node_find(child, node_id);
+ if (RTEST(result)) return result;
+ }
+ }
+
+ return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+script_lines(VALUE path)
+{
+ VALUE hash, lines;
+ ID script_lines;
+ CONST_ID(script_lines, "SCRIPT_LINES__");
+ if (!rb_const_defined_at(rb_cObject, script_lines)) return Qnil;
+ hash = rb_const_get_at(rb_cObject, script_lines);
+ if (!RB_TYPE_P(hash, T_HASH)) return Qnil;
+ lines = rb_hash_lookup(hash, path);
+ if (!RB_TYPE_P(lines, T_ARRAY)) return Qnil;
+ return lines;
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body)
+{
+ VALUE path, node, lines;
+ int node_id;
+ const rb_iseq_t *iseq = NULL;
+
+ if (rb_obj_is_proc(body)) {
+ iseq = vm_proc_iseq(body);
+
+ if (!rb_obj_is_iseq((VALUE)iseq)) {
+ iseq = NULL;
+ }
+ }
+ else {
+ iseq = rb_method_iseq(body);
+ }
+
+ if (!iseq) return Qnil;
+
+ path = rb_iseq_path(iseq);
+ node_id = iseq->body->location.node_id;
+ if (!NIL_P(lines = script_lines(path))) {
+ node = rb_ast_parse_array(lines);
+ }
+ else if (RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0) {
+ node = rb_ast_parse_str(rb_e_script);
+ }
+ else {
+ node = rb_ast_parse_file(path);
+ }
+
+ return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+ struct ASTNodeData *data;
+ VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+ return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+ return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+#define NEW_CHILD(ast, node) node ? ast_new_internal(ast, node) : Qnil
+
+static VALUE
+rb_ary_new_from_node_args(rb_ast_t *ast, long n, ...)
+{
+ va_list ar;
+ VALUE ary;
+ long i;
+
+ ary = rb_ary_new2(n);
+
+ va_start(ar, n);
+ for (i=0; i<n; i++) {
+ NODE *node;
+ node = va_arg(ar, NODE *);
+ rb_ary_push(ary, NEW_CHILD(ast, node));
+ }
+ va_end(ar);
+ return ary;
+}
+
+static VALUE
+dump_block(rb_ast_t *ast, const NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ do {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ } while (node->nd_next &&
+ nd_type(node->nd_next) == NODE_BLOCK &&
+ (node = node->nd_next, 1));
+ if (node->nd_next) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+ }
+
+ return ary;
+}
+
+static VALUE
+dump_array(rb_ast_t *ast, const NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+
+ while (node->nd_next && nd_type(node->nd_next) == NODE_LIST) {
+ node = node->nd_next;
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+
+ return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+ if (!id) return Qnil;
+ if (!rb_id2str(id)) return Qnil;
+ return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+ ID rest;
+ CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+ return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(rb_ast_t *ast, const NODE *rest_arg)
+{
+ return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast, rest_arg) : no_name_rest();
+}
+
+static VALUE
+node_children(rb_ast_t *ast, const NODE *node)
+{
+ char name[DECIMAL_SIZE_OF_BITS(sizeof(long) * CHAR_BIT) + 2]; /* including '$' */
+
+ enum node_type type = nd_type(node);
+ switch (type) {
+ case NODE_BLOCK:
+ return dump_block(ast, node);
+ case NODE_IF:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_UNLESS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_CASE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE2:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_WHEN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_IN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_WHILE:
+ case NODE_UNTIL:
+ return rb_ary_push(rb_ary_new_from_node_args(ast, 2, node->nd_cond, node->nd_body),
+ (node->nd_state ? Qtrue : Qfalse));
+ case NODE_ITER:
+ case NODE_FOR:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_iter, node->nd_body);
+ case NODE_FOR_MASGN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_var);
+ case NODE_BREAK:
+ case NODE_NEXT:
+ case NODE_RETURN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_stts);
+ case NODE_REDO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_RETRY:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_BEGIN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_RESCUE:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_resq, node->nd_else);
+ case NODE_RESBODY:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_args, node->nd_body, node->nd_head);
+ case NODE_ENSURE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_ensr);
+ case NODE_AND:
+ case NODE_OR:
+ {
+ VALUE ary = rb_ary_new();
+
+ while (1) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_1st));
+ if (!node->nd_2nd || nd_type(node->nd_2nd) != (int)type)
+ break;
+ node = node->nd_2nd;
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_2nd));
+ return ary;
+ }
+ case NODE_MASGN:
+ if (NODE_NAMED_REST_P(node->nd_args)) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_value, node->nd_head, node->nd_args);
+ }
+ else {
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_value),
+ NEW_CHILD(ast, node->nd_head),
+ no_name_rest());
+ }
+ case NODE_LASGN:
+ case NODE_DASGN:
+ case NODE_DASGN_CURR:
+ case NODE_IASGN:
+ case NODE_CVASGN:
+ case NODE_GASGN:
+ if (NODE_REQUIRED_KEYWORD_P(node)) {
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+ }
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ case NODE_CDECL:
+ if (node->nd_vid) {
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ }
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_else), ID2SYM(node->nd_else->nd_mid), NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN1:
+ return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args->nd_head),
+ NEW_CHILD(ast, node->nd_args->nd_body));
+ case NODE_OP_ASGN2:
+ return rb_ary_new_from_args(5, NEW_CHILD(ast, node->nd_recv),
+ node->nd_next->nd_aid ? Qtrue : Qfalse,
+ ID2SYM(node->nd_next->nd_vid),
+ ID2SYM(node->nd_next->nd_mid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_AND:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idANDOP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_OR:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idOROP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_CDECL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head),
+ ID2SYM(node->nd_aid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_CALL:
+ case NODE_OPCALL:
+ case NODE_QCALL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_FCALL:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_VCALL:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_SUPER:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_args);
+ case NODE_ZSUPER:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_LIST:
+ case NODE_VALUES:
+ return dump_array(ast, node);
+ case NODE_ZLIST:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_HASH:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_YIELD:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_LVAR:
+ case NODE_DVAR:
+ return rb_ary_new_from_args(1, var_name(node->nd_vid));
+ case NODE_IVAR:
+ case NODE_CONST:
+ case NODE_CVAR:
+ case NODE_GVAR:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_vid));
+ case NODE_NTH_REF:
+ snprintf(name, sizeof(name), "$%ld", node->nd_nth);
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_BACK_REF:
+ name[0] = '$';
+ name[1] = (char)node->nd_nth;
+ name[2] = '\0';
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_MATCH2:
+ if (node->nd_args) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_recv, node->nd_value, node->nd_args);
+ }
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH:
+ case NODE_LIT:
+ case NODE_STR:
+ case NODE_XSTR:
+ return rb_ary_new_from_args(1, node->nd_lit);
+ case NODE_ONCE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_DSTR:
+ case NODE_DXSTR:
+ case NODE_DREGX:
+ case NODE_DSYM:
+ {
+ NODE *n = node->nd_next;
+ VALUE head = Qnil, next = Qnil;
+ if (n) {
+ head = NEW_CHILD(ast, n->nd_head);
+ next = NEW_CHILD(ast, n->nd_next);
+ }
+ return rb_ary_new_from_args(3, node->nd_lit, head, next);
+ }
+ case NODE_EVSTR:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ARGSCAT:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_ARGSPUSH:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_SPLAT:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_BLOCK_PASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_DEFN:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_DEFS:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_ALIAS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ case NODE_VALIAS:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_alias), ID2SYM(node->nd_orig));
+ case NODE_UNDEF:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_undef);
+ case NODE_CLASS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cpath, node->nd_super, node->nd_body);
+ case NODE_MODULE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_cpath, node->nd_body);
+ case NODE_SCLASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_body);
+ case NODE_COLON2:
+ return rb_ary_new_from_args(2, NEW_CHILD(ast, node->nd_head), ID2SYM(node->nd_mid));
+ case NODE_COLON3:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_DOT2:
+ case NODE_DOT3:
+ case NODE_FLIP2:
+ case NODE_FLIP3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_beg, node->nd_end);
+ case NODE_SELF:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_NIL:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_TRUE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_FALSE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_ERRINFO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_DEFINED:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_POSTEXE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ATTRASGN:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_args));
+ case NODE_LAMBDA:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_OPT_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_KW_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_POSTARG:
+ if (NODE_NAMED_REST_P(node->nd_1st)) {
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ }
+ return rb_ary_new_from_args(2, no_name_rest(),
+ NEW_CHILD(ast, node->nd_2nd));
+ case NODE_ARGS:
+ {
+ struct rb_args_info *ainfo = node->nd_ainfo;
+ return rb_ary_new_from_args(10,
+ INT2NUM(ainfo->pre_args_num),
+ NEW_CHILD(ast, ainfo->pre_init),
+ NEW_CHILD(ast, ainfo->opt_args),
+ var_name(ainfo->first_post_arg),
+ INT2NUM(ainfo->post_args_num),
+ NEW_CHILD(ast, ainfo->post_init),
+ (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+ ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+ : var_name(ainfo->rest_arg)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_args)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_rest_arg)),
+ var_name(ainfo->block_arg));
+ }
+ case NODE_SCOPE:
+ {
+ ID *tbl = node->nd_tbl;
+ int i, size = tbl ? (int)*tbl++ : 0;
+ VALUE locals = rb_ary_new_capa(size);
+ for (i = 0; i < size; i++) {
+ rb_ary_push(locals, var_name(tbl[i]));
+ }
+ return rb_ary_new_from_args(3, locals, NEW_CHILD(ast, node->nd_args), NEW_CHILD(ast, node->nd_body));
+ }
+ case NODE_ARYPTN:
+ {
+ struct rb_ary_pattern_info *apinfo = node->nd_apinfo;
+ VALUE rest = rest_arg(ast, apinfo->rest_arg);
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, apinfo->pre_args),
+ rest,
+ NEW_CHILD(ast, apinfo->post_args));
+ }
+ case NODE_FNDPTN:
+ {
+ struct rb_fnd_pattern_info *fpinfo = node->nd_fpinfo;
+ VALUE pre_rest = rest_arg(ast, fpinfo->pre_rest_arg);
+ VALUE post_rest = rest_arg(ast, fpinfo->post_rest_arg);
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ pre_rest,
+ NEW_CHILD(ast, fpinfo->args),
+ post_rest);
+ }
+ case NODE_HSHPTN:
+ {
+ VALUE kwrest = node->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+ NEW_CHILD(ast, node->nd_pkwrestarg);
+
+ return rb_ary_new_from_args(3,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, node->nd_pkwargs),
+ kwrest);
+ }
+ case NODE_ARGS_AUX:
+ case NODE_LAST:
+ break;
+ }
+
+ rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return node_children(data->ast, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+ VALUE str;
+ VALUE cname;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ cname = rb_class_path(rb_obj_class(self));
+ str = rb_str_new2("#<");
+
+ rb_str_append(str, cname);
+ rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+ node_type_to_str(data->node),
+ nd_first_lineno(data->node), nd_first_column(data->node),
+ nd_last_lineno(data->node), nd_last_column(data->node));
+
+ return str;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+ rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+ rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+ rb_undef_alloc_func(rb_cNode);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..34fa645671
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,146 @@
+# for ast.c
+
+class RubyVM
+
+ # AbstractSyntaxTree provides methods to parse Ruby code into
+ # abstract syntax trees. The nodes in the tree
+ # are instances of RubyVM::AbstractSyntaxTree::Node.
+ #
+ # This module is MRI specific as it exposes implementation details
+ # of the MRI abstract syntax tree.
+ #
+ # This module is experimental and its API is not stable, therefore it might
+ # change without notice. As examples, the order of children nodes is not
+ # guaranteed, the number of children nodes might change, there is no way to
+ # access children nodes by name, etc.
+ #
+ # If you are looking for a stable API or an API working under multiple Ruby
+ # implementations, consider using the _parser_ gem or Ripper. If you would
+ # like to make RubyVM::AbstractSyntaxTree stable, please join the discussion
+ # at https://bugs.ruby-lang.org/issues/14844.
+ #
+ module AbstractSyntaxTree
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse(string) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Parses the given _string_ into an abstract syntax tree,
+ # returning the root node of that tree.
+ #
+ # SyntaxError is raised if the given _string_ is invalid syntax.
+ #
+ # RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+ def self.parse string
+ Primitive.ast_s_parse string
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse_file(pathname) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Reads the file from _pathname_, then parses it like ::parse,
+ # returning the root node of the abstract syntax tree.
+ #
+ # SyntaxError is raised if _pathname_'s contents are not
+ # valid Ruby syntax.
+ #
+ # RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+ def self.parse_file pathname
+ Primitive.ast_s_parse_file pathname
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.of(proc) -> RubyVM::AbstractSyntaxTree::Node
+ # RubyVM::AbstractSyntaxTree.of(method) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Returns AST nodes of the given _proc_ or _method_.
+ #
+ # RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+ #
+ # def hello
+ # puts "hello, world"
+ # end
+ #
+ # RubyVM::AbstractSyntaxTree.of(method(:hello))
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+ def self.of body
+ Primitive.ast_s_of body
+ end
+
+ # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+ # RubyVM::AbstractSyntaxTree.
+ #
+ # This class is MRI specific.
+ #
+ class Node
+
+ # call-seq:
+ # node.type -> symbol
+ #
+ # Returns the type of this node as a symbol.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # root.type # => :SCOPE
+ # lasgn = root.children[2]
+ # lasgn.type # => :LASGN
+ # call = lasgn.children[1]
+ # call.type # => :OPCALL
+ def type
+ Primitive.ast_node_type
+ end
+
+ # call-seq:
+ # node.first_lineno -> integer
+ #
+ # The line number in the source code where this AST's text began.
+ def first_lineno
+ Primitive.ast_node_first_lineno
+ end
+
+ # call-seq:
+ # node.first_column -> integer
+ #
+ # The column number in the source code where this AST's text began.
+ def first_column
+ Primitive.ast_node_first_column
+ end
+
+ # call-seq:
+ # node.last_lineno -> integer
+ #
+ # The line number in the source code where this AST's text ended.
+ def last_lineno
+ Primitive.ast_node_last_lineno
+ end
+
+ # call-seq:
+ # node.last_column -> integer
+ #
+ # The column number in the source code where this AST's text ended.
+ def last_column
+ Primitive.ast_node_last_column
+ end
+
+ # call-seq:
+ # node.children -> array
+ #
+ # Returns AST nodes under this one. Each kind of node
+ # has different children, depending on what kind of node it is.
+ #
+ # The returned array may contain other nodes or <code>nil</code>.
+ def children
+ Primitive.ast_node_children
+ end
+
+ # call-seq:
+ # node.inspect -> string
+ #
+ # Returns debugging information about this node as a string.
+ def inspect
+ Primitive.ast_node_inspect
+ end
+ end
+ end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..44a1922cb0
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,9 @@
+#!/bin/sh
+
+PWD=
+case "$0" in
+*/*) srcdir=`dirname $0`;;
+*) srcdir="";;
+esac
+
+exec ${AUTORECONF:-autoreconf} --install --symlink "$@" ${srcdir:+"$srcdir"}
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+ load './rbconfig.rb'
+ ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+ print "#{ruby} is not found.\n"
+ print "Try `make' first, then `make test', please.\n"
+ exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+ ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+ if line =~ /^end of test/
+ print "\ntest succeeded\n"
+ exit true
+ end
+ error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..52008b78db
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2364 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+ def initialize
+ @color = nil
+ @tty = nil
+ @quiet = nil
+ @verbose = nil
+ ARGV.each do |arg|
+ case arg
+ when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+ warn "unknown --color argument: #$3" if $3
+ @color = $1 ? nil : !$2
+ when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+ warn "unknown --tty argument: #$3" if $3
+ @tty = !$1 || !$2
+ true
+ when /\A-(q|-quiet)\z/
+ @quiet = true
+ when /\A-(v|-verbose)\z/
+ @verbose = true
+ end
+ end
+ @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+ @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+ case @color
+ when nil
+ @color = @tty
+ end
+ if @color
+ # dircolors-like style
+ colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+ begin
+ File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+ colors[n] ||= c
+ end
+ rescue
+ end
+ @passed = "\e[;#{colors["pass"] || "32"}m"
+ @failed = "\e[;#{colors["fail"] || "31"}m"
+ @reset = "\e[m"
+ else
+ @passed = @failed = @reset = ""
+ end
+ extend(Rotator) if @tty
+ end
+
+ def passed_string
+ "."
+ end
+ def failed_string
+ "#{@failed}F#{@reset}"
+ end
+ def init_string
+ end
+ def finish_string
+ if @quiet
+ @eol
+ else
+ "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+ end
+ end
+ def pass
+ STDERR.print passed_string
+ end
+ def fail
+ @ok = false
+ STDERR.print failed_string
+ end
+ def init
+ @ok = true
+ STDERR.print init_string
+ end
+ def finish
+ STDERR.print finish_string
+ end
+
+ module Rotator
+ ROTATOR = %w[- \\ | /]
+ BS = "\b" * ROTATOR[0].size
+ def passed_string
+ "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+ end
+ def failed_string
+ "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+ end
+ def init_string
+ @count = 0
+ " "
+ end
+ def finish_string
+ s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+ s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+ s
+ end
+ end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+ unless $ntest.zero?
+ PROGRESS.finish
+ end
+ STDERR.print "#{$0}:#{what} "
+ PROGRESS.init
+ $what = what
+ $testnum = 0
+end
+
+def test_ok(cond,n=1)
+ $testnum+=1
+ $ntest+=1
+ where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+ if cond
+ PROGRESS.pass
+ printf "ok %d (%s)\n", $testnum, where
+ else
+ PROGRESS.fail
+ printf "not ok %s %d -- %s\n", $what, $testnum, where
+ $failed+=1
+ end
+ STDOUT.flush
+ STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1 ) == [1,42,[ ]] )
+test_ok(f.call(1,43 ) == [1,43,[ ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8 ) == [8,24,[ ],nil] )
+test_ok(f.call(8,43 ) == [8,43,[ ],nil] )
+test_ok(f.call(8,43,44) == [8,43,[44],nil] )
+test_ok(f.call(8 ){45} == [8,24,[ ],45 ] )
+test_ok(f.call(8,43 ){45} == [8,43,[ ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1 ,99) == [1,42,[ ],99] )
+test_ok(f.call(1,43 ,99) == [1,43,[ ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8 ) == [8,24,nil] )
+test_ok(f.call(8,43) == [8,43,nil] )
+test_ok(f.call(8,43) == [8,43,nil] )
+test_ok(f.call(8 ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1 ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call( ) == [42,[ ],nil] )
+test_ok(f.call(43 ) == [43,[ ],nil] )
+test_ok(f.call(43,44) == [43,[44],nil] )
+test_ok(f.call( ){45} == [42,[ ],45 ] )
+test_ok(f.call(43 ){45} == [43,[ ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call( 99) == [42,[ ],99] )
+test_ok(f.call(43 ,99) == [43,[ ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call( ) == [42,nil] )
+test_ok(f.call(43) == [43,nil] )
+test_ok(f.call(43) == [43,nil] )
+test_ok(f.call( ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call( 99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+ $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+ test_ok(false)
+when 5
+ test_ok(true)
+end
+
+case 5
+when 5
+ test_ok(true)
+when 1..10
+ test_ok(false)
+end
+
+case 5
+when 1..10
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+case 5
+when 5
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+ break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ next if /vt100/ =~ line
+ $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ lastline = line
+ line = line.gsub(/vt100/, 'VT100')
+ if lastline != line
+ line.gsub!('VT100', 'Vt100')
+ redo
+ end
+ $bad = 1 if /vt100/ =~ line
+ $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+ sum += i
+ i -= 1
+ if i > 0
+ redo
+ end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ break if 3
+ case line
+ when /vt100/, /Amiga/, /paper/
+ $bad = true
+ end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+ i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+ raise "this must be handled"
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+$bad = true
+begin
+ raise "this must be handled no.2"
+rescue
+ if $bad
+ $bad = false
+ retry
+ test_ok(false)
+ end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+ begin
+ raise "exception in rescue clause"
+ rescue
+ raise $string
+ end
+ test_ok(false)
+rescue => e
+ test_ok($! == e)
+ test_ok(e.message == $string)
+ test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+ begin
+ raise "this must be handled no.4"
+ ensure
+ raise "exception in ensure clause"
+ end
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+$bad = true
+begin
+ begin
+ raise "this must be handled no.5"
+ ensure
+ $bad = false
+ end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+ begin
+ raise "this must be handled no.6"
+ ensure
+ $bad = false
+ end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+ begin
+ break
+ ensure
+ $bad = false
+ end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+ loop do
+ loop do
+ throw :foo, true
+ break
+ end
+ break
+ test_ok(false) # should not reach here
+ end
+ false
+ })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b} # sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a} # reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = "The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+ for k,v in $x
+ raise if k*2 != v
+ end
+ true
+ rescue
+ false
+ end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+ $z = k
+ self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+ $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+ 1.upto(10) {|i|
+ yield i
+ }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+ yield 1
+end
+
+def tt3(&block)
+ tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+ tt3{}
+rescue ArgumentError
+ $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+ tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+ tt4{}
+rescue ArgumentError
+ $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+ break
+ done = false # should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+ break if done
+ done = true
+ next
+ $bad = true # should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+ break if done
+ done = true
+ redo
+ $bad = true # should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+ $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+ def iter_test1
+ collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+ end
+ def iter_test2
+ a = collect{|e| [e, yield(e)]}
+ a.sort{|a,b|a[1]<=>b[1]}
+ end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+ def initialize(e); @body = e; end
+
+ def each0(&block); @body.each(&block); end
+ def each1(&block); @body.each {|*x| block.call(*x) } end
+ def each2(&block); @body.each {|*x| block.call(x) } end
+ def each3(&block); @body.each {|x| block.call(*x) } end
+ def each4(&block); @body.each {|x| block.call(x) } end
+ def each5; @body.each {|*x| yield(*x) } end
+ def each6; @body.each {|*x| yield(x) } end
+ def each7; @body.each {|x| yield(*x) } end
+ def each8; @body.each {|x| yield(x) } end
+
+ def f(a)
+ a
+ end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+ v
+end
+
+def m1
+ m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+ m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+ include Enumerable
+ def initialize
+ @a = [1,2,3]
+ end
+ def each(&block)
+ @a.each(&block)
+ end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+ test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+ x = state
+ begin
+ proc.call(*args)
+ rescue ArgumentError
+ x = !x
+ end
+ test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+ block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+ Proc.new {
+ return 55
+ }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+ lambda {
+ return 55
+ }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+ b.call
+end
+def proc_yield()
+ yield
+end
+def proc_return1
+ lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+ ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+ proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+ proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+ x = state
+ begin
+ proc.call(*args)
+ rescue LocalJumpError
+ x = !x
+ end
+ test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+ block.call
+rescue LocalJumpError
+ $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+ block_get{break 55}.call
+ rescue LocalJumpError
+ $!.exit_value
+ end)
+
+def block_call(&block)
+ block.call
+end
+
+def test_b1
+ block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+ begin
+ yield
+ rescue LocalJumpError => e
+ r if /from proc-closure/ =~ e.message
+ end
+end
+
+def test_b2
+ ljump_rescue(22) do
+ block_get{break 21}.call
+ end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+ ljump_rescue(33) do
+ Proc.new{break 31}.yield
+ end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+ lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+ ljump_rescue(55) do
+ b = block_get{break 54}
+ block_call(&b)
+ end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+ b = lambda{break 67}
+ block_call(&b)
+ 66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+ block_get{break 78}
+end
+
+def test_b7
+ b = util_r7()
+ ljump_rescue(77) do
+ block_call(&b)
+ end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+ block_call(&block)
+end
+
+def test_b8
+ util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+ lambda{block.call; 98}.call
+end
+
+def test_b9
+ util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+ util_b9{break 100}
+end
+
+def test_b10
+ util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+ ljump_rescue(111) do
+ loop do
+ Proc.new{break 110}.yield
+ break 112
+ end
+ end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+ loop do
+ break lambda{break 122}.call
+ break 121
+ end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+ ljump_rescue(133) do
+ while true
+ Proc.new{break 130}.yield
+ break 131
+ end
+ end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+ while true
+ break lambda{break 144}.call
+ break 143
+ end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+ [0].each {|c| yield 1 }
+ 156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+ method = method(m)
+ test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+class ITER_TEST1
+ def a
+ block_given?
+ end
+end
+
+class ITER_TEST2 < ITER_TEST1
+ def a
+ test_ok(super)
+ super
+ end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+ def foo x
+ return yield if block_given?
+ x
+ end
+end
+
+class ITER_TEST4 < ITER_TEST3
+ def foo x
+ test_ok(super == yield)
+ test_ok(super(x, &nil) == x)
+ end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+ def tt(aa)
+ aa
+ end
+
+ def uu(a)
+ class << self
+ define_method(:tt) do |sym|
+ super(sym)
+ end
+ end
+ end
+
+ def xx(*x)
+ x.size
+ end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+ def xx(*a)
+ a << 12
+ super
+ end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+ test_ok(x != y)
+ test_ok((x < y) == false)
+ test_ok((x > y) == false)
+ test_ok((x <= y) == false)
+ test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+ return 1 if n == 0
+ f = 1
+ while n>0
+ f *= n
+ n -= 1
+ end
+ return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+ $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+ $good = false if ((1 << i) != n1)
+ n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+ n1 = n1 / 2
+ n2 = n2 >> 1
+ $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+ n1 = 1 << i;
+ if (n1**2-1) / (n1+1) != (n1-1)
+ $good = false
+ end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+ b = a / (2 ** 32)
+ c = a >> 32
+ test_ok(b == c)
+
+ b = a * (2 ** 32)
+ c = a << 32
+ test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = <<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".upcase![0] == ?A)
+test_ok("A".downcase![0] == ?a)
+test_ok("abc".tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".squeeze!("a-z") == "abc")
+test_ok("abcd".delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+ if i.chr != $y.shift
+ $bad = true
+ break
+ end
+}
+test_ok(!$bad)
+
+s = "a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+ ch = [n].pack("C")
+ a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+ res = [a, b]
+ res += rest if rest
+ return res
+end
+
+# not enough argument
+begin
+ aaa() # need at least 1 arg
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+begin
+ aaa # no arg given (exception raised)
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+ iii=5 # nested local variable
+ $proc = Proc.new{|i|
+ iii = i
+ }
+ $proc2 = Proc.new {
+ $x = iii # nested variables shared by procs
+ }
+ # scope of nested variables
+ test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii)) # out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+ iii = 10
+ def dyna_var_check
+ loop {
+ test_ok(!defined?(iii))
+ break
+ }
+ end
+ dyna_var_check
+ break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+ test_check "signal"
+
+ $x = 0
+ trap "SIGINT", Proc.new{|sig| $x = 2}
+ Process.kill "SIGINT", $$
+ 100.times {
+ sleep 0.1
+ break if $x != 0
+ }
+ test_ok($x == 2)
+
+ trap "SIGINT", Proc.new{raise "Interrupt"}
+
+ x = false
+ begin
+ Process.kill "SIGINT", $$
+ sleep 0.1
+ rescue
+ x = $!
+ end
+ test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+ eval $foo
+rescue
+ test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+ local1 = "local1"
+ lambda {
+ local2 = "local2"
+ return binding
+ }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+ p eval("local1")
+rescue NameError # must raise error
+ $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+ EVTEST1 = 25
+ evtest2 = 125
+ $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25) # constant in module
+test_ok(eval("evtest2", $x) == 125) # local var in module
+$bad = true
+begin
+ eval("EVTEST1")
+rescue NameError # must raise error
+ $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+ p = binding
+ eval "foo11 = 1", p
+ foo22 = 5
+ Proc.new{foo11=22}.call
+ Proc.new{foo22=55}.call
+ test_ok(eval("foo11", p) == eval("foo11"))
+ test_ok(eval("foo11") == 1)
+ test_ok(eval("foo22", p) == eval("foo22"))
+ test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+ tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+ if $_.to_i % 5 != 0
+ done = false
+ break
+ end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+ TEST3 = 3
+ TEST4 = 4
+end
+
+module Const2
+ TEST3 = 6
+ TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+ "test"
+end
+bar = foo.clone
+def bar.test2
+ "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+ foo.test2
+ test_ok false
+rescue NoMethodError
+ test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+ a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+ ma = Marshal.dump(a)
+ b = Marshal.load(ma)
+ test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric. This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+ $$ = 5
+ test_ok false
+rescue NameError
+ test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+ @@rule = "Uranus"
+ def ruler0
+ @@rule
+ end
+
+ def self.ruler1 # <= per method definition style
+ @@rule
+ end
+ class << self # <= multiple method definition style
+ def ruler2
+ @@rule
+ end
+ end
+end
+
+module Olympians
+ @@rule ="Zeus"
+ def ruler3
+ @@rule
+ end
+end
+
+class Titans < Gods
+ @@rule = "Cronus" # modifies @@rule in Gods
+ include Olympians
+ def ruler4
+ @@rule
+ end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+begin
+ atlas.ruler4
+rescue RuntimeError => e
+ test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+ test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x)) # global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo)) # local variable
+
+test_ok(defined?(Array)) # constant
+test_ok(defined?(Object.new)) # method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2)) # operator expression
+
+class Foo
+ def foo
+ p :foo
+ end
+ protected :foo
+ def bar(f)
+ test_ok(defined?(self.foo))
+ test_ok(defined?(f.foo))
+ end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+ return !defined?(yield)
+end
+
+test_ok(defined_test) # not iterator
+test_ok(!defined_test{}) # called as iterator
+
+test_check "alias"
+class Alias0
+ def foo; "foo" end
+end
+class Alias1 < Alias0
+ alias bar foo
+ def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+ alias baz foo
+ undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+ def foo
+ defined? super
+ end
+ def bar
+ defined? super
+ end
+ def quux
+ defined? super
+ end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+ test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+ test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+ dosish = true
+when %r'\A//'
+ test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+ test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+ dosish = true
+else
+ test_ok(File.expand_path(".", "/") == "/")
+ test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+ test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+ test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+ test_ok(File.expand_path("/", "z:/sub") == "z:/")
+ test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+ begin
+ b = o.binding
+ eval 'self', b
+ rescue ArgumentError
+ end
+}
+
+test_check "gc"
+begin
+ 1.upto(10000) {
+ tmp = [0,1,2,3,4,5,6,7,8,9]
+ }
+ tmp = nil
+ test_ok true
+rescue
+ test_ok false
+end
+class S
+ def initialize(a)
+ @a = a
+ end
+end
+l=nil
+100000.times {
+ l = S.new(l)
+}
+GC.start
+test_ok true # reach here or dumps core
+l = []
+100000.times {
+ l.push([l])
+}
+GC.start
+test_ok true # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+ o.class.name
+}
+
+test_ok true # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+ printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+ printf "end of test(test: %d)\n", $ntest
+end
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..39a5aa139b
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,72 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+Usage: benchmark-driver [options] RUBY|YAML...
+ -r, --runner TYPE Specify runner type: ips, time, memory, once (default: ips)
+ -o, --output TYPE Specify output type: compare, simple, markdown, record (default: compare)
+ -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+ --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+ --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
+ --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
+ --bundler Install and use gems specified in Gemfile
+ --filter REGEXP Filter out benchmarks with given regexp
+ --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
+ -v, --verbose Verbose mode. Multiple -v options increase visilibity (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..16296af12b
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsampling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+ # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ # $fp = fp
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n")
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+benchmark:
+ app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/bm_app_factorial.rb
+++ b/benchmark/app_factorial.rb
diff --git a/benchmark/bm_app_fib.rb b/benchmark/app_fib.rb
index 34a7b2e725..34a7b2e725 100644
--- a/benchmark/bm_app_fib.rb
+++ b/benchmark/app_fib.rb
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ b/benchmark/app_lc_fizzbuzz.rb
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/bm_app_mandelbrot.rb
+++ b/benchmark/app_mandelbrot.rb
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/bm_app_raise.rb
+++ b/benchmark/app_raise.rb
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/bm_app_strconcat.rb
+++ b/benchmark/app_strconcat.rb
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+ small_flat_ary = 5.times.to_a
+ large_flat_ary = 100.times.to_a
+ small_pairs_ary = [[1, 2]] * 5
+ large_pairs_ary = [[1, 2]] * 100
+ mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+ small_flat_ary.flatten: small_flat_ary.flatten
+ small_flat_ary.flatten!: small_flat_ary.flatten!
+ large_flat_ary.flatten: large_flat_ary.flatten
+ large_flat_ary.flatten!: large_flat_ary.flatten!
+ small_pairs_ary.flatten: small_pairs_ary.flatten
+ small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+ large_pairs_ary.flatten: large_pairs_ary.flatten
+ large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+ mostly_flat_ary.flatten: mostly_flat_ary.flatten
+ mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+ small1 = [1, 2, 3]
+ small2 = [1, 2, 3, 4, 5]
+ small3 = [2, 3, 4, 5]
+ small4 = [2]
+ big1 = [1, 2, 3, 4] * 64
+ big2 = [1, 2, 3] * 64
+ big3 = [1, 2] * 64
+
+benchmark:
+ small-&: small1 & small2 & small3 & small4
+ small-intersection: small1.intersection(small2, small3, small4)
+ big-&: big1 & big2 & big3
+ big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_f).shuffle
+ ary10 = 10.times.map(&:to_f).shuffle
+ ary100 = 100.times.map(&:to_f).shuffle
+ ary500 = 500.times.map(&:to_f).shuffle
+ ary1000 = 1000.times.map(&:to_f).shuffle
+ ary2000 = 2500.times.map(&:to_f).shuffle
+ ary3000 = 2500.times.map(&:to_f).shuffle
+ ary5000 = 5000.times.map(&:to_f).shuffle
+ ary10000 = 10000.times.map(&:to_f).shuffle
+ ary20000 = 20000.times.map(&:to_f).shuffle
+ ary50000 = 50000.times.map(&:to_f).shuffle
+ ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+ ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_s).shuffle
+ ary10 = 10.times.map(&:to_s).shuffle
+ ary100 = 100.times.map(&:to_s).shuffle
+ ary500 = 500.times.map(&:to_s).shuffle
+ ary1000 = 1000.times.map(&:to_s).shuffle
+ ary2000 = 2500.times.map(&:to_s).shuffle
+ ary3000 = 2500.times.map(&:to_s).shuffle
+ ary5000 = 5000.times.map(&:to_s).shuffle
+ ary10000 = 10000.times.map(&:to_s).shuffle
+ ary20000 = 20000.times.map(&:to_s).shuffle
+ ary50000 = 50000.times.map(&:to_s).shuffle
+ ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.min: ary2.min
+ ary10.min: ary10.min
+ ary100.min: ary100.min
+ ary500.min: ary500.min
+ ary1000.min: ary1000.min
+ ary2000.min: ary2000.min
+ ary3000.min: ary3000.min
+ ary5000.min: ary5000.min
+ ary10000.min: ary10000.min
+ ary20000.min: ary20000.min
+ ary50000.min: ary50000.min
+ ary100000.min: ary100000.min
+ ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+ [10_000,1_000_000,100_000_000].each do |n|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift"){ ary.shift }
+ (0..4).each do |i|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+ end
+ end
+end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 & arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 - arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 | arr2
+ end
+ end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index ffab116fcd..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-# https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
- def initialize(x, y, z)
- @x = x
- @y = y
- @z = z
- end
-
- attr_accessor :x, :y, :z
-
- def vadd(b)
- Vec.new(@x + b.x, @y + b.y, @z + b.z)
- end
-
- def vsub(b)
- Vec.new(@x - b.x, @y - b.y, @z - b.z)
- end
-
- def vcross(b)
- Vec.new(@y * b.z - @z * b.y,
- @z * b.x - @x * b.z,
- @x * b.y - @y * b.x)
- end
-
- def vdot(b)
- @x * b.x + @y * b.y + @z * b.z
- end
-
- def vlength
- Math.sqrt(@x * @x + @y * @y + @z * @z)
- end
-
- def vnormalize
- len = vlength
- v = Vec.new(@x, @y, @z)
- if len > 1.0e-17 then
- v.x = v.x / len
- v.y = v.y / len
- v.z = v.z / len
- end
- v
- end
-end
-
-
-class Sphere
- def initialize(center, radius)
- @center = center
- @radius = radius
- end
-
- attr_reader :center, :radius
-
- def intersect(ray, isect)
- rs = ray.org.vsub(@center)
- b = rs.vdot(ray.dir)
- c = rs.vdot(rs) - (@radius * @radius)
- d = b * b - c
- if d > 0.0 then
- t = - b - Math.sqrt(d)
-
- if t > 0.0 and t < isect.t then
- isect.t = t
- isect.hit = true
- isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
- ray.org.y + ray.dir.y * t,
- ray.org.z + ray.dir.z * t)
- n = isect.pl.vsub(@center)
- isect.n = n.vnormalize
- else
- 0.0
- end
- end
- nil
- end
-end
-
-class Plane
- def initialize(p, n)
- @p = p
- @n = n
- end
-
- def intersect(ray, isect)
- d = -@p.vdot(@n)
- v = ray.dir.vdot(@n)
- v0 = v
- if v < 0.0 then
- v0 = -v
- end
- if v0 < 1.0e-17 then
- return
- end
-
- t = -(ray.org.vdot(@n) + d) / v
-
- if t > 0.0 and t < isect.t then
- isect.hit = true
- isect.t = t
- isect.n = @n
- isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
- ray.org.y + t * ray.dir.y,
- ray.org.z + t * ray.dir.z)
- end
- nil
- end
-end
-
-class Ray
- def initialize(org, dir)
- @org = org
- @dir = dir
- end
-
- attr_accessor :org, :dir
-end
-
-class Isect
- def initialize
- @t = 10000000.0
- @hit = false
- @pl = Vec.new(0.0, 0.0, 0.0)
- @n = Vec.new(0.0, 0.0, 0.0)
- end
-
- attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
- i = f * 255.5
- if i > 255.0 then
- i = 255.0
- end
- if i < 0.0 then
- i = 0.0
- end
- i.to_i
-end
-
-def otherBasis(basis, n)
- basis[2] = Vec.new(n.x, n.y, n.z)
- basis[1] = Vec.new(0.0, 0.0, 0.0)
-
- if n.x < 0.6 and n.x > -0.6 then
- basis[1].x = 1.0
- elsif n.y < 0.6 and n.y > -0.6 then
- basis[1].y = 1.0
- elsif n.z < 0.6 and n.z > -0.6 then
- basis[1].z = 1.0
- else
- basis[1].x = 1.0
- end
-
- basis[0] = basis[1].vcross(basis[2])
- basis[0] = basis[0].vnormalize
-
- basis[1] = basis[2].vcross(basis[0])
- basis[1] = basis[1].vnormalize
-end
-
-class Scene
- def initialize
- @spheres = Array.new
- @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
- @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
- @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
- @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
- end
-
- def ambient_occlusion(isect)
- basis = Array.new
- otherBasis(basis, isect.n)
-
- ntheta = NAO_SAMPLES
- nphi = NAO_SAMPLES
- eps = 0.0001
- occlusion = 0.0
-
- p0 = Vec.new(isect.pl.x + eps * isect.n.x,
- isect.pl.y + eps * isect.n.y,
- isect.pl.z + eps * isect.n.z)
- nphi.times do |j|
- ntheta.times do |i|
- r = rand
- phi = 2.0 * 3.14159265 * rand
- x = Math.cos(phi) * Math.sqrt(1.0 - r)
- y = Math.sin(phi) * Math.sqrt(1.0 - r)
- z = Math.sqrt(r)
-
- rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
- ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
- rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
- raydir = Vec.new(rx, ry, rz)
- ray = Ray.new(p0, raydir)
-
- occisect = Isect.new
- @spheres[0].intersect(ray, occisect)
- @spheres[1].intersect(ray, occisect)
- @spheres[2].intersect(ray, occisect)
- @plane.intersect(ray, occisect)
- if occisect.hit then
- occlusion = occlusion + 1.0
- else
- 0.0
- end
- end
- end
-
- occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
- Vec.new(occlusion, occlusion, occlusion)
- end
-
- def render(w, h, nsubsamples)
- cnt = 0
- nsf = nsubsamples.to_f
- h.times do |y|
- w.times do |x|
- rad = Vec.new(0.0, 0.0, 0.0)
-
- # Subsmpling
- nsubsamples.times do |v|
- nsubsamples.times do |u|
-
- cnt = cnt + 1
- wf = w.to_f
- hf = h.to_f
- xf = x.to_f
- yf = y.to_f
- uf = u.to_f
- vf = v.to_f
-
- px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
- py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
- eye = Vec.new(px, py, -1.0).vnormalize
-
- ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
- isect = Isect.new
- @spheres[0].intersect(ray, isect)
- @spheres[1].intersect(ray, isect)
- @spheres[2].intersect(ray, isect)
- @plane.intersect(ray, isect)
- if isect.hit then
- col = ambient_occlusion(isect)
- rad.x = rad.x + col.x
- rad.y = rad.y + col.y
- rad.z = rad.z + col.z
- end
- end
- end
-
- r = rad.x / (nsf * nsf)
- g = rad.y / (nsf * nsf)
- b = rad.z / (nsf * nsf)
- printf("%c", clamp(r))
- printf("%c", clamp(g))
- printf("%c", clamp(b))
- end
- nil
- end
-
- nil
- end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
- printf("P6\n")
- printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
- nb.each{|x|
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- [-ROW, -1, 1, ROW].each{|d|
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- }
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- }
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- (0...ROW*COL).each{|i|
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- }
-end
-
-def pboard
- return # skip print
- print "No. #$no\n"
- (0...COL).each{|i|
- print "|"
- (0...ROW-NP).each{|j|
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- }
- print "\n"
- }
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- x.each{|s|
- if $b[pos+s] != -1
- f=1
- break
- end
- }
- if f == 0 then
- x.each{|s|
- $b[pos+s] = i
- }
- a << i
- setpiece(a.dup, pos)
- a.pop
- x.each{|s|
- $b[pos+s] = -1
- }
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
- for x in nb
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- for d in [-ROW, -1, 1, ROW]
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- end
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- end
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- for i in 0...ROW*COL
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- end
-end
-
-def pboard
- print "No. #$no\n"
- for i in 0...COL
- print "|"
- for j in 0...ROW-NP
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- end
- print "\n"
- end
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- for s in x do
- if $b[pos+s] != -1
- f=1
- break
- end
- end
- if f == 0 then
- for s in x do
- $b[pos+s] = i
- end
- a << i
- setpiece(a.dup, pos)
- a.pop
- for s in x do
- $b[pos+s] = -1
- end
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
- x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
- (n-1).step(0,-1) do |bi|
- y[bi] += x.at(bi)
- end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
- i += 1
- hello = ''
- 4_000_000.times do |e|
- hello << STUFF
- end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-class Hi_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-def some_function(num)
- begin
- hi_function(num)
- rescue
- print "We shouldn't get here, exception is: #{$!.type}\n"
- end
-end
-
-def hi_function(num)
- begin
- lo_function(num)
- rescue Hi_Exception
- $HI = $HI + 1
- end
-end
-
-def lo_function(num)
- begin
- blowup(num)
- rescue Lo_Exception
- $LO = $LO + 1
- end
-end
-
-def blowup(num)
- if num % 2 == 0
- raise Lo_Exception.new(num)
- else
- raise Hi_Exception.new(num)
- end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
- i += 1
- some_function(i+1)
-end
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
- count = 1
- mx = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- row[j] = count
- count += 1
- end
- mx[bi] = row
- end
- mx
-end
-
-def mmult(rows, cols, m1, m2)
- m3 = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- val = 0
- (0 .. (cols - 1)).each do |k|
- val += m1.at(bi).at(k) * m2.at(k).at(j)
- end
- row[j] = val
- end
- m3[bi] = row
- end
- m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
- mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index b8e93bd150..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,564 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is invalid at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values ( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop across the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the current row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # following reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is acheived via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticeable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- x += 1
- end
- end
- end
- end
- end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
- def initialize(start_state)
- @bool = start_state
- end
-
- def value
- @bool
- end
-
- def activate
- @bool = !@bool
- self
- end
-end
-
-class NthToggle < Toggle
- def initialize(start_state, max_counter)
- super start_state
- @count_max = max_counter
- @counter = 0
- end
-
- def activate
- @counter += 1
- if @counter >= @count_max
- @bool = !@bool
- @counter = 0
- end
- self
- end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
- toggle.activate.value ? 'true' : 'false'
-end
-n.times do
- toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
- ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
- ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
- def initialize()
- @z = Transformation.new 1,0,0,1
- @x = Transformation.new 0,0,0,0
- @inverse = Transformation.new 0,0,0,0
- end
-
- def next!
- @y = @z.extract(3)
- if safe? @y
- @z = produce(@y)
- @y
- else
- @z = consume @x.next!()
- next!()
- end
- end
-
- def safe?(digit)
- digit == @z.extract(4)
- end
-
- def produce(i)
- @inverse.qrst(10,-10*i,0,1).compose(@z)
- end
-
- def consume(a)
- @z.compose(a)
- end
-end
-
-
-class Transformation
- attr_reader :q, :r, :s, :t
- def initialize (q, r, s, t)
- @q,@r,@s,@t,@k = q,r,s,t,0
- end
-
- def next!()
- @q = @k = @k + 1
- @r = 4 * @k + 2
- @s = 0
- @t = 2 * @k + 1
- self
- end
-
- def extract(j)
- (@q * j + @r) / (@s * j + @t)
- end
-
- def compose(a)
- self.class.new( @q * a.q,
- @q * a.r + r * a.t,
- @s * a.q + t * a.s,
- @s * a.r + t * a.t
- )
- end
-
- def qrst *args
- initialize *args
- self
- end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
- if n >= WIDTH
- WIDTH.times {print digits.next!}
- j += WIDTH
- else
- n.times {print digits.next!}
- (WIDTH-n).times {print " "}
- j += n
- end
- puts "\t:"+j.to_s
- n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_reader :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = obj.a
- k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_accessor :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- obj.a = 1
- obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m{
- }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = Const
- k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
- i += 1
- begin
- begin
- ensure
- end
- ensure
- end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
- i += 1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
- if n == 0
- ''
- else
- 10.times{
- h[Object.new] = nested_hash(h, n-1)
- }
- end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index ecfab51dbf..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-long_lived = []
-GC.start
-GC.start
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index 017eff4f94..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-class C
- attr_accessor :foo
-end
-long_lived = C.new
-GC.start
-GC.start
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = @a
- k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- @a = 1
- @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a.length
- b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
- unless v
- # unreachable code
- v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
- v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
- v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
- v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
- v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
- end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
- i += 1
- m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- begin
- rescue
- end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- i = 0
- while i<30_000_000 # while loop 1
- i += 1
- yield
- end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
- i += 1
- a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644