summaryrefslogtreecommitdiff
path: root/spec/ruby/command_line/dash_internal_encoding_spec.rb
diff options
context:
space:
mode:
Diffstat (limited to 'spec/ruby/command_line/dash_internal_encoding_spec.rb')
-rw-r--r--spec/ruby/command_line/dash_internal_encoding_spec.rb15
1 files changed, 15 insertions, 0 deletions
diff --git a/spec/ruby/command_line/dash_internal_encoding_spec.rb b/spec/ruby/command_line/dash_internal_encoding_spec.rb
new file mode 100644
index 0000000000..3049040bb4
--- /dev/null
+++ b/spec/ruby/command_line/dash_internal_encoding_spec.rb
@@ -0,0 +1,15 @@
+require_relative '../spec_helper'
+
+describe 'The --internal-encoding command line option sets Encoding.default_internal' do
+ before :each do
+ @test_string = "print Encoding.default_internal.name"
+ end
+
+ it "if given an encoding with an =" do
+ ruby_exe(@test_string, options: '--internal-encoding=big5').should == Encoding::Big5.name
+ end
+
+ it "if given an encoding as a separate argument" do
+ ruby_exe(@test_string, options: '--internal-encoding big5').should == Encoding::Big5.name
+ end
+end
'right'>4
-rw-r--r--COPYING.ja6
-rw-r--r--ChangeLog22405
-rw-r--r--KNOWNBUGS.rb5
-rw-r--r--LEGAL335
-rw-r--r--LGPL504
-rw-r--r--Makefile.in323
-rw-r--r--NEWS341
-rw-r--r--README40
-rw-r--r--README.EXT618
-rw-r--r--README.EXT.ja590
-rw-r--r--README.ja57
-rw-r--r--ToDo14
-rw-r--r--addr2line.c610
-rw-r--r--addr2line.h21
-rw-r--r--array.c4420
-rw-r--r--bcc32/Makefile.sub229
-rw-r--r--bcc32/README.bcc3237
-rwxr-xr-xbcc32/configure.bat101
-rw-r--r--[-rwxr-xr-x]bcc32/mkexports.rb39
-rw-r--r--bcc32/setup.mak98
-rw-r--r--benchmark/bm_app_answer.rb15
-rw-r--r--benchmark/bm_app_erb.rb26
-rw-r--r--benchmark/bm_app_factorial.rb11
-rw-r--r--benchmark/bm_app_fib.rb10
-rw-r--r--benchmark/bm_app_mandelbrot.rb23
-rw-r--r--benchmark/bm_app_pentomino.rb259
-rw-r--r--benchmark/bm_app_raise.rb8
-rw-r--r--benchmark/bm_app_strconcat.rb5
-rw-r--r--benchmark/bm_app_tak.rb13
-rw-r--r--benchmark/bm_app_tarai.rb10
-rw-r--r--benchmark/bm_app_uri.rb8
-rw-r--r--benchmark/bm_io_file_create.rb13
-rw-r--r--benchmark/bm_io_file_read.rb15
-rw-r--r--benchmark/bm_io_file_write.rb14
-rw-r--r--benchmark/bm_io_select.rb9
-rw-r--r--benchmark/bm_io_select2.rb18
-rw-r--r--benchmark/bm_io_select3.rb17
-rw-r--r--benchmark/bm_loop_for.rb3
-rw-r--r--benchmark/bm_loop_generator.rb14
-rw-r--r--benchmark/bm_loop_times.rb1
-rw-r--r--benchmark/bm_loop_whileloop.rb4
-rw-r--r--benchmark/bm_loop_whileloop2.rb4
-rw-r--r--benchmark/bm_so_ackermann.rb19
-rw-r--r--benchmark/bm_so_array.rb23
-rw-r--r--benchmark/bm_so_binary_trees.rb57
-rw-r--r--benchmark/bm_so_concatenate.rb18
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_exception.rb61
-rw-r--r--benchmark/bm_so_fannkuch.rb45
-rw-r--r--benchmark/bm_so_fasta.rb81
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_lists.rb47
-rw-r--r--benchmark/bm_so_mandelbrot.rb57
-rw-r--r--benchmark/bm_so_matrix.rb48
-rw-r--r--benchmark/bm_so_meteor_contest.rb564
-rw-r--r--benchmark/bm_so_nbody.rb148
-rw-r--r--benchmark/bm_so_nested_loop.rb24
-rw-r--r--benchmark/bm_so_nsieve.rb35
-rw-r--r--benchmark/bm_so_nsieve_bits.rb42
-rw-r--r--benchmark/bm_so_object.rb56
-rw-r--r--benchmark/bm_so_partial_sums.rb31
-rw-r--r--benchmark/bm_so_pidigits.rb92
-rw-r--r--benchmark/bm_so_random.rb20
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rw-r--r--benchmark/bm_so_sieve.rb24
-rw-r--r--benchmark/bm_so_spectralnorm.rb50
-rw-r--r--benchmark/bm_vm1_block.rb10
-rw-r--r--benchmark/bm_vm1_const.rb8
-rw-r--r--benchmark/bm_vm1_ensure.rb11
-rw-r--r--benchmark/bm_vm1_ivar.rb8
-rw-r--r--benchmark/bm_vm1_ivar_set.rb6
-rw-r--r--benchmark/bm_vm1_length.rb9
-rw-r--r--benchmark/bm_vm1_neq.rb8
-rw-r--r--benchmark/bm_vm1_not.rb7
-rw-r--r--benchmark/bm_vm1_rescue.rb7
-rw-r--r--benchmark/bm_vm1_simplereturn.rb9
-rw-r--r--benchmark/bm_vm1_swap.rb8
-rw-r--r--benchmark/bm_vm2_array.rb5
-rw-r--r--benchmark/bm_vm2_case.rb14
-rw-r--r--benchmark/bm_vm2_defined_method.rb9
-rw-r--r--benchmark/bm_vm2_eval.rb6
-rw-r--r--benchmark/bm_vm2_method.rb9
-rw-r--r--benchmark/bm_vm2_mutex.rb9
-rw-r--r--benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rw-r--r--benchmark/bm_vm3_clearmethodcache.rb8
-rwxr-xr-xbenchmark/bm_vm3_gc.rb7
-rw-r--r--benchmark/bm_vm_thread_alive_check1.rb6
-rw-r--r--benchmark/bm_vm_thread_create_join.rb6
-rw-r--r--benchmark/bm_vm_thread_mutex1.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex2.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex3.rb20
-rw-r--r--benchmark/bm_vm_thread_pass.rb15
-rw-r--r--benchmark/bm_vm_thread_pass_flood.rb8
-rw-r--r--benchmark/bm_vm_thread_pipe.rb17
-rw-r--r--benchmark/bmx_temp.rb9
-rw-r--r--benchmark/driver.rb270
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/other-lang/ack.pl11
-rw-r--r--benchmark/other-lang/ack.py16
-rw-r--r--benchmark/other-lang/ack.rb12
-rw-r--r--benchmark/other-lang/ack.scm7
-rw-r--r--benchmark/other-lang/eval.rb66
-rw-r--r--benchmark/other-lang/fact.pl13
-rw-r--r--benchmark/other-lang/fact.py18
-rw-r--r--benchmark/other-lang/fact.rb13
-rw-r--r--benchmark/other-lang/fact.scm8
-rw-r--r--benchmark/other-lang/fib.pl11
-rw-r--r--benchmark/other-lang/fib.py7
-rw-r--r--benchmark/other-lang/fib.rb9
-rw-r--r--benchmark/other-lang/fib.scm7
-rw-r--r--benchmark/other-lang/loop.pl3
-rw-r--r--benchmark/other-lang/loop.py2
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/other-lang/loop.scm1
-rw-r--r--benchmark/other-lang/loop2.rb1
-rw-r--r--benchmark/other-lang/tak.pl11
-rw-r--r--benchmark/other-lang/tak.py8
-rw-r--r--benchmark/other-lang/tak.rb13
-rw-r--r--benchmark/other-lang/tak.scm10
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/wc.input.base25
-rw-r--r--bignum.c3056
-rwxr-xr-xbin/erb72
-rwxr-xr-xbin/gem25
-rw-r--r--[-rwxr-xr-x]bin/irb7
-rwxr-xr-xbin/rake32
-rw-r--r--[-rwxr-xr-x]bin/rdoc77
-rwxr-xr-xbin/ri53
-rwxr-xr-xbin/testrb11
-rw-r--r--bootstraptest/pending.rb39
-rwxr-xr-xbootstraptest/runner.rb393
-rw-r--r--bootstraptest/test_attr.rb36
-rw-r--r--bootstraptest/test_autoload.rb110
-rw-r--r--bootstraptest/test_block.rb567
-rw-r--r--bootstraptest/test_class.rb159
-rw-r--r--bootstraptest/test_eval.rb321
-rw-r--r--bootstraptest/test_exception.rb416
-rw-r--r--bootstraptest/test_finalizer.rb8
-rw-r--r--bootstraptest/test_flip.rb1
-rw-r--r--bootstraptest/test_flow.rb578
-rw-r--r--bootstraptest/test_fork.rb69
-rw-r--r--bootstraptest/test_gc.rb34
-rw-r--r--bootstraptest/test_io.rb106
-rw-r--r--bootstraptest/test_jump.rb308
-rw-r--r--bootstraptest/test_literal.rb202
-rw-r--r--bootstraptest/test_load.rb27
-rw-r--r--bootstraptest/test_marshal.rb5
-rw-r--r--bootstraptest/test_massign.rb183
-rw-r--r--bootstraptest/test_method.rb1186
-rw-r--r--bootstraptest/test_objectspace.rb46
-rw-r--r--bootstraptest/test_proc.rb482
-rw-r--r--bootstraptest/test_struct.rb5
-rw-r--r--bootstraptest/test_syntax.rb902
-rw-r--r--bootstraptest/test_thread.rb454
-rw-r--r--class.c1331
-rw-r--r--common.mk1071
-rw-r--r--compar.c106
-rw-r--r--compile.c5579
-rw-r--r--complex.c1994
-rw-r--r--config.guess1459
-rw-r--r--config.sub1537
-rw-r--r--configure.in3229
-rw-r--r--constant.h34
-rw-r--r--cont.c1525
-rw-r--r--cygwin/GNUmakefile.in65
-rw-r--r--debug.c162
-rw-r--r--debug.h41
-rw-r--r--defines.h261
-rw-r--r--defs/default_gems7
-rw-r--r--defs/keywords53
-rw-r--r--defs/known_errors.def145
-rw-r--r--defs/lex.c.src53
-rw-r--r--defs/opt_insn_unif.def29
-rw-r--r--defs/opt_operand.def59
-rw-r--r--dir.c1937
-rw-r--r--distruby.rb59
-rw-r--r--djgpp/GNUmakefile.in2
-rw-r--r--djgpp/README.djgpp21
-rw-r--r--djgpp/config.hin114
-rw-r--r--djgpp/config.sed128
-rwxr-xr-xdjgpp/configure.bat20
-rw-r--r--djgpp/mkver.sed1
-rw-r--r--dln.c797
-rw-r--r--dln.h22
-rw-r--r--dln_find.c320
-rw-r--r--dmydln.c9
-rw-r--r--dmyencoding.c2
-rw-r--r--dmyext.c2
-rw-r--r--dmyversion.c2
-rw-r--r--doc/ChangeLog-1.8.05
-rw-r--r--doc/ChangeLog-1.9.380621
-rw-r--r--doc/ChangeLog-YARV6917
-rw-r--r--doc/NEWS837
-rw-r--r--doc/NEWS-1.8.7648
-rw-r--r--doc/NEWS-1.9.1422
-rw-r--r--doc/NEWS-1.9.2499
-rw-r--r--doc/etc.rd75
-rw-r--r--doc/etc.rd.ja75
-rw-r--r--doc/forwardable.rd3
-rw-r--r--doc/forwardable.rd.ja3
-rw-r--r--doc/images/boottime-classes.pngbin28677 -> 0 bytes-rw-r--r--doc/irb/irb-tools.rd.ja3
-rw-r--r--doc/irb/irb.rd5
-rw-r--r--doc/irb/irb.rd.ja5
-rw-r--r--doc/pty/README84
-rw-r--r--doc/pty/README.ja76
-rw-r--r--doc/rake/CHANGES440
-rw-r--r--doc/rake/README196
-rw-r--r--doc/rake/command_line_usage.rdoc102
-rw-r--r--doc/rake/example/Rakefile138
-rw-r--r--doc/rake/example/Rakefile235
-rw-r--r--doc/rake/example/a.c6
-rw-r--r--doc/rake/example/b.c6
-rw-r--r--doc/rake/example/main.c11
-rw-r--r--doc/rake/glossary.rdoc51
-rw-r--r--doc/rake/jamis.rb591
-rw-r--r--doc/rake/proto_rake.rdoc127
-rw-r--r--doc/rake/rakefile.rdoc534
-rw-r--r--doc/rake/rational.rdoc151
-rw-r--r--doc/rake/release_notes/rake-0.8.7.rdoc55
-rw-r--r--doc/re.rdoc582
-rw-r--r--doc/rubygems/ChangeLog5689
-rw-r--r--doc/rubygems/History.txt852
-rw-r--r--doc/rubygems/LICENSE.txt53
-rw-r--r--doc/rubygems/README41
-rw-r--r--doc/shell.rd3
-rw-r--r--doc/shell.rd.ja3
-rw-r--r--enc/Makefile.in74
-rw-r--r--enc/ascii.c93
-rw-r--r--enc/big5.c367
-rw-r--r--enc/cp949.c219
-rw-r--r--enc/depend162
-rw-r--r--enc/emacs_mule.c340
-rw-r--r--enc/encdb.c27
-rw-r--r--enc/euc_jp.c398
-rw-r--r--enc/euc_kr.c192
-rw-r--r--enc/euc_tw.c225
-rw-r--r--enc/gb18030.c601
-rw-r--r--enc/gb2312.c13
-rw-r--r--enc/gbk.c222
-rw-r--r--enc/iso_2022_jp.h42
-rw-r--r--enc/iso_8859_1.c287
-rw-r--r--enc/iso_8859_10.c244
-rw-r--r--enc/iso_8859_11.c111
-rw-r--r--enc/iso_8859_13.c243
-rw-r--r--enc/iso_8859_14.c246
-rw-r--r--enc/iso_8859_15.c240
-rw-r--r--enc/iso_8859_16.c242
-rw-r--r--enc/iso_8859_2.c252
-rw-r--r--enc/iso_8859_3.c240
-rw-r--r--enc/iso_8859_4.c242
-rw-r--r--enc/iso_8859_5.c230
-rw-r--r--enc/iso_8859_6.c107
-rw-r--r--enc/iso_8859_7.c237
-rw-r--r--enc/iso_8859_8.c107
-rw-r--r--enc/iso_8859_9.c243
-rw-r--r--enc/koi8_r.c219
-rw-r--r--enc/koi8_u.c221
-rwxr-xr-xenc/make_encmake.rb50
-rw-r--r--enc/prelude.rb6
-rw-r--r--enc/shift_jis.c421
-rw-r--r--enc/trans/CP/CP932UDA%UCS.src1912
-rw-r--r--enc/trans/CP/CP932VDC@IBM%UCS.src420
-rw-r--r--enc/trans/CP/CP932VDC@NEC_IBM%UCS.src406
-rw-r--r--enc/trans/CP/UCS%CP932UDA.src1912
-rw-r--r--enc/trans/CP/UCS%CP932VDC@IBM.src420
-rw-r--r--enc/trans/CP/UCS%CP932VDC@NEC_IBM.src406
-rw-r--r--enc/trans/EMOJI/EMOJI_ISO-2022-JP-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-DOCOMO%UCS.src293
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI-UNDOC%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-SOFTBANK%UCS.src496
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-DOCOMO.src293
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-SOFTBANK.src496
-rw-r--r--enc/trans/GB/GB12345%UCS.src7618
-rw-r--r--enc/trans/GB/GB2312%UCS.src7535
-rw-r--r--enc/trans/GB/UCS%GB12345.src7620
-rw-r--r--enc/trans/GB/UCS%GB2312.src7531
-rw-r--r--enc/trans/JIS/JISX0201-KANA%UCS.src127
-rw-r--r--enc/trans/JIS/JISX0208@1990%UCS.src6972
-rw-r--r--enc/trans/JIS/JISX0208@MS%UCS.src6893
-rw-r--r--enc/trans/JIS/JISX0208UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0208VDC@NEC%UCS.src97
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src6167
-rw-r--r--enc/trans/JIS/JISX0212@MS%UCS.src6081
-rw-r--r--enc/trans/JIS/JISX0212UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0212VDC@IBM%UCS.src120
-rw-r--r--enc/trans/JIS/UCS%JISX0201-KANA.src127
-rw-r--r--enc/trans/JIS/UCS%JISX0208@1990.src6974
-rw-r--r--enc/trans/JIS/UCS%JISX0208@MS.src6894
-rw-r--r--enc/trans/JIS/UCS%JISX0208UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0208VDC@NEC.src98
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src6170
-rw-r--r--enc/trans/JIS/UCS%JISX0212@MS.src6082
-rw-r--r--enc/trans/JIS/UCS%JISX0212UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0212VDC@IBM.src121
-rw-r--r--enc/trans/big5-hkscs-tbl.rb37302
-rw-r--r--enc/trans/big5-uao-tbl.rb19784
-rw-r--r--enc/trans/big5.trans33
-rw-r--r--enc/trans/chinese.trans32
-rw-r--r--enc/trans/cp850-tbl.rb130
-rw-r--r--enc/trans/cp852-tbl.rb130
-rw-r--r--enc/trans/cp855-tbl.rb130
-rw-r--r--enc/trans/cp949-tbl.rb8831
-rw-r--r--enc/trans/emoji-exchange-tbl.rb8407
-rw-r--r--enc/trans/emoji.trans37
-rw-r--r--enc/trans/emoji_iso2022_kddi.trans217
-rw-r--r--enc/trans/emoji_sjis_docomo.trans33
-rw-r--r--enc/trans/emoji_sjis_kddi.trans34
-rw-r--r--enc/trans/emoji_sjis_softbank.trans33
-rw-r--r--enc/trans/escape.trans94
-rw-r--r--enc/trans/euckr-tbl.rb8228
-rw-r--r--enc/trans/gb18030-tbl.rb63362
-rw-r--r--enc/trans/gb18030.trans184
-rw-r--r--enc/trans/gbk-tbl.rb21794
-rw-r--r--enc/trans/gbk.trans16
-rw-r--r--enc/trans/ibm437-tbl.rb130
-rw-r--r--enc/trans/ibm737-tbl.rb130
-rw-r--r--enc/trans/ibm775-tbl.rb130
-rw-r--r--enc/trans/ibm852-tbl.rb130
-rw-r--r--enc/trans/ibm855-tbl.rb130
-rw-r--r--enc/trans/ibm857-tbl.rb127
-rw-r--r--enc/trans/ibm860-tbl.rb130
-rw-r--r--enc/trans/ibm861-tbl.rb130
-rw-r--r--enc/trans/ibm862-tbl.rb130
-rw-r--r--enc/trans/ibm863-tbl.rb130
-rw-r--r--enc/trans/ibm865-tbl.rb130
-rw-r--r--enc/trans/ibm866-tbl.rb130
-rw-r--r--enc/trans/ibm869-tbl.rb121
-rw-r--r--enc/trans/iso-8859-1-tbl.rb98
-rw-r--r--enc/trans/iso-8859-10-tbl.rb98
-rw-r--r--enc/trans/iso-8859-11-tbl.rb90
-rw-r--r--enc/trans/iso-8859-13-tbl.rb98
-rw-r--r--enc/trans/iso-8859-14-tbl.rb98
-rw-r--r--enc/trans/iso-8859-15-tbl.rb98
-rw-r--r--enc/trans/iso-8859-2-tbl.rb98
-rw-r--r--enc/trans/iso-8859-3-tbl.rb91
-rw-r--r--enc/trans/iso-8859-4-tbl.rb98
-rw-r--r--enc/trans/iso-8859-5-tbl.rb98
-rw-r--r--enc/trans/iso-8859-6-tbl.rb53
-rw-r--r--enc/trans/iso-8859-7-tbl.rb95
-rw-r--r--enc/trans/iso-8859-8-tbl.rb62
-rw-r--r--enc/trans/iso-8859-9-tbl.rb98
-rw-r--r--enc/trans/iso2022.trans568
-rw-r--r--enc/trans/japanese.trans98
-rw-r--r--enc/trans/japanese_euc.trans46
-rw-r--r--enc/trans/japanese_sjis.trans34
-rw-r--r--enc/trans/koi8-r-tbl.rb130
-rw-r--r--enc/trans/koi8-u-tbl.rb130
-rw-r--r--enc/trans/korean.trans19
-rw-r--r--enc/trans/maccroatian-tbl.rb129
-rw-r--r--enc/trans/maccyrillic-tbl.rb130
-rw-r--r--enc/trans/macgreek-tbl.rb129
-rw-r--r--enc/trans/maciceland-tbl.rb129
-rw-r--r--enc/trans/macroman-tbl.rb129
-rw-r--r--enc/trans/macromania-tbl.rb129
-rw-r--r--enc/trans/macturkish-tbl.rb128
-rw-r--r--enc/trans/macukraine-tbl.rb130
-rw-r--r--enc/trans/newline.trans135
-rw-r--r--enc/trans/single_byte.trans91
-rw-r--r--enc/trans/tis-620-tbl.rb89
-rw-r--r--enc/trans/transdb.c18
-rw-r--r--enc/trans/ucm/glibc-BIG5-2.3.3.ucm14087
-rw-r--r--enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm18332
-rw-r--r--enc/trans/ucm/windows-950-2000.ucm20379
-rw-r--r--enc/trans/ucm/windows-950_hkscs-2001.ucm23446
-rw-r--r--enc/trans/utf8_mac-tbl.rb945
-rw-r--r--enc/trans/utf8_mac.trans242
-rw-r--r--enc/trans/utf_16_32.trans557
-rw-r--r--enc/trans/windows-1250-tbl.rb125
-rw-r--r--enc/trans/windows-1251-tbl.rb129
-rw-r--r--enc/trans/windows-1252-tbl.rb125
-rw-r--r--enc/trans/windows-1253-tbl.rb113
-rw-r--r--enc/trans/windows-1254-tbl.rb123
-rw-r--r--enc/trans/windows-1255-tbl.rb141
-rw-r--r--enc/trans/windows-1256-tbl.rb130
-rw-r--r--enc/trans/windows-1257-tbl.rb118
-rw-r--r--enc/trans/windows-874-tbl.rb99
-rw-r--r--enc/unicode.c2609
-rw-r--r--enc/unicode/name2ctype.h23866
-rw-r--r--enc/unicode/name2ctype.h.blt23866
-rw-r--r--enc/unicode/name2ctype.kwd22543
-rw-r--r--enc/unicode/name2ctype.src22543
-rw-r--r--enc/us_ascii.c31
-rw-r--r--enc/utf_16_32.h4
-rw-r--r--enc/utf_16be.c257
-rw-r--r--enc/utf_16le.c249
-rw-r--r--enc/utf_32be.c195
-rw-r--r--enc/utf_32le.c194
-rw-r--r--enc/utf_7.h5
-rw-r--r--enc/utf_8.c457
-rw-r--r--enc/windows_1251.c208
-rw-r--r--enc/x_emoji.h26
-rw-r--r--encoding.c1662
-rw-r--r--enum.c2534
-rw-r--r--enumerator.c1178
-rw-r--r--env.h60
-rw-r--r--error.c1702
-rw-r--r--eval.c13028
-rw-r--r--eval_error.c276
-rw-r--r--eval_intern.h234
-rw-r--r--eval_jump.c146
-rw-r--r--ext/-test-/array/resize/extconf.rb1
-rw-r--r--ext/-test-/array/resize/resize.c14
-rw-r--r--ext/-test-/bug-3571/bug.c23
-rw-r--r--ext/-test-/bug-3571/extconf.rb1
-rw-r--r--ext/-test-/bug-3662/bug.c16
-rw-r--r--ext/-test-/bug-3662/extconf.rb1
-rw-r--r--ext/-test-/funcall/extconf.rb2
-rw-r--r--ext/-test-/funcall/passing_block.c30
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c1
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb1
-rw-r--r--ext/-test-/old_thread_select/depend2
-rw-r--r--ext/-test-/old_thread_select/extconf.rb1
-rw-r--r--ext/-test-/old_thread_select/old_thread_select.c75
-rw-r--r--ext/-test-/st/numhash/extconf.rb1
-rw-r--r--ext/-test-/st/numhash/numhash.c69
-rw-r--r--ext/-test-/string/cstr.c20
-rw-r--r--ext/-test-/string/ellipsize.c13
-rw-r--r--ext/-test-/string/enc_associate.c14
-rw-r--r--ext/-test-/string/extconf.rb6
-rw-r--r--ext/-test-/string/init.c11
-rw-r--r--ext/-test-/string/modify.c22
-rw-r--r--ext/-test-/string/set_len.c14
-rw-r--r--ext/-test-/wait_for_single_fd/depend2
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb1
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c30
-rw-r--r--ext/-test-/win32/dln/dlntest.c17
-rw-r--r--ext/-test-/win32/dln/extconf.rb36
-rw-r--r--ext/-test-/win32/dln/libdlntest.c4
-rw-r--r--ext/-test-/win32/dln/libdlntest.def2
-rw-r--r--ext/-test-/win32/fd_setsize/depend2
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb3
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c55
-rw-r--r--ext/.cvsignore2
-rw-r--r--ext/.document89
-rw-r--r--ext/Setup5
-rw-r--r--ext/Setup.atheos4
-rw-r--r--ext/Setup.dj33
-rw-r--r--ext/Setup.emx4
-rw-r--r--ext/Setup.nt4
-rw-r--r--ext/Setup.x6833
-rw-r--r--ext/Win32API/.cvsignore3
-rw-r--r--ext/Win32API/Win32API.c215
-rw-r--r--ext/Win32API/depend1
-rw-r--r--ext/Win32API/extconf.rb6
-rw-r--r--ext/Win32API/getch.rb5
-rw-r--r--ext/Win32API/lib/win32/registry.rb831
-rw-r--r--ext/Win32API/lib/win32/resolv.rb366
-rw-r--r--ext/Win32API/point.rb18
-rw-r--r--ext/bigdecimal/.cvsignore3
-rw-r--r--ext/bigdecimal/README2
-rw-r--r--ext/bigdecimal/bigdecimal.c3628
-rw-r--r--ext/bigdecimal/bigdecimal.def2
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec30
-rw-r--r--ext/bigdecimal/bigdecimal.h176
-rw-r--r--ext/bigdecimal/bigdecimal_en.html119
-rw-r--r--ext/bigdecimal/bigdecimal_ja.html19
-rw-r--r--ext/bigdecimal/extconf.rb4
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb28
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb44
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb95
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb11
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb130
-rw-r--r--ext/continuation/continuation.c8
-rw-r--r--ext/continuation/extconf.rb3
-rw-r--r--ext/coverage/coverage.c107
-rw-r--r--ext/coverage/extconf.rb3
-rw-r--r--ext/curses/.cvsignore3
-rw-r--r--ext/curses/curses.c2979
-rw-r--r--ext/curses/extconf.rb17
-rw-r--r--ext/curses/view.rb10
-rw-r--r--ext/curses/view2.rb228
-rw-r--r--ext/date/date_core.c9774
-rw-r--r--ext/date/date_parse.c2425
-rw-r--r--ext/date/date_strftime.c1155
-rw-r--r--ext/date/date_strptime.c698
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend2
-rw-r--r--ext/date/extconf.rb2
-rw-r--r--ext/date/lib/date.rb61
-rw-r--r--ext/date/lib/date/format.rb1
-rw-r--r--ext/dbm/.cvsignore3
-rw-r--r--ext/dbm/dbm.c604
-rw-r--r--ext/dbm/extconf.rb297
-rw-r--r--ext/digest/.cvsignore3
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c142
-rw-r--r--ext/digest/bubblebabble/depend3
-rw-r--r--ext/digest/bubblebabble/extconf.rb6
-rw-r--r--ext/digest/defs.h20
-rw-r--r--ext/digest/digest.c754
-rw-r--r--ext/digest/digest.h30
-rw-r--r--ext/digest/digest.txt113
-rw-r--r--ext/digest/digest.txt.ja111
-rw-r--r--ext/digest/extconf.rb6
-rw-r--r--ext/digest/lib/digest.rb88
-rw-r--r--ext/digest/lib/digest/hmac.rb302
-rw-r--r--ext/digest/lib/md5.rb14
-rw-r--r--ext/digest/lib/sha1.rb14
-rw-r--r--ext/digest/md5/.cvsignore3
-rw-r--r--ext/digest/md5/extconf.rb7
-rw-r--r--ext/digest/md5/md5.c30
-rw-r--r--ext/digest/md5/md5.h11
-rw-r--r--ext/digest/md5/md5init.c25
-rw-r--r--ext/digest/md5/md5ossl.c25
-rw-r--r--ext/digest/md5/md5ossl.h7
-rw-r--r--ext/digest/rmd160/.cvsignore3
-rw-r--r--ext/digest/rmd160/depend2
-rw-r--r--ext/digest/rmd160/extconf.rb9
-rw-r--r--ext/digest/rmd160/rmd160.c11
-rw-r--r--ext/digest/rmd160/rmd160.h20
-rw-r--r--ext/digest/rmd160/rmd160hl.c96
-rw-r--r--ext/digest/rmd160/rmd160init.c28
-rw-r--r--ext/digest/rmd160/rmd160ossl.c43
-rw-r--r--ext/digest/rmd160/rmd160ossl.h6
-rw-r--r--ext/digest/sha1/.cvsignore3
-rw-r--r--ext/digest/sha1/depend2
-rw-r--r--ext/digest/sha1/extconf.rb9
-rw-r--r--ext/digest/sha1/sha1.c24
-rw-r--r--ext/digest/sha1/sha1.h23
-rw-r--r--ext/digest/sha1/sha1hl.c102
-rw-r--r--ext/digest/sha1/sha1init.c28
-rw-r--r--ext/digest/sha1/sha1ossl.c43
-rw-r--r--ext/digest/sha1/sha1ossl.h9
-rw-r--r--ext/digest/sha2/.cvsignore3
-rw-r--r--ext/digest/sha2/depend3
-rw-r--r--ext/digest/sha2/extconf.rb26
-rw-r--r--ext/digest/sha2/lib/sha2.rb107
-rw-r--r--ext/digest/sha2/sha2.c283
-rw-r--r--ext/digest/sha2/sha2.h194
-rw-r--r--ext/digest/sha2/sha2hl.c252
-rw-r--r--ext/digest/sha2/sha2init.c29
-rw-r--r--ext/digest/sha2/sha2ossl.c11
-rw-r--r--ext/digest/sha2/sha2ossl.h17
-rw-r--r--ext/digest/test.sh7
-rw-r--r--ext/dl/.cvsignore8
-rw-r--r--ext/dl/callback/depend15
-rw-r--r--ext/dl/callback/extconf.rb14
-rw-r--r--ext/dl/callback/mkcallback.rb246
-rw-r--r--ext/dl/cfunc.c674
-rw-r--r--ext/dl/cptr.c682
-rw-r--r--ext/dl/depend47
-rw-r--r--ext/dl/dl.c1051
-rw-r--r--ext/dl/dl.def59
-rw-r--r--ext/dl/dl.h405
-rw-r--r--ext/dl/doc/dl.txt266
-rw-r--r--ext/dl/extconf.rb198
-rw-r--r--ext/dl/h2rb500
-rw-r--r--ext/dl/handle.c503
-rw-r--r--ext/dl/install.rb49
-rw-r--r--ext/dl/lib/dl.rb12
-rw-r--r--ext/dl/lib/dl/callback.rb112
-rw-r--r--ext/dl/lib/dl/cparser.rb109
-rw-r--r--ext/dl/lib/dl/func.rb248
-rw-r--r--ext/dl/lib/dl/import.rb427
-rw-r--r--ext/dl/lib/dl/pack.rb128
-rw-r--r--ext/dl/lib/dl/stack.rb116
-rw-r--r--ext/dl/lib/dl/struct.rb345
-rw-r--r--ext/dl/lib/dl/types.rb306
-rw-r--r--ext/dl/lib/dl/value.rb112
-rw-r--r--ext/dl/lib/dl/win32.rb25
-rw-r--r--ext/dl/mkcall.rb62
-rw-r--r--ext/dl/mkcallback.rb56
-rw-r--r--ext/dl/mkcbtable.rb18
-rw-r--r--ext/dl/ptr.c1068
-rw-r--r--ext/dl/sample/c++sample.C35
-rw-r--r--ext/dl/sample/c++sample.rb60
-rw-r--r--ext/dl/sample/drives.rb70
-rw-r--r--ext/dl/sample/getch.rb5
-rw-r--r--ext/dl/sample/libc.rb69
-rw-r--r--ext/dl/sample/msgbox.rb19
-rw-r--r--ext/dl/sample/msgbox2.rb18
-rw-r--r--ext/dl/sample/stream.rb87
-rw-r--r--ext/dl/sym.c992
-rw-r--r--ext/dl/test/libtest.def28
-rw-r--r--ext/dl/test/test.c247
-rw-r--r--ext/dl/test/test.rb306
-rw-r--r--ext/dl/type.rb115
-rw-r--r--ext/dl/win32/extconf.rb3
-rw-r--r--ext/dl/win32/lib/Win32API.rb30
-rw-r--r--ext/dl/win32/lib/win32/registry.rb845
-rw-r--r--ext/dl/win32/lib/win32/resolv.rb379
-rw-r--r--ext/dl/win32/lib/win32/sspi.rb330
-rw-r--r--ext/enumerator/.cvsignore2
-rw-r--r--ext/enumerator/enumerator.c298
-rw-r--r--ext/enumerator/enumerator.txt102
-rw-r--r--ext/enumerator/extconf.rb2
-rw-r--r--ext/etc/.cvsignore3
-rw-r--r--ext/etc/depend2
-rw-r--r--ext/etc/etc.c296
-rw-r--r--ext/etc/etc.txt72
-rw-r--r--ext/etc/etc.txt.ja72
-rw-r--r--ext/etc/extconf.rb19
-rw-r--r--[-rwxr-xr-x]ext/extmk.rb353
-rw-r--r--ext/fcntl/.cvsignore3
-rw-r--r--ext/fcntl/fcntl.c10
-rw-r--r--ext/fiber/extconf.rb3
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c307
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c139
-rw-r--r--ext/fiddle/conversions.h44
-rw-r--r--ext/fiddle/extconf.rb54
-rw-r--r--ext/fiddle/fiddle.c87
-rw-r--r--ext/fiddle/fiddle.h103
-rw-r--r--ext/fiddle/function.c226
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/lib/fiddle.rb34
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb48
-rw-r--r--ext/fiddle/lib/fiddle/function.rb6
-rw-r--r--ext/gdbm/.cvsignore3
-rw-r--r--ext/gdbm/gdbm.c827
-rw-r--r--ext/iconv/.cvsignore5
-rw-r--r--ext/iconv/charset_alias.rb11
-rw-r--r--ext/iconv/depend2
-rw-r--r--ext/iconv/extconf.rb3
-rw-r--r--ext/iconv/iconv.c906
-rw-r--r--ext/iconv/mkwrapper.rb53
-rw-r--r--ext/io/console/console.c762
-rw-r--r--ext/io/console/extconf.rb20
-rw-r--r--ext/io/console/io-console.gemspec15
-rw-r--r--ext/io/console/lib/console/size.rb20
-rw-r--r--ext/io/nonblock/extconf.rb8
-rw-r--r--ext/io/nonblock/nonblock.c114
-rw-r--r--ext/io/wait/.cvsignore2
-rw-r--r--ext/io/wait/extconf.rb5
-rw-r--r--ext/io/wait/lib/nonblock.rb23
-rw-r--r--ext/io/wait/wait.c118
-rw-r--r--ext/json/extconf.rb3
-rw-r--r--ext/json/generator/depend1
-rw-r--r--ext/json/generator/extconf.rb10
-rw-r--r--ext/json/generator/generator.c1459
-rw-r--r--ext/json/generator/generator.h200
-rw-r--r--ext/json/lib/json.rb62
-rw-r--r--ext/json/lib/json/add/complex.rb22
-rw-r--r--ext/json/lib/json/add/core.rb246
-rw-r--r--ext/json/lib/json/add/rational.rb22
-rw-r--r--ext/json/lib/json/common.rb442
-rw-r--r--ext/json/lib/json/ext.rb15
-rw-r--r--ext/json/lib/json/version.rb8
-rw-r--r--ext/json/parser/depend1
-rw-r--r--ext/json/parser/extconf.rb10
-rw-r--r--ext/json/parser/parser.c2196
-rw-r--r--ext/json/parser/parser.h82
-rw-r--r--ext/json/parser/parser.rl919
-rw-r--r--ext/json/parser/prereq.mk9
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb3
-rw-r--r--ext/mathn/rational/extconf.rb3
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/nkf/.cvsignore3
-rw-r--r--ext/nkf/lib/kconv.rb287
-rw-r--r--ext/nkf/nkf-utf8/config.h77
-rw-r--r--ext/nkf/nkf-utf8/nkf.c9260
-rw-r--r--ext/nkf/nkf-utf8/nkf.h192
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c1474
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h27
-rw-r--r--ext/nkf/nkf.c402
-rw-r--r--ext/objspace/depend3
-rw-r--r--ext/objspace/extconf.rb2
-rw-r--r--ext/objspace/objspace.c650
-rw-r--r--ext/openssl/.cvsignore5
-rw-r--r--ext/openssl/extconf.rb56
-rw-r--r--ext/openssl/lib/net/ftptls.rb53
-rw-r--r--ext/openssl/lib/net/telnets.rb251
-rw-r--r--ext/openssl/lib/openssl.rb9
-rw-r--r--ext/openssl/lib/openssl/bn.rb40
-rw-r--r--ext/openssl/lib/openssl/buffering.rb236
-rw-r--r--ext/openssl/lib/openssl/cipher.rb69
-rw-r--r--ext/openssl/lib/openssl/config.rb313
-rw-r--r--ext/openssl/lib/openssl/digest.rb65
-rw-r--r--ext/openssl/lib/openssl/ssl-internal.rb185
-rw-r--r--ext/openssl/lib/openssl/ssl.rb137
-rw-r--r--ext/openssl/lib/openssl/x509-internal.rb158
-rw-r--r--ext/openssl/lib/openssl/x509.rb156
-rw-r--r--ext/openssl/openssl_missing.c39
-rw-r--r--ext/openssl/openssl_missing.h110
-rw-r--r--ext/openssl/ossl.c569
-rw-r--r--ext/openssl/ossl.h79
-rw-r--r--ext/openssl/ossl_asn1.c1201
-rw-r--r--ext/openssl/ossl_asn1.h6
-rw-r--r--ext/openssl/ossl_bio.c28
-rw-r--r--ext/openssl/ossl_bio.h2
-rw-r--r--ext/openssl/ossl_bn.c273
-rw-r--r--ext/openssl/ossl_bn.h7
-rw-r--r--ext/openssl/ossl_cipher.c498
-rw-r--r--ext/openssl/ossl_cipher.h3
-rw-r--r--ext/openssl/ossl_config.c424
-rw-r--r--ext/openssl/ossl_config.h2
-rw-r--r--ext/openssl/ossl_digest.c406
-rw-r--r--ext/openssl/ossl_digest.h3
-rw-r--r--ext/openssl/ossl_engine.c68
-rw-r--r--ext/openssl/ossl_engine.h2
-rw-r--r--ext/openssl/ossl_hmac.c134
-rw-r--r--ext/openssl/ossl_hmac.h2
-rw-r--r--ext/openssl/ossl_ns_spki.c55
-rw-r--r--ext/openssl/ossl_ns_spki.h2
-rw-r--r--ext/openssl/ossl_ocsp.c123
-rw-r--r--ext/openssl/ossl_ocsp.h2
-rw-r--r--ext/openssl/ossl_pkcs12.c98
-rw-r--r--ext/openssl/ossl_pkcs12.h3
-rw-r--r--ext/openssl/ossl_pkcs5.c101
-rw-r--r--ext/openssl/ossl_pkcs7.c183
-rw-r--r--ext/openssl/ossl_pkcs7.h3
-rw-r--r--ext/openssl/ossl_pkey.c200
-rw-r--r--ext/openssl/ossl_pkey.h39
-rw-r--r--ext/openssl/ossl_pkey_dh.c232
-rw-r--r--ext/openssl/ossl_pkey_dsa.c223
-rw-r--r--ext/openssl/ossl_pkey_ec.c1594
-rw-r--r--ext/openssl/ossl_pkey_rsa.c251
-rw-r--r--ext/openssl/ossl_rand.c108
-rw-r--r--ext/openssl/ossl_rand.h2
-rw-r--r--ext/openssl/ossl_ssl.c1304
-rw-r--r--ext/openssl/ossl_ssl.h17
-rw-r--r--ext/openssl/ossl_ssl_session.c323
-rw-r--r--ext/openssl/ossl_version.h4
-rw-r--r--ext/openssl/ossl_x509.c2
-rw-r--r--ext/openssl/ossl_x509.h2
-rw-r--r--ext/openssl/ossl_x509attr.c72
-rw-r--r--ext/openssl/ossl_x509cert.c347
-rw-r--r--ext/openssl/ossl_x509crl.c100
-rw-r--r--ext/openssl/ossl_x509ext.c109
-rw-r--r--ext/openssl/ossl_x509name.c131
-rw-r--r--ext/openssl/ossl_x509req.c90
-rw-r--r--ext/openssl/ossl_x509revoked.c48
-rw-r--r--ext/openssl/ossl_x509store.c99
-rw-r--r--ext/openssl/ruby_missing.h31
-rw-r--r--ext/pathname/extconf.rb2
-rw-r--r--ext/pathname/lib/pathname.rb527
-rw-r--r--ext/pathname/pathname.c1241
-rw-r--r--ext/psych/emitter.c538
-rw-r--r--ext/psych/emitter.h8
-rw-r--r--ext/psych/extconf.rb16
-rw-r--r--ext/psych/lib/psych.rb331
-rw-r--r--ext/psych/lib/psych/coder.rb94
-rw-r--r--ext/psych/lib/psych/core_ext.rb42
-rw-r--r--ext/psych/lib/psych/deprecated.rb83
-rw-r--r--ext/psych/lib/psych/handler.rb236
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb22
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb19
-rw-r--r--ext/psych/lib/psych/json/stream.rb15
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb12
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb29
-rw-r--r--ext/psych/lib/psych/nodes.rb77
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb18
-rw-r--r--ext/psych/lib/psych/nodes/document.rb60
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb56
-rw-r--r--ext/psych/lib/psych/nodes/node.rb53
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb67
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb81
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb37
-rw-r--r--ext/psych/lib/psych/omap.rb4
-rw-r--r--ext/psych/lib/psych/parser.rb51
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb128
-rw-r--r--ext/psych/lib/psych/set.rb4
-rw-r--r--ext/psych/lib/psych/stream.rb36
-rw-r--r--ext/psych/lib/psych/streaming.rb22
-rw-r--r--ext/psych/lib/psych/syntax_error.rb19
-rw-r--r--ext/psych/lib/psych/tree_builder.rb96
-rw-r--r--ext/psych/lib/psych/visitors.rb6
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb26
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb51
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb21
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb324
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb19
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb454
-rw-r--r--ext/psych/parser.c579
-rw-r--r--ext/psych/parser.h6
-rw-r--r--ext/psych/psych.c34
-rw-r--r--ext/psych/psych.h20
-rw-r--r--ext/psych/to_ruby.c41
-rw-r--r--ext/psych/to_ruby.h8
-rw-r--r--ext/psych/yaml_tree.c24
-rw-r--r--ext/psych/yaml_tree.h8
-rw-r--r--ext/pty/.cvsignore3
-rw-r--r--ext/pty/README65
-rw-r--r--ext/pty/README.expect (renamed from doc/pty/README.expect)0
-rw-r--r--ext/pty/README.expect.ja (renamed from doc/pty/README.expect.ja)0
-rw-r--r--ext/pty/README.ja89
-rw-r--r--ext/pty/depend2
-rw-r--r--ext/pty/expect_sample.rb55
-rw-r--r--ext/pty/extconf.rb6
-rw-r--r--ext/pty/lib/expect.rb19
-rw-r--r--ext/pty/pty.c684
-rw-r--r--ext/pty/script.rb37
-rw-r--r--ext/pty/shl.rb (renamed from sample/pty/shl.rb)0
-rw-r--r--ext/racc/cparse/.cvsignore3
-rw-r--r--ext/racc/cparse/README10
-rw-r--r--ext/racc/cparse/cparse.c101
-rw-r--r--ext/racc/cparse/extconf.rb3
-rw-r--r--ext/readline/.cvsignore3
-rw-r--r--ext/readline/README68
-rw-r--r--ext/readline/README.ja444
-rw-r--r--ext/readline/extconf.rb61
-rw-r--r--ext/readline/readline.c1420
-rw-r--r--ext/ripper/README30
-rw-r--r--ext/ripper/depend47
-rw-r--r--ext/ripper/eventids2.c279
-rw-r--r--ext/ripper/extconf.rb22
-rw-r--r--ext/ripper/lib/ripper.rb4
-rw-r--r--ext/ripper/lib/ripper/core.rb70
-rw-r--r--ext/ripper/lib/ripper/filter.rb70
-rw-r--r--ext/ripper/lib/ripper/lexer.rb179
-rw-r--r--ext/ripper/lib/ripper/sexp.rb114
-rwxr-xr-xext/ripper/tools/generate-param-macros.rb14
-rwxr-xr-xext/ripper/tools/generate.rb152
-rwxr-xr-xext/ripper/tools/preproc.rb91
-rwxr-xr-xext/ripper/tools/strip.rb12
-rw-r--r--ext/sdbm/.cvsignore3
-rw-r--r--ext/sdbm/_sdbm.c176
-rw-r--r--ext/sdbm/depend4
-rw-r--r--ext/sdbm/extconf.rb1
-rw-r--r--ext/sdbm/init.c369
-rw-r--r--ext/sdbm/sdbm.h10
-rw-r--r--ext/socket/.cvsignore3
-rw-r--r--ext/socket/.document16
-rw-r--r--ext/socket/addrinfo.h49
-rw-r--r--ext/socket/ancdata.c1814
-rw-r--r--ext/socket/basicsocket.c781
-rw-r--r--ext/socket/constants.c145
-rw-r--r--ext/socket/depend28
-rw-r--r--ext/socket/extconf.rb289
-rw-r--r--ext/socket/getaddrinfo.c102
-rw-r--r--ext/socket/getnameinfo.c38
-rw-r--r--ext/socket/init.c559
-rw-r--r--ext/socket/ipsocket.c308
-rw-r--r--ext/socket/lib/socket.rb782
-rw-r--r--ext/socket/mkconstants.rb705
-rw-r--r--ext/socket/option.c923
-rw-r--r--ext/socket/raddrinfo.c2240
-rw-r--r--ext/socket/rubysocket.h309
-rw-r--r--ext/socket/socket.c4777
-rw-r--r--ext/socket/sockport.h20
-rw-r--r--ext/socket/sockssocket.c71
-rw-r--r--ext/socket/tcpserver.c171
-rw-r--r--ext/socket/tcpsocket.c82
-rw-r--r--ext/socket/udpsocket.c265
-rw-r--r--ext/socket/unixserver.c155
-rw-r--r--ext/socket/unixsocket.c523
-rw-r--r--ext/stringio/.cvsignore3
-rw-r--r--ext/stringio/README5
-rw-r--r--ext/stringio/depend5
-rw-r--r--ext/stringio/stringio.c872
-rw-r--r--ext/strscan/.cvsignore3
-rw-r--r--ext/strscan/depend3
-rw-r--r--ext/strscan/strscan.c203
-rw-r--r--ext/syck/.cvsignore3
-rw-r--r--ext/syck/bytecode.c33
-rw-r--r--ext/syck/emitter.c127
-rw-r--r--ext/syck/gram.c76
-rw-r--r--ext/syck/handler.c29
-rw-r--r--ext/syck/implicit.c34
-rw-r--r--ext/syck/lib/syck.rb447
-rw-r--r--ext/syck/lib/syck/baseemitter.rb242
-rw-r--r--ext/syck/lib/syck/basenode.rb222
-rw-r--r--ext/syck/lib/syck/constants.rb45
-rw-r--r--ext/syck/lib/syck/encoding.rb35
-rw-r--r--ext/syck/lib/syck/error.rb34
-rw-r--r--ext/syck/lib/syck/loader.rb14
-rw-r--r--ext/syck/lib/syck/rubytypes.rb467
-rw-r--r--ext/syck/lib/syck/stream.rb41
-rw-r--r--ext/syck/lib/syck/stringio.rb85
-rw-r--r--ext/syck/lib/syck/syck.rb16
-rw-r--r--ext/syck/lib/syck/tag.rb95
-rw-r--r--ext/syck/lib/syck/types.rb192
-rw-r--r--ext/syck/lib/syck/yamlnode.rb54
-rw-r--r--ext/syck/lib/syck/ypath.rb54
-rw-r--r--ext/syck/lib/yaml/syck.rb14
-rw-r--r--ext/syck/node.c33
-rw-r--r--ext/syck/rubyext.c475
-rw-r--r--ext/syck/syck.c58
-rw-r--r--ext/syck/syck.h85
-rw-r--r--ext/syck/token.c115
-rw-r--r--ext/syck/yaml2byte.c40
-rw-r--r--ext/syck/yamlbyte.h21
-rw-r--r--ext/syslog/.cvsignore3
-rw-r--r--ext/syslog/extconf.rb2
-rw-r--r--ext/syslog/syslog.c217
-rw-r--r--ext/syslog/syslog.txt11
-rw-r--r--ext/syslog/test.rb164
-rw-r--r--ext/tk/.cvsignore3
-rw-r--r--ext/tk/ChangeLog.tkextlib109
-rw-r--r--ext/tk/MANUAL_tcltklib.eng320
-rw-r--r--ext/tk/MANUAL_tcltklib.eucj55
-rw-r--r--ext/tk/README.1st21
-rw-r--r--ext/tk/README.ActiveTcl35
-rw-r--r--ext/tk/README.fork14
-rw-r--r--ext/tk/README.macosx-aqua20
-rw-r--r--ext/tk/README.tcltklib134
-rw-r--r--ext/tk/config_list.in41
-rw-r--r--ext/tk/depend4
-rw-r--r--ext/tk/extconf.rb2007
-rw-r--r--ext/tk/lib/README4
-rw-r--r--ext/tk/lib/multi-tk.rb969
-rw-r--r--ext/tk/lib/remote-tk.rb38
-rw-r--r--ext/tk/lib/tcltk.rb22
-rw-r--r--ext/tk/lib/tk.rb1882
-rw-r--r--ext/tk/lib/tk/after.rb2
-rw-r--r--ext/tk/lib/tk/autoload.rb704
-rw-r--r--ext/tk/lib/tk/bindtag.rb83
-rw-r--r--ext/tk/lib/tk/busy.rb118
-rw-r--r--ext/tk/lib/tk/button.rb8
-rw-r--r--ext/tk/lib/tk/canvas.rb177
-rw-r--r--ext/tk/lib/tk/canvastag.rb144
-rw-r--r--ext/tk/lib/tk/checkbutton.rb13
-rw-r--r--ext/tk/lib/tk/composite.rb118
-rw-r--r--ext/tk/lib/tk/console.rb6
-rw-r--r--ext/tk/lib/tk/dialog.rb30
-rw-r--r--ext/tk/lib/tk/encodedstr.rb90
-rw-r--r--ext/tk/lib/tk/entry.rb9
-rw-r--r--ext/tk/lib/tk/event.rb276
-rw-r--r--ext/tk/lib/tk/font.rb835
-rw-r--r--ext/tk/lib/tk/fontchooser.rb176
-rw-r--r--ext/tk/lib/tk/frame.rb8
-rw-r--r--ext/tk/lib/tk/grid.rb79
-rw-r--r--ext/tk/lib/tk/image.rb194
-rw-r--r--ext/tk/lib/tk/itemconfig.rb328
-rw-r--r--ext/tk/lib/tk/itemfont.rb69
-rw-r--r--ext/tk/lib/tk/kinput.rb6
-rw-r--r--ext/tk/lib/tk/label.rb8
-rw-r--r--ext/tk/lib/tk/labelframe.rb12
-rw-r--r--ext/tk/lib/tk/listbox.rb41
-rw-r--r--ext/tk/lib/tk/macpkg.rb11
-rw-r--r--ext/tk/lib/tk/menu.rb186
-rw-r--r--ext/tk/lib/tk/menubar.rb46
-rw-r--r--ext/tk/lib/tk/menuspec.rb259
-rw-r--r--ext/tk/lib/tk/message.rb9
-rw-r--r--ext/tk/lib/tk/mngfocus.rb4
-rw-r--r--ext/tk/lib/tk/msgcat.rb64
-rw-r--r--ext/tk/lib/tk/namespace.rb171
-rw-r--r--ext/tk/lib/tk/optiondb.rb62
-rw-r--r--ext/tk/lib/tk/optionobj.rb18
-rw-r--r--ext/tk/lib/tk/pack.rb17
-rw-r--r--ext/tk/lib/tk/package.rb4
-rw-r--r--ext/tk/lib/tk/palette.rb6
-rw-r--r--ext/tk/lib/tk/panedwindow.rb72
-rw-r--r--ext/tk/lib/tk/place.rb12
-rw-r--r--ext/tk/lib/tk/radiobutton.rb13
-rw-r--r--ext/tk/lib/tk/root.rb47
-rw-r--r--ext/tk/lib/tk/scale.rb38
-rw-r--r--ext/tk/lib/tk/scrollable.rb11
-rw-r--r--ext/tk/lib/tk/scrollbar.rb75
-rw-r--r--ext/tk/lib/tk/scrollbox.rb7
-rw-r--r--ext/tk/lib/tk/selection.rb6
-rw-r--r--ext/tk/lib/tk/spinbox.rb67
-rw-r--r--ext/tk/lib/tk/text.rb336
-rw-r--r--ext/tk/lib/tk/textimage.rb24
-rw-r--r--ext/tk/lib/tk/textmark.rb108
-rw-r--r--ext/tk/lib/tk/texttag.rb136
-rw-r--r--ext/tk/lib/tk/textwindow.rb33
-rw-r--r--ext/tk/lib/tk/timer.rb91
-rw-r--r--ext/tk/lib/tk/toplevel.rb33
-rw-r--r--ext/tk/lib/tk/ttk_selector.rb98
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb2
-rw-r--r--ext/tk/lib/tk/validation.rb53
-rw-r--r--ext/tk/lib/tk/variable.rb630
-rw-r--r--ext/tk/lib/tk/virtevent.rb85
-rw-r--r--ext/tk/lib/tk/winfo.rb10
-rw-r--r--ext/tk/lib/tk/winpkg.rb25
-rw-r--r--ext/tk/lib/tk/wm.rb476
-rw-r--r--ext/tk/lib/tk/xim.rb4
-rw-r--r--ext/tk/lib/tkclass.rb2
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb8
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS106
-rw-r--r--ext/tk/lib/tkextlib/blt.rb10
-rw-r--r--ext/tk/lib/tkextlib/blt/barchart.rb6
-rw-r--r--ext/tk/lib/tkextlib/blt/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/blt/busy.rb3
-rw-r--r--ext/tk/lib/tkextlib/blt/component.rb625
-rw-r--r--ext/tk/lib/tkextlib/blt/container.rb22
-rw-r--r--ext/tk/lib/tkextlib/blt/dragdrop.rb77
-rw-r--r--ext/tk/lib/tkextlib/blt/eps.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/graph.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/htext.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/stripchart.rb6
-rw-r--r--ext/tk/lib/tkextlib/blt/table.rb132
-rw-r--r--ext/tk/lib/tkextlib/blt/tabnotebook.rb93
-rw-r--r--ext/tk/lib/tkextlib/blt/tabset.rb185
-rw-r--r--ext/tk/lib/tkextlib/blt/ted.rb12
-rw-r--r--ext/tk/lib/tkextlib/blt/tile.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/button.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/checkbutton.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/frame.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/label.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/radiobutton.rb4
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/scrollbar.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/toplevel.rb2
-rw-r--r--ext/tk/lib/tkextlib/blt/tree.rb385
-rw-r--r--ext/tk/lib/tkextlib/blt/treeview.rb283
-rw-r--r--ext/tk/lib/tkextlib/blt/unix_dnd.rb22
-rw-r--r--ext/tk/lib/tkextlib/blt/vector.rb49
-rw-r--r--ext/tk/lib/tkextlib/blt/watch.rb47
-rw-r--r--ext/tk/lib/tkextlib/blt/winop.rb12
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb22
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb51
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb7
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb54
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb18
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb32
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb18
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb15
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panelframe.rb22
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb6
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb30
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb14
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb2
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/bwidget/statusbar.rb26
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb116
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb20
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb14
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb50
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb23
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb26
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb37
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb80
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb19
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb19
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb6
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb94
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb37
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb52
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb2
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb4
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb4
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb4
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb29
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb26
-rw-r--r--ext/tk/lib/tkextlib/tcllib/calendar.rb55
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_sqmap.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_zoom.rb21
-rw-r--r--ext/tk/lib/tkextlib/tcllib/chatwidget.rb151
-rw-r--r--ext/tk/lib/tkextlib/tcllib/crosshair.rb117
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dateentry.rb62
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb14
-rw-r--r--ext/tk/lib/tkextlib/tcllib/diagrams.rb224
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dialog.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/getstring.rb9
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ico.rb52
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb17
-rw-r--r--ext/tk/lib/tkextlib/tcllib/khim.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/menuentry.rb47
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ntext.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/panelframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb785
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ruler.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/screenruler.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrolledwindow.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrollwin.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tcllib/statusbar.rb79
-rw-r--r--ext/tk/lib/tkextlib/tcllib/superframe.rb2
-rw-r--r--ext/tk/lib/tkextlib/tcllib/swaplist.rb15
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist.rb9
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_core.rb342
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb20
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/toolbar.rb175
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tooltip.rb13
-rw-r--r--ext/tk/lib/tkextlib/tcllib/widget.rb34
-rw-r--r--ext/tk/lib/tkextlib/tclx/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tile.rb288
-rw-r--r--ext/tk/lib/tkextlib/tile/dialog.rb22
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tile/sizegrip.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb261
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb10
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/tcombobox.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/tentry.rb15
-rw-r--r--ext/tk/lib/tkextlib/tile/tframe.rb10
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb10
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabelframe.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb16
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb55
-rw-r--r--ext/tk/lib/tkextlib/tile/tpaned.rb93
-rw-r--r--ext/tk/lib/tkextlib/tile/tprogressbar.rb6
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb12
-rw-r--r--ext/tk/lib/tkextlib/tile/treeview.rb1284
-rw-r--r--ext/tk/lib/tkextlib/tile/tscale.rb14
-rw-r--r--ext/tk/lib/tkextlib/tile/tscrollbar.rb39
-rw-r--r--ext/tk/lib/tkextlib/tile/tseparator.rb6
-rw-r--r--ext/tk/lib/tkextlib/tile/tspinbox.rb107
-rw-r--r--ext/tk/lib/tkextlib/tile/tsquare.rb2
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb32
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb70
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb25
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README2
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb305
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb4
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb519
-rw-r--r--ext/tk/lib/tkextlib/trofs/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/version.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb10
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb2
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb83
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb4
-rw-r--r--ext/tk/lib/tkextlib/winico/setup.rb4
-rw-r--r--ext/tk/lib/tkextlib/winico/winico.rb89
-rw-r--r--ext/tk/old-README.tcltklib.eucj8
-rw-r--r--ext/tk/old-extconf.rb440
-rw-r--r--ext/tk/sample/24hr_clock.rb130
-rw-r--r--ext/tk/sample/binding_sample.rb8
-rw-r--r--ext/tk/sample/bindtag_sample.rb38
-rw-r--r--ext/tk/sample/binstr_usage.rb14
-rw-r--r--ext/tk/sample/cd_timer.rb16
-rw-r--r--ext/tk/sample/cmd_res_test.rb2
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev2
-rw-r--r--ext/tk/sample/demos-en/README28
-rw-r--r--ext/tk/sample/demos-en/README.1st8
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding4
-rw-r--r--ext/tk/sample/demos-en/anilabel.rb24
-rw-r--r--ext/tk/sample/demos-en/aniwave.rb19
-rw-r--r--ext/tk/sample/demos-en/arrow.rb80
-rw-r--r--ext/tk/sample/demos-en/bind.rb67
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb16
-rw-r--r--ext/tk/sample/demos-en/browse122
-rw-r--r--ext/tk/sample/demos-en/browse222
-rw-r--r--ext/tk/sample/demos-en/button.rb12
-rw-r--r--ext/tk/sample/demos-en/check.rb22
-rw-r--r--ext/tk/sample/demos-en/check2.rb46
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb30
-rw-r--r--ext/tk/sample/demos-en/colors.rb20
-rw-r--r--ext/tk/sample/demos-en/combo.rb96
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb34
-rw-r--r--ext/tk/sample/demos-en/ctext.rb81
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms2
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk802
-rw-r--r--ext/tk/sample/demos-en/entry1.rb18
-rw-r--r--ext/tk/sample/demos-en/entry2.rb12
-rw-r--r--ext/tk/sample/demos-en/entry3.rb70
-rw-r--r--ext/tk/sample/demos-en/filebox.rb47
-rw-r--r--ext/tk/sample/demos-en/floor.rb560
-rw-r--r--ext/tk/sample/demos-en/floor2.rb560
-rw-r--r--ext/tk/sample/demos-en/form.rb14
-rw-r--r--ext/tk/sample/demos-en/goldberg.rb419
-rw-r--r--ext/tk/sample/demos-en/hello6
-rw-r--r--ext/tk/sample/demos-en/hscale.rb29
-rw-r--r--ext/tk/sample/demos-en/icon.rb24
-rw-r--r--ext/tk/sample/demos-en/image1.rb15
-rw-r--r--ext/tk/sample/demos-en/image2.rb28
-rw-r--r--ext/tk/sample/demos-en/image3.rb43
-rw-r--r--ext/tk/sample/demos-en/items.rb103
-rw-r--r--ext/tk/sample/demos-en/ixset28
-rw-r--r--ext/tk/sample/demos-en/ixset254
-rw-r--r--ext/tk/sample/demos-en/knightstour.rb271
-rw-r--r--ext/tk/sample/demos-en/label.rb29
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb18
-rw-r--r--ext/tk/sample/demos-en/mclist.rb117
-rw-r--r--ext/tk/sample/demos-en/menu.rb60
-rw-r--r--ext/tk/sample/demos-en/menu84.rb68
-rw-r--r--ext/tk/sample/demos-en/menubu.rb14
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb34
-rw-r--r--ext/tk/sample/demos-en/msgbox2.rb91
-rw-r--r--ext/tk/sample/demos-en/paned1.rb18
-rw-r--r--ext/tk/sample/demos-en/paned2.rb52
-rw-r--r--ext/tk/sample/demos-en/patch_1.1c193
-rw-r--r--ext/tk/sample/demos-en/pendulum.rb75
-rw-r--r--ext/tk/sample/demos-en/plot.rb36
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb38
-rw-r--r--ext/tk/sample/demos-en/radio.rb24
-rw-r--r--ext/tk/sample/demos-en/radio2.rb33
-rw-r--r--ext/tk/sample/demos-en/radio3.rb55
-rw-r--r--ext/tk/sample/demos-en/rmt68
-rw-r--r--ext/tk/sample/demos-en/rolodex6
-rw-r--r--ext/tk/sample/demos-en/rolodex-j323
-rw-r--r--ext/tk/sample/demos-en/ruler.rb42
-rw-r--r--ext/tk/sample/demos-en/sayings.rb16
-rw-r--r--ext/tk/sample/demos-en/search.rb51
-rw-r--r--ext/tk/sample/demos-en/spin.rb22
-rw-r--r--ext/tk/sample/demos-en/square12
-rw-r--r--ext/tk/sample/demos-en/states.rb30
-rw-r--r--ext/tk/sample/demos-en/style.rb80
-rw-r--r--ext/tk/sample/demos-en/tcolor18
-rw-r--r--ext/tk/sample/demos-en/text.rb14
-rw-r--r--ext/tk/sample/demos-en/textpeer.rb76
-rw-r--r--ext/tk/sample/demos-en/timer2
-rw-r--r--ext/tk/sample/demos-en/toolbar.rb130
-rw-r--r--ext/tk/sample/demos-en/tree.rb119
-rw-r--r--ext/tk/sample/demos-en/ttkbut.rb139
-rw-r--r--ext/tk/sample/demos-en/ttkmenu.rb85
-rw-r--r--ext/tk/sample/demos-en/ttknote.rb89
-rw-r--r--ext/tk/sample/demos-en/ttkpane.rb213
-rw-r--r--ext/tk/sample/demos-en/ttkprogress.rb66
-rw-r--r--ext/tk/sample/demos-en/twind.rb72
-rw-r--r--ext/tk/sample/demos-en/twind2.rb134
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb50
-rw-r--r--ext/tk/sample/demos-en/vscale.rb29
-rw-r--r--ext/tk/sample/demos-en/widget357
-rw-r--r--ext/tk/sample/demos-jp/README14
-rw-r--r--ext/tk/sample/demos-jp/anilabel.rb25
-rw-r--r--ext/tk/sample/demos-jp/aniwave.rb20
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb77
-rw-r--r--ext/tk/sample/demos-jp/bind.rb60
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb15
-rw-r--r--ext/tk/sample/demos-jp/browse122
-rw-r--r--ext/tk/sample/demos-jp/browse222
-rw-r--r--ext/tk/sample/demos-jp/button.rb6
-rw-r--r--ext/tk/sample/demos-jp/check.rb17
-rw-r--r--ext/tk/sample/demos-jp/check2.rb47
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb27
-rw-r--r--ext/tk/sample/demos-jp/colors.rb21
-rw-r--r--ext/tk/sample/demos-jp/combo.rb98
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb33
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb76
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb1
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb1
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms2
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk802
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb15
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb11
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb69
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb48
-rw-r--r--ext/tk/sample/demos-jp/floor.rb557
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb557
-rw-r--r--ext/tk/sample/demos-jp/form.rb11
-rw-r--r--ext/tk/sample/demos-jp/goldberg.rb426
-rw-r--r--ext/tk/sample/demos-jp/hello1
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb29
-rw-r--r--ext/tk/sample/demos-jp/icon.rb23
-rw-r--r--ext/tk/sample/demos-jp/image1.rb16
-rw-r--r--ext/tk/sample/demos-jp/image2.rb26
-rw-r--r--ext/tk/sample/demos-jp/image3.rb32
-rw-r--r--ext/tk/sample/demos-jp/items.rb98
-rw-r--r--ext/tk/sample/demos-jp/ixset30
-rw-r--r--ext/tk/sample/demos-jp/ixset257
-rw-r--r--ext/tk/sample/demos-jp/knightstour.rb273
-rw-r--r--ext/tk/sample/demos-jp/label.rb20
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb28
-rw-r--r--ext/tk/sample/demos-jp/mclist.rb121
-rw-r--r--ext/tk/sample/demos-jp/menu.rb63
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb67
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb69
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb15
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb39
-rw-r--r--ext/tk/sample/demos-jp/msgbox2.rb90
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb20
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb56
-rw-r--r--ext/tk/sample/demos-jp/pendulum.rb76
-rw-r--r--ext/tk/sample/demos-jp/plot.rb37
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb41
-rw-r--r--ext/tk/sample/demos-jp/radio.rb15
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb35
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb57
-rw-r--r--ext/tk/sample/demos-jp/rmt68
-rw-r--r--ext/tk/sample/demos-jp/rolodex6
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j5
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb39
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb17
-rw-r--r--ext/tk/sample/demos-jp/search.rb54
-rw-r--r--ext/tk/sample/demos-jp/spin.rb28
-rw-r--r--ext/tk/sample/demos-jp/square12
-rw-r--r--ext/tk/sample/demos-jp/states.rb11
-rw-r--r--ext/tk/sample/demos-jp/style.rb80
-rw-r--r--ext/tk/sample/demos-jp/tcolor19
-rw-r--r--ext/tk/sample/demos-jp/text.rb11
-rw-r--r--ext/tk/sample/demos-jp/textpeer.rb82
-rw-r--r--ext/tk/sample/demos-jp/timer2
-rw-r--r--ext/tk/sample/demos-jp/toolbar.rb136
-rw-r--r--ext/tk/sample/demos-jp/tree.rb120
-rw-r--r--ext/tk/sample/demos-jp/ttkbut.rb145
-rw-r--r--ext/tk/sample/demos-jp/ttkmenu.rb91
-rw-r--r--ext/tk/sample/demos-jp/ttknote.rb97
-rw-r--r--ext/tk/sample/demos-jp/ttkpane.rb216
-rw-r--r--ext/tk/sample/demos-jp/ttkprogress.rb71
-rw-r--r--ext/tk/sample/demos-jp/twind.rb69
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb113
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb50
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb30
-rw-r--r--ext/tk/sample/demos-jp/widget467
-rw-r--r--ext/tk/sample/editable_listbox.rb148
-rw-r--r--ext/tk/sample/encstr_usage.rb9
-rw-r--r--ext/tk/sample/figmemo_sample.rb456
-rw-r--r--ext/tk/sample/images/teapot.ppm49
-rw-r--r--ext/tk/sample/irbtk.rb4
-rw-r--r--ext/tk/sample/irbtkw.rbw156
-rw-r--r--ext/tk/sample/menubar1.rb20
-rw-r--r--ext/tk/sample/menubar2.rb24
-rw-r--r--ext/tk/sample/menubar3.rb72
-rw-r--r--ext/tk/sample/msgs_rb/README4
-rw-r--r--ext/tk/sample/msgs_rb/es.msg2
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg4
-rw-r--r--ext/tk/sample/msgs_rb2/README2
-rw-r--r--ext/tk/sample/msgs_tk/README2
-rw-r--r--ext/tk/sample/msgs_tk/el.msg2
-rw-r--r--ext/tk/sample/msgs_tk/es.msg2
-rw-r--r--ext/tk/sample/msgs_tk/license.terms2
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg4
-rw-r--r--ext/tk/sample/multi-ip_sample.rb7
-rw-r--r--ext/tk/sample/multi-ip_sample2.rb2
-rw-r--r--ext/tk/sample/optobj_sample.rb30
-rw-r--r--ext/tk/sample/propagate.rb2
-rw-r--r--ext/tk/sample/remote-ip_sample.rb10
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb20
-rw-r--r--ext/tk/sample/safe-tk.rb57
-rw-r--r--ext/tk/sample/scrollframe.rb28
-rw-r--r--ext/tk/sample/tcltklib/sample1.rb2
-rw-r--r--ext/tk/sample/tcltklib/sample2.rb106
-rw-r--r--ext/tk/sample/tkalignbox.rb102
-rw-r--r--ext/tk/sample/tkballoonhelp.rb118
-rw-r--r--ext/tk/sample/tkbiff.rb6
-rw-r--r--ext/tk/sample/tkbrowse.rb2
-rw-r--r--ext/tk/sample/tkcombobox.rb133
-rw-r--r--ext/tk/sample/tkdialog.rb2
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb38
-rw-r--r--ext/tk/sample/tkextlib/blt/barchart5.rb22
-rw-r--r--ext/tk/sample/tkextlib/blt/calendar.rb54
-rw-r--r--ext/tk/sample/tkextlib/blt/graph6.rb4056
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7a.rb10
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7b.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7c.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/pareto.rb34
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1b.rb2
-rw-r--r--ext/tk/sample/tkextlib/blt/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/blt/winop1.rb8
-rw-r--r--ext/tk/sample/tkextlib/blt/winop2.rb2
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb96
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb84
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb16
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb28
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb56
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb162
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb96
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb4
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb36
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb66
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb6
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb6
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb4
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb6
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb4
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb2
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb2
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb4
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb22
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb8
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb20
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb2
-rw-r--r--ext/tk/sample/tkextlib/tile/demo.rb213
-rw-r--r--ext/tk/sample/tkextlib/tile/readme.txt4
-rw-r--r--ext/tk/sample/tkextlib/tile/repeater.tcl12
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue.tcl8
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/pkgIndex.tcl2
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik.tcl30
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/pkgIndex.tcl4
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc.rb122
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc.tcl38
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/pkgIndex.tcl4
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/pkgIndex.tcl4
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik.tcl2
-rw-r--r--ext/tk/sample/tkextlib/tile/toolbutton.tcl36
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README6
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb48
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html48
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html40
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb82
-rw-r--r--ext/tk/sample/tkextlib/tkimg/demo.rb10
-rw-r--r--ext/tk/sample/tkextlib/tkimg/license_terms_of_Img_extension4
-rw-r--r--ext/tk/sample/tkextlib/tkimg/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb14
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb12
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb22
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb16
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb14
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb14
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb16
-rwxr-xr-x[-rw-r--r--]ext/tk/sample/tkextlib/tktable/tcllogo.gifbin2341 -> 2341 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb12
-rw-r--r--ext/tk/sample/tkextlib/treectrl/bitmaps.rb32
-rw-r--r--ext/tk/sample/tkextlib/treectrl/demo.rb349
-rw-r--r--ext/tk/sample/tkextlib/treectrl/explorer.rb126
-rw-r--r--ext/tk/sample/tkextlib/treectrl/help.rb106
-rw-r--r--ext/tk/sample/tkextlib/treectrl/imovie.rb30
-rw-r--r--ext/tk/sample/tkextlib/treectrl/layout.rb26
-rw-r--r--ext/tk/sample/tkextlib/treectrl/mailwasher.rb100
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-folders.rb52
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-newgroup.rb102
-rw-r--r--ext/tk/sample/tkextlib/treectrl/random.rb68
-rw-r--r--ext/tk/sample/tkextlib/treectrl/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/treectrl/www-options.rb72
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb4
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb16
-rw-r--r--ext/tk/sample/tkextlib/vu/dial_demo.rb62
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb16
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb10
-rw-r--r--ext/tk/sample/tkextlib/vu/vu_demo.rb14
-rw-r--r--ext/tk/sample/tkfrom.rb2
-rw-r--r--ext/tk/sample/tkhello.rb2
-rw-r--r--ext/tk/sample/tkmenubutton.rb56
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb16
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb16
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb22
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb114
-rw-r--r--ext/tk/sample/tkmultilistbox.rb96
-rw-r--r--ext/tk/sample/tkmultilistframe.rb168
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb28
-rw-r--r--ext/tk/sample/tkoptdb.rb32
-rw-r--r--ext/tk/sample/tkrttimer.rb17
-rw-r--r--ext/tk/sample/tksleep_sample.rb29
-rw-r--r--ext/tk/sample/tktextframe.rb267
-rw-r--r--ext/tk/sample/tktextio.rb579
-rw-r--r--ext/tk/sample/tktimer2.rb8
-rw-r--r--ext/tk/sample/tktimer3.rb8
-rw-r--r--ext/tk/sample/tktree.rb26
-rw-r--r--ext/tk/sample/ttk_wrapper.rb154
-rw-r--r--ext/tk/stubs.c134
-rw-r--r--ext/tk/tcltklib.c4500
-rw-r--r--ext/tk/tkutil/.cvsignore3
-rw-r--r--ext/tk/tkutil/extconf.rb16
-rw-r--r--ext/tk/tkutil/tkutil.c846
-rw-r--r--ext/win32ole/.cvsignore4
-rw-r--r--ext/win32ole/depend2
-rw-r--r--ext/win32ole/doc/win32ole.rd294
-rw-r--r--ext/win32ole/extconf.rb32
-rw-r--r--ext/win32ole/lib/win32ole.rb22
-rw-r--r--ext/win32ole/sample/excel1.rb15
-rw-r--r--ext/win32ole/sample/excel2.rb10
-rw-r--r--ext/win32ole/sample/ieconst.rb2
-rw-r--r--ext/win32ole/sample/ienavi.rb2
-rw-r--r--ext/win32ole/sample/ienavi2.rb40
-rw-r--r--ext/win32ole/sample/oledirs.rb2
-rw-r--r--ext/win32ole/sample/olegen.rb27
-rw-r--r--ext/win32ole/sample/xml.rb36
-rw-r--r--ext/win32ole/tests/oleserver.rb10
-rw-r--r--ext/win32ole/tests/testNIL2VTEMPTY.rb28
-rw-r--r--ext/win32ole/tests/testOLEEVENT.rb91
-rw-r--r--ext/win32ole/tests/testOLEMETHOD.rb92
-rw-r--r--ext/win32ole/tests/testOLEPARAM.rb65
-rw-r--r--ext/win32ole/tests/testOLETYPE.rb96
-rw-r--r--ext/win32ole/tests/testOLEVARIABLE.rb49
-rw-r--r--ext/win32ole/tests/testVARIANT.rb32
-rw-r--r--ext/win32ole/tests/testWIN32OLE.rb372
-rw-r--r--ext/win32ole/tests/test_ole_methods.rb36
-rw-r--r--ext/win32ole/tests/test_propertyputref.rb19
-rw-r--r--ext/win32ole/tests/test_word.rb37
-rw-r--r--ext/win32ole/tests/testall.rb15
-rw-r--r--ext/win32ole/win32ole.c6097
-rw-r--r--ext/zlib/.cvsignore3
-rw-r--r--ext/zlib/doc/zlib.rd911
-rw-r--r--ext/zlib/extconf.rb13
-rw-r--r--ext/zlib/zlib.c2272
-rw-r--r--file.c3899
-rw-r--r--gc.c3715
-rw-r--r--gc.h99
-rw-r--r--gem_prelude.rb1
-rw-r--r--golf_prelude.rb122
-rw-r--r--goruby.c24
-rw-r--r--hash.c2494
-rw-r--r--ia64.s42
-rw-r--r--id.c52
-rw-r--r--include/ruby.h34
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h56
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/defines.h334
-rw-r--r--include/ruby/encoding.h350
-rw-r--r--include/ruby/intern.h916
-rw-r--r--include/ruby/io.h202
-rw-r--r--include/ruby/missing.h235
-rw-r--r--include/ruby/oniguruma.h807
-rw-r--r--include/ruby/re.h75
-rw-r--r--include/ruby/regex.h50
-rw-r--r--include/ruby/ruby.h1491
-rw-r--r--include/ruby/st.h147
-rw-r--r--include/ruby/subst.h20
-rw-r--r--include/ruby/util.h99
-rw-r--r--include/ruby/version.h78
-rw-r--r--include/ruby/vm.h68
-rw-r--r--include/ruby/win32.h773
-rw-r--r--inits.c120
-rw-r--r--insns.def2160
-rw-r--r--install-sh (renamed from lib/rdoc/generator/template/darkfish/.document)0
-rw-r--r--instruby.rb244
-rw-r--r--intern.h500
-rw-r--r--internal.h239
-rw-r--r--io.c11047
-rw-r--r--iseq.c1529
-rw-r--r--iseq.h126
-rw-r--r--keywords42
-rw-r--r--lex.c136
-rw-r--r--lex.c.blt219
-rw-r--r--lib/.document103
-rw-r--r--lib/English.rb10
-rw-r--r--lib/Env.rb18
-rw-r--r--lib/README45
-rw-r--r--lib/abbrev.rb29
-rw-r--r--lib/base64.rb142
-rw-r--r--lib/benchmark.rb342
-rw-r--r--lib/cgi-lib.rb272
-rw-r--r--lib/cgi.rb2154
-rw-r--r--lib/cgi/.document2
-rw-r--r--lib/cgi/cookie.rb164
-rw-r--r--lib/cgi/core.rb838
-rw-r--r--lib/cgi/html.rb1021
-rw-r--r--lib/cgi/session.rb289
-rw-r--r--lib/cgi/session/pstore.rb60
-rw-r--r--lib/cgi/util.rb194
-rw-r--r--lib/cmath.rb402
-rw-r--r--lib/complex.rb633
-rw-r--r--lib/csv.rb3054
-rw-r--r--lib/date.rb1328
-rw-r--r--lib/date/format.rb603
-rw-r--r--lib/date2.rb5
-rw-r--r--lib/debug.rb1520
-rw-r--r--lib/delegate.rb470
-rw-r--r--lib/drb/acl.rb154
-rw-r--r--lib/drb/drb.rb565
-rw-r--r--lib/drb/eq.rb2
-rw-r--r--lib/drb/extserv.rb21
-rw-r--r--lib/drb/extservm.rb71
-rw-r--r--lib/drb/invokemethod.rb12
-rw-r--r--lib/drb/observer.rb20
-rw-r--r--lib/drb/ssl.rb180
-rw-r--r--lib/drb/timeridconv.rb80
-rw-r--r--lib/drb/unix.rb52
-rw-r--r--lib/e2mmap.rb107
-rw-r--r--lib/erb.rb822
-rw-r--r--lib/eregex.rb37
-rw-r--r--lib/fileutils.rb566
-rw-r--r--lib/finalize.rb193
-rw-r--r--lib/find.rb46
-rw-r--r--lib/forwardable.rb205
-rw-r--r--lib/ftools.rb261
-rw-r--r--lib/generator.rb380
-rw-r--r--lib/getoptlong.rb295
-rw-r--r--lib/getopts.rb127
-rw-r--r--lib/gserver.rb94
-rw-r--r--lib/importenv.rb33
-rw-r--r--lib/ipaddr.rb466
-rw-r--r--lib/irb.rb314
-rw-r--r--lib/irb/cmd/chws.rb9
-rw-r--r--lib/irb/cmd/fork.rb15
-rw-r--r--lib/irb/cmd/help.rb25
-rw-r--r--lib/irb/cmd/load.rb13
-rw-r--r--lib/irb/cmd/nop.rb13
-rw-r--r--lib/irb/cmd/pushws.rb9
-rw-r--r--lib/irb/cmd/subirb.rb11
-rw-r--r--lib/irb/completion.rb140
-rw-r--r--lib/irb/context.rb70
-rw-r--r--lib/irb/ext/change-ws.rb17
-rw-r--r--lib/irb/ext/history.rb15
-rw-r--r--lib/irb/ext/loader.rb17
-rw-r--r--lib/irb/ext/math-mode.rb9
-rw-r--r--lib/irb/ext/multi-irb.rb47
-rw-r--r--lib/irb/ext/save-history.rb70
-rw-r--r--lib/irb/ext/tracer.rb13
-rw-r--r--lib/irb/ext/use-loader.rb11
-rw-r--r--lib/irb/ext/workspaces.rb9
-rw-r--r--lib/irb/extend-command.rb52
-rw-r--r--lib/irb/frame.rb7
-rw-r--r--lib/irb/help.rb36
-rw-r--r--lib/irb/init.rb92
-rw-r--r--lib/irb/input-method.rb50
-rw-r--r--lib/irb/inspector.rb109
-rw-r--r--lib/irb/lc/error.rb11
-rw-r--r--lib/irb/lc/help-message23
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb8
-rw-r--r--lib/irb/lc/ja/error.rb32
-rw-r--r--lib/irb/lc/ja/help-message61
-rw-r--r--lib/irb/locale.rb168
-rw-r--r--lib/irb/magic-file.rb37
-rw-r--r--lib/irb/notifier.rb27
-rw-r--r--lib/irb/output-method.rb36
-rw-r--r--lib/irb/ruby-lex.rb180
-rw-r--r--lib/irb/ruby-token.rb30
-rw-r--r--lib/irb/slex.rb49
-rw-r--r--lib/irb/src_encoding.rb4
-rw-r--r--lib/irb/version.rb11
-rw-r--r--lib/irb/workspace.rb23
-rw-r--r--lib/irb/ws-for-case-2.rb11
-rw-r--r--lib/irb/xmp.rb19
-rw-r--r--lib/jcode.rb220
-rw-r--r--lib/logger.rb270
-rw-r--r--lib/mailread.rb62
-rw-r--r--lib/mathn.rb432
-rw-r--r--lib/matrix.rb1606
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb886
-rw-r--r--lib/matrix/lup_decomposition.rb218
-rw-r--r--lib/minitest/README.txt269
-rw-r--r--lib/minitest/autorun.rb18
-rw-r--r--lib/minitest/benchmark.rb372
-rw-r--r--lib/minitest/mock.rb106
-rw-r--r--lib/minitest/pride.rb99
-rw-r--r--lib/minitest/spec.rb519
-rw-r--r--lib/minitest/unit.rb1169
-rw-r--r--lib/mkmf.rb1563
-rw-r--r--lib/monitor.rb362
-rw-r--r--lib/mutex_m.rb121
-rw-r--r--lib/net/.document8
-rw-r--r--lib/net/ftp.rb754
-rw-r--r--lib/net/http.rb1716
-rw-r--r--lib/net/https.rb163
-rw-r--r--lib/net/imap.rb1089
-rw-r--r--lib/net/pop.rb358
-rw-r--r--lib/net/protocol.rb56
-rw-r--r--lib/net/smtp.rb798
-rw-r--r--lib/net/telnet.rb256
-rw-r--r--lib/observer.rb94
-rw-r--r--lib/open-uri.rb302
-rw-r--r--lib/open3.rb749
-rw-r--r--lib/optparse.rb492
-rw-r--r--lib/optparse/version.rb10
-rw-r--r--lib/ostruct.rb186
-rw-r--r--lib/parsearg.rb87
-rw-r--r--lib/parsedate.rb15
-rw-r--r--lib/pathname.rb1062
-rw-r--r--lib/ping.rb53
-rw-r--r--lib/pp.rb331
-rw-r--r--lib/prettyprint.rb553
-rw-r--r--lib/prime.rb509
-rw-r--r--lib/profile.rb4
-rw-r--r--lib/profiler.rb2
-rw-r--r--lib/pstore.rb390
-rw-r--r--lib/racc/parser.rb49
-rw-r--r--lib/rake.rb69
-rw-r--r--lib/rake/alt_system.rb109
-rw-r--r--lib/rake/application.rb595
-rw-r--r--lib/rake/classic_namespace.rb11
-rw-r--r--lib/rake/clean.rb32
-rw-r--r--lib/rake/cloneable.rb25
-rw-r--r--lib/rake/contrib/compositepublisher.rb21
-rw-r--r--lib/rake/contrib/ftptools.rb150
-rw-r--r--lib/rake/contrib/publisher.rb73
-rw-r--r--lib/rake/contrib/rubyforgepublisher.rb16
-rw-r--r--lib/rake/contrib/sshpublisher.rb50
-rw-r--r--lib/rake/contrib/sys.rb191
-rw-r--r--lib/rake/default_loader.rb10
-rw-r--r--lib/rake/dsl_definition.rb176
-rw-r--r--lib/rake/early_time.rb18
-rw-r--r--lib/rake/ext/core.rb27
-rw-r--r--lib/rake/ext/module.rb39
-rw-r--r--lib/rake/ext/string.rb167
-rw-r--r--lib/rake/ext/time.rb14
-rw-r--r--lib/rake/file_creation_task.rb24
-rw-r--r--lib/rake/file_list.rb403
-rw-r--r--lib/rake/file_task.rb47
-rw-r--r--lib/rake/file_utils.rb114
-rw-r--r--lib/rake/file_utils_ext.rb145
-rw-r--r--lib/rake/gempackagetask.rb15
-rw-r--r--lib/rake/invocation_chain.rb51
-rw-r--r--lib/rake/invocation_exception_mixin.rb16
-rw-r--r--lib/rake/lib/project.rake21
-rw-r--r--lib/rake/loaders/makefile.rb40
-rw-r--r--lib/rake/multi_task.rb16
-rw-r--r--lib/rake/name_space.rb25
-rw-r--r--lib/rake/packagetask.rb185
-rw-r--r--lib/rake/pathmap.rb1
-rw-r--r--lib/rake/pseudo_status.rb24
-rw-r--r--lib/rake/rake_module.rb29
-rw-r--r--lib/rake/rake_test_loader.rb22
-rw-r--r--lib/rake/rdoctask.rb234
-rwxr-xr-xlib/rake/ruby182_test_unit_fix.rb25
-rw-r--r--lib/rake/rule_recursion_overflow_error.rb20
-rw-r--r--lib/rake/runtest.rb21
-rw-r--r--lib/rake/task.rb327
-rw-r--r--lib/rake/task_argument_error.rb7
-rw-r--r--lib/rake/task_arguments.rb78
-rw-r--r--lib/rake/task_manager.rb307
-rw-r--r--lib/rake/tasklib.rb22
-rw-r--r--lib/rake/testtask.rb191
-rw-r--r--lib/rake/version.rb8
-rw-r--r--lib/rake/win32.rb55
-rw-r--r--lib/rational.rb525
-rw-r--r--lib/rbconfig/.document1
-rw-r--r--lib/rbconfig/datadir.rb13
-rw-r--r--lib/rbconfig/obsolete.rb5
-rw-r--r--lib/rdoc.rb147
-rw-r--r--lib/rdoc/README489
-rw-r--r--lib/rdoc/alias.rb113
-rw-r--r--lib/rdoc/anon_class.rb12
-rw-r--r--lib/rdoc/any_method.rb207
-rw-r--r--lib/rdoc/attr.rb136
-rw-r--r--lib/rdoc/class_module.rb582
-rw-r--r--lib/rdoc/code_object.rb307
-rw-r--r--lib/rdoc/code_objects.rb778
-rw-r--r--lib/rdoc/constant.rb86
-rw-r--r--lib/rdoc/context.rb1191
-rw-r--r--lib/rdoc/cross_reference.rb173
-rw-r--r--lib/rdoc/diagram.rb335
-rw-r--r--lib/rdoc/dot/dot.rb255
-rw-r--r--lib/rdoc/encoding.rb92
-rw-r--r--lib/rdoc/erbio.rb37
-rw-r--r--lib/rdoc/generator.rb40
-rw-r--r--lib/rdoc/generator/darkfish.rb390
-rw-r--r--lib/rdoc/generator/markup.rb208
-rw-r--r--lib/rdoc/generator/ri.rb86
-rw-r--r--lib/rdoc/generator/template/darkfish/classpage.rhtml321
-rw-r--r--lib/rdoc/generator/template/darkfish/filepage.rhtml124
-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin452 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin764 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin774 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin211 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin209 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin626 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin659 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin5886 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin853 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin621 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin342 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin309 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin591 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin592 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin613 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin610 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin584 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml64
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js118
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js32
-rw-r--r--lib/rdoc/generator/template/darkfish/js/quicksearch.js114
-rw-r--r--lib/rdoc/generator/template/darkfish/js/thickbox-compressed.js10
-rw-r--r--lib/rdoc/generator/template/darkfish/rdoc.css763
-rw-r--r--lib/rdoc/generators/chm_generator.rb112
-rw-r--r--lib/rdoc/generators/html_generator.rb1509
-rw-r--r--lib/rdoc/generators/ri_generator.rb268
-rw-r--r--lib/rdoc/generators/template/chm/chm.rb87
-rw-r--r--lib/rdoc/generators/template/html/hefss.rb418
-rw-r--r--lib/rdoc/generators/template/html/html.rb711
-rw-r--r--lib/rdoc/generators/template/html/kilmer.rb435
-rw-r--r--lib/rdoc/generators/template/html/old_html.rb728
-rw-r--r--lib/rdoc/generators/template/html/one_page_html.rb122
-rw-r--r--lib/rdoc/generators/template/xml/rdf.rb112
-rw-r--r--lib/rdoc/generators/template/xml/xml.rb112
-rw-r--r--lib/rdoc/generators/xml_generator.rb130
-rw-r--r--lib/rdoc/ghost_method.rb8
-rw-r--r--lib/rdoc/include.rb100
-rw-r--r--lib/rdoc/known_classes.rb72
-rw-r--r--lib/rdoc/markup.rb652
-rw-r--r--lib/rdoc/markup/.document2
-rw-r--r--lib/rdoc/markup/attribute_manager.rb335
-rw-r--r--lib/rdoc/markup/blank_line.rb27
-rw-r--r--lib/rdoc/markup/document.rb127
-rw-r--r--lib/rdoc/markup/formatter.rb169
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb699
-rw-r--r--lib/rdoc/markup/heading.rb20
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb33
-rw-r--r--lib/rdoc/markup/inline.rb144
-rw-r--r--lib/rdoc/markup/list.rb81
-rw-r--r--lib/rdoc/markup/list_item.rb86
-rw-r--r--lib/rdoc/markup/paragraph.rb14
-rw-r--r--lib/rdoc/markup/parser.rb497
-rw-r--r--lib/rdoc/markup/pre_process.rb227
-rw-r--r--lib/rdoc/markup/raw.rb69
-rw-r--r--lib/rdoc/markup/rule.rb20
-rw-r--r--lib/rdoc/markup/sample/rdoc2latex.rb16
-rw-r--r--lib/rdoc/markup/sample/sample.rb42
-rw-r--r--lib/rdoc/markup/simple_markup.rb476
-rw-r--r--lib/rdoc/markup/simple_markup/fragments.rb328
-rw-r--r--lib/rdoc/markup/simple_markup/inline.rb340
-rw-r--r--lib/rdoc/markup/simple_markup/lines.rb151
-rw-r--r--lib/rdoc/markup/simple_markup/preprocess.rb73
-rw-r--r--lib/rdoc/markup/simple_markup/to_flow.rb188
-rw-r--r--lib/rdoc/markup/simple_markup/to_html.rb289
-rw-r--r--lib/rdoc/markup/simple_markup/to_latex.rb333
-rw-r--r--lib/rdoc/markup/test/AllTests.rb2
-rw-r--r--lib/rdoc/markup/test/TestInline.rb154
-rw-r--r--lib/rdoc/markup/test/TestParse.rb503
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb116
-rw-r--r--lib/rdoc/markup/to_ansi.rb84
-rw-r--r--lib/rdoc/markup/to_bs.rb80
-rw-r--r--lib/rdoc/markup/to_html.rb324
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb120
-rw-r--r--lib/rdoc/markup/to_rdoc.rb301
-rw-r--r--lib/rdoc/markup/to_test.rb72
-rw-r--r--lib/rdoc/markup/to_tt_only.rb114
-rw-r--r--lib/rdoc/markup/verbatim.rb45
-rw-r--r--lib/rdoc/meta_method.rb8
-rw-r--r--lib/rdoc/method_attr.rb355
-rw-r--r--lib/rdoc/normal_class.rb71
-rw-r--r--lib/rdoc/normal_module.rb66
-rw-r--r--lib/rdoc/options.rb1179
-rw-r--r--lib/rdoc/parser.rb208
-rw-r--r--lib/rdoc/parser/c.rb1047
-rw-r--r--lib/rdoc/parser/ruby.rb1782
-rw-r--r--lib/rdoc/parser/ruby_tools.rb162
-rw-r--r--lib/rdoc/parser/simple.rb49
-rw-r--r--lib/rdoc/parsers/parse_c.rb697
-rw-r--r--lib/rdoc/parsers/parse_f95.rb1841
-rw-r--r--lib/rdoc/parsers/parse_rb.rb2605
-rw-r--r--lib/rdoc/parsers/parse_simple.rb41
-rw-r--r--lib/rdoc/parsers/parserfactory.rb99
-rw-r--r--lib/rdoc/rdoc.rb670
-rw-r--r--lib/rdoc/require.rb53
-rw-r--r--lib/rdoc/ri.rb18
-rw-r--r--lib/rdoc/ri/driver.rb1178
-rw-r--r--lib/rdoc/ri/formatter.rb5
-rw-r--r--lib/rdoc/ri/paths.rb128
-rw-r--r--lib/rdoc/ri/ri_cache.rb187
-rw-r--r--lib/rdoc/ri/ri_descriptions.rb154
-rw-r--r--lib/rdoc/ri/ri_display.rb255
-rw-r--r--lib/rdoc/ri/ri_driver.rb143
-rw-r--r--lib/rdoc/ri/ri_formatter.rb674
-rw-r--r--lib/rdoc/ri/ri_options.rb313
-rw-r--r--lib/rdoc/ri/ri_paths.rb80
-rw-r--r--lib/rdoc/ri/ri_reader.rb100
-rw-r--r--lib/rdoc/ri/ri_util.rb75
-rw-r--r--lib/rdoc/ri/ri_writer.rb62
-rw-r--r--lib/rdoc/ri/store.rb358
-rw-r--r--lib/rdoc/ruby_lex.rb1297
-rw-r--r--lib/rdoc/ruby_token.rb416
-rw-r--r--lib/rdoc/rubygems_hook.rb220
-rw-r--r--lib/rdoc/single_class.rb23
-rw-r--r--lib/rdoc/stats.rb438
-rw-r--r--lib/rdoc/stats/normal.rb48
-rw-r--r--lib/rdoc/stats/quiet.rb59
-rw-r--r--lib/rdoc/stats/verbose.rb45
-rw-r--r--lib/rdoc/task.rb326
-rw-r--r--lib/rdoc/template.rb234
-rw-r--r--lib/rdoc/text.rb302
-rw-r--r--lib/rdoc/token_stream.rb50
-rw-r--r--lib/rdoc/tokenstream.rb25
-rw-r--r--lib/rdoc/top_level.rb474
-rw-r--r--lib/rdoc/usage.rb210
-rw-r--r--lib/readbytes.rb41
-rw-r--r--lib/resolv-replace.rb22
-rw-r--r--lib/resolv.rb1421
-rw-r--r--lib/rexml/attlistdecl.rb112
-rw-r--r--lib/rexml/attribute.rb307
-rw-r--r--lib/rexml/cdata.rb115
-rw-r--r--lib/rexml/child.rb164
-rw-r--r--lib/rexml/comment.rb134
-rw-r--r--lib/rexml/doctype.rb73
-rw-r--r--lib/rexml/document.rb347
-rw-r--r--lib/rexml/dtd/attlistdecl.rb14
-rw-r--r--lib/rexml/dtd/dtd.rb82
-rw-r--r--lib/rexml/dtd/elementdecl.rb26
-rw-r--r--lib/rexml/dtd/entitydecl.rb98
-rw-r--r--lib/rexml/dtd/notationdecl.rb64
-rw-r--r--lib/rexml/element.rb2290
-rw-r--r--lib/rexml/encoding.rb102
-rw-r--r--lib/rexml/encodings/CP-1252.rb98
-rw-r--r--lib/rexml/encodings/EUC-JP.rb35
-rw-r--r--lib/rexml/encodings/ICONV.rb22
-rw-r--r--lib/rexml/encodings/ISO-8859-1.rb7
-rw-r--r--lib/rexml/encodings/ISO-8859-15.rb69
-rw-r--r--lib/rexml/encodings/SHIFT-JIS.rb37
-rw-r--r--lib/rexml/encodings/SHIFT_JIS.rb1
-rw-r--r--lib/rexml/encodings/UNILE.rb34
-rw-r--r--lib/rexml/encodings/US-ASCII.rb30
-rw-r--r--lib/rexml/encodings/UTF-16.rb34
-rw-r--r--lib/rexml/encodings/UTF-8.rb18
-rw-r--r--lib/rexml/entity.rb293
-rw-r--r--lib/rexml/formatters/default.rb111
-rw-r--r--lib/rexml/formatters/pretty.rb141
-rw-r--r--lib/rexml/formatters/transitive.rb57
-rw-r--r--lib/rexml/functions.rb83
-rw-r--r--lib/rexml/instruction.rb102
-rw-r--r--lib/rexml/light/node.rb381
-rw-r--r--lib/rexml/namespace.rb78
-rw-r--r--lib/rexml/node.rb99
-rw-r--r--lib/rexml/output.rb24
-rw-r--r--lib/rexml/parent.rb51
-rw-r--r--lib/rexml/parseexception.rb8
-rw-r--r--lib/rexml/parsers/baseparser.rb172
-rw-r--r--lib/rexml/parsers/lightparser.rb84
-rw-r--r--lib/rexml/parsers/pullparser.rb2
-rw-r--r--lib/rexml/parsers/sax2parser.rb409
-rw-r--r--lib/rexml/parsers/streamparser.rb4
-rw-r--r--lib/rexml/parsers/treeparser.rb16
-rw-r--r--lib/rexml/parsers/ultralightparser.rb80
-rw-r--r--lib/rexml/parsers/xpathparser.rb109
-rw-r--r--lib/rexml/quickpath.rb495
-rw-r--r--lib/rexml/rexml.rb32
-rw-r--r--lib/rexml/sax2listener.rb184
-rw-r--r--lib/rexml/source.rb414
-rw-r--r--lib/rexml/streamlistener.rb180
-rw-r--r--lib/rexml/syncenumerator.rb7
-rw-r--r--lib/rexml/text.rb279
-rw-r--r--lib/rexml/undefinednamespaceexception.rb8
-rw-r--r--lib/rexml/validation/relaxng.rb36
-rw-r--r--lib/rexml/validation/validation.rb10
-rw-r--r--lib/rexml/xmldecl.rb127
-rw-r--r--lib/rexml/xmltokens.rb28
-rw-r--r--lib/rexml/xpath.rb130
-rw-r--r--lib/rexml/xpath_parser.rb186
-rw-r--r--lib/rinda/rinda.rb18
-rw-r--r--lib/rinda/ring.rb90
-rw-r--r--lib/rinda/tuplespace.rb112
-rw-r--r--lib/rss.rb85
-rw-r--r--lib/rss/0.9.rb63
-rw-r--r--lib/rss/1.0.rb61
-rw-r--r--lib/rss/2.0.rb8
-rw-r--r--lib/rss/atom.rb756
-rw-r--r--lib/rss/content.rb25
-rw-r--r--lib/rss/content/1.0.rb9
-rw-r--r--lib/rss/content/2.0.rb11
-rw-r--r--lib/rss/converter.rb44
-rw-r--r--lib/rss/dublincore.rb55
-rw-r--r--lib/rss/dublincore/1.0.rb12
-rw-r--r--lib/rss/dublincore/2.0.rb12
-rw-r--r--lib/rss/dublincore/atom.rb16
-rw-r--r--lib/rss/image.rb28
-rw-r--r--lib/rss/itunes.rb410
-rw-r--r--lib/rss/maker.rb39
-rw-r--r--lib/rss/maker/0.9.rb450
-rw-r--r--lib/rss/maker/1.0.rb343
-rw-r--r--lib/rss/maker/2.0.rb169
-rw-r--r--lib/rss/maker/atom.rb172
-rw-r--r--lib/rss/maker/base.rb966
-rw-r--r--lib/rss/maker/content.rb14
-rw-r--r--lib/rss/maker/dublincore.rb150
-rw-r--r--lib/rss/maker/entry.rb163
-rw-r--r--lib/rss/maker/feed.rb426
-rw-r--r--lib/rss/maker/image.rb118
-rw-r--r--lib/rss/maker/itunes.rb242
-rw-r--r--lib/rss/maker/slash.rb33
-rw-r--r--lib/rss/maker/syndication.rb13
-rw-r--r--lib/rss/maker/taxonomy.rb126
-rw-r--r--lib/rss/maker/trackback.rb117
-rw-r--r--lib/rss/parser.rb224
-rw-r--r--lib/rss/rexmlparser.rb10
-rw-r--r--lib/rss/rss.rb787
-rw-r--r--lib/rss/slash.rb49
-rw-r--r--lib/rss/syndication.rb15
-rw-r--r--lib/rss/taxonomy.rb20
-rw-r--r--lib/rss/trackback.rb36
-rw-r--r--lib/rss/utils.rb82
-rw-r--r--lib/rss/xml-stylesheet.rb8
-rw-r--r--lib/rss/xml.rb71
-rw-r--r--lib/rss/xmlparser.rb14
-rw-r--r--lib/rss/xmlscanner.rb10
-rw-r--r--lib/rubygems.rb1305
-rw-r--r--lib/rubygems/builder.rb99
-rw-r--r--lib/rubygems/command.rb536
-rw-r--r--lib/rubygems/command_manager.rb194
-rw-r--r--lib/rubygems/commands/build_command.rb59
-rw-r--r--lib/rubygems/commands/cert_command.rb86
-rw-r--r--lib/rubygems/commands/check_command.rb65
-rw-r--r--lib/rubygems/commands/cleanup_command.rb100
-rw-r--r--lib/rubygems/commands/contents_command.rb101
-rw-r--r--lib/rubygems/commands/dependency_command.rb160
-rw-r--r--lib/rubygems/commands/environment_command.rb130
-rw-r--r--lib/rubygems/commands/fetch_command.rb78
-rw-r--r--lib/rubygems/commands/generate_index_command.rb124
-rw-r--r--lib/rubygems/commands/help_command.rb167
-rw-r--r--lib/rubygems/commands/install_command.rb165
-rw-r--r--lib/rubygems/commands/list_command.rb35
-rw-r--r--lib/rubygems/commands/lock_command.rb110
-rw-r--r--lib/rubygems/commands/outdated_command.rb30
-rw-r--r--lib/rubygems/commands/owner_command.rb76
-rw-r--r--lib/rubygems/commands/pristine_command.rb110
-rw-r--r--lib/rubygems/commands/push_command.rb60
-rw-r--r--lib/rubygems/commands/query_command.rb263
-rw-r--r--lib/rubygems/commands/rdoc_command.rb91
-rw-r--r--lib/rubygems/commands/search_command.rb31
-rw-r--r--lib/rubygems/commands/server_command.rb86
-rw-r--r--lib/rubygems/commands/setup_command.rb358
-rw-r--r--lib/rubygems/commands/sources_command.rb136
-rw-r--r--lib/rubygems/commands/specification_command.rb131
-rw-r--r--lib/rubygems/commands/stale_command.rb28
-rw-r--r--lib/rubygems/commands/uninstall_command.rb94
-rw-r--r--lib/rubygems/commands/unpack_command.rb160
-rw-r--r--lib/rubygems/commands/update_command.rb232
-rw-r--r--lib/rubygems/commands/which_command.rb82
-rw-r--r--lib/rubygems/config_file.rb375
-rw-r--r--lib/rubygems/custom_require.rb69
-rw-r--r--lib/rubygems/defaults.rb124
-rw-r--r--lib/rubygems/dependency.rb260
-rw-r--r--lib/rubygems/dependency_installer.rb304
-rw-r--r--lib/rubygems/dependency_list.rb252
-rw-r--r--lib/rubygems/deprecate.rb70
-rw-r--r--lib/rubygems/doc_manager.rb243
-rw-r--r--lib/rubygems/errors.rb35
-rw-r--r--lib/rubygems/exceptions.rb91
-rw-r--r--lib/rubygems/ext.rb18
-rw-r--r--lib/rubygems/ext/builder.rb56
-rw-r--r--lib/rubygems/ext/configure_builder.rb25
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb24
-rw-r--r--lib/rubygems/ext/rake_builder.rb39
-rw-r--r--lib/rubygems/format.rb82
-rw-r--r--lib/rubygems/gem_openssl.rb90
-rw-r--r--lib/rubygems/gem_path_searcher.rb172
-rw-r--r--lib/rubygems/gem_runner.rb86
-rw-r--r--lib/rubygems/gemcutter_utilities.rb82
-rw-r--r--lib/rubygems/indexer.rb644
-rw-r--r--lib/rubygems/install_update_options.rb128
-rw-r--r--lib/rubygems/installer.rb626
-rw-r--r--lib/rubygems/installer_test_case.rb144
-rw-r--r--lib/rubygems/local_remote_options.rb148
-rw-r--r--lib/rubygems/mock_gem_ui.rb71
-rw-r--r--lib/rubygems/old_format.rb153
-rw-r--r--lib/rubygems/package.rb83
-rw-r--r--lib/rubygems/package/f_sync_dir.rb23
-rw-r--r--lib/rubygems/package/tar_header.rb266
-rw-r--r--lib/rubygems/package/tar_input.rb235
-rw-r--r--lib/rubygems/package/tar_output.rb146
-rw-r--r--lib/rubygems/package/tar_reader.rb106
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb145
-rw-r--r--lib/rubygems/package/tar_test_case.rb137
-rw-r--r--lib/rubygems/package/tar_writer.rb241
-rw-r--r--lib/rubygems/package_task.rb126
-rw-r--r--lib/rubygems/path_support.rb70
-rw-r--r--lib/rubygems/platform.rb194
-rw-r--r--lib/rubygems/psych_additions.rb18
-rw-r--r--lib/rubygems/psych_tree.rb54
-rw-r--r--lib/rubygems/remote_fetcher.rb507
-rw-r--r--lib/rubygems/require_paths_builder.rb18
-rw-r--r--lib/rubygems/requirement.rb204
-rw-r--r--lib/rubygems/security.rb826
-rw-r--r--lib/rubygems/server.rb832
-rw-r--r--lib/rubygems/source_index.rb406
-rw-r--r--lib/rubygems/spec_fetcher.rb297
-rw-r--r--lib/rubygems/specification.rb2171
-rw-r--r--lib/rubygems/ssl_certs/ca-bundle.pem3366
-rw-r--r--lib/rubygems/syck_hack.rb145
-rw-r--r--lib/rubygems/test_case.rb870
-rw-r--r--lib/rubygems/test_utilities.rb160
-rw-r--r--lib/rubygems/text.rb65
-rw-r--r--lib/rubygems/uninstaller.rb271
-rw-r--r--lib/rubygems/user_interaction.rb562
-rw-r--r--lib/rubygems/validator.rb169
-rw-r--r--lib/rubygems/version.rb329
-rw-r--r--lib/rubygems/version_option.rb65
-rw-r--r--lib/rubyunit.rb6
-rw-r--r--lib/runit/assert.rb73
-rw-r--r--lib/runit/cui/testrunner.rb51
-rw-r--r--lib/runit/error.rb9
-rw-r--r--lib/runit/testcase.rb45
-rw-r--r--lib/runit/testresult.rb44
-rw-r--r--lib/runit/testsuite.rb26
-rw-r--r--lib/runit/topublic.rb8
-rw-r--r--lib/scanf.rb781
-rw-r--r--lib/securerandom.rb265
-rw-r--r--[-rwxr-xr-x]lib/set.rb556
-rw-r--r--lib/shell.rb153
-rw-r--r--lib/shell/builtin-command.rb68
-rw-r--r--lib/shell/command-processor.rb537
-rw-r--r--lib/shell/error.rb11
-rw-r--r--lib/shell/filter.rb55
-rw-r--r--lib/shell/process-controller.rb351
-rw-r--r--lib/shell/system-command.rb145
-rw-r--r--lib/shell/version.rb13
-rw-r--r--lib/shellwords.rb173
-rw-r--r--lib/singleton.rb420
-rw-r--r--lib/soap/attachment.rb107
-rw-r--r--lib/soap/baseData.rb942
-rw-r--r--lib/soap/element.rb258
-rw-r--r--lib/soap/encodingstyle/aspDotNetHandler.rb213
-rw-r--r--lib/soap/encodingstyle/handler.rb100
-rw-r--r--lib/soap/encodingstyle/literalHandler.rb226
-rw-r--r--lib/soap/encodingstyle/soapHandler.rb582
-rw-r--r--lib/soap/generator.rb268
-rw-r--r--lib/soap/header/handler.rb57
-rw-r--r--lib/soap/header/handlerset.rb70
-rw-r--r--lib/soap/header/simplehandler.rb44
-rw-r--r--lib/soap/httpconfigloader.rb119
-rw-r--r--lib/soap/mapping.rb10
-rw-r--r--lib/soap/mapping/factory.rb355
-rw-r--r--lib/soap/mapping/mapping.rb381
-rw-r--r--lib/soap/mapping/registry.rb541
-rw-r--r--lib/soap/mapping/rubytypeFactory.rb475
-rw-r--r--lib/soap/mapping/typeMap.rb50
-rw-r--r--lib/soap/mapping/wsdlencodedregistry.rb280
-rw-r--r--lib/soap/mapping/wsdlliteralregistry.rb418
-rw-r--r--lib/soap/marshal.rb59
-rw-r--r--lib/soap/mimemessage.rb240
-rw-r--r--lib/soap/netHttpClient.rb190
-rw-r--r--lib/soap/parser.rb251
-rw-r--r--lib/soap/processor.rb66
-rw-r--r--lib/soap/property.rb333
-rw-r--r--lib/soap/rpc/cgistub.rb206
-rw-r--r--lib/soap/rpc/driver.rb254
-rw-r--r--lib/soap/rpc/element.rb325
-rw-r--r--lib/soap/rpc/httpserver.rb129
-rw-r--r--lib/soap/rpc/proxy.rb497
-rw-r--r--lib/soap/rpc/router.rb594
-rw-r--r--lib/soap/rpc/rpc.rb25
-rw-r--r--lib/soap/rpc/soaplet.rb162
-rw-r--r--lib/soap/rpc/standaloneServer.rb43
-rw-r--r--lib/soap/soap.rb140
-rw-r--r--lib/soap/streamHandler.rb229
-rw-r--r--lib/soap/wsdlDriver.rb575
-rw-r--r--lib/sync.rb328
-rw-r--r--lib/tempfile.rb368
-rw-r--r--lib/test/unit.rb902
-rw-r--r--lib/test/unit/assertionfailederror.rb14
-rw-r--r--lib/test/unit/assertions.rb780
-rw-r--r--lib/test/unit/autorunner.rb204
-rw-r--r--lib/test/unit/collector.rb43
-rw-r--r--lib/test/unit/collector/dir.rb92
-rw-r--r--lib/test/unit/collector/objectspace.rb34
-rw-r--r--lib/test/unit/error.rb56
-rw-r--r--lib/test/unit/failure.rb51
-rw-r--r--lib/test/unit/parallel.rb161
-rw-r--r--lib/test/unit/testcase.rb147
-rw-r--r--lib/test/unit/testresult.rb80
-rw-r--r--lib/test/unit/testsuite.rb76
-rw-r--r--lib/test/unit/ui/console/testrunner.rb127
-rw-r--r--lib/test/unit/ui/fox/testrunner.rb268
-rw-r--r--lib/test/unit/ui/gtk/testrunner.rb416
-rw-r--r--lib/test/unit/ui/gtk2/testrunner.rb465
-rw-r--r--lib/test/unit/ui/testrunnermediator.rb68
-rw-r--r--lib/test/unit/ui/testrunnerutilities.rb46
-rw-r--r--lib/test/unit/ui/tk/testrunner.rb260
-rw-r--r--lib/test/unit/util/backtracefilter.rb40
-rw-r--r--lib/test/unit/util/observable.rb90
-rw-r--r--lib/test/unit/util/procwrapper.rb48
-rw-r--r--lib/thread.rb315
-rw-r--r--lib/thwait.rb95
-rw-r--r--lib/time.rb514
-rw-r--r--lib/timeout.rb152
-rw-r--r--lib/tmpdir.rb148
-rw-r--r--lib/tracer.rb247
-rw-r--r--lib/tsort.rb68
-rw-r--r--lib/ubygems.rb10
-rw-r--r--lib/un.rb203
-rw-r--r--lib/uri.rb95
-rw-r--r--lib/uri/common.rb858
-rw-r--r--lib/uri/ftp.rb170
-rw-r--r--lib/uri/generic.rb813
-rw-r--r--lib/uri/http.rb69
-rw-r--r--lib/uri/https.rb10
-rw-r--r--lib/uri/ldap.rb80
-rw-r--r--lib/uri/ldaps.rb20
-rw-r--r--lib/uri/mailto.rb89
-rw-r--r--lib/weakref.rb100
-rw-r--r--lib/webrick.rb202
-rw-r--r--lib/webrick/accesslog.rb94
-rw-r--r--lib/webrick/cgi.rb57
-rw-r--r--lib/webrick/compat.rb20
-rw-r--r--lib/webrick/config.rb32
-rw-r--r--lib/webrick/cookie.rb6
-rw-r--r--lib/webrick/htmlutils.rb5
-rw-r--r--lib/webrick/httpauth.rb56
-rw-r--r--lib/webrick/httpauth/authenticator.rb49
-rw-r--r--lib/webrick/httpauth/basicauth.rb45
-rw-r--r--lib/webrick/httpauth/digestauth.rb75
-rw-r--r--lib/webrick/httpauth/htdigest.rb39
-rw-r--r--lib/webrick/httpauth/htgroup.rb32
-rw-r--r--lib/webrick/httpauth/htpasswd.rb42
-rw-r--r--lib/webrick/httpauth/userdb.rb31
-rw-r--r--lib/webrick/httpproxy.rb269
-rw-r--r--lib/webrick/httprequest.rb178
-rw-r--r--lib/webrick/httpresponse.rb120
-rw-r--r--lib/webrick/https.rb5
-rw-r--r--lib/webrick/httpserver.rb66
-rw-r--r--lib/webrick/httpservlet/abstract.rb92
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb5
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb40
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb47
-rw-r--r--lib/webrick/httpservlet/filehandler.rb59
-rw-r--r--lib/webrick/httpservlet/prochandler.rb8
-rw-r--r--lib/webrick/httpstatus.rb172
-rw-r--r--lib/webrick/httputils.rb41
-rw-r--r--lib/webrick/httpversion.rb2
-rw-r--r--lib/webrick/log.rb56
-rw-r--r--lib/webrick/server.rb28
-rw-r--r--lib/webrick/ssl.rb13
-rw-r--r--lib/webrick/utils.rb151
-rw-r--r--lib/webrick/version.rb2
-rw-r--r--lib/wsdl/binding.rb65
-rw-r--r--lib/wsdl/data.rb64
-rw-r--r--lib/wsdl/definitions.rb250
-rw-r--r--lib/wsdl/documentation.rb32
-rw-r--r--lib/wsdl/import.rb80
-rw-r--r--lib/wsdl/importer.rb38
-rw-r--r--lib/wsdl/info.rb39
-rw-r--r--lib/wsdl/message.rb54
-rw-r--r--lib/wsdl/operation.rb130
-rw-r--r--lib/wsdl/operationBinding.rb108
-rw-r--r--lib/wsdl/param.rb85
-rw-r--r--lib/wsdl/parser.rb163
-rw-r--r--lib/wsdl/part.rb52
-rw-r--r--lib/wsdl/port.rb84
-rw-r--r--lib/wsdl/portType.rb73
-rw-r--r--lib/wsdl/service.rb61
-rw-r--r--lib/wsdl/soap/address.rb40
-rw-r--r--lib/wsdl/soap/binding.rb49
-rw-r--r--lib/wsdl/soap/body.rb56
-rw-r--r--lib/wsdl/soap/cgiStubCreator.rb76
-rw-r--r--lib/wsdl/soap/classDefCreator.rb314
-rw-r--r--lib/wsdl/soap/classDefCreatorSupport.rb126
-rw-r--r--lib/wsdl/soap/clientSkeltonCreator.rb78
-rw-r--r--lib/wsdl/soap/complexType.rb161
-rw-r--r--lib/wsdl/soap/data.rb42
-rw-r--r--lib/wsdl/soap/definitions.rb149
-rw-r--r--lib/wsdl/soap/driverCreator.rb95
-rw-r--r--lib/wsdl/soap/element.rb28
-rw-r--r--lib/wsdl/soap/fault.rb56
-rw-r--r--lib/wsdl/soap/header.rb86
-rw-r--r--lib/wsdl/soap/headerfault.rb56
-rw-r--r--lib/wsdl/soap/mappingRegistryCreator.rb92
-rw-r--r--lib/wsdl/soap/methodDefCreator.rb228
-rw-r--r--lib/wsdl/soap/operation.rb122
-rw-r--r--lib/wsdl/soap/servantSkeltonCreator.rb67
-rw-r--r--lib/wsdl/soap/standaloneServerStubCreator.rb85
-rw-r--r--lib/wsdl/soap/wsdl2ruby.rb176
-rw-r--r--lib/wsdl/types.rb43
-rw-r--r--lib/wsdl/wsdl.rb23
-rw-r--r--lib/wsdl/xmlSchema/all.rb69
-rw-r--r--lib/wsdl/xmlSchema/annotation.rb34
-rw-r--r--lib/wsdl/xmlSchema/any.rb56
-rw-r--r--lib/wsdl/xmlSchema/attribute.rb127
-rw-r--r--lib/wsdl/xmlSchema/choice.rb69
-rw-r--r--lib/wsdl/xmlSchema/complexContent.rb92
-rw-r--r--lib/wsdl/xmlSchema/complexType.rb139
-rw-r--r--lib/wsdl/xmlSchema/content.rb96
-rw-r--r--lib/wsdl/xmlSchema/data.rb80
-rw-r--r--lib/wsdl/xmlSchema/element.rb154
-rw-r--r--lib/wsdl/xmlSchema/enumeration.rb36
-rw-r--r--lib/wsdl/xmlSchema/import.rb65
-rw-r--r--lib/wsdl/xmlSchema/importer.rb87
-rw-r--r--lib/wsdl/xmlSchema/include.rb54
-rw-r--r--lib/wsdl/xmlSchema/length.rb35
-rw-r--r--lib/wsdl/xmlSchema/parser.rb166
-rw-r--r--lib/wsdl/xmlSchema/pattern.rb36
-rw-r--r--lib/wsdl/xmlSchema/schema.rb143
-rw-r--r--lib/wsdl/xmlSchema/sequence.rb69
-rw-r--r--lib/wsdl/xmlSchema/simpleContent.rb65
-rw-r--r--lib/wsdl/xmlSchema/simpleExtension.rb54
-rw-r--r--lib/wsdl/xmlSchema/simpleRestriction.rb73
-rw-r--r--lib/wsdl/xmlSchema/simpleType.rb73
-rw-r--r--lib/wsdl/xmlSchema/unique.rb34
-rw-r--r--lib/wsdl/xmlSchema/xsd2ruby.rb107
-rw-r--r--lib/xmlrpc/.document1
-rw-r--r--lib/xmlrpc/README.rdoc300
-rw-r--r--lib/xmlrpc/base64.rb24
-rw-r--r--lib/xmlrpc/client.rb177
-rw-r--r--lib/xmlrpc/config.rb10
-rw-r--r--lib/xmlrpc/create.rb203
-rw-r--r--lib/xmlrpc/datetime.rb22
-rw-r--r--lib/xmlrpc/httpserver.rb50
-rw-r--r--lib/xmlrpc/marshal.rb8
-rw-r--r--lib/xmlrpc/parser.rb435
-rw-r--r--lib/xmlrpc/server.rb212
-rw-r--r--lib/xmlrpc/utils.rb36
-rw-r--r--lib/xsd/charset.rb187
-rw-r--r--lib/xsd/codegen.rb12
-rw-r--r--lib/xsd/codegen/classdef.rb203
-rw-r--r--lib/xsd/codegen/commentdef.rb34
-rw-r--r--lib/xsd/codegen/gensupport.rb166
-rw-r--r--lib/xsd/codegen/methoddef.rb63
-rw-r--r--lib/xsd/codegen/moduledef.rb191
-rw-r--r--lib/xsd/datatypes.rb1269
-rw-r--r--lib/xsd/datatypes1999.rb20
-rw-r--r--lib/xsd/iconvcharset.rb33
-rw-r--r--lib/xsd/mapping.rb42
-rw-r--r--lib/xsd/namedelements.rb95
-rw-r--r--lib/xsd/ns.rb140
-rw-r--r--lib/xsd/qname.rb78
-rw-r--r--lib/xsd/xmlparser.rb61
-rw-r--r--lib/xsd/xmlparser/parser.rb96
-rw-r--r--lib/xsd/xmlparser/rexmlparser.rb54
-rw-r--r--lib/xsd/xmlparser/xmlparser.rb50
-rw-r--r--lib/xsd/xmlparser/xmlscanner.rb147
-rw-r--r--lib/yaml.rb478
-rw-r--r--lib/yaml/baseemitter.rb247
-rw-r--r--lib/yaml/basenode.rb216
-rw-r--r--lib/yaml/constants.rb45
-rw-r--r--lib/yaml/dbm.rb129
-rw-r--r--lib/yaml/encoding.rb33
-rw-r--r--lib/yaml/error.rb34
-rw-r--r--lib/yaml/loader.rb14
-rw-r--r--lib/yaml/rubytypes.rb408
-rw-r--r--lib/yaml/store.rb65
-rw-r--r--lib/yaml/stream.rb40
-rw-r--r--lib/yaml/stringio.rb83
-rw-r--r--lib/yaml/syck.rb19
-rw-r--r--lib/yaml/tag.rb91
-rw-r--r--lib/yaml/types.rb194
-rw-r--r--lib/yaml/yamlnode.rb54
-rw-r--r--lib/yaml/ypath.rb52
-rw-r--r--load.c792
-rw-r--r--main.c48
-rw-r--r--man/erb.1157
-rw-r--r--man/goruby.139
-rw-r--r--man/irb.1173
-rw-r--r--man/rake.1169
-rw-r--r--man/ri.1180
-rw-r--r--man/ruby.1511
-rw-r--r--marshal.c1317
-rw-r--r--math.c664
-rwxr-xr-xmdoc2man.rb465
-rw-r--r--method.h105
-rw-r--r--misc/README7
-rw-r--r--misc/inf-ruby.el247
-rw-r--r--misc/rb_optparse.bash20
-rwxr-xr-xmisc/rb_optparse.zsh38
-rw-r--r--misc/rdebug.el136
-rw-r--r--misc/rdoc-mode.el130
-rw-r--r--misc/ruby-electric.el95
-rw-r--r--misc/ruby-mode.el1807
-rw-r--r--misc/ruby-style.el78
-rw-r--r--misc/rubydb3x.el42
-rw-r--r--missing.h142
-rw-r--r--missing/acosh.c21
-rw-r--r--missing/alloca.c9
-rw-r--r--missing/cbrt.c11
-rw-r--r--missing/close.c72
-rw-r--r--missing/crypt.c123
-rw-r--r--missing/dup2.c5
-rw-r--r--missing/erf.c13
-rw-r--r--missing/ffs.c49
-rw-r--r--missing/finite.c5
-rw-r--r--missing/flock.c23
-rw-r--r--missing/hypot.c4
-rw-r--r--missing/isinf.c24
-rw-r--r--missing/isnan.c10
-rw-r--r--missing/langinfo.c148
-rw-r--r--missing/lgamma_r.c80
-rw-r--r--missing/memcmp.c10
-rw-r--r--missing/memmove.c18
-rw-r--r--missing/os2.c29
-rw-r--r--missing/setproctitle.c166
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/strcasecmp.c16
-rw-r--r--missing/strchr.c22
-rw-r--r--missing/strerror.c5
-rw-r--r--missing/strftime.c907
-rw-r--r--missing/strlcat.c74
-rw-r--r--missing/strlcpy.c70
-rw-r--r--missing/strncasecmp.c21
-rw-r--r--missing/strstr.c15
-rw-r--r--missing/strtod.c271
-rw-r--r--missing/strtol.c10
-rw-r--r--missing/strtoul.c184
-rw-r--r--missing/tgamma.c92
-rw-r--r--missing/vsnprintf.c1135
-rw-r--r--missing/x68.c40
-rw-r--r--missing/x86_64-chkstk.s10
-rw-r--r--mkconfig.rb164
-rw-r--r--node.c921
-rw-r--r--node.h293
-rw-r--r--numeric.c2562
-rw-r--r--object.c2325
-rw-r--r--pack.c1900
-rw-r--r--parse.y8798
-rw-r--r--prec.c141
-rw-r--r--prelude.rb31
-rw-r--r--proc.c2258
-rw-r--r--process.c4500
-rw-r--r--random.c1346
-rw-r--r--range.c910
-rw-r--r--rational.c2409
-rw-r--r--re.c3542
-rw-r--r--re.h42
-rw-r--r--regcomp.c6322
-rw-r--r--regenc.c933
-rw-r--r--regenc.h219
-rw-r--r--regerror.c397
-rw-r--r--regex.c4657
-rw-r--r--regex.h221
-rw-r--r--regexec.c3827
-rw-r--r--regint.h850
-rw-r--r--regparse.c5686
-rw-r--r--regparse.h362
-rw-r--r--regsyntax.c315
-rw-r--r--ruby.1351
-rw-r--r--ruby.c1898
-rw-r--r--ruby.h734
-rw-r--r--ruby_atomic.h115
-rw-r--r--rubyio.h88
-rw-r--r--rubysig.h105
-rw-r--r--rubytest.rb49
-rwxr-xr-xrunruby.rb59
-rw-r--r--safe.c135
-rw-r--r--sample/README13
-rw-r--r--sample/biorhythm.rb136
-rw-r--r--sample/cal.rb84
-rw-r--r--sample/cbreak.rb4
-rw-r--r--sample/coverage.rb62
-rw-r--r--sample/dbmtest.rb14
-rw-r--r--sample/drb/darray.rb2
-rw-r--r--sample/drb/darrayc.rb16
-rw-r--r--sample/drb/dbiff.rb4
-rw-r--r--sample/drb/dchatc.rb4
-rw-r--r--sample/drb/dchats.rb2
-rw-r--r--sample/drb/dhasen.rb4
-rw-r--r--sample/drb/dhasenc.rb3
-rw-r--r--sample/drb/dlogc.rb2
-rw-r--r--sample/drb/dlogd.rb2
-rw-r--r--sample/drb/dqin.rb2
-rw-r--r--sample/drb/dqout.rb2
-rw-r--r--sample/drb/dqueue.rb2
-rw-r--r--sample/drb/drbc.rb2
-rw-r--r--sample/drb/drbch.rb2
-rw-r--r--sample/drb/drbm.rb6
-rw-r--r--sample/drb/drbmc.rb2
-rw-r--r--sample/drb/drbs-acl.rb6
-rw-r--r--sample/drb/drbs.rb4
-rw-r--r--sample/drb/extserv_test.rb12
-rw-r--r--sample/drb/holderc.rb2
-rw-r--r--sample/drb/holders.rb6
-rw-r--r--sample/drb/http0.rb6
-rw-r--r--sample/drb/http0serv.rb12
-rw-r--r--sample/drb/name.rb16
-rw-r--r--sample/drb/namec.rb2
-rw-r--r--sample/drb/old_tuplespace.rb6
-rw-r--r--sample/drb/ring_echo.rb2
-rw-r--r--sample/drb/simpletuple.rb6
-rw-r--r--sample/drb/speedc.rb2
-rw-r--r--sample/drb/speeds.rb4
-rw-r--r--sample/dualstack-httpd.rb4
-rw-r--r--sample/eval.rb2
-rw-r--r--sample/exyacc.rb32
-rw-r--r--sample/from.rb161
-rw-r--r--sample/fullpath.rb2
-rw-r--r--sample/getopts.test36
-rw-r--r--sample/goodfriday.rb48
-rw-r--r--sample/list.rb1
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb2
-rw-r--r--sample/mine.rb1
-rw-r--r--sample/mkproto.rb6
-rw-r--r--sample/mrshtest.rb13
-rw-r--r--sample/occur.rb4
-rw-r--r--sample/occur2.rb11
-rw-r--r--sample/openssl/c_rehash.rb4
-rw-r--r--sample/openssl/cert_store_view.rb911
-rw-r--r--sample/openssl/certstore.rb2
-rw-r--r--sample/openssl/cipher.rb73
-rw-r--r--sample/openssl/echo_cli.rb21
-rw-r--r--sample/openssl/echo_svr.rb15
-rw-r--r--sample/openssl/gen_csr.rb13
-rw-r--r--sample/openssl/smime_read.rb10
-rw-r--r--sample/openssl/smime_write.rb12
-rw-r--r--sample/openssl/wget.rb17
-rw-r--r--[-rwxr-xr-x]sample/optparse/opttest.rb30
-rw-r--r--sample/philos.rb2
-rw-r--r--sample/pty/expect_sample.rb48
-rw-r--r--sample/pty/script.rb37
-rw-r--r--sample/rdoc/markup/rdoc2latex.rb15
-rw-r--r--sample/rdoc/markup/sample.rb40
-rw-r--r--sample/regx.rb23
-rw-r--r--sample/ripper/ruby2html.rb112
-rw-r--r--sample/ripper/strip-comment.rb19
-rwxr-xr-xsample/rss/blend.rb6
-rwxr-xr-xsample/rss/convert.rb2
-rw-r--r--[-rwxr-xr-x]sample/rss/list_description.rb17
-rwxr-xr-xsample/rss/re_read.rb14
-rw-r--r--[-rwxr-xr-x]sample/rss/rss_recent.rb24
-rw-r--r--sample/svr.rb4
-rw-r--r--sample/test.rb829
-rw-r--r--sample/time.rb16
-rw-r--r--sample/timeout.rb42
-rw-r--r--sample/trojan.rb2
-rw-r--r--sample/tsvr.rb2
-rw-r--r--sample/webrick/httpproxy.rb7
-rw-r--r--signal.c1038
-rw-r--r--siphash.c483
-rw-r--r--siphash.h48
-rw-r--r--sparc.c30
-rw-r--r--spec/README31
-rw-r--r--spec/default.mspec21
-rw-r--r--sprintf.c985
-rw-r--r--st.c1229
-rw-r--r--st.h72
-rw-r--r--strftime.c1145
-rw-r--r--string.c7303
-rw-r--r--struct.c712
-rw-r--r--symbian/README.SYMBIAN93
-rw-r--r--symbian/configure.bat123
-rw-r--r--symbian/missing-aeabi.c18
-rw-r--r--symbian/missing-pips.c65
-rw-r--r--symbian/pre-build83
-rw-r--r--symbian/setup440
-rw-r--r--template/Doxyfile.tmpl267
-rw-r--r--template/encdb.h.tmpl83
-rwxr-xr-xtemplate/fake.rb.in47
-rw-r--r--template/id.h.tmpl143
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/known_errors.inc.tmpl14
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/ruby.pc.in44
-rw-r--r--template/transdb.h.tmpl59
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yarvarch.en7
-rw-r--r--template/yarvarch.ja454
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/array/test_resize.rb29
-rw-r--r--test/-ext-/funcall/test_passing_block.rb22
-rw-r--r--test/-ext-/load/test_dot_dot.rb10
-rw-r--r--test/-ext-/old_thread_select/test_old_thread_select.rb99
-rw-r--r--test/-ext-/st/test_numhash.rb21
-rw-r--r--test/-ext-/string/test_cstr.rb17
-rw-r--r--test/-ext-/string/test_ellipsize.rb46
-rw-r--r--test/-ext-/string/test_enc_associate.rb12
-rw-r--r--test/-ext-/string/test_modify_expand.rb29
-rw-r--r--test/-ext-/string/test_set_len.rb25
-rw-r--r--test/-ext-/test_bug-3571.rb21
-rw-r--r--test/-ext-/test_bug-3662.rb10
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb42
-rw-r--r--test/-ext-/win32/test_dln.rb13
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb99
-rw-r--r--test/benchmark/test_benchmark.rb163
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1350
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb43
-rw-r--r--test/bigdecimal/test_bigmath.rb63
-rw-r--r--test/bigdecimal/testbase.rb27
-rw-r--r--test/cgi/test_cgi_cookie.rb110
-rw-r--r--test/cgi/test_cgi_core.rb363
-rw-r--r--test/cgi/test_cgi_header.rb185
-rw-r--r--test/cgi/test_cgi_modruby.rb145
-rw-r--r--test/cgi/test_cgi_multipart.rb325
-rw-r--r--test/cgi/test_cgi_session.rb172
-rw-r--r--test/cgi/test_cgi_tag_helper.rb341
-rw-r--r--test/cgi/test_cgi_util.rb38
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin156414 -> 0 bytes-rw-r--r--test/cgi/testdata/small.pngbin82 -> 0 bytes-rw-r--r--test/coverage/test_coverage.rb64
-rw-r--r--test/csv/base.rb8
-rw-r--r--test/csv/line_endings.gzbin59 -> 0 bytes-rw-r--r--test/csv/test_csv.rb1753
-rwxr-xr-xtest/csv/test_csv_parsing.rb221
-rwxr-xr-xtest/csv/test_csv_writing.rb97
-rwxr-xr-xtest/csv/test_data_converters.rb263
-rwxr-xr-xtest/csv/test_encodings.rb339
-rwxr-xr-xtest/csv/test_features.rb274
-rwxr-xr-xtest/csv/test_headers.rb289
-rwxr-xr-xtest/csv/test_interface.rb337
-rwxr-xr-xtest/csv/test_row.rb313
-rwxr-xr-xtest/csv/test_serialization.rb158
-rwxr-xr-xtest/csv/test_table.rb420
-rw-r--r--test/csv/ts_all.rb21
-rw-r--r--test/date/test_date.rb144
-rw-r--r--test/date/test_date_arith.rb286
-rw-r--r--test/date/test_date_attr.rb112
-rw-r--r--test/date/test_date_base.rb442
-rw-r--r--test/date/test_date_compat.rb21
-rw-r--r--test/date/test_date_conv.rb137
-rw-r--r--test/date/test_date_marshal.rb29
-rw-r--r--test/date/test_date_new.rb271
-rw-r--r--test/date/test_date_parse.rb1097
-rw-r--r--test/date/test_date_strftime.rb401
-rw-r--r--test/date/test_date_strptime.rb486
-rw-r--r--test/date/test_switch_hitter.rb577
-rw-r--r--test/dbm/test_dbm.rb139
-rw-r--r--[-rwxr-xr-x]test/digest/test_digest.rb70
-rw-r--r--test/digest/test_digest_extend.rb157
-rw-r--r--test/digest/test_digest_hmac.rb2
-rw-r--r--test/dl/test_base.rb130
-rw-r--r--test/dl/test_callback.rb69
-rw-r--r--test/dl/test_cfunc.rb80
-rw-r--r--test/dl/test_cparser.rb13
-rw-r--r--test/dl/test_cptr.rb222
-rw-r--r--test/dl/test_dl2.rb155
-rw-r--r--test/dl/test_func.rb184
-rw-r--r--test/dl/test_handle.rb184
-rw-r--r--test/dl/test_import.rb164
-rw-r--r--test/dl/test_win32.rb54
-rw-r--r--test/drb/drbtest.rb94
-rw-r--r--test/drb/test_acl.rb2
-rw-r--r--test/drb/test_drb.rb59
-rw-r--r--test/drb/test_drbssl.rb8
-rw-r--r--test/drb/test_drbunix.rb8
-rw-r--r--test/drb/ut_eq.rb30
-rw-r--r--test/drb/ut_large.rb2
-rw-r--r--test/drb/ut_safe1.rb2
-rw-r--r--test/drb/ut_timerholder.rb2
-rw-r--r--test/erb/hello.erb4
-rw-r--r--test/erb/test_erb.rb430
-rw-r--r--test/erb/test_erb_m17n.rb123
-rw-r--r--test/etc/test_etc.rb110
-rw-r--r--test/fiddle/helper.rb111
-rw-r--r--test/fiddle/test_closure.rb84
-rw-r--r--test/fiddle/test_fiddle.rb32
-rw-r--r--test/fiddle/test_function.rb69
-rw-r--r--test/fileutils/clobber.rb91
-rw-r--r--test/fileutils/fileasserts.rb74
-rw-r--r--test/fileutils/test_dryrun.rb8
-rw-r--r--test/fileutils/test_fileutils.rb279
-rw-r--r--test/fileutils/test_nowrite.rb79
-rw-r--r--test/fileutils/test_verbose.rb2
-rw-r--r--test/gdbm/test_gdbm.rb168
-rw-r--r--test/iconv/test_basic.rb59
-rw-r--r--test/iconv/test_option.rb43
-rw-r--r--test/iconv/test_partial.rb41
-rw-r--r--test/iconv/utils.rb29
-rw-r--r--test/inlinetest.rb55
-rw-r--r--test/io/console/test_io_console.rb243
-rw-r--r--test/io/nonblock/test_flush.rb42
-rw-r--r--test/io/wait/test_io_wait.rb72
-rw-r--r--test/irb/test_completion.rb22
-rw-r--r--test/irb/test_option.rb12
-rw-r--r--test/json/fixtures/fail1.json1
-rw-r--r--test/json/fixtures/fail10.json1
-rw-r--r--test/json/fixtures/fail11.json1
-rw-r--r--test/json/fixtures/fail12.json1
-rw-r--r--test/json/fixtures/fail13.json1
-rw-r--r--test/json/fixtures/fail14.json1
-rw-r--r--test/json/fixtures/fail18.json1
-rw-r--r--test/json/fixtures/fail19.json1
-rw-r--r--test/json/fixtures/fail2.json1
-rw-r--r--test/json/fixtures/fail20.json1
-rw-r--r--test/json/fixtures/fail21.json1
-rw-r--r--test/json/fixtures/fail22.json1
-rw-r--r--test/json/fixtures/fail23.json1
-rw-r--r--test/json/fixtures/fail24.json1
-rw-r--r--test/json/fixtures/fail25.json1
-rw-r--r--test/json/fixtures/fail27.json2
-rw-r--r--test/json/fixtures/fail28.json2
-rw-r--r--test/json/fixtures/fail3.json1
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail5.json1
-rw-r--r--test/json/fixtures/fail6.json1
-rw-r--r--test/json/fixtures/fail7.json1
-rw-r--r--test/json/fixtures/fail8.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/pass1.json56
-rw-r--r--test/json/fixtures/pass15.json1
-rw-r--r--test/json/fixtures/pass16.json1
-rw-r--r--test/json/fixtures/pass17.json1
-rw-r--r--test/json/fixtures/pass2.json1
-rw-r--r--test/json/fixtures/pass26.json1
-rw-r--r--test/json/fixtures/pass3.json6
-rw-r--r--test/json/setup_variant.rb11
-rwxr-xr-xtest/json/test_json.rb480
-rwxr-xr-xtest/json/test_json_addition.rb175
-rw-r--r--test/json/test_json_encoding.rb65
-rwxr-xr-xtest/json/test_json_fixtures.rb35
-rwxr-xr-xtest/json/test_json_generate.rb213
-rw-r--r--test/json/test_json_string_matching.rb39
-rwxr-xr-xtest/json/test_json_unicode.rb72
-rw-r--r--test/logger/test_logger.rb162
-rw-r--r--test/matrix/test_matrix.rb426
-rw-r--r--test/matrix/test_vector.rb134
-rw-r--r--test/minitest/test_minitest_benchmark.rb119
-rw-r--r--test/minitest/test_minitest_mock.rb154
-rw-r--r--test/minitest/test_minitest_spec.rb397
-rw-r--r--test/minitest/test_minitest_unit.rb1454
-rw-r--r--test/misc/test_ruby_mode.rb142
-rw-r--r--test/mkmf/base.rb129
-rw-r--r--test/mkmf/test_convertible.rb32
-rw-r--r--test/mkmf/test_find_executable.rb50
-rw-r--r--test/mkmf/test_flags.rb35
-rw-r--r--test/mkmf/test_signedness.rb27
-rw-r--r--test/mkmf/test_sizeof.rb45
-rw-r--r--test/monitor/test_monitor.rb31
-rw-r--r--test/net/http/test_buffered_io.rb17
-rw-r--r--test/net/http/test_http.rb555
-rw-r--r--test/net/http/test_httpheader.rb2
-rw-r--r--test/net/http/test_httpresponse.rb40
-rw-r--r--test/net/http/test_https.rb129
-rw-r--r--test/net/http/test_https_proxy.rb11
-rw-r--r--test/net/http/utils.rb115
-rw-r--r--test/net/imap/cacert.pem60
-rw-r--r--test/net/imap/server.crt61
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb505
-rw-r--r--test/net/imap/test_imap_response_parser.rb144
-rw-r--r--test/net/pop/test_pop.rb132
-rw-r--r--test/net/protocol/test_protocol.rb20
-rw-r--r--test/net/smtp/test_response.rb99
-rw-r--r--test/net/smtp/test_smtp.rb16
-rw-r--r--test/net/smtp/test_ssl_socket.rb91
-rw-r--r--test/nkf/test_kconv.rb104
-rw-r--r--test/nkf/test_nkf.rb6
-rw-r--r--test/objspace/test_objspace.rb55
-rw-r--r--test/open-uri/test_open-uri.rb730
-rw-r--r--test/open-uri/test_ssl.rb314
-rw-r--r--test/openssl/ssl_server.rb2
-rw-r--r--test/openssl/test_asn1.rb418
-rw-r--r--test/openssl/test_bn.rb23
-rw-r--r--test/openssl/test_buffering.rb88
-rw-r--r--test/openssl/test_cipher.rb22
-rw-r--r--test/openssl/test_config.rb289
-rw-r--r--test/openssl/test_digest.rb42
-rw-r--r--test/openssl/test_engine.rb15
-rw-r--r--test/openssl/test_hmac.rb28
-rw-r--r--test/openssl/test_ns_spki.rb11
-rw-r--r--test/openssl/test_ocsp.rb47
-rw-r--r--test/openssl/test_pair.rb124
-rw-r--r--test/openssl/test_pkcs12.rb209
-rw-r--r--test/openssl/test_pkcs7.rb38
-rw-r--r--test/openssl/test_pkey_dh.rb72
-rw-r--r--test/openssl/test_pkey_dsa.rb224
-rw-r--r--test/openssl/test_pkey_ec.rb182
-rw-r--r--test/openssl/test_pkey_rsa.rb207
-rw-r--r--test/openssl/test_ssl.rb438
-rw-r--r--test/openssl/test_ssl_session.rb327
-rw-r--r--test/openssl/test_x509cert.rb109
-rw-r--r--test/openssl/test_x509crl.rb29
-rw-r--r--test/openssl/test_x509ext.rb7
-rw-r--r--test/openssl/test_x509name.rb114
-rw-r--r--test/openssl/test_x509req.rb42
-rw-r--r--test/openssl/test_x509store.rb49
-rw-r--r--test/openssl/utils.rb188
-rw-r--r--test/optparse/test_bash_completion.rb42
-rw-r--r--test/optparse/test_getopts.rb34
-rw-r--r--test/optparse/test_noarg.rb14
-rw-r--r--test/optparse/test_optarg.rb4
-rw-r--r--test/optparse/test_optparse.rb19
-rw-r--r--test/optparse/test_placearg.rb13
-rw-r--r--test/optparse/test_reqarg.rb22
-rw-r--r--test/optparse/test_summary.rb38
-rw-r--r--test/optparse/test_zsh_completion.rb22
-rw-r--r--test/ostruct/test_ostruct.rb53
-rw-r--r--test/pathname/test_pathname.rb879
-rw-r--r--test/profile_test_all.rb52
-rw-r--r--test/psych/helper.rb63
-rw-r--r--test/psych/json/test_stream.rb109
-rw-r--r--test/psych/nodes/test_enumerable.rb43
-rw-r--r--test/psych/test_alias_and_anchor.rb96
-rw-r--r--test/psych/test_array.rb57
-rw-r--r--test/psych/test_boolean.rb36
-rw-r--r--test/psych/test_class.rb36
-rw-r--r--test/psych/test_coder.rb184
-rw-r--r--test/psych/test_date_time.rb17
-rw-r--r--test/psych/test_deprecated.rb210
-rw-r--r--test/psych/test_document.rb46
-rw-r--r--test/psych/test_emitter.rb94
-rw-r--r--test/psych/test_encoding.rb268
-rw-r--r--test/psych/test_engine_manager.rb57
-rw-r--r--test/psych/test_exception.rb130
-rw-r--r--test/psych/test_hash.rb44
-rw-r--r--test/psych/test_json_tree.rb65
-rw-r--r--test/psych/test_merge_keys.rb81
-rw-r--r--test/psych/test_nil.rb18
-rw-r--r--test/psych/test_null.rb19
-rw-r--r--test/psych/test_numeric.rb25
-rw-r--r--test/psych/test_object.rb44
-rw-r--r--test/psych/test_object_references.rb67
-rw-r--r--test/psych/test_omap.rb75
-rw-r--r--test/psych/test_parser.rb332
-rw-r--r--test/psych/test_psych.rb168
-rw-r--r--test/psych/test_scalar.rb11
-rw-r--r--test/psych/test_scalar_scanner.rb91
-rw-r--r--test/psych/test_serialize_subclasses.rb38
-rw-r--r--test/psych/test_set.rb49
-rw-r--r--test/psych/test_stream.rb93
-rw-r--r--test/psych/test_string.rb95
-rw-r--r--test/psych/test_struct.rb51
-rw-r--r--test/psych/test_symbol.rb17
-rw-r--r--test/psych/test_tainted.rb130
-rw-r--r--test/psych/test_to_yaml_properties.rb63
-rw-r--r--test/psych/test_tree_builder.rb79
-rw-r--r--test/psych/test_yaml.rb1269
-rw-r--r--test/psych/visitors/test_depth_first.rb49
-rw-r--r--test/psych/visitors/test_emitter.rb144
-rw-r--r--test/psych/visitors/test_to_ruby.rb325
-rw-r--r--test/psych/visitors/test_yaml_tree.rb155
-rw-r--r--test/rake/file_creation.rb34
-rw-r--r--test/rake/helper.rb492
-rw-r--r--test/rake/test_rake.rb40
-rw-r--r--test/rake/test_rake_application.rb489
-rw-r--r--test/rake/test_rake_application_options.rb335
-rw-r--r--test/rake/test_rake_clean.rb14
-rw-r--r--test/rake/test_rake_definitions.rb80
-rw-r--r--test/rake/test_rake_directory_task.rb46
-rw-r--r--test/rake/test_rake_dsl.rb77
-rw-r--r--test/rake/test_rake_early_time.rb31
-rw-r--r--test/rake/test_rake_extension.rb59
-rw-r--r--test/rake/test_rake_file_creation_task.rb56
-rw-r--r--test/rake/test_rake_file_list.rb628
-rw-r--r--test/rake/test_rake_file_list_path_map.rb8
-rw-r--r--test/rake/test_rake_file_task.rb102
-rw-r--r--test/rake/test_rake_file_utils.rb305
-rw-r--r--test/rake/test_rake_ftp_file.rb59
-rw-r--r--test/rake/test_rake_functional.rb450
-rw-r--r--test/rake/test_rake_invocation_chain.rb52
-rw-r--r--test/rake/test_rake_makefile_loader.rb44
-rw-r--r--test/rake/test_rake_multi_task.rb51
-rw-r--r--test/rake/test_rake_name_space.rb43
-rw-r--r--test/rake/test_rake_package_task.rb79
-rw-r--r--test/rake/test_rake_path_map.rb157
-rw-r--r--test/rake/test_rake_path_map_explode.rb34
-rw-r--r--test/rake/test_rake_path_map_partial.rb18
-rw-r--r--test/rake/test_rake_pseudo_status.rb21
-rw-r--r--test/rake/test_rake_rake_test_loader.rb21
-rw-r--r--test/rake/test_rake_rdoc_task.rb83
-rw-r--r--test/rake/test_rake_require.rb40
-rw-r--r--test/rake/test_rake_rules.rb327
-rw-r--r--test/rake/test_rake_task.rb267
-rw-r--r--test/rake/test_rake_task_argument_parsing.rb103
-rw-r--r--test/rake/test_rake_task_arguments.rb88
-rw-r--r--test/rake/test_rake_task_lib.rb9
-rw-r--r--test/rake/test_rake_task_manager.rb157
-rw-r--r--test/rake/test_rake_task_manager_argument_resolution.rb36
-rw-r--r--test/rake/test_rake_task_with_arguments.rb173
-rw-r--r--test/rake/test_rake_test_task.rb120
-rw-r--r--test/rake/test_rake_top_level_functions.rb111
-rw-r--r--test/rake/test_rake_win32.rb72
-rw-r--r--test/rake/test_sys.rb20
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin1024 -> 0 bytes-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/test.ja.large.rdoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_attribute_manager.rb120
-rw-r--r--test/rdoc/test_rdoc_alias.rb13
-rw-r--r--test/rdoc/test_rdoc_any_method.rb263
-rw-r--r--test/rdoc/test_rdoc_attr.rb123
-rw-r--r--test/rdoc/test_rdoc_class_module.rb718
-rw-r--r--test/rdoc/test_rdoc_code_object.rb290
-rw-r--r--test/rdoc/test_rdoc_constant.rb15
-rw-r--r--test/rdoc/test_rdoc_context.rb695
-rw-r--r--test/rdoc/test_rdoc_context_section.rb54
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb154
-rw-r--r--test/rdoc/test_rdoc_encoding.rb191
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb125
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb87
-rw-r--r--test/rdoc/test_rdoc_include.rb96
-rw-r--r--test/rdoc/test_rdoc_markup.rb91
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb240
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb152
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb57
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb21
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1486
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb410
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb27
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb332
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb345
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb355
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb110
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb341
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb229
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb122
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb23
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb37
-rw-r--r--test/rdoc/test_rdoc_options.rb392
-rw-r--r--test/rdoc/test_rdoc_parser.rb83
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1436
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb2477
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb99
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb209
-rw-r--r--test/rdoc/test_rdoc_require.rb25
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1061
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb43
-rw-r--r--test/rdoc/test_rdoc_ri_store.rb473
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb23
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb201
-rw-r--r--test/rdoc/test_rdoc_single_class.rb12
-rw-r--r--test/rdoc/test_rdoc_stats.rb543
-rw-r--r--test/rdoc/test_rdoc_task.rb111
-rw-r--r--test/rdoc/test_rdoc_text.rb397
-rw-r--r--test/rdoc/test_rdoc_top_level.rb240
-rw-r--r--test/rdoc/xref_data.rb76
-rw-r--r--test/rdoc/xref_test_case.rb71
-rw-r--r--test/readline/test_readline.rb415
-rw-r--r--test/readline/test_readline_history.rb327
-rw-r--r--test/resolv/test_addr.rb16
-rw-r--r--test/resolv/test_dns.rb121
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin50154 -> 0 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin161690 -> 0 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_110_utf16.xmlbin207464 -> 0 bytes-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb50
-rw-r--r--test/rexml/rexml_test_utils.rb5
-rw-r--r--test/rexml/test_attributes.rb198
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb44
-rw-r--r--test/rexml/test_comment.rb25
-rw-r--r--test/rexml/test_contrib.rb581
-rw-r--r--test/rexml/test_core.rb1462
-rw-r--r--test/rexml/test_doctype.rb107
-rw-r--r--test/rexml/test_document.rb109
-rw-r--r--test/rexml/test_elements.rb116
-rw-r--r--test/rexml/test_encoding.rb93
-rw-r--r--test/rexml/test_encoding_2.rb59
-rw-r--r--test/rexml/test_entity.rb167
-rw-r--r--test/rexml/test_functions.rb223
-rw-r--r--test/rexml/test_functions_number.rb32
-rw-r--r--test/rexml/test_jaxen.rb126
-rw-r--r--test/rexml/test_light.rb104
-rw-r--r--test/rexml/test_lightparser.rb12
-rw-r--r--test/rexml/test_listener.rb129
-rw-r--r--test/rexml/test_martin_fowler.rb37
-rw-r--r--test/rexml/test_namespace.rb38
-rw-r--r--test/rexml/test_notationdecl_mixin.rb58
-rw-r--r--test/rexml/test_notationdecl_parsetest.rb23
-rw-r--r--test/rexml/test_order.rb102
-rw-r--r--test/rexml/test_preceding_sibling.rb38
-rw-r--r--test/rexml/test_pullparser.rb100
-rw-r--r--test/rexml/test_rexml_issuezilla.rb14
-rw-r--r--test/rexml/test_sax.rb279
-rw-r--r--test/rexml/test_stream.rb104
-rw-r--r--test/rexml/test_ticket_80.rb56
-rw-r--r--test/rexml/test_validation_rng.rb790
-rw-r--r--test/rexml/test_xml_declaration_parent_child.rb33
-rw-r--r--test/rexml/test_xpath.rb1079
-rw-r--r--test/rexml/test_xpath_attribute_query.rb89
-rw-r--r--test/rexml/test_xpath_msw.rb38
-rw-r--r--test/rexml/test_xpath_pred.rb80
-rw-r--r--test/rexml/test_xpathtext.rb72
-rw-r--r--test/rinda/test_rinda.rb277
-rw-r--r--test/rinda/test_tuplebag.rb172
-rw-r--r--test/ripper/dummyparser.rb216
-rw-r--r--test/ripper/test_files.rb27
-rw-r--r--test/ripper/test_filter.rb83
-rw-r--r--test/ripper/test_parser_events.rb1142
-rw-r--r--test/ripper/test_ripper.rb49
-rw-r--r--test/ripper/test_scanner_events.rb844
-rw-r--r--test/rss/dot.pngbin111 -> 0 bytes-rw-r--r--test/rss/rss-assertions.rb1944
-rw-r--r--test/rss/rss-testcase.rb214
-rw-r--r--test/rss/test_1.0.rb156
-rw-r--r--test/rss/test_2.0.rb93
-rw-r--r--test/rss/test_accessor.rb32
-rw-r--r--test/rss/test_atom.rb681
-rw-r--r--test/rss/test_content.rb76
-rw-r--r--test/rss/test_dublincore.rb316
-rw-r--r--test/rss/test_image.rb49
-rw-r--r--test/rss/test_inherit.rb5
-rw-r--r--test/rss/test_itunes.rb347
-rw-r--r--test/rss/test_maker_0.9.rb215
-rw-r--r--test/rss/test_maker_1.0.rb281
-rw-r--r--test/rss/test_maker_2.0.rb194
-rw-r--r--test/rss/test_maker_atom_entry.rb393
-rw-r--r--test/rss/test_maker_atom_feed.rb454
-rw-r--r--test/rss/test_maker_content.rb15
-rw-r--r--test/rss/test_maker_dc.rb22
-rw-r--r--test/rss/test_maker_image.rb4
-rw-r--r--test/rss/test_maker_itunes.rb471
-rw-r--r--test/rss/test_maker_slash.rb37
-rw-r--r--test/rss/test_maker_sy.rb5
-rw-r--r--test/rss/test_maker_taxo.rb6
-rw-r--r--test/rss/test_maker_trackback.rb2
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb14
-rw-r--r--test/rss/test_parser.rb26
-rw-r--r--test/rss/test_parser_1.0.rb27
-rw-r--r--test/rss/test_parser_atom_entry.rb163
-rw-r--r--test/rss/test_parser_atom_feed.rb276
-rw-r--r--test/rss/test_setup_maker_0.9.rb49
-rw-r--r--test/rss/test_setup_maker_1.0.rb110
-rw-r--r--test/rss/test_setup_maker_2.0.rb42
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb409
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb445
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb38
-rw-r--r--test/rss/test_slash.rb64
-rw-r--r--test/rss/test_syndication.rb40
-rw-r--r--test/rss/test_taxonomy.rb30
-rw-r--r--test/rss/test_to_s.rb262
-rw-r--r--test/rss/test_trackback.rb28
-rw-r--r--test/rss/test_version.rb2
-rw-r--r--test/rss/test_xml-stylesheet.rb22
-rw-r--r--test/ruby/allpairs.rb103
-rw-r--r--test/ruby/beginmainend.rb2
-rw-r--r--test/ruby/enc/test_big5.rb28
-rw-r--r--test/ruby/enc/test_cp949.rb28
-rw-r--r--test/ruby/enc/test_emoji.rb442
-rw-r--r--test/ruby/enc/test_euc_jp.rb24
-rw-r--r--test/ruby/enc/test_euc_kr.rb28
-rw-r--r--test/ruby/enc/test_euc_tw.rb28
-rw-r--r--test/ruby/enc/test_gb18030.rb126
-rw-r--r--test/ruby/enc/test_gbk.rb28
-rw-r--r--test/ruby/enc/test_iso_8859.rb163
-rw-r--r--test/ruby/enc/test_koi8.rb22
-rw-r--r--test/ruby/enc/test_shift_jis.rb27
-rw-r--r--test/ruby/enc/test_utf16.rb384
-rw-r--r--test/ruby/enc/test_utf32.rb93
-rw-r--r--test/ruby/enc/test_windows_1251.rb16
-rw-r--r--test/ruby/endblockwarn.rb (renamed from test/ruby/endblockwarn_rb)0
-rw-r--r--test/ruby/envutil.rb200
-rw-r--r--test/ruby/lbtest.rb48
-rw-r--r--test/ruby/marshaltestlib.rb48
-rw-r--r--test/ruby/memory_status.rb96
-rw-r--r--test/ruby/sentence.rb668
-rw-r--r--test/ruby/test_alias.rb99
-rw-r--r--test/ruby/test_argf.rb783
-rw-r--r--test/ruby/test_array.rb2078
-rw-r--r--test/ruby/test_assignment.rb710
-rw-r--r--test/ruby/test_autoload.rb56
-rw-r--r--test/ruby/test_basicinstructions.rb685
-rw-r--r--test/ruby/test_beginendblock.rb126
-rw-r--r--test/ruby/test_bignum.rb462
-rw-r--r--test/ruby/test_call.rb4
-rw-r--r--test/ruby/test_case.rb57
-rw-r--r--test/ruby/test_class.rb276
-rw-r--r--test/ruby/test_clone.rb2
-rw-r--r--test/ruby/test_comparable.rb72
-rw-r--r--test/ruby/test_complex.rb1151
-rw-r--r--test/ruby/test_complex2.rb735
-rw-r--r--test/ruby/test_complexrational.rb407
-rw-r--r--test/ruby/test_const.rb27
-rw-r--r--test/ruby/test_continuation.rb124
-rw-r--r--test/ruby/test_defined.rb100
-rw-r--r--test/ruby/test_dir.rb208
-rw-r--r--test/ruby/test_dir_m17n.rb265
-rw-r--r--test/ruby/test_econv.rb931
-rw-r--r--test/ruby/test_encoding.rb116
-rw-r--r--test/ruby/test_enum.rb388
-rw-r--r--test/ruby/test_enumerator.rb377
-rw-r--r--test/ruby/test_env.rb360
-rw-r--r--test/ruby/test_eval.rb348
-rw-r--r--test/ruby/test_exception.rb212
-rw-r--r--test/ruby/test_fiber.rb240
-rw-r--r--test/ruby/test_file.rb269
-rw-r--r--test/ruby/test_file_exhaustive.rb1048
-rw-r--r--test/ruby/test_fixnum.rb232
-rw-r--r--test/ruby/test_flip.rb21
-rw-r--r--test/ruby/test_float.rb413
-rw-r--r--test/ruby/test_fnmatch.rb106
-rw-r--r--test/ruby/test_gc.rb85
-rw-r--r--test/ruby/test_hash.rb347
-rw-r--r--test/ruby/test_integer.rb201
-rw-r--r--test/ruby/test_integer_comb.rb622
-rw-r--r--test/ruby/test_io.rb2178
-rw-r--r--test/ruby/test_io_m17n.rb2407
-rw-r--r--test/ruby/test_iterator.rb128
-rw-r--r--test/ruby/test_lambda.rb73
-rw-r--r--test/ruby/test_literal.rb293
-rw-r--r--test/ruby/test_m17n.rb1431
-rw-r--r--test/ruby/test_m17n_comb.rb1633
-rw-r--r--test/ruby/test_marshal.rb492
-rw-r--r--test/ruby/test_math.rb281
-rw-r--r--test/ruby/test_metaclass.rb167
-rw-r--r--test/ruby/test_method.rb438
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb25
-rw-r--r--test/ruby/test_module.rb1243
-rw-r--r--test/ruby/test_notimp.rb64
-rw-r--r--test/ruby/test_numeric.rb235
-rw-r--r--test/ruby/test_object.rb687
-rw-r--r--test/ruby/test_objectspace.rb34
-rw-r--r--test/ruby/test_optimization.rb163
-rw-r--r--test/ruby/test_pack.rb612
-rw-r--r--test/ruby/test_parse.rb828
-rw-r--r--test/ruby/test_path.rb57
-rw-r--r--test/ruby/test_pipe.rb4
-rw-r--r--test/ruby/test_primitive.rb423
-rw-r--r--test/ruby/test_proc.rb802
-rw-r--r--test/ruby/test_process.rb1314
-rw-r--r--test/ruby/test_rand.rb516
-rw-r--r--test/ruby/test_range.rb333
-rw-r--r--test/ruby/test_rational.rb1139
-rw-r--r--test/ruby/test_rational2.rb1386
-rw-r--r--test/ruby/test_readpartial.rb14
-rw-r--r--test/ruby/test_regexp.rb876
-rw-r--r--test/ruby/test_require.rb359
-rw-r--r--test/ruby/test_rubyoptions.rb568
-rw-r--r--test/ruby/test_settracefunc.rb507
-rw-r--r--test/ruby/test_signal.rb203
-rw-r--r--test/ruby/test_sleep.rb15
-rw-r--r--test/ruby/test_sprintf.rb334
-rw-r--r--test/ruby/test_sprintf_comb.rb553
-rw-r--r--test/ruby/test_string.rb1986
-rw-r--r--test/ruby/test_stringchar.rb29
-rw-r--r--test/ruby/test_struct.rb228
-rw-r--r--test/ruby/test_super.rb76
-rw-r--r--test/ruby/test_symbol.rb119
-rw-r--r--test/ruby/test_syntax.rb89
-rw-r--r--test/ruby/test_system.rb162
-rw-r--r--test/ruby/test_thread.rb713
-rw-r--r--test/ruby/test_time.rb712
-rw-r--r--test/ruby/test_time_tz.rb338
-rw-r--r--test/ruby/test_trace.rb46
-rw-r--r--test/ruby/test_transcode.rb1968
-rw-r--r--test/ruby/test_undef.rb37
-rw-r--r--test/ruby/test_unicode_escape.rb269
-rw-r--r--test/ruby/test_variable.rb52
-rw-r--r--test/ruby/test_whileuntil.rb111
-rw-r--r--test/ruby/test_yield.rb382
-rw-r--r--test/ruby/ut_eof.rb12
-rw-r--r--test/rubygems/bogussources.rb8
-rw-r--r--test/rubygems/ca_cert.pem45
-rw-r--r--test/rubygems/data/gem-private_key.pem27
-rw-r--r--test/rubygems/data/gem-public_cert.pem20
-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin553 -> 0 bytes-rw-r--r--test/rubygems/fake_certlib/openssl.rb7
-rw-r--r--test/rubygems/fix_openssl_warnings.rb12
-rw-r--r--test/rubygems/insure_session.rb43
-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb2
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb2
-rw-r--r--test/rubygems/private_key.pem27
-rw-r--r--test/rubygems/public_cert.pem20
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb5
-rw-r--r--test/rubygems/rubygems_plugin.rb21
-rw-r--r--test/rubygems/simple_gem.rb66
-rw-r--r--test/rubygems/test_config.rb16
-rw-r--r--test/rubygems/test_gem.rb1281
-rw-r--r--test/rubygems/test_gem_builder.rb44
-rw-r--r--test/rubygems/test_gem_command.rb178
-rw-r--r--test/rubygems/test_gem_command_manager.rb215
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb118
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb125
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb18
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb89
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb145
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb226
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb144
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb102
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb131
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb58
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb354
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb68
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb38
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb147
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb199
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb107
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb353
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb59
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb210
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb241
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb40
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb137
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb224
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb372
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb83
-rw-r--r--test/rubygems/test_gem_config_file.rb319
-rw-r--r--test/rubygems/test_gem_dependency.rb177
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb853
-rw-r--r--test/rubygems/test_gem_dependency_list.rb268
-rw-r--r--test/rubygems/test_gem_doc_manager.rb32
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb84
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb162
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb66
-rw-r--r--test/rubygems/test_gem_format.rb88
-rw-r--r--test/rubygems/test_gem_gem_path_searcher.rb94
-rw-r--r--test/rubygems/test_gem_gem_runner.rb42
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb151
-rw-r--r--test/rubygems/test_gem_indexer.rb558
-rw-r--r--test/rubygems/test_gem_install_update_options.rb67
-rw-r--r--test/rubygems/test_gem_installer.rb1244
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb114
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb130
-rw-r--r--test/rubygems/test_gem_package_tar_input.rb129
-rw-r--r--test/rubygems/test_gem_package_tar_output.rb101
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb46
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb119
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb144
-rw-r--r--test/rubygems/test_gem_package_task.rb59
-rw-r--r--test/rubygems/test_gem_path_support.rb93
-rw-r--r--test/rubygems/test_gem_platform.rb270
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb978
-rw-r--r--test/rubygems/test_gem_requirement.rb309
-rw-r--r--test/rubygems/test_gem_security.rb100
-rw-r--r--test/rubygems/test_gem_server.rb234
-rw-r--r--test/rubygems/test_gem_silent_ui.rb111
-rw-r--r--test/rubygems/test_gem_source_index.rb250
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb408
-rw-r--r--test/rubygems/test_gem_specification.rb1728
-rw-r--r--test/rubygems/test_gem_stream_ui.rb238
-rw-r--r--test/rubygems/test_gem_text.rb58
-rw-r--r--test/rubygems/test_gem_uninstaller.rb235
-rw-r--r--test/rubygems/test_gem_validator.rb63
-rw-r--r--test/rubygems/test_gem_version.rb181
-rw-r--r--test/rubygems/test_gem_version_option.rb89
-rw-r--r--test/rubygems/test_kernel.rb55
-rw-r--r--test/runner.rb16
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb325
-rw-r--r--test/scanf/test_scanfblocks.rb81
-rw-r--r--test/scanf/test_scanfio.rb20
-rw-r--r--test/sdbm/test_sdbm.rb93
-rw-r--r--test/soap/asp.net/hello.wsdl96
-rw-r--r--test/soap/asp.net/test_aspdotnet.rb111
-rw-r--r--test/soap/calc/calc.rb17
-rw-r--r--test/soap/calc/calc2.rb29
-rw-r--r--test/soap/calc/server.cgi13
-rw-r--r--test/soap/calc/server.rb17
-rw-r--r--test/soap/calc/server2.rb20
-rw-r--r--test/soap/calc/test_calc.rb49
-rw-r--r--test/soap/calc/test_calc2.rb53
-rw-r--r--test/soap/calc/test_calc_cgi.rb69
-rw-r--r--test/soap/fault/test_customfault.rb58
-rw-r--r--test/soap/header/server.cgi119
-rw-r--r--test/soap/header/test_authheader.rb240
-rw-r--r--test/soap/header/test_authheader_cgi.rb121
-rw-r--r--test/soap/header/test_simplehandler.rb116
-rw-r--r--test/soap/helloworld/hw_s.rb16
-rw-r--r--test/soap/helloworld/test_helloworld.rb40
-rw-r--r--test/soap/marshal/test_digraph.rb56
-rw-r--r--test/soap/marshal/test_marshal.rb26
-rw-r--r--test/soap/marshal/test_struct.rb47
-rw-r--r--test/soap/ssl/README1
-rw-r--r--test/soap/ssl/ca.cert23
-rw-r--r--test/soap/ssl/client.cert19
-rw-r--r--test/soap/ssl/client.key15
-rw-r--r--test/soap/ssl/server.cert (renamed from test/rubygems/ssl_cert.pem)0
-rw-r--r--test/soap/ssl/server.key (renamed from test/rubygems/ssl_key.pem)0
-rw-r--r--test/soap/ssl/sslsvr.rb57
-rw-r--r--test/soap/ssl/subca.cert21
-rw-r--r--test/soap/ssl/test_ssl.rb204
-rw-r--r--test/soap/struct/test_struct.rb77
-rw-r--r--test/soap/swa/test_file.rb73
-rw-r--r--test/soap/test_basetype.rb970
-rw-r--r--test/soap/test_envelopenamespace.rb92
-rw-r--r--test/soap/test_httpconfigloader.rb39
-rw-r--r--test/soap/test_mapping.rb59
-rw-r--r--test/soap/test_no_indent.rb86
-rw-r--r--test/soap/test_property.rb424
-rw-r--r--test/soap/test_soapelement.rb122
-rw-r--r--test/soap/test_streamhandler.rb209
-rw-r--r--test/soap/test_styleuse.rb333
-rw-r--r--test/soap/wsdlDriver/README.txt2
-rw-r--r--test/soap/wsdlDriver/calc.wsdl126
-rw-r--r--test/soap/wsdlDriver/document.wsdl54
-rw-r--r--test/soap/wsdlDriver/echo_version.rb20
-rw-r--r--test/soap/wsdlDriver/simpletype.wsdl63
-rw-r--r--test/soap/wsdlDriver/test_calc.rb100
-rw-r--r--test/soap/wsdlDriver/test_document.rb78
-rw-r--r--test/soap/wsdlDriver/test_simpletype.rb87
-rw-r--r--test/socket/test_addrinfo.rb619
-rw-r--r--test/socket/test_ancdata.rb66
-rw-r--r--test/socket/test_basicsocket.rb88
-rw-r--r--test/socket/test_nonblock.rb149
-rw-r--r--test/socket/test_socket.rb482
-rw-r--r--test/socket/test_sockopt.rb33
-rw-r--r--test/socket/test_tcp.rb42
-rw-r--r--test/socket/test_udp.rb39
-rw-r--r--test/socket/test_unix.rb445
-rw-r--r--test/stringio/test_stringio.rb479
-rw-r--r--test/strscan/test_stringscanner.rb201
-rw-r--r--test/syck/test_array.rb18
-rw-r--r--test/syck/test_boolean.rb37
-rw-r--r--test/syck/test_class.rb27
-rw-r--r--test/syck/test_engine_manager.rb3
-rw-r--r--test/syck/test_exception.rb46
-rw-r--r--test/syck/test_hash.rb29
-rw-r--r--test/syck/test_null.rb20
-rw-r--r--test/syck/test_omap.rb56
-rw-r--r--test/syck/test_set.rb31
-rw-r--r--test/syck/test_string.rb45
-rw-r--r--test/syck/test_struct.rb42
-rw-r--r--test/syck/test_symbol.rb22
-rw-r--r--test/syck/test_time.rb24
-rw-r--r--test/syck/test_yaml.rb1413
-rw-r--r--test/syck/test_yaml_properties.rb64
-rw-r--r--test/syck/test_yamlstore.rb79
-rw-r--r--test/test_cmath.rb16
-rw-r--r--test/test_delegate.rb129
-rw-r--r--test/test_find.rb226
-rw-r--r--test/test_ipaddr.rb3
-rw-r--r--test/test_mathn.rb10
-rw-r--r--test/test_mutex_m.rb26
-rw-r--r--test/test_open3.rb242
-rw-r--r--test/test_pp.rb192
-rw-r--r--test/test_prettyprint.rb519
-rw-r--r--test/test_prime.rb174
-rw-r--r--test/test_pstore.rb129
-rw-r--r--test/test_pty.rb200
-rw-r--r--test/test_securerandom.rb175
-rw-r--r--test/test_set.rb3
-rw-r--r--test/test_shellwords.rb56
-rw-r--r--test/test_singleton.rb103
-rw-r--r--test/test_syslog.rb185
-rw-r--r--test/test_tempfile.rb308
-rw-r--r--test/test_time.rb407
-rw-r--r--test/test_timeout.rb32
-rw-r--r--test/test_tracer.rb63
-rw-r--r--test/test_tsort.rb44
-rw-r--r--test/testunit/collector/test_dir.rb389
-rw-r--r--test/testunit/collector/test_objectspace.rb98
-rw-r--r--test/testunit/runit/test_assert.rb402
-rw-r--r--test/testunit/runit/test_testcase.rb91
-rw-r--r--test/testunit/runit/test_testresult.rb144
-rw-r--r--test/testunit/runit/test_testsuite.rb49
-rw-r--r--test/testunit/test4test_hideskip.rb7
-rw-r--r--test/testunit/test_assertion.rb8
-rw-r--r--test/testunit/test_assertions.rb528
-rw-r--r--test/testunit/test_error.rb26
-rw-r--r--test/testunit/test_failure.rb33
-rw-r--r--test/testunit/test_hideskip.rb20
-rw-r--r--test/testunit/test_parallel.rb181
-rw-r--r--test/testunit/test_rake_integration.rb35
-rw-r--r--test/testunit/test_testcase.rb275
-rw-r--r--test/testunit/test_testresult.rb104
-rw-r--r--test/testunit/test_testsuite.rb129
-rw-r--r--test/testunit/tests_for_parallel/ptest_first.rb7
-rw-r--r--test/testunit/tests_for_parallel/ptest_forth.rb16
-rw-r--r--test/testunit/tests_for_parallel/ptest_second.rb11
-rw-r--r--test/testunit/tests_for_parallel/ptest_third.rb10
-rw-r--r--test/testunit/tests_for_parallel/runner.rb10
-rw-r--r--test/testunit/util/test_backtracefilter.rb41
-rw-r--r--test/testunit/util/test_observable.rb102
-rw-r--r--test/testunit/util/test_procwrapper.rb36
-rw-r--r--test/thread/test_queue.rb38
-rw-r--r--test/uri/test_common.rb88
-rw-r--r--test/uri/test_ftp.rb30
-rw-r--r--test/uri/test_generic.rb158
-rw-r--r--test/uri/test_http.rb5
-rw-r--r--test/uri/test_ldap.rb32
-rw-r--r--test/uri/test_mailto.rb26
-rw-r--r--test/uri/test_parser.rb41
-rw-r--r--test/webrick/test_cgi.rb101
-rw-r--r--test/webrick/test_cookie.rb58
-rw-r--r--test/webrick/test_filehandler.rb159
-rw-r--r--test/webrick/test_httpauth.rb111
-rw-r--r--test/webrick/test_httpproxy.rb282
-rw-r--r--test/webrick/test_httprequest.rb145
-rw-r--r--test/webrick/test_httpserver.rb73
-rw-r--r--test/webrick/test_httputils.rb36
-rw-r--r--test/webrick/test_server.rb31
-rw-r--r--test/webrick/test_utils.rb64
-rw-r--r--test/webrick/utils.rb32
-rwxr-xr-x[-rw-r--r--]test/webrick/webrick_long_filename.cgi0
-rw-r--r--test/win32ole/err_in_callback.rb9
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb55
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb65
-rw-r--r--test/win32ole/test_nil2vtempty.rb36
-rw-r--r--test/win32ole/test_ole_methods.rb36
-rw-r--r--test/win32ole/test_propertyputref.rb30
-rw-r--r--test/win32ole/test_thread.rb20
-rw-r--r--test/win32ole/test_win32ole.rb517
-rw-r--r--test/win32ole/test_win32ole_event.rb334
-rw-r--r--test/win32ole/test_win32ole_method.rb146
-rw-r--r--test/win32ole/test_win32ole_param.rb106
-rw-r--r--test/win32ole/test_win32ole_type.rb249
-rw-r--r--test/win32ole/test_win32ole_typelib.rb116
-rw-r--r--test/win32ole/test_win32ole_variable.rb61
-rw-r--r--test/win32ole/test_win32ole_variant.rb665
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb35
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb69
-rw-r--r--test/win32ole/test_word.rb72
-rw-r--r--test/with_different_ofs.rb17
-rw-r--r--test/wsdl/any/any.wsdl50
-rw-r--r--test/wsdl/any/expectedDriver.rb54
-rw-r--r--test/wsdl/any/expectedEcho.rb14
-rw-r--r--test/wsdl/any/expectedService.rb52
-rw-r--r--test/wsdl/any/test_any.rb58
-rw-r--r--test/wsdl/axisArray/axisArray.wsdl60
-rw-r--r--test/wsdl/axisArray/itemList.rb27
-rw-r--r--test/wsdl/axisArray/test_axisarray.rb69
-rw-r--r--test/wsdl/datetime/DatetimeService.rb44
-rw-r--r--test/wsdl/datetime/datetime.rb (renamed from test/rubygems/foo/discover.rb)0
-rw-r--r--test/wsdl/datetime/datetime.wsdl45
-rw-r--r--test/wsdl/datetime/datetimeServant.rb21
-rw-r--r--test/wsdl/datetime/test_datetime.rb82
-rw-r--r--test/wsdl/document/document.wsdl74
-rw-r--r--test/wsdl/document/echo.rb92
-rw-r--r--test/wsdl/document/number.wsdl54
-rw-r--r--test/wsdl/document/ping_nosoapaction.wsdl66
-rw-r--r--test/wsdl/document/test_nosoapaction.rb109
-rw-r--r--test/wsdl/document/test_number.rb99
-rw-r--r--test/wsdl/document/test_rpc.rb177
-rw-r--r--test/wsdl/emptycomplextype.wsdl31
-rw-r--r--test/wsdl/map/map.wsdl92
-rw-r--r--test/wsdl/map/map.xml43
-rw-r--r--test/wsdl/map/test_map.rb99
-rw-r--r--test/wsdl/marshal/person.wsdl21
-rw-r--r--test/wsdl/marshal/person_org.rb22
-rw-r--r--test/wsdl/marshal/test_wsdlmarshal.rb80
-rw-r--r--test/wsdl/multiplefault.wsdl68
-rw-r--r--test/wsdl/qualified/lp.rb (renamed from test/rubygems/sff/discover.rb)0
-rw-r--r--test/wsdl/qualified/lp.wsdl47
-rw-r--r--test/wsdl/qualified/lp.xsd26
-rw-r--r--test/wsdl/qualified/np.wsdl50
-rw-r--r--test/wsdl/qualified/test_qualified.rb154
-rw-r--r--test/wsdl/qualified/test_unqualified.rb143
-rw-r--r--test/wsdl/raa/RAA.rb243
-rw-r--r--test/wsdl/raa/RAAServant.rb99
-rw-r--r--test/wsdl/raa/RAAService.rb100
-rw-r--r--test/wsdl/raa/README.txt8
-rw-r--r--test/wsdl/raa/raa.wsdl264
-rw-r--r--test/wsdl/raa/server.rb103
-rw-r--r--test/wsdl/raa/test_raa.rb71
-rw-r--r--test/wsdl/ref/expectedProduct.rb90
-rw-r--r--test/wsdl/ref/product.wsdl86
-rw-r--r--test/wsdl/ref/test_ref.rb54
-rw-r--r--test/wsdl/rpc/echoDriver.rb55
-rw-r--r--test/wsdl/rpc/echo_serviceClient.rb23
-rw-r--r--test/wsdl/rpc/rpc.wsdl75
-rw-r--r--test/wsdl/rpc/test-rpc-lit.wsdl364
-rw-r--r--test/wsdl/rpc/test-rpc-lit12.wsdl455
-rw-r--r--test/wsdl/rpc/test_rpc.rb118
-rw-r--r--test/wsdl/rpc/test_rpc_lit.rb399
-rw-r--r--test/wsdl/simpletype/rpc/expectedClient.rb34
-rw-r--r--test/wsdl/simpletype/rpc/expectedDriver.rb62
-rw-r--r--test/wsdl/simpletype/rpc/expectedEchoVersion.rb23
-rw-r--r--test/wsdl/simpletype/rpc/expectedServant.rb32
-rw-r--r--test/wsdl/simpletype/rpc/expectedService.rb60
-rw-r--r--test/wsdl/simpletype/rpc/rpc.wsdl80
-rw-r--r--test/wsdl/simpletype/rpc/test_rpc.rb62
-rw-r--r--test/wsdl/simpletype/simpletype.wsdl95
-rw-r--r--test/wsdl/simpletype/test_simpletype.rb99
-rw-r--r--test/wsdl/soap/soapbodyparts.wsdl103
-rw-r--r--test/wsdl/soap/test_soapbodyparts.rb79
-rw-r--r--test/wsdl/test_emptycomplextype.rb21
-rw-r--r--test/wsdl/test_fault.rb51
-rw-r--r--test/wsdl/test_multiplefault.rb39
-rw-r--r--test/xmlrpc/htpasswd2
-rw-r--r--test/xmlrpc/test_cookie.rb96
-rw-r--r--test/xmlrpc/test_datetime.rb64
-rw-r--r--test/xmlrpc/test_features.rb6
-rw-r--r--test/xmlrpc/test_marshal.rb23
-rw-r--r--test/xmlrpc/test_parser.rb18
-rw-r--r--test/xmlrpc/test_webrick_server.rb57
-rw-r--r--test/xmlrpc/webrick_testing.rb24
-rw-r--r--test/xsd/codegen/test_classdef.rb214
-rw-r--r--test/xsd/noencoding.xml4
-rw-r--r--test/xsd/test_noencoding.rb32
-rw-r--r--test/xsd/test_xmlschemaparser.rb22
-rw-r--r--test/xsd/test_xsd.rb1511
-rw-r--r--test/xsd/xmlschema.xml12
-rw-r--r--test/yaml/test_yaml.rb1284
-rw-r--r--test/zlib/test_zlib.rb805
-rw-r--r--thread.c4872
-rw-r--r--thread_pthread.c1341
-rw-r--r--thread_pthread.h51
-rw-r--r--thread_win32.c787
-rw-r--r--thread_win32.h40
-rw-r--r--time.c5180
-rw-r--r--timev.h21
-rwxr-xr-xtool/asm_parse.rb51
-rwxr-xr-xtool/build-transcode16
-rwxr-xr-xtool/change_maker.rb30
-rwxr-xr-xtool/compile_prelude.rb198
-rwxr-xr-xtool/config.guess1501
-rwxr-xr-xtool/config.sub1705
-rw-r--r--tool/enc-emoji-citrus-gen.rb131
-rw-r--r--tool/enc-emoji4unicode.rb133
-rwxr-xr-xtool/enc-unicode.rb319
-rwxr-xr-xtool/eval.rb159
-rwxr-xr-xtool/file2lastrev.rb153
-rwxr-xr-xtool/generic_erb.rb34
-rwxr-xr-xtool/ifchange48
-rwxr-xr-xtool/insns2vm.rb15
-rw-r--r--tool/install-sh17
-rwxr-xr-xtool/instruction.rb1393
-rw-r--r--tool/jisx0208.rb84
-rwxr-xr-xtool/make-snapshot255
-rwxr-xr-xtool/mdoc2man.rb465
-rwxr-xr-xtool/merger.rb208
-rwxr-xr-xtool/mkconfig.rb280
-rwxr-xr-xtool/node_name.rb6
-rwxr-xr-xtool/parse.rb13
-rwxr-xr-xtool/rbinstall.rb604
-rwxr-xr-xtool/rmdirs11
-rwxr-xr-xtool/rubytest.rb28
-rwxr-xr-xtool/runruby.rb91
-rwxr-xr-xtool/strip-rdoc.rb22
-rw-r--r--tool/test/test_jisx0208.rb40
-rwxr-xr-xtool/transcode-tblgen.rb1064
-rwxr-xr-xtool/update-deps139
-rwxr-xr-xtool/vtlh.rb15
-rwxr-xr-xtool/ytab.sed37
-rw-r--r--transcode.c4481
-rw-r--r--transcode_data.h117
-rw-r--r--util.c4123
-rw-r--r--util.h67
-rw-r--r--variable.c1798
-rw-r--r--version.c138
-rw-r--r--version.h63
-rw-r--r--vm.c2294
-rw-r--r--vm_core.h763
-rw-r--r--vm_dump.c852
-rw-r--r--vm_eval.c1826
-rw-r--r--vm_exec.c156
-rw-r--r--vm_exec.h184
-rw-r--r--vm_insnhelper.c1741
-rw-r--r--vm_insnhelper.h220
-rw-r--r--vm_method.c1318
-rw-r--r--vm_opts.h51
-rw-r--r--vms/config.h102
-rw-r--r--vms/vms.h10
-rw-r--r--vms/vmsruby_private.c52
-rw-r--r--vms/vmsruby_private.h7
-rw-r--r--vsnprintf.c1287
-rw-r--r--win32/Makefile.sub817
-rw-r--r--win32/README.win3275
-rwxr-xr-xwin32/configure.bat164
-rw-r--r--win32/dir.h17
-rw-r--r--win32/enc-setup.mak10
-rw-r--r--win32/file.c715
-rwxr-xr-xwin32/ifchange.bat59
-rwxr-xr-xwin32/makedirs.bat3
-rw-r--r--[-rwxr-xr-x]win32/mkexports.rb191
-rw-r--r--[-rwxr-xr-x]win32/resource.rb44
-rwxr-xr-xwin32/rm.bat12
-rwxr-xr-xwin32/rmall.bat6
-rwxr-xr-xwin32/rmdirs.bat29
-rw-r--r--win32/setup.mak161
-rw-r--r--win32/stub.c42
-rw-r--r--win32/win32.c4515
-rw-r--r--win32/win32.h558
-rw-r--r--win32/winmain.c4
-rw-r--r--wince/Makefile.sub505
-rw-r--r--wince/README.wince121
-rw-r--r--wince/assert.c11
-rw-r--r--wince/assert.h6
-rwxr-xr-xwince/configure.bat102
-rw-r--r--wince/direct.c54
-rw-r--r--wince/direct.h22
-rw-r--r--wince/errno.c11
-rw-r--r--wince/errno.h55
-rw-r--r--wince/fcntl.h42
-rw-r--r--wince/io.h76
-rw-r--r--wince/io_wce.c230
-rw-r--r--wince/mkconfig_wce.rb7
-rw-r--r--wince/mkexports.rb35
-rw-r--r--wince/process.h46
-rw-r--r--wince/process_wce.c47
-rw-r--r--wince/resource.rb96
-rw-r--r--wince/setup.mak245
-rw-r--r--wince/signal.h71
-rw-r--r--wince/signal_wce.c26
-rw-r--r--wince/stddef.h5
-rw-r--r--wince/stdio.c36
-rw-r--r--wince/stdlib.c57
-rw-r--r--wince/string_wce.c89
-rw-r--r--wince/sys/stat.c102
-rw-r--r--wince/sys/stat.h68
-rw-r--r--wince/sys/timeb.c25
-rw-r--r--wince/sys/timeb.h26
-rw-r--r--wince/sys/types.h60
-rw-r--r--wince/sys/utime.c44
-rw-r--r--wince/sys/utime.h27
-rw-r--r--wince/time.h63
-rw-r--r--wince/time_wce.c301
-rw-r--r--wince/varargs.h34
-rw-r--r--wince/wince.c583
-rw-r--r--wince/wince.h191
-rw-r--r--wince/wincemain.c19
-rw-r--r--wince/wincon.h7
-rw-r--r--wince/winsock2.c338
-rw-r--r--x68/_dtos18.c250
-rw-r--r--x68/_round.c45
-rw-r--r--x68/fconvert.c81
-rw-r--r--x68/select.c167
3693 files changed, 214120 insertions, 1126475 deletions
diff --git a/.cvsignore b/.cvsignore
new file mode 100644
index 0000000000..9fd96ca149
--- /dev/null
+++ b/.cvsignore
@@ -0,0 +1,58 @@
+*.bak
+*.orig
+*.rej
+*.sav
+*~
+.ccmalloc
+.ppack
+.ext
+.git
+.svn
+.rbconfig.time
+COPYING.LIB
+ChangeLog.pre-alpha
+ChangeLog.pre1_1
+Makefile
+README.fat-patch
+README.v6
+README.atheos
+archive
+autom4te*.cache
+automake
+beos
+config.cache
+config.h
+config.h.in
+config.log
+config.status
+configure
+foo.rb
+libruby.so.*
+miniruby
+miniruby.elhash
+miniruby.elhash2
+miniruby.orig2
+miniruby.plhash
+miniruby.plhash2
+modex.rb
+newdate.rb
+newver.rb
+parse.c
+parse.y.try
+pitest.rb
+ppack
+preview
+rbconfig.rb
+rename2.h
+repack
+riscos
+rubicon
+ruby
+ruby-man.rd.gz
+rubyunit
+st.c.power
+this that
+tmp
+web
+y.output
+y.tab.c
diff --git a/.document b/.document
index 8a05d61beb..230c50e387 100644
--- a/.document
+++ b/.document
@@ -6,9 +6,6 @@
# Process all the C source files
*.c
-# prelude
-prelude.rb
-
# the lib/ directory (which has its own .document file)
lib
@@ -17,6 +14,3 @@ lib
# and some of the ext/ directory (which has its own .document file)
ext
-
-# rdoc files
-doc/*.rdoc
diff --git a/.gdbinit b/.gdbinit
deleted file mode 100644
index 2a38da8892..0000000000
--- a/.gdbinit
+++ /dev/null
@@ -1,757 +0,0 @@
-define rp
- if ruby_dummy_gdb_enums.special_consts
- end
- if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
- printf "FIXNUM: %ld\n", (long)($arg0) >> 1
- else
- if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
- set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
- if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
- printf "SYMBOL(:%c)\n", $id
- else
- if $id == idDot2
- echo SYMBOL(:..)\n
- else
- if $id == idDot3
- echo SYMBOL(:...)\n
- else
- if $id == idUPlus
- echo SYMBOL(:+@)\n
- else
- if $id == idUMinus
- echo SYMBOL(:-@)\n
- else
- if $id == idPow
- echo SYMBOL(:**)\n
- else
- if $id == idCmp
- echo SYMBOL(:<=>)\n
- else
- if $id == idLTLT
- echo SYMBOL(:<<)\n
- else
- if $id == idLE
- echo SYMBOL(:<=)\n
- else
- if $id == idGE
- echo SYMBOL(:>=)\n
- else
- if $id == idEq
- echo SYMBOL(:==)\n
- else
- if $id == idEqq
- echo SYMBOL(:===)\n
- else
- if $id == idNeq
- echo SYMBOL(:!=)\n
- else
- if $id == idEqTilde
- echo SYMBOL(:=~)\n
- else
- if $id == idNeqTilde
- echo SYMBOL(:!~)\n
- else
- if $id == idAREF
- echo SYMBOL(:[])\n
- else
- if $id == idASET
- echo SYMBOL(:[]=)\n
- else
- printf "SYMBOL(%ld)\n", $id
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- else
- if ($arg0) == RUBY_Qfalse
- echo false\n
- else
- if ($arg0) == RUBY_Qtrue
- echo true\n
- else
- if ($arg0) == RUBY_Qnil
- echo nil\n
- else
- if ($arg0) == RUBY_Qundef
- echo undef\n
- else
- if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
- echo immediate\n
- else
- set $flags = ((struct RBasic*)($arg0))->flags
- if ($flags & RUBY_T_MASK) == RUBY_T_NONE
- printf "T_NONE: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_NIL
- printf "T_NIL: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
- printf "T_OBJECT: "
- print (struct RObject *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
- printf "T_CLASS%s: ", ($flags & RUBY_FL_SINGLETON) ? "*" : ""
- print (struct RClass *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
- printf "T_ICLASS: "
- print (struct RClass *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
- printf "T_MODULE: "
- print (struct RClass *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
- printf "T_FLOAT: %.16g ", (((struct RFloat*)($arg0))->float_value)
- print (struct RFloat *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_STRING
- printf "T_STRING: "
- set print address off
- output (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
- set print address on
- printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if !($flags & RUBY_FL_USER1)
- printf "(embed) "
- else
- if ($flags & RUBY_FL_USER2)
- printf "(shared) "
- end
- if ($flags & RUBY_FL_USER3)
- printf "(assoc) "
- end
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
- printf "coderange:unknown "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
- printf "coderange:7bit "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
- printf "coderange:valid "
- else
- printf "coderange:broken "
- end
- end
- end
- print (struct RString *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
- set $regsrc = ((struct RRegexp*)($arg0))->src
- set $rsflags = ((struct RBasic*)$regsrc)->flags
- printf "T_REGEXP: "
- set print address off
- output (char *)(($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary)
- set print address on
- printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if $flags & RUBY_FL_USER6
- printf "(none) "
- end
- if $flags & RUBY_FL_USER5
- printf "(literal) "
- end
- if $flags & RUBY_FL_USER4
- printf "(fixed) "
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- print (struct RRegexp *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
- if ($flags & RUBY_FL_USER1)
- set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- printf "T_ARRAY: len=%ld ", $len
- printf "(embed) "
- if ($len == 0)
- printf "{(empty)} "
- else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
- printf " "
- end
- else
- set $len = ((struct RArray*)($arg0))->as.heap.len
- printf "T_ARRAY: len=%ld ", $len
- if ($flags & RUBY_FL_USER2)
- printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared
- printf " "
- else
- printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
- end
- if ($len == 0)
- printf "{(empty)} "
- else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
- printf " "
- end
- end
- print (struct RArray *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
- printf "T_FIXNUM: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_HASH
- printf "T_HASH: ",
- if ((struct RHash *)($arg0))->ntbl
- printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
- end
- print (struct RHash *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
- printf "T_STRUCT: len=%ld ", \
- (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
- ((struct RStruct *)($arg0))->as.heap.len)
- print (struct RStruct *)($arg0)
- x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ((struct RStruct *)($arg0))->as.ary : \
- ((struct RStruct *)($arg0))->as.heap.ptr)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
- printf "T_BIGNUM: sign=%d len=%ld ", \
- (($flags & RUBY_FL_USER1) != 0), \
- (($flags & RUBY_FL_USER2) ? \
- ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
- ((struct RBignum*)($arg0))->as.heap.len)
- if $flags & RUBY_FL_USER2
- printf "(embed) "
- end
- print (struct RBignum *)($arg0)
- x/xw (($flags & RUBY_FL_USER2) ? \
- ((struct RBignum*)($arg0))->as.ary : \
- ((struct RBignum*)($arg0))->as.heap.digits)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
- printf "T_RATIONAL: "
- print (struct RRational *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
- printf "T_COMPLEX: "
- print (struct RComplex *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FILE
- printf "T_FILE: "
- print (struct RFile *)($arg0)
- output *((struct RFile *)($arg0))->fptr
- printf "\n"
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
- printf "T_TRUE: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
- printf "T_FALSE: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_DATA
- if ((struct RTypedData *)($arg0))->typed_flag == 1
- printf "T_DATA(%s): ", ((struct RTypedData *)($arg0))->type->wrap_struct_name
- print (struct RTypedData *)($arg0)
- else
- printf "T_DATA: "
- print (struct RData *)($arg0)
- end
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
- printf "T_MATCH: "
- print (struct RMatch *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
- printf "T_SYMBOL: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
- printf "T_UNDEF: "
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_NODE
- printf "T_NODE("
- output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
- printf "): "
- print *(NODE *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
- printf "T_ZOMBIE: "
- print (struct RData *)($arg0)
- else
- printf "unknown: "
- print (struct RBasic *)($arg0)
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
-end
-document rp
- Print a Ruby's VALUE.
-end
-
-define nd_type
- print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-end
-document nd_type
- Print a Ruby' node type.
-end
-
-define nd_file
- print ((NODE*)($arg0))->nd_file
-end
-document nd_file
- Print the source file name of a node.
-end
-
-define nd_line
- print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
-end
-document nd_line
- Print the source line number of a node.
-end
-
-# Print members of ruby node.
-
-define nd_head
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_alen
- printf "u2.argc: "
- p ($arg0).u2.argc
-end
-
-define nd_next
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_cond
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_body
- printf "u2.node: "
- rp ($arg0).u2.node
-end
-
-define nd_else
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_orig
- printf "u3.value: "
- rp ($arg0).u3.value
-end
-
-
-define nd_resq
- printf "u2.node: "
- rp ($arg0).u2.node
-end
-
-define nd_ensr
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_1st
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_2nd
- printf "u2.node: "
- rp ($arg0).u2.node
-end
-
-
-define nd_stts
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-
-define nd_entry
- printf "u3.entry: "
- p ($arg0).u3.entry
-end
-
-define nd_vid
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
-define nd_cflag
- printf "u2.id: "
- p ($arg0).u2.id
-end
-
-define nd_cval
- printf "u3.value: "
- rp ($arg0).u3.value
-end
-
-
-define nd_cnt
- printf "u3.cnt: "
- p ($arg0).u3.cnt
-end
-
-define nd_tbl
- printf "u1.tbl: "
- p ($arg0).u1.tbl
-end
-
-
-define nd_var
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_ibdy
- printf "u2.node: "
- rp ($arg0).u2.node
-end
-
-define nd_iter
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_value
- printf "u2.node: "
- rp ($arg0).u2.node
-end
-
-define nd_aid
- printf "u3.id: "
- p ($arg0).u3.id
-end
-
-
-define nd_lit
- printf "u1.value: "
- rp ($arg0).u1.value
-end
-
-
-define nd_frml
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_rest
- printf "u2.argc: "
- p ($arg0).u2.argc
-end
-
-define nd_opt
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-
-define nd_recv
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_mid
- printf "u2.id: "
- p ($arg0).u2.id
-end
-
-define nd_args
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_noex
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
-define nd_defn
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_old
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
-define nd_new
- printf "u2.id: "
- p ($arg0).u2.id
-end
-
-
-define nd_cfnc
- printf "u1.cfunc: "
- p ($arg0).u1.cfunc
-end
-
-define nd_argc
- printf "u2.argc: "
- p ($arg0).u2.argc
-end
-
-
-define nd_cname
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
-define nd_super
- printf "u3.node: "
- rp ($arg0).u3.node
-end
-
-
-define nd_modl
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
-define nd_clss
- printf "u1.value: "
- rp ($arg0).u1.value
-end
-
-
-define nd_beg
- printf "u1.node: "
- rp ($arg0).u1.node
-end
-
-define nd_end
- printf "u2.node: "
- rp ($arg0).u2.node
-end
-
-define nd_state
- printf "u3.state: "
- p ($arg0).u3.state
-end
-
-define nd_rval
- printf "u2.value: "
- rp ($arg0).u2.value
-end
-
-
-define nd_nth
- printf "u2.argc: "
- p ($arg0).u2.argc
-end
-
-
-define nd_tag
- printf "u1.id: "
- p ($arg0).u1.id
-end
-
-define nd_tval
- printf "u2.value: "
- rp ($arg0).u2.value
-end
-
-define rb_p
- call rb_p($arg0)
-end
-
-define rb_numtable_entry
- set $rb_numtable_tbl = $arg0
- set $rb_numtable_id = (st_data_t)$arg1
- set $rb_numtable_key = 0
- set $rb_numtable_rec = 0
- if $rb_numtable_tbl->entries_packed
- set $rb_numtable_p = $rb_numtable_tbl->bins
- while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->bins+$rb_numtable_tbl->num_entries
- if (st_data_t)$rb_numtable_p[0] == $rb_numtable_id
- set $rb_numtable_key = (st_data_t)$rb_numtable_p[0]
- set $rb_numtable_rec = (st_data_t)$rb_numtable_p[1]
- set $rb_numtable_p = 0
- else
- set $rb_numtable_p = $rb_numtable_p + 2
- end
- end
- else
- set $rb_numtable_p = $rb_numtable_tbl->bins[$rb_numtable_id % $rb_numtable_tbl->num_bins]
- while $rb_numtable_p
- if $rb_numtable_p->key == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p->key
- set $rb_numtable_rec = $rb_numtable_p->record
- set $rb_numtable_p = 0
- else
- set $rb_numtable_p = $rb_numtable_p->next
- end
- end
- end
-end
-
-define rb_id2name
- rb_numtable_entry global_symbols.id_str (ID)$arg0
- if $rb_numtable_rec
- rp $rb_numtable_rec
- else
- echo undef\n
- end
-end
-document rb_id2name
- Print the name of id
-end
-
-define rb_method_entry
- set $rb_method_entry_klass = (struct RClass *)$arg0
- set $rb_method_entry_id = (ID)$arg1
- set $rb_method_entry_me = (rb_method_entry_t *)0
- while !$rb_method_entry_me && $rb_method_entry_klass
- rb_numtable_entry $rb_method_entry_klass->m_tbl $rb_method_entry_id
- set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
- if !$rb_method_entry_me
- set $rb_method_entry_klass = (struct RClass *)$rb_method_entry_klass->ptr->super
- end
- end
- if $rb_method_entry_me
- print *$rb_method_entry_klass
- print *$rb_method_entry_me
- else
- echo method not found\n
- end
-end
-document rb_method_entry
- Search method entry by class and id
-end
-
-define rb_classname
- call classname($arg0)
- rb_p $
- print *(struct RClass*)($arg0)
-end
-
-define rb_backtrace
- call rb_backtrace()
-end
-
-define iseq
- if dummy_gdb_enums.special_consts
- end
- if ($arg0)->type == ISEQ_ELEMENT_NONE
- echo [none]\n
- end
- if ($arg0)->type == ISEQ_ELEMENT_LABEL
- print *(LABEL*)($arg0)
- end
- if ($arg0)->type == ISEQ_ELEMENT_INSN
- print *(INSN*)($arg0)
- if ((INSN*)($arg0))->insn_id != YARVINSN_jump
- set $i = 0
- set $operand_size = ((INSN*)($arg0))->operand_size
- set $operands = ((INSN*)($arg0))->operands
- while $i < $operand_size
- rp $operands[$i++]
- end
- end
- end
- if ($arg0)->type == ISEQ_ELEMENT_ADJUST
- print *(ADJUST*)($arg0)
- end
-end
-
-define rb_ps
- rb_ps_vm ruby_current_vm
-end
-document rb_ps
-Dump all threads and their callstacks
-end
-
-define rb_ps_vm
- print $ps_vm = (rb_vm_t*)$arg0
- set $ps_threads = (st_table*)$ps_vm->living_threads
- if $ps_threads->entries_packed
- set $ps_threads_i = 0
- while $ps_threads_i < $ps_threads->num_entries
- set $ps_threads_key = (st_data_t)$ps_threads->bins[$ps_threads_i * 2]
- set $ps_threads_val = (st_data_t)$ps_threads->bins[$ps_threads_i * 2 + 1]
- rb_ps_thread $ps_threads_key $ps_threads_val
- set $ps_threads_i = $ps_threads_i + 1
- end
- else
- set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
- while $ps_threads_ptr
- set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
- set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
- rb_ps_thread $ps_threads_key $ps_threads_val
- set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
- end
- end
-end
-document rb_ps_vm
-Dump all threads in a (rb_vm_t*) and their callstacks
-end
-
-define rb_ps_thread
- set $ps_thread = (struct RTypedData*)$arg0
- set $ps_thread_id = $arg1
- print $ps_thread_th = (rb_thread_t*)$ps_thread->data
-end
diff --git a/.gitignore b/.gitignore
deleted file mode 100644
index 57557c9c2e..0000000000
--- a/.gitignore
+++ /dev/null
@@ -1,131 +0,0 @@
-*-*-*.def
-*.a
-*.bak
-*.dSYM
-*.dylib
-*.inc
-*.log
-*.o
-*.orig
-*.rej
-*.sav
-*.swp
-*~
-.*-*
-.*.list
-.*.time
-.DS_Store
-.ccmalloc
-.ext
-.pc
-.ppack
-.svn
-Makefile
-extconf.h
-y.output
-y.tab.c
-
-# /
-/*.pc
-/*_prelude.c
-/COPYING.LIB
-/ChangeLog-1.8.0
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
-/Doxyfile
-/GNUmakefile
-/README.atheos
-/README.fat-patch
-/README.v6
-/TAGS
-/archive
-/autom4te*.cache
-/automake
-/beos
-/breakpoints.gdb
-/config.cache
-/config.h
-/config.h.in
-/config.status
-/config.status.lineno
-/configure
-/doc/capi
-/enc.mk
-/enc/trans/*.c
-/encdb.h
-/exts.mk
-/goruby
-/id.h
-/largefile.h
-/lex.c
-/libruby*.*
-/miniprelude.c
-/miniruby
-/newdate.rb
-/newline.c
-/newver.rb
-/parse.c
-/parse.h
-/patches
-/patches-master
-/pitest.rb
-/ppack
-/prelude.c
-/preview
-/rbconfig.rb
-/rename2.h
-/repack
-/revision.h
-/riscos
-/rubicon
-/ruby
-/ruby-man.rd.gz
-/test.rb
-/tmp
-/transdb.h
-/uncommon.mk
-/web
-/yasmdata.rb
-
-# /benchmark/
-/benchmark/bmx_*.rb
-
-# /enc/trans/
-/enc/trans/*.c
-
-# /ext/
-/ext/extinit.c
-
-# /ext/dl/
-/ext/dl/*.func
-
-# /ext/dl/callback/
-/ext/dl/callback/*.func
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
-
-# /ext/iconv/
-/ext/iconv/config.charset
-/ext/iconv/iconv.rb
-
-# /ext/ripper/
-/ext/ripper/eventids1.c
-/ext/ripper/eventids2table.c
-/ext/ripper/ripper.*
-/ext/ripper/ids1
-/ext/ripper/ids2
-
-# /ext/socket/
-/ext/socket/constants.h
-/ext/socket/constdefs.h
-/ext/socket/constdefs.c
-
-# /ext/tk/
-/ext/tk/config_list
-
-# /spec/
-/spec/mspec
-/spec/rubyspec
-
-# /win32/
-/win32/*.ico
diff --git a/.indent.pro b/.indent.pro
deleted file mode 100644
index 6a207a0554..0000000000
--- a/.indent.pro
+++ /dev/null
@@ -1,21 +0,0 @@
--bap
--nbbb
--nbc
--br
--nbs
--ncdb
--ce
--cli0.5
--ndj
--ei
--nfc1
--i4
--l120
--lp
--npcs
--psl
--sc
--sob
-
--TID
--TVALUE
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 286342c1cc..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-# no installation...
-before_script: autoconf
-script: "./configure && make all test"
-
-branches:
- only:
- - trunk
- - ruby_1_9_3
diff --git a/BSDL b/BSDL
deleted file mode 100644
index 82725534fa..0000000000
--- a/BSDL
+++ /dev/null
@@ -1,22 +0,0 @@
-Copyright (C) 1993-2010 Yukihiro Matsumoto. All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions
-are met:
-1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
-
-THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGE.
diff --git a/COPYING b/COPYING
index a1f19ff99d..9043404a83 100644
--- a/COPYING
+++ b/COPYING
@@ -1,6 +1,6 @@
Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the
-2-clause BSDL (see the file BSDL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the GPL
+version 2 (see the file GPL), or the conditions below:
1. You may make and give away verbatim copies of the source form of the
software without restriction, provided that you duplicate all of the
diff --git a/COPYING.ja b/COPYING.ja
index 5b5b91c149..933cc7cb9a 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,6 +1,6 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(B2-clause BSDL
-$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G$-$^$9(B
-2-clause BSDL$B$K$D$$$F$O(BBSDL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
+Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
+$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
diff --git a/ChangeLog b/ChangeLog
index b123bd3f89..c10e42d760 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,17341 +1,18324 @@
-Thu Jun 27 20:11:52 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Jun 8 01:37:58 2008 Tanaka Akira <akr@fsij.org>
- * ext/openssl/lib/openssl/ssl-inernal.rb (verify_certificate_identity):
- fix hostname verification. Patched by nahi.
+ * ext/socket/socket.c (s_accept_nonblock): make accepted fd
+ nonblocking. [ruby-talk:274079]
- * test/openssl/test_ssl.rb (test_verify_certificate_identity): test for
- above.
+Sun Jun 8 01:28:42 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 26 18:28:29 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * win32/mkexports.rb: deal with __fastcall name decorations.
+ [ruby-list:44111]
- * test/ruby/test_m17n.rb: assert_predicate and assert_not_predicate
- is not available on 1.9.3.
+Sun Jun 8 01:23:29 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jun 26 17:08:13 2013 Kazuki Tsujimoto <kazuki@callcc.net>
+ * lib/rexml/source.rb (REXML::SourceFactory::SourceFactory): typo
+ fixed. [ruby-list:44099]
- * include/ruby/ruby.h, vm_eval.c (rb_funcall_with_block):
- new function to invoke a method with a block passed
- as an argument.
+Sun Jun 8 01:17:45 2008 NAKAMURA Usaku <usa@ruby-lang.org>
- * string.c (sym_call): use the above function to avoid
- a block sharing. [ruby-dev:47438] [Bug #8531]
+ * {bcc32,win32}/Makefile.sub (COMMON_MACROS): workaround for old SDK's
+ bug. [ruby-core:12584]
- * vm_insnhelper.c (vm_yield_with_cfunc): don't set block
- in the frame.
+Sun Jun 8 00:56:44 2008 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/ruby/test_symbol.rb (TestSymbol#test_block_given_to_proc):
- run related tests.
+ * lib/net/http.rb, lib/open-uri.rb: remove
+ Net::HTTP#enable_post_connection_check. [ruby-dev:31960]
-Wed Jun 26 17:01:22 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/net/imap.rb: hostname should be verified against server's
+ indentity as persented in the server's certificate. [ruby-dev:31960]
- * benchmark/bm_hash_shift.rb: add benchmark for Hash#shift
+ * ext/openssl/lib/net/telnets.rb, ext/openssl/lib/net/ftptls.rb: ditto.
- * hash.c (rb_hash_shift): use st_shift if hash is not being iterated to
- delete element without iterating the whole hash.
+Thu Jun 5 16:19:27 2008 NAKAMURA Usaku <usa@ruby-lang.org>
- * hash.c (shift_i): remove function
+ * win32/win32.c (make_cmdvector): adjust escaped successive
+ double-quote handling. (merge from trunk)
- * include/ruby/st.h (st_shift): add st_shift function
+Thu Jun 5 12:24:25 2008 NAKAMURA Usaku <usa@ruby-lang.org>
- * st.c (st_shift): ditto
+ * win32/win32.c (init_env): initialize HOME and USER environment
+ variables unless set. [ruby-core:12328] (merge from trunk)
- [Backport #8328] [ruby-core:55250] Patch by funny-falcon
+ * win32/win32.c (NtInitialize, getlogin): ditto.
-Wed Jun 26 16:52:57 2013 Kazuki Tsujimoto <kazuki@callcc.net>
+ * configure.in, win32/Makefile.sub (LIBS): need to link shell32
+ library for SH* functions on mswin32 and mingw32.
- * test/ruby/test_proc.rb (TestProc#test_block_given_method_to_proc):
- run test for r41359.
+Thu Jun 5 12:21:06 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jun 26 16:52:57 2013 Kazuki Tsujimoto <kazuki@callcc.net>
+ * gc.c (id2ref): valid id should not refer T_VALUE nor T_ICLASS.
+ [ruby-dev:31911]
- * include/ruby/intern.h, proc.c (rb_method_call_with_block):
- new function to invoke a Method object with a block passed
- as an argument.
+Wed Jun 4 16:39:56 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * proc.c (bmcall): use the above function to avoid a block sharing.
- [ruby-core:54626] [Bug #8341]
+ * Makefile.in (ext/extinit.o): use $(OUTFLAG) as well as other
+ objects. [ruby-Bugs-14228]
- * test/ruby/test_proc.rb (TestProc#test_block_persist_between_calls):
- run related tests.
+Tue Jun 3 16:13:40 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 26 16:36:39 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yyerror): limit error message length. [ruby-dev:31848]
- * defs/id.def (predefined): add "idProc".
+ * regex.c (re_mbc_startpos): separated from re_adjust_startpos.
- * proc.c (mnew, mproc, mlambda): use predefined IDs.
+Tue Jun 3 15:27:11 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm.c (Init_VM): ditto.
+ * gc.c (os_obj_of, os_each_obj): hide objects to be finalized.
+ [ruby-dev:31810]
-Wed Jun 26 16:36:39 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 4 19:15:57 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
- * include/ruby/intern.h (rb_block_lambda): add declaration instead of
- deprecated rb_f_lambda.
+ * eval.c (remove_method): should not remove undef place holder.
+ [ruby-dev:31817]
-Wed Jun 26 16:31:49 2013 Shugo Maeda <shugo@ruby-lang.org>
+Tue Jun 3 15:05:48 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/imap.rb (capability_response): should ignore trailing
- spaces. Thanks, Peter Kovacs. [ruby-core:55024] [Bug #8415]
+ * process.c (struct rb_exec_arg): proc should be a VALUE.
- * test/net/imap/test_imap_response_parser.rb: related test.
+ * process.c (rb_f_exec): suppress a warning.
-Wed Jun 26 16:29:41 2013 Charlie Somerville <charliesome@ruby-lang.org>
+ * process.c (rb_detach_process): cast for the platforms where size of
+ pointer differs from size of int.
- * intern.h: remove dangling rb_class_init_copy declaration
- [ruby-core:55120] [Bug #8434]
+ * process.c (rb_f_exec, rb_f_system): should not exceptions after
+ fork. [ruby-core:08262]
-Wed Jun 26 16:22:12 2013 Charlie Somerville <charliesome@ruby-lang.org>
+Wed May 21 01:32:56 2008 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * class.c (include_modules_at): invalidate method cache if included
- module contains constants
+ * lib/webrick/httpservlet/filehandler.rb: should normalize path
+ name in path_info to prevent script disclosure vulnerability on
+ DOSISH filesystems. (fix: CVE-2008-1891)
+ Note: NTFS/FAT filesystem should not be published by the platforms
+ other than Windows. Pathname interpretation (including short
+ filename) is less than perfect.
- * test/ruby/test_module.rb: add test
+ * lib/webrick/httpservlet/abstract.rb
+ (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
+ should escape the value of Location: header.
-Wed Jun 26 16:13:25 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
+ command line arguments.
- * io.c (io_getc): fix 7bit coderange condition, check if ascii read
- data instead of read length. [ruby-core:55444] [Bug #8516]
+Sun May 18 01:57:44 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 26 16:10:01 2013 Eric Hodel <drbrain@segment7.net>
+ * file.c (isdirsep): backslash is valid path separator on cygwin too.
+ backported from 1.8 HEAD.
- * ext/socket/extconf.rb: Enable RFC 3542 IPV6 socket options for OS X
- 10.7+. [ruby-trunk - Bug #8517]
+Sat May 17 23:53:57 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 5 12:38:14 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * file.c (file_expand_path): fix for short file name on Cygwin.
- * win32/win32.c (setup_overlapped, finish_overlapped): extract from
- rb_w32_read() and rb_w32_write().
+Sat May 17 23:50:29 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed May 29 21:03:08 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * file.c (OpenFile): prevent conflict on Windows.
- * configure.in (POSTLINK): default to : command to get rid of flag
- only command, since BSD make does not work with it.
+ * file.c (USE_NTFS): fixed merge miss.
-Wed May 29 20:59:38 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat May 17 12:36:46 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/yaml.rb: documentation updates, patched by zzak.
- [ruby-core:54735] [Backport #8356]
+ * file.c (file_expand_path): rb_str_set_len is not backported.
-Wed May 15 14:04:39 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat May 17 12:15:48 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * Makefile.in (miniruby): 1.9.3 doesn't have POSTLINK macro.
- reported by Takahiro Kambe at [ruby-list:49362].
+ * file.c (file_expand_path): support for alternative data stream
+ and ignored trailing garbages of NTFS.
-Wed May 15 01:06:26 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * file.c (rb_file_s_basename): ditto.
- * include/ruby/intern.h: should include sys/time.h for struct timeval
- if it exists.
+ * file.c (rb_file_s_extname): ditto.
-Wed May 15 00:23:07 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Mar 3 23:36:41 2008 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * configure.in (warnflags): disable -Werror by default unless
- development. [ruby-core:52131] [Bug #7830]
+ * lib/webrick/httpservlet/filehandler.rb: should normalize path
+ separators in path_info to prevent directory traversal attacks
+ on DOSISH platforms.
+ reported by Digital Security Research Group [DSECRG-08-026].
-Wed May 15 00:21:31 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/webrick/httpservlet/filehandler.rb: pathnames which have
+ not to be published should be checked case-insensitively.
- * signal.c: need to include unistd.h for write(2).
+Sun Sep 23 21:57:25 2007 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue May 14 20:25:58 2013 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * lib/net/http.rb: an SSL verification (the server hostname should
+ be matched with its certificate's commonName) is added.
+ this verification can be skipped by
+ "Net::HTTP#enable_post_connection_check=(false)".
+ suggested by Chris Clark <cclark at isecpartners.com>
- * ext/dl/lib/dl/func.rb (DL::Function#call): check tainted when
- $SAFE > 0.
- * ext/fiddle/function.c (function_call): check tainted when $SAFE > 0.
- * test/fiddle/test_func.rb (module Fiddle): add test for above.
+ * lib/net/open-uri.rb: use Net::HTTP#enable_post_connection_check to
+ perform SSL post connection check.
+ * ext/openssl/lib/openssl/ssl.c
+ (OpenSSL::SSL::SSLSocket#post_connection_check): refine error message.
-Tue May 14 11:36:22 2013 Shugo Maeda <shugo@ruby-lang.org>
+Sun Sep 23 06:08:38 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/imap.rb (getacl_response): parse the mailbox of an ACL
- response correctly. [ruby-core:54365] [Bug #8281]
+ * ext/stringio/stringio.c (strio_init): separate from strio_initialize
+ to share with strio_reopen properly. [ruby-Bugs-13919]
-Tue May 14 11:24:22 2013 Martin Bosslet <Martin.Bosslet@gmail.com>
+Sun Sep 23 05:42:35 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
- * ext/openssl/ossl_ssl.c: Correct shutdown behavior w.r.t GC.
+ * lib/rdoc/options.rb (Options::check_diagram): dot -V output
+ changed. [ ruby-Bugs-11978 ], Thanks Florian Frank.
- * test/openssl/test_ssl.rb: Add tests to verify correct behavior.
+Mon Sep 17 04:47:02 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- [Bug #8240] Patch provided by Shugo Maeda. Thanks!
+ * ruby.c (proc_options): -W should be allowed in RUBYOPT
+ environment variable. [ruby-core:12118]
-Tue May 14 11:22:33 2013 Naohisa Goto <ngotogenome@gmail.com>
+Mon Sep 17 04:31:46 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * configure.in (AC_CHECK_HEADERS): atomic.h for Solaris atomic_ops.
+ * range.c (range_step): fixed integer overflow. [ruby-dev:31763]
- * ruby_atomic.h: Skip using Solaris10 atomic_ops on Solaris 9 or
- earlier if atomic.h is not available. [ruby-dev:47229] [Bug #8228]
+Fri Sep 7 14:57:36 2007 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-Tue May 14 10:42:23 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (rubylib_mangled_path): eliminate RSTRING_PTR
+ [ruby-dev:31679]
- * lib/mkmf.rb (MAIN_DOES_NOTHING): ensure symbols for tests to be
- preserved. [ruby-core:53745] [Bug #8169]
+ * ruby.c(push_include_cygwin): ditto.
-Tue May 14 10:42:23 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 7 14:32:38 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (MAIN_DOES_NOTHING): force to refer symbols for tests
- to be preserved. [ruby-core:53745] [Bug #8169]
+ * array.c (rb_ary_subseq): need integer overflow check.
+ [ruby-dev:31736]
-Tue May 14 10:39:33 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * array.c (rb_ary_splice): ditto. [ruby-dev:31737]
- * regexec.c (onig_search): fix problem with optimization of \z.
- [Backport #8210]
- patched by k_takata at [ruby-core:54251].
+ * array.c (rb_ary_fill): ditto. [ruby-dev:31738]
-Tue May 14 09:36:14 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_splice): integer overflow for length.
+ [ruby-dev:31739]
- * time.c (GetTimeval): check if already initialized instance.
+Fri Sep 7 14:27:33 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * time.c (GetNewTimeval): check if newly created instance.
+ * eval.c (mnew): should preserve noex as safe_level.
- * time.c (time_init_0, time_init_1, time_init_copy, time_mload): must
- be newly created instance. [ruby-core:53436] [Bug #8099]
+ * eval.c (rb_call0): tighten security check condition..
-Thu Apr 11 11:24:42 2013 Akinori MUSHA <knu@iDaemons.org>
+Fri Sep 7 14:19:16 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/ipaddr.rb (IPAddr#in6_addr): Fix a typo with the closing
- parenthesis.
+ * configure.in (group_member): check if presents.
-Thu Apr 11 11:24:42 2013 Akinori MUSHA <knu@iDaemons.org>
+ * configure.in (XCFLAGS): add _GNU_SOURCE on linux.
- * lib/ipaddr.rb (IPAddr#in6_addr): Fix the parser so that it can
- recognize IPv6 addresses with only one edge 16-bit piece
- compressed, like [::2:3:4:5:6:7:8] or [1:2:3:4:5:6:7::].
- [Bug #7477]
+ * file.c (group_member): use system routine if available.
-Thu Apr 11 11:22:32 2013 Naohisa Goto <ngoto@gen-info.osaka-u.ac.jp>
+Fri Sep 7 14:14:19 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * string.c (rb_str_concat): set array element after definition
- to fix compile error with Fujitsu C Compiler 5.6 on Solaris 10
- on Sparc. [Bug #5878] [ruby-dev:45123]
+ * include/ruby/defines.h (flush_register_windows): call "ta 0x03"
+ even on Linux/Sparc. [ruby-dev:31674]
-Thu Apr 11 11:21:25 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 7 14:12:37 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * parse.y (parser_magic_comment): should pass the proper value.
- [ruby-dev:44984][Bug #5753]
+ * ext/win32ole/win32ole.c (ole_type_progid, reg_enum_key,
+ reg_get_val, ole_wc2mb): fix the bug. Thanks, arton.
+ [ruby-dev:31576]
-Thu Apr 11 11:18:57 2013 Tadayoshi Funaba <tadf@dotrb.org>
+Fri Sep 7 14:02:10 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/date/date_core.c: [ruby-core:52303]
+ * process.c (detach_process_watcher): should not pass the pointer
+ to an auto variable to the thread to be created. pointed and
+ fix by KUBO Takehiro <kubo at jiubao.org> [ruby-dev:30618]
-Thu Apr 4 16:21:39 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Sep 7 13:52:36 2007 Tanaka Akira <akr@fsij.org>
- * ext/objspace/objspace.c (count_nodes): fix key for unknown node.
- based on a patch by tmm1 (Aman Gupta) in [ruby-core:53130] [Bug #8014]
+ * bignum.c (big_lshift): make shift offset long type.
+ (big_rshift): ditto.
+ (rb_big_lshift): ditto.
+ (big_rshift): ditto.
+ [ruby-dev:31434]
-Thu Apr 4 16:17:14 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 16 08:44:55 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * Makefile.in (miniruby, ruby): move MAINLIBC because linker arguments
- must appear after object files with newer versions of gcc. patch by
- tmm1 (Aman Gupta) in [ruby-core:53121] [Bug #8009]
+ * hash.c (rb_hash_delete_key): delete the entry without calling block.
-Thu Apr 4 09:44:10 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_hash_shift): should consider iter_lev too.
- * configure.in (DLDFLAGS): use TARGET_ENTRY to specify an entry point
- instead of TARGET which may contain non-identifer characters.
+ * hash.c (delete_if_i): use rb_hash_delete_key() so that the block
+ isn't called twice. [ruby-core:11556]
- * lib/mkmf.rb (create_makefile): add TARGET_NAME which is the first
- part consists of only word characters. [ruby-core:46248][Bug #6709]
+Thu Aug 16 08:43:50 2007 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Tue Apr 2 13:13:19 2013 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * lib/rinda/tuplespace.rb: fix Rinda::TupleSpace keeper thread bug.
+ the thread is started too early. [ruby-talk:264062]
- * transcode.c (documentation for str_encode): Explain
- that transcoding to the same encoding is a no-op
- (i.e. no exceptions, no replacements,...).
- [ruby-core:43557][Bug #6190]
+ * test/rinda/test_rinda.rb: ditto.
-Tue Apr 2 13:13:19 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 16 08:40:38 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * transcode.c (str_encode_bang, encoded_dup): if nothing was
- transcoded, just set encoding but leave coderange unchanged as
- forcee_encoding. [ruby-core:43557][Bug #6190]
+ * ext/pty/pty.c (establishShell): handshaking before close slave
+ device. [ruby-talk:263410]
-Tue Apr 2 13:07:29 2013 Tanaka Akira <akr@fsij.org>
+Thu Aug 16 08:29:39 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * time.c (num_exact): use to_r method only if to_int method is
- available.
- [ruby-core:53764] [Bug #8173] reported by Hiro Asari.
+ * configure.in (ac_cv_func_isinf): set yes also on OpenSolaris.
+ [ruby-Bugs-12859]
-Tue Apr 2 13:01:55 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 16 08:28:16 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (EXTDLDFLAGS): split options for each extension
- libraries, and unused in ruby.pc. [Bug #6734]
+ * lib/rexml/encodings/{ISO-8859-15,CP-1252}.rb: fixed invalid syntax.
- * lib/mkmf.rb (MakeMakefile#configuration): add EXTDLDFLAGS.
+Thu Aug 16 08:26:08 2007 Tadayoshi Funaba <tadf@dotrb.org>
-Tue Apr 2 12:59:35 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/README: fixed a typo.
- * win32/win32.c (rb_w32_read): Windows 8 fixed one of a bug of console
- API.
- based on the patch by Heesob Park at [ruby-core:49479] [Bug #7379]
+Thu Aug 16 08:20:50 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Apr 2 12:56:15 2013 Naohisa Goto <ngotogenome@gmail.com>
+ * ext/extmk.rb (extmake): save all CONFIG values.
- * signal.c (ruby_abort): fix typo in r39354 [Bug #5014]
+ * ext/extmk.rb (extmake): remove mkmf.log at clean, and extconf.h at
+ distclean, respectively.
-Tue Apr 2 12:56:15 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/extmk.rb: remove rdoc at clean, and installed list file at
+ distclean, respectively.
- * signal.c (check_stack_overflow): extract duplicated code and get rid
- of declaration-after-statement. [Bug #5014]
+Thu Aug 16 07:58:18 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Apr 2 12:56:15 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * sprintf.c (rb_f_sprintf): should not check positional number as
+ width. [ruby-core:11838]
- * signal.c (sigsegv): avoid to use async signal unsafe functions
- when nested sigsegv is happen.
- [Bug #5014] [ruby-dev:44082]
+Thu Aug 16 07:52:24 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Mar 29 13:22:15 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * dln.c (conv_to_posix_path): removed.
- * include/ruby/missing.h: fixed merge mistake of r39985.
- [Backport #8080]
+ * ruby.c (rubylib_mangled_path, rubylib_mangled_path2): return
+ VALUE instead of a pointer to static buffer.
-Thu Mar 28 19:01:54 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ruby.c (push_include_cygwin): fixed buffer overflow.
+ [ruby-dev:31297]
- * include/ruby/missing.h: removed __linux__. it's unnecessary.
+ * ruby.c (ruby_init_loadpath): not convert built-in paths.
-Thu Mar 28 19:01:54 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Aug 16 07:51:37 2007 Akinori MUSHA <knu@iDaemons.org>
- * thread.c: disabled _FORTIFY_SOURCE for avoid to hit glibc bug.
- [Bug #8080] [ruby-core:53349]
- * test/ruby/test_io.rb (TestIO#test_io_select_with_many_files):
- test for the above.
+ * defines.h: Pull the RUBY_MBCHAR_MAXSIZE definition from trunk,
+ which is necessary for dir.c to compile on djgpp and emx.
-Thu Mar 28 19:01:54 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Aug 16 07:42:10 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * include/ruby/missing.h (__syscall): moved to...
- * io.c: here. because __syscall() is only used from io.c.
+ * intern.h (is_ruby_native_thread): removed since declared as an int
+ function in ruby.h already.
- * include/ruby/missing.h: move "#include <sys/type.h>" to ....
- * include/ruby/intern.h: here. because it was introduced for
- fixing NFDBITS issue. [ruby-core:05179].
+Thu Aug 16 07:40:41 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 28 19:01:54 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * file.c (rb_file_s_rename): deleted code to get rid of a bug of
+ old Cygwin.
- * include/ruby/missing.h (struct timespec): include <sys/time.h>
+ * file.c (rb_file_truncate): added prototype of GetLastError()
+ on cygwin. [ruby-dev:31239]
-Thu Mar 28 19:01:54 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * intern.h (is_ruby_native_thread): prototype.
- * configure.in: check struct timeval exist or not.
- * include/ruby/missing.h (struct timeval): check HAVE_STRUCT_TIMEVAL
- properly. and don't include sys/time.h if struct timeval exist.
+ * missing/strftime.c (strftime): fix printf format and actual
+ arguments.
- * file.c: include sys/time.h explicitly.
- * random.c: ditto.
- * thread_pthread.c: ditto.
- * time.c: ditto.
- * ext/date/date_strftime.c: ditto.
+ * ext/Win32API/Win32API.c (Win32API_initialize): ditto.
-Thu Mar 28 18:54:31 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/tcltklib.c (ip_finalize): ditto.
- * regcomp.c (optimize_node_left, set_optimize_info_from_tree): right
- handling for look behind anchor.
+ * ext/dl/ptr.c (rb_dlptr_inspect): ditto. [ruby-dev:31268]
- * regexec.c (onig_search): ditto.
- [Backport #8076]
+ * ext/dl/sym.c (rb_dlsym_inspect): ditto.
- this patch is derived from Onigmo base tree.
+ * ext/socket/getnameinfo.c: include stdio.h always.
-Thu Mar 28 18:35:01 2013 Luis Lavena <luislavena@gmail.com>
+ * ext/win32ole/win32ole.c (ole_hresult2msg, folevariable_name,
+ folevariable_ole_type, folevariable_ole_type_detail,
+ folevariable_value, folemethod_visible): missing return value.
- * win32/file.c (get_user_from_path): add internal function that retrieves
- username from supplied path (refactored).
- * win32/file.c (rb_file_expand_path_internal): refactor expansion of user
- home to use get_user_from_path and cover dir_string corner cases.
- [ruby-core:53168] [Bug #8034]
+Thu Aug 16 07:32:13 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 28 18:35:01 2013 Luis Lavena <luislavena@gmail.com>
+ * lib/mkmf.rb (create_makefile): make OBJS depend on RUBY_EXTCONF_H
+ only if extconf.h is created.
- * win32/file.c (rb_file_expand_path_internal): Expand home directory when
- used as second parameter (dir_string). [ruby-core:53168] [Bug #8034]
- * test/ruby/test_file_exhaustive.rb: add test to verify.
+Thu Aug 16 07:29:33 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 28 18:18:49 2013 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * {win32,wince,bcc32}/setup.mak (-version-): no RUBY_EXTERN magic.
- * ext/openssl/ossl_asn1.c: raise TypeError when trying to encode nil
- values for Primitive instances.
- * test/openssl/test_asn1.rb: Assert consistent behavior when
- encoding nil values: Primitives raise TypeError, Constructives
- raise NoMethodError.
- Fixes [ruby-core:43009][Bug #6102]
+Thu Aug 16 06:43:03 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 28 18:14:41 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (init_mkmf): should remove mkmf.log too.
- * tool/mkconfig.rb: reconstruct comma separated list values. a
- command line to Windows batch file is split not only by spaces
- and equal signs but also by commas and semicolons.
+Thu Aug 16 06:40:58 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 28 18:13:38 2013 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_config.c (ossl_config_set_section): do not
+ initialize aggregations with dynamic values. [ruby-talk:259306]
- * string.c (str_byte_substr): don't set coderange if it's not known.
- [Bug #7954] [ruby-dev:47108]
+Thu Aug 16 06:39:19 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 28 18:12:19 2013 Kouhei Sutou <kou@cozmixng.org>
+ * eval.c (get_backtrace): check the result more.
+ [ruby-dev:31261] [ruby-bugs-12398]
- * lib/rexml/document.rb: move entity_expansion_text_limit accessor to ...
- * lib/rexml/rexml.rb: ... here to make rexml/text independent from
- REXML::Document. It causes circular require.
- * lib/rexml/document.rb (REXML::Document.entity_expansion_text_limit):
- deprecated.
- * lib/rexml/document.rb (REXML::Document.entity_expansion_text_limit=):
- deprecated.
- * lib/rexml/text.rb: add missing require "rexml/rexml" for
- REXML.entity_expansion_text_limit.
- Reported by Robert Ulejczyk. Thanks!!! [ruby-core:52895] [Bug #7961]
+Thu Aug 16 06:32:25 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 21 20:34:52 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * bignum.c (rb_big_lshift, rb_big_rshift): separated functions
+ to get rid of infinite recursion. fixed calculation in edge
+ cases. [ruby-dev:31244]
- * test/win32ole/test_err_in_callback.rb (TestErrInCallBack#setup):
- allow using different root for source and build directories.
- this may fixes a minor problem of r39834.
+ * numeric.c (rb_fix_lshift, rb_fix_rshift): ditto.
-Thu Mar 21 20:34:52 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Aug 16 06:26:58 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/win32ole/test_err_in_callback.rb (TestErrInCallBack#setup): use
- relative path to get rid of "too long commandline" error.
+ * bignum.c (rb_big_pow): refine overflow check. [ruby-dev:31242]
-Thu Mar 21 20:34:52 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Aug 16 06:25:48 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/win32ole/test_err_in_callback.rb
- (TestErrInCallBack#test_err_in_callback): shouldn't create a file in
- the top of build directory.
+ * time.c (time_succ): Time#succ should return a time object in the
+ same timezone mode to the original. [ruby-talk:260256]
-Tue Feb 26 09:53:59 2013 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Aug 16 06:24:39 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * st.c (st_add_direct): int is not always same with st_index_t. some
- version of clang reports error.
+ * numeric.c (fix_pow): integer power calculation: 0**n => 0,
+ 1**n => 1, -1**n => 1 (n: even) / -1 (n: odd).
- * thread.c (vm_living_thread_num): ditto.
- reported by d6rkaiz (Isao Sugimoto) at [ruby-dev:47096]
- [Backport #7946]
+Thu Aug 16 06:11:34 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Feb 22 18:36:51 2013 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/base64.rb (Base64::b64encode): should not specify /o option
+ for regular expression. [ruby-dev:31221]
- * lib/rexml/document.rb (REXML::Document.entity_expansion_text_limit):
- new attribute to read/write entity expansion text limit. the default
- limit is 10Kb.
+Thu Aug 16 06:08:53 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rexml/text.rb (REXML::Text.unnormalize): check above attribute.
+ * sprintf.c (rb_f_sprintf): more checks for format argument.
+ [ruby-core:11569], [ruby-core:11570], [ruby-core:11571],
+ [ruby-core:11573]
-Fri Feb 22 14:48:15 2013 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Aug 16 05:39:31 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm.c (vm_exec): get rid of a SEGV when calling rb_iter_break() from
- some extention libraries. [Backport #7896] [ruby-core:52607]
+ * bignum.c (bignorm): do not empty Bignum. [ruby-dev:31229]
-Fri Feb 22 14:40:57 2013 Narihiro Nakamura <authornari@gmail.com>
+Thu Aug 16 05:12:05 2007 pegacorn <subscriber.jp AT gmail.com>
- * gc.c : remove a unused function.
+ * ext/openssl/ossl.h: include ossl_pkcs5.h. [ruby-dev:31231]
-Fri Feb 22 14:40:57 2013 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_pkcs5.h: new file for PKCS5. [ruby-dev:31231]
- * regparse.c (onig_number_of_names): suppress a warning.
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_s): use ossl_raise()
+ instead of rb_raise(). [ruby-dev:31222]
-Fri Feb 22 14:40:57 2013 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/sdbm/_sdbm.c: DOSISH platforms need io.h. [ruby-dev:31232]
- * vm_insnhelper.c (vm_call_cfunc): remove useless hack.
+ * ext/syck/syck.h: include stdlib.h for malloc() and free().
+ [ruby-dev:31232]
-Fri Feb 22 14:40:57 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/syck.h (syck_parser_set_input_type): prototype added.
+ [ruby-dev:31231]
- * vm_insnhelper.c (vm_call_cfunc): suppress a warning. note that
- `volatile type *var' doesn't make var itself volatile.
+ * win32/win32.c: include mbstring.h for _mbspbrk(). [ruby-dev:31232]
-Fri Feb 22 14:28:17 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32.h (rb_w32_getcwd): prototype added. [ruby-dev:31232]
- * eval_jump.c (rb_exec_end_proc): remember the latest exit status.
- [ruby-core:43173][Bug #5218]
+Thu Aug 16 05:02:39 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Feb 22 14:25:57 2013 NARUSE, Yui <naruse@ruby-lang.org>
+ * bignum.c (rb_cstr_to_inum): check leading non-digits.
+ [ruby-core:11691]
- * ext/readline/readline.c (Init_readline): don't set 0 to
- rl_catch_signals and rl_catch_sigwinch. [Bug #5423]
+Thu Aug 16 05:00:01 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Feb 13 16:18:22 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+ * numeric.c (fix_pow): 0**2 should not raise floating point
+ exception. [ruby-dev:31216]
- * ext/json: Import JSON 1.5.5.
+Thu Aug 16 04:56:35 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Feb 6 17:39:19 2013 Eric Hodel <drbrain@segment7.net>
+ * win32/win32.c (CreateChild): enclose command line except for
+ command.com which can not handle quotes. [ruby-talk:258939]
- * lib/rdoc: Import RDoc 3.9.5.
+Thu Aug 16 04:54:45 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Feb 6 14:27:25 2013 Shugo Maeda <shugo@ruby-lang.org>
+ * lib/mkmf.rb (link_command, cc_command, cpp_command): do not expand
+ ::CONFIG which is an alias of MAKEFILE_CONFIG.
- * ext/socket/raddrinfo.c (rsock_unix_sockaddr_len): return
- sizeof(sa_familiy_t) if path is empty. see "Autobind Feature" in
- unix(7) for details.
+Thu Aug 16 04:53:21 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/lib/socket.rb (unix_socket_abstract_name?): treat an
- empty path as an abstract name.
+ * struct.c (rb_struct_init_copy): disallow changing the size.
+ [ruby-dev:31168]
- * test/socket/test_unix.rb: related test.
+Thu Aug 16 04:52:11 2007 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/socket/unixsocket.c (rsock_init_unixsock): use rb_inspect()
- because rb_sys_fail_str() fails if its argument contains NUL.
+ * random.c: documentation fix. srand(0) initializes PRNG with '0',
+ not with random_seed.
- * test/socket/test_unix.rb: related test.
+Thu Aug 16 04:49:10 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c (sock_s_pack_sockaddr_un): calculate the
- correct address length of an abstract socket.
+ * bcc32/{Makefile.sub,setup.mak}: remove surplus slash from srcdir.
- * test/socket/test_unix.rb: related test.
+Thu Aug 16 04:40:37 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/raddrinfo (rsock_unix_sockaddr_len): renamed from
- rsock_unixpath_len, because it returns not the length of the path,
- but the length of a socket address for the path.
+ * sprintf.c (rb_f_sprintf): sign bit extension should not be done
+ if FPLUS flag is specified. [ruby-list:39224]
- * ext/socket/raddrinfo.c (rsock_unixpath_len, init_unix_addrinfo),
- ext/socket/unixsocket.c (unixsock_connect_internal,
- rsock_init_unixsock): calculate the correct address length of
- an abstract socket. Without this fix, sizeof(struct sockaddr_un)
- is specified as the length of an abstract socket for bind(2) or
- connect(2), so the address of the socket is filled with extra NUL
- characters. See unix(7) for details.
+Thu Aug 16 04:39:15 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/socket/lib/socket.rb (unix_server_socket): don't access the
- file system if the platform is Linux and path starts with NUL,
- which means that the socket is an abstract socket.
+ * array.c (rb_ary_initialize): should call rb_ary_modify() first.
+ [ruby-core:11562]
- * test/socket/test_unix.rb: related test.
+Thu Aug 16 04:38:39 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c (sock_s_pack_sockaddr_un): support the longest
- path in sockaddr_un, really.
- reported by nagachika.
- http://d.hatena.ne.jp/nagachika/20120426/ruby_trunk_changes_35474_35476
+ * parse.y (yylex): return non-valid token for an invalid
+ instance/class variable name. a patch from from Yusuke ENDOH
+ <mame AT tsg.ne.jp>. [ruby-dev:31095]
- * ext/socket/raddrinfo.c (init_unix_addrinfo): support the longest
- path in sockaddr_un.
- (inspect_sockaddr): ditto.
- (addrinfo_mdump): ditto.
- (addrinfo_mload): ditto.
- (rsock_unixpath_str): new function.
- (rsock_unixpath): removed.
- (rsock_unixaddr): use rsock_unixpath_str.
+Thu Aug 16 04:36:41 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c (sock_s_pack_sockaddr_un): support the longest
- path in sockaddr_un.
- (sock_s_unpack_sockaddr_un): ditto.
- (sock_s_gethostbyaddr): unused variable removed.
+ * parse.y (dsym): return non-null NODE even if yyerror(). based on a
+ patch from from Yusuke ENDOH <mame AT tsg.ne.jp>. [ruby-dev:31085]
- * ext/socket/unixsocket.c (rsock_init_unixsock): support the longest
- path in sockaddr_un.
+Thu Aug 16 04:34:56 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/rubysocket.h (rsock_unixpath_str): declared.
- (rsock_unixpath): removed.
+ * process.c (proc_exec_v, rb_proc_exec): preserve errno.
- * test/socket/test_unix.rb: comment out test_nul because abstract unix
- sockets may contain NULs.
+Thu Aug 16 04:30:45 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Feb 6 14:20:12 2013 Tanaka Akira <akr@fsij.org>
+ * variable.c (rb_path2class): get rid of dangling pointer caused by
+ optimized out value.
- * ext/socket/basicsocket.c (bsock_getsockname): ignore truncated
- part of socket address.
- (bsock_getpeername): ditto.
- (bsock_local_address): ditto.
- (bsock_remote_address): ditto.
+Thu Aug 16 04:24:28 2007 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/socket/unixsocket.c (unix_path): ditto.
- (unix_addr): ditto.
- (unix_peeraddr): ditto.
+ * ext/dl/lib/dl/win32.rb: seems that dl doesn't accept void argument.
+ fixed [ruby-bugs:PR#5489].
- * ext/socket/init.c (cloexec_accept): ditto.
+Thu Aug 16 04:23:44 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Feb 6 14:19:07 2013 Kouhei Sutou <kou@cozmixng.org>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser): handle more
+ extensions. [ruby-dev:30972]
- * lib/rexml/parsers/baseparser.rb, test/rexml/test_comment.rb:
- allow a single hyphen in comment. [Bug #5278] [ruby-core:39289]
- Reported by Thomas Fritzsche. Thanks!!!
+Thu Aug 16 04:14:17 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Feb 6 14:14:38 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (ruby_setreuid, ruby_setregid): rename to get rid of name
+ clash.
+Thu Aug 16 04:11:17 2007 Ryan Davis <ryand@zenspider.com>
- * file.c (realpath_rec): prevent link from GC while link_names refers
- the content.
+ * lib/rexml/dtd/dtd.rb: Fixed typo in code. Fixes bug #10420
-Wed Feb 6 14:13:25 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 16 04:08:20 2007 Shugo Maeda <shugo@ruby-lang.org>
- * missing/setproctitle.c (environ): use (*_NSGetEnviron()) instead of
- environ on Darwin for namespace cleanness, same as [ruby-core:00537].
- [ruby-core:45615] [Bug #6576]
+ * lib/net/imap.rb (ResponseParser#next_token): fixed
+ error message. (backported from HEAD)
-Wed Feb 6 14:05:09 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/imap.rb (ResponseParser#parse_error): fixed
+ the condition not to refer @token.symbol unexpectedly.
+ Thanks, Dick Monahan. (backported from HEAD)
- * dir.c (glob_make_pattern): names under recursive need to be single
- basenames to match for each name. [ruby-core:47418] [Bug #6977]
+Thu Aug 16 04:05:20 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Jan 15 16:30:29 2013 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * marshal.c (w_extended): erroneous check condition when dump
+ method is defined. [ruby-core:10646]
- * thread_pthread.c (gvl_init): Reset gvl.wait_yield explicitly when
- fork()ing. Patch by Apollon Oikonomopoulos. Thanks!
- [Bug #7693][ruby-core:51424]
+Sat Jun 9 10:40:00 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-Tue Jan 15 16:25:35 2013 Narihiro Nakamura <authornari@gmail.com>
+ * stable version 1.8.5-p52 released.
- * gc.c (rb_objspace_call_finalizer): finalize_deferred may free up
- a object which is reachable from a part after this function,
- e.g. ruby_vm_destruct(). [ruby-dev:46647] [Bug #7452]
+Thu Jun 7 14:53:46 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
- * test/ruby/test_gc.rb (test_finalizing_main_thread): add a test
- for above.
+ * eval.c (method_inspect): show proper class name.
+ [ruby-talk:248647], Thanks Calamitas.
-Tue Jan 15 16:23:30 2013 NARUSE, Yui <naruse@ruby-lang.org>
+Mon May 28 19:37:24 2007 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/net/protocol.rb (Net::InternetMessageIO#each_crlf_line):
- treat \r as newline as mame pointed. [ruby-dev:46425] [Bug #7278]
+ * win32/win32.c (move_to_next_entry): revert r12338. not necessary
+ on ruby_1_8_5.
-Tue Jan 15 16:23:30 2013 NARUSE, Yui <naruse@ruby-lang.org>
+Sun May 27 05:52:37 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
- * lib/net/protocol.rb (Net::InternetMessageIO#each_crlf_line):
- don't use /n in universal regexp. [ruby-dev:46394] [Bug #7278]
+ * eval.c (mnew): call of super via a method object should work again.
+ [ruby-talk:248647], Thanks Calamitas.
-Tue Jan 15 16:13:47 2013 Kenta Murata <mrkn@mrkn.jp>
+ * test/ruby/test_method.rb (TestMethod::test_method_super): test for
+ above fix.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_to_s): use CRuby style.
+Wed May 23 06:51:46 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-Tue Jan 15 16:13:47 2013 Kenta Murata <mrkn@mrkn.jp>
+ * lib/cgi.rb (CGI#[]): get rid of exceptions being raised.
+ [ruby-dev:30740], Thanks Kentaro KAWAMOTO.
- * ext/bigdecimal/bigdecimal.c: use `RB_TYPE_P(x, t)` instead of
- `TYPE(x) == t`.
+Wed May 23 06:14:15 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jan 15 16:13:47 2013 Kenta Murata <mrkn@mrkn.jp>
+ * win32/win32.c (move_to_next_entry): loc also must move forward.
+ [ruby-talk:251987]
- * ext/bigdecimal/bigdecimal.c (BigDecimal_sub):
- need to specify precision for converting Rational and Float.
- [ruby-dev:46544] [Bug #7404]
+Wed May 23 05:55:04 2007 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_mult): ditto.
+ * win32/win32.c (init_stdhandle): stderr should be without buffering,
+ but mswin32 use buffering when stderr is not connected to tty.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_divide): ditto.
+Wed May 23 03:33:55 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_DoDivmod): ditto.
+ * lib/monitor.rb (ConditionVariable#wait, mon_enter, mon_exit_for_cond):
+ ensures Thread.critical to be false. [ruby-talk:248300]
- * ext/bigdecimal/bigdecimal.c (BigDecimal_divremain): ditto.
+Wed May 23 03:25:13 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb: add tests for the above fixes.
+ * util.c (ruby_strtod): exponent is radix 10. [ruby-talk:248272]
-Tue Jan 15 16:03:30 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed May 23 02:09:32 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * tool/mkconfig.rb: use configured libdir value to fix
- --enable-load-relative on systems where libdir is not default value,
- overridden in config.site files. [ruby-core:47267] [Bug #6903]
+ * eval.c (rb_yield_0): should not clear state on TAG_NEXT when
+ it's invoked from within lambda body. [ruby-talk:248136]
-Tue Jan 15 15:55:09 2013 Eric Hodel <drbrain@segment7.net>
+ * eval.c (proc_invoke): handle TAG_NEXT which would be caused by
+ next in the lambda body as well.
- * object.c (Init_Object): Added RDoc location pointers for
- Kernel#methods, Kernel#protected_methods, Kernel#private_methods and
- Kernel#public_methods. [Bug #6666]
+Wed May 23 01:55:49 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Jan 11 17:12:44 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_fclose, rb_w32_close): need to save errno
+ before calling original fclose()/close().
- * vm_core.h (rb_iseq_t): move flip_cnt from struct iseq_compile_data,
- because it has same life span as enclosing iseq. [Bug #7671]
- [ruby-core:51296]
+Wed May 23 01:42:29 2007 Shugo Maeda <shugo@ruby-lang.org>
-Fri Jan 11 17:11:26 2013 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/net/imap.rb (disconnect): call shutdown for
+ SSLSocket. Thanks, Technorama Ltd.
- * lib/mkmf.rb: add dummy clean-static target to prevent errors for the
- case real clean-static target doesn't exist.
+Wed May 23 01:28:14 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jan 11 17:02:59 2013 Koichi Sasada <ko1@atdot.net>
+ * error.c (rb_notimplement), io.c (pipe_open): removed definite
+ articles and UNIX manual section from messages. [ruby-dev:30690]
- * vm_exec.h (GENTRY): GENTRY should be pointer size.
- A patch by yoshidam (Yoshida Masato) [Bug #7332].
+ * io.c (pipe_open): raise NotImplementedError for command "-" on
+ platforms where fork(2) is not available. [ruby-dev:30681]
-Fri Jan 11 16:57:31 2013 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed May 23 00:06:19 2007 NAKAMURA Usaku <usa@ruby-lang.org>
- * vm_trace.c (rb_threadptr_exec_event_hooks): added a parameter to pop
- a frame before JUMP_TAG() if exception occurred. This change fix bug
- of Ruby 1.9. [ruby-core:51128] [ruby-trunk - Bug #7624]
+ * ext/socket/socket.c (s_recv, s_recvfrom): some systems (such as
+ windows) doesn't set fromlen if the socket is connection-oriented.
+ reported by Bram Whillock in [ruby-core:10512] [ruby-Bugs#9061]
- * vm_core.h (EXEC_EVENT_HOOK_AND_POP_FRAME): add to use
- `rb_threadptr_exec_event_hooks()' with the pop flag.
+Tue Mar 20 15:37:24 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
- * vm.c (vm_exec): use EXEC_EVENT_HOOK_AND_POP_FRAME() while exception
- handling. While exception hadnling, if an exception is raised in
- hooks, need to pop current frame and raise this raised exception by
- hook.
+ * distruby.rb: Add zip generation.
- * bootstraptest/test_flow.rb: add a test.
+Fri Mar 16 21:48:11 2007 Akinori MUSHA <knu@iDaemons.org>
-Mon Jan 7 15:50:25 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dl/dl.c (rb_ary2cary): Fix a bug in type validation;
+ submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
+ in [ruby-dev:30554].
- * vm.c (rb_vm_make_proc): save the proc made from the given block so
- that it will not get collected. [ruby-core:50545] [Bug #7507]
+Fri Mar 16 18:28:06 2007 Akinori MUSHA <knu@iDaemons.org>
-Tue Dec 25 23:35:09 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/etc/etc.c (etc_getgrgid): Fix a bug in Etc::getgrgid()
+ always returning the (real) group entry of the running process;
+ reported by: UEDA Hiroyuki <ueda AT netforest.ad.jp>
+ in [ruby-dev:30586].
- * lib/mkmf.rb: fix for if config["libdir"] is nil.
+Wed Mar 14 12:30:00 2007 Shigeo Kobayashi <shigeo@tinyforest.jp>
-Tue Dec 25 20:40:47 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c: BigDecimal("-.31") is now
+ treated as ("-0.31") not as ("0.31").
- * bignum.c, include/ruby/intern.h (rb_big_eql): exported.
+Fri Mar 16 18:05:40 2007 Akinori MUSHA <knu@iDaemons.org>
- * thread.c (recursive_check): object_id maybe a Bignum, not Fixnum on
- LLP64. see also r38493 and r38548.
- reported by Heesob Park at [ruby-core:51083] [Bug #7607], and patched
- by shirosaki at [ruby-core:51095]
+ * lib/cgi.rb (CGI::header): IIS >= 5.0 does not need the nph
+ assumption any more; submitted by MIYASAKA Masaru <alkaid AT
+ coral.ocn.ne.jp> in [ruby-dev:30537].
-Tue Dec 25 09:54:31 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Tue Mar 13 17:29:43 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
- * gc.c (obj_id_to_ref): add a macro to treat Bignum object id.
- This follows the change r38493.
+ * stable version 1.8.5-p35 released.
- * gc.c (id2ref): fix for working fine with Bignum object id on x64
- Windows.
- * gc.c (wmap_finalize): ditto.
+Tue Mar 13 14:42:10 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-Sat Dec 22 00:33:28 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/fileutils/fileasserts.rb: Fix wrong error message.
- * object.c (rb_obj_hash): shouldn't assume object_id can be long.
- based on a patch by Heesob Park at [ruby-core:51060].
- cf. [Backport #7454]
+ * lib/fileutils.rb (FileUtils::mv): Type Error; should utilize
+ Strings instead of Symbols here.
-Sat Dec 22 00:33:28 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Mar 12 17:22:44 2007 NAKAMURA Usaku <usa@ruby-lang.org>
- * gc.c (nonspecial_obj_id): VALUE is not compatible with Fixnum on
- LLP64 platform, such as 64bit Windows.
- reporeted by Heesob Park at [ruby-core:50255] [Bug #7454], and the
- fix is suggested by akr.
+ * lib/fileutils.rb (FileUtils::mv): fix incomplete backport of
+ FileUtils.mv changes at r11988
-Fri Dec 21 16:03:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Mar 12 16:09:28 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_argf.rb (TestArgf#test_chars): since marshal data is
- binary, shouldn't pass via text mode. use base64 encoded data.
+ * mkconfig.rb (patchlevel): read from version.h.
-Thu Dec 13 23:10:52 Charlie Somerville <charlie@charliesomerville.com>
- * object.c (Init_Object): use rb_mod_init_copy for Class#initialize_copy
- * class.c (rb_class_init_copy): rename to class_init_copy_check, performs type
- checks on arguments to prevent reinitialization of initialized class
- [ruby-core:50869] [Bug #7557]
- * class.c (rb_mod_init_copy): use class_init_copy_check if receiver is T_CLASS
- * test/ruby/test_class.rb (class TestClass): related test
+Sun Mar 11 18:57:50 2007 Akinori MUSHA <knu@iDaemons.org>
+ * misc/README: Add a note about ruby-electric.el.
-Thu Dec 20 18:46:17 2012 Naohisa Goto <ngotogenome@gmail.com>
+ * misc/ruby-mode.el (ruby-non-block-do-re): Fix
+ ruby-non-block-do-re. [ruby-core:03719]
- * test/dl/test_func.rb (test_name_with_block, test_bind, test_qsort1):
- call unbind to release the callback closure because maximum number
- of callbacks is limited to DL::MAX_CALLBACK (== 5) with pure DL
- without Fiddle.
+ * misc/inf-ruby.el: Synchronize the comment section with trunk.
-Thu Dec 20 18:46:17 2012 Naohisa Goto <ngotogenome@gmail.com>
+ * misc/README, misc/rdebug.el: Add rdebug.el, Emacs ruby-debug
+ interface based on rubydb3x.el; submitted by Martin Nordholts
+ <enselic AT gmail.com> in [ruby-bugs:PR#9023].
- * ext/dl/lib/dl/func.rb (DL::Function#unbind, #bound?): suppress
- NoMethodError when Fiddle is available. [ruby-core:50756] [Bug #7543]
- * test/dl/test_func.rb (test_bound*, test_unbind*): tests for the above.
+Sun Mar 11 17:45:51 2007 Akinori MUSHA <knu@iDaemons.org>
-Thu Dec 20 18:46:17 2012 Naohisa Goto <ngotogenome@gmail.com>
+ * ext/dl/mkcallback.rb (mkfunc): Make sure that a callback
+ function is found in the function table before trying to call
+ it; submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
+ in [ruby-dev:30524].
- * ext/dl/lib/dl/func.rb (DL::Function#initialize, DL::Function#bind):
- ABI should be set by using CFunc#calltype even when Fiddle is used.
- When Fiddle is used and a block is given, name shoud not be ignored.
- [ruby-core:50562] [Bug #7514]
+Tue Mar 6 18:58:37 2007 Keiju Ishitsuka <keiju@ruby-lang.org>
+
+ * lib/shell/process-controller.rb: fix thread synchronization
+ problem for [ruby-dev:30477].
+
+Sun Mar 4 23:53:27 2007 Minero Aoki <aamine@loveruby.net>
- * ext/dl/lib/dl/import.rb (DL::Importer#bind_function): should respect
- abi and name when Fiddle is used.
+ * lib/fileutils.rb (mv): could not move a directory between
+ different filesystems. [ruby-dev:30411]
- * test/dl/test_func.rb (test_name_with_block): test for "name" method
- with giving a block.
+Sat Mar 3 21:41:31 2007 Akinori MUSHA <knu@iDaemons.org>
-Thu Dec 20 18:43:00 2012 Naohisa Goto <ngotogenome@gmail.com>
+ * eval.c (stack_check): Unset inline to fix build with GCC 3.4.6;
+ submitted by: NISHIMATSU Takeshi <t_nissie AT yahoo.co.jp> in
+ [ruby-list:43218].
+ cf. http://gcc.gnu.org/bugzilla/show_bug.cgi?id=24556
- * ext/fiddle/extconf.rb, ext/fiddle/function.c
- (Fiddle::Function::STDCALL): FFI_STDCALL is not a macro, but an
- enumeration. [ruby-core:50398] [Bug #7483]
+Sat Mar 3 16:30:39 2007 Akinori MUSHA <knu@iDaemons.org>
-Thu Dec 20 18:40:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * env.h (SCOPE_CLONE): Introduce a new scope flag to prevent a
+ local_tbl region from getting freed many times; submitted by
+ Chikanaga Tomoyuki <chikanag AT nippon-control-system.co.jp> in
+ [ruby-dev:30460].
- * thread.c (exec_event_hooks): exceptions in event hooks should not
- propagate outside.
+ * eval.c (proc_invoke): Ditto.
-Thu Dec 20 18:37:45 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * gc.c (obj_free): Ditto.
- * test/ruby/test_m17n_comb.rb (test_str_crypt): Use RbConfig to get
- libc's directory. Patched by Vit Ondruch [ruby-core:49763] [Bug #7312]
+ * parse.y (top_local_setup_gen): Ditto.
-Thu Dec 20 18:37:45 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Mar 3 15:41:33 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (rb_str_crypt): crypt(3) may return NULL.
- Latest glibc (2.16?) crypt(3) actually returns NULL. [Bug #7312]
+ * parse.y (stmt, arg): should not omit lhs of OP_ASGN1 even if
+ empty. [ruby-dev:30452]
-Thu Dec 20 18:36:19 2012 Naohisa Goto <ngotogenome@gmail.com>
+Wed Feb 28 20:51:32 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
- * ext/dl/lib/dl/func.rb (DL::Function#bind): When Fiddle is used,
- @ptr should be updated. This fixes SEGV raised in DL::Function#call
- after calling DL::Function#bind. [Bug #7516] [ruby-dev:46708]
+ * pack.c (pack_unpack): properly ignore non-base64 octets such as
+ UTF-8 encoded BOMs; submitted by SOUMA Yutaka <holon@radastery.jp>
+ to fix [ruby-core:10437]
- * test/dl/test_func.rb (test_bind): test for the above
+Wed Feb 28 00:08:11 2007 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-Thu Dec 20 18:35:36 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * mkconfig.rb (RbConfig): add CONFIG['PATCHLEVEL']
- * gc.h (SET_MACHINE_STACK_END): add volatile for preventing
- harmful optimization. [ruby-dev:46665] [Bug #7468]
+ * common.mk: new target dist
-Thu Dec 20 18:34:38 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * distruby.rb: new file
- * compile.c (ADD_CATCH_ENTRY): add a cast to fix SEGV with x64 mingw
- on Windows 8. Without cast, 0 might be non zero value at higher bits
- in rb_ary_new3().
- [ruby-core:50258] [Bug #7456]
+Tue Feb 27 21:19:35 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Dec 19 21:24:40 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/win32.c (set_pioinfo_extra): new function for VC++8 SP1
+ workaround. [ruby-core:10259]
- * io.c (argf_each_codepoint): add missing ARGF#codepoints [Bug #7438]
+ * win32/win32.c (NtInitialize): call above function.
-Wed Dec 19 21:20:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Feb 26 09:57:58 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (file_expand_path): use wcscasecmp().
+ * signal.c (ruby_signal): don't set SA_RESTART. a backport from
+ the HEAD. [ruby-talk:220937] [ruby-talk:147220]
-Wed Dec 19 21:15:29 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Feb 13 02:21:12 2007 Sam Roberts <sroberts@uniserve.com>
- * parse.y (parser_yylex): fix false usage of local variable, it cannot
- appear in fname state [ruby-core:49659] [Bug #7408]
+ * io.c (rb_f_syscall): Fix buffer overflow with syscall
+ arguments. [ruby-bugs:PR#8541]
-Wed Dec 19 21:14:28 2012 Narihiro Nakamura <authornari@gmail.com>
+Sat Feb 10 09:33:47 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * gc.c: return true or false. Patch by Dirkjan Bussink. [Bug #6821]
+ * ext/win32ole/win32ole.c (ole_variant2val): sorry, fix the enbug.
- * test/ruby/test_gc.rb: add test-case for this bug.
+Sat Feb 10 09:08:01 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Wed Dec 19 21:12:49 2012 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/win32ole/win32ole.c (ole_variant2val): fix compile error
+ on VC++.
- * marshal.c (r_entry0): don't taint classes and modules because
- Marshal.load just returns the dumped classes and modules.
- [Bug #7325] [ruby-core:49198]
+Sat Feb 10 08:38:30 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * test/ruby/test_marshal.rb: related test.
+ * ext/win32ole/win32ole.c (ole_variant2val): fix the bug when
+ SAFEARRAY pointer is NULL.
-Tue Dec 11 19:19:33 2012 Luis Lavena <luislavena@gmail.com>
+Tue Feb 6 20:41:39 2007 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/file.c (replace_to_long_name): correct logic around wildcard
- characters detection and ensure wide-chars are used as pattern.
- [ruby-core:49451] [Bug #7374]
+ * string.c (rb_str_sub_bang): calling rb_str_modify() should be just
+ before actually modifying the string.
+ fixed: [ruby-dev:30211] (originally reported by zunda)
-Sat Nov 17 21:45:12 Luis Lavena <luislavena@gmail.com>
+Sat Jan 27 15:20:11 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/file.c (replace_to_long_name): skip expansion for all wildcard
- characters.
- [ruby-core:49451] [Bug #7374]
+ * parse.y (dyna_var_lookup): should not alter dvar->val not to
+ destroy living value. [ruby-core:10076]
- * test/ruby/test_file_exhaustive.rb: add more assertions to test.
+ * parse.y (dyna_init): ditto.
-Tue Dec 11 19:19:33 2012 Luis Lavena <luislavena@gmail.com>
+Wed Jan 24 18:05:39 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/file.c (replace_to_long_name): skip automatic path expansion
- when wildcard character is used. [ruby-core:49451] [Bug #7374]
+ * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): fix
+ regexp font-lock bug. [ruby-talk:235758]
- * test/ruby/test_file_exhaustive.rb: add a test for above.
+Sun Jan 14 07:26:44 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Tue Dec 11 19:18:12 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/win32ole/win32ole.c (ole_free, ole_type_free,
+ olemethod_free, olevariable_free, oleparam_free,
+ ole_event_free): fix memory leak. [ruby-core:09846]
- * win32/mkexports.rb (each_export): skip garbages generated by VS2012's
- nmake.
- reported and patched by Yoshida Masato at [Bug #7333] [ruby-dev:46484]
+Tue Jan 9 12:29:20 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Dec 11 19:15:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/etc/etc.c (etc_getpwuid, etc_getgrgid): fix to correctly
+ convert uid/gid from VALUE.
- * parse.y (parser_here_document): flush string content between new
- line and :string_embexpr. [ruby-core:48703] [Bug #7255]
+ * ext/etc/etc.c (etc_getpwuid): ditto.
-Tue Dec 11 17:53:55 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 25 20:08:28 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
- * compile.c (iseq_compile_each): count flip-flop state in local iseq
- not in each iseqs, so that the keys can be other than hidden
- strings. [ruby-core:47253] [Bug #6899]
+ * ext/openssl/ossl.h: fixed compilation problem on gcc 3.2.
+ [ruby-talk:214786]
- * vm_insnhelper.c (lep_svar_get, lep_svar_set, vm_getspecial): store
- flip-flop states in an array instead of a hash.
+Mon Dec 25 10:40:40 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
- * iseq.c (set_relation): main iseq also can has local scope.
+ * stable version 1.8.5-p12 released.
-Tue Dec 11 17:52:30 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Dec 16 04:02:10 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * include/ruby/backward/rubysig.h: fix visibility. [Bug #6607]
+ * ext/tk/tcltklib.c: shouldn't run the killed thread at callback.
+ [ruby-talk: 227408]
-Tue Dec 11 17:49:45 2012 Koichi Sasada <ko1@atdot.net>
+Fri Dec 15 17:21:14 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (rb_vm_make_env_object): make Proc object if Env is possible
- to point block. [ruby-core:41038] [ruby-trunk - Bug #5634]
+ * lib/rdoc/ri/ri_options.rb: prevent NameError. [ruby-dev:29597]
- * vm.c (rb_vm_make_proc): No need to make Proc object here.
+Thu Dec 14 23:37:38 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bootstraptest/test_proc.rb: add tests.
+ * dir.c (glob_helper): get rid of possible memory leak.
-Tue Dec 11 17:47:01 2012 Narihiro Nakamura <authornari@gmail.com>
+ * win32/win32.c (cmdglob, rb_w32_cmdvector, rb_w32_opendir,
+ rb_w32_get_environ): not to use GC before initialization.
- * lib/irb/magic-file.rb: set a encoding, which is detected from
- the file to read, to the internal encoding.
- [Bug #4281][ruby-dev:43036]
+Wed Dec 6 19:53:41 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Nov 15 15:17:11 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (SITE_DIR): fixed to emtpy RUBY_SITE_LIB in config.h on
+ NetBSD. fixed: [ruby-dev:29358]
- * gc.c (free_method_entry_i): method entry may be in
- unlinked_method_entry_list. [ruby-core:43383][Bug #6171]
+Mon Dec 4 10:43:46 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Nov 14 20:20:46 2012 Naohisa Goto <ngotogenome@gmail.com>
+ * parse.y (dyna_init_gen): dvar initialization only if dvar is
+ assigned inner block. [ruby-talk:227402]
- * ruby_atomic.h: renamed from atomic.h to avoid header file name
- conflict on Solaris 10. [ruby-dev:46414] [Bug #7287]
+Mon Dec 4 10:22:26 2006 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
- * gc.c, signal.c, vm_core.h, common.mk: reflect the rename from
- atomic.h to ruby_atomic.h.
+ * stable version 1.8.5-p2 released.
-Tue Nov 13 18:13:10 2012 Narihiro Nakamura <authornari@gmail.com>
+Sun Dec 3 17:11:12 2006 Shugo Maeda <shugo@ruby-lang.org>
- * gc.c: Use the non-recursive marking instead of recursion. The
- recursion marking of CRuby needs checking stack overflow and the
- fail-safe system, but these systems not good at partial points,
- for example, marking deep tree structures. [ruby-dev:46184]
- [Feature #7095]
+ * lib/cgi.rb (CGI::QueryExtension::read_multipart): should quote
+ boundary. JVN#84798830
- * configure.in (GC_MARK_STACKFRAME_WORD): removed. It's used by
- checking stack overflow of marking.
+Sun Nov 26 16:36:46 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
- * win32/Makefile.sub (GC_MARK_STACKFRAME_WORD): ditto.
+ * version.h: addition of RUBY_PATCHLEVEL.
+ * version.c: ditto.
- * gc.c (free_stack_chunks): it is used only when per-VM object space
- is enabled.
+Fri Nov 24 10:17:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * gc.c (rb_objspace_call_finalizer): mark self-referencing finalizers
- before run finalizers, to fix SEGV from btest on 32bit.
+ * bignum.c (bignorm): avoid segmentation. a patch from Hiroyuki
+ Ito <ZXB01226@nifty.com>. [ruby-list:43012]
- * gc.c (gc_mark_stacked_objects): extract from gc_marks().
+Thu Nov 2 15:43:39 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * gc.c (rb_objspace_call_finalizer): call gc_mark_stacked_objects
- at suitable point.
+ * parse.y (primary): should set NODE even when compstmt is NULL.
+ merge from trunk. fixed: [ruby-dev:29732]
- * gc.c (init_heap): call init_mark_stack before to allocate
- altstack. This change avoid the stack overflow at the signal
- handler on 32bit, but I don't understand reason... [Feature #7095]
+Sat Sep 23 21:34:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Nov 10 01:25:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/cgi.rb (CGI::QueryExtension::read_multipart): CGI content
+ may be empty. a patch from Jamis Buck <jamis at 37signals.com>.
- * file.c (append_fspath): no need to do encoding trick here.
+Mon Sep 4 21:43:57 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Nov 10 00:37:02 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/dbm/extconf.rb: create makefile according to the result of check
+ for dbm header. fixed: [ruby-dev:29445]
- * siphash.h: check configure macros before include newer headers.
+Tue Aug 29 19:10:10 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Nov 10 00:37:02 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_hash_s_create): fixed memory leak, based on the patch
+ by Kent Sibilev <ksruby at gmail.com>. fixed: [ruby-talk:211233]
- * siphash.c (sip_init_state): use union to suppress warnings by gcc
- 4.7.
+Fri Aug 25 17:15:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Nov 10 00:37:02 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * stable version 1.8.5 released.
- * random.c (rb_memhash): use siphash.
+Fri Aug 25 17:02:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Nov 9 16:17:09 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c (gc_sweep): typo fixed.
- * file.c (append_fspath): revert a part of r37562.
+Tue Aug 22 18:47:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (rb_file_expand_path_internal): ditto.
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_method):
+ rdoc documents C module methods as instance methods. a patch in
+ [ruby-core:08536].
- * file.c (rb_file_expand_path_internal): ignore the encoding of the
- given path name and use filesystem encoding, except when the result
- is 8bit range and the filesystem encoding is US-ASCII.
- [ruby-dev:39393] [Bug #2154]
+Sat Aug 19 14:15:02 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Nov 9 16:15:50 2012 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * win32/Makefile.sub (config.status): include winsock2.h instead of
+ winsock.h when --with-winsock2 is specified.
+ fixed: [ruby-dev:29296]
- * test/csv/test_features.rb: add require for Tempfile.
- * test/csv/test_serialization.rb: ditto.
+Sat Aug 19 11:28:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Nov 9 13:47:45 2012 Luis Lavena <luislavena@gmail.com>
+ * file.c (rb_file_s_rename): use errno if set properly.
+ fixed: [ruby-dev:29293]
- * test/win32ole/test_win32ole.rb (test_s_codepage_changed):
- FileSystemObject only supports ANSI or UTF-16LE encoding.
- Patch by bosko (Bosko Ivanisevic) [ruby-trunk - Bug #6650]
+Sat Aug 19 11:09:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Nov 9 13:16:16 2012 Kenta Murata <mrkn@mrkn.jp>
+ * parse.y (then): remove semicolon warning. [ruby-dev:29299]
- * bignum.c (bigmul0): enable big_mul_toom3.
- [ruby-core:48552] [Bug #7242]
+Thu Aug 17 19:15:16 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bignum.c (bigmul1_toom3): fix incorrect calculation.
- the patch is made by Heesob Park.
- [ruby-core:48552] [Bug #7242]
+ * file.c (rb_stat_[rRwWxX]): check for super user.
+ fixed: [ruby-core:08616]
-Fri Nov 9 13:16:16 2012 Kenta Murata <mrkn@mrkn.jp>
+Thu Aug 17 14:47:06 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bignum.c (bigmul0): disable big_mul_toom3 temporalily.
- [ruby-core:48552] [Bug #7242]
+ * lib/mkmf.rb: added rdoc by Daniel Berger. [ruby-core:08177]
- * test/ruby/test_bignum.rb (test_mul_large_numbers):
- add a test for bigmul1_toom3 suggested in [Bug #7242].
+Thu Aug 17 00:39:05 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Thu Nov 8 17:37:54 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rinda/ring.rb (do_reply): Fix for RingServer fails to find a
+ TupleSpace when TupleSpace resides in the same ruby process with
+ RingServer. a patch from Kent Sibilev. [ruby-core:08453]
- * file.c (append_fspath): filesystem encoding is prior to the encoding
- of argument.
+Wed Aug 16 11:45:36 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * file.c (rb_file_expand_path_internal, EXPAND_PATH_BUFFER): ignore
- the encoding of the given path name, use filesystem encoding always
- instead. [ruby-dev:39393] [Bug #2154]
+ * process.c (proc_setuid, proc_setgid, proc_seteuid, proc_setegid):
+ get rid of bogus implementations on Mac OS X.
- * test/ruby/test_file_exhaustive.rb: removed 2.0 spec tests.
+Tue Aug 15 19:10:18 2006 Eric Hodel <drbrain@segment7.net>
-Thu Nov 8 17:33:53 2012 Luis Lavena <luislavena@gmail.com>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment): Fix
+ broken class-level documentation.
- * ext/zlib/extconf.rb: Recognize zlibwapi as linking library.
- Patch by Daniel Berger.
+Wed Aug 16 11:09:26 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- [ruby-core:44979] [Feature #6421]
+ * ruby.c (set_arg0): fill argv other than the first with an empty
+ string instead of NULL.
-Thu Nov 8 16:17:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Aug 16 11:08:00 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_dir_m17n.rb: remove a garbage.
+ * win32/win32.h: removed an excess macro. fixed: [ruby-dev:29258]
-Thu Nov 8 15:22:09 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Aug 8 23:49:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_dir_m17n.rb: sorry, typo.
+ * lib/irb/extend-command.rb (IRB::ExtendCommandBundle): pacify
+ RDoc. a patch from Eric Hodel <drbrain at segment7.net>.
+ [ruby-core:08522]
-Thu Nov 8 14:50:02 2012 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Tue Aug 8 11:32:54 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/win32ole/test_win32ole_variant.rb: setting WIN32OLE.locale
- to pass some assertion. Thanks to Hiroshi Shirosaki.
- [ruby-core:46873][Bug #6814]
+ * Makefile.in, common.mk, configure.in: fix for platforms without
+ rm. patches from Yutaka kanemoto <kinpoco at gmail.com>.
+ [ruby-dev:29215]
-Thu Nov 8 14:46:17 2012 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Mon Aug 7 17:56:59 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/win32ole/test_win32ole.rb (test_s_codepage_changed):
- FileSystemObject only supports ANSI or UTF-16LE encoding.
- Patch by h.shirosaki (Hiroshi Shirosaki) [ruby-trunk - Bug #6650]
+ * ext/bigdecimal/bigdecimal.c, ext/digest/rmd160/rmd160ossl.c,
+ ext/digest/sha1/sha1ossl.c, ext/readline/readline.c: move
+ incluion of config.h to pacify AIX. a patch from Yutaka
+ Kanemoto <kinpoco at gmail.com>. [ruby-dev:29197]
+Mon Aug 7 15:55:08 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Nov 8 14:43:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/syck/syck.c (syck_move_tokens): should avoid negative
+ memmove. [ruby-list:42625]
- * test/ruby/test_dir_m17n.rb: refactoring. RE should be in the left side
- of the =~ operator, and compare the result with nil is meaningless.
+Mon Aug 7 14:37:48 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Nov 8 14:43:17 2012 Luis Lavena <luislavena@gmail.com>
+ * configure.in, common.mk: AIX link issue. a patch from Yutaka
+ Kanemoto <kinpoco at gmail.com>. [ruby-dev:29190]
- * test/ruby/test_dir_m17n.rb (create_and_check_raw_file_name): add new
- helper method to ease encoding testing. Patch by Oleg Sukhodolsky.
- [ruby-core:46589][Bug #6765]
+ * ext/socket/socket.c: AIX socket support. [ruby-dev:29190]
- * test/ruby/test_dir_m17n.rb (test_filename_extutf8): use filesystem
- encoding when reading entries and comparing.
+Mon Aug 7 12:05:28 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_name): removed.
+ * dln.c, eval.c, gc.c, regex.c, ruby.h: shut up AIX alloca
+ warning. a patch from Yutaka Kanemoto <kinpoco at gmail.com>.
+ [ruby-dev:29191]
- * test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_jp_name): split test.
+Sun Aug 6 20:40:41 2006 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Nov 8 14:16:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/date/format.rb (str[fp]time): %[EO]U didn't denote %U.
- * lib/mkmf.rb (MakeMakefile#timestamp_file): use .-. instead of !, a
- special character of NMAKE and BSD make. [Bug #7265]
+Sat Aug 5 17:07:43 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Nov 8 14:16:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (top_local_setup): local_vars[-1] should point
+ ruby_scope itself to protect local_tbl from garbage collection.
+ [ruby-dev:29049]
- * lib/mkmf.rb (MakeMakefile#timestamp_file): use ! instead of %, a GNU
- make special character.
+Sat Aug 5 13:54:03 2006 Tadayoshi Funaba <tadf@dotrb.org>
-Thu Nov 8 14:16:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/date/format.rb (str[fp]time): "%\n" means "\n".
- * lib/mkmf.rb (create_makefile): use timestamp for destination
- directories to make them before making or copying files there.
- [ruby-dev:46067] [Bug #6904]
+Fri Aug 4 15:21:00 2006 Eric Hodel <drbrain@segment7.net>
-Thu Nov 8 14:13:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib: Merge RDoc and .document from HEAD.
+ * lib/drb/ssl.rb: Close socket on SSLError [ruby-core:7197]
- * configure.in (visibility_option): visibility attribute is not
- available before GCC 4, so do not use -fvisibility option in that
- case. [ruby-core:48147] [Bug #7205]
+Fri Aug 4 19:13:41 2006 Keiju Ishitsuka <keiju@ruby-lang.org>
-Thu Nov 8 14:11:49 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/irb/{init.rb,ruby-lex.rb,slex.rb}: can't input '\c' for
+ [ruby-core: 7122].
- * vm.c (rb_vm_jump_tag_but_local_jump): pass through thrown objects.
- [ruby-dev:46234] [Bug #7185]
+Fri Aug 4 14:02:14 2006 James Edward Gray II <james@grayproductions.net>
- * vm_eval.c (rb_eval_cmd): if state is non-zero, val should be nil and
- rb_vm_jump_tag_but_local_jump() just jump tag.
+ * lib/date/format.rb (__strptime, strftime): allow multi-line patterns
+ in Date#strftime the same as Time#strftime accepts.
+ fixed: [ruby-core:08466]
-Thu Nov 8 14:09:18 2012 Kenta Murata <mrkn@mrkn.jp>
+Fri Aug 4 13:56:51 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_add),
- test/bigdecimal/test_bigdecimal.rb:
- need to specify precision for converting Rational and Float.
- [ruby-core:48045] [Bug #7176]
+ * pack.c (pack_pack): check argument overrun for 'P'. based on a
+ patch by rucila <rucila at yahoo.cojp>. fixed: [ruby-dev:29182]
-Thu Nov 8 14:05:31 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Aug 1 17:44:03 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (has_redirection): should use shell (cmd.exe) when
- the commandline containts '&'.
- reported by Roger Pack at [ruby-core:47912] [Bug #7143], and
- patched by Heesob Park at [ruby-core:47931].
+ * win32/win32.c (init_stdhandle): assign standard file handles.
-Fri Oct 26 17:22:18 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Aug 1 12:24:58 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * file.c (append_fspath): need to set the encoding to result always.
+ * eval.c (Init_Binding): fix old commit miss.
-Fri Oct 26 11:03:46 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jul 31 17:08:20 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
- (rb_enc_path_last_separator, rb_enc_path_end)
- (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
- path handling functions.
+ * win32/win32.c (exit_handler): new function; release winsock and
+ environment work area.
- * file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
- (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
- (rb_file_join): should respect the encodings of arguments than
- file system encoding. [ruby-dev:45145] [Bug #5919]
+ * win32/win32.c (NTInitialize): setup exit_handler.
- * dir.c (check_dirname, ruby_glob0): ditto.
+ * win32/win32.c (StartSockets): use exit_handler.
- * ext/pathname/pathname.c (path_sub_ext): ditto.
+ * win32/win32.c (rb_w32_getenv): use GetEnvironmentStrings() instead
+ of GetEnvironmentVariable(), because the latter cannot distinguish
+ wheather a null environment variable exists or not.
+ fixed: [ruby-talk:205123]
-Fri Oct 26 11:03:46 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jul 31 16:15:13 2006 Tanaka Akira <akr@fsij.org>
- * util.c, include/ruby/util.h (ruby_add_suffix): remove the function.
- [Bug #5153] [ruby-core:38736]
+ * test/ruby/test_process.rb (TestProcess#test_rlimit_nofile):
+ setrlimit may fail with EINVAL.
+ reported by MIYAMUKO Katsuyuki. [ruby-dev:29174]
- * io.c (argf_next_argv): remove the call of above function.
+Mon Jul 31 13:38:22 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/-test-/add_suffix, test/-ext-/test_add_suffix.rb: remove the test
- extension module because this is only for testsing ruby_add_suffix().
+ * lib/webrick/httprequest.rb (WEBrick::HTTPReuqest#parse_uri): improve
+ for the value of IPv6 address in the Host: header field.
- * LEGAL: remove the mention about a part of util.c, because now we
- removed the part.
+Mon Jul 31 09:22:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (argf_next_argv): now the new filename is not guranteed to
- use, so should check the return value of rename(2).
+ * ruby.h: use ifdef (or defined) for macro constants that may or
+ may not be defined to shut up gcc's -Wundef warnings.
+ [ruby-core:08447]
- * test/ruby/test_argf.rb (TestArgf#test_inplace_rename_impossible):
- now we expect same result with other platforms on no_safe_rename
- platforms (=Windows).
+Sun Jul 30 23:26:22 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 25 18:16:25 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_call0): trace call/return of method defined from block.
+ fixed: [ruby-core:08329]
- * lib/rubygems/installer.rb (check_that_user_bin_dir_is_in_path):
- test_generate_bin_bindir_with_user_install_warning(TestGemInstaller)
- fails on Windows with msys bash. It makes comparing paths
- case-insensitive.
- pick from upstream to fix a failure of test-all [ruby-core:47711]
- https://github.com/rubygems/rubygems/commit/c474edb2f3704206f04da1c8c6cf9fb079d84abe
+ * eval.c (rb_trap_eval): make the current thread runnable to deal with
+ exceptions which occurred within the trap. fixed: [ruby-dev:27729]
-Thu Oct 25 17:55:01 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/cgi/session.rb, lib/cgi/session/pstore.rb: suppress warnings.
+ fixed: [ruby-talk:204896]
- * test/etc/test_etc.rb (TestEtc#test_getpwuid): `s' is never set to nil.
+Sat Jul 29 06:12:06 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Oct 25 16:59:17 2012 Luis Lavena <luislavena@gmail.com>
+ * ext/tk/lib/multi-tk.rb: freeze ip_name for security reason.
- * test/ruby/test_file_exhaustive.rb: fix test introduced in r36811 for
- posix environments where HOME is not defined. [ruby-core:47322]
+Sat Jul 29 01:23:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Oct 25 16:59:17 2012 Luis Lavena <luislavena@gmail.com>
+ * lib/logger.rb: improves the amount of documentation that Rdoc
+ picks up when processing logger.rb by moving the require
+ statement back before the comment block. a patch from Hugh
+ Sasse <hgs at dmu.ac.uk>. [ruby-core:08422]
- * configure.in (mingw): add shlwapi to the list of dependency
- libs for Windows.
- * win32/Makefile.sub (EXTSOLIBS): ditto.
+Thu Jul 27 22:21:52 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * internal.h: declare internal functions rb_w32_init_file,
- rb_file_expand_path_internal and rb_file_expand_path_fast.
+ * time.c (time_to_s): fixed format mismatch.
- * file.c (Init_File): invoke Windows initialization rb_w32_init_file
+Thu Jul 27 21:19:54 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/file.c (rb_file_load_path_internal): new function.
- Windows-specific implementation that replaces file_expand_path.
- [Bug #6836][ruby-core:46996]
+ * math.c (domain_check): a new function to check domain error
+ explicitly for systems that return NaN like FreeBSD.
+ [ruby-core:07019]
- * win32/file.c (rb_w32_init_file): new function. Initialize codepage
- cache for faster conversion encodings lookup.
+ * math.c (math_acos, math_asin, math_acosh, math_atanh, math_log,
+ math_log10, math_sqrt): use domain_check().
- * file.c (file_expand_path): rename to rb_file_expand_path_internal.
- Conditionally exclude from Windows.
+ * math.c (math_sqrt): fix documentation flaw.
- * file.c (rb_file_expand_path_fast): new function. delegates to
- rb_file_expand_path_internal without performing a hit to the
- filesystem.
+Thu Jul 27 18:12:12 2006 WATANABE Hirofumi <eban@ruby-lang.org>
- * file.c (file_expand_path_1): use rb_file_expand_path_internal without
- path expansion (used by require).
- * file.c (rb_find_file_ext_safe): ditto.
- * file.c (rb_find_file_safe): ditto.
+ * time.c: need to declare time_utc_offset.
- * load.c (rb_get_expanded_load_path): use rb_file_expand_path_fast.
- * load.c (rb_feature_provided): ditto.
+Thu Jul 27 17:01:01 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (rb_file_expand_path): use rb_file_expand_path_internal with
- path expansion.
- * file.c (rb_file_absolute_path): ditto.
+ * io.c (io_close): always calls "close" method of the receiver.
+ [ruby-core:6911] [ruby-core:8112]
- * test/ruby/test_file_exhaustive.rb: new tests to exercise
- rb_file_expand_path_internal implementation and compliance with
- existing behaviors.
+Thu Jul 27 16:49:01 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Oct 25 16:59:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * time.c (time_to_s): use +0900 style timezone string for local time.
+ [ruby-dev:29143]
- * win32/file.c (INVALID_FILE_ATTRIBUTES): define for old SDK.
+Thu Jul 27 16:41:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Oct 25 16:59:17 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl.h: move <ruby.h> inclusion point to shut up
+ Solaris compiler. [ruby-core:08114]
- * win32/makedirs.bat: new command to make intermediate
- directories, and not to report any errors if the directory
- already exists.
+Wed Jul 26 22:20:59 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/Makefile.sub (MAKEDIRS): enable command extensions.
+ * configure.in: add support for as and ASFLAGS. [ruby-dev:29138]
-Thu Oct 25 16:59:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Jul 26 22:13:45 2006 Minero Aoki <aamine@loveruby.net>
- * win32/Makefile.sub (MAKEDIRS): use mkdir of cmd.exe instead of ruby.
- [Bug #6103] [ruby-core:43012]
+ * lib/net/http.rb: sync with HEAD (rev 1.132).
- * win32/README.win32: added a notice about command extension of cmd.exe.
+ * lib/net/http.rb (Net::HTTP#post, request_post, request): should
+ set Content-Type: x-www-form-urlencoded by default.
-Thu Oct 25 16:59:17 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * lib/net/http.rb (Net::HTTPHeader#content_type): should return
+ nil when there's no Content-Type.
- * Makefile.in (PLATFORM_DIR): add a variable for `win32` directory.
- * Makefile.in (clean-platform): add new target.
- It cleans `win32` directory.
+ * lib/net/http.rb (Net::HTTPHeader#sub_type): should return nil
+ when there's no sub Content-Type (e.g. "Content-Type: text").
- * common.mk (clean): add a dependency for `win32` directory.
- * common.mk (distclean): ditto.
- * common.mk (distclean-platform): add new target.
- It cleans `win32` directory.
- * common.mk ($(PLATFORM_D)): add new target to make `win32` directory.
- * common.mk (win32/win32.$(OBJEXT)): move win32.o into `win32`
- directory.
- * common.mk (win32/file.$(OBJEXT)): add new target for win32/file.c.
+ * lib/net/http.rb (Net::HTTPHeader#type_params): wrongly failed
+ when there's no Content-Type.
- * configure.in: move win32.o into `win32` directory and add
- win32/file.o to MISSING.
+Wed Jul 26 18:35:38 2006 Minero Aoki <aamine@loveruby.net>
- * file.c (file_load_ok, rb_file_load_ok): replace static
- file_load_ok() with public rb_file_load_ok().
- It's to link Windows implementation in win32/file.c.
- * file.c (rb_find_file_ext_safe): ditto.
- * file.c (rb_find_file_safe): ditto.
+ * ext/strscan/strscan.c: sync with HEAD (rev 1.25).
- * win32/file.c (rb_file_load_ok): new file. Add Windows specific
- optimized implementation of rb_file_load_ok(). We created a
- separated file to avoid too many #ifdef macro which is unreadable.
+ * ext/strscan/strscan.c (strscan_do_scan):
+ StringScanner.new("").scan(//) should return "". [ruby-Bugs:4361]
- * win32/Makefile.sub (PLATFORM_DIR): add a variable for `win32`
- directory.
- * win32/Makefile.sub (MISSING): move win32.obj into `win32`
- directory and add win32/file.obj to MISSING.
- * win32/Makefile.sub (MAKEDIRS): replace MINIRUBY with BASERUBY.
- It's because miniruby doesn't exist when making `win32` directory.
- * win32/Makefile.sub (clean-platform): add new target to clean `win32`
- directory.
- * win32/Makefile.sub ({$(srcdir)}.c{}.obj): make it not match
- win32/file.c to build properly.
- * win32/Makefile.sub (win32/win32.$(OBJEXT)): move win32.obj into
- `win32` directory.
+Wed Jul 26 18:14:19 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- Patch created with Luis Lavena.
- [ruby-core:42480] [Feature #5999]
+ * ext/pty/pty.c (getDevice): retry once after GC on failure.
+ [ruby-core:08282]
-Fri Oct 19 13:28:29 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 26 17:28:16 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (opt-dir): allow multiple directories separated by
- $PATH_SEPARATOR as well as dir_config in mkmf.rb. [ruby-core:47868]
- [Bug #7120]
+ * sprintf.c (rb_f_sprintf): prepend ".." to %u for negative bignum,
+ but not "-". fixed: [ruby-core:08167]
-Tue Oct 16 11:18:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 26 16:39:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (dir_config, init_mkmf): use configured libdir value as
- default library path. [ruby-core:43726] [Bug #6207]
+ * string.c (rb_str_scan): add string modification check.
+ [ruby-core:7216]
-Tue Oct 16 10:56:55 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 26 16:06:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (rb_find_file_ext_safe, rb_find_file_safe): default to
- US-ASCII for encdb and transdb.
+ * lib/cgi.rb (CGI::QueryExtension::read_multipart): check
+ multipart boundary end. a patch from Fujioka <fuj at rabbix.jp>
+ [ruby-dev:28470]
- * load.c (search_required): keep encoding of feature name. set
- loading path to filesystem encoding. [Bug #6377][ruby-core:44750]
+Wed Jul 26 01:02:59 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ruby.c (add_modules, require_libraries): assume default external
- encoding as well as ARGV.
+ * configure.in: suppress warnings by automake 1.8 or later.
-Tue Oct 16 10:47:43 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 25 00:30:06 2006 Eric Hodel <drbrain@segment7.net>
- * random.c (random_s_rand): ensure default PRNG is re-initialized
- after fork. patched by Eric Wong. [ruby-core:41209][Bug #5661]
+ * lib/prettyprint.rb: RD to RDoc conversion by Hugh Sasse.
-Tue Oct 16 10:21:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 25 14:49:51 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * ruby.c (rb_f_sub, rb_f_gsub): pass the given block.
- [ruby-core:47967] [Bug #7157]
+ * lib/mkmf.rb (configuration): typo.
-Tue Oct 16 09:47:47 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Jul 25 13:14:32 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_regexp.rb
- (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): use
- Regexp.new instead of literal to ignore a parser warning.
+ * process.c (rb_proc_times): rename hz to hertz to avoid name
+ crash on AIX. [ruby-dev:29126]
-Tue Oct 16 09:47:47 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jul 24 22:03:40 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_regexp.rb
- (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): ignoring
- warnings are already set in setup method.
+ * eval.c (backtrace): skip frames successive on node and method name.
-Sun Oct 14 01:21:42 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jul 24 17:55:55 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * regparse.c (parse_char_class): should match with a hyphen after a
- range in a character class.
+ * process.c (rb_f_system): add security check. [ruby-talk:202947]
- * test/ruby/test_regexp.rb (TestRegexp#test_char_class): fixed wrong
- test.
+ * process.c (rb_f_system): move signal right before fork to avoid
+ signal handler intervention.
- * test/ruby/test_regexp.rb (TestRegexp#check): now can accept the
- error message.
+Mon Jul 24 15:51:52 2006 Tanaka Akira <akr@fsij.org>
- * test/ruby/test_regexp.rb
- (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): renamed
- because the previous name was wrong.
+ * ext/readline/readline.c (readline_readline): rl_deprep_term_function
+ may be NULL with libedit. reported by Ryan Davis. [ruby-dev:29070]
- * test/ruby/test_regexp.rb
- (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): added
- more test pattern.
+Mon Jul 24 15:19:55 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Oct 13 01:41:38 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (rb_call0): revert last change. [ruby-dev:29112]
+ [ruby-core:08374]
- * regparse.c (parse_char_class): also need to check the type of token
- after raw hyphen in regexp class, because the charcter code area
- is union'ed with the property of TK_CHAR_TYPE.
- reported by Bushi Zhang at [ruby-core:47115] [Backport #6853].
+Sun Jul 23 22:59:49 2006 Tanaka Akira <akr@fsij.org>
-Sat Oct 13 01:39:46 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/socket/test_unix.rb: disabled on cygwin.
+ reported by Kouhei Yanagita. [ruby-dev:29080]
- * test/ruby/test_regexp.rb
- (TestRegexp#test_raw_hyphen_and_type_char_after_range): added new
- test. ref [ruby-core:47115] [Backport #6853]
+Fri Jul 21 21:21:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Oct 12 18:19:35 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_call0): include funcalled methods in caller list.
+ fixed: [ruby-core:08290]
- * file.c (rb_get_path_check): path name must not contain NUL bytes.
+Fri Jul 21 12:11:00 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Oct 12 17:51:43 2012 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/extmk.rb, lib/mkmf.rb (with_destdir): remove drive letter before
+ prepending destdir on DOSISH.
- * error.c (exc_to_s, name_err_to_s, name_err_mesg_to_str): do not
- taint messages.
+Thu Jul 20 15:07:14 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Oct 12 16:11:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.h: export classes/modules to implement sandbox.
+ [ruby-core:08283]
- * configure.in (LIBDIR_BASENAME): use configured libdir value to fix
- --enable-load-relative on systems where libdir is not default value,
- overridden in config.site files. [ruby-core:47267] [Bug #6903]
+Thu Jul 20 00:06:29 2006 Keiju Ishitsuka <keiju@ishitsuka.com>
- * ruby.c (ruby_init_loadpath_safe): ditto.
+ * lib/irb/completion.rb: support for completion of numeric
+ number. [ruby-dev: 29038]
-Fri Oct 12 13:56:01 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+Wed Jul 19 23:53:05 2006 Kouhei Sutou <kou@cozmixng.org>
- * test/rexml/test_encoding.rb:
- Add require 'require 'rexml/document'
+ * lib/rss/parser.rb, lib/rss/utils.rb: added documents.
-Fri Oct 12 13:36:32 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Jul 18 22:10:13 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * numeric.c (flodivmod): must through the same pass if HAVE_FMOD or not.
- this is a bugfix of r35013.
+ * process.c (rb_f_system): block SIGCHLD during the process
+ execution, like glibc system(3) does. [ruby-talk:202361]
-Fri Oct 12 13:28:37 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Jul 18 23:12:14 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (rb_cloexec_fcntl_dupfd): get rid of compile error on windows.
- reported by Donovan Lampa at [ruby-core:43152] [Backport #6127],
- based on a patch by Hiroshi Shirosaki at [ruby-core:47917].
+ * win32/win32.c (open_ifs_socket): should not use plain malloc.
-Fri Oct 12 00:30:17 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * win32/win32.c (rb_w32_opendir): should not use plain realloc.
- * io.c (ioctl_narg_len, linux_iocparm_len): reinstantiate linux
- specific narg length calculation.
- * test/ruby/test_io.rb (test_ioctl_linux2): add new test for old and
- unstructured ioctl.
+Tue Jul 18 18:05:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Oct 12 00:30:17 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/ruby/test_float.rb (TestFloat::test_strtod): update test to
+ conform strtod change.
- * io.c (ioctl_narg_len): don't use _IOC_SIZE macro on Linux.
- On Linux some constants for ioctl(2) doesn't include the size of
- its return value and 16bit value; for example FIONREAD 0x541B.
- Moreover the manual, ioctl_list(2), says "Note that the size
- bits are very unreliable: in lots of cases they are wrong,
- either because of buggy macros using sizeof(sizeof(struct)),
- or because of legacy values."
- So we shouldn't use it.
+Tue Jul 18 15:49:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Sep 25 09:30:36 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * pack.c (pack_unpack): propagate association array to copied
+ string. [ruby-core:08223]
- * win32/mkexports.rb: should not export DllMain().
- reported by luis at [ruby-core:46743] [Bug #6790], solved by
- Heesob Park, and confirmed by nobu.
+ * pack.c (pack_unpack): return referenced string itself if it has
+ same length as specified. a patch from <nobu at ruby-lang.org>
+ in [ruby-core:08225].
-Mon Sep 24 16:34:07 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * pack.c (pack_pack): taint 'p' packed strings.
- * include/ruby/win32.h (rb_w32_pow): add new function.
- We use powl() instead of broken pow() for x64-mingw32. This workaround
- fixes test failures related to floating point numeric.
- [ruby-core:46686] [Bug #6784]
+Tue Jul 18 14:03:02 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Sep 24 10:38:55 2012 Luis Lavena <luislavena@gmail.com>
+ * lib/webrick/httpserver.rb (WEBrick::HTTPServer::unmount): remove
+ inpect argument from sprintf. [ruby-dev:29039]
- * test/win32ole/test_win32ole_method.rb (is_ruby64?): Correct platform
- used to identify mingw-w64 (x64-mingw32). Patch by Hiroshi Shirosaki.
- [ruby-core:46651][Bug #6782]
+Tue Jul 18 10:53:37 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Sep 24 10:37:56 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * object.c (rb_cstr_to_dbl): limit out-of-range message.
- * lib/test/unit/parallel.rb: workaround fix for rubygems.
- RubyGems can't find rake if the source directory is not equal to
- the directory which is running the test. [Bug #6604]
+ * util.c (ruby_strtod): return end pointer even if ERANGE occurred.
+ fixed: [ruby-dev:29041]
-Fri Sep 21 19:53:38 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jul 18 00:43:05 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/dl/cfunc.c (rb_dlcfunc_call): should convert a Bignum value to
- unsigned long long on Win64.
- [ruby-core:44636][Bug #6364] reported by raylinn@gmail.com (ray linn)
+ * util.c (ruby_strtod): stop at dot not followed by digits.
+ fixed: [ruby-dev:29035]
-Fri Sep 21 18:45:20 2012 Luis Lavena <luislavena@gmail.com>
+Tue Jul 18 00:01:27 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * include/ruby/win32.h: undef stat to silence mingw-w64 stat
- redefinition warnings (GCC 4.6.3).
+ * ext/extmk.rb: remove LIBRUBY_SO if static linked extensions exist.
-Fri Sep 21 17:54:54 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Jul 17 23:30:46 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in: add -Wall always.
+ * configure.in (rb_cv_msvcrt): defaulted to msvcrt. Workaround for a
+ bug of cygwin 1.5.20.
-Thu Sep 20 10:23:37 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Jul 17 13:43:05 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (native_cond_initialize): destroy condattr
- after using it. Patch by Stanislav Sedov. Thank you.
- [Bug #7041] [ruby-core:47619]
+ * pack.c (define_swapx): should not use plain malloc.
-Sun Sep 9 23:01:43 2012 Tanaka Akira <akr@fsij.org>
+Mon Jul 17 12:58:41 2006 WATANABE Hirofumi <eban@ruby-lang.org>
- * ext/zlib/extconf.rb: detect z_crc_t type which will be defined
- since zlib-1.2.7.
+ * configure.in: should use ac_cv_lib_dl_dlopen=no on MinGW.
- * ext/zlib/zlib.c (rb_zlib_crc_table): use z_crc_t if available.
+Sat Jul 15 23:50:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (rb_require_safe): wait for another thread requiring the same
+ feature. fixed: [ruby-core:08229]
- * ext/zlib/extconf.rb: Use an exception instaed of bare puts.
+Sat Jul 15 01:27:13 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * dir.c (has_magic): glob names contain alphabets to enable case fold
+ search also for directories. fixed: [ruby-talk:201917]
- * ext/psych/extconf.rb: Use an exception instaed of bare abort.
+Sat Jul 15 01:09:22 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * st.c (malloc): use xmalloc/xcalloc instead of plain
+ malloc/calloc, to detect memory allocation failure. see
+ <http://www.nongnu.org/failmalloc/>.
- * ext/fiddle/extconf.rb: Use an exception instaed of bare abort.
+ * gc.c (rb_memerror): should not raise empty nomem_error.
-Sun Sep 9 02:44:21 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Jul 14 13:08:13 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/readline/extconf.rb: Use an exception instead of bare exit.
+ * ext/tk/lib/tk.rb: add methods for new features of latest Tcl/Tk8.5.
-Sun Sep 9 02:34:39 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/namespace.rb: ditto.
- * ext/extmk.rb: Show a message when extconf.rb raised an exception.
- * ext/openssl/extconf.rb: Use exception raising instead of message
- and/or abort. We want to display error message to console _and_
- logging into mkmf.log.
+Fri Jul 14 02:30:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Sep 9 02:30:20 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/monitor.rb: document patch from Hugh Sasse <hgs at dmu.ac.uk>.
+ [ruby-core:08205]
- * thread.c (rb_mutex_lock): stop multiple threads use
- pthread_cond_timedwait() concurrently. [Bug #6278] [ruby-core:44275]
+Fri Jul 14 01:09:46 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Aug 30 09:24:43 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (then): error in warning action.
- * lib/uri/ftp.rb (URI::FTP#initialize): raise InvalidURIError if "//"
- is not present [ruby-core:47344] [Bug #6945]
+Fri Jul 14 00:10:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Aug 28 00:40:14 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * array.c (rb_ary_pop): may cause realloc oscillation. a patch
+ from MORITA Naoyuki <mlgetter at kidou.sakura.ne.jp>.
+ [ruby-dev:29028]
- * test/webrick/test_cgi.rb (TestWEBrickCGI#start_cgi_server): there are
- no guarantee of existance of RbConfig::CONFIG['LIBPATHENV'].
- it only exists in Unix-like environments.
+Thu Jul 13 22:23:56 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/webrick/test_filehandler.rb
- (WEBrick::TestFileHandler#test_script_disclosure): ditto.
+ * ext/tk/lib/tk/composite.rb: improve handling of the classname on the
+ option database for the widget class which includes TkComposite.
-Thu Aug 23 12:08:25 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Thu Jul 13 20:32:19 2006 Kouhei Sutou <kou@cozmixng.org>
- * test/ruby/test_file_exhaustive.rb
- (TestFileExhaustive#test_stat_special_file): add a test.
- GetFileAttributesExW fails to get attributes of special files
- such as pagefile.sys.
+ * lib/rss/parser.rb: updated documents by a patch from
+ Hugh Sasse <hgs at dmu.ac.uk>. [ruby-core:8194]
- * win32/win32.c (check_valid_dir): for performance, check the path
- by FindFirstFileW only if the path contains "...".
+Wed Jul 12 13:54:09 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/win32.c (winnt_stat): use GetFileAttributesExW instead of
- FindFirstFileW since GetFileAttributesExW is faster.
- Based on the patch by Dusan D. Majkic.
- [ruby-core:47083] [Feature #6845]
+ * parse.y (then): we'd like to reserve colon here for the future.
+ warning added.
-Thu Aug 23 11:19:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 11 20:58:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (ruby_init_stack): STACK_GROW_DIR_DETECTION is
- necessary on platforms with unknown stack direction. [Bug #6761]
+ * ruby.h: export rb_cMethod. [ruby-talk:201259]
-Thu Aug 23 11:19:51 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jul 11 19:13:33 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread_pthread.c (get_stack): Linux is the only OS which includes
- the size of guard page into the stack size.
+ * ext/tk/lib/multi-tk.rb: remove restriction on the class of
+ pseudo-toplevel.
-Thu Aug 23 11:19:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 11 18:00:57 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * gc.h (IS_STACK_DIR_UPPER): utility macro.
+ * ext/tk/lib/multi-tk.rb: security fix.
- * thread_pthread.c (get_stack): seems stack size does not include
- guard size on Mac OS X.
+Tue Jul 11 17:33:39 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * thread_pthread.c (ruby_init_stack): adjust stack size for offset of
- addr from the bottom.
+ * string.c (rb_str_dump): need to extend len for \b.
-Thu Aug 23 11:19:51 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jul 10 22:00:00 2006 Shigeo Kobayashi <shigek@ruby-lang.org>
- * thread_pthread.c (ruby_init_stack): use stack info if possible.
+ * ext/bigdecimal/bigdecimal.c: Allows '_' to appear within
+ digits. [ruby-dev:28872]
-Mon Aug 20 17:11:01 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/bigdecimal/lib/bigdecimal/util.rb: Bug in to_r reported by
+ [ruby-list:42533] fixed.
- * file.c (file_path_convert): don't convert it when the path string is
- ascii only. [ruby-core:41556] [Bug #5733]
- tests are contributed by nobu.
+Mon Jul 10 19:22:19 2006 Tanaka Akira <akr@fsij.org>
-Thu Aug 9 22:48:58 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * gc.c (gc_sweep): expand heap earlier.
+ reported by MORITA Naoyuki. [ruby-dev:28960]
- * pack.c (pack_unpack): when unpack('M') occurs an illegal byte
- sequence, output the "=" character and the following character in
- the decoded data without any transformation.
- [ruby-dev:44875] [Bug #5635]
+Mon Jul 10 18:59:34 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Jul 31 10:36:12 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/lib/tk/font.rb: sorry. mistaken to patch.
- * ext/psych/lib/psych.rb: updated to released version.
+Mon Jul 10 18:46:52 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/psych/psych.gemspec: ditto
+ * ext/tk/tcltklib.c: make SEGV risk lower at exit.
-Thu Jul 19 09:33:46 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/lib/tk.rb: ditto.
- * ext/psych/emitter.c (initialize): allow a configuration object to be
- passed to the constructor so that mutation isn't required after
- instantiation.
+ * ext/tk/lib/multi-tk.rb: fail to call function-style methods on slave
+ interpreters. The strategy (MultiTkIp_PseudoToplevel_Evaluable) to
+ fix the problem is a little tricky. You may have to take care of
+ conflicting with it.
- * ext/psych/lib/psych/handler.rb: add configuration object
+ * ext/tk/lib/tk.rb: a little change for the pseudo-toplevel strategy.
- * ext/psych/lib/psych/visitors/emitter.rb: use configuration object if
- extra configuration is present.
+ * ext/tk/lib/tk/font.rb: ditto.
-Tue Jul 17 03:56:34 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/lib/tk/msgcat.rb: ditto.
- * ext/psych/lib/psych/visitors/to_ruby.rb: strings with YAML anchors
- are properly referenced. Patched by Joe Rafaniello via Github:
- https://github.com/tenderlove/psych/pull/69
- * ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
- * test/psych/test_alias_and_anchor.rb: test for change
+ * ext/tk/lib/tkextlib/itk/incr_tk.rb: ditto.
-Sat Jun 16 01:27:14 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/sample/demos-en/widget: fail to call function-style methods
+ on sample scripts. To fix it, a strategy which similar to the way
+ on MultiTiIp is used. Please take care when re-write and re-run a
+ demo script on the Widget-Demo code viewer.
- * ext/psych/lib/psych.rb: bumping psych to 1.3.3
- * ext/psych/psych.gemspec: ditto
+ * ext/tk/sample/demos-jp/widget: ditto.
-Fri May 18 15:53:05 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Jul 10 13:58:40 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/psych/extconf.rb: Use an exception instaed of bare abort.
+ * signal.c (ruby_nativethread_signal, posix_nativethread_signal,
+ sigsend_to_ruby_thread, install_nativethread_sighandler):
+ nativethread-support on signal handler. RE-backport from 1.9.
-Fri May 18 01:28:21 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
- * ext/psych/parser.c (transcode_string): fix encoding index names.
- Thanks markizko for reporting.
+ * eval.c (ruby_native_thread_kill): ditto.
-Wed May 16 05:11:29 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon Jul 10 10:54:14 2006 Ryan Davis <ryand@zenspider.com>
- * ext/psych/lib/psych/visitors/to_ruby.rb: fix a bug with string
- subclass dumping and loading.
+ * lib/rdoc/parsers/parse_f95.rb: massive overhaul from Yasuhiro
+ Morikawa including new file suffixes, function support, public
+ variables and constants, derived-types, defined operators and
+ assignments, namelists, and subroutine and function
+ arguments. Truly massive.
- * test/psych/test_array.rb: pertinent tests
+ * lib/rdoc/diagram.rb: diagrams are now cached.
- * test/psych/test_string.rb: ditto
+ * lib/irb/completion.rb: fixed a crasher when completing against
+ an unnamed class/module.
-Wed May 16 01:31:21 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/rdoc/parsers/parse_c.rb: private comment (--/++) support in
+ C-file rdoc.
- * ext/psych/lib/psych/visitors/to_ruby.rb: convert omap tagged maps to
- Psych::Omap objects rather than hashes. [Bug #6425]
+ * lib/debug.rb: minor clarification in help.
- * test/psych/test_omap.rb: pertinent test.
+ * lib/pp.rb: minor clarification on exception.
-Wed May 16 01:15:45 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon Jul 10 09:29:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/psych/lib/psych/visitors/yaml_tree.rb: keep a reference to
- custom coders so that GC does not impact dumped yaml reference ids.
+ * eval.c (rb_clear_cache_for_undef): clear entries for included
+ module. fixed: [ruby-core:08180]
-Mon Apr 30 04:43:53 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon Jul 10 01:48:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych/json/yaml_events.rb: implicit styles should not
- be changeable for JSON events.
+ * st.h (st_data_t): use pointer sized integer for st_data_t.
+ [ruby-dev:28988]
-Sun Jul 29 04:32:31 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jul 9 18:06:47 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (ruby_pc): make configurable. [Bug #6051]
+ * lib/mkmf.rb (try_constant): fix for value 1 at cross compiling.
-Sun Jul 29 04:32:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (create_makefile): prevent substitution of macro
+ definition. fixed: http://www.yotabanana.com/lab/20060624.html#p02
- * template/ruby.pc.in: added rubylibprefix, {rubylib,vendor,site}dir
- and {ruby,vendor,site}archdir. [ruby-core:42766][Feature #6052]
+Sun Jul 9 00:54:34 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Jul 29 04:31:01 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (next_jump): deal with destination of next.
+ fixed: [ruby-core:08169]
- * bignum.c: Added #include <strings.h> for ffs(). Patch by Perry
- Smith. Thank you. [Bug #6748]
+Fri Jul 7 00:38:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jul 28 04:04:01 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * hash.c (rb_hash_default): should not call default procedure if
+ no key is given. [ruby-list:42541]
- * include/ruby/intern.h (rb_num_zerodiv): Added NORETURN.
- Patched by Xi Wang. [Bug #6736]
+Fri Jul 7 00:29:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jul 4 19:36:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * time.c (time_mload): a patch from Daniel Berger
+ <Daniel.Berger at qwest.com>. [ruby-core:08128]
- * ext/dl/cfunc.c (rb_dlcfunc_call): also needed the workaround for VC8
- for x64. [ruby-dev:45875] [Bug #6676]
- reported by aves_ramphastos (Seigo Ishigane)
+Thu Jul 6 22:21:57 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jul 3 19:37:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (rb_proc_times): use sysconf(_SC_CLK_TCK) value prior to
+ HZ and CLK_TCK. fixed: [ruby-talk:200293]
- * file.c (rmext): no extension to strip if empty string.
+Thu Jul 6 22:17:21 2006 Minero Aoki <aamine@loveruby.net>
- * proc.c (rb_vm_rewrite_dfp_in_errinfo): Fix `unexpected return'
- occurs when a proc is called in ensure. [Backport #6460]
+ * ext/racc/cparse/cparse.c: sync with original code, rev 1.8.
-Tue Jul 3 11:44:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/racc/cparse/cparse.c: should mark CparseParams objects.
- * file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
- (rb_enc_path_last_separator, rb_enc_path_end)
- (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
- path handling functions.
+ * lib/racc/parser.rb: sync with original code, rev 1.8.
- * file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
- (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
- (rb_file_join): should respect the encodings of arguments than
- file system encoding. [ruby-dev:45145] [Bug #5919]
+ * lib/racc/parser.rb: update coding style.
- * dir.c (check_dirname, ruby_glob0): ditto.
+Mon Jul 3 19:04:38 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/pathname/pathname.c (path_sub_ext): ditto.
+ * ext/tk/tcltklib.c (ip_make_menu_embeddable): help to make a menu
+ widget embeddable (pack, grid, and so on) like as a general widget.
+ However, an embeddable menu may require to be definied some event
+ bindings for general use.
-Tue Jul 3 11:43:46 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk/event.rb: [bug fix] Tk.callback_break and
+ Tk.callback_continue don't work on MultiTkIp.
- * dir.c (dir_chdir, check_dirname): get rid of optimization-out.
+ * ext/tk/lib/multi-tk.rb: ditto.
-Thu Jun 28 17:57:49 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tk.rb: lack of Tk.callback_return.
- * win32/win32.c (is_socket, is_console): add prototypes to fix compile
- problem with gcc introduced at r32549.
+ * ext/tk/lib/tk/menu.rb: improve creating clone menus.
-Wed Jun 27 08:31:50 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jul 3 14:42:06 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * insns.def (splatarray): make new array if flag is set.
+ * ext/etc/extconf.rb (PW_UID2VAL, PW_GID2VAL): defaulted to conversion
+ from int, and sys/types.h needs to be included before grp.h.
+ fixed: [ruby-dev:28938]
- * compile.c (iseq_compile_each): make new array with
- splat. [ruby-core:21901][Feature #1125]
+Mon Jul 3 01:14:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jun 27 04:23:26 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_inspect): encode \b (\010) for escape.
+ [ruby-dev:28927]
- * win32/win32.c (rb_w32_sysinit): let the system not display the
- critical-error-handler message box and the Windows Error Reporting
- dialog. [ruby-core:45389] [Bug #6535]
+ * string.c (rb_str_dump): ditto.
-Wed Jun 27 04:20:41 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jul 2 19:17:56 2006 Minero Aoki <aamine@loveruby.net>
- * bignum.c (rb_big_pow): estimate result bit size more precisely.
- [ruby-core:30735][Feature #3429]
+ * ext/racc/cparse/cparse.c: sync with original code (rev 1.7).
-Tue Jun 26 20:36:53 2012 Tanaka Akira <akr@fsij.org>
+ * ext/racc/cparse/cparse.c: use rb_catch instead of rb_iterate.
+ Giving a block to a Ruby-level method by rb_iterate is obsolete on
+ Ruby 1.9. Note that current cparse.c still includes one
+ rb_iterate call on Ruby 1.8, but it is not a problem (at least
+ just now).
- * lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
- OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
- http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
- reported by Bohuslav Kabrda.
- [ruby-core:43844] [ruby-trunk - Bug #6221]
+Sat Jul 1 15:15:49 2006 Tanaka Akira <akr@m17n.org>
-Tue Jun 26 20:35:59 2012 Eric Hodel <drbrain@segment7.net>
+ * test/socket/test_nonblock.rb: add timeout to send/receive
+ an empty UDP packet.
+ [ruby-dev:28820]
- * ext/zlib/zlib.c (do_inflate): Inflate more data if buffered data
- exists. Allows Zlib::Inflate#set_dictionary to work.
- [ruby-trunk - Bug #5929]
+Fri Jun 30 23:46:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 21 13:42:57 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in: should test isinf for Solaris with GCC compiler.
+ a patch from <ville.mattila at stonesoft.com>. [ruby-core:07791]
- * thread.c (rb_threadptr_execute_interrupts_common):
- test_signal_requiring of test/ruby/test_signal.rb fail if the sub
- process is killed on waiting IO in lex_io_gets in rb_load_file in
- rb_load_internal in require.
- This is because
- (1) the process receive the killing signal in
- rb_thread_io_blocking_region in rb_read_internal in lex_io_gets.
- (2) set th->errinfo as INT2FIX(TAG_FATAL) at
- rb_threadptr_execute_interrupts_common.
- (3) escape rb_load_file in rb_load_internal and jump to EXEC_TAG()
- without set loaded as TRUE.
- (4) call first rb_exc_raise(GET_THREAD()->errinfo); because loaded
- is FALSE as above. this errinfo should be an exception object
- but this is INT2FIX(TAG_FATAL).
- Don't call first rb_exc_raise if GET_THREAD()->errinfo is Fixnum.
+ * configure.in: -shared patch from Andrew Morrow
+ <andrew.c.morrow at gmail.com>. [ruby-core:08100]
-Mon Jun 11 19:56:22 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Jun 29 18:58:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/webrick/test_cgi.rb (class TestWEBrickCGI): respect
- RbConfig::CONFIG["LIBPATHENV"]. [Bug #5135] [ruby-core:38653]
- * test/webrick/test_filehandler.rb (class WEBrick): ditto.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_version): fix patch
+ failure.
-Tue Jun 5 14:03:53 2012 Akinori MUSHA <knu@iDaemons.org>
+Thu Jun 29 18:00:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/ipaddr.rb: Inhibit zero-filled octets in an IPv4 address in
- all platforms. [ruby-dev:45671]
+ * ext/bigdecimal/bigdecimal.c: add RDoc document. a patch from
+ mathew <meta at pobox.com>. [ruby-core:07050]
- * lib/ipaddr.rb: Allow the x:x:x:x:x:x:d.d.d.d form not limited to
- IPv4 mapped/compatible addresses. This change also makes it
- possible for the parser to understand IPv4 mapped and compatible
- IPv6 addresses in non-compressed form.
+Wed Jun 28 15:47:14 2006 Eric Hodel <drbrain@segment7.net>
- * lib/ipaddr.rb: Stop exposing IPSocket.valid*? methods which were
- only usable on non-IPv6-ready platforms.
+ * lib/optparse.rb: RDoc patch from Robin Stocker <robin@nibor.org>
+ [ruby-core:08087]
-Sat Jun 2 18:49:39 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Jun 28 19:04:34 2006 Tanaka Akira <akr@m17n.org>
- * string.c (rb_enc_cr_str_buf_cat): don't reset coderange as unknown.
- the condition 'ptr_a8 && str_cr != ENC_CODERANGE_7BIT' means not
- unknown, str is also ASCII-8BIT because str_encindex == ptr_encindex,
- and nont (str_cr == ENC_CODERANGE_UNKNOWN) and
- str_cr != ENC_CODERANGE_7BIT means str_cr is valid because ASCII-8BIT
- can't be broken. [ruby-dev:45688] [Bug #6509]
+ * test/socket/test_unix.rb: test_seqpacket_pair removed.
+ [ruby-dev:28846]
-Wed May 30 17:19:56 2012 Eric Hodel <drbrain@segment7.net>
+Tue Jun 27 23:03:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/zlib/zlib.c (do_inflate): Inflate more data if buffered data
- exists. Allows Zlib::Inflate#set_dictionary to work.
- [ruby-trunk - Bug #5929]
+ * string.c: RDoc update for =~ method. a patch from Alex Young
+ <alex at blackkettle.org>. [ruby-core:08068]
-Mon May 28 11:40:19 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 27 22:47:18 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * io.c (rb_io_extract_modeenc): fail only if conflicting
- text/binary modes given explicitly. [ruby-dev:45268][Bug #6055]
+ * ext/tk/tcltklib.c: forgot to update TCLTKLIB_RELEASE_DATE.
-Fri May 25 17:18:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk.rb (tk_tcl2ruby): [bug fix] sometimes fail to convert
+ a tcl string to a ruby object if the tcl string includes "\n".
- * parse.y (f_arglist): should reset lexical states after empty
- argument list with no parenthesis as well as parenthesized list,
- so that reserved name method definition work. [ruby-dev:45626]
- [Bug #6403]
+Tue Jun 27 16:04:05 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-Fri May 25 10:40:31 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * win32/win32.h: define isascii on MinGW for msvcrt compatibility.
- * include/ruby/win32.h (FD_SET): change function to macro.
- To avoid buffer overflow when smaller FD_SETSISE is used in ext
- libraries.
+ * configure.in: set ac_cv_header_sys_time_h=no on MinGW
+ for msvcrt compatibility.
- * win32/win32.c (rb_w32_fdset): this function is not used anymore.
- But we leave this for compatibility.
+Tue Jun 27 11:36:02 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (rb_w32_select_with_thread): fix SEGV when smaller
- FD_SETSISE is used in ext libraries. Dereference of fd_set pointer
- causes SEGV.
+ * ext/etc/etc.c (setup_passwd, setup_group): allow bignum uid, gid and
+ so on. [ruby-talk:199102]
- * test/-ext-/win32/test_fd_setsize.rb(TestFdSetSize): add tests for
- above.
- * ext/-test-/win32/fd_setsize/depend: ditto.
- * ext/-test-/win32/fd_setsize/extconf.rb: ditto.
- * ext/-test-/win32/fd_setsize/fd_setsize.c: ditto.
+Mon Jun 26 13:37:27 2006 Eric Hodel <drbrain@segment7.net>
- [ruby-core:44588] [Bug #6352]
+ * lib/rdoc: Merge from HEAD.
+ Add options to limit the ri search path.
-Fri May 25 10:38:06 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 27 00:54:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_strip_bom): check EOF. [Bug #6487][ruby-core:45203]
+ * util.c (powersOf10): constified.
-Fri May 25 10:36:38 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 26 18:37:44 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * parse.y (f_arglist): should reset lexical states after empty
- argument list with no parenthesis as well as parenthesized list,
- so that reserved name method definition work. [ruby-dev:45626]
- [Bug #6403]
+ * ext/tk/tcltklib.c (ip_delete): fix SEGV when a slave-ip is
+ deleted on callback.
-Mon May 21 16:24:40 2012 Akinori MUSHA <knu@iDaemons.org>
+Mon Jun 26 10:47:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/syslog/syslog.c (mSyslog_inspect): Use rb_sprintf().
+ * io.c (pipe_open): avoid closing uninitialized file descriptors.
+ a patch from <tommy at tmtm.org> [ruby-dev:28600]
- * ext/syslog/syslog.c (mSyslog_inspect): Make sure self is a
- module before calling rb_class2name().
+Mon Jun 26 09:56:22 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat May 19 14:42:37 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * win32/win32.[ch] (rb_w32_send, rb_w32_sendto): constified.
- * test/drb/drbtest.rb ({DRbCore,DRbAry}#teardown}: cannot pass SIGTERM
- to another process on Windows, so use SIGINT instead.
+Sun Jun 25 23:02:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat May 19 14:42:20 2012 Tanaka Akira <akr@fsij.org>
+ * Makefile.in, mkconfig.rb: catch-up for latest autoconf.
- * lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
- OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
- http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
- reported by Bohuslav Kabrda.
- [ruby-core:43844] [ruby-trunk - Bug #6221]
+Sat Jun 24 06:35:00 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat May 19 14:41:45 2012 Tanaka Akira <akr@fsij.org>
+ * signal.c: revert last change.
- * test/drb/drbtest.rb: rescue Errno::ESRCH for Process.kill.
- reported by NARUSE, Yui. [ruby-dev:45551]
+ * ruby.h: ditto.
-Sat May 19 14:41:09 2012 Tanaka Akira <akr@fsij.org>
+ * eval.c: ditto.
- * lib/drb/extservm.rb (DRb::ExtServManager): don't use /bin/sh to
- invoke service subprocess. mark detach threads for clean up.
+Thu Jun 22 11:52:02 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/drb/drbtest.rb: clean up the service subprocess in teardown.
+ * lib/net/http.rb (Net::HTTPResponse): duplicated error 501;
+ HTTPInternalServerError should be error 500. [ruby-core:08037]
- * test/drb/test_drb.rb: set @service_name for teardown.
+Thu Jun 22 05:15:58 2006 Tanaka Akira <akr@m17n.org>
- * test/drb/test_drbunix.rb: ditto.
+ * ext/socket/socket.c (sock_s_socketpair): try GC only once.
+ [ruby-dev:28778]
- * test/drb/test_drbssl.rb: ditto.
+Wed Jun 21 21:28:32 2006 Tadayoshi Funaba <tadf@dotrb.org>
-Sat May 19 14:40:49 2012 Tanaka Akira <akr@fsij.org>
+ * lib/date.rb (jd_to_commercial): now works fine even if in
+ mathn-ized context.
- * lib/drb/ssl.rb: close accepted TCP socket if SSL accept is failed.
- [ruby-dev:45541]
+Wed Jun 21 17:32:31 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat May 19 14:39:50 2012 Tanaka Akira <akr@fsij.org>
+ * signal.c (ruby_nativethread_signal, posix_nativethread_signal,
+ sigsend_to_ruby_thread, install_nativethread_sighandler):
+ nativethread-support on signal handler (backport from 1.9).
- * lib/webrick/utils.rb: fix fcntl call.
+ * ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
- * lib/drb/unix.rb: ditto.
+ * eval.c (ruby_native_thread_kill): ditto.
-Fri May 18 18:13:44 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 21 08:39:54 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (MakeMakefile#configuration): keep space at end of
- OUTFLAG and COUTFLAG. [ruby-dev:45650]
+ * lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): merge Date
+ and Time processing. [ruby-core:08033]
-Fri May 18 00:04:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 21 01:40:25 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (rb_w32_fstat, rb_w32_fstati64): convert FILETIME
- to time_t directly, not to be affected by TZ unnecessarily.
+ * parse.y (yylex, reswords): modifier token is no longer returned in
+ fname state. [ruby-dev:28775]
- * win32/win32.c (unixtime_to_filetime): convert time_t to FILETIME
- simply.
+Wed Jun 21 01:12:46 2006 Kouhei Sutou <kou@cozmixng.org>
-Wed May 16 01:07:46 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/rss/rss.rb: RSS::Element.def_corresponded_attr_writer
+ supported date type.
- * ext/digest/md5/extconf.rb: use pkg_config for openssl so that
- customized ssl paths are used for linking. Backports fixes for
- [ruby-core:44755].
- * ext/digest/rmd160/extconf.rb: ditto
- * ext/digest/sha1/extconf.rb: ditto
- * ext/digest/sha2/extconf.rb: ditto
+Tue Jun 20 22:08:36 2006 Kouhei Sutou <kou@cozmixng.org>
-Mon May 14 17:14:10 2012 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * test/rss/test_parser.rb: split parser tests into ...
+ * test/rss/test_parser_1.0.rb: ... RSS 1.0 parsing tests and ...
+ * test/rss/test_parser_2.0.rb: ... RSS 2.0 parsing tests.
- * test/ruby/test_io.rb (test_flush_in_finalizer1): don't use IO.for_fd
- to close IO objects. it create IO object with already closed fd, and
- cause occasional Errno::EBADF in following tests. [ruby-core:45020]
- [Bug #6228]
+Tue Jun 20 21:19:06 2006 Kouhei Sutou <kou@cozmixng.org>
-Mon May 14 17:14:10 2012 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * lib/rss/rss.rb: provided default RSS::Element#children.
- * test/ruby/test_io.rb (TestIO): revert r35631. it broke the intent of
- test_flush_in_finalizer1. [ruby-core:43951] [Bug ##6228]
+ * lib/rss/0.9.rb: used default RSS::Element#children.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
-Mon May 14 13:18:56 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 20 21:04:33 2006 Kouhei Sutou <kou@cozmixng.org>
- * parse.y (parser_tokadd_string): insert a backslash only if
- quoted by single quotes. [ruby-dev:45281] [Bug #6069]
+ * lib/rss/rss.rb: provided default RSS::Element#_tags.
-Mon May 14 13:17:57 2012 Luis Lavena <luislavena@gmail.com>
+ * lib/rss/0.9.rb: used default RSS::Element#_tags.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
- * test/ruby/test_io.rb (class TestIO): Disable GC during IO tests to
- avoid file descriptors being GC'ed. Suggestion by Tomoyuki Chikanaga
- [ruby-core:43951][Bug #6228]
+Tue Jun 20 20:47:07 2006 Kouhei Sutou <kou@cozmixng.org>
-Fri May 11 14:09:48 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rss/rss.rb: hide RSS::Element.install_model.
+ (RSS::Element.install_have_child_element,
+ RSS::Element.install_have_children_element,
+ RSS::Element.install_text_element,
+ RSS::Element.install_date_element): call
+ RSS::Element.install_model internally.
- * ext/bigdecimal/bigdecimal.c (PUSH): to prevent VALUE from GC,
- must not cast it to unsigned long, which may be shorter than
- VALUE, and the result can be mere garbage.
+ * lib/rss/0.9.rb: followed new API.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/content.rb: ditto.
+ * lib/rss/dublincore.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/syndication.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
-Fri May 11 01:04:54 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Tue Jun 20 20:18:05 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * io.c (io_unread): fix IO#pos with mode 'r' bug on Windows.
- If the end of reading buffer is CR, io_unread() needs to unread one
- more byte.
- [ruby-core:44874] [Bug #6401]
+ * ext/openssl/extconf.rb: add check for OBJ_NAME_do_all_sorted.
- * test/ruby/test_io_m17n.rb (TestIO_M17N#test_pos_with_buffer_end_cr):
- add a test for above.
+ * ext/openssl/ossl_cipher.c (ossl_s_ciphers): new method
+ OpenSSL::Cipher.ciphers. it returns all the cipher names.
-Wed May 9 15:59:17 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/lib/openssl/cipher.rb:
+ - add constants AES128, AES192, AES256. [ruby-dev:28610]
+ - reimplement without eval()
- * configure.in (RUBY_WERROR_FLAG): append all warning flags which
- are enabled to compile, so that printf format modifiers properly
- fail. [ruby-core:41351] [Bug #5679]
+ * ext/openssl/lib/openssl/digest.rb: reimplement without eval().
-Mon May 7 20:23:29 2012 Tanaka Akira <akr@fsij.org>
+ * test/openssl/test_cipher.rb, test_digest: fix about reimplemented
+ features.
- * lib/securerandom.rb (random_bytes): call to_int method for the
- argument at first.
+ * sample/openssl/cipher.rb: rewrite all.
-Mon May 7 20:23:29 2012 Tanaka Akira <akr@fsij.org>
+Sat Jun 19 11:21:46 2006 Eric Hodel <drbrain@segment7.net>
- * lib/securerandom.rb: show actual read length in an error message.
+ * lib/test/unit/assertions.rb: Merge RDoc from HEAD.
-Mon May 7 11:09:20 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jun 20 01:06:57 2006 Kouhei Sutou <kou@cozmixng.org>
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal): define IDs before
- they are used. [ruby-core:44900] [Bug #6406]
+ * lib/rss/rss.rb:
+ - cleanup validation mechanism. Now, #XXX_validation is
+ needless.
+ - changed internal variable name RSS::Element::MODEL to
+ RSS::Element::MODELS.
+ - RSS::Element.install_model requires uri.
-Fri Apr 27 11:02:33 2012 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/rss/0.9.rb: followed new validation API.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/content.rb: ditto.
+ * lib/rss/dublincore.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/syndication.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
- * test/rinda/test_rinda.rb (test_core_03_notify): Fixed test failures
- [ruby-dev:44430] [Ruby 1.9 - Bug #372]
+Mon Jun 19 23:40:59 2006 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Apr 27 08:29:51 2012 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * ext/nkf/lib/kconv.rb: remove default -m0 and fix document.
- * test/rinda/test_rinda.rb: fix sticks on some testsf problem
- [Bug #6272]
+ * ext/nkf/nkf-8/{nkf.c, config.h, utf8tbl.c, utf8tbl.h}:
+ imported nkf 2.0.7.
-Wed Apr 25 05:56:56 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 19 22:31:59 2006 Kouhei Sutou <kou@cozmixng.org>
- * lib/optparse.rb (OptionParser#to_a): split for each lines.
- [ruby-dev:45568][Bug #6348]
+ * lib/rss/rss.rb:
+ - provided default #to_s as RSS::Element#to_s.
+ - removed RSS::Element#other_element.
+ - RSS::Element#tag requires attributes as Hash instead of Array.
-Tue Apr 24 21:20:39 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/rss/0.9.rb: removed #to_s to use RSS::Element#to_s.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
- * lib/optparse.rb (OptionParser#to_a): should split by end-of-line,
- and MUST TEST IT, MUST RUN THE TEST, MUST VERIFY BEFORE BACKPORT.
- [ruby-dev:45568][Bug #6348]
+ * lib/rss/2.0.rb: removed #other_element.
-Tue Apr 24 14:55:41 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 19 22:09:16 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * lib/optparse.rb (OptionParser#to_a): String#to_a is no longer
- defined. [ruby-dev:45568][Bug #6348]
+ * ext/win32ole/win32ole.c(ole_invoke): support some kind of
+ method of word. [ruby-Bugs#3237]
-Sat Apr 21 07:16:16 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/win32ole/tests/test_word.rb: ditto.
- * strftime.c (rb_strftime_with_timespec): fix padding of time zone
- offset. [ruby-dev:43287][Bug #4458]
+ * ext/win32ole/tests/testall.rb: ditto.
- * strftime.c (rb_strftime_with_timespec): add an interim digit for
- the timezone offset which is less than an hour.
+Mon Jun 19 00:02:17 2006 Kouhei Sutou <kou@cozmixng.org>
- * strftime.c (rb_strftime_with_timespec): fix carry-up bug and
- overwrite '+' with '-' if negative offset less than a hour.
- [ruby-core:44447][Bug #6323]
+ * lib/rss/rss.rb: automatically detected attributes.
-Fri Apr 20 12:30:06 2012 Eric Hodel <drbrain@segment7.net>
+ * lib/rss/0.9.rb: removed #_attrs.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
- * lib/rubygems/ssl_certs/AddTrustExternalCARoot.pem: Removed to avoid
- conflict with ca-bundle.pem
- * lib/rubygems/ssl_certs/VerisignClass3PublicPrimaryCertificationAuthority-G2.pem:
- ditto.
- * lib/rubygems/ssl_certs/Entrust_net-Secure-Server-Certification-Authority.pem:
- ditto.
+ * lib/rss/parser.rb: followed new internal API.
-Fri Apr 20 08:30:55 2012 Eric Hodel <drbrain@segment7.net>
+Mon Jun 19 00:00:17 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/rubygems: Update to RubyGems 1.8.23 which contains security
- fixes:
+ * ext/tk/lib/multi-tk.rb: fix bug: initialize improper tables.
- RubyGems now disallows redirection from HTTPS to HTTP.
+Sun Jun 18 22:36:13 2006 Kouhei Sutou <kou@cozmixng.org>
- RubyGems now verifies SSL connections.
+ * lib/rss/rss.rb: RSS::Element#initialize accepts initial
+ attributes.
+ * lib/rss/0.9.rb: ditto.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/dublincore.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
- See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
- changes since 1.8.22.
- * test/rubygems: ditto.
+ * lib/rss/utils.rb: added Utils.element_initialize_arguments? to
+ detect backward compatibility initial arguments.
-Fri Apr 20 07:39:50 2012 Eric Hodel <drbrain@segment7.net>
+ * lib/rss/parser.rb: user initial attributes to initialize
+ RSS::Element.
- * lib/rubygems: Update to RubyGems 1.8.22 plus r33517 and r35337 which
- were ported to the rubygems git repository.
+Sun Jun 18 18:24:42 2006 Kouhei Sutou <kou@cozmixng.org>
- See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
- changes since 1.8.11.
+ * lib/rss/converter.rb: use NKF for Uconv fallback.
- * test/rubygems: ditto.
+Sun Jun 18 18:22:04 2006 Kouhei Sutou <kou@cozmixng.org>
- * lib/rubygems/version.rb: Fixed init_with warning by calling into
- yaml_initialize (for syck) from psych's init_with
+ * test/rss/test_image.rb: shared name space configuration.
-Thu Apr 19 12:55:31 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 18 18:13:25 2006 Kouhei Sutou <kou@cozmixng.org>
- * ext/-test-/win32/dln/extconf.rb: need import library for ordinal
- entry even on mingw. [ruby-core:44441][Bug #6320]
+ * lib/rss/rss.rb: improved ignore_unknown_element
+ handling. RSS::NotExpectedTagError provides tag URI.
+ * lib/rss/parser.rb: ditto.
+ * lib/rss/0.9.rb: ditto.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/content.rb: ditto.
+ * lib/rss/dublincore.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/syndication.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
-Wed Apr 18 23:08:58 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rss/rss-assertions.rb: checked URI of not expected tag too.
+ * test/rss/test_parser.rb: ditto.
- * configure.in (DOT, DOXYGEN): use AC_CHECK_PROGS instead of
- AC_CHECK_PROG which needs the third argument. [ruby-core:44433]
- [Bug #6316]
+Sun Jun 18 18:08:36 2006 Kouhei Sutou <kou@cozmixng.org>
- * configure.in (PKG_CONFIG): fix condition to skip older version
- of pkg-config. continue in backticks does not affect outside.
+ * lib/rss/rss.rb: changed empty namespace URI representation to ""
+ from nil.
+ * lib/rss/parser.rb: ditto.
+ * lib/rss/0.9.rb: ditto.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
-Tue Apr 17 21:35:47 2012 Kouhei Sutou <kou@cozmixng.org>
+Sun Jun 18 18:03:50 2006 Kouhei Sutou <kou@cozmixng.org>
- * lib/rexml/parsers/baseparser.rb, test/rexml/test_namespace.rb:
- fix the default xml namespace URI validation.
- [ruby-dev:45169] [Bug #5956]
- Reported by Miho Hiramatsu. Thanks!!!
+ * lib/rss/parser.rb: removed a guard for requiring open-uri.
-Mon Apr 17 14:27:22 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 18 18:01:26 2006 Kouhei Sutou <kou@cozmixng.org>
- * dln.c (rb_w32_check_imported): skip ordinal entries. based on a
- patch by phasis68 (Heesob Park) at [ruby-core:44381].
- [ruby-core:44371][Bug #6303]
+ * lib/rss/rss.rb: fixed typo: except -> expect
+ * lib/rss/parser.rb: ditto.
+ * test/rss/rss-assertions.rb: ditto.
+ * test/rss/test_parser.rb: ditto.
-Sun Apr 15 14:57:00 2012 Tanaka Akira <akr@fsij.org>
+Sun Jun 18 17:52:39 2006 Kouhei Sutou <kou@cozmixng.org>
- * test/test_pty.rb (test_pty_check_default): call PTY.check until
- "cat" command is finished.
+ * lib/rss/rss.rb: RSS::Element#calc_indent became to be deprecated.
+ * lib/rss/0.9.rb: ditto.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/taxonomy.rb: ditto.
+ * lib/rss/trackback.rb: ditto.
-Sun Apr 15 14:54:16 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/rss/test_1.0.rb: removed RSS::Element.indent_size tests.
+ * test/rss/test_2.0.rb: ditto.
- * test/ruby/test_process.rb (TestProcess#windows?): new method.
+Sun Jun 18 00:49:11 2006 Tanaka Akira <akr@m17n.org>
- * test/ruby/test_process.rb (TestProcess#*): use above method.
+ * ext/socket/socket.c (bsock_recv_nonblock): new method
+ BasicSocket#recv_nonblock.
+ (udp_recvfrom_nonblock): renamed from ip_recvfrom_nonblock.
+ IPSocket#recvfrom_nonblock is moved to UDPSocket#recvfrom_nonblock.
+ (unix_recvfrom_nonblock): removed.
+ UNIXSocket#recvfrom_nonblock is removed.
- * test/ruby/test_process.rb (TestProcess#test_execopts_redirect):
- windows doesn't support FD_CLOEXEC.
+Sat Jun 17 22:17:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Apr 15 06:40:28 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * lib/mathn.rb (Integer::prime_division): raise ZeroDivisionError
+ on zeros. [ruby-dev:28739]
- * include/ruby/win32.h (rb_w32_aspawn_flags): add the declaration of
- new function.
+Sat Jun 17 14:53:32 2006 Tanaka Akira <akr@m17n.org>
- * process.c (enum): add EXEC_OPTION_PGROUP and move the position
- above for the usage in proc_spawn_n().
+ * lib/pathname.rb: backport from 1.9.
+ (Kernel#Pathname): new method.
- * process.c (proc_spawn_n): add an argument to pass new option
- `new_pgroup`. The option specifies CREATE_NEW_PROCESS_GROUP flag to
- CreateProcessW(). This flag is necessary for the usage of
- Process.kill on the subprocess on Windows.
+Sat Jun 17 10:30:41 2006 Kouhei Sutou <kou@cozmixng.org>
- * process.c (rb_exec_arg_addopt): ditto.
+ * lib/rss/rss.rb (Hash#merge, Enumerable#sort_by): removed.
- * process.c (rb_spawn_process): ditto.
+ * lib/rss/rss.rb (RSS::RootElementMixin#to_xml): added.
+ [ruby-talk:197284]
- * process.c (documentation for rb_f_spawn): add documentation for new
- option `new_pgroup` of spawn.
+ We can convert RSS version easily like the following:
+ rss10 = RSS::Parser.parse(File.read("1.0.rdf"))
+ File.open("2.0.rss", "w") {|f| f.print(rss10.to_xml("2.0"))}
- * test/ruby/test_process.rb (TestProcess#test_execopts_new_pgroup):
- add tests for option `new_pgroup`.
+ * test/rss/test_1.0.rb: added #to_xml test.
+ * test/rss/test_2.0.rb: ditto.
- * test/ruby/test_thread.rb
- (TestThreadGroup#test_thread_timer_and_interrupt):
- add option `new_pgroup: true` to spawn on Windows. It's needed for
- Process.kill on a subprocess.
+ * test/rss/rss-testcase.rb: added some helper methods that
+ generates sample RSS 2.0.
- * win32/win32.c (CreateChild): add an argument to pass
- dwCreationFlags of CreateProcessW().
+ * sample/rss/convert.rb: added a sample script to convert RSS format.
- * win32/win32.c (rb_w32_spawn): ditto.
+Sat Jun 17 10:23:22 2006 Kouhei Sutou <kou@cozmixng.org>
- * win32/win32.c (rb_w32_aspawn_flags): add new function to pass
- dwCreationFlags.
+ * lib/rss/rss.rb (Kernel#funcall): removed.
+ * lib/rss/parser.rb (Kernel.URI): removed.
- * win32/win32.c (rb_w32_aspawn): refactor to move the content to
- rb_w32_aspawn_flags().
- [ruby-core:43245][Bug #6131]
+ * lib/rss/maker/: supported
+ xxx.new_yyy do |yyy|
+ yyy.zzz = zzz
+ ...
+ end
+ style and this style became the style of the recommendation.
-Sun Apr 15 06:40:28 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ Old style
+ yyy = xxx.new_yyy
+ yyy.zzz = zzz
+ ...
+ is supported too but this style isn't recommended.
+ [ruby-talk:197284]
- * test/ruby/test_thread.rb
- (TestThreadGroup#test_thread_timer_and_interrupt): skip on Windows.
- Process.kill cannot kill a subprocess if CREATE_NEW_PROCESS_GROUP
- flag is not specified in a call to CreateProcessW().
+ * test/rss/test_*maker*.rb: used new recommended style.
- * win32/win32.c (CreateChild): revert the usage of
- CREATE_NEW_PROCESS_GROUP flag for compatibility.
- [ruby-core:43245][Bug #6131]
+Sat Jun 17 09:03:47 2006 Kouhei Sutou <kou@cozmixng.org>
-Sun Apr 15 04:35:48 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * lib/rss, test/rss: backported from trunk. (2005-11-16 - now)
- * io.c (rb_io_eof): use eof() instead of io_fillbuf(). It's because
- io_unread() doesn't work properly when reading CRLF with read(length)
- and mode 'r'.
- [ruby-core:44189][Bug #6271]
+ * lib/rss/rss.rb (RSS::VERSION): 0.1.5 -> 0.1.6.
+ * test/rss/test_version.rb (RSS::TestVersion#test_version): ditto.
- * test/ruby/test_io_m17n.rb (TestIO_M17N#test_read_crlf_and_eof):
- test for above.
+ * lib/rss/trackback.rb: added TrackBack prefix.
+ * lib/rss/maker/trackback.rb: ditto.
-Sun Apr 15 03:00:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rss/rss.rb : removed needless argument 'prefix'.
+ * lib/rss/parser.rb: ditto.
- * io.c (io_unread): fixed memory leak. report by nagachika via IRC.
+ * lib/rss/1.0.rb: added rdf:Bag.
-Sun Apr 15 03:00:54 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+ * lib/rss/taxonomy.rb: implemented taxonomy module.
+ * test/rss/test_taxonomy.rb: added tests for taxonomy support.
- * io.c (static int io_fflush): add the definition.
- Use it in set_binary_mode_with_seek_cur().
+ * lib/rss/1.0.rb: added convenience method 'resources'.
+ * lib/rss/taxonomy.rb: ditto.
+ * test/rss/rss-assertions.rb: added test for 'resources'.
+ * test/rss/test_taxonomy.rb: ditto.
- * io.c (set_binary_mode_with_seek_cur): refactoring to split the
- content into io_unread(). Fix the possibility of buffer overflow.
+ * lib/rss/rss.rb: fixed a indentation bug.
+ * lib/rss/taxonomy.rb: fixed <taxo:topic> #to_s bug.
+ * test/rss/test_taxonomy.rb: added a #to_s test.
- * io.c (io_unread): add new implementation for Windows. Previous one
- caused invalid cursor position using IO#pos with OS text mode. New
- one fixes the bug.
+ * lib/rss/maker/taxonomy.rb: implemented taxonomy module for RSS
+ Maker.
+ * lib/rss/taxonomy.rb: supported RSS Maker.
+ * lib/rss/maker.rb: added taxonomy module support.
- * test/ruby/test_io_m17n.rb
- (TestIO_M17N#test_pos_dont_move_cursor_position): add a test for
- above bug.
- [ruby-core:43497] [Bug #6179]
+ * lib/rss/rss.rb: adjusted to other element API.
+ * lib/rss/1.0.rb: adjusted to other element API but backward
+ compatibility is reserved.
+ * lib/rss/0.9.rb: ditto.
-Sun Apr 15 03:00:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/rss/test_maker_taxo.rb: added test case for taxonomy module
+ for RSS Maker.
+ * test/rss/test_setup_maker_1.0.rb: added tests for taxo:topic.
- * test/ruby/test_io.rb (TestIO#test_pos_with_getc): updated.
- see [ruby-core:43550]
+ * test/rss/test_setup_maker_1.0.rb: added backward compatibility
+ test.
+ * test/rss/test_setup_maker_0.9.rb: ditto.
+ * test/rss/test_setup_maker_2.0.rb: ditto.
-Sun Apr 15 03:00:54 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/rss/rss-testcase.rb: added convenience method for setting
+ up taxo:topic.
+ * test/rss/rss-assertions.rb: added assertion for taxo:topic.
- * test/ruby/test_io.rb (TestIO#test_pos_with_getc): added.
- see [Bug #6179][ruby-core:43518]
+ * sample/rss/blend.rb: followed new API.
-Wed Apr 11 16:22:16 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rss/taxonomy.rb: changed class or module prefix to
+ Taxonomy from Taxo.
+ * lib/rss/maker/taxonomy.rb: ditto.
- * ext/-test-/add_suffix/bug.c (ruby_add_suffix): no static
- declaration. [ruby-core:44277][Bug #6279]
+ * test/rss/test_taxonomy.rb: use #reject directory.
-Sun Apr 8 06:53:55 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/rss/: use #__send__ instead of #send.
+ * test/rss/: ditto.
- * io.c (io_unread): cast as long the value for extra_max.
- [ruby-core:44137] [Bug #6257]
+ * lib/rss/parser.rb: added entity handling type predicate.
+ * lib/rss/rexmlparser.rb: ditto.
+ * lib/rss/xmlparser.rb: ditto.
+ * lib/rss/xmlscanner.rb: ditto.
-Sat Apr 7 10:28:40 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/rss/xmlscanner.rb: more robust entity handling.
- * ext/psych/lib/psych.rb: bumping up psych version to match release.
- * ext/psych/psych.gemspec: ditto
+ * test/rss/test_parser.rb: added an entity handling test.
-Sat Apr 7 02:07:00 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * test/rss/test_2.0.rb: added RSS 2.0 tests.
+ * test/rss/rss-assertions.rb: extended XML stylesheet assertion.
+ * lib/rss/0.9.rb: added initialize method.
+ * test/rss/test_1.0.rb: cleanup.
- * ext/psych/parser.c: fall back to any encoding if the external
- encoding is wrong. [ruby-core:44163]
- * test/psych/test_encoding.rb: fix test
+ * lib/rss/image.rb: added Image prefix.
+ * lib/rss/maker/image.rb: ditto.
-Wed Apr 4 18:29:15 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rss/rss.rb: improved type conversion.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/0.9.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/syndication.rb: ditto.
- * test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): syntax error.
+ * test/rss/test_2.0.rb: added type conversion tests.
+ * test/rss/test_accessor.rb: ditto.
+ * test/rss/test_to_s.rb: ditto.
+ * test/rss/test_syndication.rb: ditto.
+ * test/rss/test_setup_maker_2.0.rb: ditto.
+ * test/rss/test_setup_maker_1.0.rb: ditto.
+ * test/rss/test_setup_maker_0.9.rb: ditto.
+ * test/rss/test_maker_sy.rb: ditto.
+ * test/rss/test_maker_image.rb: ditto.
+ * test/rss/test_maker_2.0.rb: ditto.
+ * test/rss/test_maker_0.9.rb: ditto.
+ * test/rss/test_image.rb: ditto.
- * test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): call uname
- only on linux because it's a workaround for linux only.
+ * test/rss/test_maker_1.0.rb: use assert instead of assert_equal.
-Wed Apr 4 11:32:09 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rss/rss-assertions.rb: improved type conversion assertions.
- * ext/-test-/add_suffix/bug.c: make all functions in util.c static
- to get rid of multiple definitions. reported at
- https://trac.macports.org/ticket/33814
+ * lib/rss/rss.rb: added backward compatibility codes.
+ * lib/rss/parser.rb: ditto.
+ * test/rss/test_parser.rb: ditto.
+ * test/rss/test_2.0.rb: ditto.
-Tue Apr 3 18:34:33 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jun 17 02:01:00 2006 Tanaka Akira <akr@m17n.org>
- * process.c (setreuid, setregid): suppress warnings.
- [ruby-core:43374][Bug #6169]
+ * lib/pp.rb (Kernel#pretty_inspect): defined for pretty printed
+ string.
-Sat Mar 31 12:11:21 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Sat Jun 17 00:23:58 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_x509cert.c: Fix doc typo.
+ * parse.y (reswords): kDO_BLOCK was missing. fixed: [ruby-core:7995]
-Fri Mar 30 14:17:17 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Sat Jun 17 00:02:15 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * ext/openssl/ossl_pkcs7.c: fix crash when parsing garbage data.
- * test/openssl/test_pkcs7.rb: assert correct behavior for it.
- Thanks to Matt Venables for reporting the issue.
- [ruby-core:43250][Bug #6134]
+ * ext/win32ole/win32ole.c (ole_propertyput): support
+ PROPERTYPUTREF. [ruby-talk:183042]
-Fri Mar 30 14:17:17 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/win32ole/tests/test_propertyputref.rb: ditto.
- * test/openssl/test_x509cert.rb: exclude test that fails when issuing
- a certificate with RSA signature and DSS1 digest for earlier
- OpenSSL versions when used in conjunction with OpenSSL 1.0.1.
- Thanks, Vit Ondruch, for reporting the issue.
- [ruby-core:42949][Bug #6089]
+Thu Jun 15 23:02:47 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Fri Mar 30 14:15:40 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/win32ole/win32ole.c (fole_methods): The return value
+ of WIN32OLE#ole_methods should include PROPERTYPUTREF methods.
- * string.c (str_new_empty): should copy also the encoding as an
- empty substring. [ruby-dev:45441][Bug #6206]
+ * ext/win32ole/win32ole.c (fole_put_methods): The return value
+ of WIN32OLE#ole_put_methods should include PROPERTYPUTREF methods.
-Fri Mar 30 14:14:36 2012 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/win32ole/tests/test_ole_methods.rb: ditto.
- * ext/date/date_core.c (datetime_s_now): [ruby-core:43256].
+ * ext/win32ole/tests/testall.rb : ditto.
-Fri Mar 30 14:12:53 2012 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Wed Jun 14 18:23:28 2006 Eric Hodel <drbrain@segment7.net>
- * numeric.c: fix flodivmod for cornercases [Bug #6044]
- add ruby_float_mod
+ * enum.c (enum_any): Documentation typo.
- * insns.def (opt_mod): use ruby_float_mod
+Wed Jun 14 15:01:09 2006 Eric Hodel <drbrain@segment7.net>
- * internal.h: declare ruby_float_mod
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser#warn): Don't print
+ warnings when -q is set.
- * test/ruby/test_float.rb: tests for above
+Wed Jun 14 23:03:53 2006 Tanaka Akira <akr@m17n.org>
- * test/ruby/envutil.rb: create helper assert_is_minus_zero
+ * configure.in: check sizeof(rlim_t).
+ check setrlimit.
-Wed Mar 28 08:44:24 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * process.c (proc_getrlimit): new method Process.getrlimit.
+ (proc_setrlimit): new method Process.setrlimit.
- * ext/psych/lib/psych.rb: updating version to match gem
- * ext/psych/psych.gemspec: ditto
- * ext/psych/lib/psych/visitors/to_ruby.rb: fixing deprecation warning
+ * ruby.h (NUM2ULL): new macro.
-Mon Jul 18 13:36:47 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon Jun 12 22:25:09 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych.rb: define a new BadAlias error class.
+ * sprintf.c (rb_f_sprintf): adjust precision length to prevent
+ splitting multi-byte characters. [ruby-list:42389]
- * ext/psych/lib/psych/visitors/to_ruby.rb: raise an exception when
- deserializing an alias that does not exist.
+Sun Jun 11 23:20:07 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/psych/test_merge_keys.rb: corresponding test.
+ * lib/optparse.rb (OptionParser::Arguable#getopts): pass self to the
+ parser.
-Fri Mar 9 06:29:22 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+Sun Jun 11 10:00:57 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/psych/lib/psych.rb (load, parse): stop parsing or loading after
- the first document has been parsed.
+ * win32/win32.h (write): not need to define on bcc.
- * test/psych/test_stream.rb: pertinent tests.
+Sun Jun 11 08:30:33 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Mar 9 06:17:05 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/optparse.rb (OptionParser#getopts): new methods.
- * ext/psych/lib/psych.rb (parse_stream, load_stream): if a block is
- given, documents will be yielded to the block as they are parsed.
- [ruby-core:42404] [Bug #5978]
+Sat Jun 10 18:02:40 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych/handlers/document_stream.rb: add a handler that
- yields documents as they are parsed
+ * ext/bigdecimal/lib/bigdecimal/newton.rb (Newton::nlsolve): typo
+ fixed: raize -> raise. [ruby-talk:196608]
- * test/psych/test_stream.rb: corresponding tests.
+Thu Jun 8 14:19:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Mar 6 02:31:20 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * win32/win32.[ch] (rb_w32_read, rb_w32_write): new functions.
+ use recv() and send() when fd is socket. fixed: [ruby-dev:28694]
- * ext/psych/lib/psych/core_ext.rb: only extend Kernel if IRB is loaded
- in order to stop method pollution.
+Wed Jun 7 16:22:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Feb 28 10:28:51 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/tempfile.rb (Tempfile::make_tmpname): put dot between
+ basename and pid. [ruby-talk:196272]
- * ext/psych/lib/psych.rb: default open YAML files with utf8 external
- encoding. [ruby-core:42967]
- * test/psych/test_tainted.rb: ditto
+Wed Jun 7 14:53:04 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Feb 24 13:54:33 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * win32/win32.c (errmap): add some winsock errors.
- * ext/psych/parser.c: prevent a memory leak by protecting calls to
- handler callbacks.
- * test/psych/test_parser.rb: test to demonstrate leak.
+Wed Jun 7 11:34:38 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Feb 24 08:08:38 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * configure.in: add new configure option `--with-winsock2' for mingw.
- * ext/psych/parser.c: set parser encoding based on the YAML input
- rather than user configuration.
- * test/psych/test_encoding.rb: corresponding tests.
- * test/psych/test_parser.rb: ditto
- * test/psych/test_tainted.rb: ditto
+ * win32/Makefile.sub (config.h): define USE_WINSOCK2 in config.h
+ instead of in CPPFLAGS.
-Fri Feb 10 03:41:31 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/socket/extconf.rb: determine whether to use winsock2 or not
+ by using with_config.
- * ext/psych/parser.c: removed external encoding setter, allow parser
- to be reused.
- * ext/psych/lib/psych/parser.rb: added external encoding setter.
- * test/psych/test_parser.rb: test parser reuse
+Wed Jun 7 10:45:10 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Jan 18 12:49:15 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * win32/{configure.bat, setup.mak, Makefile.sub, win32.h}: add
+ new configure option `--with-winsock2'.
- * ext/psych/lib/psych/visitors/to_ruby.rb: Added support for loading
- subclasses of String with ivars
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Added support for dumping
- subclasses of String with ivars
- * test/psych/test_string.rb: corresponding tests
+ * win32/win32.c (StartSockets): ditto.
-Wed Jan 18 10:39:47 2012 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/socket/extconf.rb: ditto.
- * ext/psych/lib/psych/visitors/to_ruby.rb: Added ability to load array
- subclasses with ivars.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Added ability to dump
- array subclasses with ivars.
- * test/psych/test_array.rb: corresponding tests
+ * win32/win32.c (open_ifs_socket): new function.
-Wed Dec 21 02:25:36 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * win32/win32.c (StartSockets, rb_w32_socket): use open_ifs_socket()
+ instead of socket().
+ ifs socket support is backported from trunk.
- * ext/psych/emitter.c: fixing clang warnings. Thanks Joey!
+Wed Jun 7 09:14:44 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Dec 18 12:42:48 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * eval.c (rb_call0): binding for the return event hook should have
+ consistent scope. [ruby-core:07928]
- * ext/psych/lib/psych/visitors/to_ruby.rb: BigDecimals can be restored
- from YAML.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: BigDecimals can be dumped
- to YAML.
- * test/psych/test_numeric.rb: tests for BigDecimal serialization
+ * eval.c (EXEC_EVENT_HOOK): trace_func may remove itself from
+ event_hooks. no guarantee for arbitrary hook deletion.
+ [ruby-dev:28632]
-Sun Dec 18 12:03:13 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon Jun 5 18:12:12 2006 Tanaka Akira <akr@m17n.org>
- * ext/psych/lib/psych/scalar_scanner.rb: Strings that look like dates
- should be treated as strings and not dates.
+ * ext/socket/socket.c (sock_s_unpack_sockaddr_in): reject
+ non-AF_INET/AF_INET6 sockaddr.
+ (sock_s_unpack_sockaddr_un): reject non-AF_UNIX sockaddr.
+ [ruby-dev:28691]
- * test/psych/test_scalar_scanner.rb: corresponding tests.
+Sun Jun 4 20:40:19 2006 Tanaka Akira <akr@m17n.org>
-Wed Dec 7 08:04:31 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/socket/socket.c: fix sockaddr_un handling.
+ [ruby-dev:28677]
- * ext/psych/lib/psych.rb (module Psych): parse and load methods take
- an optional file name that is used when raising Psych::SyntaxError
- exceptions
- * ext/psych/lib/psych/syntax_error.rb (module Psych): allow nil file
- names and handle nil file names in the exception message
- * test/psych/test_exception.rb (module Psych): Tests for changes.
+Fri Jun 2 22:08:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Nov 30 09:09:37 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/forwardable.rb: RDoc typo fix from Jan Svitok
+ <jan.svitok at gmail.com>. [ruby-core:07943]
- * ext/psych/parser.c (parse): parse method can take an option file
- name for use in exception messages.
- * test/psych/test_parser.rb: corresponding tests.
+Fri Jun 2 19:02:09 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue Nov 22 04:46:22 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/openssl/extconf.rb: use create_header.
- * ext/psych/lib/psych.rb: remove autoload from psych
- * ext/psych/lib/psych/json.rb: ditto
+ * ext/openssl/ossl.h, ext/openssl/openssl_missing.h:
+ include RUBY_EXTCONF_H.
-Wed Nov 9 04:52:16 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Fri Jun 2 17:16:52 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/psych/lib/psych/tree_builder.rb: dump complex numbers,
- rationals, etc with reference ids.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
- * ext/psych/lib/psych/visitors/to_ruby.rb: loading complex numbers,
- rationals, etc with reference ids.
- * test/psych/test_object_references.rb: corresponding tests
+ * lib/mkmf.rb (CLEANINGS): remove extconf.h by distclean if created.
-Mon Nov 7 20:31:52 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Fri Jun 2 00:11:19 2006 Tanaka Akira <akr@m17n.org>
- * ext/psych/lib/psych/scalar_scanner.rb: make sure strings that look
- like base 60 numbers are serialized as quoted strings.
- * test/psych/test_string.rb: test for change.
+ * ext/socket/socket.c (s_recvfrom): alen may be zero with UNIXSocket
+ too. (tested on NetBSD 3.0)
+ (s_recvfrom_nonblock): extracted from sock_recvfrom_nonblock.
+ (sock_recvfrom_nonblock): use s_recvfrom_nonblock.
+ (ip_recvfrom_nonblock): new method: IPSocket#recvfrom_nonblock
+ (unix_recvfrom_nonblock): new method: UNIXSocket#recvfrom_nonblock
+ (s_accept_nonblock): extracted from sock_accept_nonblock.
+ (sock_accept_nonblock): use s_accept_nonblock.
+ (tcp_accept_nonblock): new method: TCPServer#accept_nonblock
+ (unix_accept_nonblock): new method: UNIXServer#accept_nonblock
-Thu Oct 27 08:47:38 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Jun 1 19:12:37 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/psych/parser.c: remove unused variable.
+ * win32/win32.c (rb_w32_cmdvector): backslashes inside single-quotes
+ no longer has special meanings. fixed: [ruby-list:42311]
-Wed Oct 5 02:50:27 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Thu Jun 1 16:14:41 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/psych/lib/psych/syntax_error.rb: Add file, line, offset, and
- message attributes during parse failure.
- * ext/psych/parser.c: Update parser to raise exception with correct
- values.
- * test/psych/test_exception.rb: corresponding tests.
+ * win32/win32.c (rb_w32_getcwd): runtime's getcwd() will not success
+ if the length of the cwd is longer than MAX_PATH.
+ fixed [ruby-list:42335]
-Wed Oct 5 01:52:16 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Thu Jun 1 11:29:14 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/psych/parser.c (parse): Use context_mark for indicating error
- line and column.
+ * win32/win32.c (rb_w32_getcwd): set errno if not set.
+ fixed [ruby-list:42346]
-Wed Oct 5 01:22:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Sat May 27 11:29:46 2006 nobuyoshi nakada <nobu@ruby-lang.org>
- * ext/psych/lib/psych/scalar_scanner.rb: use normal begin / rescue
- since postfix rescue cannot receive the exception class. Thanks
- nagachika!
+ * ext/extmk.rb (extmake): remove extinit files if no statically linked
+ extensions.
-Tue Mar 27 22:22:50 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 26 09:05:11 2006 nobuyoshi nakada <nobu@ruby-lang.org>
- * configure.in (RUBY_STACK_GROW_DIRECTION): substitute CPU name as
- shell variable name. based on the patch by The Written Word Inc. at
- [ruby-core:40421]. [Bug #5488]
+ * ruby.h, lib/mkmf.rb (create_header): clear command line options for
+ macros moved to extconf.h.
-Mon Mar 26 09:57:12 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/extmk.rb (extract_makefile, extmk): made RUBY_EXTCONF_H and
+ EXTSTATIC permanent.
- * parse.y (parser_nextc): set encoding for the buffer of ripper.
+ * ext/{dbm,digest/*,socket,zlib}/extconf.rb: used $defs and $INCFLAGS.
-Sun Mar 18 13:23:28 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * {bcc32,win32,wince}/Makefile.sub (COMPILE_C, COMPILE_CXX): added
+ $(INCFLAGS).
- * encoding.c (rb_enc_compatible): return ASCII-8BIT even if 2nd string
- is ascii only string. [ruby-core:42354] [Bug #5968]
+ * lib/mkmf.rb (configuration): add $defs unless extconf.h was created.
-Tue Mar 6 18:55:37 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 25 01:52:07 2006 nobuyoshi nakada <nobu@ruby-lang.org>
- * lib/test/unit/assertions.rb (assert_send, assert_not_send):
- parenthesize non-empty arguments.
+ * lib/mkmf.rb (pkg_config): particular config commands support.
-Tue Mar 6 18:55:37 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/extmk.rb: deal with $static set in extconf.rb.
- * lib/test/unit/assertions.rb (assert_send): make arguments in
- the default message clearer.
+ * mkconfig.rb: merge multiple entries to an entry with multiple lines.
-Tue Mar 6 12:48:08 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb: allow a series of commands to link.
- * ext/io/console/console.c (set_rawmode): clear ECHOE and ECHOK
- bits too.
+ * win32/Makefile.sub: embed manifests.
- * ext/io/console/console.c (echo_p): ignore ECHOE and ECHOK bits.
- [ruby-dev:45309] [Bug #6116]
+ * win32/setup.mak: suffix OS name by runtime version.
- * ext/io/console/console.c (console_raw): fix rdoc.
+Wed May 24 23:52:11 2006 nobuyoshi nakada <nobu@ruby-lang.org>
- * ext/io/console/console.c (console_set_echo): mentioned about
- platform dependency.
+ * configure.in (ac_install_sh): ignore dummy install-sh.
+ [ruby-talk:193876]
-Tue Mar 6 12:40:08 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed May 24 03:10:48 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/io/console/console.c (console_raw, console_set_raw)
- (console_getch): optional parameters. [EXPERIMENTAL]
+ * ext/openssl/lib/openssl/ssl.rb
+ (OpenSSL::SSL::SocketForwarder#setsockopt,getsockopt): typo fixed.
-Tue Mar 6 12:39:27 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 22 17:54:12 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/io/console/console.c (console_cooked, console_set_cooked):
- new methods to reset cooked mode. [EXPERIMENTAL]
+ * ext/socket/socket.c (sock_recvfrom_nonblock): use rb_read_pending
+ instead of rb_io_read_pending.
+ [ruby-dev:28663]
-Tue Mar 6 12:31:47 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 22 17:30:04 2006 Tanaka Akira <akr@m17n.org>
- * ext/io/console/console.c (io_getch): default delegating method
- for StringIO. https://github.com/nobu/io-console/issues/4
+ * rubyio.h (rb_io_set_nonblock): declared.
- * ext/stringio/stringio.c: moved some methods to hidden modules.
+ * io.c (rb_io_set_nonblock): new function.
+ (io_getpartial): nonblocking read support.
+ (io_read_nonblock): new method: IO#read_nonblock.
+ (io_write_nonblock): new method: IO#write_nonblock.
-Tue Mar 6 12:29:34 2012 Eric Hodel <drbrain@segment7.net>
+ * ext/socket/socket.c
+ (sock_connect_nonblock): new method: Socket#connect_nonblock.
+ (sock_accept_nonblock): new method: Socket#accept_nonblock.
+ (sock_recvfrom_nonblock): new method: Socket#recvfrom_nonblock.
- * io.c (Init_IO): Mention io/console methods. [Ruby 1.9 - Bug #5602]
- * ext/io/console/console.c: Mention that io/console must be required
- similar to lib/time.rb
+ [ruby-core:7917]
-Tue Mar 6 11:42:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 22 15:57:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/syck/lib/syck/rubytypes.rb (Exception.yaml_new): fix bug
- that causes YAML serialization problem for Exception.
- Exception#initialize doesn't use visible instance variable for
- the exception message, so call the method with the message.
- patched by Jingwen Owen Ou <jingweno AT gmail.com>.
- http://github.com/ruby/ruby/pull/41
+ * eval.c (umethod_bind): should not update original class.
+ [ruby-dev:28636]
-Fri Mar 2 22:09:03 2012 Hiroshi Nakamura <nahi@ruby-lang.org>
+Mon May 22 13:38:57 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * .travis.yml: Backport TravisCI configuration from trunk.
+ * eval.c (ev_const_get): should support constant access from
+ within instance_eval(). [ruby-dev:28327]
-Thu Mar 1 18:39:44 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 18 17:51:32 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (rb_file_join): honor input encodings than ASCII-8BIT.
- [ruby-core:40338] [Bug #5483]
+ * time.c (time_timeval): should round for usec floating
+ number. [ruby-core:07896]
-Tue Feb 28 11:56:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (time_add): ditto.
- * configure.in (debugflags): check if -ggdb is accepted.
- [ruby-core:42875][Bug #6080]
+Thu May 18 17:11:45 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Feb 27 17:25:40 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/cgi.rb (CGI::out): support utf-8. a patch from Fujioka
+ <fuj at rabbix.jp>. [ruby-dev:28649]
- * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): since methods
- can be overridden, so should not make an assumption on the type
- of results. [ruby-core:42969][Bug #6093]
+Thu May 18 00:42:12 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-Mon Feb 27 02:28:17 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/extmk.rb, lib/mkmf.rb: use BUILD_FILE_SEPARATOR in Makefiles.
- * regparse.c (add_code_range_to_buf0): wrong condition of duplicated
- warnings.
+Wed May 17 17:55:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Feb 26 12:26:26 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dir.c (sys_warning): should not call a vararg function
+ rb_sys_warning() indirectly. [ruby-core:07886]
- * compile.c (iseq_compile_each): call on special object instead of
- self. since stabby lambda is a syntax, so it should not be
- affected by the context. [ruby-core:42349][Bug #5966]
+Wed May 17 08:17:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * insns.def (send): no special deal for FCALL. self should be put
- on TOS instead.
+ * util.c (ruby_strtod): try to reduce errors using powersOf10
+ table. [ruby-dev:28644]
-Sat Feb 25 23:47:49 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue May 16 15:34:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (utime_internal): fix a variable missed to replace.
- [ruby-core:42864] [Bug #6077]
+ * re.c (rb_reg_initialize): should not allow modifying literal
+ regexps. frozen check moved from rb_reg_initialize_m as well.
-Sat Feb 25 21:29:09 2012 URABE Shyouhei <shyouhei@ruby-lang.org>
+Tue May 16 09:20:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_literal.rb (TestRubyLiteral#test_special_const):
- test for https://bugs.php.net/bug.php?id=61095
+ * re.c (rb_reg_initialize): should not modify untainted objects in
+ safe levels higher than 3.
-Sat Feb 25 21:29:09 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (rb_memcmp): type change from char* to const void*.
- * dir.c, file.c, io.c (rb_sys_fail_path): use rb_sys_fail_str.
+ * dir.c (dir_close): should not close untainted dir stream.
- * error.c: new functions to deal exceptions with string instances.
+ * dir.c (GetDIR): add tainted/frozen check for each dir operation.
- * dir.c, file.c, io.c: use rb_sys_fail_path.
+Mon May 15 17:42:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 25 21:18:12 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_symbol_arg):
+ typo fixed. a patch from Florian Gross <florg at florg.net>.
- * dir.c (dir_inspect), io.c (rb_io_inspect): keep encoding of path.
- [Bug #6072]
+Sat May 13 16:14:05 2006 Tanaka Akira <akr@m17n.org>
-Sat Feb 25 21:18:12 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/pp.rb (PP.mcall): new method.
+ (Struct#pretty_print): call Kernel#class and Struct#members even if
+ overridden.
+ (Struct#pretty_print_cycle): ditto.
+ [ruby-core:7865]
- * dir.c (dir_initialize): keep path in original encoding.
+Thu May 11 19:57:00 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * error.c (syserr_initialize): prefer the encoding of message over
- locale. [ruby-dev:45279][Bug #6071]
+ * util.c (ruby_strtod): differ addition to minimize error.
+ [ruby-dev:28619]
-Sat Feb 25 17:10:51 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Aug 11 15:39:25 2006 Eric Hodel <drbrain@segment7.net>
- * lib/fileutils.rb: use chomp(?/) instead of sub to optimize and avoid
- to regexping invalid string.
+ * lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
+ documented.
-Sat Feb 25 16:39:13 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Thu May 11 18:10:43 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * complex.c (nucomp_marshal_load): raise error on invalid data.
- reported by John Firebaugh [ruby-core:42860] [Bug #6076]
+ * util.c (ruby_strtod): should not raise ERANGE when the input
+ string does not have any digits. [ruby-dev:28629]
-Fri Feb 24 23:49:05 2012 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Sun May 7 03:09:51 2006 Stephan Maka <stephan@spaceboyz.net>
- * lib/ostruct.rb (delete_field): Bug fix so previous value is
- returned. Patch by Nick Recobra [Bug #6063]
+ * lib/resolv.rb (Resolv::DNS::Requester::ConnectedUDP#initialize):
+ Use AF_INET6 for nameservers containing colons.
-Fri Feb 24 08:53:28 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat May 6 00:38:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * parse.y (parser_tokadd_string, parser_yylex): insert a backslash
- if the next character is non-ascii. [ruby-dev:45278] [Bug #6069]
+ * signal.c (trap): sig should be less then NSIG. Coverity found
+ this bug. a patch from Kevin Tew <tewk at tewk.com>.
+ [ruby-core:07823]
-Thu Feb 23 14:44:36 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Thu May 4 02:24:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/uri/common.rb (URI::Parser#initialize_regexp):
- use \A \z instead of ^ $. [Bug #5843]
+ * ext/syck/emitter.c (syck_scan_scalar): avoid accessing
+ uninitialized array element. a patch from Pat Eyler
+ <rubypate at gmail.com>. [ruby-core:07809]
-Thu Feb 23 08:08:23 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * array.c (rb_ary_fill): initialize local variables first. a
+ patch from Pat Eyler <rubypate at gmail.com>. [ruby-core:07810]
- * win32/win32.c (rb_w32_uchmod): typo. [Bug#5671] [ruby-dev:44898]
+ * ext/syck/yaml2byte.c (syck_yaml2byte_handler): need to free
+ type_tag. a patch from Pat Eyler <rubypate at gmail.com>.
+ [ruby-core:07808]
- * test/ruby/test_file.rb (TestFile#test_chmod_m17n): test of above bug.
+Wed May 3 02:12:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Feb 22 23:27:52 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (make_hostent_internal): accept ai_family
+ check from Sam Roberts <sroberts at uniserve.com>.
+ [ruby-core:07691]
- * test/iconv/test_option.rb: enabled. [ruby-core:42802][Bug #6061]
+Mon May 1 12:23:19 2006 <sinara@blade.nagaokaut.ac.jp>
-Wed Feb 22 22:04:15 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * numeric.c (num_div): use floor rather than rb_Integer().
+ [ruby-dev:28589]
- * io.c (rb_io_s_foreach): argument check before making Enumerator.
- [ruby-dev:31525]
+ * numeric.c (flo_divmod): the first element of Float#divmod should
+ be an integer. [ruby-dev:28589]
-Wed Feb 22 22:04:15 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_float.rb: add tests for divmod, div, modulo and remainder.
- * io.c (rb_io_s_foreach): return enumerator including kerword
- arguments. [ruby-dev:45267][Bug #6054]
+Sat Apr 29 22:42:08 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Feb 22 21:42:16 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): should initialize
+ flag. [ruby-core:07785]
- * configure.in: remove workaround replacement from gcc to gcc-4.2.
- [Backport #6043]
+Fri Apr 28 10:53:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Feb 22 08:11:06 2012 Narihiro Nakamura <authornari@gmail.com>
+ * util.c (ruby_strtod): should not cut off 18 digits for no
+ reason. [ruby-core:07796]
- * gc.c : remove gc_clear_mark_on_sweep_slots() and use
- rest_sweep() instead of it, because some dead objects might be
- marked in next the mark phase by false pointers.
- [ruby-core:42672]
+ * util.c (ruby_strtod): fixed wrong conversion.
-Sun Feb 19 12:27:24 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Apr 27 01:38:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * configure.in: ignore all warnings from an arbitrary
- header in /usr/local/include.
+ * array.c (rb_ary_fill): internalize local variable "beg" to
+ pacify Coverity. [ruby-core:07770]
-Fri Feb 17 12:51:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Apr 26 16:59:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (create_header): log the content of header.
+ * pack.c (pack_unpack): now supports CRLF newlines. a patch from
+ <tommy at tmtm.org>. [ruby-dev:28601]
-Fri Feb 17 12:26:15 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Tue Apr 25 18:00:05 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/readline/test_readline.rb (test_completion_proc_empty_result):
- ensure clearance of Readline's line_buffer after the test.
+ * ext/tk/tcltklib.c (delete_slaves): maybe increment the reference
+ count of a NULL Tcl_Obj [ruby-core:07759].
-Fri Feb 17 11:46:39 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Apr 25 07:55:31 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/readline/test_readline.rb (test_line_buffer__point): use
- lambda not to exit entire method by "return". or "next" for
- proc. [ruby-dev:45042] [Bug #5802]
+ * lib/jcode.rb (String::tr_s): should have translated non
+ squeezing character sequence (i.e. a character) as well. thanks
+ to Hiroshi Ichikawa <gimite at gimite.ddo.jp> [ruby-list:42090]
-Fri Feb 17 10:15:54 2012 Tanaka Akira <akr@fsij.org>
+Tue Apr 25 00:08:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/dbm/extconf.rb: check _DB_H_ macro unavailable except
- Berkeley DB library.
+ * regex.c (re_compile_pattern): should check if c is not a
+ multibyte character. a patch from KIMURA Koichi
+ <kimura.koichi at canon.co.jp>. [ruby-dev:28598]
-Fri Feb 17 10:14:47 2012 Tanaka Akira <akr@fsij.org>
+Fri Apr 21 15:19:13 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/dbm/test_dbm.rb: fix skip condition for libgdbm 1.8.0 or prior.
- reported by Bohuslav Kabrda.
- [ruby-core:42685] [ruby-trunk - Bug #6036]
+ * ext/tk/tcltklib.c (lib_eventloop_ensure): refer freed pointer
+ [ruby-core:07744] and memory leak.
-Fri Feb 17 09:53:46 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Apr 21 12:14:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * tool/transcode-tblgen.rb (import_ucm): don't use \h because the
- script should work with ruby 1.8.
+ * ext/socket/socket.c: document update patch from Sam Roberts
+ <sroberts at uniserve.com>. [ruby-core:07701]
- * tool/enc-unicode.rb: ditto.
+Wed Apr 19 13:55:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Feb 16 17:54:14 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (arg): too much NEW_LIST()
- * ext/dbm/extconf.rb: merge trunk's ext/dbm/extconf.rb and
- related functions of lib/mkmf.rb. [Backport #6021]
+ * eval.c (SETUP_ARGS0): remove unnecessary access to nd_alen.
-Thu Feb 16 09:25:52 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Apr 19 11:57:04 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * configure.in (enable_pthread): use -pthread on OpenBSD without
- explicit option. patched by Jeremy Evans. [ruby-core:38572]
+ * eval.c (rb_eval): use ARGSCAT for NODE_OP_ASGN1.
+ [ruby-dev:28585]
-Thu Feb 16 07:34:34 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * parse.y (list_concat): revert last change.
- * cont.c (rb_fiber_reset_root_local_storage): add a new function to
- restore rb_thread_t::local_storage.
+ * parse.y (arg): use NODE_ARGSCAT for placeholder.
- * cont.c (rb_obj_is_fiber): add a new function to tell finalizer to
- prevent fibers from destroy.
+Wed Apr 19 11:13:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * gc.c (rb_objspace_call_finalizer): don't sweep fibers at finalizing
- objspace.
+ * lib/getoptlong.rb (GetoptLong::get): RDoc update patch from
+ mathew <meta at pobox.com>. [ruby-core:07738]
- * internal.h (rb_fiber_reset_root_local_storage, rb_obj_is_fiber):
- add prototypes.
+Wed Apr 19 10:13:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (ruby_vm_destruct): reset main thread's local_storage before
- free main thread. rb_thread_t::local_storage is replaced by fiber's
- local storage when forked from fiber, and it should be already freed
- when the fiber was destroyed. [ruby-core:41456] [Bug #5700]
+ * variable.c (rb_const_set): raise error when no target klass is
+ supplied. [ruby-dev:28582]
- * test/ruby/test_fiber.rb (test_fork_from_fiber): add test for fork
- from fiber.
+Wed Apr 19 09:49:36 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Feb 16 06:30:37 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (list_concat): should not modify nodes other than
+ NODE_ARRAY. [ruby-dev:28583]
- * ext/fiddle/closure.c (callback): deal with unsinged integers.
- [ruby-core:42458][Bug #5991][Bug #6022]
+Tue Apr 18 17:40:37 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/fiddle/conversions.c (value_to_generic, generic_to_value):
- ditto.
+ * ext/tk/lib/multi-tk.rb: add a binding to a container for a slave IP.
- * ext/fiddle/closure.c (callback): same as r34506.
+ * ext/tk/lib/tk.rb: update RELEASE_DATE.
-Wed Feb 15 10:35:43 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/tcltklib.c: forget to reset a Tcl interpreter.
- * include/ruby/ruby.h (FIXNUM_P): simple flag should be int.
+ * ext/tk/stubs.c: fix potential bugs about handling rb_argv0.
-Wed Feb 15 10:33:41 2012 Eric Hodel <drbrain@segment7.net>
+Tue Apr 18 00:11:21 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm_eval.c (check_funcall): Call respond_to? with matching arity for
- legacy single-argument implementations. [ruby-trunk - Bug #6000]
+ * eval.c: block_unique should be 1, not frame_unique.
+ [ruby-dev:28577]
-Wed Feb 15 10:25:22 2012 Naohisa Goto <ngotogenome@gmail.com>
+Fri Aug 11 15:39:25 2006 Eric Hodel <drbrain@segment7.net>
- * vm_eval.c (check_funcall): set array elements one-by-one to fix
- compile error with Fujitsu C Compiler 5.6 on Solaris 10 on Sparc.
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_body): Make RDoc
+ ignore C function prototypes. Patch by Tilman Sauerbeck
+ <tilman at code-monkey.de>. [ruby-core:8574]
+ * lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
+ documented.
-Wed Feb 15 10:25:22 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 10 01:03:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_object.rb: tests that respond_to? returns false.
+ * prec.c (prec_prec_f): documentation patch from
+ <gerardo.santana at gmail.com>. [ruby-core:07689]
-Wed Feb 15 10:25:22 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Apr 8 02:34:34 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm_eval.c (check_funcall): try respond_to? first if redefined.
- [Bug #5158]
+ * bignum.c (rb_big_pow): second operand may be too big even if
+ it's a Fixnum. [ruby-talk:187984]
-Wed Feb 15 07:15:50 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Apr 8 02:12:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * compile.c (defined_expr): guard the whole expression.
- [ruby-dev:45021][Bug#5786]
+ * README.EXT: update symbol description. [ruby-talk:188104]
-Wed Feb 15 05:08:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Apr 6 23:28:47 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/dl/cptr.c (rb_dlptr_s_to_ptr): use rb_check_funcall.
+ * COPYING: explicitly note GPLv2. [ruby-talk:187922]
- * ext/dl/cfunc.c (dlcfunc_mark), ext/dl/cptr.c (dlptr_mark):
- workaround to mark wrapped object. this is not a true fix,
- because [Bug #4929] is caused by the interface design of DL.
+Thu Apr 6 11:18:37 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Feb 15 05:04:47 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk/panedwindow.rb: lack of arguments. [ruby-core:7681]
- * ext/dl/cptr.c (rb_dlptr_aref, rb_dlptr_aset): check NULL pointer
- dereference.
+Thu Apr 6 01:04:47 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/rinda/test_rinda.rb: decrease the code that depends on timing.
- [Bug #372] [Bug #4160]
+ * ext/tk/tcltklib.c: fix SEGV when embedding to an application.
+ [ruby-core:7600]
-Wed Feb 15 05:03:41 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/tcltklib.c: fix SEGV at exit. [ruby-talk:186489]
- * test/rinda/test_rinda.rb (test_remote_array_and_hash):
- add local variables to protect objects from GC. [ruby-dev:44253]
- [Bug #5104]
+ * ext/tk/tkutil/tkutil.c: follow to changing specification of
+ instance_eval on ruby-1.9.x.
-Wed Feb 15 05:02:43 2012 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * ext/tk/lib/tk.rb: ditto.
- * test/win32ole/test_err_in_callback.rb (test_err_in_callback):
- skip test if ADODB.connection is not available.
+ * ext/tk/lib/multi-tk.rb: ditto.
-Wed Feb 15 04:49:23 2012 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/tk/lib/tk.rb: remove warning about redefinition of methods.
- * parse.y (debug_lines, coverage): set file path encoding for coverage
- result. [ruby-dev:44950]
+ * ext/tk/lib/tk/variable.rb: remove warning about unseting Tcl
+ variables.
-Tue Feb 14 16:57:11 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Mar 29 20:54:44 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * lib/rake/file_list.rb (Rake::FileList#egrep): there is no need to
- open files in binary mode.
- see more details in https://github.com/jimweirich/rake/issues/74
+ * ext/win32ole/win32ole.c (fole_getproperty): WIN32OLE#[] should accept
+ multi arguments.
-Tue Feb 14 16:52:17 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/win32ole/tests/testWIN32OLE.rb (test_setproperty_bracket): ditto.
- * lib/rdoc/encoding.rb (RDoc::Encoding.read_file): fixup newline chars
- on Windows.
- see https://github.com/rdoc/rdoc/issues/87
+Wed Mar 29 10:07:44 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/rdoc/test_rdoc_markup_pre_process.rb
- (TestRDocMarkupPreProcess#test_include_file,
- TestRDocMarkupPreProcess#test_include_file_encoding_incompatible):
- follow above change.
+ * ext/nkf/nkf-utf8/nkf.c (nkf_each_char_to_hex, encode_fallback_subchar,
+ e2w_conv): support C90 compiler.
-Tue Feb 14 16:34:11 2012 Shota Fukumori <sorah@tubusu.net>
+Wed Mar 29 06:48:40 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/rubygems/test_gem_commands_help_command.rb: Add one
- `require` because if run test-all with test/unit parallel
- running, sometimes this test fails by some constants not found.
- The error reason is some worker doesn't require the file needed by
- this test. This issue is related to [ruby-core:36168].
+ * eval.c (backtrace): reports aliased method names in a generated
+ backtrace. a patch from "U.Nakamura" <usa at garbagecollect.jp>.
+ [ruby-dev:28471]
-Tue Feb 14 15:58:31 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Mar 27 22:19:09 2006 NARUSE, Yui <naruse@ruby-lang.org>
- * gc.c (initial_params): pack in a struct.
+ * ext/nkf/nkf-utf8/{nkf.c, utf8tbl.c, config.h}: imported nkf 2.0.6.
+ * Add --ic / --oc option and mapping tables.
+ * Add fallback option.
+ * Add --no-best-fit-chars option.
+ * Fix some bugs.
- * gc.c (rb_gc_set_params): set parameters always.
- [ruby-dev:44648] [Bug #5467]
+ * ext/nkf/nkf.c (nkf_split_options): added for parse option string.
-Tue Feb 14 15:44:42 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/nkf/lib/kconv.rb (Kconv.to*): add -m0.
+ Note that Kconv.to* still imply -X.
- * test/irb/test_completion.rb: skip if cannot load irb/completion
- (maybe readline does not exist).
+Mon Mar 27 03:17:21 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Feb 14 15:07:23 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_call0): insecure calling should be checked for non
+ NODE_SCOPE method invocations too.
- * lib/test/unit/assertions.rb (build_message): skip escaped
- question marks.
+ * eval.c (rb_alias): should preserve the current safe level as
+ well as method definition.
-Mon Feb 13 12:06:29 2012 Loren Segal <lsegal@soen.ca>
+Fri Mar 24 23:14:30 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (Init_IO): use directive hack to make ARGF documentable
- in other tools. [ruby-core:42515][Bug #6007]
+ * eval.c (yield_under_i): pass self again for instance_eval().
+ [ruby-dev:28466]
-Sun Feb 12 16:57:56 2012 Akinori MUSHA <knu@iDaemons.org>
+Fri Mar 24 17:20:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * misc/rdoc-mode.el (rdoc-imenu-create-index): Add imenu support
- to rdoc-mode.
+ * process.c (rb_f_sleep): remove description about SIGALRM which
+ is not valid on the current implementation. [ruby-dev:28464]
- * misc/rdoc-mode.el (rdoc-mode): Fix regexp patterns containing
- "\s " where CR/LF is not supposed to match.
+Thu Mar 23 10:47:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Feb 12 16:56:23 2012 Akinori MUSHA <knu@iDaemons.org>
+ * eval.c (method_missing): should support argument splat in
+ super. [ruby-talk:185438]
- * misc/rdoc-mode.el (rdoc-mode): Add provide so that requiring
- this library succeeds.
+Mon Mar 20 12:05:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Feb 12 16:53:18 2012 Akinori MUSHA <knu@iDaemons.org>
+ * configure.in: Solaris SunPro compiler -rapth patch from
+ <kuwa at labs.fujitsu.com>. [ruby-dev:28443]
- * lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): Just
- call File.unlink and ignore ENOENT because existence check
- before unlinking does not help in terms of race condition.
+Mon Mar 20 09:40:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): My
- comment about thread safeness is obsolete.
+ * configure.in: remove enable_rpath=no for Solaris.
+ [ruby-dev:28440]
-Sun Feb 12 16:50:28 2012 Akinori MUSHA <knu@iDaemons.org>
+Fri Mar 17 19:08:49 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/shellwords.rb: Fix rdoc markups.
+ * ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: fix typo.
+ [ruby-core:07571]
-Sun Feb 12 16:50:28 2012 Akinori MUSHA <knu@iDaemons.org>
+Wed Mar 15 16:54:21 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/shellwords.rb (Shellwords#shellsplit): Fix a bug where
- consecutive backslashes in double quotes are all removed except
- the one at the tail.
+ * lib/mkmf.rb (create_makefile): support libraries without *.so.
-Sun Feb 12 16:38:13 2012 Akinori MUSHA <knu@iDaemons.org>
+Wed Mar 15 16:35:43 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/shellwords.rb (Shellwords#shellescape): Drop the //n flag
- that only causes warnings with no real effect. [Bug #5637]
+ * ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: should use
+ "rb_str_new(0, 0)" to make empty string.
-Sun Feb 12 16:34:55 2012 Akinori MUSHA <knu@iDaemons.org>
+Sat Mar 11 14:24:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * tool/merger.rb (#default_merge_branch): Add support for
- Subversion 1.7 which adopted a whole new working directory
- structure.
+ * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::wrap): removed
+ space before argument parenthesis. [ruby-talk:183630]
-Sun Feb 12 09:38:46 2012 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ruby.1: a clarification patch from David Lutterkort
+ <dlutter at redhat.com>. [ruby-core:7508]
- * vm_method.c (rb_add_method): should not call method_added hook
- for undef operation. [Bug #5015]
+Sat Mar 4 15:26:40 2006 Tanaka Akira <akr@m17n.org>
-Sun Feb 12 09:29:28 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c (id2ref): fix symbol test.
- * regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): Power PC does not
- allow unaligned word access.
+Sat Mar 4 01:08:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * st.c (UNALIGNED_WORD_ACCESS): x86_64 allows unaligned word
- access as well as i386.
+ * lib/rdoc/ri/ri_paths.rb (RI::Paths): adding paths from rubygems
+ directories. a patch from Eric Hodel <drbrain at segment7.net>.
+ [ruby-core:07423]
-Sat Feb 11 08:06:12 2012 Tanaka Akira <akr@fsij.org>
+Thu Mar 2 19:44:18 2006 Tanaka Akira <akr@m17n.org>
- * test/openssl/test_ssl.rb (test_multibyte_read_write): start server
- for each length to avoid race condition.
+ * gc.c: align VALUE with sizeof(RVALUE) globally.
+ (is_pointer_to_heap): check alignment out of loop.
+ (id2ref): avoid collision between symbols and objects.
+ (rb_obj_id): ditto. moved from object.c.
+ [ruby-talk:178364] [ruby-core:7305]
-Sat Feb 11 06:13:07 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Mar 2 18:58:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * dir.c (fnmatch): The * needs to be escaped to avoid formatting in
- fnmatch comment.
- patched by @dalton. https://github.com/ruby/ruby/pull/91
+ * eval.c (rb_thread_fd_writable): should not re-schedule output
+ from KILLED thread (must be error printing).
-Sat Feb 11 03:38:48 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Thu Mar 2 17:57:49 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * io.c (rb_sys_fail_path): move the definition.
- Move above for using it in set_binary_mode_with_seek_cur().
+ * gc.c: commited magic for reducing RVALUE size on windows. (24->20byte)
+ [ruby-core:7474]
- * io.c (set_binary_mode_with_seek_cur): fix improper seek cursor.
- Seeking file cursor with setting binary mode has possibility to
- cause infinite loop. Fixed the bug and refined error handling.
- Introduced at r34043.
+Thu Mar 2 12:59:14 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- And cleanups as below.
- Remove unnecessary parentheses of `fptr`.
- Use return value of setmode().
+ * win32/win32.c (filetime_to_unixtime): should set tm_isdst to -1.
+ stat() didn't treat daylight saving time property on WinNT.
+ [ruby-talk:182100]
- * test/ruby/test_io_m17n.rb
- (TestIO_M17N#test_seek_with_setting_binmode): add a test for abobe.
- [ruby-core:41671] [Bug #5714]
+Thu Mar 2 08:02:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 11 03:38:48 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * gc.c (add_heap): heap_slots may overflow. a patch from Stefan
+ Weil <weil at mail.berlios.de>.
- * test/ruby/test_io_m17n.rb
- (TestIO_M17N#test_{read_with_binmode_and_get[cs]}): only for Windows.
+Wed Mar 1 00:24:31 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Feb 11 03:38:48 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/parsers/parse_rb.rb (read_escape): could not handle /\^/.
+ merged Mr. Ishizuka's lib/irb/ruby-lex.rb 's patch rev 1.29.
+ [ruby-talk:181631] [ruby-dev:28404]
- * win32/win32.c, include/ruby/win32.h (rb_w32_fd_is_text): new function.
+Tue Feb 28 09:32:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/win32.c (init_stdhandle): set default mode of stdin as binmode.
+ * lib/drb/extservm.rb (invoke_service_command): cannot invoke command
+ if command name is quoted on mswin32. [ruby-dev:28400]
- * io.c (set_binary_mode_with_seek_cur): new function to replace
- SET_BINARY_MODE_WITH_SEEK_CUR macro. now returns previous mode of the
- fd and take care of LF in rbuf.
+Mon Feb 27 00:19:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (do_writeconv): set text mode when needed.
+ * ruby.h (SYM2ID): should not cast to signed long.
+ [ruby-core:07414]
- * io.c (io_read): need to change the mode of the IO to binmode
- temporally when the length for IO#read, because IO#read with length
- must behave so.
+Fri Feb 24 20:07:23 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/ruby/test_io_m17n.rb (TestIO_M17N#test_{read_with_length,
- read_with_length_binmode,get[cs]_and_read_with_binmode,
- read_with_binmode_and_get[cs],read_write_with_binmode}): tests for
- above changes.
+ * test/drb/drbtest.rb (add_service_command): quote pathnames in the
+ server's command line for space contained directory names.
+ Thanks, arton. [ruby-dev:28386]
- all patches are written by Hiroshi Shirosaki. [ruby-core:41496]
- [Feature #5714]
+Fri Feb 24 12:11:08 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Feb 11 03:37:56 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * instruby.rb: install *.exe.manifest and *.dll.manifest if exist.
+ It's for VC++8.
- * test/rexml/test_order.rb (OrderTester#test_more_ordering): use
- GZip::GzReader.open instead of GZip::GzReader.new with File.new.
- fixed a test error on Windows introduced at r33946.
+Fri Feb 24 11:33:52 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Feb 11 03:37:34 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * bcc32/Makefile.sub (HAVE_HYPOT): bcc32 has hypot().
- * ext/zlib/zlib.c (rb_gzreader_initialize): revert a part of r33937.
- 1st, to change the mode of an IO is very sensitive problem, so
- fixed test errors on Windows introduced at r33953.
- the maintainer of this library should judge it.
- 2nd, usually Zlib::GzReader.new is not called directly. #initialize
- is called via .open, and in the method the I/O is opened in binary
- mode, so there is no problem without changing the mode in #initialize.
+Fri Feb 24 11:19:58 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- fixed test errors on Windows introduced at r33947.
-Sat Feb 11 03:23:58 2012 Luis Lavena <luislavena@gmail.com>
+ * time.c (time_new_internal): add prototype to tell the compiler
+ arugments types.
- * ext/zlib/zlib.c (rb_gzreader_initialize): use binary mode by default
- under Windows. Patch by Hiroshi Shirosaki. [ruby-core:40706]
- [Feature #5562]
+ * win32/win32.c (NtInitialize): need to set a handler for VC++8.
- * include/ruby/encoding.h (void rb_econv_binmode): define NEWLINE
- decorator.
+Fri Feb 24 08:19:16 2006 NARUSE, Yui <naruse@ruby-lang.org>
- * io.c (rb_cloexec_fcntl_dupfd): Introduce NEED_READCONV and
- NEED_WRITECONV to replace universal newline decorator by CRLF only
- when required to improve file reading and writing under Windows.
- Patch by Hiroshi Shirosaki. [ruby-core:40706] [Feature #5562]
- * io.c (do_writeconv): adjust binary mode if required.
- * io.c (read_all, appendline, swallow, rb_io_getline_1): ditto.
- * io.c (io_getc, rb_io_each_codepoint, rb_io_ungetc): ditto.
- * io.c (rb_io_binmode, rb_io_ascii8bit_binmode): ditto.
- * io.c (rb_io_extract_modeenc, rb_sysopen): ditto.
- * io.c (pipe_open, prep_stdio, io_encoding_set): ditto.
- * io.c (rb_io_s_pipe, copy_stream_body): ditto.
+ * test.rb: Removed. Obsolete by test/nkf.
- * test/ruby/test_io_m17n.rb (EOT): add test for pipe and stdin in
- binary mode.
+ * ext/.document: enabled documents in nkf and kconv
- * win32/win32.c (init_stdhandle): remove O_BINARY from stdhandle
- initialization.
- * win32/win32.c (rb_w32_write): use FTEXT mode accordingly.
+ * ext/nkf/nkf.c ext/nkf/lib/kconv.rb: Add rdoc.
-Sat Feb 11 03:20:22 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Feb 23 22:39:59 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * io.c (argf_next_argv): wrong timing of setting ecflags.
- fixed the failure of TestArgf#test_textmode introduced at r33662.
+ * bcc32/Makefile.sub: use borlndmm.dll if possible. bcc32's RTL internal
+ memory manager cannot handle large memory block properly.
+ ex: 10000.times { "" << "." * 529671; GC.start } # crash
+ [ruby-dev:28230]
-Sat Feb 11 03:19:45 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Feb 23 13:20:28 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/ruby/test_io_m17n.rb
- (TestIO_M17N#test_default_stdout_stderr_mode): new test for
- r33627-33629. see [backport #5565]
-Sat Feb 11 03:20:22 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (SETUP_ARGS0): fixed memory corruption. [ruby-dev:28360]
- * include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_READ_MASK,
- ECONV_NEWLINE_DECORATOR_WRITE_MASK): new macro.
+Tue Feb 21 02:18:46 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (rb_io_extract_modeenc, pipe_open, prep_stdio, argf_next_argv):
- set TEXTMODE_NEWLINE_DECORATOR_ON_WRITE for textmode on creating IO
- if the flag is available.
+ * configure.in (mingw): have link. [ruby-list:41838]
- * io.c (make_writeconv): drop decorators for reading.
+ * win32/Makefile.sub (config.h): ditto.
- * io.c (make_readconv): drop decorators for writing.
+Tue Feb 21 02:07:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (do_writeconv): existing writeconv is not the condition to raise
- ArgumentError. should check textmode or not.
+ * parse.y (f_arglist): should set command_start = Qtrue for
+ command body. [ruby-talk:180648]
- * test/ruby/test_io_m17n.rb
- (TestIO_M17N#test_{cr,lf,crlf}_decorator_on_stdout): test above
- changes.
+Mon Feb 20 17:37:26 2006 Tanaka Akira <akr@m17n.org>
+ * mkconfig.rb: alias RbConfig for Config.
-Sat Feb 11 03:19:45 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Feb 20 12:27:53 2006 Kent Sibilev <ksruby@gmail.com>
- * test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
- default_mode_on_unix,text_mode,binary_mode}): sorry for wrong test
- committed in r33144. I'd misunderstood the spec of ruby's universal
- newline.
+ * lib/rational.rb (Integer::gcd): small typo fix.
+ [ruby-core:07395]
-Sat Feb 11 03:17:41 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Feb 20 01:05:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
- default_mode_on_unix,text_mode,binary_mode}): tests for [Bug #5164].
+ * lib/rational.rb (Integer::gcd): replaced by gcd4 in
+ [ruby-core:07390]. [ruby-core:07377]
-Sat Feb 11 03:13:27 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Feb 20 00:57:02 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * transcode.c: enabled econv newline option.
+ * ext/openssl/ossl.h (OSSL_Debug): should not use __func__.
+ [ruby-dev:28339]
-Sat Feb 11 02:39:09 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Sun Feb 19 04:46:29 2006 Guy Decoux <ts@moulon.inra.fr>
- * variable.c (set_const_visibility): clear inine-cache when constant's
- visibility is modified. [ruby-dev:44929]
+ * eval.c: initial value for block_unique must be 1.
+ [ruby-talk:180420]
- * test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
- add test for it.
+Sat Feb 18 23:58:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
+ * lib/tracer.rb (Tracer::Tracer.add_filter): turn on tracer mode
+ only when caller() level size is one. [ruby-core:07389]
- * variable.c (set_const_visibility): print a warning when no argument
- is passwd to Module#private_constant. [ruby-list:48558]
+ * lib/rdoc/parsers/parse_rb.rb: need not to require "tracer".
+ [ruby-core:07389]
- * vm_method.c (set_method_visibility): ditto for
- Module#private_class_method.
+ * sample/rtags.rb: ditto.
-Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
+Sat Feb 18 12:18:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * variable.c (set_const_visibility): Module#private_constant has
- changed the visibility of only the first argument. Now it changes
- all of them. [ruby-list:48558]
+ * lib/fileutils.rb (FileUtils::fu_world_writable): make it
+ private. [ruby-core:07383]
- * test/ruby/test_module.rb: add a test for above.
+Sat Feb 18 00:22:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 11 02:39:09 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/tracer.rb: merged a minor clarification patch from Daniel
+ Berger <Daniel.Berger at qwest.com>. [ruby-core:07376]
- * variable.c (set_const_visibility): clear inine-cache when constant's
- visibility is modified. [ruby-dev:44929]
+Fri Feb 17 11:18:42 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
- add test for it.
+ * util.c (ruby_strtod): Float("1e") should fail. [ruby-core:7330]
-Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
+ * pack.c (EXTEND32): unpack("l") did not work where sizeof(long) != 4.
+ [ruby-talk:180024]
- * variable.c (set_const_visibility): print a warning when no argument
- is passwd to Module#private_constant. [ruby-list:48558]
+ * pack.c (pack_unpack): fixed integer overflow on template "w".
+ [ruby-talk:180126]
- * vm_method.c (set_method_visibility): ditto for
- Module#private_class_method.
+Fri Feb 17 09:39:29 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 11 02:39:09 2012 Yusuke Endoh <mame@tsg.ne.jp>
+ * eval.c (rb_thread_wait_for): sleep should always sleep for
+ specified amount of time. [ruby-talk:180067]
- * variable.c (set_const_visibility): Module#private_constant has
- changed the visibility of only the first argument. Now it changes
- all of them. [ruby-list:48558]
+Thu Feb 16 01:10:48 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_module.rb: add a test for above.
+ * eval.c (backtrace): frame->orig_func may not be initialized.
+ [ruby-core:07367]
-Sat Feb 11 02:26:51 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Wed Feb 15 16:52:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/openssl/buffering.rb: Force multi-byte strings to be treated as
- binary data.
- * test/openssl/test_ssl.rb: Add test for it.
+ * eval.c (rb_eval): NODE_OP_ASGN1 should allow splat in its
+ argument list. [ruby-core:07366]
- Thanks to Niklas Baumstark for reporting the issue!
+ * parse.y (arg): avoid unnecessary extra argument.
+ [ruby-core:07366]
- [Ruby 1.9 - Bug #5233] [ruby-core:39120]
+ * eval.c (rb_eval): honor visibility on OP_ASGN1 and
+ OP_ASGN2. [ruby-core:07366]
-Fri Feb 10 17:25:28 2012 Tanaka Akira <akr@fsij.org>
+Wed Feb 15 10:09:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/set.rb (SortedSet.setup): remove old_init after initialize
- method is redefined. The remove before redefinition makes the
- warning prevention fragile. [ruby-dev:44892]
+ * eval.c (yield_under_i): should not pass self as an argument to
+ the block for instance_eval. [ruby-core:07364]
-Fri Feb 10 17:02:12 2012 okkez <okkez000@gmail.com>
+Wed Feb 15 09:20:35 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (rb_thread_create_timer_thread): fix memory
- leak. [ruby-dev:44904] [Bug #5688]
+ * eval.c (rb_obj_instance_eval): should be no singleton classes for
+ true, false, and nil. [ruby-dev:28186]
-Fri Feb 10 05:22:32 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Feb 14 18:48:33 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * cont.c (fiber_setcontext): Use longjmp() instead of swapcontext() on
- FreeBSD 9. [ruby-dev:41316] [Bug #3295] [Bug #5526]
+ * eval.c (DMETHOD_P): accessing wrong frame. [ruby-dev:28181]
-Fri Feb 10 05:13:12 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+ * eval.c (proc_invoke): preserve FRAME_DMETH flag.
- * object.c: Added examples for Object#is_a? and
- Object#instance_of? patcheed from Manoj Kumar.
- [Bug #5880] [ruby-core:42057]
+Tue Feb 14 15:13:51 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Fri Feb 10 05:11:43 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/zlib/zlib.c: supress warning on test/zlib. [ruby-dev:28323]
- * io.c (argf_next_argv): reset ARGF.next_p on ARGV.replace.
- r34409 breaks replacing ARGV.
- [ruby-dev:45160] [Bug #5952]
+Tue Feb 14 14:01:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Feb 10 05:11:43 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (search_time_t): support non 32bit time_t environments.
- * io.c (argf_close): skip stdin, which should be readable again.
- [ruby-dev:45160] [Bug #5952]
+ * win32/Makefile.sub (config.h): VC++8 has ``long long'' type.
- * io.c (argf_readlines): reinitialize after all read to be
- readable again.
+ * win32/Makefile.sub (config.h): VC++8's time_t is 64bit value.
-Fri Feb 9 01:36:19 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * win32/win32.c (rb_w32_utime): drop read-only attribute before
+ changing file time.
- * backport r34482 from trunk
+ all changes are backported from CVS HEAD.
- * ext/openssl/ossl_ssl.c: Add SSL constants and allow to unset SSL
- option to prevent BEAST attack. See [Bug #5353].
+Tue Feb 14 11:21:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- In OpenSSL, OP_DONT_INSERT_EMPTY_FRAGMENTS is used to prevent
- TLS-CBC-IV vulunerability described at
- http://www.openssl.org/~bodo/tls-cbc.txt
- It's known issue of TLSv1/SSLv3 but it attracts lots of attention
- these days as BEAST attack. (CVE-2011-3389)
+ * io.c (argf_forward): should not use frame->argv.
+ [ruby-core:07358]
- Until now ossl sets OP_ALL at SSLContext allocation and call
- SSL_CTX_set_options at connection. SSL_CTX_set_options updates the
- value by using |= so bits set by OP_ALL cannot be unset afterwards.
- This commit changes to call SSL_CTX_set_options only 1 time for each
- SSLContext. It sets the specified value if SSLContext#options= are
- called and sets OP_ALL if not.
+Mon Feb 13 18:08:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- To help users to unset bits in OP_ALL, this commit also adds several
- constant to SSL such as
- OpenSSL::SSL::OP_DONT_INSERT_EMPTY_FRAGMENTS. These constants were
- not exposed in Ruby because there's no way to unset bits in OP_ALL
- before.
+ * eval.c (rb_call0): argument update propagation. [ruby-dev:28044]
- Following is an example to enable 0/n split for BEAST prevention.
+ * env.h: remove argv member from struct FRAME.
- ctx.options = OP_ALL & ~OP_DONT_INSERT_EMPTY_FRAGMENTS
+Mon Feb 13 13:27:00 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/openssl/test_ssl.rb: Test above option exists.
+ * eval.c (eval): should push class from binding if supplied.
+ [ruby-core:07347]
-Thu Feb 9 17:08:20 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Feb 13 00:04:00 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * cont.c (cont_mark): mark original Thread object from saved_thread.
- [ruby-dev:44567] [Bug #5386]
+ * lib/erb.rb (ERB::Compiler): add instance variable @insert_cmd to
+ change <%='s behavior. (backported 1.15 - 1.16)
-Thu Feb 9 17:05:07 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Feb 11 02:04:11 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * cont.c (HAVE_GETCONTEXT): see getcontext(3) because DragonFly BSD
- x64 port doesn't have it.
+ * eval.c (eval): no need to push ruby_class. [ruby-dev:28176]
-Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Feb 11 01:57:44 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/memory_status.rb (Memory::Win32): 64bit support.
+ * eval.c (rb_f_autoload): check if ruby_cbase is nil (during
+ instance_eval for objects cannot have singleton classes,
+ e.g. fixnums and symbols). [ruby-dev:28178]
-Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Feb 7 23:03:24 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/dl/lib/value.rb (DL::ValueUtil.{unsigned_value,signed_value}):
- currenly pack/unpack does not accept "q!" and "Q!".
+ * ext/zlib/zlib.c: should not access ruby objects in finalizer.
+ [ruby-dev:28286]
-Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Feb 6 16:02:51 2006 WATANABE Hirofumi <eban@ruby-lang.org>
- * ext/fiddle/conversions.c (value_to_generic): src is not guranteed as
- a Bignum if the type is LONG_LONG. it may be a Fixnum if the value
- is small.
+ * file.c (rb_thread_flock): ERROR_NOT_LOCKED is not an error on Cygwin.
+ In such situation, flock() should return 0.
-Thu Feb 9 16:19:04 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Feb 6 00:41:08 2006 Tanaka Akira <akr@m17n.org>
- * ext/dl/lib/types.rb: Win64 support.
+ * ruby.h (RSTRUCT_LEN, RSTRUCT_PTR): defined for source level
+ compatibility with ruby 1.9.
-Thu Feb 9 11:11:15 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Sun Feb 5 21:05:34 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/dbm/dbm.c (Init_dbm): fix a build error on mswin32.
- use `extern __declspec(dllimport)` for dll link with VC.
- [ruby-core:41996] [Bug #5869]
+ * numeric.c (fix_to_s): removed workaround for radix 2. Historically,
+ rb_fix2str could only handle radix 8, 10, 16. (Rev1.37) But for now,
+ it can handle radix 2..36. [ruby-Bugs#3438] [ruby-core:7300]
-Thu Feb 9 11:11:15 2012 Tanaka Akira <akr@fsij.org>
+Sun Feb 5 18:55:08 2006 Minero Aoki <aamine@loveruby.net>
- * ext/dbm/dbm.c: use db_version() instead of DB_VERSION_STRING to
- detect runtime Berkeley DB version.
- use dpversion instead of _QDBM_VERSION to detect runtime QDBM
- version.
- [ruby-dev:44948]
+ * lib/net/http.rb: imported from trunk, rev 1.129
-Thu Feb 9 11:11:15 2012 Tanaka Akira <akr@fsij.org>
+ * lib/net/http.rb (add_field, get_fields): keep 1.8.2 backward
+ compatibility.
- * ext/dbm/extconf.rb: detect gdbm_version in libgdbm.
+ * lib/net/https.rb: imported from trunk, rev 1.3.
- * ext/dbm/dbm.c: make DBM::VERSION more informative for gdbm, qdbm and
- Berkeley DB 1.x. [ruby-dev:44944]
+ * lib/net/https.rb: #use_ssl? definition moved from net/http.rb.
-Thu Feb 9 07:32:40 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Feb 5 14:22:15 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * numeric.c (rb_enc_uint_char): raise RangeError when added codepoint
- is invalid. [Feature #5855] [Bug #5863] [Bug #5864]
+ * lib/pstore.rb: should return default value if name is not found.
+ [ruby-core:7304]
- * string.c (rb_str_concat): ditto.
+ * lib/pstore.rb: should raise PStore::Error if not in transaction.
- * string.c (rb_str_concat): set encoding as ASCII-8BIT when the string
- is US-ASCII and the argument is an integer greater than 127.
+Sat Feb 4 22:51:43 2006 Tanaka Akira <akr@m17n.org>
- * regenc.c (onigenc_mb2_code_to_mbclen): rearrange error code.
+ * eval.c: apply the FreeBSD getcontext/setcontext workaround
+ only before FreeBSD 7-CURRENT.
- * enc/euc_jp.c (code_to_mbclen): ditto.
+Sat Feb 4 21:19:23 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * enc/shift_jis.c (code_to_mbclen): ditto.
+ * win32/win32.c (LK_ERR): ERROR_NOT_LOCKED is not an error.
+ In such situation, flock() should return 0.
-Thu Feb 9 07:28:43 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Feb 4 15:56:37 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/pathname/test_pathname.rb: not read but binread.
- patched by Benoit Daloze, [ruby-core:42440] [Bug #5984]
+ * numeric.c (fix_to_s): (2**32).to_s(2) fails with exception where
+ sizeof(int) == 4 < sizeof(long). [ruby-core:7300]
-Wed Feb 8 22:29:59 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 3 15:06:50 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * string.c (rb_str_modify_expand): fix memory leak.
+ * ext/syck/syck.c (syck_move_tokens): should reset p->cursor or etc
+ even if skip == 0. This causes buffer overrun.
+ (ex: YAML.load('--- "..' + '\x82\xA0' * 511 + '"'))
-Wed Feb 8 10:58:45 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Feb 2 23:51:18 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/readline/readline.c (readline_attempted_completion_function):
- respect encodings. [Bug #5941]
+ * ext/syck/emitter.c (syck_emitter_write): should not set '\0' on
+ emitter's marker. if marker points to the end of buffer, this causes
+ buffer overrun. (ex: YAML.dump("." * 12288))
-Wed Feb 8 10:56:00 2012 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Thu Feb 2 16:01:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/readline/readline.c (readline_attempted_completion_function):
- fix compile error.
+ * eval.c (eval): need not to protect $SAFE value.
+ [ruby-core:07177]
-Wed Feb 8 10:56:00 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Feb 2 14:45:53 2006 Ville Mattila <ville.mattila@stonesoft.com>
- * ext/readline/readline.c (readline_attempted_completion_function):
- empty completion result does not mean memory error.
+ * configure.in: The isinf is not regognized by autoconf
+ library guesser on solaris 10. [ruby-core:7138]
-Wed Feb 8 10:54:49 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Feb 1 22:01:47 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/readline/readline.c (readline_readline): check if outstream
- is closed to get rid of a bug of readline 6. [ruby-dev:45043]
- [Bug #5803]
+ * configure.in, hash.c (ruby_setenv): use setenv(3) and unsetenv(3)
+ where they are supported. modifing environ variable seems to
+ segfault solaris 10. [ruby-core:7276] [ruby-dev:28270]
-Wed Feb 8 10:52:51 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ruby.c (set_arg0): if use setenv(3), environ space cannot be used
+ for altering argv[0].
- * ext/readline/readline.c (Init_readline): like r18313, libedit's
- replace_history_entry may use offset instead of which.
- so introduce history_replace_offset_func and initialize it.
+Tue Jan 31 14:46:28 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/readline/readline.c (hist_set): use history_replace_offset_func.
+ * struct.c (rb_struct_select): update RDoc description.
+ [ruby-core:7254]
-Wed Feb 8 10:52:36 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jan 31 11:58:51 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/readline/readline.c (Init_readline): fix wrong condition.
+ * ext/tk/lib/multi-tk.rb: add MultiTkIp#eval and bg_eval.
-Wed Feb 8 10:50:11 2012 Naohisa Goto <ngotogenome@gmail.com>
+ * ext/tk/lib/tk/namespace.rb: TkNamespace#eval was enbugged at the
+ last commit. Now it will return a proper object.
- * test/ruby/test_rubyoptions.rb (test_script_from_stdin): slave pty
- should be manipulated because master pty may not be a tty on some
- environment (e.g. Solaris). [Bug:#5222] [ruby-dev:44420]
+Tue Jan 31 00:10:26 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Feb 8 10:38:36 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/rubyext.c (syck_resolver_transfer): workaround for SEGV.
+ ex: ruby -ryaml -e 'YAML.load("!map:B {}")' [ruby-core:7217]
- * Makefile.in (CFLAGS): append ARCH_FLAG.
+Sat Jan 28 07:56:57 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * configure.in (ARCH_FLAG): exclude from CFLAGS.
+ * lib/rdoc/usage.rb: support "a:0:33" style caller[-1]. In this case
+ file name is "a:0". I don't know this really happens though...
+ [ruby-Bugs:3344]
-Wed Feb 08 09:19:00 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Wed Jan 25 22:29:04 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_cipher.c: Add warning about key as IV.
+ * configure.in, dln.c, file.c, intern.h, missing.h (eaccess): use
+ system routine if provided. fixed: [ruby-core:07195]
-Wed Feb 8 10:37:31 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Sun Jan 22 23:27:13 2006 Go Noguchi <gonoguti@yahoo.co.jp>
- * ext/openssl/ossl_cipher.c: Update and complete documentation.
+ * lib/test/unit/autorunner.rb (process_args): ignore arguments after
+ '--' so that test scripts can handle them. fixed: [ruby-dev:28258]
-Wed Feb 08 09:57:33 2012 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Sun Jan 22 22:09:52 2006 Tanaka Akira <akr@m17n.org>
- * ext/openssl/ossl_asn1.c: Call INT2NUM only once for GeneralString.
- Thanks to Mantas Mikulenas for noticing and providing a patch!
- [ruby-core:42358] [Bug #5972]
+ * eval.c (POST_GETCONTEXT): define separately from PRE_GETCONTEXT on
+ IA64 to avoid reusing variable address.
-Wed Feb 8 10:34:59 2012 TAKAO Kouji <kouji@takao7.net>
+Sun Jan 22 20:03:35 2006 Tanaka Akira <akr@m17n.org>
- * ext/readline/readline.c (readline_attempted_completion_function):
- in Readline module with GNU Readline 6 case, Readline module
- resets completion_append_character to " ", after it executes
- completion. So, Readline module stores
- completion_append_character, and Readline module always sets it
- after Readline module executes completion. [ruby-dev:43456]
- [Feature #4635]
+ * eval.c (ruby_setjmp): define PRE_GETCONTEXT and POST_GETCONTEXT
+ instead of FUNCTION_CALL_MAY_RETURN_TWICE.
+ define PRE_GETCONTEXT to clear carry flag for workaround of
+ FreeBSD/i386 getcontext/setcontext bug.
+ [ruby-dev:28263]
-Wed Feb 8 09:47:52 2012 Tanaka Akira <akr@fsij.org>
+Sat Jan 21 00:36:47 2006 Tanaka Akira <akr@m17n.org>
- * test/ruby/test_sleep.rb (test_sleep_5sec): 0.1sec tolerance is too
- small for busy environment.
+ * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): use only on SPARC and IA64
+ before gcc 4.0.3.
+ [ruby-dev:28247]
-Wed Feb 8 09:45:23 2012 Tanaka Akira <akr@fsij.org>
+Thu Jan 19 22:21:23 2006 Minero Aoki <aamine@loveruby.net>
- * test/dbm/test_dbm.rb: split tests for read only database.
+ * lib/fileutils.rb (mv): should remove file after copying.
+ [ruby-dev:28223]
- * test/gdbm/test_gdbm.rb: ditto.
+Wed Jan 18 23:37:06 2006 Tanaka Akira <akr@m17n.org>
-Wed Feb 8 09:43:48 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): don't clobber %l7 of SPARC
+ if enable-shared.
+ (ruby_setjmp): call FUNCTION_CALL_MAY_RETURN_TWICE after getcontext
+ too.
+ reported by Pav Lucistnik and Marius Strobl.
+ http://lists.freebsd.org/pipermail/freebsd-sparc64/2006-January/003739.html
- * error.c (name_err_mesg_to_str): clear rb_thread_t::errinfo when
- ignore exception under rb_protect(). [ruby-core:41612] [Bug #5755]
+Tue Jan 17 11:32:46 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/ruby/test_exception.rb (test_exception_in_name_error_to_str):
- add a corresponding test.
+ * win32/setup.mak (MAKE): workaround for nmake 8.
-Wed Feb 8 09:36:42 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jan 17 11:10:21 2006 NAKAMURA Usaku <usa@ruby-lang.org>
- * encoding.c (require_enc): reject only loading from untrusted
- load paths. [ruby-dev:44541] [Bug #5279]
+ * win32/{Makefile.sub,setup.mak}: invoke .bat via shell. workaround
+ for nmake 8.
- * transcode.c (load_transcoder_entry): ditto.
+Mon Jan 16 10:26:23 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Feb 8 09:36:42 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/emitter.c (syck_emit_seq, syck_emit_map, syck_emit_item):
+ should output complex key mark even if map's key is empty seq/map.
+ [ruby-core:7129]
- * encoding.c (load_encoding): predefined encoding names are safe.
- [ruby-dev:44469] [Bug #5279]
+Sat Jan 14 05:37:06 2006 Tanaka Akira <akr@m17n.org>
- * transcode.c (load_transcoder_entry): ditto.
+ * io.c (READ_DATA_PENDING, READ_DATA_PENDING_COUNT): defined
+ for DragonFly BSD 1.4.0.
-Tue Feb 7 14:29:16 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jan 14 03:43:24 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * st.c (st_foreach): should not yield same pair when checking
- after unpacking.
+ * file.c (rb_file_s_chmod): avoid warning where sizeof(int) !=
+ sizeof(void*).
-Tue Feb 7 14:03:45 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Fri Jan 13 19:14:56 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/tempfile.rb (Tempfile#_close): clear @tempfile and @data[1] even
- when exception is raised at @tempfile.close. [ruby-dev:45113]
+ * lib/rdoc/diagram.rb:
+ - properly quote bare element attributes
+ - terminates dangling elements (e.g. <img>, <br>, <link>, etc)
+ - converts "CVS" to the more HTML-friendly acronym element
+ - adds missing type attributes to style elements
- * lib/tempfile.rb (Tempfile#unlink): fix a typo.
+ based on Paul Duncan's patch <pabs@pablotron.org> [ruby-core:7028]
-Tue Feb 7 14:02:32 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/rdoc/generators/html_generator.rb: ditto.
+ * lib/rdoc/generators/template/html/hefss.rb: ditto.
+ * lib/rdoc/generators/template/html/html.rb: ditto.
+ * lib/rdoc/generators/template/html/kilmer.rb: ditto.
- * test/ruby/test_io.rb (test_autoclose_true_closed_by_finalizer,
- test_autoclose_true_closed_by_finalizer): skip if IO objects are
- not recycled yet. [ruby-dev:45098] [Bug #5850]
+Thu Jan 12 11:53:08 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Feb 7 13:59:26 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/sample/tkballoonhelp.rb: [bug fix] couldn't add to a widget
+ which is constructed with TkComposite module.
+ [new feature] support 'command' option which is called just before
+ popping up the balloon help.
- * gc.c (run_finalizer): clear rb_thread_t::errinfo when ignore
- an exception under rb_protect(). [ruby-dev:45113]
+Wed Jan 11 15:00:00 2006 Ville Mattila <mulperi@iki.fi>
-Mon Feb 6 15:34:47 2012 Tanaka Akira <akr@fsij.org>
+ * io.c (READ_PENDING*): Support solaris 64-bit environments.
+ Solaris defines a opaque FILE struct when compiling 64 bit
+ binaries. This means that we dont have access to _ptr etc.
+ members anymore. The solution by Steven Lumos is to define
+ FILE64 that has needed members available. I've modified
+ the origanal patch a bit so that it compiles both with gcc
+ and now free sun studio 11 compiler and both amd64 and sparc.
+ NOTE! We have to 64 bit solaris FILE structure time to time
+ otherwise we'll get breakage.
+ [ruby-core:7106]
- * ruby.c (fill_standard_fds): use fstat() instead of fcntl(F_GETFD)
- for MinGW. reported by Luis Lavena. [ruby-core:40526] [Bug #5516]
+Tue Jan 10 19:42:33 2006 Tanaka Akira <akr@m17n.org>
-Mon Feb 6 15:34:47 2012 Tanaka Akira <akr@fsij.org>
+ * gc.c (garbage_collect): mark ruby_current_node.
+ if an exception is raised in a finalizer called written in C by
+ rb_gc_call_finalizer_at_exit, ruby_set_current_source may use
+ collected ruby_current_node and mark_source_filename may corrupt
+ memory.
- * ruby.c (fill_standard_fds): new function to open closed standard
- file descriptors.
- (ruby_sysinit): call fill_standard_fds.
+Tue Jan 10 13:30:34 2006 akira yamada <akira@ruby-lang.org>
-Mon Feb 6 15:19:17 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/syck/rubyext.c (syck_resolver_transfer): should be able to load
+ !ruby/object:Bignum syntax 1.8.3 dumped. [ruby-core:6159]
- * io.c (rb_io_fsync,rb_io_fdatasync): release GVL during fsync().
- fsync() and fdatasync() may take a long time on slow disks and/or
- if there is much dirty data.
- Patch by Eric Wong. [Feature #5665] [ruby-core:41247]
+Tue Jan 10 12:47:41 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Feb 6 15:01:55 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/yaml/rubytypes.rb (Fixnum): Bignum could not be loaded in
+ ruby 1.8.3/1.8.4. [ruby-core:6115]
- * vm_eval.c (vm_call0): should pass block to enumerators. patched
- by Kazuki Tsujimoto. [ruby-dev:44961][Bug #5731]
+ * lib/yaml/rubytypes.rb (Numeric): Subclass of Numeric could not
+ be dumped properly. [ruby-core:7047]
- * vm_eval.c (method_missing), vm_insnhelper.c (vm_call_method):
- ditto. patched by satoshi shiba.
+Tue Jan 10 12:00:48 2006 Aaron Schrab <aaron @nospam@ schrab.com>
-Mon Feb 6 21:52:20 2012 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/yaml/rubytypes.rb (Symbol#yaml_new): YAML loading of quoted
+ Symbols broken. [ruby-Bugs:2535]
- * common.mk (INSTRUBY_ARGS): added --mantype to apply mdoc2man.rb
- to man pages. Fixes #5598.
- (do-install-nodoc, do-install-local, do-install-man,
- dont-install-nodoc, dont-install-local, dont-install-man):
- No longer needs --mantype.
+Mon Jan 9 19:54:35 2006 arton <artonx@yahoo.co.jp>
- Reported by Rainer Orth <ro AT cebitec.uni-bielefeld.de>,
- patch by George Koehler <xkernigh AT netscape.net>.
+ * ext/zlib/extconf.rb: zlib compiled DLL version 1.2.3 distributed by
+ http://www.zlib.net/ has zdll.lib. [ruby-dev:28209]
-Mon Feb 6 21:21:46 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jan 9 14:17:12 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/unit/assertions.rb (MINI_DIR): quick dirty hack to get rid of
- warnings when using assert/assert_respond_to.
+ * win32/Makefile.sub (OPTFLAGS): I have experienced trouble on y- flag,
+ (VisualC++6) so use -O2b2xg- if $(MSC_VER) < 1400. [ruby-core:7040]
-Mon Feb 6 20:38:19 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Jan 9 14:17:12 2006 Kero van Gelder <rubyforge @nospam@ kero.tmfweb.nl>
- * file.c (file_expand_path): reset coderange after expanding path.
+ * lib/webrick/httpservlet/filehandler.rb: fixed typo. [ruby-core:7075]
-Mon Feb 6 20:32:17 2012 Tadayoshi Funaba <tadf@dotrb.org>
+Sat Jan 7 15:40:07 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/date/date_strptime.c: moved detector of leftover.
+ * parse.y (singleton): get rid of segfault on syntax error.
+ fixed: [ruby-core:07070]
-Mon Feb 6 20:32:17 2012 Tadayoshi Funaba <tadf@dotrb.org>
+Fri Jan 6 10:16:20 2006 Steven Lumos <steven@lumos.us>
- * ext/date/date_parse.c: [ruby-core:42173].
+ * io.c (READ_DATA_PENDING): defined for 64bit Solaris on SPARC.
+ [ruby-core:7057]
+ (READ_DATA_PENDING_COUNT): ditto.
+ (READ_DATA_PENDING_PTR): ditto.
-Mon Feb 6 20:31:35 2012 Tadayoshi Funaba <tadf@dotrb.org>
+Sun Jan 1 17:07:59 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/date/date_core.c: uses to_integer instead.
- * test/date/test_switch_hitter.rb: added a test.
+ * win32/win32.c (rb_w32_seekdir): should not segfault even if passed
+ the location which rb_w32_telldir didn't return. [ruby-core:7035]
+ (I think HEAD implementation is better. but binary compatibility)
-Mon Feb 6 20:31:35 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/ruby/test_dir.rb: added.
- * ext/date/date_core.c (wholenum): fix the type of the return value.
+Sat Dec 31 22:57:00 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 6 20:31:35 2012 Tadayoshi Funaba <tadf@dotrb.org>
+ * eval.c (rb_thread_save_context): should not recycle scope object used
+ in a thread. fixed: [ruby-dev:28177]
- * ext/date/date_core.c: [ruby-dev:45008].
+Fri Dec 30 18:22:42 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 6 16:38:56 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+ * gc.c (garbage_collect): mark objects refered from aborting threads.
+ [ruby-dev:28190]
- * win32/win32.c (unixtime_to_filetime): should check the return value
- of localtime(). reported by snowjail at gmail.com.
- [ruby-dev:44838] [Bug #5596]
+ * win32/Makefile.sub: VC++8 support.
-Mon Feb 6 16:36:25 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 30 14:24:53 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * io.c (rb_update_max_fd): fstat(2) can fail with other than
- EBADF. [ruby-dev:44837] [Bug #5593]. Cf.
- http://pubs.opengroup.org/onlinepubs/9699919799/functions/fstat.html
+ * dir.c (glob_helper): do not use TRUE for djgpp.
-Mon Feb 6 16:31:16 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Dec 30 04:54:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (io_fwrite): call rb_w32_write_console() only if FMODE_TTY is
- set. this is the one of the reason of IO writing slowness of Windows
- in 1.9.3 or later.
+ * file.c (eaccess): workaround for VC++8 runtime.
-Mon Feb 6 16:21:57 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/win32.c (ioinfo): VC++8 support.
- * file.c (file_expand_path): reset coderange after expanding path.
+Thu Dec 29 23:59:37 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 6 00:06:39 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_gc_mark_threads): leave unmarked threads which won't wake
+ up alone, and mark threads in the loading table. [ruby-dev:28154]
- * ext/json/parser/parser.rl (json_string_unescape): workaround fix
- for over optimization of GCC 4.7. [ruby-core:42085] [Bug #5888]
- http://gcc.gnu.org/bugzilla/show_bug.cgi?id=51862
+ * eval.c (rb_gc_abort_threads), gc.c (gc_sweep): kill unmarked
+ threads. [ruby-dev:28172]
-Fri Feb 3 16:16:10 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 29 17:02:07 2005 Tanaka Akira <akr@m17n.org>
- * test/ruby/envutil.rb (EnvUtil.invoke_ruby): yield also child pid
- in block form.
+ * test/ruby/envutil.rb (EnvUtil.rubybin): search "ruby" instead of
+ "miniruby". [ruby-dev:28140]
-Fri Feb 3 16:16:10 2012 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Tue Dec 27 16:59:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_thread.rb
- (TestThreadGroup#test_thread_timer_and_interrupt): skip exit status
- assertion because we cannot get signal status on Windows.
+ * test/drb/drbtest.rb (DRbService::self.ext_service): increase
+ timeout limit. a patch from Kazuhiro NISHIYAMA
+ <zn at mbf.nifty.com>. [ruby-dev:28132]
- * win32/win32.c (CreateChild): create process group to receive the
- signal by GenerateConsoleCtrlEvent().
+Tue Dec 27 08:29:18 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * win32/win32.c (kill): use CTRL_BREAK_EVENT instead of CTRL_C_EVENT
- if a process group is specified. CTRL_C_EVENT signal cannot be
- generated for process groups for the specification.
- [ruby-dev:45149] [Bug #5812]
+ * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket#post_connection_chech):
+ treat wildcard character in commonName. [ruby-dev:28121]
-Fri Feb 3 16:16:10 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Dec 26 22:32:47 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/envutil.rb (invoke_ruby): remove :timeout option before
- pass it to Kernel#spawn.
+ * eval.c (rb_eval), gc.c (gc_mark_children), node.h (NEW_ALIAS,
+ NEW_VALIAS), parse.y (fitem): allow dynamic symbols to
+ NODE_UNDEF and NODE_ALIAS.
+ backported from trunk. fixed: [ruby-dev:28105]
-Fri Feb 3 10:10:02 2012 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Dec 26 08:50:36 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (ping_signal_thread_list): remove return value.
- * thread_pthread.c (check_signal_thread_list): add a new function to
- check if signal thread list is empty.
- * thread_pthread.c (thread_timer): check signal thread list after
- timer_thread_function(). main thread might be added into signal thread
- list during timer_thread_function().
+ * eval.c (ev_const_get): fixed a bug in constant reference during
+ instance_eval. [yarv-dev:707]
-Fri Feb 3 10:10:02 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (ev_const_defined): ditto.
- * thread_pthread.c (ubf_select): call rb_thread_wakeup_timer_thread()
- only when it is not timer_thread. [Bug #5757] [ruby-dev:44985]
- patched by Tomoyuki Chikanaga.
+ * lib/yaml.rb (YAML::add_domain_type): typo fixed. a patch from
+ Joel VanderWerf <vjoel at path.berkeley.edu>.
+ [ruby-talk:165285] [ruby-core:6995]
-Wed Feb 1 09:50:10 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Dec 24 18:58:14 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * doc/re.rdoc (Repetition): fix typo. reported by Ori Avtalion
- and patched by Zachary Scott. [Bug #5947]
+ * stable version 1.8.4 released.
-Tue Jan 24 11:38:05 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Dec 23 10:30:23 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/uri/common.rb (URI.encode_www_form_component): initialize on
- requiring to support JRuby, which runs parallel multithreads.
- [ruby-core:42222] [Bug #5925]
+ * ext/digest/sha2/sha2.c (ULL): support AIX C. a patch from
+ Kailden <kailden at gmail.com>. [ruby-core:06984]
- * lib/uri/common.rb (URI.decode_www_form_component): initialize on
+Wed Dec 21 16:53:06 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Jan 28 05:53:34 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * file.c (w32_io_info): should return handle because FileIndex is
+ valid only while file is open. [ruby-dev:28088]
- * lib/irb/completion.rb (IRB::InputCompletor::CompletionProc):
- ignore non-string name modules. [ruby-core:42244][Bug #5938]
+Wed Dec 21 14:53:26 2005 Tanaka Akira <akr@m17n.org>
-Mon Jan 23 18:18:58 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/pathname.rb (test_kernel_open): use File.identical?.
+ [ruby-talk:171804]
- * encoding.c (rb_enc_compatible): fix segv on symbols.
- [ruby-core:42204] [Bug #5921]
+Tue Dec 20 22:41:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jan 17 17:18:41 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (eval_under_i): evaluate source in caller's frame.
+ [ruby-dev:28076]
- * configure.in (SPT_TYPE): enable as SPT_REUSEARGV on Darwin.
+ * eval.c (rb_call_super): use original method name on exception.
+ [ruby-dev:28078]
- * missing/setproctitle.c (ruby_init_setproctitle): changed prefix.
+Tue Dec 20 13:11:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Jan 16 16:41:53 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/rubyext.c: fixed GC problem (backported HEAD 1.55 - 1.62)
+ [ruby-dev:27839]
- * lib/optparse.rb (Regexp): fix incorrect options when casting to
- a Regexp, and suppress encoding option warnings.
- https://github.com/ruby/ruby/pull/82
+ * ext/syck/syck.h (S_FREE): small hack. no need to check if pointer is
+ NULL or not before S_FREE.
-Fri Jan 13 15:22:43 2012 Tanaka Akira <akr@fsij.org>
+ * st.c: uses malloc instead of xmalloc to avoid GC. syck uses st_insert
+ in gram.c to insert node from rb_syck_bad_anchor_handler into
+ SyckParser's hash table. if GC occurs in st_insert, it's not under
+ SyckParser's mark system yet. so RString can be released wrongly.
+ [ruby-dev:28057]
- * time.c (TIME_COPY_GMT): copy vtm.utc_offset and vtm.zone too.
- patch by Tomoyuki Chikanaga.
- [ruby-dev:44827] [Bug #5586]
+Tue Dec 20 12:53:23 2005 why the lucky stiff <why@ruby-lang.org>
-Thu Jan 12 13:52:13 2012 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/syck/rubyext.c (syck_emitter_reset): to ensure compatibility
+ with previous Ruby versions, documents are no longer headless.
- * cont.c (cont_restore_0): prevent optimizing out `sp'. sp is used for
- reserving a memory space with ALLOCA_N for restoring machine stack
- stored in cont->machine_stack, but clang optimized out it (and
- maybe #5851 is also caused by this).
- This affected TestContinuation#test_check_localvars.
+Tue Dec 20 01:46:48 2005 Tanaka Akira <akr@m17n.org>
- * cont.c (cont_restore_1): revert workaround introduced in r32201.
+ * io.c (rb_f_backquote): fix a GC problem on
+ IA64 with gcc 4.0.3 20051216 (prerelease) -O3.
-Thu Jan 12 01:40:33 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Dec 19 23:32:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_io.rb (TestIO#test_autoclose): Tempfile.new doesn't
- accept the block argument.
+ * parse.y (rb_symname_p): fixed wrong validation. [ruby-dev:28047]
-Sat Jan 7 22:46:36 2012 Kouhei Sutou <kou@cozmixng.org>
+Sat Dec 17 03:57:01 2005 Tanaka Akira <akr@m17n.org>
- * lib/rexml/parsers/baseparser.rb: use private instead of _xxx
- method name. This is Ruby code not Python code.
- refs #5696
+ * bignum.c (rb_big_rshift): fix a GC problem on
+ IA64 with gcc 4.0.3 20051216 (prerelease).
-Tue Jan 03 23:57:37 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+Sat Dec 17 03:30:23 2005 Tanaka Akira <akr@m17n.org>
- * lib/rexml/parsers/baseparser.rb: rexml BaseParser uses
- instance_eval unnecessarily on listener add.
- patch from Charles Nutter. [Bug #5696] [ruby-core:41437]
+ * eval.c (bmcall): fix a GC problem by tail call on
+ IA64 with gcc 4.0.3 20051216 (prerelease).
-Tue Jan 03 19:13:05 2012 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+Fri Dec 16 00:54:06 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/rexml/test_sax.rb: add require 'rexml/document'.
- [Backport #5834] [ruby-dev:45079]
+ * signal.c (Init_signal): revert C++ style comment.
+ [ruby-dev:28041]
-Tue Jan 3 19:05:42 2012 Naohisa Goto <ngotogenome@gmail.com>
+Thu Dec 15 12:35:14 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * include/ruby/defines.h (FLUSH_REGISTER_WINDOWS): move sparc asm code
- to a separete file sparc.c for preventing inlining optimization.
- Patched by Jurij Smakov. [Bug #5244] [ruby-core:40685]
- * sparc.c (rb_sparc_flush_register_windows): ditto.
- * configure.in: ditto.
+ * lib/tmpdir.rb: merged RDoc patch from Eric Hodel <drbrain at
+ segment7.net>. [ruby-core:06894]
-Mon Jan 2 23:52:20 2012 TAKAO Kouji <kouji@takao7.net>
+Thu Dec 15 01:33:31 2005 Tanaka Akira <akr@m17n.org>
- * ext/readline/readline.c (Init_readline): libedit check
- rl_getc_function only when rl_initialize() is called, and
- using_history() call rl_initialize(). This assignment should be
- placed before using_history(). [ruby-core:40641] [Bug #5539]
+ * ext/zlib/zlib.c (zstream_run): fix a GC problem by tail call on
+ x86_64 with gcc 4.0.3 20051111 (prerelease) (Debian 4.0.2-4)
-Mon Jan 2 23:47:58 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 14 12:11:46 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * tool/rbinstall.rb (install_recursive, bin-comm): split mere
- string not path name. [ruby-core:40462] [Bug #5492]
+ * test/gdbm/test_gdbm.rb: specify pid for the argument of
+ Process.wait. workaround for Cygwin.
-Mon Jan 2 23:41:57 2012 Tajima Akil <artonx@yahoo.co.jp>
+Wed Dec 14 12:01:26 2005 Tanaka Akira <akr@m17n.org>
- * win32/Makefile.sub (CONFIG_H): have stdint.h if VC2010.
- [Bug #5243]
+ * marshal.c (r_object0): fix a GC problem for reading a bignum on
+ IA64 with gcc 3.3.5 (Debian 1:3.3.5-13).
-Mon Jan 2 21:40:45 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Dec 13 12:23:47 2005 Tanaka Akira <akr@m17n.org>
- * tool/merger.rb (#version_up): version.h date should be Japanese
- locale date.
+ * re.c (rb_reg_regcomp): fix a GC problem on x86_64 with
+ gcc 3.3.5 (Debian 1:3.3.5-13).
-Mon Jan 2 21:36:56 2012 Luis Lavena <luislavena@gmail.com>
+Tue Dec 13 01:44:16 2005 Tanaka Akira <akr@m17n.org>
- * configure.in: check -fno-omit-frame-pointer acceptance and usage
- under MinGW. [ruby-core:39957] [Bug #5407]
+ * array.c (rb_ary_diff): fix a GC problem on IA64 with
+ gcc 3.3.5 (Debian 1:3.3.5-13).
+ When rb_ary_push is called, there was no register which contains
+ `hash' but `&RHASH(hash)->tbl' instead.
-Mon Jan 2 20:05:10 2012 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Dec 13 00:08:09 2005 Tanaka Akira <akr@m17n.org>
- * include/ruby/ruby.h (SIZE_MAX): define SIZE_MAX if not defined.
- patched by The Written Word Inc. [ruby-core:40422] [Bug #5489]
+ * sprintf.c (rb_str_format): fix a GC problem.
+ [ruby-dev:28001]
-Mon Jan 2 20:00:01 2012 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 12 15:54:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/pty/pty.c (pty_check): should return nil until the child
- terminates or stops. [ruby-dev:44600] [Bug #2642]
+ * test/openssl/test_ssl.rb (test_parallel): call GC.start to close
+ unused files. [ruby-dev:27981]
-Mon Jan 2 19:27:18 2012 Yusuke Endoh <mame@tsg.ne.jp>
+Mon Dec 12 00:33:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread.c (update_coverage): skip coverage count up if the current
- line is out of the way. rb_sourceline() is unreliable when source
- code is big. [ruby-dev:44413]
+ * ext/digest/digest.c (rb_digest_base_s_digest): add volatile to
+ protect temporary context object. [ruby-dev:27979]
- * test/coverage/test_coverage.rb: add a test for above.
+ * ext/iconv/iconv.c (Init_iconv): rb_gc_register_address() should
+ be called before actual variable initialization.
+ [ruby-dev:27986]
-Mon Jan 2 19:08:54 2012 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Dec 9 23:31:02 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (gvl_yield): don't prevent concurrent sched_yield().
- [Bug #5130] [ruby-core:38647]
+ * lib/rexml/encoding.rb (encoding=): give priority to particular
+ conversion to iconv. [ruby-core:06520]
-Mon Jan 2 18:54:52 2012 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Dec 8 02:07:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/configure.bat: disable delayed expansion of enironment variable.
- [Bug #5517] [ruby-core:40531]
+ * eval.c (umethod_bind): adjust invoking class for module method.
+ [ruby-dev:27964]
-Wed Dec 28 11:22:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 8 00:40:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/fileutils.rb (FileUtils::Entry_#entries): use utility method
- instead of typoed regexp. [ruby-core:41829] [Bug #5817]
+ * eval.c (call_trace_func): klass parameter should be a
+ class/module that defines calling method. [ruby-talk:169307]
-Thu Dec 15 10:44:54 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 7 17:10:27 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * array.c (rb_ary_reject_bang, rb_ary_delete_if): update rdoc.
- documentation from Thomas Leitner <t_leitner AT gmx.at> in
- [ruby-core:41616]. [Bug #5752]
+ * sprintf.c (rb_f_sprintf): [ruby-dev:27967]
-Wed Dec 14 15:28:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 7 15:31:35 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * transcode.c (str_encode): about the extension of :fallback
- option since 1.9.3.
+ * sprintf.c (rb_str_format): integer overflow check added.
-Tue Oct 4 06:43:47 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * sprintf.c (GETASTER): ditto.
- * ext/psych/lib/psych.rb: update psych version.
- * ext/psych/psych.gemspec: generate new gemspec for new version.
+Wed Dec 7 01:02:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Oct 4 06:29:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/README.macosx-aqua: [new document] tips to avoid the known
+ bug on platform specific dialogs of Tcl/Tk Aqua on MacOS X.
- * ext/psych/lib/psych.rb: calling `yaml` rather than `to_yaml`.
- * ext/psych/lib/psych/nodes/node.rb: Rename `to_yaml` to just `yaml`
- in order to avoid YAML::ENGINE switching from replacing this method.
- * test/psych/helper.rb: fix tests for method name change.
- * test/psych/test_document.rb: ditto
- * test/psych/visitors/test_emitter.rb: ditto
+ * ext/tk/tcltklib.c: fix bug on switching threads and waiting on the
+ deleted interpreter on vwait and tkwait command.
-Tue Oct 4 06:20:19 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/lib/multi-tk.rb: kill the meaningless loop for the deleted Tk
+ interpreter.
- * ext/psych/lib/psych/scalar_scanner.rb: Match values against the
- floating point spec defined in YAML to avoid erronious parses.
- * test/psych/test_numeric.rb: corresponding test.
+ * ext/tk/sample/demos-jp/image3.rb: [bug fix] wrong argument.
-Tue Oct 4 05:59:24 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/sample/demos-en/image3.rb: ditto.
- * ext/psych/lib/psych/visitors/to_ruby.rb: ToRuby visitor can be
- constructed with a ScalarScanner.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: ScalarScanner can be
- passed to the YAMLTree visitor.
+ * ext/tk/sample/demos-jp/menu.rb: fix message for MacOS X.
-Tue Oct 4 05:47:23 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/sample/demos-jp/menu8x.rb: ditto.
- * ext/psych/lib/psych/visitors/to_ruby.rb: Define Regexp::NOENCODING
- for 1.9.2 backwards compatibility.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Fix Date string
- generation for 1.9.2 backwards compatibility.
+ * ext/tk/sample/demos-en/menu.rb: ditto.
-Fri Sep 2 04:05:25 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Tue Dec 6 16:37:57 2005 Yuya Nishida <yuya@j96.org>
- * ext/psych/lib/psych/visitors/yaml_tree.rb: emit strings tagged as
- ascii-8bit as binary in YAML.
- * test/psych/test_string.rb: corresponding test.
+ * eval.c (exec_under): avoid accessing ruby_frame->prev.
+ [ruby-dev:27948]
-Wed Dec 7 19:04:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 1 00:50:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (rpath): fix typo in the help string. a patch from
- Yuji Yamano <yyamano AT kt.rim.or.jp> in [ruby-list:48568].
+ * eval.c (rb_funcall2): allow to call protected methods.
+ fixed: [ruby-dev:27890]
-Wed Nov 30 18:22:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 30 23:52:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * complex.c (nucomp_rationalize): fix function. [ruby-core:40667]
- [Bug #5546]
+ * parse.y (NEWHEAP, ADD2HEAP): set count after pointer was set.
+ fixed: [ruby-dev:27896]
-Thu Nov 17 10:36:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Wed Nov 30 13:43:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych.rb (load_file): make sure opened yaml files are
- also closed. [ruby-core:41088]
+ * misc/ruby-mode.el (ruby-expr-beg): support $! at the end of
+ expression. [ruby-dev:27868]
-Wed Nov 30 02:58:46 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Mon Nov 28 18:55:43 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * numeric.c (dbl2ival): Fix Float#divmod and #round for 32 bit
- platform. part 1 of [bug #5276]
+ * ext/socket/socket.c (init_inetsock_internal): remove setting
+ SO_REUSEADDR option on server socket on Cygwin.
+ fixed: [ruby-core:6765] ([ ruby-Bugs-2872 ])
-Wed Nov 30 02:58:46 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Mon Nov 28 13:08:54 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * numeric.c (flo_round): Fix criteria for 32 bits platform
- part 2 of [bug #5276]
+ * win32/win32.c (rb_w32_strerror): remove all CR and LF. (avoid broken
+ error message on bccwin32 + winsock)
-Wed Nov 30 02:37:32 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Mon Nov 28 09:21:49 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * numeric.c (flo_round): Make Float#round round big values [bug
- #5272]
+ * lib/mkmf.rb (create_makefile): should not change sodir with
+ dir.gsub!. (bccwin32 failed to install third party exntesions)
+ [ruby-dev:27834]
-Wed Nov 30 02:37:32 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Nov 27 00:56:13 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * numeric.c (flo_round): substitute machine dependent magic number.
+ * lib/wsdl/xmlSchema/complexContent.rb: missing
+ ComplexContent#elementformdefault method.
-Wed Nov 30 02:28:22 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Sat Nov 26 19:57:45 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * numeric.c (int_round): Integer#round always returns an Integer [Bug
- #5271]
+ * dln.c (conv_to_posix_path): should initialize posix.
-Fri Nov 4 01:56:30 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 24 21:05:58 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (make_writeconv): unversal_newline converter is for reading.
- so, if the io is text mode and has ECONV_UNIVERSAL_NEWLINE_DECORATOR
- flag, use crlf_newline converter for writing.
- this change fixes the problem about the luck of CR up Kernel.p and
- Kernel.puts to stdout/stderr on Windows.
+ * configure.in (AC_CHECK_FUNCS): need to check link().
+ fixed: [ruby-dev:27814]
-Mon Nov 7 23:39:23 2011 Tajima Akio <artonx@yahoo.co.jp>
+Thu Nov 24 01:22:25 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * io.c (io_fflush): remove fsync().
- * io.c (rb_io_flush, rb_io_rewind): fsync() here.
- These pathces are backports of trunk r33651 for [Bug #5585]
+ * file.c (w32_io_info): CreateFile failed on Win9x if file was already
+ opened. (FILE_SHARE_READ was needed, but actually I don't understand
+ the flags of CreateFile well...)
-Mon Oct 10 22:33:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Nov 23 20:59:01 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/-ext-/old_thread_select/test_old_thread_select.rb:
- select() with timeout may return early in old Linux kernels
- with 250 Hz tickrate and no dynticks, so skip everything older
- than 2.6.32 (which has long term support).
- And, Make the timing assertions consistently use assert_operator with
- timing difference in error message
- Patch by Eric Wong. [Bug #5335] [ruby-core:39618]
+ * ext/tk/lib/tk.rb: add Tk.pkgconfig_list and Tk.pkgconfig_get
+ [Tk8.5 feature].
-Tue Oct 4 16:17:50 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk/text.rb: supports new indices modifires on a Text
+ widget [Tk8.5 feature].
- * lib/time.rb (Time.strptime): use Time.at if d[:seconds] is set.
- Reported by Christopher Eberz. [ruby-core:39903] Bug #5399
+ * ext/tk/lib/tk/virtevent.rb: add TkNamedVirtualEvent.
-Tue Oct 4 11:44:10 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk/autoload.rb: ditto.
- * gc.c (rb_gc_set_params): ruby_verbose can be Qnil, so use RTEST.
+ * ext/tk/lib/tk/event.rb: add :data key for virtual events [Tk8.5
+ feature].
-Mon Oct 3 23:56:39 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Wed Nov 23 18:55:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * gc.c (rb_gc_set_params): output GC parameter change messages only
- if -w/-v options are specified. these messages are output to stderr,
- not to stdout. [ruby-core:39795] [Bug #5380]
+ * file.c (w32_io_info): should not call GetFileInformationByHandle
+ for pipe.
- * test/ruby/test_gc.rb (test_gc_parameter): add test for it.
+ * file.c (w32_io_info): checks return value from rb_w32_get_osfhandle.
-Wed Sep 28 09:14:16 2011 Nobuyoshi Nakada <>
+ * file.c (w32_io_info): now can identify directory on WinNT.
- * configure.in (pthread_np.h): needs pthread.h to be included
- previously on OpenBSD. a patch by George Koehler <xkernigh AT
- netscape.net> at [ruby-core:39752]. [Bug #5376]
+Wed Nov 23 03:40:49 2005 Guy Decoux <ts@moulon.inra.fr>
-Tue Sep 13 15:02:48 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (KR_REHASH): should cast to unsigned for 64bit CPU.
+ [ruby-core:06721]
- * lib/pstore.rb (PStore): always open in binary mode even if
- default encodings are set. [Bug #5311] [ruby-core:39503]
+Wed Nov 23 11:01:33 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Oct 8 07:31:42 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * intern.h, file.c: failed to compile on windows.
- * array.c (ary_join_1): should not copy the encoding of non-string
- element after string element. [ruby-core:39776] [Bug #5379]
+Wed Nov 23 07:26:44 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Oct 8 06:51:46 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/openssl/extconf.rb: check for X509V3_EXT_nconf_nid.
- * lib/rubygems: Update to RubyGems 1.8.11. Move Deprecate into the
- Gem namespace.
+ * ext/openssl/ossl_x509ext.c (MakeX509ExtFactory): should use
+ OPENSSL_malloc to allocate X509V3_CTX.
-Sat Oct 8 06:37:08 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext): use
+ X509V3_EXT_nconf_nid to avoid SEGV (and to build extensions which
+ values are placed in separate section).
- * gc.c (rb_gc_set_params): output GC parameter change messages only
- if -w/-v options are specified. these messages are output to stderr,
- not to stdout. [ruby-core:39795] [Bug #5380]
+ * test/openssl/test_x509ext.rb: new file.
- * test/ruby/test_gc.rb (test_gc_parameter): add test for it.
+Wed Nov 23 01:22:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 8 06:26:24 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * file.c (test_identical): test if two files are identical.
- * gc.c (add_heap_slots, init_heap): reset heaps_inc zero when
- heap slots are expanded by environment variable RUBY_HEAP_MIN_SLOTS.
- [ruby-core:39777] [Bug #5380]
+ * file.c (rb_f_test): support DOSISH systems where st_ino is not
+ reliable. fixed: [ruby-core:06672]
- * test/ruby/test_gc.rb (test_gc_parameter): add test for it.
+ * win32.h, win32.c (rb_w32_osid): check the running platform.
- * test/ruby/envutil.rb (assert_normal_exit): add :child_env option to
- enable pass environemnt variables to child process.
+Tue Nov 22 23:52:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 8 05:45:28 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/optparse.rb: match incomplete (in current enconding) multibyte
+ string. http://inamode6.tokuhirom.dnsalias.org/show/1551
- * proc.c (proc_call): Update documentation to match argument handling
- of proc/Proc.new/lambda/->()
+Tue Nov 22 18:36:11 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Oct 8 05:38:29 2011 Eric Hodel <drbrain@segment7.net>
+ * win32/win32.c (winnt_stat): set mapped errno instead of ENOENT.
- * proc.c (proc_call): Fix documentation of Proc#call vs Proc#===.
- [Ruby 1.9 - Bug #5349]
+Tue Nov 22 14:46:57 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Sep 27 13:05:39 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * file.c (rb_file_s_basename): skip slashes just after UNC top slashes.
- * ext/openssl/ossl_asn1.c: fix int_ossl_asn1_decode0_cons when being
- fed arbitrary string values.
- Clearly distinguish between the cases "universal, infinite and
- not a SEQUENCE or SET" and "universal SEQUENCE or SET, possibly
- infinite". Raise error for universal tags that are not infinite.
- * test/openssl/test_asn1.rb: add a test for this.
+ * test/ruby/test_path.rb (test_dirname, test_basename): follow new
+ spec. and add new tests.
- Thanks to Hiroshi Yoshida for reporting this bug.
- [Bug #5363] [ruby-dev:44542]
+Tue Nov 22 13:18:32 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Sep 17 23:34:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_stat): Dir.chdir('//server/shared');
+ p Dir.glob('*') should work on WinNT. (implemented our own
+ stat(2) on WinNT) [ruby-list:41552] [ruby-dev:27711]
- * parse.y (parser_data_type): inherit the core type in ripper so
- that checks in core would work. [ruby-core:39591] [Bug #5331]
+Tue Nov 22 02:31:53 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Sep 23 14:15:01 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/tk/lib/tkextlib/tile.rb: bug fix (Tk::Tile::USE_TTK_NAMESPACE
+ is not defined).
- * ext/openssl/ossl_asn1.c
- ext/openssl/ossl_pkey.c: Remove unused variables.
+Tue Nov 22 01:45:21 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Sep 23 06:54:44 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * file.c (rb_file_s_basename): DOSISH_UNC is defined on cygwin but
+ DOSISH is not. fixed: [ruby-dev:27797]
- * backport r33315 from trunk.
+Mon Nov 21 22:50:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/openssl/test_ssl_session.rb: execute test_session_exts_read
- only for OpenSSL versions >= 0.9.8k. Thanks, Eric Wong, for
- reporting this.
- [Bug #4961] [ruby-core:37726]
+ * file.c (rb_path_skip_prefix, rb_file_s_basename): UNC without path
+ should not be splitted. fixed: [ruby-dev:27776] [ruby-dev:27786]
-Fri Sep 23 12:18:52 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * parse.y (dsym): prohibit empty symbol literal by interpolation.
+ fixed: [ruby-talk:166529]
- * backport r33311 from trunk.
+Mon Nov 21 16:03:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/openssl/test_ssl_session.rb: ensure server calls callbacks in
- test_ctx_server_session_cb. Thanks to Eric Wong for the patch.
- [Bug #5336] [ruby-core:39619]
+ * win32/setup.mk: findstr doesn't exist on win9x.
+ fixed: [ruby-dev:27756]
-Thu Sep 22 19:45:22 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Sun Nov 20 22:34:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (ubf_select): activate timer thread when interrupt
- blocking thread.
- A patch created by Koichi Sasada. [ruby-core:39634] [Bug #5343]
- to cover race condition, timer thread periodically send SIGVTARLM to
- threads in signal thread list. so you should activate timer thread
- when interrupt a thread.
+ * parse.y (rb_symname_p): [ not followed by ] is not valid symbol.
+ fixed: [ruby-talk:166520]
-Wed Sep 21 16:57:03 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Nov 19 19:57:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/io/wait/test_io_wait.rb (TestIOWait#setup): of course, the
- behavior of mingw is just same with mswin.
+ * lib/fileutils.rb (FileUtils::ln): ln documentation fix.
+ [ruby-core:06661]
-Sat Sep 17 22:21:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Nov 19 07:34:32 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * vm.c (rb_vm_make_env_object, rb_vm_get_sourceline): export as a
- workaround for ruby-debug19 for the time being.
- [ruby-core:38972] [Bug #5193]
+ * ext/tk/lib/tk/font.rb: remove dependency on Ruby's version (1.8
+ or 1.9).
-Fri Sep 16 01:08:19 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tkextlib/ICONS/icons.rb: ditto.
- * NEWS: cosmetic changes.
+ * ext/tk/sample/tkextlib/treectrl/demo.rb: ditto.
-Wed Sep 14 12:39:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Fri Nov 18 17:57:08 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * configure.in: do not use gcc-4.2 as the default compiler.
+ * file.c (rb_file_s_dirname): should use skipprefix for UNC path.
+ pointed out by nobu ([ruby-dev:27744]). fixed: [ruby-core:5076]
- * NEWS: describe the issue about Xcode.
+Fri Nov 18 17:35:09 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Sep 14 11:46:30 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/multi-tk.rb: add restriction to access the entried
+ command table and manipulate other IPs (for reason of security).
+ Now, a IP object can be controlled by only its master IP or the
+ default IP.
- * thread.c (rb_fd_rcopy): added an argument guard.
- Patch by NAKAMURA Usaku. [Bug #5306] [ruby-core:39435]
+ * ext/tk/lib/remote-tk.rb: add restriction to manipulate.
-Tue Sep 13 09:28:58 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/tcltklib.c (ip_is_slave_of_p): add TclTkIp#slave_of?(ip)
+ to check manipulability.
- * NEWS: wrote about rb_reserved_fd_p() and objspace.
+ * ext/tk/lib/tk.rb: bug fix on handling of Tcl's namespaces.
-Mon Sep 12 20:47:52 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk/namespace.rb: ditto.
- * thread.c (rb_thread_select): fix a typo to initialize efds
- properly. [Bug #5299] [ruby-core:39380]
+Fri Nov 18 17:26:06 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Sep 12 20:41:20 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * file.c (rb_file_s_dirname): added checks for some patterns with drive
+ letter. fixed: [ruby-dev:27738]
- * thread.c (rb_thread_select): fix to ignore an argument
- modification of rb_thread_fd_select().
- based on a patch by Eric Wong. [Bug #5306] [ruby-core:39435]
- * thread.c (rb_fd_rcopy): New. for reverse fd copy.
+ * test/ruby/test_path.rb (test_dirname): added tests for above
+ patterns.
- * test/-ext-/old_thread_select/test_old_thread_select.rb
- (test_old_select_false_positive): test for bug5306.
+Fri Nov 18 12:18:02 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/-test-/old_thread_select/old_thread_select.c (fdset2array):
- New. convert fdsets to array.
- * ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
- return 'read', 'write', 'except' argument of rb_thread_select()
- to ruby script.
+ * win32/win32.h (S_IFIFO): r,w = IO.pipe; r.stat.pipe? now
+ returns true on VisualC++6.
-Tue Sep 6 13:15:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 16 23:24:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * encoding.c (load_encoding): predefined encoding names are safe.
- [ruby-dev:44469] [Bug #5279]
+ * common.mk (static-ruby): overridable.
- * transcode.c (load_transcoder_entry): ditto.
+ * ext/extmk.rb (parse_args): force to link extensions statically only
+ if static is given for extstatic.
-Fri Sep 9 16:02:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/extmk.rb (RUBY, RUBYW): overridable.
- * insns.def (concatstrings): don't use initial ASCII-8BIT string.
- [ruby-core:38635] [Bug #5126]
+Tue Nov 15 23:46:35 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Sep 8 21:17:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/find.rb (Find::find): should not ignore symbolic links to
+ non-existing files. [ruby-talk:165866]
- * ext/nkf/nkf-utf8/nkf.c: import nkf 2.1.2 (be9c280)
- Bump version number/release date only.
+Tue Nov 15 16:23:26 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Sep 7 23:42:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_fill): previous commit disabled this usage:
- * io.c (argf_next_argv): open in default text mode.
- [ruby-core:39234] [Bug #5268]
+ a = [0,1,2,3,4,5,6,7,8,9]
+ a.fill {|i| a[i] * 10} #=> [nil, nil, ...., nil]
-Mon Sep 5 15:06:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ previous commit has the advantage of early garbage collection, but
+ potensially this would break some script. so I reverted behavior.
- * test/rubygems/test_gem_security.rb
- (test_class_build_self_signed_cert): reset opt[:trust_dir] to apply
- temporary Gem.user_home.
+Tue Nov 15 16:04:10 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Sep 4 00:56:58 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+ * array.c (rb_ary_fill): tail elements were vanished when the middle
+ part of array was filled. (ie: [0,1,2,3,4].fill(-1,2,1) => [0,1,-1])
- * backport r33177 from trunk.
+ * test/ruby/test_array.rb (test_fill): added.
- * test/ruby/test_fiber.rb (TestFiber#test_no_valid_cfp):
- add a test. Unlike TestThread#test_no_valid_cfp,
- this test succeeds even if win32ole is required (see r33153).
+Tue Nov 15 14:39:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Sep 2 21:11:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_fill): should adjust array length correctly when
+ an array is expanded in the fill process. [ruby-core:06625]
- * io.c (validate_enc_binmode, prep_stdio): default to text mode on
- dosish platforms. [ruby-core:38822] [Bug #5164]
+Mon Nov 14 23:49:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * transcode.c (rb_econv_prepare_options): keep default ecflags
- unchanged if no options.
+ * file.c (rb_file_s_readlink): ERANGE will occur only on GPFS.
+ [ruby-dev:27699]
-Fri Sep 2 14:36:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 14 17:36:22 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm_insnhelper.c (vm_search_const_defined_class): search
- ancestors only when global scope. [ruby-core:39227] [Bug #5264]
+ * array.c (rb_ary_first): RDoc update from Daniel Berger
+ <djberg96@yahoo.com>. [ruby-core:06577].
-Fri Sep 2 09:58:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 11 10:31:44 2005 Zach Dennis <zdennis@mktec.com>
- * parse.y (parser_tokadd_string, parser_yylex): ignore a backslash
- which prefixes an non-ascii character, which has no escape
- syntax. [ruby-core:39222] [Ruby 1.9 - Bug #5262]
+ * ext/socket/socket.c: Socket Documentation. [ruby-core:6552]
-Thu Sep 1 17:31:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 11 08:20:56 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * insns.def (defineclass), vm_insnhelper.c (vm_get_cvar_base): see
- also inherited constants for classes without superclass and
- modules. [ruby-core:37698] [Bug #3423]
+ * Makefile.in (OUTFLAG): keep trailing spaces. [ruby-dev:27666]
-Thu Sep 1 14:11:16 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * mkconfig.rb: substitution refereces added.
- * test/ruby/test_thread.rb (TestThread#test_no_valid_cfp): skip when
- win32ole is required. in such case, win32ole redefines
- Thread#initialize, and the block argument becomes to be not the top
- of the thread, then this testcase always fails.
+Fri Nov 11 07:44:18 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Aug 31 16:02:45 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in: undef HAVE_LINK on BeOS. (link(2) always returns
+ EINVAL, and this causes error in test/fileutils.)
- * ext/json: Merge json gem v1.5.4 (3dab4c5a6a97fac03dac).
+ * file.c: overwride chown(2) and fchown(2) on BeOS. (these functions
+ should not change user/group id if -1 is passed as corresponding
+ argument, and this causes error in test/fileutils too)
+ [ruby-dev:27672]
-Wed Aug 31 13:19:31 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * file.c (rb_file_s_link): checks HAVE_LINK.
- * numeric.c (flo_round): Avoid overflow by optimizing for trivial
- cases
- [Bug #5227]
+Tue Nov 8 15:32:27 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Aug 31 06:45:32 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/drb/ssl.rb (DRb::SSLConfig#accept): fixed typo.
+ [ruby-dev:27560] [ruby-core:4627]
- * configure.in: fix r32835. $withval can't be used outer AC_ARG_WITH().
+Mon Nov 7 13:43:51 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Aug 31 05:29:03 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/stubs.c (_nativethread_consistency_check): use simpler
+ (low cost) way to check whether the Tcl interpreter was compiled
+ with threads enabled of not.
- * win32/win32.c (rb_w32_select_with_thread): and my typo. we all must
- be more careful.
+ * ext/tk/tcltklib.c: reduce warnings.
-Wed Aug 31 05:28:45 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/tkutil/tkutil.c: ditto.
- * thread.c (rb_thread_select): critical typo in r33117.
+Mon Nov 7 00:06:58 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Aug 31 05:28:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/yaml.rb: removed :nodoc: to generate Kernel doc. [ruby-core:6324]
- * test/-ext-/old_thread_select/test_old_thread_select.rb
- (TestOldThreadSelect#test_old_select_read_timeout): if the machine
- is fast enough, the time used by code around IO.select may be smaller
- than Time implement threshold.
+Sun Nov 6 23:39:13 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Aug 31 05:27:59 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/iconv/iconv.c (Iconv::BrokenLibrary): exception when detected a
+ bug of underlying library.
- * ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
- typo.
+Sun Nov 6 21:46:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/-ext-/old_thread_select/test_old_thread_select.rb
- (TestOldThreadSelect#test_old_select_signal_safe): use SIGINT instead
- of SIGUSR1 because the former is general and the latter is platform
- dependent.
+ * ext/tk/stubs.c (ruby_tcl_create_ip_and_stubs_init): should touch
+ interpreter after initialization is done. [ruby-dev:27638]
-Wed Aug 31 05:26:30 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Nov 6 20:13:27 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c, include/ruby/intern.h (rb_w32_fd_copy): implement
- for rb_thread_select() in thread.c. the use of rb_fd_copy() is
- introduced in r33117.
- [Bug #5229] [ruby-core:39102]
+ * file.c (rb_file_s_readlink): readlink(2) on AIX fails with ERANGE if
+ buffer size is less than required. fixed: [ruby-dev:27634]
- * thread.c (rb_thread_select): must call rb_fd_init() before using
- rb_fdset_t. see the implementations of rb_fd_init()s if you want to
- know the reason.
+Wed Nov 2 20:25:28 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Aug 30 11:25:21 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/extconf.rb: ext/tk/extconf.rb: change the check parameter
+ for Win32.
- * ext/json: Merge json gem 1.5.4+ (2149f4185c598fb97db1).
- [Bug #5173] [ruby-core:38866]
+Wed Nov 2 20:14:53 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Aug 30 09:53:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tcltklib: merge into ext/tk and remove.
- * cont.c (fiber_entry): fix stack allocation failure on Debian
- GNU/kFreeBSD.
- Patch by Lucas Nussbaum <lucas at lucas-nussbaum dot net>.
- [Bug #5241] [ruby-core:39147]
+Wed Nov 2 19:03:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Aug 30 09:52:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tcltklib/tcltklib.c (ip_rbUpdateObjCmd,
+ ip_rb_threadUpdateObjCmd): passed improper flags to DoOneEvent().
- * backport r33117 from trunk.
+ * ext/tk/tkutil.c: use rb_obj_respond_to() instead of rb_respond_to().
- * thread.c (rb_thread_select): rewrite by using
- rb_thread_fd_select(). old one is EINTR unsafe.
- Patch by Eric Wong. [Bug #5229] [ruby-core:39102]
+Tue Nov 1 14:20:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/-ext-/old_thread_select/test_old_thread_select.rb:
- a testcase for rb_thread_select().
- * ext/-test-/old_thread_select/old_thread_select.c: ditto.
- * ext/-test-/old_thread_select/depend: ditto.
- * ext/-test-/old_thread_select/extconf.rb: ditto.
+ * eval.c (rb_call_super): should call method_missing if super is
+ called from Kernel method.
-Tue Aug 30 09:16:17 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (exec_under): frame during eval should preserve external
+ information.
- * configure.in: fix a build failure on GNU Hurd.
- Patch by Samuel Thibault <sthibault at debian dot org>. Thank you!
- [Bug #5250] [ruby-core:39185]
+Tue Nov 1 10:50:17 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Aug 28 15:38:17 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/openssl/extconf.rb: should check ERR_peek_last_error().
+ [ruby-dev:27597]
- * backport r33106 from trunk.
+ * ext/openssl/ossl.c (ossl_raise): ditto.
- * ext/date/date_parse.c (date_zone_to_diff): keep a temporary string
- stored in variable while the contents buffer is beeing used.
+Mon Oct 31 17:34:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_parse.c (date_zone_to_diff): get rid of out of bounds
- memory read. [ruby-dev:44409] [Bug #5213]
+ * configure.in: use proper option for Sun linker. A patch from
+ Shinya Kuwamura <kuwa at labs.fujitsu.com>. [ruby-dev:27603]
-Sun Aug 28 05:29:50 2011 Ryan Davis <ryand-ruby@zenspider.com>
+Mon Oct 31 11:27:22 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * backport r33102 from trunk.
+ * test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb (test_s_open_error):
+ skip on Win32/DOS platforms.
- * lib/minitest/*: Imported minitest 2.5.1 (r6596)
- * test/minitest/*: ditto
+Mon Oct 31 05:49:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Aug 27 20:54:54 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+ * ext/openssl/ossl_cipher.c (ossl_cipher_update): input data must
+ not be empty. [ruby-talk:161220]
- * backport r33099 from trunk.
+ * test/openssl/test_cipher.rb: add test for Cipher#update("").
- * vm.c (rb_vm_rewrite_dfp_in_errinfo): change return type
- to suppress a warning.
+Mon Oct 31 05:37:20 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * vm_core.h: ditto.
+ * lib/webrick/httpservlet/cgihandler.rb
+ (WEBrick::HTTPServlet::CGIHandler#do_GET): the value of Set-Cookie:
+ header field should be splited into each cookie. [ruby-Bugs:2199]
-Sat Aug 27 19:03:44 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+ * lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookie): new method
+ to parse the value of Set-Cookie: header field.
- * backport r33096 from trunk.
+ * test/webrick/test_cookie.rb, test/webrick/test_cgi.rb,
+ test/webrick/webrick.cgi: add some test for cookie.
- * proc.c (proc_new): force to rewrite errinfo when calling Proc.new in ensure.
- [Bug #5234] [ruby-core:39125]
+Mon Oct 31 03:19:36 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (rb_vm_rewrite_dfp_in_errinfo): new function.
+ * ext/readline/readline.c (readline_readline): type check.
+ [ruby-core:6089]
- * vm.c (vm_make_env_each): changed accordingly.
+ * numeric.c (fix_rshift): RDoc fix. [ruby-core:6351]
- * vm_core.h: ditto.
+ * util.h (strtod): add #undef for platforms defines strtod()
+ macro. [ruby-dev:27563]
- * bootstraptest/test_flow.rb: add tests for above.
+Mon Oct 31 02:35:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Aug 27 08:59:12 2011 Eric Hodel <drbrain@segment7.net>
+ * test/ruby/test_float.rb (test_precision): test by assert_in_delta.
+ [ruby-dev:27575]
- * NEWS: Update version of rake to 0.9.2.2.
+Sat Oct 29 01:58:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Aug 27 08:44:58 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/etc/etc.c: document update from mathew <meta@pobox.com>.
+ [ruby-core:06473]
- * backport r33087 from trunk
+ * ext/fcntl/fcntl.c: ditto.
- * lib/rdoc: Import RDoc 3.9.4. Typo and grammar fixes by Luke Gruber.
- [Ruby 1.9 - Bug #5203]
+Thu Oct 27 16:45:31 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Aug 27 07:53:34 2011 Eric Hodel <drbrain@segment7.net>
+ * string.c (scan_once): wrong condition to use mbclen2().
+ [ruby-dev:27535]
- * backport r33087 from trunk.
+Wed Oct 26 09:27:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/open-uri.rb: Fix indentation of OpenURI::OpenRead#open. Use ++
- instead of `' for method arguments in open-uri.rb
+ * ext/syck/implicit.c (syck_type_id_to_uri): should return
+ newly allocated memory. otherwise, type_id will be freed
+ twice. [ruby-dev:27384] [ruby-core:6385]
-Sat Aug 27 07:22:07 2011 Eric Hodel <drbrain@segment7.net>
+Wed Oct 26 09:04:51 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * backport r33086 from trunk.
+ * ruby.h (Qfalse, Qtrue, Qnil, Qundef): make sure these immediate
+ values have VALUE type. there is an environment where sizeof(VALUE)
+ != sizeof(int) like IA64. if 32bit integer (Qtrue) is passed to ANYARGS
+ and received by 64bit integer (VALUE), upper bits may have garbage value.
+ [ruby-dev:27513]
- * ext/pathname/lib/pathname.rb: Fix typos and grammar mistakes. Patch
- by Luke Gruber. [#5203]
- * ext/pty/lib/expect.rb: ditto
- * lib/mathn.rb: ditto
- * lib/net/http.rb: ditto
- * lib/open-uri.rb: ditto
- * lib/ostruct.rb: ditto
- * lib/tempfile.rb: ditto
- * lib/thread.rb: ditto
- * lib/weakref.rb: ditto
- * sample/webrick/httpproxy.rb: ditto
+Wed Oct 26 01:58:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 26 10:10:37 2011 Eric Hodel <drbrain@segment7.net>
+ * configure.in (RUBY_EXTERN): macro to export symbols in shared
+ library. [ruby-core:05528]
- * backport r33074 from trunk.
+ * defines.h, {bcc32,win32,wince}/Makefile.sub (RUBY_EXTERN): moved to
+ configuration pass.
- * lib/rubygems: Update to RubyGems 1.8.10. Fixes security issue in
- creating ruby-format gemspecs. Fixes Gem.dir not being at the front
- of Gem.path to fix uninstall and cleanup commands. Fixes gem
- uninstall stopping on the first missing gem.
+ * ext/extmk.rb (extmake): RUBY_EXTERN for static linked extensions.
-Wed Aug 24 09:49:10 2011 Koichi Sasada <ko1@atdot.net>
+Tue Oct 25 15:32:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * backport r33045 from trunk.
+ * lib/rational.rb: applied documentation patch from Gavin Sinclair
+ <gsinclair@gmail.com>. [ruby-core:06364]
- * insns.def (defined): fix to checking class variable.
- A patch by Magnus Holm <judofyr@gmail.com>. Thanks!
+ * lib/irb.rb (IRB::Irb::eval_input): handle prompts with newlines
+ in irb auto-indentation mode. [ruby-core:06358]
-Fri Aug 26 08:21:10 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Tue Oct 25 02:12:08 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_variable.rb: add a test for above.
+ * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::LABEL_LIST_RE):
+ reduce redundant backtrack. [ruby-talk:161771]
-Thu Aug 25 09:43:16 2011 Eric Hodel <drbrain@segment7.net>
+Tue Oct 25 00:27:35 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * backport r33066 from trunk.
+ * lib/rinda/*: RDoc documentation from Eric Hodel
+ <drbrain@segment7.net> added.
- * ext/openssl/lib/openssl/bn.rb: Hide copyright info from RDoc.
- * ext/openssl/lib/openssl/digest.rb: ditto
- * ext/openssl/lib/openssl/cipher.rb: ditto
+Mon Oct 24 21:14:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Aug 25 09:25:48 2011 Eric Hodel <drbrain@segment7.net>
+ * configure.in, io.c: use sys/syscall.h if syscall.h is not available.
+ [ruby-core:06247]
- * backport r33065 from trunk.
+Mon Oct 24 20:49:45 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/openssl/ossl_digest.c: Document OpenSSL::Digest::digest and add
- an example to OpenSSL::Digest. Patch by Sylvain Daubert.
- [Ruby 1.9 - Bug #5166]
- * ext/openssl/lib/openssl/digest.rb (module OpenSSL): ditto
+ * ext/Win32API/lib/win32/resolv.rb (get_info): support multiple DNS.
+ fixed: [ruby-list:40058], [ruby-dev:27479]
-Thu Aug 25 08:19:43 2011 Koichi Sasada <ko1@atdot.net>
+Mon Oct 24 07:57:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (vm_make_env_each): work around to solve Bug #2729.
- fixes: Bug #2729
- a patch from Kazuki Tsujimoto <kazuki@callcc.net>
- This problem is caused by changing dfp (dynamic env pointer)
- from saved dfp. Saved dfp is pointed env in VM stack. However,
- the dfp can be moved because VM copies env from VM stack to
- the heap. At this copying, dfp was also changed. To solve this
- problem, I'll try to change throw mechanism (not save target dfp,
- but save target cfp).
+ * ext/tk/lib/tk/canvas.rb (TkCanvasItemConfig::__item_val2ruby_optkeys):
+ typo fixed. [ruby-talk:162187]
- * bootstraptest/test_flow.rb: add a test for above.
+ * ext/tk/lib/tk/menu.rb (TkMenuEntryConfig::__item_val2ruby_optkeys):
+ ditto. [ruby-core:06359]
-Thu Aug 25 08:04:08 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Sun Oct 23 21:50:15 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * numeric.c (int_round): Fix Integer#round [ruby-core:39096]
+ * ext/enumerator/enumerator.c: applied documentation patch from
+ James Edward Gray II <james@grayproductions.net>.
+ [ruby-core:06348]
-Thu Aug 25 06:51:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Sun Oct 23 07:11:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/psych/lib/psych.rb: Fixing psych version number.
+ * ext/tcltklib/extconf.rb: improve messages [ruby-core:06325].
-Thu Aug 25 06:11:35 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/tk/lib/tk.rb, ext/tk/lib/tk/canvas.rb, ext/tk/lib/tk/entry.rb,
+ ext/tk/lib/tk/frame.rb, ext/tk/lib/tk/image.rb,
+ ext/tk/lib/tk/itemconfig.rb, ext/tk/lib/tk/labelframe.rb,
+ ext/tk/lib/tk/listbox.rb, ext/tk/lib/tk/menu.rb,
+ ext/tk/lib/tk/radiobutton.rb, ext/tk/lib/tk/scale.rb,
+ ext/tk/lib/tk/spinbox.rb, ext/tk/lib/tk/text.rb,
+ ext/tk/lib/tk/toplevel.rb: improve conversion of option values.
- * ext/psych/lib/psych/nodes/node.rb: default `to_yaml` encoding to be
- UTF-8.
- * test/psych/test_encoding.rb: test yaml dump encoding.
+ * ext/tk/lib/tkextlib/*: ditto.
-Wed Aug 24 08:53:06 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tkextlib/*: update to support ActiveTcl8.4.11.2.
- * backport r33043 from trunk.
+ * ext/tk/lib/tkextlib/trofs/*: support Trofs 0.4.3.
- * lib/rdoc: Update to RDoc 3.9.3. Fixes RDoc with `ruby -Ku`. Allows
- HTTPS image paths to be turned into <img> tags. Prevents special
- markup inside <tt> from being processed.
+ * ext/tk/lib/tkextlib/tile/*: support Tile 0.7.2.
-Wed Aug 24 07:57:43 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tkextlib/vu/*: support vu 2.3.0.
- * backport r33040 from trunk.
+ * ext/tk/lib/tkextlib/tcllib/*: support Tcllib 1.8 (Tklib 0.3).
- * lib/rubygems: Update to RubyGems 1.8.9. Fixes uninstalling multiple
- gems and gem cleanup.
+Sat Oct 22 23:54:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Aug 24 06:45:20 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * ext/extmk.rb, lib/mkmf.rb (with_config): support --with-extension
+ options. [ruby-dev:27449]
- * backport r33036 from trunk.
+Sat Oct 22 13:26:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/minitest/*: Imported minitest 2.5.0 (r6557)
- * test/minitest/*: ditto
+ * object.c (sym_inspect), parse.y (parser_yylex, rb_symname_p): check
+ if valid as a symbol name more strictly. [ruby-dev:27478]
-Tue Aug 23 15:23:56 2011 Eric Hodel <drbrain@segment7.net>
+ * test/ruby/test_symbol.rb: tests for [ruby-core:03573].
- * backport r33027 from trunk.
+ * time.c (rb_strftime): removed meaningless volatile modifiers, and
+ concatenate successive nul characters at once. [ruby-dev:27472]
- * load.c (rb_f_require): Improve documentation of Kernel#require.
- [Ruby 1.9 - Bug #5210]
+Fri Oct 21 19:21:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Tue Aug 23 15:11:48 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * rubysig.h (CHECK_INTS): fixed typo. (I believe bit-or is improper)
- * backport r33023 from trunk.
+Fri Oct 21 17:49:32 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/zlib/zlib.c (gzfile_read_header): Ensure that each section of
- gzip header is readable to avoid SEGV.
+ * bin/erb (ERB::Main::run): typo fixed. [ruby-core:06337]
- * test/zlib/test_zlib.rb (test_corrupted_header): Test it.
+Fri Oct 21 15:27:17 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Aug 22 23:43:33 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * bignum.c (bignew_1): convertion from `int' to `char' discards
+ upper bits, (ie. (char)0xff00 -> 0) so it's better to test if
+ nonzero and set 0 or 1 instead of simply casting ... as a flag usage.
+ (but I believe this won't cause actual bug in current implementation)
+ [ruby-dev:27055]
- * backport r33021 from trunk.
+ * time.c: should use LONG_LONG instead of `long long'.
- * sprintf.c (rb_str_format): add RB_GC_GUARD to prevent temporary
- strings from GC.
+Thu Oct 20 09:37:15 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Aug 21 17:58:38 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+ * lib/mkmf.rb (create_makefile): Borland make seems not to allow
+ empty dependency list. If this change is not good, please correct
+ it.
- * backport r33019 from trunk.
+Thu Oct 20 07:55:09 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * iseq.c (iseq_s_disasm): remove variable which is no longer used
- since r33013.
+ * lib/mkmf.rb (create_makefile): get rid of a restriction
+ of Borland make. fixed: [ruby-dev:27460]
-Sun Aug 21 14:20:58 2011 Naohisa Goto <ngotogenome@gmail.com>
+Thu Oct 20 00:13:18 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * configure.in: use LD_LIBRARY_PATH_64 on 64-bit Solaris.
+ * rubysig.h (CHECK_INTS): fix typo.
-Sun Aug 21 11:13:54 2011 Naohisa Goto <ngotogenome@gmail.com>
+Wed Oct 19 23:58:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * backport r32895 from trunk.
+ * lib/mkmf.rb (create_makefile): do not create unnecessary empty
+ directories. fixed: [ruby-dev:27451]
- * ext/fiddle/conversions.c (generic_to_value): ffi_arg and ffi_sarg
- should be used to handle shorter return value. fix [Bug #3861]
- [ruby-core:32504]
+Wed Oct 19 19:26:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/fiddle/closure.c (callback): ditto
+ * parse.y (rb_gc_mark_parser): get rid of segfault with old yacc.
+ fixed: [ruby-dev:27439]
- * ext/fiddle/conversions.h (fiddle_generic): ditto
+Wed Oct 19 08:28:32 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/fiddle/conversions.c (value_to_generic): char, short and int
- are strictly distinguished on big-endian CPU, e.g. sparc64.
+ * file.c (rb_file_join): elements may contain null pointer strings.
+ report and fixed by Lloyd Zusman (hippoman): [ruby-core:06326]
-Sat Aug 20 13:28:32 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+Wed Oct 19 02:34:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * backport r33013 from trunk.
+ * eval.c, gc.c, time.c: made internal symbols static. [ruby-dev:27435]
- * iseq.c (iseq_s_disasm): fix a bug that may cause SEGV.
+Wed Oct 19 01:27:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_method.rb (test_body): add a test for the above change.
+ * regex.c (re_compile_pattern): numeric literal inside character class
+ disabled succeeding backtrack. fixed: [ruby-list:41328]
-Sat Aug 20 10:43:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 17 21:18:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/stringio/stringio.c (strio_read): return new string if nil
- is explicitly given as a buffer ([Bug #5207]), otherwise set the
- encoding. also removed dead code.
+ * parse.y (parser_heap): byacc never free parser stack.
+ fixed: [ruby-dev:27428]
-Fri Aug 19 14:25:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 17 16:04:47 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * process.c (proc_spawn_v, proc_spawn): should not wait the
- spawned process.
+ * file.c (chmod_internal, lchmod_internal): fixed type of 2nd argument.
- * process.c (proc_spawn_v): fix missing argument, and try with
- /bin/sh only if failed with ENOEXEC.
+Sun Oct 16 22:16:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 19 14:12:57 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/extmk.rb: omit non-existing directories.
- * backport r33007 from trunk.
+Sun Oct 16 14:30:05 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/net/imap.rb (idle): raises a Net::IMAP::Error when the
- connection is closed. based on the patch by Hugo Barauna.
- [Bug #5190] [ruby-core:38930]
+ * lib/rinda/rinda.rb (Rinda::Tuple#initialize): check remote hash
+ tuple. fixed: [ruby-list:41227]
-Fri Aug 19 11:28:58 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * test/rinda/test_rinda.rb: test it.
- * backport r33001 from trunk.
+Sun Oct 16 03:38:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/net/imap.rb (msg_att): accepts extra space before ')'.
- based on the patch by art lussos. [Bug #5163] [ruby-core:38820]
+ * rubysig.h (CHECK_INTS): prevent signal handler to run during
+ critical section. [ruby-core:04039]
-Wed Aug 17 15:27:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (load_wait): need not to call rb_thread_schedule()
+ explicitly. [ruby-core:04039]
- * backport r32996 from trunk.
+ * eval.c (rb_thread_schedule): clear rb_thread_critical.
+ [ruby-core:04039]
- * ext/bigdecimal/bigdecimal.c (cannot_be_coerced_into_BigDecimal):
- add a new function for raising error when an object cannot coerce
- into BigDecimal. [Bug #5172]
+Sat Oct 15 19:56:38 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/bigdecimal/bigdecimal.c (BigDecimalValueWithPrec): use
- cannot_be_coerced_into_BigDecimal function.
+ * bin/erb: typo fixed, again. thanks, Doug Kearns.
- * ext/bigdecimal/bigdecimal.c (BigMath_s_exp): ditto.
+Fri Oct 14 22:08:26 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigMath_s_log): ditto.
+ * win32/win32.c (ioctl): should set errno.
- * test/bigdecimal/test_bigdecimal.rb: test for the avobe changes.
+Fri Oct 14 16:57:32 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/bigdecimal/testbase.rb (under_gc_stress): add a new utility
- method to run tests under the condition of GC.stress = true.
+ * lib/webrick/config.rb (Config::FileHandler): :UserDir should be nil.
+ It is harmful to permit the access to ~/public_html by default.
+ suggested by Hiroyuki Iwatsuki.
-Wed Aug 17 10:16:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Thu Oct 13 23:29:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * backport r32994 from trunk.
+ * parse.y (HEAPCNT): bison allocates indivisible size.
+ fixed: [ruby-core:06261]
- * rational.c (nurat_coerce): Rational#coerce should converts itself
- into Complex if the argument is a Complex with non-zero imaginary
- part. [Bug #5020] [ruby-dev:44088]
+ * io.c, pack.c, ext/syck/rubyext.c, ext/syck/syck.h, missing/isinf.c:
+ get rid of warnings. fixed: [ruby-core:06247]
- * test/ruby/test_rational.rb (test_coerce): test for the above change.
+Wed Oct 12 12:52:57 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Aug 17 06:33:19 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/openssl/ossl.c (Init_openssl): should call
+ OpenSSL_add_ssl_algorithms().
- * backport r32992 from trunk.
+Wed Oct 12 11:08:54 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * ext/openssl/ossl_x509cert.c: Add class documentation for
- OpenSSL::X509::Certificate.
+ * file.c (rb_f_test): typo in RDoc comments.
-Wed Aug 17 05:02:25 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Tue Oct 11 21:41:58 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * backport r32987 from trunk.
+ * eval.c (rb_obj_respond_to): check if obj responds to the given
+ method with the given visibility. [ruby-dev:27408]
- * ext/openssl/ossl_pkey.c: corrected docs, OpenSSL::PKey::DH does
- *not* support #sign/verify.
+ * eval.c (rb_respond_to): conform to Object#respond_to?. [ruby-dev:27411]
-Tue Aug 16 18:56:54 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 11 00:01:21 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (ruby_threadptr_data_type): rename to hide.
- [ruby-core:38972]
+ * st.c (st_free_table): do not call free() but xfree().
+ [ruby-core:06205]
-Tue Aug 16 18:52:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Oct 8 20:04:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/mkexports.rb (Exports::Mswin#each_export): exclude Init_
- and _threadptr_ functions, as well as mingw.
+ * eval.c (Init_Binding): add Binding#dup method. [yarv-dev:666]
-Tue Aug 16 09:38:37 2011 Eric Hodel <drbrain@segment7.net>
+ * parse.y (rb_parser_malloc, rb_parser_free): manage parser stack on
+ heap. [ruby-list:41199]
- * backport r32981 and r32982 from trunk.
+ * ext/iconv/charset_alias.rb: parse config.charset_alias file directly.
- * ext/dl: Add documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #5192]
+Fri Oct 7 09:54:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/.document (fiddle): Remove duplicate entry
+ * lib/cgi.rb (CGI::Cookie::parse): Cookies from Nokia devices may
+ not be parsed correctly. A patch from August Z. Flatby
+ (augustzf) in [ruby-Patches-2595]. [ruby-core:06183]
- * ext/fiddle: Complete documentation of Fiddle. Patch by Vincent
- Batts. [#5192]
+Thu Oct 6 20:12:16 2005 Minero Aoki <aamine@loveruby.net>
-Tue Aug 16 08:00:15 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/strscan/strscan.c (strscan_free): remove useless code.
+ [ruby-dev:26368] [ruby-dev:27389]
+ (backported from trunk, rev 1.22)
- * backport r32977 from trunk
+Wed Oct 5 04:42:38 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/socket: Make Socket documentation appear. Add documentation for
- Socket, TCPServer, SOCKSSocket. Patch by Sylvain Daubert.
- [Ruby 1.9 - Feature #5182]
+ * lib/xmlrpc/server.rb (XMLRPC::Server#initialize): should mount the
+ servlet on "/".
-Mon Aug 15 10:16:55 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
- * backport r32973 from trunk.
+Wed Oct 5 03:59:09 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/openssl/ossl_ssl.c: Support disabling OpenSSL compression.
+ * lib/xmlrpc/server.rb (XMLRPC::Server#serve): delete wrong call
+ of "join".
- * test/openssl/test_ssl.rb: Add a test for it.
- Thanks to Eric Wong for the patch.
- [Ruby 1.9 - Feature #5183] [ruby-core:38911]
+Mon Oct 3 00:04:00 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Sat Aug 13 22:17:27 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * pack.c (EXTEND16): [ruby-dev:27383]
- * tool/mkconfig.rb: do not make the entries related to sitedir and
- verdordir if disabled by --without options. [ruby-core:38922]
- [Bug #5187]
+Thu Sep 29 10:26:18 2005 Tanaka Akira <akr@m17n.org>
-Sat Aug 13 17:06:57 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/dl/dl.c (rb_io_to_ptr): abolish sizeof(FILE).
+ [ruby-dev:27317]
- * ext/date/date_core.c: [ruby-core:38861]
+Thu Sep 29 07:22:05 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Aug 13 16:59:51 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * evalc. (rb_f_send): underscores need to be escaped.
+ fixed by Doug Kearns. [ruby-core:06053]
- * test/date/test_*.rb: added tests.
+Thu Sep 29 00:57:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Aug 13 09:36:19 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * eval.c (ev_const_get), variable.c (rb_const_get_0): retry only when
+ autoload succeeded.
- * ext/date/date_parse.c (parse_ddd_cb): fix r32896. RB_GC_GUARD
- insertion position was mistaken. [ruby-dev:44337] [Bug #5152]
+ * variable.c (rb_autoload_load): now return true if autoload
+ succeeded. fixed: [ruby-dev:27331]
-Sat Aug 13 09:26:24 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Wed Sep 28 23:42:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/psych/lib/psych/core_ext.rb: Make Kernel#y private.
- [ruby-core:38913]
+ * file.c (apply2files): add prototype.
- * test/psych/test_yaml.rb: corresponding test.
+ * file.c (rb_stat_inspect): constified.
-Sat Aug 13 09:15:16 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * class.c (rb_mod_init_copy, rb_class_init_copy), file.c (rb_stat_init_copy),
+ numeric.c (num_init_copy), object.c (rb_obj_init_copy, Init_Object),
+ re.c (match_init_copy, rb_reg_init_copy), time.c (time_init_copy):
+ undocumented.
- * ext/date/date_core.c (date_strftime_alloc): followed the change
- of r32885.
+Wed Sep 28 23:09:23 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * NEWS: followed the above change.
+ * lib/delegate.rb: document update from James Edward Gray II
+ <james@grayproductions.net>. [ruby-core:06027]
-Sat Aug 13 08:49:05 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Wed Sep 28 15:14:19 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/date/date_core.c: [ruby-core:38855].
+ * lib/webrick/cgi.rb (WEBrick::CGI#start): req.query_string should
+ refer the value of QUERY_STRING. [ruby-list:41186]
-Sat Aug 13 03:41:37 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#query_string=):
+ add new method.
- * backport r32953 from trunk.
+Wed Sep 28 10:45:44 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/uri/common.rb: Fix documentation of URI::Parser.new. Patch by
- Steve Klabnik. [Ruby 1.9 - Bug #5177]
+ * ext/tcltklib/tcltklib.c: cannot compile with Tcl/Tk8.0.x
+ [ruby-dev:27335].
-Sat Aug 13 02:19:57 2011 Eric Hodel <drbrain@segment7.net>
+Wed Sep 28 08:12:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * backport r32950 from trunk.
+ * io.c (read_buffered_data): check if reached EOF. fixed: [ruby-dev:27334]
- * ext/digest/digest.c: Add documentation for the Digest module. Patch
- by Sylvain Daubert. [Ruby 1.9 - Bug #5167]
+Wed Sep 28 07:56:52 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 5 13:32:43 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * lib/yaml/basenode.rb (YAML::BaseNode::match_segment): fix typo.
+ [ruby-dev:27237], [ruby-core:05854]
- * backport r32856 from trunk.
+ * lib/yaml/tag.rb (Module#yaml_as): suppress warnings.
- * lib/xmlrpc/client.rb, lib/xmlrpc/server.rb: should use
- String#bytesize instead of String#size.
+ * lib/yaml/types.rb (YAML::PrivateType, YAML::DomainType): ditto.
-Fri Aug 12 13:53:03 2011 Narihiro Nakamura <narihiro@netlab.jp>
+Wed Sep 28 03:23:35 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * backport r32894 from trunk.
+ * rubysig.h: fixed build problem with --enable-pthread on platforms
+ which don't have setitimer().
- * gc.c (gc_lazy_sweep): if sweep target slots are not found, we
- try heap_increment() because it might be able to expand the
- heap. [Bug #5127] [ruby-dev:44285]
+Mon Sep 26 22:32:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * gc.c (gc_clear_mark_on_sweep_slots): if a sweeping was
- interrupted, we expand the heap if at all possible.
+ * eval.c (set_trace_func): add rb_secure(4) to prevent adding
+ tracing function.
-Fri Aug 12 12:28:17 2011 Eric Hodel <drbrain@segment7.net>
+Sun Sep 25 12:05:10 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/rake: Update to Rake 0.9.2.2. Prevent pollution of toplevel
- namespace by Commands. Remove unused variable and debugging
- statement in tests.
+ * bin/erb: typo fixed.
-Fri Aug 12 09:00:24 2011 Eric Hodel <drbrain@segment7.net>
+Sun Sep 25 01:46:43 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * backport r32941 from trunk
+ * misc/ruby-mode.el (ruby-calculate-indent): arrange deep-indent
+ closing parenthesis at same column as the opening.
- * lib/rubygems: Import RubyGems 1.8.8. Fixes encoding of YAML gemspec
- from gems. Github Issue #149
+Sun Sep 25 00:42:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 12 03:24:35 2011 Eric Hodel <drbrain@segment7.net>
+ * misc/ruby-mode.el (ruby-expr-beg): deal with heredoc separately.
+ fixed: [ruby-list:41168]
- * backport r32935 from trunk
+ * misc/ruby-mode.el (ruby-calculate-indent): not to deepen indent
+ level for continuous line inside parentheses.
+ http://nabeken.tdiary.net/20050915.html#p02
- * lib/rdoc: Import RDoc 3.9.2. Fixes TIDYLINK for HTML output.
+Sun Sep 25 00:18:11 2005 Tanaka Akira <akr@m17n.org>
-Tue Aug 2 22:04:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (unknown_node): show more information. [ruby-dev:26196]
- * backport r32815 from trunk.
+Sat Sep 24 08:56:01 2005 Minero Aoki <aamine@loveruby.net>
- * gc.c (init_heap): allocate sigaltstack after heaps are allocated.
- [ruby-dev:44315] [Bug #5139]
+ * lib/fileutils.rb (cd): no longer accept :noop option, related
+ code is useless (backported from trunk, rev 1.67).
+ [ruby-core:05858] [ruby-Bugs:2494]
- * vm.c (thread_free): use free because objspace is not ready.
+Sat Sep 24 08:38:07 2005 Minero Aoki <aamine@loveruby.net>
- * vm.c (th_init): use malloc because objspace is not ready.
+ * lib/fileutils.rb: fix visibility of FileUtils::NoWrite, Verbose,
+ DryRun (backported from trunk, rev 1.66). [ruby-core:05954]
-Thu Aug 11 19:04:38 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * test/fileutils/test_nowrite.rb: test it.
- * backport r32931 from trunk.
+ * test/fileutils/test_dryrun.rb: new file.
- * variable.c (autoload_delete): An autoload entry is still in a
- RCLASS_IV_TBL, not in a RCLASS_CONST_TBL, so take back the table
- changed in r29600. And an autoload entry keeps not a
- rb_const_entry_t but a NODE so remove rb_const_entry_t thing added
- in r29602.
+ * test/fileutils/test_verbose.rb: new file.
-Thu Aug 11 15:07:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Sep 24 02:40:20 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (link_command): use LIBRUBYARG in rbconfig for
- unbundled extensions. [ruby-core:38802] [Bug #5147]
+ * lib/delegate.rb: document update from James Edward Gray II
+ <james@grayproductions.net>. [ruby-core:05942]
- * lib/mkmf.rb (init_mkmf): revert r32902. [ruby-core:38903]
+Thu Sep 22 23:36:24 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Aug 10 19:30:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/mkmf.rb (find_executable0): default path if environment is not
+ set. [ruby-dev:27281]
- * backport r32903 from trunk.
+Thu Sep 22 16:33:12 2005 Shugo Maeda <shugo@ruby-lang.org>
- * complex.c (nucomp_rationalize): calls rationalize of real part if
- imaginary part is exactly zero. The patch is made by Marc-Andre
- Lafortune. fixes [Bug #5178] [ruby-core:38885]
+ * test/readline/test_readline.rb (TestReadline::replace_stdio):
+ merged the patch of [ruby-dev:25232] instead of [ruby-dev:25223].
- * test/ruby/test_complex.rb (test_rationalize): add a test for the
- above change.
+Wed Sep 21 23:30:44 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * complex.c (nucomp_to_r): fix RDoc comment. The patch is made by
- Marc-Andre Lafortune.
+ * lib/mkmf.rb (configuration): generalized nmake dependent code.
-Wed Aug 10 14:11:07 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Sep 21 09:07:55 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (init_mkmf): set $LIBRUBYARG regardless of shared
- option. [ruby-core:38802] [Bug #5147]
+ * stable version 1.8.3 released.
-Wed Aug 10 02:57:01 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Sep 21 08:52:25 2005 why the lucky stiff <why@ruby-lang.org>
- * lib/net/http.rb: come back autoload. OpenSSL constant is used
- some places, so it leads mistakes like HTTP.start.
+ * ext/syck/token.c: correctly compute identation of a block
+ scalar's parent node. [ruby-talk:150620]
-Tue Aug 9 22:57:45 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Wed Sep 21 08:20:24 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/date/date_parse.c (date_zone_to_diff): add RB_GC_GUARD.
- [ruby-dev:44337] [Bug #5152]
+ * README.EXT, README.EXT.ja: add new features.
- * ext/date/data_parse.c (parse_ddd_cb): ditto.
+Wed Sep 21 07:43:58 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Aug 9 12:20:33 2011 Naohisa Goto <ngotogenome@gmail.com>
+ * lib/optparse.rb (default_argv, Arguable#options): defaults strings
+ to be parsed to Arguable instance.
- * test/fiddle/helper.rb (libc_so, libm_so): Solaris support added.
- [ruby-core:38853] [Bug #5168]
+Wed Sep 21 02:44:09 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/dl/test_base.rb (libc_so, libm_so): on Solaris, remove libc
- and libm version numbers for detecting default libc and libm.
+ * file.c (path_check_0): disallow sticky world writable directory
+ in PATH (and $LOAD_PATH). [ruby-dev:27226]
-Tue Aug 9 10:49:52 2011 Igor Zubkov <igor.zubkov@gmail.com>
+ * file.c (fpath_check): typo fixed.
- * array.c: Fix typo. https://github.com/ruby/ruby/pull/36
+Tue Sep 20 22:29:49 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Mon Aug 8 00:10:45 2011 Akinori MUSHA <knu@iDaemons.org>
+ * test/wsdl/simpletype/rpc/test_rpc.rb, test/wsdl/ref/test_ref.rb,
+ test/wsdl/any/test_any.rb test/soap/wsdlDriver/test_calc.rb:
+ suppress deliberate warnings with $VERBOSE = nil.
- * test/test_syslog.rb (TestSyslog#test_log): Do not be too
- specific about the log line format. Fixes #5081.
+Tue Sep 20 21:26:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Aug 7 23:39:44 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/io/wait/lib/nonblock.rb: disable on platforms non-blocking flag
+ is not available. fixed: [ruby-dev:27187]
- * time.c (rb_strftime_alloc): raise ERANGE if width is too large.
- Patch by Nobuyoshi Nakada. [Bug #4457] [ruby-dev:43285]
+Tue Sep 20 18:23:04 2005 Tanaka Akira <akr@m17n.org>
- * test/ruby/test_time.rb (class TestTime): add a test for the
- above change.
+ * eval.c (thread_mark): mark th->last_status. [ruby-dev:27179]
-Sun Aug 7 14:15:10 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+Tue Sep 20 18:20:33 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * backport r32876 from trunk.
+ * lib/yaml.rb: require 'yaml/constants'. [ruby-core:5776]
- * ext/objspace/objspace.c: fix typos in a document.
+Tue Sep 20 17:48:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Aug 7 04:42:36 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): add charset
+ information to content-type header.[ruby-core:5127]
- * marshal.c (w_object): Fix exception message when _dump_data
- is not defined on a T_DATA object.
+ * lib/xmlrpc/server.rb (CGIServer::serve): ditto.
-Sat Aug 6 06:14:20 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/xmlrpc/server.rb (ModRubyServer::serve): ditto.
- * lib/rdoc: Update to 3.9.1. Fixes === lines in verbatim sections.
- Fixes :nodoc: on class aliases. Fixes :stopdoc: creating references
- to Object. Fixes spacing when class comments are merged in ri.
- Fixes `ri []` crash. Fixes bug report URL when rdoc crashes. Adds
- :doc: and :nodoc: to allow hiding of implementation details in ruby.
- Makes `rdoc` and `ri` gem-aware.
+ * lib/xmlrpc/server.rb (WEBrickServlet::service): ditto.
-Sat Aug 6 03:19:45 2011 Eric Hodel <drbrain@segment7.net>
+Tue Sep 20 17:34:46 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/rubygems: Import RubyGems 1.8.7:
- Added missing require for `gem uninstall --format-executable`.
+ * test/webrick/test_cgi.rb: set ENV["PATH"] to CGIEnvPath on
+ windows. bcc32's runtime is not installed into system directory,
+ so it cannot be found without this setting. [ruby-dev:27166]
- The correct name of the executable being uninstalled is now displayed
- with --format-executable.
+Tue Sep 20 17:10:38 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- Fixed `gem unpack uninstalled_gem` default version picker.
+ * test/dbm/test_dbm.rb (TestDBM::test_s_open_error): remove
+ test_s_open_error test to detect duplicate open.
+ [ruby-dev:27202]
- RubyGems no longer claims a nonexistent gem can be uninstalled.
+Tue Sep 20 17:08:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- `gem which` no longer claims directories are requirable files.
+ * io.c: PIPE_BUF is not defined on BeOS. use _POSIX_PIPE_BUF instead.
+ [ruby-dev:27185]
- `gem cleanup` continues cleaning up gems if one can't be uninstalled
- due to permissions. Issue #82.
+Tue Sep 20 16:53:53 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- Gem repository directories are no longer created world-writable.
- Patch by Sakuro OZAWA. [Ruby 1.9 - Bug #4930]
+ * test/readline/test_readline.rb (TestReadline::replace_stdio):
+ BSD seek support from [ruby-dev:25223]. fixed: [ruby-dev:27150]
-Fri Aug 5 23:08:39 2011 Naohisa Goto <ngotogenome@gmail.com>
+Tue Sep 20 15:39:40 2005 why the lucky stiff <why@ruby-lang.org>
- * backport r32845 from trunk.
+ * ext/syck/emitter.c (syck_scan_scalar): prevent indicators from
+ appearing alone or at the end of plain scalars. [ruby-core:5826]
- * configure.in: when Solaris cc, use $(CC) to link shared libs.
+ * ext/syck/emitter.c (syck_emit_scalar): treat typed scalar nodes
+ as complex keys.
-Fri Aug 5 22:16:20 2011 Naohisa Goto <ngotogenome@gmail.com>
+ * lib/syck.h: version 0.60.
- * numeric.c (rb_infinity, rb_nan): use WORDS_BIGENDIAN to get endian.
- fix [Bug #5160] [ruby-dev:44356]
+ * lib/yaml/basenode.rb (YAML::BaseNode#at): transform keys during
+ key searches.
-Fri Aug 5 15:57:10 2011 Naohisa Goto <ngotogenome@gmail.com>
+ * ext/syck/rubyext.c: loading of binary-typed nodes. prevent
+ emission of plain strings that look like symbols, but which aren't.
- * complex.c (f_signbit): fix compile error in gcc4 on Solaris with
- CFLAGS="-std=gnu99". [ruby-dev:44355] fix [Bug #5159]
+Tue Sep 20 05:50:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * math.c: ditto.
+ * test/xmlrpc/test_webrick_server.rb (setup_http_server):
+ should not include 'webrick/https' unless 'use_ssl' because
+ it fails where openssl is not installed.
-Thu Aug 5 10:09:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Tue Sep 20 00:34:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * backport r32846 from trunk.
+ * io.c (io_close): call rb_io_close() directly if io is a T_FILE
+ object. [ruby-dev:27156]
- * thread_pthread.c (native_cond_signal): retry to call pthread_cond_signal
- and pthread_cond_broadcast if they return EAGAIN in
- native_cond_signal and native_cond_broadcast, respectively.
- It is for the pthread implementation of Mac OS X 10.7 (Lion).
- fixes #5155. [ruby-dev:44342].
+Mon Sep 19 19:09:08 2005 Minero Aoki <aamine@loveruby.net>
- * thread_pthread.c (native_cond_broadcast): ditto.
+ * file.c (rb_file_chown): should accept nil. [ruby-dev:27171]
+ (backport from trunk, rev 1.208)
- * thread_pthread.c (struct cached_thread_entry): stop using
- pthread_cond_t and its functions directly.
+Mon Sep 19 18:35:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (register_cached_thread_and_wait): ditto.
+ * ext/dl/dl.c (rb_io_to_ptr): fix DragonFlyBSD support.
+ [ruby-dev:27151]
- * thread_pthread.c (use_cached_thread): ditto.
+Mon Sep 19 14:17:04 2005 Minero Aoki <aamine@loveruby.net>
-Fri Aug 5 07:35:00 2011 Luis Lavena <luislavena@gmail.com>
+ * ext/syck/emitter.c (syck_emit): passing an int* value to the
+ long* parameter causes unaligned access on LP64 systems.
+ [ruby-dev:27161]
- * lib/rubygems/installer.rb (class Gem): Correct path check on Windows
- Possible fix for [Ruby 1.9 - Bug #5111]
+Mon Sep 19 13:44:03 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * test/rubygems/test_gem_installer.rb (load Gem): ditto
- Backported from trunk r32804
+ * ext/win32ole/win32ole.c: avoid core dump with WIN32OLE_EVENT.
+ [ruby-dev:27133]
-Fri Aug 5 07:00:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 19 10:36:06 2005 Minero Aoki <aamine@loveruby.net>
- * test/io/console/test_io_console.rb (test_noctty): daemon() on
- Fedora Rawhide seems not to detach the controlling terminal,
- when the argument noclose is non-zero. ref: [Bug #5135]
+ * lib/fileutils.rb (cp_r): default is :dereference_root=>true for
+ backward compatibility. [ruby-dev:27145]
-Wed Aug 4 02:35:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * test/fileutils/test_fileutils.rb (test_cp_r): test it.
- * configure.in: use build_os variable for checking C and C++ compilers
- matching.
+Mon Sep 19 09:57:39 2005 Minero Aoki <aamine@loveruby.net>
- * configure.in: use clang++ if clang is used.
+ * test/fileutils/test_fileutils.rb: backported from trunk (1.36).
+ (again) [ruby-dev:27145]
-Thu Aug 4 02:21:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 19 07:45:37 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/mkmf.rb (link_command): use static library only for bundled
- extensions. [Bug #5147]
+ * ext/openssl/ossl_pkey.h, ossl_pkey_rsa.c, ossl_pkey_dsa.c:
+ an instance variable "private" is added to OpenSSL::PKey class.
+ this ivar is a flag that shows whether there is a private key
+ in the instance.
-Wed Aug 3 00:11:08 2011 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_engine.c: (ossl_engine_load_privkey): set private
+ key flag.
- * lib/prettyprint.rb: update document. [ruby-core:36776]
+Mon Sep 19 06:41:32 2005 Minero Aoki <aamine@loveruby.net>
+ * lib/fileutils.rb: backported from trunk (rev 1.65):
-Tue Aug 2 20:10:16 2011 Shota Fukumori <sorah@tubusu.net>
+ * lib/fileutils.rb (rm_r): new option :secure.
- * test/testunit/test_parallel.rb: pass "--ruby" option to
- test/testunit/tests_for_parallel/runner.rb. [Bug #5132] [ruby-dev:44303]
- Backported from trunk r32812.
+ * lib/fileutils.rb (rm_rf): new option :secure.
-Tue Aug 2 12:03:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb: new method #remove_entry_secure.
- * hash.c (recursive_hash): hash value of emptied hash should be
- equal to an empty hash. [ruby-core:38650]
+ * lib/fileutils.rb (cd): remove option :noop.
-Tue Aug 2 11:42:15 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb (cp_r): new option :dereference_root.
- * parse.y (rb_enc_symname2_p): :! is valid symbol. [Bug #5136]
+ * lib/fileutils.rb (cp_r): new option :dereference_root.
-Tue Aug 2 03:26:02 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/fileutils.rb: new method #remove_entry.
- * test/rake/test_rake_directory_task.rb (TestRakeDirectoryTask#
- test_directory_win32): fixed wrong test.
- backported r32670 from trunk.
+ * lib/fileutils.rb: new method #chmod_R.
-Mon Aug 1 15:45:23 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/fileutils.rb: new method #chown.
- * test/rake/test_rake_functional.rb: Don't assume the binary name of
- ruby is "ruby". [Ruby 1.9 - Bug #5114]
- * test/rake/helper.rb: ditto
+ * lib/fileutils.rb: new method #chown_R.
-Mon Aug 1 05:21:42 2011 TAKANO Mitsuhiro (takano32) <tak@no32.tk>
+ * lib/fileutils.rb: new method .commands.
- * cont.c (cont_save_thread): fix missing semicolon.
+ * lib/fileutils.rb: new method .options.
-Sun Jul 31 22:57:16 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/fileutils.rb: new method .have_option?.
- * enc/Makefile.in (ECHO1): Same as the recent fix in common.mk.
- ":" in a make variable replacement cause a syntax error with
- /usr/ccs/bin/make on Solaris. Uses $(NULLCMD) instead.
+ * lib/fileutils.rb: new method .options_of.
-Sun Jul 31 22:44:08 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+ * lib/fileutils.rb: new method .collect_method.
- * configure.in: fix typos.
+ * lib/fileutils.rb: use module_function instead of single extend.
-Sun Jul 31 21:19:51 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * test/fileutils/test_fileutils.rb: backported from trunk (1.36).
- * lib/mkmf.rb (configuration:ECHO1): Same as the recent fix in
- common.mk.
- ":" in a make variable replacement cause a syntax error with
- /usr/ccs/bin/make on Solaris. Uses $(NULLCMD) instead.
+Mon Sep 19 03:17:48 2005 Tanaka Akira <akr@m17n.org>
-Sun Jul 31 21:16:02 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * file.c (rb_thread_flock): wrap the flock system call by
+ TRAP_BEG/TRAP_END to enable signals. [ruby-dev:27122]
- * complex.c (f_signbit): gcc4 on Solaris DOES have signbit but does
- not have it on header.
+ * ext/socket/socket.c (bsock_send): wrap the sendto and send system
+ call by TRAP_BEG/TRAP_END to enable signals when writing to a socket
+ which is full. [ruby-dev:27132]
- * math.c: ditto.
+ * io.c (rb_io_syswrite): wrap the write system call by
+ TRAP_BEG/TRAP_END to enable signals when writing to a pipe which is
+ full. [ruby-dev:27134]
-Sun Jul 31 21:09:04 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+Mon Sep 19 03:02:08 2005 Tanaka Akira <akr@m17n.org>
- * common.mk (node_name.inc): Use $(Q) for consistency.
+ * io.c (io_fwrite): wrap the write system call by TRAP_BEG/TRAP_END to
+ enable signals when writing to a pipe which is full.
- * Makefile.in (INSNS): ditto.
+Sun Sep 18 02:10:47 2005 why the lucky stiff <why@ruby-lang.org>
-Sun Jul 31 20:39:12 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/yaml/rubytypes.rb: remove comments that are bungling up
+ the rdoc and ri output. output symbols as plain scalars.
- * common.mk (ECHO1): nmake does not allow parenthesis in make variable
- replacement.
+ * ext/syck/rubyext.c (syck_emitter_reset): emit headless
+ documents always.
-Sun Jul 31 20:21:36 2011 "Yuki Sonoda (Yugui)" <yugui@yugui.jp>
+ * ext/syck/emitter.c (syck_scan_scalar): quote scalars with any
+ kind of surrounding line space, tabs or spaces alike.
- * common.mk (ECHO1): ":" in a make variable replacement cause a syntax
- error with /usr/ccs/bin/make on Solaris. Uses $(NULLCMD) instead.
+ * ext/syck/token.c: accept tabs as whitespace, not for indentation,
+ but strip from plain scalars.
- * configure.in (NULLCMD): new check.
+ * test/yaml/test_yaml.rb: remove outdated tests.
- * Makefile.in (NULLCMD): Reflects checking in configure.
+Sat Sep 17 23:25:04 2005 sheepman <sheepman@sheepman.sakura.ne.jp>
- * win32/Makefile.sub (NULLCMD): new assignment.
+ * lib/mathn.rb (Rational::inspect): should preserve original
+ operand. [ruby-core:05806]
-Sun Jul 31 11:31:07 2011 Kazuki Tsujimoto <kazuki@callcc.net>
+Sat Sep 17 23:20:27 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * backport r32768 from trunk.
+ * lib/cgi.rb (CGI::Cookie): should handle multiple values for a
+ cookie name. [ruby-talk:156140]
- * vm.c: check if cfp is valid. [Bug #5083] [ruby-dev:44208]
+Sat Sep 17 10:42:13 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Jul 31 01:23:45 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
+ should call Kernel.eval on caller's safe-level instead of slave's
+ safe-level (Of course, the given script should be evaluated on
+ slave's safe-level).
- * backport r32762 from trunk.
+Sat Sep 17 09:45:26 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb (test_version): removed.
+ * string.c (rb_str_substr): should propagate taintness even for
+ empty strings. [ruby-dev:27121]
-Sat Jul 30 23:51:44 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * string.c (rb_str_aref): should infect result if range argument
+ is tainted. [ruby-dev:27121]
- * lib/cmath.rb (cbrt): should return a real number if possible.
+Sat Sep 17 08:35:39 2005 Kouhei Sutou <kou@cozmixng.org>
-Sat Jul 30 23:48:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/rss/maker/base.rb (RSS::Maker::ItemsBase#normalize): fixed
+ strange RSS::Maker::Item#max_size behavior.
+ Thanks to Kazuhiko <kazuhiko@fdiary.net>.
- * ext/date/date_core.c: an issue that is same as [ruby-dev:44071].
+ * test/rss/test_maker_1.0.rb (RSS::TestMaker10#test_items): ditto.
- * ext/date/date_strftime.c: identical to [ruby-dev:44112].
+Fri Sep 16 23:09:20 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Sat Jul 30 23:19:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/win32ole/win32ole.c (ole_search_event_at): bug fix
+ in ext/win32ole/sample/ienavi.rb.
- * defs/default_gems: separate from tool/rbinstall.rb.
+ * ext/win32ole/win32ole/tests/testOLEEVENT.rb: ditto.
-Sat Jul 30 23:14:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 16 22:41:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_io_each_byte): rbuf can be refreshed during yield.
- [Bug #5119]
+ * file.c (rb_file_s_extname): empty string for path name ending with a
+ period. fixed: [ruby-core:05651]
-Sat Jul 30 22:35:50 2011 Naohisa Goto <ngotogenome@gmail.com>
+ * file.c (rb_file_join): smarter behavior at edge cases.
+ fixed: [ruby-core:05706]
- * strftime.c (NEEDS): avoid SEGV due to integer overflow in
- sparc-solaris2.10 and i686-linux. fix [Bug #4456] [ruby-dev:43284]
+Fri Sep 16 18:34:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jul 30 14:27:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/syck/node.c (syck_replace_str): was using return from the
+ void function. a patch from MIYAMUKO Katsuyuki
+ <miyamuko at mtb.biglobe.ne.jp>. [ruby-dev:27111]
- * backport r32754 from trunk.
+Fri Sep 16 14:48:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_version): version 1.1.0.
+ * ext/tk/lib/multi-tk.rb: fix typo on MultiTkIp#bg_eval_string
- * ext/bigdecimal/bigdecimal.gemspec: turn into a default gem.
+Fri Sep 16 12:02:12 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * tool/rbinstall.rb: ditto.
+ * ext/syck/rubyext.c (syck_resolver_transfer): remove C++ style
+ comment (//). [ruby-core:05793]
-Sat Jul 30 13:52:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Fri Sep 16 00:14:14 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
- revive zero and implicit precision support as a deprecated feature.
+ * test/logger/test_logger.rb: unintentionally overwritten changes by
+ Usa. reverted.
- * test/bigdecimal/test_bigdecimal_util.rb: modify a test for the above
- change.
+Fri Sep 16 00:06:18 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * NEWS: describes the above change.
+ * lib/webrick/cgi.rb (WEBrick::CGI::Socket#initialize): should set
+ $stdout.binmode.
-Sat Jul 30 10:58:10 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Sep 15 23:25:21 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * vm.c (th_init): preallocate alternative stack.
- NoMemoryError is better than rb_bug, of course.
- Patch by Eric Wong. [ruby-core:38572][ruby-core:38594].
+ * lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.5.
- * signal.c (rb_register_sigaltstack): ditto.
+ #nnn is a ticket number at http://dev.ctor.org/soap4r
- * vm_core.h: moved ALT_STACK_SIZE definition from signal.c.
+ * SOAP
- * vm.c (thread_free): use xfree() instead of free().
+ * allow to configure an envelope namespace of SOAP request. (#124)
+ TemporaryNamespace = 'http://www.w3.org/2003/05/soap-envelope'
+ @client.options["soap.envelope.requestnamespace"] =
+ TemporaryNamespace
+ @client.options["soap.envelope.responsenamespace"] =
+ TemporaryNamespace
+ @client.do_proc(...)
-Sat Jul 30 07:20:49 2011 Tanaka Akira <akr@fsij.org>
+ * let SOAP request XML indent space configuable. see
+ "soap.envelope.no_indent" option. (#130)
- * ext/socket/lib/socket.rb (udp_server_sockets): unused variable
- removed.
- patch by Jeremy Evans. [ruby-core:38600]
+ * let external CES configuable.
+ ex. client["soap.mapping.external_ces"] = 'SJIS'. $KCODE is used
+ by default. (#133)
+ external CES ::= CES used in Ruby object of client and server
+ internal CES ::= CES used in SOAP/OM
-Fri Jul 29 23:56:32 2011 Tanaka Akira <akr@fsij.org>
+ * add iso-8859-1 external CES support. (#106)
- * lib/securerandom.rb: call OpenSSL::Random.seed at the
- SecureRandom.random_bytes call.
- based on the patch by Masahiro Tomita. [ruby-dev:44270]
+ * fixed illegal 'qualified' handling of elements. it caused
+ ASP.NET inteoperability problem. (#144)
-Fri Jul 29 20:48:39 2011 Tanaka Akira <akr@fsij.org>
+ * added 'soap.envelope.use_numeric_character_reference' (boolean)
+ option to let query XML use numeric character reference in XML,
+ not plain UTF-8 character. !GoogleSearch server seems to not
+ allow plain UTF-8 character since 2005-08-15 update. (#147)
- * ext/socket/mkconstants.rb: fix typos.
+ * SOAP::Header::SimpleHeader (de)serialization throws an exception
+ on !SimpleHeader.on_(in|out)bound when header is a String. so we
+ could not use a simple single element headerItem. fixed. thanks
+ to emil. (#129)
-Fri Jul 29 20:28:56 2011 Tanaka Akira <akr@fsij.org>
+ * out parameter of rpc operation did not work. (#132)
- * ext/socket/mkconstants.rb: use whitespaces as a separator.
+ * follow HTTP redirect only if using http-access2. (#125) (#145)
-Fri Jul 29 18:59:07 2011 Tanaka Akira <akr@fsij.org>
+ * add a workaround for importing an WSDL whose path begins with
+ drive letter. (#115)
- * ext/socket/mkconstants.rb: add documents for constants.
- patch by Eric Hodel. [ruby-core:37853] [Bug #4989]
+ * WSDL
-Mon Jul 25 23:51:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * SOAP Data which is defined as a simpletype was not mapped
+ correctly to Ruby obj when using wsdl2ruby.rb generated classdef
+ file. (#123)
- * backport r32671 from trunk.
+ * rpc/literal support. (#118)
- * proc.c: pre-allocate the unlinked_method_entry_list_entry struct to
- avoid memory allocation during GC. based on a patch from Eric Wong.
- [ruby-core:38498]
+ * re-implemented local element qualify/unqualify control. handles
+ elementFormDefault and form in WSDL. (#119)
-Mon Jul 25 22:36:11 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * Array of an element which has simpleType causes a crash. (#128)
- * backport r32669 from trunk.
+ * prarmeterOrder may not contain return part so it can be shorter
+ than parts size. Thanks to Hugh. (#139)
- * proc.c (struct METHOD), gc.c (gc_marks), vm_method.c
- (rb_gc_mark_unlinked_live_method_entries): fix SEGV bug.
- rb_method_entry_t was free'd even when the method is still on the
- stack if it is BMETHOD (i.e., Method#call). This is because
- rb_method_entry_t is embedded in struct METHOD. This commit
- separates them and marks the live method entries.
- See [ruby-core:38449] in detail. fix [Bug #5047] [ruby-core:38171]
+ * Samples
-Thu Jul 28 23:36:28 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * added !BasicAuth client sample. (#117)
- * ext/fiddle/closure.c (callback): use rb_ary_tmp_new() instead of
- xmalloc() to allocate an array for arguments of callback procedure,
- to prevent arguments from being swept by GC. [ruby-core:38546]
- [Bug #4929]
+ * added Base64 client/server sample.
-Thu Jul 28 22:51:27 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * added Flickr SOAP interface client sample. (#122)
- * backport r32723 from trunk.
+ * added !SalesForce client sample. (#135)
- * ext/openssl/ossl_cipher.c (ossl_cipher_initialize): Avoid possible
- SEGV from AES encryption/decryption. Processing data by
- Cipher#update without initializing key (meaningless usage of Cipher
- object since we don't offer a way to export a key) could cause SEGV.
+ * updated Thawte CA certificate for !GoogleAdWords sample.
- In OpenSSL, the EVP which has EVP_CIPH_RAND_KEY flag (such as DES3)
- allows uninitialized key, but other EVPs (such as AES) does not
- allow it. Calling EVP_CipherUpdate() without initializing key causes
- SEGV so we set the data filled with "\0" as the key by default. See
- #2768.
+ * updated a client script with the newer version made by Johan.
+ thanks!
- * test/openssl/test_cipher.rb: test it.
+ * shortened long file names. (#120)
-Thu Jul 28 04:53:31 2011 Eric Hodel <drbrain@segment7.net>
+ * fixed typo in authheader sample. (#129)
- * lib/delegate.rb: Move file-level documentation to the appropriate
- classes.
+ * updated deprecated method usage. (#138)
-Thu Jul 28 00:33:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Sep 15 23:02:57 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/fileutils/test_fileutils.rb: add OpenBSD case.
- patched by Jeremy Evans [ruby-core:38530] see #5097
+ * win32/win32.h (rb_w32_stat): added prototype.
- * test/ruby/test_process.rb: ditto.
+Thu Sep 15 22:35:55 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Jul 27 17:59:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/ruby/test_signal.rb (test_exit_action): skip the test using
+ fork on fork-less platforms.
- * include/ruby/missing.h: define __syscall if the platform has
- __syscall in the library but doesn't define it in headers
- for example Mac OS X.
+Thu Sep 15 11:39:18 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Jul 27 15:39:14 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/dialog.rb: If a dialog does not show up yet,
+ TkDialogObj#name raises an exception. [ruby-talk:156109]
- * object.c: Add usage documentation for BasicObject. Based on patch
- by Thomas Sawyer. [Ruby 1.9 - Bug #5067]
+Thu Sep 15 01:39:19 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Wed Jul 27 12:24:17 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rinda/tuplespace.rb (Rinda::TemplateEntry::initialize): pull
+ up method. Tabs converted to spaces.
- * lib/rubygems/uninstaller.rb: Add missing require and update
- messaging to avoid confusion with uninstall --format-executable.
- [Ruby 1.9 - Bug #4062]
+Thu Sep 15 00:18:24 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jul 27 10:47:57 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/net/telnet.rb (Net::Telnet::waitfor): replace sysread with
+ readpartial. [ruby-talk:127641]
- * lib/rubygems: Update to RubyGems 1.8.6.1.
+Wed Sep 14 22:40:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jul 27 10:04:06 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * dir.c (ruby_glob): glob function not using ruby exception system.
- * backport r32690 from trunk.
+Wed Sep 14 01:26:03 2005 Minero Aoki <aamine@loveruby.net>
- * test/openssl/test_pkcs12.rb: Add test and intermediate certificates.
- [ Ruby 1.9 - Feature #3793 ] [ruby-core:32088]
+ * lib/net/https.rb: backported from trunk, rev 1.3.
+ [ruby-dev:25673] (again), [ruby-dev:26617] (again),
+ [ruby-dev:27062]
-Sat Jul 27 01:26:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/openssl/lib/net/https.rb: removed.
- * NEWS: add changes of bigdecimal and bigdecimal/util.
+ * ext/openssl/lib/net/protocols.rb: removed.
-Wed Jul 27 01:13:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/net/http.rb: #use_ssl?, #use_ssl are moved from net/https.
- * ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
- zero or negative precision is error. fixes #5098.
- [ruby-dev:44210]
+Tue Sep 13 22:09:40 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/bigdecimal/lib/bigdecimal/util.rb (Float#to_d): modified for
- specifying precision. fixes #5098. [ruby-dev:44210]
+ * lib/logger.rb (Logger): added formatter accessor to logger for
+ dictating the way in which the logger should format the messages it
+ displays. Thanks to Nicholas Seckar (cf. [ruby-talk:153391]) and
+ Daniel Berger.
- * ext/bigdecimal/lib/bigdecimal/util.rb (Integer#to_d): added
- for symmetry to BigDecimal() function with an Integer.
- fixes #5098. [ruby-dev:44210]
+ * lib/logger.rb (Logger): added VERSION constant.
- * ext/bigdecimal/lib/bigdecimal/util.rb (BigDecimal#to_d): added
- for adapting other Numeric subclasses. [ruby-dev:44245]
+ * lib/logger.rb: removed document for LogDevice. It is an
+ implementation detail and is not a public interface.
- * test/bigdecimal/test_bigdecimal_util.rb: add tests for the above
- changes.
+ * test/logger/test_logger.rb: added tests.
-Wed Jul 27 00:54:38 2011 Kenta Murata <mrkn@mrkn.jp>
+Tue Sep 13 21:47:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bigdecimal/bigdecimal.c (VpDup) a new function for duplicating
- a BigDecimal.
+ * eval.c (BEGIN_CALLARGS): pop halfly pushed status.
+ fixed: [ruby-dev:26881]
- * bigdecimal/bigdecimal.c (BigDecimal_new): support generating a new
- BigDecimal from another BigDecimal using BigDecimal global function
- or constructor. [ruby-dev:44245]
+Tue Sep 13 16:26:45 2005 Minero Aoki <aamine@loveruby.net>
-Mon Jul 25 22:24:09 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * lib/net/http.rb: backported from trunk, rev 1.128.
+ [ruby-dev:25673] [ruby-dev:26617]
- * backport r32666 from trunk.
+ * lib/net/protocol.rb: backported from trunk, rev 1.78.
- * lib/xmlrpc/client.rb: Fix possible HTTP header formatting failure by
- 'Basic' header. Long username caused the base64 String truncation in
- HTTP header which is not allowed. See #5046.
+ * lib/net/protocol.rb: new method #old_open to support net/smtp
+ and net/pop.
- * test/xmlrpc/test_webrick_server.rb: test it.
+ * lib/net/smtp.rb: use #old_open.
-Mon Jul 25 15:36:07 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * lib/net/pop.rb: ditto.
- * ext/openssl/lib/openssl/{x509.rb,ssl.rb}: Add deprecation warning
- for openssl/{x509,ssl} usage. Users should require "openssl" instead
- of "openssl/ssl" and "openssl/x509". Start of transition period
- introduced by [ruby-dev:38018].
+Tue Sep 13 12:33:05 2005 why the lucky stiff <why@ruby-lang.org>
-Mon Jul 25 13:50:33 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * lib/yaml.rb: reworking YAML::Stream to use the new
+ emitter.
- * backport r32662 from trunk.
+ * lib/yaml/stream.rb: ditto.
- * ext/openssl/lib/openssl/x509.rb: Cosmetic change: move definition
- introduced in r30152 to x509-internal.rb.
+ * lib/yaml/rubytypes.rb: added Object#yaml_new.
-Mon Jul 25 13:35:20 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * lib/yaml/tag.rb: the tag_subclasses? method now
+ shows up in the class. allow taguri to be set using an accessor.
+ continue support of Object#to_yaml_type.
- * backport r32658 from trunk.
+ * ext/syck/rubyext.c: new emitter code. yaml_new and yaml_initialize
+ get called, should they be present. consolidated all the diaspora of internal
+ node types into the family below YAML::Syck::Node -- Map,
+ Seq, Scalar -- all of whom are SyckNode structs pointing to
+ Ruby data. moved Object#yaml_new into the node_import and made it the
+ default behavior. the target_class is always called wih yaml_new, prepended
+ a parameter, which is the klass. loaded nodes through GenericResolver show their style.
+ new Resolver#tagurize converts type ids to taguris.
- * ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Avoid randomly generated
- SSLError from SSLSocket just after invoking SSLSocket#close.
- OpenSSL's SSL_shutdown could try to send alert packet and it might
- set SSLerr(global error stack) as the result. It causes the next
- SSL read/write operation to fail by unrelated reason.
+ * ext/syck/implicit.re: were 'y' and 'n' seriously omitted??
- By design, we're ignoring any error at SSL_shutdown() so we clear
- global error stack after SSL_shutdown is called. See #5039.
+ * ext/syck/emitter.c: renovated emitter, walks the tree in advance.
+ consolidated redundant block_styles struct into
+ the scalar_style struct. (this means loaded nodes can now
+ be sent back to emitter and preserve at least its very basic
+ formatting.)
-Sun Jul 24 20:29:53 2011 Tanaka Akira <akr@fsij.org>
+ * ext/syck/gram.c: headless documents of any kind allowed.
- * ext/socket/extconf.rb: refine the recvmsg test.
+ * ext/syck/node.c: new syck_replace_str methods and syck_empty_*
+ methods for rewriting node contents, while keeping the ID
+ and other setup info. added syck_seq_assign.
-Sun Jul 24 20:02:31 2011 Tanaka Akira <akr@fsij.org>
+ * ext/syck/syck.h: reflect block_styles and new node functions.
- * ext/socket/extconf.rb: fix the recvmsg test.
+Mon Sep 12 20:53:06 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Jul 24 08:42:51 2011 Tanaka Akira <akr@fsij.org>
+ * test/openssl/test_pkcs7.rb (test_enveloped): skip this test
+ to avoid a bug of PKCS7_enctypt() (only if ext/openssl is
+ compiled with OpenSSL-0.9.7d or earlier versions).
+ http://www.mail-archive.com/openssl-dev@openssl.org/msg17376.html
- * ext/socket/extconf.rb: test recvmsg allocates file descriptors for
- fd passing even with MSG_PEEK.
+Mon Sep 12 14:03:33 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/socket/ancdata.c: use the above test result.
+ * test/dbm/test_dbm.rb: remove locking test, which may not be
+ supported on some platforms. [ruby-dev:27030]
-Sun Jul 24 01:24:31 2011 Eric Hodel <drbrain@segment7.net>
+Mon Sep 12 10:45:58 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/rubygems/specification.rb: Restore behavior of
- Gem::Specification#loaded. [Ruby 1.9 - Bug #5032]
+ * ext/dl/dl.c (rb_io_to_ptr): merged a patch for DragonFly BSD
+ from Takahiro Kambe <taca at back-street.net>. [ruby-dev:27023]
-Sun Jul 24 01:14:49 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Sep 11 22:05:51 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/rake/test_rake_functional.rb (setup): Use __FILE__ for the base
- directory. Current directory is not the top source directory when
- the building process runs on other than there.
+ * bin/erb (ERB::Main#run): set ERB#filename so that it is used
+ when reporting syntax/runtime errors. Tabs converted to spaces.
- * test/rake/test_rake_rake_test_loader.rb: ditto.
+Sat Sep 10 10:17:03 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/rake/test_rake_task_argument_parsing.rb
- (test_terminal_width_using_hardcoded_80): hardcoded 80 is used
- when app.unix? is false.
+ * ext/openssl/ossl_engine.c (ossl_engine_s_by_id):
+ OpenSSL::Engine.by_id calls given block before calling
+ ENGINE_init (block parameter is the return value of this method
+ itself). this functionality is useful to load dynamic shared
+ engines. the following code is a sample of loading a key using
+ OpenSC PKCS #11 module.
-Sun Jul 24 00:42:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ require "openssl"
+ pkcs11 = OpenSSL::Engine.by_id("dynamic"){|e|
+ e.ctrl_cmd("SO_PATH", "/usr/lib/opensc/engine_pkcs11.so")
+ e.ctrl_cmd("LIST_ADD", "1")
+ e.ctrl_cmd("LOAD")
+ }
+ pkcs11.ctrl_cmd("PIN", "secret")
+ key = pkcs11.load_private_key
- * configure.in: change the default compiler to gcc-4.2 if target os
- is OS X 10.7 (Lion).
+ * ext/openssl/ossl_engine.c (ossl_engine_ctrl_cmd): new method
+ OpenSSL::Engine#ctrl_cmd. it wraps ENGINE_ctrl_cmd_string.
-Sat Jul 23 17:06:25 2011 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_engine.c (ossl_engine_get_cmds): new method
+ OpenSSL::Engine#cmds. it returms engine command definitions.
- * io.c (rb_update_max_fd): validate fd.
+Sat Sep 10 10:09:47 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/socket/rubysocket.h (rsock_discard_cmsg_resource): add
- msg_peek_p argument for the declaration.
+ * ext/openssl/ossl_asn1.c (asn1str_to_str): new function.
- * ext/socket/ancdata.c (discard_cmsg): add msg_peek_p argument.
- assume FreeBSD, NetBSD and MacOS X doesn't generate passed fd
- when MSG_PEEK.
- (rsock_discard_cmsg_resource): add msg_peek_p argument.
- (bsock_recvmsg_internal): call rsock_discard_cmsg_resource with
- msg_peek_p argument.
+ * ext/openssl/ossl_pkcs7.c: new class OpenSSL::PKCS7::RecipientInfo.
+ this class wraps PKCS7_RECIP_INFO struct.
- * ext/socket/unixsocket.c (unix_recv_io): call
- rsock_discard_cmsg_resource with msg_peek_p argument.
+ * ext/openssl/ossl_pkcs7.c: OpenSSL::PKCS7::Signer is renamed to
+ OpenSSL::PKCS7::SignerInfo. ("Signer" remains as an alias of
+ SignerInfo.)
-Sat Jul 23 14:38:28 2011 Eric Hodel <drbrain@segment7.net>
+ * test/openssl/test_pkcs7.rb: new file.
- * test/rake*: Remove dependencies on flexmock and session gems.
- [Ruby 1.9 - Bug #4987]
+Sat Sep 10 10:05:51 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Jul 22 21:46:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): assume that
+ the argument is a DER string if Base64 decoding failed.
- * vm_insnhelper.c (vm_call_cfunc): added volatile for a workaround
- of cfp consistency error problem on OS X 10.7 (Lion). It's
- suspected llvm optimization bug.
- [Bug #5076] [ruby-dev:44185]
+ * ext/openssl/ossl_ns_pki.c (ossl_spki_to_der): new method.
-Fri Jul 22 21:50:16 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/openssl/test_ns_spki.rb: add new file.
- * lib/uri/generic.rb (WFKV_): unroll the loop of regexp.
+Sat Sep 10 09:56:24 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/uri/generic.rb (URI.decode_www_form_component): ditto.
+ * ext/openssl/lib/digest.rb: added SHA224, SHA256, SHA384 and SHA512.
+ these features are enabled if this library is compiled with
+ OpenSSL 0.9.8 or later.
-Fri Jul 22 21:49:48 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/openssl/test_digest.rb: add test for new digests.
- * enum.c (enum_inject): remove empty line to notify rdoc
- Enumerable#reduce is alias. patched by milki@github.
- https://github.com/ruby/ruby/pull/26
+Sat Sep 10 09:51:30 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Jul 22 21:49:28 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl.c (ossl_raise): should use ERR_peek_last_error
+ to get last error on the current thread. And should report
+ errors on the stack while OpenSSL.debug is true.
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#each):
- Allow HTTP/0.9 request which doesn't has any header or body.
- patched by Felix Jodoin. [ruby-core:38040] [Bug #5022]
+ * ext/openssl/ossl.c (ossl_get_errors): new method for debugging
+ this library.
-Fri Jul 22 21:45:21 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): fix error message.
- * ext/dl/handle.c (dlhandle_sym): clear previous error with dlerror()
- before calling dlsym(). [ruby-dev:44091] [Bug #5021]
+ * ext/openssl/ossl_x509req.c (ossl_x509req_set_attributes): get rid
+ of unused variable.
-Fri Jul 22 19:05:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_x509store.c (ossl_x509store_initialize): should
+ set @time to avoid warning.
- * parse.y (rb_enc_symname2_p): get rid of potential out-of-bound
- access.
+ * ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths,
+ X509_STORE_add_cert, X509_STORE_add_crl): should raise error if
+ wrapped functions failed.
-Fri Jul 22 13:55:59 2011 Eric Hodel <drbrain@segment7.net>
+ * test/openssl/test_x509store.rb: add test for errors.
- * lib/net/http.rb: Net::HTTP#finish is used to manually close
- connections. [Ruby 1.9 - Bug #5045]
+Fri Sep 9 22:13:19 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Jul 22 13:51:29 2011 Eric Hodel <drbrain@segment7.net>
+ * eval.c (rb_call0): prohibit calling tainted method (>2) when
+ $SAFE == 0.
- * ext/readline/readline.c: Add examples for Readline.completion_proc=.
- [Ruby 1.9 - Bug #5057]
+Fri Sep 9 16:45:25 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 22 13:20:33 2011 Eric Hodel <drbrain@segment7.net>
+ * string.c (rb_str_times): make empty strings to keep taintness,
+ and a little improvement. [ruby-dev:26900]
- * tool/rbinstall.rb (default gems): Install executables into the fake
- gem dir for Gem.bin_path. [Ruby 1.9 - Bug #4485]
+ * ext/iconv/iconv.c (iconv_try), ext/iconv/extconf.rb: get rid of meta
+ characters in command line option. fixed: [ruby-talk:155369]
-Fri Jul 22 13:03:12 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Sep 8 14:58:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * backport r32609 from trunk.
+ * merged a patch from Takahiro Kambe <taca at back-street.net> to
+ support DragonFly BSD. [ruby-dev:26984]
- * ext/openssl/ossl_hmac.c: Revert checking return type of
- HMAC_Init_ex as it is not compatible with OpenSSL < 1.0.0.
+Wed Sep 7 12:55:08 2005 Tanaka Akira <akr@m17n.org>
-Fri Jul 22 11:22:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/open-uri.rb: abolish mod === tempfile to avoid a problem
+ [ruby-dev:26967].
- * backport r32606 from trunk.
+Wed Sep 7 10:45:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_digest.c: Check return value of EVP_DigestInit_ex.
- * ext/openssl/ossl_hmac.c: Check return value of HMAC_Init_ex.
- Thanks, Jared Jennings, for the patch.
- [ Ruby 1.9 - Bug #4944 ] [ruby-core:37670]
+ * eval.c (rb_thread_switch): convert all exceptions to
+ SystemExit. fixed: [ruby-core:05724]
-Fri Jul 22 09:17:43 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * eval.c (rb_thread_terminated): show backtrace before propagate
+ exceptions to main thread.
- * backport r32604 from trunk.
+Wed Sep 7 08:35:04 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_engine.c: Avoid double free of ENGINE reference.
- * test/openssl/test_engine.rb: Add a test for it.
- Thanks to Ippei Obayashi for providing the patch.
- [ Ruby 1.9 - Bug #5062 ] [ruby-dev:44173]
+ * Makefile.in, configure.in (MINIOBJS): miniruby on HP-UX can not load
+ extension libraries.
-Fri Jul 22 06:39:34 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * bignum.c (bignew_1, bigadd): K&R style argument actually can't be
+ defined as char.
- * lib/csv.rb: Do not modify CSV.generate's argument [ruby-core:38356]
+ * missing/vsnprintf.c: ANSI compiler supports const keyword.
-Thu Jul 21 20:02:11 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/digest/sha2/extconf.rb: reject platforms which has inttypes.h
+ but no 64bit integer.
- * thread.c (set_trace_func, thread_set_trace_func_m): reset tracing
- state when set_trace_func hook is removed. This is workaround patch
- to force to reset tracing state that is broken by continuation call.
- a patch from James M. Lawrence. [Feature #4347] [ruby-core:34998]
+ * lib/mkmf.rb (what_type?): guesstimate type.
- * test/ruby/test_continuation.rb (class TestContinuation): add a test
- for above. a patch from James M. Lawrence.
+ * ext/etc/etc.c (setup_passwd), ext/etc/extconf.rb: pw_age might be
+ char*. fixed: [ruby-core:05470]
-Thu Jul 21 20:59:59 2011 Tanaka Akira <akr@fsij.org>
+Wed Sep 7 08:32:47 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/socket/ancdata.c (discard_cmsg): workaround for MacOS X Lion.
+ * object.c (rb_mod_cvar_get, rb_mod_cvar_set): document fix from
+ sheepman <sheepman@sheepman.sakura.ne.jp>; a bug in visibility
+ description. [ruby-dev:26965]
+ * sprintf.c (rb_f_sprintf): warn "too many argument" on verbose
+ mode (-v/-w); backported from 1.9. [ruby-dev:26963]
-Thu Jul 21 07:07:57 2011 Tanaka Akira <akr@fsij.org>
+Mon Sep 5 17:03:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * backport r32579, r32581, r32587 by akr and r32588 by kazu.
+ * lib/ostruct.rb: a patch from Florian Gross <florgro at gmail.com>
+ merged to allow recursive inspect (and to_s) for OpenStruct.
+ [ruby-core:05532]
- r32579:
+Mon Sep 5 07:01:12 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * io.c (rb_update_max_fd): new function.
+ * ext/openssl/openssl/lib/openssl/buffering.rb (Buffering#do_write):
+ should clear data from the buffer which already been output.
- * internal.h (rb_update_max_fd): declare rb_update_max_fd.
+Fri Sep 2 23:51:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (rb_thread_create_timer_thread): update max fd when
- timer thread pipe is created.
+ * lib: do not use __send__ to access private methods. [ruby-dev:26935]
- r32581:
+Fri Sep 2 03:29:00 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
- * io.c (UPDATE_MAXFD): removed.
+ * lib/irb/init.rb: make IRB -I option that is same befavior for ruby.
+ [ruby-dev:26872], [ruby-dev: 26920]
- r32587:
+ * lib/irb/locale.rb: support to print help message when OS locale is
+ ja_JP.utf-8. [ruby-dev:26872]
- * include/ruby/intern.h (rb_update_max_fd): declaration moved from
- internal.h.
+Thu Sep 1 17:11:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c: ditto.
+ * eval.c (rb_call0): wrong condition for $SAFE restoration.
- * io.c: call rb_update_max_fd for each new fds.
+Thu Sep 1 14:12:45 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * process.c: ditto.
+ * ext/tk/lib/multi-tk.rb: On Tcl8.5, MultiTkIp#invoke_hidden doesn't
+ work (gives wrong order of arguments).
- * random.c: ditto.
+ * ext/tk/lib/multi-tk.rb: add MultiTkIp#invoke_hidden_on_namespace
+ to support '-namespace' option of 'interp invokehidden' command
+ on Tcl8.5.
- * ruby.c: ditto.
+Wed Aug 31 14:43:15 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/io/console/console.c: ditto.
+ * win32/Makefile.sub (OPTFLAGS): default global optimization to
+ disabled for all VC++ versions. fixed: [ruby-dev:26897]
- * ext/openssl/ossl_bio.c: ditto.
+Wed Aug 31 11:35:43 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/pty/pty.c: ditto.
+ * test/gdbm/test_gdbm.rb (teardown): should remove GDBM temporary
+ file.
- * ext/socket/init.c: ditto.
+Wed Aug 31 10:30:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/socket/socket.c: ditto.
+ * process.c (proc_detach, proc_setmaxgroups): missing argument type
+ declaration. (I recommend ANSI-style function)
- * ext/socket/ancdata.c: ditto.
+Tue Aug 30 23:20:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/unixsocket.c: ditto.
+ * eval.c (rb_rescue2): initialization miss. fixed: [ruby-dev:26917]
- r32588:
+ * lib/mkmf.rb (xsystem, xpopen): no longer expand by Config.
- * io.c (rb_update_max_fd): remove parentheses. they are not in
- macro.
+ * lib/mkmf.rb (link_command, cc_command, cpp_command): expand
+ variables at once, and quote hdrdir. fixed: [ruby-core:05680]
-Sun Jul 17 08:07:31 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/mkmf.rb (libpathflag): quote paths.
- * backport r32563 from trunk
+Tue Aug 30 19:34:27 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/openssl/test_ssl_session.rb: add PEM SSL session without TLS
- extensions. Use this as the default for the tests to ensure
- compatibility with OpenSSL 0.9.7.
- [ Ruby 1.9 - Bug #4961 ] [ruby-core:37726]
+ * ext/digest/md5/md5ossl.h, ext/digest/rmd160/rmd160ossl.h,
+ ext/digest/sha1/sha1ossl.h: include <stddef.h> to avoid
+ error in compilation with OpenSSL-0.9.8. [ruby-list:41068]
-Sat Jul 16 17:29:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 29 19:54:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * configure.in (RUBY_UNIVERSAL_ARCH): restore arch flag.
- Bug #4977
+ * lib/rdoc/usage.rb: improper exceptions. [ruby-dev:26870]
-Sat Jul 16 11:18:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/usage.rb: support the case when non-ruby code exists before
+ shebang. (this is needed when ri.bat is executed on windows)
- * win32/setup.mak: support to build x64-mswin64 on Windows7 (and Vista,
- perhaps).
- backported r32521 from trunk
+Mon Aug 29 17:48:17 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jul 16 06:31:23 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * eval.c (method_arity): should return proper arity value.
+ [ruby-dev:26390]
- * lib/uri/common.rb (module): Remove optional parser argument to
- Kernel#URI
- [ruby-core:38061]
+Mon Aug 29 01:19:57 2005 Tanaka Akira <akr@m17n.org>
- * lib/uri/generic.rb (module): ditto
+ * lib/time.rb (Time.parse): extract fractional seconds using
+ Date._parse. [ruby-talk:153859]
-Sat Jul 16 01:15:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Aug 27 20:20:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * time.c (time_dup): used rb_obj_class() instead of CLASS_OF().
- The patch is made by Kazuki Tsujimoto. [Bug #5012] [ruby-dev:44071]
+ * ext/curses/curses.c ({curses,window}_clrtoeol): added. suggested
+ by Reyn Vlietstra.
- * test/ruby/test_time.rb (TestTime#test_getlocal_dont_share_eigenclass):
- added a new test for eigenclass of time object.
+ * ext/curses/curses.c: chtype in curses is not `char', rahter `long'.
+ [ruby-Bugs:2298]
-Fri Jul 15 19:11:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/curses/view.rb: String =~ String is deprecated.
- * bignum.c (bigsub_int): add RB_GC_GUARD. This patch is made by
- Makoto Kishimoto. fixes #4223 [ruby-dev:42907]
+Wed Aug 24 10:53:28 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * bignum.c (bigadd_int): ditto.
+ * test/logger/test_logger.rb (test_shifting_size): should close log
+ device before unlink, since some platform cannot unlink opened
+ file.
-Fri Jul 15 09:59:12 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Sun Aug 21 00:13:27 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * backport r32546 from trunk.
+ * lib/wsdl/xmlSchema/importer.rb (WSDL::XMLSchema::Importer#fetch): add
+ a workaround for importing an WSDL whose path begins with drive
+ letter. [ruby-dev:26242]
- * ext/digest/sha2/sha2.c (SHA256_Update, SHA512_Update): avoid Bus
- Error caused by unalignment access on Sparc-Solaris (and possibly on
- other similar environment.) This patch just do memcpy always instead
- of checking architecture. I see no perf drop on my 64bit env. For
- more details, see #4320.
+Sat Aug 20 22:37:13 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * test/digest/test_digest.rb: add test for unalignment access.
+ * lib/logger.rb (write, shift_log?, shift_log): file shifting race
+ condition bug fixed. [ruby-dev:26764]
+ * test/logger/test_logger.rb: tests.
-Thu Jul 14 12:40:07 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Fri Aug 19 18:13:39 2005 Tanaka Akira <akr@m17n.org>
- * backport r32537 from trunk.
+ * lib/time.rb (Time.apply_offset): fix a problem with last day of
+ month. reported by Lucas Nussbaum. [ruby-talk:152866]
- * ext/openssl/ossl.c (ossl_verify_cb): trap the exception from
- verify callback of SSLContext and X509Store and make the
- verification fail normally. Raising exception directly from callback
- causes orphan resources in OpenSSL stack. Patched by Ippei Obayashi.
- See #4445.
+Thu Aug 18 12:46:28 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/openssl/test_ssl.rb
- (test_exception_in_verify_callback_is_ignored): test it.
+ * bcc32/Makefile.sub (COMMON_HEADERS): reverted 1.42.2.24.
+ I misunderstood, bccwin32 on ruby_1_8 uses winsock2 originally.
+ [ruby-dev:26806]
-Wed Jul 13 08:20:08 2011 Shota Fukumori <sorah@tubusu.net>
+ * win32/win32.h: include winsock2.h instead of winsock.h. (bcc32)
- * lib/test/unit.rb(Test::Unit::Options#process_args): Fix bug.
- Fix process_args didn't return `@option` after r30939. Backported
- r32526 from trunk.
+Wed Aug 17 23:58:05 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Jul 11 23:50:39 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+ * object.c (rb_to_integer): argument constified.
- * time.c: can't compile time.c on AIX due to missing declaration for
- ffs(). It is declared in strings.h on AIX. backported r32518 from
- trunk.
+ * eval.c (terminate_process): take String message.
-Mon Jul 11 23:47:00 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+ * eval.c (rb_thread_switch): propagate the exception caused thread
+ termination directly. fixed: [ruby-core:05552]
- * thread_pthread.c (get_stack): need to adjust stack addr for
- [Bug #1813] on AIX. backported r32511 from trunk.
+Wed Aug 17 00:05:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Jul 11 15:17:03 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (rb_add_method): preserve safe level in the environment
+ where a method is defined .
- * numeric.c (rb_num2ull): use FIX2LONG instead of FIX2ULONG. see
- rb_num2ulong(). fixed the problem of ObjectSpace._id2ref of IL32LLP64
- platforms, introduced at r32433.
- backported r32512 from trunk.
+ * eval.c (rb_call0): restore preserved safe level in the method
+ execution.
-Sun Jul 10 23:58:55 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+Mon Aug 15 00:38:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * version.h: 1.9.3 is no longer trunk.
+ * eval.c (rb_rescue2): reduce PUSH_TAG() as well as NODE_RESCUE.
+ [ruby-dev:26800]
-Sun Jul 10 23:24:29 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * range.c (range_check, range_init): reduce useless exceptions.
- * class.c (rb_mix_module): reverted r31873.
- (check_mix_method_i, do_mix_method_i) reverted r31917.
+Sat Aug 13 18:51:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_module.rb (TestModule#test_mix_const): reverted
- r31918.
+ * eval.c (rb_block_pass): distinguish current block from others.
+ fixed: [ruby-dev:26274]
-Sun Jul 10 22:50:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/stringio/stringio.c (strio_set_string): disallow nil.
+ http://www.rubyist.net/~nobu/t/20050811.html#c05
- * ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): fix
- precision treatment errors.
+Thu Aug 11 23:29:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb: add tests for the above change.
- fix precision treatment errors.
+ * ext/stringio/stringio.c: keep holding string after closed.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_power): precision argument
- should be optional for its compatibility.
+Thu Aug 11 13:01:48 2005 Kouhei Sutou <kou@cozmixng.org>
-Sun Jul 10 22:38:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rss: fixed sort bug. [ruby-list:41018]
- * parse.y (var_ref): distinguish vcall from local variable
- references. based on a patch by Michael Edgar michael.j.edgar
- AT dartmouth.edu. Bug #5002
+ * lib/rss/1.0.rb (RSS::RDF::Channel#setup_maker_attributes):
+ removed self.
-Sun Jul 10 21:51:29 2011 Koichi Sasada <ko1@atdot.net>
+ * lib/rss/maker/base.rb (RSS::Maker::ItemsBase#<=>): use #date
+ instead of @date.
+ (RSS::Maker::Base::self.def_array_element): added #size.
- * internal.h: add comments (cautions).
+ * lib/rss/maker/1.0.rb
+ (RSS::Maker::RSS10::Channel#to_rss,
+ RSS::Maker::RSS10::Items::Item#to_rss): cleared dc_dates set
+ upped by using #date.
-Sun Jul 10 20:59:38 2011 Shota Fukumori <sorah@tubusu.net>
+ * lib/rss/maker/dublincore.rb
+ (RSS::Maker::ChannelBase, RSS::Maker::ItemsBase::ItemBase):
+ fixed opposite alias.
- * lib/test/unit.rb: Add new class variable `@@testfile_prefix`.
- This is for changing test name prefix. (For testing)
+ * test/rss/test_setup_maker_1.0.rb
+ (RSS::TestSetupMaker10::test_setup_maker_items_sort): added some
+ tests for RSS::Maker::ItemsBase#do_sort.
- * test/testunit/tests_for_parallel/ptest_first.rb: Renamed from
- test_first.rb
+Wed Aug 10 10:29:40 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/testunit/tests_for_parallel/ptest_second.rb: Renamed from
- test_second.rb
+ * ext/tk/lib/tk.rb: fix bug on handling __ruby2val_optkeys().
- * test/testunit/tests_for_parallel/ptest_third.rb: Renamed from
- test_third.rb
+ * ext/tk/lib/tk/itemconfig.rb: fix bug on handling
+ __item_ruby2val_optkeys().
- * test/testunit/tests_for_parallel/ptest_forth.rb: Renamed from
- test_forth.rb
+ * ext/tk/lib/tk/canvas.rb: didn't check __item_ruby2val_optkeys().
- * test/testunit/tests_for_parallel/runner.rb: Remove misc.rb
+ * ext/tk/lib/tkextlib/blt/component.rb: ditto.
- * test/testunit/tests_for_parallel/ptest_first.rb: ditto.
+Tue Aug 9 15:12:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/testunit/tests_for_parallel/ptest_second.rb: ditto.
+ * ext/tcltklib/tcltklib.c: remove dangerous 'rb_jump_tag's.
- * test/testunit/tests_for_parallel/ptest_third.rb: ditto.
+ * ext/tk/lib/tk.rb: add __val2ruby_optkeys and __ruby2val_optkeys to
+ help to convert option values between ruby and tcl.
- * test/testunit/tests_for_parallel/ptest_forth.rb: ditto.
+ * ext/tk/lib/tk/itemconfig.rb: add __item_val2ruby_optkeys and
+ __item_ruby2val_optkeys to help to convert option values between
+ ruby and tcl.
- * test/testunit/tests_for_parallel/misc.rb: Removed because no longer
- needed.
+ * ext/tk/lib/tk/radiobutton.rb: use __ruby2val_optkeys for 'variable'
+ option (for the reason of backward compatibility).
- * test/testunit/test_parallel.rb: Fix assertions for above.
+ * ext/tk/lib/tk/composite.rb: clarify the arguments of super().
-Sun Jul 10 16:57:08 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/lib/tk/spinbox.rb: ditto.
- * vm_insnhelper.c (vm_throw): check a class frame.
- Fixes Bug #4648.
- The patch is contributed by Kazuki Tsujimoto.
+ * ext/tk/lib/tk/text.rb: ditto.
- * bootstraptest/test_proc.rb: add tests for above.
+ * ext/tk/lib/tk/validation.rb: ditto.
-Sun Jul 10 17:28:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tkextlib/*: support to treat tkvariable-type
+ configure options.
- * thread_pthread.c (mutex_debug): use exit(EXIT_FAILURE) instad of
- exit(1).
- * thread_pthread.c (add_signal_thread_list): ditto.
- * thread.c (rb_thread_call_with_gvl): ditto.
- * util.c (Bug): ditto.
+Tue Aug 9 20:30:19 2005 Tadashi Saito <shiba@mail2.accsnet.ne.jp>
-Sun Jul 10 15:58:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * bignum.c (rb_big_coerce): allow bignum x bignum coercing.
+ [ruby-dev:26778]
- * ext/json: Merge json gem 1.5.4+ (f7f78896607b6f6226cd).
- [Bug #4700]
+Mon Aug 8 20:43:02 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sun Jul 10 16:41:32 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/ruby/test_method.rb: added. [ruby-dev:26761]
- * vm_core.h (typedef struct rb_vm_struct): create a new
- 'inhibit_thread_creation' field.
- * thread.c (rb_thread_terminate_all): set inhibit_thread_creation.
- * thread.c (thread_s_new): don't permit to create new thread
- if the VM is under destruction. Otherwise evil finalizer code
- can make SEGV. [Bug #4992][ruby-core:37858]
+Sun Aug 7 23:50:14 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * bootstraptest/test_objectspace.rb: new test for this fix.
+ * test/ruby/test_super.rb: added from HEAD. [ruby-dev:26743]
-Sun Jul 10 16:06:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Aug 7 01:31:15 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * signal.c (sigsegv): use abort() instead of exit() when nested
- SEGV was happen. Because unnested SEGV use abort().
- [Bug #5013][ruby-dev:44078]
+ * ext/win32ole/win32ole.c (WIN32OLE_EVENT#on_event): should set
+ only one event handler.
-Sun Jul 10 15:30:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/win32ole/tests/testOLEEVENT.rb: ditto.
- * load.c (rb_f_autoload): prevent to autoload for singleton
- classes. fixes [Bug #4886] [ruby-dev:43816]
+ * ext/win32ole/tests/testOLEPARAM.rb: remove re-defined
+ test_ole_type_detail method.
- * bootstraptest/test_autoload.rb: add tests for the above change.
+Sat Aug 6 12:35:24 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun Jul 10 15:09:17 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/tk/lib/{tk.rb,tk/itemconfig.rb}: configure creates
+ TkVariable if key name is 'variable' or 'textvariable'
+ by default. [ruby-dev:26749]
- * lib/test/unit/assertions.rb: Import documentation patch by Justin
- Collins. [ruby-core:37225] [Feature #4903]
+ * ext/tk/lib/tk/{label,radiobutton}.rb: removed its own
+ {variable,textvariable} function.
-Sun Jul 10 14:57:36 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/tk/variable.rb: retains backward conpatibility.
- * ext/date/date_core.c: canonicalizes nth and sf.
+Fri Aug 5 12:50:32 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Jul 10 14:13:50 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tcltklib/tcltklib.c: fixed memory leak when tk_funcall raised
+ exception. (copies argv into heap in tk_funcall instead of
+ caller)
- * internal.h (rb_thread_call_with_gvl, rb_thread_call_without_gvl):
- make them visible as experimental C APIs. fixes Feature #4328.
+Fri Aug 5 12:42:57 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Jul 10 12:18:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/mkmf.rb (create_makefile): need to convert path separetor
+ before invoking install command.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_power): support non-integral
- exponent. fixes [Bug #3271]
+Fri Aug 5 00:27:04 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): ditto.
+ * ext/tcltklib/tcltklib.c: refactoring - extract ruby string <->
+ tcl object conversion as get_str_from_obj and get_obj_from_str.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_power_op): add a function to
- only use for "**" operator.
+Fri Aug 5 00:19:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb: add a bunch of tests for the
- above changes.
+ * extmk.rb (extmake): needs to be wrapped in an Array.
- * ext/bigdecimal/bigdecimal.c (is_integer): add an utility function.
+Thu Aug 4 18:38:36 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/bigdecimal/bigdecimal.c (is_negative): ditto.
+ * ext/tcltklib/tcltklib.c: cannot compile for Tcl7.6/Tk4.2.
- * ext/bigdecimal/bigdecimal.c (is_positive): ditto.
+ * ext/tcltklib/tcltklib.c: add nativethread consistency check.
- * ext/bigdecimal/bigdecimal.c (is_zero): ditto.
+ * ext/tcltklib/stubs.c: ditto.
- * ext/bigdecimal/bigdecimal.c (is_one): ditto.
+ * ext/tk/lib/tk.rb: forgot to define TclTkIp.encoding and encoding=
+ when Tcl is 7.6 or 8.0.
- * ext/bigdecimal/bigdecimal.c (is_even): ditto.
+ * ext/tk/lib/tk/wm.rb: support to make some methods as options of
+ root or toplevel widget. [ruby-talk:150336]
-Sun Jul 10 12:08:39 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/tk/lib/tk/root.rb: ditto.
- * compile.c (when_vals): when a string literal is written on when
- clause, skip string creation to make it faster. [ruby-dev:44068]
- [Feature #5000]
+ * ext/tk/lib/tk/toplevel.rb: ditto.
-Sun Jul 10 11:35:29 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/tk/lib/tkextlib/SUPPRT_STATUS: update RELEASE_DATE
- * parse.y (reduce_nodes_gen): NODE_RETURN in rescue body must not be
- reduced when there is an else clause. This caused bizarre behavior
- in [Bug #4473] [ruby-core:35629] [ruby-core:37884].
+Thu Aug 4 08:03:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Jul 10 09:46:14 2011 Masaya Tarui <tarui@ruby-lnag.org>
+ * ext/extmk.rb (extmake): should not modify $mflags for each
+ extentions.
- * range.c (range_max): fix behavior with excluded end value.
- [Bug #4591]
+Thu Aug 4 00:25:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Jul 10 09:13:18 2011 Eric Hodel <drbrain@segment7.net>
+ * common.mk, Makefile.in, {bcc32,win32,wince}/Makefile.sub: integrated
+ macro definitions.
- * NEWS: Fix RubyGems version. [Ruby 1.9 - Bug #5004]
+ * bcc32/Makefile.sub: LIBRUBY_SO should use DLDOBJS, not EXTOBJS.
-Sat Jul 9 20:01:59 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * {win32,wince}/Makefile.sub: separate config.h for compiler versions.
- * internal.h: rb_rational_reciprocal is defined in rational.c.
+Wed Aug 3 21:59:16 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Jul 9 19:48:31 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/tk/variable.rb: TkVariable#trace didn't work on
+ TkVariable retrived from TkVariable.new_hash.ref. [ruby-dev:26721]
- * internal.h: added declarations.
- * complex.c: followed the above change.
+Wed Aug 3 08:22:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jul 9 17:24:41 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/socket/socket.c (ruby_connect): revert [ruby-talk:111654]
+ changes at 2004-09-07. [ruby-dev:26656]
- * NEWS: bigdecimal is not a builtin.
+Tue Aug 2 10:20:54 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Jul 9 17:17:53 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tcltklib/tcltklib.c: use Tcl_[GS]etVar2Ex instead of
+ Tcl_Obj[GS]etVar2. (avoid Tcl_NewStringObj on supported platforms)
- * ext/date/date_core.c: some improvements for performance.
+ * ext/tcltklib/tcltklib.c: use ip_{get,set,unset}_variable2_core from
+ ip_{get,set,unset}_variable.
-Sat Jul 9 16:56:01 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c: replaced Tcl_Panic with rb_bug.
- * atomic.h (ATOMIC_OR): _InterlockedOr is unavailable in VC6.
+Tue Aug 2 01:41:28 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * numeric.c (ULLONG_MAX): fallback definition.
+ * lib/ping.rb (Ping.pingecho): should rescue StandardError.
+ [ruby-dev:26677]
-Sat Jul 9 15:59:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 1 19:09:41 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * win32/win32.c (rb_w32_{read,write}): should be signed.
- Bug #5001
+ * ext/tcltklib/tcltklib.c: refactoring - replaced rb_ivar_defined &
+ rb_ivar_get with single rb_attr_get call.
-Sat Jul 9 14:02:20 2011 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
+Mon Aug 1 18:45:07 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/cgi/core.rb: fix multipart form parsing bug. [Bug #3866]
+ * ext/tcltklib/tcltklib.c (Tcl_GetStringResult): refactoring - define
+ alternative macro on Tcl7.x or earlier.
-Sat Jul 9 11:41:03 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Mon Aug 1 13:57:35 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/matrix.rb: Add Vector#normalize [ruby-dev:43829]
+ * ext/tcltklib/tcltklib.c (deleted_ip): refactoring - interpreter
+ deletion check. [ruby-dev:26664]
-Sat Jul 9 09:25:06 2011 Eric Hodel <drbrain@segment7.net>
+Mon Aug 1 01:17:40 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * enumerator.c: Remove "enumeration sequenced by".
- [Ruby 1.9 - Bug #4757]
+ * lib/drb/drb.rb (check_insecure_method): use private_methods and
+ protected_methods instead of respond_to? to check method visibility.
+ [ruby-dev:26616]
-Sat Jul 9 09:14:56 2011 Eric Hodel <drbrain@segment7.net>
+ * test/drb/drbtest.rb: ditto.
- * io.c: Note that methods other than IO#gets may increase IO#lineno.
- [Ruby 1.9 - Bug #4902]
+ * test/drb/ut_drb.rb: ditto.
-Sat Jul 9 08:39:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 1 00:07:32 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
+ * lib/irb/context.rb: fix `irb --readline` option. [ruby-list:40955]
- * common.mk (RUN_OPT): disable gems.
+Fri Jul 29 09:59:38 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jul 9 08:37:05 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_yield_0): push yielded node instead of yielding.
+ fixed: [yarv-dev:549]
- * io.c (rb_io_close): close(2) on a fd which is being read by
- another thread causes deadlock on Mac OS X 10.5
+Thu Jul 28 18:09:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Jul 8 21:20:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tcltklib/stubs.c: When --enable-tcltk-stubs, the initialize
+ routine creates a Tcl/Tk interpreter and deletes it. However,
+ init cost of Tk's MainWindow is not so small. And that makes it
+ impossible to use libraries written with Tcl functions only on
+ an environment without a graphical display. This changes support
+ delaying initalization of Tk_Stubs until the script needs Tk.
- * addr2line.c: use USE_ELF instead of __ELF__ because Solaris
- doesn't define it. USE_ELF is already provided by configure.
- patched by Naohisa Goto. [ruby-dev:44066] [Bug #4998]
+ * ext/tcltklib/stubs.h: New file. Define prototypes and return
+ codes of functions on stubs.c.
- * addr2line.h: ditto.
+ * ext/tcltklib/tcltklib.c: Support delaying initalization of
+ Tk_Stubs until the script needs Tk.
- * vm_dump.c: ditto.
+ * ext/tcltklib/tcltklib.c: Show friendly error messages for errors
+ on initialization.
-Fri Jul 8 16:40:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c: Avoid SEGV on ip_finalize() when ruby is
+ exiting and $DEBUG is true. (Not fix. If you know the reason of
+ why, please fix it.)
- * ext/json/parser/parser.rl (convert_encoding): should not modify
- the argument.
+ * ext/tk/tkutil.c (ary2list, ary2list2): bug fix on handling of
+ encoding.
- * ext/json/parser/parser.rl (convert_encoding): no needs to use
- force_encoding.
+ * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
+ don't work propery.
-Fri Jul 8 15:53:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk.rb: Forget extending Tk::Encoding module to Tk.
+ * ext/tk/lib/tk/variable.rb: TkVarAccess fails to initialize the
+ object for an element of a Tcl's array variable.
- * error.c (rb_bug): get rid of segfault after all threads
- disposed.
+Wed Jul 27 23:23:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Jul 8 15:01:06 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * gc.c (obj_free): make message format consistent with one from
+ gc_mark(). [ruby-talk:149668]
- * ext/openssl/ossl.h: include openssl/e_os2.h before checking the
- definition of OPENSSL_SYS_WIN32.
+Wed Jul 27 22:11:37 2005 Kouhei Sutou <kou@cozmixng.org>
-Fri Jul 8 14:40:39 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * sample/rss/tdiary_plugin: removed. because the plugin
+ is imported in the tDiary plugin packages.
- * win32/win32.c (wunlink): reverted a part of r32426. it was mistakenly
- mixed.
+Wed Jul 27 10:59:02 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Jul 8 14:29:47 2011 Narihiro Nakamura <authornari@gmail.com>
+ * dir.c (dir_each): rewinddir(3) before iteration.
+ [ruby-talk:149628]
- * configure.in: can't subtract void *.
+Tue Jul 26 12:57:49 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Jul 8 14:33:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/openssl_missin.c: include <openssl/engine.h> before
+ <openssl/x509_vfy.h> to avoid compilation error of mswin32.
+ suggested by NAKAMURA Usaku.
- * win32/Makefile.sub (config.h): define GC_MARK_STACKFRAME_WORD.
- fixed build problem of r32438. the value (30) is temporary value.
- maybe it's enough by 20~24 according to my observation.
+Mon Jul 25 21:30:46 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 8 13:47:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * {bcc32,win32,wince}/Makefile.sub: moved CPPFLAGS only for ruby
+ source to XCFLAGS.
- * thread.c (rb_mutex_unlock_all): folded into
- rb_threadptr_unlock_all_locking_mutexes.
- * thread.c (rb_threadptr_unlock_all_locking_mutexes) ditto.
+Mon Jul 25 13:45:18 2005 NAJIMA Hiroki <najima@mickey.ai.kyutech.ac.jp>
-Fri Jul 8 13:36:02 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c: check HAVE_SYS_IOCTL_H before including the header.
+ [ruby-dev:26610]
- * thread.c (thread_unlock_all_locking_mutexes): rename to
- rb_threadptr_unlock_all_locking_mutexes and remove static.
- * vm_core.h: add rb_threadptr_unlock_all_locking_mutexes declaration.
- * thread.c (thread_start_func_2): adjust the above rename.
+Mon Jul 25 14:10:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * eval.c (ruby_cleanup): call rb_threadptr_unlock_all_locking_mutexes
- again after finalizer. [Bug #4988] [ruby-dev:44049]
+ * ext/tk/lib/multi-tk.rb: fix en-bugged part in the last commit.
-Fri Jul 8 13:06:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Jul 23 16:49:04 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * cont.c (FIBER_MACHINE_STACK_ALLOCATION_SIZE): Fiber stack size
- don't need to keep multiple number of sizeof(VALUE).
+ * ext/openssl/ossl_engine.c (ossl_engine_s_load): should check
+ OPENSSL_NO_STATIC_ENGINE.
-Fri Jul 8 11:39:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 22 21:06:08 2005 Tadashi Saito <shiba@mail2.accsnet.ne.jp>
- * common.mk (sudo-precheck): true command is not standard on
- Windows.
+ * bignum.c (rb_big_eq): reduce isnan(). [ruby-dev:26600]
-Fri Jul 8 10:39:52 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * numeric.c (flo_eq, flo_gt, flo_ge, flo_lt, flo_le): ditto.
- * thread_pthread.c (gvl_destroy): fix cond_t leak.
+Fri Jul 22 15:02:39 2005 Kouhei Sutou <kou@cozmixng.org>
-Fri Jul 8 09:17:59 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rss/rss.rb: moved copyright description to lib/rss.rb.
- * gc.c: Improve documentation
+ * lib/rss.rb: added for convenience.
-Thu Jul 7 23:35:31 2011 Narihiro Nakamura <authornari@gmail.com>
+ * sample/rss/re_read.rb: added #to_s sample.
- * gc.c: change water_mark value that may call
- gc_mark(lev <= GC_LEVEL_MAX) in gc_mark().
- In ruby_stack_check(), water_mark is a value that may call some
- C function. Fixes Bug #3781
+ * sample/rss/blend.rb: use 'require "rss"' instead of
+ 'require "rss/*"'.
+ * sample/rss/list_description.rb: ditto.
+ * sample/rss/rss_recent.rb: ditto.
+ * sample/rss/tdiary-plugin/rss-recent.rb: ditto.
- * configure.in: define GC_MARK_STACKFRAME_WORD that approximate
- size of gc_mark() and gc_mark_children() stackframes.
+ * sample/rss/tdiary-plugin/rss-recent.rb: 0.0.6 -> 0.0.7.
-Thu Jul 7 17:55:05 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Jul 22 14:37:43 2005 Kouhei Sutou <kou@cozmixng.org>
- * test/testunit/test_parallel.rb (TestParallelWorker#teardown): wait
- the child process even if the communication pipe is broken.
+ * lib/rss/parser.rb (RSS::Parser#initialize): accept HTTP/FTP
+ URI and local file path too.
-Thu Jul 7 15:44:42 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rss/test_parser.rb (RSS::TestParser#test_parse): test
+ for the above.
- * encoding.c (rb_enc_set_index, rb_enc_associate_index): should
- check if frozen.
+Fri Jul 22 07:01:42 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * parse.y (rb_intern3), ruby.c (process_options, ruby_script):
- defer freezing after associating encodings.
+ * ext/tk/tkutil.c (tk_conv_args): forget to revert thread_critical
+ and gc_disable when raise ArgumentError.
-Thu Jul 7 15:16:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/remote-tk.rb: RemoteTkIp doesn't need to include TkUtil.
- * numeric.c (rb_num2ull): use own switch sentence.
- Current implementation can't convert 18446744073709551615.
+ * ext/tcltklib/tcltklib.c: add TclTkIp#has_mainwindow? method.
-Thu Jul 7 06:56:15 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk.rb: add Tk.has_mainwindow? method.
- * cont.c (FIBER_STACK_FLAGS): workaround fix for r32420 on FreeBSD.
+ * ext/tk/lib/multi-tk.rb: add MultiTkIp#has_mainwindow? method.
-Thu Jul 7 06:46:12 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/remote-tk.rb: add RemoteTkIp#has_mainwindow? method.
- * benchmark/driver.rb: Add difference column to report that averages
- across all runs of a benchmark. [Ruby 1.9 - Feature #4982]
+ * ext/tk/lib/multi-tk.rb: slave IP fail to exit itself when $SAFE==4.
-Thu Jul 7 06:19:38 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/multi-tk.rb: remove constants from MultiTkIp module to
+ avoid access from external.
- * lib/rubygems.rb: Reduce requires to improve `make benchmark`.
- [#4962]
- * lib/rubygems/specification.rb: Delay initialization of rubygems
- until require is called.
+ * ext/tk/lib/multi-tk.rb: check_root flag is ignored on slave IPs'
+ mainloop.
-Thu Jul 7 04:31:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: hang-up Tk.mainloop called on a slave IP
+ with $SAFE==4.
- * parse.y (arg): rescue_mod is in inverse order from other
- modifiers. patched by michael.j.edgar AT dartmouth.edu at
- [ruby-core:36248]. fixed #4716.
+ * ext/tk/lib/multi-tk.rb: MultiTkIp#bg_eval_proc doesn't work
+ properly.
-Thu Jul 7 00:40:16 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: add MultiTkIp#set_cb_error(proc) and
+ cb_error(exc) to log errors at callbacks on safe slave IPs.
- * win32/win32.c (kill): check that the process exited or not before
- terminating it. [Bug #4943]
+ * ext/tk/lib/multi-tk.rb: fail to get an available slave IP object
+ when call Tk.mainloop in the block which is given to new_* method,
+ because cannot finish initialize while the root widget is alive.
-Wed Jul 6 23:13:19 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: fail to control a slave IP when Tk.mainloop
+ runs on the IP.
- * parse.y (opt_call_args): allow trailing comma after assoc
- argument e.g. 'foo(bar:1,)'. fixed #3456
+Wed Jul 20 19:20:37 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Jul 6 22:11:12 2011 Shota Fukumori <sorah@tubusu.net>
+ * io.c (S_ISREG): need to define S_ISREG before it is used first.
- * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Validate date in
- "Date:" header
+Wed Jul 20 18:40:50 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Jul 6 21:29:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c (wsplit_p): patch for the environment where
+ fcntl(F_GETFL, O_NONBLOCK) is not supported. in that case,
+ set FMODE_WSPLIT without fcntl check. [ruby-dev:26566]
- * cont.c (fiber_machine_stack_alloc): cleanup pointer arithmetic.
- "size/sizeof(VALUE)" is ugly and easy confusing.
- * cont.c (fiber_initialize_machine_stack_context): ditto.
+Wed Jul 20 18:07:11 2005 Tanaka Akira <akr@m17n.org>
-Wed Jul 6 21:24:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c (rb_io_ctl): update FMODE_WSPLIT_INITIALIZED and FMODE_WSPLIT
+ by F_SETFL.
- * cont.c (fiber_machine_stack_alloc): fix mprotect misuse. A stack
- guard page should have PROT_NONE.
- * cont.c (fiber_initialize_machine_stack_context):
- th->machine_stack_maxsize shouldn't be included guard pages size.
- [Bug #4983][ruby-dev:44043]
+Wed Jul 20 10:04:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jul 6 21:23:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * variable.c (rb_class_path): need to adjust snprintf() len for
+ teminating NUL. [ruby-dev:26581]
- * cont.c (fiber_machine_stack_alloc): use MAP_STACK if it's provided.
+Wed Jul 20 04:01:55 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Jul 6 21:22:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/socket/socket.c: sorry, BeOS also uses HAVE_CLOSESOCKET,
+ so reverted.
- * cont.c (fiber_machine_stack_alloc): use MAP_FAILED instead of -1.
+ * ext/socket/extconf.rb: should not define HAVE_CLOSESOCKET
+ on windows.
-Wed Jul 6 21:21:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Jul 20 03:16:43 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * cont.c (fiber_machine_stack_alloc): remove unnecessary cast.
+ * ext/socket/socket.c: should not undef close() on win32.
+ it's defined to rb_w32_close(), otherwise handle leaks.
+ [ruby-Bugs-2131]
-Wed Jul 6 18:10:13 2011 Shota Fukumori <sorah@tubusu.net>
+Wed Jul 20 00:48:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Adding space after
- comma.
+ * error.c (syserr_initialize): don't use str before StringValue()
+ check. [ruby-dev:26579]
- * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Remove variable
- `now`. Suppress warning.
+Tue Jul 19 22:47:29 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jul 6 12:18:09 2011 Shota Fukumori <sorah@tubusu.net>
+ * error.c (syserr_initialize): add 1 byte for snprintf() size for
+ NUL at the end. [ruby-dev:26574]
- * test/cgi/test_cgi_header.rb(test_cgi_header_nph): Fix bug depends to
- time. The test fails if time past 1 second in line 136-145
+Tue Jul 19 16:39:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Jul 5 15:28:04 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_io_inspect): replace sprintf() with "%s" format all
+ over the place by snprintf() to avoid integer overflow.
- * parse.y (parser_here_document): should dispatch heredoc_end
- scanner event on an empty here document. fixed Bug#4543.
+Tue Jul 19 14:08:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Tue Jul 5 13:49:26 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/tcltklib/tcltklib.c: rbtk_eventloop_depth is used as int.
- * addr2line.c: fix r32407 to check HAVE_ALLOCA_H.
+ * ext/tcltklib/tcltklib.c: rbtk_pending_exception is tested with
+ NIL_P, so should assign Qnil instead of 0 (Qfalse).
-Tue Jul 5 14:05:43 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c (ip_invoke_real): fixed memory leak when
+ ip is deleted.
- * lib/webrick/httpauth/digestauth.rb (_authenticate):
- Literal texts in HTTP ABNF is case-insensitive (RFC2616 2.1),
- and a sample implementation in RFC2617 also ignores the case
- of algorithms. So now this ignores those cases.
- [ruby-dev:43965] [Feature #4936]
+Tue Jul 19 13:19:46 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/webrick/httpauth/digestauth.rb (initialize):
- Because of above, opera_hack is useless and removed.
+ * ext/tk/lib/tk/variable.rb: For symmetry, add TkVariable#string. It
+ returns a string even if the default value type of the TkVariable
+ object is not "string".
-Tue Jul 5 01:30:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Mon Jul 18 21:40:20 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * thread_pthread.c (native_sleep): cut the waiting time up to
- 100,000,000 because Solaris cond_timedwait() return EINVAL if an
- argument is greater than current_time + 100,000,000. This is
- considered as a kind of spurious wakeup. The caller to native_sleep
- should care about spurious wakeup.
+ * eval.c (rb_call0): make the pointer to NODE volatile
+ instead of NODE itself.
-Tue Jul 5 01:24:26 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Mon Jul 18 14:32:21 2005 Tanaka Akira <akr@m17n.org>
- * cont.c: disable FIBER_USE_NATIVE on Solaris because resuming any
- Fiber caused SEGV. I haven't follow up the issue deeply, but it
- works when disabling the feature.
+ * eval.c (rb_call0): make body volatile to avoid optimization problem.
+ [ruby-dev:26195]
-Tue Jul 5 01:22:46 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Mon Jul 18 12:23:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * addr2line.c: include <alloca.h> to fix a build issue on Solaris.
+ * ext/io/wait/wait.c: wrong backport from trunk. fixed: [ruby-dev:26562]
-Tue Jul 5 00:49:05 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Jul 18 09:36:25 2005 Tanaka Akira <akr@m17n.org>
- * ext/coverage/coverage.c: resurrect r32071 + add GC guard for
- rb_coverages. [ruby-core:37352] [Bug #4927]
- [ruby-core:36539] [Feature #4796]
+ * rubyio.h (FMODE_WSPLIT, FMODE_WSPLIT_INITIALIZED): new constant.
- * test/coverage/test_coverage.rb resurrect r32071.
+ * io.c (wsplit_p): new function.
+ (io_fwrite): split writing data by PIPE_BUF if wsplit_p is true in
+ multi-threaded mode.
+ [ruby-dev:26540]
-Mon Jul 4 22:24:46 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Jul 17 13:46:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (get_stack): For NetBSD/FreeBSD, use
- pthread_attr_getstack() if possible. and, remove an assumption
- of stack growing direction.
+ * ext/io/wait/extconf.rb, ext/io/wait/wait.c: Win32 platforms support.
-Mon Jul 4 20:42:31 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Fri Jul 15 23:59:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/coverage/coverage.c: revert r32071. The commit caused SEGV on
- some minor nonfree OS. I have no means of debugging the bug. My
- personal opinion is that such OS should be unsupported unless there
- is an active maintainer. [ruby-core:37352]
+ * lib/rdoc/parsers/parse_c.rb (handle_class_module): handle a
+ module enclosed in a built-in module. fixed: [ruby-talk:148239]
- * test/coverage/test_coverage.rb: ditto.
+ * lib/rdoc/parsers/parse_c.rb (find_body): allow macros as methods.
-Mon Jul 4 07:14:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/rdoc/parsers/parse_c.rb (find_call_seq): allow :nodoc: modifier
+ in C. [ruby-core:04572]
- * thread_pthread.c (get_stack): the return address of get_stack
- must be the highest address of the current thread's stack.
+Fri Jul 15 18:00:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Jul 4 06:37:22 2011 Koichi Sasada <ko1@atdot.net>
+ * bcc32/Makefile.sub (COMMON_HEADERS): ruby_1_8 is using winsock.h.
+ failed to compile ext/socket on bcc5.6.4. [ruby-dev:26193]
- * include/ruby/intern.h, thread_pthread.c (rb_reserved_fd_p,
- RB_RESERVED_FD_P): added. This C API is to limit to access
- fds which are used by RubyVM internal. In this version of
- CRuby, return 1 if fd is communication pipe.
- If your application needs to close all file descriptors to
- present resource leak, skip internal fds using this C API.
- We also define a macro RB_RESERVED_FD_P(fd). So you can write
- #ifndef RB_RESERVED_FD_P
- #define RB_RESERVED_FD_P(fd) 0
- #endif
- for Ruby 1.9.2 or previous version to write compatible extensions.
- See [ruby-core:37727]
+Fri Jul 15 07:58:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * thread_win32.c (rb_reserved_fd_p): added (return 0 for any fds).
+ * lib/webrick/server.rb (WEBrick::GenericServer#accept_client):
+ sockets should be non-blocking mode. [ruby-dev:26405]
- * io.c (rb_io_initialize): raise ArgumentError if given fd is reserved by Ruby.
+ * lib/webrick/utils.rb (WEBrick::Utils.set_non_blocking): new method.
-Sun Jul 3 23:43:56 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#read_chunked):
+ should call sock.read repeatedly until the preferred size data
+ is obtained.
- * ext/extmk.rb (extmake): suppresses outputs from extconf.rb.
- (extmake) warns a failure in extconf.rb.
+Thu Jul 14 18:27:16 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Jul 3 13:44:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_strerror): should return correct message
+ for ENAMETOOLONG and ENOTEMPTY. (bcc32) [ruby-dev:26533]
- * array.c (ary_reject_bang): should not remove elements which are
- not yielded. [Bug #2545]
+ * win32/win32.c (rb_w32_strerror): stripped CR LF on the tail.
+ (bcc32) [ruby-dev:26533]
-Sun Jul 3 06:10:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Jul 14 00:45:42 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (get_stack): pthread_attr_getstack() doesn't
- return stack start address, but stack base address. Thus,
- we need to add stack size for getting stack start address.
- And, we don't have to decrease guard size twice.
- * thread_pthread.c (thread_start_func_1): don't use inaccurate
- stack start guess if native_thread_init_stack() can be used.
- [Bug #1813] [ruby-core:24540]
+ * LEGAL (ext/nkf/nkf-utf8): updated from nkf1.7 to nkf-utf8.
-Sun Jul 3 04:50:08 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Jul 13 19:37:47 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * thread_pthread.c (get_stack): add to a care of guard page on Mac
- OS X. [Bug #1813] [ruby-core:24540]
- * signal.c (ruby_signal): SIGBUS use alternative stack too.
- * signal.c (sigbus): On Mac, thread stack overflow makes SIGBUS
- instead of SIGSEGV. thus, added stackoverflow check.
- * signal.c (default_handler): get rid of compilation warning.
- * signal.c (Init_signal): ditto.
+ * win32/win32.c (rb_w32_mkdir): should set EEXIST (not EACCES)
+ if file or directory already exists. (bcc32) [ruby-dev:26508]
-Sat Jul 02 08:59:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * win32/win32.c (rb_w32_rmdir): should set ENOTDIR (not EINVAL)
+ if it is not directory. (bcc32, win32)
- * test/openssl/test_ocsp.rb
- * test/openssl/test_x509_cert.rb: Perform SHA-256 tests only if
- supported by the available OpenSSL version. Versions < 0.9.8 don't
- support it. [ruby-core:37724]
+ * win32/win32.c (rb_w32_rmdir, rb_w32_unlink): restore
+ FILE_ATTRIBUTE_READONLY flag on function failure.
-Sat Jul 2 07:17:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 13 12:40:00 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * array.c (rb_ary_reject_bang, rb_ary_delete_if): rejected
- elements should be removed. fixed [Bug #2545]
+ * ext/tcltklib/tcltklib.c: TclTkLib.do_one_event doesn't work.
-Sat Jul 2 01:57:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/tk/lib/tk.rb: Tk.thread_update is available.
- * NEWS: remove a description of Kernel#respond_to? because it has
- been reverted at revision 28564.
+Tue Jul 12 23:32:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jul 2 00:58:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/mkmf.rb: keep curdir unexpanded.
- * NEWS: describe a change of multiplication of Bignum.
+Mon Jul 11 08:31:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 1 18:52:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * regex.c (read_special): fix parsing backslashes following \c in
+ regexp. fixed: [ruby-dev:26500]
- * benchmark/bm_app_erb.rb: increase loop count. too short
- measurement time makes less accuracy.
- * benchmark/bm_app_factorial.rb: ditto.
- * benchmark/bm_app_mandelbrot.rb: ditto.
- * benchmark/bm_app_strconcat.rb: ditto.
+Mon Jul 11 02:53:00 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * benchmark/bm_io_file_create.rb: ditto.
- * benchmark/bm_io_file_read.rb: ditto.
- * benchmark/bm_io_file_write.rb: ditto.
+ * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
+ mistook in merging the patch of [ruby-dev:26235] at
+ revision 1.4.2.6.
- * benchmark/bm_so_concatenate.rb: ditto.
- * benchmark/bm_so_lists.rb: ditto.
- * benchmark/bm_so_matrix.rb: ditto.
- * benchmark/bm_so_random.rb: ditto.
- * benchmark/bm_so_sieve.rb: ditto.
+Sun Jul 10 23:58:04 2005 Tanaka Akira <akr@m17n.org>
- * benchmark/bm_vm_thread_mutex1.rb: ditto.
- * benchmark/bm_vm_thread_mutex2.rb: ditto.
- * benchmark/bm_vm_thread_mutex3.rb: ditto.
+ * lib/pathname.rb (Pathname#unlink): try Dir.unlink first to
+ avoid unlink a directory by root.
+ cf. [ruby-dev:26237]
- * benchmark/bm_vm1_block.rb: cleanup.
- * benchmark/bm_vm1_const.rb: cleanup.
- * benchmark/bm_vm1_ensure.rb: cleanup.
- * benchmark/bm_vm1_ivar.rb: cleanup.
- * benchmark/bm_vm1_length.rb: cleanup.
- * benchmark/bm_vm1_neq.rb: cleanup.
- * benchmark/bm_vm1_not.rb: cleanup.
- * benchmark/bm_vm1_rescue.rb: cleanup.
- * benchmark/bm_vm1_simplereturn.rb: cleanup.
- * benchmark/bm_vm1_swap.rb: cleanup.
+Sun Jul 11 05:18:17 2005 Michael Neumann <mneumann@ruby-lang.org>
- * benchmark/bm_vm2_array.rb: cleanup.
- * benchmark/bm_vm2_case.rb: cleanup.
- * benchmark/bm_vm2_defined_method.rb: cleanup.
- * benchmark/bm_vm2_eval.rb: cleanup.
- * benchmark/bm_vm2_method.rb: cleanup.
- * benchmark/bm_vm2_mutex.rb: cleanup.
- * benchmark/bm_vm2_poly_method.rb: cleanup.
- * benchmark/bm_vm2_poly_method_ov.rb: cleanup.
- * benchmark/bm_vm2_proc.rb: cleanup.
- * benchmark/bm_vm2_regexp.rb: cleanup.
- * benchmark/bm_vm2_send.rb: cleanup.
- * benchmark/bm_vm2_super.rb: cleanup.
- * benchmark/bm_vm2_unif1.rb: cleanup.
- * benchmark/bm_vm2_zsuper.rb: cleanup.
+ * lib/xmlrpc/server.rb (XMLRPC::Server): Switch from GServer over to
+ WEBrick. This makes file lib/xmlrpc/httpserver.rb obsolete (at least it is
+ no further used by the XML-RPC library).
- * benchmark/bm_vm_thread_alive_check1.rb: cleanup.
+Sun Jul 10 12:47:01 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 1 15:23:00 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * lib/debug.rb (debug_command): added a deficient format specifier.
+ fixed: [ruby-core:05419]
- * lib/matrix: Add LUP decomposition
+Sat Jul 9 21:28:46 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Fri Jul 1 15:21:14 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * ext/win32ole/win32ole.c (ole_method_dispid): convert dispid
+ in Ruby and C by INT2NUM and NUM2INT.
- * lib/matrix.rb: Allow non integer exponents for Matrix#**
+ * ext/win32ole/win32ole.c (ole_invoke2): ditto.
-Fri Jul 1 15:13:25 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * ext/win32ole/test/testWIN32OLE.rb: ditto.
- * lib/matrix: Add Eigenvalue Decomposition
+ * ext/win32ole/test/testOLEMETHOD.rb: ditto.
-Fri Jul 1 15:10:22 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Fri Jul 8 15:45:04 2005 Kouhei Sutou <kou@cozmixng.org>
- * lib/matrix: Add Matrix#round
+ * lib/rss/rss.rb (RSS::VERSION): 0.1.4 -> 0.1.5.
-Fri Jul 1 11:41:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/rss/test_version.rb (RSS::TestVersion#test_version):
+ ditto.
- * string.c (tr_trans): free heap ptr when the str is not embedded.
- patched by Eric Wong. [Bug #4956] [ruby-core:37708]
+ * lib/rss/0.9.rb (RSS::Rss::Channel::Item::Category):
+ domain attribute of <category> is optional. Thanks to
+ Chris Lee <clee@kde.org>.
-Fri Jul 1 11:07:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/rss/test_parser.rb (RSS::TestParser#test_category20):
+ adjusted test case.
- * thread.c (do_select): fix memory leak.
- Patch by Eric Wong. Thank you! [Bug #4953] [ruby-core:37702]
+Tue Jul 5 23:44:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 1 08:21:28 2011 Koichi Sasada <ko1@atdot.net>
+ * instruby.rb: expand source library path.
- * vm_insnhelper.c (vm_getivar): check vm state version
- to invalidate inline cache (ivar index).
- fixes Bug #4926.
+Tue Jul 5 23:27:14 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm_insnhelper.c (vm_setivar): ditto.
+ * array.c (sort_2): get rid of yet another bcc's bug.
+ fixed: [ruby-core:05152]
-Fri Jul 1 08:03:15 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_save_context): must not switch contexts during
+ re-allocating stack. fixed: [ruby-core:05219]
- * error.c, thread_pthread.c (WRITE_CONST): suppress warnings
- `ignoring return value'.
+Tue Jul 5 15:15:10 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Jul 1 06:41:36 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/tkutil.c: fix typo.
- * thread.c (rb_threadptr_check_signal): only wake up main thread.
+Tue Jul 5 14:51:35 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread.c (rb_threadptr_execute_interrupts_common): check signal
- delivery if it is main thread.
- fixes [ruby-dev:44005] [Ruby 1.9 - Bug #4950]
+ * ext/tcltklib/tcltklib.c: bug fix on treating Unicode strings.
- * bootstraptest/test_fork.rb: add a test for above.
+ * ext/tcltklib/tcltklib.c: add methods to treat encoding mode.
- * signal.c (rb_get_next_signal): skip if signal_buff is empty.
- (check signal_buff.size first)
+ * ext/tcltklib/MANUAL.eng: add description of TclTkLib#encoding,
+ encoding_system, and so on.
- * vm_core.h: remove unused variable rb_thread_t::exec_signal.
+ * ext/tcltklib/MANUAL.euc: ditto.
- * thread.c (rb_thread_check_trap_pending): check
- rb_signal_buff_size() because rb_thread_t::exec_signal
- is no longer available.
+ * ext/tk/tkutil.c: fail to create a Tcl's list string from an
+ array including multiple kind of encoded strings.
-Fri Jul 1 03:28:25 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/tk/lib/tk.rb: ditto.
- * class.c (Init_class_hierarchy): should name BasicObject
- explicitly.
+ * ext/tk/lib/multi-tk.rb: 2nd arg of _{to|from}UTF8 is omissible.
- * variable.c (rb_const_defined_0): should not check for
- superclasses as const_get.
+ * ext/tk/lib/remote-tk.rb: ditto.
-Fri Jul 1 03:24:03 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/tk.rb: override TclTkLib#encoding and encoding= to
+ use TkCore::INTERP.encoding and encoding=.
- * ext/date/date_core.c: mathn is still alive (should die soon).
+ * ext/tk/lib/tk.rb: when "require 'tk'" and $KCODE=='NONE', check
+ DEFAULT_TK_ENCODING to decide Ruby/Tk's system encoding mode.
-Thu Jun 30 23:50:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/tk/lib/tk/encodedstr.rb: check both of Tk.encoding and
+ Tk.encoding_system. Tk.encoding has higher priority.
- * misc/ruby-mode.el (ruby-indent-beg-re): Fix broken regular
- expression. Fixes #4546
+ * ext/tk/lib/tk/optiondb.rb: ditto.
-Thu Jun 30 23:43:30 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/tk/lib/tk/spinbox.rb: ditto.
- * ext/openssl/ossl.c/.h: Added ossl_x509_name_sk2ary.
- * ext/openssl/ossl.c: Replaced ossl_x509_ary2k by generic macro to
- simplify future conversions.
- * ext/openssl/ossl_ssl.c: Implement SSLSocket#client_ca.
- * test/openssl/test_ssl.rb: Add test for SSLSocket#client_ca.
- Thanks to Ippei Obayashi for providing the patch!
- [ Ruby 1.9 - Feature #4481 ] [ruby-core:35461]
+ * ext/tk/lib/tk/validation.rb: ditto.
-Thu Jun 30 22:38:58 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/lib/tk/namespace.rb: arguemnts for TclTkIp#_merge_tklist
+ should be UTF-8 strings.
- * benchmark/bm_vm2_defined_method.rb: added to measure performance of
- bmethod (method defined by define_method()).
+Mon Jul 4 14:35:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 30 22:17:04 2011 Koichi Sasada <ko1@atdot.net>
+ * sample/svr.rb: service can be stopped by ill-behaved client; use
+ tsvr.rb instead.
- * vm_insnhelper.c (vm_call_bmethod): fix to hook call/return event
- for methods defined by define_method(). fixes Bug #4613.
+Mon Jul 4 13:25:21 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread.c (call_trace_proc): Fix to skip if class is not given (0).
- Note that ID and Class object are passed for call/return event
- if the called method was defined by define_method().
- If you are author of tracer/profiler/debugger, this may be an
- important change. You should check passed class as zero or
- non-zero instead of checking the event type.
+ * missing/erf.c: original erf.c by prof. Okumura is confirmed to
+ be public domain. reverted BSD implementation.
- * test/ruby/test_settracefunc.rb: add a test for above.
+Mon Jul 4 11:15:37 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Jun 30 21:18:35 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+ * test/{dbm,gdbm,sdbm}/test_{dbm,gdbm,sdbm}.rb: skip some tests
+ which using fork on fork-less platforms.
- * configure.in: Add warnflags for XL/C on AIX during configure
- to avoid [Bug #3971]. See [ruby-core:32859]
+Sun Jul 3 23:26:30 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Jun 30 21:16:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * test/wsdl/document/test_rpc.rb: compare formatted time string of
+ Time objects instead of comparing Time objects itself to avoid
+ unintended conflict of usec part. [ruby-dev:26220]
- * ext/date/date_core.c (m_ajd): refers a constant.
+Sat Jul 2 22:41:04 2005 Tanaka Akira <akr@m17n.org>
-Thu Jun 30 20:54:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (unix_send_io, unix_recv_io): support x86-64 and
+ IA64.
- * ext/io/console/io-console.gemspec: spin-off gem for 1.9.2.
+Sat Jul 2 17:06:23 2005 Tanaka Akira <akr@m17n.org>
-Thu Jun 30 20:36:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * defines.h (FLUSH_REGISTER_WINDOWS): defined for IA64.
+ (flush_register_windows): declare flush_register_windows.
- * ext/date/date_core.c: trivial changes.
+ * eval.c (flush_register_windows): new function.
-Thu Jun 30 20:12:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 1 17:48:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_module.rb: tests for [Bug #3422] and [Bug #3423].
+ * bignum.c (get2comp): revert all prior changes, and calculate
+ proper 2's complement for negative numbers. backported from
+ HEAD.
-Thu Jun 30 20:03:39 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Fri Jul 1 15:50:12 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/date/date_core.c: modified doc.
+ * missing/erf.c: need to include some headers for some platforms.
-Thu Jun 30 19:09:19 2011 Koichi Sasada <ko1@atdot.net>
+ * win32/win32.h (copysign, scalb): define for compatibility with
+ other platforms. [ruby-dev:26430]
- * thread_pthread.c (thread_timer): ignore unknown errno.
- (we observed that select(2) was canceled by errno=514 on
- boron == Linux/Xen environment)
+Fri Jul 1 15:37:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 30 17:33:25 2011 Koichi Sasada <ko1@atdot.net>
+ * missing/crypt.c: modified to make it compilable on platforms
+ other than BSD. [ruby-dev:26430]
- * ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
- Fix rdoc. Fixes Bug #3892.
+ * missing/erf.c: ditto. code from <exp.c> merged.
- * ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
- Change key type if the klass of a object is zero (internal object).
- Read rdoc for details.
+Fri Jul 1 12:44:56 2005 Tanaka Akira <akr@m17n.org>
- * internal.h: export rb_objspace_data_type_name().
+ * lib/open-uri.rb (OpenURI.open_http): refine post_connection_check
+ call.
-Thu Jun 30 17:25:08 2011 Koichi Sasada <ko1@atdot.net>
+Fri Jul 1 11:34:08 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (ping_signal_thread_list, thread_timer):
- fix to keep polling state if there are any ping-tasks.
+ * missing/crypt.c: replaced with 4.4BSD version.
-Thu Jun 30 12:25:34 2011 Koichi Sasada <ko1@atdot.net>
+ * missing/erf.c: ditto.
- * thread_pthread.c (rb_thread_create_timer_thread): allocate
- machine stack for the timer thread at least 12KB. FreeBSD 8.2
- AMD64 causes machine stack overflow (SIGSEGV) only with
- PTHREAD_STACK_MIN (maybe defined as 2KB).
+ * missing/vsnprintf.c: removed the third provision from the old
+ BSD license. [ruby-core:05177]
-Thu Jun 30 09:36:37 2011 Eric Hodel <drbrain@segment7.net>
+Fri Jul 1 01:45:21 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/weakref.rb: Attach documentation to WeakRef and add missing
- documentation
+ * enum.c (enum_min, enum_max): must not return Qundef.
+ fixed: [ruby-core:05299]
-Thu Jun 30 09:30:14 2011 Eric Hodel <drbrain@segment7.net>
+Fri Jul 1 00:18:40 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/yaml.rb: Document toplevel YAML and YAML::ENGINE to describe
- Psych vs Syck engines.
+ * lib/delegate.rb (Delegator::respond_to): respond_to? must check
+ destination object. [ruby-talk:146894]
-Thu Jun 30 09:21:52 2011 Eric Hodel <drbrain@segment7.net>
+Thu Jun 30 19:00:21 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
+ * lib/irb/ruby-lex.rb (RubyLex::identify_number): alternative implements
+ for [ruby-dev:26410]. And support a numeric form of 0d99999.
- * lib/cmath.rb: Hide handle_no_method_error from RDoc.
- * error.c: Document or hide undocumented error classes.
+Thu Jun 30 17:28:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 30 07:49:04 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/irb/ruby-lex.rb (RubyLex::identify_number): should not treat
+ plain zero as an octal number. [ruby-dev:26410]
- * hash.c: Document ENV
+Thu Jun 30 15:13:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 30 06:37:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_eval): pre-evaluate argument for unambiguous
+ evaluation order. [ruby-dev:26383]
- * ruby.c (ruby_init_loadpath_safe): ensure RUBYLIB_PREFIX stored
- before RUBYLIB, even if MANGLED_PATH is enabled. fixed #1679.
- MANGLED_PATH is disabled by the default and will be removed
- completely in the future.
+Thu Jun 30 09:53:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 30 06:32:21 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/delegate.rb (Delegator::method_missing): forward unknown
+ method to the destination. suggested by
+ <christophe.poucet@gmail.com>. [ruby-talk:146776]
- * lib/drb/drb.rb: Hide deprecated toplevel DRb constants.
+Tue Jun 28 21:59:29 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Jun 30 06:17:02 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * dir.c, eval.c, hash.c, process.c, ruby.c: avoid warning "unused
+ variable" [ruby-dev:26387]
- * lib/cmath.rb (CMath.log): second argument: b can be nil.
+Sat Jun 25 17:15:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Thu Jun 30 06:23:28 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_query): should
+ discard if key=val pair is empty. patch from Gary Wright.
- * thread.c (ruby_thread_s_pass): Fix typo.
+Sat Jun 25 23:30:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 30 06:16:53 2011 Eric Hodel <drbrain@segment7.net>
+ * process.c (detach_process_watcher): terminate process watcher
+ thread right after rb_waitpid() succeed. [ruby-talk:146430]
- * lib/rdoc: Update to RDoc 3.8 which contains fixes for documentation
- in trunk.
+Sat Jun 25 15:49:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jun 30 02:53:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * enum.c (enum_min, enum_max): do not ignore nil as the first element.
- * thread.c (rb_threadptr_execute_interrupts_common): remove
- meaningless native_thread_yield(). It never close a race.
+Sat Jun 25 14:40:17 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Thu Jun 30 02:41:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/sdbm/init.c (fsdbm_select): SDBM#select had returned the array
+ which contained each elements twice. [ruby-dev:26358]
- * thread.c (rb_thread_schedule_limits): minor optimization.
- eliminate machine context saving when running time is enough small.
+Fri Jun 25 05:06:47 2005 Michael Neumann <mneumann@ruby-lang.org>
-Thu Jun 30 02:28:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/xmlrpc/*, test/xmlrpc/*: backported changes from HEAD into 1.8
- * thread.c (rb_thread_schedule_rec): move interrupt_flag check to
- rb_thread_schedule().
- And also rename to rb_thread_schedule_limits() and remove
- sched_depth argument. It's no longer called recursive.
- * thread.c (rb_thread_schedule): add to check interrupt_flag as
- above explained.
+Fri Jun 24 17:00:00 2005 Shigeo Kobayashi <shigeo@tinyforest.jp>
- * thread.c (rb_threadptr_execute_interrupts_rec): rename to
- rb_threadptr_execute_interrupts_common() and remove sched_depth
- argument. It's no longer called recursive.
+ * ext/bigdecimal/bigdecimal.c: patch from "NATORI Shin"
+ (u-tokyo.ac.jp) applied to fix rounding bug.
- * thread.c (rb_thread_sleep): adapt the renaming.
- * thread.c (rb_threadptr_execute_interrupts): ditto.
- * thread.c (rb_thread_execute_interrupts): ditto.
+Fri Jun 24 13:06:45 2005 akira yamada <akira@ruby-lang.org>
-Thu Jun 30 01:31:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/uri/common.rb, lib/uri/generic.rb: fixed typo in documents and
+ replaced some existent domain name with "example.com".
- * thread.c (thread_s_pass): change RDoc description and remove
- a sample code. The actual implementation never behave as explained by
- an example. It's a documentation bug.
+Fri Jun 24 12:23:19 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Jun 30 00:54:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk.rb: fix typo on Tk.grid_propagate.
- * thread.c (rb_thread_stop): change RDoc sample code. The old
- example is buggy and may cause deadlock. The patch is
- suggested by Heesob Park <phasis@gmail.com>. Thank you!
- [Bug #3606][ruby-core:31454]
+ * ext/tk/lib/tk.rb: Tk.event_generate and TkWindow#event_generate
+ accept TkEvent::Event object as context argument.
-Thu Jun 30 00:49:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/event.rb: add TkEvent::Event#valid_fields and
+ valid_for_generate to get field parameters of event_generate.
- * thread.c (rb_thread_wakeup): change RDoc sample code. The old
- example is buggy and may not display anything by a race.
- The patch is suggested by Heesob Park <phasis@gmail.com>.
- Thank you! [Bug #3606][ruby-core:31454]
+Thu Jun 23 23:55:59 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jun 30 00:43:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * runruby.rb: should load built rbconfig.rb.
- * thread.c (rb_thread_run): change RDoc. The old example is buggy
- and may cause deadlock. The patch is suggested by Heesob Park
- <phasis@gmail.com>. Thank you! [Bug #3606][ruby-core:31454]
+Thu Jun 23 16:53:15 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Jun 30 00:30:15 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * ext/tk/lib/tk/canvastag.rb: TkcGroup.new cannot include given items.
+ TkcGroup#exclude calls wrong method.
+ Add alias TkcGroup#add [ruby-talk:146049].
- * lib/cmath.rb: make same exception for Math. fix [Bug #3137].
+ * ext/tk/lib/tk/canvas.rb: TkCanvas#dtag and some subcommands of
+ TkCanvas#addtag fail to treat a TkcTag argument.
-Thu Jun 30 00:03:20 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * ext/tk/lib/tk/event.rb: add TkEvent::Event#generate to help to send
+ current event to other widgets.
- * lib/irb/completion.rb: complement correctly string literal. fix
- [Bug #1145].
+Mon Jun 20 18:44:04 2005 Tanaka Akira <akr@m17n.org>
-Wed Jun 29 23:42:51 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): DUMMY_SETJMP is replaced
+ because setjmp is not enough to fix getcontext and SPARC register
+ window problem.
- * ext/date/date_core.c: avoided using timev.
- * ext/date/date_strftime.c: ditto.
- * ext/date/date_tmx.h: ditto.
+Mon Jun 20 16:48:36 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Jun 29 23:17:57 2011 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/dbm/dbm.c (fdbm_closed): new method DBM#closed?
- * ext/openssl/ossl.h (OPENSSL_SYS_WIN32): support for mingw(msys).
+ * ext/gdbm/gdbm.c (fgdbm_closed): new method GDBM#closed?
-Wed Jun 29 23:09:14 2011 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/sdbm/init.c (fsdbm_closed): new method SDBM#closed?
- * ext/tk/extconf.rb (intptr_t, uintptr_t): support for the latest ActiveTcl with mingw.
+ * test/dbm/test_dbm.rb, test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb
+ (teardown): close all db objects before deleting data files.
-Wed Jun 29 22:49:10 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * win32/win32.{ch} (unlink): hook runtime function to change
+ file attribute before unlinking.
+ fixed: [ruby-dev:26360]
- * lib/irb/cmd/help.rb: support RDoc 3.7. fix [Bug #3760].
+Mon Jun 20 02:15:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 29 22:04:14 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * gc.c (define_final): document fix: finalizers never get called
+ before target object is destroyed.
- * lib/tracer.rb: Tracer.on only if required by -r command-line option.
- and consider --disable-gems option.
- * test/test_tracer.rb: add tests for it.
+Mon Jun 20 01:26:49 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Jun 29 13:55:36 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/openssl/openssl_missing.c, ext/openssl/ossl.h,
+ ext/openssl/ossl_asn1.c, ext/openssl/ossl_bio.c,
+ ext/openssl/ossl_pkcs12.h, ext/openssl/ossl_x509req.c: avoid
+ compiler warnings. suggested by Michal Rokos.
- * variable.c (rb_const_get_0): should not look for superclasses if
- the second optional argument is given for #const_get().
- fix [Bug #3422] [Bug #3423]
+Sun Jun 19 14:09:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 29 12:07:27 2011 Eric Hodel <drbrain@segment7.net>
+ * gc.c (run_final): reduce unnecessary object allocation during
+ finalization.
- * math.c: Attach documentation for Math.
- * object.c: Document NIL, TRUE, FALSE.
- * io.c: Improve grammar in ARGF comment. Document STDIN/OUT/ERR.
- Document ARGF global constant.
- * lib/rake: Hide deprecated toplevel constants from RDoc (import from
- rake trunk).
- * lib/thwait.rb: Document ThWait.
- * lib/mathn.rb: Hide Math redefinition from RDoc
- * lib/sync.rb: Add a basic comment for Sync_m, Synchronizer_m, Sync,
- Synchronizer.
- * parse.y: Document SCRIPT_LINES__.
- * hash.c: Document ENV class and global constant.
- * vm.c: Document TOPLEVEL_BINDING.
- * version.c: Document RUBY_* constants.
- * ruby.c: Document DATA and ARGV.
+ * gc.c (rb_gc_call_finalizer_at_exit): deferred finalizers list should
+ be cleared before calling them. fixed: [ruby-talk:145790]
-Wed Jun 29 10:13:12 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Fri Jun 17 13:01:40 2005 Tanaka Akira <akr@m17n.org>
- * lib/matrix.rb: Matrix.zero can build rectangular matrices.
- Vector#r should be called #magnitude
+ * lib/time.rb (Time.parse): fix previous leap seconds support.
+ (Time.rfc2822): ditto.
+ (Time.xmlschema): ditto.
-Wed Jun 29 10:11:08 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Thu Jun 16 15:06:55 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/matrix.rb: Add Matrix#diagonal?, hermitian?, normal?,
- orthogonal?
- permutation?, symmetric?, {lower|upper}triangular?, unitary?, zero?
+ * ext/tcltklib/tcltklib.c (ip_rb_threadVwaitCommand): Tcl_Release
+ was missing.
-Wed Jun 29 10:09:35 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Thu Jun 16 13:34:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/matrix.rb: Specialize Matrix#find_index to return [row, col]
- and accept the same optional argument as #each
+ * ext/tk/lib/tk.rb: add Tk.getMultiple{Open|Save}File() which return
+ an Array of selected files.
-Wed Jun 29 10:07:32 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Thu Jun 16 12:53:24 2005 Tanaka Akira <akr@m17n.org>
- * lib/matrix.rb: Matrix#each{_with_index} can iterate over a subset
- of the Matrix
+ * lib/time.rb (Time.parse): "Fri Jan 1 08:59:60 +0900 1999" was
+ parsed as "Fri Jan 01 09:00:00 JST 1999" even on an environment
+ which supports leap seconds.
+ (Time.rfc2822): ditto.
+ (Time.xmlschema): ditto.
-Wed Jun 29 06:21:02 2011 Koichi Sasada <ko1@atdot.net>
+Thu Jun 16 08:29:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * thread_pthread.c (native_stop_timer_thread): skip to close
- communication pipe to avoid timing bug (process termination timing).
- The communication pipe will closed by OS.
+ * ext/dl/sym.c (rb_dlsym_call): needs FREE_ARGS before return.
+ fixed memory leak. [ruby-Bugs-2034]
-Wed Jun 29 06:09:54 2011 Koichi Sasada <ko1@atdot.net>
+Wed Jun 15 18:26:39 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * error.c (rb_async_bug_errno): async-safe bug report function.
- In timer thread, signal handler should use it.
- The patch is contributed by Eric Wong <normalperson@yhbt.net>.
- Refs: [ruby-core:37644] and [ruby-core:37647]
+ * ext/tk/lib/tk.rb: support "tk inactive" sub-command [for Tcl/Tk8.5a3]
- * thread_pthread.c: use rb_async_bug_errno().
- And replace all fprintf() to write().
+ * ext/tk/lib/tk/namespace.rb: support "namespace path" sub-command and
+ 'namespace ensemble' sub-command [for Tcl/Tk8.5a3]
- * internal.h (rb_async_bug_errno): add decl. of above func.
+Tue Jun 14 02:02:43 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Jun 28 23:46:08 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * ext/tk/tkutil.c: add TkUtil::CallbackSubst.subst_arg(m, ...) &
+ _define_attribute_aliases(hash) to get substitution-argument from
+ attributes (e.g. subst_arg(:x,:y,:num,:button) --> "%x %y %b %b ").
- * lib/tracer.rb: count only non-internal libraries in stack trace,
- ignoring custom_require.
+ * ext/tk/lib/tk/event.rb: use _define_attribute_aliases().
-Tue Jun 28 21:44:58 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+Mon Jun 13 13:01:05 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/irb/ruby-lex.rb: recognize '\char' in ruby statement.
+ * hash.c (ruby_setenv): fixed SEGV. [ruby-dev:26186]
-Tue Jun 28 20:39:29 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Mon Jun 13 01:54:20 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/debug.rb (var_list): Command 'var *' did not work on 1.9(!).
- global_variables, local_variables, and instance_variables returns
- Symbols from 1.9 and need to stringify before evaling it.
- See #4931.
+ * signal.c (sigexit): call rb_thread_signal_exit() instead of
+ rb_exit(). [ruby-dev:26347]
-Tue Jun 28 19:23:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (rb_thread_signal_exit): a new function to exit on main
+ thread.
- * signal.c: Now, USE_TRAP_SIGMASK depend on HAVE_PTHREAD_SIGMASK.
- The code have already depended on pthread_sigmask since r27464.
+ * eval.c (rb_thread_switch): exit status should be retrieved from
+ ruby_errinfo.
-Tue Jun 28 15:09:21 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_f_exit): ensure exit(0) should call
+ exit(EXIT_SUCCESS).
- * lib/benchmark.rb: merge eregon/benchmark.
- https://github.com/eregon/ruby/tree/benchmark
- patched by Benoit Daloze. [ruby-core:37593] [Bug #4940]
+Mon Jun 13 01:20:02 2005 Tanaka Akira <akr@m17n.org>
- * lib/benchmark (Benchmark#bmbm): bmbm should be consistent with bm
- for the return value.
+ * eval.c (rb_gc_mark_threads): curr_thread may not be part of the
+ thread list. [ruby-dev:26312]
- * test/benchmark: remove preemptive test instead of skipping
- I removed the preemptive test I wrote for Feature #4197.
- I'll add it back when the implementation will be able to satisfy it.
+Fri Jun 10 23:35:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/benchmark (Benchmark#bmbm): remove useless explicit call,
- #format is an alias of #to_s test/benchmark: add a test for
- format of long time.
+ * missing/mkdir.c: remove. [ruby-core:05177]
- * lib/benchmark: fix label width: always add 1 to ensure there is a
- space delimiter even with times over 100s
- When I asked for Feature #4197, I wanted to make delimiting spaces
- consistent for #bm and #bmbm.
- But with times over 100s, the output contains no space between the
- label and the first time (user).
- Now both ensure there is always a space, even if that means 3 spaces
- with times under 10s (because it is formatted as %10.6f)
+Fri Jun 10 22:54:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/benchmark: let labels be a constant
- lib/benchmark (Benchmark#realtime): avoid creating an unused Proc
- lib/benchmark (Benchmark#benchmark): use ensure clause to restore
- STDOUT.sync, as in #bmbm
+ * missing.h: fd_set stuffs need sys/types.h. fixed: [ruby-core:05179]
-Tue Jun 28 13:41:51 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Jun 9 23:58:12 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_win32.c (native_stop_timer_thread): fixed commit miss of
- r32244. grep sources before changing the signature of a function.
+ * ext/Win32API/Win32API.c (Win32API_Call): disable global
+ optimization. fixed: [ruby-core:05143]
-Tue Jun 28 11:49:14 2011 Koichi Sasada <ko1@atdot.net>
+Thu Jun 9 23:35:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (consume_communication_pipe):
- Make "buff" as static. (Maybe) "buff" can be shared between
- any caller (any threads) because no one use the read values.
- "buff" (1024 byte) on stack may cause stack overflow on
- several environment (we found a crash on FreeBSD).
- And remove const value "buff_size", and define CCP_READ_BUFF_SIZE
- macro.
+ * enum.c (enum_inject): default the result value to Qundef to use
+ first element as initial value if not given.
-Tue Jun 28 11:45:30 2011 Eric Hodel <drbrain@segment7.net>
+Thu Jun 9 19:55:41 2005 Tanaka Akira <akr@m17n.org>
- * lib/rake: Update rake to fix some bugs and hide deprecated features
- from RDoc.
- * lib/rake/version.rb: Bump version to 0.9.2.1 to distinguish it from
- the released version.
- * NEWS: ditto
+ * eval.c (ruby_longjmp): new macro to call longjmp, setcontext, etc.
+ (ruby_setjmp): new macro to call setjmp, getcontext, etc.
+ (ruby_setjmp): call setjmp before getcontext to avoid IA64 register
+ stack problem.
+ [ruby-talk:144939]
-Tue Jun 28 11:17:28 2011 Eric Hodel <drbrain@segment7.net>
+ * gc.c (Init_stack): remove IA64_MAGIC_STACK_LIMIT.
- * lib/rdoc: Update to RDoc 3.7 (final)
- * NEWS: ditto
+Thu Jun 9 11:55:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Jun 28 10:18:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/delegate.rb (SimpleDelegator::__setobj__): need check for
+ recursive delegation. [ruby-core:04940]
- * process.c (rb_daemon): fix wrong #endif position.
+Wed Jun 8 18:47:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Jun 28 07:50:32 2011 Eric Hodel <drbrain@segment7.net>
+ * misc/ruby-mode.el (ruby-expr-beg): fix looking point drift.
- * object.c (Init_Object): Teach RDoc what Init_class_hierarchy does to
- hook up ri for BasicObject, Object, Module and Class.
+Wed Jun 8 11:11:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Jun 28 05:03:32 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * bignum.c (get2comp): calculate proper 2's complement for
+ negative numbers. a bug in normalizing negative numbers
+ reported from Honda Hiroki <hhonda@ipflex.com>.
- * thread.c (rb_thread_local_aref): RDoc fix. Thread#[] example
- had a race. See #4480.
+Wed Jun 8 08:33:10 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jun 28 01:22:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * enum.c (enum_min_by, enum_max_by): return nil if no iteration.
+ fixed: [ruby-dev:26245]
- * ext/bigdecimal/bigdecimal.c (BigMath_s_log): move BigMath.log from
- bigdecimal/math.rb.
+ * eval.c (rb_need_block): ensure a block is given.
- * ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
+ * eval.c (backtrace): skip successive frames sharing same node.
- * test/bigdecimal/test_bigdecimal.rb: move test for BigMath.log from
- test/bigdecimal/test_bigmath.rb.
+Wed Jun 8 00:15:08 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/bigdecimal/test_bigmath.rb: ditto.
+ * ext/socket/socket.c (ruby_getaddrinfo__aix): merged a patch from
+ KUBO Takehiro <kubo at jiubao.org> to support AIX. [ruby-list:40832]
-Tue Jun 28 01:19:52 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+Wed Jun 8 00:09:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/irb/ruby-lex.rb: fix [Bug #4232].
+ * lib/yaml/rubytypes.rb (Array::to_yaml): merged a patch from
+ Tilman Sauerbeck <tilman at code-monkey.de>. [ruby-core:05055]
-Tue Jun 28 00:14:13 2011 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/yaml/rubytypes.rb (Hash::to_yaml): ditto.
- * lib/drb/drb.rb: fix [Bug #4409]. add DRbServer#here?.
+Wed Jun 8 00:00:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/drb/test_drb.rb: ditto.
+ * ext/curses/curses.c (curses_insertln): merged a patch from
+ TAKAHASHI Tamotsu <ttakah at lapis.plala.or.jp>. [ruby-ext:02305]
- * test/drb/drbtest.rb: ditto.
+Tue Jun 7 19:34:15 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/drb/ut_eq.rb: ditto.
+ * lib/irb/init.rb (IRB::IRB.rc_file_generators): more flexible
+ IRB.rc_file_generators. [ruby-core:05163]
-Tue Jun 28 00:08:43 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+Tue Jun 7 18:39:31 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/irb/workspace.rb: fix BUG#4793.
+ * lib/thread.rb: RDoc documentation from Eric Hodel
+ <drbrain at segment7.net> added. [ruby-core:05148]
-Mon Jun 27 22:06:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Jun 7 18:30:04 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (consume_communication_pipe): don't use C99
- style variable length array.
+ * lib/mkmf.rb (create_makefile): add .SUFFIXES from depend file.
+ fixed: [ruby-dev:26294]
-Mon Jun 27 22:04:27 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Jun 7 17:39:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c (consume_communication_pipe): change return
- type to void. caller doesn't use it.
+ * object.c (rb_mod_cvar_get): Module#class_variable_get(): back
+ ported from CVS HEAD. [ruby-talk:144741]
-Mon Jun 27 21:29:50 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * object.c (rb_mod_cvar_set): Module#class_variable_set().
+ [ruby-talk:144741]
- * thread_pthread.h (rb_global_vm_lock_struct): add volatile to
- gvl->waiting. now thread_timer() access it w/o lock.
+Tue Jun 7 16:32:53 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Jun 27 21:16:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * sprintf.c (rb_f_sprintf): raise exception on debug mode (-d),
+ not verbose mode (-v/-w). [ruby-core:05123]
- * thread_pthread.c: s/__gvl_acquire/gvl_acquire_common/ and
- s/__gvl_release/gvl_release_common/.
+Tue Jun 7 10:30:49 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Mon Jun 27 11:41:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: slave-ip fails to call procedures
+ delegated by master-ip.
- * thread_pthread.c (rb_thread_create_timer_thread):
- the type of return value of write(2) is ssize_t.
+Sun Jun 5 23:00:35 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Mon Jun 27 09:57:02 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/lib/tk/console.rb: create console when required
- * thread_pthread.c (rb_thread_create_timer_thread):
- Fixes missing initialization of oflags.
+ * ext/tk/sample/tkextlib/tile/demo.rb: fix TypeError & create Console
-Mon Jun 27 09:07:42 2011 Koichi Sasada <ko1@atdot.net>
+Sat Jun 4 14:55:18 2005 Tanaka Akira <akr@m17n.org>
- * thread_pthread.c: Stop polling in the timer thread when there are
- no waiting thread. If there are 2 or more runnable threads,
- the timer thread does polling. Avoid polling makes power save
- for several computers (0.2W per a Ruby process, when I measured).
- If outside-event such as signal or Thread#kill was occurred
- when the timer thread does not do polling, then wake-up
- the timer thread using communication-pipe (the timer thread
- waits this communication-pipe with select(2)).
- The discussion about this modification can be found from the post
- [ruby-core:33456] and other related posts.
- Note that Eric Wong and KOSAKI Motohiro give us the huge
- contributions for this modification. Thanks.
+ * test/dbm/test_dbm.rb: merged from ext/dbm/testdbm.rb.
- * thread_pthread.c (rb_thread_wakeup_timer_thread): add a function.
- This function wakes up the timer thread using communication-pipe.
+ * test/gdbm/test_gdbm.rb: merged from ext/gdbm/testgdbm.rb.
- * thread.c (rb_thread_stop_timer_thread): add a parameter which
- specify closing communication-pipe or not.
+ * test/sdbm/test_sdbm.rb: renamed from ext/sdbm/testsdbm.rb with
+ modification to use test/unit.
- * thread.c (rb_thread_terminate_all): do not stop timer thread here
- (ruby_cleanup() terminate timer thread).
+Fri Jun 3 14:06:12 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * signal.c: wake up timer thread using
- rb_thread_wakeup_timer_thread() from signal handler.
+ * ext/tk/lib/multi-tk.rb: fix typo.
- * eval.c (ruby_cleanup): use rb_thread_stop_timer_thread(1).
+Wed Jun 1 11:32:42 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * process.c: use rb_thread_stop_timer_thread(0)
- (reuse communication-pipe).
+ * bcc32/Makefile.sub: can use single quote character in DESTDIR.
+ [ruby-dev:26205]
- * thread_win32.c (rb_thread_wakeup_timer_thread): add a dummy
- function.
+Mon May 30 23:48:29 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * vm_core.h: add and fix decl. of functions.
+ * ext/tk/lib/tk/macpkg.rb: add PACKAGE_NAME information of Tcl/Tk
+ Extension.
-Mon Jun 27 08:01:19 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/tk/msgcat.rb: ditto.
- * ext/date/date_parse.c: should use ALLOCA_N.
+ * ext/tk/lib/tk/winpkg.rb: ditto.
-Mon Jun 27 01:34:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tkextlib/*: ditto.
- * test/etc/test_etc.rb (TestEtc#test_get{pw,gr}nam): skip entries
- start with + sign, which means NIS. these are returned in the
- case that passwd and group entries in /etc/nsswitch.conf are set
- to use "nis" explicitly on Debian. fixed #3683
+Sat May 28 16:40:15 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Mon Jun 27 00:44:53 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/openssl/test_x509store.rb: add test for expired CRL
+ and refine some assertions.
- * parse.y (rb_parser_end_seen_p): fix documentation about return
- value. patched by Sho Hashimoto. [Bug #4511]
+Sat May 28 05:15:51 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Mon Jun 27 00:40:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_time): should
+ not set internal flag directry.
- * hash.c (rb_hash_reject): add documentation that Hash#reject
- without block returns enumerator.
- patched by Michael Edgar [Bug #4847] [ruby-core:36800]
+Sat May 28 02:00:11 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Jun 26 23:49:21 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
+ ENV["REQUEST_URI"] is better to get correct Request-URI
+ than ENV["SCRIPT_NAME"] + ENV["PATH_INFO"]. [ruby-dev:26235]
- * test/date/test_switch_hitter.rb: added a test.
+Fri May 27 16:32:04 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- Sun Jun 26 22:21:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/mkmf.rb: use the semicolon as the path separator
+ in the environment of MSYS. fixed: [ruby-dev:26232]
- * ext/date/date_core.c: refactoring.
+Thu May 26 06:08:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun Jun 26 18:03:30 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/tk/lib/tk.rb: add shortcut-methods of tk_call + tk_split_list
- * parse.y: comma at the end of line is no longer allowed.
- A patch from Yukihiro Matsumoto <matz AT ruby-lang.org>.
- (fixed #3456).
+Wed May 25 22:52:42 2005 Shugo Maeda <shugo@ruby-lang.org>
-Sun Jun 26 13:35:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/irb/input-method.rb: do not use Readline::HISTORY.pop.
+ (backported from HEAD)
- * vm_dump.c (rb_vm_bugreport): change CrashReporter suggestion messages
- on Mac. It should be placed after "-- C level backtrace" line.
- Suggested by Endoh-san.
+Wed May 25 21:55:40 2005 Shugo Maeda <shugo@ruby-lang.org>
- <before>
- -- See Crash Report log file under ~/Library/Logs/CrashReporter or ---------
- -- /Library/Logs/CrashReporter, for the more detail of ---------------------
- -- C level backtrace information -------------------------------------------
+ * ext/readline/readline.c: supported libedit. (backported from HEAD)
- <after>
- -- C level backtrace information -------------------------------------------
+ * ext/readline/extconf.rb: ditto.
- See Crash Report log file under ~/Library/Logs/CrashReporter or
- /Library/Logs/CrashReporter, for the more detail of.
+ * test/readline/test_readline.rb: ditto.
-Sun Jun 26 10:08:28 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Wed May 25 20:06:27 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/extconf.rb
- * ext/openssl/ossl_missing.h/.c: add ASN1_put_eoc if missing.
+ * ext/tk/lib/tk.rb: TkComm#tk_split_*list fail to split a kind of SJIS
+ strings. To avoid the trouble, add arguments to control converting
+ encoding, and do split on a UTF8 string.
- * ext/openssl/ossl_asn1.c: introduce ossl_asn1_object_size and
- ossl_asn1_put_object to wrap functionality depending on OpenSSL
- version in use.
- Fixes [ Ruby 1.9 - Bug #4916 ] reported by Hiroshi Nakamura.
- [ruby-core:37286]
+ * ext/tk/lib/multi-tk.rb: modify to attend encoding.
-Sun Jun 26 01:00:15 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/remote-tk.rb: ditto.
- * ext/date/date_core.c (date_strftime_internal): removed meaningless braces.
- * ext/date/date_core.c (gengo): the value should be int.
+ * ext/tk/lib/tk/itemconfig.rb: ditto.
-Sat Jun 25 23:45:30 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/lib/tk/listbox.rb: ditto.
- * vm_insnhelper.c (vm_search_superclass): avoid control frame
- stack overrun. currently super() in Proc created in a method
- defined by Module#define_method raise NoMethodError. [Bug #4881]
- * test/ruby/test_method.rb t_super_in_proc_from_define_method):
- add test for it.
+ * ext/tk/lib/tk/namespace.rb: ditto.
-Sat Jun 25 23:23:14 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/lib/tk/panedwindow.rb: ditto.
- * thread.c (sleep_forever): now Kernel#sleep don't wakeup by
- signal handler execution. [Bug #4072]
+ * ext/tk/lib/tk/text.rb: ditto.
-Sat Jun 25 23:14:47 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/lib/tk/textmark.rb: ditto.
- * thread.c (rb_threadptr_check_signal): remove unnecessary th->status
- backup. fix race condition which may results unexpected main thread's
- status transition. see #4072
+ * ext/tk/lib/tk/texttag.rb: ditto.
-Fri Jun 24 19:57:30 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/tk/lib/tk/variable.rb: ditto.
- * lib/webrick/httprequest.rb (setup_forwarded_info): Parsing request
- header failed when the request is from 2 or more Apache reverse
- proxies. It's said that all X-Forwarded-* headers will contain more
- than one (comma-separated) value if the original request already
- contained one of these headers. Since we could use these values as
- Host header, we choose the initial(first) value. See #4922.
+ * ext/tk/lib/tk/winfo.rb: ditto.
- * test/webrick/test_httprequest.rb (test_forwarded): Test it.
+ * ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb: ditto.
-Fri Jun 24 17:06:33 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb: ditto.
- * process.c (proc_daemon): should not start timer thread
- twice. fixed Bug#4920.
+ * ext/tk/lib/tk.rb: add TkWindow#lower_window/raise_window and
+ Tk#lower_window/raise_window by reason of method-name conflict
-Fri Jun 24 15:54:14 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/tk/lib/tk/canvas.rb: bug fix on TkCanvas#delete when given
+ non-TkcItem arguments.
- * ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Try to shutdown SSL
- connection more gracefully. Call SSL_shutdown() max 4 times until it
- returns 1 (success). Bi-directional SSL close has several states but
- SSL_shutdown() kicks only 1 transition per call. Max 4 is from
- mod_ssl.c of Apache httpd that says 'max 2x pending + 2x data = 4'.
- See #4237.
+ * ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb: ditto.
-Fri Jun 24 07:24:37 2011 Eric Hodel <drbrain@segment7.net>
+Wed May 25 12:59:48 2005 Tanaka Akira <akr@m17n.org>
- * lib/rake/version.rb: Fixed VERSION to work with tool/rbinstall.rb
- * bin/rake: Import bin/rake from 0.9.2
- * tool/rbinstall.rb (install): Rake::VERSION is now in
- lib/rake/version.rb. Fixes `make install`
+ * lib/open-uri.rb (OpenURI::Meta::RE_QUOTED_STRING): a content of
+ quoted-string should be zero or more characters.
-Fri Jun 24 07:11:37 2011 Eric Hodel <drbrain@segment7.net>
+Tue May 24 23:42:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/rake: Import Rake 0.9.2
+ * numeric.c (fix_pow): support Fixnum ** Float case directly
+ without coercing. [ruby-talk:142697] [ruby-talk:143054]
-Fri Jun 24 00:44:15 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue May 24 16:57:24 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_core.c (c_valid_{julian,gregorian}_p): fixed the range of month.
+ * ruby.c (require_libraries): caused SEGV when continuation jumped
+ in to the required library code.
-Fri Jun 24 00:14:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue May 24 11:56:25 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * ext/date/date_core.c: trivial changes on text.
+ * lib/getopts.rb: should warn only if verbose mode.
+ fixed: [ruby-dev:26201]
-Thu Jun 23 22:46:57 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Tue May 24 06:45:31 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_x509name.c: Add X509::Name#hash_old as a wrapper
- for X509_NAME_hash_old in OpenSSL 1.0.0. See #4805
+ * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): string
+ literals to be matched non-greedy.
- * test/openssl/test_x509name.rb (test_hash): Make test pass with
- OpenSSL 1.0.0.
+Tue May 24 00:34:32 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * NEWS: Add it.
+ * test/soap/calc: method name 'set' was able to crash with a class Set.
+ [ruby-dev:26210]
-Thu Jun 23 19:30:53 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * test/wsdl/document/test_rpc.rb: dateTime comparison failed under
+ TZ=right/Asia/Tokyo (with leap second.) [ruby-dev:26208]
- * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_time): Check
- argument type with NUM2LONG if the arg is not a Time object.
- See #4919.
+Mon May 23 16:24:05 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_timeout): Check
- type with NUM2LONG. Time as an arg is not allowed. See #4919.
+ * ext/tcltklib/extconf.rb: Framework support on MacOS X Tiger.
- * test/openssl/test_ssl_session.rb (test_session_time,
- test_session_timeout): Test it.
+ * ext/tcltklib/README.1st: add description of Framework support options.
-Wed Jun 23 13:30:30 2011 Shota Fukumori <sorah@tubusu.net>
+Mon May 23 12:21:37 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * signal.c(ruby_atomic_exchange): Fix definition style.
+ * re.c (make_regexp): should not return junk address during
+ compile time. [ruby-dev:26206]
-Wed Jun 22 22:34:05 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Sun May 22 21:54:06 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/openssl/ossl_ssl.c (ossl_sslctx_session_new_cb): Return 0 to
- OpenSSL from the callback for SSL_CTX_sess_set_get_cb().
- Returning 0 means to OpenSSL that the session is still valid
- (since we created Ruby Session object) and was not freed by us with
- SSL_SESSION_free(). Call SSLContext#remove_session(sess) in
- session_get_cb block if you don't want OpenSSL to cache the session
- internally.
- This potential issue was pointed by Ippei Obayashi. See #4416.
+ * lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.4.
- * test/openssl/test_ssl_session.rb (test_ctx_server_session_cb): Test
- it.
+ == SOAP client and server ==
+
+ === for both client side and server side ===
+
+ * improved document/literal service support.
+ style(rpc,document)/use(encoding, literal) combination are all
+ supported. for the detail about combination, see
+ test/soap/test_style.rb.
+
+ * let WSDLEncodedRegistry#soap2obj map SOAP/OM to Ruby according to
+ WSDL as well as obj2soap. closes #70.
+
+ * let SOAP::Mapping::Object handle XML attribute for doc/lit service.
+ you can set/get XML attribute via accessor methods which as a name
+ 'xmlattr_' prefixed (<foo name="bar"/> -> Foo#xmlattr_name).
+
+ === client side ===
+
+ * WSDLDriver capitalized name operation bug fixed. from
+ 1.5.3-ruby1.8.2, operation which has capitalized name (such as
+ KeywordSearchRequest in AWS) is defined as a method having
+ uncapitalized name. (converted with GenSupport.safemethodname
+ to handle operation name 'foo-bar'). it introduced serious
+ incompatibility; in the past, it was defined as a capitalized.
+ define capitalized method as well under that circumstance.
+
+ * added new factory interface 'WSDLDriverFactory#create_rpc_driver'
+ to create RPC::Driver, not WSDLDriver (RPC::Driver and WSDLDriver
+ are merged). 'WSDLDriverFactory#create_driver' still creates
+ WSDLDriver for compatibility but it warns that the method is
+ deprecated. please use create_rpc_driver instead of create_driver.
+
+ * allow to use an URI object as an endpoint_url even with net/http,
+ not http-access2.
+
+ === server side ===
+
+ * added mod_ruby support to SOAP::CGIStub. rename a CGI script
+ server.cgi to server.rb and let mod_ruby's RubyHandler handles the
+ script. CGIStub detects if it's running under mod_ruby environment
+ or not.
+
+ * added fcgi support to SOAP::CGIStub. see the sample at
+ sample/soap/calc/server.fcgi. (almost same as server.cgi but has
+ fcgi handler at the bottom.)
+
+ * allow to return a SOAPFault object to respond customized SOAP fault.
+
+ * added the interface 'generate_explicit_type' for server side
+ (CGIStub, HTTPServer). call 'self.generate_explicit_type = true'
+ if you want to return simplified XML even if it's rpc/encoded
+ service.
+
+ == WSDL ==
+
+ === WSDL definition ===
+
+ * improved XML Schema support such as extension, restriction,
+ simpleType, complexType + simpleContent, ref, length, import,
+ include.
+
+ * reduced "unknown element/attribute" warnings (warn only 1 time for
+ each QName).
+
+ * importing XSD file at schemaLocation with xsd:import.
+
+ === code generation from WSDL ===
+
+ * generator crashed when there's '-' in defined element/attribute
+ name.
+
+ * added ApacheMap WSDL definition.
+
+ * sample/{soap,wsdl}: removed.
+
+Sun May 22 19:11:35 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#intialize):
+ should initialize session id context. [ruby-core:4663]
+
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): add session id support.
+
+Sat May 21 10:24:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * bcc32/Makefile.sub: tds files were not deleted when DESTDIR
+ included '\' path delimiter. [ruby-dev:26193]
+
+Thu May 19 19:04:29 2005 speakillof <speakillof@yahoo.co.jp>
+
+ * lib/rexml/encodings/SHIFT-JIS.rb: encoding and decoding were
+ swapped. [ruby-core:4772]
+
+Wed May 18 23:42:25 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * error.c (exc_exception): reverted to call Exception#initialize
+ directly. fixed: [ruby-dev:26177]
+
+Wed May 18 23:39:09 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (glob_helper): get rid of using String. [ruby-dev:26180]
+
+ * dir.c (push_braces): should skip balanced braces.
+
+ * eval.c (ruby_options), win32/win32.c (NtInitialize): move argument
+ intialization back. [ruby-dev:26180]
+
+Tue May 17 15:31:31 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should
+ break the loop if the socket reached to EOF. [ruby-talk:142285]
+
+Tue May 17 11:52:18 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (unixtime_to_filetime): use localtime() instead of
+ gmtime() when using FileLocalTimeToFileTime().
+
+Mon May 16 22:28:43 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * win32/win32.h, {bcc32,win32,wince}/Makefile.sub: moved rb_[ugp]id_t
+ to get rid of redefinition warnings on mingw.
+
+ * class.c (rb_class_init_copy): singleton class is disallowed to copy,
+ from its definition. fixed: [ruby-talk:142749]
+
+Mon May 16 08:52:29 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * win32/win32.{h,c}: define rb_[pgu]id_t.
+
+Mon May 16 00:21:02 2005 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#unlink): use SystemCallError instead of
+ Errno::EISDIR because EISDIR is not portable.
+ [ruby-core:5001]
+
+Sun May 15 22:11:33 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb (DRbObject#method_missing): use raise(exception).
+ [ruby-dev:26164]
+
+Sun May 15 18:56:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in, ruby.h: define rb_[pgu]id_t macros instead of typedefs
+ to get rid of types which might not be defined yet. [ruby-dev:26165]
+
+Sun May 15 14:35:46 2005 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#unlink): unlink a symlink to a directory
+ was failed. [ruby-core:4992]
+
+Sun May 15 09:57:30 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * win32/win32.c (unixtime_to_filetime): deal with DST.
+ [ruby-talk:141817]
+
+Sat May 14 23:59:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * error.c (exc_exception, {exit,name_err,syserr}_initialize): call
+ Execption#initialize. fixed: [ruby-talk:142593]
+
+Sat May 14 23:57:26 2005 Erik Huelsmann <ehuels@gmail.com>
+
+ * configure.in: Check for the availability of pid_t, gid_t and uid_t and
+ remove AC_TYPE_UID_T. fixed: [ruby-core:04745]
+
+ * defines.h: Remove pid_t typedef.
+
+ * ruby.h: Define rb_pid_t, rb_gid_t and rb_uid_t in accordance with
+ the available system types.
+
+ * process.c: Change instances of pid_t and gid_t to their rb_*
+ counterparts.
+
+ * ext/pty/pty.c: Change pid_t to rb_pid_t.
+
+ * vms/config.h: Define HAVE_{P,G,U}ID_T to 1.
+
+ * win32/Makefile.sub: Remove #define for {g,u}id_t.
+
+ * win32/win32.c: Change pid_t to rb_pid_t.
+
+ * wince/Makefile.sub: Remove #define for {g,u}id_t.
+
+ * wince/sys/types.h: Remove definitions of {p,g,u}id_t.
+
+Fri May 13 23:44:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb: keep srcdir unexpanded.
+
+ * lib/mkmf.rb (create_makefile): quote topdir and hdrdir if necessary.
+ fixed: [ruby-core:04932]
+
+ * lib/mkmf.rb (configuration), {bcc32,win32,wince}/Makefile.sub: make
+ also INSTALL_PROG and INSTALL_DATA system dependent.
+ fixed: [ruby-core:04931]
+
+Fri May 13 17:54:39 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * variable.c (generic_ivar_get): rb_attr_get should not warn.
+ [ruby-dev:26010]
+
+Fri May 13 12:28:43 2005 Daniel Berger <djberge@qwest.com>
+
+ * array.c (rb_ary_select): can remove argc check. [ruby-core:4911]
+
+ * test/ruby/test_array.rb: add test for find_all.
+
+Fri May 13 11:29:00 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * eval.c (unknown_node): add volatile directive to prototype.
+
+Thu May 12 17:08:48 2005 Tanaka Akira <akr@m17n.org>
+
+ * io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
+ (swallow, rb_io_each_byte, rb_io_getc): revert previous change.
+
+ * io.c (rb_io_eof, io_fread, appendline, swallow, rb_io_each_byte)
+ (rb_io_getc, rb_getc): call clearerr before getc to avoid
+ stdio incompatibility.
+
+Thu May 12 16:52:20 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * lib/rdoc/parsers/parse_c.rb: more readability for mixing
+ progress "c..." and warning message.
+
+Thu May 12 16:31:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * ext/nkf/nkf-utf8/nkf.c: follow nkf 2.0.5
+
+Thu May 12 16:15:01 2005 Tanaka Akira <akr@m17n.org>
+
+ * io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
+ (swallow, rb_io_each_byte, rb_io_getc): don't rely EOF flag.
+ [ruby-talk:141527]
+
+Thu May 12 15:56:20 2005 Tilman Sauerbeck <tilman@code-monkey.de>
+
+ * lib/rdoc/parsers/parse_c.rb: show parsing progress for C files.
+ [ruby-core:4341]
+
+Thu May 12 13:47:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * test/drb/test_drb{ssl,unix}.rb: can test drb
+ before install. (backported from HEAD) [ruby-dev:26146]
+
+Thu May 12 09:53:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * version.c (ruby_show_version): flush for non-tty stdout.
+
+Thu May 12 09:07:07 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * test/ruby/envutil.rb, test/drb/drbtest.rb: can test drb
+ before install. (backported from HEAD) [ruby-Bugs-1672]
+
+Thu May 12 01:23:55 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval), parse.y (arg): reduce fixnum range literal at
+ parser. fixed: [ruby-dev:26113]
+
+ * eval.c (unknown_node): ignore broken NODE to get rid of accessing
+ possibly inaccessible address. fixed: [ruby-dev:26122]
+ should emit more useful information like [ruby-dev:26126], though.
+
+Wed May 11 16:20:01 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/cgi.rb: new methods WEBrick::CGI#[], WEBrick::CGI#logger
+ and WEBrick::CGI#config. (backported from HEAD)
+
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape_path): should
+ not use String#split("/"). (backported from HEAD)
+
+Wed May 11 15:58:39 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (break_jump): break should not cross functions.
+ [ruby-list:40818]
+
+Wed May 11 10:39:37 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * lib/tempfile.rb (Tempfile#unlink): fixed typo.
+
+Wed May 11 01:03:36 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (TMP_ALLOC): use macro NEW_NODE() to get rid of warnings on
+ platforms which have no alloca(). fixed: [ruby-talk:141301]
+
+Sun May 8 23:17:47 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/timer.rb: fix typo.
+
+Sun May 8 16:52:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * lib/profiler.rb: fixed "undefined method `[]' for nil:NilClass"
+ [ruby-core:4775] [ruby-talk:140401] [ruby-dev:26118]
+
+Sat May 7 22:58:00 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (have_var): no libs argument is given.
+
+Sun May 1 09:58:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ruby.c (process_sflag): replace '-' in variable names with '_'.
+ [ruby-dev:26107]
+
+ * ruby.c (set_arg0): use also environment variable space for setting
+ $0. [ruby-core:04774]
+
+Wed Apr 27 23:42:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * win32/Makefile.sub (OPTFLAGS): default global optimization to
+ disabled only for VC++6.
+
+Tue Apr 26 22:58:00 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_invoke_core): call Tcl's "::unknown"
+ command when can't get information of target command.
+
+Mon Apr 25 01:18:43 2005 Tanaka Akira <akr@m17n.org>
+
+ * regex.c: declare rb_warn to have variadic argument. [ruby-core:4751]
+
+Sat Apr 23 19:45:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_RubyExitCommand): exit with status code
+ via TclTkIp#_eval didn't work. [ruby-talk:139390]
+
+Fri Apr 22 16:41:50 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_set_exc_message): fixed memory leak.
+
+ * ext/tcltklib/tcltklib.c: eTkCallbackReturn was not initialized.
+
+Thu Apr 21 00:07:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (create_makefile): support platforms have file separator
+ other than /.
+
+ * {bcc32,win32,wince}/Makefile.sub (BUILD_FILE_SEPARATOR): separator
+ of building platform.
+
+ * {bcc32,win32,wince}/Makefile.sub (CP, INSTALL): use COPY command.
+
+Wed Apr 20 23:22:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * Makefile.in, common.mk: miniruby depens on MINIOBJS.
+
+ * dmydln.c (dln_load): dummy function to raise LoadError.
+
+ * cygwin/GNUmakefile.in, {bcc32,win32,wince}/Makefile.sub: miniruby
+ can't load extensions on Windows.
+
+Wed Apr 20 23:01:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * win32/ifchange.bat: delete testing files.
+
+Wed Apr 20 07:27:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * {bcc32,win32,wince}/configure.bat, {bcc32,win32,wince}/setup.mak:
+ add extout option.
+
+ * bcc32/setup.mak: make configuration variables overridable.
+
+Wed Apr 20 04:15:27 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
+
+ * lib/irb.rb lib/irb/* doc/irb: IRB 0.9.5
+
+Tue Apr 19 23:37:09 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/ftools.rb (File.safe_unlink): do not modify a symlinked file.
+
+Tue Apr 19 00:06:20 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb: expand path for ext/**/extconf.rb.
+
+Mon Apr 18 11:25:14 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/zlib/zlib.c (zstream_run): fixed SEGV. [ruby-core:4712]
+
+Sun Apr 17 23:57:49 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb (extmake, parse_args): do not expand destdir.
+
+ * ext/extmk.rb (relative_from): treat mere drive letter as an absolute
+ path.
-Wed Jun 22 22:21:17 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Sat Apr 16 17:01:16 2005 Kouhei Sutou <kou@cozmixng.org>
- * ext/openssl/ossl_ssl_session.c: Respect T_BIGNUM time values. Patch by
- Tomoyuki Chikanaga.
- [ Ruby 1.9 - Bug #4919 ] [ruby-dev:43869]
+ * sample/rss/tdiary_plugin/rss-recent.rb (rss_recent_cache_rss):
+ use the first date information of items as site date information
+ if channel doesn't have date information.
-Wed Jun 22 21:29:25 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Apr 16 15:27:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/depend (SOCK_HEADERS): use $(top_srcdir) instead of
- $(topdir). sorry!
+ * configure.in (RUBY_PROG_INSTALL): not add -p option to INSTALL.
+ files need timestamps to be kept are only ar-archive on a few
+ platforms, and be installed by instruby.rb but not INSTALL.
+ fixed: [ruby-core:04721]
-Wed Jun 22 19:47:03 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * mkconfig.rb: purge autoconf value variables.
- * cont.c (cont_capture): add volatile.
- On clang -O, it is needed to avoid the optimization.
- With this and llvm/clang's recent fix, clang 3.0 can
- build ruby-trunk with -O option.
+Sat Apr 16 10:36:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * cont.c (cont_capture): use for-loop.
+ * bcc32/Makefile.sub: quick hack... prepend DESTDIR.
+ still have restriction on DESTDIR ("", "/", "e:")
- * array.c (rb_ary_each): add volatile and use it.
+Sat Apr 16 03:59:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * vm_insnhelper.c (vm_call_cfunc): ditto.
+ * ext/openssl/extconf.rb: check for OPENSSL_cleanse.
-Wed Jun 22 18:20:46 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/openssl/openssl_missing.h: ditto.
- * ext/openssl/ossl_ssl.c (ossl_sslctx_session_remove_cb):
- OpenSSL::SSL::SSLContext#session_remove_cb was broken. It wrongly
- tried to call the session_*new*_cb callback.
+Thu Apr 14 19:18:30 2005 Minero Aoki <aamine@loveruby.net>
- * test/openssl/test_ssl_session.rb (class OpenSSL): Test it.
+ * lib/fileutils.rb (remove_file): ignore exceptions caused by
+ chmod.
-Wed Jun 22 17:37:49 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/fileutils.rb (remove_dir): try to get rights to rmdir.
+ [ruby-Bugs:1502] (2 items backportted from HEAD, rev 1.53-54)
- * ext/openssl/ossl.h: Introduced OSSL_BIO_reset macro for PEM/DER
- fallback scenarios.
+Thu Apr 14 16:57:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * bcc32/Makefile.sub: failed to remove debug information files.
+ fixed: [ruby-dev:26034]
+
+Wed Apr 13 23:40:21 2005 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss/rss.rb (RSS::VERSION): 0.1.3 -> 0.1.4.
+
+ * lib/rss/rss.rb (RSS::Element#converter): fixed converter
+ transmission bug.
+
+Wed Apr 13 21:20:35 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in (mingw32): extract msvcr*.dll from objdump result.
+
+Wed Apr 13 20:24:30 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (mingw32): use actual runtime DLL name as ruby DLL
+ name and default load path.
+
+ * win32/Makefile.sub, win32/setup.mak: ditto.
+
+Tue Apr 12 15:33:09 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_finalize): better modification than the
+ previous commit [ruby-dev:26029].
+
+Tue Apr 12 12:38:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_finalize): fix SEGV when Tcl_GlobalEval()
+ modifies the argument string to eval.
+
+Tue Apr 12 02:21:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_finalize): add existence check of
+ Tcl commands before calling Tcl_GlobalEval().
+
+Mon Apr 11 23:47:21 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb: [druby-ja:123] fix: When reference of my object is
+ loaded, the object is tainted.
+
+ * test/drb/test_drb.rb: ditto.
+
+Mon Apr 11 22:18:23 2005 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * dir.c, file.c (lstat): avoid warnings for mingw.
+
+Mon Apr 11 20:11:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_finalize): adhoc patch to avoid SEGV
+ when exit on Tcl/Tk8.3.x.
+
+Mon Apr 11 15:26:25 2005 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/mkmf.rb (configuration): shouldn't output hdrdir twice.
+
+Mon Apr 11 12:09:05 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * {bcc32,win32,wince}/Makefile.sub: ri data was not installed
+ into correct path. [ruby-dev:26011]
+
+ * bcc32/Makefile.sub: defaulted install-nodoc. [ruby-dev:26011]
+
+Sun Apr 10 10:12:42 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c(ole_invoke): retry after converting Qnil
+ to VT_EMPTY.
+
+ * ext/win32ole/win32ole/tests/testWIN32OLE.rb: correct error
+ message string "Unknown" => "unknown".
+
+Sat Apr 9 18:20:31 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/image.rb: support to create TkImage object without
+ creating a new image object on Tk.
+
+ * ext/tk/lib/tk/menu.rb: use TkCommandNames on create_self()
+
+ * ext/tk/lib/tk/root.rb: TkRoot.to_eval() returns '.'.
+
+ * ext/tk/lib/tk/text.rb: add methods to create a TkText::IndexString
+ from (x, y) coords.
+
+ * ext/tk/lib/tkextlib/tile/: add demo and update support status.
+
+Sat Apr 9 14:42:29 2005 Kouhei Sutou <kou@cozmixng.org>
+
+ * sample/rss/tdiary_plugin/rss-recent.rb: supported configuration
+ via Web browser.
+
+Sat Apr 9 11:59:57 2005 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss: backoported from HEAD.
+
+ * lib/rss: refactored.
+ - gave a name to 'x'.
+ - undef_method -> remove_method for avoiding a warning in ruby 1.6.
+
+
+ * lib/rss/parser.rb: @@setter -> @@setters.
+
+ * lib/rss/parser.rb
+ (RSS::BaseListener.register_uri)
+ (RSS::BaseListener.uri_registered?)
+ (RSS::BaseListener.install_get_text_element):
+ swapped the first argument and the second argument.
+
+ * lib/rss/taxonomy.rb: swapped the first argument and the second
+ argument for RSS::BaseListener.install_get_text_element.
+ * lib/rss/image.rb: ditto.
+ * lib/rss/syndication.rb: ditto.
+ * lib/rss/dublincore.rb: ditto.
+ * lib/rss/parser.rb: ditto.
+ * lib/rss/1.0.rb: ditto.
+ * lib/rss/2.0.rb: ditto.
+ * lib/rss/0.9.rb: ditto.
+ * lib/rss/content.rb: ditto.
+
+ * lib/rss/parser.rb
+ (RSS::BaseListener.install_setter)
+ (RSS::BaseListener.register_uri): changed fallback way.
+
+ * lib/rss/parser.rb: added class name registry for complex model
+ elements. (ex. have childlen elements, have some attributes and
+ a child element and so on.)
+
+
+ * lib/rss/dublincore.rb: supported multiple Dublin Core items.
+ * lib/rss/maker/dublincore.rb: ditto.
+
+ * lib/rss/maker/image.rb: supproted new Dublin Core API.
+
+
+ * lib/rss/maker/base.rb: added default current_element implementation.
+
+
+ * lib/rss/trackback.rb (RSS::TrackBackUtils.new_with_value_if_need):
+ moved to RSS::Utils.
+
+ * lib/rss/utils.rb (RSS::Utils.new_with_value_if_need):
+ moved from RSS::TrackBackUtils.
+
+
+ * lib/rss/maker/image.rb: fixed invalid argument of
+ add_need_initialize_variable bug.
+ * lib/rss/maker/trackback.rb: ditto.
+
+
+ * lib/rss/rss.rb (Hash#merge): added for ruby 1.6.
+
+ * lib/rss/rss.rb (RSS::BaseModel.date_writer): changed to accept nil
+ for date value.
+
+
+ * test/test_dublincore.rb: added tests for plural accessor and
+ multiple Dublin Core items.
+
+ * test/test_setup_maker_1.0.rb: fixed swapped actual and expected
+ values.
+
+ * test/rss/rss-assertions.rb (assert_multiple_dublin_core): added
+ an assertion for testing multiple Dublin Core items.
+
+ * test/rss/test_maker_dc.rb (test_rss10_multiple): added a test
+ for making multiple Dublin Core items.
+
+ * test/rss/test_maker_dc.rb (test_date): added a test for #date=
+ and #dc_date=.
+
+
+ * sample/rss/tdiary_plugin/rss-recent.rb:
+ new option: @options['rss-recent.use-image-link']:
+ use image as link instread of text if available.
+
+ * sample/rss/tdiary_plugin/rss-recent.rb (RSS_RECENT_VERSION):
+ 0.0.5 -> 0.0.6.
+
+Fri Apr 8 20:17:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb (extmake): hdrdir needs to be defined also in
+ Config::CONFIG.
+
+ * lib/mkmf.rb (configuration, create_makefile): get rid of recursive
+ macro reference.
+
+Fri Apr 8 18:26:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c: add callbacks to OpenSSL::SSL::SSLContexts.
+ - SSLContext#client_cert_cb=(aProc). it is called when a client
+ certificate is requested by a server and no certificate was not
+ set for the SSLContext. it must return an Array which includes
+ OpenSSL::X509::Certificate and OpenSSL::PKey::RSA/DSA objects.
+ - SSLContext#tmp_dh_callback=(aProc). it is called in key
+ exchange with DH algorithm. it must return an OpenSSL::PKey::DH
+ object.
+
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): ignore the
+ argument if it's nil.
- * ext/openssl/ossl_pkey_dsa.c
- * ext/openssl/ossl_x509req.c
- * ext/openssl/ossl_pkey_rsa.c
- * ext/openssl/ossl_pkey_ec.c
- * ext/openssl/ossl_ssl_session.c
- * ext/openssl/ossl_x509crl.c
* ext/openssl/ossl_pkey.c
- * ext/openssl/ossl_pkey_dh.c
- * ext/openssl/ossl_x509cert.c
- * ext/openssl/ossl_pkcs7.c: Use OSSL_BIO_reset.
+ (GetPrivPKeyPtr, ossl_pkey_sign): should call rb_funcall first.
+ (DupPrivPKeyPtr): new function.
- * ext/openssl/ossl_ssl.c
- * ext/openssl/ossl_cipher.c
- * ext/openssl/ossl_pkey_ec.c
- * ext/openssl/ossl_pkcs12.c
- * ext/openssl/ossl_ssl_session.c: Replace rb_raise occurrences by
- ossl_raise. This automatically flushes OpenSSL's error queue.
+ * ext/openssl/ossl_pkey_dh.c: add default DH parameters.
- * ext/openssl/ossl_pkcs7.c: Raise error if DER fallback for parsing
- fails.
+ * ext/openssl/ossl_pkey.h: ditto.
- * test/openssl/test_pkey_ec.rb
- * test/openssl/test_pkey_dsa.rb
- * test/openssl/test_pkey_rsa.rb: Add assertions that OpenSSL.errors is
- empty.
+Fri Apr 8 01:55:20 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/openssl/test_pkey_rsa.rb: Remove initial OpenSSL.errors call in
- test_new.
- [ Ruby 1.9 - Bug #4885 ] [ruby-core:37134]
+ * ext/tk/sample/demos-{en,jp}/goldberg.rb: reduced window size.
+ [ruby-dev:25992]
-Wed Jun 22 15:01:24 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Apr 7 23:58:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_ssl.c: Use SSL_MODE_RELEASE_BUFFERS if available.
- Thanks, Eric Wong, for providing the patch.
- [ Ruby 1.9 - Feature #4672 ] [ruby-core:36127]
+ * ext/extmk.rb (extmake): keep directory names in Makefile as macros.
-Wed Jun 22 14:47:53 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/mkmf.rb (configuration, create_makefile): ditto.
- * test/openssl/test_buffering.rb
- * test/openssl/test_pkcs12.rb: Inherit from Test::Unit::TestCase
- instead of MiniTest::Unit::TestCase. [ruby-core:37275]
+ * lib/mkmf.rb (CXX_EXT): separate C++ extensions.
-Wed Jun 22 12:41:03 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Thu Apr 7 17:43:25 2005 Shugo Maeda <shugo@ruby-lang.org>
- * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der):
- OpenSSL::SSL::Session#to_der was broken. Fix buffer handling.
+ * eval.c (rb_call0): "return" event hook should be always executed
+ if event_hooks is set. fixed: [ruby-core:04662]
+ (backported from HEAD)
- * test/openssl/test_ssl_session.rb (test_session): Test it.
+Mon Apr 4 23:17:52 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Jun 22 12:38:52 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/tk/lib/tk.rb (TkComm#array2tk_list): accept enc-mode argument to
+ decide whether convert encoding of each element or not.
- * test/openssl/test_ssl_session.rb: Split out SSL::Session related
- tests from test_ssl.rb
+ * ext/tk/lib/tk/variable.rb (TkVariable#value=): fail to convert the
+ encoding of array elements when assign an array to an TkVariable
+ object.
-Wed Jun 22 03:20:52 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon Apr 4 10:26:48 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/psych/lib/psych/visitors/to_ruby.rb: Fix cyclic references of
- objects. Thanks to CvX for reporting the bug and a test case.
- * test/psych/test_object.rb: test for cyclic object references.
+ * ext/tk/lib/tk/dialog.rb: fixed typo.
-Wed Jun 22 02:39:54 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Sun Apr 3 17:16:33 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/net/http.rb (Net::HTTP.post_form): Do not ignore query part of
- the given URI to post. See #655.
+ * win32/win32.{h,c} (rb_w32_fdopen): avoid warning on bcc32.
+ (backported from HEAD)
- * test/net/http/test_http.rb, test/net/http/utils.rb: Test it.
+Sat Apr 2 23:38:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 22 01:28:13 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * configure.in (CP, INSTALL): get rid of less portable options.
- * test/openssl/test_x509store.rb (test_set_errors): Redhat is
- distributing a patched version of OpenSSL that allows multiple CRL
- for a key (multi-crl.patch.) Make test pass on such env. See #4122,
- #4554.
+ * lib/mkmf.rb (configuration, create_makefile): correct configuration
+ variable.
-Tue Jun 21 21:50:37 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * {bcc32,win32,wince}/{Makefile.sub,setup.mak}: leave prefix empty in
+ config.status for backward compatibility. fixed: [ruby-core:04649]
- * lib/webrick/httpresponse.rb (HTTPResponse#setup_header): Close
- HTTP/1.1 connection when returning an IO object as response body
- without setting HTTPResponse#chunked to true. See #855 no.1.
+ * lib/mkmf.rb (create_makefile): ensure library directories get made
+ before copying libraries there.
- * test/webrick/test_httpserver.rb: Test it.
+Sat Apr 2 16:59:46 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Jun 21 21:27:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk.rb: forgot to update RELEASE_DATE
- * internal.h: move rb_thread_io_blocking_region() declaration
- from intern.h to internal.h. It's still experimental API and
- need more discussion. [ruby-dev:43698]
- * include/ruby/intern.h: ditto.
+ * ext/tk/lib/tk/variable.rb: fix namespace trouble when autoloading
- * ext/socket/rubysocket.h: include internal.h.
- * ext/socket/depend: add internal.h dependency.
- * ext/socket/extconf.rb: add $INCFLAGS to topdir.
+ * ext/tk/lib/tk/palette.rb: define Tcl variable 'tkPalette' as global
-Tue Jun 21 20:38:47 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/tk/dialog.rb: use array2tk_list method when calling
+ Tk.ip_eval.
- * ext/date/date_core.c (datetime_s_*): canonicalize 24 o'clock.
+ * ext/tk/lib/tk/autoload.rb: add autoload entry 'TkDialogObj' and
+ 'TkWarningObj'
-Tue Jun 21 19:46:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Apr 2 02:19:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/ruby/test_thread.rb (TestThread#test_priority): enable
- this test again. Current GVL respect thread priority rather
- than past.
+ * ext/tk/lib/tk.rb (TkWindow.initialize): accept 'without_creating'
+ option without 'widgetname' option to allow creating a widget object
+ which is used as an argument of Tcl/Tk's widget allocation commands.
-Tue Jun 21 13:25:35 2011 TAKAO Kouji <kouji@takao7.net>
+ * ext/tk/lib/tk/image.rb (TkImage.initialize): accept 'imagename'
+ option to create a image object by the given name.
- * ext/readline/readline.c (readline_getc): applied a patch in
- #3827 by by Akio Tajima <artonx AT yahoo.co.jp>. (see #3827)
+Thu Mar 31 22:23:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jun 21 13:16:31 2011 TAKAO Kouji <kouji@takao7.net>
+ * lib/mkmf.rb (SRC_EXT): exclude just case different suffixes on case
+ insensitive file system platforms.
- * ext/readline/extconf.rb: fixed bug, specify --disable-libedit
- then disable libedit, does not specify then check readline and
- libedit if failed checking readline. (fixes #3375)
+ * README.EXT, README.EXT.ja (Appendix C): utility functions.
-Mon Jun 20 22:52:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Mar 31 14:15:44 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * process.c (before_exec): use sig_do_nothing instead of SIG_DFL
- for avoiding a race.
- * process.c (sig_do_nothing): new function.
+ * ext/openssl/ossl_engine.c (ossl_engine_s_load): should return
+ value. [ruby-dev:25971]
-Mon Jun 20 21:31:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Mar 31 08:25:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread_pthread.c (thread_timer): rename timeout_10ms to
- time_quantum. it's no longer 10ms.
+ * common.mk (RUBYOPT): clear for the environment RubyGems installed.
-Mon Jun 20 18:46:02 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * common.mk (clean-local): keep $(PREP) files till distclean.
- * ext/openssl/ossl_cipher.c, ext/openssl/lib/openssl/cipher.rb:
- Documentation fix by Ippei Obayashi. See #4419.
+ * common.mk (check): do all tests.
-Mon Jun 20 15:41:33 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Thu Mar 31 06:00:20 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/webrick/cookie.rb (WEBrick::Cookie.parse): Revert r31228.
- r31228 was for allowing the 'Cookie:' header which did not have no
- SP after ';' for separating cookie-pairs but RFC6265 requires single
- SP after ';' there. We allow multiple SPs here for compatibility
- with older WEBrick version.
+ * ext/openssl/ossl_engine.c (ossl_engine_s_load): should not raise
+ error even if the specified engine could not be loaded. (Dynamic
+ engines don't have fixed name to load.)
- * test/webrick/test_cookie.rb: Test it.
+Thu Mar 31 00:18:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Jun 19 13:31:26 2011 Shota Fukumori <sorah@tubusu.net>
+ * win32/ifchange.bat, win32/rm.bat: backported from HEAD.
- * NEWS: Introduce --hide-skip on test/unit.
+Wed Mar 30 23:44:50 2005 Nobuyoshi Nakada <nobu.nokada@softhome.net>
-Sun Jun 19 10:05:16 2011 Shota Fukumori <sorah@tubusu.net>
+ * Makefile.in, */Makefile.sub, */configure.bat,
+ cygwin/GNUmakefile.in, common.mk, configure.in, ext/extmk.rb,
+ lib/mkmf.rb, instruby.rb, runruby.rb: backport extout.
+ [ruby-dev:25963]
- * lib/test/unit/parallel.rb: Override Test::Unit::TestCase#on_parallel_worker?
- only when $0 == __FILE__.
+Wed Mar 30 17:41:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/test/unit/parallel.rb: Run Test::Unit::Worker.run only when
- $0 == __FILE__.
+ * ext/tcltklib/tcltklib.c: add TclTkIp#_create_console() method to
+ create a Tcl/Tk's console window.
-Sat Jun 18 23:59:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: support TclTkIp#_create_console() method.
- * io.c (fill_cbuf): finish reading at EOF, and the readconv has
- been cleared by another thread while io_fillbuf() is waiting at
- select(). a patch in [ruby-core:37197] by Hiroshi Shirosaki
- <h.shirosaki AT gmail.com>. fixed #3840
+ * ext/tk/lib/remote-tk.rb: ditto.
-Sat Jun 18 21:36:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/console.rb: ditto.
- * thread_pthread.c: remove GVL_DEBUG
+ * ext/tk/lib/tk.rb: update RELEASE_DATE
-Sat Jun 18 21:32:02 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/sample/demo-*/check2.rb: use 'return' in the Proc object.
- * vm.c, vm_core.h (rb_vm_stack_to_heap): remove const.
- It makes compilations warnings.
+ * ext/tk/sample/tkextlib/**: ditto.
-Sat Jun 18 18:54:15 2011 Koichi Sasada <ko1@atdot.net>
+Tue Mar 29 22:11:56 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * vm.c, vm_core.h (rb_vm_stack_to_heap): fix "const" place.
+ * test/rinda/test_rinda.rb: use DRbObject.new_with instead of reinit.
+ [ruby-dev:25961]
-Sat Jun 18 17:23:38 2011 Tanaka Akira <akr@fsij.org>
+Mon Mar 28 23:40:40 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * eval.c, hash.c, load.c, proc.c, range.c, thread.c, time.c: don't
- declare internal functions.
+ * lib/drb/drb.rb: move method DRbObject#reinit to DRbObject.new_with.
+ extract method DRbObject.prepare_backtrace. add DRb.regist_server,
+ remove_server, fetch_server. change server in thread variable if
+ in-proc server. [druby-ja:113]
- * internal.h, vm_core.h: declare internal functions.
+ * lib/drb/gw.rb: ditto.
- * array.c: include internal.h.
+Mon Mar 28 20:43:34 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * common.mk: update dependency for array.o.
+ * ext/syck/rubyext.c: get rid of warnings caused by a bug of VC.
-Sat Jun 18 13:39:33 2011 Tanaka Akira <akr@fsij.org>
+Mon Mar 28 08:39:49 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * internal.h: declarations declared in include/ruby/*.h removed.
+ * ext/iconv/iconv.c (iconv_create): Iconv::Failure requires 3
+ arguments. (pointed out by NaHi)
-Sat Jun 18 12:42:17 2011 Tanaka Akira <akr@fsij.org>
+Sat Mar 26 22:51:33 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * method.h, internal.h iseq.h: declare internal functions.
+ * ext/tk/lib/tk.rb (_callback_entry_class?): add for checking whether
+ a class is available for a callback entry.
- * compile.c, eval.c, iseq.c, object.c, parse.y, proc.c, process.c,
- thread.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c: don't
- declare internal functions.
+ * ext/tk/lib/tk.rb (after_cancel): add Tk.after_cancel(afterID) method.
- Note that rb_method_entry_eq() is defined in vm_method.c but
- there was a declaration in proc.c with different const-ness.
- Now it is declared in method.h with same const-ness to the
- definition.
+ * ext/tk/lib/tk.rb (array2tk_list): change from private module method
+ of TkComm to public module method.
- * object.c (rb_mod_module_exec): don't declare functions declared in
- include/ruby/intern.h.
+ * ext/tk/lib/tk.rb (cget): add check that slot argument is not
+ empty string.
-Sat Jun 18 12:05:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk.rb (configinfo): ditto.
- * include/ruby/backward/classext.h: for evil gems. fixed #4803
+ * ext/tk/lib/tk/itemconfig.rb (itemcget): add check that slot argument
+ is not empty string.
-Sat Jun 18 11:12:13 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk/itemconfig.rb (itemconfiginfo): ditto.
- * common.mk: update dependencies.
+ * ext/tk/lib/tk/entry.rb: add TkEntry#icursor and icursor= (alias of
+ cursor and cursor= method).
-Sat Jun 18 11:09:03 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk/font.rb: improve font treatment when the font name is
+ empty string.
- * io.c: suppress warnings.
+ * ext/tk/lib/tk/variable.rb: add :variable, :window and :procedure
+ type.
-Sat Jun 18 10:22:39 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk/variable.rb: improve treatment of array-type
+ tkvariable.
- * internal.h: declare more internal functions.
+ * ext/tk/lib/tkextlib/blt.rb: add commands for zooming.
- * iseq.h (rb_method_get_iseq): declared.
+ * ext/tk/lib/tkextlib/blt/*: bug fix.
- * compile.c, eval.c, eval_error.c, iseq.c, parse.y, proc.c, range.c,
- ruby.c, time.c, util.c, vm.c: don't declare internal functions.
+ * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and add methods
+ to call TreeCtrl commands for bindings.
- * eval.c, parse.y, thread_pthread.c: non-existing function declarations
- removed.
+ * ext/tk/sample/tkextlib/blt/*: new sample scripts.
-Sat Jun 18 08:12:54 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/sample/tkextlib/treectrl/*: ditto.
- * common.mk: dependencies updated.
+Fri Mar 25 10:53:16 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * tool/update-deps: new file to assist update dependencies in
- common.mk.
+ * configure.in (WIN32_LEAN_AND_MEAN): removed because a lot of
+ troubles. [ruby-list:40721]
-Sat Jun 18 07:27:27 2011 Tanaka Akira <akr@fsij.org>
+Thu Mar 24 23:10:44 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * internal.h: declare internal functions here.
+ * lib/mkmf.rb (macro_defined?): try to compile for an old compiler
+ which doesn't bail out at #error directive. [ruby-dev:25818]
- * node.h: declare NODE dependent internal functions here.
+ * lib/mkmf.rb (check_sizeof): refine logging messages.
- * iseq.h: declare rb_iseq_t dependent internal functions here.
+Thu Mar 24 03:57:48 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * vm_core.h: declare rb_thread_t dependent internal functions here.
+ * lib/webrick/utils.rb (WEBrick::Utils.create_listeners):
+ - should raise ArgumentError if no port is specified.
+ - even if the specified port is 0, all TCPServers should be
+ initialized with the port given to the first one.
- * bignum.c, class.c, compile.c, complex.c, cont.c, dir.c, encoding.c,
- enumerator.c, error.c, eval.c, file.c, gc.c, hash.c, inits.c, io.c,
- iseq.c, load.c, marshal.c, math.c, numeric.c, object.c, parse.y,
- proc.c, process.c, range.c, rational.c, re.c, ruby.c, string.c,
- thread.c, time.c, transcode.c, variable.c, vm.c,
- tool/compile_prelude.rb: don't declare internal functions declared
- in above headers. include above headers if required.
+ * lib/webrick/server.rb (WEBrick::GenericServer#initialize): if :Port
+ parameter is 0, it should be updated with the port number which
+ actually listened.
- Note that rb_thread_mark() was declared as
- void rb_thread_mark(rb_thread_t *th) in cont.c but defined as
- void rb_thread_mark(void *ptr) in vm.c. Now it is declared as
- the later in internal.h.
+Wed Mar 23 00:35:10 2005 Shugo Maeda <shugo@ruby-lang.org>
-Sat Jun 18 02:36:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * test/ruby/test_settracefunc.rb (test_event): added tests for
+ "class" and "end" and "raise".
- * ext/bigdecimal/bigdecimal.c (VpNewRbClass): fix type of the 2nd
- argument.
+Tue Mar 22 22:40:18 2005 Shugo Maeda <shugo@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.h: ditto.
+ * eval.c (rb_call0): check event_hooks instead of trace_func.
-Sat Jun 18 02:30:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Tue Mar 22 17:30:44 2005 Shugo Maeda <shugo@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigMath_s_exp): move BigMath.exp from
- bigdecimal/math.rb.
+ * eval.c (rb_add_event_hook): new function to add a hook function for
+ interpreter events. (backported form HEAD)
- * ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
+Sun Mar 20 22:51:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb: move test for BigMath.exp from
- test/bigdecimal/test_bigmath.rb.
+ * lib/mkmf.rb (mkmf_failed): check if Makefile is created without
+ create_makefile.
- * test/bigdecimal/test_bigmath.rb: ditto.
+Sat Mar 19 23:48:10 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jun 18 00:20:54 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * misc/ruby-mode.el (ruby-expr-beg): returned true always.
+ fixed: [ruby-list:40683]
- * ext/date/date_core.c: do not define wnum[01].
+Sat Mar 19 00:41:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Jun 17 18:57:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk/font.rb: add some TkFont class methods to get font
+ information without creating a TkFont object.
- * compile.c (iseq_compile_each): fix return value of obj[a,*b]=c.
+ * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and define some
+ classes for components of Tk::TreeCtrl
-Fri Jun 17 13:09:45 2011 Eric Hodel <drbrain@segment7.net>
+Thu Mar 17 17:42:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/curses/curses.c: Clean up documentation.
+ * struct.c (make_struct): allow non local-id field
+ names. [ruby-core:04575]
-Fri Jun 17 09:25:14 2011 Eric Hodel <drbrain@segment7.net>
+ * struct.c (inspect_struct): ditto.
- * ext/curses/curses.c: Document curses constants. Patch by Vincent
- Batts. [Ruby 1.9 - Bug #4880]
+Wed Mar 16 23:36:02 2005 Shugo Maeda <shugo@ruby-lang.org>
-Fri Jun 17 09:11:05 2011 Eric Hodel <drbrain@segment7.net>
+ * eval.c (rb_call0): call_cfunc() should be protected.
- * object.c: Document Module#method_added and #method_removed.
- Patch by Bryce Kerley. [Ruby 1.9 - Feature #4867]
+ * test/ruby/test_settracefunc.rb: added test for c-return.
-Fri Jun 17 08:50:16 2011 Eric Hodel <drbrain@segment7.net>
+Wed Mar 16 22:20:25 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * io.c: Improve documentation of IO and File open and new.
- Patch by Roger Pack. [Ruby 1.9 - Bug #4790]
+ * object.c (str_to_id): fixed typo.
-Fri Jun 17 07:53:50 2011 Eric Hodel <drbrain@segment7.net>
+Wed Mar 16 18:08:32 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/csv.rb: Document #raw_encoding. Patch by David Czarnecki.
- [Ruby 1.9 - Bug #4874]
+ * eval.c (rb_call0): reorganize "return" event post.
-Fri Jun 17 07:46:50 2011 Eric Hodel <drbrain@segment7.net>
+Tue Mar 15 23:49:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/benchmark.rb: Document Benchmark::Tms#memberwise. Patch by
- David Czarnecki. [Ruby 1.9 - Bug #4873]
+ * ext/iconv/iconv.c (Init_iconv): InvalidEncoding also should include
+ Iconv::Failure.
-Fri Jun 17 07:38:31 2011 Eric Hodel <drbrain@segment7.net>
+Tue Mar 15 16:38:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/prettyprint.rb: Improve documentation. Patch by Ysiad
- Ferreiras. [#4834]
+ * ext/tk/tkutil.c (ary2list): give wrong arguments to hash2kv()
-Fri Jun 17 07:23:03 2011 Eric Hodel <drbrain@segment7.net>
+Mon Mar 14 19:39:33 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * array.c (rb_ary_drop): Improve documentation. Patch by Caley Woods.
- [Ruby 1.9 - Bug #4858]
+ * ext/tk/lib/tk/timer.rb (TkTimer): forgot to clear @return_value
+ when restarting
-Fri Jun 17 06:11:31 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/sample/cd_timer.rb: new sample of TkRTTimer
- * lib/webrick/log.rb: Improve documentation of BasicLog and Log.
- Patch by Olivier Brisse. [Ruby 1.9 - Bug #4833]
- * lib/webrick/httpstatus.rb: Improve documentation of
- WEBrick::HTTPStatus. Patch by Olivier Brisse.
- [Ruby 1.9 - Bug #4833]
+Mon Mar 14 12:21:03 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Jun 17 04:48:22 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/lib/tk/timer.rb (TkRTTimer): forgot to reset the callback
+ time. So, 'continue' do all callbacks between 'stop' and 'continue'.
- * thread_pthread.c, thread_pthread.h: remove unused variables.
- (native_thread_data_t::gvl_cond, native_thread_data_t::gvl_next)
+Mon Mar 14 08:14:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 16 14:32:31 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * object.c (str_to_id): warn for NUL containing strings.
- * time.c (rb_time_new): prevent overflow by "* 1000".
+Mon Mar 14 00:13:49 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Jun 17 03:07:36 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/lib/tk/timer.rb (TkRTTimer): correct calculation of offset
+ value. get a little better accuracy.
- * benchmark/bm_vm4_thread_create_join.rb,
- benchmark/bm_vm4_thread_mutex[1-3].rb: renamed to
- bm_thread_* (fix last rename).
+ * ext/tk/sample/demos-en/widget: use a binding with no local variables
+ when eval a sample script.
-Fri Jun 17 02:26:47 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/sample/demos-en/bind.rb: ditto.
- * thread_pthread.c (native_thread_create): fix debug message.
- (add last newline)
+ * ext/tk/sample/demos-en/tcolor: ditto.
-Thu Jun 16 23:40:49 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/sample/demos-jp/widget: ditto.
- * thread.c (rb_thread_schedule_rec): fix {UN,}LIKELY macro misuse.
- * gc.c (rb_newobj): ditto.
- * vm_insnhelper.c (vm_method_search): ditto.
+ * ext/tk/sample/demos-jp/bind.rb: ditto.
-Thu Jun 16 20:06:15 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/tk/sample/demos-jp/tcolor: ditto.
- * test/testunit/test_parallel.rb: Fix Regexp for test.
+Sun Mar 13 10:04:17 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/testunit/tests_for_parallel/test_third.rb: Use
- Test::Unit::TestCase#on_parallel_worker? for detecting worker.
+ * test/rinda/test_rinda.rb: remove test_gc. [ruby-dev:25871]
- * lib/test/unit/testcase.rb(Test::Unit::TestCase#on_parallel_worker?):
- New Method Test::Unit::TestCase#on_parallel_worker? returns true
- when a testcase is running on parallel worker.
- * lib/test/unit/parallel.rb(Test::Unit::TestCase#on_parallel_worker?):
- ditto.
+Thu Mar 10 19:12:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Jun 16 19:27:12 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c (lib_eventloop_ensure): mis-delete a timer
+ handler when exit from a recursive called eventloop
- * test/test_securerandom.rb: Add testcase. This testcase does NOT aim
- to test cryptographically strongness and randomness. It includes
- the test for PID recycle issue of OpenSSL described in #4579 but
- it's disabled by default.
+ * ext/tk/lib/tk/timer.rb: new TkRTTimer class, which can works for a
+ realtime operation
-Thu Jun 16 17:55:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/sample/tkrttimer.rb: sample of TkRTTimer class
- * test/ruby/test_io.rb (TestIO#test_copy_stream_socket): fix
- test hanging up issue. Patch by CHIKANAGA Tomoyuki.
+ * ext/tk/lib/tk/textmark.rb: move TkTextMark#+ and TkTextMark#- to
+ TkText::IndexModMethods
-Thu Jun 16 15:17:39 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/text.rb: improve TkTextMark#+ and TkTextMark#-, and
+ add them to TkText::IndexModMethods module
- * variable.c (const_missing): Add simple example of const_missing.
- Patch by Anuj Dutta. [Ruby 1.9 - Bug #4794]
+ * ext/tk/sample/tktextio.rb: add test part of "seek by text index
+ modifiers"
-Thu Jun 16 15:09:29 2011 Eric Hodel <drbrain@segment7.net>
+Thu Mar 10 08:10:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/monitor.rb: Improve documentation. Patch by Sandor Szucs.
- [Ruby 1.9 - Bug #4823]
+ * re.c (make_regexp): need to free internal regexp structure when
+ compilation fails. [ruby-talk:133228]
-Thu Jun 16 14:54:09 2011 Eric Hodel <drbrain@segment7.net>
+Wed Mar 9 20:25:58 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/webrick/utils.rb: Document WEBrick::Utils. Patch by Olivier
- Brisse. [Ruby 1.9 - Bug #4819]
+ * ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_write): call
+ rb_sys_fail if errno isn't 0. [ruby-dev:25831]
-Thu Jun 16 14:26:46 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/openssl/lib/openssl/cipher.rb: fix typo. [ruby-dev:24285]
- * lib/webrick/httpservlet/erbhandler.rb: Allow the ERB document to
- alter the content-type of the response. [Ruby 1.9 - Bug #4685]
+Wed Mar 9 15:46:35 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Thu Jun 16 14:15:47 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/webrick/server.rb (WEBrick::GenericServer#start): should
+ restore @token if accept failure. suggested by Dominique Brezinski.
+ [ruby-core:04518]
- * lib/timeout.rb: Clarify timeout duration types. Patch by Alf Mikula.
- [Ruby 1.9 - Bug #4791]
- * lib/net/http.rb: ditto
+Wed Mar 9 13:37:57 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Jun 16 13:25:25 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/sample/tktextio.rb: fix bug of handling 'end' position.
+ support initial text, overwrite setting and pos_gravity control.
- * lib/rdoc*: Import RDoc 3.7 release candidate
+Tue Mar 8 18:16:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Jun 16 11:35:09 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/tk/sample/tktextio.rb: New sample script. TkTextIO class in this
+ sample supports to use a text widget as if it is a I/O stream (such
+ like as StringIO class).
- * lib/net/imap.rb (search_response): parses SEARCH responses from
- the Yahoo IMAP server correctly. patched by Mark Nadig. [Bug #4509]
+Tue Mar 8 13:54:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Jun 16 09:12:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c: workaround for some of 4.4BSD-Lite derived OSs.
- * fix for build on solaris 10.
+Tue Mar 8 12:36:17 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 16 09:08:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c: document from Sam Roberts
+ <sroberts@uniserve.com> for getsockopt and setsockopt is merged.
+ [ruby-doc:824]
- * test/io/console/test_io_console.rb (TestIO_Console#test_sync):
- fix for daemon process.
+Tue Mar 8 01:27:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Jun 16 07:58:01 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.66
+ fixed: [ruby-dev:25828]
- * test/testunit/test_parallel.rb(test_ignore_tzero): Test for r32109.
+Mon Mar 7 21:35:02 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/testunit/tests_for_parallel/test_third.rb: Use another way to
- detect that test is running on worker. This fixes sometimes
- TestParallel failing.
+ * sample/webrick/httpsd.rb: fix typo in comment. suggested by
+ Kazuhiko Shiozaki.
-Thu Jun 16 07:20:06 2011 Shota Fukumori <sorah@tubusu.net>
+Mon Mar 7 14:55:43 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/test/unit.rb(Test::Unit::Runner#_run_parallel): Ignore -j0
- because it makes blocking forever by IO.select.
+ * eval.c (block_pass): should not push unique number if a block is
+ not an orphan. [ruby-dev:25808]
-Thu Jun 16 03:08:11 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Feb 16 02:55:21 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/testunit/test_parallel.rb (TestParallel::TestParallelWorker#
- setup): now can run on Windows, probably.
+ * ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_read,
+ ossl_ssl_write):
+ - need to set errno on Win32 platform.
+ - should call rb_sys_fail instead of rasing SSLError if
+ SSL_ERROR_SYSCALL occured.
+ - should wait for that the underlying IO become readable or
+ writable if the error was SSL_ERROR_WANT_READ or
+ SSL_ERROR_WANT_WRITE. [ruby-dev:25795]
- * test/testunit/test_parallel.rb (TestParallel::TestParallel#setup):
- ditto.
+ * ext/openssl/lib/openssl/buffering.rb
+ (Buffering#initialize): should set @eof and @rbuffer.
+ (Buffering#fill_rbuff): should rescue Errno::EAGAIN.
+ (Buffering#consume_rbuf): pointless eof flag resetting is deleted.
+ (Buffering#read): should return an empty string if the specified
+ size is zero.
+ (Buffering#readpartial): new method.
+ (Buffering#readline): fix typo.
+ (Buffering#getc): return the first character of string correctly.
+ (Buffering#each): fix typo. suggested by Brian Ollenberger.
+ (Buffering#readchar): fix typo.
+ (Buffering#eof?): should read again it the input buffer is empty.
+ (Buffering#do_write): should rescue Errno::EAGAIN.
+ (Buffering#puts): use "\n" as the output field separator.
-Thu Jun 16 03:00:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/lib/openssl/ssl.rb: set non-blocking flag to the
+ underlying IO.
- * thread.c (do_select): Windows: no need to poll if select(2) is
- cancelable.
+ * ext/openssl/extconf.rb: get rid of GNUmakefile generation.
- * thread_win32.c (native_fd_select): new function to make select(2)
- cancelable.
+ * text/openssl/test_pair.rb: test for IO like methods.
- * thread_win32.c (rb_w32_check_interrupt): new function for checking
- interrupt.
+ * test/ruby/ut_eof.rb: test about empty file.
- * win32/win32.c (rb_w32_select_with_thread): new function. cancelable
- select(2).
+Mon Mar 7 10:22:06 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * win32/win32.c (rb_w32_select): use above function internally.
+ * lib/un.rb: should use OptionParser. (backported form HEAD)
-Wed Jun 15 23:30:45 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Mar 7 09:18:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * gc.c: fix a regression by r31690 on AIX because AIX malloc
- return NULL if it's passed 0. But some caller don't expect it.
- patch by Yutaka Kanemoto. [ruby-dev:43779]
- (vm_malloc_prepare): return calculated size.
- (vm_xmalloc): use above result.
- (vm_xcalloc): ditto.
+ * string.c (rb_str_cmp_m): should not return false but nil.
+ fixed: [ruby-dev:25811]
-Wed Jun 15 23:11:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Mar 7 01:22:14 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread.c: remove BLOCKING_REGION_CORE() macro. It's no longer used
- since r32022.
+ * ext/tk/tkutil.c: remove the some codes which depend on the
+ difference between Ruby1.8 and 1.9, because st.c on Ruby1.9
+ was changed.
-Wed Jun 15 21:00:47 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Mon Mar 7 00:01:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/openssl/test_config.rb: execute based on the existence of the
- OpenSSL module.
+ * ext/tcltklib/tcltklib.c: fail to call TclTkLib.mainloop when $SAFE==4
-Wed Jun 15 12:35:11 2011 Tanaka Akira <akr@fsij.org>
+Sun Mar 6 16:41:33 2005 Minero Aoki <aamine@loveruby.net>
- * test/ruby/test_io.rb (test_copy_stream_socket): wait a child process
- before SIGUSR1 handler is removed.
+ * lib/net/http.rb: HTTPHeader holds its header fields as an array
+ (backport from CVS HEAD rev 1.112-1.123). [ruby-list:40629]
- * test/pathname/test_pathname.rb (define_assertion): use line number
- for test method names.
+ * test/net/http/test_httpheader.rb: new file.
-Wed Jun 15 10:37:43 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Mar 6 11:47:10 2005 Sam Roberts <sroberts@uniserve.com>
- * file.c (rb_stat_rdev): use DEVT2NUM.
+ * lib/pp.rb: rdoced. [ruby-core:4490]
- * file.c (rb_stat_rdev_major): ditto.
+Sun Mar 6 11:36:37 2005 Tanaka Akira <akr@m17n.org>
- * file.c (rb_stat_rdev_minor): ditto.
+ * lib/pp.rb (File::Stat#pretty_print): Etc.getpwuid and Etc.getgrgid
+ may return nil. [ruby-talk:129826]
+ reported by Daniel Berger.
-Wed Jun 15 05:12:59 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat Mar 5 18:06:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/tk/tcltklib.c (lib_eventloop_core): revert the last change (it's
- the part for ruby_1_8), and use rb_thread_check_ints() when RUBY_VM
- is defined.
+ * dir.c (fnmatch): removed unnecessary code. (ruby_1_8 didn't have
+ String#clear, so [ruby-dev:24749] didn't affect it)
-Wed Jun 15 04:42:47 2011 Koichi Sasada <ko1@atdot.net>
+ * win32/win32.c (NtInitialize): ditto. (by numeric.c 1.101.2.14)
- * benchmark/bm_vm3_thread_*.rb: renamed bm_vm3_thread_*.rb to
- benchmark/bm_vm_thread_*.rb.
+Sat Mar 5 16:29:26 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Jun 15 04:28:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/multi-tk.rb: freeze callback-entry objects
- * benchmark/bm_vm4_thread_pass.rb: rename bm_vm4* to
- bm_vm_thread_*. suggested by ko1.
- * benchmark/bm_vm4_pipe.rb: ditto.
- * benchmark/bm_vm4_alive_check1.rb: ditto.
- * benchmark/bm_vm4_pass_flood.rb: ditto.
+ * ext/tk/lib/tkextlib/tile.rb: support tile-0.6
-Wed Jun 15 03:52:50 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Mar 4 19:39:28 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * benchmark/bm_vm4_pass_flood.rb: new benchmark for GVL fairness.
- * benchmark/bm_vm4_alive_check1.rb: ditto.
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#do_includes): replace
+ also locally defined modules.
-Wed Jun 15 01:27:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/iconv/iconv.c: backport Iconv::InvalidEncoding from CVS HEAD.
- * thread_pthread.c (gvl_yield): fix live lock issue on 1-2 cpus
- system. It's additional fix for r32021.
- * thread_pthread.c (gvl_init): add switch_wait_cond.
- * thread_pthread.h (typedef struct rb_global_vm_lock_struct): ditto.
+ * ext/strscan/strscan.c: moved misplaced rdoc.
-Tue Jun 14 23:16:22 2011 Tanaka Akira <akr@fsij.org>
+Fri Mar 4 15:58:12 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * bootstraptest/runner.rb (show_progress): refine verbose mode.
- (exec_test): ditto.
+ * lib/cgi-lib.rb: add deprecation warning. [ruby-dev:25499]
+ getopts.rb, parsearg.rb, importenv.rb as well.
-Tue Jun 14 23:02:36 2011 Tanaka Akira <akr@fsij.org>
+Fri Mar 4 11:17:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * bootstraptest/runner.rb (show_progress): extracted from assert_check.
- (assert_check): use show_progress.
- (assert_normal_exit): ditto.
- (assert_finish): ditto.
- (flunk): ditto.
+ * ext/tcltklib/tcltklib.c (ip_rbUpdateCommand): get rid of
+ warnings with Tcl/Tk 8.3 or former (backport from CVS_HEAD).
-Tue Jun 14 22:51:42 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tcltklib/tcltklib.c (ip_rb_threadUpdateCommand): ditto.
- * test/date/test_*.rb: added tests.
+Fri Mar 4 10:15:30 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Jun 14 22:09:58 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/set.rb (SortedSet::setup): a hack to shut up warning.
+ [ruby-talk:132866]
- * ext/date/date_core.c: renamed some functions.
- * ext/date/date_core.c: modified doc.
+Fri Mar 4 07:07:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Jun 14 21:26:01 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.63
- * cont.c (cont_save_thread): add new utility function.
- rb_context_t::saved_thread.machine_stack_start and
- machine_stack_end should be cleared immediately after a snapshot of
- current thread is stored to saved_thread. [ruby-dev:43680] [Bug #4855]
- this change aims to get rid of unnecessary GC mark at machine stack.
+Thu Mar 3 23:49:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-Tue Jun 14 19:50:49 2011 Tanaka Akira <akr@fsij.org>
+ * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.62
- * test/ruby/test_autoload.rb: remove temporary directory.
+Thu Mar 3 11:49:51 2005 Kouhei Sutou <kou@cozmixng.org>
-Tue Jun 14 11:05:03 2011 Narihiro Nakamura <narihiro@netlab.jp>
+ * sample/rss/tdiary_plugin/rss-recent.rb: added site information.
- * gc.c (rb_gc_set_params): call initial_expand_heap if
- initial_heap_min_slots is set.
+Wed Mar 2 19:53:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jun 14 11:02:08 2011 Narihiro Nakamura <narihiro@netlab.jp>
+ * ext/extmk.rb (parse_args): add DESTDIR only when not directed
+ already. fixed: [ruby-dev:25781]
- * gc.c: use size_t.
+Wed Mar 2 17:14:18 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Jun 14 01:10:38 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/tcltklib/tcltklib.c (lib_eventloop_core): fix typo
- * test/coverage/test_coverage.rb: add a test for restart. a patch
- from Xavier Shay. [ruby-core:36745]
+Wed Mar 2 16:00:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Jun 14 01:05:10 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/tcltklib/tcltklib.c: enforce thread-check and exception-handling
+ to avoid SEGV trouble.
+ [KNOWN BUG] When supports pthread and running multiple Tk
+ interpreters, an interrupt signal causes SEGV frequently. That
+ may be a trouble of Ruby's signal handler.
- * ext/coverage/coverage.c: make it restartable. [ruby-core:36539]
+ * ext/tk/tkutil/tkutil.c; fix a bug on converting a SJIS string array
+ to a Tcl's list string.
-Mon Jun 13 23:55:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/tcltklib.c: wrap Tcl's original "namespace" command to
+ protect from namespace crash.
- * thread.c (rb_thread_schedule_rec): call gvl_yield() unconditionally.
- * thread_pthread.c: remove HAVE_GVL_YIELD macro.
- * thread_win32.c (gvl_yield): new. this fallback logic was moved from
- rb_thread_schedule_rec().
+ * ext/tk/lib/multi-tk.rb: enforce exception-handling.
-Mon Jun 13 23:50:25 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: catch IRB_EXIT to work on irb.
- * ext/io/console/console.c (console_dev): typo.
+ * ext/tk/lib/tk.rb: ditto.
-Mon Jun 13 23:38:23 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/tcltklib.c: add TclTkLib.mainloop_thread?
- * parse.y (parser_parse_string): flush delayed token. based on a
- patch by Masaya Tarui in [ruby-dev:43762]. Bug #4544
+ * ext/tk/lib/multi-tk.rb: (bug fix) callback returns a value.
- * parse.y (yylex): revert r24557. delayed token at the end of
- string should be flushed already by the above change.
+ * ext/tk/lib/tk/canvas.rb (delete): bug fix when multiple arguments.
-Mon Jun 13 23:33:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/clock.rb: fix 'no method error'.
- * ext/io/console/console.c (console_dev): console should be
- unbuffered.
+ * ext/tk/lib/clock.rb (self.clicks): accept a Symbol argument.
- * ext/io/console/console.c (console_dev): take care of no-ctty
- case.
+ * ext/tk/lib/variable.rb: be able to set default_value_type; :numeric,
+ :bool, :string, :symbol, :list, :numlist or nil (default; same to
+ :string). If set a type, TkVariable#value returns a value of the
+ type.
-Mon Jun 13 23:06:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tkextlib/tclx/tclx.rb: add Tk::TclX.signal to warn the
+ risk of using TclX extension's 'signal' command.
- * thread_pthread.c: rewrite GVL completely. This fix improve some
- benchmark dramatically (e.g. vm3_thread_mutex result changed
- form 120.601sec to 3.426sec).
- * thread_win32.c: ditto.
- * thread_pthread.h: ditto.
- * vm_core.h: ditto.
- * thread.c: ditto.
+ * ext/tk/sample/irbtk.rb: irb with Ruby/Tk.
-Mon Jun 13 23:11:52 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/sample/demos-*/anilabel.rb: bug fix on 'show code'
- * test/socket/test_unix.rb: don't use Thread.abort_on_exception.
+ * ext/tk/sample/demos-*/aniwave.rb: new Ruby/Tk animation demo.
-Mon Jun 13 23:05:01 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/sample/demos-*/pendulum.rb: ditto.
- * ext/socket/unixsocket.c (unix_send_io): race condition fixed.
- (unix_recv_io): ditto.
- fixed by Eric Wong. [ruby-core:35574]
+ * ext/tk/sample/demos-*/goldberg.rb: ditto.
- * test/socket/test_unix.rb: test added for above problem.
+ * ext/tk/sample/demos-*/widget: add entries of animation demos.
-Mon Jun 13 21:41:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Mar 1 00:47:43 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * thread_win32.c (native_cond_signal): remove unnecessary rb_bug().
- It's additional fix for r32021. [Bug #4696]
+ * test/rinda/test_rinda.rb: backport from CVS_HEAD. use
+ MockClock.sleep instead of Kernel.sleep [ruby-dev:25387]
-Mon Jun 13 20:50:49 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Tue Mar 1 00:34:24 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/openssl/test_ec.rb
- test/openssl/test_pkey_ec.rb: merge both files into test_pkey_ec.rb.
- Removed redundant group instantiation from PKey tests.
- * test/openssl/utils.rb: only create TEST_PKEY_EC_P256V1 if EC is
- defined.
+ * lib/rinda/tuplespace.rb (Rinda::TupleSpace): improved keeper thread.
-Mon Jun 13 20:28:24 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * test/rinda/test_rinda.rb: ditto.
- * test/openssl/digest.rb: remove MDC2 from test, it is not available
- by default in an OpenSSL installation.
+Mon Feb 28 11:42:23 2005 Ian Macdonald <ian@caliban.org>
-Mon Jun 13 20:18:55 2011 Koichi Sasada <ko1@atdot.net>
+ * exception error messages updated. [ruby-core:04497]
- * vm_core.h, vm_insnhelper.h: move decl. of
- ruby_vm_global_state_version and related macros
- from vm_core.h to vm_insnhelper.h.
+Mon Feb 28 09:03:09 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (vm_clear_all_cache): added. This function is called
- when ruby_vm_global_state_version overflows.
- TODO: vm_clear_all_inline_method_cache() is only place holder.
- We need to implement it ASAP.
+ * ext/socket/socket.c (Init_socket): add bunch of Socket
+ constants. Patch from Sam Roberts <sroberts@uniserve.com>.
+ [ruby-core:04409]
- * vm_method.c (vm_clear_global_method_cache): added.
+Wed Feb 23 15:04:32 2005 akira yamada <akira@ruby-lang.org>
-Mon Jun 13 19:46:21 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * lib/uri/generic.rb (split_userinfo): should split ":pass" into ""
+ and "pass". [ruby-dev:25667]
- * lib/cmath.rb: add new method Object#real?. fix #3137
+Wed Feb 23 08:00:18 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Jun 13 18:52:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * array.c (rb_ary_s_create): no need for negative argc check.
+ [ruby-core:04463]
- * ext/bigdecimal/bigdecimal.c (is_kind_of_BigDecimal): new function to
- examine the whether the object is kind of BigDecimal.
+ * array.c (rb_ary_unshift_m): ditto.
-Mon Jun 13 18:49:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Wed Feb 23 01:57:46 2005 Shugo Maeda <shugo@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimalCmp): use GetVpValueWithPrec
- for Float and Rational arguments.
+ * lib/net/imap.rb (initialize): handle certs correctly. Thanks,
+ NABEYA Kenichi. (backported from CVS HEAD)
- * test/bigdecimal/test_bigdecimal.rb (test_new, test_cmp, test_power):
- add and modify tests for the above change.
+Tue Feb 22 07:25:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimalCmp): modify coding style to
- match ruby's standard.
+ * parse.y (parser_yylex): identfier after dot must not be a variable.
-Mon Jun 13 18:33:04 2011 Tanaka Akira <akr@fsij.org>
+Mon Feb 21 10:04:49 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/securerandom.rb (SecureRandom.random_bytes): modify PRNG state
- to prevent random number sequence repetition at forked child
- process which has same pid.
- reported by Eric Wong. [ruby-core:35765]
+ * {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
-Mon Jun 13 17:02:34 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/win32.[ch] (fcntl): ditto.
- * lib/net/http.rb (Net::HTTP#use_ssl?): require 'openssl' only when
- https is needed. fixes r31933.
+ * win32/win32.c (rb_w32_connect): support nonblocking mode.
-Mon Jun 13 14:35:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/socket/socket.c (wait_connectable, ruby_connect): support
+ nonblocking connect on various platforms.
+ all changes are backported from CVS HEAD. [ruby-core:3154],
+ [ruby-core:4364].
- * lib/cmath.rb (CMath.cbrt): returns the principal value of the cube
- root of the argument. fix #3676
+Sun Feb 20 00:48:48 2005 Tanaka Akira <akr@m17n.org>
- * test/test_cmath.rb (test_cbrt_returns_principal_value_of_cube_root):
- test for the above change.
+ * lib/open-uri.rb (URI::FTP#buffer_open): access mechanism
+ re-implemented according to RFC 1738.
+ reported by Guillaume Marcais. [ruby-talk:131650]
-Mon Jun 13 14:17:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Sat Feb 19 18:11:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/test/unit.rb (Test::Unit::GlobOption#non_options): fix typo.
+ * lib/drb/drb.rb (DRbObject#respond_to?): take two arguments.
+ [ruby-dev:25722]
-Mon Jun 13 13:04:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * test/drb/drbtest.rb: ditto.
- * ext/openssl/ossl_digest.c: fix error for digests that have no oid
- (e.g. DSS1).
- * test/openssl/test_digest.c: add tests for this.
+Sat Feb 19 13:52:02 2005 Tanaka Akira <akr@m17n.org>
-Mon Jun 13 12:51:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/open-uri.rb: call OpenSSL::SSL::SSLSocket#post_connection_check
+ after connection is made.
- * lib/yaml.rb: load psych only when syck is not loaded.
+Sat Feb 19 01:32:03 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Jun 13 12:23:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/bigdecimal/lib/bigdecimal/newton.rb: resolved LoadError.
+ [ruby-dev:25685]
-Mon Jun 13 12:23:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/bigdecimal/sample/linear.rb: ditto.
- * ext/psych/lib/psych/deprecated.rb (Object#to_yaml_properties):
- undef to_yaml_properties before redefine it.
+ * ext/bigdecimal/sample/nlsolve.rb: ditto.
- * ext/syck/lib/syck/rubytypes.rb: ditto.
+ * ext/bigdecimal/lib/bigdecimal/nlsolve.rb: removed because this file
+ is sample script and same file exists in ext/bigdecimal/sample.
-Mon Jun 13 11:30:10 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Fri Feb 18 17:14:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_digest.c: allow Digests to be created by sn, ln or
- oid.
- * test/openssl/test_digest.rb: add tests for this.
- [Ruby 1.9 - Feature #4412] [ruby-core:35319]
+ * lib/xmlrpc/parser.rb (XMLRPC::FaultException): make it subclass
+ of StandardError class, not Exception class. [ruby-core:04429]
-Mon Jun 13 10:54:03 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Feb 17 20:11:18 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/openssl/pkey_dh.c: corrected documentation.
- * test/openssl/utils.rb: add test key for DH.
- * test/openssl/test_pkey_dh.rb: add tests.
+ * lib/drb/drb.rb (DRbServer.default_safe_level): fix typo.
-Mon Jun 13 10:13:08 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Feb 17 20:11:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/pkey_dh.c: clarify difference between DH#public_key and
- DH#pub_key in documentation.
+ * test/digest/test_digest.rb: separate test case for each algorithms.
+ [ruby-dev:25412]
-Mon Jun 13 05:50:43 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Feb 17 11:54:00 2005 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * NEWS: introduce PKey.read.
+ * lib/test/unit/collector.rb (collect_file): now deletes paths added
+ to $LOAD_PATH instead of restoring it verbatim.
-Mon Jun 13 05:17:29 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/test/unit/autorunner.rb (AutoRunner.run): fixed so that
+ 'ruby -rtest/unit -rtest1 -rtest2 -e0' will use the objectspace
+ collector again. Also tried to simplify the calling convention.
- * ext/openssl/ossl_pkey.c: added PKey.read module function that allows
- reading arbitrary public/private keys from DER-/PEM-encoded File or
- string instances.
- * ext/openssl/ossl_pkey_dh.c: improved documentation.
- * test/openssl/utils.rb: added EC test key.
- * test/openssl/test_pkey_rsa.rb
- test/openssl/test_pkey_dsa.rb: Test PKey.read. Reuse keys from
- OpenSSL::TestUtils.
- * test/openssl/test_pkey_ec.rb: Created test file for EC tests.
- Test PKey.read.
- [Ruby 1.9 - Feature #4424] [ruby-core:35330]
+ * test/runner.rb: adjusted for new AutoRunner semantics.
-Mon Jun 13 04:42:24 2011 Koichi Sasada <ko1@atdot.net>
+ * lib/test/unit.rb: ditto.
- * ext/objspace/objspace.c (total_i): fix to skip no ruby objects.
+Thu Feb 17 04:21:47 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Jun 13 03:07:38 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/open3.rb (Open3::popen3): $? should not be EXIT_FAILURE.
+ fixed: [ruby-core:04444]
- * test/benchmark/test_benchmark.rb (capture_output):
- replace '-' as space. On NetBSD, subtract between two Process.times
- after and before the short process may return negative value like:
- t0=Process.times; yield; t1=Process.times; p t1.utime-t0.utime
+Thu Feb 17 00:09:45 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Mon Jun 13 02:40:23 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * test/drb/ignore_test_drb.rb: move TestDRbReusePort to new file
+ [ruby-dev:25238]
- * test/openssl/test_pkey_dsa.rb: Test for DSA#syssign/sysverify.
+ * test/drb/test_drb.rb: add method DRbService.ext_service, move
+ TestDRbReusePort to new file [ruby-dev:25238]
-Mon Jun 13 01:59:19 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * test/drb/test_drb.rb: ditto.
- * ext/openssl/ossl_pkey_dh.c: completed documentation.
- * ext/openssl/ossl_pkey_dsa.c: corrected examples. Improved parameter
- sections.
+ * test/drb/test_drbssl.rb: ditto.
+
+ * test/drb/test_drbunix.rb: ditto.
+
+ * test/drb/ut_drb.rb: reduce sleep.
-Mon Jun 13 00:25:10 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Feb 17 00:02:27 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_pkey_dsa.c: completed documentation.
+ * eval.c (is_defined): NODE_IASGN is an assignment.
-Sun Jun 12 23:36:46 2011 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Wed Feb 16 23:34:30 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/drb/drb.rb (kill_sub_thread): remove the method. [ruby-core:34185]
+ * lib/drb/drb.rb: add lazy stop_service. ([druby-ja:109])
-Sun Jun 12 21:01:56 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/drb/extserv.rb: ditto.
- * ext/date/date_core.c (d_lite_marshal_load): should give converted value.
+Wed Feb 16 17:07:57 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun Jun 12 20:36:30 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/tkutil.c: Follow the change of st.c (st_foreach)
+ [ruby-list:40623].
+ Sometimes mis-convert from a Ruby's Array of SJIS Strings, which
+ includes some kind of SJIS characters, to a Tcl's UTF8 list string.
- * ext/date/date_core.c: edited doc.
+Mon Feb 14 23:58:17 2005 Kouhei Sutou <kou@cozmixng.org>
-Sun Jun 12 18:12:07 2011 Koichi Sasada <ko1@atdot.net>
+ * lib/rss/parser.rb (RSS::ListenerMixin::tag_end):
+ fixed invalid namespace handling bug.
- * benchmark/bm_vm3_clearmethodcache.rb: added.
+Mon Feb 14 13:12:38 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Jun 12 17:40:29 2011 Koichi Sasada <ko1@atdot.net>
+ * ext/openssl/lib/openssl/ssl.rb
+ (OpenSSL::SSL::SSLSocket#post_connection_check): new method.
- * vm_method.c (rb_clear_cache*): update only vm state version.
+Mon Feb 14 00:40:49 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * vm_method.c (rb_method_entry_get_without_cache, rb_method_entry):
- Fill method cache entry with vm state version, and
- check current vm state version for method (cache) look up.
- This modification speed-up invalidating of global method cache table.
- [Ruby 1.9 - Feature #3905] [ruby-core:36908]
+ * lib/drb/drb.rb (InvokeMethod.perform): pass DRb info to sub thread.
-Sun Jun 12 16:19:48 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * test/drb/test_drb.rb (test_01_safe1_safe4_eval): fix test case.
- * ext/tk/extconf.rb: fail on Mac OS X. [Bug #4853][ruby-dev:43655]
+Sun Feb 13 23:13:46 2005 Kouhei Sutou <kou@cozmixng.org>
-Sun Jun 12 15:56:08 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rss/dublincore.rb (RSS::DublicCoreModel#date{,=}): added
+ convenient methods.
- * thread.c: remove th->transition_for_lock. It's thread unsafe.
- [Bug #4723][ruby-dev:43563]
+ * lib/rss/0.9.rb (RSS::Rss::Channel#date{,=}): ditto.
-Sun Jun 12 15:47:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rss/2.0.rb (RSS::Rss::Channel::Item#date{,=}): ditto.
- * thread.c: introduce spurious wakeup safe deadlock check.
- [Bug #4696][ruby-dev:43554]
+ * test/rss/: added tests for the convenient methods.
-Sun Jun 12 13:33:52 2011 Koichi Sasada <ko1@atdot.net>
+Sun Feb 13 22:43:03 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * benchmark/bm_vm3_thread_mutex.rb: remove it.
+ * lib/drb/drb.rb (DRbServer): add default_safe_level, safe_level,
+ config[:safe_level] ([druby-ja:120])
- * benchmark/bm_vm3_thread_mutex[1-3].rb: added 3 benchmarks.
- 1: one thread with one mutex (no contention).
- 2: two threads with one mutex (contention).
- 3: 1000 threads with one mutex (huge number of contention)
- Above removed benchmark was type 3.
- Therefore, this commit adds type 1 and 2 benchmark.
+ * test/drb/test_drb.rb, ut_eval.rb, ut_safe1.rb: ditto.
-Sun Jun 12 11:16:59 2011 Tanaka Akira <akr@fsij.org>
+Sun Feb 13 16:56:52 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * io.c: use select() appropriately for sendfile().
- Fixed by Eric Wong. [ruby-core:36150]
- (maygvl_copy_stream_wait_readwrite): removed.
- (nogvl_copy_stream_sendfile): use nogvl_copy_stream_wait_write and
- maygvl_copy_stream_wait_read instead of
- maygvl_copy_stream_wait_readwrite.
+ * lib/webrick/cgi.rb (WEBrick::CGI.start): should set reason-phrase
+ to the value of status header field. ([ruby-dev:40617])
-Sun Jun 12 09:32:13 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Feb 13 00:52:33 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * atomic.h (ATOMIC_OR): _InterlockedOr is not available on mingw.h
- * gc.c (rb_gc_set_params): VM_OBJSPACE is disabled on mingw.
+ * lib/erb.rb (ERB::Util.h, u): make it module_function.
-Sun Jun 12 01:07:09 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Sat Feb 12 17:29:19 2005 Tanaka Akira <akr@m17n.org>
- * ext/date/date_core.c: edited doc.
+ * lib/open-uri.rb (OpenURI.open_loop): send authentication only for
+ the URI directly specified.
-Sat Jun 11 23:18:00 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Feb 12 15:07:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm_core.h (RUBY_VM_SET_TIMER_INTERRUPT, RUBY_VM_SET_INTERRUPT,
- RUBY_VM_SET_FINALIZER_INTERRUPT): use atomic ops for preventing
- interrupt_flag bit lost. [Bug #4770][ruby-dev:43467]
- * thread.c (rb_threadptr_execute_interrupts_rec): ditto.
- * vm_core.h (typedef struct rb_thread_struct): change type of
- interrupt_flag to rb_atomic_t.
- * atomic.h: move atomic ops definition from signal.c.
- * signal.c: remove atomic ops definition.
- * common.mk (gc, signal, thread, cont): add to dependency to atomic.h.
+ * random.c (rand_init): suppress warning.
-Sat Jun 11 23:23:52 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Sat Feb 12 13:54:03 2005 Tanaka Akira <akr@m17n.org>
- * ext/date/date_core.c: edited doc.
+ * lib/open-uri.rb: support https if the platform provides CA
+ certificates.
-Sat Jun 11 23:02:36 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Sat Feb 12 06:18:28 2005 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
- * ext/openssl/lib/openssl/buffering.rb (module OpenSSL):
- Buffering#each_byte should return String in accordance with IO in
- 1.9.
+ * ext/etc/etc.c (Init_etc): sGroup needs HAVE_ST_GR_PASSWD check.
+ [ruby-dev:25675]
- * test/openssl/test_buffering.rb (class OpenSSL): add tests for getc
- and each_byte.
+Fri Feb 11 17:40:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Jun 11 22:41:37 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths):
+ new method OpenSSL::X509::Store#set_default_paths.
- * time.c: a correction of doc for strftime (%v).
+Fri Feb 11 11:33:53 2005 Tanaka Akira <akr@m17n.org>
-Sat Jun 11 22:30:53 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/open-uri.rb (URI::HTTP#proxy_open): new option supported:
+ :http_basic_authentication.
+ suggested by Kent Sibilev. [ruby-core:4392]
- * ext/date/date_core.c: replaced doc for strftime based on Time's one.
+Fri Feb 11 06:30:07 2005 George Ogata <g_ogata@optushome.com.au>
-Sat Jun 11 22:07:56 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * misc/ruby-mode.el: ignore parenthesis inside heredoc.
+ [ruby-core:04415]
- * ext/date/date_core.c (datetime_s_{iso8601,rfc3339,xmlschema,rfc2822,httpdate}):
- do not take argument comp.
+Fri Feb 11 04:54:13 2005 Tilman Sauerbeck <tilman@code-monkey.de>
-Sat Jun 11 21:58:31 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/rdoc/generators/html_generator.rb: [ruby-core:04412]
- * ext/date/date_core.c: added examples.
+ * lib/rdoc/generators/ri_generator.rb: ditto.
-Sat Jun 11 19:40:45 2011 Narihiro Nakamura <authornari@gmail.com>
+Thu Feb 10 11:14:17 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * gc.c: expand heap if initial_heap_min_slots is bigger than
- HEAP_MIN_SLOTS.
+ * win32/Makefile.sub (COMMON_HEADERS): shouldn't include winsock2.h.
-Sat Jun 11 19:42:50 2011 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/socket/extconf.rb (sockaddr_storage): remove workaround for
+ mswin32.
- * ChangeLog (vim): set shiftwidth to 2.
+Thu Feb 10 10:29:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Jun 11 19:27:06 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/curses/curses.c: don't need to check HAVE_WCOLOR_SET excluding
+ window_color_set().
- * ext/openssl/ossl_x509req.c: raise RequestError instead of
- CertificateError when Request#to_der gets an error from OpenSSL.
- Patch from Ippei Obayashi, see #4420. I cannot write a test for
- this... Request does not allow to create broken bytes...
+Thu Feb 10 00:47:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jun 11 19:34:51 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * struct.c (make_struct): fixed: [ruby-core:04402]
- * ext/date/date_core.c (Date::(ABBR_)?(MONTH|DAY)NAMES): should be usascii.
+Wed Feb 9 08:07:08 2005 Paul Duncan <pabs@pablotron.org>
-Sat Jun 11 19:24:33 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/curses/curses.c (window_color_set): [ruby-core:04393]
- * ext/date/date_core.c: rewrote doc.
+Tue Feb 8 23:51:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Sat Jun 11 19:04:15 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/drb/drb.rb: reject :instance_eval, :class_eval, :module_eval
+ [druby-ja:117]
- * lib/test/unit.rb (Test::Unit::GlobOption#non_options): should run
- with 1.8.
+Tue Feb 8 13:06:12 2005 Sam Roberts <sroberts@uniserve.com>
-Sat Jun 11 18:05:57 2011 WATANABE Hirofumi <eban@ruby-lang.org>
+ * ext/socket/socket.c (Init_socket): SO_REUSEPORT added.
+ [ruby-talk:130092]
- * bootstraptest/runner.rb: should initialize $stress to avoid warnings.
+Tue Feb 8 09:30:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jun 11 18:02:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/cgi.rb (CGI::Cookie): [ruby-talk:130040]
- * io.c (io_getc): should be 7bit if ascii. fixes #4557
+Tue Feb 8 00:19:02 2005 Tanaka Akira <akr@m17n.org>
-Sat Jun 11 16:52:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/resolv.rb (Resolv::DNS::Name#subdomain_of?): new method.
+ (Resolv::DNS::Name#inspect): ditto.
+ Suggested by Sam Roberts. [ruby-talk:129086]
- * numeric.c (rb_enc_uint_chr): fix message format. Bug#4869
+Mon Feb 7 10:06:30 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jun 11 16:28:25 2011 Kouhei Sutou <kou@cozmixng.org>
+ * object.c: [ruby-doc:818]
- * lib/rexml/formatters/pretty.rb
- (REXML::Formatters::Pretty#write_text),
- test/rexml/test_core.rb
- (Tester#test_pretty_format_long_text_finite): don't ignore
- 'width' parameter in pretty formatter. fixes #4498
- Reported by Michael Frasca. Thanks!!!
+Mon Feb 7 01:56:20 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Jun 11 16:11:36 2011 Kouhei Sutou <kou@cozmixng.org>
+ * instruby.rb, rubytest.rb (srcdir): no longer embed srcdir into
+ rbconfig.rb. (backported from CVS HEAD)
- * test/rexml/test_core.rb
- (Tester#test_pretty_format_long_text_finite): remove needless
- assert_nothing_raised.
+ * ext/socket/extconf.rb (sockaddr_storage): winsock2.h have the
+ definition of struct sockaddr_storage, but socket.c doesn't
+ include it because this version of ruby still has binary level
+ compatibility with winsock1.
-Sat Jun 11 16:04:03 2011 Kouhei Sutou <kou@cozmixng.org>
+ * lib/mkmf.rb (create_makefile): should support header files in
+ depend file.
- * lib/rexml/parsers/xpathparser.rb
- (REXML::Parsers::XPathParser#parse),
- test/rexml/test_elements.rb
- (ElementsTester#test_each_with_frozen_condition):
- don't modify original XPath. fixes #4161
- Reported by Pavel Shved. Thanks!!!
+Mon Feb 7 01:21:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jun 11 15:53:27 2011 Kouhei Sutou <kou@cozmixng.org>
+ * ext/socket/extconf.rb: check if getaddrinfo() works fine only when
+ wide-getaddrinfo option is not given. fixed: [ruby-dev:25422]
- * test/rexml/test_elements.rb (ElementsTester): remove needless
- prefix from test name.
+ * lib/mkmf.rb ($extmk): check if under ext directory.
-Sat Jun 11 15:36:36 2011 Martin Duerst <duerst@it.aoyama.ac.jp>
- * common.mk: fixed a grammatical error
+ * lib/mkmf.rb (Logging.postpone): allow recursive operation.
-Sat Jun 11 14:20:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/mkmf.rb (try_constant): make sure if really a constant, reduce
+ the number of times of compile.
- * vm.c (thread_memsize): don't ignore size of th->local_storage.
+ * lib/mkmf.rb (have_macro, have_var, byte_order): new functions.
-Sat Jun 11 10:32:46 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (find_library): allow directory list with separators.
- * lib/mkmf.rb: should quote arch_hdrdir and libpath for the case
- installed prefix contains spaces.
+ * lib/mkmf.rb (arg_config): manage provided configuration options.
-Sat Jun 11 10:20:52 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (dir_config): accept arrays of directory names as
+ default values.
- * thread_pthread.c (native_cond_timeout): wrap conditionally used
- label.
+ * mkconfig.rb: no longer embed srcdir and compile_dir into
+ rbconfig.rb.
- * thread_pthread.c (native_sleep): remove unused variable.
+ * lib/mkmf.rb (create_makefile): fix unbalanced parens.
-Sat Jun 11 10:15:50 2011 Tanaka Akira <akr@fsij.org>
+Sun Feb 6 19:23:01 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * thread.c (rb_thread_execute_interrupts): use GetThreadPtr to extract
- rb_thread_t from VALUE.
- reported by Motohiro KOSAKI. [ruby-dev:43700]
+ * eval.c (stack_extend): add prototype because VC++8 doesn't
+ accept __declspec(noinline) with K&R style function definitions.
+ (backported from CVS HEAD)
-Sat Jun 11 10:00:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Feb 6 14:14:26 2005 Tadayoshi Funaba <tadf@dotrb.org>
- * ruby.c (ruby_process_options): add missing return type.
+ * lib/date.rb (new_with_hash): changed messages of exception.
-Fri Jun 10 23:18:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/date/format.rb (str[fp]time): undocumented conversion
+ specifications %[1-3] are now deprecated.
- * ext/tk/tcltklib.c (lib_eventloop_core): replace CHECK_INTS with
- rb_thread_check_ints(). Because current code can't be compiled.
+Sun Feb 6 12:20:11 2005 Akinori MUSHA <knu@iDaemons.org>
-Fri Jun 10 16:38:13 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * bignum.c (rb_big2ulong_pack): One too many arguments are passed
+ to big2ulong().
- * encoding.c (rb_locale_charmap): When ruby process is run as Windows
- Service the console codepage is not set, GetConsoleCP returns 0.
- So on such environment, use GetACP().
- http://blogs.msdn.com/b/michkap/archive/2005/02/08/369197.aspx
- patched by Rafal Bigaj [ruby-core:36832] [Bug #4854]
+ * re.c (rb_reg_init_copy, rb_reg_initialize_m): One too many
+ arguments are passed to rb_reg_initialize().
-Fri Jun 10 14:34:24 2011 Koichi Sasada <ko1@atdot.net>
+Sun Feb 6 03:24:20 2005 Tanaka Akira <akr@m17n.org>
- * common.mk: restore TESTRUN_SCRIPT to "$(srcdir)/test.rb".
- TESTRUN_SCRIPT is used by "make run", "make gdb" and so on.
+ * lib/resolv.rb (Resolv::DNS::Resource::TXT): multiple strings was not
+ handled.
+ (Resolv::DNS::Resource::TXT#strings): new method to return all
+ strings.
+ (Resolv::DNS::Message::MessageEncoder#put_string_list): new method.
+ (Resolv::DNS::Message::MessageDecoder#get_string_list): ditto.
+ based on [ruby-talk:129732] by Sam Roberts.
-Fri Jun 10 13:01:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Feb 4 00:30:45 2005 Kouhei Sutou <kou@cozmixng.org>
- * test/ruby/test_module.rb (TestModule#remove_rake_mixins): remove all
- module related to Rake.
+ * lib/rss: supported Image module.
+ http://web.resource.org/rss/1.0/modules/image/
-Fri Jun 10 09:52:38 2011 Eric Hodel <drbrain@segment7.net>
+Thu Feb 3 23:42:36 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * encoding.c: Mention that Encoding.compatible? can work with more
- than just Strings.
+ * ext/stringio/stringio.c (strio_close, strio_close_read, strio_close_write):
+ should return nil instead of self as well as IO. [ruby-dev:25623]
-Fri Jun 10 02:25:53 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/stringio/stringio.c (strio_extend, strio_putc): fill with zero
+ extended portion. [ruby-dev:25626]
- * ext/psych/lib/psych.rb: updating version to match released gem.
+Wed Feb 2 23:52:53 2005 sheepman <sheepman@tcn.zaq.ne.jp>
-Fri Jun 10 01:06:29 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/stringio/stringio.c (strio_truncate): should MEMZERO an extended
+ part. [ruby-dev:25618]
- * ext/bigdecimal (BigDecimal_to_i): Integer#** may return flonum.
+Wed Feb 2 21:56:01 2005 Kouhei Sutou <kou@cozmixng.org>
-Fri Jun 10 00:35:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/rss/rss.rb (RSS::Element#convert): added.
- * complex.c (string_to_c_internal): uses rb_reg_nth_match;
- * rational.c (string_to_r_internal): ditto.
+ * lib/rss/rss.rb: convert -> need_convert.
-Fri Jun 10 00:25:03 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/rss/1.0.rb: ditto.
- * gc.c: remove an unused declaration.
+ * lib/rss/0.9.rb: ditto.
-Fri Jun 10 00:24:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/rss/2.0.rb: ditto.
- * rational.c (string_to_r): Rational#** may return flonum.
+ * lib/rss/trackback.rb: ditto.
-Thu Jun 9 23:57:53 2011 Tanaka Akira <akr@fsij.org>
+Tue Feb 1 22:48:48 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * io.c: fix IO.copy_stream interrupt handling.
- based on the patch by Eric Wong. [ruby-core:36156]
+ * lib/drb/drb.rb (DRb::DRbObject#respond_to?): check marshal_dump and
+ _dump.
- * vm_core.h (rb_thread_call_with_gvl): don't declare here.
+Tue Feb 1 00:20:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread.c: include internal.h.
- (rb_thread_execute_interrupts): new function.
+ * configure.in (aix): fix linker flags on AIX. [ruby-talk:125460]
- * internal.h (rb_thread_execute_interrupts): declared.
- (rb_thread_call_with_gvl): declared.
+Mon Jan 31 13:33:21 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Jun 9 23:34:01 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tcltklib/tcltklib.c: add invalid namespace check
- * gc.c (rb_objspace_call_finalizer): use rb_typeddata_is_kind_of() for
- type check to get rid of a double free when main Thread has singleton
- class. [ruby-core:36741] [Bug #4828]
- * thread.c (rb_obj_is_mutex): add a new utility function.
- * vm.c (rb_obj_is_thread): ditto.
+ * ext/tk/lib/multi-tk.rb: add invalid_namespace? method
-Thu Jun 9 22:53:49 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/lib/remote-tk.rb: ditto
- * test/ruby/test_thread.rb (TestThread#test_kill_thread_subclass):
- add test for Thread.kill with Thread subclass instance.
+Mon Jan 31 10:29:18 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 9 22:31:47 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/irb/context.rb (IRB::Context::initialize): [ruby-core:04330]
- * test/ruby/test_thread.rb (TestThread#test_kill_wrong_argument):
- test for [ruby-core:35086].
- partially forward porting r31402 from ruby_1_9_2 branch.
+Sat Jan 29 09:42:12 2005 Sam Roberts <sroberts@uniserve.com>
-Thu Jun 9 18:36:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/resolv.rb (Resolv::DNS::Resource::IN::SRV): Added RFC2782 SRV
+ resource record for specifying location of services.
- * string.c: Fix the ambiguous description of the behavior of
- rb_str_aref_m with a range. It returns nil when the beginning of
- the range is greater than the end of the string rather than the range.
+Fri Jan 28 17:16:55 2005 Tanaka Akira <akr@m17n.org>
-Thu Jun 9 10:57:03 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf):
+ parse options line for ndots option.
+ (Resolv::Hosts#lazy_initialize): return self.
+ (Resolv::DNS#lazy_initialize): ditto.
+ (Resolv::DNS::Config#lazy_initialize): ditto.
+ Suggested by Sam Roberts.
- * ext/psych/lib/psych/visitors/to_ruby.rb: Hash subclasses can be read
- from YAML files.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Hash subclasses can be
- dumped to YAML files.
- * test/psych/test_hash.rb: corresponding test.
+Thu Jan 27 13:18:03 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jun 9 09:18:51 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * st.c (st_foreach): report success/failure by return value.
+ [ruby-Bugs-1396]
- * ext/psych/lib/psych/visitors/to_ruby.rb: Ruby modules can be loaded
- from YAML files.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby modules can be
- dumped to YAML files.
- * test/psych/test_class.rb: corresponding test.
+Thu Jan 27 00:15:29 2005 Minero Aoki <aamine@loveruby.net>
-Thu Jun 9 09:05:04 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * test/fileutils/test_fileutils.rb (setup): support BSD-style
+ directory group inheritance. (backport from HEAD, rev 1.32)
- * ext/psych/lib/psych/visitors/to_ruby.rb: Ruby classes can be loaded
- from YAML files.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby classes can be
- dumped to YAML files.
- * test/psych/test_class.rb: corresponding test.
+ * test/fileutils/fileasserts.rb (assert_same_entry): show entry
+ difference. (backport from HEAD, rev 1.4)
-Wed Jun 8 21:38:57 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Wed Jan 26 23:09:11 2005 Minero Aoki <aamine@loveruby.net>
- * cont.c (root_fiber_alloc): set root fiber's status RUNNING.
- in cont_mark() only RUNNING fiber's machine stack is marked.
- root fiber's status should be RUNNING at the beginning regardless of
- FIBER_USE_NATIVE. [ruby-core:36735] fixes #4827
+ * lib/net/protocol.rb (WriteAdapter#puts): should append \n, not
+ prepend. [ruby-talk:128302] (backport from HEAD, rev 1.75)
-Tue Jun 7 20:50:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Jan 26 10:51:50 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * doc/irb/irb.rd: fix typo. patch by Nobuhiro IMAI.
- [Bug #4843] [ruby-dev:43639]
- * doc/irb/irb.rd.ja: ditto.
- * doc/ChangeLog-YARV: ditto.
+ * win32/win32.c (flock_winnt, flock_win95): unlock file even if
+ LOCK_NB is specified. (backported from CVS HEAD)
-Tue Jun 7 18:52:55 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Jan 25 17:11:51 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/rubygems/user_interaction.rb (Gem::StreamUI#tty?): IO#tty? of
- Windows has been fixed at r29969.
+ * ruby.c (proc_options): correct -T option in RUBYOPT. (backported
+ from CVS HEAD)
- * test/rubygems/test_gem_stream_ui.rb: now can run tests.
+Tue Jan 25 14:05:52 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Jun 7 18:36:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c: fix SEGV bug; trouble on canceling remained
+ after scripts [ruby-dev:25479]: NULL current namespace when deleting
+ Tk interpreter [ruby-talk:126225]
- * test/rubygems/test_gem.rb (TestGem#{test_self_user_home_userprofile,
- test_self_user_home_user_drive_and_path}): should simply ignore
- meaningless tests instead of skipping them.
+ * ext/tcltklib/extconf.rb: bug fix; TCL_ENABLE_THREAD flag is inverted
+ [ruby-talk:126360]
-Tue Jun 7 18:15:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tcltklib/extconf.rb: add yet another native-thread check
- * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
- should show some messages when skipping tests.
+ * ext/tk/tkutil.c: fix SEGV bug; NULL string pointer when finalize
+ Ruby interpreter
-Tue Jun 7 13:59:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: avoid warning for deleted safeTk ip frame
- * ext/date/date_core.c (date_s_today, datetime_s_now): check the
- result of localtime_r().
+ * ext/tk/lib/tk/bindtag.rb: bug fix; new method of named bindtag
+ doesn't return the created object [ruby-dev:25479]
-Tue Jun 7 13:36:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk/menu.rb: bug on treating arguments [ruby-dev:25479]
- * ext/tk/extconf.rb: use $defs not $CPPFLAGS to get rid of
- command line escape issues on Windows. fixed #4835.
+ * ext/tk/lib/tk.rb: bug fix; cannot accept a callback ID string for
+ a command argument [ruby-dev:25479]
-Tue Jun 7 03:18:45 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/tk/lib/multi-tk.rb: ditto
- * test/ruby/test_io.rb (TestIO#test_s_{,bin}write): do not create a
- file under /tmp. [Bug #4846]
+ * ext/tk/lib/tk/*.rb: ditto
-Mon Jun 6 22:51:43 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/lib/tkextlib/*.rb: ditto
- * cont.c: use #if FIBER_USE_NATIVE instead of #ifdef.
- you can suppress use of setcontext for Fiber with compile option
- -DFIBER_USE_NATIVE=0
+ * ext/tk/sample/demos-jp/anilabel.rb: new demo script
-Mon Jun 6 21:59:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/sample/demos-en/anilabel.rb: ditto
- * test/date/test_switch_hitter.rb: added a test.
+ * ext/tk/sample/tkHTML/ss.rb: local variable scope bug fix
+ [ruby-dev:25479]
-Mon Jun 6 21:37:45 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Mon Jan 24 15:44:25 2005 Tilman Sauerbeck <tilman@code-monkey.de>
- * ext/date/date_core.c: added notes.
+ * lib/rdoc/parsers/parse_c.rb: allow whitespace after function names.
+ [ruby-core:4296]
-Mon Jun 6 21:02:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/rdoc/parsers/parse_simple.rb: adds support for private comments
+ in the "simple" parser. [ruby-core:4301]
- * ext/date/date_core.c: flattened format to strftimev.
- * ext/date/date_core.c (date_strftime_internal): taints run.
+Mon Jan 24 15:44:25 2005 Charles Mills <cmills@freeshell.org>
-Mon Jun 6 15:10:17 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/parsers/parse_c.rb: adds support for constants
+ (rb_define_const), accessors (rb_define_attr), and makes a
+ couple fixes. [ruby-core:4307]
- * include/ruby/{defines,missing}.h (rb_infinity, rb_nan): move from
- defines.h to missing.h. (couldn't use RUBY_EXTERN there.)
+Mon Jan 24 15:44:25 2005 Florian Gro <florgro@gmail.com>
-Mon Jun 6 14:35:48 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/parsers/parse_rb.rb: Logic for def Builtin.method() end
+ [ruby-core:4302]
- * test/rdoc/test_rdoc_markup_pre_process.rb (TestRDocMarkupPreProcess#
- {test_include_file,test_include_file_encoding_incompatible}): no
- need to write such workaround. don't hide the bug of ruby. (and the
- bug is already fixed.)
+Mon Jan 24 15:44:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Jun 6 14:11:11 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * document updates - [ruby-core:04296], [ruby-core:04301],
+ [ruby-core:04302], [ruby-core:04307]
- * ext/date/date_core.c (valid_jd_sub): need to convert from VALUE to
- double.
+Sun Jan 23 12:41:16 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/date/date_core.c (offset_to_sec): get rid of a compiler warning.
+ * lib/soap/wsdlDriver.rb: from 1.5.3-ruby1.8.2, operation which has
+ capitalized name (such as KeywordSearchRequest in AWS) is defined as
+ a method having uncapitalized name. (converted with
+ GenSupport.safemethodname to handle operation name 'foo-bar'). it
+ introduced serious incompatibility; in the past, it was defined as a
+ capitalized.
-Mon Jun 6 14:09:08 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ define capitalized method as well under that circumstance.
- * include/ruby/defines.h (rb_infinity, rb_nan): export for Windows.
+Sun Jan 23 05:24:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Mon Jun 6 10:54:45 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/openssl/ossl_ocsp.c (ossl_ocspreq_to_der): should call
+ GetOCSPReq at first.
- * lib/test/unit.rb(Test::Unit::Runner#puke):
- Add overriding from MiniTest::Unit#puke. This reverts minitest's fix
- that skip messages are hidden when not verbose mode (-v option).
- To hide skip messages, use --hide-skip option instead.
+Sat Jan 22 23:09:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Mon Jun 6 10:52:13 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/drb/ssl.rb (accept): rescue SSLError. [druby-ja:110]
- * lib/net/http.rb: don't use autoload.
+Sat Jan 22 22:35:03 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Mon Jun 6 09:39:43 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/drb/unix.rb: fail if UNIXFileOwner is set. [druby-ja:111]
- * ext/psych/parser.c (parse): release event objects to plug memory
- leak. Thanks Mark J. Titorenko!
+Fri Jan 21 23:58:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Jun 5 23:26:15 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/stringio/stringio.c (strio_set_pos): clear EOF flag.
+ [ruby-talk:127511]
- * eval.c: remove rb_thread_stop_timer_thread function declaration.
- Instead, include vm_core.h.
- * process.c: ditto.
+Fri Jan 21 20:07:02 2005 Tanaka Akira <akr@m17n.org>
-Sun Jun 5 21:38:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/resolv.rb (Resolv::DNS::Config.resolv): don't raise ResolvError.
+ reported by Sam Roberts. [ruby-talk:127133]
- * thread_pthread.c (thread_timer): add to care a spurious wakeup.
- When native_cond_timedwait() return 0 by spurious wakeup, we
- don't have to neither 1) call timer_thread_function and 2)
- exit the timer thread.
+Fri Jan 21 16:58:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Jun 5 17:50:01 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * dir.c (rb_push_glob): should work for NUL delimited patterns.
- * ext/date/date_core.c (m_real_cwyear): new. derived from m_cwyear.
- * ext/date/date_strftime.c: trivial changes.
+Fri Jan 21 13:58:37 2005 Shugo Maeda <shugo@ruby-lang.org>
-Sun Jun 5 17:22:01 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/net/imap.rb (u8tou16): fixed typo. fixed: [ruby-list:40546]
+ (backported from CVS HEAD)
- * ext/tk/config_list.in: add new options for tcltklib.
+Fri Jan 21 09:30:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Sun Jun 5 10:06:50 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * rubyio.h (rb_eof_error): should mark as NORETURN. (backported
+ from CVS HEAD)
- * ext/date/date_tmx.h: now does not place decoded data. allows to
- access indirectly via functions on demand.
- * ext/date/date_strftime.c: ditto.
- * ext/date/date_core.c: ditto.
- * ext/date/date_core.c ({d|dt}_lite_to_s): use strftime.
+Fri Jan 21 00:31:36 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Jun 5 06:22:02 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/syck/rubyext.c (syck_parser_bufsize_set): avoid VC++ warning
+ "local variable 'size' used without having been initialized".
- * NEWS: wrote about changes of date.
+Thu Jan 20 19:03:24 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Jun 4 16:59:26 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/extmk.rb (extmake): shouldn't set $extflags on mswin32.
- * ext/date/date_core.c (d_lite_inspect): changed the format.
- * ext/date/date_core.c: refactoring and fixing some bugs.
+ * win32/Makefile.sub (LIBRUBY_SO): should use $DLDOBJS instead of
+ $EXTOBJS.
+ fixed: [ruby-core:04290] (backported from CVS HEAD)
-Sat Jun 4 04:04:41 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jan 20 11:42:02 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/rubygems/test_gem_commands_which_command.rb:
- "missing" exists on ruby's top source directory. [Bug #4815]
+ * string.c (rb_str_new4): should propagate taintedness.
-Fri Jun 3 21:48:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * struct.c (rb_struct_set): use original method name, not callee
+ name, to retrieve member slot. [ruby-core:04268]
- * lib/rubygems/test_case.rb: Refix for test-all in separate directory.
- r31147 + r31151.
+ * time.c (time_strftime): protect from format modification from GC
+ finalizers.
-Fri Jun 3 20:58:47 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Jan 19 18:06:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/date/date_core.c (d_lite_plus): get rid of compiler warnings.
+ * lib/ipaddr.rb (to_s, test_to_s): too many colons with some cases.
+ (backported from CVS HEAD)
-Fri Jun 3 20:56:40 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Jan 19 01:16:30 2005 Tanaka Akira <akr@m17n.org>
- * include/ruby/missing.h, numeric.c (round): moved prototype of round()
- from numeric.c to missing.h. (note: round() is C99 feature, so ruby
- provides it if not exist in C runtime.)
+ * lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf): ignore
+ domain and search directive without an argument.
+ reported by Sam Roberts. [ruby-talk:126781]
-Fri Jun 3 20:42:04 2011 Shota Fukumori <sorah@tubusu.net>
+Tue Jan 18 15:03:05 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/test/unit/parallel.rb: Keep $stdin, $stdout before run testcase
- and restore after run. Because some test break $stdin, $stdout.
- Fixes [Bug #4433] [ruby-core:35353]
+ * lib/webrick/ssl.rb (WEBrick::Config::SSL): the default value
+ of :SSLEnable is false.
-Fri Jun 3 19:58:14 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/webrick/server.rb (WEBrick::Daemon.start): prepared stdio
+ don't allow changing its mode.
- * io.c (io_fflush): windows -- call fsync() only when the FD is tied to
- file, because if the FD is pipe, it blocks.
+ * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_service):
+ should delete trailing LF from the result of pack("m*").
-Fri Jun 3 09:27:31 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
+ - should delete trailing LF from the result of pack("m*").
+ - clear Request-Line not to send the response by HTTPServer#run.
- * lib/net/http.rb (URI::HTTP#request_uri): return nil when the uri
- is path-rootless form. Bug #4759
+ * lib/webrick/httputils (WEBrick::HTTPUtils.parse_qvalues):
+ refine regexp (and change the name of a local variable).
-Thu Jun 2 23:51:03 2011 James Edward Gray II <jeg2@ruby-lang.org>
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils#escape_path): add
+ new method to escape URI path component.
- * lib/csv.rb: Improve the line ending detection algorithm
- patch by Alexey).
+ * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line): should
+ escape SCRIPT_NAME and PATH_INFO before being parsed as a URI.
-Thu Jun 2 20:05:57 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/webrick/*, sample/webrick/httpproxy.rb: add new file.
- * io.c (rb_io_s_write, rb_io_s_binwrite): return!!!
+Mon Jan 17 23:33:46 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jun 2 16:29:34 2011 Shota Fukumori <sorah@tubusu.net>
+ * configure.in (aix): fix typo. [ruby-talk:126401]
- * io.c: Add File.write, File.binwrite. [Feature #1081] [ruby-core:21701]
+Mon Jan 17 07:08:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_io.rb: Test for File.write, File.binwrite.
+ * ext/readline/readline.c: suppress warnings.
- * NEWS: News for above.
+ * lib/irb/extend-command.rb (IRB::ContextExtender.def_extend_command):
+ ditto.
-Thu Jun 2 12:33:09 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/irb/ext/history.rb (IRB::Context::set_last_value): ditto.
- * io.c (io_fflush, rb_io_flush): need to fsync() when ruby calls
- internal flush. [ruby-core:36670] [Bug #4813]
+ * lib/irb/ext/history.rb (IRB::Context::eval_history): ditto.
-Thu Jun 2 07:56:24 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/irb/locale.rb (IRB::Locale::real_load): ditto.
- * ext/tk/tcltklib.c: reduce CPU power required by an eventloop.
+ * lib/irb/slex.rb (SLex::Node::create_subnode): remove garbage.
-Tue May 31 21:28:33 2011 Tanaka Akira <akr@fsij.org>
+Mon Jan 17 00:09:42 2005 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
- redirect stderr to null device.
+ * lib/uri/common.rb (PORT): typo fix. fixed: [ruby-core:04256]
-Thu Jun 2 00:45:26 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+Sat Jan 15 14:57:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/tk/extconf.rb: fix for uninitialized global variables.
- [Ruby 1.9 - Bug #4811]
+ * ruby.c (proc_options): ignore trailing CRs at the end of short
+ options as well as long options. fixed: [ruby-core:04232]
-Wed Jun 1 21:57:08 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Jan 15 13:35:16 2005 Kouhei Sutou <kou@cozmixng.org>
- * thread_pthread.c (native_sleep): fix 1000times calculation error.
- this is a regression since r31457. [Bug #4808] [ruby-dev:43606]
+ * lib/rss/rss.rb (RSS::VERSION): 0.1.2 -> 0.1.3.
-Wed Jun 1 17:19:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rss/rss.rb: accept inheritance. [ruby-talk:126104]
- * thread_pthread.c: remove unused macro.
+Thu Jan 13 04:48:53 2005 Tanaka Akira <akr@m17n.org>
-Wed Jun 1 15:42:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_fread): don't warn nonblocking behavior by default.
- * parse.y (peek_n): new macro to see next nth char.
+Wed Jan 12 00:36:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 1 15:40:46 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * object.c (rb_class_superclass): superclass of singleton class also
+ should be a singleton class. fixed: [ruby-list:40519]
- * tool/rbinstall.rb (gem): fix for rubygems change.
+Tue Jan 11 09:44:40 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Jun 1 14:07:57 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * numeric.c (Init_Numeric): turn off floating point exceptions
+ on bcc32. "1e300".to_f had crashed by overflow.
- * lib/minitest/*: Imported minitest 2.2.2 (r6281)
- * test/minitest/*: ditto
+Tue Jan 11 03:10:10 2005 Minero Aoki <aamine@loveruby.net>
-Wed Jun 1 12:35:50 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * lib/fileutils.rb (copy_entry): could not copy symbolic link.
+ [ruby-talk:125733]
- * lib/rubygems*: Import rubygems 1.8.5 (released @ 137c80f)
- * test/rubygems: Ditto
+ * lib/fileutils.rb (copy_stream): use read/write instead of
+ sysread/syswrite.
-Wed Jun 1 12:34:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Mon Jan 10 23:08:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * NEWS: add new features of bigdecimal.
+ * variable.c (rb_autoload): hide internal data from ruby level.
+ fixed: [ruby-dev:25435], [ruby-list:40498]
-Wed Jun 1 09:41:14 2011 Eric Hodel <drbrain@segment7.net>
+Mon Jan 10 01:22:55 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/cgi/util.rb: Improve documentation. Patch by Kuba Fietkiewicz.
- [Ruby 1.9 - Bug #4775]
- * lib/cgi/core.rb: ditto
+ * gc.c (rb_data_object_alloc): klass may be NULL.
+ [ruby-list:40498]
-Wed Jun 1 09:26:05 2011 Eric Hodel <drbrain@segment7.net>
+Sun Jan 9 03:12:58 2005 Tanaka Akira <akr@m17n.org>
- * lib/mathn.rb: Improve documentation and attach it to Numeric.
- Modified from patch by Anil V. [Ruby 1.9 - Bug #4762]
+ * io.c (io_fread): warn nonblocking behavior.
+ (io_readpartial): new method IO#readpartial.
-Wed Jun 1 09:21:30 2011 Eric Hodel <drbrain@segment7.net>
+Sat Jan 8 04:38:47 2005 why the lucky stiff <why@ruby-lang.org>
- * lib/prime.rb: Indent examples enough to appear as code sections.
- Note that Prime is Enumerable. [#4762]
+ * lib/yaml.rb: Kernel#y requires an argument.
-Wed Jun 1 07:34:57 2011 Eric Hodel <drbrain@segment7.net>
+Fri Jan 7 21:12:29 2005 TAMURA Takashi <sheepman@tcn.zaq.ne.jp>
- * hash.c (key_i): Change rdoc from "the first occurrence" to "an
- occurrence" since first occurrence is not a specification of
- Hash#key. [Ruby 1.9 - Bug #4760]
+ * random.c (rand_init): use ALLOC_N instead of ALLOCA_N
+ [ruby-dev:25426]
-Wed Jun 1 07:26:19 2011 Eric Hodel <drbrain@segment7.net>
+Fri Jan 7 18:03:35 2005 Tanaka Akira <akr@m17n.org>
- * ext/pty/pty.c (pty_check): Restore "not reached" comment.
- [Ruby 1.9 - Bug #4756]
+ * gc.c (mark_locations_array): avoid core dump with -O3.
+ [ruby-dev:25424]
-Wed Jun 1 07:21:40 2011 Eric Hodel <drbrain@segment7.net>
+Thu Jan 6 20:31:07 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/zlib/zlib.c: Fix document-method declarations for set_sync and
- set_comment. [Ruby 1.9 - Bug #4695]
+ * ext/zlib/zlib.c (zstream_end): should return value. (backported
+ from CVS HEAD)
-Wed Jun 1 06:43:13 2011 Masaya Tarui <tarui@ruby-lang.org>
+Thu Jan 6 19:55:13 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * load.c (loaded_feature_path): cut nonsense loop execution to fix
- performance bug.
+ * win32/win32.c (rb_w32_close): didn't close socket handle.
+ [ruby-dev:25414]
-Wed Jun 1 01:16:02 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_open_osfhandle): bcc32's _open_osfhandle
+ never set EMFILE.
- * class.c (rb_mix_module): implement Module#mix.
+Thu Jan 6 17:14:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Jun 1 01:15:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * random.c (random_seed): O_NONBLOCK isn't defined on some
+ platforms. [ruby-dev:25417]
- * io.c (io_encoding_set): should honor already set ecflags since it
- might be set by mode option. fixed #4804
+Thu Jan 6 13:45:35 2005 Tanaka Akira <akr@m17n.org>
-Wed Jun 1 00:34:04 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/time.rb: recognize +00:00 and GMT as a localtime.
- * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): remove unused
- variable.
+Thu Jan 6 07:58:28 2005 Dave Thomas <dave@pragprog.com>
-Wed Jun 1 00:32:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/rdoc/usage.rb (RDoc::RDoc.usage_no_exit): Allow for colons
+ in path names on DOS machines. (thanks to Johan Nilsson)
- * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): support instantiation from
- a Float through Rational.
+Wed Jan 5 20:16:32 2005 Tanaka Akira <akr@m17n.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_new): ditto.
+ * random.c (limited_big_rand): didn't work if SIZEOF_BDIGITS == 2.
+ [ruby-dev:25408]
- * test/bigdecimal/test_bigdecimal.rb (test_global_new_float): add a test for
- the above changes.
+ * random.c (random_seed): refined.
- * test/bigdecimal/test_bigdecimal.rb (test_new_with_float): ditto.
+Wed Jan 5 12:49:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jun 1 00:07:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (rb_thread_initialize): Thread objects cannot be initialized
+ again. fixed: [ruby-core:04067]
- * ext/bigdecimal/bigdecimal.c (BigDecimal_coerce): support coerce with a
- Rational. The precision used for instantiate a BigDecimal from the
- given Rational is obtained from the receiver BigDecimal.
+Wed Jan 5 10:48:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb (test_coerce): add a test for the
- above change.
+ * dir.c (dir_s_mkdir): win32 special processing doesn't need any
+ longer. (backported from CVS HEAD)
-Tue May 31 23:49:08 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
+ interface. (backported from CVS HEAD)
- * ext/date/date_core.c (offset_to_sec): fixed invalid validation.
+ * win32/win32.[ch] (rb_w32_rmdir): new function. (backported from CVS
+ HEAD)
-Tue May 31 23:43:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Wed Jan 5 02:30:11 2005 Tanaka Akira <akr@m17n.org>
- * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): replace the algorithm for
- coercing from a Rational to stop requiring "bigdecimal/util.rb".
- [ruby-core:34318]
+ * random.c (init_by_array): imported from mt19937ar-cok.tgz.
+ (genrand_int32): ditto.
+ (genrand_real): replaced with genrand_res53 in mt19937ar-cok.
+ (rand_init): support bignum for longer seed.
+ (random_seed): generate longer seed.
+ (make_mask): new function.
+ (limited_rand): ditto.
+ (limited_big_rand): ditto.
+ (rb_f_rand): call limited_rand and limited_big_rand.
+ [ruby-dev:25403]
- * ext/bigdecimal/bigdecimal.c (GetVpValue): refactoring.
+Tue Jan 4 23:25:29 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation from a
- Rational.
+ * bignum.c (rb_big_rand): should return positive random number.
+ [ruby-dev:25401]
- * test/bigdecimal/test_bigdecimal.rb (test_global_new_with_rational): add a
- test for the above change.
+Tue Jan 4 11:15:29 2005 TAMURA Takashi <sheepman@tcn.zaq.ne.jp>
- * test/bigdecimal/test_bigdecimal.rb (test_new_with_rational): ditto.
+ * bignum.c (rb_big_rand): do not use rb_big_modulo to generate
+ random bignums. [ruby-dev:25396]
-Tue May 31 22:44:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Mon Jan 3 14:01:54 2005 Tanaka Akira <akr@m17n.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation a
- BigDecimal object from an Integer.
+ * random.c (random_seed): don't use /dev/urandom if it is not
+ character device.
- * test/bigdecimal/test_bigdecimal.rb (test_new_with_integer):
- add for testing the above change.
+Mon Jan 3 11:37:42 2005 Tanaka Akira <akr@m17n.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_global_new): replace its body
- with a BigDecimal_new call.
+ * random.c (random_seed): use /dev/urandom if available.
+ [ruby-dev:25392]
- * test/bigdecimal/test_bigdecimal.rb (test_global_new_with_integer):
- add for testing the above change.
+Mon Jan 3 07:46:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue May 31 22:24:39 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/webrick/httpauth/htpasswd.rb (WEBrick::Htpasswd#reload):
+ raise NotImplementedError if password is encrypted by digest
+ algorithms. This patch is contributed by sheepman. [ruby-list:40467]
- * ext/date/date_core.c: use simple/complex mode instead of light/right mode.
- * test/date/*.rb: followed the above changes.
+ * lib/webrick/httpauth/digestauth.rb
+ (WEBrick::HTTPAuth::DigestAuth#_authenticate): fix digest calculation.
+ This patch is contributed by sheepman. [ruby-list:40482]
-Tue May 31 21:28:33 2011 Tanaka Akira <akr@fsij.org>
+ * lib/webrick/{httpauth.rb,httpauth/basicauth.rb,httpproxy.rb}: use
+ pack/unpack-template char "m" instead of lib/base64.rb to do base64
+ encoding/decoding. fixed: [ruby-dev:25336]
- * test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
- initialize SIGINT handler.
+ * test/webrick/test_httpauth.rb: new file.
-Tue May 31 17:03:24 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Sat Jan 1 04:20:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/net/http.rb, lib/net/protocol.rb: Allow to configure to wait
- server returning '100 continue' response before sending HTTP request
- body. See NEWS for more detail. See #3622.
- Original patch is made by Eric Hodel <drbrain@segment7.net>.
+ * ext/openssl/ossl_ns_spki.c (ossl_spki_set_challenge): should call
+ StringValue before GetSPKI. fixed: [ruby-dev:25359].
- * test/net/http/test_http.rb: test it.
+Sat Jan 1 01:13:28 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * NEWS: Add new feature.
+ * variable.c (rb_autoload): [ruby-dev:25373]
-Tue May 31 14:17:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Dec 31 14:10:43 2004 Dave Thomas <dave@pragprog.com>
- * io.c (rb_io_s_pipe): potential bug. the mode of read IO is set as
- DEFAULT_TEXTMODE in call of io_set_encoding(), and of write IO is
- also set as it in call of io_new_instance() via rb_protect().
- so, if DEFAULT_TEXTMODE is not 0, we should check the result of
- extract_binmode() and avoid crush of default IO mode and the result.
+ * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item): Fix problem
+ if heading contains formatting.
-Tue May 31 13:00:17 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+Thu Dec 30 00:41:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * strftime.c (rb_strftime_with_timespec): improved style consistency.
- constified some variables.
+ * eval.c (svalue_to_avalue): [ruby-dev:25366]
- * test/test_time.rb (TestTime#test_huge_precision): test for #4456.
+ * string.c (rb_str_justify): [ruby-dev:25367]
-Tue May 31 12:53:10 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Dec 29 11:07:07 2004 Dave Thomas <dave@pragprog.com>
- * test/io/wait/test_io_wait.rb (TestIOWait#{test_nread,test_ready?,
- test_wait}: give system some time to process the written data.
+ * lib/rdoc/generators/template/html/kilmer.rb: Update to use new
+ sections.
-Tue May 31 12:40:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Dec 28 22:31:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_io.rb (TestIO#test_open_mode): MUST release resources
- explicitly. fix problem of r31671
+ * string.c (rb_str_justify): create buffer string after argument type
+ conversion. fixed: [ruby-dev:25341]
-Tue May 31 10:49:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Dec 28 15:41:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm_exec.c: remove conditions for clang
- because clang version 3.0 (trunk 132165) doesn't need them.
+ * ext/nkf/nkf-utf8/nkf.c (reinit): should initialize all static
+ variables. fixed: [ruby-list:40445]
-Mon May 30 22:19:33 2011 Tanaka Akira <akr@fsij.org>
+Tue Dec 28 15:25:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_signal.rb (TestSignal#test_signal_requiring): don't
- close stderr.
+ * ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): second byte is up to
+ 0xfe.
-Mon May 30 20:22:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/nkf/lib/kconv.rb (Kconv#kconv): should handle UTF8 and UTF16
+ properly.
- * test/ruby/test_signal.rb (TestSignal#test_signal_requiring): small
- but critical typo of r31642. sorry...
- [Bug #4798] [ruby-core:36550]
+Tue Dec 28 13:35:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon May 30 15:44:16 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate): ensure
+ freeing internal zstreams. fixed: [ruby-dev:25309]
- * insns.def (opt_mult): as r31805, volatile it.
- Without this, clang -O fails calculation.
+ * ext/zlib/zlib.c (rb_deflate_init_copy): replace rb_deflate_clone.
- * numeric.c (fix_mul): ditto.
+Tue Dec 28 12:26:45 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * rational.c (f_imul): ditto.
+ * win32/Makefile.sub, win32/setup.mak (RDOCTARGET, install,
+ install-nodoc, install-doc): rdoc support for mswin32.
-Mon May 30 10:26:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/configure.bat (--enable-install-doc, --disable-install-doc):
+ ditto.
- * numeric.c (int_pow): make sure to assign the result of x * z.
- If xz is optimized out, the value won't overflow.
+Mon Dec 27 20:02:14 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun May 29 23:17:29 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c: fix SEGV bug when deleting Tk interp
- * re.c (rb_reg_match): fix rdoc of Regexp#=~.
- patched by Tsuyoshi Sawada. [Bug #4781]
+ * ext/tk/lib/multi-tk.rb: ditto
-Sun May 29 23:10:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Dec 27 16:55:17 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/webrick/https.rb (WEBrick::HTTPRequest#parse_uri):
- keep parse_uri as private. patched by okkez. [Bug #4773]
+ * ext/openssl/ossl_x509name.c (Init_ossl_x509name): should use
+ rb_hash_new to get exactly a Hash. fix [ruby-dev:25325].
-Sun May 29 17:53:03 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Dec 27 16:29:56 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * numeric.c: add #include "internal.h" for rb_big_uminus() prototype.
+ * string.c (rb_str_justify): [ruby-dev:25341]
-Sun May 29 15:09:05 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 27 15:47:48 2004 Minero Aoki <aamine@loveruby.net>
- * numeric.c (flo_round): fix for negative value.
+ * test/fileutils/fileasserts.rb: sync with HEAD.
-Sun May 29 02:16:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/fileutils/test_fileutils.rb: ditto.
- * test/net/http/utils.rb (TestNetHTTPUtils#teardown): add nil check.
+ * test/fileutils/test_nowrite.rb: ditto.
-Sun May 29 00:22:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Dec 27 15:21:07 2004 Minero Aoki <aamine@loveruby.net>
- * process.c (before_exec, after_exec): change from macro to function.
+ * lib/fileutils.rb (mv): should raise error when moving a
+ directory to the (empty) directory. [ruby-talk:124368]
+ (backport from HEAD 1.48)
-Sat May 28 19:30:17 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/fileutils.rb (mv): wrongly did not overwrite file on Win32
+ platforms. (backport from HEAD 1.48)
- * process.c (before_exec, after_exec): change SIGPIPE handler to SIG_DFL
- before calling execve(). Because r31760 reintroduced an issue that
- system() may hang up (i.e. [ruby-dev:12261]).
- * process.c (save_sigpipe, restore_sigpipe): new.
+Sat Dec 25 11:11:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat May 28 16:08:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * stable version 1.8.2 released.
- * signal.c (Init_signal, default_handler): change default SIGPIPE handler
- from empty function to SIG_IGN. [ruby-dev:43215]
- * signal.c (sigpipe): removed.
+Sat Dec 25 04:23:49 2004 Minero Aoki <aamine@loveruby.net>
-Sat May 28 03:04:27 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/fileutils.rb (mkdir, mkdir_p): should ensure directory
+ permission. (backportted from HEAD, 1.47)
- * io.c (fill_cbuf): return MORE_CHAR_SUSPENDED when cbuf is not empty.
+ * lib/fileutils.rb (traverse, remove_dir): untaint trasted
+ objects. (backportted from HEAD, 1.46)
-Sat May 28 02:22:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Dec 25 01:28:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * string.c (rb_str_bytesize): rb_str_bytesize() should use LONG2NUM().
- Patch by Nikolai Weibull. [Bug #4789] [ruby-core:36511]
+ * io.c: cancel io_reopen() change on Dec. 24th.
-Sat May 28 02:06:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * dln.c: use <dlfcn.h> for NetBSD. [ruby-dev:25313]
- * io.c (fill_cbuf): Fix test-all crash.
+ * io.c (rb_f_select): IO list could be altered. [ruby-dev:25312]
-Sat May 28 00:58:40 2011 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+Fri Dec 24 23:51:48 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/ostruct.rb (method_missing): Handle [] and []= correctly.
- Based on a patch by Caius Durling, bug #4179 [ruby-core:33792]
+ * bcc32/Makefile.sub: bcc32 should use RTL dll (backport from HEAD)
+ [ruby-dev:25306]
-Fri May 27 23:56:54 2011 Kouhei Sutou <kou@cozmixng.org>
+ * win32/win32.[ch]: ditto.
- * test/rexml/test_core.rb (Tester::test_text_frozen): split frozen
- string test. refs #4783
+Fri Dec 24 23:27:18 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri May 27 22:46:23 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk/image.rb: TkPhotoImage#cget bug fix
- * tool/rbinstall.rb (gem): install gemspec of json. fixed #4784
+Fri Dec 24 18:39:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Fri May 27 22:45:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.[ch]: failed to compile on bcc32 (and probably wince)
+ [ruby-dev:25306]
- * io.c (validate_enc_binmode): do not clear textmode flag if
- default. fixed #4732
+Fri Dec 24 02:52:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (fill_cbuf): finish reading at EOF.
+ * io.c (io_reopen, rb_io_reopen): prohibit to change access mode for
+ special IO ports. [ruby-dev:25225]
-Fri May 27 11:31:51 2011 misfo <tedwardo2@gmail.com>
+Fri Dec 24 02:22:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rexml/text.rb (REXML::Text#initialize): prevent an error
- when passing a frozen string to REXML::Text.new
+ * ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
- dup the string passed in instead of cloning so that it's frozen
- state is ignored
+ * ext/syck/rubyext.c (syck_loader_transfer): check type conversion.
-Fri May 27 08:47:26 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/syck/rubyext.c (syck_parser_assign_io, rb_new_syck_node): duck
+ typing.
- * thread.c (ppoll): typo bug fix.
+ * ext/syck/rubyext.c (syck_parser_s_alloc, syck_parser_initialize):
+ allocation framework.
-Fri May 27 08:35:04 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/syck/rubyext.c (syck_emitter_s_alloc, syck_emitter_initialize):
+ ditto.
- * ext/tk/lib/tk.rb: hang-up at exit before calling Tk.mainloop.
+Fri Dec 24 01:21:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/tk/lib/tk/extconf.rb: cannot make on MinGW [Ruby 1.9 - Bug #4141].
+ * ext/tk/lib/tkextlib/blt.rb: add BLT extension support
-Thu May 27 00:34:07 2011 James Edward Gray II <jeg2@ruby-lang.org>
+ * ext/tk/lib/tkextlib/blt/*.rb: ditto
- * lib/csv.rb: Enhance each() to support Enumerator.
+ * ext/tk/lib/tkextlib/blt/tile/*.rb: ditto
-Thu May 26 10:32:11 2011 James Edward Gray II <jeg2@ruby-lang.org>
+Thu Dec 23 23:36:28 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/csv.rb: Documentation improvements from Ysiad Ferreiras.
- [Ruby 1.9 - Bug #4785]
+ * process.c (proc_setgroups): check if the argument lenght is
+ modified. fixed: [ruby-dev:25285]
-Thu May 26 15:42:02 2011 Cezary Baginski <cezary.baginski@gmail.com>
+Thu Dec 23 13:13:33 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/xmlrpc/parser.rb (FaultException): fix to_s and inspect
+ * ext/tcltklib/tcltklib.c: define TclTkLib::COMPILE_INFO and
+ RELEASE_DATE
- * test/xmlrpc/parser.rb: test for the above
+ * ext/tcltklib/extconf.rb: ditto
-Wed May 25 11:54:31 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/tkutil.c: define TkUtil::RELEASE_DATE
- * ext/curses/curses.c: Remove color constants block.
- [Ruby 1.9 - Bug #4748]
+ * ext/tk/lib/tk.rb: define Tk::RELEASE_DATE
-Wed May 25 09:56:45 2011 Eric Hodel <drbrain@segment7.net>
+Thu Dec 23 09:38:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/curses/curses.c: Add missing documentation for button state, MIN
- and MAX comments. Add Curses. to TABSIZE= and ESCDELAY= methods.
- [Ruby 1.9 - Bug #4747]
+ * io.c (io_reopen): restore exact mode. fixed: [ruby-core:04003]
-Wed May 25 09:35:31 2011 Eric Hodel <drbrain@segment7.net>
+Thu Dec 23 00:16:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/benchmark.rb: Restore nodoc for Benchmark::Job and
- Benchmark::Report. [Ruby 1.9 - Bug #4726]
+ * configure.in (bsdi): use $(CC) for LDSHARED. fixed [ruby-dev:25270]
-Wed May 25 09:29:38 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 22 11:14:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/pop.rb: Hide implementation details from RDoc.
- [Ruby 1.9 - Bug #4711]
+ * io.c (rb_io_mode_modenum): replace O_ACCMODE with O_RDWR.
+ fixed: [ruby-dev:25273]
-Wed May 25 09:26:29 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 22 08:34:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/ftp.rb: Add :nodoc: for private methods.
- [Ruby 1.9 - Bug #4710]
+ * ext/dl/sym.c (rb_dlsym_initialize): extract internal pointers after
+ all argument conversion. fixed: [ruby-dev:25271]
-Wed May 25 09:19:17 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 22 00:08:01 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/zlib/zlib.c: Fix Document-method declarations. Improve
- Zlib::GzipFile's method catalog. [Ruby 1.9 - Bug #4695]
+ * lib/soap/*, test/soap/*, sample/soap/authheader/*: eval cleanup.
-Wed May 25 08:22:12 2011 Eric Hodel <drbrain@segment7.net>
+Tue Dec 21 22:07:33 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/erb.rb: Hide documentation for implementation details of ERB.
- [Ruby 1.9 - Bug #4694]
+ * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+ ossl_asn1_decode_all): temporary value should be marked volatile.
-Wed May 25 07:58:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Dec 21 14:40:02 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/tempfile.rb (Tempfile.{mkdir,rmdir}): revert for backward
- compatibility.
+ * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+ ossl_asn1_decode_all): use rb_str_new4 to avoid SEGV.
+ fix [ruby-dev:25261]
-Wed May 25 07:13:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/openssl/test_asn1.rb: add tests for OpenSSL::ASN1.
- * spec/README: update the description.
+Tue Dec 21 12:22:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed May 25 07:12:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_reopen): keep duplex pipe in correct mode for exception
+ safeness. fixed: [ruby-dev:25152]
- * lib/tempfile.rb (Tempfile.{lock,unlock}_tempfile): refactor.
+Tue Dec 21 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue May 24 17:30:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk/grid.rb: rescue bug of 'grid configure' on Tcl/Tk8.3-
- * spec/README: fix typo.
- patched by bowsersenior. https://github.com/ruby/ruby/pull/24
+Tue Dec 21 00:53:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue May 24 07:06:34 2011 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * ext/openssl/ossl_asn1.c (ossl_asn1_traverse): [ruby-dev:25261]
- * ext/tk/lib/tk.rb: fail to start Tk.mainloop (exit immediately) on
- some environment (reported on [ruby-talk:381444]).
+ * ext/openssl/ossl_asn1.c (ossl_asn1_decode): ditto.
- * ext/tk/lib/tk/canvas.rb: support creating a canvas item object from
- an item ID number.
+ * ext/openssl/ossl_asn1.c (ossl_asn1_decode_all): ditto.
- * ext/tk/lib/tk/image.rb: import documents which are pull-requested.
- [Ruby 1.9 - Feature #4595]
+Mon Dec 20 23:22:26 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/tk/lib/tk/extconf.rb: search directories for 64bit library (e.g.
- /usr/lib64), add some new configure options (see README.tcltklib),
- and bug fix.
+ * added files:
+ * lib/soap/mapping/wsdl*.rb
+ * lib/wsdl/soap/element.rb
+ * lib/wsdl/xmlSchema/simpleContent.rb
- * ext/tk/lib/tk/README.tcltklib: modify docs for some new configure
- options.
+ * modified files:
+ * lib/soap/*
+ * lib/wsdl/*
+ * lib/xsd/*
+ * test/soap/*
+ * test/wsdl/*
+ * test/xsd/*
+ * sample/soap/*
+ * sample/sdl/*
+
+ * summary
+ * imported from the soap4r repository. Version: 1.5.3-ruby1.8.2
+
+ * added several XSD basetype support: nonPositiveInteger,
+ negativeInteger, nonNegativeInteger, unsignedLong, unsignedInt,
+ unsignedShort, unsignedByte, positiveInteger
-Tue May 24 04:01:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * HTTP client connection/send/receive timeout support.
- * lib/yaml.rb: switch default YAML engine to Psych, old syck engine
- may be enabled via YAML::ENGINE.yamler = "syck". [ruby-core:36374]
+ * HTTP client/server gzipped content encoding support.
-Mon May 23 09:45:26 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * improved WSDL schema definition support; still is far from
+ complete, but is making step by step improovement.
- * include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. Forgot to
- include this file in the commit r31692. __APPLE__ is not
- CASEFOLD_FILESYSTEM again, from this time.
+Mon Dec 20 22:56:39 2004 Tanaka Akira <akr@m17n.org>
-Mon May 23 10:01:02 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * gc.c (stack_end_address): gcc noinline attribute is available since
+ gcc-3.1.
- * ext/openssl/ossl_asn1.c: Do not parse zero-tagged values as EOC. Do
- not let current length become negative for infinite length constructed
- values. Support constructed values of length zero. Added tests.
+Mon Dec 20 14:07:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Mon May 23 09:19:53 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/multi-tk.rb: supports new features of Tcl/Tk8.5a2
- * lib/net/smtp.rb: Document Net::SMTP::Response. Patch by J.R. Garcia.
- [Ruby 1.9 - Bug #4768]
+ * ext/tk/lib/tk/clock.rb: ditto
-Mon May 23 09:03:52 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/tk/lib/tk/text.rb: ditto
- * lib/test/unit/parallel.rb: Never Ignore SIGINT. When received
- Interrupt, immediately puts result and exit. [ruby-dev:43571]
+ * ext/tk/lib/tk/panedwindow.rb: ditto
- * lib/test/unit.rb: When received Interrupt, wait results from workers
- and collect them. [ruby-dev:43571]
+Mon Dec 20 12:47:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Mon May 23 09:08:07 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/openssl/lib/net/https.rb,protocols.rb,telnets.rb: delete
+ doc and code about SSLContext#{key_file,cert_file}.
+ fixed: [ruby-dev:25243]
- * lib/mathn.rb: Improve documentation. Patch by Sandor Szucs.
- [Ruby 1.9 - Bug #4767]
+Mon Dec 20 12:42:17 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon May 23 08:45:55 2011 Eric Hodel <drbrain@segment7.net>
+ * io.c (io_fwrite): workaround for MSVCRT's bug.
+ fixed: [ruby-core:03982]
- * lib/ostruct.rb: Improve documentation. Patch by Franklin Webber.
- [Ruby 1.9 - Bug #4761]
+Mon Dec 20 11:21:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon May 23 08:35:24 2011 Eric Hodel <drbrain@segment7.net>
+ * io.c (rb_io_eof): check if closed before clearerr().
+ fixed: [ruby-dev:25251]
- * hash.c: Improve documentation of Hash#key. Patch by Utkarsh
- Kukreti. [Ruby 1.9 - Bug #4760]
+Mon Dec 20 03:30:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon May 23 08:32:59 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/cgi/session.rb (CGI::Session#initialize): empty session id was
+ used if request had no session key. fixed: [ruby-core:03981]
- * enumerator.c: Improve documentation. Patch by Dave Copeland.
- [Ruby 1.9 - Bug #4757]
+Mon Dec 20 01:51:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon May 23 07:19:45 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * struct.c (make_struct): [ruby-dev:25249]
- * NEWS (openssl): Infinite length support. Different behavior of
- Constructive and Primitive constructors.
+Mon Dec 20 00:28:20 2004 Kouhei Sutou <kou@cozmixng.org>
-Mon May 23 06:58:33 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/rexml/encodings/SHIFT-JIS.rb: backported from CVS HEAD.
- * ext/openssl/ossl_asn1.c: Forbid Constructives whose value is not an
- Array to prevent segfault. Added test.
+ * lib/rexml/encodings/SHIFT_JIS.rb: ditto.
-Mon May 23 06:33:17 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Sun Dec 19 17:19:48 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/openssl/ossl_asn1.c: Forbid Constructive without infinite
- length. This also prevents a segfault. Added test and improved
- documentation.
+ * ext/openssl/ossl_x509store.c
+ (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
+ (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
-Mon May 23 05:58:14 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * test/openssl/ossl_x509store.rb: test certificate validity times.
- * ext/openssl/ossl_asn1.c: Fix decoding of infinite length values.
- Simplified ossl_asn1_decode0 by splitting it into three separate
- functions. Add tests.
- [Ruby 1.9 - Bug #4374][ruby-core:35123]
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
+ second argument to specify the output format (see also
+ X509_NAME_print_ex).
-Mon May 23 04:03:46 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
+ OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
+ OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
- * ext/openssl/ossl_asn1.c (ossl_asn1_initialize): Allow creation of
- Constructives with an explicit tag_class parameter without
- automatically setting tagging to :EXPLICIT. Fixes a bug when encoding
- infinite length primitive values.
+ * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
+ new module to provide the parse for RFC2253 DN format.
-Mon May 23 04:03:46 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
+ new method to parse RFC2253 DN format.
- * ext/openssl/ossl_asn1.c (ossl_asn1_cons_to_der): Add an additional
- EOC for infinite length Constructives that are supposed to be encoded
- with explicit tagging. Also tabify method correctly.
+ * test/openssl/ossl_x509name.rb: add tests about RFC2253 DN.
-Mon May 23 03:44:39 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * text/openssl/ssl_server.rb: try to listen ports from 20443 to 20542
+ while EADDRINUSE is raised.
- * ext/openssl/ossl_asn1.c (ossl_asn1data_to_der): Remove redundant
- flag tmp_cons.
+ * all changes in this entry are backport from 1.9.
-Mon May 23 00:35:00 2001 Kenta Murata <mrkn@mrkn.jp>
+Sun Dec 19 17:24:59 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bignum.c (dump_bignum, bigmul1_balance, big_split, biglsh_bang),
- (bigrsh_bang, big_split3, bigmul1_toom3, bigmul0): implement Toom3 (Toom-Cook)
- multiplication.
+ * configure.in (enable_rpath): use rpath flag to embed the library
+ path into extensions on ELF environment. [ruby-dev:25035]
- * include/ruby/defines.h: add format prefixes for BDIGIT and BDIGIT_DBL.
+Sun Dec 19 11:01:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun May 22 23:24:02 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/test/unit.rb: use standalone runner for -e.
- * ext/openssl/ossl_asn1.c: Instead of rb_intern use static symbols to
- improve performance.
+ * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
+ multiple -p and -x options.
-Sun May 22 21:56:51 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
+ ditto.
- * ext/openssl/ossl_asn1.c: Use OpenSSL constants V_ASN1_xxx instead of
- hardcoded numbers for initializing class_tag_map.
+Sat Dec 18 16:36:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun May 22 21:29:29 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+ * ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
+ disallow interrupt by type conversion. fixed: [ruby-dev:25226]
- * include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. See #4255.
- Now __APPLE__ is not CASEFOLD_FILESYSTEM again.
+Sat Dec 18 15:16:41 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * load.c (loaded_feature_path, rb_feature_p, load_lock): Revert r30508.
- See #4255. Make $LOADED_FEATURES scanning case-sensitive again.
+ * lib/webrick/httpauth.rb,
+ lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
+ pack/unpack-template char "m" instead of lib/base64.rb to do base64
+ encoding/decoding.
-Sun May 22 18:59:27 2011 Hiroshi Nakamura <nahi@ruby-lang.org>
+Sat Dec 18 10:51:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_asn1.c(ossl_asn1_default_tag): avoid using RCLASS_SUPER
- to make it compilable. Plus, tabify and change variable definition style.
+ * dir.c (dir_open_dir): new function. [ruby-dev:25242]
-Sun May 22 18:26:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 17 18:07:01 2004 Shugo Maeda <shugo@ruby-lang.org>
- * gc.c (vm_xcalloc): use calloc provided by platforms.
- fixes #4754
+ * test/readline/test_readline.rb: fix for BSD. Thanks, GOTOU Yuuzou.
+ fixed: [ruby-dev:25218]
-Sun May 22 11:44:53 2011 Eric Hodel <drbrain@segment7.net>
+Fri Dec 17 16:28:12 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/pty/pty.c: Improve documentation. Patch by David Copeland.
- [Ruby 1.9 - Bug #4756]
+ * ext/tk/lib/tk.rb: fix bug on setting up system encoding
-Sun May 22 11:26:39 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/event.rb: fix error on require process
- * lib/timeout.rb: Improve documentation. Patch by David Copeland.
- [Ruby 1.9 - Bug #4755]
+ * ext/tk/lib/tk/font.rb: fix abnormal termination error on Windows
-Sun May 22 11:21:41 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
+ accepts event-sequence arguments
- * lib/ipaddr.rb: Improve documentation. Patch by Sandor Szucs.
- [Ruby 1.9 - Bug #4753]
+ * ext/tk/lib/tk/text.rb: fail to dump embedded images
-Sun May 22 11:14:40 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/text.rb: tag_nextrange and tag_prevrange returns wrong
+ types of values
- * lib/forwardable.rb: Document def_delegator. Patch by Sandor Szucs.
- [Ruby 1.9 - Bug #4752]
+ * ext/tk/lib/tk/texttag.rb: nextrange and prevrange returns wrong
+ types of values
-Sun May 22 11:11:41 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/text.rb: add TkText::IndexModMethods module and
+ TkText::IndexString class to treat text index modifiers
- * lib/fileutils.rb: Document block behavior of FileUtils.cd. Patch by
- Bil Kleb. [Ruby 1.9 - Bug #4751]
+ * ext/tk/lib/tk/texttag.rb: use TkText::IndexModMethods module
-Sun May 22 11:07:47 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/textmark.rb: ditto
- * ext/curses/curses.c: Complete documentation. Patch by Vincent
- Batts. [Ruby 1.9 - Bug #4748]
+ * ext/tk/lib/tk/textimage.rb: ditto
-Sun May 22 09:29:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/textwindow.rb: ditto
- * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
- use spawn. it prevent that other tests inherit renamed $0.
+ * ext/tk/lib/tk/textimage.rb: wrong gravity of text mark for embedded
+ image
-Sun May 22 08:57:13 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/tk/lib/tk/textwindow.rb: wrong gravity of text mark for
+ embedded window
- * ext/openssl/ossl_asn1.c: Default tag lookup in constant time via hash
- instead of previous linear algorithm.
- [Ruby 1.9 - Feature #4309][ruby-core:34813]
+Fri Dec 17 13:50:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
-Sun May 22 07:54:16 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * vms/vmsruby_private.c, vms/vmsruby_private.h: private routines
+ for VMS port are added.
- * ext/openssl/ossl_digest.c: Explain DSS and DSS1 in documentation.
+ * eval.c (ruby_init): change to call VMS private intialization routine.
-Sun May 22 07:10:25 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Fri Dec 17 13:33:58 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/openssl/test_pkey_dsa.rb: Add tests for sign/verify.
+ * lib/cgi/session.rb (CGI::Session#initialize): control adding
+ session_id hidden fields. fixed: [ruby-talk:123850]
-Sun May 22 06:07:17 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Dec 16 23:25:25 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/openssl/test_x509cert.rb: Merge DSA-related tests from ruby_1_8
- branch.
+ * lib/drb/drb.rb, lib/drb/ssl.rb: backported from CVS HEAD.
+ [druby-ja:101]
-Sun May 22 04:11:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/drb/test_drb.rb: adjust and reduce sleep (backported from
+ CVS HEAD.)
- * thread.c (Init_Thread): add a code comment why the meaningless
- line is necessary.
+Thu Dec 16 18:44:58 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun May 22 01:35:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
+ for reading request till data arrive. [ruby-talk:121068]
- * ext/date/date_core.c: modified documentation.
+ * lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
+ should log about all accepted socket. [ruby-core:03962]
-Sat May 21 22:46:26 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
+ "%%" and "%u" are supported. [webricken:135]
- * ext/date/date_strftime(date_strftime_with_tmx): "%v" means "%e-%b-%Y".
+ * lib/webrick/httpservlet/filehandler.rb
+ (WEBrick::HTTPServlet::FileHandler#check_filename):
+ :NondisclosureName is acceptable if it is Enumerable.
-Sat May 21 22:14:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/webrick/config.rb (WEBrick::Config::FileHandler):
+ default value of :NondisclosureName is [".ht*", "*~"].
- * io.c (rb_io_extract_modeenc): accept combination hash and
- File::Constants. (eg. File.open('yo', :mode => File::WRONLY))
- [Feature #4742][ruby-core:36338]
- * test/ruby/test_io.rb (TestIO#test_open_mode): new test.
+Thu Dec 16 18:36:52 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat May 21 21:44:14 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl.c (ossl_raise): refine message format.
- * test/date/test_switch_hitter.rb: new.
+Thu Dec 16 16:29:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat May 21 21:18:29 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/sample/demos-en/widget: modify version check for
+ supporting features
- * ext/date/date_{core,parse}.c: moved nearly all core code from ext/date/lib.
- * ext/date/lib/{date,date/format}.rb: removed nearly all code.
+Thu Dec 16 16:03:50 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat May 21 02:58:46 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
- * ext/.document: Add curses to documented extensions.
- * ext/curses/curses.c: Improve documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #4747]
+ * ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
-Sat May 21 02:51:01 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk.rb: add TkComm._callback_entry?()
- * ext/bigdecimal/lib/bigdecimal/util.rb: Improve documentation. Patch
- by Pete Higgins. [Ruby 1.9 - Bug #4746]
+ * ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
-Sat May 21 02:44:10 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
- * ext/bigdecimal/lib/bigdecimal/jacobian.rb: Document isEqual. Patch
- by Kuba Fietkiewicz. [Ruby 1.9 - Bug #4744]
+ * ext/tk/lib/tk/canvastag.rb: ditto
-Sat May 21 02:22:34 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/dialog.rb: ditto
- * ext/date/lib/date/format.rb: Document date formats. Patch by
- Clinton Nixon. [Ruby 1.9 - Bug #4743]
+ * ext/tk/lib/tk/optiondb.rb: ditto
-Fri May 20 05:15:19 2011 Nobuhiro Iwamatsu <iwamatsu@nigauri.org>
+ * ext/tk/lib/tk/text.rb: ditto
- * gc.c: Fix build on m68k by 'error: too few arguments to
- function 'mark_locations_array''.
+ * ext/tk/lib/tk/texttag.rb: ditto
-Fri May 20 04:23:42 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/textwindow.rb: ditto
- * lib/scanf.rb: Improve documentation. Patch by Gabe McArthur.
- [Ruby 1.9 - Bug #4735]
+ * ext/tk/lib/tk/timer.rb: ditto
-Fri May 20 00:58:01 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk/validation.rb: ditto
- * enc/trans/ibm737-tbl.rb: greek code page. fixes #4738
+ * ext/tk/lib/tkextlib/*: ditto
-Thu May 19 14:44:05 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Dec 16 03:14:28 2004 Minero Aoki <aamine@loveruby.net>
- * test/ruby/test_signal.rb (test_signal_requiring): skip on Windows.
- we can send SIGINT only to pid 0 and the process itself.
+ * lib/net/http.rb (basic_encode): return value of pack('m') may
+ include multiple CR/LFs. Backported from main trunk (rev 1.112).
+ [ruby-dev:25212]
-Thu May 19 09:07:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 16 00:33:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib: revert r31635-r31638 and untabify with expand(1).
+ * hash.c (Init_Hash): remove custom "hash" and "eql?".
-Thu May 19 07:47:26 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Wed Dec 15 18:57:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/openssl/test_pkey_rsa.rb: Add tests for sign/verify.
+ * lib/set.rb (Set::eql): wrong definition. [ruby-dev:25207]
-Thu May 19 07:19:16 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Wed Dec 15 18:48:42 2004 Shugo Maeda <shugo@ruby-lang.org>
- * ext/openssl/ossl_pkey.c: Add documentation.
+ * ext/curses/curses.c (window_subwin): call NUM2INT() before
+ GetWINDOW(). (backported from CVS HEAD)
-Thu May 19 07:06:56 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 15 17:03:50 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/benchmark.rb: Fix indentation.
- * lib/net/imap.rb: Fix indentation of regular expressions.
+ * win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
+ isatty because it never sets errno. (backported from CVS HEAD)
-Thu May 19 06:36:11 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 15 15:39:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/net/imap.rb: Fix indentation of EOF for heredoc.
- * lib/debug.rb (Commands): Fix indentation of EOHELP for heredoc.
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): avoid SEGV
+ (rollback the previous commit).
-Thu May 19 06:30:38 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 15 16:10:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb: Fix indentation of EOM for heredoc.
+ * object.c (rb_obj_id_obsolete): warn always.
-Thu May 19 06:16:41 2011 Eric Hodel <drbrain@segment7.net>
+ * eval.c (rb_enable_super): ditto.
- * lib: Convert tabs to spaces for ruby files per
- http://redmine.ruby-lang.org/projects/ruby/wiki/DeveloperHowto#coding-style
- Patch by Steve Klabnik [Ruby 1.9 - Bug #4730]
- Patch by Jason Dew [Ruby 1.9 - Feature #4718]
+Wed Dec 15 15:31:02 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu May 19 06:06:07 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/set.rb (Set#==): [ruby-dev:25206]
- * lib/cgi/util.rb: Improve documentation. Patch by Clinton Nixon.
- [Ruby 1.9 - Bug #4733]
- * lib/cgi/core.rb: ditto
- * lib/cgi/cookie.rb: ditto
+Wed Dec 15 14:22:10 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu May 19 06:02:21 2011 Eric Hodel <drbrain@segment7.net>
+ * win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
+ fixed: [ruby-core:03959]
- * lib/tempfile.rb: Document Dir.mkdir and Dir.rmdir. Patch by Clinton
- Nixon. [Ruby 1.9 - Bug #4728]
+Wed Dec 15 10:30:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu May 19 05:57:52 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
- * encoding.c: Improve documentation for Encoding#default_external and
- Encoding#default_internal.
+Tue Dec 14 17:10:09 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed May 18 22:45:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (rb_w32_close): need to reset osfhnd().
- * ext/io/console/lib/console/size.rb (IO#console_size): new
- method. (EXPERIMENTAL)
+Tue Dec 14 14:03:57 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed May 18 22:41:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
+ [ruby-dev:25187]
- * internal.h: add for internal use only.
+Tue Dec 14 12:36:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed May 18 22:36:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/cgi/session.rb (CGI::Session::initialize): generate new
+ session if given session_id does not exist. [ruby-list:40368]
- * eval.c (setup_exception): internal exception should be hidden
+Mon Dec 13 18:13:52 2004 Tanaka Akira <akr@m17n.org>
-Wed May 18 20:25:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * gc.c (stack_end_address): new function to obtain stack end address.
+ stack_end_address calls __builtin_frame_address(0) to obtain the
+ frame pointer of a stack frame of stack_end_address. The address
+ is the stack pointer of the caller's stack frame.
+ (SET_STACK_END): use stack_end_address.
+ This makes the conservative garbage collector to scan a stack frame
+ of the garbage_collect function itself. This is required because
+ callee-save registers may be stored in the frame.
+ [ruby-dev:25158]
- * lib/timeout.rb (Timeout#timeout): don't leak "execution expired"
- exception. [Bug #4283] [ruby-core:34534].
+Mon Dec 13 00:58:02 2004 Tanaka Akira <akr@m17n.org>
-Wed May 18 06:09:24 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/pathname.rb (cleanpath_aggressive): make it private.
+ (cleanpath_conservative): ditto.
+ Suggested by Daniel Berger. [ruby-core:3914]
- * lib/cmath.rb: Add some examples and improve documentation. Patch by
- Sandor Szucs. [Ruby 1.9 - Bug #4727]
+Sun Dec 12 20:06:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Wed May 18 05:40:31 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/drb/drb.rb: backported from CVS HEAD.
- * lib/benchmark.rb: Remove nodoc from Benchmark::Job and
- Benchmark::Report. Patch by Sandor Szucs. [Ruby 1.9 - Bug #4726]
+Sun Dec 12 10:35:10 2004 Dave Thomas <dave@pragprog.com>
-Wed May 18 05:29:26 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
+ show an accessor's r/w flag if none was specified
- * lib/webrick/compat.rb: Improve documentation. Patch by Sandor
- Szucs. [Ruby 1.9 - Bug #4725]
+Sun Dec 12 10:14:03 2004 Dave Thomas <dave@pragprog.com>
-Wed May 18 05:10:35 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
+ explicitly given on the command line.
- * lib/tracer.rb: Improve documentation. Patch by Richard Ramsden.
- [Ruby 1.9 - Feature #4720]
+Sun Dec 11 23:54:07 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed May 18 04:53:41 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/*: update to support libraries in ActiveTcl8.4.12.0
+ (see ext/tk/ChangeLog.tkextlib).
- * lib/cmath.rb: Improve documentation. Patch by Jason Dew.
- [Ruby 1.9 - Feature #4717]
+ * ext/tk/sample/scrollframe.rb: add a new sample.
-Wed May 18 04:50:24 2011 Eric Hodel <drbrain@segment7.net>
+Sat Dec 11 20:12:21 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/net/ftp.rb: Improve documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #4710]
+ * lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
+ [ruby-list:40390]
-Wed May 18 03:14:49 2011 Eric Hodel <drbrain@segment7.net>
+ * test/drb/drbtest.rb: ditto.
- * test/test_singleton.rb: Add tests from lib/singleton.rb. Patch by
- Pete Higgins. [Ruby 1.9 - Bug #4715]
+ * test/drb/ut_drb.rb: ditto.
-Wed May 18 03:03:07 2011 Eric Hodel <drbrain@segment7.net>
+Sat Dec 11 15:38:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/singleton.rb: Improve documentation. Patch by Pete Higgins.
- [Ruby 1.9 - Bug #4709]
+ * lib/jcode.rb (String::succ): [ruby-dev:25156]
-Tue May 17 21:24:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Dec 11 12:41:55 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * thread.c (rb_mutex_lock): remove remove_signal_thread_list() call.
- It's meaningless because lock_interrupt doesn't call
- add_signal_thread_list().
+ * eval.c (run_trap_eval): prototype; avoid VC++ warnings.
-Tue May 17 20:20:49 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/socket/getaddrinfo.c: fix typo. fixed: [ruby-core:03947]
- * vm_core.h (rb_thread_struct): add volatile to
- transition_for_lock because it is not protected by lock.
+ * win32/win32.c: need to include dln.h.
-Tue May 17 20:08:53 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Dec 11 00:10:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * LEGAL (missing/{elf,tgamma,lgamma_r}.c): they've been replaced by
- public domain implementations.
+ * io.c (io_reopen): [ruby-dev:25150]
- * LEGAL (vsnprintf.c): it has moved to srcdir from missing/.
+Fri Dec 10 08:39:27 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * LEGAL (missing/crypt.c): list its original license.
+ * ext/socket/socket.c (sock_listen): get OpenFile just before calling
+ listen(2). fixed: [ruby-dev:25149]
-Tue May 17 19:54:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Dec 9 17:00:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
- * LEGAL (configure): add missing/setproctitle.c
+ * ext/socket/socket.c, ext/socket/getaddrinfo.c: port to VMS
-Tue May 17 19:35:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- Fix FreeBSD test failure.
+Thu Dec 9 16:31:02 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
- use ps -o command instead of ps -o cmd. FreeBSD doesn't support
- -o cmd option.
+ * ext/sdbm/init.c (GetDBM): typo.
-Tue May 17 08:04:26 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Thu Dec 9 16:05:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
- * ext/openssl/ossl_digest.c: Add documentation.
+ * defines.h: change path of vms.h
+ * vms/vms.h: delete reference for snprintf()
+ * vms/config.h: new file
+ * vms/config.h_in: deleted
-Tue May 17 07:14:58 2011 Eric Hodel <drbrain@segment7.net>
+Thu Dec 9 14:38:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/http.rb: Improve documentation of proxy configuration
- methods. Patch by Alf Mikula. [Ruby 1.9 - Bug #4714]
+ * string.c (rb_str_inspect): escape # which starts an expression
+ substitution. fixed: [ruby-core:03922]
-Tue May 17 07:09:01 2011 Eric Hodel <drbrain@segment7.net>
+ * string.c (rb_str_dump): not escape # which isn't a substitution.
- * lib/net/pop.rb: Improve documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #4711]
- * lib/net/telnet.rb: ditto
+Thu Dec 9 10:54:36 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue May 17 07:00:41 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
- * lib/net/http.rb: Fix nodoc for Net::HTTP::version_1_1?. Patch by
- Alf Mikula. [Ruby 1.9 - Bug #4713]
+ * ext/sdbm/init.c: ditto.
-Tue May 17 06:56:26 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/gdbm/gdbm.c: ditto.
- * lib/optparse.rb: Add link to make_switch to improve documentation.
- Patch by David Copeland. [Ruby 1.9 - Bug #4708]
+Thu Dec 9 03:08:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue May 17 06:50:40 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
+ the running script is '-e one-liner' or '-' (stdin).
- * lib/observer.rb: Improve documentation. Patch by David Copeland.
- [Ruby 1.9 - Bug #4707]
+ * ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
+ stub libs
-Tue May 17 06:42:53 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
+ have a wrong parent class.
- * lib/logger.rb: Improve documentation. Patch by David Copeland.
- [Ruby 1.9 - Bug #4706]
+ * ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
+ TkWarning2 --> TkWarningObj (old names are changed to alias names)
-Tue May 17 06:28:14 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
+ option and hashes for configuration
- * lib/gserver.rb: Improve documentation. Patch by David Copeland.
- [Ruby 1.9 - Bug #4705]
+ * ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
+ button name
-Tue May 17 06:21:15 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
+ get_value() and value=(val) ==> set_value(val).
- * lib/cgi.rb: Add toplevel documentation to class CGI
- * lib/cgi/session.rb: Add overview documentation to CGI::Cookie
- * lib/cgi/html.rb: Don't add CGI::TagMaker documentation to CGI.
- Patch by David Copeland. [Ruby 1.9 - Bug #4704]
- * lib/cgi/core.rb: Clean up CGI documentation. Patch by David
- Copeland. [Ruby 1.9 - Bug #4704]
- * lib/cgi/cookie.rb: Clean up CGI::Cookie documentation. Patch by
- David Copeland. [Ruby 1.9 - Bug #4704]
+ * ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
-Tue May 17 05:52:30 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
+ TkOptionMenuButton = TkOptionMenubutton)
- * ext/digest: Improve documentation of Digest, Digest::HMAC and
- Digest::SHA2. Patch by Pete Higgins. [Ruby 1.9 - Bug #4702]
+ * ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
+ event_generate) for Event object
-Tue May 17 03:51:42 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/font.rb: configinfo returns proper types of values
- * lib/abbrev.rb: Hide copyright and revision information from RDoc.
- Inspired by patch from David Copeland, bug #4703.
+ * ext/tk/lib/tk.rb: bind methods accept subst_args + block
-Tue May 17 03:33:21 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/canvas.rb: ditto
- * lib/timeout.rb (module Timeout): Hide internal constants. Patch by
- Pete Higgins. [Ruby 1.9 - Bug #4701]
+ * ext/tk/lib/tk/canvastag.rb: ditto
-Mon May 16 11:21:09 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tk/frame.rb: ditto
- * configure.in, win32/Makefile.sub (RUBY_SO_NAME): add CPU as prefix
- of RUBY_SO_NAME on x64/ia64 mswin/mingw.
- [Feature #4602]
+ * ext/tk/lib/tk/text.rb: ditto
-Mon May 16 08:00:05 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tk/texttag.rb: ditto
- * lib/rdoc.rb: Update to RDoc 3.6.1, allows OpenSSL::Digest to be
- found.
+ * ext/tk/lib/tk/toplevel.rb: ditto
-Mon May 16 05:49:54 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/lib/tkextlib/*: ditto and bug fix
- * lib/drb/acl.rb: Add documentation.
+Wed Dec 8 23:54:29 2004 Dave Thomas <dave@pragprog.com>
-Mon May 16 05:13:20 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
+ meant that h2 tag was invisible.
- * ext/openssl/ossl_asn1.c: Add documentation.
+Wed Dec 8 21:56:31 2004 Kouhei Sutou <kou@cozmixng.org>
-Mon May 16 00:32:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rss, test/rss, sample/rss: backported from CVS HEAD.
- * test/ruby/test_signal.rb (TestSignal#test_signal_process_group):
- skip if the platform doesn't have :pgroup capability. (i.e. skip
- if mswin32)
+Wed Dec 8 14:31:36 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun May 15 23:53:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c (io_fwrite): change dereference for cosmetic reason.
- * include/ruby/intern.h: resurrect old rb_fd_copy().
- * thread.c (rb_fd_copy): ditto.
+ * sprintf.c (rb_f_sprintf): [ruby-dev:25104]
-Sun May 15 23:45:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Dec 7 19:08:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
- * include/ruby/intern.h: remove rb_fd_copy() to rb_fd_dup() and
- rb_w32_fdcopy() to rb_w32_fd_dup().
- * win32/win32.c: ditto.
- * thread.c: ditto.
+ * io.c (io_fwrite): fix offset incrementation (for VMS and Human68k)
-Sun May 15 22:26:39 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Tue Dec 7 00:27:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * signal.c (rb_f_kill): accept '-SIGXXX' style signal with Symbol or
- implicit convertion with #to_str. [ruby-dev:43169] fixes #4362
- * test/ruby/test_signal.rb (test_signal_process_group): add a test
- for send signal to process group.
+ * process.c (proc_setgroups): [ruby-dev:25081]
-Sun May 15 21:22:35 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Dec 6 18:08:10 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * cont.c (cont_init): clear macihne_stack_start/end of saved thread to
- prevent mark machine stack of GC'ed Thread. root Fiber is not
- initialized by fiber_init().
- based on a patch by Serge Balyuk [ruby-core:35891] fixes #4612
- * test/ruby/test_fiber.rb (test_gc_root_fiber): add test for it.
+ * re.c (rb_reg_eqq): document fix. [ruby-talk:122541]
-Sun May 15 21:04:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 6 17:19:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * transcode.c (econv_init): revert r31353. [ruby-dev:43512]
+ * rubysig.h (TRAP_BEG, TRAP_END): safe errno around CHECK_INTS.
+ (backported from CVS HEAD) [ruby-dev:24993]
-Sun May 15 03:39:35 2011 Eric Hodel <drbrain@segment7.net>
+Mon Dec 6 10:18:17 2004 Dave Thomas <dave@pragprog.com>
- * ext/zlib/zlib.c: Improve documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #4695]
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in):
+ Oops - 1.8 doesn't have String#clear
-Sun May 15 03:23:46 2011 Eric Hodel <drbrain@segment7.net>
+Mon Dec 6 09:59:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/erb.rb: Document ERB::Compiler. Patch by Simon Chiang.
- [Ruby 1.9 - Bug #4694]
+ * ext/socket/socket.c (sock_connect): use rb_str_new4().
+ [ruby-dev:25052]
-Sun May 15 00:58:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- fix mswin32 build error.
+Mon Dec 6 01:42:08 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * missing/setproctitle.c: add #ifdef HAVE_UNISTD_H.
- * win32/Makefile.sub (MISSING): add setproctitle.obj
+ * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
+ ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
+ ossl_rsa_private_decrypt): should take an optional argument
+ to specify padding mode. [ruby-talk:122539]
-Sat May 14 22:45:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
+ PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
+ under OpenSSL::PKey::RSA.
- * missing/setproctitle.c: add to include "ruby/util.h".
+ * test/openssl/test_pkey_rsa.rb: new file.
-Sat May 14 19:52:22 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Dec 5 19:39:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
- add for $0 test.
+ * lib/optparse.rb (OptionParser::Completion#complete): new parameter
+ to direct case insensitiveness.
-Sat May 14 19:50:46 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/optparse.rb (OptionParser#order!): ignore case only for long
+ option. [ruby-dev:25048]
- * missing/setproctitle.c (compat_init_setproctitle): use
- ruby_strdup() instead of strdup().
+Sat Dec 4 22:54:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat May 14 19:37:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c (io_write): remove rb_str_locktmp(). [ruby-dev:25050]
- * include/ruby/missing.h: add setproctitle() declaration.
- * missing/setproctitle.c: added.
- * configure.in: add check for missing/setproctitle.c.
+ * io.c (io_fwrite): takes VALUE string as an argument.
+ [ruby-dev:25050]
- * ruby.c (ruby_process_options): add to call compat_init_setproctitle().
- * ruby.c (set_arg0): remove all platform specific code. it's
- moved to missing/setproctitle.c.
- * ruby.c (origarg): remove len field. It's no longer used.
- * ruby.c (get_arglen): removed.
+ * ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
+ [ruby-dev:25050]
- This patch makes a lot of cleanup set_arg0 related code and fixes
- [Feature #4689].
+ * ext/socket/socket.c (udp_connect): [ruby-dev:25045]
-Sat May 14 17:42:21 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/socket/socket.c (udp_bind): ditto.
- * process.c (rb_proc_times): improve documentation.
- [ruby-core:35785] fixes #4581, reported by Andrew Grimm.
+ * ext/socket/socket.c (udp_send): ditto.
-Sat May 14 12:12:54 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/socket/socket.c (bsock_send): ditto.
- * test/openssl/test_pkey_dsa.rb: Add basic tests and tests that
- ensure new public key PEM encoding behavior and ensure backward
- compatibility.
- [Ruby 1.9 - Bug #4422] [ruby-core:35328]
- * test/openssl/test_pkey_rsa.rb: Remove line with 'puts'.
+ * ext/socket/socket.c (s_recvfrom): ditto.
-Sat May 14 12:06:49 2011 Eric Hodel <drbrain@segment7.net>
+ * hash.c (rb_hash_hash): should provide "hash" method where "eql?"
+ is redefined. [ruby-talk:122482]
- * lib/rdoc/context.rb (class RDoc): Fix infinite loop caused by
- re-encountering BasicObject.
+Sat Dec 4 14:54:52 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat May 14 10:32:36 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * eval.c (proc_invoke): use volatile `tmp' rather than `args'.
+ [ruby-core:03882]
- * test/openssl/test_pkey_rsa.rb: Add tests that ensure new public key
- encoding behavior and also ensure backward compatibility.
- [Ruby 1.9 - Bug #4421] [ruby-core:35327]
+Sat Dec 4 14:28:56 2004 Dave Thomas <dave@pragprog.com>
-Sat May 14 09:50:10 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
+ Section comments may now be bracketed by lines which are
+ ignored. You can now write
+ # -----------
+ # :section: Dave's Section
+ # comment material
+ # -----------
+ The lines before :section: are removed, and identical lines at the end are
+ also removed if present.
- * lib/yaml/dbm.rb: Add documentation. Patch by Justin Collins.
- [Ruby 1.9 - Bug #4693]
- * lib/yaml/store.rb: ditto
+Sat Dec 4 03:33:45 2004 Shugo Maeda <shugo@ruby-lang.org>
-Sat May 14 09:31:43 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/readline/readline.c: check $SAFE. (backported from CVS HEAD)
- * lib/rdoc.rb: Updated to RDoc 3.6
+ * test/readline/test_readline.rb: added tests for readline.
+ (backported from CVS HEAD)
-Sat May 14 07:30:29 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Sat Dec 4 02:24:00 2004 NARUSE, Yui <naruse@ruby-lang.org>
- * ext/psych/lib/psych.rb: released a new gem, so increasing version.
+ * ext/nkf/nkf.c: add constant NKF::VERSION
-Sat May 14 05:08:32 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/nkf/nkf.c(guess): this becomes an alias of guess2
- * ext/openssl/ossl_digest.c
- * ext/openssl/ossl_pkey.c
- * ext/openssl/ossl_pkey.h
- * test/openssl/pkey/test_pkey_rsa.rb
- Reverted premature commit. Sorry for the noise!
+ * ext/nkf/test.rb(mime_out2): add --no-cp932
-Sat May 14 05:02:58 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
- * lib/uri.rb: Add toplevel documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #4690]
+Sat Dec 4 00:35:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat May 14 04:19:06 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
- * NEWS: Describe altered behaviour for RSA and DSA public key
- encoding. [Ruby 1.9 - Bug #4421, Bug #4422]
- [ruby-core:35327,35328]
+Fri Dec 3 18:57:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat May 14 02:57:52 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/ostruct.rb: 1.9 marshaling support back-ported.
+ [ruby-core:03871]
- * lib/ipaddr.rb (unless Socket): Document valid*? methods. Patch by
- Sebastian Martinez. [Ruby 1.9 - Feature #4687]
+Fri Dec 3 13:45:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat May 14 02:54:04 2011 Eric Hodel <drbrain@segment7.net>
+ * eval.c (proc_invoke): copy arguments to frame.argv.
+ [ruby-core:03861]
- * lib/rexml/functions.rb: Add some documentation for REXML::Functions.
- Patch by Sebastian Martinez. [Ruby 1.9 - Feature #4688]
+Fri Dec 3 12:25:41 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat May 14 02:51:42 2011 Eric Hodel <drbrain@segment7.net>
+ * st.h: fix prototypes.
- * lib/resolv.rb: Hide private method and state-tracking constants from
- RDoc. Patch by Mark Turner. [Ruby 1.9 - Feature #4691]
+Fri Dec 3 00:21:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri May 13 19:23:21 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * object.c (convert_type): use rb_respond_to() again.
+ [ruby-dev:25021]
- * numeric.c (flo_coerce): Add #flo_coerce documentation.
- Patch by Sebastian Martinez.
- https://github.com/ruby/ruby/pull/21
+ * eval.c (rb_respond_to): funcall respond_to? if it's redefined.
+ [ruby-dev:25021]
-Fri May 13 18:42:22 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
+Fri Dec 3 01:55:24 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * README.EXT: fix typo. Patch by William Blackerby.
- https://github.com/ruby/ruby/pull/19
+ * ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
+ returns proper object. "widget.option = val" returns val, and
+ "widget.option(val)" returns self.
- * README.EXT.ja: ditto.
+ * ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
-Fri May 13 15:22:34 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
+ TkRadiobutton#value=(val).
- * win32/win32.c (rb_w32_select): check invalid handle before doing
- select operations. see [ruby-dev:43513], [ruby-dev:43535]
+ * ext/tk/lib/tk/spinbox.rb: callback substitution support on
+ command option.
-Fri May 13 08:34:00 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tk/sample/demos-en/widget: bug fix (wrong image height)
- * lib/rdoc/rdoc.rb: Output summary after documentation report.
- * lib/rdoc/stats/normal.rb: Don't output information for users when
- we're not on a TTY
+ * ext/tk/sample/demos-jp/widget: ditto.
-Fri May 13 07:49:02 2011 Eric Hodel <drbrain@segment7.net>
+Fri Dec 3 00:11:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/fileutils.rb: Hide internal methods from RDoc. Patch by Darragh
- Curran. [Ruby 1.9 - Bug #4684]
+ * io.c (rb_file_initialize): [ruby-dev:25032]
-Fri May 13 07:36:23 2011 Eric Hodel <drbrain@segment7.net>
+Thu Dec 2 16:41:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/webrick/httpservlet/erbhandler.rb: Add documentation.
+ * eval.c (rb_protect): prevent continuations created inside from being
+ called from the outside. [ruby-dev:25003]
-Fri May 13 07:04:33 2011 Eric Hodel <drbrain@segment7.net>
+ * eval.c (rb_callcc, rb_cont_call): prohibit calling from different
+ signal contexts. [ruby-dev:25022]
- * lib/mathn.rb: Fix indentation. Patch by Jason Dew.
- [Ruby 1.9 - Feature #4682]
+Thu Dec 2 09:57:24 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri May 13 06:50:43 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
+ marshaled again. [ruby-core:03862]
- * lib/mathn.rb: Add documentation. Patch by Jason Dew. [Ruby 1.9 -
- Feature #4667]
+Thu Dec 2 09:30:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri May 13 05:44:19 2011 Eric Hodel <drbrain@segment7.net>
+ * eval.c (thread_mark): mark thread group. [ruby-dev:25020]
- * lib/logger.rb (class Logger): Document Logger#datetime_format.
- Patch by Sergio Gil Perez de la Manga. [Ruby 1.9 - Bug #4678]
+ * eval.c (thgroup_add): check whether the argument is really a Thread.
-Fri May 13 05:39:11 2011 Eric Hodel <drbrain@segment7.net>
+Thu Dec 2 07:57:16 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * re.c (Init_Regexp): Document option constants. Patch by Vincent
- Batts. [Ruby 1.9 - Bug #4677]
- * lib/uri/common.rb (module URI): Documentation for URI. Patch by
- Vincent Batts. [Ruby 1.9- Bug #4677]
- * lib/uri/ftp.rb (module URI): ditto
- * lib/uri/generic.rb (module URI): ditto
- * lib/uri/http.rb (module URI): ditto
- * lib/uri/https.rb (module URI): ditto
- * lib/uri/ldap.rb (module URI): ditto
- * lib/uri/ldaps.rb (module URI): ditto
- * lib/uri/mailto.rb (module URI): ditto
- * process.c (Init_process): Document Process constants. Patch by
- Vincent Batts. [Ruby 1.9- Bug #4677]
+ * io.c (rb_io_ctl): [ruby-dev:25019]
-Fri May 13 05:16:38 2011 Eric Hodel <drbrain@segment7.net>
+Wed Dec 1 02:21:02 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/rss/atom.rb (module RSS): Document URIs. Patch by Mark Turner.
- [Ruby 1.9 - #4671]
- * lib/rss/rss.rb (module RSS): Document exception classes. Patch by
- Mark Turner. [Ruby 1.9 - #4671]
+ * signal.c (sighandler): call handler immediately only for default
+ handlers. [ruby-dev:25003]
-Fri May 13 02:15:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Nov 30 23:38:18 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (select_internal): remove unused variable (interrupt_flag).
+ * io.c (io_fread): need not to null terminate. [ruby-dev:24998]
-Thu May 12 18:24:34 2011 Kouhei Sutou <kou@clear-code.com>
+ * io.c (read_all): remove unnecessary rb_str_resize().
+ [ruby-dev:24996] (backported from CVS HEAD)
- * configure.in: limit to "T" type for prefix of external symbols
- because x86_64-w64-mingw32-gcc on Debian GNU/Linux generates the
- following symbol:
- 0000000068483390 D _GLOBAL__F__conftest_external
+ * io.c (io_readpartial): ditto.
- Approved by nobu.
+ * io.c (io_read): ditto.
-Thu May 12 14:50:52 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Nov 30 16:18:50 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/dl/test_base.rb (Fiddle::LIBC_SO): its always msvc*.dll on
- mswin/mingw.
+ * io.c (io_fread): need not to null terminate. [ruby-dev:24998]
-Thu May 12 14:47:53 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * io.c (read_all): remove unnecessary rb_str_resize().
+ [ruby-dev:24996]
- * lib/mkmf.rb (Logging.postpone): copy only when temporary logfile
- exists.
+ * io.c (io_read): ditto.
-Thu May 12 12:24:22 2011 Nobuhiro Iwamatsu <iwamatsu@nigauri.org>
+Tue Nov 30 00:49:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_ssl.c: By trunk@31346, function check of SSLv2 is
- executed.
- However, the problem is not revised in this.
- This adds the control of using function of SSLv2 in made macro by
- function check.
+ * io.c (rb_io_sysread): use temporary lock. [ruby-dev:24992]
-Thu May 12 08:10:46 2011 Eric Hodel <drbrain@segment7.net>
+Mon Nov 29 16:06:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/set.rb (class Set): Add nodoc to internal-use methods. Patch
- by Pete Higgins. [Ruby 1.9 - Bug #4665]
+ * ext/stringio/stringio.c (strio_write): insufficiently filled string
+ being extended when overwriting. [ruby-core:03836]
-Thu May 12 08:01:14 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+Mon Nov 29 15:59:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_pkey_ec.c: Allow encryption when PEM-encoding
- Elliptic Curve private keys.
- [ruby-core:35329] [Bug #4423]
+ * lib/ostruct.rb (OpenStruct::method_missing): check method
+ duplication for -d.
-Thu May 12 07:54:59 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/ostruct.rb (OpenStruct::initialize): ditto.
- * object.c (rb_obj_equal): Add documentation. Patch by Vincent Batts.
- [Ruby 1.9 - Bug #4664]
- * lib/rexml: ditto
- * lib/mkmf.rb: ditto
- * ext/socket/lib/socket.rb: ditto
+Mon Nov 29 15:22:28 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu May 12 07:30:08 2011 Eric Hodel <drbrain@segment7.net>
+ * test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
+ not supported.
- * Various .document files: Update .document files to match files which
- have documentation.
+Mon Nov 29 03:08:30 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu May 12 07:18:45 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * object.c (convert_type): direct call conversion methods for the
+ performance. [ruby-core:03845]
- * ext/openssl/ossl_pkey_dsa.c: Use generic X.509 SubjectPublicKeyInfo
- format for PEM-encoding DSA public keys.
- [ruby-core:35328] [Bug #4422]
+ * eval.c (rb_funcall_rescue): new function.
-Thu May 12 06:27:31 2011 Martin Bosslet <Martin.Bosslet@googlemail.com>
+ * object.c (rb_Array): avoid using rb_respond_to().
- * ext/openssl/ossl_pkey_rsa.c: Use generic X.509 SubjectPublicKeyInfo
- format for encoding RSA public keys.
- [ruby-core:35327] [Bug #4421]
+ * object.c (rb_Integer): ditto.
-Wed May 11 19:45:27 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * parse.y (reduce_nodes): empty body should return nil.
- * lib/forwardable.rb: support 'delegate :foo => :bar' for to meet
- by specification of RDOC.
+ * string.c (rb_str_aset): the original string should not be
+ affected by modifying duplicated string. [ruby-dev:24981]
-Wed May 11 08:36:38 2011 Eric Hodel <drbrain@segment7.net>
+Mon Nov 29 13:57:38 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/webrick: Add documentation for WEBrick::HTTPAuth
+ * win32/win32.c (CreateChild): search executable file if no program
+ name given. (backported from CVS HEAD)
-Wed May 11 03:06:35 2011 Eric Hodel <drbrain@segment7.net>
+Mon Nov 29 13:37:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rss.rb: Add documentation for RSS. Patch by Steve Klabnik.
- [Ruby 1.9 - Bug #4663]
+ * io.c (fptr_finalize): must not use FILE after fclose().
+ [ruby-dev:24985]
-Tue May 10 14:50:32 2011 Shota Fukumori <sorah@tubusu.net>
+Mon Nov 29 13:16:31 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/test/unit.rb: Add option for hiding skip messages when test
- ends. #4657
+ * win32/win32.c (CreateChild): push back the last space before next
+ loop because CharNext() eats it.
- * test/testunit/test_hideskip.rb, test/testunit/test4test_hideskip.rb:
- test for above.
+Mon Nov 29 01:18:18 2004 Tanaka Akira <akr@m17n.org>
-Tue May 10 10:53:04 2011 Eric Hodel <drbrain@segment7.net>
+ * io.c (rb_io_check_writable): call io_seek regardless of
+ NEED_IO_SEEK_BETWEEN_RW. [ruby-dev:24986]
- * common.mk (rdoc): Add rdoc-coverage rule
+Sat Nov 27 21:43:39 2004 Tanaka Akira <akr@m17n.org>
-Tue May 10 09:13:21 2011 Eric Hodel <drbrain@segment7.net>
+ * io.c: avoid data lost with nonblocking fd and
+ stdio buffering in sync mode. [ruby-dev:24966]
+ based on matz's patch [ruby-dev:24967]
+ (io_fwrite): new primitive writing function which writes
+ directly if sync mode.
+ (rb_io_fwrite): wrapper for io_fwrite now.
+ (io_write): call io_fwrite instead of rb_io_fwrite.
- * lib/webrick: Add Documentation
+Sat Nov 27 14:44:15 2004 Kent Sibilev <ksibilev@bellsouth.net>
-Tue May 10 04:22:09 Eric Hodel <drbrain@segment7.net>
+ * lib/cgi/session.rb (CGI::Session::initialize): create_new_id is
+ now a instance method. [ruby-core:03832]
- * lib/webrick/log.rb: Hide copyright info from ri
- * lib/webrick/httpstatus.rb: ditto
- * lib/webrick/htmlutils.rb: ditto
- * lib/webrick/httpversion.rb: ditto
- * lib/webrick/version.rb: ditto
- * lib/webrick/httpauth/userdb.rb: ditto
- * lib/webrick/httpauth/authenticator.rb: ditto
- * lib/webrick/accesslog.rb: ditto
+Sat Nov 27 09:41:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon May 9 20:57:13 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * io.c (io_fread): old rb_io_fread with file closing checking.
+ (rb_io_fread): wrapper for io_fread now.
+ [ruby-dev:24964]
- * test/ruby/test_{complex,rational}.rb: added tests.
+Fri Nov 26 18:02:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Mon May 9 20:29:44 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
- * complex.c (string_to_c_internal): a refactoring.
+ * ext/tk/lib/tk/image.rb: bug fix
-Mon May 9 18:33:05 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
- * string.c: Improve documentation for String#start_with? and
- String#end_with?. fixes #4652
- patched by Andrew Grimm <andrew.j.grimm at gmail.com>
+ * ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
-Mon May 9 13:49:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Fri Nov 26 13:49:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * complex.c (string_to_c_internal): support scientific notation.
- patched by Tinco Andringa. https://github.com/ruby/ruby/pull/16
- [ruby-core:36046][Bug #4655]
+ * eval.c (method_missing): raise TypeError for classes do not
+ have allocators. [ruby-core:03752]
-Mon May 9 11:52:48 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/erb.rb: add RDoc by James Edward Gray II. [ruby-core:03786]
- * numeric.c (int_ord): remove K&R style.
- patched by Daehyub Kim. https://github.com/ruby/ruby/pull/17
+Fri Nov 26 13:29:02 2004 Dave Thomas <dave@pragprog.com>
-Sun May 8 22:17:24 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
+ out of preprocessing when we find a :section: directive (previously cleared out the
+ comment, but this apparently now generates an error in gsub!)
- * test/ruby/test_{complex2,complexrational}.rb: use skip.
- * test/date/*.rb: ditto.
+Fri Nov 26 00:17:40 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun May 8 21:02:31 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * io.c (io_read): move StringValue() check before GetOpenFile().
+ [ruby-dev:24959]
- * test/ruby/test_{complex2,complexrational}.rb: NEVER SKIP.
+Thu Nov 25 20:14:57 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun May 8 21:01:21 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
+ threads should be also processed. [ruby-talk:121320]
- * test/date/test_date_base.rb: fixed.
+Thu Nov 25 10:14:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun May 8 20:54:11 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * dir.c (push_braces): do not reuse buffer strings. [ruby-core:03806]
- * test/date/*.rb: NEVER SKIP.
+Thu Nov 25 07:59:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun May 8 20:37:33 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * io.c (read_all): stringify non-nil buffer argument, and always
+ taint the result. [ruby-dev:24955]
- * test/date/*.rb: reverted 31432.
+Wed Nov 24 01:01:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun May 8 20:32:43 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * io.c (io_read): integer conversion should be prior to
+ GetOpenFile(). [ruby-dev:24952]
- * test/date/*.rb: reverted 31483.
+ * configure.in, io.c: cancel [ ruby-Patches-1074 ].
-Sun May 8 19:39:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Nov 23 08:09:50 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread_pthread.c (native_cond_timedwait): add to care EINTR.
- * thread_pthread.c (thread_timer): remove EINTR check.
+ * ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
-Sun May 8 19:04:15 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Nov 23 02:00:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/time.rb (xmlschema): avoid passing any negative numbers.
+ * file.c (rb_file_chown): integer conversion should be prior to
+ GetOpenFile(). [ruby-dev:24949]
-Sun May 8 18:40:03 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Nov 23 00:10:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_{parse,strptime}.c: introduced some macros.
+ * file.c (rb_file_chown): integer conversion should be prior to
+ GetOpenFile(). [ruby-dev:24947]
-Sun May 8 17:17:13 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * file.c (rb_file_truncate): ditto.
- * test/date/*.rb: use skip /w messages.
+ * file.c (rb_file_s_truncate): ditto.
-Sun May 8 17:04:55 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * dir.c (dir_seek): use NUM2OFFT().
- * ext/date/lib/date/format.rb (_httpdate): omitted to call zone_to_diff.
+ * misc/ruby-mode.el (ruby-non-block-do-re): should not match words
+ start with block keyword and underscore. [ruby-core:03719]
-Sun May 8 16:56:19 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Mon Nov 22 22:33:02 2004 Dave Thomas <dave@pragprog.com>
- * ext/date/date_core.c (date_s_test_*): use macros.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
+ of variables or constants when oarsing 'require'
-Sun May 8 10:24:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Nov 22 00:13:35 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.c: cleanup signal_thread_list related ifdef.
- 1) we don't have to use #ifdef FOO-PLATFORM directly 2) About
- half #ifdef didn't care symbian properly.
+ * dir.c (dir_seek): should retrieve dir_data after NUM2INT().
+ [ruby-dev:24941]
-Sun May 8 05:19:37 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Nov 20 23:57:33 2004 Dave Thomas <dave@pragprog.com>
- * test/io/wait/test_io_wait.rb: Linux socketpair(2) only support
- AF_UNIX, but windows socketpair doesn't support it. we can't
- avoid platform check. sigh!
+ * lib/rdoc/README (et al): Add a new directive, :section:, and
+ change the output format to accomodate. :section: allows to to
+ group together methods, attributes, constants, etc under
+ headings in the output. If used, a table of contents is
+ generated.
-Sun May 8 00:13:05 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Nov 20 23:56:54 2004 Dave Thomas <dave@pragprog.com>
- * test/io/wait/test_io_wait.rb: use Socket.pair instead of pipe.
- Windows can only treat a socket.
+ * lib/rdoc/options.rb (Options::parse): Force --inline-source if
+ --one-file option given
-Sat May 7 22:43:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Nov 20 23:55:19 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread.c (rb_fd_zero): remove redundant zero fill.
+ * string.c (rb_str_splice): should place index wrapping after
+ possible modification. [ruby-dev:24940]
-Sat May 7 22:38:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Nov 20 13:26:03 2004 NARUSE, Yui <naruse@ruby-lang.org>
- * thread.c (rb_fd_init): remove volatile qualifier.
+ * ext/nkf/nkf-utf8/utf8tbl.c: original revision 1.7
-Sat May 7 22:34:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Nov 20 05:34:24 2004 NARUSE, Yui <naruse@ruby-lang.org>
- * thread.c (rb_fd_init_copy): new internal api. It provide efficient
- copy constructor semantics.
- * thread.c (do_select): use rb_fd_init_copy().
+ * ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
-Sat May 7 15:18:06 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- fix incorrect native_cond_signal call when deadlock was detected.
+ * ext/nkf/test.rb: add test for mime encode/decode
- * thread.c (lock_func): decrement cond_waiting if timeout was happen.
+Sat Nov 20 01:37:34 2004 Johan Holmberg <holmberg@iar.se>
-Sat May 7 18:28:37 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (error_print): nicer traceback at interrupt.
+ [ruby-core:03774]
- * thread_pthread.c (USE_MONOTONIC_COND): check the availability
- more strictly.
+Sat Nov 20 00:07:16 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_pthread.h (rb_thread_cond_t): ditto.
+ * string.c (str_gsub): internal buffer should not be listed by
+ ObjectSpace.each_object() by String#gsub. [ruby-dev:24931]
-Sat May 7 15:15:10 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 19 01:20:22 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- fix win32 native_cond_timedwait() makes SIGSEGV.
+ * lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
+ exception if data corresponding to session specified from the
+ client does not exist.
- * thread_win32.h (rb_thread_cond_struct): add prev field instead of
- last. (ie cond_event_entry is now using double linked list instead of
- single)
- * thread_win32.c (cond_event_entry): add prev field.
+Fri Nov 19 00:59:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread_win32.c (__cond_timedwait): remove entry properly if timeout
- was happen.
+ * string.c (str_gsub): internal buffer should not be listed by
+ ObjectSpace.each_object(). [ruby-dev:24919]
- * thread_win32.c (native_cond_signal): change for double linked list.
- * thread_win32.c (native_cond_broadcast): ditto.
- * thread_win32.c (native_cond_initialize): ditto.
+Thu Nov 18 18:41:08 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Sat May 7 12:41:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- fix mutex deadlock test hang-up.
+ * test/ruby/test_stringchar.rb (test_bang): added.
- * thread_win32.c (abs_timespec_to_timeout_ms): fix 1000x calculation
- mistake. (ie fix hang-up native_cond_timedwait())
+ * string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
+ (rb_str_swapcase_bang): missing rb_str_modify(). [ruby-dev:24915]
-Sat May 7 03:14:13 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Nov 18 00:21:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- sleep_cond use monotonic time if possible.
+ * process.c (proc_getpgrp): prohibit for $SAFE=2.
+ [ruby-dev:24899]
- * thread_pthread.c (native_thread_init): change sleep_cond
- attribute to monotonic.
- * thread_pthread.c (native_sleep): use native_cond_timeout().
+ * process.c (get_pid): ditto. [ruby-dev:24904]
- * thread_pthread.c (native_cond_timeout): add overflow care.
- * thread_win32.c (native_cond_timeout): ditto.
+ * process.c (get_ppid): ditto.
-Sat May 7 02:49:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
- fix win32 compile error.
+ * array.c (rb_ary_delete): defer rb_ary_modify() until actual
+ modification. [ruby-dev:24901]
- * thread_win32.c (RB_CONDATTR_CLOCK_MONOTONIC): define
- RB_CONDATTR_CLOCK_MONOTONIC always.
- * thread_pthread.c (RB_CONDATTR_CLOCK_MONOTONIC): ditto.
+Thu Nov 18 10:10:14 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat May 7 02:29:41 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c, rubyio.h (rb_io_modenum_flags): exported.
- mutex: deadlock check timeout use monotonic time.
+ * ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
+ well as IO.new does. [ruby-dev:24896]
- * thread_pthread.c (native_cond_timeout): new internal api.
- it calculate a proper time for argument of native_cond_timedwait().
- * thread_win32.c (native_cond_timeout): ditto.
+Wed Nov 17 23:42:40 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * thread_pthread.c (thread_timer): use native_cond_timeout()
- instead of get_ts.
- * thread.c (lock_func): ditto.
+ * test/ruby/test_settracefunc.rb: added. [ruby-dev:24884]
- * thread_pthread.c (get_ts): removed. use native_cond_timeout().
- * thread.c (init_lock_timeout): ditto.
+Wed Nov 17 13:56:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat May 7 01:54:21 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
- * thread_pthread.c (get_ts): add monotonic clock capability.
- * thread_pthread.c (rb_thread_create_timer_thread): use monotonic
- clock if possible.
+ * parse.y (string_content): should not use FL_UNSET.
-Sat May 7 01:43:37 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * node.h (NODE_NEWLINE): remove unused bit to utilize flag field
+ in nodes.
- * thread_pthread.h (rb_thread_cond_t): add clockid field. it's
- no longer an alias of pthread_cond_t.
- * thread_pthread.c: adapt new rb_thread_cond_t type.
- * thread.c (mutex_alloc): ditto.
- * thread_win32.c (native_cond_initialize): ditto.
- * configure.in: add check for pthread_cond_attr_setclock() and
- clockid_t type.
+Wed Nov 17 13:09:40 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri May 6 23:29:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * {bcc32,win32,wince}/Makefile.sub (test): should build ruby.exe
+ before running test. [ruby-core:03756]
- * thread.c (rb_wait_for_single_fd): use ppoll() instead of poll()
- if possible. based on a patch from Eric Wong. [ruby-core:36003].
+Wed Nov 17 04:33:01 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri May 6 23:13:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * pack.c: all features are backport from 1.9. [ruby-dev:24826]
- * configure.in: remove nanosleep check. we no longer use it.
- r20124 removed last usage.
+ * bignum.c (rb_big2ulong_pack): new function to pack Bignums.
-Fri May 6 22:35:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 17 03:42:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/syck/rubyext.c (mktime_do): extra digits are not used.
+ * string.c (rb_str_splice): move rb_str_modify() after
+ StringValue(), which may alter the receiver. [ruby-dev:24878]
-Fri May 6 17:43:07 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Nov 16 23:45:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/syck/rubyext.c (mktime_do): remove unused variable offset.
+ * numeric.c (flo_divmod): protect float values from GC by
+ assignment to local variables. [ruby-dev:24873]
- * ext/syck/syck.h: use #ifdef instead of #if DEBUG.
+Tue Nov 16 16:30:21 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri May 6 16:27:33 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
+ config.status to force updating them.
- * ext/date/date_core.c (DAY_IN_NANOSECONDS): refix: 31438.
- check with LONG_MAX and cast as long; without this the calculation
- will be done as int and overflow.
+Tue Nov 16 16:20:45 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri May 6 15:01:11 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/stringio/stringio.c (strio_read): position was ignored when a
+ buffer was passed. http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
- * ext/syck/rubyext.c (mktime_do): avoid buffer overrun, by
- silently ignoring lesser significant digits. Required buffer
- length can be computable so you might at first think of
- allocating enough memory space on the fly using alloca(). That
- is a wrong idea because when using alloca there is always risk
- of integer overflow. A function that accepts outer-process
- resources like this should not blindly trust its inputs. In
- this particular case we just want to generate milliseconds
- resolution by strtod() so the string in question needs no more
- length than what we originally have. Ignoring lesser
- significant digits should suffice I believe.
+Tue Nov 16 11:19:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri May 6 14:25:53 2011 Tinco Andringa <mail@tinco.nl>
+ * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
+ Regexp conversion.
- * ext/syck/rubyext.c (mktime_do): YAML.load time correctly parse
- usecs smaller than 1 fixes #4571
+Tue Nov 16 01:41:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu May 5 22:23:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * string.c (str_mod_check): frozen check should be separated.
+ [ruby-core:3742]
- * thread_pthread.c (native_mutex_reinitialize_atfork): removed
- unused macro.
- * thread_win32.c (native_mutex_reinitialize_atfork): ditto.
+ * array.c (rb_ary_update): pedantic check to detect
+ rb_ary_to_ary() to modify the receiver. [ruby-dev:24861]
-Thu May 5 22:09:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 15 13:50:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_core.c (DAY_IN_NANOSECONDS): long long int is not
- available on all platforms.
+ * string.c (rb_str_justify): typo fixed. [ruby-dev:24851]
-Thu May 5 17:36:31 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Nov 15 11:50:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (frame_func_id): store result of method_entry_of_iseq() to
- cfp->me because method_entry_of_iseq() might become expensive.
+ * misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
+ operator symbols. [ruby-talk:120177]
-Thu May 5 15:03:51 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Sun Nov 14 13:27:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (frame_func_id): __method__ return different name from
- methods defined by Module#define_method with a same block.
- [ruby-core:35386] fixes #4606
- * eval.c (method_entry_of_iseq): new helper function. search control
- frame stack for a method entry which has given iseq.
- * test/ruby/test_method.rb: add tests for #4606
+ * lib/pp.rb (PP#object_address_group): remove odd number of 'f'
+ prefixed to negative address.
-Wed May 4 22:13:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Nov 14 08:51:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * benchmark/bm_vm4_pipe.rb: Reduced iterations. Too slow benchmark
- is bad.
- * benchmark/bm_vm4_thread_pass.rb: ditto.
+ * test/logger/test_logger.rb: Logger just expects
+ Logger#datetime_format to be used for Time#strftime independently of
+ locale. [ruby-dev:24828]
-Wed May 4 22:08:22 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 12 15:03:26 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * test/date/test_date_base.rb: don't use no message skip().
+ * eval.c (ruby_options): now we cannot call rb_glob() before
+ ruby_init(), so call rb_w32_cmdvector() at ruby_options().
-Wed May 4 21:11:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
+ export it.
- * benchmark/bm_io_select2.rb: reduce number of using file
- descriptors. because gdb need some fds.
+Fri Nov 12 14:08:01 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed May 4 19:00:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
- * thread.c (rb_wait_for_single_fd): Fix wrong return value.
- * test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb
- (TestWaitForSingleFD#test_wait_for_closed_pipe): test for it.
+ * ext/tk/lib/tk.rb: ditto
-Wed May 4 18:46:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 12 00:31:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/-test-/wait_for_single_fd: New. for testing
- rb_wait_for_single_fd() internal function.
- The patch was written by Eric Wong. [ruby-core:35991]
+ * ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
+ pointer. [ruby-dev:24783]
- * test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb: ditto.
+Thu Nov 11 17:36:12 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed May 4 12:46:25 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * dir.c (rb_globi): also should call back via rb_glob_caller().
+ [ruby-dev:24775]
- * thread.c (rb_wait_for_single_fd): Added POLLNVAL check.
- based on a patch from Eric Wong at [ruby-core:35991].
+Thu Nov 11 16:47:21 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed May 4 11:51:01 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/ruby/test_file.rb (test_truncate_wbuf): we want to test
+ only File#truncate, not behaviour of seek(2).
- * io.c (rb_f_select): remove useless ifdef.
+Thu Nov 11 09:41:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed May 4 11:42:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * dir.c (push_braces): was confusing VALUE and char*.
- * ext/socket/init.c (wait_connectable): fix error handling code.
- RB_WAITFD_OUT is turned on even though an error occur.
+ * dir.c (rb_push_glob): Dir.glob should have called its block.
-Wed May 4 10:12:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Nov 11 01:52:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/readline/readline.c (readline_event): use rb_wait_for_single_fd().
- The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
+ * error.c (syserr_initialize): use stringified object.
+ [ruby-dev:24768]
-Wed May 4 10:10:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Nov 10 22:49:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/socket/init.c (wait_connectable): use rb_wait_for_single_fd().
- The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
+ * lib/delegate.rb (SimpleDelegator::dup): wrong number of
+ arguments.
- * ext/socket/init.c (try_wait_connectable, wait_connectable_ensure):
- removed.
+ * lib/delegate.rb (DelegateClass::dup): ditto.
-Wed May 4 10:07:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Nov 10 12:31:21 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/io/wait/wait.c (io_wait): use rb_wait_for_single_fd().
- The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
+ * README.EXT (Example): extconf.rb is indispensable now.
-Wed May 4 10:01:27 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Nov 10 03:33:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread.c (rb_wait_for_single_fd): new. poll(2) based backend for
- rb_wait_for_single_fd().
- Now only Linux uses it.
+ * ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
+ or older
- The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
+ * ext/tk/lib/tkextlib/tile/style.rb: bug fix
-Wed May 4 09:56:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Nov 9 14:27:18 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * thread.c (rb_wait_for_single_fd): new.
- * thread.c (select_single): select(2) based backend for
- rb_wait_for_single_fd().
+ * lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
- * io.c (make_writeconv): use rb_wait_for_single_fd() instead of
- rb_thread_fd_select().
- * io.c (rb_io_wait_readable): ditto.
- * thread.c (rb_thread_wait_fd_rw): ditto.
+Tue Nov 9 01:05:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (wait_readable): removed.
- * thread.c (init_set_fd): new helper function.
- * include/ruby/io.h (RB_WAITFD_IN, RB_WAITFD_PRI, RB_WAITFD_OUT):
- new constant for rb_single_wait_fd().
+ * dir.c (rb_glob2): do not allocate buffer from heap to avoid
+ memory leaks. use string object for buffering instead.
+ [ruby-dev:24738]
- The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
+ * dir.c (join_path): ditto.
-Wed May 4 08:04:59 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * io.c (io_read): external input buffer may be modified even after
+ rb_str_locktmp(). [ruby-dev:24735]
- * ext/psych/lib/psych/visitors/yaml_tree.rb: fix time dumping so that
- Syck can load UTC times that Psych dumps.
+ * dir.c (fnmatch): p or s may be NULL. [ruby-dev:24749]
-Wed May 4 07:33:00 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Nov 9 00:53:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * thread.c (rb_fd_copy): fix wrong argument.This issue was pointed
- out by Eric Wong. [ruby-core:35982]
+ * regex.c (slow_match): avoid GCC 3.4.x warnings.
-Tue May 3 20:29:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Nov 9 00:50:06 2004 Dave Thomas <dave@pragprog.com>
- * test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
- Skip sticky bit test if the platform is FreeBSD. It doesn't allow to
- change sticky bit if a target is regular file.
+ * lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
-Tue May 3 18:23:57 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+Mon Nov 8 23:38:35 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/date/test_date.rb (TestDate#test_coerce):
- test for [ruby-core:35127].
+ * lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
+ [ruby-dev:24743]
-Tue May 3 04:27:53 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 8 22:20:19 2004 Dave Thomas <dave@pragprog.com>
- * thread.c (rb_thread_select): preserve errno if no error
- occurred.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+ Fix bug where parent class wasn't being detected if the
+ child class was defined using the A::B notation.
-Tue May 3 03:57:04 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 8 00:14:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * include/ruby/intern.h (rb_w32_fdcopy): add prototype. fixes
- #4640
+ * configure.in: add setup for mignw32 cross compiling.
+ [ruby-talk:119413]
-Mon May 2 01:02:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Nov 7 23:49:26 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/fileutils.rb (FileUtils#chmod): accept symbolic mode argument.
- The patch was written by takkanm. [ruby-core:26029][Feature #2190]
+ * ext/tk/lib/tk.rb: bind-event methods accept multi substitution
+ arguments.
- * lib/fileutils.rb (FileUtils#fu_mode): new helper function.
- * lib/fileutils.rb (FileUtils#symbolic_modes_to_i): ditto.
- * lib/fileutils.rb (FileUtils#mode_mask): ditto.
- * lib/fileutils.rb (FileUtils#user_mask): ditto.
+ * ext/tk/lib/tk/canvas.rb: ditto.
- * test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
- new test for the above symbolic mode.
- * test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_R): ditto.
+ * ext/tk/lib/tk/canvastag.rb: ditto.
-Mon May 2 00:36:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/text.rb: ditto.
- * ext/socket/init.c (rsock_connect): add to care EINTR. based
- on a patch from Eric Wong at [ruby-core:35621][Bug #4555]
+ * ext/tk/lib/tk/texttag.rb: ditto.
-Sun May 1 01:06:24 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tkextlib: ditto.
- * thread.c (rb_thread_select): release GVL while waiting select().
+Sat Nov 6 14:58:44 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Apr 30 23:10:15 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/webrick/server.rb (WEBrick::HTTPServer#start): remove
+ :DoNotReverseLookup option. (Socket#do_not_reverse_lookup is a
+ ruby 1.9 feature)
- * win32/win32.c (rb_w32_fdcopy): New. This can copy even though
- fdset size exceed FD_SETSIZE.
- * include/ruby/intern.h (rb_fd_copy): use rb_w32_fdcopy()
+Sat Nov 6 11:31:04 2004 Tadayoshi Funaba <tadf@dotrb.org>
-Sat Apr 30 20:18:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/date.rb (_parse): checks whether zone was given.
- * thread.c (do_select): Change argument type to rb_fdset_t.
- Now do_select() is free from unexpected hangup if
- HAVE_RB_FD_INIT=1 [Bug #4636]
+Sat Nov 6 00:46:27 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread.c (rb_thread_fd_select, rb_thread_wait_fd_rw):
- adapt new argument type.
+ * string.c (rb_str_locktmp): check STR_TMPLOCK flag before
+ locking. [ruby-dev:24727]
- * thread.c (rb_thread_select): make dummy implementation.
+Fri Nov 5 18:12:42 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Apr 30 20:16:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
+ X_Scrollable and Y_Scrollable
- * thread.c (rb_fd_copy): Change function argument. Now
- rb_fd_copy() has fully copy semantics.
- * include/ruby/intern.h: ditto.
+ * ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
-Sat Apr 30 20:11:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
+ Y_Scrollable
- * include/ruby/intern.h (rb_thread_select): mark as deprecated.
+Fri Nov 5 16:05:32 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/io/wait/wait.c (wait_readable): use rb_thread_fd_select
- instead of rb_thread_select.
- * ext/socket/init.c (wait_connectable0): ditto.
- * ext/readline/readline.c (readline_event): ditto.
- * io.c (rb_io_wait_readable, wait_readable, rb_io_wait_writable,
- wait_writable): ditto.
+ * ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
-Sat Apr 30 20:06:36 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 5 13:22:58 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread.c (do_select): remove useless ifdef. time calculation
- is not heavy weight.
+ * ext/tk/lib/tk/text.rb: sorry. bug fix again.
-Sat Apr 30 16:48:36 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 5 13:17:54 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * benchmark/bm_io_select3.rb: New.
+ * ext/tk/lib/tk/text.rb: bug fix
-Sat Apr 30 16:27:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 5 08:52:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (copy_stream_body, rb_io_s_copy_stream): move rb_fd_init()
- from copy_stream_body to rb_io_s_copy_stream. fds of passing
- rb_fd_term() have to be guaranteed initialized.
+ * gc.c (gc_mark): stricter GC stack check.
-Sat Apr 30 16:13:17 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 5 08:52:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * benchmark/bm_io_select.rb, benchmark/bm_io_select2.rb: New.
- based on a patch from Eric Wong at [Feature #4531]
+ * gc.c (gc_mark): stricter GC stack check.
-Sat Apr 30 03:25:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Nov 5 08:34:43 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/io/wait/test_io_wait.rb: New. for testing ext/io/wait.
- the patch was written by Eric Wong. [Feature #4531]
+ * string.c (str_gsub): should have removed rb_str_unlocktmp(str).
+ [ruby-dev:24708]
-Sat Apr 30 00:34:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Nov 4 21:25:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * include/ruby/win32.h: remove redundant declaration of
- rb_w32_time_subtract().
+ * string.c (str_gsub): string modify check no longer based on
+ tmplock. [ruby-dev:24706]
-Sat Apr 30 00:16:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Nov 4 19:27:46 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * thread_pthread.c (gvl_init): fix hangup if GVL_SIMPLE_LOCK=1.
- We don't have to call mutex_unlock() before initialize it!
+ * io.c (rb_f_open): fix typo.
-Fri Apr 29 13:15:15 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Nov 4 15:02:14 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * thread_win32.c (native_cond_timedwait): New. r31373 caused
- win32 build failure.
+ * ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
+ of TkVarAccess objects
- * thread_win32.c (__cond_timedwait, abs_timespec_to_timeout_ms):
- New helper functions.
+Thu Nov 4 09:11:35 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/win32.c (rb_w32_time_subtract): rename from subtract and
- remove static.
+ * gc.c (gc_mark): enable GC stack checking.
-Fri Apr 29 10:43:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Nov 4 03:11:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * benchmark/bm_vm4_pipe.rb: Add two new benchmark for GVL
- performance. They was written by Koichi Sasada.
- * benchmark/bm_vm4_thread_pass.rb: ditto.
+ * string.c (str_gsub): lock strings temporarily. [ruby-dev:24687]
-Fri Apr 29 10:25:31 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/socket/socket.c (s_recvfrom): tmplock input buffer.
+ [ruby-dev:24705]
- * vm_method.c (rb_clear_cache_by_class): Revert r29673. It made
- a segmentation fault regression. [Bug #4289][ruby-core:34554].
+Wed Nov 3 22:32:12 2004 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Apr 29 10:24:51 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c: On NetBSD don't use setruid() and setrgid().
- * io.c (make_writeconv): do not add textmode newline decorator if any
- newline decorator is set already. fixes #4618, fixes #4619
+Wed Nov 3 22:24:17 2004 Daigo Moriwaki <techml@sgtpepper.net>
-Fri Apr 29 10:17:42 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
+ avoid warnings.
- * thread.c (lock_func): small cleanup.
+Wed Nov 3 17:19:59 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Apr 29 10:07:13 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * array.c (rb_ary_uniq_bang): do not push frozen string from hash
+ table. [ruby-dev:24695]
- * thread.c (rb_mutex_lock, lock_func): Avoid busy loop and
- performance regression. bm_vm3_thread_mutex.rb performance
- change from 109.064sec to 16.331sec. [Feature #4607]
+ * array.c (rb_ary_and): ditto.
- * thread.c (init_lock_timeout): New helper function.
+ * array.c (rb_ary_or): ditto.
-Thu Apr 28 16:15:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Nov 3 17:13:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * win32/{win32.c,dir.h} (rb_w32_uopendir): new API to pass UTF-8 path.
+ * io.c (pipe_open): fix compile error
- * win32/win32.c (opendir_internal, rb_w32_opendir): extract and merge
- common part of rb_w32_opendir() and rb_w32_uopendir().
+Wed Nov 3 16:58:07 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * dir.c (do_opendir, glob_helper): encoding.
+ * ext/tk/lib/tk.rb: support to use different Tcl commands between
+ configure and configinfo
- * dir.c (dir_initialize, do_opendir): convert path to UTF-8 and call
- rb_w32_uopendir() instead of rb_w32_opendir() on Windows.
- fixes #4491, reported by Joey Zhou.
+ * ext/tk/lib/font.rb: ditto.
-Thu Apr 28 15:32:53 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/itemconfig.rb: support to use different Tcl commands
+ between item_configure and item_configinfo
- * test/dl/test_base.rb (DL::LIBC_SO): its always msvc*.dll on
- mswin/mingw.
+ * ext/tk/lib/itemfont.rb: ditto.
-Thu Apr 28 06:07:06 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/extconf.rb: install SUPPORT_STATUS
- * lib/csv.rb (CSV::open): suppress universal newline decorator.
- fixes #4603
+ * ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
- * lib/csv.rb (CSV.read): no mode is needed.
+Wed Nov 3 16:30:41 2004 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Apr 28 06:06:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/nkf: follow nkf 2.0.4
- * io.c (rb_io_extract_modeenc, rb_f_backquote): set default text
- mode. fixes #4619
+Wed Nov 3 15:53:34 2004 Kouhei Sutou <kou@cozmixng.org>
- * io.c (pipe_open): set universal newline decorator if needed.
+ * test/rss/test_maker_*.rb: added tests for RSS Maker.
-Wed Apr 27 11:33:08 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/rss/maker.rb: added RSS Maker.
- * enc/trans/emoji_iso2022_kddi.trans: ISO-2022-JP-KDDI doesn't have
- CP932 UDA. Another reason is emacs-mule: the implementation of
- stateless-iso-2022-jp doesn't support beyond 94x94 (0x7fxx);
- but CP932 UDA is in 7Fxx-92xx.
+ * lib/rss/maker/*.rb: ditto.
-Wed Apr 27 07:42:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Nov 2 16:35:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * configure.in (STRIP): use proper toolchain. based on a patch
- from Jon Forums at [ruby-core:35909]. fixes #4617
+ * ext/enumerator/enumerator.c (each_cons_i): pass copy of an
+ internal consequent array. [ruby-talk:118691]
-Wed Apr 27 01:20:59 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Nov 2 16:05:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_core.c (date_zone_to_diff): renamed.
- * ext/date/date_parse.c: ditto.
- * ext/date/date_strptime.c: ditto.
+ * process.c (rb_f_fork): need to flush stdout and stderr before
+ fork(2). [ruby-talk:117715]
-Wed Apr 27 01:16:59 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Nov 2 01:20:09 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * encoding.c (enc_find): accept Encoding objects.
+ * eval.c (proc_invoke): nail down dyna_var node when Proc object
+ or continuation is created. [ruby-dev:24671]
-Wed Apr 27 00:55:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 1 13:59:28 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * transcode.c (econv_opts): add newline option.
+ * ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
- * io.c (validate_enc_binmode, rb_io_extract_modeenc): set newline
- decorator according to open mode.
+ * ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
+ ext/stringio/extconf.rb: added.
- * transcode.c (rb_econv_prepare_options): new function, to prepare
- econv options with newline flags.
+ * MANIFEST, ext/**/MANIFEST: removed.
- * include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_MASK): add.
+ * README.EXT, README.EXT.ja: remove MANIFEST stuff.
-Wed Apr 27 00:51:01 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Nov 1 01:14:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * file.c (rb_file_truncate): fix function.
+ * io.c (rb_f_open): create copy of popen specifier. [ruby-dev:24656]
- * include/ruby/win32.h (ftruncate, truncate, ftello, fseeko): non-64
- versions on mingw are useless because they use int32_t. fixes #4564
+Mon Nov 1 00:36:48 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Wed Apr 27 00:50:33 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * main.c (_stklen): move to gc.c.
- * ext/date/date_core.c: modified validation methods.
- * ext/date/lib/date.rb: ditto.
+Sun Oct 31 00:22:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Apr 27 00:00:37 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * string.c (rb_str_locktmp): lock string temporarily.
- * ext/date/date_core.c (dt_lite_set_tmx): should get df value.
+ * string.c (str_independent): add tmplock check.
-Tue Apr 26 22:34:04 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * io.c (io_write): lock output string temporarily.
+ [ruby-dev:24649]
- * ext/date/lib/date/format.rb (_iso8601): allowed day only civil
- date. disallowed separatorless day only ordinal date.
+ * io.c (io_write): use rb_str_locktmp().
-Mon Apr 25 21:31:36 2011 Nobuhiro Iwamatsu <iwamatsu@nigauri.org>
+ * io.c (read_all): ditto.
- * ext/openssl/extconf.rb: Should check SSLv2_*method.
- openssl compiled with "no-ssl2" the extconf don't fail
- when running `make' having this compilation errors.
- Patched by Laurent Arnoud. fixes #4562, #4556
+Sat Oct 30 06:53:24 2004 Peter Vanbroekhoven <peter.vanbroekhoven@cs.kuleuven.ac.be>
-Mon Apr 25 20:53:32 2011 Tajima, Akio <artonx@yahoo.co.jp>
+ * eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
- * win32/win32.c (kill): accept 0 only sig is SIGINT #4596
+Sat Oct 30 00:19:40 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Apr 25 19:59:47 2011 Tajima, Akio <artonx@yahoo.co.jp>
+ * enum.c (enum_sort_by): protect continuation jump in.
+ [ruby-dev:24642]
- * win32/win32.c (kill): accept 0 as pid, fixes #4596
+Fri Oct 29 21:27:51 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Apr 25 16:43:45 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c (rb_io_check_initialized): new function to check uninitialized
+ object. [ruby-talk:118234]
- * random.c (random_rand): remove unused variables.
+ * file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
- * struct.c (rb_struct_define_without_accessor): ditto.
+Fri Oct 29 10:00:30 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * strftime.c (rb_strftime_with_timespec): ditto.
+ * eval.c (rb_thread_start_0): forget to free some memory chunks.
+ [ruby-core:03611]
- * sprintf.c: ditto.
+ * eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
+ should be wrapped by PUSH_TAG/POP_TAG(). [ruby-dev:24627]
- * time.c (time_asctime): remove useless GetTimeval().
+Thu Oct 28 08:42:02 2004 Tanaka Akira <akr@m17n.org>
- * thread_pthread.c: cast to (void *) for %p.
+ * io.c (argf_forward): use ANSI style.
+ (argf_read): call argf_forward with argv argument.
+ [ruby-dev:24624]
-Mon Apr 25 11:02:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 28 23:32:54 2004 akira yamada <akira@ruby-lang.org>
- * ext/ripper/lib/ripper/sexp.rb: fix rdoc around sexp.
- patched by Sho Hashimoto. fixes #4599
+ * ext/zlib/zlib.c (zstream_detach_input): resets klass of z->input if
+ z->input isn't nil.
-Mon Apr 25 08:24:04 2011 Shota Fukumori <sorah@tubusu.net>
+Thu Oct 28 23:19:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * random.c (rb_f_rand, random_s_rand): RDocs for them.
+ * ext/extmk.rb: prefer relative path. [ruby-talk:93037]
-Mon Apr 25 07:18:00 2011 Kenta Murata <mrkn@mrkn.jp>
+Wed Oct 27 18:49:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * random.c (random_s_rand, Init_Random): Random.rand should behave as
- Random::DEFAULT.rand rather than Kernel#rand.
+ * gc.c: prototype; rb_io_fptr_finalize() doesn't return any value
+ at this version.
- * random.c (rand_range, random_rand): rand_range function extracted
- from random_rand function.
+Wed Oct 27 17:27:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * random.c (rb_f_rand): accept a Range argument as Random#rand
- [ruby-dev:43427] #4605
+ * gc.c (gc_sweep): recover ruby_in_compile variable.
-Mon Apr 25 03:31:06 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Wed Oct 27 09:17:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/time.rb: require 'date'.
- * ext/date/lib/date/format.rb: removed require line.
+ * string.c (str_gsub): use a string object for exception safeness.
+ [ruby-dev:24601]
-Mon Apr 25 03:08:39 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 26 23:52:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/date/lib/date/format.rb: require 'date'.
+ * io.c (rb_io_getline): rs modification check should not interfere in the loop.
-Mon Apr 25 03:04:16 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 26 23:30:39 2004 Dave Thomas <dave@pragprog.com>
- * ext/date/lib/date/format.rb (_iso8601): added a pattern.
+ * lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
+ Restore correct :nopdoc: behavior with nested classes and modules.
-Mon Apr 25 02:51:22 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Oct 26 18:21:29 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/lib/date/format.rb: require 'date_core.so'.
- date/format needs methods which are now in date_core.so.
- This breaks make rdoc which uses Date._parse from time.rb.
+ * string.c (RESIZE_CAPA): check string attribute before modifying
+ capacity member of string structure. [ruby-dev:24594]
-Mon Apr 25 02:47:46 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 26 11:33:26 2004 David G. Andersen <dga@lcs.mit.edu>
- * ext/date/lib/date/format.rb (_iso8601): fixed a bug of regex.
+ * ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
+ performance. [ruby-talk:117701]
-Mon Apr 25 02:12:26 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 26 10:56:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/lib/date/format.rb: an adjustment of regex.
+ * sprintf.c (rb_f_sprintf): raise ArgumentError for extra
+ arguments, unless (digit)$ style used.
-Mon Apr 25 01:58:50 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 26 11:33:26 2004 David G. Andersen <dga@lcs.mit.edu>
- * ext/date/lib/date/format.rb: omitted to call _parse.
+ * ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
+ performance. [ruby-talk:117701]
-Mon Apr 25 01:03:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Oct 26 10:56:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * string.c (rb_to_id): remove unused variable.
+ * sprintf.c (rb_f_sprintf): raise ArgumentError for extra
+ arguments, unless (digit)$ style used.
-Sun Apr 24 22:19:05 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Mon Oct 25 18:35:39 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * complex.c, rational.c: omitted some method calls.
+ * win32/win32.c (isUNCRoot): should check NUL after '.'.
+ [ruby-dev:24590]
-Sun Apr 24 02:57:27 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * win32/win32.c (isUNCRoot): fixed buffer overrun.
- * ext/date/date_parse.c (n2i): takes long.
+Mon Oct 25 08:03:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Apr 24 02:51:06 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * eval.c (get_backtrace): ignore illegal backtrace. [ruby-dev:24587]
- * ext/date/date_parse.c: reverted.
+Sun Oct 24 00:41:09 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Apr 24 02:25:23 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_load, search_required, rb_require_safe, rb_require): use
+ frozen shared string to avoid outside modification. [ruby-dev:24580]
- * include/ruby/intern.h: pcc can't use __builtin_constant_p.
+Sat Oct 23 22:18:32 2004 Guy Decoux <ts@moulon.inra.fr>
- * vm_exec.c: change condition.
+ * eval.c (frame_free): Guy Decoux solved the leak problem.
+ Thanks. [ruby-core:03549]
-Sun Apr 24 01:58:01 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Oct 23 00:20:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_core.c (leap_p): suppress warning: parentheses.
+ * ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
+ to avoid potential vulnerability.
- * ext/date/date_core.c (date_s__parse_internal): remove unused
- variable "str".
+ * ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
+ to avoid SEGV. [ruby-dev:24568]
- * ext/date/date_parse.c (parse_ddd_cb): use RSTRING_LENINT.
+Fri Oct 22 12:02:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_strftime.c (date_strftime_with_tmx): remove unused
- variable.
+ * eval.c (rb_alias): was warning for wrong condition.
+ [ruby-dev:24565]
-Sun Apr 24 00:34:23 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Fri Oct 22 10:36:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/date/date_parse.c: removed some unused macros. use strchr()
- instead of index().
+ * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
+ should check if path_info is not nil.
-Sat Apr 23 21:29:42 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Fri Oct 22 00:22:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_core.c: replacement of implementation of
- _parse. [experimental]
- * ext/date/date_parse.c: new.
- * ext/date/lib/date/format.rb: removed ruby version of _parse.
+ * ext/zlib/zlib.c (zstream_shift_buffer): should restore class
+ field of a buffer. [ruby-dev:24562]
-Fri Apr 22 12:04:15 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Oct 22 00:20:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * array.c (rb_ary_sort_bang): fix rdoc.
- patched by burningTyger. https://github.com/ruby/ruby/pull/11
+ * string.c (rb_str_include): should not treat char as negative value.
+ [ruby-dev:24558]
-Fri Apr 22 11:49:49 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 21 21:32:30 2004 IWATSUKI Hiroyuki <don@na.rim.or.jp>
- * lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
- XML-RPC's int is 32bit int, and Fixnum also may be beyond 32bit.
+ * lib/pstore.rb (PStore#transaction): Use the empty content when a
+ file is not found. [ruby-dev:24561]
- * lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
- XML-RPC doesn't allow Infinity and NaN.
- http://www.xmlrpc.com/spec
+Thu Oct 21 19:06:15 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Apr 22 04:16:14 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
+ ensure to close @body. (http://bugs.debian.org/277520)
- * ext/psych/parser.c (parse): strings from psych have proper taint
- markings.
+Thu Oct 21 00:36:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/psych/test_tainted.rb: test for string taint
+ * eval.c (rb_alias): should warn on method discarding.
+ [ruby-dev:24546]
-Thu Apr 21 01:30:02 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
+ string buffer by clearing klass. [ruby-dev:24548]
- * random.c (rb_f_srand): fix rdoc: srand(0)'s 0 is a seed.
- [ruby-core:35833] fixes #4590
+Wed Oct 20 19:45:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Apr 21 01:01:28 2011 Masaya Tarui <tarui@ruby-lang.org>
+ * string.c (str_gsub): reentrant check. [ruby-dev:24432]
- * win32/win32.c (CreateChild): maximum length of lpCommandLine is
- 32,768 characters, including the Unicode terminating null character.
+ * backport all SEGV bug fixes from CVS HEAD. [ruby-dev:24536]
-Wed Apr 20 21:32:11 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Wed Oct 20 04:17:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_strptime.c (date__strptime_internal): do not
- overwrite local variables.
+ * ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
+ is a string. [ruby-dev:24490]
-Wed Apr 20 14:41:28 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/sdbm/init.c (fsdbm_delete_if): ditto.
- * string.c (rb_str_each_line): check string's length when compare
- separator and string. [ruby-core:35815] fixes #4586
+Wed Oct 20 01:37:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Apr 20 00:02:13 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_times): Array#* should return an instance of
+ the class of right operand. [ruby-dev:24526]
- * misc/ruby-mode.el (ruby-parse-partial): use position of open paren.
+ * ext/zlib/zlib.c (zstream_detach_buffer): should not expose
+ class-less object to Ruby world. [ruby-dev:24530]
-Tue Apr 19 01:00:21 2011 Tajima Akio <artonx@yahoo.co.jp>
+ * eval.c (proc_dup): provide Proc#dup as well. [ruby-talk:116915]
- * test/ruby/test_io.rb (TestIO#test_cross_thread_close_fd):
- skip cross thread pipe close if windows
+ * eval.c (ruby_exec): stack marking position may be higher than
+ expected. thanks to Guy Decoux. [ruby-core:03527]
-Mon Apr 18 12:15:46 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Oct 19 22:43:12 2004 Dave Thomas <dave@pragprog.com>
- * test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
- avoid float error. [ruby-core:35804]
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
+ we come across 'attr' in a context where it isn't
+ followed by a symbol, just issue a warning.
-Sun Apr 17 00:20:14 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 19 20:41:37 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * ext/date/date_{core,strftime}.c: use struct tmx instead of vtm.
- * ext/date/date_tmx.h: new.
+ * ext/win32ole.c(ole_invoke): retrieve the result value when
+ retrying the IDispatch::invoke.
-Sat Apr 16 22:23:52 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 19 17:24:11 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/date/date_strftime.c (date_strftime_wo_timespec): changed
- the way of validation of locale modifiers.
+ * io.c (read_all): block string buffer modification during
+ rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
-Sat Apr 16 21:55:12 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * dir.c (rb_push_glob): block call at once the end of method.
+ [ruby-dev:24487]
- * ext/date/date_core.c: replacement of implementation of
- _strptime. [experimental]
- * ext/date/date_strptime.c: new.
- * ext/date/lib/date/format.rb: removed ruby version of _strptime.
+ * ext/enumerator/enumerator.c (enum_each_slice): remove
+ rb_gc_force_recycle() to prevent potential SEGV.
+ [ruby-dev:24499]
-Sat Apr 16 10:18:30 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
+ buffer by clearing klass. [ruby-dev:24510]
- * vm.c (Init_VM): suppress warning: "OPT_BASIC_OPERATIONS" is not
- defined.
+Tue Oct 19 16:12:18 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Apr 15 23:41:18 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/tk/tkutil.c: backport from CVS HEAD
- * ruby.c (proc_options): suppress warning:
- "ALLOW_DEFAULT_SOURCE_ENCODING" is not defined.
+Tue Oct 19 08:54:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Apr 15 15:10:29 2011 Akinori MUSHA <knu@iDaemons.org>
+ * intern.h, object.c (rb_class_inherited_p): export.
- * lib/uri/generic.rb (#route_from_path): Fix a bug where
- URI('http://h/b/').route_to('http://h/b') wrongly returned './'
- (should be '../b'). [Bug #4476]
+Tue Oct 19 08:46:57 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Apr 15 14:58:06 2011 Akinori MUSHA <knu@iDaemons.org>
+ * string.c (rb_str_upto): method result must be checked. [ruby-dev:24504]
- * lib/fileutils.rb (FileUtils#touch): Fix corrupted output when
- mtime is specified in addition to nocreate (and verbose).
- ref [ruby-dev:43401]
+ * eval.c (error_print): ditto. [ruby-dev:24519]
-Thu Apr 14 23:43:43 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Oct 18 23:37:05 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * numeric.c (ruby_float_step): wrong loop condition.
- fixes [ruby-core:35753], reported by Joey Zhou.
+ * marshal.c (r_object0): check inheritance by the internal function.
+ [ruby-dev:24515]
- * test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
- test above change.
+Mon Oct 18 15:58:01 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Apr 14 22:48:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * range.c (range_step, range_each): need cast.
- * lib/test/unit.rb (Test::Unit::Options#setup_options): set possible
- values for completion. no conversion is needed.
+Fri Oct 29 16:34:19 2004 Daiki Ueno <ueno@unixuser.org>
- * lib/test/unit.rb (Test::Unit::Runner::Worker#initialize): use
- positional arguments instead of keyword arguments.
+ * misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
+ line after opening heredoc identifier. [ruby-dev:24635]
- * lib/test/unit.rb (Test::Unit::Runner#jobs_status): io/console may
- not be available. use 80 as the last resort if IO#winsize and
- COLUMNS are unavailable.
+Mon Oct 18 07:26:21 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb (Test::Unit::Runner::Worker#died): rename using a
- verb.
+ * file.c (rb_file_truncate): discard read buffer before truncation.
+ [ruby-dev:24197]
- * lib/test/unit.rb (Test::Unit::Runner#_run_parallel): check if worker
- is signaled and use its exit status.
+Mon Oct 18 02:11:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/test/unit.rb (Test::Unit::Runner::Worker#dead): no longer @in
- and @out are separated.
+ * lib/webrick/config.rb (WEBrick::Config::General): add default values:
+ - WEBrick::Config[:DoNotReverseLookup]
+ - WEBrick::Config[:RequestCallback] (it used as an alias of
+ :RequestHandler in WEBrick::HTTPServer#run)
+ - WEBrick::Config::FileHandler[:AcceptableLanguages]
-Thu Apr 14 21:23:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/httpservlet/filehandler.rb
+ (WEBrick::HTTPServlet::FileHandler#set_filename): search files
+ having suffix of language-name which Accept-Language header field
+ includes if :AcceptableLanguages options is present.
- * variable.c (rb_autoload_p): search superclasses as same as actual
- loading. fixes [ruby-core:35679]
+ * lib/webrick/httpservlet/filehandler.rb
+ (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
+ search servlet correspond to the suffix of filename.
-Thu Apr 14 21:21:06 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/httprequest.rb: add attributes access methods: accept,
+ accept_charset, accept_encoding, accept_language, content_length
+ and content_type.
- * include/ruby/win32.h (frexp, modf): wrongly declared as pure in
- mingw math.h.
+ * lib/webrick/httpresponse.rb: add attribute access methods:
+ content_length, content_length=, content_type and content_type=.
- * include/ruby/win32.h (ftruncate, truncate): mingw64 misses
- prototypes.
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
+ use the second suffix to detect media type. (the first suffix
+ may be a language name.)
- * win32/win32.c (rb_w32_read): suppress warning.
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
+ add method to parse Accept header field. it returns an Array of
+ values sorted by the qvalues.
-Thu Apr 14 19:55:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Oct 18 02:04:11 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/fileutils.rb (FileUtils#touch): fix corrupted output when
- FileUtils.touch(:nocreate => true, :verbose => true) case.
- The patch was written by Hiroyuki Iwatsuki. [ruby-dev:43401]
+ * lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): new
+ method to register virtual hosting servers.
-Thu Apr 14 16:01:45 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/webrick/server.rb (WEBrick::GenericServer#accept): call
+ do_not_reverse_lookup for each socket if :DoNotReverseLookup
+ is set. [ruby-core:02357]
- * io.c (rb_f_syscall): suppress warning: "HAVE___SYSCALL" is not
- defined.
+Mon Oct 18 00:42:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Apr 14 00:41:09 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/socket/socket.c (sock_s_getservbyaname): protocol string
+ might be altered. [ruby-dev:24503]
- * thread.c (thread_fd_close_i): IOError exception should be assigned
- to rb_thread_t::thrown_errinfo.
+ * string.c (rb_str_upto): check if return value from succ is a
+ string. [ruby-dev:24504]
-Wed Apr 13 20:12:26 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Sun Oct 17 23:03:48 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * io.c (rb_io_fdatasync): remove unused variable.
+ * ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
-Tue Apr 12 20:54:12 2011 Tanaka Akira <akr@fsij.org>
+Sun Oct 17 13:05:04 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * include/ruby/st.h: parenthesize macro arguments.
+ * ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
+ * ext/win32ole/win32ole.c (fole_get_methods): ditto.
+ * ext/win32ole/win32ole.c (fole_put_methods): ditto.
+ * ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
+ WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
-Tue Apr 12 19:19:50 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Oct 16 14:45:28 2004 Kouhei Sutou <kou@cozmixng.org>
- * lib/uri/common.rb: avoid race condition. fixes #4572
+ * lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
-Tue Apr 12 18:07:13 2011 TAKAO Kouji <kouji@takao7.net>
+Sat Oct 16 13:42:49 2004 Kouhei Sutou <kou@cozmixng.org>
- * ext/readline/extconf.rb: --disable-libedit to disable
- libedit. fixes #4550
+ * lib/rss/: untabified.
+ * test/rss/: untabified.
+ * lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
-Tue Apr 12 10:37:39 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Oct 16 13:34:56 2004 Kouhei Sutou <kou@cozmixng.org>
- * include/ruby/win32.h: VC doesn't have ftruncate() and others, but
- ruby needs HAVE_ macros to use our emulation functions.
- (fix the problem of 31262)
+ * lib/rss: supported prety print.
+ * test/rss/test_1.0.rb: added test for calculating default indent size.
-Tue Apr 12 01:33:00 2011 Luis Lavena <luislavena@gmail.com>
+Fri Oct 15 18:04:35 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * configure.in: properly evaluate existence of truncate, ftruncate
- and ftello for MinGW. [ruby-core:35678]
- * win32/win32.c: rename truncate, ftruncate and ftello to avoid
- redefinitions.
- * win32/win32.h: ditto.
+ * ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
+ acceptable. Add TkTimer.start ( == new + start ).
-Mon Apr 11 21:51:52 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Oct 15 12:43:09 2004 Tanaka Akira <akr@m17n.org>
- * io.c: revert r31230. Because it made a regression.
- [ruby-core:35631]
+ * eval.c (Init_stack): make prototype declaration consistent with
+ the definition in gc.c.
-Mon Apr 11 21:49:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Oct 14 14:34:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/ruby/test_io.rb: Added TestIO#test_cross_thread_close_stdio
- and TestIO#test_cross_thread_close_fd.
- The patch was written by Eric Wong. [ruby-core:35669]
+ * io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
-Mon Apr 11 21:15:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Oct 14 13:33:59 2004 Kouhei Sutou <kou@cozmixng.org>
- * file.c (rb_group_member): kill 256K of stack usage.
- the patch was written by Eric Wong. [ruby-core:35699]
+ * lib/rss/rss.rb: added link to Tutorial.
-Mon Apr 11 07:24:13 2011 Eric Hodel <drbrain@segment7.net>
+Mon Oct 11 13:48:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/ossl.c: Fix typo, document version constants.
+ * ext/tk/lib/tk/*: untabify
-Sun Apr 10 22:23:45 2011 Tanaka Akira <akr@fsij.org>
+Sun Oct 10 12:32:08 2004 Dave Thomas <dave@pragprog.com>
- * include/ruby/ruby.h: parenthesize macro arguments.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
+ to be used as a variable name
-Sat Apr 9 23:31:47 2011 Shota Fukumori <sorah@tubusu.net>
+Sat Oct 9 21:23:37 2004 Kouhei Sutou <kou@cozmixng.org>
- * ext/stringio/stringio.c (strio_each, strio_readlines):
- Use `NUM2LONG` instead of `FIX2INT`. Fixes [ruby-dev:43395].
+ * lib/rss/converter.rb: changed to try to use Iconv for default
+ conversion.
-Sat Apr 9 23:22:27 2011 Shota Fukumori <sorah@tubusu.net>
+ * lib/rss/rss.rb: 0.0.9 -> 0.1.0.
- * ext/stringio/stringio.c (strio_each):
- Fix exception message and don't raise immediately if block is not
- given.
- Fixes [ruby-dev:43394].
+Sat Oct 9 19:50:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/stringio/test_stringio.rb (test_each_line_limit_0):
- Fix test for above.
+ * io.c (rb_io_getline): should not treat char as negative value.
+ [ruby-dev:24460]
-Sat Apr 9 21:54:15 2011 Shota Fukumori <sorah@tubusu.net>
+Fri Oct 8 09:49:32 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/stringio/stringio.c (strio_each, strio_readlines):
- limit must not be zero. Fixes [ruby-dev:43392].
+ * pack.c (pack_pack): pointer modification check before each
+ iteration. [ruby-dev:24445]
- * test/stringio/test_stringio.rb: Add tests for above.
+Fri Oct 8 01:13:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Apr 9 18:01:36 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk/optiondb.rb: make it more secure
- * include/ruby/util.h: parenthesize macro arguments.
+Thu Oct 7 23:47:57 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Apr 8 16:01:56 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
+ cannot propagate view port information from the source widget
+ (that calls 'set') to other assigned widgets.
- * ext/stringio/stringio.c (strio_getline): check whether str is
- a string when str and lim are given.
- https://twitter.com/watson1978/status/56225052152168449
+Thu Oct 7 17:36:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Apr 7 20:03:52 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
+ a Fixnum for 2nd element (it's pid) of the return value.
- * include/ruby/io.h: parenthesize macro arguments.
+Thu Oct 7 12:55:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Apr 6 21:08:31 2011 Tanaka Akira <akr@fsij.org>
+ * io.c (io_read): should freeze buffer before thread context
+ switch. [ruby-dev:24442]
- * include/ruby/intern.h: parenthesize macro arguments.
+ * pack.c (pack_unpack): string conversion should at the top of the
+ method. [ruby-dev:24439]
-Wed Apr 6 15:12:40 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c (io_read): buffer should be frozen only after the length
+ check. [ruby-dev:24440]
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize):
- pop pushed error after each try of reading. fixes #4550
+Thu Oct 7 02:56:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
+ * ext/stringio/stringio.c: use FMODE_APPEND.
+
+Thu Oct 7 01:05:33 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
+
+Thu Oct 7 00:08:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
+ ALLOCA_N() to prevent modification. [ruby-dev:24438]
+
+Wed Oct 6 09:21:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_mode_flags): preserve append mode flag.
+ [ruby-dev:24436]
+
+ * io.c (rb_io_modenum_mode): do not use external output buffer.
+
+ * string.c (rb_str_justify): differ pointer retrieval to prevent
+ padding string modification. [ruby-dev:24434]
+
+ * range.c (range_each_func): allow func to terminate loop by
+ returning RANGE_EACH_BREAK.
+
+ * range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
+
+Mon Oct 4 14:04:14 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
+ while GC. [ruby-dev:24408]
+
+Mon Oct 4 12:53:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/optiondb.rb: support definition of command
+ resources on widgets
+
+ * ext/tk/lib/tk/image.rb: bug fix
+
+Sun Oct 3 21:20:03 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
+ version of Microsoft Exchange Server. (backported from HEAD)
+
+ * lib/net/imap.rb (RTEXT_REGEXP): ditto.
+
+ * lib/net/imap.rb (CTEXT_REGEXP): ditto.
+
+Sat Oct 2 20:34:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * node.h (NEW_DVAR): extra semicolon.
+
+Sat Oct 2 00:42:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (r_byte): retrieve pointer from string value for each
+ time. [ruby-dev:24404]
+
+ * marshal.c (r_bytes0): ditto.
+
+ * enum.c (sort_by_i): re-entrance check added. [ruby-dev:24399]
+
+ * io.c (io_read): should freeze all reading buffer.
+ [ruby-dev:24400]
+
+ * string.c (rb_str_sum): should use bignums when bits is greater
+ than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+
+ * eval.c (specific_eval): defer pointer retrieval to prevent
+ unsafe sourcefile string modification. [ruby-dev:24382]
+
+ * eval.c (specific_eval): defer pointer retrieval to prevent
+ unsafe sourcefile string modification. [ruby-dev:24382]
+
+ * string.c (rb_str_sum): wrong cast caused wrong result.
+ [ruby-dev:24385]
+
+ * enum.c (enum_sort_by): hide temporary array from
+ ObjectSpace.each_object. [ruby-dev:24386]
+
+ * string.c (rb_str_sum): check was done with false pointer.
+ [ruby-dev:24383]
+
+ * string.c (rb_str_sum): string may be altered. [ruby-dev:24381]
+
+Mon Oct 11 17:51:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
+ avoid mode string modification. [ruby-dev:24454]
+
+ * io.c (rb_io_getline_fast): should take delim as unsigned char to
+ distinguish EOF and '\377'. [ruby-dev:24460]
+
+ * io.c (rb_io_getline): add check for RS modification.
+ [ruby-dev:24461]
+
+ * enum.c (enum_sort_by): use qsort() directly instead using
+ rb_iterate(). [ruby-dev:24462]
+
+ * enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
+ prevent access to recycled object (via continuation for
+ example). [ruby-dev:24463]
+
+Fri Oct 1 11:40:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
+ sourcefile string modification. [ruby-dev:24373]
+
+ * io.c (io_read): block string buffer modification during
+ rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
+
+ * io.c (rb_io_s_popen): mode argument may be altered.
+ [ruby-dev:24375]
+
+ * file.c (rb_file_s_basename): ext argument may be altered.
+ [ruby-dev:24377]
+
+ * enum.c (enum_sort_by): use NODE instead of 2 element arrays.
+ [ruby-dev:24378]
+
+ * string.c (rb_str_chomp_bang): StringValue() may change the
+ receiver. [ruby-dev:24371]
+
+Fri Oct 1 11:25:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/grid.rb: revive TkGrid.grid
+
+ * ext/tk/lib/tk/pack.rb: revive TkPack.pack
+
+ * ext/tk/lib/tk/place.rb: revive TkPlace.place
+
+Thu Sep 30 00:50:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_init): bug fix
+
+ * ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
+
+ * ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
+
+ * ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
+ matting pattern argument
+
+Wed Sep 29 10:58:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * enum.c (sort_by_i): internally used object must not be changed
+ outside. [ruby-dev:24368]
+
+Mon Sep 27 13:46:45 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
+ accessors. [ruby-dev:24342]
+
+ * marshal.c (w_object, r_object0): use accessors.
+
+Mon Sep 27 09:14:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
+ [ruby-talk:113807]
+
+Fri Sep 24 16:09:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
+ to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
+
+Fri Sep 24 08:29:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_subseq): original object might be modified after
+ sharing data creation. [ruby-dev:24327]
+
+ * array.c (rb_ary_replace): ditto.
+
+ * array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
+
+ * struct.c (struct_members): always check struct size and size of
+ members list in the class. [ruby-dev:24320]
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_initialize): ditto.
+Thu Sep 23 09:29:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Apr 6 11:36:44 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (rb_str_sub_bang): check if string is not modified
+ during iteration. [ruby-dev:24315]
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize):
- pop pushed error after each try of reading. fixes #4550
+ * hash.c (rb_hash_rehash): replace st_foreach() by its deep
+ checking counterpart. [ruby-dev:24310]
-Tue Apr 5 20:33:43 2011 Tanaka Akira <akr@fsij.org>
+Wed Sep 22 13:38:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * include/ruby/encoding.h: parenthesize macro arguments.
+ * hash.c (rb_hash_rehash): add iteration check. [ruby-dev:24301]
-Mon Apr 4 22:02:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * st.c (st_foreach): add deep check.
- * ext/io/nonblock/nonblock.c (io_nonblock_set): Avoid F_SETFL if
- we're not changing the O_NONBLOCK bit. F_SETFL is an expensive
- operation since it needs to affect all processes with the same
- file object.
- The patch is written by Eric Wong. [ruby-core:35556]
+Wed Sep 22 13:06:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Apr 4 21:41:26 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
+ merge from HEAD.
- * io.c (rb_io_syswrite): While local FS writes are usually
- buffered, the buffers can be full or the file opened with
- O_SYNC. IO#syswrite can also be used on blocking IOs
- (pipe/socket) just like IO#write.
- The patch is written by Eric Wong. [ruby-core:35554]
+Wed Sep 22 00:11:12 2004 Dave Thomas <dave@pragprog.com>
-Mon Apr 4 11:50:40 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * process.c: Add documentation for fork()
- * test/test_tempfile.rb: simply ignore platform dependent testcases
- instead of skipping.
+Wed Sep 22 09:04:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Apr 3 22:52:22 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * array.c (rb_ary_collect_bang): element size might change during
+ comparison. [ruby-dev:24300]
- * ext/syslog/syslog.c: improve rdoc.
- a patch by Jonas Pfenniger. [ruby-core:35592] fixes #4545
+ * array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
-Sun Apr 3 22:10:09 2011 Tanaka Akira <akr@fsij.org>
+ * array.c (rb_ary_eql): ditto. [ruby-dev:24300]
- * ext/zlib/zlib.c: parenthesize macro arguments.
+Tue Sep 21 18:29:49 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Apr 3 21:33:58 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * array.c (rb_ary_equal): merge miss.
- * configure.in: disable fdatasync again on Mac OS X.
- [ruby-core:35493][Bug #4500]
+ * array.c (rb_ary_uniq_bang): element size might change during
+ comparison. [ruby-dev:24298]
-Sun Apr 3 21:16:20 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Sep 20 00:24:19 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (io_reopen): IO#close releases GVL if possible.
- close() may block for certain file types (NFS, SO_LINGER
- sockets, inotify), so let other threads run. The patch was
- created by Eric Wong [ruby-core:35555][Bug #4527]
+ * enum.c (enum_sort_by): do not use qsort directly. use
+ rb_ary_sort_bang() instead. [ruby-dev:24291]
- * io.c (fptr_finalize): ditto.
+ * enum.c (enum_sort_by): pedantic type check added.
+ [ruby-dev:24291]
- * io.c (maygvl_fclose): new.
- * io.c (nogvl_fclose): ditto.
- * io.c (maygvl_close): ditto.
- * io.c (nogvl_close): ditto.
+ * hash.c (rb_hash_foreach_iter): check iter_lev after each
+ iteration. [ruby-dev:24289]
-Fri Apr 1 22:25:50 2011 Tanaka Akira <akr@fsij.org>
+ * array.c (rb_ary_and): element size might change during
+ comparison. [ruby-dev:24290]
- * ext/syslog/syslog.c: parenthesize macro arguments.
+ * array.c (rb_ary_or): ditto. [ruby-dev:24292]
-Fri Apr 1 18:53:06 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
- * lib/webrick/cookie.rb (WEBrick::Cookie.parse): 'white space is
- permitted between tokens' according to RFC2965. Though 'Netscape
- spec' does not define the syntax clearly, make it tolerant as a
- server. As a real-world example, rest-client gem sends
- 'Cookie: foo=1;bar=2'
+Sat Sep 18 15:02:22 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/webrick/test_cookie.rb (test_parse_non_whitespace): test it.
+ * array.c (rb_ary_equal): element size might change during
+ comparison. [ruby-dev:24254]
-Fri Apr 1 13:19:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_diff): ditto. [ruby-dev:24274]
- * vm_core.h (RUBY_VM_CHECK_INTS_TH): merge a patch by ko1
- in [ruby-dev:43373].
+ * array.c (rb_ary_select): ditto. [ruby-dev:24278]
-Thu Mar 31 23:15:46 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_delete): ditto. [ruby-dev:24283]
- * misc/ruby-mode.el (ruby-brace-to-do-end, ruby-do-end-to-brace):
- adjust space between block beginning and block arguments
+ * array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
-Thu Mar 31 20:42:05 2011 Tanaka Akira <akr@fsij.org>
+ * array.c (rb_ary_initialize): element size might change during
+ initializing block. [ruby-dev:24284]
- * ext/strscan/strscan.c: parenthesize macro arguments.
+Sat Sep 18 14:10:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Mar 31 18:06:12 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
+ the original directory when exception has caused in changing
+ direcotry or within block. thanks to Johan Holmberg
+ <holmberg@iar.se> [ruby-core:03446]
- * vm_insnhelper.c (vm_get_ev_const): should ignore crefs with
- the NODE_FL_CREF_PUSHED_BY_EVAL flag.
+Fri Sep 17 20:20:27 2004 Minero Aoki <aamine@loveruby.net>
-Thu Mar 31 16:49:56 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * lib/fileutils.rb (mkdir_p): backport from CVS HEAD 1.45. [ruby-core:03420]
- * vm_insnhelper.c (vm_get_ev_const): search root cref properly.
- [ruby-dev:43365]
+Fri Sep 17 17:11:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Mar 31 14:50:25 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * array.c (rb_ary_delete): element comparison might change array
+ size. [ruby-dev:24273]
- * eval.c (rb_mod_s_constants): should ignore crefs with
- the NODE_FL_CREF_PUSHED_BY_EVAL flag.
+ * file.c (rb_file_truncate): clear stdio buffer before truncating
+ the file. [ruby-dev:24191]
-Wed Mar 30 22:55:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
+ which might return singleton class. [ruby-dev:24202]
- * misc/ruby-mode.el (ruby-toggle-block): toggle do/end and {}.
+Fri Sep 17 16:07:09 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * misc/ruby-mode.el (ruby-move-to-block): move to opening of
- block.
+ * ext/tk/lib/multi-tk.rb: improve exit operation
-Wed Mar 30 14:35:15 2011 Shugo Maeda <shugo@ruby-lang.org>
+Fri Sep 17 15:01:57 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * vm_insnhelper.h (COPY_CREF): should copy
- the NODE_FL_CREF_PUSHED_BY_EVAL flag to hide constants from
- methods defined by class_eval. [ruby-dev:43365]
+ * ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
+ (thread_)tkwait
-Wed Mar 30 00:24:53 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
- * ext/stringio/stringio.c: parenthesize macro arguments.
+ * ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
+ interpreters (however, the 'real' eventloop must be run on the
+ Default Master IP)
-Tue Mar 29 21:51:31 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
- * object.c (rb_String): Kernel#String should call to_str before to_s.
+ * ext/tk/sample/remote-ip_sample2.rb: ditto
-Tue Mar 29 10:28:08 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/sample/tkoptdb-safeTk.rb: ditto
- * test/webrick/test_filehandler.rb
- (WEBrick::TestFileHandler#test_short_filename): the cgi doesn't exist
- on current directory.
+Thu Sep 16 18:12:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue Mar 29 05:19:57 2011 Tanaka Akira <akr@fsij.org>
+ * lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
+ to request.user attribute.
- * ext/socket/raddrinfo.c: parenthesize macro arguments.
+ * lib/webrick/httpservlet/filehandler.rb
+ (WEBrick::HTTPServlet::FileHandler#initialize): should expand
+ the pathname of document root directory.
-Tue Mar 29 00:03:51 2011 Tajima Akio <artonx@yahoo.co.jp>
+Thu Sep 16 15:49:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/webrick/test_filehandler.rb (test_short_filename):
- read real short filename by cmd because smb mounted files
- have different naming convention.
+ * string.c (rb_str_intern): protect string argument from GC.
+ [ruby-core:03411]
-Mon Mar 28 11:38:08 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Sep 15 20:22:23 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/date/date_core.c (date_s_today): use int for year.
+ * ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
+ of MultiTkIp
- * ext/date/date_core.c (datetime_s_now): ditto.
+Tue Sep 14 23:54:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Mon Mar 28 11:07:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
+ the previous changes.
- * ext/extmk.rb: set MFLAGS from MAKEFLAGS when using nmake.
+Tue Sep 14 23:45:44 2004 Dave Thomas <dave@pragprog.com>
-Mon Mar 28 11:07:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
+ Add Eric Hodel's simpleformatter.
- * common.mk (love): all you need is love.
+Tue Sep 14 16:59:37 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun Mar 27 23:16:31 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tcltklib/tcltklib.c: fix SEGV
- * ext/socket/ipsocket.c: parenthesize macro arguments.
+ * ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
-Sun Mar 27 16:55:34 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
- * misc/ruby-mode.el (ruby-mode-map): remove unnecessary
- binding. fixes
- http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=468952
+ * ext/tk/sample/safe-tk.rb: new sample script
- * misc/ruby-mode.el: suppress warnings at byte compile. fixes
- http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=502926
+Tue Sep 14 00:15:15 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Sun Mar 27 11:18:35 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/zlib/zlib.c: backported from HEAD.
- * ext/date/date_core.c: removed unused variables.
+Mon Sep 13 19:16:33 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat Mar 26 15:16:09 2011 Tanaka Akira <akr@fsij.org>
+ * eval.c (blk_copy_prev): need frame_dup(). [ruby-dev:24103]
- * ext/socket/getaddrinfo.c: parenthesize macro arguments.
+Mon Sep 13 16:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Mar 26 05:27:34 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
+ safe-level value argument
- * ext/date/lib/date/format.rb (DateTime#strftime): removed because
- date_core defines it.
+Mon Sep 13 10:20:45 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Mar 25 21:59:45 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * object.c (nil_inspect): fix typo.
- * ext/date/date_core.c: should not force cast with macros.
+Mon Sep 13 01:03:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Fri Mar 25 21:56:10 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
- * ext/sdbm/init.c: parenthesize macro arguments.
+ * ext/tcltklib/tcltklib.c: store original 'exit' command
-Fri Mar 25 19:39:40 2011 Ben Walton <bwalton@artsci.utoronto.ca>
+ * ext/tk/tkutil.c: fix(?) SEGV
- * test/test_syslog.rb:
- Skip syslog tests that rely on LOG_PERROR unless it's defined
+Sun Sep 12 23:46:23 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- Instead of checking looking at the platform to determine if the tests
- relying on LOG_PERROR should be run, look for the definition of the
- constant as this will be robust against all platforms as long as the
- underlying syslog.c code sets it up correctly.
+ * util.c (ruby_strdup): remove unnecessary code. (xmalloc never
+ returns NULL.)
- This specifically addresses failures on Solaris 9.
+ * util.c (ruby_getcwd): fix memory leak on failure.
- Use LOG_PID instead of LOG_PERROR in Syslog.open test
+Sun Sep 12 02:41:58 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- LOG_PERROR isn't a POSIX option for syslog, so it fails on platforms
- that don't define it. Solaris 9 and 10 are examples of this.
+ * ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
+ allow_ruby_exit=
- Use LOG_PID instead.
-Fri Mar 25 15:42:17 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: ditto.
- * ext/sdbm/_sdbm.c (sdbm_open): use size_t.
+ * ext/tk/lib/remote-tk.rb: ditto.
+ * ext/tcltklib/MANUAL.euc: ditto.
+
+ * ext/tcltklib/MANUAL.eng: ditto.
+
+ * ext/tcltklib/tcltklib.c: fix some reasons of SEGV
+
+ * ext/tk/tkutil.c: ditto.
+
+ * ext/tk/lib/multi-tk.rb: ditto.
+
+ * ext/tk/lib/tk/timer.rb: ditto.
+
+Sat Sep 11 16:09:46 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
+
+Fri Sep 10 20:20:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
+ pointer conversion.
+
+Fri Sep 10 02:43:54 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/template/kilmer.rb: James Buck's
+ patch for call-seq.
+
+Thu Sep 9 13:58:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
+ 'argv' and 'argv0' variable
+
+ * ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
+
+Thu Sep 9 11:46:18 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
+ spaces aroun parameter to define_method_under (James Buck)
+
+Wed Sep 8 18:44:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
+ [ruby-dev:24190]
+
+Wed Sep 8 15:19:49 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
+
+ * ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
+ and error treatment
+
+ * ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
+
+ * ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear, and
+ erase
+
+ * ext/tk/lib/tk/text.rb: add TkText#clear and erase
+
+Tue Sep 7 15:17:49 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/socket/socket.c (ruby_connect): break immediately if a
+ socket is non-blocking. [ruby-talk:111654]
+
+Mon Sep 6 11:08:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
+
+Mon Sep 6 11:00:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * dir.c (dir_s_chdir): the patch to shut up false warning when
+ exception occurred within a block. a patch was given from Johan
+ Holmberg <holmberg at iar.se>. [ruby-core:03292]
+
+Mon Sep 6 07:51:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (cvar_cbase): singletons should refer outer cvar scope.
+ [ruby-dev:24223]
+
+ * eval.c (rb_load): should preserve previous ruby_wrapper value.
+ [ruby-dev:24226]
+
+Sat Sep 4 01:14:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (cvar_cbase): class variables cause SEGV in
+ instance_eval() for fixnums and symbols. [ruby-dev:24213]
+
+Fri Sep 3 17:47:58 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * struct.c (make_struct): remove redefining constant when
+ conflict. [ruby-dev:24210]
+
+Fri Sep 3 11:31:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
+ [ruby-dev:24207]
+
+Fri Sep 3 02:12:48 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
+
+ * ext/tk/lib/tk/text.rb: fix typo
+
+ * ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
+
+Fri Sep 3 01:54:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb: already built-in libraries satisfy dependencies.
+ [ruby-dev:24028]
+
+Thu Sep 2 11:36:20 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * eval.c (rb_obj_instance_eval): backported from HEAD.
+
+Wed Sep 1 21:18:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/tk/lib/tk/spinbox.rb: fix typo
+
+Tue Aug 31 18:24:04 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/tk/tkutil.c (cbsubst_init): fix memory leak
+
+ * ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
+
+Tue Aug 31 16:04:22 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
+ destroy its root widget
+
+Tue Aug 31 12:30:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (del_root): fix SEGV
+
+Mon Aug 30 23:11:06 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
+ if it finds the same class in multiple places.
+
+Mon Aug 30 22:40:30 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
+
+Mon Aug 30 21:50:14 2004 Dave Thomas <dave@pragprog.com>
+
+ * object.c: Add RDoc for Module.included.
+
+Mon Aug 30 15:10:46 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
+
+Mon Aug 30 11:29:35 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (CreateChild): strip trailing spaces. [ruby-dev:24143]
+ merge from HEAD.
+
+Sun Aug 29 14:08:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
+
+ * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
+
+Sat Aug 28 23:04:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big_and): protect parameters from GC.
+ [ruby-talk:110664]
+
+Thu Aug 26 04:38:29 2004 Dave Thomas <dave@pragprog.com>
+
+ * eval.c (return_jump): Minor typo in error message. Now reads
+ "return can't jump across threads".
+
+Tue Aug 24 17:30:00 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
+ use a session id as a filename. (backported from HEAD)
+
+ * lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
+
+ * lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
+ Dir::tmpdir. (backported from HEAD)
+
+Tue Aug 24 14:40:16 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
+ session id after check. (backported from HEAD)
+
+Tue Aug 24 09:09:01 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
+ functions may replace the pointer indicated by the first argument.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+
+ * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
+
+Mon Aug 23 14:04:51 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read):
+ - should return an empty string if specified length to read is 0.
+ - should check for pending data and wait for fd before reading.
+ - call underlying IO's sysread if SSL session is not started.
+ [ruby-dev:24072], [ruby-dev:24075]
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_write):
+ - call underlying IO's syswrite if SSL session is not started.
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
+ OpenSSL::SSL#pending.
+
+ * ext/openssl/lib/openssl/buffering.rb: should not use select.
+
+Mon Aug 23 12:40:56 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/resolv.rb (Config.default_config_hash): when multiple domains
+ are set, Win32::Resolv.get_resolv_info returns Array.
+
+Sun Aug 22 01:15:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
+ should call :ProxyContentHandler before finishing CONNECT.
+
+Sat Aug 21 06:41:16 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
+
+ * lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
+ uniformly. [ruby-dev:24118]
+
+Thu Aug 19 16:29:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
+
+ * ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
+
+ * ext/tk/lib/menu.rb: typo bug.
+
+Thu Aug 19 15:15:24 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * dir.c (free_dir): fix memory leak. reported by yamamoto
+ madoka.
+
+Thu Aug 19 11:00:00 2004 Akiyoshi, Masamichi <masamichi.akiyoshi@hp.com>
+
+ * dln.c (dln_load): Modify to call lib$find_image_symbol for VMS.
+ * io.c (rb_io_fwrite): Use fputc() for VMS non-stream file.
+
+Thu Aug 19 06:07:45 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/token.c: re2c no longer compiled with bit vectors. caused
+ problems for non-ascii characters. [ruby-core:03280]
+ * ext/syck/implicit.c: ditto.
* ext/syck/bytecode.c: ditto.
- * ext/sdbm/_sdbm.c (delpair): use ptrdiff_t.
+ * lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
+ fixed problem with extra line feeds at end of folding, whitespace
+ opening scalar blocks.
+
+ * lib/yaml/rubytypes.rb: subtelties in handling strings with
+ non-printable characters and odd whitespace patterns.
+
+Wed Aug 18 23:41:33 2004 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/protocol.rb (rbuf_fill): OpenSSL::SSL::SSLSocket has its own
+ buffer, select(2) might not work. [ruby-dev:24072]
+
+Wed Aug 18 17:10:12 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
+ Tcl_FindExecutable() for Tcl/Tk 8.4.
+
+Wed Aug 18 12:52:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_obj_instance_eval): evaluates under special singleton
+ classes as for special constants.
+
+Tue Aug 17 17:20:59 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_reopen): should clear allocated OpenFile. pointed
+ out by Guy Decoux. [ruby-core:03288]
+
+Tue Aug 17 01:36:32 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
+ parsing so RDoc::usage plays better with OptionParser.
+
+Sat Aug 14 13:09:10 2004 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb: backport from CVS HEAD (rev1.44).
+
+ * lib/fileutils.rb: cp_r should copy symlink itself, except cp_r
+ root.
+
+ * lib/fileutils.rb: new option mv :force.
+
+ * lib/fileutils.rb: new module FileUtils::DryRun.
+
+Sat Aug 14 02:48:16 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/usage.rb: Added. Allows command line programs
+ to report usage using their initial RDoc comment.
+
+Fri Aug 13 13:23:17 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
+ fix regex for range-spec.
+
+ * lib/webrick/httpservlet/filehandler.rb
+ (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
+ multipart/byteranges response was broken.
+
+ * lib/webrick/httpservlet/erbhandler.rb
+ (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
+ by suffix of script filename.
+
+ * lib/xmlrpc/server.rb: refine example code.
+
+Wed Aug 11 17:17:50 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
+
+Sun Aug 8 00:43:31 2004 why the lucky stiff <why@ruby-lang.org>
- * ext/sdbm/init.c: use RSTRING_LENINT.
+ * lib/implicit.c: added sexagecimal float#base60.
- * ext/dl/handle.c: suppress warning: shorten-64-to-32.
+ * ext/syck/rubyext.c (yaml_org_handler): ditto.
- * ext/strscan/strscan.c: ditto.
+ * lib/token.c: indentation absolutely ignored when processing flow
+ collections. plain scalars are trimmed if indentation follows in
+ an ambiguous flow collection.
- * ext/syck/emitter.c: ditto.
+Sat Aug 7 00:50:01 2004 Tanaka Akira <akr@m17n.org>
+ * ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
+
+Tue Aug 3 13:49:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/namespace.rb: bug fix
+
+ * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
+
+Mon Aug 2 18:04:21 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
+ trans_str to the same as src_str when trans_str is not given.)
+
+Mon Aug 2 11:53:06 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
+ looking up some top level symbols (batsman)
+
+Mon Aug 2 11:48:29 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
+ variable names to support SWIG generated files (Hans Fugal)
+
+Sat Jul 31 17:40:16 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
+ ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
+ ruby-backward-sexp): keywords must match word-wise.
+
+Sat Jul 31 05:47:37 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
+
+ * lib/yaml/rubytypes.rb: exceptions were using an older
+ YAML.object_maker. [ruby-core:03080]
+
+ * ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
+ handline CR-LFs. "\000" was showing up on folded blocks which
+ stopped at EOF.
+
+ * ext/syck/token.c: re2c compiled with bit vectors now.
* ext/syck/implicit.c: ditto.
+ * ext/syck/bytecode.c: ditto.
- * ext/syck/syck.c: ditto.
+Fri Jul 30 16:10:54 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/syck/token.c: ditto.
+ * ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
+ the unknown encoding name is given.
-Fri Mar 25 12:14:58 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
- * ext/nkf/nkf-utf8/nkf.c: import nkf 7f18e30.
+ * ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
-Fri Mar 25 11:49:29 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
- * test/ruby/test_process.rb (TestProcess#test_no_curdir): skip silently
- on Windows, because this tests a platform specific feature and it'll
- never be supported on ruby on Windows.
+Wed Jul 28 18:59:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_dir_m17n.rb
- (TestDir_M17N#test_filename_extutf8_invalid,
- TestDir_M17N#test_filename_as_bytes_extutf8): ditto.
+ * lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
+ and CGI_COOKIES. they will no longer be used.
- * test/open-uri/test_open-uri.rb
- (TestOpenURI#test_find_proxy_case_sensitive_env): ditto.
+Wed Jul 28 01:04:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/dl/test_handle.rb (DL::TestHandle#test_NEXT,
- DL::TestHandle#test_DEFAULT): ditto.
+ * gc.c (run_final): wrong order of data. [ruby-dev:23984]
-Thu Mar 24 23:06:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 27 07:05:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm_insnhelper.c (vm_get_ev_const): should not autoload in
- defined? mode.
+ * eval.c (rb_eval): copy on write for argument local variable
+ assignment.
- * variable.c (rb_const_defined_0): fix autoloading base.
- [ruby-core:35509]
+ * eval.c (assign): ditto.
-Thu Mar 24 22:48:43 2011 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_call0): update ruby_frame->argv with the default
+ value used for the optional arguments.
- * ext/sdbm/_sdbm.c: parenthesize macro arguments.
+ * object.c (Init_Object): "===" calls rb_obj_equal() directly.
+ [ruby-list:39937]
-Thu Mar 24 14:45:57 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Jul 26 11:22:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/openssl/ossl.c: suppress warning: shorten-64-to-32.
+ * lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
+ escape space.
- * ext/openssl/ossl.h: ditto.
+Sun Jul 25 11:05:21 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/openssl/ossl_asn1.c: ditto.
+ * win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
+ {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
- * ext/openssl/ossl_bio.c: ditto.
+Sat Jul 24 13:32:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_bn.c: ditto.
+ * range.c (rb_range_beg_len): returns Qnil only when "beg" points
+ outside of a range. No boundary check for "end".
- * ext/openssl/ossl_cipher.c: ditto.
+Fri Jul 23 16:40:25 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_hmac.c: ditto.
+ * gc.c (define_final): should not disclose NODE* to Ruby world.
+ [ruby-dev:23957]
- * ext/openssl/ossl_ns_spki.c: ditto.
+Fri Jul 23 09:03:16 2004 Shugo Maeda <shugo@ruby-lang.org>
- * ext/openssl/ossl_ocsp.c: ditto.
+ * lib/net/imap.rb (disconnected?): new method. (backported from HEAD)
- * ext/openssl/ossl_pkcs5.c: ditto.
+Thu Jul 22 16:41:54 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_pkey.c: ditto.
+ * lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
+ permission of the session data file to 0600.
- * ext/openssl/ossl_pkey_dh.c: ditto.
+ * lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
+ ditto.
- * ext/openssl/ossl_pkey_dsa.c: ditto.
+Thu Jul 22 00:02:21 2004 Masahiro Kitajima <katonbo@katontech.com>
- * ext/openssl/ossl_pkey_ec.c: ditto.
+ * process.c (rb_f_system): not need to call last_status_set() any
+ longer on _WIN32.
- * ext/openssl/ossl_pkey_rsa.c: ditto.
+Tue Jul 20 09:15:17 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/openssl/ossl_rand.c: ditto.
+ * test/fileutils/test_fileutils.rb: File.link raises EINVAL on BeOS.
- * ext/openssl/ossl_ssl.c: ditto.
+Mon Jul 19 01:15:07 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/openssl/ossl_x509ext.c: ditto.
+ * lib/webrick/httpservlet/cgihandler.rb
+ (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
+ variable to CGI process on Windows native platforms. [ruby-dev:23936]
- * ext/openssl/ossl_x509name.c: ditto.
+ * lib/webrick/httpservlet/cgihandler.rb
+ (WEBrick::HTTPServlet::CGIhandler#do_GET): use $?.exitstatus and
+ refine log message.
-Thu Mar 24 11:48:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Jul 18 16:14:29 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/ossl_rand.c (ossl_rand_egd_bytes): use NUM2INT because
- the result is used with functions whose argument is int.
+ * ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
+ ( wrong number of argument )
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): ditto.
+Sun Jul 18 08:13:58 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_purpose): ditto.
+ * sprintf.c (rb_f_sprintf): remove extra sign digit.
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_trust): ditto.
+Sun Jul 18 03:21:42 2004 Akinori MUSHA <knu@iDaemons.org>
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_purpose): ditto.
+ * dir.c (range): use NULL instead of 0.
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_trust): ditto.
+ * dir.c (range): get rid of a gcc 3.4 warning.
-Thu Mar 24 11:36:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Jul 18 03:12:11 2004 Shugo Maeda <shugo@ruby-lang.org>
- * ext/openssl/ossl_x509name.c: id_aref's type is ID.
+ * lib/net/imap.rb (receive_responses): return if a LOGOUT response
+ received. (backported from HEAD)
+ * lib/net/imap.rb (send_string_data): wait command continuation
+ requests before sending octet data of literals. (backported from HEAD)
-Thu Mar 24 10:04:35 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Jul 17 23:54:59 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/io/console/console.c (console_set_winsize):
- suppress warning: shorten-64-to-32.
+ * ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
-Thu Mar 24 09:56:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Jul 17 22:04:44 2004 akira yamada <akira@ruby-lang.org>
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify): flags is VALUE,
- so it should use NUM2INT.
+ * lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
- * ext/openssl/ossl_ocsp.c (ossl_ocspbres_verify): ditto.
+Sat Jul 17 18:29:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Mar 23 21:09:29 2011 Tanaka Akira <akr@fsij.org>
+ * parse.y (stmt): not to show same error messages twice.
- * ext/readline/readline.c: parenthesize macro arguments.
+Sat Jul 17 13:13:32 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Mar 23 08:07:33 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
+ process expression interpolation. [ruby-talk:106691]
- * numeric.c (flo_round): fix inaccurate results.
+Sat Jul 17 05:26:27 2004 Dave Thomas <dave@pragprog.com>
-Wed Mar 23 00:12:16 2011 Tajima Akio <artonx@yahoo.co.jp>
+ * lib/rdoc/diagram.rb: Incorporate Micheal Neuman's
+ client-side imagemao patch
- * win32/win32.c: wait process real termination after reading
- exit code. fixes #4518
+Sat Jul 17 01:57:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Mar 22 21:20:10 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
+ [ruby-talk:106657] The solution was found by Guy Decoux.
- * lib/rubygems/test_case.rb: save current dir to @current_dir
- before Dir.chdir.
+Fri Jul 16 22:30:28 2004 Michael Neumann <mneumann@ntecs.de>
-Tue Mar 22 20:10:04 2011 Tanaka Akira <akr@fsij.org>
+ * file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
+ #dev_minor. [ruby-core:03195]
- * ext/psych/parser.c: parenthesize macro arguments.
+Fri Jul 16 15:23:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Mar 22 20:10:01 2011 Tanaka Akira <akr@fsij.org>
+ * eval.c (return_jump, break_jump): raise unexpceted local jump
+ exception directly. [ruby-dev:23740]
- * ext/openssl/ruby_missing.h: parenthesize macro arguments.
+ * lib/base64.rb (Deprecated): super in bound method calls original
+ name method in stable version. [ruby-dev:23916]
-Tue Mar 22 13:33:22 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Fri Jul 16 11:31:49 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * ext/openssl/lib/openssl/buffering.rb: removed circular require of
- openssl.rb.
+ * lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
+ garbage (patch from akira yamada) [ruby-dev:23911]
- * ext/openssl/lib/openssl/*: removed following comment for transition
- measures of avoiding circular require. No one claimed about this as
- far as I know.
- ##
- # Should we care what if somebody require this file directly?
- # require "openssl"
+Fri Jul 16 11:20:00 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Mar 22 10:57:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
+ "%f" or etc on MSVCRT platforms. (backported from HEAD)
- * test/runner.rb: set Gem::TestCase's @@project_dir.
+Fri Jul 16 11:17:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rubygems/test_case.rb: set Gem::TestCase's @@project_dir only
- when it is not defined.
+ * error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
+ [ruby-dev:23913]
-Tue Mar 22 09:38:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * error.c (exit_success_p): new method SystemExit#success?.
+ [ruby-dev:23912]
- * numeric.c (flo_round): use pow instead of while-loop. fixes #4510
- patched by Alex Young [ruby-core:35526]
+ * error.c (syserr_initialize): initialization for subclasses.
+ [ruby-dev:23912]
-Tue Mar 22 06:47:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jul 15 23:53:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/date/date_strftime.c (date_strftime_wo_timespec):
- suppress warning: shorten-64-to-32.
+ * lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
+ no longer has to_str method.
-Tue Mar 22 06:42:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jul 15 22:59:48 2004 Shugo Maeda <shugo@ruby-lang.org>
- * ext/date/date_core.c: suppress warning: shorten-64-to-32.
+ * ext/readline/extconf.rb: added dir_config for curses, ncurses,
+ termcap. (backported from HEAD)
-Tue Mar 22 06:41:37 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jul 15 20:29:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/test/unit/parallel.rb: remove unused variable.
+ * class.c, error.c, eval.c, intern.h, object.c, variable.c:
+ do not set path if it is a singleton class. [ruby-dev:22588]
+ (backport from 1.9)
-Tue Mar 22 06:19:42 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jul 15 10:15:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * enc/utf_16le.c: suppress warning: shorten-64-to-32.
+ * ext/tk/, ext/tcltklib/: bug fix
- * ext/dbm/dbm.c: ditto.
+ * ext/tk/lib/tk.rb: better operation for SIGINT when processing
+ callbacks.
+ * ext/tk/lib/tk/msgcat.rb: ditto.
+ * ext/tk/lib/tk/variable.rb: ditto.
+ * ext/tk/lib/tk/timer.rb: ditto.
- * ext/gdbm/gdbm.c: ditto.
+ * ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
+ to define validatecommand methods easier
- * parse.y (Init_ripper): suppress warning: unused value.
+ * ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
+ classes
-Mon Mar 21 11:21:32 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
+ check for items (e.g. canvas items; depends on the class) to
+ avoid some troubles on Tk extension widget class definition.
- * lib/test/unit.rb: Refactoring. Unified if and elsif.
+ * ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
-Sun Mar 20 23:09:34 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
- * ext/date/date_strftime.c: checks duplicated modifiers.
-Sun Mar 20 22:32:30 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Wed Jul 14 18:08:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/date/date_strftime.c: removed unused code and arguments.
+ * ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
+ argument. [ruby-dev:23891]
-Sun Mar 20 21:34:49 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * test/openssl/test_x509store.rb: prune tests for CRL checking
+ unless X509::V_FLAG_CRL_CHECK is defined.
- * ext/date/date_core.c: replacement of implementation of
- strftime. It has some limitations that is same as Time's
- one. [experimental]
- * ext/date/date_strftime.c: new.
- * ext/date/lib/date/format.rb: removed ruby version of strftime.
+Wed Jul 14 12:29:07 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sun Mar 20 12:43:12 2011 Tanaka Akira <akr@fsij.org>
+ * util.c (ruby_strtod): should not convert string in the form of
+ "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
- * ext/openssl/ossl_x509store.c: parenthesize macro arguments.
+ * test/ruby/test_float.rb (test_strtod): add test for bug fix.
-Sun Mar 20 01:39:48 2011 Tajima Akio <artonx@yahoo.co.jp>
+Wed Jul 14 00:31:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * hash.c (ruby_setenv): check env process block size with OS ver.
- * win32/win32.c: export rb_w32_osver for above patch.
- * include/ruby/win32.h: declare rb_w32_osver for Win32 Libs.
+ * array.c: rdoc patch. merged patch from Johan Holmberg
+ <holmberg@iar.se> [ruby-core:3170]
-Sat Mar 19 18:35:05 2011 Tajima Akio <artonx@yahoo.co.jp>
+Tue Jul 13 19:39:12 2004 akira yamada <akira@ruby-lang.org>
- * hash.c (ruby_setenv): calculate total env block size for win32.
- * test/ruby/test_env.rb: add test for above patch.
+ * lib/uri/generic.rb (URI::Generic#merge_path):
+ "URI('http://www.example.com/foo/..') + './'" should return
+ "URI('http://www.example.com/')". [ruby-list:39838]
+ "URI('http://www.example.com/') + './foo/bar/..'" should return
+ "URI('http://www.example.com/foo/')". [ruby-list:39844]
-Sat Mar 19 17:14:46 2011 Tajima Akio <artonx@yahoo.co.jp>
+ * test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
- * hash.c (ruby_setenv): checking with max process environment
- block size for Win32. 32767 for 2000/XP, 2003. if failed to
- read the block, then checking with 5120 for earlier Windows.
+Tue Jul 13 15:51:45 2004 Akinori MUSHA <knu@iDaemons.org>
-Sat Mar 19 12:30:25 2011 Tanaka Akira <akr@fsij.org>
+ * lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
+ extmk mode.
- * ext/openssl/ossl_x509revoked.c: parenthesize macro arguments.
+ * lib/mkmf.rb (dir_config): Prepend a new library path instead of
+ appending so it is tried first.
-Fri Mar 18 20:44:36 2011 Tanaka Akira <akr@fsij.org>
+Tue Jul 13 00:50:48 2004 Dave Thomas <dave@pragprog.com>
- * ext/openssl/ossl_x509req.c: parenthesize macro arguments.
+ * lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
-Fri Mar 18 08:48:06 2011 Oleg Shaldybin <oleg.shaldybin@gmail.com>
+Mon Jul 12 21:20:36 2004 Dave Thomas <dave@pragprog.com>
- * lib/fileutils.rb (FileUtils::Entry_#copy_file): updated FileUtils.cp
- to still copy file permissions when :preserve is false (as cp does
- this even when -p isn't set).
+ * html_generator.rb: Support hyperlinks of the form {any text}[xxx]
+ as well as stuff[xxx]
-Fri Mar 18 00:59:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jul 10 09:30:24 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/win32ole/extconf.rb (create_docfile): removed. should not
- modify source directory unnecessarily, platform dependent
- documentation should be dealt with by rdoc. [ruby-core:35495]
+ * test/soap/marshal/test_struct.rb: use qualified build-tin class name
+ (::Struct) to avoid name crash.
-Fri Mar 18 00:54:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jul 10 04:21:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * include/ruby/ruby.h (rb_funcall_passing_block): add prototype.
- a patch by James M. Lawrence at [ruby-core:35501]
+ * ext/tk/lib/tk.rb: better operation for SIGINT when processing
+ callbacks.
+ * ext/tk/lib/tk/msgcat.rb: ditto.
+ * ext/tk/lib/tk/variable.rb: ditto.
+ * ext/tk/lib/tk/timer.rb: ditto.
-Wed Mar 17 06:23:31 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk/validation.rb (__def_validcmd): add a module
+ function of Tk::ValidateConfigure to define validatecommand
+ methods easier
- * ext/openssl/ossl_x509name.c: parenthesize macro arguments.
+Fri Jul 9 22:36:36 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Mar 16 20:36:56 2011 Tanaka Akira <akr@fsij.org>
+ * array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
+ <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
- * ext/socket/ipsocket.c (init_inetsock_internal): raise an error on
- listen(2) failure.
- reported by Xavier Shay. [ruby-core:35505]
+ * numeric.c: rdoc patch.
-Wed Mar 16 15:06:21 2011 Eric Hodel <drbrain@segment7.net>
+Fri Jul 9 19:26:39 2004 Tanaka Akira <akr@m17n.org>
- * ext/openssl/lib/openssl/buffering.rb (module OpenSSL): #flush should
- not change sync mode on exception.
- * test/openssl/test_buffering.rb: added
+ * lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
+ notice https is not supported.
-Wed Mar 16 13:45:28 2011 Eric Hodel <drbrain@segment7.net>
+Fri Jul 9 14:28:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/lib/openssl/buffering.rb: de-nest Buffering module
+ * eval.c (rb_thread_raise): accept third argument as well as
+ Kernel#raise, and evaluate the arguments to create an exception in
+ the caller's context. [ruby-talk:105507]
- * ext/openssl/lib/openssl/buffering.rb: add RDoc
+Fri Jul 9 01:47:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Mar 16 08:40:39 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib : bug fix
+ * ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
+ * ext/tk/lib/tkextlib/itk : add [incr Tk] support
+ * ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
+ * ext/tk/sample/tkextlib/iwidgets : very simple examples of
+ [incr Widgets]
- * ext/openssl/ossl_x509ext.c: parenthesize macro arguments.
+Thu Jul 8 22:52:19 2004 Kouhei Sutou <kou@cozmixng.org>
-Tue Mar 15 18:34:27 2011 Tanaka Akira <akr@fsij.org>
+ * lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
+ validation and validation which disregard order of elements.
+ * test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
+ validation.
+ * test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
+ name.
- * ext/openssl/ossl_x509crl.c: parenthesize macro arguments.
+Thu Jul 8 00:05:23 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/tempfile.rb (Tempfile::initialize): got out code of
+ generating tmpname. [ruby-dev:23832][ruby-dev:23837]
+
+Wed Jul 7 15:53:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * string.c (rb_str_match): raise TypeError when both arguments are
+ strings. [ruby-dev:22869] (backported from HEAD)
+
+ * string.c (rb_str_match2): removed.
+
+ * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
+ wince/Makefile.sub (string.c): now not depend on version.h.
+
+Wed Jul 7 00:48:34 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/tk/lib/tkextlib/tktrans.rb,
+ ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
+
+Tue Jul 6 18:38:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib : improve framework of developping Tcl/Tk extension
+ wrappers
+
+Mon Jul 5 23:56:42 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss/{trackback,syndication,dublincore,content}.rb: worked
+ with ruby 1.6 again.
+
+ * test/rss/rss-assertions.rb: ditto.
+
+Mon Jul 5 22:54:39 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
+
+Mon Jul 5 09:02:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
+ is a set of bit flags. [ruby-dev:23859]
+
+Mon Jul 5 01:27:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
+ the socket whose last-access-time is oldest. (and add new one)
+ [ruby-dev:23860]
+
+Sun Jul 4 12:24:50 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss/rss.rb: added copyright header.
+
+Sun Jul 4 00:24:40 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * added files
+ * lib/soap/attachment.rb
+ * lib/soap/header
+ * lib/soap/mimemessage.rb
+ * lib/soap/rpc/httpserver.rb
+ * lib/wsdl/soap/cgiStubCreator.rb
+ * lib/wsdl/soap/classDefCreator.rb
+ * lib/wsdl/soap/classDefCreatorSupport.rb
+ * lib/wsdl/soap/clientSkeltonCreator.rb
+ * lib/wsdl/soap/driverCreator.rb
+ * lib/wsdl/soap/mappingRegistryCreator.rb
+ * lib/wsdl/soap/methodDefCreator.rb
+ * lib/wsdl/soap/servantSkeltonCreator.rb
+ * lib/wsdl/soap/standaloneServerStubCreator.rb
+ * lib/wsdl/xmlSchema/enumeration.rb
+ * lib/wsdl/xmlSchema/simpleRestriction.rb
+ * lib/wsdl/xmlSchema/simpleType.rb
+ * lib/xsd/codegen
+ * lib/xsd/codegen.rb
+ * sample/soap/authheader
+ * sample/soap/raa2.4
+ * sample/soap/ssl
+ * sample/soap/swa
+ * sample/soap/whois.rb
+ * sample/soap/calc/samplehttpd.conf
+ * sample/soap/exchange/samplehttpd.conf
+ * sample/soap/sampleStruct/samplehttpd.conf
+ * sample/wsdl/raa2.4
+ * sample/wsdl/googleSearch/samplehttpd.conf
+ * test/openssl/_test_ssl.rb
+ * test/soap/header
+ * test/soap/ssl
+ * test/soap/struct
+ * test/soap/swa
+ * test/soap/wsdlDriver
+ * test/wsdl/multiplefault.wsdl
+ * test/wsdl/simpletype
+ * test/wsdl/test_multiplefault.rb
+
+ * modified files
+ * lib/soap/baseData.rb
+ * lib/soap/element.rb
+ * lib/soap/generator.rb
+ * lib/soap/marshal.rb
+ * lib/soap/netHttpClient.rb
+ * lib/soap/parser.rb
+ * lib/soap/processor.rb
+ * lib/soap/property.rb
+ * lib/soap/soap.rb
+ * lib/soap/streamHandler.rb
+ * lib/soap/wsdlDriver.rb
+ * lib/soap/encodingstyle/handler.rb
+ * lib/soap/encodingstyle/literalHandler.rb
+ * lib/soap/encodingstyle/soapHandler.rb
+ * lib/soap/mapping/factory.rb
+ * lib/soap/mapping/mapping.rb
+ * lib/soap/mapping/registry.rb
+ * lib/soap/mapping/rubytypeFactory.rb
+ * lib/soap/mapping/wsdlRegistry.rb
+ * lib/soap/rpc/cgistub.rb
+ * lib/soap/rpc/driver.rb
+ * lib/soap/rpc/element.rb
+ * lib/soap/rpc/proxy.rb
+ * lib/soap/rpc/router.rb
+ * lib/soap/rpc/soaplet.rb
+ * lib/soap/rpc/standaloneServer.rb
+ * lib/wsdl/data.rb
+ * lib/wsdl/definitions.rb
+ * lib/wsdl/operation.rb
+ * lib/wsdl/parser.rb
+ * lib/wsdl/soap/definitions.rb
+ * lib/wsdl/xmlSchema/complexContent.rb
+ * lib/wsdl/xmlSchema/complexType.rb
+ * lib/wsdl/xmlSchema/data.rb
+ * lib/wsdl/xmlSchema/parser.rb
+ * lib/wsdl/xmlSchema/schema.rb
+ * lib/xsd/datatypes.rb
+ * lib/xsd/qname.rb
+ * sample/soap/calc/httpd.rb
+ * sample/soap/exchange/httpd.rb
+ * sample/soap/sampleStruct/httpd.rb
+ * sample/soap/sampleStruct/server.rb
+ * sample/wsdl/amazon/AmazonSearch.rb
+ * sample/wsdl/amazon/AmazonSearchDriver.rb
+ * sample/wsdl/googleSearch/httpd.rb
+ * test/soap/test_basetype.rb
+ * test/soap/test_property.rb
+ * test/soap/test_streamhandler.rb
+ * test/soap/calc/test_calc.rb
+ * test/soap/calc/test_calc2.rb
+ * test/soap/calc/test_calc_cgi.rb
+ * test/soap/helloworld/test_helloworld.rb
+ * test/wsdl/test_emptycomplextype.rb
+ * test/wsdl/axisArray/test_axisarray.rb
+ * test/wsdl/datetime/test_datetime.rb
+ * test/wsdl/raa/test_raa.rb
+ * test/xsd/test_xmlschemaparser.rb
+ * test/xsd/test_xsd.rb
+
+ * summary
+ * add SOAP Header mustUnderstand support.
+
+ * add HTTP client SSL configuration and Cookies support (works
+ completely with http-access2).
+
+ * add header handler for handling sending/receiving SOAP Header.
+
+ * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
+ Model. it caused error.
+
+ * add WSDL simpleType support to restrict lexical value space.
+
+ * add SOAP with Attachment support.
+
+Sat Jul 3 17:19:44 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
+
+Thu Jul 1 23:15:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/pstore.rb (transaction): safer backup scheme. [ruby-list:39102]
+
+ * lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
+ [ruby-dev:23157]
+
+ * lib/pstore.rb (transaction): allow overriding dump and load.
+ [ruby-dev:23567]
+
+ * lib/pstore.rb (PStore#transaction): get rid of opening in write mode
+ when read only transaction. [ruby-dev:23842]
+
+ * lib/yaml/store.rb: follow lib/pstore.rb's change.
+
+Thu Jul 1 18:36:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tcltklib : bug fix
+
+ * ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
+
+Thu Jul 1 11:59:45 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
+ EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
+ EVP_DigestFinal_ex and EVP_DigestInit_ex.
+
+ * ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
+
+ * ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
+ EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
+ OpenSSL 0.9.6.
-Tue Mar 15 09:49:03 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
+ re-implemnt (the arguments for this method is ).
- * test/misc/test_ruby_mode.rb (test_singleton_class): Skip for Pending.
+ * ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
+ OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
-Mon Mar 14 21:20:44 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
+ ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
+ ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
+ and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
+ and EVP_CIPHER_CTX_init should only be called once.
- * test/ruby/test_require.rb (test_require_too_long_filename):
- increase path length, because MAXPATHLEN is defined as 4096 on linux.
+ * ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
+ OpenSSL::Cipher::Cipher#key_len=.
- * test/ruby/test_require.rb (test_require_path_home_1): ditto.
+ * ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
+ finction; print warning for Cipher#<<.
- * test/ruby/test_require.rb (test_require_path_home_2): ditto.
+ * ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
+ EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
+ and EVP_MD_CTX_init should only be called once.
-Mon Mar 14 19:54:37 2011 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_digest.c (digest_final): should call
+ EVP_MD_CTX_cleanup to avoid memory leak.
- * ext/openssl/ossl_x509cert.c: parenthesize macro arguments.
+ * ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
+ into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
-Sun Mar 13 18:11:28 2011 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_hmac.c (hmac_final): should call
+ HMAC_CTX_cleanup to avoid memory leak.
- * ext/openssl/ossl_x509attr.c: parenthesize macro arguments.
+ * test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
+ test/openssl/test_hmac.rb: new file.
-Sun Mar 13 16:07:58 2011 Shota Fukumori <sorah@tubusu.net>
+Thu Jul 1 04:08:30 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/pstore.rb: Fix don't raise "nested transaction" when thread_safe
- is true. Patch by Masaki Matsushita (Glass_saga). [ruby-dev:43337]
+ * ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
+ workaround for the versions earlier than OpenSSL-0.9.7.
- * test/test_pstore.rb: Test for above.
- Patch by Masaki Matsushita (Glass_saga) [ruby-dev:43337]
+Thu Jul 1 03:33:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Mar 12 04:12:41 2011 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
+ empty pkey object if no argument is passed. [ruby-talk:103328]
- * ext/openssl/ossl_ssl_session.c: parenthesize macro arguments.
+ * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-Sat Mar 12 02:27:07 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
- * ext/date/date_core.c ({d,dt}_lite_marshal_load): checks the given
- argument.
+ * ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
+ OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
+ OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
+ OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
-Sat Mar 12 01:26:24 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
+ OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
+ OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
+ OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
+ OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
- * ext/date/date_core.c: changed some directives.
+Thu Jul 1 03:16:09 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Mar 12 01:16:02 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
+ to specify a string to be written.
- * ext/date/date_core.c, ext/date/lib/*: moved rdoc descriptions.
+ * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
+ take optional second argument to specify a string to be written.
-Sat Mar 12 00:06:24 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
+ refine regexp for end-of-line.
- * ext/date/lib: moved from lib.
+ * ext/opnessl/lib/openssl/ssl.rb
+ (OpenSSL::SSL::SocketForwarder#listen): fix typo.
-Fri Mar 11 23:32:38 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Wed Jun 30 11:38:51 2004 Mikael Brockman <phubuh@phubuh.org>
- * lib/date/delta*: removed undocumented delta.
+ * parse.y (primary): should not be NULL. [ruby-core:03098]
-Fri Mar 11 18:42:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 30 02:53:24 2004 why the lucky stiff <why@ruby-lang.org>
- * lib/mkmf.rb (find_executable0): should exclude directories.
+ * ext/syck/rubyext.c (syck_emitter_new): set buffer after
+ Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
-Fri Mar 11 01:40:35 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Jun 29 10:31:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c (proc_getmaxgroups, proc_setmaxgroups): Process#maxgroups
- and Process#maxgroups= now raise NotImplementedError if the
- platform don't support supplementary groups concept.
+ * eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
-Fri Mar 11 01:25:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * gc.c (define_final, run_final): preserve and restore safe level for
+ finalizers. [ruby-core:03058]
- * process.c (get_sc_ngroups_max): return -1 if platform don't
- support NGROUPS_MAX.
+ * signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
+ safe level for signal handlers. [ruby-dev:23829]
-Thu Mar 10 22:28:15 2011 Tanaka Akira <akr@fsij.org>
+Mon Jun 28 14:57:56 2004 Jeff Mitchell <quixoticsycophant@yahoo.com>
- * ext/openssl/ossl_ssl.h: parenthesize macro arguments.
+ * configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
+ DOSISH compilers. [ruby-core:03107]
-Thu Mar 10 21:59:37 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Jun 28 00:30:19 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * parse.y (parser_encode_length): add exception as UTF8-MAC for
- magic comment's emacs newline specifier
- patched by James M. Lawrence [ruby-core:35476] fixes #4489
+ * sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
-Thu Mar 10 16:00:22 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Jun 27 22:39:51 2004 Kouhei Sutou <kou@cozmixng.org>
- * parse.y (parser_encode_length): fix typo: the length of
- "-dos" and "-mac" is not 5 but 4.
- patched by James M. Lawrence [ruby-core:35476] fixes #4489
+ * sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
-Thu Mar 10 10:52:01 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Sun Jun 27 12:19:46 2004 Kouhei Sutou <kou@cozmixng.org>
- * test/ruby/test_require.rb: setting too long string to ENV causes
- Errno::EINVAL on Windows. long path name errors may causes over
- about 1024 bytes, then limit it about 4000 bytes.
+ * {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
-Thu Mar 10 10:09:35 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Jun 26 11:07:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb (Test::Unit::Runner::Worker#read): fix for the case
- when IO#read or IO#gets returns nil.
+ * configure.in (aix): -b must come at the start of the command line,
+ and -e must not appear while testing libraries. [ruby-talk:104501]
-Thu Mar 10 07:12:03 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * lib/mkmf.rb (dir_config): quote directory names if necessary.
+ [ruby-talk:104505]
- * lib/rubygems*: Import rubygems 1.6.2 (release candidate @ 2026fbb5)
- * test/rubygems: Ditto
- * test/runner.rb: Added test to load path to fix test requires.
+Fri Jun 25 15:33:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Mar 10 03:00:43 2011 Tanaka Akira <akr@fsij.org>
+ * ext/iconv/extconf.rb: check stricter. [ruby-talk:104501]
- * ext/openssl/ossl_ssl.c: parenthesize macro arguments.
+ * ext/iconv/extconf.rb: include iconv.h for libiconv. [ruby-dev:22715]
-Wed Mar 9 23:51:26 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Fri Jun 25 08:31:29 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_io_m17n.rb (test_io_new_enc): "sjis" is now an alias
- of Windows-31J.
+ * eval.c (rb_thread_atfork): remove "fork terminates thread"
+ warning. [ruby-dev:23768]
-Wed Mar 9 23:06:13 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
+ [ruby-core:02786][ruby-core:03067]
- * misc/ruby-mode.el (ruby-parse-partial): fix indent after aref.
+ * ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
+ should give us packed address, not struct sockaddr.
+ [ruby-core:03053]
-Wed Mar 9 12:50:24 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Fri Jun 25 02:04:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/psych/lib/psych/visitors/yaml_tree.rb: Rescue exceptions when
- people implement the method method. Thanks Lin Jen-Shin.
- [ruby-core:35255]
+ * {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
+ including version.h. [ruby-talk:104456] (backported from HEAD)
- * test/psych/visitors/test_yaml_tree.rb: test for implementation of
- method method.
+Thu Jun 24 14:23:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Mar 9 11:53:31 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c (rb_io_fread): return already read data when system call is
+ interrupted. [ruby-talk:97206]
- * enc/shift_jis.c: Change SJIS as an alias of Windows-31J.
- [ruby-dev:43027] fixes #4280
+Thu Jun 24 01:32:43 2004 Shugo Maeda <shugo@ruby-lang.org>
- * enc/shift_jis.c: Add PCK as an alias of Windows-31J.
+ * version.h: added declarations of ruby_version,
+ ruby_release_date, ruby_platform.
+ (backported from HEAD)
-Wed Mar 9 00:45:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 23 22:23:37 2004 Dave Thomas <dave@pragprog.com>
- * ext/extmk.rb: nmake substitutes all occurrences in macro.
+ * ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
+ with OS X not returning 'from' parameter to recvfrom for
+ connection-oriented sockets.
- * ext/extmk.rb: workaround for nmake.
+Wed Jun 23 01:45:27 2004 Dave Thomas <dave@pragprog.com>
-Tue Mar 8 23:49:45 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
+ Fix problem with the 'r' being dropped from %r{xxx}
- * process.c (proc_setgroups): cleanup.
+Wed Jun 23 00:20:20 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Tue Mar 8 23:40:30 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
+ CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
- * test/misc/test_ruby_mode.rb: test for ruby-mode.el.
+Wed Jun 23 00:00:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Mar 8 23:27:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c (rb_io_initialize): should check fcntl result. [ruby-dev:23742]
- * process.c (get_sc_ngroups_max): try to use NGROUPS_MAX at first if
- _SC_NGROUP_MAX is not defined.
+Tue Jun 22 21:11:36 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Tue Mar 8 23:10:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
+ dLibraries().
- * misc/ruby-mode.el (ruby-parse-partial): fix for array in block.
+ * ext/win32ole/win32ole.c (ole_event_free): ditto.
-Tue Mar 8 21:44:49 2011 Tanaka Akira <akr@fsij.org>
+ * ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
+ before CR.
- * ext/openssl/ossl_rand.c: parenthesize macro arguments.
+Tue Jun 22 16:47:42 2004 Shugo Maeda <shugo@ruby-lang.org>
-Tue Mar 8 16:45:31 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
+ Thanks, Rutger Nijlunsing.
- * hash.c (ruby_setenv): MSDN says that Windows XP or earlier limits
- the total size of environment block to 5,120 chars. and on such
- OS, putenv() causes SEGV. So, ruby should limit the size of an
- environment variable to 5,120 bytes for workaround.
+Mon Jun 21 10:19:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Mar 8 15:57:20 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
+ FindClose() instead of _findfirst()/_findnext()/_findclose().
+ merge from HEAD.
- * test/rubygems/test_gem_spec_fetcher.rb
- (TestGemSpecFetcher#test_cache_dir_escapes_windows_paths): cache_dir
- may have driveletter and `:' for base of cache_dir itself, so need
- to skip it for checking.
+Sat Jun 19 13:24:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Mar 8 12:30:06 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (method_call): allow changing $SAFE. [ruby-dev:23713]
- * misc/ruby-mode.el (ruby-deep-indent-paren-p, ruby-calculate-indent):
- do not apply deep-indent inside parens at the beginning of
- expressions.
+Fri Jun 18 23:12:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Mar 8 09:32:48 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
+ safe level.
- * common.mk (configure-ext, build-ext), ext/extmk.rb (extmake):
- support parallel-make under ext.
+Wed Jun 16 23:05:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Mar 8 09:25:23 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * object.c (rb_mod_freeze): prepare string representation before
+ freezing. [ruby-talk:103646]
- * process.c (proc_setgroups): use getgrnam() if getgrnam_r() is
- not available.
+Wed Jun 16 16:04:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c: RARRAY_LEN() returns long int.
+ * object.c (rb_mod_le): singleton class inherits Class rather than its
+ object's class. [ruby-dev:23690]
-Tue Mar 8 09:07:03 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 16 16:01:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (RUBY_REPLACE_TYPE): enclose in quotes for multiple
- type names.
+ * gc.c (stack_grow_direction): memoize the direction.
-Tue Mar 8 01:43:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * gc.c (Init_stack): should always move to end of VALUE.
- * process.c (get_sc_ngroups_max): define to wrap sysconf(3).
- this also supports Windows which doesn't have sysconf(3).
+Tue Jun 15 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * process.c (maxgroups): use get_sc_ngroups_max.
+ * ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
- * process.c (proc_setmaxgroups): ditto.
+Mon Jun 14 18:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Mar 8 01:16:49 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/remote-tk.rb: bug fix
- * gc.c (rb_objspace): an initializer must be a constant.
+Sun Jun 13 00:23:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Mar 8 01:11:44 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
- * process.c (maxgroups): cast because sysconf(3)'s return value is long.
+ * ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
+ eliminate warning about instance variable access
- * process.c (proc_setmaxgroups): ditto.
+ * ext/tk/lib/tk/menubar.rb: improve supported menu_spec
- * process.c (proc_setgroups): cast because RARRAY_LEN() is long.
+ * ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
-Tue Mar 8 00:02:47 2011 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk/root.rb: add menu_spec support
- * ext/openssl/ossl_pkey_rsa.c: parenthesize macro arguments.
+ * ext/tk/lib/tk/text.rb: bug fix
-Mon Mar 7 22:59:39 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/tk/lib/tk/toplevel.rb: add menu_spec support
- * lib/pstore.rb: Delete variable @transaction and fix #4474. Patch by
- Masaki Matsushita (Glass_saga).
+ * ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
- * test/test_pstore.rb(test_thread_safe): Add test for #4474.
+Sat Jun 12 11:15:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Mon Mar 7 21:31:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * configure.in (target_os): strip -gnu suffix on Linux.
- * process.c (proc_setgroups): replace getgrnam() with getgrnam_r()
- because getgrnam() isn't thread safe.
+Fri Jun 11 17:08:21 2004 Akinori MUSHA <knu@iDaemons.org>
-Mon Mar 7 20:49:12 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * config.guess: Restore a wrongly removed hyphen.
- * process.c (proc_getmaxgroups, proc_setmaxgroups): reflect
- platform maxgroups limitation by default instead hardcoded 65536.
+Fri Jun 11 14:30:08 2004 Akinori MUSHA <knu@iDaemons.org>
-Mon Mar 7 17:13:00 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * config.guess: Attempt to avoid system name change on
+ Darwin platforms also.
- * gc.c (rb_gc_set_params): allow GC parameter configuration by
- environment variables. based on a patch from funny-falcon at
- https://gist.github.com/856296, but honors safe level.
+Fri Jun 11 14:22:45 2004 Akinori MUSHA <knu@iDaemons.org>
-Mon Mar 7 09:05:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * config.guess, config.sub: Attempt to avoid system name change on
+ Linux platforms. We have been using "linux" instead of
+ "linux-gnu" on this branch.
- * process.c: NUM2RLIM is defined but no getrlimit and setrlimit on
- mingw.
+Thu Jun 10 19:19:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Mar 7 08:38:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
+ [ruby-talk:103062]
- * ext/date/date_core.c (DateTimeData): should not use bare 'long long'
- and 'long double', which are not defined by C89.
+Wed Jun 9 18:04:14 2004 akira yamada <akira@ruby-lang.org>
- * ext/date/date_core.c (dt_lite_plus): get rid of overflow at casting
- down double to integer.
+ * lib/uri/generic.rb (URI::Generic::merge,
+ URI::Generic::route_from): accepts non-hierarchical URI.
+ [ruby-dev:23631]
-Mon Mar 7 00:21:11 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/uri/test_generic.rb (TestGeneric::test_route,
+ TestGeneric::test_merge): added tests for above changes.
- * process.c (proc_getgroups): get rid of maxgroups dependency.
- ngroups can be calculated dynamically.
+Wed Jun 9 17:39:37 2004 Akinori MUSHA <knu@iDaemons.org>
-Sun Mar 6 23:45:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * config.guess, config.sub: Update to a more recent version as of
+ 2004-01-20.
- * configure.in: rlim_t use standard RUBY_REPLACE_TYPE mechanism.
+ * configure.in: Add support for DragonFly BSD.
-Sun Mar 6 23:26:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Jun 2 20:16:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c (proc_setmaxgroups): added negative value check.
- This was suggested by Daniel Berger. Thanks Daniel!
- [ruby-core:35426][Bug#4467]
+ * string.c (str_new4): should share shared instance if it already
+ exists. [ruby-dev:23665]
-Sun Mar 6 23:18:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Jun 2 12:41:53 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * process.c (maxgroups, proc_setmaxgroups): increase max groups
- limitation up to 65536.
+ * io.c (rb_io_gets_m): set lastline ($_) even when read line is
+ nil. [ruby-dev:23663]
-Sun Mar 6 22:20:59 2011 Tanaka Akira <akr@fsij.org>
+Fri May 28 11:20:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl/ossl_pkey_ec.c: parenthesize macro arguments.
+ * eval.c (rb_eval): bad influence on frame node.
-Sun Mar 6 21:49:04 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (eval): reverted wrongly removed condition. [ruby-dev:23638]
- * sample/list.rb (MyElem#initialize): initialize @head
- explicitly. Otherwise -W2 option makes following warning.
- "warning: instance variable @head not initialized".
- This issue was founded by Andrew Grimm. Thanks Andrew!
- [ruby-core:35435][Bug#4471]
+Thu May 27 23:15:18 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sun Mar 6 05:21:41 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/logger.rb: leading 0 padding of timestamp usec part.
- * class.c: fix camelCase to snake_case in documentation code examples.
- patched by Andrew Grimm. fixes Bug #4469
+ * lib/csv.rb (CSV.parse): [CAUTION] behavior changed. in the past,
+ CSV.parse accepts a filename to be read-opened (it was just a
+ shortcut of CSV.open(filename, 'r')). now CSV.parse accepts a
+ string or a stream to be parsed e.g.
+ CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
- * marshal.c: ditto.
+ * lib/csv.rb: CSV::Row and CSV::Cell are deprecated. these classes
+ are removed in the future. in the new csv.rb, row is represented
+ as just an Array. since CSV::Row was a subclass of Array, it won't
+ hurt almost all programs except one which depended CSV::Row#match.
+ and a cell is represented as just a String or nil(NULL). this
+ change will cause widespread destruction.
- * proc.c: ditto.
+ CSV.open("foo.csv", "r") do |row|
+ row.each do |cell|
+ if cell.is_null # using Cell#is_null
+ p "(NULL)"
+ else
+ p cell.data # using Cell#data
+ end
+ end
+ end
- * sample/biorhythm.rb: ditto.
+ must be just;
- * vm_eval.c: ditto.
+ CSV.open("foo.csv", "r") do |row|
+ row.each do |cell|
+ if cell.nil?
+ p "(NULL)"
+ else
+ p cell
+ end
+ end
+ end
- * vm_method.c: ditto.
+ * lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
+ change. CSV.open, CSV.parse, and CSV,generate now do not force
+ opened file binmode. formerly it set binmode explicitly.
+ with CSV.open, binmode of opened file depends the given mode
+ parameter "r", "w", "rb", and "wb". CSV.parse and CSV.generate open
+ file with "r" and "w".
-Sun Mar 6 03:22:27 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ setting mode properly is user's responsibility now.
- * io.c (io_cntl): use rb_thread_io_blocking_region() instead
- rb_thread_blocking_region().
+ * lib/csv.rb: accepts String as a fs (field separator/column separator)
+ and rs (record separator/row separator)
-Sat Mar 5 22:54:36 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/csv.rb (CSV.read, CSV.readlines): added. works as IO.read and
+ IO.readlines in CSV format.
- * include/ruby/intern.h: fix a typo of prototype declaration.
- rb_mutex_try_lock -> rb_mutex_trylock [ruby-dev:43213]
+ * lib/csv.rb: added CSV.foreach(path, rs = nil, &block). CSV.foreach
+ now does not handle "| cmd" as a path different from IO.foreach.
+ needed?
-Sat Mar 5 19:44:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/csv/test_csv.rb: updated.
- * test/ruby/test_io.rb (TestIO#test_fcntl_lock): small clean up.
+ * test/ruby/test_float.rb: added test_strtod to test Float("0").
-Sat Mar 5 01:33:46 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu May 27 21:37:50 2004 Tanaka Akira <akr@m17n.org>
- * io.c (io_cntl, nogvl_io_cntl): IO.fcntl() and IO.ioctl()
- release GVL during calling kernel interface.
- Suggested by Eric Wong. [ruby-core:35417][Bug #4463]
+ * lib/pathname.rb (Pathname#initialize): refine pathname initialization
+ by pathname.
- * test/ruby/test_io.rb (TestIO#test_fcntl_lock): add new test for
- IO.fcntl().
+Thu May 27 20:22:05 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Fri Mar 4 23:09:12 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
- * test/testunit/test_parallel.rb
- (test_should_run_all_without_any_leaks): consider that the order of
- testcase could change. [ruby-dev:43300] [Bug #4466]
+Thu May 27 14:53:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Fri Mar 4 22:01:14 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
+ add errno checking. [ruby-dev:23627]
- * io.c (io_cntl): change 'cmd' type to int. ioctl and fcntl need to
- be passed int.
- * io.c (rb_io_ctl): ditto.
+Wed May 26 14:19:42 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Mar 4 21:10:40 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (rb_eval, eval): make line number consistent on eval with
+ Proc. [ruby-talk:101253]
- * configure.in: save warnflags. the patch is created by Eric Wong.
- [Bug #4465]
+Wed May 26 13:59:17 2004 Dave Thomas <dave@pragprog.com>
-Wed Mar 2 21:15:00 2011 Tanaka Akira <akr@fsij.org>
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
+ 'do' after for statement
- * ext/openssl/ossl_pkey_dsa.c: parenthesize macro arguments.
+Wed May 26 13:56:03 2004 Dave Thomas <dave@pragprog.com>
-Thu Mar 3 22:10:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
+ relative path to code CSS file
- * process.c (check_exec_redirect_fd, check_exec_redirect): raise
- ArgumentError if fd >= 3 on Windows because the feature is not
- supported.
+Wed May 26 13:14:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_process.rb (test_execopts_redirect): remove meaningless
- argument.
+ * io.c (rb_io_init_copy): copy also positions. [ruby-talk:100910]
-Thu Mar 3 21:21:42 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed May 26 00:00:00 2004 why the lucky stiff <why@ruby-lang.org>
- * test/ruby/test_process.rb (test_execopts_redirect): redirecting fd
- >= 3 is not supported on Windows, so should not specify such options
- when calling spawn or others.
+ * ext/syck/syck.c (syck_new_parser): clear parser on init.
+ thanks, ts. [ruby-core:02931]
-Thu Mar 3 18:59:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
+ thanks, ts. [ruby-core:02929]
- * string.c (rb_str_slice_bang): raise error when the string is frozen.
+ * lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
-Thu Mar 3 14:25:19 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/yaml.rb: added rdoc to beginning of lib.
- * strftime.c (STRFTIME): return 0 and ERANGE when precision is too
- large. [ruby-dev:43284] fixes #4456
+Mon May 24 10:46:26 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Mar 3 00:46:51 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
+ must be absolute URIs
- * addr2line.c (uleb128): cast the value to unsigned long.
+Sat May 22 12:00:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * addr2line.c (fill_lines): print error when lseek fails.
+ * MANIFEST: add new encodings in rexml.
-Thu Mar 3 00:36:29 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/MANIFEST: add recent files.
- * lib/rexml/encoding.rb (REXML::Encoding#encoding=): store @encoding
- a String which means the name of the encoding.
- this partially revert r29646.
+Sat May 22 05:37:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/rexml/document.rb: follow above.
+ * ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
+ on the other processes by Tcl/Tk's 'send' command
- * lib/rexml/output.rb: ditto.
+Fri May 21 09:22:05 2004 Dave Thomas <dave@pragprog.com>
- * lib/rexml/parsers/baseparser.rb: ditto.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
+ Add ()'s around parameters that don't have them
- * lib/rexml/source.rb: ditto.
+Thu May 20 17:02:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rexml/xmldecl.rb: ditto.
+ * lib/mkmf.rb (check_sizeof): define result size. [ruby-core:02911]
-Wed Mar 2 23:19:56 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (create_header): macro name should not include equal
+ sign.
- * string.c (str_byte_substr): return nil for negative length.
+Thu May 20 15:59:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Wed Mar 2 21:15:00 2011 Tanaka Akira <akr@fsij.org>
+ * ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
- * ext/openssl/ossl_pkey_dh.c: parenthesize macro arguments.
+Thu May 20 14:35:52 2004 Tanaka Akira <akr@m17n.org>
-Wed Mar 2 14:24:04 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/socket/socket.c: check SCM_RIGHTS macro addition to
+ the msg_control field to test existence of file descriptor passing
+ by msg_control.
- * lib/test/unit/parallel.rb: Fix name from `inclement_io` to
- `increment_io`.
+Thu May 20 12:38:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Mar 2 14:06:01 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * numeric.c (flo_eq): always check if operands are NaN.
+ [ruby-list:39685]
- * string.c (rb_str_slice_bang): move treatments which is only needed
- when the result is not nil.
+Thu May 20 12:34:39 2004 Dave Thomas <dave@pragprog.com>
-Wed Mar 2 14:02:29 2011 Shota Fukumori <sorah@tubusu.net>
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
+ At Ryan Davis' suggestion, honor visibility modifers if guarded by a
+ statement modifier
- * test/testunit/test_parallel.rb(TestParallel#spawn_runner):
- Fix outputing empty line in running test.
+Thu May 20 12:22:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/testunit/tests_for_parallel/test_third.rb: Remove `sleep`
+ * lib/mkmf.rb (have_type): do not check pointer to incomplete type,
+ which always get compiled. [ruby-list:39683]
-Tue Mar 1 22:29:10 2011 Tanaka Akira <akr@fsij.org>
+Wed May 19 11:09:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/ossl_pkey.h: parenthesize macro arguments.
+ * ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
+ private to public
-Tue Mar 1 22:02:35 2011 Shota Fukumori <sorah@tubusu.net>
+Tue May 18 14:00:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit/parallel.rb: Fix number.
+ * node.h (NEW_DSTR): adjust list length.
-Tue Mar 1 21:48:22 2011 Shota Fukumori <sorah@tubusu.net>
+ * parse.y (literal_concat): ditto.
- * lib/test/unit/parallel.rb: For Windows.
+Mon May 17 16:14:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/testunit/test_parallel.rb(TestParallelWorker#test_quit_in_test):
- Fix for above specification change.
- * test/testunit/test_parallel.rb(TestParallel#spawn_runner):
- Fix outputing empty line in running test.
+ * numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
+ instead of "0.0e+00". [ruby-dev:23480]
-Tue Mar 1 20:51:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
+ outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
+ is considered, but there is assumption DBL_DIG == 15 in current
+ implementation)
- * test/ruby/test_system.rb (TestSystem#test_system_at):
- remove tests for [bug#4396]. because we decided to reject this
- ticket.
+Mon May 17 10:13:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Mar 1 19:46:19 2011 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/socket/socket.c (setup_domain_and_type): honor duck typing.
+ [ruby-dev:23522]
- * test/date/{test_date.rb,test_date_attr.rb}: [ruby-dev:43280]
+ * ext/socket/socket.c (sock_s_getnameinfo): ditto.
-Tue Mar 1 18:40:38 2011 Ryan Davis <ryan@YPCMC09457>
+Mon May 17 01:15:23 2004 why the lucky stiff <why@ruby-lang.org>
- * lib/rubygems*: Import rubygems 1.6.0 (released version @ 58d8a0b9)
- * test/rubygems: Ditto
+ * lib/yaml.rb: removed fallback to pure Ruby parser.
-Tue Mar 1 16:22:22 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
+ of zero at times, which kept some blocks from getting indentation.
- * win32/win32.c: revert r30987 because it causes some failures in
- test-all, especially webrick.
+ * lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
-Tue Mar 1 15:59:53 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/syck/syck.h: reports style of scalars now, be they plain, block
+ single-, or double-quoted.
- * string.c (rb_str_byteslice): the resulted encoding should keep
- original encoding. this also fixes the encoding when the result
- shares internal string. [ruby-core:35376]
+ * ext/syck/syck.c: ditto.
-Tue Mar 1 13:25:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * ext/syck/gram.c: ditto.
- * ext/bigdecimal/bigdecimal.c (VpMemAlloc): CVE-2011-0188.
- Fixes a bug reported by Drew Yao <ayao at apple.com>
+ * ext/syck/node.c: ditto.
-Tue Mar 1 10:34:39 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/syck/token.c: ditto.
- * string.c (rb_str_byteslice): Add String#byteslice. [ruby-core:35376]
+ * ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
+ if scalar style is plain.
-Tue Mar 1 00:12:49 2011 Tajima Akio <artonx@yahoo.co.jp>
+ * ext/syck/rubyext.c (yaml_org_handler): some empty strings were
+ loaded as symbols.
- * include/ruby/win32.h: define WIN32 if neither _WIN64 nor WIN32
- defined. it forces to use push/pop for pack(4) pragma.
+ * test/yaml/test_yaml.rb (test_perl_regexp): updated test to
+ match new regexp serialization.
-Mon Feb 28 23:52:13 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon May 17 00:03:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * test/testunit/test_rake_integration.rb (test_with_rake_runner):
- use assert_in_out_err for suppress messages.
+ * lib/drb/drb.rb: Cosmetic documentation changes.
-Mon Feb 28 22:48:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun May 16 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * win32/win32.c (rb_w32_spawn): use shell if a commandline contain
- double-quote character.
- * win32/win32.c (is_internal_cmd): similar, use shell if a commandline
- contain caret character.
+ * lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
+ RDoc operation), and added file-level comment.
- * test/ruby/test_system.rb (TestSystem#test_system_at): fix
- wrong test case. if system() invoke a command by using shell,
- system() never return nil. Also, "" quotation must not appear
- twice in a command line.
+Sun May 16 20:55:49 2004 Tanaka Akira <akr@m17n.org>
-Mon Feb 28 17:36:57 2011 Tanaka Akira <akr@fsij.org>
+ * ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
+ specify an open flag.
+ (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
+ and DBM::NEWDB.
- * ext/openssl/ossl_pkcs7.c: parenthesize macro arguments.
+Sun May 16 13:10:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Mon Feb 28 16:48:42 2011 Tanaka Akira <akr@fsij.org>
+ * lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
+ generating warnings, many were on private methods).
- * ext/openssl/ossl_pkcs12.c: parenthesize macro arguments.
+Sat May 15 01:41:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Feb 28 16:28:15 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (eval): forgot to restore $SAFE value before evaluating
+ compiled node. [ruby-core:02872]
- * string.c (tr_trans): when the hash for multibyte repl is empty,
- tr is inverse mode, and a character doesn't much the table, the
- character should be replaced by last replacement. Bug #4449
+Sat May 15 01:33:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Feb 28 16:38:56 2011 Tanaka Akira <akr@fsij.org>
+ * range.c (range_each_func): terminates loop if generating value
+ is same to @end. [ruby-talk:100269]
- * ext/openssl/ossl_ocsp.c: parenthesize macro arguments.
+Fri May 14 22:08:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Feb 28 13:02:15 2011 Danial Pearce <github@tigris.id.au>
+ * string.c (rb_str_new4): should not reuse frozen shared string if
+ the original is not an instance of String. [ruby-talk:100193]
- * lib/tempfile.rb: Fix example file paths in docs for tempfile.
- https://github.com/ruby/ruby/pull/5
+Fri May 14 18:39:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Mon Feb 28 12:56:18 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
+ Now, supports all of the followings.
+ TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
+ TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
+ TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
+ TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
+ TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
+ TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
- * ext/openssl/ossl_cipher.c (ossl_cipher_init): typo fix.
- https://github.com/ruby/ruby/pull/8
+Fri May 14 12:11:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Feb 28 12:28:13 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
+ [ruby-dev:23498]
- * ext/date/date_core.c (datetime_s_now): localtime() and localtime_r()
- required time_t pointer as 1st parameter, and tv_sec member of struct
- timeval is long.
+Thu May 13 15:47:30 2004 akira yamada <akira@ruby-lang.org>
-Mon Feb 28 11:57:40 2011 Shota Fukumori <sorah@tubusu.net>
+ * lib/net/telnet.rb (Net::Telnet::login): "options" can specify
+ regexps for login prompt and/or password prompt.
- * test/testunit/test_parallel.rb: Temporally disable test on Windows.
+Thu May 13 14:23:45 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Mon Feb 28 07:28:35 2011 Shota Fukumori <sorah@tubusu.net>
+ * hash.c (delete_if_i): use st_delete_safe() (via
+ rb_hash_delete()) instead of returning ST_DELETE.
+ backport from HEAD. [ruby-dev:23487]
- * lib/test/unit.rb(Test::Unit::Runner#after_worker_quit):
- method name more be natural English.
+Thu May 13 13:01:30 2004 akira yamada <akira@ruby-lang.org>
- * lib/test/unit.rb(Test::Unit::Runner::Worker.launch):
- IO.sync doesn't need. Should use "b" for mode.
+ * lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
-Sun Feb 27 21:59:37 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu May 13 11:04:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_system.rb (TestSystem#test_system_redirect_win):
- add test for system().
+ * pack.c (pack_pack): always add with null for 'Z'.
-Sun Feb 27 18:00:09 2011 Shota Fukumori <sorah@tubusu.net>
+ * pack.c (pack_unpack): terminated by null for 'Z'. [ruby-talk:98281]
- * lib/test/unit.rb: Refactoring; Worker never use Hash for internal
- storage.
+Wed May 12 19:59:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb: Never use Kernel#spawn. Use IO.popen instead.
+ * lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
+ [ruby-talk:99788]
-Sun Feb 27 13:16:48 2011 Tanaka Akira <akr@fsij.org>
+Wed May 12 17:41:42 2004 Tanaka Akira <akr@m17n.org>
- * ext/openssl/ossl_ns_spki.c: parenthesize macro arguments.
+ * lib/resolv.rb (Resolv::DNS::Config): make it configurable without
+ external file such as /etc/resolv.conf.
-Sat Feb 26 17:07:53 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Wed May 12 14:37:27 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/date.rb: [Feature #4257]
+ * ext/openssl/ossl_x509name.c: attribute value of DC (short name of
+ domainComponent) should be IA5String.
- * ext/date/extconf.rb: new
+Wed May 12 13:20:19 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/date/date_core.c: new
+ * ext/tk/lib/tk/composite.rb: improve configure methods (based on
+ the proposal of [ruby-talk:99671]).
-Sat Feb 26 16:10:23 2011 Shota Fukumori <sorah@tubusu.net>
+Wed May 12 11:51:08 2004 Dave Thomas <dave@pragprog.com>
- * lib/test/unit.rb: --jobs-status won't puts over 2 lines.
+ * class.c (rb_obj_singleton_methods): fix rdoc
- * test/testunit/test_parallel.rb: Fix test for above.
+Mon May 10 21:44:42 2004 Dave Thomas <dave@pragprog.com>
- * lib/test/*: refactoring.
+ * lib/rdoc/generators/html_generator.rb: Change scheme for
+ looking up symbols in HTML generator.
-Sat Feb 26 07:10:05 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Mon May 10 16:45:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych/scalar_scanner.rb: fix parsing timezone's whose
- whose format is (+/-)hhmm. Thanks Goncalo Silva!
+ * eval.c (eval): warning during eval should not cause deadlock.
+ [ruby-talk:98651]
- * test/psych/test_scalar_scanner.rb: test for bug.
+ * eval.c (rb_eval): raise TypeError exception for superclass
+ mismatch. [ruby-list:39567]
-Thu Feb 24 23:02:55 2011 Tanaka Akira <akr@fsij.org>
+Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
- * ext/openssl/ossl_hmac.c: parenthesize macro arguments.
+ * lib/rdoc/generators/html_generator.rb: Hack to search parents
+ for unqualified constant names.
-Thu Feb 24 22:53:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
- * common.mk (love): for the birthday.
+ * lib/rdoc/generators/html_generator.rb: Hack to search parents
+ for unqualified constant names.
-Thu Feb 24 22:51:54 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun May 9 22:37:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * vm.c (ruby_vm_destruct): run vm exit hooks after all objects are
- destructed.
+ * lib/net/ftp.rb: improved documentation
+ * lib/net/imap.rb: ditto
+ * lib/net/pop.rb: ditto
+ * lib/net/smtp.rb: ditto
+ * lib/net/telnet.rb: ditto
-Thu Feb 24 14:40:33 2011 Shota Fukumori <sorah@tubusu.net>
+Fri May 7 21:50:21 2004 Dave Thomas <dave@pragprog.com>
- * ChangeLog (vim): Modeline for vim
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
+ multiple arguments to 'include'
-Thu Feb 24 13:39:25 2011 Shota Fukumori <sorah@tubusu.net>
+Fri May 7 21:31:56 2004 Minero Aoki <aamine@loveruby.net>
- * common.mk: Use $RUNRUBY for worker process.
+ * lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
+ [ruby-core:02843]
- * lib/test/unit.rb: Fix bug.
+Fri May 7 11:25:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * lib/test/unit.rb: @options[:ruby](@opts[:ruby]) is now Array.
+ * util.c (ruby_strtod): "0.0000000000000000001" should be converted
+ to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
+ [ruby-talk:99318] [ruby-dev:23465]
- * test/testunit/parallel.rb: Fix for above.
+Fri May 7 10:00:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Feb 24 10:05:55 2011 Shota Fukumori <sorah@tubusu.net>
+ * ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
- * test/testunit/tests_for_parallel/misc.rb: Fix bug in r30947.
+Thu May 6 22:13:17 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/test/unit.rb, lib/test/unit/assertions.rb: For this test.
+ * ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
+ hostname.
-Wed Feb 23 23:07:38 2011 Shota Fukumori <sorah@tubusu.net>
+Thu May 6 14:22:29 2004 why the lucky stiff <why@ruby-lang.org>
- * test/testunit/test_parallel.rb, test/testunit/parallel/*:
- Test for r30939.
+ * lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
+ for Ranges, Strings, Structs, Regexps.
- * lib/test/unit.rb: For test.
+ * lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
+ String's flow style.
- * lib/test/parallel.rb: For test.
+ * lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
- * lib/test/unit/testcase.rb: For test.
+ * ext/syck/gram.c: fixed transfer methods on structs, broke it
+ last commit.
-Wed Feb 23 22:05:13 2011 Tanaka Akira <akr@fsij.org>
+Thu May 6 11:40:28 2004 Shugo Maeda <shugo@ruby-lang.org>
- * ext/openssl/ossl_engine.c: parenthesize macro arguments.
+ * lib/net/imap.rb (string): accept NIL.
-Tue Feb 22 23:15:17 2011 Shota Fukumori <sorah@tubusu.net>
+ * lib/net/imap.rb (body_type_basic): allow body-fields omissions.
- * lib/test/unit.rb: Fix --ruby option doesn't effect.
+Thu May 6 01:59:04 2004 Dave Thomas <dave@pragprog.com>
- * lib/test/unit.rb: Fix typo.
+ * lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
+ Don't include the &block parameter if we have explicit
+ yield parameters.
-Tue Feb 22 21:39:28 2011 Tanaka Akira <akr@fsij.org>
+Wed May 5 03:40:29 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/openssl/ossl_digest.c: parenthesize macro arguments.
+ * lib/rinda/ring.rb: use recv instead of recvfrom.
-Tue Feb 22 14:34:26 2011 Shota Fukumori <sorah@tubusu.net>
+Tue May 4 23:52:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * lib/test/unit.rb: Fix merging miss.
+ * lib/gserver.rb: documented
-Tue Feb 22 12:27:26 2011 Shota Fukumori <sorah@tubusu.net>
+Tue May 4 23:46:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * lib/test/unit.rb: Add new options; --jobs,-j,--ruby,--jobs-status,
- --no-retry.
- [Feature #4415] [ruby-dev:43226],[ruby-dev:43222],[ruby-core:35294]
+ * lib/xmlrpc/README.txt: introduced for documentation purposes
- * lib/test/unit/parallel.rb: Used at test/unit --jobs(-j) option.
+Mon May 3 09:47:24 2004 Dave Thomas <dave@pragprog.com>
- * test/csv/test_serialization.rb: test/unit parallel running ready.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ Fix parsing bug if yield called within 1 line block
- * test/rake/test_file_task.rb: test/unit parallel running ready.
+Sun May 2 01:04:38 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Feb 22 06:09:10 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/tcltklib, ext/tk: renewal Ruby/Tk
- * ext/syslog/syslog.c: Apply documentation patch from mathew murphy.
- [Bug #4149]
+Fri Apr 30 20:08:41 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Feb 22 03:09:10 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
- * ext/psych/lib/psych.rb: increase Psych to 1.1.0 for help with
- debugging.
+Tue Apr 27 13:12:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Feb 22 03:04:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
- * ext/psych/lib/psych/streaming.rb: refactor streaming methods to a
- module.
- * ext/psych/lib/psych/stream.rb: extracted streaming specific methods
- to a module.
- * ext/psych/lib/psych/json/stream.rb: JSON stream inherits from
- JSONTree and includes streaming methods.
- * ext/psych/lib/psych/visitors/json_tree.rb: JSON does not support
- object references, so remove object reference testing when building
- JSON trees.
+Tue Apr 27 08:41:28 2004 why the lucky stiff <why@ruby-lang.org>
-Tue Feb 22 02:41:51 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/yaml/rubytypes.rb: passing Range tests.
- * ext/psych/lib/psych/visitors/yaml_tree.rb (accept): use Hash#key?
- when looking up object references to err on the side of cache
- misses.
+ * ext/syck/syck.h: version 0.44.
-Mon Feb 21 10:58:39 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/syck/gram.c: transfers no longer open an indentation.
+ fixed transfers which precede blocks.
- * ext/psych/lib/psych/json/yaml_events.rb: refactoring JSON event
- handling methods to a module for reuse.
- * ext/psych/lib/psych/json/tree_builder.rb: AST builder uses JSON
- event methods.
- * ext/psych/lib/psych/json/stream.rb: stream emitter uses JSON event
- methods.
+ * ext/syck/token.c: ditto.
-Mon Feb 21 10:54:29 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/syck/syck.c: fixed segfault if an anchor has been released already.
- * ext/psych/lib/psych/json/stream.rb: do not emit custom tags in maps
- or sequences when emitting JSON.
- * ext/psych/lib/psych/json/tree_builder.rb: do not emit custom tags in
- sequences when emitting JSON.
- * test/psych/json/test_stream.rb: tests for custom stream emits.
- * test/psych/test_json_tree.rb: tests for JSON emits.
+ * ext/syck/node.c (syck_free_members): organized order of free'd nodes.
-Mon Feb 21 10:05:10 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
+ StringValue.
- * ext/psych/lib/psych/json/ruby_events.rb: DRY up ruby event handling
- for JSON.
- * ext/psych/lib/psych/visitors/json_tree.rb: use ruby events module
- * ext/psych/lib/psych/json/stream.rb: ditto
+Mon Apr 26 23:56:54 2004 Daniel Kelley <news-1082945587@dkelley.gmp.san-jose.ca.us>
-Mon Feb 21 10:01:01 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * README.EXT, README.EXT.ja: fixed wrong function signature.
+ [ruby-talk:98349]
- * ext/psych/lib/psych/json/stream.rb: fix JSON stream emits to use
- double quotes during stream.
- * test/psych/json/test_stream.rb: tests to reflect changes.
+Mon Apr 26 21:40:09 2004 Dave Thomas <dave@pragprog.com>
-Mon Feb 21 00:38:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
+ to instance methods.
- * test/ruby/test_system.rb (TestSystem#test_system_at):
- add testcase for bug4396.
+Sat Apr 24 10:38:31 2004 Dave Thomas <dave@pragprog.com>
-Sun Feb 20 19:59:32 2011 Tanaka Akira <akr@fsij.org>
+ * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
+ Fix bug where consecutive headings are merged.
- * ext/openssl/ossl_cipher.c: parenthesize macro arguments.
+Fri Apr 23 23:26:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Feb 20 16:26:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb: $hdrdir should not contain macros for backward
+ compatibility. [bruby-dev:28]
- * thread.c (exec_recursive): prevent temporary objects from GC.
+ * version.c (ruby_show_copyright): obtain copyright year from
+ RUBY_RELEASE_YEAR.
- * prevent temporary objects from GC, and should not use
- RSTRING_PTR() for function calls since it evaluates the argument
- a couple of times.
+ * win32/resource.rb: ditto.
-Sun Feb 20 16:22:53 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
+ include them.
- * file.c (rb_file_flock): use rb_thread_io_blocking_region for the
- time being.
+ * win32/resource.rb: include winver.h for older WindowsCE.
-Sun Feb 20 05:33:17 2011 Ryan Davis <ryand-ruby@zenspider.com>
+Fri Apr 23 16:38:46 2004 Tanaka Akira <akr@m17n.org>
- * lib/minitest/*.rb: Imported minitest 2.0.2 r6207.
- * test/minitest/*: ditto
+ * lib/pathname.rb: sync taint/freeze flag between
+ a pathname object and its internal string object.
-Sun Feb 20 02:14:09 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Apr 23 14:52:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * signal.c (sig_trap): avoid pthread_sigmask(xx, &mask, &mask) usage
- because FreeBSD don't permit it. If it's used, it behave as
- pthread_sigmask(xx, NULL, &mask).
+ * parse.y (stmt, arg, aref_args): should not make sole splat into
+ array, in aref_args other than aref with op_asgn.
- * signal.c (init_sigchld): ditto.
+Fri Apr 23 14:14:38 2004 Tanaka Akira <akr@m17n.org>
-Sun Feb 20 00:46:51 2011 Tanaka Akira <akr@fsij.org>
+ * lib/resolv.rb: don't use Regexp#source to embed regexps.
+ [ruby-dev:23432]
- * ext/openssl/ossl_bn.c: parenthesize macro arguments.
+Thu Apr 22 04:15:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Feb 19 22:37:42 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * parse.y (aref_args): should pass expanded list. [ruby-core:02793]
- * vm_insnhelper.c (vm_check_if_namespace): guard temporary object
- from GC.
+Thu Apr 22 01:12:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 19 06:36:27 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * numeric.c (flo_to_s): tweak output string based to preserve
+ decimal point and to remove trailing zeros. [ruby-talk:97891]
- * lib/test/unit.rb: partial revert of r30849. [ruby-core:32864]
+ * string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
+ search. [ruby-talk:97342]
- * test/testunit/test_rake_integration.rb: adding an integration test
- with the rake loader to prevent regressions.
+Wed Apr 21 22:57:27 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Fri Feb 18 19:31:31 2011 Shugo Maeda <shugo@ruby-lang.org>
+ * lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
- * lib/fileutils.rb (FileUtils::remove_entry_secure): there is a
- race condition in the case where the given path is a directory,
- and some other user can move that directory, and create a
- symlink while this method is executing.
- Reported by: Nicholas Jefferson <nicholas at pythonic.com.au>
+Wed Apr 21 20:05:00 2004 Tanaka Akira <akr@m17n.org>
-Fri Feb 18 00:28:39 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
+ [ruby-list:39542]
- * compile.c (get_exception_sym2type): guard temporary object from GC.
+Mon Apr 19 18:11:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Feb 17 23:54:29 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * hash.c (rb_hash_equal): returns true if two hashes have same set
+ of key-value set. [ruby-talk:97559]
- * iseq.c (prepare_iseq_build): initialize iseq_compile_data::err_info
- with nil. this fix exception in rb_iseq_load().
+ * hash.c (rb_hash_eql): returns true if two hashes are equal and
+ have same default values.
-Thu Feb 17 22:32:35 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Mon Apr 19 08:19:58 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
- * test/ruby/test_marshal.rb (test_marshal_dump_extra_iv):
- fix a typo of local variable. [Bug #3720] [ruby-dev:42083]
+ * dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
+ lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
+ lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
+ lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
+ lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
+ lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
+ lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
+ lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
-Thu Feb 17 21:32:53 2011 Tanaka Akira <akr@fsij.org>
+Mon Apr 19 08:14:18 2004 Dave Thomas <dave@pragprog.com>
- * ext/openssl/ossl.h: parenthesize macro arguments.
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
+ #ifdef HAVE_PROTOTYPES
-Wed Feb 16 20:37:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Apr 16 22:33:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * eval_jump.c (rb_exec_end_proc): changed at_exit and END proc
- evaluation order. [Bug #4400] [ruby-core:35237]
- * eval_jump.c (rb_mark_end_proc): ditto.
+ * ext/iconv/iconv.c: nearly finished RDoc comments.
- * test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_nested_at_exit):
- added a test for nested at_exit.
- * test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_beginendblock):
- changed the test to adopt new spec.
+Fri Apr 16 17:04:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Feb 16 20:17:06 2011 Tanaka Akira <akr@fsij.org>
+ * string.c (rb_str_equal): always returns true or false, never
+ returns nil. [ruby-dev:23404]
- * ext/openssl/openssl_missing.h: parenthesize macro arguments.
+Fri Apr 16 08:27:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 15 21:37:45 2011 Tanaka Akira <akr@fsij.org>
+ * ext/extmk.rb: skip linking when libraries to be preloaded not
+ compiled. [ruby-list:39561]
- * ext/gdbm/gdbm.c: parenthesize macro arguments.
+Thu Apr 15 23:21:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 15 20:34:53 2011 Tanaka Akira <akr@fsij.org>
+ * process.c (pst_success_p): new method Process::Status#success?.
+ [ruby-dev:23385]
- * array.c (ary_join_1): fix array size.
+Thu Apr 15 17:12:13 2004 Tanaka Akira <akr@m17n.org>
-Tue Feb 15 19:43:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
+ GDBM::WRCREAT and GDBM::NEWDB.
+ (fgdbm_initialize): use specified read/write flag.
- * configure.in: fix and resubmit r30621. [ruby-dev:43203]
+Wed Apr 14 11:29:56 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Feb 15 15:41:30 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * numeric.c (flo_eq): workaround for bcc32's bug.
+ (ruby-bugs-ja:PR#594)
- * array.c (array_join): copy the encoding of the first element as
- an initial encoding.
+Wed Apr 14 13:06:35 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
- * array.c (array_join_0): ditto.
+ * array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
+ process.c, re.c, string.c: typos in RDoc comments. [ruby-core:02783]
- * array.c (array_join_1): ditto.
+Wed Apr 14 11:06:38 2004 Dave Thomas <dave@pragprog.com>
- * array.c (inspect_ary): ditto.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
+ behavior of :enddoc: -- it now unconditionally terminates
+ processing of the current file.
- * array.c (array_join_1): add an argument to check the appending is
- first one or not.
+Wed Apr 14 11:03:22 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Tue Feb 15 15:40:53 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * defines.h: include <net/socket.h> to get fd_set definition in BeOS.
- * hash.c (inspect_i): copy the encoding of the first key as
- an initial encoding.
+Tue Apr 13 23:06:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Mon Feb 14 15:00:16 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/rinda/rinda.rb: change pattern matching.
+ a === b -> a == b || a === b. [druby-ja:98]
- * array.c (inspect_ary): don't taint the inspected result of a
- recursive array.
+ * test/rinda/test_rinda.rb: ditto.
-Tue Feb 15 15:43:29 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Apr 13 19:54:29 2004 Minero Aoki <aamine@loveruby.net>
- * encoding.c (rb_enc_compatible): change the rule for empty strings:
- remove the special treatment of the US-ASCII encoded empty string.
- Now Encoding.compatible? usually respect the encoding of the
- receiver.
+ * lib/net/http.rb: should not overwrite HTTP request header.
+ [ruby-list:39543]
-Tue Feb 15 15:39:37 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Apr 13 01:30:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * string.c (rb_enc_cr_str_buf_cat): remove special treatment of
- ASCII-8BIT receivers.
+ * ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
+ * ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
- * string.c (str_gsub): set initial encoding of the buffer as the
- same of the receiver. [ruby-core:35141]
+Mon Apr 12 19:11:29 2004 Eric Hodel <drbrain@segment7.net>
-Tue Feb 15 09:49:33 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * gc.c (rb_gc_copy_finalizer): typo. [ruby-core:02774]
- * test/ruby/test_system.rb (TestSystem#test_system_at): use findstr
- command instead of find command, because the latter is confusing
- another famous Unix command.
+Mon Apr 12 18:52:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Mon Feb 14 23:01:19 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
+ a value.
- * thread.c (rb_thread_io_blocking_region): reset th->waiting_fd
- after blocking region, because remaining waiting_fd might
- cause unnecessary IOError.
+Mon Apr 12 10:43:47 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Feb 14 21:06:50 2011 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
+ rb_push_glob): fix memory leak. (leaked when block was interrupted)
- * configure.in: revert r30621. That revision introduced mkmf test
- failures and it turned out to be OK to revert. [ruby-dev:43203]
+Mon Apr 12 10:27:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Mon Feb 14 21:04:01 2011 Tanaka Akira <akr@fsij.org>
+ * bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
- * ext/fiddle/conversions.h: parenthesize macro arguments.
+ * win32/Makefile.sub: ditto.
-Mon Feb 14 18:41:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * wince/Makefile.sub: ditto.
- * win32/setup.mak (USE_RUBYGEMS): fixed r30835. It didn't work on
- mswin32 port. If you changed win32/configure.bat, you should change
- setup.mak too.
+Sun Apr 11 19:12:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Feb 14 17:28:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ruby.c (require_libraries): restore source file/line after
+ statically linked extensions initialized. [ruby-dev:23357]
- * test/ruby/test_system.rb (TestSystem#test_system_at):
- added test. [ruby-core:35218] (#4393)
+Sun Apr 11 10:47:04 2004 Dave Thomas <dave@pragprog.com>
-Mon Feb 14 13:15:35 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
+ classes and modules are a special case too... (handle extending existing
+ classes with or without :enddoc:)
- * win32/win32.c (is_internal_cmd): if the first char of prog is '@',
- execute it via shell. [ruby-core:35218] (#4393)
+Sat Apr 10 23:51:13 2004 Dave Thomas <dave@pragprog.com>
-Mon Feb 14 10:33:45 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
+ made one too many assumptions...
- * lib/test/unit.rb: revert r30863, because it causes too many noise.
+Sat Apr 10 00:00:19 2004 Dave Thomas <dave@pragprog.com>
-Mon Feb 14 07:34:55 2011 Tanaka Akira <akr@fsij.org>
+ * lib/rdoc/markup/simple_markup/inline.rb: Fix problem
+ with \_cat_<b>dog</b>
- * ext/curses/curses.c: parenthesize macro arguments.
+Wed Apr 7 00:19:50 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Sun Feb 13 19:41:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rinda/rinda.rb: fix hash tuple bug.
- * lib/test/unit.rb (Test::Unit::RequireFiles#non_options): skip
- test suites failed to load instead of mere messages.
+ * lib/rinda/tuplespace.rb: ditto.
-Sun Feb 13 09:56:44 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/rinda/test_rinda.rb
- * test/openssl/test_config.rb (OpenSSL#test_freeze): fix error
- message assertion.
+Tue Apr 6 18:24:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/io/nonblock/test_flush.rb (TestIONonblock#flush_test):
- return true to finish the test.
+ * io.c (rb_io_reopen): should use rb_io_check_io().
- * test/syck/test_string.rb (Syck::TestString#test_non_binary_string):
- use assert_not instead of refute, unless required minitest
- explicitly.
+Tue Apr 6 16:46:09 2004 Tanaka Akira <akr@m17n.org>
- * test/test_prime.rb (TestPrime::sieve.Integer): ditto.
+ * configure.in: check the size of time_t.
- * test/xmlrpc/webrick_testing.rb (WEBrick_Testing#start_server):
- catch IOError when server socket was closed.
+ * time.c (time_add): new function.
+ (time_plus): use time_add.
+ (time_minus): use time_add.
-Sun Feb 13 07:39:51 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
+Tue Apr 6 13:21:30 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * enum.c (enum_inject): typo fixed. a patch from Gaku Ueda in
- [ruby-core:35216].
+ * ext/socket/socket.c (make_hostent): must return value.
-Sun Feb 13 00:48:47 2011 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Apr 6 00:05:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/date.rb (Date#===): [ruby-core:35127]
+ * lib/rinda/rinda.rb: add require 'drb/drb'
-Sun Feb 13 00:29:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 5 08:18:23 2004 Dave Thomas <dave@pragprog.com>
- * lib/test/unit.rb (Test::Unit::Options#process_args): always
- return options.
+ * lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
+ references work properly.
- * lib/test/unit.rb (Test::Unit::RequireFiles#non_options): return
- if any test case get loaded.
+Sun Apr 4 20:33:42 2004 Minero Aoki <aamine@loveruby.net>
- * lib/test/unit.rb (Test::Unit::AutoRunner#initialize): do not add
- default directory if it is nil.
+ * eval.c (Init_load): make $LOADED_FEATURES built-in.
+ [ruby-dev:23299]
- * lib/test/unit.rb (Test::Unit::AutoRunner#process_args): return
- true if any test cases to run.
+ * ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
-Sat Feb 12 23:17:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
- * lib/test/unit.rb (assert_include): add alias.
+Sun Apr 4 14:01:20 2004 Dave Thomas <dave@pragprog.com>
-Sat Feb 12 14:44:20 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
+ Fix bug where files weren't being excluded properly
- * thread.c (rb_thread_io_blocking_region): new function to run
- blocking region with GIL released, for fd.
+Sat Apr 3 17:11:05 2004 why the lucky stiff <why@ruby-lang.org>
- * thread.c (rb_thread_fd_close): implement. [ruby-core:35203]
+ * ext/syck/syck.h: version 0.43.
- * vm.c (th_init): rename from th_init2.
+ * ext/syck/lib/gram.c: allow root-level inline collections.
+ [ruby-talk:94922]
-Sat Feb 12 14:41:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
+ [ruby-talk:94930]
- * lib/test/unit.rb (Test::Unit::AutoRunner#initialize): use
- default_dir if no test case given.
+ * ext/syck/bytecode.c: turn off default implicit typing.
- * lib/test/unit.rb (Test::Unit::Runner): rename from Test::Unit::Mini.
+ * ext/syck/implicit.c: detect base60 integers.
- * lib/test/unit.rb (Test::Unit::GlobOption#non_options): run tests
- under base directory if no argument given.
+ * ext/syck/rubyext.c: handle base60, as well as hex and octal
+ with commas. implicit typing of ruby symbols.
-Sat Feb 12 08:03:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 2 17:27:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_settracefunc.rb (TestSetTraceFunc): ensure to use
- method_added hook defined in Module.
+ * eval.c (top_include): include in the wrapped load is done for
+ the wrapper, not for a singleton class for wrapped main.
+ [ruby-dev:23305]
-Sat Feb 12 01:04:02 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 2 15:13:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ruby.c (proc_options): enable rubygems if --gem option is given.
+ * bignum.c (rb_big_eq): use temporary double variable to save the
+ result (internal float register may be bigger than 64 bits, for
+ example, 80 bits on x86). [ruby-dev:23311]
- * ruby.c (process_options): load rubygems if it is disabled but
- --gem option is given.
+Fri Apr 2 14:35:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Feb 11 23:27:50 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * eval.c (block_pass): should generate unique identifier of the
+ pushing block. [ruby-talk:96363]
- * ruby.c (proc_options): add --gem=enabled as an alias of
- --enable=gems and --gem=disabled as an alias of --disable=gems.
- Gem named "enabled" or "disabled" has already been reserved
- legitimately for this purpose.
+Fri Apr 2 07:31:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Feb 11 23:17:04 2011 Tanaka Akira <akr@fsij.org>
+ * ext/socket/socket.c (make_hostent): fix memory leak, based on
+ the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
- * ext/dl/cfunc.c: parenthesize macro arguments.
+Thu Apr 1 22:55:33 2004 Dave Thomas <dave@pragprog.com>
-Fri Feb 11 21:41:53 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
+ =begin rdoc/=end
- * bin/testrb, test/runner.rb, lib/test/unit.rb: improve backward
- compatibility.
+ * lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
+ top-level method being taken as file comment.
-Fri Feb 11 19:45:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Apr 1 22:55:04 2004 Dave Thomas <dave@pragprog.com>
- * eval.c (ruby_cleanup): use rb_ary_free to free internal object.
+ * lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
- * gc.h (RUBY_FREE_UNLESS_NULL): get rid of double free.
- [ruby-core:35192]
+Thu Apr 1 19:58:37 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Fri Feb 11 16:57:03 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
+ object with soap/marshal.
+ added URIFactory class for URI mapping. BasetypeFactory checks
+ instance_variables when original mapping is not allowed (ivar must
+ be empty). Instance of URI have instance_variables but it must be
+ llowed whenever original mapping is allowed or not.
- * test/ruby/test_transcode.rb (test_from_cp50221): fix wrong
- assertion and move back.
+ * lib/xsd/datatypes.rb: check the smallest positive non-zero
+ single-precision float exactly instead of packing with "f".
+ [ruby-talk:88822]
-Fri Feb 11 14:33:18 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
+ [ruby-dev:22588]
+ c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
- * lib/test/unit/assertions.rb (assert_no_match): alias for
- backward compatibility.
+Wed Mar 31 19:06:23 2004 Tanaka Akira <akr@m17n.org>
-Fri Feb 11 12:06:48 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (year_leap_p): new function.
+ (timegm_noleapsecond): ditto.
+ (search_time_t): use timegm_noleapsecond instead of
+ mktime for first guess.
- * ruby.c (add_gems, require_libraries, proc_options): add
- --require and --gem options.
+Wed Mar 31 12:04:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Feb 11 12:03:24 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/delegate.rb (DelegateClass): define internal methods of the
+ result class, but not metaclass of the caller. [ruby-talk:96156]
- * configure.in (rubygems): add --disable-rubygems option.
+ * intern.h: provide proper prototypes. [ruby-core:02724]
-Fri Feb 11 11:39:03 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.h: missing.h is now prerequisite to intern.h.
- * template/fake.rb.in (CROSS_COMPILING): get rid of NameError.
+Tue Mar 30 20:25:34 2004 Tanaka Akira <akr@m17n.org>
-Thu Feb 10 23:12:34 2011 Tanaka Akira <akr@fsij.org>
+ * time.c (search_time_t): limit guess range by mktime if it is
+ available. [ruby-dev:23274]
- * ext/dl/dl.h: parenthesize macro arguments.
+Sun Mar 28 14:16:59 2004 Minero Aoki <aamine@loveruby.net>
-Wed Feb 9 23:11:27 2011 Tanaka Akira <akr@fsij.org>
+ * lib/net/pop.rb (auth): failed when account/password include "%".
+ [ruby-talk:95933]
- * ext/pty/pty.c: parenthesize macro arguments.
+Sat Mar 27 21:40:41 2004 Tanaka Akira <akr@m17n.org>
-Tue Feb 8 11:47:11 2011 Loren Sands-Ramshaw <lorensr@gmail.com>
+ * lib/open-uri.rb: permit extra semicolon in content-type field.
- * array.c: documentation clarification in rotate, rotate!,
- index, and rindex. [ruby-core:35144]
+Sat Mar 27 10:40:48 2004 Tanaka Akira <akr@m17n.org>
-Wed Feb 9 09:45:43 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
+ instead of PrettyPrint.
- * test/rdoc/test_rdoc_encoding.rb: remove unnecessary (and wrong)
- platform-dependent hacks.
+Thu Mar 25 23:28:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Feb 9 00:47:18 2011 Tanaka Akira <akr@fsij.org>
+ * time.c (time_overflow_p): backport 1.9 usec overflow function.
+ (ruby-bugs PR#1307)
- * ext/etc/etc.c: parenthesize macro arguments.
+Thu Mar 25 23:15:24 2004 Dave Thomas <dave@pragprog.com>
-Tue Feb 8 19:38:00 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
+ Add --version option
- * misc/ruby-mode.el (ruby-expr-beg): fix for invalid nest errors.
+Thu Mar 25 04:16:18 2004 Dave Thomas <dave@pragprog.com>
-Tue Feb 8 19:22:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
+ which dumps our all known names
- * configure.in (AC_MSG_CHECKING): fixed typo. the patch is
- created by Benoit Daloze. Thanks a lot. [Bug #4384][ruby-core:35148]
+Thu Mar 25 03:57:47 2004 Dave Thomas <dave@pragprog.com>
-Tue Feb 8 16:04:03 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
+ allow nested classes to be designated using "."--you must
+ now use "::"
- * io.c (rb_io_s_sysopen): use NUM2MODET() instead NUM2UINT().
+Thu Mar 25 02:00:18 2004 Dave Thomas <dave@pragprog.com>
-Tue Feb 8 15:59:23 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/generators/template/html/one_page_html.rb (Page):
+ Fix to work with C modules.
- * process.c (rb_run_exec_options_err): use MODET2NUM() instead
- LONG2NUM().
+Wed Mar 24 21:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Tue Feb 8 13:59:56 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
+ * lib/uri/common.rb: Ditto.
+ * lib/uri/ftp.rb: Ditto.
+ * lib/uri/generic.rb: Ditto.
+ * lib/uri/http.rb: Ditto.
+ * lib/uri/https.rb: Ditto.
+ * lib/uri/ldap.rb: Ditto.
+ * lib/uri/mailto.rb: Ditto.
+ (All backported from 1.9)
- * configure.in: revert r30725. Now we have proper runtime fallback.
- Therefore, no need compile time disabling. (see r30762).
+Wed Mar 24 18:48:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Feb 8 01:00:21 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
+ DESTDIR after installed.
- * process.c (proc_setgroups): add GC guard to prevent intermediate
- variable from GC.
+ * lib/mkmf.rb (RUBY): / is not recognized as path separator on
+ nmake/bmake. [ruby-list:39388]
-Tue Feb 8 00:56:33 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
- * misc/ruby-mode.el (ruby-expr-beg, ruby-in-here-doc-p): tell
- singleton class definitions from here documents.
+Wed Mar 24 12:32:56 2004 Dave Thomas <dave@pragprog.com>
- * misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial): keyword
- followed by colon is label.
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
+ Don't document methods if we don't know for sure the
+ class or module.
-Mon Feb 7 22:56:16 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+ Don't store documentation for singleton classes if we
+ don't know the real class.
- * lib/benchmark.rb (Benchmark#bmbm): use ensure clause instead of
- Object#tap to restore STDOUT.sync.
+Wed Mar 24 11:11:26 2004 Dave Thomas <dave@pragprog.com>
-Mon Feb 7 22:34:20 2011 Tanaka Akira <akr@fsij.org>
+ * lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
+ Allow non-RDoc templates by putting a slash in the template name
- * lib/net/http.rb (Net::HTTP#connect): support SNI (Server Name
- Indication) for HTTPS. [ruby-dev:43164]
- http://stackoverflow.com/questions/4685736/openssl-server-name-indication-support-in-ruby
+Mon Mar 22 16:19:57 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Mon Feb 7 16:05:32 2011 Eric Hodel <drbrain@segment7.net>
+ * ruby.1: add -width option to .Bl for old groff.
- * lib/rdoc: Upgrade to RDoc 3.5.3 Fixes [Bug #4376]
+Sun Mar 21 21:11:16 2004 Keiju Ishitsuka <keiju@ishitsuka.com>
-Mon Feb 7 11:46:59 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/shell/*: bug fix for Shell#system(command_line_string).
- * common.mk (rdoc): add --encoding=UTF-8; ruby's rdoc must be UTF-8.
+Sat Mar 20 20:57:10 2004 David Black <dblack@wobblini.net>
-Mon Feb 7 10:21:50 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/scanf.rb: Backported 1.9 branch
+ modifications/corrections to 1.8 branch
- * test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
- there is no easy way to create owner unreadable file on Windows.
- So, skip the test.
+Sat Mar 20 23:51:03 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Sun Feb 6 13:48:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_require_safe): preserve old ruby_errinfo.
+ [ruby-talk:95409]
- * ext/json/lib/json/common.rb (JSON::MissingUnicodeSupport.iconv):
- should not drop rest of the result. use Iconv.conv instead.
+ * eval.c (rb_f_raise): should not clear backtrace information if
+ exception object already have one.
-Sun Feb 6 12:46:02 2011 Eric Hodel <drbrain@segment7.net>
+Sat Mar 20 15:25:36 2004 Dave Thomas <dave@pragprog.com>
- * string.c (gsub): Ensure result encoding is the same as input
- encoding. [Bug #4340].
+ * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
+ page background to white.
-Sun Feb 6 12:18:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Mar 20 09:52:33 2004 Tadayoshi Funaba <tadf@dotrb.org>
- * parse.y (words, qwords): dispatch array events. based on a
- patch from Michael Edgar. [Bug #4365].
+ * lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
+ part of second minute that follows a comma or a full stop.
-Sun Feb 6 12:12:59 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Mar 19 01:55:57 2004 Mauricio Fernandez <batsman.geo@yahoo.com>
- * test/fileutils/fileasserts.rb (FileAssertions): separate module.
+ * io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
-Sun Feb 6 11:29:23 2011 Tanaka Akira <akr@fsij.org>
+Thu Mar 18 21:44:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/dbm/dbm.c: parenthesize macro arguments.
+ * lib/drb/drb.rb: backport drb.rb 1.16.
-Sat Feb 5 22:01:59 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Mar 18 17:49:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
- revert r30796. r30797 and r30798 are an alternative fix.
- [ruby-dev:43174]
+ * struct.c (make_struct): allow const_id for accessor names.
+ [ruby-core:04585]
-Sat Feb 5 21:47:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_attr): check if attribute name is local_id or
+ const_id.
- * parse.y (mlhs_basic): include mlhs_post for ripper. a patch
- from Michael Edgar at [ruby-core:35078].
+Thu Mar 18 16:22:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Feb 5 21:22:21 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (proc_eq): avoid false positive by using scope and
+ dyna_vars. no longer use frame.uniq.
- * lib/test/unit/assertions.rb (assert_block): move from
- test/fileutils/fileasserts.rb.
+Wed Mar 17 14:44:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/fileutils/fileasserts.rb (assert_block): pass arguments
- as-is. [ruby-dev:43174]
+ * dir.c (range): fix possible "\0" overrun. (in case of "\0-")
-Sat Feb 5 16:47:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Mar 15 07:39:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
- msg can be passed nil. [Bug #4371] [ruby-dev:43174]
+ * eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
+ yield is not break destination. [ruby-dev:23197]
-Sat Feb 5 15:18:25 2011 Eric Hodel <drbrain@segment7.net>
+Sat Mar 13 14:28:16 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/rdoc: Upgrade to RDoc 3.5.2
+ * test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
+ trunk)
-Sat Feb 5 12:05:27 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/drb/test_drbunix.rb: ditto.
- * ext/syck/rubyext.c (syck_node_init_copy): SyckNode is not
- copiable. [ruby-core:35094]
+Wed Mar 10 22:28:09 2004 Minero Aoki <aamine@loveruby.net>
-Sat Feb 5 11:48:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb (remove_dir): should handle symlink correctly.
+ This patch is contributed by Christian Loew. [ruby-talk:94635]
+ (Backport from main trunk)
- * ext/openssl/ossl_cipher.c (ossl_cipher_alloc): leave data ptr
- NULL.
+Wed Mar 10 16:28:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/openssl/ossl_cipher.c (ossl_cipher_new, ossl_cipher_initialize):
- allocate internal structure. [ruby-core:35094]
+ * eval.c (return_jump): set return value to the return
+ destination. separated from localjump_destination().
- * ext/openssl/ossl_cipher.c (ossl_cipher_copy): ditto.
+ * eval.c (break_jump): break innermost loop (or thread or proc).
-Sat Feb 5 11:29:10 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_yield_0): set exit_value for block break.
- * ext/json/parser/parser.h (GET_PARSER): raise TypeError.
+Wed Mar 10 15:58:43 2004 Ryan Davis <ryand@zenspider.com>
- * ext/json/parser/parser.rl (cParser_initialize): ditto.
+ * eval.c (eval): Only print backtrace if generating the backtrace
+ doesn't generate an exception. [ruby-core:02621]
- * ext/json/parser/parser.h (GET_PARSER): check if initialized.
- [ruby-core:35079]
+Tue Mar 9 13:04:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/json/parser/parser.rl (cParser_initialize): ditto.
+ * io.c (rb_io_ungetc): raise IOError instead of calling
+ rb_sys_fail(). [ruby-talk:23181]
-Sat Feb 5 10:09:31 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Mar 8 19:32:28 2004 akira yamada <akira@ruby-lang.org>
- * load.c (rb_get_expanded_load_path): always expand load paths.
+ * lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
+ -> (?::#{PORT}). [ruby-dev:23170]
-Sat Feb 5 09:38:08 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Mar 8 15:31:41 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * transcode.c (encoded_dup): extract.
+ * dir.c (range): treat incomplete '[' as ordinary character (like
+ has_magic does).
-Sat Feb 5 03:37:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dir.c (range): Cancel above change. More discussion is needed.
- * lib/fileutils.rb (FileUtils::LowMethods): make low level methods
- in NoWrite and DryRun to do nothing. [ruby-dev:43129]
+Sun Mar 7 22:37:46 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/fileutils/fileasserts.rb: add message arguments.
+ * test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
- * test/fileutils/fileasserts.rb (Test::Unit::Assertions#assert_block):
- show the given message.
+ * test/drb/ut_eval.rb: ditto.
-Sat Feb 5 02:09:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/drb/ut_large.rb: ditto.
- * parse.y (lex_getline, parser_set_encode): set encoding of lines
- in SCRIPT_LINES__ as source encoding. [ruby-dev:43168]
+ * test/drb/ut_safe1.rb: ditto.
-Sat Feb 5 02:08:37 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
- * vm.c (ruby_thread_data_type): add prefix.
+Sun Mar 7 16:22:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat Feb 5 00:59:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * Makefile.in (lex.c): use $? instead of $<.
- * vm_core.h (GetThreadPtr): use TypedData_Get_Struct() instead
- CoreDataFromValue() because we need type check. Otherwise,
- type mismatch can cause segmentation fault crash.
- [ruby-core:35086] [Ruby 1.9-Bug#4367]
+Fri Mar 5 00:54:14 2004 Dave Thomas <dave@pragprog.com>
- * vm.c (thread_data_type): remove static.
+ * lib/test/unit.rb: MOve RDoc documentation so that you can
+ now say 'ri Test::Unit'
-Fri Feb 4 19:14:27 2011 Tanaka Akira <akr@fsij.org>
+Tue Mar 2 12:32:59 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * enc/trans/utf8_mac.trans: parenthesize macro arguments.
+ * win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
+ defined? NORETURN. [ruby-dev:23100]
-Fri Feb 4 12:11:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Mar 1 12:24:10 2004 Dave Thomas <dave@pragprog.com>
- * string.c (str_utf8_nth): fixed a condition of optimized lead
- byte counting. [Bug #4366][ruby-dev:43170]
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
+ Allow aliases to have parentheses
-Fri Feb 4 01:50:13 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Feb 29 23:14:53 2004 Dave Thomas <dave@pragprog.com>
- * string.c (count_utf8_lead_bytes_with_word): wrote function
- comments.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+ Handle :nodoc: on singleton classes.
-Fri Feb 4 00:14:55 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Feb 28 10:58:49 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/zlib/zlib.c (gzfile_reader_get_unused): no need to dup
- before rb_str_resurrect.
+ * MANIFEST: add test_erb.rb
-Thu Feb 3 20:04:44 2011 Tanaka Akira <akr@fsij.org>
+ * lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
+ if both filename and safe_level given. [ruby-dev:23050]
- * ext/curses/curses.c (CHECK): unused macro removed.
+Fri Feb 27 01:00:09 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Thu Feb 3 18:33:26 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
- * ext/zlib/zlib.c (gzfile_reader_get_unused): use rb_str_resurrect
- because gz->z.input is hidden string. [ruby-core:35057]
+Wed Feb 25 21:16:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Feb 3 16:34:10 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * instruby.rb (with_destdir): should return the given argument if no
+ DESTDIR is given.
- * enc/shift_jis.c (code_to_mbc): cast as int from the subtraction of
- pointers.
+ * instruby.rb: use path name expansion of cmd.exe.
- * enc/utf_16le.c (utf16le_mbc_enc_len): use ptrdiff_t.
+Wed Feb 25 09:35:22 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * enc/utf_32be.c (utf32be_left_adjust_char_head): ditto.
+ * error.c (NameError::Message): new class for lazy evaluation of
+ message to ensure replaced before marshalling. merge from HEAD.
+ (ruby-bugs-ja:PR#588)
- * enc/utf_32le.c (utf32le_left_adjust_char_head): ditto.
+ * eval.c (rb_method_missing): use NameError::Message. merge from
+ HEAD. (ruby-bugs-ja:PR#588)
-Thu Feb 3 16:31:43 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Feb 24 18:59:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * include/ruby/missing.h: don't use HAVE_STDDEF_H because it never
- defined by configure though configure.bat defines it.
+ * dir.c (glob_helper): '**/' should not match leading period
+ unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
- * include/ruby/ruby.h: move include stddef.h to defines.h
+Tue Feb 24 13:22:21 2004 Dave Thomas <dave@pragprog.com>
- * include/ruby/defines.h: ditto.
+ * lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
+ heuristics on which files to include and exclude. Now only include
+ non-standard files if they are explicitly named in ARGV.
-Wed Feb 2 20:25:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Feb 24 07:23:30 2004 Dave Thomas <dave@pragprog.com>
- * include/ruby/encoding.h (rb_enc_step_back): cast 4th argument 'n'
- as int because Ruby usually treats length value as long but
- onigenc_step_back's 4th argument is int.
+ * lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
+ choosing a default main page to display (ie. don't select a page
+ if we don't have documentation for it).
-Thu Feb 3 07:20:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
- * ext/psych/lib/psych/visitors/to_ruby.rb: use Regexp::NOENCODING
- rather than magic number.
+ * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
+ class variables in code listings
- * ext/syck/lib/syck/rubytypes.rb: ditto
+Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
-Thu Feb 3 07:16:11 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
+ class variables in code listings
- * re.c (Init_Regexp): added a constant for ARG_ENCODING_NONE
- [ruby-core:35054]
+Tue Feb 24 06:32:27 2004 Dave Thomas <dave@pragprog.com>
- * test/ruby/test_regexp.rb: corresponding test.
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
+ aliases in C files.
-Thu Feb 3 07:02:16 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Tue Feb 24 06:16:22 2004 Dave Thomas <dave@pragprog.com>
- * ext/psych/lib/psych/visitors/to_ruby.rb: ARG_ENCODING_NONE regular
- expressions can round trip. [ruby-core:34969]
+ * lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
+ parsing files.
- * test/psych/test_yaml.rb: test for ARG_ENCODING_NONE regex
+Tue Feb 24 06:08:47 2004 Dave Thomas <dave@pragprog.com>
- * ext/sych/lib/syck/rubytypes.rb: ARG_ENCODING_NONE regular
- expressions can round trip.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
+ Start collecting text of constant values earlier: was missing
+ values in output if there was no space after '='
- * test/syck/test_yaml.rb: test for ARG_ENCODING_NONE regex
+Tue Feb 24 06:08:25 2004 Dave Thomas <dave@pragprog.com>
-Wed Feb 2 17:09:22 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/generators/html_generator.rb: Escape contant values.
- * io.c (rb_io_fdatasync): Use fsync(2) if the underlying
- operating system does not support fdatasync(2).
+Tue Feb 24 03:45:06 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Feb 2 14:51:08 2011 Eric Hodel <drbrain@segment7.net>
+ * ext/openssl/ossl_config.c (ossl_config_each): add new method
+ OpenSSL::Config#each. it iterates with section name, field name
+ and value.
- * lib/rdoc/markup/to_tt_only.rb: commit miss
- * test/rdoc/test_rdoc_markup_to_tt_only.rb: ditto
- * test/rdoc/test_rdoc_single_class.rb: ditto
+ * ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
-Wed Feb 2 09:27:53 2011 Eric Hodel <drbrain@segment7.net>
+Mon Feb 23 09:16:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc: Upgrade to RDoc 3.5.1
+ * instruby.rb (DOSISH): embedded path in batch files should not be
+ prefixed by DESTDIR. [ruby-core:02186]
-Wed Feb 2 00:30:43 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Feb 22 09:54:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * include/ruby/st.h (st_table): Added comment why we need __extension__.
+ * re.c: corrected documentation format (again)
-Tue Feb 1 20:45:44 2011 Tanaka Akira <akr@fsij.org>
+Sun Feb 22 09:43:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * enc/encdb.c: parenthesize macro arguments.
+ * re.c: corrected documentation format (rb_reg_initialize_m)
-Tue Feb 1 15:12:26 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Feb 21 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * test/ruby/test_require.rb (TestRequire#test_require_with_unc):
- use ``127.0.0.1'' instead of ``localhost'' as host name, because
- XP or earlier cannot resolv it as NBT hostname.
+ * ext/zlib/zlib.c: documented, but needs more effort.
-Tue Feb 1 13:20:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sat Feb 21 11:12:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/benchmark/test_benchmark.rb (#capture_bench_output):
- Added explicit sleep. Windows have imprecise time support.
- Thus Tms.new.Add!{} may be or may be not equal 0. The
- test failure started since r30747.
+ * missing/os2.c, missing/x68.c: typo fix. pointed out by greentea.
-Tue Feb 1 11:03:47 2011 Ryan Davis <ryan@lust.local>
+Fri Feb 20 18:59:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/rubygems*: Import rubygems 1.5.0 (released version @ 1fb59d0)
- * test/rubygems: Ditto
+ * lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
+ irb. [ruby-dev:39243]
-Tue Feb 1 08:01:39 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
- * ext/io/console/console.c (console_set_winsize): new method to set
- console size. [EXPERIMENTAL]
+ * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
+ Support visibility modifiers for attributes
- * ext/io/console/console.c (console_winsize): use GetWriteFD.
+Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
-Tue Feb 1 02:28:14 2011 Masaya Tarui <tarui@ruby-lnag.org>
+ * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
+ Support visibility modifiers for attributes
- * include/ruby/win32.h, win32/win32.c: add rb_w32_inet_ntop.
- inet_ntop's minimum supported client is Vista.
+Thu Feb 19 22:39:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Feb 1 00:10:30 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
+ DRb.start_service could handle this.
- * lib/benchmark.rb: fix benchmark to work with current ruby.
- patched by Benoit Daloze [ruby-core:33846] [ruby-dev:43143]
- merged from https://github.com/eregon/ruby/commits/benchmark
+Thu Feb 19 22:19:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * lib/benchmark (Report#width): update documentation
- * lib/benchmark: document the return value of #benchmark and the
- :list attribute in Report
- * lib/benchmark (Tms#format): rename variables, use String#%
- instead of Kernel.format
- * lib/benchmark: remove undocumented Benchmark::times (an alias
- of Process::times used twice)
- * lib/benchmark (#benchmark): use label_width for the caption
- * lib/benchmark (Tms#initialize): rename variables
- * lib/benchmark: allow title to not be a String and call #to_s
- * lib/benchmark (Benchmark#bm): return an Array of the times with
- the labels
- * lib/benchmark: correct output for Benchmark#bmbm
- (remove the extra space)
- * lib/benchmark: add a few tests for Benchmark::Tms output
- * lib/benchmark: improve style (enumerators, ljust, unused vars)
- * lib/benchmark: add spec about output and return value
- * lib/benchmark: improve basic style and consistency
- no parenthesis for print and use interpolation instead of printf
- * lib/benchmark: remove unnecessary conversions and variables
- * lib/benchmark: correct indentation
- * lib/benchmark: rename the FMTSTR constant and variable to FORMAT
- * lib/benchmark: remove useless exception
+ * lib/ostruct.rb: documented
- * test/benchmark: remove unused variable warnings
+Thu Feb 19 21:28:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Mon Jan 31 23:27:23 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/strscan/strscan.c: improved documentation
- * node.c (add_id): remove duplicated rb_id2str() call.
+Thu Feb 19 03:10:52 2004 Minero Aoki <aamine@loveruby.net>
-Sun Jan 30 17:19:46 2011 Tanaka Akira <akr@fsij.org>
+ * ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
- * missing/langinfo.c: parenthesize macro arguments.
+Thu Feb 19 02:30:34 2004 Minero Aoki <aamine@loveruby.net>
-Mon Jan 31 21:57:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/strscan/strscan.c: documentation checked.
- * configure.in: revert r30698.
+Thu Feb 19 00:11:05 2004 Dave Thomas <dave@pragprog.com>
-Mon Jan 31 21:32:44 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
+ Strip extraneous space from filenames in :include:
- * thread.c (thread_start_func_2): check deadlock condition before
- release thread stack. fix memory violation when deadlock detected.
- reported by Max Aller. [Bug #4009] [ruby-core:32982]
+Wed Feb 18 22:52:00 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Mon Jan 31 14:45:47 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
- * lib/irb/locale.rb (IRB::Locale::#search_file):
- Gem might be undefined if --disable-gems. [ruby-core:34990]
+Wed Feb 18 22:47:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Mon Jan 31 12:26:14 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/strscan/strscan.c: documented
- * addr2line.c: suppressed shorten-64-to-32 warnings.
- * regcomp.c: ditto.
- * regexec.c: ditto.
- * regint.h: ditto.
- * regparse.c: ditto.
- * regparse.h: ditto.
- * time.c: ditto.
- * variable.c: ditto.
+Wed Feb 18 22:03:11 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Mon Jan 31 04:45:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/*: should not depend on $KCODE.
- * array.c (rb_ary_uniq_bang): call ARY_SET_LEN(ary, 0) before
- ary_resize_capa because ary_resize_capa expects resized length is
- smaller than current array length. call rb_ary_unshare before
- ary_resize_capa because ary_resize_capa lost the reference to
- original shared array. [ruby-core:34997]
+Wed Feb 18 17:18:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Sun Jan 30 17:19:46 2011 Tanaka Akira <akr@fsij.org>
+ * ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
- * missing/crypt.c: parenthesize macro arguments.
+Wed Feb 18 10:40:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Jan 30 16:40:27 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * sprintf.c (rb_f_sprintf): do not prepend dots for negative
+ numbers if FZERO is specified. [ruby-list:39218]
- * test/rubygems/test_gem_security.rb (TestGemSecurity): valid only
- if OpenSSL is available.
+Tue Feb 17 23:40:34 2004 Guy Decoux <ts@moulon.inra.fr>
- * test/dl/test_dl2.rb (TestDL#test_sin): math functions do not
- work on x86_64 due to the design of DL2.
+ * sprintf.c (rb_f_sprintf): preserve original val for
+ format_integer. [ruby-talk:92975]
- * test/dl/test_func.rb (DL::TestFunc#test_{sinf,sin): ditto.
+Tue Feb 17 23:28:45 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sun Jan 30 16:09:22 2011 Tanaka Akira <akr@fsij.org>
+ * test/ruby/marshaltestlib.rb: common marshal testcase added.
- * strftime.c (rb_strftime_with_timespec): %G produces 4 digits.
+ * test/ruby/test_marshal.rb: use above testsuite.
-Sun Jan 30 15:13:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/soap/marshal/test_marshal.rb: ditto.
- * enc/emacs_mule.c (emacsmule_islead): 7bit range is also leading
- byte.
+ * test/soap/marshal/cmarshal.rb: removed (not used).
-Sun Jan 30 13:03:16 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Feb 17 10:51:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
- * hash.c (rb_hash_fetch_m): use useful message for longer key, not a
- nonsense id value.
+ * ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
- * string.c (rb_str_ellipsize): new function to ellipsize a string.
+Tue Feb 17 01:35:28 2004 Tanaka Akira <akr@m17n.org>
- * include/ruby/encoding.h (rb_enc_step_back): new function to step
- back n characters.
+ * eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
+ to NODE_LIT. [ruby-dev:22920]
-Sun Jan 30 12:53:38 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Feb 17 01:24:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * enc/emacs_mule.c (emacsmule_islead): fix inverse condition.
+ * bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
+ STACK_GROW_DIRECTION. [ruby-dev:22910]
-Sun Jan 30 09:37:25 2011 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+ * bcc32/Makefile.sub (config.h): add newer checks.
- * io.c (struct argf): char behaves like an unsigned char
- by default on AIX.
+ * wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
-Sun Jan 30 08:02:55 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Feb 17 00:38:10 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * configure.in: Mac OS X wrongly reports it has fdatasync(3).
+ * lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
-Sun Jan 30 03:29:47 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Feb 17 00:18:03 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/openssl/ossl_bn.c (GetBNPtr): add missing nil case.
- patched by Martin Bosslet. [ruby-core:34987]
+ * test/rinda/test_rinda.rb: import test_rinda.rb
-Sun Jan 30 01:02:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Feb 17 00:14:30 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * include/ruby/ruby.h: Added NUM2MODET() and MODET2NUM() default
- definition.
- Because r30686 introduced win32 build failure.
+ * bcc32/Makefile.sub: avoid warning "Redefinition of macro
+ 'HAVE_GETLOGIN'".
-Sat Jan 29 22:16:26 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * vms/config.h_in: ditto.
- * array.c (rb_ary_join): [].join.encoding must be US-ASCII.
- [ruby-list:47790]
+Mon Feb 16 23:28:14 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Jan 29 20:22:39 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/csv.rb: document reduction. [ruby-core:02429]
- * benchmark/driver.rb (BenchmarkDriver#measure): Show command line
- when abnormal exiting occur.
+Mon Feb 16 22:08:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Sat Jan 29 10:53:16 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * lib/generator.rb: corrected doc format
+ * lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
+ * lib/rinda/tuplespace.rb: ditto
- * vm_insnhelper.c (vm_get_ev_const): no-scope reference to toplevel
- private constant has been prohibited incorrectly.
+Mon Feb 16 20:41:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
- * test/ruby/test_module.rb (test_toplevel_private_constant): add a
- test for above.
+ * bcc32/Makefile.sub: show more warnings. (refering to mingw)
-Sat Jan 29 08:43:23 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * bcc32/setup.mak: ditto.
- * lib/rubygems*: Import rubygems 1.5.0 (release candidate @ 09893d9)
- * test/rubygems: Ditto
+Mon Feb 16 13:39:44 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Jan 29 02:02:37 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * dir.c (rb_glob, rb_globi): add const.
- * variable.c (rb_mod_const_of, sv_i): Module#constant should exclude
- private constants. see [ruby-core:32912].
+ * ruby.h: ditto.
- * test/ruby/test_module.rb (test_constants_with_private_constant): add
- a test for above.
+Mon Feb 16 02:16:33 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Sat Jan 29 01:36:41 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * bcc32/Makefile.sub: should warn suspicious pointer conversion.
- * variable.c (rb_const_set): const_set should preserve constant
- visibility. see [ruby-core:32912].
+ * bcc32/setup.mak: ditto.
- * test/ruby/test_module.rb: add a test for above.
+Sun Feb 15 19:06:42 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Sat Jan 29 01:24:57 2011 Yusuke Endoh <mame@tsg.ne.jp>
+ * lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
+ RequestExpiredError if not found.
- * compile.c (NODE_CLASS, NODE_MODULE), insns.def (defineclass): raise
- an exception when "class Foo::Bar" is evaluated and Foo::Bar is
- private. To implement this, define_type of "defineclass" is added
- so that the instruction can distinguish whether the class definition
- is scoped (class Foo::Bar) or not (class Bar).
+Sun Feb 15 15:56:46 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * test/ruby/test_class.rb (test_redefine_private_class),
- test/ruby/test_module.rb
- (test_define_module_under_private_constant): add tests for above.
+ * ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
+ Thanks, arton.
-Sat Jan 29 01:19:17 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Sun Feb 15 01:46:05 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * constant.h, variable.c: to ensure compatibility, rb_const_get_* must
- not raise an exception even when the constant is private. Instead,
- rb_public_const_get_* and rb_public_const_defined_* are introduced,
- which raise an exception when the referring constant is private.
- see [ruby-core:32912].
+ * lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
+ [ruby-dev:22870]
- * vm_insnhelper.c (vm_get_ev_const): use rb_public_const_get_* instead
- of rb_const_get_* to follow the constant visibility when user code
- refers a constant.
+Sat Feb 14 11:29:41 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * test/ruby/test_marshal.rb (test_marshal_private_class): add a test.
- This test had failed because of incompatibility of rb_const_get.
+ * sample/drb/*: import lib/drb/sample
-Sat Jan 29 00:30:44 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Sat Feb 14 11:08:23 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * variable.c (set_const_visibility): fix typo. a patch from Tomoyuki
- Chikanaga in [ruby-core:32919].
+ * lib/drb/drb.rb: add pretty_print, thanks gotoken.
-Fri Jan 28 23:20:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Feb 13 12:35:08 2004 Minero Aoki <aamine@loveruby.net>
- * test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create,
- TestGDBM2#test_writer_open_notexist): We only need to skip libgdbm
- 1.8.0, not all 1.8.x. 1.8.1 or later don't have GDBM_WRITER sickness.
+ * test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
+ EACCES on Windows.
-Fri Jan 28 21:56:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Feb 12 21:45:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * ext/dbm/extconf.rb: Added new header places for Fedora13.
+ * lib/ftools.rb: documented
-Fri Jan 28 21:49:30 2011 Tanaka Akira <akr@fsij.org>
+Thu Feb 12 21:25:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
- * ext/zlib/zlib.c: parenthesize macro arguments.
+ * lib/base64.rb: backported from HEAD (modularised and documented)
-Fri Jan 28 17:47:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Feb 12 20:31:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/gdbm/test_gdbm.rb (TestGDBM2#test_writer_open_notexist):
- gdbm 1.8.x changed GDBM::WRITER behavior. Thus our testcase need
- to be changed too.
+ * lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
+ directives in DOS line-ending files at all.
-Fri Jan 28 17:33:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Feb 12 02:23:56 2004 Tanaka Akira <akr@m17n.org>
- * test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create): skip
- the test if gdbm version is 1.8.x.
+ * lib/pathname.rb: use assert_raise instead of assert_raises.
-Fri Jan 28 16:30:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/pp.rb: ditto.
- * test/ruby/test_require.rb (TestRequire#test_require_too_long_filename):
- Added -w option because too long path error don't output a message
- by default since r30660. [Bug #4336] [ruby-dev:43134]
+ * lib/time.rb: ditto.
-Fri Jan 28 16:19:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/tsort.rb: ditto.
+ use TSortHash and TSortArray instead of Hash and Array in test.
- * test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2}):
- Added -w option because too long path error don't output a message
- by default since r30660. [Bug #4336] [ruby-dev:43134]
+Wed Feb 11 20:01:12 2004 akira yamada <akira@ruby-lang.org>
-Fri Jan 28 16:04:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
+ File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
- * test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2,3}):
- split from test_require_path_home.
+ * test/ruby/test_proc.rb (TestProc::test_eq): added a
+ test. [ruby-dev:22599]
-Fri Jan 28 13:04:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/ruby/test_proc.rb (TestProc::test_eq): added tests for
+ Proc#==. [ruby-dev:22592], [ruby-dev:22601]
- * configure.in (--with-valgrind): Fixed r29683. Now this option
- is really default on.
+Tue Feb 10 16:43:56 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jan 28 12:05:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (umethod_bind): purge unused check. [ruby-dev:22850]
- * configure.in: Add #include<sys/stat.h> when struct stat is
- tested. Otherwise, incomplete type dereference error will occur.
+Mon Feb 9 17:16:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Fri Jan 28 11:53:19 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
- * configure.in: redundant variable names made strange conftest
- error. Fixed it.
+Mon Feb 9 13:00:55 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-Fri Jan 28 11:47:00 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
+ [ruby-dev:22815]
- * test/ruby/test_process.rb (TestProcess#test_too_long_path{,2}):
- should handle Errno::E2BIG, because this test checks crash of ruby,
- not the error type system.
+ * dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
+ [ruby-dev:22819]
-Fri Jan 28 11:23:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Sun Feb 8 16:46:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_io_open): Use NUM2MODET() instead NUM2UINT().
- * io.c (rb_scan_open_args): ditto.
+ * lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
+ sign for higher heap areas.
-Fri Jan 28 10:58:20 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Feb 6 22:48:16 2004 Dave Thomas <dave@pragprog.com>
- * configure.in: Added mode_t type checking.
- * process.c (rb_exec_arg_addopt): Use NUM2MODET() instead
- NUM2LONG because clang makes compile error by this narrowing
- conversion.
- * process.c (rb_run_exec_options_err): ditto.
+ * lib/rdoc/generators/html_generator.rb (gen_url): Support
+ https in RDoc hyperlinks
-Fri Jan 28 02:37:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Feb 6 22:41:22 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * re.c (rb_reg_raise): add GC guard to prevent intermediate
- variable from GC.
+ * lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
+ commit. [ruby-dev:22813]
-Fri Jan 28 02:35:41 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Feb 6 22:22:50 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * hash.c (rb_hash_fetch_m): add GC guard to prevent intermediate
- variable from GC.
+ * lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
+ variable which is defined in the test.
-Fri Jan 28 01:33:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Fri Feb 6 00:48:37 2004 Tanaka Akira <akr@m17n.org>
- * test/ruby/test_process.rb (TestProcess#test_too_long_path)
- TestProcess#test_too_long_path): Reduced string size from 100MB
- to 10MB. 100MB may cause no memory error. It isn't intended.
+ * lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
-Fri Jan 28 01:27:42 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Feb 5 23:56:55 2004 Tanaka Akira <akr@m17n.org>
- * test/ruby/test_process.rb (TestProcess#test_too_long_path2):
- Factored out from test_too_long_path. A test should only do
- one test.
+ * lib/prettyprint.rb (PrettyPrint#seplist): added.
-Thu Jan 27 23:29:36 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/pp.rb (PPMethods#pp_object): use seplist.
+ (PPMethods#pp_hash): ditto.
+ (Array#pretty_print): ditto.
+ (Struct#pretty_print): ditto.
+ (MatchData#pretty_print): ditto.
- * st.c (st_foreach): check if unpacked.
+ * lib/set.rb (Set#pretty_print): use seplist.
-Thu Jan 27 23:14:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Feb 4 02:12:06 2004 Tanaka Akira <akr@m17n.org>
- * misc/ruby-mode.el (ruby-mode-map): remove deprecated binding.
- use M-; instead.
+ * file.c (test_l): fix wrong method name in document.
+ (test_S): ditto.
+ (test_b): ditto.
+ (test_c): ditto.
+ (test_suid): ditto.
+ (test_sgid): ditto.
+ (test_sticky): ditto.
-Thu Jan 27 21:58:32 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Feb 3 08:04:57 2004 Tanaka Akira <akr@m17n.org>
- * bignum.c (rb_str_to_inum): get rid of too huge alloca().
+ * lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
-Thu Jan 27 21:43:29 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Feb 2 19:33:49 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * object.c (rb_str_to_dbl): rewrite again. use ALLOCV instead
- rb_str_tmp_new().
+ * configure.in: backport from 1.9 for Interix.
-Thu Jan 27 21:41:47 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * dln.c (dln_load): ditto.
- * win32/win32.c: get rid of STRNDUPA(). It's dangerous API.
+Mon Feb 2 13:31:51 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Jan 27 21:31:57 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/net/http.rb (canonical_each): fix merge miss.
- * win32/win32.c (rb_w32_aspawn): get rid of too huge alloca().
- [Bug #4330] [ruby-core:34898]
+Mon Feb 2 01:54:00 2004 Tanaka Akira <akr@m17n.org>
-Thu Jan 27 20:30:18 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/pp.rb (Struct#pretty_print): make it 1.8 style.
+ (Numeric#pretty_print, FalseClass#pretty_print)
+ (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
+ with instance variables. [ruby-talk:91157]
- * win32/win32.c (rb_w32_spawn): get rid of too huge alloca().
+ * lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
+ address.
-Thu Jan 27 18:49:53 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/resolv-replace.rb (BasicSocket#send): don't replace because
+ it has no hostname argument.
+ (IPSocket.getaddress): raise SocketError instead of
+ Resolv::ResolvError for errors.
+ (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
+ (SOCKSSocket#initialize): use IPSocket.getaddress instead of
+ Resolv.getaddress.
+ (UDPSocket#send): recognize 3 arguments form. try all addresses on
+ 4 arguments form.
- * win32/win32.c (open_dir_handle): get rid of too huge alloca().
+Sun Feb 1 18:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Thu Jan 27 18:34:58 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/net/http.rb: merged coding style changes from HEAD.
- * file.c (w32_io_info): get rid of too huge alloca().
- [Bug #4313] [ruby-core:34830]
+Sun Feb 1 16:15:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-Thu Jan 27 18:19:51 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/test/unit.rb: rearranged documentation for RDoc's sake.
+ * lib/matrix.rb: improved documentation.
+ * lib/net/http.rb: slight documentation formatting improvement.
- * win32/win32.c (wstati64): get rid of too huge alloca().
- [Bug #4316] [ruby-core:34834]
+Sun Feb 1 05:30:06 2004 Tanaka Akira <akr@m17n.org>
-Thu Jan 27 15:11:52 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
+ raise an errror on non-http proxy URI.
+ (OpenURI::Buffer#<<): make a tempfile binmode. [ruby-talk:90793]
- * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): get rid of too huge
- alloca(). this is the real fix of [ruby-core:34833].
+Sat Jan 31 09:20:32 2004 NAKAMURA, Hiroshi <nakahiro@sairon.co.jp>
-Thu Jan 27 12:46:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * sample/openssl/gen_csr.rb: wrong usage string.
- * process.c (ALLOC_ARGV_WITH_STR): fix void pointer arithmetic.
+Sat Jan 31 01:00:32 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Jan 27 08:41:40 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
+ "parts" attribute of soap:body element in WSDL.
- * process.c (proc_exec_v, rb_proc_exec_n, rb_proc_exec)
- (proc_spawn_n, proc_spawn): get rid of too huge alloca().
- [ruby-core:34827], [ruby-core:34833]
+ * lib/wsdl/xmlSchema/schema.rb: friendly warning message for
+ simpleType element which is not supported for now.
-Thu Jan 27 08:32:17 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/mapping/factory.rb: deleted unused methods.
- * include/ruby/ruby.h (ALLOCV): new API for exception-safe
- temporary buffer. [ruby-core:34844]
+ * lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
+ string <-> Ruby class name matching.
- * string.c (rb_alloc_tmp_buffer, rb_free_tmp_buffer):
- implementation of the API.
+ * test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
+ files.
-Thu Jan 27 08:22:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jan 29 23:56:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * dln_find.c (dln_find_1): use rb_warning and return immediately
- if fname is longer than buffer.
+ * util.c (mblen): fix overrun. [ruby-dev:22672]
-Wed Jan 26 22:57:30 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+Thu Jan 29 22:41:53 2004 Dave Thomas <dave@pragprog.com>
- * class.c (clone_method): add GC guard to prevent intermediate
- variable from GC. [Bug #4321] [ruby-dev:43107]
+ * lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
+ THis means you can write "see f1[link:files/f1_rb.html]".
-Wed Jan 26 22:45:16 2011 Tanaka Akira <akr@fsij.org>
+Thu Jan 29 15:33:23 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * template/id.h.tmpl: parenthesize macro arguments.
+ * ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
+ second argument. it expected to be a Hash not an Integer.
-Wed Jan 26 22:28:49 2011 CHIKANAGA Tomoyuki <nagachika00@gmail.com>
+ * ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
+ function for OpenSSL::X509::Name#add_entry.
- * vm_eval.c (rb_throw_obj): add GC guard to prevent intermediate
- variable from GC. [Bug #4322] [ruby-dev:43108]
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
+ tag number to each element of return value.
-Wed Jan 26 17:08:59 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
+ OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): OpenSSL::ASN1.decode
- should reject indefinite length primitive encodings as that is
- illegal. Patch by Martin Bosslet. See #4324.
+ * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
+ second argument takes OBJECT_TYPE_TEMPLATE by default.
-Wed Jan 26 10:36:28 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
- * string.c (=~): documentation fix; the return value is nil when
- it doesn't match. patched by Andrei Kulakov [ruby-core:34562]
+Wed Jan 28 04:29:41 2004 Eric Schwartz <emschwar@fc.hp.com>
-Tue Jan 25 08:41:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/cgi/session.rb: use LOCK_SH to read, and a few other
+ improvements. [ruby-core:02328]
- * dln_find.c (dln_find_1): omit too long pathnames.
+Tue Jan 27 11:09:29 2004 FUKUMOTO Atsushi <fukumoto@nospam.imasy.or.jp>
-Tue Jan 25 08:28:19 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (s_recvfrom): sending length should be an
+ invariant while retrying on EAGAIN. [ruby-talk:89962]
- * string.c (rb_str_resize): get rid of out-of-bound access.
+Tue Jan 27 10:35:18 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Jan 25 07:48:22 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/win32ole/win32ole.c (set_argv): fix condition.
- * test/ruby/test_thread.rb: remove unused variables.
+Tue Jan 27 02:26:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue Jan 25 07:45:44 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
+ refine regex for header-name.
- * test/ruby/test_thread.rb (TestThread#test_condvar_nolock_2): get
- rid of method redefined.
+Tue Jan 27 00:30:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Jan 25 07:00:52 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/Makefile.sub: rollback.
- * string.c (rb_string_value_cstr): rb_str_modify can change
- RSTRING_PTR.
+Mon Jan 26 22:53:04 2004 Dave Thomas <dave@pragprog.com>
-Tue Jan 25 03:24:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * io.c: Remove documentation references to $defout.
- * test/ruby/test_thread.rb: Added various ConditionVariable tests.
+Mon Jan 26 15:11:47 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Jan 24 22:26:33 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * sample/exyacc.rb: escape '}' to avoid warning.
- * object.c (rb_str_to_dbl): Fix again. use rb_str_tmp_new()
- instead ALLOC_N.
+Mon Jan 26 14:41:46 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Jan 24 21:50:48 2011 Tanaka Akira <akr@fsij.org>
+ * lib/delegate.rb (Delegator::initialize): preserve
+ singleton_method_added method [ruby-dev:22685]
- * vm_insnhelper.h: parenthesize macro arguments.
+ * lib/delegate.rb (Delegator::initialize): use Kernel::raise
+ instead of mere raise. [ruby-dev:22681]
-Mon Jan 24 21:28:34 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Jan 26 12:47:17 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * object.c (rb_str_to_dbl): use ALLOC_N instead ALLOCA_N because
- ALLOC_N may cause stack overflow.
+ * ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
-Mon Jan 24 21:04:45 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jan 26 11:35:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * error.c (rb_invalid_str): prevent intermediate variable from GC.
- [ruby-core:34820]
+ * ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
+ (ruby-bugs:PR#1256)
-Sun Jan 23 23:01:54 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/win32ole/win32ole.c (set_argv): set real arguments to
+ WIN32OLE::ARGV. [ruby-list:39073]
- * test/io/console/test_io_console.rb: Don't run test if the system
- don't support io/console.
+Thu Jan 22 22:54:53 2004 Shugo Maeda <shugo@ruby-lang.org>
-Sun Jan 23 22:17:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
+ strings for Novell GroupWise Internet Agent.
+ * lib/net/imap.rb (DATA_REGEXP): ditto.
- * test/fiddle/test_fiddle.rb: Don't run test if the system don't support
- fiddle.
+Thu Jan 22 16:21:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/fiddle/test_function.rb: ditto.
- * test/fiddle/test_closure.rb: ditto.
+ * parse.y (string_content): reset lexical states at the beginning of
+ string contents. [ruby-list:39061]
-Sun Jan 23 11:39:18 2011 Tanaka Akira <akr@fsij.org>
+Wed Jan 21 21:55:51 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * vm_exec.h: parenthesize macro arguments.
+ * lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
+ * lib/drb/extserv.rb: typo
-Sun Jan 23 10:33:02 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jan 21 17:57:56 2004 Shugo Maeda <shugo@ruby-lang.org>
- * template/fake.rb.in (ruby): suppress warnings.
+ * lib/net/imap.rb (envelope): allow NIL.
+ * lib/net/imap.rb (body): ditto.
+ * lib/net/imap.rb (number): ditto.
+ * lib/net/imap.rb (ensure_nz_number): show a detailed error
+ message.
-Sun Jan 23 08:00:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jan 21 16:44:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (str_nth_len, str_utf8_nth): return the rest length together.
+ * lib/mkmf.rb (merge_libs): squeeze successive same libraries.
+ [ruby-dev:22652]
- * string.c (rb_str_substr): get rid of measure the length always
- to improve performance for huge string. [ruby-core:34648]
+Wed Jan 21 16:01:37 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Jan 23 00:40:10 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/digest/rmd160/extconf.rb: have_library appends found library.
- * test/test_syslog.rb: Fix to make a lot of test failure if
- the platform doesn't support syslog.
+Wed Jan 21 11:36:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jan 22 11:49:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * parse.y (block_append): update nd_end for "real" head node.
+ [ruby-list:39058]
- * ext/psych/lib/psych/visitors/to_ruby.rb: fixing merge key support
- when multiple merge keys are specified.
+Tue Jan 20 14:48:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/psych/test_merge_keys.rb: tests for multi-merge key support
+ * ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
+ of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
-Sat Jan 22 11:33:04 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Tue Jan 20 14:43:17 2004 Dave Thomas <dave@pragprog.com>
- * ext/psych/lib/psych/visitors/to_ruby.rb: merge keys are actually
- part of YAML 1.1, so they should be supported. Remove warning and
- merge keys to parent. [ruby-core:34679]
+ * lib/base64.rb: Add RDoc
- * test/psych/test_merge_keys.rb: test for merge keys
+Tue Jan 20 14:25:51 2004 Dave Thomas <dave@pragprog.com>
-Sat Jan 22 10:25:19 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/abbrev.rb: Add RDoc
- * ext/psych/parser.c (parse): add the file name to the exception when
- parse errors occur.
+Tue Jan 20 13:22:39 2004 Dave Thomas <dave@pragprog.com>
- * test/psych/test_parser.rb: test for parse error file name
+ * lib/rdoc/generators/html_generator.rb: Document aliases at
+ top-most level.
-Sat Jan 22 10:12:30 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/English.rb: Document English.rb.
- * ext/psych/parser.c (parse): fix assertion error when reusing a
- parser after an exception has been raised
+Tue Jan 20 02:49:22 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/psych/test_parser.rb: test for assertion error
+ * ext/openssl/extconf.rb: add check for OpenSSL version.
+ [ruby-list:39054]
-Sat Jan 22 04:09:22 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Tue Jan 20 02:38:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych/nodes/node.rb: Make Psych::Nodes::Node
- enumerable.
+ * marshal.c (w_class): should not dump singleton class.
+ [ruby-dev:22631]
- * ext/psych/lib/psych/visitors/depth_first.rb: Add a depth-first
- visitor to enumerate over a YAML AST in a depth-first fashion
+Tue Jan 20 01:31:36 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/psych/nodes/test_enumerable.rb: test for enumerating nodes
+ * io.c (lineno): typo fix(FIX2INT -> INT2FIX).
- * test/psych/visitors/test_depth_first.rb: test for depth-first
- visitor
+Mon Jan 19 21:53:38 2004 akira yamada <akira@ruby-lang.org>
-Sat Jan 22 00:53:42 2011 Tanaka Akira <akr@fsij.org>
+ * io.c, re.c, string.c, time.c: fixed up positions of RDocs.
- * vm_core.h: parenthesize macro arguments.
+Mon Jan 19 07:09:20 2004 Tadayoshi Funaba <tadf@dotrb.org>
-Fri Jan 21 18:15:09 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/date.rb: zone was wrong when it was behind UTC.
+ Thanks Mark J. Reed.
- * configure.in: should not use -Werror=* flags while conftests.
+ * lib/date/format.rb: %z is now always replaced by four digits
+ with a leading plus or minus sign.
-Fri Jan 21 09:17:00 2011 Luis Lavena <luislavena@gmail.com>
+ * sample/cal.rb: added a class, anyway.
- * configure.in: Fix incorrectly detected x86_64-w64-mingw32 due
- canonalization of target_os. Bug #3889 [ruby-core:32634]
+Sun Jan 18 20:47:35 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Jan 20 23:44:00 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ruby.c: use translate_char() on Cygwin.
- * configure.in: Fix rb_cv_va_args_macro was broken. We are using
- -Werror=implicit-function-declaration compile option. therefore
- we need a function declaration explicitly.
+Sun Jan 18 02:33:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Jan 20 23:58:02 2011 Tanaka Akira <akr@fsij.org>
+ * defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
- * node.h: parenthesize macro arguments.
+Sun Jan 18 00:23:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jan 20 23:25:28 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * marshal.c (class2path): check anonymous class/module before
+ checking referable, and allow singleton classes.
- * configure.in: Add '#include <stdlib.h>' to
- rb_cv_localtime_overflow test too. It's reported by Tomoyuki
- Chikanaga. Thanks.
+Fri Jan 16 14:33:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jan 20 16:11:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * marshal.c (class2path): get class path and check referable.
+ [ruby-dev:22588]
- * README.EXT, README.EXT.ja: You shouldn't choose ``conftest.c'' as a
- name of a source file.
+Fri Jan 16 09:52:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jan 20 12:15:44 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (proc_eq): Proc with empty body may not be equal.
+ [ruby-dev:22590]
- * configure.in: Add stdlib.h inclusion into rb_cv_negative_time_t
- test because it's required for exit(3). The patch is
- created by Tomoyuki Chikanaga. [Bug #4287] [ruby-dev:43060]
+Thu Jan 15 13:03:10 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jan 20 11:39:41 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * io.c (argf_read): do not append EOF. (ruby-bugs-ja:PR#585)
- * test/webrick/utils.rb (TestWEBrick::RubyBin): test CGI does not need
- to load rubygems. if it activated, ruby raises LoadError about
- rbconfig.rb.
+ * io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
+ weird behavior. [ruby-dev:22424]
-Thu Jan 20 09:19:42 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Wed Jan 14 13:31:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/psych/lib/psych/visitors/json_tree.rb: Fix JSON emit for
- DateTime and Time classes.
+ * ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
- * test/psych/test_json_tree.rb: test for JSON emit
+Tue Jan 13 18:54:28 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Jan 20 08:02:46 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/logger.rb(Logger#msg2str): no special treatment for the object
+ which responds to :to_str. commited at 2004-01-11T21:46:27 by
+ gsinclair.
- * ext/psych/lib/psych/coder.rb (represent_object): arbitrary objects
- may be passed to the Psych::Coder object.
+ * lib/logger.rb(LogDevice#initialize): remove type checking if the
+ given object is a String. Kernel.open handles it correctly.
+ commited at 2004-01-11T21:46:27 by gsinclair.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: support for visiting
- arbitrary objects set on the coder.
+ * test/logger/test_logger.rb: follow above change (ArgumentError ->
+ TypeError.) follow above commit.
- * test/psych/test_coder.rb: supporting test case.
+Tue Jan 13 14:27:13 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Thu Jan 20 06:03:17 2011 Tanaka Akira <akr@fsij.org>
+ * lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
+ moved run method which allows output level. [ruby-dev:22554]
- * method.h: parenthesize macro arguments.
+Tue Jan 13 04:29:52 2004 Dave Thomas <dave@pragprog.com>
-Wed Jan 19 13:16:05 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
+ Show fully-qualified class names in class list.
- * lib/rubygems/commands/sources_command.rb: Finish removing code,
- (fixes sources command test).
+Tue Jan 13 01:04:37 2004 Dave Thomas <dave@pragprog.com>
-Wed Jan 19 13:04:16 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
+ incorporating DESTDIR in the rdoc installation.
- * proc.c (proc_call): Add gc guard to avoid segfault. The fix
- is created by Tomoyuki Chikanaga. [Bug #4238][ruby-dev:42963]
+Mon Jan 12 23:27:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Jan 19 12:31:28 2011 Eric Hodel <drbrain@segment7.net>
+ * parse.y (primary): fix position after FCALL. [ruby-dev:22574]
- * lib/rubygems.rb: Since gem_prelude requires rubygems, enable
- custom_require always.
+Mon Jan 12 12:07:22 2004 Dave Thomas <dave@pragprog.com>
-Wed Jan 19 12:08:08 2011 Eric Hodel <drbrain@segment7.net>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
+ Someone changed the "// in eval.c" comments to "/*...*/" style,
+ so the parsing of the source file name broke.
- * lib/rubygems/commands/dependency_command.rb: Remove require of
- deleted file.
- * lib/rubygems/commands/fetch_command.rb: ditto
- * lib/rubygems/commands/setup_command.rb: ditto
- * lib/rubygems/commands/sources_command.rb: ditto
- * lib/rubygems/commands/specification_command.rb: ditto
+ * object.c: Remove spurious space in TrueClass documentation.
-Wed Jan 19 08:13:59 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
+ bad regexp: if the code before a documented method contained
+ a comment that wasn't terminated by whitespace, that comment
+ and all intervening code was included in the following
+ method's documentation.
- * lib/rubygems*: Import rubygems 1.5.0 (release candidate)
- * test/rubygems: Ditto
+ * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
+ HTML formats need explicit line breaks.
-Tue Jan 18 23:31:01 2011 Yusuke Endoh <mame@tsg.ne.jp>
+Mon Jan 12 11:46:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y: avoid NULL reference. [ruby-dev:43067]
+ * configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
+ quotes. [ruby-dev:22564]
-Wed Jan 19 02:54:04 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/mkmf.rb (libpathflag): do not enclose with quotes always.
- * vsnprintf.c (cvt): set first byte of buf to NUL for the case when
- no bytes are written to the buf. [ruby-dev:43062]
+ * {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
-Tue Jan 18 23:04:51 2011 Tanaka Akira <akr@fsij.org>
+Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
- * gc.h: parenthesize macro arguments.
+ * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
+ generation support to ri (Elliot Hughes)
-Tue Jan 18 18:31:14 2011 Keiju Ishitsuka <keiju@ishitsuka.com>
+Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
- * lib/irb/completion.rb: Irb tab completion support for XX::method
- forms.
+ * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
+ generation support to ri (Elliot Hughes)
-Tue Jan 18 15:05:55 2011 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
- * lib/logger.rb: added RDoc document for logging message escape
- by Hal Brodigan. See #3869
+ * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
+ Also accept command line options via the 'RI' environment variable.
-Tue Jan 18 07:53:52 2011 Tanaka Akira <akr@fsij.org>
+Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
- * eval_intern.h: parenthesize macro arguments.
+ * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
+ Also accept command line options via the 'RI' environment variable.
-Tue Jan 18 04:42:44 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+Sat Jan 10 21:27:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/psych/lib/psych/parser.rb (Mark): Adding a class to wrap
- marker information
+ * eval.c (eval): need to add message delimiter. [ruby-dev:22561]
- * ext/psych/parser.c (mark): Add a method to return the mark object
- for the parser
+Sat Jan 10 01:54:50 2004 Eric Sunshine <sunshine@sunshineco.com>
- * test/psych/test_parser.rb: tests for the Mark class.
+ * defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
+ S_IRWXO, etc. macros are defined since future code might require
+ them (even though present code only requires a subset).
-Tue Jan 18 02:46:55 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
+ correctly on Rhapsody when -arch compiler flag was used (via
+ configure's --enable-fat-binary option).
- * ext/psych/lib/psych/visitors/json_tree.rb (visit_String): JSON
- strings should be dumped with double quotes. [ruby-core:34186]
+Fri Jan 9 10:05:14 2004 Siena. <siena@faculty.chiba-u.jp>
- * test/psych/test_json_tree.rb: test for double quotes
+ * lib/mkmf.rb (libpathflag): use single quotes. [ruby-dev:22440]
-Mon Jan 17 23:36:33 2011 Tanaka Akira <akr@fsij.org>
+Thu Jan 8 23:49:21 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * array.c (rb_ary_times): less MEMCPY calls.
+ * configure.in (RDOCTARGET): new macro. if you want to install
+ rdoc documentation, you need to run configure with
+ --enable-install-doc.
-Mon Jan 17 22:54:33 2011 Tanaka Akira <akr@fsij.org>
+Thu Jan 8 21:29:43 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * debug.h: parenthesize macro arguments.
+ * ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
+ public key only.
-Mon Jan 17 21:40:25 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
+ OpenSSL::PKey::DH#to_der.
- * ruby.c (process_options): revert r30549.
+ * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
+ OpenSSL::PKey::DSA#to_der.
-Sun Jan 16 20:55:45 2011 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
+ OpenSSL::PKey::RSA#to_der.
- * vsnprintf.c: parenthesize macro arguments.
+Thu Jan 8 16:51:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Jan 15 11:57:30 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
+ dumps "E" at month-end.
- * configure.in (warnflags): add -Werror=implicit-function-declaration
- if available.
+Thu Jan 8 11:20:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
- * lib/mkmf.rb (init_mkmf): ignore warnings in mkmf tests.
+ * eval.c, object.c, process.c, re.c: don't use C++ style comments.
- * test/mkmf/base.rb (setup, teardown): restore config values.
+Thu Jan 8 04:36:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/mkmf/test_flags.rb: split from test_find_executable.rb.
+ * lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
+ @config[:Logger] if it was not given.
-Sat Jan 15 10:04:14 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * sample/webrick/*: new files.
- * ruby.c (process_options): autoload rubygems.
+ * MANIFEST: add sample/webrick/*
- * tool/compile_prelude.rb (Prelude#initialize): ignore empty
- preludes.
+Wed Jan 7 13:00:18 2004 Dave Thomas <dave@pragprog.com>
- * ruby.c (ruby_init_prelude): get rid of global namespace
- pollution.
+ * lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
+ being too eager to find matches of ambiguous method
+ names (such as "ri Thread.join" would return both
+ Thread.join and ThreadsWait.join)
-Sat Jan 15 09:42:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jan 7 12:35:41 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * include/ruby/io.h: missing prototypes.
+ * lib/debug.rb: revert command parse regexps. [ruby-list:39014] by
+ Shirai,Kaoru.
-Fri Jan 14 23:25:55 2011 Tanaka Akira <akr@fsij.org>
+Wed Jan 7 08:21:04 2004 Dave Thomas <dave@pragprog.com>
- * vm_method.c: parenthesize macro arguments.
+ * lib/rdoc/parsers/parserfactory.rb: Check for shebang
+ line in files that would otherwise be treated as
+ plain text.
-Fri Jan 14 15:32:29 2011 Shugo Maeda <shugo@ruby-lang.org>
+Tue Jan 6 22:13:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/net/imap/test_imap.rb: call neither logout nor disconnect
- unless connected. patch by Kazuhiro NISHIYAMA. [ruby-dev:42860]
+ * eval.c (rb_mod_modfunc): should break if m has no super class.
+ [ruby-dev:22498]
-Fri Jan 14 14:56:57 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jan 6 21:55:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/net/imap.rb: use bytesize for binary strings.
- patched by Yoshimasa Niwa. [ruby-core:34222]
+ * io.c (fptr_finalize): should save errno just after failure.
+ [ruby-dev:22492]
-Fri Jan 14 14:01:12 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jan 6 14:53:14 2004 Dave Thomas <dave@pragprog.com>
- * pack.c (pack_unpack): the resulted string of unpack('M') must have
- ASCII-8BIT encoding (and ENC_CODERANGE_VALID). [ruby-core:34482]
+ * bin/ri: split out the display side, making it pluggable. Added
+ new ri_driver and ri_display files in lib/rdoc/ri.
-Fri Jan 14 13:38:58 2011 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jan 6 06:37:53 2004 Dave Thomas <dave@pragprog.com>
- * ext/zlib/zlib.c (gzfile_check_footer): ISIZE (Input SIZE) in
- gzip's header is the size of uncompressed input data modulo 2^32.
- [ruby-core:34481] http://www.ietf.org/rfc/rfc1952.txt
+ * bin/rdoc: Add --ri-system switch
-Fri Jan 14 11:36:25 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/.document: Update with list of files that seem to have
+ documentation
- * configure.in, win32/Makefile.sub (RUNRUBY): require path should
- include "." because rbconfig.rb is there.
+ * lib/test/unit.rb: Reorder comment to make it RDoc friendly.
-Fri Jan 14 10:40:11 2011 Ryan Davis <ryan@lust.local>
+ * Makefile.in: add install-nodoc target, and make it
+ generate RDoc on default install.
- * gem_prelude.rb: Just require rubygems. Fixes rubygems 1.4.
- * lib/rubygems.rb: removed all Gem::Quickloader code.
- * ruby.c: renamed ruby_init_gems to ruby_init_prelude. Set
- $disable_rubygems since there is no fine grained mechanism to
- skip parts of the prelude. Open to suggestions on how to do this
- better.
- * test/*.rb: Load path isn't set up correctly, so add
- --disable-gems as needed to failing tests that are explicitly
- testing stderr w/ ==.
+ * lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
+ --doc-dir option to ri.
-Fri Jan 14 07:30:47 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
- * io.c (argf_next_argv): go advance when the next file cannot be
- read. [ruby-core:34446]
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ fix parsing if there are braces in a method parameter list
-Thu Jan 13 20:49:19 2011 Tanaka Akira <akr@fsij.org>
+Fri Jan 2 14:54:11 2004 Dave Thomas <dave@pragprog.com>
- * vm_insnhelper.c: parenthesize macro arguments.
+ * bin/ri: Add new --classes option, and arrange for
+ help messages to be paged too.
-Thu Jan 13 13:21:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * bin/rdoc: Add statistics.
- * vm_dump.c: delete dashes to make lines 80 chars, Patched by
- Shota Fukumori (sora_h). [Bug #4275] [ruby-dev:43021]
+ * process.c: (MG) Added Process documentation
-Thu Jan 13 13:21:00 2011 Kenta Murata <mrkn@mrkn.jp>
+ * lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
+ Fix problem with labels not displaying in RI labeled
+ lists using BS and ANSI modes.
- * vm_dump.c: fix misspelling of CrashReporter, Patched by Shota
- Fukumori (sora_h). [Bug #4275] [ruby-dev:43021]
+Fri Jan 2 01:50:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jan 13 06:27:29 2011 Ryan Davis <ryand-ruby@zenspider.com>
+ * io.c (argf_eof): ARGF.eof? should not have any side effect.
+ [ruby-dev:22469]
- * error.c: Exception#to_s should actually call to_s.
+Wed Dec 31 17:25:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jan 13 00:32:54 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c (argf_each_byte): should return self. [ruby-dev:22465]
- * addr2line.c (get_nth_dirname): decrement the directory index
- because the index specifies the index of given included_directories
- which is separated by NUL and its index is begun from 1.
- Note that 0 specifies the current directory of the compilation.
- see also http://www.dwarfstd.org/doc/dwarf-2.0.0.pdf
+Wed Dec 31 11:20:34 2003 Dave Thomas <dave@pragprog.com>
-Thu Jan 13 00:06:38 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
+ file referenced in "// in sss.c" relative to current file.
- * io.c (rb_f_syscall): Add warning messages. [ruby-core:34062]
+Wed Dec 31 11:17:37 2003 Dave Thomas <dave@pragprog.com>
-Thu Jan 13 00:00:07 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/rdoc/generators/html_generator.rb: Fix problem when
+ a public method was aliased, but the alias is then
+ made private, and hence doesn't appear in RDoc output.
- * io.c (rb_f_syscall): Some syscall return unsigned or pointer value.
- Therefore we should only check the result is -1 or not.
- [ruby-core:34062]
+Wed Dec 31 01:33:05 2003 Dave Thomas <dave@pragprog.com>
-Wed Jan 12 23:55:48 2011 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
+ string.c, time.c: Add RDoc for Kernel functions, and tidy.
- * io.c (rb_f_syscall): Add 64bit Linux support. Some syscall takes
- long type arguments.
+Tue Dec 30 19:39:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jan 12 19:37:10 2011 Tanaka Akira <akr@fsij.org>
+ * io.c (rb_f_readline): should raise EOFError at the end of
+ files. [ruby-dev:22458]
- * vm_dump.c: parenthesize macro arguments.
+ * io.c (argf_read): should concatenate input files when length
+ argument is nil. [ruby-dev:22450]
-Wed Jan 12 19:28:23 2011 Tanaka Akira <akr@fsij.org>
+ * io.c (argf_read): should update supplied string buffer (2nd
+ argument) even when IO#read is called multiple times.
- * vm.c (thread_free): reset ruby_current_thread if it points the
- thread to free.
- * gc.c (slot_sweep): don't call RUBY_VM_SET_FINALIZER_INTERRUPT if
- there is no current thread.
- [ruby-dev:43000]
+ * io.c: should initialize lineno by zero. [ruby-dev:22460]
-Wed Jan 12 19:09:29 2011 Tanaka Akira <akr@fsij.org>
+Tue Dec 30 12:30:30 2003 Dave Thomas <dave@pragprog.com>
- * enum.c (sort_by_i): reenter check more strictly.
- (sort_by_cmp): ditto.
- [ruby-dev:43003] reported by Usaku NAKAMURA.
+ * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
+ class and a method have the same name, finding Xxx.abc was trying
+ to find 'abc' in method 'Xxx', not class 'Xxx'.
-Wed Jan 12 16:25:12 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * lib/net/http.rb (Net::HTTP#connect): makes it timeout during
- SSL handshake too. [ruby-core:34203]
- Patch by Marc Slemko.
+Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
- * test/net/http/test_http.rb (TestNetHTTP_v1_2#test_timeout_during_HTTP_session):
- test for [ruby-core:34203]
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
+ Handle undoing nesting of yield parameters correctly for:
- * test/net/http/test_https.rb (TestNetHTTPS#test_timeout_during_SSL_handshake):
- ditto.
+ def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
-Wed Jan 12 16:24:53 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
- * ext/readline/extconf.rb: new checks for RL_PROMPT_START_IGNORE
- and RL_PROMPT_END_IGNORE. [ruby-core:34331]
+Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
- * ext/readline/readline.c: enables USE_INSERT_IGNORE_ESCAPE only if
- RL_PROMPT_{START,END}_IGNORE are available to get rid of compilation
- error with libedit.
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
+ Handle undoing nesting of yield parameters correctly for:
-Wed Jan 12 15:53:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
- * README.EXT.ja (rb_ensure): typo.
+Mon Dec 29 12:51:02 2003 Dave Thomas <dave@pragprog.com>
-Wed Jan 12 11:33:46 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c: Add RDoc for Kernel global functions.
- * addr2line.c: OpenBSD uses the elf_abi.h header file instead of the
- elf.h header file. patched by Jeremy Evans [ruby-core:34384]
+Mon Dec 29 11:00:16 2003 Dave Thomas <dave@pragprog.com>
-Wed Jan 12 03:59:36 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * array.c: Tidy up RDoc loose ends.
- * test/webrick/test_cgi.rb: Removes usage of deprecated
- :RequestHandler option.
- patched by Peter Weldon [ruby-core:34010]
+Mon Dec 29 05:05:51 2003 Dave Thomas <dave@pragprog.com>
- * test/webrick/test_httpproxy.rb: ditto.
+ * struct.c, random: Add RDoc comments
- * test/webrick/test_httpserver.rb: Add a test of the deprecation
- behaviour.
+Mon Dec 29 02:20:54 2003 Dave Thomas <dave@pragprog.com>
-Wed Jan 12 08:37:07 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c: Add RDoc for class Proc, Method, UnboundMethod
- * hash.c (hash_i): return different values for inverse hash.
- [ruby-core:34334]
+Mon Dec 29 00:41:44 2003 Dave Thomas <dave@pragprog.com>
-Tue Jan 11 20:32:59 2011 Tanaka Akira <akr@fsij.org>
+ * math.c: Add RDoc comments
- * variable.c: parenthesize macro arguments.
+Sun Dec 28 20:19:11 2003 Tanaka Akira <akr@m17n.org>
-Tue Jan 11 13:06:38 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
+ raise EOFError.
- * array.c (rb_ary_resize): should care of embeded array when extending
- the array.
+ * ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
+ gzfile_read_all returns "".
- * array.c (rb_ary_resize): need to set capa when changing the real
- size of the array.
- these are latent bugs.
+Sun Dec 28 15:25:08 2003 Dave Thomas <dave@pragprog.com>
-Mon Jan 10 22:46:43 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
+ Object, Module, etc...
- * include/ruby/defines.h (CASEFOLD_FILESYSTEM): HFS+ is case
- insensitive.
+Sun Dec 28 11:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * load.c (loaded_feature_path, rb_feature_p, load_lock): on a
- case-insensitive filesystem, loaded features search should
- ignore case. [ruby-core:34297]
+ * test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
+ [ruby-talk:88852]
-Mon Jan 10 21:34:12 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/csv/{bom.csv,mac.csv}: removed.
- * common.mk (showflags): show LD commands.
+Sun Dec 28 08:56:51 2003 Dave Thomas <dave@pragprog.com>
-Mon Jan 10 14:32:55 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c: Thead[Group] RDoc (thanks to MG)
- * test/ruby/test_method.rb (TestMethod#test_define_method): method
- transplanting between class and module is impossible.
+Sun Dec 28 03:50:05 2003 Dave Thomas <dave@pragprog.com>
-Mon Jan 10 13:51:17 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
+ Escape method names used in regexp
- * misc/rdoc-mode.el (rdoc-mode): show trailing whitespace.
+Sun Dec 28 01:46:02 2003 Dave Thomas <dave@pragprog.com>
-Mon Jan 10 11:22:02 2011 Tanaka Akira <akr@fsij.org>
+ * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
+ Add support for rules in 'ri' output.
- * util.c: parenthesize macro arguments.
+Sun Dec 28 01:35:35 2003 Dave Thomas <dave@pragprog.com>
-Mon Jan 10 07:41:31 2011 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
+ Sometimes the Ruby source aliases two otherwise
+ unrelated methods (for example Kernel#object_id and
+ Kernel#hash are both the same C function). Provide a
+ facility to allow the methods to be documented
+ separately.
- * misc/README: mention rdoc-mode.el and ruby-style.el.
+Sun Dec 28 01:05:31 2003 Dave Thomas <dave@pragprog.com>
-Sun Jan 9 20:37:21 2011 Tanaka Akira <akr@fsij.org>
+ * marshal.c, signal.c: RDoc collemts added by Elliott Hughes
- * transcode.c: parenthesize macro arguments.
+Sun Dec 28 00:48:47 2003 Dave Thomas <dave@pragprog.com>
-Sun Jan 9 16:31:53 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
+ Some source files use lower case class or module names
+ when naming the Init_XXX function in C.
- * io.c (Kernel.#syscall): implemented on LP64/LLP64 environments too.
- also uses __syscall if available for *BSD on 64bit architecture.
- [ruby-core:34062]
+Sat Dec 27 23:41:46 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Sun Jan 9 16:31:34 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * configure.in: fix "test: too many arguments" error.
- * lib/irb/locale.rb (IRB::Locale::LOCALE_NAME_RE):
- some platform has a locale without territory but with
- encoding.
- (#each_sub_locale): ditto.
+Sat Dec 27 15:32:19 2003 Dave Thomas <dave@wireless_3.local.thomases.com>
-Sun Jan 9 14:47:50 2011 TAKAO Kouji <kouji@takao7.net>
+ * time.c: RDoc comments added
- * ext/readline/readline.c: apply a patch from Nobuyoshi Nakada.
- fixed #3616 [ruby-core:31484] IRB + readline incorrectly counts
- non-printing characters in prompt
+Sat Dec 27 15:07:57 2003 Dave Thomas <dave@pragprog.com>
-Sat Jan 8 21:47:26 2011 Tanaka Akira <akr@fsij.org>
+ * object.c: Add RDoc comments for Symbol class.
- * enum.c (enum_sort_by): use rb_ary_resize.
- (ary_cutoff): removed.
+Sat Dec 27 14:42:30 2003 Dave Thomas <dave@pragprog.com>
-Sat Jan 8 21:24:17 2011 Tanaka Akira <akr@fsij.org>
+ * numeric.c: Add RDoc comments.
- * pack.c (swapf): compilation condition simplified.
- (swapd): ditto.
+Sat Dec 27 00:44:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Jan 8 20:51:25 2011 Tanaka Akira <akr@fsij.org>
+ * io.c (next_argv): warn always for stdin on inplace edit mode.
- * pack.c (swapd): remove duplicated code.
+ * io.c (read_all): need to check string value.
-Sat Jan 8 19:28:55 2011 Tanaka Akira <akr@fsij.org>
+ * io.c (argf_read): allow ARGF.read(nil). [ruby-dev:22433]
- * thread.c: parenthesize macro arguments.
+Fri Dec 26 23:02:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Jan 7 23:07:40 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_f_backquote): need not to check nil result.
+ [ruby-core:02078]
- * lib/mkmf.rb (configuration): backref needs to capture.
+ * io.c (rb_io_getline): should return nil when read_all gives
+ empty string, even when nil rs is specified. [ruby-core:02077]
-Fri Jan 7 21:57:22 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 26 18:50:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * misc/ruby-mode.el (ruby-mode-variables), misc/ruby-style.el:
- show trailing whitespace.
+ * configure.in: check if getcontext and setcontext are available.
- * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): highlight
- regexp after open bracket. [ruby-core:34183]
+ * eval.c: use presence of getcontext/setcontext.
-Fri Jan 7 00:37:35 2011 Tanaka Akira <akr@fsij.org>
+Fri Dec 26 16:40:53 2003 Tanaka Akira <akr@m17n.org>
- * string.c: parenthesize macro arguments.
+ * lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
-Thu Jan 6 22:42:02 2011 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Dec 26 09:26:58 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * bignum.c (bigmul1_karatsuba): avoid overflow that make assertion
- fail in certain case. this patch is contributed from Ray Chason
- <chasonr at gmail.com> in personal communication.
+ * pack.c (pack_pack): add sign check for 'i', and 'l'.
+ [ruby-dev:22427]
-Thu Jan 6 20:55:49 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * bignum.c (rb_quad_pack): add range check for 'quad int'.
- * lib/mkmf.rb (create_makefile): ignore rest from first dot from
- TARGET to generate init function name.
- this is followup of r30464.
+Thu Dec 25 22:39:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Jan 6 11:27:01 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * string.c (rb_str_update): don't return any value.
- * ext/psych/lib/psych/json/tree_builder.rb (start_mapping): tags
- should not be included in JSON mapping
+Thu Dec 25 15:30:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jan 6 09:23:33 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * string.c (rb_str_update): call rb_str_modify().
- * lib/net/protocol.rb (eof?): BufferedIO should proxy eof? to the
- underlying IO object.
+Thu Dec 25 05:08:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jan 6 09:12:31 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * eval.c (search_required): search actual file name once when no
+ extension specified.
- * lib/mkmf.rb (configuration): fixing gsub when multiple error flags
- are passed to GCC.
+Thu Dec 25 04:00:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jan 6 05:25:49 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * stable version 1.8.1 released.
- * array.c (rb_ary_modify): export.
+Thu Dec 25 00:17:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Jan 6 05:14:41 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: check for nanosleep, -lrt if required.
+ [ruby-core:02059]
- * ext/stringio/stringio.c (get_strio, strio_set_string)
- (strio_reopen): check if frozen. [ruby-core:33648]
+ * eval.c (thread_timer): use select(2) if nanosleep(2) is not
+ available.
-Thu Jan 6 05:10:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c: check __stub_getcontext for glibc on some platforms.
+ [ruby-list:38984]
- * array.c (rb_ary_resize): new utility function. [ruby-dev:42912]
+Wed Dec 24 23:48:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Jan 6 05:03:26 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
+ test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
+ to express -0.0. [ruby-talk:88786]
- * dln.c (init_funcname_len): ignore rest from first dot.
- [ruby-dev:41774]
+Wed Dec 24 23:29:30 2003 Tanaka Akira <akr@m17n.org>
-Thu Jan 6 02:55:48 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/tsort.rb (test_orphaned_break): removed.
- * ext/psych/lib/psych/visitors/yaml_tree.rb: use YAML 1.0 output
- format for serializing nil values. Thanks Eric Hodel!
+Wed Dec 24 20:53:06 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/psych/test_nil.rb: test for nil values
+ * ext/tk/sample/tkmulticolumnlist.rb: new sample
-Wed Jan 5 14:21:34 2011 Mark Dodwell <hi@mkdynamic.co.uk>
+ * ext/tk/sample/tkmultilistframe.rb: bug fix
- * string.c: fix rdoc typo.
- https://github.com/shyouhei/ruby/pull/3
+Wed Dec 24 20:37:37 2003 Eric Sunshine <sunshine@sunshineco.com>
-Wed Jan 5 14:06:01 2011 NAKAMURA Usaku <usa@ruby-lang.org>
+ * configure.in (LDSHARED): Fixed typographical error in assignment of
+ LDSHARED for Rhapsody which caused linking of extension modules to
+ fail.
- * test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
- skip on Windows because chmod 0 doesn't mean unreadable by owner.
+Wed Dec 24 17:51:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jan 5 13:56:54 2011 Akinori MUSHA <knu@iDaemons.org>
+ * file.c (rb_thread_flock): enable thread support again.
- * lib/net/http.rb (Net::HTTP#get): A header hash given should not
- be modified.
+Wed Dec 24 16:46:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Jan 5 12:10:08 2011 Aaron Patterson <aaron@tenderlovemaking.com>
+ * eval.c (catch_timer): do not call rb_thread_schedule() inside to
+ avoid pthread_mutex_lock() deadlock. interrupts to system calls
+ are detected by TRAP_END via EINTR error.
- * ext/dl/{cfunc.c,dl.h,handle.c}, ext/fiddle/fiddle.{h,c}: Use _WIN32
- rather than checking for windows.h. Thanks Jon Forums!
- [ruby-core:33977]
+ * eval.c (thread_timer): do not post signal unless it is
+ absolutely necessary.
-Sat Jan 1 17:02:50 2011 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
- * lib/irb/locale.rb (IRB::Locale#search_file): make it possible
- to load a localization from a gem.
- (IRB::Locale#lc_path): obsoleted because of the change of #search_file
- (IRB::Locale#each_localized_path): new private method, based on
- lc_path
- (IRB::Locale#find): follows the change of #search_file.
- (IRB::Locale#load): removed duplicate with #find.
+ * regex.c (re_compile_pattern): check if nextp is smaller than
+ pend. [ruby-dev:22372]
-Sat Jan 1 11:44:42 2011 Tanaka Akira <akr@fsij.org>
+ * eval.c (umethod_bind): remove method overridden check.
+ [ruby-dev:22366]
- * strftime.c: parenthesize macro arguments.
+Wed Dec 24 16:13:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Jan 1 11:10:29 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
+ status by SSL_get_error().
- * ext/zlib/zlib.c: take care of platforms where long is bigger
- than int.
+ * ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
-Sat Jan 1 11:03:58 2011 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 24 14:23:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * NEWS (optparse): shell completion support.
+ * ext/stringio/stringio.c (strio_read): clear the buffer argument
+ when returning nil. [ruby-dev:22363]
- * misc/README (rb_optparse.{bash,zsh}): for shell completion.
+ * test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
+ add buffer argument tests.
- * include/ruby/intern.h (VALUE rb_ary_print_on): I have never seen
- this function anywhere.
+Wed Dec 24 14:07:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jan 1 04:20:11 2011 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/assertions.rb: Modules are allowed to rescue.
- * win32/win32.c (rb_w32_write_console): don't raise exception when
- the conversion is for writing to console.
- Patched by Heesob Park [ruby-core:33999]
+ * lib/test/unit/autorunner.rb: show output_level in order.
-Fri Dec 31 12:02:06 2010 Tanaka Akira <akr@fsij.org>
+ * lib/test/unit/collector/dir.rb: get rid of successive same
+ directories in load path.
- * enum.c (enum_sort_by): use less temporary objects.
+ * test/testunit/test_assertions.rb (test_assert_nothing_raised,
+ test_assert_raise): test for modules.
-Fri Dec 31 11:46:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 24 13:43:34 2003 Shugo Maeda <shugo@ruby-lang.org>
- * configure.in (warnflags), lib/mkmf.rb (configuration): turn
- warnings into errors only for bundled extensions.
- [ruby-core:33815]
+ * lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
+ strings.
-Fri Dec 31 11:15:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 24 11:26:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/zlib/zlib.c (sizeof): zlib.h mistakenly assumes the result
- of sizeof to be int, not size_t.
+ * test/fileutils/test_fileutils.rb: should not create any
+ files or directories in current directory. [ruby-talk:88724]
-Fri Dec 31 10:27:34 2010 Tanaka Akira <akr@fsij.org>
+Wed Dec 24 10:29:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * st.c: parenthesize macro arguments.
+ * ext/stringio/stringio.c (strio_read): never return nil at
+ unlimited read. [ruby-dev:22334]
-Fri Dec 31 03:23:26 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/stringio/stringio.c (strio_read): support second
+ argument. [ruby-dev:22350]
- * vsnprintf.c (BSD__uqtoa): Fix overflow when long != quad_t.
- patched by Peter Weldon <peter.weldon AT null.net>
- [ruby-core:33985]
+Wed Dec 24 09:38:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 31 03:00:34 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * parse.y (arg): should return 0 after error. [ruby-dev:22360]
- * Makefile.in: remove unnecessary semicolons.
+Wed Dec 24 00:56:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Dec 30 23:09:47 2010 wanabe <s.wanabe@gmail.com>
+ * io.c (read_all): do not return nil at the end of file.
+ [ruby-dev:22334]
- * vm.c (vm_define_method): guard iseq from GC while method definition.
- [ruby-dev:42832]
+ * io.c (argf_read): do not depend on nil at eof behavior of
+ IO#read().
-Thu Dec 30 20:18:32 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (rb_thread_join): dup exception before re-raising it.
- * win32/Makefile.sub: ditto.
+ * io.c (rb_io_eof): call clearerr() to prevent side effect. this
+ patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
+ [ruby-dev:22234]
-Thu Dec 30 20:57:09 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * pack.c (OFF16): get offset for big endian machines.
- * Makefile.in: Check V=1 argument if run "make clean" or similar.
+ * pack.c (pack_pack): use OFF16 instead of OFF16B.
+ [ruby-dev:22344]
-Thu Dec 30 20:41:50 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * pack.c (pack_unpack): ditto.
- * Makefile.in: Kill ugly line continuation.
+Tue Dec 23 22:47:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Dec 30 11:49:40 2010 Tanaka Akira <akr@fsij.org>
+ * io.c (rb_io_check_readable): set FMODE_RBUF always, even if
+ NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
- * sprintf.c: parenthesize macro arguments.
+ * io.c (rb_io_check_writable): clear FMODE_RBUF before writing
+ something.
-Wed Dec 29 21:20:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Dec 23 22:25:00 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
- * io.c (maygvl_copy_stream_wait_readwrite): define if USE_SENDFILE
+ * lib/optparse.rb: incomplete RDoc documentation added in place of
+ existing RD comments. Tabs converted to spaces.
-Wed Dec 29 20:37:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Dec 23 19:44:47 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/extmk.rb: strip current directory prefix.
+ * test/soap/test_streamhandler.rb (test_basic_auth): removed.
+ soap4r + basic_auth is not officially supported in ruby/1.8.1 even
+ though soap4r + basic_auth + http-access2 should run fine.
- * enc/depend (clean): remove name2ctype.h when out-of-place build.
+Tue Dec 23 19:42:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/Makefile.sub (clean-enc): pass V to inferior make.
+ * io.c (rb_io_ungetc): raise an exception at unread stream to
+ avoid unspecified behavior. [ruby-dev:22330]
-Wed Dec 29 18:23:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/ruby/test_system.rb (test_syntax): glob relatively from
+ __FILE__.
- * re.c (rb_reg_expr_str): need to escape if the coderange is invalid.
+Tue Dec 23 18:09:40 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Dec 29 10:06:51 2010 Tanaka Akira <akr@fsij.org>
+ * pack.c (pack_pack): remove unnecessary negative value check.
+ [ruby-dev:22329]
- * signal.c: parenthesize macro arguments.
+Tue Dec 23 17:26:55 2003 KONISHI Hiromasa <konishih@fd6.so-net.ne.jp>
-Wed Dec 29 07:22:15 2010 Eric Hodel <drbrain@segment7.net>
+ * bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
- * lib/rake/rdoctask.rb: Deprecate in favor of rdoc/task.
+Tue Dec 23 16:08:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Wed Dec 29 07:07:06 2010 Eric Hodel <drbrain@segment7.net>
+ * lib/rexml/encodings/US-ASCII.rb: typo. [ruby-talk:88650]
- * lib/rdoc: Import RDoc 3.1
+ * test/ruby/test_system.rb: num of asserts depended on running dir.
-Tue Dec 28 18:36:38 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
+ handle euc-jp. install iconv, uconv or xmlscan.
- * error.c, include/ruby/intern.h (rb_compile_error_with_enc): new
- function to raise syntax error, with source encoding'ed message.
+Tue Dec 23 14:13:51 2003 akira yamada <akira@ruby-lang.org>
- * parse.y (compile_error): use above function.
- [ruby-core:33951] (#4217)
+ * lib/uri/generic.rb (URI::Generic::check_userinfo,
+ URI::Generic::check_user, URI::Generic::check_password): tests
+ conflicts/depends with other components closely.
-Tue Dec 28 07:37:38 2010 Tanaka Akira <akr@fsij.org>
+ * test/uri/test_generic.rb (TestGeneric::test_set_component):
+ added tets.
- * ruby.c: parenthesize macro arguments.
+Tue Dec 23 11:08:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Dec 28 07:17:11 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
+ "euc-jp" might not be in supported encoding name list.
+ [ruby-talk:88650]
- * NEWS: add ARGF.write and so on.
+Tue Dec 23 06:10:31 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue Dec 28 07:12:38 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/webrick/cgi.rb (CGI): add support for mod_ruby.
- * NEWS: add new magic-comment. (warn-indent) [ruby-core:25442]
+ * lib/webrick/cgi.rb (CGI::Socket): add check for existence of
+ OpenSSL module in all HTTPS related methods.
-Tue Dec 28 04:32:37 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
+ value to OpenSSL::SSLSocket#cipher.
- * ext/fiddle/extconf.rb: check for windows.h while building fiddle.
- Thanks Jon Forums! [ruby-core:33923]
+ * lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
+ set "connection: close" if @keep_alive is false.
-Tue Dec 28 01:45:12 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
+ SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
- * NEWS: Add Zlib.deflate and Zlib.inflate.
- [ruby-dev:42833]
+Mon Dec 22 23:00:05 2003 akira yamada <akira@ruby-lang.org>
-Mon Dec 27 21:22:33 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
- * win32/configure.bat: Remove obsoleted coding rule. Now, we
- don't support to build on Windows 95/98 and Me.
+Mon Dec 22 21:59:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 27 18:27:13 2010 Tanaka Akira <akr@fsij.org>
+ * ext/iconv/iconv.c (map_charset): always ensure code is a String.
- * re.c: parenthesize macro arguments.
+Mon Dec 22 21:15:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 27 15:22:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * class.c (rb_mod_init_copy): always copy singleton class.
+ [ruby-dev:22325]
- * win32/README.win32: note to need NT based OS to build ruby.
+Mon Dec 22 20:44:36 2003 akira yamada <akira@ruby-lang.org>
-Mon Dec 27 12:14:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
+ has no host-part.
- * common.mk (EXTMK_ARGS): specify to pass macro V, because nmake
- doesn't pass it via MAKEFLAGS.
+ * test/uri/test_generic.rb (TestGeneric::test_route): added a test.
-Mon Dec 27 10:33:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Dec 22 20:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/zlib/zlib.c (Init_zlib): Add Zlib.deflate and Zlib.inflate.
- [ruby-dev:42833]
+ * lib/cgi.rb: reduce eval.
-Mon Dec 27 07:38:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
+ local_path. [ruby-list:38883]
- * misc/rb_optparse.zsh: add compdef for generator.
+Mon Dec 22 20:09:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Mon Dec 27 07:32:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * test/soap/test_property.rb: remove duplicated test method.
- * lib/optparse.rb (OptionParser#compsys): escape brackets too.
- [ruby-dev:42754]
+Mon Dec 22 18:22:04 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Dec 27 01:30:08 2010 Tanaka Akira <akr@fsij.org>
+ * bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
+ HAVE_ISINF definition to follow previous commits of missing.h
+ and win32/win32.h.
- * ext/socket/mkconstants.rb: add IF_NAMESIZE.
- add a default for INET6_ADDRSTRLEN.
+Mon Dec 22 17:23:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 26 23:49:47 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * configure.in (ac_cv_func_setitimer): moved from defines.h
- * win32/Makefile.sub: suppress a strange error message when RMALL
- found no such file.
- * win32/rmall.bat: new.
+ * defines.h, rubysig.h, signal.c: removed macro handling which
+ should be done in configure.
-Sun Dec 26 21:23:23 2010 <kosaki.motohiro@gmail.com>
+ * configure.in (intrinsics.h): check if present.
- * win32/Makefile.sub: fix 'nmake clean-enc' breakage since r28322.
+ * ruby.h: include intrinsics.h if available.
-Sun Dec 26 22:25:07 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bignum.c, marshal.c: include ieeefp.h if available.
- * ext/ripper/depend (ripper.y): fix messages with nmake.
- [ruby-dev:42896]
+ * missing.h (isinf): define as a macro if finite() and isnan()
+ are available. [ruby-core:02032]
-Sun Dec 26 22:24:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 22 17:07:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * file.c (file_expand_path): get rid of warnings caused by
- -Wdeclaration-after-statement on cygwin.
+ * configure.in (mingw): set isnan, finite and isinf to yes.
-Sun Dec 26 20:28:34 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Mon Dec 22 13:40:19 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * process.c (before_exec): add small comment.
+ * lib/soap/property.rb: passing block by reference.
-Sun Dec 26 20:52:21 2010 Tanaka Akira <akr@fsij.org>
+Mon Dec 22 00:32:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/socket/mkconstants.rb: define INET_ADDRSTRLEN as 16 if not
- available. fix compilation error on mswin32-60. reported by nobu.
+ * eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
+ ALLOW_INTS which may switch context. [ruby-dev:22319]
-Sun Dec 26 19:37:37 2010 Tanaka Akira <akr@fsij.org>
+ * ext/syck/emitter.c (syck_emitter_write): str bigger than
+ e->bufsize causes buffer overflow. [ruby-dev:22307]
- * ext/socket/option.c: define IFNAMSIZ if not available.
- fix compilation error on mingw32. reported by nobu.
+Sun Dec 21 17:29:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 26 12:16:29 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * class.c (rb_check_inheritable): new function. [ruby-dev:22316]
- * lib/rdoc/ri/paths.rb (RDoc::RI::Paths::HOMEDIR): no exception if
- HOME is not set. [ruby-core:33867]
+ * intern.h: add prototype.
-Sun Dec 26 11:39:11 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (superclass): use rb_check_inheritable().
- * parse.y (stmt): missing ripper rule. i.e., `a::B ||= c 1'.
- http://twitter.com/#!/wannabe53/status/18797576396472321
- http://twitter.com/#!/wannabe53/status/18798416150663168
+ * object.c (rb_class_initialize): check argument validity.
-Sun Dec 26 11:15:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Dec 21 16:25:10 2003 Tanaka Akira <akr@m17n.org>
- * test/with_different_ofs.rb (DifferentOFS): should not affect
- original classes.
+ * lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
+ beginning of the argument.
+ (Pathname#join): concatenate from the last argument.
+ (Pathname#parent): just use Pathname#+.
-Sun Dec 26 09:35:07 2010 Tanaka Akira <akr@fsij.org>
+Sun Dec 21 00:12:37 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * rational.c: parenthesize macro arguments.
+ * ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
-Sun Dec 26 09:22:19 2010 Tanaka Akira <akr@fsij.org>
+ * ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
- * ext/socket/option.c (rb_if_indextoname): new function to abstract
- environments without if_indextoname.
- (inspect_ipv6_multicast_if): new function to inspect
- IPV6_MULTICAST_IF.
- Socket::Option.new(:INET6, :IPV6, :MULTICAST_IF,
- [2].pack("I!")).inspect is
- "#<Socket::Option: INET6 IPV6 MULTICAST_IF eth0>".
+Sat Dec 20 21:59:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Dec 26 04:31:15 2010 Luis Lavena <luislavena@gmail.com>
+ * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
- * ext/dl/win32/registry.rb: Corrected RegCreateKeyExA signature.
- Patch by Rafal Michalski [ruby-core:33874] [Ruby 1.9-Bug#4203]
+ * lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
+ instead of Status: header field.
-Sun Dec 26 02:31:58 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
- * io.c (advice_arg_check): Change argument check.
- Now, an unsupported advice makes NotImplementedError.
- [ruby-dev:42887] [Ruby 1.9-Feature#4204]
+Sat Dec 20 16:07:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 26 03:00:53 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/optparse.rb (OptionParser::Completion::complete): wrong
+ Regexp for word boundary. pointed out by Gavin Sinclair.
- * ext/socket/extconf.rb: Fix build error which was introduced r30372.
+ * lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
+ missing.
-Sun Dec 26 01:37:10 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Dec 20 11:40:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/extconf.rb: check the existence of if_indextoname().
+ * lib/yaml.rb (YAML::YAML): adjust Marshal version.
- * ext/socket/option.c: yesterday's akr's commits destroyed the build of
- some unrelated platforms (such as Windows).
+Sat Dec 20 03:56:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Dec 25 23:29:11 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_with_disable_interrupt): prohibit thread context
+ switch during proc execution. [ruby-dev:21899]
- * ext/socket/option.c (inspect_ipv4_add_drop_membership): new function
- to inspect struct ip_mreq and struct ip_mreqn for
- IP_ADD_MEMBERSHIP and IP_DROP_MEMBERSHIP.
- Socket::Option.new(:INET, :IP, :ADD_MEMBERSHIP,
- [239,255,99,81, 0,0,0,0].pack("CCCCCCCC")).inspect is now
- "#<Socket::Option: INET IP ADD_MEMBERSHIP 239.255.99.81 0.0.0.0>".
- (inspect_ipv4_multicast_if): new function to inspect struct in_addr
- and struct ip_mreqn for IP_MULTICAST_IF.
- Socket::Option.new(:INET, :IP, :MULTICAST_IF,
- [192,168,0,7].pack("CCCC")).inspect is now
- "#<Socket::Option: INET IP MULTICAST_IF 192.168.0.7>".
+Sat Dec 20 02:41:02 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/socket/extconf.rb: check struct ip_mreq and struct ip_mreqn.
+ * lib/webrick/cgi.rb: add file. (yet another CGI library)
-Sat Dec 25 22:49:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * MANIFEST: add lib/webrick/cgi.rb.
- * test/csv: DifferentOFS needs to be include in each classes.
+Sat Dec 20 02:18:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/digest/test_digest_extend.rb (TestDigestExtend#setup):
- should not depend on the result of previous tests
+ * misc/ruby-mode.el (ruby-calculate-indent): proper indentation
+ inside of parentheses. [ruby-dev:22308]
- * test/with_different_ofs.rb (DifferentOFS::WithDifferentOFS): give
- name.
+Fri Dec 19 21:24:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/with_different_ofs.rb (DifferentOFS): test suite for test
- suites affected by $,.
+ * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
+ HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
- * test/digest/test_digest_extend.rb (TestDigestExtend): should not
- assume $, invariant.
+ * lib/webrick/https.rb (HTTPRequest#parse): should check presence
+ of cert() method to detect SSLSocket.
- * test/csv/test_data_converters.rb, test/csv/test_table.rb: don't
- call setup within tests.
+Fri Dec 19 22:56:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Dec 25 20:01:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/soap/property.rb (SOAP::Property#load): new method for loading
+ property value into existing property tree.
- * io.c (pipe_open): Added rb_thread_atfork(). We must reinitialize
- GVL at new process creation.
+ * test/soap/test_property.rb: add test.
-Sat Dec 25 18:26:55 2010 Tanaka Akira <akr@fsij.org>
+Fri Dec 19 19:21:49 2003 akira yamada <akira@ruby-lang.org>
- * ext/socket/option.c (inspect_ipv6_mreq): new function to inspect
- struct ipv6_mreq for IPV6_JOIN_GROUP and IPV6_LEAVE_GROUP.
- Socket::Option.new(:INET6, :IPV6, :JOIN_GROUP,
- [0xff12,0,0,0,0,0,0,1, 2].pack("nnnnnnnnI!")).inspect is now
- "#<Socket::Option: INET6 IPV6 JOIN_GROUP ff12::1 eth0>".
+ * lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
+ should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
- * ext/socket/extconf.rb: check struct ipv6_mreq.
+Fri Dec 19 17:36:49 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sat Dec 25 18:04:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/sample/tkmultilistbox.rb: bug fix
- * lib/csv.rb (CSV.foreach): 'rb' mode is defaulted in open.
+ * ext/tk/sample/tkmultilistframe.rb: new sample script
- * lib/csv.rb (CSV#init_separators): cannonicalize encoding options
- as Encoding objects.
+Fri Dec 19 03:44:27 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Dec 25 18:30:34 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/webrick/httputils.rb (parse_form_data): should return an
+ empty Hash if the body is empty.
- * thread.c (rb_thread_atfork): Add small comment why we need
- reset random seed.
+Thu Dec 18 21:47:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Dec 25 17:33:55 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (create_makefile): should remove deffile if it's
+ made by miniruby. based on nobu's patch.
- * test/csv/base.rb (TestCSV.with_different_ofs): give name to
- anonymous classes.
+Thu Dec 18 21:44:21 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/csv.rb (CSV#init_separators): use IO#gets with length
- parameter to get rid of wrong convertion.
+ * eval.c (stack_extend): ignore inline optimization on VC7.
- * lib/csv.rb (CSV::foreach, CSV#initialize): directly use encoding
+ * win32/Makefile.sub (OS, RT): can override.
- * lib/csv.rb, test/csv: should not assume $, invariant.
+ * win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
+ option. based on Tietew's patch [ruby-dev:22289]
-Sat Dec 25 16:08:06 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Dec 18 16:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * signal.c: change rb_atomic_t definition from uchar to uint.
+ * dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
+ return NULL.
-Sat Dec 25 15:04:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 18 15:27:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/csv/test_encodings.rb (TestEncodings#setup): fix evil test
- suite writing to the source directory.
+ * lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
+ [ruby-dev:21678]
-Sat Dec 25 15:08:08 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Dec 17 15:15:30 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/pty/pty.c (chfunc): Added rb_thread_atfork_before_exec().
- We must reinitialize GVL at new process creation. Otherwise
- we may meet an insane deadlock. [Bug#4121][ruby-dev:42686]
+ * lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
+ String#[] if more than one arguments are specified.
-Sat Dec 25 14:27:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/delegate.rb: avoid using common instance name as "@obj".
- * io.c (rb_io_extract_encoding_option): accept Encoding object as
- encoding: optional argument. [ruby-dev:42884]
+ * lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
+ subclass of String, but DelegateClass(String).
-Sat Dec 25 13:37:55 2010 Ryan Davis <ryand-ruby@zenspider.com>
+ * ext/curses/extconf.rb: restore function check for init_color.
+ [ruby-list:38905]
- * lib/minitest/*.rb: Imported minitest 2.0.2 r6093.
+ * Makefile.in: need to specify $(MAINLIBS) for the miniruby
+ generation rule.
-Sat Dec 25 13:05:59 2010 Tanaka Akira <akr@fsij.org>
+ * configure.in: better FreeBSD -lc_r support.
- * random.c: parenthesize macro arguments.
+Wed Dec 17 00:16:14 2003 Minero Aoki <aamine@loveruby.net>
-Sat Dec 25 12:48:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/strscan/strscan.c: new method
+ StringScanner#beginning_of_line? (alias #bol?)
- * load.c (rb_f_require_relative): don't omit return type.
+ * ext/strscan/strscan.c: new method StringScanner#concat and #<<.
-Sat Dec 25 11:06:00 2010 Eric Hodel <drbrain@segment7.net>
+ * ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
+ nor freeze STR (allow destructive modification).
- * load.c (rb_f_require_relative): Add documentation.
+ * test/strscan/test_stringscanner.rb: test new methods above.
-Sat Dec 25 11:02:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/strscan/test_stringscanner.rb: test destructive string
+ modification.
- * ext/zlib/zlib.c (gzreader_gets): support optional length
- parameter.
+Tue Dec 16 21:20:47 2003 Tanaka Akira <akr@m17n.org>
- * ext/zlib/zlib.c (gzfile_read, gzfile_readpartial): length should
- be long.
+ * lib/pp.rb: don't use local variable `pp'.
-Sat Dec 25 10:51:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/prettyprint.rb: ditto.
- * ext/json/generator/generator.{c,h} (fbuffer_free_only_buffer):
- unused.
+Tue Dec 16 13:20:43 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/openssl/ossl_pkcs5.c (ossl_pkcs5_pbkdf2_hmac): add casts.
+ * ext/tk/lib/tk.rb: condition bug of if statement on
+ {pack,grid}_propagate methods
-Fri Dec 24 08:46:04 2010 Tanaka Akira <akr@fsij.org>
+Tue Dec 16 03:17:29 2003 why the lucky stiff <why@ruby-lang.org>
- * process.c: parenthesize macro arguments.
+ * lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
-Thu Dec 23 19:17:14 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * test/yaml/test_yaml.rb: add test.
- * test/net/imap/cacert.pem: updated because it has been expired.
+Tue Dec 16 01:14:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/net/imap/server.crt: signed again because CA cert was expired.
+ * eval.c (catch_timer): check rb_thread_crtical in main native
+ thread.
-Thu Dec 23 11:16:52 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (thread_timer): just sends signals periodically, to
+ prevent main native thread from receiving them in critical
+ section. [ruby-core:01959]
- * parse.y: parenthesize macro arguments.
+Mon Dec 15 13:32:22 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 23 11:00:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * dir.c (check_dirname): check string safety and remove extraneous
+ trailing directory separators. [ruby-dev:22279]
- * error.c (rb_check_type): check for type from extensions for ruby
- 1.8. see [ruby-core:33797].
+ * file.c: renamed and externalized rb_path_next,
+ rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
-Thu Dec 23 08:12:59 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
+ rb_path_last_separator, rb_path_end.
- * lib/net/smtp.rb: refactoring Net::SMTP#esmtp= to use an
- attr_accessor
+Mon Dec 15 09:27:46 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 23 06:35:41 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
+ of rb_protect should take an argument of VALUE.
- * lib/net/smtp.rb: Net::SMTP should close the SSL connection if the
- connection verification fails.
+Sun Dec 14 18:46:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Dec 23 01:47:58 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/socket/socket.c (Init_socket): IPv6 is not supported although
+ AF_INET6 is defined on MinGW.
- * NEWS: remove #object_id. [ruby-dev:42840]
+ * lib/ipaddr.rb (AF_INET6): workaround in the environment which does
+ not support IPv6.
-Wed Dec 22 08:56:39 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Sat Dec 13 18:55:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * NEWS: add Module#private_constant and Module#public_constant.
- [ruby-dev:39685][ruby-core:32698]
+ * ext/iconv/charset_alias.rb: preserve original order.
-Wed Dec 22 07:59:23 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/iconv/extconf.rb: remove wrapper file at clean.
- * NEWS: add IO#advise. [ruby-core:33110] [Ruby 1.9-Feature#4038]
+Sat Dec 13 18:09:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Dec 21 23:45:31 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * eval.c (thread_timer): use timer by sub-thread and nanosleep.
+ [ruby-talk:87519]
- * gc.c (Init_GC): move back object_id to Kernel. [ruby-dev:42840]
+ * gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
-Tue Dec 21 12:45:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Dec 13 17:17:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (target_archs): remove temporary objects.
+ * eval.c (proc_alloc): cache the created object at first time.
+ [ruby-talk:61288], [ruby-dev:22240]
- * enc/Makefile.in, enc/depend (clean): remove work directories.
+Sat Dec 13 09:01:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Dec 21 07:39:12 2010 Tanaka Akira <akr@fsij.org>
+ * configure.in: check ucontext.h.
- * pack.c: parenthesize macro arguments.
+ * eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
+ on ia64 or with native thread enabled. [ruby-core:01932]
-Tue Dec 21 06:25:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Dec 13 03:09:14 2003 why the lucky stiff <why@ruby-lang.org>
- * test/rexml/test_contrib.rb (ContribTester#test_pos): should not
- use fixed path name for tests. [ruby-dev:42827]
+ * lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
- * test/rexml/test_sax.rb (SAX2Tester#test_socket): should not use
- fixed port for tests. [ruby-dev:42828]
+ * test/yaml/test_yaml.rb: add test.
-Tue Dec 21 06:10:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 12 22:36:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * compile.c (setup_args), vm.c (invoke_block_from_c),
- vm_insnhelper.c (caller_setup_args): reverted r30241 and r30243
- except for the test.
+ * lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
+ "#{aCell}" and so on.
-Tue Dec 21 01:41:42 2010 Masaya Tarui <tarui@ruby-lnag.org>
+ * test/csv/test_csv.rb: add tests.
- * io.c : add an extra byte to buffer for the specification of read
- in Windows. see [ruby-core:33460] and r29980. and, we have to
- discuss how to do this one byte.
+Fri Dec 12 19:33:06 2003 Minero Aoki <aamine@loveruby.net>
-Tue Dec 21 01:18:06 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
- * error.c: Fix build error for win32. This regression was
- introduced by r30271.
+ * lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
-Tue Dec 21 00:59:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/fileutils.rb (rmdir_r): ditto.
- * thread.c (thread_cleanup_func): Moved interrupted_lock
- destroying code from native_thread_destroy() to
- thread_cleanup_func() because it's platform independent logic.
+ * lib/fileutils.rb (fu_copy_dir): check if it is a directory after
+ mkdir(2).
- * thread_win32.c (native_thread_destroy): ditto.
- * thread_pthread.c (native_thread_destroy): ditto.
+Fri Dec 12 06:06:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Dec 21 00:46:20 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * eval.c (proc_invoke): fix class name in warning message for
+ define_method. [ruby-dev:22235]
- * thread.c (thread_cleanup_func): Don't touch native threading
- resource at fork. Sadly this is purely bandaid. We need to
- implement proper fix later. [Bug #4169] [ruby-core:33767]
+Thu Dec 11 21:24:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Tue Dec 21 00:22:44 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
- * error.c (exit_success_p): Check status code more carefully.
- status code may have garbage in upper bit.
+ * ext/openssl/ossl.[ch]: ditto.
-Mon Dec 20 23:12:37 2010 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
- * node.c: parenthesize macro arguments.
+Thu Dec 11 20:54:28 2003 Minero Aoki <aamine@loveruby.net>
-Mon Dec 20 20:04:41 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
+ mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
- * NEWS: add #__id__ and #object_id. [ruby-dev:42778]
+ * lib/fileutils.rb (fu_list): call to_str for all arguments.
-Mon Dec 20 20:03:21 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Thu Dec 11 20:07:01 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * thread_pthread.c (native_thread_destroy): Fixed gvl_cond leak.
+ * lib/ftools.rb (makedirs): sync with fileutils.
-Mon Dec 20 13:49:05 2010 Eric Hodel <drbrain@segment7.net>
+Thu Dec 11 19:53:03 2003 Minero Aoki <aamine@loveruby.net>
- * NEWS: Add item for RDoc 3.0.1
+ * lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
+ (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
- * lib/rdoc: Import RDoc 3.0.1, remove require for perl parser.
+Thu Dec 11 19:08:02 2003 Minero Aoki <aamine@loveruby.net>
-Mon Dec 20 12:15:32 2010 Eric Hodel <drbrain@segment7.net>
+ * lib/fileutils.rb (mkdir_p): check if it is a directory after
+ mkdir(2) instead of before mkdir(2), to avoid race condition.
+ [ruby-talk:87730]
+ Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
- * lib/rdoc: Import RDoc 3.0.
+Thu Dec 11 18:49:30 2003 Minero Aoki <aamine@loveruby.net>
-Mon Dec 20 01:55:03 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * lib/fileutils.rb: def m( arg ) -> def m(arg).
- * io.c (Init_IO): Added O_DIRECT. This feature was proposed by
- Run Paint Run Run.
- [Feature #4015] [ruby-core:33018]
+Thu Dec 11 11:39:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 19 19:15:23 2010 Tanaka Akira <akr@fsij.org>
+ * configure.in (ieeefp.h), numeric.c: needed for finite() on
+ Solaris. [ruby-core:01921]
- * marshal.c: parenthesize macro arguments.
+ * file.c (rb_stat_inspect): adjust format specifier.
-Sat Dec 18 21:52:37 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * parse.c (arg_prepend): nodetype() is for debug use.
- * vsnprintf.c (BSD_vfprintf): suppress warning: "_WIN32" is not
- defined.
+ * ruby.h (ISASCII, etc): cast to int to get rid of warning.
-Sat Dec 18 16:02:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.h (alloca.h): include even in GCC. [ruby-core:01925]
- * compile.c (setup_args), vm.c (invoke_block_from_c),
- vm_insnhelper.c (caller_setup_args): fix of r30241. lambda block
- should check argument number.
+ * ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
+ specifier.
-Sat Dec 18 14:42:29 2010 Tanaka Akira <akr@fsij.org>
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
+ BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
- * load.c: parenthesize macro arguments.
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
-Sat Dec 18 10:07:04 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
+ volatile.
- * compile.c (setup_args, iseq_compile_each): optimize AMPER LAMBDA
- combination as block.
+ * ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
+ format specifier.
-Fri Dec 17 22:07:16 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
+ define unless used.
- * gc.c (Init_GC): move #__id__ and #object_id to BasicObject.
- [ruby-dev:42778]
+ * ext/pty/pty.c (getDevice): get rid of warning.
-Fri Dec 17 19:35:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (port_str, sock_s_getaddrinfo,
+ sock_s_getnameinfo): FIX2INT() now returns long.
- * test/mkmf/base.rb (TestMkmf::FakeLog): capture output from mkmf.
+ * ext/socket/socket.c (init_inetsock_internal): uninitialized
+ variable.
- * test/mkmf/test_find_executable.rb (test_find_executable):
- suppress meaningless differences for chkbuild.
+ * ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
-Fri Dec 17 13:26:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
+ ISDIGIT() instead of isdigit() to avoid warnings and for
+ platforms which don't support non-ascii charater.
- * win32/setup.mak (BASERUBY): quit with an error when BASERUBY was not
- able to set, just like configure.in does. [ruby-dev:42782]
+Wed Dec 10 19:28:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 17 07:04:09 2010 Tanaka Akira <akr@fsij.org>
+ * ext/stringio/stringio.c (strio_read): set EOF flag at short read.
+ [ruby-dev:22223], [ruby-dev:22224]
- * iseq.c: parenthesize macro arguments.
+Wed Dec 10 18:07:25 2003 Minero Aoki <aamine@loveruby.net>
-Fri Dec 17 04:18:37 2010 Eric Hodel <drbrain@segment7.net>
+ * lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
- * transcode.c (str_encode): Alter comment for better wording and ri
- output.
+Wed Dec 10 17:54:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): do not set EOF flag when
+ requested length is zero. [ruby-dev:22214]
-Fri Dec 17 00:05:40 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Wed Dec 10 17:17:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * io.c (rb_io_advise): New API. IO#advise() allows to tell the
- ruby runtime how it expects to use a file handle. This feature
- can be improved a performance some situations.
- Note: This feature is mainly developed by Run Paint Run Run.
- Thank you! [ruby-core:33110] [Ruby 1.9-Feature#4038]
+ * io.c (read_all): should return given string even if data read is
+ empty. [ruby-dev:22207]
- * io.c (do_io_advise): Helper function.
- * io.c (io_advise_sym_to_const): ditto.
+Wed Dec 10 17:16:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 16 23:29:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/stringio/stringio.c (strio_read): adjust behavior at reading
+ beyond EOF to IO. [ruby-dev:22205]
- * tool/rbinstall.rb (bin-comm): use transformed name.
- [ruby-dev:42777]
+ * test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
+ beyond EOF.
-Thu Dec 16 21:52:07 2010 Tanaka Akira <akr@fsij.org>
+ * test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
+ TestEOF::Seek test case.
- * io.c: parenthesize macro arguments.
+Wed Dec 10 15:01:19 2003 Shugo Maeda <shugo@ruby-lang.org>
-Thu Dec 16 21:46:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/monitor/test_monitor.rb (test_cond): use Queue#deq
+ instead of sleep.
- * tool/mkconfig.rb (RbConfig): honor ARCHFLAGS and RC_ARCHS to
- override embedded ARCH_FLAG value on universal-darwin.
+Wed Dec 10 14:45:39 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Dec 16 19:50:12 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
+ for TIOCSCTTY on *BSD. based on gotoyuzo's patch.
+ (ruby-bugs:PR#1211)
- * win32/{configure.bat,setup.mak,Makefile.sub} (PROGRAM_PREFIX,
- PROGRAM_SUFFIX): unite the differences of the names of macros of
- prefix and suffix.
- reported by HANEDA Norikatsu. [ruby-dev:42775]
+ * ext/pty/pty.c (establishShell): should close descriptors if fork
+ failed.
-Thu Dec 16 08:04:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Dec 10 12:53:05 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * node.h (RNode): match the type of flags to RBasic, and renamed
- nd_file as nd_reserved.
+ * win32/win32.h: define execv() using do_aspawn().
- * iseq.c (set_relation), vm_insnhelper.c (vm_cref_push): nd_file
- is always zero-cleared.
+ * process.c (proc_exec_v): remove #ifdef's which stopped needing.
-Thu Dec 16 07:22:30 2010 Ryan Davis <ryand-ruby@zenspider.com>
+Tue Dec 9 23:32:23 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/minitest/unit.rb: Imported minitest 2.0.1 r6079.
+ * ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
+ ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
+ ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
+ ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
+ ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
+ ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
+ overrided instance methods, which are private methods on the super
+ class, are changed to 'private'
-Wed Dec 15 20:45:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Dec 9 19:53:02 2003 akira yamada <akira@ruby-lang.org>
- * lib/test/unit.rb (process_args): need to setup @help to print options.
+ * lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
+ for host-part.
-Wed Dec 15 11:19:33 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/uri/test_generic.rb (test_route): added tests for the above
+ change.
- * test/zlib/test_zlib.rb (test_to_io): forgotten to fix with r30201.
+Tue Dec 9 14:10:48 2003 Tanaka Akira <akr@m17n.org>
-Wed Dec 15 11:07:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
+ to avoid clearing EOF flag.
+ (rb_io_check_writable): ditto.
- * io.c (simple_sendfile): enable on Mac OS X.
+Tue Dec 9 02:53:55 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * io.c (nogvl_copy_stream_sendfile): moved precheck of copy length.
+ * ext/tk/sample/tkalignbox.rb: new sample script
- * io.c (nogvl_copy_stream_sendfile): should wait for both of
- read/write fds.
+Tue Dec 9 00:45:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Wed Dec 15 07:11:55 2010 Tanaka Akira <akr@fsij.org>
+ * lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
+ and made the former call the latter. [ruby-core:01890]
- * hash.c: parenthesize macro arguments.
+ * test/testunit/test_assertions.rb: ditto.
-Wed Dec 15 04:02:00 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+Tue Dec 9 00:07:35 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
- fix compile error when !HAVE_X509V3_SET_NCONF. Thanks
- Chikanaga-san. [ruby-dev:42761] [Ruby 1.9-Bug#4158]
+ * lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
+ methods as delegates to WEBrick.
-Wed Dec 15 03:41:31 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * test/soap/calc/{test_calc.rb,test_calc2.rb},
+ test/soap/helloworld/test_helloworld.rb,
+ test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
+ follow the change.
- * test/ripper/test_parser_events.rb (TestRipper#test_block_variables):
- Limit address space 100MB instead 100KB. Quite frankly, This
- margin is too narrow to contain ruby. [ruby-dev:42763] [Bug#4159]
+Mon Dec 8 22:48:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Dec 14 23:53:52 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/autorunner.rb: remove dependency to a particular
+ runner. [ruby-core:01901], [ruby-list:38869]
- * io.c (simple_sendfile): improve linux compatibility on FreeBSD,
- and now it works. But without cpuset -l 0, it still gets stuck.
+ * lib/test/unit/ui/testrunnerutilities.rb: moved output level
+ constants from Console.
-Tue Dec 14 20:31:33 2010 Tanaka Akira <akr@fsij.org>
+ * lib/test/unit/ui/console/testrunner.rb: ditto.
- * gc.c: parenthesize macro arguments.
+ * lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
+ accept output_level.
-Tue Dec 14 18:31:48 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Dec 8 15:03:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/test/unit.rb: help messages.
+ * ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
-Tue Dec 14 18:19:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Dec 8 13:02:11 2003 Minero Aoki <aamine@loveruby.net>
- * common.mk (help): there is no reason to use the abbreviation for here.
+ * lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
-Tue Dec 14 15:03:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/uri/test_common.rb: add test for URI.regexp.
- * test/ruby/test_io.rb (test_reopen, test_reinitialize): should close
- the temporary files.
+Mon Dec 8 12:44:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Dec 14 14:24:15 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * pack.c: define swap16 and swap32 only if they are not
+ defined. OpenBSD defines these macros. [ruby-dev:22181]
- * test/ruby/test_io.rb (make_tempfile): change the prefix from 'foo'
- to 'test_io' because the old one is meaningless and inconvenient.
+Sun Dec 7 20:54:17 2003 Tanaka Akira <akr@m17n.org>
- * test/ruby/test_io.rb (test_binmode_after_closed): the temporary file
- maked by make_temfile is already closed.
+ * ext/iconv/iconv.c (map_charset): make case sensitive.
+ ext/iconv/charset_alias.rb (charset_alias): don't ignore
+ config.charset's information. sort aliases.
-Tue Dec 14 13:52:19 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Dec 6 22:58:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/ruby/test_io.rb (test_flush_in_finalizer[12]): should close
- temporary file because it's only used for taking pathname and
- unlinking the file after the end of the test (in GC phase).
+ * ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
+ SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
+ but not finished the handshake process, we should retry it.
-Tue Dec 14 13:34:33 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
- * ext/zlib/zlib.c (gzfile_s_open): should close the IO if some error
- occurs in initializing.
+ * ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
-Tue Dec 14 13:04:16 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
- * lib/net/http.rb (Net::HTTPRequest#send_request_body_data):
- set binmode to tempfile.
+Sat Dec 6 21:45:10 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Dec 14 12:55:46 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * io.c (flush_before_seek): flush before seek on any platform.
- * test/zlib/test_zlib.rb (*): should close files associated with zlib.
+ * configure.in: ditto.
-Tue Dec 14 11:30:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Dec 6 17:23:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * test/ruby/test_argf.rb (test_inplace_rename_impossible): unlink
- the renamed temporary file on no_safe_rename platforms.
+ * lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
+ as well as downcase one.
- * test/ruby/test_argf.rb (test_readlines_limit_0,
- test_each_line_limit_0): should close argf because the associated
- Tempfile object cannot unlink the temporary file when it's gc'ed
- on some platforms (Windows, etc.)
+ * lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
-Tue Dec 14 11:27:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Dec 5 23:22:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/minitest/unit.rb (Minitest::Unit#_run_suite): split test
- name and its time. Thiw allows to know test's name when you are
- running tests and meet a test which spends long time at realtime.
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
+ Test::Unit::Assertions::assert_nothing_raised): use the last
+ argument as message unless class object.
-Tue Dec 14 11:25:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/testunit/test_assertions.rb (test_assert_raises): test for
+ multiple exception list. [ruby-core:01891]
- * configure.in: Add -Werror=declaration-after-statement to default
- warning flag. If you are using GCC, this flag is useful to
- prevent breaking VC build.
+ * test/testunit/test_assertions.rb (test_assert_nothing_raised): test
+ for non-exception classes.
-Tue Dec 14 10:25:57 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Dec 5 22:23:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): how many gcc-c99isms
- must a man mend; before he can build with VC? r30178
+ * lib/soap/netHttpClient.rb: proxy support did not work. fixed.
-Mon Dec 13 21:26:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/soap/property.rb: add class methods for loading property from
+ stream/file/propertyfile. propertyfile is a file which is located at
+ somedir in $:.
- * io.c (simple_sendfile): disable the use of sendfile(2) on
- FreeBSD. It blocks on TestIO#test_copy_stream_socket.
+ * lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
+ lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
+ e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
-Mon Dec 13 18:35:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
- * io.c: define USE_SENDFILE on FreeBSD or DragonFly BSD.
- Remove Mac OS X because its argument is different from them.
+Fri Dec 5 17:26:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Dec 13 12:00:09 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_exec_end_proc): maintain tmp_end_procs.
+ [ruby-dev:22154]
- * file.c: parenthesize macro arguments.
+Fri Dec 5 13:36:59 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Dec 13 11:21:14 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_exec_end_proc): should not clear end_procs and
+ ephemeral_end_procs before execution. [ruby-dev:22144]
- * io.c (simple_sendfile): added for BSD version of sendfile(2).
+ * eval.c (rb_obj_extend): call Module#extended hook after
+ extended_object. [ruby-list:38866]
-Mon Dec 13 09:50:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * object.c (Init_Object): Module#extended defined.
- * lib/net/http.rb (Net::HTTPRequest#set_form): Added to support
- both application/x-www-form-urlencoded and multipart/form-data.
- There is a similar API, Net::HTTPRequest#set_form_data, but
- to keep its compatibility this is newly added. [ruby-dev:42729]
+Fri Dec 5 13:17:30 2003 Tanaka Akira <akr@m17n.org>
-Sun Dec 12 23:45:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
- * compile.c (iseq_compile_each): fix for __goto__ and __label__
- where were totally broken.
+Fri Dec 5 11:54:45 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 12 22:45:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/stringio/stringio.c (strio_read): follow IO#read.
- * common.mk (ID_H_INCLUDES): now id.h depends on vm_opts.h.
+ * test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
+ test/stringio/test_stringio.rb: add EOF test.
-Sun Dec 12 20:42:47 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Fri Dec 5 02:49:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * template/id.h.tmpl: suppress all warning: "SUPPORT_JOKE" is not
- defined. [ruby-dev:42730]
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
+ allow multiple exception list. [ruby-core:01884]
-Sun Dec 12 20:35:07 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
+ check whether arguments are subclass of Exception.
- * misc/rb_optparse.zsh: update how to install.
+Thu Dec 4 23:54:00 2003 Rick Ohnemus <rick.ohnemus@systemware.com>
- * misc/rb_optparse.zsh: avoid error when setopt noclobber.
+ * dln.c (aix_loaderror): should not use member named 'errno' which
+ might be a macro (e.g. on AIX).
- * lib/optparse.rb: fix typo. pointed out at
- <http://d.hatena.ne.jp/nagachika/20101207>.
+Thu Dec 4 23:32:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Dec 12 13:27:35 2010 Tanaka Akira <akr@fsij.org>
+ * io.c (read_all): do not depend on lseek position.
+ [ruby-dev:22026]
- * eval_error.c: parenthesize macro arguments.
+Thu Dec 4 22:37:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 12 11:53:24 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_eval): preserve $! value when retry happens in the
+ rescue clause. [ruby-talk:86697]
- * error.c: parenthesize macro arguments.
+Thu Dec 4 21:50:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 12 04:01:58 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
+ should rescue errors and re-raise DRbConnError on write too.
+ [ruby-dev:22132]
- * string.c (rb_str_inspect): fix: extra back slash is added when
- the string is dummy encoding and includes \x22 or \x5C.
+Thu Dec 4 16:41:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Dec 12 02:42:24 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * parse.y (exc_list): allow expanding list. [ruby-dev:22134]
- * ext/openssl/ossl_asn1.c: indefinite length BER to DER encoding is
- properly supported. Thanks Martin Bosslet! [ruby-core:33082]
+Thu Dec 4 14:09:24 2003 Minero Aoki <aamine@loveruby.net>
-Sat Dec 11 17:43:34 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * test/fileutils/test_fileutils.rb (test_cp): test if the error is
+ kind of SystemCallError. It is needless details that which errno
+ is set on each systems.
- * ext/bigdecimal/bigdecimal.h: suppress "warning: 'VPrint' declared
- 'static' but never defined".
+Thu Dec 4 13:24:13 2003 Shugo Maeda <shugo@ruby-lang.org>
-Sat Dec 11 09:24:57 2010 Tanaka Akira <akr@fsij.org>
+ * lib/monitor.rb: use Object#__send__ instead of Object#send.
- * encoding.c: parenthesize macro arguments.
+Thu Dec 4 13:17:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Dec 11 08:12:48 2010 Eric Hodel <drbrain@segment7.net>
+ * lib/soap/streamHandler.rb: support latest released version of
+ http-access2.
- * ext/openssl/ossl.c, ext/openssl/ossl_pkey_rsa.c: Document RSA, RSA
- encryption/decryption and PKCS #5 encryption/decryption.
+Thu Dec 4 13:04:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Dec 11 06:23:41 2010 Eric Hodel <drbrain@segment7.net>
+ * lib/soap/soap.rb: add SOAP::Env module for environment repository
+ such as HTTP_PROXY.
- * ext/openssl/ossl_x509name.c: include Comparable to provide #==.
- Document OpenSSL::X509::Name#<=>. [Ruby 1.9-Feature#4116]
+ * lib/soap/property.rb: property implementation.
-Sat Dec 11 05:48:28 2010 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
+ lib/soap/rpc/driver.rb: use soap/property.rb.
- * ext/tk/lib/multi-tk.rb: infinite loop on method_missing at loading.
- [ruby-dev:42716] [Ruby 1.9-Bug#4129]
+ * lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
+ use SOAP::Env.
- * ext/tk/lib/multi-tk.rb: when no eventloop is running, ruby freezes at
- exit.
+ * lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
+ management interface, but ignored for now.
-Sat Dec 11 02:23:15 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
+ wiredump charset explicitly. it was fixed to 'utf-8' when iconv or
+ uconv module was found.
- * ext/openssl/extconf.rb: try pkgconfig first, then fall back to
- normal have_library, etc. Thanks Erik Hollensbe. [ruby-core:32406]
+Thu Dec 4 10:43:58 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Dec 10 22:33:39 2010 Tanaka Akira <akr@fsij.org>
+ * ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
+ feature.
- * dln_find.c: parenthesize macro arguments.
+Thu Dec 4 10:27:12 2003 Minero Aoki <aamine@loveruby.net>
-Fri Dec 10 20:05:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/http.rb: update hyperlink to the Japanese document.
- * template/id.h.tmpl (ruby_method_ids): suppress warnings.
- [ruby-dev:42730]
+Thu Dec 4 09:12:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Dec 10 18:29:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
+ the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
- * ruby.c (ruby_init_loadpath_safe): relatively called non-shared
- binary cannot be found in PATH, so use given pathname.
+Thu Dec 4 08:29:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Dec 10 18:28:40 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/server.rb (GenericServer#start): should rescue
+ Exception to avoid unexpected aborting. [ruby-core:01853]
- * cygwin/GNUmakefile.in (SCRIPTPROGRAMS): ignore backup files and etc.
+ * lib/webrick/server.rb (GenericServer#start_thread): should check
+ that peeraddr isn't nil before printing.
- * cygwin/GNUmakefile.in (scriptbin): set executable bit.
+ * lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
+ rescue Exception to avoid unexpected aborting of thread.
- * tool/rbinstall.rb (install_recursive): always skip default ignored
- files. if block is given, call it instead of calling install.
+Thu Dec 4 03:48:59 2003 Tanaka Akira <akr@m17n.org>
- * tool/rbinstall.rb (bin-comm): use install_recursive.
+ * lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
+ (Pathname#make_link, Pathname#make_symlink): new method.
-Fri Dec 10 18:12:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 4 01:45:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/mkmf/base.rb (TestMkmf#config_value): extract macro value from
- config.h.
+ * io.c (argf_read): should not terminate on empty string; wait
+ until real EOF. [ruby-dev:21969]
- * test/mkmf/test_sizeof.rb (TestMkmf::TestSizeof#test_sizeof_builtin),
- (TestMkmf::TestSizeof#test_sizeof_struct): more tests.
+ * io.c (argf_read): should adjust length to read, when length is
+ specified and read spans command line argument files.
- * lib/mkmf.rb (check_signedness): should use the prelude code.
- [ruby-dev:42731]
+Wed Dec 3 19:38:36 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/mkmf.rb (Logging.log_close): separate from Logging.logfile.
+ * lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
- * test/mkmf/base.rb (TestMkmf::MKMFLOG): show mkmf.log at failures.
+Wed Dec 3 13:49:07 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/mkmf/base.rb (TestMkmf#teardown): close log file for each tests.
+ * ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
-Fri Dec 10 11:36:43 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/tk/lib/tkafter.rb: ditto.
- * compile.c (enum): remove a comma at end of enumerator list.
+ * ext/tk/lib/tkcanvas.rb: ditto.
- * constant.h (rb_const_flag_t): ditto.
+ * ext/tk/lib/tkdialog.rb: ditto.
- * iseq.h (enum catch_type): ditto.
+ * ext/tk/lib/tktext.rb: ditto.
- * iseq.h (enum defined_type): ditto.
+Wed Dec 3 13:28:13 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm_core.h (enum iseq_type): ditto.
+ * Makefile.in (lex.c): try gperf first, and copy from the source
+ directory if failed. [ruby-dev:22123]
- * vm_core.h (enum vm_special_object_type): ditto.
+ * ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
-Fri Dec 10 10:47:53 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
- * sprintf.c (_HAVE_SANE_QUAD_): Don't forget LP64, r30156.
+Tue Dec 2 23:18:12 2003 Minero Aoki <aamine@loveruby.net>
-Fri Dec 10 10:37:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/net/http.rb: wrote the warning about HTTP_PROXY environment
+ variable.
- * sprintf.c (_HAVE_SANE_QUAD_): if a certain platform has LONG_LONG in
- 8 byte, it might be sane quad. [ruby-core:33634]
+Tue Dec 2 21:31:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Dec 10 10:07:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * bin/testrb: new test runner. [ruby-core:01845]
- * lib/net/http.rb: remove version 1.1 features.
+ * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
+ Test::Unit::AutoRunner#process_args): take test list to run and
+ options.
-Fri Dec 10 02:18:02 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
+ Test::Unit::AutoRunner#run): should not exit inside a library,
+ just return the result instead.
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_cleanup): removing C
- implementation of `cleanup`.
+ * lib/test/unit.rb: ditto.
- * ext/openssl/lib/openssl/x509.rb: adding ruby implementation of
- `cleanup`. OpenSSL::X509::StoreContext#cleanup is deprecated since
- reusing the underlying struct doesn't make sense. [ruby-dev:42546]
+ * test/runner.rb: exit with the test result.
-Thu Dec 9 20:14:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Dec 2 20:18:48 2003 Eric Sunshine <sunshine@sunshineco.com>
- * parse.y (lvar_defined_gen, shadowing_lvar_gen, dvar_defined): no
- warnings for unused method and block arguments.
- [ruby-dev:42718] [ruby-dev:42724]
+ * configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
+ instead of Bison or byacc.
-Thu Dec 9 19:25:49 2010 Tanaka Akira <akr@fsij.org>
+ * parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
+ 10000 (Bison's default) since some old versions of Yacc define it as
+ low as 150 by default, which is too low for Ruby to parse some files,
+ such as date/format.rb. Among other issues, the parse problem causes
+ "make test" to fail.
- * dln.c: parenthesize macro arguments.
+Tue Dec 2 20:03:20 2003 Minero Aoki <aamine@loveruby.net>
-Thu Dec 9 18:51:06 2010 Tanaka Akira <akr@fsij.org>
+ * test/fileutils/test_fileutils.rb: check if Pathnames are usable
+ for arguments.
- * lib/webrick/accesslog.rb (WEBrick::AccessLog#format): support
- %{remote}p for logging remote (client) port number.
- [ruby-dev:42670]
+Tue Dec 2 04:22:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Thu Dec 9 11:00:30 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * lib/test/unit/assertions.rb: fixed #assert_no_match message.
- * array.c (rb_ary_dup): should copy contents only. no instance
- variable, no class would be copied. it would affect methods
- #sort, #reject, #transpose, #uniq, #compact, and #shuffle.
- [ruby-core:33640]
+ * test/testunit/test_assertions.rb: ditto.
- * array.c (rb_ary_reverse_m): ditto.
+Tue Dec 2 00:43:00 2003 why the lucky stiff <why@ruby-lang.org>
- * array.c (rb_ary_rotate_m): ditto.
+ * ext/syck/syck.c: string buffering bug. decrementing by full
+ max_size now. [ruby-core:01834]
-Wed Dec 8 21:38:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Dec 1 21:33:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/dl/lib/dl/struct.rb: clean a warning: assigned but unused
- variable. patched by Kouhei Yanagita. [ruby-dev:42722]
+ * numeric.c (num_sadded): prohibit singleton method definition for
+ Numerics. fill yet another gap between Fixnum and Bignum.
- * ext/dl/lib/dl/import.rb: ditto.
+Mon Dec 1 17:33:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Dec 8 21:36:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * pack.c (htov16): converts endian using swap16. htov32(), hton16,
+ hton32 as well. [ruby-talk:85377]
- * parse.y (shadowing_lvar_gen): fix line number. [ruby-dev:42718]
+ * pack.c (swap16): swap 2 bytes no matter how big short is on the
+ platform. swap32() is also prepared.
-Wed Dec 8 20:37:11 2010 Tanaka Akira <akr@fsij.org>
+ * numeric.c (rb_num2int): returns long to preserve information.
+ rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
+ [ruby-talk:85377]
- * dir.c: parenthesize macro arguments.
+ * numeric.c (rb_num2uint): should not check for value range if the
+ source value is negative.
-Tue Dec 7 22:37:15 2010 Masaya Tarui <tarui@ruby-lnag.org>
+Mon Dec 1 17:14:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_read): duplicate string if shared. [ruby-dev:42719]
+ * sample/optparse/opttest.rb: added.
-Tue Dec 7 22:31:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 1 16:10:52 2003 Dave Thomas <dave@pragprog.com>
- * lib/optparse.rb (OptionParser::Officious): separate completion
- options from --help. [ruby-dev:42690]
+ * lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
- * lib/optparse.rb (OptionParser::Completion#candidate),
- (OptionParser::Switch#compsys): remove unused variables.
+Mon Dec 1 14:17:49 2003 Minero Aoki <aamine@loveruby.net>
-Tue Dec 7 22:05:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
+ Pathname for arguments. [ruby-core:01795]
- * transcode.c (transcode_loop): call default handler of the given
- hash, method, proc or [] method as fallback. [ruby-dev:42692]
+ * test/fileutils/test_fileutils.rb: does much strict test on
+ "same" files detecting.
-Tue Dec 7 21:59:37 2010 Kouhei Sutou <kou@cozmixng.org>
+Mon Dec 1 09:28:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * lib/rexml/light/node.rb: remove circular require.
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (XCFLAGS): re-export $(XCFLAGS).
-Tue Dec 7 21:56:01 2010 Kouhei Sutou <kou@cozmixng.org>
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
- * test/rexml/test_light.rb: really suppress a warning.
+Mon Dec 1 01:03:27 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Dec 7 21:51:57 2010 Kouhei Sutou <kou@cozmixng.org>
+ * lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
+ and ARCH_FLAG. [ruby-dev:22085]
- * test/rexml/test_light.rb: suppress a warning.
+Sun Nov 30 20:18:07 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Dec 7 21:14:03 2010 Tanaka Akira <akr@fsij.org>
+ * configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
+ [ruby-core:01819]
- * debug.c: parenthesize macro arguments.
+ * Makefile.in: add ARCH_FLAG to CFLAGS.
-Tue Dec 7 21:06:38 2010 Kouhei Sutou <kou@cozmixng.org>
+ * Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
- * lib/rexml/doctype.rb, test/rexml/test_doctype.rb: suppress warnings.
- [ruby-core:33305]
- Reported by Aaron Patterson. Thanks!!!
+ * lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
-Tue Dec 7 18:56:52 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
- * ext/nkf/lib/kconv.rb (String#kconv): fix typo and update rdoc.
- patched by Kouhei Yanagita [ruby-dev:42696]
+ * Makefile.in: add ARCH_FLAG to DLDFLAGS.
-Tue Dec 7 20:32:11 2010 Kouhei Sutou <kou@cozmixng.org>
+ * configure.in: should put getcwd in AC_CHECK_FUNCS, not
+ AC_REPLACE_FUNCS. [ruby-core:01826]
- * test/rexml/test_doctype.rb: add Accessor to test case name.
+Sun Nov 30 18:22:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Dec 7 20:31:02 2010 Kouhei Sutou <kou@clear-code.com>
+ * configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
+ DLDFLAGS and LDSHARED.
- * test/rexml/test_doctype.rb: Doctype -> DocType.
+ * configure.in: XCFLAGS for compiling ruby itself. ARCH_FLAG is
+ reflected in CFLAGS.
-Tue Dec 7 20:29:23 2010 Kouhei Sutou <kou@clear-code.com>
+ * lib/mkmf.rb: ditto. do not import XCFLAGS from config.status.
- * test/rexml/test_doctype_mixin.rb: rename to ...
- * test/rexml/test_doctype.rb: ... this to remove needless name.
+Sun Nov 30 17:37:36 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Dec 7 17:03:16 2010 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
- * lib/net/imap.rb (xlist): supported the XLIST command, which is an
- extension by Apple and Google. patch by Geoff Youngs.
- [ruby-core:33521]
+Sun Nov 30 13:02:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Dec 7 08:00:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
+ Conditional Expressions.
- * configure.in, win32/Makefile.sub (WERRORFLAG): flag to treat
- warnings as errors.
+ * lib/wsdl/soap/definitions.rb: refactoring - Move Method.
- * lib/mkmf.rb (Logging.postpone): yield log file object.
+ * test/xsd/{test_noencoding.rb,noencoding.xml}: new files. test for
+ encoding unspecified XML file parsing.
- * lib/mkmf.rb (xsystem): add options, :werror only right now.
+ * test/wsdl/{test_fault.rb,map,datetime}: new files. test of
+ SOAPFault, dateTime and Apache's Map.
- * lib/mkmf.rb (with_werror): check as if warnings are errors.
+Sun Nov 30 09:35:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb (convertible_int): make declaration conflict
- warnings errors not to pass wrong type. [ruby-dev:42684]
+ * string.c (rb_str_update): get rid of SEGV at just allocated String.
+ [ruby-core:01812]
- * lib/mkmf.rb (COMMON_MACROS): get rid of conflicts.
+Fri Nov 28 23:19:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/Makefile.sub (WARNFLAGS): make declaration conflict
- warnings errors if possible.
+ * gc.c (gc_mark): explicitly check mark recursion levels, instead
+ of unreliable stack length.
-Sun Dec 7 21:16:10 2010 Tanaka Akira <akr@fsij.org>
+Fri Nov 28 22:49:56 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * cont.c: parenthesize macro arguments.
+ * lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
-Tue Dec 7 00:27:14 2010 Masaya Tarui <tarui@ruby-lnag.org>
+Fri Nov 28 21:44:40 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * win32/win32.c (rb_w32_read): fixed more for readline,
- and so on. [ruby-core:33511]
+ * test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
+ a directory for FreeBSD.
-Mon Dec 6 23:18:22 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 28 19:37:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/mkmf/base.rb (TestMkmf#setup): run quietly.
+ * hash.c (env_has_value, env_index): must match exactly.
- * test/mkmf/test_find_executable.rb (test_find_executable): use
- configured results.
+ * test/ruby/test_env.rb (test_has_value, test_index): condition for
+ aboves.
- * common.mk (test-build): test for build process.
+Fri Nov 28 17:59:20 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Dec 6 22:47:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_env.rb: add tests for ENV.
- * lib/optparse.rb (OptionParser#candidate): skip separators.
+Fri Nov 28 17:47:46 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * sample/optparse/opttest.rb: should not override --help.
- [ruby-dev:42690]
+ * lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
+ DRbConnError.
-Mon Dec 6 19:00:48 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Fri Nov 28 15:41:15 2003 Tanaka Akira <akr@m17n.org>
- * misc/rb_optparse.zsh: fix typos.
+ * lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
+ argument.
-Mon Dec 6 18:59:04 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Fri Nov 28 14:41:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * NEWS: add new encodings.
+ * lib/soap/streamHandler.rb: drop unused http parameters.
-Mon Dec 6 18:56:42 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
+ lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
+ lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
+ under WSDL dynanic client environment. fixed.
- * test/ruby/test_string.rb (TestString#test_scan): add a test for
- [ruby-core:33338] #4087.
+ * test/wsdl/raa/*: add tests.
-Mon Dec 6 18:55:36 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
+ bug of soap4r. XSDDateTimeImple.to_time passed a Float to
+ Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
+ causes rounding error.
- * test/uri/test_common.rb (TestCommon#test_encode_www_form): add
- tests for r30015.
+ * test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
-Mon Dec 6 10:39:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Nov 28 04:15:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/uri/common.rb (URI::Parser#initialize_pattern):
- refix for restrict the pattern.
+ * eval.c (method_arity): used wrong Proc object. [ruby-talk:86504]
-Mon Dec 6 09:45:11 2010 Eric Hodel <drbrain@segment7.net>
+Fri Nov 28 00:47:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/openssl (OpenSSL): add toplevel documentation
- * ext/openssl/ossl_ssl.c (SSLContext, SSLSocket: add additional
- documentation
- * ext/openssl: move "let rdoc know about mOSSL" comments so they don't
- show up in output
+ * eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
+ success, false as failure. [ruby-dev:22067]
-Mon Dec 6 09:16:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
+ ANSI macro instead of hard coded value.
- * lib/uri/common.rb (URI::Parser#initialize_pattern):
- workaround fix pattern of hostname for RFC 3986. [ruby-dev:42672]
+ * eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
+ TYPEs.
-Mon Dec 6 09:14:38 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Nov 27 22:05:48 2003 Akinori MUSHA <knu@iDaemons.org>
- * lib/mkmf.rb (check_signedness): rename unused variable prelude.
+ * eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
+ process to get the base address for the RSE backing store, so
+ hardcode it for the moment.
+ [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
-Sun Dec 5 17:56:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Nov 27 17:36:42 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * class.c (make_metaclass): fix probable typo. builtin type flag
- cannot be used with FL_TEST.
+ * ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
+ TkTimer#wait recieves the exception of the callback.
+ The exception is kept on @return_value.
-Sun Dec 5 12:09:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Nov 27 16:58:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * lib/irb/init.rb (IRB.parse_opts): fix typo. [ruby-core:33574]
+ * win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
-Sun Dec 5 11:27:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 26 15:38:47 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * ruby.c (load_file_internal): decrement for ungotten line.
- [ruby-dev:42680]
+ * test/fileutils/test_fileutils.rb (test_ln_s): should take the
+ existing symbolic link for OpenBSD.
-Sun Dec 5 10:32:11 2010 Tanaka Akira <akr@fsij.org>
+Wed Nov 26 04:48:42 2003 why the lucky stiff <why@ruby-lang.org>
- * complex.c: parenthesize macro arguments.
+ * ext/syck/token.c: removed YYTOKTMP references which
+ were causing buffer overflows on large block scalars,
+ comments, quoted scalars and plain scalars.
-Sat Dec 4 11:39:17 2010 Eric Hodel <drbrain@segment7.net>
+ * ext/syck/rubyext.c: dynamic changing of buffer size.
- * ext/openssl/ossl_x509ext.c (initialize): add documentation.
+ * ext/syck/syck.h: default buffer size of 4k.
-Sat Dec 4 11:21:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 26 00:55:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * hash.c (rb_hash_update_by): new API for Hash#update.
+ * lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
-Sat Dec 4 11:18:10 2010 Tanaka Akira <akr@fsij.org>
+ * lib/webrick/httpserver.rb (HTTPServer#run): should pass the
+ request's keep_alive flag to the response.
- * class.c: parenthesize macro arguments.
+Tue Nov 25 21:41:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Sat Dec 4 11:07:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * defines.h (ENV_IGNORECASE): should define when DOSISH without
+ human68k. [ruby-dev:22047]
- * vm_core.h (rb_vm_inc_const_missing_count): missing prototype.
+ * hash.c (env_has_value, env_index): don't ignore case of value.
+ [ruby-dev:22048]
-Sat Dec 4 08:50:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Nov 25 21:39:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/iconv/iconv.c (Init_iconv): no warnings if $VERBOSE is nil.
+ * file.c (path_check_1): honor sticky bits always.
+ [ruby-talk:86273]
-Sat Dec 4 08:25:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Nov 25 20:02:14 2003 Minero Aoki <aamine@loveruby.net>
- * vm_insnhelper.c (vm_call_method): revert r30064 and r30071,
- because of [ruby-core:26761]. Bug#4106 rejected.
+ * test/fileutils/test_fileutils.rb: do test in more deep
+ directory.
-Sat Dec 4 07:46:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/fileutils/test_nowrite.rb: ditto.
- * lib/mkmf.rb (String#tr_cpp): substitute * with P like as
- autoconf.
+Tue Nov 25 19:04:23 2003 Tanaka Akira <akr@m17n.org>
-Fri Dec 3 22:36:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
+ refined.
- * vm_insnhelper.c (vm_call_method): protected methods should be
- checked against the real class.
+Tue Nov 25 18:13:30 2003 Minero Aoki <aamine@loveruby.net>
-Fri Dec 3 20:23:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
+ test. [ruby-dev:22045]
- * lib/mkmf.rb (convertible_int): define printf format prefix too.
+ * test/fileutils/test_nowrite.rb: ditto.
- * lib/mkmf.rb (convertible_int): detect convertible integer type.
- port RUBY_REPLACE_INT from configure.in.
+Tue Nov 25 17:52:11 2003 Tanaka Akira <akr@m17n.org>
- * lib/mkmf.rb (check_sizeof): should return integer always.
+ * lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
+ if the environment variable is case sensitive.
-Fri Dec 3 12:54:48 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Nov 25 16:41:33 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * win32/Makefile.sub (RCFLAGS): VC10 and after only. fixed the problem
- of r30015. [ruby-core:33530]
+ * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
+ removed. this test requires extra libraries in soap4r/1.5.*.
-Fri Dec 3 12:41:52 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Tue Nov 25 16:24:42 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * gc.c (rb_objspace_free): With our "lazy-sweep" GC engine, it is
- possible for an object to survive until its surrounding object
- space is about to be freed. Those objects, if any, remains
- leaked for the rest of a process life. This is problematic
- because for instance a T_DATA object may have its own destructor
- to terminate something.
+ * lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
+ GPL2 -> Ruby's.
- * vm.c (ruby_vm_destruct): ruby_current_vm termination should be
- somewhere after rb_objspace_free for above reason.
+ * lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
+ lib/soap/streamHandler.rb: add interface to streamhandler.
-Fri Dec 3 12:17:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/marshal.rb: raise error if parse fails.
- * vm_insnhelper.c (vm_call_method): protected singleton methods should
- be visible from same real class methods. [ruby-core:33506]
+ * lib/soap/netHttpClient.rb: add https support. Patched by
+ Oliver M. Bolzer.
-Fri Dec 3 07:08:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
- * ext/stringio/stringio.c (strio_getline): round upto next char
- boundary. [ruby-dev:42674]
+ * lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
+ lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
+ using charset for parsing response from buggy server.
-Fri Dec 3 06:52:46 2010 Tanaka Akira <akr@fsij.org>
+ * lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
+ typed multi-ref array.
- * compile.c: parenthesize macro arguments.
+ * lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
+ SOAPStruct which has multi-accessors which name are the same, to an
+ array.
-Fri Dec 3 04:08:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/soap/rpc/element.rb: fixed illegal parameter order.
- * encoding.c (enc_alias_internal): use st_insert2 and change return
- value to int.
+ * lib/soap/rpc/element.rb: element name of response message could have
+ the name other than 'return'.
- * encoding.c (enc_alias): follow enc_alias_internal.
+ * lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
+ lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
+ lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
+ fault definition in a operation. [ruby-talk:84948]
-Fri Dec 3 01:52:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
+ test for above fix.
- * encoding.c (enc_alias_internal): use xfree instead of free.
+ * lib/wsdl/soap/complexType.rb: support WSDL array definition with
+ maxOccures="unbound".
-Thu Dec 2 23:52:26 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * lib/xsd/charset.rb: use cp932 under emx. Patched by
+ Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
- * NEWS: entry for ruby_vm_at_exit().
+ * lib/xsd/xmlparser/parser.rb: set @charset nil by default. Nil means
+ 'follow encoding declaration in XML'.
- * eval.c (ruby_cleanup): bug fix around at_exit (1) timing was
- wrong. (2) execution order was opposite.
+ * sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
+ sample/wsdl/googleSearch/sampleClient.rb,
+ sample/wsdl/googleSearch/wsdlDriver.rb,
+ test/wsdl/test_emptycomplextype.rb,
+ test/wsdl/marshal/test_wsdlmarshal.rb,
+ test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
+ instead of File.open(...).read. [ruby-dev:21964]
-Thu Dec 2 23:05:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
+ simplify the test case.
- * win32/Makefile.sub (RCFLAGS): -nologo switch is only available in
- newer versions of rc.exe. fixed the problem of r30012.
+ * test/wsdl/axisArray/*: add tests for axis's array encoding.
-Thu Dec 2 21:28:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Nov 25 16:15:29 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * ext/json/lib/json/add/rails.rb: removed.
+ * ruby.h: don't treat Cygwin as Windows.
-Thu Dec 2 21:22:05 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Nov 25 15:18:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * encoding.c (enc_alias_internal): free the copied key and
- return NULL when given key is already registered.
+ * configure.in: change default value of --enable-pthread (default: no)
- * encoding.c (enc_alias): call set_encoding_const only when the
- alias is not registered yet.
+Tue Nov 25 07:31:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Dec 2 19:58:24 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * parse.y (primary): allow newlines just before right argument
+ parenthesis. (ruby-bugs:PR#1221)
- * vm.c (ruby_vm_at_exit): new API. This enables extension libs to
- hook a VM termination. Right now, because the VM we have is
- process global, most extensions do not deallocate resources and
- leave them to Operating System's reaping userland processes. But
- in a future we plan to have multiple VMs to run simultaneously in
- a single process (MVM project). At that stage we can no longer
- rely on OSes and have to manage every resources to be reclaimed
- properly. So it is. For a forward-compatibility reason this API
- is introduced now, encouraging you to be as gentle as you can for
- your resources; that is, tidy up your room.
+Mon Nov 24 23:32:06 2003 Tanaka Akira <akr@m17n.org>
- * include/ruby/vm.h: ditto.
+ * lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
+ catch/throw for redirection instead of exception.
+ (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
- * vm_core.h (rb_vm_struct): new field.
+Mon Nov 24 19:59:48 2003 Tanaka Akira <akr@m17n.org>
- * vm.c (vm_init2): initialize above new field.
+ * lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
+ instead of HTTP_PROXY in the CGI environment.
- * eval.c (ruby_cleanup): trigger those hooks.
+Mon Nov 24 19:32:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Dec 2 17:00:44 2010 Tanaka Akira <akr@fsij.org>
+ * ext/etc/extconf.rb: check for pw_passwd in struct passwd and
+ gr_passwd in struct group for DJGPP.
- * bignum.c: parenthesize macro arguments.
+ * ext/etc/etc.c: ditto.
-Thu Dec 2 15:31:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/Setup.dj: support for curses, etc, zlib.
- * win32/win32.c (rb_w32_read): more fix. [ruby-core:33513]
+Mon Nov 24 17:00:00 2003 Tanaka Akira <akr@m17n.org>
-Thu Dec 2 13:41:43 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/open-uri.rb: validate option names.
+ :content_length_proc and :progress_proc option implemented.
- * win32/win32.c (rb_w32_read): workaround for console reading troubles.
- fixed [ruby-core:33511]
+Mon Nov 24 14:53:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 2 13:10:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
- * lib/uri/common.rb (URI.encode_www_form):
- split key-value when the value is Array like object.
+Sat Nov 22 23:09:45 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Thu Dec 2 10:39:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in: set enable_pthread to no on MinGW.
- * lib/net/http.rb (Net::HTTP#set_form_data):
- use URI.encode_www_form for application/x-www-form-urlencoded.
+Sat Nov 22 22:56:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Dec 2 10:38:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in: add --enable-pthread option (default: yes)
- * ext/extmk.rb: remove $makeflags.defined?, it should be $mflags.
+Sat Nov 22 22:48:46 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Thu Dec 2 10:19:47 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
- * win32/Makefile.sub (rc): suppress meaningless message.
+ * ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
-Thu Dec 2 10:09:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/sample/tkcombobox.rb: new sample script
- * ext/json/generator/extconf.rb: remove the lines which set -O3
- when -O option is not set.
- Note that -O3 doesn't always exist.
+ * ext/tcltklib/tcltklib.c: add native thread check
- * ext/json/parser/extconf.rb: ditto.
+Sat Nov 22 18:49:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 2 10:01:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
+ libcruses returns no value, just like keypad().
- * ext/extmk.rb: define $makeflags.defined? like $mflags.
+Sat Nov 22 17:36:36 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Dec 2 07:20:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (HAVE_GETCWD): output to config.h.
- * lib/test/unit.rb (Test::Unit::GCStressOption): --gc-stress
- option.
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (XCFLAGS): output to config.status.
- * lib/test/unit.rb (Test::Unit::Mini#_run_suites): show the result
- even when interrupted on the way.
+Sat Nov 22 13:10:10 2003 Minero Aoki <aamine@loveruby.net>
-Thu Dec 2 07:08:38 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
- * ext/io/console/console.c (setattr): should retry on EINTR.
- [ruby-dev:42666]
+Sat Nov 22 11:28:48 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Dec 2 02:30:50 2010 Eric Hodel <drbrain@segment7.net>
+ * gc.c (Init_stack): stack region is far smaller than usual if
+ pthread is used.
- * lib/net/http.rb: fixed positional wording to match revised order.
+Sat Nov 22 07:30:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Thu Dec 2 01:24:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
+ when an exception had no backtrace.
- * ext/json/lib/json/common.rb: don't use iconv on 1.9.
- patched by Shota Fukumori [ruby-core:33164]
+ * test/testunit/util/test_backtracefilter.rb: ditto.
-Thu Dec 2 01:02:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Nov 21 16:44:18 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/json: Update github/flori/json from 1.4.2+ to
- e22b2f2bdfe6a9b0. this fixes some bugs.
+ * ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
+ substitutions on validatecommand option of TkEntry widget
-Thu Dec 2 00:05:44 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
- * lib/net/http.rb: improve rdoc.
- This change the order of chapter because such overview should
- begin with simple examples.
- patched by Eric Hodel [ruby-core:33469]
+Fri Nov 21 16:12:11 2003 Akinori MUSHA <knu@iDaemons.org>
-Wed Dec 1 22:01:49 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ruby.1: Fix markups and grammar.
- * numeric.c (Init_Numeric): fixed a potential bug when using bccwin32
- ruby with Microsoft's dll, though we already gave up of supporting
- bccwin32. [ruby-core:33503]
+Fri Nov 21 14:49:42 2003 Minero Aoki <aamine@loveruby.net>
-Wed Dec 1 21:43:21 2010 Tanaka Akira <akr@fsij.org>
+ * ruby.1: wrote about ruby related environment variables.
- * array.c: parenthesize macro arguments.
+Fri Nov 21 12:28:03 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Dec 1 21:41:57 2010 Tanaka Akira <akr@fsij.org>
+ * marshal.c (w_extended): singleton methods should not be checked
+ when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
- * test/socket/test_addrinfo.rb: extract Errno::EADDRINUSE as a method.
+Fri Nov 21 01:40:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/socket/test_socket.rb: ditto.
+ * configure.in: check <pthread.h>
-Wed Dec 1 15:08:32 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ruby.h: include pthread.h if existence.
+ define is_ruby_native() macro when not HAVE_NATIVETHREAD
- * test/openssl/test_ssl.rb (test_not_started_session): non socket
- argument of SSLSocket.new is not supported on Windows.
+ * eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
-Wed Dec 1 14:36:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 21 00:43:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * string.c (rb_memhash): zero-filled strings should return
- different values. [ruby-core:33500]
+ * lib/test/unit/assertions.rb: use #__send__ instead of #send.
-Wed Dec 1 14:27:49 2010 Ryan Davis <ryand-ruby@zenspider.com>
+ * lib/test/unit/testcase.rb: ditto.
- * lib/minitest/*.rb: Imported minitest 2.0.0 r5952.
- * test/minitest/*.rb: ditto.
- * lib/test/unit.rb: Compatibility fix for minitest changes.
+Thu Nov 20 19:19:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Wed Dec 1 10:16:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in: don't find the Cygwin's pthread library on MinGW.
- * string.c (rb_str_inspect): fix typo (not 0xFD but 0xFE).
+Thu Nov 20 19:15:50 2003 Minero Aoki <aamine@loveruby.net>
-Wed Dec 1 09:28:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
+ have st_ino (always 0). [ruby-dev:21972]
- * addr2line.c: Follow .gnu_debuglink section.
- A user of distribution provided ruby will see line
- info if s/he has a debug package for ruby.
- patched by Shinichiro Hamaji [ruby-dev:42655]
+ * lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
+ allow overwriting files by rename(2).
-Wed Dec 1 01:29:15 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/fileutils/test_fileutils.rb: windows? ->
+ have_drive_letter?, have_file_perm?
- * string.c (rb_str_inspect): inspect as a dummy encoding string
- when a UTF-16/32 (not BE/LE) string does not have a BOM.
- Unicode and some RFCs say that a string labeled as UTF-16/32
- doesn't have a BOM, it should be considered big endian.
- But many Windows programs generates little endian UTF-16
- strings without a BOM. So String#inspect treats a string
- labeled UTF-16/32 without a BOM as a dummy encoding string.
- patched by Martin Duerst. [ruby-core:33461]
+Thu Nov 20 17:50:58 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Nov 30 17:04:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/sample/tkballoonhelp.rb: new sample script
- * addr2line.c (parse_debug_line_cu): ignore DW_LNE_set_discriminator.
- To ignore, it needs to read a single unsigned LEB128 integer.
+ * ext/tk/sample/tkmultilistbox.rb: ditto
-Tue Nov 30 16:29:19 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/sample/tktextframe.rb: ditto
- * vm_dump.c: undef HAVE_BACKTRACE when the OS is FreeBSD (in other
- words backtrace() is libexecinfo) and it is optimized.
- This temporary hack may be also applied to other libexecinfo
- environments.
+Thu Nov 20 13:37:34 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Nov 30 16:23:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ruby.h: define is_ruby_native_thread() for no native thread
+ environment
- * lib/net/http.rb: improve rdoc.
- patched by Eric Hodel ref #4100
+ * eval.c: ditto
-Tue Nov 30 12:23:52 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 20 12:42:47 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * win32/win32.c (rb_w32_read): read only 1 byte at once on console.
- workaround of Windows bug. see [ruby-core:33460].
- this is not the final solution.
+ * configure.in: always check existence of the pthread library
-Tue Nov 30 11:39:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ruby.h: define macros for ruby's native thread check
- * lib/net/http.rb: improve rdoc.
- patched by mathew murphy [ruby-core:33472] ref #4100
+ * eval.c: add ruby's native thread check
-Tue Nov 30 05:03:44 2010 Eric Hodel <drbrain@segment7.net>
+ * gc.c: ditto
- * lib/uri/common.rb (encode_www_form, encode_www_form_component):
- Improve English in documentation.
+Wed Nov 19 14:45:18 2003 Minero Aoki <aamine@loveruby.net>
- * ext/openssl/ossl_ssl.c (ssl_version=, ciphers=): Document
- #ssl_version=, add documentation for #ciphers=.
+ * lib/net/http.rb (to_ary): print more friendly warning message.
-Mon Nov 29 22:55:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 19 14:32:08 2003 Minero Aoki <aamine@loveruby.net>
- * lib/uri/common.rb (URI::WFKV_): get rid of backtrack explosion
- by nested repeat operators. [ruby-core:33464]
+ * lib/fileutils.rb (fu_same?): add djgpp and wince.
-Mon Nov 29 22:53:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb (cannot_overwrite_file?): add wince.
- * win32/Makefile.sub (scriptbin.mk): fix generated rules.
+Wed Nov 19 11:04:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * win32/win32.c (rb_w32_write_console): fix argument type.
+ * lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
+ is same as mswin32.
-Mon Nov 29 21:12:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 19 07:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * misc/ruby-mode.el (ruby-forward-sexp): stop after literal hash
- key labels.
+ * lib/test/unit.rb: do not run tests if $! is set.
- * misc/ruby-mode.el (ruby-font-lock-keywords): highlight literal
- hash key labels as symbols.
+ * lib/test/unit/assertionfailederror.rb: extend StandardError instead
+ Exception (irb catches the former but not the latter).
-Mon Nov 29 18:31:31 2010 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue Nov 18 23:31:36 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/ruby/test_transcode.rb (test_unicode_public_review_issue_121):
- - Removed commented-out options that are no longer under discussion.
- - Added two more tests for forthcomming clarifications.
+ * missing/memmove.c (memmove): take void *, not char *.
-Mon Nov 29 14:31:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * missing.h (memmove): ditto.
- * win32/win32.c (rb_w32_isatty): use GetConsoleMode() to determine the
- fd is console or not, just like rb_w32_write_console(). [experimental]
+ * missing.h (strchr, strrchr): return char *, not int.
-Mon Nov 29 14:19:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Nov 18 22:20:10 2003 Minero Aoki <aamine@loveruby.net>
- * include/ruby/win32.h (rb_w32_write_console): wrong prototype.
+ * lib/fileutils.rb (fu_same?): temporal fix for windows.
-Mon Nov 29 14:10:55 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Nov 18 19:05:04 2003 Minero Aoki <aamine@loveruby.net>
- * win32/win32.c (rb_w32_write_console): fixed indentation.
+ * lib/fileutils.rb (fu_same?): check by inode instead of path
+ name, to detect two hard links pointing to the same content.
-Sun Nov 28 22:13:39 2010 Koichi Sasada <ko1@atdot.net>
+ * test/fileutils.rb: did not create correctly looped symlinks.
- * thread_pthread.c (NATIVE_MUTEX_LOCK_DEBUG): move and use it.
+Tue Nov 18 18:23:05 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ChangeLog: fix my timezone.
+ * ext/stringio/stringio.c (strio_read): behave as IO at empty string.
+ [ruby-dev:21939], [ruby-dev:21941]
-Mon Nov 28 21:58:58 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
- * thread_pthread.c: remove pthread_atfork().
+ * ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
+ clear EOF flag.
-Mon Nov 28 21:54:22 2010 Koichi Sasada <ko1@atdot.net>
+ * test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
- * thread_pthread.c (native_cond_*): Check return code.
- (Some OSes except Linux return error code).
+Tue Nov 18 14:06:35 2003 Minero Aoki <aamine@loveruby.net>
-Sun Nov 28 21:46:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
+ [ruby-talk:85344] [ruby-core:01699]
- * thread_pthread.c (thread_start_func_1): initialize native thread
- data immediately before starting.
+ * lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
+ e.g. remote objects for receivers.
-Sun Nov 28 14:56:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/fileutils.rb: FileTest -> File.
- * io.c (struct argf): make lineno long, and reorder members.
+ * lib/fileutils.rb: put parentheses for arguments of File.xxxx?
-Sun Nov 28 14:55:42 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
- * thread_win32.c (gvl_release, gvl_init): suppress warnings.
+ * test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
-Sun Nov 28 14:48:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
- * thread_pthread.c (gvl_release, gvl_init): suppress warnings.
+ * test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
- * vm_core.h (rb_vm_gvl_destroy): add prototype.
+ * test/fileutils/test_fileutils.rb (test_install): test "install a a".
-Sun Nov 28 14:46:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/fileutils/fileasserts.rb: new method assert_symlink.
- * thread_pthread.c (gvl_reinit): register atfork handler only in
- the parent process, to get rid of dead lock.
+ * test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
-Sun Nov 28 12:23:57 2010 Koichi Sasada <ko1@atdot.net>
+Mon Nov 17 19:38:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread.c, vm_core.h: make gvl_acquire/release/init/destruct
- APIs to modularize GVL implementation.
+ * file.c (getcwdofdrv): avoid using getcwd() directly, use
+ my_getcwd() instead.
- * thread_pthread.c, thread_pthread.h: Two GVL implementations.
- (1) Simple locking GVL which is same as existing GVL.
- (2) Wake-up queued threads. The wake-up order is simple FIFO.
- (We can make several queues to support exact priorities, however
- this causes some issues such as priority inversion and so on.)
- This impl. prevents spin-loop (*1) caused on SMP environments.
- *1: Only one Ruby thread acquires GVL again and again.
- Bug #2359 [ruby-core:26694]
+ * merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
+ <sunshine@sunshineco.com>. [ruby-core:01596]
- * thread_win32.c, thread_win32.h: Using simple lock
- not by CRITICAL_SECTION but by Mutex.
- Bug #3890 [ruby-dev:42315]
+Mon Nov 17 10:50:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm.c (ruby_vm_destruct): ditto.
+ * lib/optparse.rb (OptionParser::Completion::complete): allow least
+ common completion for three or more candidates.
-Sun Nov 28 04:40:00 2010 Luis Lavena <luislavena@gmail.com>
+Mon Nov 17 09:41:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_fwrite): use rb_w32_write_console under Windows.
+ * lib/test/unit/ui/tk/testrunner.rb,
+ lib/test/unit/ui/gtk/testrunner.rb:
+ run GUI main loop in sub thread.
- * win32/win32.c (rb_w32_write_console): added to write to write
- Unicode using WriteConsoleW for stdout/stderr. [ruby-core:33166]
+ * lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
-Sun Nov 28 03:58:47 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/autorunner.rb (keyword_display): sort keywords.
- * lib/net/http.rb: improve rdoc.
- patched by Mike Perham [ruby-core:33433]
+Sun Nov 16 18:10:57 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Nov 27 19:12:10 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_eval): iterator should return value from next inside
+ begin/rescue/end. (ruby-bugs:PR#1218)
- * time.c: parenthesize macro arguments.
+Sun Nov 16 13:26:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Nov 27 18:08:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * marshal.c (w_object): LINK check earlier than anything else,
+ i.e. do not dump TYPE_IVAR for already dumped objects.
+ (ruby-bugs:PR#1220)
- * time.c (leap_year_v_p): fixed typo. [ruby-dev:42631]
+ * eval.c (rb_eval): call "inherited" only when a new class is
+ generated; not on reopening.
-Sat Nov 27 17:57:08 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (eval): prepend error position in evaluating string to
+ "mesg" attribute string only when it's available and is a
+ string.
- * resolv.rb (Resolv::DNS): use the same DNS server when retry using
- TCP. reported by Julian Mehnle. [ruby-core:32970]
+Sun Nov 16 12:16:10 2003 Minero Aoki <aamine@loveruby.net>
-Sat Nov 27 15:45:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/protocol.rb: logging response body. [experimental]
+ [ruby-list:38800]
- * vm_dump.c (rb_vm_bugreport): see CrashReport log on Mac OS X.
+Sun Nov 16 10:49:38 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
- * configure.in: link addr2line only for ELF.
+ * lib/thread.rb (Thread.exclusive): wrap method definition in
+ class Thread to enable rdoc to process.
-Sat Nov 27 13:58:55 2010 Shugo Maeda <shugo@ruby-lang.org>
+Sun Nov 16 09:45:23 2003 Minero Aoki <aamine@loveruby.net>
- * lib/optparse.rb (OptionParser#candidate): : was missing. Thanks,
- Shota Fukumori. [ruby-dev:42634]
+ * lib/net/http.rb (set_debug_output): warn if method is called
+ after #start. [ruby-dev:38798]
-Sat Nov 27 12:07:05 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sun Nov 16 04:41:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * man/ruby.1: Ruby man page from Arthur Gunn in [ruby-core:33412]
+ * eval.c (eval): do not re-raise exception to avoid unnecessary
+ exception copying, instead modify exception and internal
+ information to adjust eval().
-Sat Nov 27 11:29:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (backtrace): can return the current frame information
+ only if lev < -1.
- * lib/optparse.rb (OptionParser#candidate): get rid of 1.9 syntax
- so that BASERUBY can be 1.8.
+Sat Nov 15 22:16:42 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Nov 27 08:16:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
+ refine error message.
- * addr2line.c (rb_dump_backtrace_with_lines): should close fd on
- edge case.
+Sat Nov 15 10:05:40 2003 Tanaka Akira <akr@m17n.org>
-Fri Nov 26 13:33:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
+ refactored to support options.
+ (Buffer): maintain size by this class.
- * addr2line.c: apply a patch from shinichiro.h.
+Sat Nov 15 07:40:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Nov 26 12:21:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_method_node): new API to retrieve method body.
- * addr2line.c: added to show source filename and line number of
- functions in backtrace. [ruby-dev:42625]
- a patch from shinichiro.h <shinichiro.hamaji AT gmail.com>
+Fri Nov 14 13:21:30 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * addr2line.h: ditto.
+ * ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
- * common.mk: add addr2line.$(OBJEXT).
+ * ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
+ argument [ruby-talk:85066]
- * configure.in: check dl_iterate_phdr.
+Thu Nov 13 20:53:35 2003 Tanaka Akira <akr@m17n.org>
- * vm_dump.c (rb_vm_bugreport): use rb_dump_backtrace_with_lines in
- addr2line.c when the binary is ELF.
+ * lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
+ [ruby-ext:02251]
-Fri Nov 26 12:12:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Nov 13 19:17:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * regcomp.c (setup_tree): restart setup_tree() for a node whose
- AnchorNode's type is ANCHOR_PREC_BEHIND or ANCHOR_PREC_BEHIND_NOT
- and divide_look_behind_alternatives() divided it to NT_ALT or
- NT_LIST. [ruby-core:33370]
+ * lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
+ (if available)
-Fri Nov 26 11:40:11 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 13 17:56:41 2003 Tanaka Akira <akr@m17n.org>
- * vm_dump.c (dump_thread): get only required rights of the target
- thread because THREAD_ALL_ACCESS causes an access error on XP.
- reported by Masaya TARUI via IRC.
+ * lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
+ reported by Take_tk <ggb03124@nifty.ne.jp>.
+ [ruby-ext:02245]
-Fri Nov 26 11:09:07 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 13 16:45:53 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * vm_dump.c (dump_thread): show the displacement from the beginning
- of the symbol.
+ * ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
+ X509::Request#to_der.
-Fri Nov 26 10:48:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 13 11:31:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm_dump.c (dump_thread): follow the output of glibc.
- see [ruby-dev:42627]
+ * lib/optparse.rb (OptionParser::Completion#complete): prior shorter
+ name to containing longer name.
-Fri Nov 26 09:48:45 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Nov 13 06:08:54 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * re.c (rb_reg_initialize_str): should succeed the taint status from
- the origin. [ruby-core:33338]
+ * ext/tk/lib/tk.rb: stop freezing some classes
-Fri Nov 26 09:32:37 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/multi-tk.rb: ditto.
- * vm_dump.c (dump_thread): seems to be necessary the 3rd argument of
- SymGetLineFromAddr64(), even though MSDN says it can be zero.
+Wed Nov 12 17:32:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Nov 26 09:03:38 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
+ uncaught throw in sub thread raises ThreadError.
- * regcomp.c (onig_is_prelude): added to check whether ruby is still
- in prelude (or other boot processes) or not.
+ * lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
+ necessary.
- * regcomp.c (optimize_node_left): use onig_is_prelude for printing.
+Wed Nov 12 14:09:43 2003 Shugo Maeda <shugo@ruby-lang.org>
- * regcomp.c (set_optimize_info_from_tree): ditto.
+ * test/monitor/test_monitor.rb: fix the timing problem by Queue.
- * regcomp.c (onig_compile): ditto.
+Wed Nov 12 12:59:44 2003 Shugo Maeda <shugo@ruby-lang.org>
- * regcomp.c (print_compiled_byte_code_list): print its address.
+ * test/monitor/test_monitor.rb: added.
- * regcomp.c (print_indent_tree): print its contents tree of
- ANCHOR_PREC_READ(_NOT) and ANCHOR_PREC_BEHIND(_NOT).
+Wed Nov 12 10:14:28 2003 Shugo Maeda <shugo@ruby-lang.org>
-Thu Nov 25 23:10:49 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
- * regcomp.c (print_distance_range): use PRIuSIZE.
+Wed Nov 12 06:11:39 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * regcomp.c (print_optimize_info): use %ld because the type of
- calculated value of integers is long.
+ * ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
+ add functions to convert STACK into Array.
- * regexec.c (onig_print_compiled_byte_code): add prototype.
+ * ext/openssl/ossl.h: add prototypes.
- * regexec.c (match_at): add 2nd argument.
+ * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
+ ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
+ ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
+ PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
-Thu Nov 25 10:29:55 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Nov 12 00:47:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * ext/dl/callback/mkcallback.rb (gencallback): shouldn't assume that
- VALUE is the same size with long.
+ * lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
-Thu Nov 25 10:03:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Nov 11 23:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * test/win32ole/test_err_in_callback.rb (teardown): remove tmp file
- only when it exists.
+ * lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
+ the case when the requested font is not available.
-Thu Nov 25 01:38:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Nov 11 22:44:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * enc/trans/big5-hkscs-tbl.rb: Update table as HKSCS-2008.
- patched by oCameLo oTnTh [ruby-core:33256]
+ * io.c (appendline): file may not end with newline. a bug if
+ READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
- * enc/big5.c: add alias Big5-HKSCS:2008 to Big5-HKSCS.
+Tue Nov 11 10:42:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Nov 24 15:18:07 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tk/lib/tk.rb: raise an exception when creating TkWindow
+ object, because TkWindow class is an abstract class.
- * vsnprintf (BSD_vfprintf): use QUADINT macro only when _HAVE_SANE_QUAD_
- macro is defined.
+Tue Nov 11 03:30:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Nov 24 12:47:16 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
+ if the specified value doesn't exist.
- * vsnprintf (BSD_vfprintf): added VC++ compatible size specifications
- (I, I32, I64).
+ * lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
+ a empty hash if the specified section doesn't exist.
-Wed Nov 24 11:19:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Nov 10 11:40:29 2003 Shugo Maeda <shugo@ruby-lang.org>
- * string.c (rb_str_inspect): treat UTF-16 and UTF-32 as BE or LE.
+ * lib/monitor.rb (wait): return true on signal/broadcastfalse and
+ false on timeout. Thanks Gennady Bystritsky.
-Wed Nov 24 06:35:32 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Nov 10 00:07:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * enc/trans/utf_16_32.trans: add the UTF-32 converter.
+ * parse.y (primary): primary_value may be 0 when syntax error.
+ [ruby-talk:84893]
-Wed Nov 24 05:40:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Nov 9 02:05:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Wed Nov 24 06:13:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
+ maintain symmetry with #assert_nil. Also added better output for
+ #assert_kind_of.
- * win32/win32.c (filecp, wstr_to_mbstr, mbstr_to_wstr):
- refactored.
+ * test/testunit/tc_assertions.rb: ditto.
-Wed Nov 24 05:40:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Nov 8 18:50:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * enc/trans/utf_16_32.trans: add a converter from UTF-8 to UTF-16.
+ * test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
+ reading.
-Wed Nov 24 03:21:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/soap/marshal/*: backport from soap4r/1.5.1. all differences are
+ for ruby/1.6.
- * enc/trans/utf_16_32.trans: raise error on unpaired upper
- surrogates.
+ * lib/soap/*: backport from soap4r/1.5.1. all differences are for
+ ruby/1.6.
-Wed Nov 24 01:40:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
+ ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
+ [ruby-talk:84813]
- * enc/utf_16_32.h: add UTF-16 and UTF-32 as a dummy encoding.
+ * lib/wsdl/soap/definitions.rb: element name typo in custom exception
+ struct definition which is needed for wsdlDriver; camelCase ->
+ underscore_name.
- * enc/trans/utf_16_32.trans: add a converter from UTF-16 to UTF-8.
+Sat Nov 8 13:49:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Tue Nov 23 21:59:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: improvement of pthread check
- * win32/win32.c (wlink, rb_w32_getppid): use typedef instead of
- repeating complicated function prototypes.
+Sat Nov 8 13:28:46 2003 Takaaki Tateishi <ttate@ttsky.net>
+ * ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
+ Thanks, Kaoru Shirai.
-Tue Nov 23 18:54:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Nov 8 06:19:38 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * vm.c (rb_thread_mark): should mark self in control
- frames. [ruby-core:33289]
+ * ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
+ TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
+ (queueing a handler to the EventQueue).
-Tue Nov 23 07:57:31 2010 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
- * lib/date/delta/parser.{ry,rb}: fixed a bug of token scanner.
+Fri Nov 7 23:23:04 2003 Tanaka Akira <akr@m17n.org>
-Tue Nov 23 07:29:24 2010 Tadayoshi Funaba <tadf@dotrb.org>
+ * lib/pathname.rb (Pathname#+): if self or the argument is `.', return
+ another.
+ (Pathname#parent): if self is `.', return `..'.
+ (Pathname#children): if self is `.', don't prepend self for a
+ pathname in a result.
+ (Pathname#join): re-implemented using Pathname#+.
+ (Pathname#find): if self is `.', remove `./' prefix of yielding
+ pathname.
- * complex.c, rational.c ({nucomp,nurat}_expt): added a check.
+Fri Nov 7 10:23:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Nov 23 07:27:27 2010 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
+ lookup failure. (ruby-bugs:PR#1215)
- * lib/date.rb (daynum): should be private.
+Fri Nov 7 04:08:05 2003 UENO Katsuhiro <katsu@blue.sky.or.jp>
-Tue Nov 23 07:22:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
+ an alias of Zlib::GzipReader#each.
- * ChangeLog (change-log-indent-text): hanging indent.
+Fri Nov 7 01:03:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Nov 23 06:30:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_load): save and restore rb_prohibit_interrupt.
+ [ruby-dev:21857]
- * configure.in (SITE_DIR, VENDOR_DIR),
- version.c (ruby_initial_load_paths): exclude directories that
- are configured without them from $LOAD_PATH. [ruby-core:33267]
+Thu Nov 6 18:05:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (rubylibprefix): No ruby, No libprefix.
+ * io.c (rb_io_inspect): show the path also at a closed file.
+ [ruby-dev:21851]
-Tue Nov 23 01:05:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Nov 6 11:42:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vsnprintf.c (BSD_vfprintf): don't output floating point
- when the precision is 0. [ruby-dev:42615]
+ * ext/stringio/stringio.c (strio_set_string, strio_reopen): check
+ tainted.
-Mon Nov 22 21:30:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
+ strio_putc): add infection.
- * string.c (rb_str_inspect): fix for ascii-compatible external
- encoding and different encoding string. [ruby-core:33283]
+ * ext/stringio/stringio.c (strio_path): just nil. [ruby-dev:21846]
-Mon Nov 22 18:45:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (proc_options): reserve searched script path in the
+ source file name table. [ruby-list:38765]
- * lib/mkmf.rb (create_makefile): should not duplicate rules.
- bug fix of r29842.
+ * lib/optparse.rb (OptionParser::Completion#complete): default not to
+ ignore case on completion. [ruby-talk:84726]
-Mon Nov 22 18:04:40 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/win32.c (make_cmdvector): process backslashes even if a quote
+ is not enclosed.
- * enc/big5.c: split CP950 from Big5.
+Wed Nov 5 23:49:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * enc/big5.c: split CP951 from Big5-HKSCS.
+ * sample/openssl/gen_csr.rb: there (at least) is a CA which does not
+ accept DN in UTF8STRING format. it's a sample.
- * enc/trans/big5.trans: import conversion table of Big5, Big5-HKSCS,
- CP950, and CP951 from ICU. they need fallback conversions.
- ref [ruby-core:33256]
- http://source.icu-project.org/repos/icu/data/trunk/charset/data/ucm/
+Wed Nov 5 22:55:16 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * tool/transcode-tblgen.rb (import_ucm): add to import ucm files.
+ * configure.in, eval.c, signal.c: : add '--with-pthread-ext'
+ option to fix the pthread trouble on 'tcltklib'
-Mon Nov 22 18:33:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
- * string.c (rb_str_inspect): append for each chars instead of bulk
- copy if encoding conversion is needed. [ruby-core:33283]
+ * ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
+ to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
-Mon Nov 22 14:22:45 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
+ tk_menuSetFocus
- * time.c (time_zone): use rb_locale_str_new_cstr to set encoding
- as locale and convert its content to internal encoding.
- [ruby-core:33278]
+Wed Nov 5 17:33:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Nov 22 11:58:11 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_load): allow interrupt during loaded program
+ evaluation. [ruby-dev:21834]
- * string.c (rb_str_concat): set ENC_CODERANGE_VALID when the
- receiver is 7BIT and the argument is non ASCII.
+ * hash.c (rb_hash_fetch): always warn if default argument and a
+ block are supplied at the same time. [ruby-dev:21842]
-Mon Nov 22 01:48:58 2010 Tadayoshi Funaba <tadf@dotrb.org>
+ * hash.c (env_fetch): ditto.
- * lib/date.rb: some improvements for performance.
+ * array.c (rb_ary_fetch): ditto.
-Sat Nov 20 07:45:50 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+Wed Nov 5 19:08:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/mkmf.rb: adding compilation support for ObjC/ObjC++ extensions.
- Thanks Scott Gonyea! [ruby-core:33260]
+ * lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
+ do not remove next argument if empty value is placed.
-Sat Nov 20 01:57:55 2010 Akio Tajima <artonx@yahoo.co.jp>
+ * test/optparse: added.
- * common.mk: add dependency(insns.inc) to compile.obj
+Wed Nov 5 17:05:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Nov 19 23:05:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/ui/gtk/testrunner.rb: typo.
- * win32/Makefile.sub (insns_rules.mk): remove extra backslash.
+Wed Nov 5 11:13:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * cygwin/GNUmakefile.in, win32/Makefile.sub (clean): rc files are
- made at compile time, so should be removed by clean.
+ * string.c: add #include "version.h". this file still depends on it.
-Fri Nov 19 22:09:46 2010 Kouhei Sutou <kou@cozmixng.org>
+ * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
+ wince/Makefile.sub: add version.h dependency to string.c.
- * test/rexml/test_core.rb
- (Tester#test_pretty_format_long_text_finite): skip a test that
- uses long string on small memory system. [ruby-dev:42599]
+Wed Nov 5 09:14:23 2003 Shugo Maeda <shugo@ruby-lang.org>
-Fri Nov 19 21:07:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/monitor.rb: revert to the previous revision.
- * lib/optparse.rb: shell completion support for zsh. based on
- <http://d.hatena.ne.jp/rubikitch/20071002/zshcomplete>
+Wed Nov 5 08:39:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/optparse.rb: shell completion support for bash.
+ * lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
-Fri Nov 19 00:00:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/https.rb (HTTPRequest#meta_vars): create
+ SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
- * cygwin/GNUmakefile.in (SCRIPTPROGRAMS): no needs on cygwin.
+ * ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
+ if no cert-chain was given.
- * win32/Makefile.sub (scriptbin): create script binaries.
+Tue Nov 4 23:44:48 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Nov 18 23:21:23 2010 Kouhei Sutou <kou@cozmixng.org>
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
+ remove needless version.h dependency.
- * lib/rexml/formatters/pretty.rb (REXML::Formatters::Pretty#wrap):
- REXML::Formatters::Pretty#wrap used a recursive method call to
- format text. This switches it to use an iterative approach.
- [ruby-core:33245]
- Patch by Jeremy Evans. Thanks!!!
+Tue Nov 4 23:38:43 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/rexml/test_core.rb: add a test for it.
+ * class.c, hash.c, string.c: remove #include "version.h".
-Thu Nov 18 22:58:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * Makefile.in: remove needless version.h dependency.
- * include/ruby/io.h (rb_io_buffer_t): extract from rb_io_t.
+Tue Nov 4 06:54:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Nov 18 07:37:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (read_all): fptr->f may be NULL, if IO is closed in the
+ signal handler.
- * Makefile.in (reconfig): force reconfigure with previous options.
+ * io.c (io_read): ditto.
- * common.mk (showconfig): show configure flags, like as
- `config.status --config' generated by recent autoconf.
+ * string.c (get_pat): remove 1.8.0 warning code.
-Thu Nov 18 07:16:49 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_match): extend warning until 1.8.2.
- * missing/langinfo.c (strncasecmp): get rid of redefinition.
+ * string.c (rb_str_match2): ditto.
-Thu Nov 18 00:02:17 2010 James Edward Gray II <jeg2@ruby-lang.org>
+ * class.c (class_instance_method_list): remove 1.8.0 warnings.
+ method_list now recurs. [ruby-dev:21816]
- * lib/csv.rb: Upgrading output encoding with ASCII content
- as needed. [ruby-core:33229]
+ * class.c (rb_obj_singleton_methods): ditto.
-Wed Nov 17 23:19:21 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_select): remove select with block.
+ [ruby-dev:21824]
- * win32/configure.bat: remove quotes from arguments to be quoted.
+ * hash.c (rb_hash_select): ditto.
- * lib/mkmf.rb (create_makefile): use forward slashes in messages.
+ * hash.c (env_select): ditto.
- * lib/mkmf.rb (create_makefile): make extension libraries messages
- brief.
+ * re.c (match_select): ditto.
- * win32/Makefile.sub (MAKEDIRS): should not include silent flag.
+ * struct.c (rb_struct_select): ditto.
- * common.mk (ext/ripper/ripper.c, ext/json/parser/parser.c): pass
- Q and ECHO. [ruby-core:33226]
+Mon Nov 3 22:53:21 2003 Minero Aoki <aamine@loveruby.net>
-Wed Nov 17 16:09:52 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/racc/parser.rb: synchronize with Racc 1.4.4.
- * test/test_tracer.rb: new test case.
- minimal regression test for r29280.
+ * ext/racc/cparse/cparse.c: ditto.
-Wed Nov 17 16:04:23 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * ext/racc/cparse/cparse.c (parse_main): should abort when
+ the length of LR state stack <=1, not ==0.
- * test/ruby/envutil.rb (Test::Unit::Assersions#assert_warn):
- new assertion to assert that a particular warning message is
- displayed.
- forward port from branches/ruby_1_9_2@29795.
+Mon Nov 3 08:50:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Nov 17 15:16:48 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * process.c (check_uid_switch): remove duplicated error messages.
- * regint.h (OnigOpInfoType): constify name.
+ * process.c (check_gid_switch): ditto.
- * regcomp.c (op2name): constify return value.
+Sun Nov 2 02:28:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * regcomp.c (onig_print_compiled_byte_code): use PRIuPTR and
- uintptr_t to clean warnings.
+ * lib/webrick/ssl.rb: new option :SSLExtraChainCert.
- * regcomp.c (print_indent_tree): use PRIxPTR and intptr_t.
+Sun Nov 2 01:02:04 2003 Akinori MUSHA <knu@iDaemons.org>
- * regexec.c (match_at): use PRIdPTR and intptr_t.
+ * string.c (rb_str_hash): Update the HASH_PERL alternative hash
+ algorithm in sync with Perl 5.8.
-Wed Nov 17 09:49:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * st.c (strhash): Ditto.
- * enc/shift_jis.c (property_name_to_ctype): fix memory leak.
+Sat Nov 1 18:21:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * enc/euc_jp.c (property_name_to_ctype): ditto.
+ * ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
+ SSLSocket#peer_cert_chain.
-Wed Nov 17 08:54:04 2010 James Edward Gray II <jeg2@ruby-lang.org>
+ * ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
+ which returns underlying X509_REQ.
- * lib/csv.rb: Upgrading output encoding as needed. [ruby-core:33135]
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
+ ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
+ ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
+ use underlying C struct without duplication not to leak momory.
-Tue Nov 16 22:30:39 2010 Yusuke Endoh <mame@tsg.ne.jp>
+Sat Nov 1 01:49:03 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * vm_insnhelper.c (vm_throw): remove fear of undefined behavior :-)
- Coverity Scan found this bug.
+ * lib/soap/mapping/factory.rb: mark marshalled basetype objects when
+ @allow_original_mapping is true. multi-referencing basetype node is
+ prohibited in SOAP/1.1 encoding but soap4r's original ruby object
+ mapping requires basetype to be marked to detect self referencing
+ loop. e.g. o = 1; o.instance_eval { @iv = o } soap4r's original
+ mapping is only used through soap/marshal API.
-Tue Nov 16 09:33:00 2010 Kenta Murata <mrkn@mrkn.jp>
+ * test/soap/marshal/test_marshal.rb: add tests for self referencing
+ immutable objects.
- * ext/bigdecimal/lib/bigdecimal/util.rb (to_digits): avoid unused
- variables warning, reported by Aaron Patterson.
+ * test/soap/calc/test_calc_cgi.rb: fix test name.
-Tue Nov 16 06:39:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Oct 31 22:26:29 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
- * pack.c (PACK_ITEM_ADJUST): return nil not result array and yield
- values if block is given. [ruby-core:33193]
+ * wince/string_wce.c (strrchr): should decrement pointer.
-Tue Nov 16 00:21:20 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * wince/Makefile.sub: correct a range of isdigit().
- * regparse.c (and_cclass, or_cclass): fix memory leak. Coverity Scan
- found this bug. [ruby-dev:42579]
+Fri Oct 31 12:55:24 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Nov 16 00:07:32 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
+ [ruby-dev:21791]
- * gc.c (assign_heap_slot): fix fear of memory leak and memory
- violation. Coverity Scan found this bug.
+ * bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
-Mon Nov 15 23:54:45 2010 Yusuke Endoh <mame@tsg.ne.jp>
+Fri Oct 31 01:38:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval_intern.h (CHECK_STACK_OVERFLOW): it was not intended to add
- size_t to a pointer typed VALUE*. Coverity Scan found this defect.
+ * wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
+ at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
-Mon Nov 15 23:41:21 2010 Yusuke Endoh <mame@tsg.ne.jp>
+Fri Oct 31 01:02:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * compile.c (iseq_set_exception_local_table, iseq_set_local_table,
- rb_iseq_build_from_ary): fix type inconsistency (which is benign
- because sizeof(ID) == sizeof(ID*), though). Coverity Scan found
- these bugs.
+ * compar.c (cmp_equal): protect exceptions from <=> comparison
+ again. returns nil if any exception or error happened during
+ comparison.
-Mon Nov 15 22:47:27 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * eval.c (search_required): should update *featurep when DLEXT2 is
+ defined. (ruby-bugs-ja:PR#581)
- * vm_eval.c (rb_funcall): ensure va_end after va_init_list. Coverity
- Scan found this bug.
+Thu Oct 30 23:41:04 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-Mon Nov 15 08:36:12 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/drb/drb.rb: add DRbArray
- * lib/racc/parser.rb (do_parse, yyparse): using class eval to define
- method and avoid __send__.
+ * lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
-Mon Nov 15 06:43:48 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
- * etc/openssl/ossl_ssl.c (ossl_ssl_get_cert): raise exception if
- pointer is invalid. Thanks Ippei Obayashi! [ruby-dev:42573]
+Thu Oct 30 23:19:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sun Nov 14 17:57:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/soap/generator.rb: better XML pretty printing.
- * enc/Makefile.in (distclean): should not remove sources which are
- distributed in tarball.
+ * lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
+ assignment in the element which has "encodingStyle" attribute, and
+ add necessary namespace assignment for "arrayType" attribute.
-Sun Nov 14 16:48:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
+ through CGI.
- * parse.y (parser_set_token_info): turn on/off with directives.
- [ruby-core:25442]
+Thu Oct 30 22:59:39 2003 why the lucky stiff <why@ruby-lang.org>
-Sun Nov 14 12:05:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/yaml2byte.c: HASH const too long. Thanks, matz.
- * io.c (argf_readlines): forward to current_file for arguments
- check. http://twitter.com/nagachika/status/3634254856589312
+Thu Oct 30 19:13:53 2003 Akinori MUSHA <knu@iDaemons.org>
-Sun Nov 14 08:48:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/MANIFEST: Add yamlbyte.h.
- * win32/setup.mak (-basic-vars-, -runtime-): suppress trailing
- space and compiler command line.
+Thu Oct 30 14:25:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Nov 14 04:22:32 2010 Alexander Zavorine <alexandre.zavorine@nokia.com>
+ * io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
+ buffer filled.
- * symbian/setup (config.h): Added HAVE_LABS and HAVE_LLABS to config.h.
+ * io.c (rb_io_fptr_cleanup): move path deallocation to
+ rb_io_fptr_finalize (finalizer called by GC).
- * symbian/configure.bat: Changed packaging version in line with API
- style 3 versioning.
+Thu Oct 30 13:23:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Nov 13 16:37:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (logop): left may be NULL. [ruby-talk:84539]
- * common.mk (showflags, help): emit messages at once.
+ * eval.c (rb_eval): NODE_CASE nd_head may be NULL.
- * win32/Makefile.sub (MSG, EOM): remove surrounding quotes by %~I.
+Thu Oct 30 10:14:51 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Nov 13 01:31:30 2010 Akio Tajima <artonx@yahoo.co.jp>
+ * lib/test/unit/autorunner.rb: make fox runner work.
- * win32/Makefile.sub: reorder variable End Of Message (don't display it)
+Thu Oct 30 09:32:26 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Nov 12 20:52:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (rb_f_system): fixed lack of security check before
+ calling do_spawn() on win32. [ruby-talk:84555]
- * common.mk (showflags, help): use caret to quote leading spaces on
- Windows.
+Thu Oct 30 02:46:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * Makefile.in, common.mk, cygwin/GNUmakefile.in, enc/depend,
- ext/ripper/depend, lib/mkmf.rb, win32/Makefile.sub: caddle up.
+ * eval.c (proc_invoke): single array value to normal Proc#call
+ (i.e. not via lambda call), should be treated just like yield.
+ [ruby-dev:21726]
-Fri Nov 12 16:35:31 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 30 02:25:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * configure.in: support C level backtrace information on FreeBSD.
- When devel/libexecinfo is installed on FreeBSD, now ruby
- can show C level backtrace information.
- http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/libexecinfo/
+ * ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
+ add new method to inherit @sync from @io.sync.
-Fri Nov 12 09:58:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
+ set sync flag explicitly.
- * win32/setup.mak: use findstr.exe instead of find.exe, because all
- target build platforms should have findstr.exe, and, find.exe often
- means another command such as cygwin's.
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
-Fri Nov 12 00:30:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
+ certificates in @extra_chain_cert.
- * win32/Makefile.sub (config.h): need PRI_LL_PREFIX.
+Wed Oct 29 22:02:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Nov 11 23:38:32 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
+ interpreter to exec, instead of test/ruby/envutil.rb,
- * configure.in: ANSI C-conforming const and volatile are mandatory
+Wed Oct 29 19:58:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * configure.in (AC_C_CONST, AC_C_INLINE, AC_C_VOLATILE): check
- before used in other checks.
+ * ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
+ defined and TCL_MAJOR_VERSION >= 8.
- * configure.in (RUBY_CHECK_PRINTF_PREFIX): should not break from
- RUBY_WERROR_FLAG, so that ac_c_werror_flag gets restored.
+ * ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
+ rb_threadVwaitProc): use CONST84 instead of CONST.
-Thu Nov 11 23:04:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
+ ip_rb_threadTkWaitCommand): use CONST84 always.
- * ext/iconv/iconv.c (warn_deprecated): show caller position.
+Wed Oct 29 17:27:05 2003 Tanaka Akira <akr@m17n.org>
-Thu Nov 11 23:03:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
- * io.c (argf_close): untie tied io before closing.
+ * lib/pathname.rb (realpath): examine Dir.pwd because it may have
+ symlinks.
- * io.c (argf_write): add ARGF.write and so on.
+Wed Oct 29 17:16:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (argf_read_nonblock): add ARGF.read_nonblock.
+ * eval.c (rb_longjmp): must not disturb original jump.
+ [ruby-dev:21733]
-Thu Nov 11 21:49:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 29 15:28:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/rdoc/stats.rb (RDoc#print): get rid of NaN.
+ * eval.c (Init_Proc): taint preallocated exception object
+ sysstack_error. [ruby-talk:84534]
-Thu Nov 11 21:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 29 11:27:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * common.mk (SHOWFLAGS): show compile flags.
+ * parse.y (ret_args): node may be NULL. [ruby-talk:84530]
- * common.mk: hide long command lines by default. verbose-mode is
- turned on by V=1 as before.
- http://jarp.does.notwork.org/diary/200605b.html#200605121
+Tue Oct 28 15:20:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Thu Nov 11 21:32:09 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
+ WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
+ ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
+ rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
+ ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
+ avoid VC++ warnings.
- * lib/mkmf.rb (try_func): accept variable address.
+Mon Oct 27 19:19:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/win32ole/extconf.rb: libuuid is needed on cygwin.
+ * eval.c (rb_longjmp): ignore reentering error while warning.
+ [ruby-dev:21730]
-Thu Nov 11 21:24:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 27 00:23:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * file.c (file_expand_path): use cygwin_conv_path on cygwin 1.7 or
- later.
+ * ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
+ calling 'exit' in the Tk callback procedure. [ruby-list:38656]
- * ruby.c (push_include_cygwin): ditto.
+Sat Oct 25 09:18:04 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Nov 11 20:49:48 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_method_missing): protect exception from within
+ "inspect". (ruby-bugs:PR#1204)
- * include/ruby/ruby.h (PRI_LL_PREFIX): format type specifier for
- LONG_LONG may vary on platforms.
+Fri Oct 24 23:26:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Nov 11 20:45:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_hash_each): Hash#each should yield single value.
+ [ruby-talk:84420]
- * configure.in (SYMBOL_PREFIX): separate from EXPORT_PREFIX.
+ * hash.c (env_each): ditto for ENV.each.
- * win32/mkexports.rb (Exports#each_export): use SYMBOL_PREFIX.
+Thu Oct 23 20:25:32 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Wed Nov 10 07:20:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/webrick/server.rb (GenericServer#start): should rescue
+ IOError from IO::accept. [ruby-dev:21692]
- * cygwin/GNUmakefile.in (scriptbin): make executable file from
- scripts with stub.
+Thu Oct 23 17:59:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ruby.c (load_file_internal): assume xflag for exe file as well
- as no-shebang file.
+ * eval.c (ruby_cleanup): initialize stack bottom for embedding.
+ [ruby-dev:21686]
- * tool/rbinstall.rb: install script programs.
+ * ext/dl/extconf.rb: move list of files to clean from DEPEND file,
+ to get rid of macro redefinitions.
- * win32/mkexports.rb (Exports#initialize): alias ruby_sysinit for
- stub.
+Thu Oct 23 13:44:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/stub.c: stub for scripts. [EXPERIMENTAL]
+ * parse.y: integrate operations for stack_type. [ruby-dev:21681]
-Tue Nov 9 21:57:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Oct 23 00:41:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * dln.c (init_funcname): allocate and build initialization
- funciton name at once.
+ * test/soap/calc/*, test/soap/helloworld/*: set logging threshold
+ to ERROR.
-Tue Nov 9 21:14:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 22 12:53:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (AC_FUNC_GETPGRP, AC_FUNC_SETPGRP): no need when
- not used.
+ * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
+ ignore tests which raised LoadError.
- * configure.in (EXPORT_PREFIX): check generic prefix.
+ * test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
+ test/ruby/test_system.rb: avoid requiring same file twice.
-Tue Nov 9 13:24:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
+ ARGV unless invoked directly. do not create test cases unless
+ required libraries are available.
- * regenc.c (onigenc_minimum_property_name_to_ctype):
- \p{...} should be case insensitive. [ruby-core:33000]
+Wed Oct 22 02:31:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * regenc.c (onigenc_property_list_add_property):
- ditto.
+ * eval.c (ruby_cleanup): should not ignore exit_value in END
+ execution. [ruby-dev:21670]
- * enc/euc_jp.c (init_property_list, property_name_to_ctype):
- to lowercase property names.
+Tue Oct 21 23:16:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * enc/shift_jis.c (init_property_list, property_name_to_ctype):
- ditto.
+ * eval.c (ruby_cleanup): call finalizers and exit procs before
+ terminating threads.
-Tue Nov 9 13:29:36 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
- * win32/win32.c (overlapped_socket_io): get rid of a warning of 64bit
- mingw.
+Tue Oct 21 15:57:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Nov 9 10:44:19 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
+ prepend the directory of target file to the load path.
- * util.c (ruby_strtod): this code uses FPU's rounding system.
- But x86's FPU calculates double precision floating-point
- numbers in 80bit precision, so it fails to round the value.
- So ensure the value is assigned a variable. [ruby-dev:42551]
- see also [ruby-math:00802]
- http://www.shudo.net/java-grandprix99/strictfp/
+Tue Oct 21 15:08:53 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Tue Nov 9 07:30:15 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (do_spawn, do_aspawn): should wait child process even
+ if callded with P_OVERLAY.
- * error.c (rb_syserr_new): new function to make SystemCallError
- instance without errno. [EXPERIMENTAL]
+ * win32/win32.c (do_spawn, do_aspawn): should return child's exit
+ status to parent.
- * error.c (rb_syserr_fail, rb_mod_syserr_fail): ditto.
+Tue Oct 21 00:35:02 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Nov 9 05:54:57 2010 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * test/soap/calc/*, test/soap/helloworld/*: catch the exception from
+ test server thread and recover.
- * lib/*.rb: Remove unused variable warnings.
- Patch by Run Paint [ruby-core:30991]
+Tue Oct 21 00:22:57 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * lib/rubygems/*, lib/rdoc/*.rb, lib/rake/*.rb: ditto
+ * test/drb/*: import drb/runit.
-Mon Nov 8 18:26:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Oct 20 23:55:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * util.c (ruby_hdtoa): fix type cast and bufsize.
+ * eval.c (rb_eval): set current node after arguments evaluation.
+ [ruby-dev:21632]
-Mon Nov 8 15:40:56 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_yield_0): set current node and keep it at local jump.
- * vsnprintf.c (BSD_vfprintf): fix precision specifier doesn't
- work well on %f. [ruby-dev:42552]
+Mon Oct 20 22:01:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Nov 8 14:41:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (rb_thread_cleanup): keep thread group for main thread.
+ [ruby-dev:21644]
- * win32/win32.c (get_wsa_extension_function): typos.
+Mon Oct 20 18:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Nov 8 13:41:33 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_catch): backout.
- * tool/enc-unicode.rb,
- enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
- enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
- Add Age property to regexp. [ruby-core:33019]
- patched by Ammar Ali, tested by Run Paint Run Run
+Mon Oct 20 17:31:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Nov 8 12:16:39 2010 Ben Walton <bwalton@artsci.utoronto.ca>
+ * eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
+ destination.
- * configure.in: support -h for solaris linker when gcc not used
+ * eval.c (localjump_destination): use unique number in ruby_frame
+ for localjump destination.
-Mon Nov 8 11:47:39 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Oct 20 11:31:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (finish_overlapped_socket): refactoring.
+ * test/ruby/test_signal.rb (test_signal): restore old trap.
-Mon Nov 8 11:02:21 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Oct 20 11:00:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/win32.c (get_proc_address): refactoring.
+ * gc.c (gc_sweep): loosen page free condition to avoid add_heap()
+ race condition. [ruby-dev:21633]
- * win32/win32.c (get_wsa_exetinsion_function): refactoring.
+ * gc.c (gc_sweep): do not update malloc_limit when malloc_increase
+ is smaller than malloc_limit.
-Mon Nov 8 09:45:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Oct 20 09:45:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * enc/trans/gbk-tbl.rb: Add euro sign. [ruby-core:33094]
- CP936, which is de facto definition of GBK, has it.
- http://msdn.microsoft.com/en-us/goglobal/cc305153.aspx
+ * lib/debug.rb (debug_command): remove debug print.
-Mon Nov 8 07:26:20 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 20 00:25:41 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in: check only the first symbol to get rid of
- duplication. [ruby-core:33084] #4031
+ * eval.c (search_required): required name must not be changed before
+ loading. [ruby-dev:24492]
-Sun Nov 7 10:13:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 19 13:12:30 2003 Tanaka Akira <akr@m17n.org>
- * configure.in (NM): check on all platforms. #4031
+ * lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
-Sun Nov 7 06:16:33 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+Sun Oct 19 00:14:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * test/openssl/test_ocsp.rb: adding test for r29699. Thanks Elise
- Huard! [ruby-core:32460]
+ * test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
+ server. (17171)
-Sat Nov 6 07:33:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Oct 18 23:01:32 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * configure.in (rb_cv_export_prefix): check for prefixed
- underscore of exported symbols
+ * missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
- * tool/rbinstall.rb (bin-comm): prepend prolog shell script if
- necessary.
+Sat Oct 18 05:48:59 2003 why the lucky stiff <why@ruby-lang.org>
- * configure.in (LIBRUBY_RELATIVE): use rpath token expansion.
+ * ext/syck/rubyext.c: YAML::Syck::compile method.
-Sat Nov 6 07:24:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/syck.c: Buffer edge bug.
- * template/ruby.pc.in (arch, sitearch): reordered.
+ * ext/syck/yaml2byte.c: YAML to bytecode converter.
- * configure.in: keep failed file.
+ * ext/syck/yamlbyte.h: Ditto.
-Sat Nov 6 07:03:49 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/syck/bytecode.c: Bytecode parser fixes to empty collections
+ and empty strings.
- * process.c (rb_fork_err): save errinfo before fdopen.
+ * ext/syck/token.c: Ditto.
-Sat Nov 6 00:43:58 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+Fri Oct 17 23:07:38 2003 Akinori MUSHA <knu@iDaemons.org>
- * ext/openssl/ossl_ocsp.c (ossl_ocspcid_initialize): an optional
- parameter may be used to specify the OpenSSL::OCSP::CertificateId on
- initialization. Thanks Elise Huard! [ruby-core:32460]
+ * ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
+ Provide Kernel#to_enum as an alias for Kernel#enum_for. Maybe
+ this is a better name.
-Fri Nov 5 12:23:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Oct 17 23:00:30 2003 Akinori MUSHA <knu@iDaemons.org>
- * test/ruby/test_{process,system}.rb (test_fallback_to_sh):
- meaningless and wrong tests where /bin/sh does not exist.
+ * lib/generator.rb: Add rdoc documentation.
- * process.c (proc_spawn_v): should spawn, not exec.
+Fri Oct 17 22:16:42 2003 Akinori MUSHA <knu@iDaemons.org>
-Fri Nov 5 01:21:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/set.rb: Reword and fix Overview.
- * process.c (proc_exec_v, proc_spawn_v): try to execute with sh if
- no shebang. [ruby-core:32745] [EXPERIMENTAL]
+ * lib/set.rb: It is not necessary to require
+ 'test/unit/ui/console/testrunner'.
-Fri Nov 5 00:39:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Oct 17 11:15:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (rb_io_readlines, rb_io_each_line): limit must not be zero.
- a patch from Tomoyuki Chikanaga at [ruby-dev:42538]. #4024
+ * test/ruby/test_range.rb: added.
-Fri Nov 5 00:14:15 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * MANIFEST: add test/ruby/test_range.rb.
- * ext/fiddle/extconf.rb: fixing ffi library location on windows.
- Thanks Usa! [ruby-core:32930]
+Fri Oct 17 03:21:23 2003 William Sobel <will.sobel@barra.com>
-Thu Nov 4 20:04:44 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/socket/socket.c (make_hostent): h_aliases may be NULL.
+ (ruby-bugs:PR#1195)
- * gc.c (rb_newobj): force garbage_collect() if GC.stress == true.
+ * ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
-Thu Nov 4 19:48:22 2010 Koichi Sasada <ko1@atdot.net>
+Fri Oct 17 00:12:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ChangeLog: missed to write a last ChangeLog.
+ * ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
+ without initializing on TkComposite module.
- * gc.c (gc_finalize_deferred): removed.
+Thu Oct 16 23:51:04 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * gc.c (rb_gc_finalize_deferred): Do not invoke a free_unused_heaps().
+ * ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
+ in a callback operation, Ruby/Tk shows a (verbose) backtrace
+ information on the callback process.
-Thu Nov 4 19:45:27 2010 Koichi Sasada <ko1@atdot.net>
+Thu Oct 16 17:09:19 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * gc.c (run_final): do not need argument obj.
+ * lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
+ debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
-Thu Nov 4 19:26:10 2010 Koichi Sasada <ko1@atdot.net>
+Thu Oct 16 16:54:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * gc.c (before_gc_sweep): fix commit miss.
+ * string.c (rb_str_upto): ("a"..."a").to_a should return [].
+ [ruby-core:01634]
-Thu Nov 4 19:20:46 2010 Koichi Sasada <ko1@atdot.net>
+Thu Oct 16 16:40:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * gc.c (after_gc_sweep, before_gc_sweep):
- invoke rb_sweep_method_entry() as soon as possible.
+ * ext/tk/lib/tk.rb:
+ Add Tk::EncodedString and Tk::UTF8_String class to support
+ characters using the \uXXXX escape to the UNICODE string.
-Thu Nov 4 19:13:58 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
+ new demo-scripts (samples of Tk::UTF8_String)
- * gc.c (after_gc_sweep, slot_sweep): finalizers should be invoked
- as soon as possible.
+ * ext/tk/sample/{demos-en,demos-jp}/widget
+ add entries for 'unicodeout.rb'
-Thu Nov 4 10:30:40 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Thu Oct 16 08:38:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (--with-valgrind): Now this option is default on.
- You can still explicitly disable this feature by specifying
- --without-valgrind.
+ * test/digest/test_digest.rb (test_eq): show failed class.
-Thu Nov 4 02:06:16 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * test/ruby/test_iterator.rb (test_break, test_return_trace_func):
+ test localjump destination.
- * cont.c (fiber_t_alloc): raise an error when fiber is going to be
- initialized twice. [ruby-dev:42524]
+Wed Oct 15 20:22:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Nov 4 02:04:25 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
+ instance_eval('path_query'). [ruby-list:38575]
- * cont.c (rb_fiber_resume): raise an "double resume" error when root
- fiber is going to be resumed. [ruby-dev:42523]
+Wed Oct 15 17:24:45 2003 URABE Shyouhei <root@mput.dip.jp>
-Wed Nov 3 14:17:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/cgi.rb (CGI::Cookie): tiny typo fix.
- * lib/ostruct.rb (OpenStruct#delete_field): also undefine
- accessor methods. [ruby-core:33010]
+Wed Oct 15 15:00:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 3 14:13:46 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (ruby_run): just return FAILURE instead of parse error
+ count. [ruby-list:38569]
- * string.c (rb_enc_cr_str_buf_cat): concatenation of valid
- encoding string and invalid encoding string should result
- invalid encoding. [ruby-core:33027]
+Wed Oct 15 13:17:02 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Nov 3 08:58:59 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/digest/digest.c (rb_digest_base_alloc): need to initialize
+ buffer. [ruby-dev:21622]
- * gc.c, vm.c, vm_core.h: remove USE_VALUE_CACHE option.
+Wed Oct 15 11:23:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Nov 3 07:47:25 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
+ * marshal.c (w_object): dump extended modules as well.
- * lib/irb/ruby-lex.rb (RubyLex#identify_string): parse multiple
- regex options. a patch from Heesob Park in [ruby-core:32988].
+ * marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
+ modules before invoking marshal_load. these two fixes are done
+ by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
-Wed Nov 3 07:33:57 2010 Tanaka Akira <akr@fsij.org>
+Wed Oct 15 09:30:34 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * vm_method.c (rb_clear_cache_by_class): just return if the class has
- no method. reported by Eric Wong. [ruby-core:32689]
+ * ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
-Tue Nov 2 22:50:25 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/syck/syck.h: include stdio.h for definition of FILE.
- * ext/psych/lib/psych/visitors/visitor.rb (initialize): push accessor
- methods to subclass that actually uses them.
+Wed Oct 15 08:09:07 2003 why the lucky stiff <why@ruby-lang.org>
-Tue Nov 2 22:47:08 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/syck/bytecode.c: Checkin of YAML bytecode support.
- * ext/psych/lib/psych/visitors/visitor.rb (accept): switch to
- a dispatch cache rather than case / when statement.
+ * ext/syck/gram.c: Ditto.
-Tue Nov 2 21:46:52 2010 Kouhei Sutou <kou@cozmixng.org>
+ * ext/syck/syck.c: Ditto.
- * NEWS: fix a typo.
+ * ext/syck/token.c: Ditto.
-Tue Nov 2 20:10:32 2010 Tajima Akio <artonx@yahoo.co.jp>
+ * ext/syck/handler.c: Ditto.
- * test/rake/test_tasks.rb: clear env var which is used by the test.
- [ruby-dev:42508]
+ * ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
-Tue Nov 2 00:25:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/syck/rubyext.c: Ditto (on both counts).
- * ext/socket/extconf.rb: win64 is just same with win32 about socket.
- notice: but wince is not same.
+Wed Oct 15 05:05:53 2003 Akinori MUSHA <knu@iDaemons.org>
-Mon Nov 1 21:25:57 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * lib/generator.rb: A new library which converts an internal
+ iterator to an external iterator.
- * main.c: <stdlib.h> is needed, to introduce the getenv(3)
- prototype declaration. Without it a C compiler shall infer
- the getenv type as "int getenv(...);", but this is totally
- wrong, especially when your machine's sizeof(int) and
- sizeof(char*) differs. On such environment a return value
- of getenv(3), which is in fact a char*, might first casted
- into a int (loses data here), and then casted back to char*
- by automatic integral promotion to fit to the prototype of
- ruby_set_debug_option().
+ * lib/abbrev.rb: A new library which creates an abbreviation table
+ from a list.
-Sun Oct 31 23:27:09 2010 Koichi Sasada <ko1@atdot.net>
+Wed Oct 15 04:31:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * gc.c (finalizer_table, objspace->final.table):
- Create finalizer_table at Init_heap().
- Remove all null checks of finalizer_table.
+ * ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
+ new demo-scripts
- * gc.c (mark_tbl): skip if no table entries.
+ * ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
+ add entries for 'entry3.rb'
- * gc.c (slot_swee): remove useless need_call_final check.
+Wed Oct 15 04:31:47 2003 Akinori MUSHA <knu@iDaemons.org>
-Sun Oct 31 22:32:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/digest/test_digest.rb: Moved from ext/digest/test.rb.
- * gc.c (rb_objspace_free): finalizers should be called separately
- from freeing objspace. [ruby-dev:42479]
+Wed Oct 15 03:53:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Sun Oct 31 22:24:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
+ on the last commit).
- * eval.c (ruby_cleanup): free current VM and its objspace even
- when exiting by SystemExit.
+Wed Oct 15 00:25:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Oct 31 22:10:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yylex): argument parentheses preceded by spaces should
+ be warned; not error. [ruby-talk:84103]
- * compile.c (new_child_iseq): adjust argument types.
+Wed Oct 15 00:20:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * iseq.c (prepare_iseq_build, rb_iseq_new),
- (rb_iseq_new_with_bopt_and_opt, rb_iseq_new_with_opt),
- (rb_iseq_new_with_bopt): ditto.
+ * ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
+ switch on threads smoothly and avoid seg-fault.
- * compile.c (iseq_set_exception_table): suppress warnings.
+ * ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
+ _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
+ and tkwait command wait on an eventloop.)
- * insns.def (putspecialobject, defined): ditto.
+ * ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
+ _thread_tkwait.
- * iseq.c (iseq_load): ditto.
+ * ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
+ If 1st argument is true, waits on a thread. If false, waits on
+ an eventloop. If 2nd argument is true, checks existence of
+ rootwidgets. If false, doesn't. Default is wait(true, false).
-Sun Oct 31 09:30:51 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
+ TkVariable#wait(arg, true). wait_visibility and wait_destroy
+ have an argument for waiting on a thread or an eventloop.
- * vm_core.h: some refactoring.
- - move decl. of rb_compile_option_struct to iseq.h.
- - define enum iseq_type.
- - define enum vm_special_object_type.
+ * ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
- * compile.c: some refactoring.
- - apply above changes.
- - (struct iseq_link_element): change value of type.
- - remove unused decl.
- - fix comment.
- - rename iseq_build_body and iseq_build_exception to
- iseq_build_from_ary_body and iseq_build_from_ary_exception.
+ * ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
+ an eventloop'.
- * iseq.h: define enum catch_type and enum defined_type.
+Wed Oct 15 00:10:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * insns.def: apply above changes.
+ * lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
+ SOAPBasetype and SOAPCompoundtype.
- * iseq.c: define ISEQ_MAJOR_VERSION and ISEQ_MINOR_VERSION.
+ * lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
+ Encoding methods signature change. Pass SOAPGenerator as a parameter.
-Sat Oct 30 23:38:59 2010 Kouhei Sutou <kou@cozmixng.org>
+ * lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
+ for better marshalling/unmarshalling support. Now I think SOAP
+ marshaller supports all kind of object graph which is supported by
+ Ruby's original marshaller. Of course there could be bugs as always.
+ Find it. :-)
- * lib/rexml/encoding.rb: untabify.
+ * lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
+ DEBUG is too noisy.
-Sat Oct 30 21:06:37 2010 Kouhei Sutou <kou@cozmixng.org>
+ * lib/xsd/datatypes.rb: DateTime#of is obsoleted. Use DateTime#offset.
- * lib/rexml/encoding.rb: use Ruby native encoding mechanism.
- [ruby-dev:42464]
- * lib/rexml/encodings/: remove.
+ * test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
+ useless warning.
- * lib/rexml/document.rb, lib/rexml/formatters/default.rb,
- lib/rexml/output.rb, lib/rexml/parseexception.rb,
- lib/rexml/parsers/baseparser.rb, lib/rexml/source.rb,
- lib/rexml/xmldecl.rb: use Ruby's native Encoding object.
+Tue Oct 14 19:09:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/rexml/, test/rss/: follow the above encoding changes.
+ * eval.c (ruby_finalize_0): return the given exit status unless
+ SystemExit got raised.
- * NEWS: add REXML's incompatible change about encoding.
+Tue Oct 14 11:53:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 30 17:23:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * intern.h (ruby_stop): never return.
- * util.c (ruby_strtod): get rid of overflow/underflow as possible.
+ * ruby.h (ruby_run): ditto.
-Sat Oct 30 14:37:39 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 14 04:43:55 2003 Tanaka Akira <akr@m17n.org>
- * configure.in (ruby_pc): erase runtime-defined variables and
- check if generated pc file is valid.
+ * lib/pathname.rb (realpath): make ELOOP check bit more robust.
+ (children): prepend self by default.
+ (chroot): obsoleted.
- * template/ruby.pc.in (DEFFILE): need for mingw.
+Tue Oct 14 02:29:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * template/ruby.pc.in (LIBRUBY): fix the order.
+ * eval.c (rb_require_safe): segfault after loading .so.
-Sat Oct 30 11:33:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 14 02:05:23 2003 Akinori MUSHA <knu@iDaemons.org>
- * win32/Makefile.sub (ruby_pc): ignore missing variables.
+ * ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
+ module for the Enumerable interface.
- * template/ruby.pc.in: add missing variables for mswin.
+Mon Oct 13 23:55:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat Oct 30 10:24:35 2010 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
+ not "ruby".
- * object.c: Make BasicObject.new accept no parameter.
- Revert of r26135 [ruby-core:27080], as per [ruby-core:32952].
+Mon Oct 13 23:57:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 30 09:40:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_feature_p): match by classified suffix.
- * enum.c: use constants in id.h.
+ * eval.c (rb_require_safe): require library in the specified safe
+ level.
-Sat Oct 30 09:08:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (rb_autoload, rb_autoload_load): restore safe level
+ when autoload was called. [ruby-dev:21338]
- * ext/fiddle/closure.c (fiddle_closure): embed cif not reference
- so that the content surely get initialized. [ruby-dev:42480]
+ * intern.h: prototypes; rb_require_safe.
-Sat Oct 30 07:01:53 2010 Tanaka Akira <akr@fsij.org>
+ * test/runner.rb: accept non-option arguments.
- * lib/resolv-replace.rb: suppress warning.
+Mon Oct 13 20:49:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/open-uri.rb: ditto.
+ * string.c (str_new4): should not preserve FL_TAINT status in the
+ internal shared string. [ruby-dev:21601]
-Sat Oct 30 06:32:52 2010 Tanaka Akira <akr@fsij.org>
+ * string.c (rb_str_new4): ditto.
- * test/pathname/test_pathname.rb (TestPathname#test_grpowned?): the
- group of the created file is inherited from the parent
- directory on BSDs and MacOS X. Linux also inherit the group if
- the setgid bit of the directory is set. It causes the test fail.
- fixed by Shota Fukumori. [ruby-dev:42458]
+ * eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
-Sat Oct 30 05:58:54 2010 Tanaka Akira <akr@fsij.org>
+ * process.c: ditto. [ruby-list:38521]
- * lib/resolv.rb: retry via TCP if UDP reply is truncated.
- fixed by Julian Mehnle. [ruby-core:32407]
+Mon Oct 13 19:51:02 2003 Koji Arai <jca02266@nifty.ne.jp>
-Sat Oct 30 00:35:13 2010 Koichi Sasada <ko1@atdot.net>
+ * lib/debug.rb (debug_command): should enter emacs mode when
+ assigned any value to the environment variable "EMACS".
+ On Meadow, (getenv "EMACS") is "meadow".
- * iseq.c (iseq_s_compile): fix optional argument.
- a patch from Yutaka HARA [ruby-core:32953] [Ruby 1.9-Bug#4001]
+Sun Oct 12 14:45:03 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Sat Oct 30 00:24:42 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/win32ole/extconf.rb: check "windows.h", not "windows".
+ [ruby-talk:84051]
- * ext/objspace/objspace.c (memsize_of): take care of
- T_CLASS/const_tbl.
- a patch from nagachika <nagachika00@gmail.com> [ruby-dev:42490]
+Sat Oct 11 20:41:03 2003 Corinna Vinschen <corinna@vinschen.de>
-Fri Oct 29 23:32:36 2010 Koichi Sasada <ko1@atdot.net>
+ * file.c (eaccess): Use access(2) on Cygwin.
- * test/profile_test_all.rb: added.
- You can use test-all profiler with the following command:
- RUBY_TEST_ALL_PROFILE=true make test-all
- This command generates ./test_all_profile and you can analyze
- which tests consume memories.
+Sat Oct 11 17:09:21 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/runner.rb: ditto.
+ * lib/rexml/quickpath.rb (REXML::QuickPath::match):
+ escape '[' to avoid warning.
-Fri Oct 29 10:02:03 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Oct 11 16:08:41 2003 Tanaka Akira <akr@m17n.org>
- * tool/enc-unicode.rb,
- enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
- enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
- Add 'Unknown' Script.
- patched by Run Paint Run Run. [ruby-core:32937] #3998
+ * lib/pathname.rb (realpath): check existence of the file.
-Fri Oct 29 05:13:34 2010 Koichi Sasada <ko1@atdot.net>
+ * lib/pathname.rb (realpath): re-implemented.
+ (realpath_root?, realpath_rec): removed
- * ext/objspace/objspace.c (ObjectSpace.memsize_of_all): rename
- ObjectSpace.total_memsize_of_all_objects() to
- ObjectSpace.memsize_of_all([klass]).
- Accept Class object to filter the objects.
+Sat Oct 11 10:19:39 2003 Shugo Maeda <shugo@ruby-lang.org>
- * test/objspace/test_objspace.rb: fix test for above change.
+ * lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
+ Bystritsky.
-Fri Oct 29 03:04:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Oct 10 07:50:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (rb_str_dump): fix expected length. [ruby-core:32935]
+ * eval.c (is_defined): inheritance line adjustment as like as
+ rb_call_super().
-Thu Oct 28 23:31:39 2010 Koichi Sasada <ko1@atdot.net>
+Fri Oct 10 01:19:00 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * gc.c (before_gc_sweep, run_final): fix decrement timing of final_num.
+ * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
+ optional argument to specify the DirectoryString type
+ (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
+ for DirectoryString, and strongly requires to use UTF8String for
+ all certificates issued after December, 31 2003.
-Thu Oct 28 20:11:30 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
- * tool/enc-unicode.rb,
- enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
- enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
- Update Oniguruma for Unicode 6.
- patched by Run Paint Run Run. [ruby-core:32923] #3989
+Thu Oct 9 23:50:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 28 20:06:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_thread_start_0): prevent thread from GC.
+ [ruby-dev:21572]
- * include/ruby/oniguruma.h (ONIGENC_CTYPE_SPECIAL_MASK):
- change mask from 128 to 256. [ruby-core:32931]
+Thu Oct 9 19:11:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 28 12:06:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_thread_start_0): non-volatile should be restored from
+ volatile.
- * lib/webrick/httprequest.rb (read_request_line): extend max
- length to 2083. This is from Internet Explorer's max uri
- length. http://support.microsoft.com/kb/208427 [ruby-core:32924]
+Thu Oct 9 17:43:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 28 04:00:08 2010 Koichi Sasada <ko1@atdot.net>
+ * eval.c (proc_save_safe_level, proc_get_safe_level,
+ proc_set_safe_level): save/restore safe level 1..4.
- * gc.c (GC.stat): added. [ruby-dev:38607]
+Thu Oct 9 16:33:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/ruby/test_gc.rb: add a test for above.
+ * marshal.c (r_object0): remove unnecessary iv restoration for
+ USRMARSHAL. [ruby-dev:21582]
-Thu Oct 28 03:13:06 2010 Koichi Sasada <ko1@atdot.net>
+ * marshal.c (w_object): dump generic instance variables from
+ a string from '_dump'.
- * ext/objspace/objspace.c (memsize_of): fix rdoc.
+ * variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
+ is not set.
- * ext/objspace/objspace.c (total_memsize_of_all_objects): added.
+ * time.c (time_dump): copy instance variables to dumped string, to
+ be included in the marshaled data.
- * test/objspace/test_objspace.rb:
- - add a test for ObjectSpace.total_memsize_of_all_objects.
- - add two tests for ObjectSpace.memsize_of (for nil and Fixnum).
+ * bignum.c (rb_big2ulong): add range check to ensure round trip.
-Wed Oct 27 23:55:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Oct 9 15:45:27 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/iconv/iconv.c (Init_iconv): warn deprecated use.
+ * pack.c (uv_to_utf8): change message to "out of range", since
+ negative values are not "too big". [ruby-dev:21567]
-Wed Oct 27 18:50:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Oct 9 14:05:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * bignum.c (rb_big2long, rb_big2ulong): rb2ulong() returns VALUE, but
- its real range is ulong. So, if the size of VALUE is bigger than
- ulong, upper bits are always zero even if the actual value is
- negative.
- fixed #3490
+ * eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
+ [ruby-dev:21557]
-Wed Oct 27 18:27:17 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Oct 9 10:51:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_io.rb (TestIO#pipe): should close write end of pipe
- before closing read end, to get rid of timing problem.
+ * eval.c (rb_yield_0): no error if block is empty.
- * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
+Thu Oct 9 06:43:33 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 27 18:14:27 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (localjump_error): id should be ID.
- * win32/win32.c (rb_w32_getppid): support Win64.
+ * eval.c (rb_eval): nd_rval is set in copy_node_scope().
-Wed Oct 27 15:07:19 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (rb_yield_0): unused variable.
- * thread_win32.c (w32_error): should get error no only once, because
- the result of the second getting will indicate the error of the
- first FormatMessage() call.
+ * eval.c (rb_yield_0): nothing to do for empty node.
-Wed Oct 27 13:51:25 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
+ [ruby-dev:21551]
- * test/ruby/test_io.rb (TestIO#pipe): need to propagate exceptions
- in read/write thread. fix r29541.
+ * eval.c (rb_thread_start_0): set the value by break as the result.
+ [ruby-dev:21552]
- * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
+ * eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
+ variables across THREAD_SAVE_CONTEXT.
-Wed Oct 27 12:05:40 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Oct 9 12:05:46 2003 Eric Sunshine <sunshine@sunshineco.com>
- * class.c (clone_const): need to return value. fix r29602.
+ * configure.in: revived NextStep, OpenStep, and Rhapsody ports which
+ had become unbuildable; enhanced --enable-fat-binary option so that
+ it accepts a list of desired architectures (rather than assuming a
+ fixed list), or defaults to a platform-appropriate list if user does
+ not provide an explicit list; made the default list of architectures
+ for MAB (fat binary) more comprehensive; now uses -fno-common even
+ when building the interpreter (in addition to using it for
+ extensions), thus allowing the interpreter to be embedded into a
+ plugin module of an external project (in addition to allowing
+ embedding directly into an application); added checks for
+ <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
+ ensures that -I/usr/local/include is employed when extensions'
+ extconf.rb scripts invoke have_header() since extension checks on
+ NextStep and OpenStep will fail without it if the desired resource
+ resides in the /usr/local tree; fixed formatting of --help message.
-Wed Oct 27 11:58:58 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
+ invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
+ (see configure's --enable-fat-binary option); added rule for new
+ missing/getcwd.c.
- * include/ruby/ruby.h (NUM2LONG_internal): add cast to get rid of a
- non GCC compiler warning. this is intentional type conversion.
+ * defines.h: fixed endian handling during MAB build (see configure's
+ --enable-fat-binary option) to ensure that all portions of the
+ project see the correct WORDS_BIGENDIAN value (some extension modules
+ were getting the wrong endian setting); added missing constants
+ GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
+ and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
+ define in NeXT section.
-Wed Oct 27 09:25:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
+ NextStep since, on some installations, this value always resolves
+ uselessly to zero.
- * cont.c: apply documentation patch by Run Paint Run Run.
- [ruby-core:32915]
+ * dln.c: added error reporting to NextStep extension loader since the
+ previous behavior of failing silently was not useful; now ensures
+ that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
+ for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
+ on Rhapsody since this header lacks multiple-include protection,
+ which resulted in "redefinition" compilation errors.
-Wed Oct 27 02:12:10 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * main.c: also create hard reference to objc_msgSend() on NeXT
+ platforms (in addition to Apple platforms).
- * object.c (Init_Object), constant.h, variable.c
- (rb_mod_private_constant, rb_mod_public_constant,
- set_const_visibility, rb_const_get_0): add Module#public_constant
- and private_constant. [ruby-dev:39685][ruby-core:32698]
+ * lib/mkmf.rb: now exports XCFLAGS from configure script to extension
+ makefiles so that extensions can be built MAB (see configure's
+ --enable-fat-binary option); also utilize XCFLAGS in cc_command()
+ (but not cpp_command() because MAB flags are incompatible with
+ direct invocation of `cpp').
- * test/ruby/test_module.rb: add tests for above.
+ * ext/curses/extconf.rb: now additionally checks for presence of these
+ curses functions which are not present on NextStep or Openstep:
+ bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
+ setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
+ wscrl(), wsetscrreg()
-Wed Oct 27 02:02:54 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/curses/curses.c: added appropriate #ifdef's for additional set of
+ curses functions now checked by extconf.rb; fixed curses_bkgd() and
+ window_bkgd() to correctly return boolean result rather than numeric
+ result; fixed window_getbkgd() to correctly signal an error by
+ returning nil rather than -1.
- * class.c, constant.h, gc.c, method.h, object.c, variable.c,
- vm_insnhelper.c: use struct rb_constant_entry_t as entry of
- RCLASS_CONST_TBL. RCLASS_CONST_TBL has contained VALUE of constant
- directly. Now instead rb_const_entry_t is contained in
- RCLASS_CONST_TBL, rb_const_entry_t is managed by malloc, and
- have not only the value itself but also visibility flag.
- This is another preparation for private constant (see
- [ruby-dev:39685][ruby-core:32698]).
+ * ext/etc/etc.c: setup_passwd() and setup_group() now check for null
+ pointers before invoking rb_tainted_str_new2() upon fields extracted
+ from `struct passwd' and `struct group' since null pointers in some
+ fields are common on NextStep/OpenStep (especially so for the
+ `pw_comment' field) and rb_tainted_str_new2() throws an exception
+ when it receives a null pointer.
-Wed Oct 27 01:56:34 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
+ platforms such as NextStep and OpenStep which lack strdup().
- * class.c, gc.c, object.c, variable.c, vm_insnhelper.c,
- include/ruby/ruby.h: separate RCLASS_CONST_TBL from RCLASS_IV_TBL.
- RCLASS_IV_TBL has contained not only instance variable table but
- also constant table. Now the two table are separated to
- RCLASS_CONST_TBL and RCLASS_IV_TBL. This is a preparation for
- private constant (see [ruby-dev:39685][ruby-core:32698]).
+ * ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
+ gethostbyaddr(), and gethostbyname() from (const char*) to non-const
+ (char*) for older platforms such as NextStep and OpenStep.
-Tue Oct 26 18:51:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
+ platforms such as NextStep and OpenStep which lack strdup(); include
+ <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
+ argument of gethostbyaddr() and getservbyname() from (const char*) to
+ non-const (char*) for older platforms.
- * lib/scanf.rb (extract_float): allow 2.e+2 style.
- [ruby-dev:42452] #3978
+ * ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
+ platforms such as NextStep and OpenStep which lack strdup().
-Tue Oct 26 18:09:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 8 22:19:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * Makefile.in (ASFLAGS): needs INCFLAGS.
+ * lib/test/unit.rb: removed installation instructions.
- * configure.in (rb_cv_dynamic_alloca): check if extra source for
- dynamic size alloca.
+ * lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
+ central location.
- * missing/x86_64-chkstk.s (___chkstk): necessary for alloca of
- amd64-mingw32msvc-gcc on Ubuntu.
+ * lib/test/unit.rb: ditto.
- * thread_win32.c (ruby_alloca_chkstk): check stack overflow
+ * lib/test/unit.rb: extracted the running code in to AutoRunner.
-Tue Oct 26 18:04:53 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/autorunner.rb: added.
- * template/ruby.pc.in (Libs): needs DLDFLAGS.
+ * lib/test/unit/collector/objectspace.rb: extracted common test
+ collection functionality in to a module.
-Tue Oct 26 12:47:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/collector.rb: ditto; added.
- * common.mk (pkgconfig-data): moved from Makefile.in.
+ * test/testunit/collector/test_objectspace.rb: ditto.
- * tool/rbinstall.rb: install pc file only if non-empty.
- [ruby-core:32901] #3983
+ * lib/test/unit/collector/dir.rb: added. Supports collecting tests out
+ of a directory structure.
- * win32/Makefile.sub (ruby_pc): create pc file.
+ * test/testunit/collector/test_dir.rb: added.
-Tue Oct 26 09:13:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/runner.rb: simplified to use the new capabilities.
- * configure.in (rb_cv_gcc_atomic_builtins): check for atomic
- builtins, all are not available in Apple derivative gcc.
+Tue Oct 7 15:23:09 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Tue Oct 26 00:29:26 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
- * Makefile.in (pkgconfig-data): create pkg-config metadata file.
+ * test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
- * tool/rbinstall.rb: install pkg-config metadata file.
+ * test/ruby/endblockwarn.rb: new file added to test of END-in-method
+ warning.
- * template/ruby.pc.in: template of pkg-config metadata file.
+Tue Oct 7 12:23:47 2003 Tanaka Akira <akr@m17n.org>
-Mon Oct 25 16:38:07 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
- * signal.c (rb_atomic_t): GCC (of at least recent versions)
- has ubiquitous support for atomic operations. On that
- compiler a C program can issue a memory barrier using these
- dedicated instructions. According to the GCC manual they
- cargo culted this feature form the Itanium ABI so chances
- are that other compilers could also support this feature.
- But so far GCC is the only compiler that I know to have it.
- Also note that this works on non-Itanium machines.
+ * ext/socket/extconf.rb: useless assignment removed.
-Mon Oct 25 06:21:35 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 7 09:13:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vsnprintf.c (BSD_vfprintf): prec digits fractal part should be
- appended to 0 if prec is given. [ruby-dev:42453] #3979
+ * test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
+ allowed in eval.
-Mon Oct 25 02:57:21 2010 Koichi Sasada <ko1@atdot.net>
+Tue Oct 7 04:15:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * common.mk (run.gdb): Quit gdb on 'make gdb' when
- no signals are received.
+ * parse.y (stmt): should not expand mrhs if lhs is solely starred.
-Mon Oct 25 00:25:23 2010 Tadayoshi Funaba <tadf@dotrb.org>
+Tue Oct 7 02:57:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/date.rb: some corrections of documentation.
+ * parse.y (stmt): rhs of multiple assignment should not be
+ expanded using "to_a". [ruby-dev:21527]
-Sun Oct 24 17:14:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 7 01:42:34 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * array.c, gc.c, hash.c, object.c, string.c, struct.c,
- transcode.c, variable.c, vm.c, vm_insnhelper.c, vm_method.c:
- replace calls to rb_error_frozen() with rb_check_frozen(). a
- patch from Run Paint Run Run at [ruby-core:32014]
+ * ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
+ free function for ASN1_OBJECT.
- * include/ruby/intern.h (rb_check_frozen): optimize.
- [ruby-core:32878]
+ * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
+ ASN1::ObjectId#sn; it returns short name text representation of OID.
-Sun Oct 24 15:16:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
+ ASN1::ObjectId#ln; it returns long name text representation of OID.
- * lib/test/unit.rb (Test::Unit::Mini#run): abort if interrupted.
+ * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
+ ASN1::ObjectId#oid; it returns numerical representation of OID.
- * lib/test/unit.rb (Test::Unit::Mini#run_test_suites): show the
- result even when interrupted on the way.
+Mon Oct 6 22:59:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * lib/test/unit.rb (Test::Unit::Mini#run_test_suites): ensure
- output sync mode to be restored.
+ * lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
+ respond_to?(:binmode). record separator was wrong when you gave
+ text mode IO to Reader.parse and Writer.generate.
-Sun Oct 24 14:11:16 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/csv/test_csv.rb: add tests for above change.
- * vm.c (vm_define_method): defined method is run with the default
- public visibility regardless the visibility context of definition.
- [ruby-core:30638]
+Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
-Sun Oct 24 12:08:54 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
- * lib/test/unit.rb: make test/unit play nicely with the rake test
- loader. [ruby-core:32864]
+ * ext/socket/socket.c (thread_read_select): restored.
-Sun Oct 24 00:25:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 6 16:23:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_rubyoptions.rb (test_segv_test): follow up the
- change at r29556.
+ * marshal.c (w_object): wrong method name in the message.
-Sat Oct 23 14:39:58 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 6 16:02:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb: $extmk should be true for test/runner.
+ * parse.y (stmt): END in method should cause warning.
+ [ruby-dev:21519]
-Sat Oct 23 10:55:37 2010 Koichi Sasada <ko1@atdot.net>
+Mon Oct 6 15:17:23 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * vm_dump.c (rb_vm_bugreport): fix to add bug outputs.
- - loaded script ($0)
- - loaded features ($")
- - process memory map on Linux (/proc/self/maps)
+ * test/ruby/test_iterator.rb (test_block_argument_without_paren):
+ added. (follows sample/test.rb)
- * vm_dump.c (rb_vmdebug_stack_dump_raw): fix header message.
+Mon Oct 6 11:57:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Fri Oct 22 14:50:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
+ test for eval-ed BEGIN END order.
- * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
- assertion message must not be nil.
+Mon Oct 6 09:19:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Oct 22 13:59:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * marshal.c (w_object): should pass "weak" value to next level.
+ [ruby-dev:21496]
- * lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
- treat nil case. Please run test-all before commit such change.
+ * eval.c (proc_alloc): should not use cached object if klass is
+ different. [ruby-talk:83685]
-Thu Oct 21 23:58:14 2010 Koichi Sasada <ko1@atdot.net>
+Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
- * gc.c (gc_lazy_sweep): Variable declarations should be at
- the head of block.
+ * lib/pathname.rb: version information is added in document.
-Thu Oct 21 23:56:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 5 23:07:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c (objspace_each_objects, rb_objspace_each_objects): use
- struct.
+ * eval.c (rb_f_END): block should be given. [ruby-dev:21497]
- * gc.c (objspace_each_objects): fix return with no value.
+Sun Oct 5 22:51:23 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Thu Oct 21 23:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/ext/openssl/extconf.rb: add check for some engine functions
+ unavailable in OpenSSL-0.9.6.
- * dir.c (dir_initialize): remove useless intermediate variable.
+ * lib/ext/openssl/ossl_engine.c: ditto.
-Thu Oct 21 16:07:20 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Oct 5 17:56:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (rb_f_select): change rdoc.
- patched by Eito Katagiri [ruby-core:31805]
+ * eval.c (rb_eval): fix evaluation order. [ruby-list:38431]
-Thu Oct 21 15:55:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Oct 5 15:05:06 2003 akira yamada <akira@ruby-lang.org>
- * lib/webrick/httpauth/digestauth.rb
- (WEBrick::HTTPAuth::ProxyDigestAuth#check_uri): privated.
- [ruby-dev:42344]
+ * test/uri/*: translated RUNIT to Test::Unit.
-Thu Oct 21 15:50:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Oct 5 14:37:39 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * io.c (rb_f_select): add correct rdoc.
- patched by Dave Thomas [ruby-core:32467]
+ * lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
-Thu Oct 21 15:42:01 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/soap/marshal/test_marshal.rb: ditto.
- * lib/net/telnet.rb (Net::Telnet#close): added.
- patched by Erik Hollensbe [ruby-dev:42260] #3830
+ * test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
+ RUBYBIN.
-Thu Oct 21 13:08:00 2010 Narihiro Nakamura <authornari@gmail.com>
+Sun Oct 5 13:47:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * gc.c (rb_objspace_each_objects): don't lazy sweep in
- rb_objspace_each_objects. [Bug #3940] [ruby-dev:42369]
+ * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
+ about scope, order and allowed syntax.
-Thu Oct 21 00:05:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 5 11:54:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * test/ruby/test_io.rb (TestIO#pipe): get rid of deadlock on pipe.
- a patch from Tomoyuki Chikanaga at [ruby-dev:42435]. #3970
+ * test/ruby/envutil.rb: added. split "rubybin" from test_system.rb.
- * test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
+ * test/ruby/test_system.rb: use envutil.rb
-Wed Oct 20 23:54:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_beginendblock.rb: added.
- * ext/dbm/dbm.c: rdoc based on a patch by mathew meta AT
- pobox.com, at [ruby-core:32853].
+ * test/ruby/beginmainend.rb: added. used in test_beginendblock.rb.
-Wed Oct 20 10:47:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Oct 5 11:23:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * util.c (ruby_strtod): reject 0x1.p+0. [ruby-dev:42432] #3966
+ * test/testunit/runit/test_testresult.rb: removed some unnecessary
+ cruft.
-Wed Oct 20 10:00:57 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Oct 5 11:14:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * vsnprintf.c (BSD_vfprintf): print floating point on "%#a".
- [ruby-dev:42431] Bug#3965
+ * lib/rubyunit.rb: aliasing TestCase into the top level is
+ problematic.
-Tue Oct 19 19:30:11 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/runit/assert.rb: fixed a couple of bugs caused by recent
+ refactoring in Test::Unit.
- * vsnprintf.c (BSD_vfprintf): clear ALT flag for %a.
- [ruby-core:32841] [ruby-core:32848]
+ * test/testunit/runit/*: added.
-Tue Oct 19 12:19:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 5 10:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * vsnprintf.c (BSD_vfprintf): fix over-count of field size.
+ * lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
+ work. [ruby-dev:21484]
-Tue Oct 19 03:08:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 5 09:52:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * vsnprintf.c (BSD_vfprintf): use HEXPREFIX flag for prefix of %a.
- [ruby-core:32841]
+ * lib/test/unit/assertions.rb: will use pp for output if available.
+ Can be disabled by setting Assertions.use_pp = false.
-Mon Oct 18 13:18:01 2010 Akinori MUSHA <knu@iDaemons.org>
+ * test/testunit/test_assertions.rb: made a small change to exception
+ formatting.
- * ext/digest/digest.c (rb_digest_class_init): Define
- Digest::Class.new(). [Feature #3954]
+Sun Oct 5 07:42:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Mon Oct 18 12:58:40 2010 Tanaka Akira <akr@fsij.org>
+ * lib/test/unit/assertions.rb: made small improvements to assertion
+ messages. Deprecated Assertions#assert_not_nil; use #assert instead.
- * pack.c (pack_pack): refine the document. [ruby-dev:42397]
- (pack_unpack): ditto.
+ * test/testunit/test_assertions.rb: ditto.
-Mon Oct 18 10:19:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/testunit/util/test_procwrapper.rb: use #assert instead of
+ #assert_not_nil.
- * lib/net/http.rb (transport_request): @socket may be nil.
- patched by Egbert Eich [ruby-core:32829]
+Sun Oct 5 04:10:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Mon Oct 18 09:57:28 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/assertions.rb: refactored message building.
- * sprintf.c (BSD_vfprintf): wrong padding around prefix and
- floating point with %a. [ruby-dev:42403] Bug #3956
+Sun Oct 5 03:40:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Oct 17 22:36:33 2010 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl_asn1.h: global symbols should be declared
+ as external.
- * lib/date/delta.rb: added an rdoc tag.
+Sun Oct 5 03:03:20 2003 akira yamada <akira@ruby-lang.org>
-Sun Oct 17 10:47:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_exception.rb (test_else): added.
- * variable.c (rb_mod_remove_const): update rdoc.
- [ruby-core:31957]
+Sun Oct 5 02:12:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Sun Oct 17 10:40:17 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/assertions.rb: changed assertion messages to rely more
+ heavily on #inspect. Added backtrace filtering for exceptions in
+ assertion messages.
- * class.c (rb_define_{class,module}_id_under): register to be
- marked, which probably are defined and used internally.
+ * test/testunit/test_assertions.rb: ditto.
-Sat Oct 16 11:10:55 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Sun Oct 5 02:12:00 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
- * ext/win32ole/win32ole.c (ole_encoding2cp): set codepage 20936
- according to GB2312. [Bug #3937] [ruby-core:32758]
+ * lib/drb/acl.rb, lib/drb/ssl.rb: added.
-Sat Oct 16 10:54:57 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/drb/drb.rb: exit from a thread using 'break'.
- * Makefile.in (CPP): already used in .c.i rule.
+Sat Oct 4 21:49:14 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * cygwin/GNUmakefile.in (DLLWRAP, WINDRES): add --driver-name and
- --preprocessor options explicitly. [ruby-core:32776]
+ * gc.c (Init_stack): the type of space is changed to unsigned int
+ from double. [ruby-dev:21483]
-Sat Oct 16 10:06:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Oct 4 17:52:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/sdbm/_sdbm.c (SEEDUPS, BADMESS): make settable using command
- line options.
+ * lib/soap/netHttpClient.rb: follow http-access2. hosts which matches
+ ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
+ - [,:] separated. ("ruby-lang.org:rubyist.net")
+ - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
+ - if you want specify host by IP address, give full address.
+ ("192.168.1.1, 192.168.1.2")
- * ext/sdbm/_sdbm.c (makroom): suppress unused result warning.
+ * lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
- * ext/sdbm/extconf.rb: disable BADMESS, a library should not emit
- messages directly.
+ * test/runner.rb: give testsuite name.
-Sat Oct 16 08:39:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Oct 4 15:16:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * dln.c (dln_strerror): get English message first, instead of
- system default. see [ruby-dev:42358].
+ * marshal.c (w_object): instance variable dump do not cause error
+ for objects that cannot be dumped, if they traversed from
+ marshal_dump. they are just ignored.
-Sat Oct 16 00:08:00 2010 Koichi Sasada <ko1@atdot.net>
+ * gc.c (Init_stack): cast "space" (doble value) into unsigned
+ int. should run on PowerPC.
- * hash.c (rb_hash_aref): skip calling "default" method
- if it is not needed, for speed-up.
+ * eval.c (rb_eval): should not execute else part if any exception
+ is caught. [ruby-dev:21482]
-Fri Oct 15 23:36:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (f_args): should allow unparenthesized block argument.
- * file.c (NUM2DEVT, DEVT2NUM, PRI_DEVT_PREFIX): fallback to
- unsigned int.
+ * parse.y (f_rest_arg): should allow unparenthesized rest
+ argument.
-Fri Oct 15 22:54:46 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Sat Oct 4 14:59:51 2003 Tanaka Akira <akr@m17n.org>
- * ext/win32ole/win32ole.c (ole_hresult2msg): get English message first,
- instead of system default. [ruby-core:32765]
+ * lib/pathname.rb (initialize): raise ArgumentError if argument has
+ '\0' character.
+ (relative_path_from): new method.
+ (each_entry): new method for replacement of dir_foreach.
+ (foreach, foreachline, dir_foreach, chdir): obsoleted.
-Fri Oct 15 22:47:31 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Oct 4 12:58:48 2003 akira yamada <akira@ruby-lang.org>
- * include/ruby/ruby.h (VALUE): prefer long over uintptr_t,
- FIX2LONG expects VALUE to be long at least.
+ * test/uri/* (6 files): added.
- * include/ruby/ruby.h (FIX2LONG): parenthesize the argument.
+Sat Oct 4 12:44:45 2003 akira yamada <akira@ruby-lang.org>
-Fri Oct 15 20:30:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
- * configure.in (dev_t): use RUBY_REPLACE_TYPE.
+Sat Oct 4 07:33:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * file.c (rb_stat_inspect): use PRI_DEVT_PREFIX.
+ * lib/test/unit/testsuite.rb: changed #<< to return self, and added
+ #delete.
-Fri Oct 15 17:26:57 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/testunit/test_testsuite.rb: ditto. Also slightly refactored
+ #test_size.
- * pack.c (pack_pack): simplify comparison of explicit_endian
- as pointed by nobu.
+ * lib/test/unit/collector/objectspace.rb: collector now preserves the
+ hierarchy of suites.
- * pack.c (pack_unpack): ditto.
+ * test/testunit/collector/test_objectspace.rb: ditto.
-Fri Oct 15 16:40:37 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Oct 4 04:48:49 2003 why the lucky stiff <why@ruby-lang.org>
- * pack.c (pack_pack): fix more than one modifiers appear in the
- format string. [ruby-core:32793]
+ * ext/syck/rubyext.c: default keys handled.
- * pack.c (pack_unpack): ditto.
+ * ext/syck/syck.h: lowered default buffer size to 16k for increased
+ performance.
-Thu Oct 14 23:20:42 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * test/yaml: checkin of basic unit tests.
- * test/win32ole/test_folderitem2_invokeverb.rb: refactoring.
+Sat Oct 4 04:24:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Thu Oct 14 22:18:29 2010 Koichi Sasada <ko1@atdot.net>
+ * ext/openssl/extconf.rb: add check for X509V3_set_nconf.
- * insns.def, iseq.c, vm_insnhelper.c: rename variable name
- (ip -> iseq).
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
+ cannot implement if X509V3_set_nconf doesn't exist.
-Thu Oct 14 20:41:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Oct 4 02:12:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * pack.c (pack_pack): support endian modifiers: < and >.
- [ruby-dev:42376] Feature #3491
+ * lib/xsd/datatypes.rb: dump sign by itself. under the problematic
+ platform, sprintf("%+.10g", -0.0) => +0. sigh.
- * pack.c (pack_unpack): ditto.
+ * sample/wsdl/amazon/*: update schema ver2 to ver3.
+
+Sat Oct 4 01:33:46 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (initialize): duplicate and freeze argument.
+ (to_s): return duplicated string.
+ (children): new method.
+ (each_line): new alias to foreachline.
-Thu Oct 14 20:50:51 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Fri Oct 3 16:13:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/win32ole/win32ole.c (reg_get_val): expand environment in
- the pathname. [Bug #3907]
+ * ext/openssl/ossl_asn1.c: add DER encoder and decoder.
-Thu Oct 14 07:35:07 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
- * file.c (DEVT2NUM): added. Size of dev_t is depend on the
- environment even if POSIX defines dev_t as unsigned integer.
- For example, OpenVMS, 64bit Solaris 9, and NetBSD 6 defines
- dev_t as 64bit unsigned integer.
+ * ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
- * file.c (rb_stat_dev): use DEVT2NUM.
+ * ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
- * file.c (rb_stat_dev_major): dev_t is not long. major(3)'s return
- value is int.
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
+ DER encoded data argument.
- * file.c (rb_stat_dev_minor): dev_t is not long. minor(3)'s return
- value is int.
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
+ DER encoded data in OpenSSL::ASN1 types.
- * configure.in: check size of dev_t.
+Fri Oct 3 13:02:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Thu Oct 14 07:22:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit.rb: refactored to use optparse.
- * array.c (rb_ary_and, rb_ary_or), class.c (rb_mod_init_copy),
- gc.c (undefine_final), time.c (time_mload): get rid of
- type-punning casts.
+ * lib/test/unit.rb: added support for selecting the output
+ level from the command-line.
-Thu Oct 14 04:16:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit.rb: added a command-line switch to stop processing
+ the command-line, allowing arguments to be passed to tests.
- * numeric.c (ruby_float_step): fix Numeric#step with infinity unit
- doesn't works well. [ruby-core:32779]
+ * lib/test/unit.rb: changed the method for specifying a runner or a
+ filter from the command-line.
-Wed Oct 13 23:16:46 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/test/unit/collector/objectspace.rb: fixed a bug causing all
+ tests to be excluded when the filter was set to an empty array.
- * tool/enc-unicode.rb: get rid of lots of warnings.
+ * test/testunit/collector/test_objectspace.rb: ditto.
- * iseq.c (insn_operand_intern, rb_iseq_disasm): fix format specifiers.
+Fri Oct 3 08:14:32 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (thread_free): ditto.
+ * lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
+ 'class ::Foo' syntax. [ruby-talk:83514]
- * numeric.c (check_uint): get rid of overflow on LLP64 platforms.
+Fri Oct 3 08:01:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * insns.def (opt_case_dispatch): use st_data_t.
+ * lib/test/unit/assertions.rb: added a default message for #assert,
+ #assert_block, and #flunk.
-Wed Oct 13 22:32:34 2010 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
+ * test/testunit/test_assertions.rb: ditto.
- * lib/cgi/util.rb (CGI::unescape): bugfix to unescape the multibyte
- string. Thanks nobu and tDiary dev members. [Bug #3909]
+ * lib/test/unit/failure.rb: failures now show a better trace of where
+ they occurred.
-Wed Oct 13 21:13:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/testunit/test_failure.rb: ditto (added).
- * numeric.c (int_chr): raise error when the value is negative.
+ * lib/test/unit/testcase.rb: ditto.
-Wed Oct 13 19:24:08 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * test/testunit/test_testcase.rb: ditto.
- * vm.c (ruby_vm_destruct): This function type was wrong; correct to the prototype.
+ * lib/test/unit/util/backtracefilter.rb: added.
-Wed Oct 13 14:58:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/testunit/util/test_backtracefilter.rb: added.
- * numeric.c (rb_num_to_uint): fix 32bit logic.
+ * lib/test/unit/error.rb: changed to use BacktraceFilter and improved
+ output.
-Wed Oct 13 12:53:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/testunit/test_error.rb: ditto.
- * numeric.c (rb_num_to_uint): added to check the range of arguments.
- Mainly for negative value with NUM2UINT on 32bit environment.
+Thu Oct 2 20:33:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (rb_str_concat): use rb_num_to_uint.
+ * ext/iconv/iconv.c (iconv_failure_initialize): conform with
+ orthodox initialization method.
-Wed Oct 13 12:10:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/iconv/iconv.c (iconv_fail): initialize exception instance
+ from the class, and do not share instance variables with the
+ others. [ruby-dev:21470]
- * thread_win32.c (w32_error): get English message first, instead
- of system default. see [ruby-core:32765].
- [experimental]
+Thu Oct 2 18:20:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 13 11:04:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (Init_Time): define initialize. [ruby-dev:21469]
- * debug.c (ruby_set_debug_option): define always for binary
- compatibility with debug env enabled binary.
+Thu Oct 2 17:39:38 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * signal.c (ruby_enable_coredump): ditto.
+ * ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
+ it supports OpenSSL hardware cryptographic engine interface.
-Wed Oct 13 10:52:51 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_engine.h: ditto.
- * include/ruby/ruby.h (ruby_executable_node): missing prototype.
+ * ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
-Wed Oct 13 05:23:04 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/extconf.rb: add check for openssl/engine.h.
- * missing/strchr.c: add strlen's prototype.
+ * ext/openssl/ossl.c: call Init_ossl_engine().
- * missing/strstr.c: ditto.
+ * ext/openssl/ossl.h: include openssl/engine.h.
-Wed Oct 13 00:21:17 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
+ EVP_PKEY referes engine.
- * ext/syck/rubyext.c (struct mktime_arg): constified.
+Thu Oct 2 17:22:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/syck/rubyext.c (mktime_do, mktime_r, rb_syck_mktime): fix
- function signatures.
+ * time.c (time_load): restore instance variables (if any) before
+ loading from marshaled data.
-Wed Oct 13 00:18:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Oct 2 14:19:15 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * st.c (MurmurMagic): get rid of literal overflow.
+ * ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
+ set error object to $!.
- * configure.in (RUBY_CHECK_PRINTF_PREFIX): check for printf format
- specifier if possible.
+ * ext/iconv/iconv.c (iconv_convert): error handler block should
+ return appended part and the rest. if rest is nil, the
+ conversion stops.
-Tue Oct 12 23:58:19 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Oct 2 12:00:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * win32/win32.c (rb_w32_open_osfhandle, rb_w32_wopen, rb_w32_pipe):
- use uintptr_t instead of long for win64.
+ * variable.c (rb_const_defined_0): look up constants in Object as
+ well. [ruby-dev:21458]
- * win32/win32.c (socketpair_internal): suppress warnings.
+ * test/ruby/test_defined.rb (TestDefined::test_defined): test for
+ constants.
- * win32/win32.c (ftruncate): use HANDLE instead of long for win64.
+Thu Oct 2 11:17:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * vsnprintf.c (BSD_vfprintf): fix cast.
+ * lib/test/unit/assertions.rb: should not capture an
+ AssertionFailedError unless explicitly requested.
- * numeric.c (rb_num2fix): result of rb_num2long is SIGNED_VALUE.
+ * test/testunit/test_assertions.rb: ditto.
- * compile.c (iseq_build_body), error.c (set_syserr, get_syserr),
- (syserr_initialize), gc.c (define_final, rb_gc_copy_finalizer),
- (run_final), hash.c (rb_hash_aref, rb_hash_lookup2),
- (rb_hash_fetch_m, rb_hash_clear, rb_hash_aset, eql_i),
- iseq.c (iseq_load, iseq_data_to_ary), marshal.c (r_symlink),
- thread.c (rb_thread_local_aref),
- variable.c (generic_ivar_remove, ivar_get, rb_const_get_0),
- (rb_cvar_get), vm.c (rb_vm_check_redefinition_opt_method),
- vm_insnhelper.c (vm_get_ev_const), vm_method.c (remove_method),
- ext/iconv/iconv.c (map_charset): use st_data_t.
+ * test/testunit/collector/test_objectspace.rb: fixed a test failure
+ caused by methods being returned in different orders on different
+ platforms by moving test sorting from TestSuite into the locations
+ where suites are constructed. [ruby-talk:83156]
- * compile.c (iseq_build_body), insns.def (getglobal, setglobal),
- iseq.c (iseq_load, iseq_data_to_ary), util.c (valid_filename):
- use VALUE.
+ * lib/test/unit/testcase.rb: ditto.
- * gc.c (obj_free, rb_objspace_call_finalizer): fix truncating
- cast.
+ * lib/test/unit/testsuite.rb: ditto.
- * gc.c (mark_current_machine_context): suppress warnings.
+ * lib/test/unit/collector/objectspace.rb: ditto.
- * compile.c (iseq_compile_each): fix truncating cast.
+Thu Oct 2 03:25:01 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * cont.c (fiber_setcontext): missing variable definition.
+ * eval.c (rb_thread_raise): prototype; avoid VC++ warning.
-Tue Oct 12 19:25:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 2 01:37:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * error.c (exc_to_s): use OBJ_INFECT.
+ * time.c (time_mdump): new marshal dumper. _dump is still
+ available for compatibility.
- * error.c (name_err_to_s): ditto.
+ * time.c (time_mload): new marshal loader.
- * error.c (name_err_mesg_to_str): ditto.
+ * marshal.c (w_object): preserve instance variables for objects
+ with marshal_dump.
- * error.c (syserr_initialize): ditto.
+ * marshal.c (r_object0): restore instance variables before calling
+ marshal_load.
-Tue Oct 12 19:07:55 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * error.c (rb_warn_m): always return nil.
- * error.c (syserr_initialize): taint message if mesg is given
- and it is tainted.
+Thu Oct 2 01:32:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Oct 12 18:25:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_f_block_given_p): real required condition is
+ ruby_frame->prev->iter == ITER_CUR.
- * io.c (rb_io_ungetc): always see Bignum. On 32bit valid value
- may be a Bignum. On 64bit for errors. [ruby-dev:42366]
+ * eval.c (rb_block_given_p): ditto.
-Tue Oct 12 18:25:04 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (block_pass): update ruby_frame->iter only when previous
+ value is ITER_NOT.
- * string.c (rb_str_concat): use unsigned int for GB18030.
+Thu Oct 2 01:02:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Oct 12 17:53:49 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * variable.c (rb_const_defined_at): should exclude constants from
+ Object when TYPE(klass) == T_MODULE *and* exclude is on.
+ [ruby-dev:21458]
- * numeric (check_uint): the mask must refer to VALUE.
+ * variable.c (rb_const_get_0): do not lookup constants from Object
+ when TYPE(klass) == T_MODULE *and* exclude is on.
-Tue Oct 12 17:47:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 2 00:21:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * numeric (check_uint): set MSB for negative value.
+ * test/logger/test_logger.rb: unlinking file before close causes
+ problem under win32 box.
- * numeric (rb_num2uint): return value's type of rb_num2ulong
- is VALUE.
+ * lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
+ when stringified and embedded into XML instance. Ruby's sprintf may
+ format -0.0 as "0.0" (no minus sign) depending on underlying C
+ sprintf implementation.
- * numeric (int_chr): variable i can't be negative.
+ * test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
-Tue Oct 12 16:04:37 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/soap/calc/*: give httpd config param "CGIInterpreter".
+ "/usr/bin/env ruby" thing does not work under non-Unix boxes.
- * win32/win32.c (rb_w32_strerror): get English message first, instead
- of system default. see [ruby-dev:42358].
- [experimental]
+Sat Oct 2 00:42:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Oct 12 15:52:35 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * marshal.c (r_byte): retrieve pointer from string value for each
+ time. [ruby-dev:24404]
- * win32/win32.c (rb_w32_strerror): unmap some range of errno for
- workaround of VC10's strerror() and sys_nerr problem.
- based on a patch from Akio Tajima, [ruby-dev:42355].
+ * marshal.c (r_bytes0): ditto.
-Tue Oct 12 15:36:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * enum.c (sort_by_i): re-entrance check added. [ruby-dev:24399]
- * io.c (rb_io_ungetc): use unsigned int for GB18030.
+ * io.c (io_read): should freeze all reading buffer.
+ [ruby-dev:24400]
-Tue Oct 12 15:14:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (rb_str_sum): should use bignums when bits is greater
+ than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
- * io.c (rb_io_putc): support multibyte characters.
- [ruby-core:30697]
+ * eval.c (specific_eval): defer pointer retrieval to prevent
+ unsafe sourcefile string modification. [ruby-dev:24382]
-Tue Oct 12 15:10:31 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (rb_str_sum): wrong cast caused wrong result.
+ [ruby-dev:24385]
- * numeric.c (rb_enc_uint_chr): split from int_chr.
+ * enum.c (enum_sort_by): hide temporary array from
+ ObjectSpace.each_object. [ruby-dev:24386]
- * numeric.c (int_chr): use rb_enc_uint_chr.
+ * string.c (rb_str_sum): check was done with false pointer.
+ [ruby-dev:24383]
- * include/ruby/encoding.h (rb_enc_uint_chr): added.
+ * string.c (rb_str_sum): string may be altered. [ruby-dev:24381]
-Tue Oct 12 14:04:41 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 2 00:25:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * numeric.c (int_chr): a codepoint of Ruby M17N must be 32bit
- unsigned int; GB18030 uses MSB. Also note that OnigCodePoint
- is defined as unsigned int.
+ * signal.c (ruby_signal_name): adjust to the prototype.
-Tue Oct 12 12:20:54 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * process.c (pst_inspect): ditto.
- * vm_dump.c (dump_thread): foolish mistake.
+ * ext/etc/etc.c (etc_getgrent, Init_etc): typo.
-Tue Oct 12 10:39:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 1 20:49:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * configure.in (RUBY_MINGW32): canonicalize only on mingw.
+ * gc.c (heaps): manage slots and limits together. [ruby-dev:21453]
-Mon Oct 11 20:20:23 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * gc.c (add_heap): should not clear heaps slot even if realloc()
+ failed.
- * lib/net/http.rb (HTTP.get): specify ASCII-8BIT as the result
- encoding of Zlib::GzipReader.
- http://hibari.2ch.net/test/read.cgi/tech/1281473294/271
+Wed Oct 1 20:36:49 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Mon Oct 11 17:42:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * MANIFEST: add wince/mkconfig_wce.rb.
- * error.c (syserr_initialize): use mesg's encoding when locale
- encoding is US-ASCII. If locale encoding is not US-ASCII,
- assume err has non ASCII characters. [ruby-dev:42358]
+Wed Oct 1 17:22:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Mon Oct 11 14:03:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
+ setgrent, getgrent, endgrent.
- * error.c (syserr_initialize): set the encoding of Errno::*#message
- as locale. [ruby-dev:42358]
+ * ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
-Mon Oct 11 06:38:27 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Oct 1 17:01:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/stringio/stringio.c (strio_set_encoding):
- StringIO#set_encoding can get 2nd argument and optional hash
- for API compatibility to IO. [ruby-dev:42356]
+ * eval.c (rb_load): Object scope had priority over required file
+ scope. [ruby-dev:21415]
-Mon Oct 11 06:11:30 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Oct 1 14:09:53 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
- * io.c (rb_io_set_encoding): use rb_funcall2 when the io is not
- a T_FILE. [ruby-dev:42356]
+ * wince/mkconfig_wce.rb: sorry, forget to commit.
-Sun Oct 10 18:42:23 2010 Akinori MUSHA <knu@iDaemons.org>
+Wed Oct 1 10:08:42 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
- * lib/set.rb (Set#replace): Apply a bit of optimization.
+ * wince/setup.mak: add sigmarionIII SDK support.
-Sun Oct 10 10:20:07 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * wince/Makefile.sub: ditto.
- * configure.in (RUBY_MINGW32): canonicalize as like mswin version.
+ * wince/mkexports.rb: fix linker error in SH4.
-Sun Oct 10 05:33:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
- * vm_core.h (rb_signal_buff_size, rb_signal_exec): moved
- declarations from thread.c.
+Wed Oct 1 08:02:52 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-Sat Oct 9 16:54:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * wince/time_wce.c (time): add zero check.
- * configure.in (RSHIFT): quote to get rid of argument expansion
- for autoconf 2.68.
+Tue Sep 30 16:11:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Oct 9 11:00:06 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * Makefile.in: copy lex.c from $(srcdir) if it's not the current
+ directory. [ruby-dev:21437]
- * thread.c (thread_reset_event_flags, exec_event_hooks): ignore
- hooks marked as removed.
+Tue Sep 30 11:29:23 2003 Tanaka Akira <akr@m17n.org>
- * thread.c (thread_exec_event_hooks): remove hooks to be removed.
+ * process.c (pst_inspect): describe stopped process "stopped".
- * thread.c (rb_threadptr_remove_event_hook, rb_remove_event_hook):
- defer removing hooks if running the hooks. [ruby-dev:42350]
+Tue Sep 30 09:31:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Oct 9 10:51:00 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/runner.rb: glob for directories.
- * thread.c (rb_threadptr_exec_event_hooks): suppress each event
- hooks separately.
+Tue Sep 30 09:11:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * thread.c (thread_suppress_tracing): split from
- ruby_suppress_tracing, accepting thread pointer and event mask.
+ * eval.c (rb_eval): while/until should not capture break unless
+ they are destination of the break.
-Sat Oct 9 08:16:01 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Sep 30 03:12:02 2003 Minero Aoki <aamine@loveruby.net>
- * thread.c (rb_threadptr_remove_event_hook): fix typo.
+ * lib/net/http.rb (finish): revert to 1.93.
-Fri Oct 8 10:52:25 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/pop.rb (finish): revert to 1.60.
- * common.mk (RBCONFIG): depends on version.h due to
- RUBY_PATCHLEVEL. [ruby-core:32709]
+ * lib/net/smtp.rb (finish): revert to 1.67.
-Fri Oct 8 00:24:54 2010 James Edward Gray II <jeg2@ruby-lang.org>
+ * lib/net/http.rb (do_start): ensure to close socket if failed to
+ start session.
- * lib/csv.rb: Fixing documentation typos. [ruby-core:32712]
+ * lib/net/pop.rb (do_start): ditto.
-Thu Oct 7 09:14:28 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/net/smtp.rb (do_start): ditto.
- * vm_exec.c (vm_exec_core): Treat clang as non gcc on this
- context: It has __asm__ but doesn't works well.
+ * lib/net/smtp.rb: SMTP#started? wrongly returned false always.
-Wed Oct 6 12:28:22 2010 Tanaka Akira <akr@fsij.org>
+Tue Sep 30 02:54:49 2003 Minero Aoki <aamine@loveruby.net>
- * lib/uri/generic.rb (URI::Generic#hostname): new method.
- (URI::Generic#hostname=): ditto.
+ * test/ruby/test_iterator.rb: new test
+ test_break__nested_loop[123].
- * lib/open-uri.rb: use URI#hostname
+Mon Sep 29 23:39:13 2003 Minero Aoki <aamine@loveruby.net>
- * lib/net/http.rb: ditto.
+ * lib/net/http.rb (finish): does not raise IOError even if
+ !started?, to allow closing socket which was opened before
+ session started.
- reported by Adam Majer. [ruby-core:32056]
+ * lib/net/pop.rb (finish): ditto.
-Wed Oct 6 11:52:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/smtp.rb (finish): ditto.
- * io.c (fptr_finalize): write_mutex might have been destroyed
- already in finalization phase, as the order of finalizers is not
- guaranteed. rb_mutex_t should be used in place of Mutex object
- in the future.
+Mon Sep 29 19:06:51 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Oct 5 22:17:02 2010 wanabe <s.wanabe@gmail.com>
+ * ext/win32ole/extconf.rb: add windows.h checking.
+ (ruby-bugs:PR#1185)
- * win32/mkexports.rb: revert r29320 and r29402.
+Mon Sep 29 16:18:30 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Mon Oct 4 12:43:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/logger.rb: check if the given logdevice object respond_to :write
+ and :close, not is_a? IO. duck duck.
- * parse.y (regexp): dregexp has literal string only at the head
- and successors are array. [ruby-core:32682]
+ * test/logger/test_logger.rb: self IO.pipe reading/writing may be
+ locked by the flood. use tempfile.
-Mon Oct 4 10:22:21 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/wsdl/xmlSchema/data.rb: wrong constant reference.
- * random.c (rand_init): This checks the value is in 32bit or not,
- so use int32_t, not int.
+Mon Sep 29 16:11:23 2003 Minero Aoki <aamine@loveruby.net>
-Mon Oct 4 09:47:39 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * test/fileutils/test_fileutils.rb: clean up temporary symlink.
+ Patched by NaHi. [ruby-dev:21420]
- * random.c (rand_init): remove useless assignment.
+Mon Sep 29 11:16:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * re.c (update_char_offset): remove unused variable.
+ * eval.c (rb_thread_atfork): wrong format specifier.
+ [ruby-dev:21428]
- * re.c (read_escaped_byte): ditto.
+ * process.c (pst_inspect): better description.
-Mon Oct 4 09:30:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Sep 29 02:31:44 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/openssl/lib/openssl/bn.rb (Integer#to_bn): OpenSSL::BN.new
- accepts only Strings, so call Integer#to_s(16).
- 16 is for an optimization. [ruby-dev:42336]
+ * lib/webrick/utils.rb (Utils::su): use setgid and setuid to
+ set real and effective IDs. and setup group access list by
+ initgroups.
-Mon Oct 4 07:57:51 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Sep 28 11:14:19 2003 Koji Arai <jca02266@nifty.ne.jp>
- * cont.c (fiber_memsize): Return size.
- Before this change, fiber_memsize always returns 0.
+ * ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
+ `initialize_copy' should be defined.
-Mon Oct 4 07:16:55 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/stringio/stringio.c (Init_stringio): ditto.
- * enc/unicode.c (onigenc_unicode_property_name_to_ctype):
- remove useless assignment.
+Sat Sep 27 18:25:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * vm.c (vm_make_proc_from_block): ditto.
+ * lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
+ $KCODE = "NONE" environment. check added.
- * variable.c (rb_ivar_count): ditto.
+ * test/xsd/test_xsd.rb: add tests for above fix.
-Mon Oct 4 06:40:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Sep 27 15:58:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * Makefile.in (clean-rdoc): Don't use \ in variable expansion.
- BSD make treats it as an escape character.
+ * lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
-Mon Oct 4 00:01:53 2010 wanabe <s.wanabe@gmail.com>
+ * lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
+ a chance to reset logging severity threshold.
- * tool/config.sub: revert r29320, r29324, r29347, r29354, r29365
- to automake-1.11.1. [ruby-core:32634]
+ * test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
+ silent.
- * win32/mkexports.rb: no longer use 'mingw64'. a patch from Luis Lavena
- at [ruby-core:32678].
+Sat Sep 27 09:44:18 2003 Minero Aoki <aamine@loveruby.net>
-Sun Oct 3 20:36:37 2010 Akio Tajima (arton) <artonx@yahoo.co.jp>
+ * test/fileutils/test_fileutils.rb: clear all errors on Windows.
+ [ruby-dev:21417]
- * test/win32ole/test_folderitem2_invokeverb.rb: Change creating
- shortcut verb to 'Link' [Bug #3339]
+ * test/fileutils/test_nowrite.rb: ditto.
-Sun Oct 3 19:44:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 27 09:14:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
- * configure.in (Makefile): get rid of duplicated ruby target when
- already there it was.
+ * array.c (rb_ary_delete): comparison may change the capacity.
+ [ruby-dev:24348]
-Sat Oct 2 22:59:32 2010 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * array.c (rb_ary_fill): fill should honor length argument.
+ [ruby-dev:24346]
- * test/win32ole/test_thread.rb: add for win32ole with Thread.
+ * array.c (rb_ary_replace): should not use ptr from shared array.
+ [ruby-dev:24345]
-Fri Oct 1 17:03:00 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
+ [ruby-talk:113807]
- * test/webrick/test_httpproxy.rb (TestWEBrickHTTPProxy::test_upstream_proxy):
- My machine fails this test at this line, saying 503 service unavailable.
+Sat Sep 27 04:57:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Thu Sep 30 16:11:08 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * test/ruby/test_file.rb: new file. only asserts unlink-before-close
+ behaviour now.
- * win32/win32.c (rb_w32_getenv): should return NULL if specified name
- is empty. a patch from Heesob Park at [ruby-core:32650]
+ * test/soap/marshal/test_digraph.rb: should close before unlink.
+ unlink-before-close pattern is not needed here.
-Thu Sep 30 15:18:23 2010 Yukihiro Matsumoto <matz@ruby-lang.org>
+Sat Sep 27 03:32:37 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * parse.y (command_asgn): allow command_call to be right hand side
- expression of chained assignment. [ruby-dev:42313]
+ * test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
+ each module namespace. TestMarshal in
+ test/soap/marshal/test_marshal.rb crashed with
+ test/ruby/test_marshal.rb.
-Thu Sep 30 10:55:38 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Sep 27 01:30:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * hash.c (ruby_setenv): workaround for old Windows. a patch from
- Heesob Park. [ruby-core:32353]
+ * ext/socket/socket.c (ruby_connect): on win32, type of the 4th
+ argument of getsockopt is char *.
-Thu Sep 30 09:29:06 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Sep 26 18:35:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/uri/common.rb (URI.encode_www_form): change treatment of
- undefined value in given array as latest internet draft for
- application/www-form-urlencoded.
- http://tools.ietf.org/html/draft-hoehrmann-urlencoded-01
+ * lib/resolv-replace.rb: 1.8 compliance. [ruby-talk:82946]
-Thu Sep 30 09:34:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Sep 26 17:39:27 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * vm_dump.c (dump_thread): fixed wrong type of return value of
- SymGetModuleBase64(). [ruby-dev:42306]
+ * test/ruby/test_marshal.rb: add test for ruby's objects.
-Wed Sep 29 21:04:05 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Fri Sep 26 09:52:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/ruby/test_rubyoptions.rb (TestRubyOptions::test_script_from_stdin):
- As usual, PTY is not always available.
+ * defines.h (flush_register_windows): use volatile only for gcc on
+ Solaris. [ruby-dev:21403]
-Wed Sep 29 18:38:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (xsystem): use system directly to honor shell meta
+ charaters.
- * tool/config.sub (x64): regularize only for pc vendor, and strip
- useless 64 suffix.
+Fri Sep 26 00:10:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Wed Sep 29 17:53:02 2010 Kenta Murata <mrkn@mrkn.jp>
+ * lib/README: updated.
- * ext/bigdecimal/bigdecimal.c (BIGDECIMAL_ENABLE_VPRINT):
- VPrint is usually disabled. It's only used in debugging.
+Thu Sep 25 17:48:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Sep 29 17:41:34 2010 Kenta Murata <mrkn@mrkn.jp>
+ * ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
+ rb_protect.
- * ext/bigdecimal/bigdecimal.c (BigDecimal_save_limit):
- return the result of a block.
+ * ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
+ value.
- * test/bigdecimal/test_bigdecimal.rb (test_save_limit):
- add a test for the above change.
+Thu Sep 25 09:00:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-Wed Sep 29 16:18:03 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/ostruct.rb: Added OpenStruct#==.
- * vm_dump.c (dump_thread): remove unused optional arguments.
+ * test/ostruct/test_ostruct.rb: Added.
-Wed Sep 29 13:26:30 2010 Kenta Murata <mrkn@mrkn.jp>
+Thu Sep 25 07:55:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_save_rounding_mode):
- return the result of a block.
+ * ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
+ ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
+ not use C++ or C99 style comment yet. (ruby-bugs:PR#1184)
- * test/bigdecimal/test_bigdecimal.rb (test_save_rounding_mode):
- add a test for the above change.
+Thu Sep 25 00:23:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb (test_save_exception_mode):
- add a test for the return value of BigDecimal.save_exception_mode.
+ * MANIFEST: add SOAP4R.
-Wed Sep 29 12:45:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+Thu Sep 25 00:13:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_div2, BigDecimal_add2,
- BigDecimal_sub2, BigDecimal_mult2, VpLimitRound): remove meaningless
- casts to get rid of compiler warnings.
+ * lib/soap/* (29 files): SOAP4R added.
-Wed Sep 29 12:35:13 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/wsdl/* (42 files): WSDL4R added.
- * ext/bigdecimal/bigdecimal.c (VPrint, VpToString): fix format.
+ * lib/xsd/* (12 files): XSD4R added.
-Wed Sep 29 12:31:12 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/soap/* (16 files): added.
- * lib/rdoc/known_classes.rb (RDoc::KNOWN_CLASSES): add Encoding.
+ * test/wsdl/* (2 files): added.
-Tue Sep 28 20:50:23 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/xsd/* (3 files): added.
- * tool/config.sub (x64): regularize same as mswin.
+ * sample/soap/* (27 files): added.
-Tue Sep 28 20:06:14 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * sample/wsdl/* (13 files): added.
- * vm_dump.c (rb_vm_bugreport): add windows support.
- based on patches from Peter Weldon at [ruby-core:32551]
+Wed Sep 24 02:08:11 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Mon Sep 27 23:30:34 2010 Koichi Sasada <ko1@atdot.net>
+ * lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
+ [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
- * insns.def (opt_case_dispatch), vm_insnhelper.c:
- execute the procedures of "when" clauses by bytecode
- instead of st_foreach() when the object does not hit
- prepared hash. [ruby-dev:42304]
+Tue Sep 23 23:10:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Mon Sep 27 15:54:03 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * lib/logger.rb: add Logger#<<(msg) for writing msg without any
+ formatting.
- * test/net/http/test_https.rb: As always, localhost is not
- guaranteed to be resolved as 127.0.0.1. But a SSL
- certificate needs a socket to listen on a specific address
- where a CN resolves to. On situations where localhost is
- not 127.0.0.1, these tests are not possible.
+ * test/logger/test_logger.rb: ditto.
-Mon Sep 27 15:25:05 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Tue Sep 23 20:47:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/net/imap/test_imap.rb: resurrection of r29259.
- this change depends on minitest 1.7.1.
+ * error.c (rb_warn_m): should not warn if -W0 is specified.
+ [ruby-talk:82675]
- * lib/test/unit/assertions.rb: ditto.
+Mon Sep 22 21:28:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-Sun Sep 26 22:59:45 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * MANIFEST: updated.
- * tool/config.sub (x86_64-pc-mingw64): regularize.
+Mon Sep 22 19:22:26 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sun Sep 26 22:21:07 2010 wanabe <s.wanabe@gmail.com>
+ * configure.in (AC_CHECK_FUNCS): add setuid and setgid.
- * ext/openssl/ossl_hmac.c (ossl_hmac_hexdigest, ossl_hmac_s_hexdigest),
- ext/openssl/ossl_pkey_ec.c (ossl_ec_group_set_seed),
- ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der),
- ext/openssl/ossl_pkcs7.c (numberof): suppress warnings.
- [ruby-core:31932]
+Mon Sep 22 12:34:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Sep 26 10:25:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * util.c (ruby_strtod): skip preceding zeros before counting
+ digits in the mantissa. (ruby-bugs:PR#1181)
- * tool/config.{guess,sub}: updated to automake-1.11.1.
+Sun Sep 21 04:12:36 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Sat Sep 25 22:48:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
+ should be a String.
- * configure.in (LIBRUBY_DLDFLAGS): fix quoting.
+ * ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
-Sat Sep 25 10:30:37 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
- * configure.in (LIBRUBY_DLDFLAGS): use -unexported_symbol only
- when available. http://trac.macports.org/ticket/26341
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
-Sat Sep 25 10:05:49 2010 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
- * configure.in: Always add -mieee for Renesas SH4.
- Thanks, Nobuhiro Iwamatsu. [Feature #3874] [ruby-core:32548]
+Sat Sep 20 11:49:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Sep 25 01:34:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/logger.rb: typo fixed.
- * Makefile.in (install-cross): target to install cross-compiling
- stuff.
+ * test/logger/test_logger.rb: new file.
-Fri Sep 24 23:44:59 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 19 11:39:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
- * string.c (sym_call), vm.c (invoke_block_from_c),
- vm_insnhelper.c (vm_yield_with_cfunc): pass given block.
- [ruby-core:32075]
+ * test/testunit/*: Added.
- * vm_eval.c (rb_funcall_passing_block): new function to call
- method with passing given block.
+ * lib/test/unit.rb: Documentation update.
-Fri Sep 24 15:50:43 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
+ Ditto.
- * string.c (rb_str_to_i): fix rdoc: String#to_i raises an
- exception when base is invalid. [ruby-core:31685]
+ * lib/test/unit.rb: Factored out an ObjectSpace collector.
-Fri Sep 24 15:28:35 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/test/unit/collector/objectspace.rb: Ditto.
- * string.c (rb_str_rindex): use rb_enc_prev_char instead of repeated
- str_nth.
- patched by Michael Selig [ruby-core:32498]
+ * sample/testunit/*: Added.
-Fri Sep 24 14:19:12 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Fri Sep 19 01:00:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/test_pty.rb: Same as 229281; existence of PTY class do not
- guarantee a successful pty operation.
+ * lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
+ condition.
-Fri Sep 24 06:25:55 2010 Ryan Davis <ryand-ruby@zenspider.com>
+ * lib/webrick/log.rb (BasicLog#format): add "\n" to message.
- * lib/minitest/*.rb: Imported minitest 1.7.2 r5879.
- * test/minitest/*.rb: ditto.
+Thu Sep 18 22:43:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Sep 23 23:09:08 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
- * vm_insnhelper.c (vm_get_cref0): cref is stacked only in normal
- iseqs, so check if it is the case first.
+ * eval.c (proc_invoke): should update "result" for orphans.
-Thu Sep 23 23:08:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Sep 18 20:33:03 2003 Tietew <tietew-ml-ruby-list@tietew.net>
- * tool/config.sub: mingw64 should use x86_64. [ruby-core:32514]
+ * parse.y (str_xquote): do not prepend escapes in
+ backqoute literals. [ruby-list:38409]
-Thu Sep 23 21:40:40 2010 wanabe <s.wanabe@gmail.com>
+Thu Sep 18 20:30:17 2003 Tanaka Akira <akr@m17n.org>
- * ext/socket/raddrinfo.c (init_addrinfo, inspect_sockaddr): suppress
- warnings. see [ruby-core:31932].
+ * lib/pathname.rb: update document.
-Thu Sep 23 19:27:57 2010 wanabe <s.wanabe@gmail.com>
+Thu Sep 18 15:27:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * thread_win32.c (w32_wait_events, w32_close_handle): suppress warnings.
- see [ruby-core:31932].
+ * lib/logger.rb: new file. Logger, formerly called devel-logger or
+ Devel::Logger.
-Thu Sep 23 18:54:39 2010 wanabe <s.wanabe@gmail.com>
+ * sample/logger/*: new file. samples of logger.rb.
- * tool/config.sub: add mingw64.
+Wed Sep 17 23:41:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * win32/mkexports.rb (Exports::Mingw64): added.
+ * eval.c (localjump_destination): should not raise ThreadError
+ exception for "break". [ruby-dev:21348]
- * win32/mkexports.rb (Exports::Mingw32): renamed from Exports::Mingw.
+ * eval.c (proc_invoke): use result instead of prot_tag->retval.
+ retval is no longer propagated to the ancestors.
-Thu Sep 23 09:01:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Sep 17 20:34:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm_insnhelper.c (vm_cref_push): no outer cref is needed for proc
- from method. Bug #3786, Bug #3860, [ruby-core:32501]
+ * parse.y (tokadd_string, parse_string, yylex): escaped terminator
+ is now interpreted as is. [ruby-talk:82206]
-Wed Sep 22 17:12:01 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Wed Sep 17 18:52:36 2003 Minero Aoki <aamine@loveruby.net>
- * test/openssl/utils.rb (OpenSSL#silent): always restore $VERBOSE.
- [ruby-dev:42285]
+ * test/fileutils/fileassertions.rb: new file.
-Wed Sep 22 16:59:40 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * test/fileutils/test_fileutils.rb: new file.
- * test/test_prime.rb (TestPrime#test_new): the warning expected have
- not been displayed when $VERBOSE == nil. Patch by Shota Fukumori
- a.k.a. sora_h. [ruby-dev:42272]
- Recovers $stderr even if StringIO.new fails. Reported by unak.
+ * test/fileutils/test_nowrite.rb: new file.
-Wed Sep 22 01:55:48 2010 Koichi Sasada <ko1@atdot.net>
+Wed Sep 17 18:51:02 2003 Minero Aoki <aamine@loveruby.net>
- * bootstraptest/test_method.rb: fix last commit.
+ * test/strscan/test_stringscanner.rb: require test/unit.
-Wed Sep 22 01:49:52 2010 Koichi Sasada <ko1@atdot.net>
+Wed Sep 17 18:35:34 2003 Minero Aoki <aamine@loveruby.net>
- * bootstraptest/test_method.rb: add a test for [ruby-core:30534].
+ * test/strscan/test_stringscanner.rb: new file.
-Wed Sep 22 00:52:44 2010 WATANABE Hirofumi <eban@ruby-lang.org>
+Wed Sep 17 18:03:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/rdoc/ri/store.rb (save_cache): remove duplicate entries.
+ * ext/openssl: all files are reviewed to simplify and avoid memory leak.
-Wed Sep 22 00:00:05 2010 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/extconf.rb: add check for assert.h.
- * ext/pathname/pathname.c (path_f_pathname): Pathname() translated
- from pathname.rb.
+ * ext/openssl/ossl.c (ossl_buf2str): new function to convert
+ C buffer to String and free buffer.
-Tue Sep 21 22:18:30 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
+ Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
- * tool/mkconfig.rb: fixed build problem on mswin64 introduced in r29278.
+ * ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
+ functions to convert object to DER string.
-Tue Sep 21 02:42:35 2010 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/openssl/ossl.h: ditto.
- * test/pathname/test_pathname.rb (TestPathname#test_mkdir): fix typo.
+ * ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
+ BIO to String object and free BIO.
-Mon Sep 20 23:23:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_bio.h: ditto.
- * dir.c (bracket): get rid of scanning at the end of the pattern
- string, not to raise an exception while globbing command line.
- [ruby-core:32478]
+ * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
-Mon Sep 20 11:25:49 2010 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
- * ext/pathname/pathname.c (Init_pathname): Pathname#=~ undefinition
- translated from pathname.rb.
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
-Mon Sep 20 02:34:11 2010 Kenta Murata <mrkn@mrkn.jp>
+ * ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
+ and reimplement in openssl/x509.rb.
- * ext/bigdecimal/bigdecimal.c (check_rounding_mode, BigDecimal_mode):
- raise ArgumentError instead of TypeError passing invalid modes.
+ * ext/openssl/ossl_x509attr.c: reimplemented and disable some
+ method temporarily. this class doesn't work fine without ASN.1
+ data support;-) I'll rewrite in near future.
- * test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
- change against the above modifications.
+ * ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
+ unused code.
-Sun Sep 19 22:08:39 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
- * lib/mkmf.rb (try_link): rdoc
- (try_compile): ditto
- (try_cpp): ditto
- (try_func): ditto
- (try_var): ditto
- (try_run): ditto
- (egrep_cpp): ditto
+Tue Sep 16 22:25:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sun Sep 19 20:43:33 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * test/csv/test_csv.rb: add negative tests of row_sep.
- * configure.in (--disable-install-doc): disables capi too, in addition
- to rdoc.
- (--disable-install-rdoc): a new option for disabling only rdoc.
- (--disable-install-capi): a new option for disabling only capi.
+Tue Sep 16 18:02:36 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sun Sep 19 20:37:45 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * regex.c (re_compile_pattern): should not translate character
+ class range edge. [ruby-list:38393]
- * common.mk (clean): removes all documents on cleaning.o
- (CAPIOUT): new variable.
- (clean-capi, distclean-capi, realclean-capi): new targets
+Tue Sep 16 16:47:56 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * Makefile.in (clean-capi, distclean-capi, realclean-capi): ditto.
+ * MANIFEST: add test/csv/mac.csv.
- * win32/Makefile.sub (clean-capi, distclean-capi, realclean-capi):
- ditto.
+ * win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
-Sun Sep 19 13:44:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 15 19:02:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * configure.in (LIBRUBY_SO): fix an oversight of replace
- RUBY_INSTALL_NAME with RUBY_SO_NAME. a patch from Jeremy Evans
- at [ruby-core:32474].
+ * lib/csv.rb: add extra pamameter to specify row(record) separater
+ character. To parse Mac's CR separated CSV, do like this.
+ CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
+ The 3rd parameter in this example ?, is for column separater and the
+ 4th ?\r is for row separater. Row separater is nil by default. Nil
+ separater means "\r\n" or "\n".
-Sun Sep 19 07:48:20 2010 Tanaka Akira <akr@fsij.org>
+ * test/csv/test_csv.rb: add tests for above feature.
- * ext/pathname/pathname.c (path_unlink): Pathname#unlink and
- Pathname#delete translated from pathname.rb.
+ * test/csv/mac.csv: added. Sample CR separated CSV file.
-Sun Sep 19 06:06:07 2010 Kenta Murata <mrkn@mrkn.jp>
+Fri Sep 12 22:41:48 2003 Michal Rokos <m.rokos@sh.cvut.cz>
- * ext/bigdecimal/bigdecimal.c (check_rounding_mode): added for
- converting symbol to rounding mode number.
+ * ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
- * ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round):
- support to specify rounding mode by symbol.
+ * ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
- * test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
- add tests for above changes.
+ * ext/openssl/ossl_asn1.[ch]: new files
-Sun Sep 19 05:14:35 2010 Kenta Murata <mrkn@mrkn.jp>
+ * ext/openssl/ossl_bio.[ch]: new files
- * ext/bigdecimal/bigdecimal.c: fix rounding algorithms for half-down
- and half-even. This change is based on the patch created by Matthew
- Willson, the reporter of this bug. [Bug #3803] [ruby-core:32136]
+Fri Sep 12 12:30:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/bigdecimal/test_bigdecimal.rb: add tests for above changes.
+ * intern.h (rb_disable_super, rb_enable_super): replace with dummy
+ expressions instead of prototypes. the functions remain yet for
+ binary compatibility. [ruby-talk:81758]
-Sat Sep 18 20:09:51 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 12 12:09:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/pathname/pathname.c (path_each_entry): Pathname#each_entry
- translated from pathname.rb.
+ * bignum.c (rb_big_and): convert argument using 'to_int'.
-Fri Sep 17 23:44:07 2010 Kouhei Sutou <kou@cozmixng.org>
+ * bignum.c (rb_big_or): ditto.
- * lib/rexml/xpath_parser.rb, test/rexml/test_xpath.rb:
- add missing method availability check. [ruby-core:32447]
- Reported by Wiebe Cazemier. Thanks!!!
+ * bignum.c (rb_big_xor): ditto.
-Fri Sep 17 23:23:26 2010 Kouhei Sutou <kou@cozmixng.org>
+Fri Sep 12 07:06:14 2003 David Black <dblack@superlink.net>
- * test/rexml/test_sax.rb: don't use thread and sleep to avoid slow test.
+ * lib/scanf.rb: Took out useless @matched_item variable; some small
+ refactoring.
-Fri Sep 17 23:10:44 2010 Kouhei Sutou <kou@cozmixng.org>
+Thu Sep 11 08:43:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/rexml/test_core.rb: enable.
+ * eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
+ name is not tainted.
-Fri Sep 17 22:46:02 2010 Kouhei Sutou <kou@cozmixng.org>
+ * lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
+ Supports StringIO.
- * test/rexml/: untabify.
+Wed Sep 10 22:47:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Fri Sep 17 22:29:56 2010 Kouhei Sutou <kou@cozmixng.org>
+ * ext/openssl/ossl.h: add a workaround for win32 platform.
+ libeay32.dll doesn't export functions defined in conf_api.h.
- * test/rexml/: fix fixture data path. All REXML tests are worked.
+ * ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
-Fri Sep 17 22:15:15 2010 Kouhei Sutou <kou@cozmixng.org>
+ * ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
- * test/rexml/test_listener.rb: remove needless codes.
+ * ext/openssl/ossl_config.c (set_conf_section_i): should check
+ if the argument is Array.
-Fri Sep 17 22:12:23 2010 Kouhei Sutou <kou@cozmixng.org>
+Wed Sep 10 22:41:54 2003 Tietew <tietew@tietew.net>
- * test/rexml/: import REXML tests from
- http://www.germane-software.com/repos/rexml/trunk/test/.
- Many tests are failed temporary. I'll fix them quickly. Sorry.
+ * eval.c (win32_get_exception_list): avoid VC7 warning.
+ [ruby-win32:577]
-Fri Sep 17 16:48:49 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * test/io/console/test_io_console.rb (TestIO_Console::helper):
- PTY.open is not guaranteed to work. On my machine opening a
- pty is prohibited via process control group. On those cases
- exceptions shall occur, and that doesn't mean our fault.
- Skip those tests on such situations.
+ * eval.c (struct tag): dst should be VALUE.
-Fri Sep 17 08:30:27 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/tracer.rb: count only non-internal libraries in stack trace,
- ignoring custom_require. [ruby-core:31858]
+ * eval.c (localjump_destination): stop at the scope where the current
+ block was created. [ruby-dev:21353]
-Fri Sep 17 02:18:41 2010 Akinori MUSHA <knu@iDaemons.org>
+Tue Sep 9 05:17:04 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * tool/mkconfig.rb: Fix build with m4 1.4.15 generating duplicate
- lines in config.status. According to nobu, the mswin32 port may
- depend on the piece of code in question, so the behavior is left
- unchanged on mswin32.
+ * ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
-Thu Sep 16 23:47:59 2010 Tanaka Akira <akr@fsij.org>
+Tue Sep 9 02:41:35 2003 Michal Rokos <m.rokos@sh.cvut.cz>
- * ext/pathname/pathname.c (path_opendir): Pathname#opendir translated
- from pathname.rb.
+ * ext/openssl/ossl_config.c: Refine compatibility.
-Thu Sep 16 21:40:37 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Sep 9 01:50:45 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * lib/test/unit.rb (Test::Unit::GlobOption): merged RejectOption.
+ * lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
+ the message.
- * test/runner.rb: utilize GlobOption.
+ * lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
-Thu Sep 16 21:31:24 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 8 22:15:33 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * lib/rdoc/ri/driver.rb (RDoc::RI::Driver.setup_options)
- (RDoc::RI::Driver.fixup_options): split from process_args.
- libraries should not parse ARGV inside, since it's a task of
- applications, not libraries.
+ * ext/tk/lib/multi-tk.rb: modify security check at creating
+ a new interpreter
-Thu Sep 16 21:02:30 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 8 20:00:12 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/ri/paths.rb (RDoc::RI::Paths.each): HOMEDIR can be nil
- if $HOME is unset.
+ * lib/optparse.rb, lib/optparse/version.rb: search also all
+ capital versions.
-Thu Sep 16 14:50:42 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Mon Sep 8 19:26:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * test/ruby/test_file_exhaustive.rb (TestFileExhaustive::test_expand_path):
- ENV["HOME"] might not be set. On those cases without it an
- exception raises here, which effectively disables later
- tests on this method.
+ * ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
-Thu Sep 16 08:30:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_config.c: refine all with backward compatibility.
- * sprintf.c (rb_f_sprintf): fix rdoc. pointed out by Tomoyuki
- Chikanaga at [ruby-core:32395], and a patch from Daniel
- Bovensiepen at [ruby-core:32403].
+ * ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
-Thu Sep 16 08:27:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/openssl/ossl_x509.c: added new constants under X509 module.
+ DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
+ DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
- * ext/etc/extconf.rb: use expanded sysconfdir with empty DESTDIR.
- [ruby-core:32394]
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
+ the members of the struct. it's left to GC.
-Thu Sep 16 06:07:24 2010 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
- * ext/pathname/pathname.c (path_rmdir): Pathname#rmdir translated
- from pathname.rb.
+ * ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
+ add attr readers: issuer_certificate, subject_certificate,
+ subject_request, crl and config.
-Thu Sep 16 00:36:25 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Sep 8 18:26:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/readline/extconf.rb: Remove Readline 6 check because
- Ruby's license is now GPLv3 compatible. [ruby-core:28736]
+ * lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
+ instead of config[:Port] or req.request_uri.port.
-Thu Sep 16 00:26:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
- * COPYING: change Ruby's License from a dual license with GPLv2
- to a dual license with 2-clause BSDL.
- [ruby-dev:42166] [ruby-core:31971]
- [ruby-dev:39167] [ruby-core:25272]
+ * lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
- * COPYING.ja: ditto.
+ * lib/webrick/config.rb: :Listen option never be used.
- * BSDL: added. this is from The FreeBSD License.
+ * lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
+ option and add warning message.
-Wed Sep 15 21:07:06 2010 Tanaka Akira <akr@fsij.org>
+ * lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
- * ext/pathname/pathname.c (path_mkdir): Pathname#mkdir translated
- from pathname.rb.
+ * lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
-Wed Sep 15 13:37:00 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+Sun Sep 7 16:08:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * test/net/imap/test_imap.rb: "localhost" not guaranteed to
- resolve to "127.0.0.1". On my machine it is "::1" instead.
- The problem is, you have to connect to the imaps server via
- the canonical name written in a server certificate, and that
- of the server.cert is "localhost". So you have to listen to
- the address of what "localhost" resolves to. I think this
- situation cannot be resolved in a handy manner because the
- test "test_imaps_post_connection_check" is actually
- expecting to connect to a server via an address other than
- the CN. On my machine several assertions won't pass because
- the test cannot connect to the server.
+ * ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
-Wed Sep 15 09:12:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
- * io.c (rb_io_puts): fix for wide char encoding strings.
- [ruby-dev:42212]
+Sat Sep 6 02:26:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Wed Sep 15 07:27:52 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/ruby/test_*.rb: assert_same, assert_match, and so on.
- * string.c (rb_str_format_m): mentioned about Hash argument. a patch
- from Daniel Bovensiepen at [ruby-core:32386].
+Sat Sep 6 18:45:46 2003 Mauricio Fernandez <batsman.geo@yahoo.com>
- * sprintf.c (get_hash): ditto, and fix typo.
+ * parse.y (assignable): call rb_compile_error(), not rb_bug().
+ [ruby-core:01523]
-Wed Sep 15 07:22:20 2010 Tanaka Akira <akr@fsij.org>
+Sat Sep 6 17:40:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/pathname/pathname.c (path_entries): Pathname#entries translated
- from pathname.rb.
+ * ext/openssl/ruby_missing.c: rid of unnecessary backward
+ compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
+ all sources.
-Wed Sep 15 02:13:44 2010 Aaron Patterson <aaron@tenderlovemaking.com>
+ * ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
- * ext/fiddle/closure.c : Don't use FFI closure alloc on OpenBSD.
- Thanks Jeremy Evans! [ruby-core:32384]
+ * ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
-Tue Sep 14 20:17:48 2010 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
- * ext/pathname/pathname.c (path_s_getwd): Pathname.getwd and
- Pathname.pwd translated from pathname.rb.
+ * ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
-Tue Sep 14 05:13:04 2010 Tanaka Akira <akr@fsij.org>
+Sat Sep 6 01:23:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * ext/pathname/pathname.c (path_s_glob): Pathname.glob translated
- from pathname.rb.
+ * win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
-Tue Sep 14 01:24:51 2010 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+ * win32/win32.c (CreateChild): fix condition about whether to call
+ shell or not.
- * ext/socket/raddrinfo.c (ruby_getaddrinfo__aix): suppress a
- warning.
+Sat Sep 6 00:36:20 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
-Mon Sep 13 20:48:30 2010 Tanaka Akira <akr@fsij.org>
+ * Makefile.in (test): phony target.
- * ext/pathname/pathname.c (path_zero_p): Pathname#zero? translated
- from pathname.rb.
+ * lib/mkmf.rb (have_library, find_library): configure by library
+ name.
-Mon Sep 13 19:56:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
+ array as argument.
- * ext/socket/rubysocket.h (__DARWIN_ALIGNBYTES): workaround of a
- bug in system header of darwin 9. [ruby-core:32341]
+ * test/ruby/test_*.rb: moved invariants to left side in
+ assert_equal, and use assert_nil, assert_raises and so on.
-Mon Sep 13 18:11:55 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (isInternalCmd): distinguish command.com and
+ cmd.exe.
- * lib/mkmf.rb (try_do): fix typo. a patch from Peter Weldon
- at [ruby-core:32327].
+ * win32/win32.c (make_cmdvector): a character just after wildcard
+ was ignored. [ruby-core:01518]
-Mon Sep 13 10:12:09 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Sep 5 20:27:08 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * util.c (ruby_strtod): reject Float('0x0.').
- [ruby-dev:42239] Bug #3820
+ * test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
-Mon Sep 13 09:23:58 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Sep 5 18:00:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
- * ext/openssl/ossl_bn.c (ossl_bn_is_prime): fix comparison
- with rb_scan_args. Before this fix, OpenSSL::BN#prime?
- is fully broken. [ruby-dev:42225]
+ * ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
-Mon Sep 13 06:45:24 2010 Tanaka Akira <akr@fsij.org>
+ * ext/openssl/ossl_digest.c: add ossl_digest_new().
- * ext/pathname/pathname.c (path_writable_real_p):
- Pathname#writable_real? translated from pathname.rb.
+ * ext/openssl/ossl_digest.h: ditto.
-Sun Sep 12 21:21:50 2010 Tadayoshi Funaba <tadf@dotrb.org>
+ * ext/openssl/ossl_cipher.c: add ossl_cipher_new().
- * lib/date.rb: [ruby-core:32096] Thanks Colin Bartlett.
+ * ext/openssl/ossl_cipher.h: ditto.
-Sun Sep 12 19:30:27 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 5 15:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/pathname/pathname.c (path_world_writable_p):
- Pathname#world_writable? translated from pathname.rb.
+ * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
+ search delimiter forward if found in backward.
-Sun Sep 12 09:16:06 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 5 13:32:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/pathname/pathname.c (path_writable_p): Pathname#writable?
- translated from pathname.rb.
+ * test/runner.rb: arguments should be keys.
-Sun Sep 12 08:36:15 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 5 12:09:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * process.c (rlimit_resource_name2int): support more limits:
- RLIMIT_MSGQUEUE, RLIMIT_NICE, RLIMIT_RTPRIO, RLIMIT_RTTIME and
- RLIMIT_SIGPENDING.
- (Init_process): ditto.
- patch by Run Paint Run Run. [ruby-core:32262]
+ * test/ruby/test_system.rb (test_system): check existence of ruby
+ interpreter.
-Sun Sep 12 04:27:13 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 5 11:32:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c (rlimit_resource_name2int): use STRCASECMP to avoid
- ALLOCA_N.
+ * lib/optparse.rb (--version): fix assignment/reference order.
-Sat Sep 11 16:47:41 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
+ be deprecated in future.
- * hash.c (ruby_setenv): raise if putenv and SetEnvironmentVariable
- failed, because of the restriction of the size on Windows.
- based on a patch from Peter Weldon at [ruby-core:32304]. fix:
- Bug#3812, [ruby-core:32250]
+ * lib/optparse/version.rb (OptionParser#show_version): hide Object.
-Sat Sep 11 15:19:57 2010 Eric Hodel <drbrain@segment7.net>
+ * test/runner.rb: fix optparse usage.
- * lib/webrick/httpauth/digestauth.rb (WEBrick::Config::DigestAuth):
- Add documentation
+ * test/runner.rb: glob all testsuits if no tests given.
- * lib/webrick/config.rb (WEBrick::Config::DigestAuth): Add
- documentation
+Fri Sep 5 10:42:58 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Sat Sep 11 12:32:05 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * test/runner.rb: added. gets testcases from command line and runs it.
- * include/ruby/intern.h (rb_set_kcode, rb_get_kcode): removed
- zombie prototype declarations. a patch from Eric Hodel
- at [ruby-core:32305].
+ * test/ruby/test_gc.rb: remove useless part which was for dumping test
+ result.
-Sat Sep 11 06:53:12 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 5 09:28:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/pathname/pathname.c (path_symlink_p): Pathname#symlink?
- translated from pathname.rb.
+ * test/ruby/test_gc.rb: added. splitter.rb which I made to split
+ sample/test.rb into test/ruby/test_* kindly removed GC test (the
+ last section in the original test) to reduce things to be worried.
-Fri Sep 10 23:03:43 2010 Tanaka Akira <akr@fsij.org>
+Fri Sep 5 03:00:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/pathname/pathname.c (path_sticky_p): Pathname#sticky? translated
- from pathname.rb.
+ * test/ruby/test_iterator.rb (test_block_in_arg): add no block
+ given tests.
-Fri Sep 10 19:11:13 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
+ test.
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#continue): add
- method for generating HTTP/1.1 100 continue response if the client
- expects it, otherwise does nothing. Patch by Brian Candler.
- ref #855.
+Fri Sep 5 01:10:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * test/webrick/test_httprequest.rb: test added.
+ * test/ruby: tests for ruby itself.
-Fri Sep 10 17:49:34 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
+ some tests could not be translates... search '!!' mark to see it.
- * ext/openssl/lib/openssl/x509-internal.rb: removed unused local
- variable.
+ * test/csv/test_csv.rb: should require 'csv', not '../lib/csv'. test
+ runner should set load path correctly.
- * test/openssl/*: less warnings while test running with -w.
+Fri Sep 5 01:03:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Fri Sep 10 16:49:20 2010 Akinori MUSHA <knu@iDaemons.org>
+ * test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
+ opened file cannot be removed under win32 box.
- * class.c (rb_scan_args): Add support for optional keyword
- argument hash. [ruby-dev:42221] [ruby-dev:38048]
+Thu Sep 4 23:59:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * README.EXT, README.EXT.ja: Update documentation accordingly.
+ * parse.y (tokadd_string): newlines have no special meanings in
+ %w/%W, otherwise they are ignored only when interpolation is
+ enabled. [ruby-dev:21325]
- * dir.c (dir_initialize): Make use of the new rb_scan_args()
- feature.
+Thu Sep 4 19:38:25 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * io.c (rb_io_s_popen, rb_scan_open_args, rb_io_initialize)
- (rb_io_s_pipe, open_key_args, io_s_foreach, io_s_readlines)
- (rb_io_s_read, rb_io_set_encoding): Ditto.
+ * ext/io/wait/.cvsignore: added.
- * transcode.c (str_transcode, econv_args)
- (econv_primitive_convert): Ditto.
+ * ext/openssl/.cvsignore: added.
- * ext/zlib/zlib.c (rb_gzreader_initialize): Ditto.
+Thu Sep 4 19:28:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-Fri Sep 10 10:33:18 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * sample/openssl: added. Sample of standard distribution library
+ should be locate in sample/{module_name}/*.
- * random.c (rb_genrand_ulong_limited): renamed from
- rb_rand_internal and now this is public API.
+ * ext/openssl/sample/*: removed. move to sample/openssl/*.
- * include/ruby/ruby.h (rb_genrand_ulong_limited): added.
+Thu Sep 4 18:02:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * bignum.c (big_sparse_p): use rb_genrand_ulong_limited.
+ * test/csv/test_csv.rb: use remove_const to reduce warnings. use
+ Dir.tmpdir to locate working files.
-Fri Sep 10 13:07:22 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+Thu Sep 4 17:41:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/digest/lib/digest.rb: removed unused exception variable
- assignment to avoid a warning.
+ * misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
+ valid delimiter.
-Fri Sep 10 07:29:14 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * misc/ruby-mode.el (ruby-here-doc-end-match): must quote
+ arbitrary string to use as regexp.
- * ext/etc/etc.c (etc_systmpdir): assume system default tmpdir
- safe. [ruby-dev:42089]
+ * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
+ call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
+ matched.
-Fri Sep 10 07:03:23 2010 Tanaka Akira <akr@fsij.org>
+Thu Sep 4 15:40:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/pathname/pathname.c (path_size_p): Pathname#size? translated from
- pathname.rb.
+ * test/csv/test_csv.rb: run on test/unit original layer.
-Fri Sep 10 02:15:29 2010 Tanaka Akira <akr@fsij.org>
+Thu Sep 4 12:54:50 2003 why the lucky stiff <why@ruby-lang.org>
- * ext/socket/option.c (inspect_peercred): support OpenBSD-current.
- patch by Jeremy Evans. [ruby-core:32240]
+ * ext/syck/token.c: headerless documents with root-level spacing now
+ honored.
-Thu Sep 9 23:25:53 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Sep 4 00:06:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * vm.c (vm_backtrace_each): skip allocator frames which have no
- name. [ruby-core:32231]
+ * eval.c (mark_frame_adj): need to adjust argv pointer if using
+ system's alloca. [ruby-core:01503]
-Thu Sep 9 22:39:08 2010 Tanaka Akira <akr@fsij.org>
+Wed Sep 3 21:33:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * ext/pathname/pathname.c (path_size): Pathname#size translated from
- pathname.rb.
+ * test: add test directory. Test::Unit aware testcases and needed
+ files should be located in this directory. dir/file name convention;
+ test/{module_name}/test_{testcase_name}.rb
+ test/{module_name}/{needed_files}
+ someday, someone will write testrunner which searches test_*.rb and
+ run testcases automatically.
-Thu Sep 9 22:34:48 2010 wanabe <s.wanabe@gmail.com>
+ * test/csv/*: add testcase for lib/csv.rb.
- * compile.c (case_when_optimizable_literal): When float value can be
- treated as integer, add to table hash of case that way.
- based on a patch from Ikuo KOBORI. [ruby-dev:42038]
+Wed Sep 3 01:37:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * insns.def (opt_case_dispatch): ditto.
+ * io.c (rb_f_gets): should call next_argv() before type check
+ current_file. [ruby-list:38336]
- * test/ruby/test_case.rb: add tests.
+Tue Sep 2 20:37:15 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-Thu Sep 9 17:15:15 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
+ for skipping server verification.
- * test/net/http/test_https.rb (test_identity_verify_failure): follows
- the SSL hostname check error message of openssl.
+Tue Sep 2 23:36:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Sep 9 10:44:46 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (proc_invoke): should retrieve retval when pcall is true.
- * test/ruby/test_env.rb (test_aset): OpenBSD acts like NetBSD in
- that it ignores characters after = in ENV.
- patched by Jeremy Evans [ruby-core:32184]
+Tue Sep 2 14:09:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Sep 9 09:02:01 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
+ the patch is submitted by nmu <nmu@users.sourceforge.jp>.
- * tool/rbinstall.rb (install?): gemspec filename should include
- its version. patched by Luis Lavena [ruby-core:32165]
+ * ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
+ some platforms.
-Wed Sep 8 22:46:31 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/socket/getnameinfo.c (getnameinfo): ditto.
- * ext/openssl/ossl_ssl.c (ssl_get_error): Thread context switch was
- blocked on Windows while blocking call for SSLSocket. Need to
- convert errno for letting rb_io_wait_readable detect EWOULDBLOCK.
- Patch by arton. ref #3794.
+Tue Sep 2 14:02:19 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-Wed Sep 8 20:56:57 2010 Tanaka Akira <akr@fsij.org>
+ * ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
- * ext/pathname/pathname.c (path_setgid_p): Pathname#setgid? translated
- from pathname.rb.
+ * ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
+ bug fix and improvement of font control
-Wed Sep 8 06:25:41 2010 Tanaka Akira <akr@fsij.org>
+Tue Sep 2 09:51:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/pathname/pathname.c (path_setuid_p): Pathname#setuid? translated
- from pathname.rb.
+ * eval.c (rb_eval): should not handle exceptions within rescue
+ argument. [ruby-talk:80804]
-Tue Sep 7 21:03:35 2010 Tanaka Akira <akr@fsij.org>
+Tue Sep 2 00:44:37 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/pathname/pathname.c (path_readable_real_p):
- Pathname#readable_real? translated from pathname.rb.
+ * re.c (rb_memsearch): fix overrun. [ruby-talk:80759]
-Mon Sep 6 23:07:25 2010 Tanaka Akira <akr@fsij.org>
+Tue Sep 2 00:41:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/pathname/pathname.c (path_world_readable_p):
- Pathname#world_readable? translated from pathname.rb.
+ * ext/iconv/iconv.c (map_charset): use lower case keys.
-Mon Sep 6 11:03:13 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/iconv/iconv.c (iconv_fail): just yield error and return the
+ result if a block is given.
- * Fixed wrong check of missing functions. Patch by Adrian Quark.
- ref #3400
- The patch contains following comment:
- This patch should avoid unnecessary incompatibility with future
- versions of Openssl. Changes suggested by bmaher_at_amazon.com.
+ * ext/iconv/iconv.c (iconv_convert): yield error and append the
+ result if a block is given.
-Mon Sep 6 10:46:55 2010 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * ext/iconv/charset_alias.rb (charset_alias): optional third
+ argument.
- * Fixed exception message for SSL post connection check failure. Patch
- by Paul Betteridge. ref [Bug #3704]
+ * ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
+ SHIFT_JIS on cygwin.
-Mon Sep 6 10:31:59 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Sep 1 18:34:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/readline/readline.c (readline_s_get_line_buffer):
- Readline.line_buffer should return locale string.
- [ruby-dev:42184] #3791
+ * eval.c (rb_eval): make tail recursion in ELSE clause of
+ RESCUE a jump.
-Mon Sep 6 09:47:24 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Sep 1 18:00:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * util.c (ruby_strtod): check there is at least 1 digit after
- "0x" before ".". [ruby-dev:42183] #3790
+ * parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
+ Dave Butcher.
-Mon Sep 6 09:44:50 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (Init_Thread): protect thgroup_default. suggested by Guy
+ Decoux in [ruby-talk:80623]
- * util.c (ruby_strtod): check integer overflow.
- [ruby-dev:42180] #3789
+Mon Sep 1 16:59:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Sep 6 06:17:21 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
+ thread termination.
- * ext/pathname/pathname.c (path_readable_p): Pathname#readable?
- translated from pathname.rb.
+ * eval.c (rb_thread_start_0): should not error_print() within
+ terminated thread, because $stderr used by it might be
+ overriden now. [ruby-dev:21280]
-Sun Sep 5 23:02:34 2010 Tanaka Akira <akr@fsij.org>
+Sun Aug 31 22:46:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * ext/pathname/pathname.c (path_owned_p): Pathname#owned?
- translated from pathname.rb.
+ * eval.c (TAG_DST()): take no argument.
-Sat Sep 4 23:48:47 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (p_gid_sw_ensure): return VALUE.
- * file.c (rb_file_s_readlink): symlink target should be in
- filesystem encoding.
+Sun Aug 31 22:27:10 2003 Hidetoshi NAGAI <nagai@dumbo.ai.kyutech.ac.jp>
-Sat Sep 4 10:40:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (p_gid_sw_ensure): lack of function type
- * load.c (ruby_init_ext): export for golfers.
+Sun Aug 31 12:25:06 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
- * vm_core.h (rb_iseq_eval, rb_iseq_compile_with_option): ditto.
+ * lib/optparse.rb: --version takes an optional argument; "all" or
+ a list of package names.
-Sun May 23 17:29:41 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+Sun Aug 31 10:17:02 2003 Tadayoshi Funaba <tadf@dotrb.org>
- * common.mk (capi): uses a timestamp file to get rid of
- generating twice.
+ * lib/date/format.rb: yyyy/mm is not an acceptable format.
-Fri Jun 18 01:33:21 2010 Yuki Sonoda (Yugui) <yugui@yugui.jp>
+ * lib/time.rb: follow above.
- * enc/Makefile.in (realclean): has been missing. necessary
- for make realclean-enc.
+Sat Aug 30 14:25:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Sep 3 23:51:26 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_iter_break): should not call TAG_JUMP directly.
- * ext/pathname/pathname.c (path_socket_p): Pathname#socket?
- translated from pathname.rb.
+Sat Aug 30 03:58:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Fri Sep 3 06:40:44 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
- * ext/pty/pty.c (chfunc): pass through exceptions.
+ * eval.c (POP_TAG): no longer propagate retval. retval is now set
+ directly by localjump_destination().
- * io.c (rb_io_bufwrite, rb_io_bufread): added.
+ * eval.c (localjump_destination): new function to cast
+ return/break local jump.
- * process.c (rb_fork_err): protect from exceptions.
+ * eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
-Fri Sep 3 06:16:07 2010 Tanaka Akira <akr@fsij.org>
+Fri Aug 29 22:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
- * ext/pathname/pathname.c (path_pipe_p): Pathname#pipe?
- translated from pathname.rb.
+ * bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
+ then result will be the same as +,-,*,/ respectively.
-Fri Sep 3 06:14:40 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Aug 29 17:30:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
- * ext/pty/pty.c (chfunc): restore errno from SystemCallError and
- propagate proper exception to the parent. [ruby-dev:41965]
+ * process.c: bug fix
-Thu Sep 2 22:10:38 2010 Tanaka Akira <akr@fsij.org>
+ * process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
- * ext/pathname/pathname.c (path_file_p): Pathname#file?
- translated from pathname.rb.
+ * process.c: deny handling IDs during evaluating the block given to
+ the Process::{UID,GID}.switch method
-Thu Sep 2 09:12:02 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
- * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): don't forget to free
- memory.
+ * ext/tcltklib/tcltklib.c : can create a interpreter without Tk
-Thu Sep 2 09:01:13 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c : bug fix on handling exceptions
- * win32/win32.c (CreateChild): unicodize.
+ * ext/tcltklib/MANUAL.euc : modify
- * win32/win32.c (rb_w32_spawn, rb_w32_aspawn): convert arguments of
- CreateChild() from ACP to WideChar.
+ * ext/tk/lib/tk.rb : freeze some core modules
-Thu Sep 2 06:53:43 2010 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/multi-tk.rb : more secure
- * ext/pathname/pathname.c (path_directory_p): Pathname#directory?
- translated from pathname.rb.
+ * ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
+ Tk's list
-Wed Sep 1 22:03:41 2010 Tanaka Akira <akr@fsij.org>
+ * ext/tk/lib/tk.rb: improve accessibility of TkVariable object
- * ext/pathname/pathname.c (path_grpowned_p): Pathname#grpowned?
- translated from pathname.rb.
+ * ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
+ ext/tk/lib/tktext.rb : fix bug of font handling
-Wed Sep 1 17:39:02 2010 Ryan Davis <ryand-ruby@zenspider.com>
+ * ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
- * lib/minitest/*.rb: Imported minitest 1.7.1 r5835.
- * test/minitest/*.rb: ditto.
+Thu Aug 28 22:07:12 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Sep 1 16:50:42 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * variable.c (rb_autoload_load): call const_missing if autoloading
+ constant is not defined to allow hook.
- * string.c (tr_setup_table): optimized. don't create hash objects
- when given pattern is ASCII only.
+ * eval.c (rb_eval): use rb_const_get_from() instead of
+ rb_const_get_at().
- * string.c (tr_find): ditto.
+ * eval.c (is_defined): forgot to check NODE_COLON3.
-Wed Sep 1 14:35:29 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Aug 28 17:30:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * array.c (rb_ary_rotate_m): fix typo of rdoc.
- patched by Andrei Kulakov [ruby-core:31975]
+ * variable.c (rb_const_get_0): should check constants defined in
+ included modules, if klass is Object. [ruby-talk:79302]
-Wed Sep 1 14:33:36 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * numeric.c (check_uint): check should be done using UINT_MAX, not
+ INT_MAX. this fix is submitted by Lyle Johnson
+ <lyle@knology.net> in [ruby-core:01486]
- * enum.c (enum_zip): fix typo of rdoc.
- patched by Andrei Kulakov [ruby-core:31974]
+Thu Aug 28 05:02:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Sep 1 12:56:36 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
- * thread.c (ruby_suppress_tracing): restore the state and invoke
- the func with normal state. a patch from Satoshi Shiba <shiba
- AT rvm.jp> at [ruby-dev:42162]. [ruby-core:31783]
+Thu Aug 28 02:37:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Aug 31 21:10:23 2010 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
+ consistent with *a = [1], which set [[1]] to a.
- * ext/pathname/pathname.c (path_exist_p): Pathname#exist? translated
- from pathname.rb.
+ * node.h: merge NODE_RESTARY to NODE_SPLAT.
-Tue Aug 31 17:32:34 2010 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+ * parse.y: rules simplified a bit by removing NODE_RESTARY.
- * ext/tk/stubs.c: fix [Bug #3771] "VC++ can't make ext/tk with enabling
- stubs". Thanks, Akio Tajima [ruby-dev:42159].
+ * sample/test.rb: updated for new assignment behavior.
-Tue Aug 31 03:42:14 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Aug 27 22:33:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (tr_setup_table): fix bug in r29146.
- Initialize table even if cflag is 0; tr_find see whether
- del is empty or not.
+ * error.c (rb_bug): should not use other methods; this function is
+ not for ordinary use. [ruby-dev:21259]
- * string.c (tr_find): nodel can't be NULL; if NULL, it means
- it is not specified.
+Wed Aug 27 15:07:57 2003 Minero Aoki <aamine@loveruby.net>
-Mon Aug 30 21:29:21 2010 Tanaka Akira <akr@fsij.org>
+ * lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
+ response. [ruby-list:38279]
- * ext/pathname/pathname.c (path_executable_real_p):
- Pathname#executable_real? translated from pathname.rb.
+Wed Aug 27 05:10:15 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Aug 30 15:00:13 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/win32.c (map_errno): support winsock error.
- * string.c (tr_setup_table): initialize negating table when
- negating string is given. [ruby-core:31851]
+ * win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
+ kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
+ pass errno to map_errno().
- * string.c (tr_find): add a sentence for the time when
- target characters include negating one.
+ * win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
+ rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
+ rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
+ rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
+ rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
+ rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
+ rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
+ rb_w32_fclose, rb_w32_close): use map_errno().
- * string.c (rb_str_count): move definition.
+ * win32/win32.h: add winsock errors.
-Mon Aug 30 07:32:41 2010 Tanaka Akira <akr@fsij.org>
+Tue Aug 26 23:53:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/pathname/pathname.c (path_executable_p): Pathname#executable?
- translated from pathname.rb.
+ * lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
+ frozen OpenStruct. [ruby-talk:80214]
-Sun Aug 29 23:54:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Aug 26 20:03:50 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * lib/rdoc/parser/ruby.rb (RDoc#parse_call_parameters): don't
- include assignment. [Bug #3759], [ruby-dev:42154]
+ * lib/mkmf.rb (create_tmpsrc): add the hook for source.
+ [ruby-list:38122]
- * lib/rdoc/parser/ruby.rb (RDoc#parse_class): ignore non-constant
- name singleton class. [Bug #3759], [ruby-dev:42154]
+Tue Aug 26 15:59:53 2003 why the lucky stiff <why@ruby-lang.org>
-Sun Aug 29 23:25:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * implicit.c (syck_type_id_to_taguri): corrected detection of
+ x-private types.
- * file.c (rb_get_path_check): clarify error message for
- ASCII-incompatible path name.
+Sun Aug 24 01:02:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Aug 29 16:02:54 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * file.c (file_expand_path): performance improvement.
+ [ruby-talk:79748]
- * common.mk (node_name.inc): remove command option -n and give
- file as stdin, because IronRuby 1.1 still doesn't support it.
- So now we can use ir.exe as BASERUBY.
+Sat Aug 23 23:41:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * tool/node_name.rb: read stdin with while gets.
+ * file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
+ apparent cases. [ruby-talk:79748]
-Sun Aug 29 13:22:43 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 23 18:56:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * vm.c (rb_thread_method_id_and_class): curried proc has no
- method. [ruby-core:31871]
+ * ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
+ resize a string, rb_str_cat() disallows NULL. [ruby-dev:21237]
-Sun Aug 29 12:51:33 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 23 16:48:41 2003 Keiju Ishitsuka <keiju@ishitsuka.com>
- * load.c (rb_provide_feature): clarify error message for frozen
- $LOADED_FEATURES. based on a patch from Run Paint Run Run at
- [ruby-core:31913].
+ * lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
-Sun Aug 29 12:19:58 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 23 15:59:58 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * load.c (load_failed): should honor encoding. [ruby-core:31915]
+ * eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
+ EXEC_TAG() for retry. [ruby-dev:21216]
-Sun Aug 29 09:35:10 2010 NARUSE, Yui <naruse@ruby-lang.org>
+Sat Aug 23 02:32:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * common.mk (clean): exclude *.inc. [ruby-dev:41931]
+ * eval.c (rb_yield_splat): should check if "values" is array.
- * common.mk (distclean): include *.inc.
+ * enum.c (each_with_index_i): typo.
- * common.mk (help): change description about clean and distclean.
+Fri Aug 22 17:07:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Aug 29 06:34:52 2010 Tanaka Akira <akr@fsij.org>
+ * enum.c (inject_i): use rb_yield_values.
- * ext/pathname/pathname.c (path_chardev_p): Pathname#chardev?
- translated from pathname.rb.
+ * enum.c (each_with_index_i): ditto.
-Sat Aug 28 17:39:33 2010 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (rb_yield_splat): new function to call "yield *values".
- * ext/bigdecimal/bigdecimal.c (BigDecimal_save_exception_mode,
- BigDecimal_save_rounding_mode, BigDecimal_save_limit): added.
+ * string.c (rb_str_scan): use rb_yield_splat().
- * test/bigdecimal/test_bigdecimal.rb: added tests for the above
- features.
+Fri Aug 22 06:13:22 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/rubyext.c: refactoring of the transfer method
+ dispatch. added yaml_org_handler for faster dispatch of
+ transfers to base types.
+
+ * lib/yaml/rubytypes.rb: removed handling of builtins from
+ Ruby library.
+
+ * ext/syck/token.c: quoted and block scalars are now implicit !str
+
+ * ext/syck/implicit.c: empty string detected as !null.
+
+Fri Aug 22 01:00:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (block_pass): improve passing current block.
+
+Fri Aug 22 00:13:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
+ fixed, and VpNmlz() speed up.
+
+Wed Aug 20 16:44:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/socket/socket.c (ruby_connect): many systems seem to have
+ a problem in select() after EINPROGRESS. [ruby-list:38080]
+
+Wed Aug 20 01:31:17 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/syck.h: Parser definition problems on HP-UX.
+ [ruby-talk:79389]
+
+ * ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
+
+ * ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
+
+ * ext/syck/rubyext.c: Tainting issues.
+
+Tue Aug 19 23:20:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
+
+ * ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
+
+Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
+
+ * lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
+
+ * lib/webrick/compat.rb (File::fnmatch): remove old migration code.
+
+ * lib/webrick/httpserver.rb (HTTPServer#run): ditto.
+
+ * lib/webrick/server.rb (GenericServer#listen): the body of this
+ method is pull out as Utils::create_lisnteners.
+
+ * lib/webrick/utils.rb (Utils::create_lisnteners): new method.
+
+ * lib/webrick/server.rb (GenericServer#start): should rescue
+ unknown errors. and refine comments.
+
+ * ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
+ socket if SSLSocket raises error.
+
+Tue Aug 19 11:19:33 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * io.c (next_argv): should not call GetOpenFile() if rb_stdout is
+ not a IO (T_FILE).
+
+Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
+ a builtin.
+
+ * ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
+
+ * ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
+ add a return to the tails of each line.
+
+ * ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
+
+ * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
+
+ * ext/openssl/sample/echo_svr.rb: use SSLServer.
+
+ * ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
+
+Tue Aug 19 01:24:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
+ headers are inconsistent at this macro. [ruby-core:01432]
+
+ * ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
+
+ * ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
+ winspool.h
+
+ * instruby.rb: make list at first instead of iterator.
+ [ruby-talk:79347]
+
+Mon Aug 18 11:23:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (glob_helper): preserve raw order for **.
+
+Sun Aug 17 23:39:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
+
+Sun Aug 17 17:10:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
+ method to specify if the underlying IO will be closed in
+ SSLSocket#close.
+
+ * ext/openssl/lib/openssl/buffering.rb: add forwarders to
+ setsockopt, getsockopt and fcntl.
+
+ * ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
+
+Sun Aug 17 11:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb (extmake): should not force to remake Makefile when
+ installation and so on.
+
+Sat Aug 16 23:58:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (w_symbol, w_object): get rid of warnings.
-Sat Aug 28 08:11:05 2010 Tanaka Akira <akr@fsij.org>
+ * re.c (rb_memsearch): ditto.
- * ext/pathname/pathname.c (path_blockdev_p): Pathname#blockdev?
- translated from pathname.rb.
+ * time.c (time_dump): ditto.
-Fri Aug 27 16:20:01 2010 URABE Shyouhei <shyouhei@ruby-lang.org>
+ * ext/extmk.rb (extmake): not continue making when extconf.rb
+ failed.
- * string.c (rb_str_prepend): new method by Shota Fukumori (sora_h)
- [Feature #3765]
+ * ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
-Fri Aug 27 15:24:20 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/openssl/ossl.h: remove version.h dependency.
- * math.c (math_atan2): you should know that M_PI is not the feature
- of C90.
- fixed build failure caused by r29115.
+ * ext/openssl/ruby_missing.h: ditto.
-Fri Aug 27 15:26:33 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb (pkg_config): use --libs output except with
+ only-L for other options. [ruby-list:38099]
- * file.c (null_device): move from io.c.
+ * lib/mkmf.rb (create_makefile): separate rule for static
+ library from shared object.
-Fri Aug 27 12:47:44 2010 Kenta Murata <mrkn@mrkn.jp>
+ * win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
+ define exec_prefix and libdir.
- * math.c (math_atan2): change the behavior when x and y are zero.
- [ruby-dev:42090] [Bug #3736] [ruby-dev:42116]
+Fri Aug 15 23:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
- * test/ruby/test_math.rb (test_atan2): add tests for the above
- changes.
+ * ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
+ method fixed.
-Fri Aug 27 12:26:23 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
- * object.c (rb_obj_class): remove mention of obsolete method.
- a patch from Run Paint Run Run at [ruby-core:31842].
+Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 27 12:25:03 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (HUGE_ST_INO): check whether struct stat.st_ino
+ is larger than long. [ruby-dev:21194]
+ http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
- * io.c (null_device): the name of null device. [ruby-dev:41791]
+ * error.c (syserr_eqq): errno might exceed Fixnum limit.
-Fri Aug 27 07:57:34 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (Init_Exception): moved base initialization from
+ init_syserr().
- * array.c (rb_ary_shuffle_bang): bail out from modification during
- shuffle.
+ * inits.c (rb_call_inits): postpone initializing errnos until
+ Bignum is available.
- * array.c (rb_ary_sample): ditto.
+Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 27 05:11:51 2010 Tanaka Akira <akr@fsij.org>
+ * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
+ keyname() and so on be declared.
- * ext/pathname/pathname.c (path_sysopen): Pathname#sysopen translated
- from pathname.rb.
+ * ext/curses/curses.c (curses_resizeterm, window_resize):
+ arguments conflicted with macros in term.h.
-Thu Aug 26 22:53:56 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/curses/curses.c (Curses module methods): ensure
+ initialized. [ruby-dev:21191]
- * array.c (rb_ary_shuffle): rdoc fix. argument name was missing.
- a patch from Run Paint Run Run at [ruby-core:31848].
+Fri Aug 15 02:08:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Aug 26 21:49:46 2010 Tanaka Akira <akr@fsij.org>
+ * gc.c (id2ref): recycle check should be done by klass == 0.
+ [ruby-core:01408]
- * ext/pathname/pathname.c (path_readlines): Pathname#readlines
- translated from pathname.rb.
+Fri Aug 15 01:34:23 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-Thu Aug 26 10:37:00 2010 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/openssl/ossl_pkey.c: move generate_cb here
- * regint.h (OnigStackIndex): the type should be intptr_t.
- Original Oniguruma assumes the size of long and that of void *
- are equal, but it's not true on LLP64 platform: mswin64.
- originally patched by shintaro kuwamoto [ruby-dev:42133]
+ * ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
-Thu Aug 26 10:38:11 2010 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+ * ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
- * test/dl/test_base.rb: AIX does not have dynamically loadable lib[cm].
+ * ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
- * test/fiddle/helper.rb: AIX does not have dynamically loadable lib[cm].
+Fri Aug 15 00:38:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-Thu Aug 26 09:49:50 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
- * array.c (rb_ary_shuffle_bang): check number of argument.
+ * ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
-Tue Aug 26 09:11:40 2010 Kenta Murata <mrkn@mrkn.jp>
+ * ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
- rmpd_set_thread_local_exception_mode, VpGetException,
- VpSetException): thread-local exception mode.
+Thu Aug 14 21:19:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
- rmpd_set_thread_local_precision_limit, VpGetPrecLimit,
- VpSetPrecLimit): thread-local precision limit.
+ * eval.c (Init_Thread): Continuation#[] added. [ruby-talk:79028]
- * ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
- rmpd_set_thread_local_rounding_mode, VpGetRoundMode,
- VpSetRoundMode, VpException, VpInternalRound):
- thread-local rounding mode.
+Thu Aug 14 20:03:34 2003 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round,
- VpIsRoundMode, VpGetRoundMode, VpSetRoundMode, VpActiveRound,
- VpMidRound, VpLeftRound), ext/bigdecimal/bigdecimal.h:
- use unsigned short for rounding mode.
+ * ext/win32ole/win32ole.c (OLE_FREE): should not call
+ ole_message_loop.
- * test/bigdecimal/test_bigdecimal.rb (test_mode): add test for
- setting rounding mode.
+ * ext/win32ole/win32ole.c (ole_event_free): ditto.
- * test/bigdecimal/test_bigdecimal.rb (test_thread_local_mode):
- add test for setting mode thread-locally.
+ * ext/win32ole/win32ole.c (ole_initialize): stop calling
+ OleUninitialize at exit.
-Thu Aug 26 07:29:54 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 14 11:27:37 2003 NAKAMURA Usaku <usa@ruby-lang.org>
- * array.c (rb_ary_{shuffle_bang,sample}): use Random class object.
+ * gc.c (rb_data_object_alloc): check type of 1st argument.
+ [ruby-dev:21192]
+
+Thu Aug 14 00:21:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
+
+ * parse.y (lhs): ditto.
+
+ * parse.y (yylex): should return tCOLON3 right after kCLASS.
+ [ruby-talk:78918]
+
+ * error.c (exc_initialize): was converting argument to string too
+ eagerly. Only check was needed. [ruby-talk:78958]
+
+Wed Aug 13 23:31:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
+ BigDecimal::limit removed.
+
+Wed Aug 13 19:21:34 2003 Christian Neukirchen <chneukirchen@yahoo.de>
+
+ * lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
+ to SSLSocket. [ruby-talk:78919]
+
+Wed Aug 13 18:13:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
+
+ * eval.c (proc_invoke): unpack return/break destination when block
+ is already left.
+
+Wed Aug 13 15:58:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * object.c (rb_class_s_alloc): add function prototype to avoid VC++
+ warning.
+
+Wed Aug 13 13:50:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/Win32API/Win32API.c (Win32API_initialize): should pass some
+ class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
+
+Tue Aug 12 16:55:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * Makefile.in: static link libraries to LIBRUBY_SO with static linked
+ ext. [ruby-dev:21157]
+
+ * ext/extmk.rb (extmake): sort extension library initialization order.
+
+ * ext/extmk.rb (extmake): compact $extlibs.
+
+Tue Aug 12 02:48:56 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
+ flag before calling getcontext(2).
+
+ * eval.c (struct thread): add member to save backing store on
+ IA64. (ruby-bugs PR1086)
+
+ * eval.c (thread_mark): mark IA64 backing store region.
+
+ * eval.c (thread_free): free saved IA64 backing store.
+
+ * eval.c (rb_thread_save_context): save IA64 backing store as well.
+
+ * eval.c (rb_thread_restore_context): restore IA64 backing store.
+
+ * eval.c (THREAD_ALLOC): initialize IA64 members.
+
+Mon Aug 11 22:31:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/debug.rb(debug_command): inspection command should inspect
+ resulting value even if it's nil. [ruby-dev:21180] by OMAE, jun
+ <jun66j5@ybb.ne.jp>.
+
+ * lib/debug.rb(debug_command): incomplete regexp.
+
+Mon Aug 11 17:33:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_call_super): do not use rb_block_given_p() for
+ check. [ruby-talk:78656]
+
+ * eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
+
+Sun Aug 10 10:43:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
+ from 1k to 16k bytes. [ruby-talk:78603]
+
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
+ partial write to allow interruption in SSLSocket#write.
+
+Sun Aug 10 00:34:16 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
+ for ccache.
+
+Sat Aug 9 10:36:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): do not dump generic instance variable when
+ marshal_dump is defined.
+
+Sat Aug 9 00:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal.c: F style output(like 1234.56789) implemented
+ to to_s method.
+ * ext/bigdecimal_??.html: F style output(like 1234.56789)
+ implemented to to_s method.
+
+Fri Aug 8 12:33:17 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
+ add the -aa option to WLDFLAGS.
+
+Fri Aug 8 11:29:26 2003 Koji Arai <jca02266@nifty.ne.jp>
+
+ * marshal.c (w_object): should set `c_arg' at first.
+
+Fri Aug 8 03:22:28 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httputils.rb (FormData#list): should not take
+ a side effect for the receiver.
+
+Thu Aug 7 14:40:37 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * cygwin/GNUmakefile: better --disbale-shared option support.
+
+ * cygwin/GNUmakefile: add forwarding DLL target for cygwin.
+
+Thu Aug 7 14:21:05 2003 Corinna Vinschen <vinschen@redhat.com>
+
+ * configure.in: Fix Cygwin specific naming of libraries to
+ be net distribution compliant. (ruby-bugs:PR#1077)
+ cygwin-ruby18.dll -> cygruby18.dll
+
+Thu Aug 7 12:51:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_at_exit): should not be called without a block.
+ block_given check added.
+
+Thu Aug 7 06:46:06 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_call0): forgot to pop ruby_class.
+
+ * eval.c (rb_call0): update ruby_class as well as ruby_cref.
+ (ruby-bugs-ja:PR#540)
+
+Thu Aug 7 04:52:50 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
+ ruby_cref. [ruby-talk:78141]
+
+Thu Aug 7 04:19:15 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
+ Linux/ia64. This makes gc.c compile but miniruby coredumps for
+ the moment.
+
+Thu Aug 7 00:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal.c: Comparison results adjusted to Float's.
+ * ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
+
+Wed Aug 6 22:58:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/testcase.rb: Added equality checking.
+ * lib/test/unit/testsuite.rb: Added equality checking.
+ * lib/test/unit/assertions.rb: Fixed a warning.
+
+Wed Aug 6 17:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb (extmake): pass LIBPATH to make ruby. [ruby-dev:21137]
+
+ * ext/extmk.rb (extmake): set library name as source file name in
+ Init_ext(). [ruby-dev:21137]
+
+ * lib/mkmf.rb (Logging::postpone): postpone logging messages after
+ heading message as the result of the block.
+
+ * lib/mkmf.rb (macro_defined?): append newline to src unless ended
+ with it.
+
+ * lib/mkmf.rb (have_library): treat nil function name as "main".
+ (ruby-bugs:PR#1083)
+
+ * lib/mkmf.rb (pkg_config): should append additional libraries to
+ $libs but not $LIBS. [ruby-dev:21137]
+
+ * ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
+
+ * ext/digest/sha1/extconf.rb: have_library already appends library
+ name.
+
+Wed Aug 6 17:23:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c: initialize /* OK */ variables by Qnil to stop warnings.
+
+Wed Aug 6 04:58:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/Setup*: add io/wait and openssl.
+
+Wed Aug 6 01:13:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
+
+ * eval.c (rb_f_autoload_p): ditto.
+
+ * class.c (rb_mod_init_copy): no longer implements independent
+ clone and dup methods. override "initialize_copy" instead.
+ [ruby-core:01352]
+
+ * object.c (rb_class_s_alloc): define Class allocation function.
+ this makes Classes to follow clone framework that uses
+ initialize_copy.
+
+ * object.c (rb_class_initialize): separate instantiation and
+ initialization.
- * random.c (try_get_rnd): use default_rand for Random as same as
- singleton methods.
+ * object.c (rb_obj_alloc): prohibit instantiation from
+ uninitialized class.
- * random.c (rb_random_real): check the range of result.
+ * object.c (rb_class_superclass): check uninitialized class.
-Wed Aug 25 22:11:11 2010 Tanaka Akira <akr@fsij.org>
+ * array.c (rb_ary_fill): wrong index processing with block. this
+ fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
- * ext/pathname/pathname.c (path_binread): Pathname#binread translated
- from pathname.rb.
+ * marshal.c (w_object): should preserve generic ivar for nil,
+ true, false, symbols, and fixnums.
-Wed Aug 25 03:42:43 2010 NAKAMURA Usaku <usa@ruby-lang.org>
+ * marshal.c (w_uclass): base_klass check should be done after
+ rb_class_real().
- * ext/dl/cfunc.c (rb_dlcfunc_call): workaround for VC9 for x64.
- reported by kuwamoto shintaro in [ruby-dev:42125].
+Wed Aug 6 01:18:50 2003 Minero Aoki <aamine@loveruby.net>
-Tue Aug 24 23:28:50 2010 Yusuke Endoh <mame@tsg.ne.jp>
+ * lib/net/http.rb: update document.
- * .gitignore: updated.
+ * lib/net/pop.rb: ditto.
-Tue Aug 24 22:07:28 2010 Tanaka Akira <akr@fsij.org>
+ * lib/net/protocol.rb: ditto.
- * ext/pathname/pathname.c (path_read): Pathname#read translated from
- pathname.rb.
+Wed Aug 6 00:48:37 2003 Koji Arai <jca02266@nifty.ne.jp>
-Tue Aug 24 10:11:04 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * marshal.c (w_object): should recommend marshal_dump rather than
+ _dump_data.
- * configure.in: read API version from include/ruby/version.h.
+Tue Aug 5 17:58:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
- * {bcc,win}32/setup.mak (-version-): ditto.
+ * lib/fileutils.rb (install): should preserve timestamp only.
- * version.h (RUBY_LIB_VERSION): use API version numbers.
+Tue Aug 5 17:31:59 2003 Ian Macdonald <ian@caliban.org>
-Tue Aug 24 07:07:28 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
+ simple typo.
- * array.c (rb_ary_shuffle_bang, rb_ary_sample): add optional
- argument random. [ruby-dev:41923] [EXPERIMENTAL]
+Tue Aug 5 15:47:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * random.c (rb_random_{int32,real,bytes}): fallback to normal
- method invocation.
+ * eval.c (rb_load): should preserve current source file/line.
-Tue Aug 24 06:08:10 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Aug 5 10:04:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * include/ruby/version.h (RUBY_API_VERSION_*): renamed and moved
- from version.h. [ruby-dev:42103]
+ * string.c (str_new4): ptr may refer null_str.
-Tue Aug 24 05:58:18 2010 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 4 17:25:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
- * ChangeLog: flushed. [ruby-dev:42050]
+ * stable version 1.8.0 released.
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
For the changes before 1.8.0, see doc/ChangeLog-1.8.0
Local variables:
-coding: us-ascii
add-log-time-format: (lambda ()
(let* ((time (current-time))
- (system-time-locale "C")
(diff (+ (cadr time) 32400))
(lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
+ (hi (+ (car time) (/ diff 65536))))
(format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
indent-tabs-mode: t
tab-width: 8
-change-log-indent-text: 2
end:
-vim: tabstop=8 shiftwidth=2
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
deleted file mode 100644
index b97a08d928..0000000000
--- a/KNOWNBUGS.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-#
-# This test file concludes tests which point out known bugs.
-# So all tests will cause failure.
-#
-
diff --git a/LEGAL b/LEGAL
index 65706459cd..908eb270f5 100644
--- a/LEGAL
+++ b/LEGAL
@@ -5,59 +5,34 @@ All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
- When this software is partly used or it is distributed with Ruby,
- this of Ruby follows the license of Ruby.
+regex.[ch]:
+
+ These files are under LGPL. Treat them as LGPL says. (See the file
+ LGPL for details)
+
+ Extended regular expression matching and search library.
+ Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
+
+ The GNU C Library is free software; you can redistribute it and/or
+ modify it under the terms of the GNU Library General Public License as
+ published by the Free Software Foundation; either version 2 of the
+ License, or (at your option) any later version.
+
+ The GNU C Library is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ Library General Public License for more details.
+
+ You should have received a copy of the GNU Library General Public
+ License along with the GNU C Library; see the file LGPL. If not,
+ write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+ Boston, MA 02111-1307, USA. */
+
+ Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
+ Last change: May 21, 1993 by t^2
+ removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
+ Perl5 extension added by matz <matz@caelum.co.jp>
+ UTF-8 extension added Jan 16 1999 by Yoshida Masato <yoshidam@tau.bekkoame.ne.jp>
configure:
@@ -68,8 +43,9 @@ configure:
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-tool/config.guess:
-tool/config.sub:
+config.guess:
+config.sub:
+parse.c:
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
@@ -96,58 +72,7 @@ tool/config.sub:
configuration script generated by Autoconf, you may include it under
the same distribution terms that you use for the rest of that program.
-parse.c:
-
- This file is licensed under the GPL, but is incorporated into Ruby and
- redistributed under the terms of the Ruby license, as permitted by the
- exception to the GPL below.
-
- Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
- Free Software Foundation, Inc.
-
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2, or (at your option)
- any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 51 Franklin Street, Fifth Floor,
- Boston, MA 02110-1301, USA. */
-
- /* As a special exception, you may create a larger work that contains
- part or all of the Bison parser skeleton and distribute that work
- under terms of your choice, so long as that work isn't itself a
- parser generator using the skeleton or a modified version thereof
- as a parser skeleton. Alternatively, if you modify or redistribute
- the parser skeleton itself, you may (at your option) remove this
- special exception, which will cause the skeleton and the resulting
- Bison output files to be licensed under the GNU General Public
- License without this special exception.
-
- This special exception was added by the Free Software Foundation in
- version 2.2 of Bison. */
-
util.c (partly):
-
- Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
-
- Permission to use, copy, modify, and distribute this software for any
- purpose without fee is hereby granted, provided that this entire notice
- is included in all copies of any software which is or includes a copy
- or modification of this software and in all copies of the supporting
- documentation for such software.
-
- THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
- WARRANTY. IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
- REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
- OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-
win32/win32.[ch]:
You can apply the Artistic License to these files. (or GPL,
@@ -158,32 +83,6 @@ win32/win32.[ch]:
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
-util.c (partly):
-
- Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
random.c
This file is under the new-style BSD license.
@@ -231,109 +130,72 @@ random.c
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
-vsnprintf.c:
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
-
- This code is derived from software contributed to Berkeley by
- Chris Torek.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
- IMPORTANT NOTE:
- --------------
- From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
- paragraph 3 above is now null and void.
-
st.[ch]:
+x68/*:
missing/alloca.c:
missing/dup2.c:
-missing/erf.c:
missing/finite.c:
missing/hypot.c:
missing/isinf.c:
missing/isnan.c:
-missing/lgamma_r.c:
missing/memcmp.c:
missing/memmove.c:
+missing/strcasecmp.c:
missing/strchr.c:
+missing/streror.c:
+missing/strftime.c:
+missing/strncasecmp.c:
missing/strstr.c:
missing/strtol.c:
-missing/tgamma.c:
ext/digest/sha1/sha1.[ch]:
These files are all under public domain.
-missing/crypt.c:
+missing/strtod.c:
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
+ This file will not be used on most platforms depending on how the
+ configure script results. In any case you must not receive any fee
+ with the file itself.
- Copyright (c) 1989, 1993
- The Regents of the University of California. All rights reserved.
+ Copyright (c) 1988-1993 The Regents of the University of California.
+ Copyright (c) 1994 Sun Microsystems, Inc.
- This code is derived from software contributed to Berkeley by
- Tom Truscott.
+ Permission to use, copy, modify, and distribute this
+ software and its documentation for any purpose and without
+ fee is hereby granted, provided that the above copyright
+ notice appear in all copies. The University of California
+ makes no representations about the suitability of this
+ software for any purpose. It is provided "as is" without
+ express or implied warranty.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
+missing/strtoul.c:
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
+ This file will not be used on most platforms depending on how the
+ configure script results. In any case you must not receive any fee
+ with the file itself.
+
+ Copyright 1988 Regents of the University of California
-missing/setproctitle.c
+ Permission to use, copy, modify, and distribute this
+ software and its documentation for any purpose and without
+ fee is hereby granted, provided that the above copyright
+ notice appear in all copies. The University of California
+ makes no representations about the suitability of this
+ software for any purpose. It is provided "as is" without
+ express or implied warranty.
+
+missing/erf.c:
+missing/crypt.c:
+missing/vsnprintf.c:
This file is under the old-style BSD license. Note that the
paragraph 3 below is now null and void.
- Copyright 2003 Damien Miller
- Copyright (c) 1983, 1995-1997 Eric P. Allman
- Copyright (c) 1988, 1993
- The Regents of the University of California. All rights reserved.
+ Copyright (c) 1990, 1993
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Chris Torek.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -359,46 +221,10 @@ missing/setproctitle.c
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-missing/strlcat.c
-missing/strlcpy.c
-
- These files are under the new-style BSD license.
-
- Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. The name of the author may not be used to endorse or promote products
- derived from this software without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
- INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
- AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL
- THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
- EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
- PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
- OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
- WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
- OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
- ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-missing/langinfo.c
-
- This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
- Ruby uses a modified version. The file contains the following
- author/copyright notice:
-
- Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
- Permission to use, copy, modify, and distribute this software
- for any purpose and without fee is hereby granted. The author
- disclaims all warranties with regard to this software.
+ IMPORTANT NOTE:
+ --------------
+ From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+ paragraph 3 above is now null and void.
ext/digest/md5/md5.[ch]:
@@ -438,7 +264,18 @@ ext/digest/rmd160/rmd160.[ch]:
Copyright (c) Katholieke Universiteit Leuven
1996, All Rights Reserved
+ext/digest/rmd160/rmd160hl.c:
+ext/digest/sha1/sha1hl.c:
+
+ These files are under the beer-ware license.
+
+ "THE BEER-WARE LICENSE" (Revision 42):
+ <phk@login.dkuug.dk> wrote this file. As long as you retain this notice you
+ can do whatever you want with this stuff. If we meet some day, and you think
+ this stuff is worth it, you can buy me a beer in return. Poul-Henning Kamp
+
ext/digest/sha2/sha2.[ch]:
+ext/digest/sha2/sha2hl.c:
These files are under the new-style BSD license.
diff --git a/LGPL b/LGPL
new file mode 100644
index 0000000000..b1e3f5a263
--- /dev/null
+++ b/LGPL
@@ -0,0 +1,504 @@
+ GNU LESSER GENERAL PUBLIC LICENSE
+ Version 2.1, February 1999
+
+ Copyright (C) 1991, 1999 Free Software Foundation, Inc.
+ 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+[This is the first released version of the Lesser GPL. It also counts
+ as the successor of the GNU Library Public License, version 2, hence
+ the version number 2.1.]
+
+ Preamble
+
+ The licenses for most software are designed to take away your
+freedom to share and change it. By contrast, the GNU General Public
+Licenses are intended to guarantee your freedom to share and change
+free software--to make sure the software is free for all its users.
+
+ This license, the Lesser General Public License, applies to some
+specially designated software packages--typically libraries--of the
+Free Software Foundation and other authors who decide to use it. You
+can use it too, but we suggest you first think carefully about whether
+this license or the ordinary General Public License is the better
+strategy to use in any particular case, based on the explanations below.
+
+ When we speak of free software, we are referring to freedom of use,
+not price. Our General Public Licenses are designed to make sure that
+you have the freedom to distribute copies of free software (and charge
+for this service if you wish); that you receive source code or can get
+it if you want it; that you can change the software and use pieces of
+it in new free programs; and that you are informed that you can do
+these things.
+
+ To protect your rights, we need to make restrictions that forbid
+distributors to deny you these rights or to ask you to surrender these
+rights. These restrictions translate to certain responsibilities for
+you if you distribute copies of the library or if you modify it.
+
+ For example, if you distribute copies of the library, whether gratis
+or for a fee, you must give the recipients all the rights that we gave
+you. You must make sure that they, too, receive or can get the source
+code. If you link other code with the library, you must provide
+complete object files to the recipients, so that they can relink them
+with the library after making changes to the library and recompiling
+it. And you must show them these terms so they know their rights.
+
+ We protect your rights with a two-step method: (1) we copyright the
+library, and (2) we offer you this license, which gives you legal
+permission to copy, distribute and/or modify the library.
+
+ To protect each distributor, we want to make it very clear that
+there is no warranty for the free library. Also, if the library is
+modified by someone else and passed on, the recipients should know
+that what they have is not the original version, so that the original
+author's reputation will not be affected by problems that might be
+introduced by others.
+
+ Finally, software patents pose a constant threat to the existence of
+any free program. We wish to make sure that a company cannot
+effectively restrict the users of a free program by obtaining a
+restrictive license from a patent holder. Therefore, we insist that
+any patent license obtained for a version of the library must be
+consistent with the full freedom of use specified in this license.
+
+ Most GNU software, including some libraries, is covered by the
+ordinary GNU General Public License. This license, the GNU Lesser
+General Public License, applies to certain designated libraries, and
+is quite different from the ordinary General Public License. We use
+this license for certain libraries in order to permit linking those
+libraries into non-free programs.
+
+ When a program is linked with a library, whether statically or using
+a shared library, the combination of the two is legally speaking a
+combined work, a derivative of the original library. The ordinary
+General Public License therefore permits such linking only if the
+entire combination fits its criteria of freedom. The Lesser General
+Public License permits more lax criteria for linking other code with
+the library.
+
+ We call this license the "Lesser" General Public License because it
+does Less to protect the user's freedom than the ordinary General
+Public License. It also provides other free software developers Less
+of an advantage over competing non-free programs. These disadvantages
+are the reason we use the ordinary General Public License for many
+libraries. However, the Lesser license provides advantages in certain
+special circumstances.
+
+ For example, on rare occasions, there may be a special need to
+encourage the widest possible use of a certain library, so that it becomes
+a de-facto standard. To achieve this, non-free programs must be
+allowed to use the library. A more frequent case is that a free
+library does the same job as widely used non-free libraries. In this
+case, there is little to gain by limiting the free library to free
+software only, so we use the Lesser General Public License.
+
+ In other cases, permission to use a particular library in non-free
+programs enables a greater number of people to use a large body of
+free software. For example, permission to use the GNU C Library in
+non-free programs enables many more people to use the whole GNU
+operating system, as well as its variant, the GNU/Linux operating
+system.
+
+ Although the Lesser General Public License is Less protective of the
+users' freedom, it does ensure that the user of a program that is
+linked with the Library has the freedom and the wherewithal to run
+that program using a modified version of the Library.
+
+ The precise terms and conditions for copying, distribution and
+modification follow. Pay close attention to the difference between a
+"work based on the library" and a "work that uses the library". The
+former contains code derived from the library, whereas the latter must
+be combined with the library in order to run.
+
+ GNU LESSER GENERAL PUBLIC LICENSE
+ TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+ 0. This License Agreement applies to any software library or other
+program which contains a notice placed by the copyright holder or
+other authorized party saying it may be distributed under the terms of
+this Lesser General Public License (also called "this License").
+Each licensee is addressed as "you".
+
+ A "library" means a collection of software functions and/or data
+prepared so as to be conveniently linked with application programs
+(which use some of those functions and data) to form executables.
+
+ The "Library", below, refers to any such software library or work
+which has been distributed under these terms. A "work based on the
+Library" means either the Library or any derivative work under
+copyright law: that is to say, a work containing the Library or a
+portion of it, either verbatim or with modifications and/or translated
+straightforwardly into another language. (Hereinafter, translation is
+included without limitation in the term "modification".)
+
+ "Source code" for a work means the preferred form of the work for
+making modifications to it. For a library, complete source code means
+all the source code for all modules it contains, plus any associated
+interface definition files, plus the scripts used to control compilation
+and installation of the library.
+
+ Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope. The act of
+running a program using the Library is not restricted, and output from
+such a program is covered only if its contents constitute a work based
+on the Library (independent of the use of the Library in a tool for
+writing it). Whether that is true depends on what the Library does
+and what the program that uses the Library does.
+
+ 1. You may copy and distribute verbatim copies of the Library's
+complete source code as you receive it, in any medium, provided that
+you conspicuously and appropriately publish on each copy an
+appropriate copyright notice and disclaimer of warranty; keep intact
+all the notices that refer to this License and to the absence of any
+warranty; and distribute a copy of this License along with the
+Library.
+
+ You may charge a fee for the physical act of transferring a copy,
+and you may at your option offer warranty protection in exchange for a
+fee.
+
+ 2. You may modify your copy or copies of the Library or any portion
+of it, thus forming a work based on the Library, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+ a) The modified work must itself be a software library.
+
+ b) You must cause the files modified to carry prominent notices
+ stating that you changed the files and the date of any change.
+
+ c) You must cause the whole of the work to be licensed at no
+ charge to all third parties under the terms of this License.
+
+ d) If a facility in the modified Library refers to a function or a
+ table of data to be supplied by an application program that uses
+ the facility, other than as an argument passed when the facility
+ is invoked, then you must make a good faith effort to ensure that,
+ in the event an application does not supply such function or
+ table, the facility still operates, and performs whatever part of
+ its purpose remains meaningful.
+
+ (For example, a function in a library to compute square roots has
+ a purpose that is entirely well-defined independent of the
+ application. Therefore, Subsection 2d requires that any
+ application-supplied function or table used by this function must
+ be optional: if the application does not supply it, the square
+ root function must still compute square roots.)
+
+These requirements apply to the modified work as a whole. If
+identifiable sections of that work are not derived from the Library,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works. But when you
+distribute the same sections as part of a whole which is a work based
+on the Library, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote
+it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Library.
+
+In addition, mere aggregation of another work not based on the Library
+with the Library (or with a work based on the Library) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+ 3. You may opt to apply the terms of the ordinary GNU General Public
+License instead of this License to a given copy of the Library. To do
+this, you must alter all the notices that refer to this License, so
+that they refer to the ordinary GNU General Public License, version 2,
+instead of to this License. (If a newer version than version 2 of the
+ordinary GNU General Public License has appeared, then you can specify
+that version instead if you wish.) Do not make any other change in
+these notices.
+
+ Once this change is made in a given copy, it is irreversible for
+that copy, so the ordinary GNU General Public License applies to all
+subsequent copies and derivative works made from that copy.
+
+ This option is useful when you wish to copy part of the code of
+the Library into a program that is not a library.
+
+ 4. You may copy and distribute the Library (or a portion or
+derivative of it, under Section 2) in object code or executable form
+under the terms of Sections 1 and 2 above provided that you accompany
+it with the complete corresponding machine-readable source code, which
+must be distributed under the terms of Sections 1 and 2 above on a
+medium customarily used for software interchange.
+
+ If distribution of object code is made by offering access to copy
+from a designated place, then offering equivalent access to copy the
+source code from the same place satisfies the requirement to
+distribute the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+ 5. A program that contains no derivative of any portion of the
+Library, but is designed to work with the Library by being compiled or
+linked with it, is called a "work that uses the Library". Such a
+work, in isolation, is not a derivative work of the Library, and
+therefore falls outside the scope of this License.
+
+ However, linking a "work that uses the Library" with the Library
+creates an executable that is a derivative of the Library (because it
+contains portions of the Library), rather than a "work that uses the
+library". The executable is therefore covered by this License.
+Section 6 states terms for distribution of such executables.
+
+ When a "work that uses the Library" uses material from a header file
+that is part of the Library, the object code for the work may be a
+derivative work of the Library even though the source code is not.
+Whether this is true is especially significant if the work can be
+linked without the Library, or if the work is itself a library. The
+threshold for this to be true is not precisely defined by law.
+
+ If such an object file uses only numerical parameters, data
+structure layouts and accessors, and small macros and small inline
+functions (ten lines or less in length), then the use of the object
+file is unrestricted, regardless of whether it is legally a derivative
+work. (Executables containing this object code plus portions of the
+Library will still fall under Section 6.)
+
+ Otherwise, if the work is a derivative of the Library, you may
+distribute the object code for the work under the terms of Section 6.
+Any executables containing that work also fall under Section 6,
+whether or not they are linked directly with the Library itself.
+
+ 6. As an exception to the Sections above, you may also combine or
+link a "work that uses the Library" with the Library to produce a
+work containing portions of the Library, and distribute that work
+under terms of your choice, provided that the terms permit
+modification of the work for the customer's own use and reverse
+engineering for debugging such modifications.
+
+ You must give prominent notice with each copy of the work that the
+Library is used in it and that the Library and its use are covered by
+this License. You must supply a copy of this License. If the work
+during execution displays copyright notices, you must include the
+copyright notice for the Library among them, as well as a reference
+directing the user to the copy of this License. Also, you must do one
+of these things:
+
+ a) Accompany the work with the complete corresponding
+ machine-readable source code for the Library including whatever
+ changes were used in the work (which must be distributed under
+ Sections 1 and 2 above); and, if the work is an executable linked
+ with the Library, with the complete machine-readable "work that
+ uses the Library", as object code and/or source code, so that the
+ user can modify the Library and then relink to produce a modified
+ executable containing the modified Library. (It is understood
+ that the user who changes the contents of definitions files in the
+ Library will not necessarily be able to recompile the application
+ to use the modified definitions.)
+
+ b) Use a suitable shared library mechanism for linking with the
+ Library. A suitable mechanism is one that (1) uses at run time a
+ copy of the library already present on the user's computer system,
+ rather than copying library functions into the executable, and (2)
+ will operate properly with a modified version of the library, if
+ the user installs one, as long as the modified version is
+ interface-compatible with the version that the work was made with.
+
+ c) Accompany the work with a written offer, valid for at
+ least three years, to give the same user the materials
+ specified in Subsection 6a, above, for a charge no more
+ than the cost of performing this distribution.
+
+ d) If distribution of the work is made by offering access to copy
+ from a designated place, offer equivalent access to copy the above
+ specified materials from the same place.
+
+ e) Verify that the user has already received a copy of these
+ materials or that you have already sent this user a copy.
+
+ For an executable, the required form of the "work that uses the
+Library" must include any data and utility programs needed for
+reproducing the executable from it. However, as a special exception,
+the materials to be distributed need not include anything that is
+normally distributed (in either source or binary form) with the major
+components (compiler, kernel, and so on) of the operating system on
+which the executable runs, unless that component itself accompanies
+the executable.
+
+ It may happen that this requirement contradicts the license
+restrictions of other proprietary libraries that do not normally
+accompany the operating system. Such a contradiction means you cannot
+use both them and the Library together in an executable that you
+distribute.
+
+ 7. You may place library facilities that are a work based on the
+Library side-by-side in a single library together with other library
+facilities not covered by this License, and distribute such a combined
+library, provided that the separate distribution of the work based on
+the Library and of the other library facilities is otherwise
+permitted, and provided that you do these two things:
+
+ a) Accompany the combined library with a copy of the same work
+ based on the Library, uncombined with any other library
+ facilities. This must be distributed under the terms of the
+ Sections above.
+
+ b) Give prominent notice with the combined library of the fact
+ that part of it is a work based on the Library, and explaining
+ where to find the accompanying uncombined form of the same work.
+
+ 8. You may not copy, modify, sublicense, link with, or distribute
+the Library except as expressly provided under this License. Any
+attempt otherwise to copy, modify, sublicense, link with, or
+distribute the Library is void, and will automatically terminate your
+rights under this License. However, parties who have received copies,
+or rights, from you under this License will not have their licenses
+terminated so long as such parties remain in full compliance.
+
+ 9. You are not required to accept this License, since you have not
+signed it. However, nothing else grants you permission to modify or
+distribute the Library or its derivative works. These actions are
+prohibited by law if you do not accept this License. Therefore, by
+modifying or distributing the Library (or any work based on the
+Library), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Library or works based on it.
+
+ 10. Each time you redistribute the Library (or any work based on the
+Library), the recipient automatically receives a license from the
+original licensor to copy, distribute, link with or modify the Library
+subject to these terms and conditions. You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties with
+this License.
+
+ 11. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Library at all. For example, if a patent
+license would not permit royalty-free redistribution of the Library by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Library.
+
+If any portion of this section is held invalid or unenforceable under any
+particular circumstance, the balance of the section is intended to apply,
+and the section as a whole is intended to apply in other circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system which is
+implemented by public license practices. Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+ 12. If the distribution and/or use of the Library is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Library under this License may add
+an explicit geographical distribution limitation excluding those countries,
+so that distribution is permitted only in or among countries not thus
+excluded. In such case, this License incorporates the limitation as if
+written in the body of this License.
+
+ 13. The Free Software Foundation may publish revised and/or new
+versions of the Lesser General Public License from time to time.
+Such new versions will be similar in spirit to the present version,
+but may differ in detail to address new problems or concerns.
+
+Each version is given a distinguishing version number. If the Library
+specifies a version number of this License which applies to it and
+"any later version", you have the option of following the terms and
+conditions either of that version or of any later version published by
+the Free Software Foundation. If the Library does not specify a
+license version number, you may choose any version ever published by
+the Free Software Foundation.
+
+ 14. If you wish to incorporate parts of the Library into other free
+programs whose distribution conditions are incompatible with these,
+write to the author to ask for permission. For software which is
+copyrighted by the Free Software Foundation, write to the Free
+Software Foundation; we sometimes make exceptions for this. Our
+decision will be guided by the two goals of preserving the free status
+of all derivatives of our free software and of promoting the sharing
+and reuse of software generally.
+
+ NO WARRANTY
+
+ 15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
+WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
+EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
+OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
+KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
+LIBRARY IS WITH YOU. SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
+THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
+WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
+AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
+FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
+CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
+LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
+RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
+FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
+SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
+DAMAGES.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Libraries
+
+ If you develop a new library, and you want it to be of the greatest
+possible use to the public, we recommend making it free software that
+everyone can redistribute and change. You can do so by permitting
+redistribution under these terms (or, alternatively, under the terms of the
+ordinary General Public License).
+
+ To apply these terms, attach the following notices to the library. It is
+safest to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least the
+"copyright" line and a pointer to where the full notice is found.
+
+ <one line to give the library's name and a brief idea of what it does.>
+ Copyright (C) <year> <name of author>
+
+ This library is free software; you can redistribute it and/or
+ modify it under the terms of the GNU Lesser General Public
+ License as published by the Free Software Foundation; either
+ version 2.1 of the License, or (at your option) any later version.
+
+ This library is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ Lesser General Public License for more details.
+
+ You should have received a copy of the GNU Lesser General Public
+ License along with this library; if not, write to the Free Software
+ Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
+Also add information on how to contact you by electronic and paper mail.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the library, if
+necessary. Here is a sample; alter the names:
+
+ Yoyodyne, Inc., hereby disclaims all copyright interest in the
+ library `Frob' (a library for tweaking knobs) written by James Random Hacker.
+
+ <signature of Ty Coon>, 1 April 1990
+ Ty Coon, President of Vice
+
+That's all there is to it!
+
+
diff --git a/Makefile.in b/Makefile.in
index 41ea4122e8..8fd59babcd 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,27 +1,16 @@
SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-RUNCMD = $(SHELL)
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
#### Start of system configuration section. ####
srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
+VPATH = $(srcdir):$(srcdir)/missing
CC = @CC@
-CPP = @CPP@
-YACC = bison
+YACC = @YACC@
PURIFY =
AUTOCONF = autoconf
@SET_MAKE@
MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-DOXYGEN = @DOXYGEN@
prefix = @prefix@
exec_prefix = @exec_prefix@
@@ -34,64 +23,37 @@ datadir = @datadir@
arch = @arch@
sitearch = @sitearch@
sitedir = @sitedir@
-ruby_version = @ruby_version@
TESTUI = console
TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+RDOCTARGET = @RDOCTARGET@
EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
+RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
empty =
OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS = @CFLAGS@ $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@
-INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
+CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS =
+EXTLDFLAGS =
XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
+EXTLIBS =
LIBS = @LIBS@ $(EXTLIBS)
MISSING = @LIBOBJS@ @ALLOCA@
LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) $(ARCH_FLAG)
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
SOLIBS = @SOLIBS@
MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+MINIOBJS = @MINIOBJS@
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
RUBY_SO_NAME=@RUBY_SO_NAME@
EXEEXT = @EXEEXT@
PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
- $(MINIRUBYOPT)
-RUNRUBY = @RUNRUBY@ $(RUNRUBYOPT) -- $(RUN_OPTS)
-XRUBY = @XRUBY@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-
-DEFAULT_PRELUDES = $(@USE_RUBYGEMS@_GEM_PRELUDE)
+MINIRUBY = @MINIRUBY@
+RUNRUBY = @RUNRUBY@
#### End of system configuration section. ####
@@ -107,50 +69,23 @@ LIBRUBYARG = @LIBRUBYARG@
LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-THREAD_MODEL = @THREAD_MODEL@
-
PREP = @PREP@
ARCHFILE = @ARCHFILE@
SETUP =
EXTSTATIC = @EXTSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-MAKEDIRS = @MKDIR_P@
-CP = cp
-MV = mv
RM = rm -f
-RMDIR = @RMDIR@
-RMDIRS = @RMDIRS@
-RMALL = @RMALL@
NM = @NM@
AR = @AR@
ARFLAGS = rcu
RANLIB = @RANLIB@
AS = @AS@
-ASFLAGS = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP = @OBJDUMP@
-OBJCOPY = @OBJCOPY@
-VCS = @VCS@
-VCSUP = @VCSUP@
+ASFLAGS = @ASFLAGS@
OBJEXT = @OBJEXT@
-ASMEXT = S
-DLEXT = @DLEXT@
MANTYPE = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-MKMAIN_CMD = mkmain.sh
-
-SRC_FILE = $<
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-configure_args = @configure_args@
+PREINSTALL = @PREINSTALL@
#### End of variables
all:
@@ -161,62 +96,47 @@ all:
.NOEXPORT:
miniruby$(EXEEXT):
- @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(DMYEXT) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+ @$(RM) $@
+ $(PURIFY) $(CC) $(MAINOBJ) $(MINIOBJS) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@ $(LDFLAGS) $(MAINLIBS)
$(PROGRAM):
@$(RM) $@
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+ $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
# We must `rm' the library each time this rule is invoked because "updating" a
# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
# supported.
$(LIBRUBY_A):
@$(RM) $@
- $(ECHO) linking static-library $@
- $(Q) $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
+ $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
@-$(RANLIB) $@ 2> /dev/null || true
$(LIBRUBY_SO):
- @-$(PRE_LIBRUBY_UPDATE)
- $(ECHO) linking shared-library $@
- $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
- -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
+ $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
File.symlink "$(LIBRUBY_SO)", link}' \
$(LIBRUBY_ALIASES) || true
-fake: $(arch)-fake.rb
-$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
- @./config.status --file=$@:$(srcdir)/template/fake.rb.in
- @chmod +x $@
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
- @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
- $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
- $(ECHO) installing cross-compiling stuff
- $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
- $(Q) $(BASERUBY) -p \
- -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
- -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
- rbconfig.rb > fake-rbconfig.rb
- $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
- $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
- @$(RM) fake.rb fake-rbconfig.rb
- $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
- $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
- $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status
+fake.rb: Makefile
+ @echo ' \
+ class Object; \
+ CROSS_COMPILING = RUBY_PLATFORM; \
+ remove_const :RUBY_PLATFORM; \
+ remove_const :RUBY_VERSION; \
+ RUBY_PLATFORM = "@arch@"; \
+ RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
+ end; \
+ if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
+ class File; \
+ remove_const :ALT_SEPARATOR; \
+ ALT_SEPARATOR = "\\"; \
+ end; \
+ end; \
+ ' > $@
+
+Makefile: $(srcdir)/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/common.mk
MAKE=$(MAKE) $(SHELL) ./config.status
@{ \
echo "all:; -@rm -f conftest.mk"; \
@@ -226,164 +146,33 @@ $(MKFILES): config.status
$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
{ echo "Makefile updated, restart."; exit 1; }
-uncommon.mk: $(srcdir)/common.mk
- sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+config.status: $(srcdir)/configure
+ MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
-.PHONY: reconfig
-reconfig-args = $(srcdir)/configure $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
-reconfig-exec-1 = set -x; "$$@"
+$(srcdir)/configure: $(srcdir)/configure.in
+ cd $(srcdir) && $(AUTOCONF)
-reconfig config.status: $(srcdir)/configure $(srcdir)/enc/Makefile.in
- @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
- set $(SHELL) $($@-args); $(reconfig-exec-$(V))
+lex.c: keywords
+ @-$(RM) $@
+ gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
+ cp "$(srcdir)/$@" .
-$(srcdir)/configure: $(srcdir)/configure.in
- $(CHDIR) $(srcdir) && exec $(AUTOCONF)
-
-incs: id.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
- @\
- if cmp -s $(srcdir)/defs/lex.c.src $?; then \
- [ $(Q) ] && echo copying $@ || set -x; \
- $(CP) $(srcdir)/lex.c.blt $@; \
- else \
- [ $(Q) ] && echo generating $@ || set -x; \
- gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(srcdir)/defs/lex.c.src && \
- $(CP) $@ $(srcdir)/lex.c.blt; \
- fi
-
-NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
-
-enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
- $(MAKEDIRS) $(@D)
- @set +e; \
- if cmp -s $(?:.kwd=.src) $?; then \
- set -x; \
- $(CP) $(?:.kwd=.h.blt) $@; \
- else \
- trap '$(RM) $@-1.h $@-2.h' 0 && \
- set -x; \
- sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
- gperf $(NAME2CTYPE_OPTIONS) < $? > $@-2.h && \
- diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(?:.kwd=.src) && \
- $(CP) $@ $(?:.kwd=.h.blt); \
- fi
+.y.c:
+ $(YACC) $<
+ sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
+ rm -f y.tab.c
.c.@OBJEXT@:
- @$(ECHO) compiling $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $<
.s.@OBJEXT@:
- @$(ECHO) assembling $<
- $(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
- @$(ECHO) translating $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
- @$(ECHO) preprocessing $<
- $(Q) $(CPP) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+ $(AS) $(ASFLAGS) -o $@ $<
clean-local::
- $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output
- -$(Q)$(RM) $(pkgconfig_DATA)
+ @$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
distclean-local::
- $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
- -$(Q)$(RM) run.gdb
- -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h
- -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
- @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
- test "$$#" = 0 && set .; \
- set dummy `\
- find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
- `; shift; \
- cd ..; \
- for dir do \
- echo $(@:-ext=)ing "$$dir"; \
- (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
- case "$@" in \
- *distclean-ext*|*realclean-ext*) \
- $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
- esac; \
- done
-
-distclean-ext realclean-ext::
- -$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
- -$(Q)$(RMDIRS) $(EXTOUT) 2> /dev/null || true
-
-clean-enc distclean-enc realclean-enc:
- @test -f "$(ENC_MK)" || exit 0; \
- echo $(@:-enc=ing) encodings; \
- exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
-
-clean-rdoc distclean-rdoc realclean-rdoc:
- @echo $(@:-rdoc=ing) rdoc
- $(Q)$(RMALL) $(RDOCOUT)
-clean-capi distclean-capi realclean-capi:
- @echo $(@:-capi=ing) capi
- $(Q)$(RMALL) $(CAPIOUT)
-
-clean-platform:
- @$(RM) $(PLATFORM_D)
- -$(Q) $(RMDIR) $(PLATFORM_DIR) 2> /dev/null || true
+ @$(RM) ext/config.cache $(RBCONFIG)
ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(ECHO) compiling $@
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-up::
- @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-update-mspec:
- @$(CHDIR) $(srcdir); \
- if [ -d spec/mspec ]; then \
- cd spec/mspec; \
- echo updating mspec ...; \
- exec git pull; \
- else \
- echo retrieving mspec ...; \
- exec git clone $(MSPEC_GIT_URL) spec/mspec; \
- fi
-
-update-rubyspec: update-mspec
- @$(CHDIR) $(srcdir); \
- if [ -d spec/rubyspec ]; then \
- cd spec/rubyspec; \
- echo updating rubyspec ...; \
- exec git pull; \
- else \
- echo retrieving rubyspec ...; \
- exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
- fi
-
-test-rubyspec-precheck:
- @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
-
-INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
- vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
- $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
- $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
- $(ECHO) generating $@
- $(Q) $(BASERUBY) -Ks $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
+ $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(OUTFLAG)$@ -c ext/extinit.c
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 30fec33fdd..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,341 +0,0 @@
-# -*- rd -*-
-= NEWS
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with. For a full list of changes
-with all sufficient information, see the ChangeLog file.
-
-== Changes since the 1.9.2 release
-=== License
-
-* Ruby's License is changed from a dual license with GPLv2
- to a dual license with 2-clause BSDL.
-
-=== Known platform dependent issues
-==== OS X Lion
-
-* You have to configure ruby with '--with-gcc=gcc-4.2' if you're using
- Xcode 4.1, or, if you're using Xcode 4.2, you have to configure ruby
- with '--with-gcc=clang'.
-
-=== C API updates
-
-* rb_scan_args() is enhanced with support for option hash argument
- extraction.
-
-* ruby_vm_at_exit() added. This enables extension libs to hook a VM
- termination.
-
-* rb_reserved_fd_p() added. If you want to close all file descriptors,
- check using this API. [ruby-core:37759]
-
-=== Library updates (outstanding ones only)
-
-* builtin classes
-
- * ARGF
- * new methods:
- * ARGF.print
- * ARGF.printf
- * ARGF.putc
- * ARGF.puts
- * ARGF.read_nonblock
- * ARGF.to_write_io
- * ARGF.write
-
- * Array
- * extended method:
- * Array#pack supports endian modifiers
-
- * Bignum
- * Multiplication algorithm for Bignums with a large number of digits over
- 150 BDIGITs is changed in order to reduce its calculation time.
- Now such large Bignums are multiplied by using Toom-3 algorithm.
-
- * Encoding
- * new encodings:
- * CP950
- * CP951
- * UTF-16
- * UTF-32
- * change alias:
- * SJIS is Windows-31J
-
- * File
- * new constant:
- * File::NULL
- name of NULL device.
- * File::DIRECT
- name of O_DIRECT.
-
- * IO
- * extended method:
- * IO#putc supports multibyte characters
- * new methods:
- * IO#advise
- * IO.write(name, string, [offset] )
- Write `string` to file `name`.
- Opposite with File.read.
- * IO.binwrite(name, string, [offset] )
- binary version of IO.write.
-
- * Kernel
- * move #__id__ to BasicObject.
- * extended method:
- * Kernel#rand supports range argument
-
- * Module
- * new methods:
- * Module#private_constant
- * Module#public_constant
-
- * Random
- * extended method:
- * Random.rand supports range argument
-
- * String
- * extended method:
- * String#unpack supports endian modifiers
- * new method:
- * String#prepend
- * String#byteslice
-
- * Time
- * extended method:
- * Time#strftime supports %:z and %::z.
-
- * Process
- * Process#maxgroups and Process#maxgroups= now raise NotImplementedError if
- the platform don't support supplementary groups concept.
-
-* bigdecimal
-
- * BigDecimal#power and BigDecimal#** support non-integral exponent.
-
- * Kernel.BigDecimal and BigDecimal.new now accept instances of Integer,
- Rational, Float, and BigDecimal. If you pass a Rational or a Float to
- them, you must specify the precision to produce the digits of a BigDecimal.
-
- * The behavior of BigDecimal#coerce with a Rational is changed. It uses
- the precision of the receiver BigDecimal to produce the digits of a
- BigDecimal from the given Rational.
-
-* bigdecimal/util
-
- * BigDecimal#to_d and Integer#to_d are added.
-
- * Float#to_d accepts a precision.
-
- * Rational#to_d raises ArgumentError when passing zero or negative
- precision.
-
- * Rational#to_d
-
- * Zero and an implicit precision is deprecated.
- This feature is removed at the next release of bigdecimal.
-
- * A negative precision isn't supported.
- Be careful it is an incompatible change.
-
-* date
-
- * Accepts flonum explicitly with limitations.
- * If the given offset is flonum, DateTime assumes its precision is
- at most second.
-
- DateTime.new(2001,2,3,0,0,0,3.0/24) ==
- DateTime.new(2001,2,3,0,0,0,'+03:00')
- #=> true
-
- * If the given operand for -/+ is flonum, DateTime assumes its
- precision is at most nanosecond.
-
- DateTime.new(2001,2,3) + 0.5 == DateTime.new(2001,2,3,12)
- #=> true
-
- * Precision of offset is always at most second.
-
- Rational('0.5') == Rational('0.500001') #=> false
- DateTime.new(2001,2,3,0,0,0,Rational('0.5')) ==
- DateTime.new(2001,2,3,0,0,0,Rational('0.500001'))
- #=> true
-
- * Ignores long offset and far reform day (with warning).
-
- * Now accepts only:
-
- -1<=offset<=1 (-24:00..+24:00)
- 2298874<=start<=2426355 or -/+oo
- (proleptic Gregorian/Julian mean -/+oo)
-
- * A method strftime cannot produce huge output (same as Time's one).
-
- * Even though Date/DateTime can handle far dates, the following causes
- an exception.
-
- DateTime.new(1<<10000).strftime('%Y') # Errno::ERANGE
-
- * Changed the format of inspect.
- * Changed the format of marshal (but, can load old dumps).
-
-* io/console
- * new methods:
- * IO#noecho {|io| }
- * IO#echo=
- * IO#echo?
- * IO#raw {|io| }
- * IO#raw!
- * IO#getch
- * IO#winsize
- * IO.console
-
-* json
- * updated to v1.5.4.
-
-* matrix
- * new classes:
- * Matrix::EigenvalueDecomposition
- * Matrix::LUPDecomposition
- * new methods:
- * Matrix#diagonal?
- * Matrix#eigen
- * Matrix#eigensystem
- * Matrix#hermitian?
- * Matrix#lower_triangular?
- * Matrix#lup
- * Matrix#lup_decomposition
- * Matrix#normal?
- * Matrix#orthogonal?
- * Matrix#permutation?
- * Matrix#round
- * Matrix#symmetric?
- * Matrix#unitary?
- * Matrix#upper_triangular?
- * Matrix#zero?
- * Vector#magnitude, #norm
- * Vector#normalize
- * extended methods:
- * Matrix#each and #each_with_index can iterate on a subset of the elements
- * Matrix#find_index returns [row, column] and can iterate on a subset
- of the elements
- * Matrix#** implements Numeric exponents (using the eigensystem)
- * Matrix.zero can build rectangular matrices
-
-* minitest
- * Minitest has been updated to version 2.2.2.
- * For full details, see https://github.com/seattlerb/minitest/blob/master/History.txt
-
-* net/http
- * SNI (Server Name Indication) supported for HTTPS.
-
- * Allow to configure to wait server returning '100 continue' response
- before sending HTTP request body. Set Net::HTTP#continue_timeout AND pass
- 'expect' => '100-continue' to a extra HTTP header.
-
- For example, the following code sends HTTP header and waits for getting
- '100 continue' response before sending HTTP request body. When 0.5 [sec]
- timeout occurs or the server send '100 continue', the client sends HTTP
- request body.
- http.continue_timeout = 0.5
- http.request_post('/continue', 'body=BODY', 'expect' => '100-continue')
-
- * new method:
- * Net::HTTPRequest#set_form): Added to support
- both application/x-www-form-urlencoded and multipart/form-data.
-
-* objspace
- * new method:
- * ObjectSpace::memsize_of_all
-
-* openssl
- * PKey::RSA and PKey::DSA now use the generic X.509 encoding scheme
- (e.g. used in a X.509 certificate's Subject Public Key Info) when
- exporting public keys to DER or PEM. Backward compatibility is
- ensured by (already existing) fallbacks during creation.
- * OpenSSL::ASN1::Constructive#new and OpenSSL::ASN1::Primitive#new
- (and the constructors of their sub-classes) will no longer force
- tagging to be set to :EXPLICIT when tag and/or tag_class are passed
- as parameters. tagging must be set explicitly.
- * Support for infinite length encodings via infinite_length attribute.
- * OpenSSL::PKey.read( file | string [, pwd] ) allows to read arbitrary
- public/private keys in DER-/PEM-encoded form with an optional password
- for encrypted PEM encodings.
- * Add new method OpenSSL::X509::Name#hash_old as a wrapper of
- X509_NAME_hash_old() defined from OpenSSL 1.0.0. It returns OpenSSL 0.9.8
- compatible hash value.
-
-* optparse
- * support for bash/zsh completion.
-
-* Rake
- * Rake has been upgraded from 0.8.7 to 0.9.2.2. For full release notes see
- https://github.com/jimweirich/rake/blob/master/CHANGES
-
-* RDoc
- * RDoc has been upgraded to version 3.9.4. For full release notes see
- http://docs.seattlerb.org/rdoc/History_txt.html
-
-* rexml
- * Support Ruby native encoding mechanism and iconv dependency is dropped.
-
-* RubyGems
- * RubyGems has been upgraded to version 1.8.10. For full release notes see
- http://rubygems.rubyforge.org/rubygems-update/History_txt.html
-
-* stringio
- * extended method:
- * StringIO#set_encoding can get 2nd argument and optional hash.
-
-* test/unit
- * New arguments:
- * -j N, --jobs=N: Allow run N testcases at once.
- * --jobs-status: Show status of jobs when parallel running.
- * --no-retry: Don't retry testcases which failed when parallel running.
- * --ruby=RUBY: path to ruby for job(worker) process. optional.
- * --hide-skip: Hide skip messages. You'll see the number of skips at end of
- test result.
-
-* uri
- * new methods:
- * URI::Generic#hostname
- * URI::Generic#hostname=
-
-* webrick
- * new method:
- * WEBrick::HTTPRequest#continue for generating '100 continue' response.
- * new logging directive:
- * %{remote}p for remote (client) port number.
-
-* yaml
- * The default YAML engine is now Psych. You may downgrade to syck by setting
- YAML::ENGINE.yamler = 'syck'.
-
-* zlib
- * new methods:
- * Zlib.deflate
- * Zlib.inflate
-
-* FileUtils
- * extended method:
- * FileUtils#chmod supports symbolic mode argument.
-
-=== Language changes
-
-* Regexps now support Unicode 6.0. (new characters and scripts)
-
-* [experimental] Regexps now support Age property.
- Unlike Perl, current implementation takes interpretation of the
- interpretation of UTS #18.
- http://www.unicode.org/reports/tr18/
-
-* Turning on/off indentation warnings with directives.
- ("# -*- warn-indent: true -*-" / "# -*- warn-indent: false -*-")
-
-=== Compatibility issues (excluding feature bug fixes)
-
- * Rational#to_d
-
- See above.
diff --git a/README b/README
index 3d2e636e4d..cf836415ad 100644
--- a/README
+++ b/README
@@ -16,9 +16,8 @@ Perl). It is simple, straight-forward, and extensible.
+ Iterators and Closures
+ Garbage Collection
+ Dynamic Loading of Object files(on some architecture)
- + Highly Portable (works on many Unix-like/POSIX compatible platforms
- as well as Windows, Mac OS X, BeOS etc.)
- cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatforms
+ + Highly Portable(works on many UNIX machines, and on DOS,
+ Windows, Mac, BeOS etc.)
* How to get Ruby
@@ -27,6 +26,11 @@ The Ruby distribution files can be found in the following FTP site:
ftp://ftp.ruby-lang.org/pub/ruby/
+The latest source code of this version series can be checked out
+through SVN with the following command:
+
+ $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
+
The trunk of the Ruby source tree can be checked out with the
following command:
@@ -66,10 +70,6 @@ This is what you need to do to compile and install Ruby:
2. Run ./configure, which will generate config.h and Makefile.
- Some C compiler flags may be added by default depending on your
- environment. Specify optflags=.. and warnflags=.. as necessary
- to override them.
-
3. Edit defines.h if you need. Usually this step will not be needed.
4. Remove comment mark(#) before the module names from ext/Setup (or
@@ -89,32 +89,6 @@ This is what you need to do to compile and install Ruby:
7. Run 'make install'
- This command will create following directories and install files
- onto them.
-
- * ${DESTDIR}${prefix}/bin
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib
- * ${DESTDIR}${prefix}/lib/ruby
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/share/man/man1
- * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
-
- If Ruby's API version is `x.y.z', the ((|${MAJOR}|)) is `x', the
- ((|${MINOR}|)) is `y', and the ((|${TEENY}|)) is `z'.
-
- NOTE: teeny of the API version may be different from one of
- Ruby's program version
-
You may have to be a super user to install ruby.
If you fail to compile ruby, please send the detailed error report with
diff --git a/README.EXT b/README.EXT
index de63f54699..e5d39911ca 100644
--- a/README.EXT
+++ b/README.EXT
@@ -8,8 +8,8 @@ In C, variables have types and data do not have types. In contrast,
Ruby variables do not have a static type, and data themselves have
types, so data will need to be converted between the languages.
-Data in Ruby are represented by the C type `VALUE'. Each VALUE data
-has its data-type.
+Data in Ruby are represented by C type `VALUE'. Each VALUE data has
+its data-type.
To retrieve C data from a VALUE, you need to:
@@ -31,12 +31,10 @@ The Ruby interpreter has the following data types:
T_STRING string
T_REGEXP regular expression
T_ARRAY array
+ T_FIXNUM Fixnum(31bit integer)
T_HASH associative array
T_STRUCT (Ruby) structure
T_BIGNUM multi precision integer
- T_FIXNUM Fixnum(31bit or 63bit integer)
- T_COMPLEX complex number
- T_RATIONAL rational number
T_FILE IO
T_TRUE true
T_FALSE false
@@ -48,8 +46,9 @@ In addition, there are several other types used internally:
T_ICLASS
T_MATCH
T_UNDEF
+ T_VARMAP
+ T_SCOPE
T_NODE
- T_ZOMBIE
Most of the types are represented by C structures.
@@ -79,8 +78,7 @@ There is the data-type check function
void Check_Type(VALUE value, int type)
-which raises an exception if the VALUE does not have the type
-specified.
+which raises an exception if the VALUE does not have the type specified.
There are also faster check macros for fixnums and nil.
@@ -89,53 +87,42 @@ There are also faster check macros for fixnums and nil.
1.3 Convert VALUE into C data
-The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
+The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
respectively. They are singletons for the data type.
-The equivalent C constants are: Qnil, Qfalse, Qtrue.
-Note that Qfalse is false in C also (i.e. 0), but not Qnil.
-
-The T_FIXNUM data is a 31bit or 63bit length fixed integer.
-This size is depend on the size of long: if long is 32bit then
-T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
-T_FIXNUM can be converted to a C integer by using the
-FIX2INT() macro or FIX2LONG(). Though you have to check that the
-data is really FIXNUM before using them, they are faster. FIX2LONG()
-never raises exceptions, but FIX2INT() raises RangeError if the
-result is bigger or smaller than the size of int.
-There are also NUM2INT() and NUM2LONG() which converts any Ruby
-numbers into C integers. These macros includes a type check,
-so an exception will be raised if the conversion failed. NUM2DBL()
-can be used to retrieve the double float value in the same way.
-
-You can use the macros
-StringValue() and StringValuePtr() to get a char* from a VALUE.
-StringValue(var) replaces var's value with the result of "var.to_str()".
-StringValuePtr(var) does same replacement and returns char*
-representation of var. These macros will skip the replacement if var
-is a String. Notice that the macros take only the lvalue as their
-argument, to change the value of var in place.
-
-You can also use the macro named StringValueCStr(). This is just
-like StringValuePtr(), but always add nul character at the end of
-the result. If the result contains nul character, this macro causes
-the ArgumentError exception.
-StringValuePtr() doesn't guarantee the existence of a nul at the end
-of the result, and the result may contain nul.
+
+The T_FIXNUM data is a 31bit length fixed integer (63bit length on
+some machines), which can be convert to a C integer by using the
+FIX2INT() macro. There is also NUM2INT() which converts any Ruby
+numbers into C integers. The NUM2INT() macro includes a type check, so
+an exception will be raised if the conversion failed. NUM2DBL() can
+be used to retrieve the double float value in same way.
+
+To get char* from a VALUE, version 1.7 recommend to use new macros
+StringValue() and StringValuePtr(). StringValue(var) replaces var's
+value to the result of "var.to_str()". StringValuePtr(var) does same
+replacement and returns char* representation of var. These macros
+will skip the replacement if var is a String. Notice that the macros
+requires to take only lvalue as their argument, to change the value
+of var in the replacement.
+
+In version 1.6 or earlier, STR2CSTR() was used to do same thing
+but now it is obsoleted in version 1.7 because of STR2CSTR() has
+a risk of dangling pointer problem in to_str() impliclit conversion.
Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has the corresponding
-structure can be cast to retrieve the pointer to the struct. The
-casting macro will be of the form RXXXX for each data type; for
-instance, RARRAY(obj). See "ruby.h".
+for T_ARRAY etc. The VALUE of the type which has corresponding structure
+can be cast to retrieve the pointer to the struct. The casting macro
+will be of the form RXXXX for each data type; for instance, RARRAY(obj).
+See "ruby.h".
-There are some accessing macros for structure members, for example
-`RSTRING_LEN(str)' to get the size of the Ruby String object. The
-allocated region can be accessed by `RSTRING_PTR(str)'. For arrays,
-use `RARRAY_LEN(ary)' and `RARRAY_PTR(ary)' respectively.
+For example, `RSTRING(str)->len' is the way to get the size of the
+Ruby String object. The allocated region can be accessed by
+`RSTRING(str)->ptr'. For arrays, use `RARRAY(ary)->len' and
+`RARRAY(ary)->ptr' respectively.
Notice: Do not change the value of the structure directly, unless you
-are responsible for the result. This ends up being the cause of
-interesting bugs.
+are responsible for the result. This ends up being the cause of interesting
+bugs.
1.4 Convert C data into VALUE
@@ -165,10 +152,9 @@ range, but is a bit slower.
1.5 Manipulating Ruby data
-As I already mentioned, it is not recommended to modify an object's
-internal structure. To manipulate objects, use the functions supplied
-by the Ruby interpreter. Some (not all) of the useful functions are
-listed below:
+As I already mentioned, it is not recommended to modify an object's internal
+structure. To manipulate objects, use the functions supplied by the Ruby
+interpreter. Some (not all) of the useful functions are listed below:
String functions
@@ -177,7 +163,6 @@ listed below:
Creates a new Ruby string.
rb_str_new2(const char *ptr)
- rb_str_new_cstr(const char *ptr)
Creates a new Ruby string from a C string. This is equivalent to
rb_str_new(ptr, strlen(ptr)).
@@ -188,58 +173,13 @@ listed below:
sources should be tainted.
rb_tainted_str_new2(const char *ptr)
- rb_tainted_str_new_cstr(const char *ptr)
Creates a new tainted Ruby string from a C string.
- rb_sprintf(const char *format, ...)
- rb_vsprintf(const char *format, va_list ap)
-
- Creates a new Ruby string with printf(3) format.
-
rb_str_cat(VALUE str, const char *ptr, long len)
Appends len bytes of data from ptr to the Ruby string.
- rb_str_cat2(VALUE str, const char* ptr)
-
- Appends C string ptr to Ruby string str. This function is
- equivalent to rb_str_cat(str, ptr, strlen(ptr)).
-
- rb_str_catf(VALUE str, const char* format, ...)
- rb_str_vcatf(VALUE str, const char* format, va_list ap)
-
- Appends C string format and successive arguments to Ruby string
- str according to a printf-like format. These functions are
- equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
- rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
-
- rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
-
- Creates a new Ruby string with the specified encoding.
-
- rb_usascii_str_new(const char *ptr, long len)
- rb_usascii_str_new_cstr(const char *ptr)
-
- Creates a new Ruby string with encoding US-ASCII.
-
- rb_str_resize(VALUE str, long len)
-
- Resizes Ruby string to len bytes. If str is not modifiable, this
- function raises an exception. The length of str must be set in
- advance. If len is less than the old length the content beyond
- len bytes is discarded, else if len is greater than the old length
- the content beyond the old length bytes will not be preserved but
- will be garbage. Note that RSTRING_PTR(str) may change by calling
- this function.
-
- rb_str_set_len(VALUE str, long len)
-
- Sets the length of Ruby string. If str is not modifiable, this
- function raises an exception. This function preserves the content
- upto len bytes, regardless RSTRING_LEN(str). len must not exceed
- the capacity of str.
-
Array functions
rb_ary_new()
@@ -259,35 +199,17 @@ listed below:
Creates an n-element array from a C array.
- rb_ary_to_ary(VALUE obj)
-
- Converts the object into an array.
- Equivalent to Object#to_ary.
-
- There are many functions to operate an array.
- They may dump core if other types are given.
-
- rb_ary_aref(argc, VALUE *argv, VALUE ary)
-
- Equivaelent to Array#[].
-
- rb_ary_entry(VALUE ary, long offset)
-
- ary[offset]
-
- rb_ary_subseq(VALUE ary, long beg, long len)
-
- ary[beg, len]
-
rb_ary_push(VALUE ary, VALUE val)
rb_ary_pop(VALUE ary)
rb_ary_shift(VALUE ary)
rb_ary_unshift(VALUE ary, VALUE val)
+ Array operations. The first argument to each functions must be an
+ array. They may dump core if other types given.
2. Extending Ruby with C
-2.1 Adding new features to Ruby
+2.1 Addding new features to Ruby
You can add new features (classes, methods, etc.) to the Ruby
interpreter. Ruby provides APIs for defining the following things:
@@ -322,7 +244,7 @@ To define methods or singleton methods, use these functions:
VALUE (*func)(), int argc)
The `argc' represents the number of the arguments to the C function,
-which must be less than 17. But I doubt you'll need that many.
+which must be less than 17. But I believe you don't need that much. :-)
If `argc' is negative, it specifies the calling sequence, not number of
the arguments.
@@ -342,23 +264,15 @@ will be called like:
where obj is the receiver, and args is the Ruby array containing
actual arguments.
-There are some more functions to define methods. One takes an ID
-as the name of method to be defined. See 2.2.2 for IDs.
-
- void rb_define_method_id(VALUE klass, ID name,
- VALUE (*func)(ANYARGS), int argc)
-
-There are two functions to define private/protected methods:
+There are two more functions to define methods. One is to define
+private methods:
void rb_define_private_method(VALUE klass, const char *name,
VALUE (*func)(), int argc)
- void rb_define_protected_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-At last, rb_define_module_function defines a module functions,
-which are private AND singleton methods of the module.
-For example, sqrt is the module function defined in Math module.
-It can be called in the following way:
+The other is to define module functions, which are private AND singleton
+methods of the module. For example, sqrt is the module function
+defined in Math module. It can be call in the form like:
Math.sqrt(4)
@@ -372,26 +286,22 @@ To define module functions, use:
void rb_define_module_function(VALUE module, const char *name,
VALUE (*func)(), int argc)
-In addition, function-like methods, which are private methods defined
+Oh, in addition, function-like methods, which are private methods defined
in the Kernel module, can be defined using:
void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-To define an alias for the method,
+To define alias to the method,
void rb_define_alias(VALUE module, const char* new, const char* old);
-To define a reader/writer for an attribute,
-
- void rb_define_attr(VALUE klass, const char *name, int read, int write)
-
To define and undefine the `allocate' class method,
void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
void rb_undef_alloc_func(VALUE klass);
-func has to take the klass as the argument and return a newly
-allocated instance. This instance should be as empty as possible,
+func have to take the klass as the argument and return a newly
+allocated instance. This instance should be empty as possible,
without any expensive (including external) resources.
2.1.3 Constant definition
@@ -411,33 +321,21 @@ There are several ways to invoke Ruby's features from C code.
2.2.1 Evaluate Ruby Programs in a String
The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program. This function will do the job:
+evaluate the string as Ruby program. This function will do the job.
VALUE rb_eval_string(const char *str)
Evaluation is done under the current context, thus current local variables
of the innermost method (which is defined by Ruby) can be accessed.
-Note that the evaluation can raise an exception. There is a safer
-function:
-
- VALUE rb_eval_string_protect(const char *str, int *state)
-
-It returns nil when an error occur. Moreover, *state is zero if str was
-successfully evaluated, or nonzero otherwise.
-
-
2.2.2 ID or Symbol
-You can invoke methods directly, without parsing the string. First I
-need to explain about ID. ID is the integer number to represent
-Ruby's identifiers such as variable names. The Ruby data type
-corresponding to ID is Symbol. It can be accessed from Ruby in the
-form:
+You can invoke methods directly, without parsing the string. First I need
+to explain about ID. ID is the integer number to represent Ruby's
+identifiers such as variable names. The Ruby data type corresponding to ID
+is Symbol. It can be accessed from Ruby in the form:
:Identifier
-or
- :"any kind of string"
You can get the ID value from a string within C code by using
@@ -468,8 +366,8 @@ specified by the symbol mid.
2.2.4 Accessing the variables and constants
You can access class variables and instance variables using access
-functions. Also, global variables can be shared between both
-environments. There's no way to access Ruby's local variables.
+functions. Also, global variables can be shared between both environments.
+There's no way to access Ruby's local variables.
The functions to access/modify instance variables are below:
@@ -488,8 +386,7 @@ See 2.1.3 for defining new constant.
3.1 Ruby constants that C can be accessed from C
-As stated in section 1.3,
-the following Ruby constants can be referred from C.
+The following Ruby constants can be referred from C.
Qtrue
Qfalse
@@ -519,32 +416,25 @@ function below.
You can defined hooked variables. The accessor functions (getter and
setter) are called on access to the hooked variables.
- void rb_define_hooked_variable(const char *name, VALUE *var,
+ void rb_define_hooked_variable(constchar *name, VALUE *var,
VALUE (*getter)(), void (*setter)())
If you need to supply either setter or getter, just supply 0 for the
hook you don't need. If both hooks are 0, rb_define_hooked_variable()
works just like rb_define_variable().
-The prototypes of the getter and setter functions are as follows:
-
- VALUE (*getter)(ID id, VALUE *var);
- void (*setter)(VALUE val, ID id, VALUE *var);
-
-
-Also you can define a Ruby global variable without a corresponding C
-variable. The value of the variable will be set/get only by hooks.
-
void rb_define_virtual_variable(const char *name,
VALUE (*getter)(), void (*setter)())
-The prototypes of the getter and setter functions are as follows:
+This function defines a Ruby global variable without a corresponding C
+variable. The value of the variable will be set/get only by hooks.
- VALUE (*getter)(ID id);
- void (*setter)(VALUE val, ID id);
+The prototypes of the getter and setter functions are as follows:
+ (*getter)(ID id, void *data, struct global_entry* entry);
+ (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-3.3 Encapsulate C data into a Ruby object
+3.3 Encapsulate C data into Ruby object
To wrap and objectify a C pointer as a Ruby object (so called
DATA), use Data_Wrap_Struct().
@@ -558,10 +448,6 @@ function to free the pointer allocation. If this is -1, the pointer
will be just freed. The functions mark and free will be called from
garbage collector.
-These mark / free functions are invoked during GC execution. No
-object allocations are allowed during it, so do not allocate ruby
-objects inside them.
-
You can allocate and wrap the structure in one step.
Data_Make_Struct(klass, type, mark, free, sval)
@@ -607,9 +493,6 @@ has only one source file, choosing ``LIBRARY.c'' as a file name is
preferred. On the other hand, in case your library has multiple source
files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
with an intermediate file ``LIBRARY.o'' on some platforms.
-Note that some functions in mkmf library described below generate
-a file ``conftest.c'' for checking with compilation. You shouldn't
-choose ``conftest.c'' as a name of a source file.
Ruby will execute the initializing function named ``Init_LIBRARY'' in
the library. For example, ``Init_dbm()'' will be executed when loading
@@ -618,8 +501,7 @@ the library.
Here's the example of an initializing function.
--
-void
-Init_dbm(void)
+Init_dbm()
{
/* define DBM class */
cDBM = rb_define_class("DBM", rb_cObject);
@@ -653,8 +535,8 @@ struct dbmdata {
obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
--
-This code wraps the dbmdata structure into a Ruby object. We avoid
-wrapping DBM* directly, because we want to cache size information.
+This code wraps the dbmdata structure into a Ruby object. We avoid wrapping
+DBM* directly, because we want to cache size information.
To retrieve the dbmdata structure from a Ruby object, we define the
following macro:
@@ -674,7 +556,8 @@ methods with a fixed number of arguments receive arguments like this:
--
static VALUE
-fdbm_delete(VALUE obj, VALUE keystr)
+fdbm_delete(obj, keystr)
+ VALUE obj, keystr;
{
:
}
@@ -688,7 +571,10 @@ arguments like this:
--
static VALUE
-fdbm_s_open(int argc, VALUE *argv, VALUE klass)
+fdbm_s_open(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
{
:
if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -703,17 +589,16 @@ argument is the C array of the method arguments, and the third
argument is the receiver of the method.
You can use the function rb_scan_args() to check and retrieve the
-arguments. The third argument is a string that specifies how to
-capture method arguments and assign them to the following VALUE
-references.
-
+arguments. For example, "11" means that the method requires at least one
+argument, and at most receives two arguments.
-The following is an example of a method that takes arguments by Ruby's
-array:
+Methods with an arbitrary number of arguments can receive arguments
+by Ruby's array, like this:
--
static VALUE
-thread_initialize(VALUE thread, VALUE args)
+fdbm_indexes(obj, args)
+ VALUE obj, args;
{
:
}
@@ -734,7 +619,7 @@ are not exported to the Ruby world. You need to protect them by
If the file named extconf.rb exists, it will be executed to generate
Makefile.
-extconf.rb is the file for checking compilation conditions etc. You
+extconf.rb is the file for check compilation conditions etc. You
need to put
require 'mkmf'
@@ -754,12 +639,12 @@ The value of the variables below will affect the Makefile.
$LDFLAGS: included in LDFLAGS make variable (such as -L)
$objs: list of object file names
-Normally, the object files list is automatically generated by searching
-source files, but you must define them explicitly if any sources will
+In normal, object files list is automatically generated by searching
+source files, but you need directs them explicitly if any sources will
be generated while building.
If a compilation condition is not fulfilled, you should not call
-``create_makefile''. The Makefile will not be generated, compilation will
+``create_makefile''. The Makefile will not generated, compilation will
not be done.
(5) prepare depend (optional)
@@ -769,7 +654,7 @@ check dependencies. You can make this file by invoking
% gcc -MM *.c > depend
-It's harmless. Prepare it.
+It's no harm. Prepare it.
(6) generate Makefile
@@ -777,11 +662,6 @@ Try generating the Makefile by:
ruby extconf.rb
-If the library should be installed under vendor_ruby directory
-instead of site_ruby directory, use --vendor option as follows.
-
- ruby extconf.rb --vendor
-
You don't need this step if you put the extension library under the ext
directory of the ruby source tree. In that case, compilation of the
interpreter will do this step for you.
@@ -793,12 +673,12 @@ Type
make
to compile your extension. You don't need this step either if you have
-put the extension library under the ext directory of the ruby source tree.
+put extension library under the ext directory of the ruby source tree.
(8) debug
You may need to rb_debug the extension. Extensions can be linked
-statically by adding the directory name in the ext/Setup file so that
+statically by the adding directory name in the ext/Setup file so that
you can inspect the extension with the debugger.
(9) done, now you have the extension library
@@ -811,120 +691,53 @@ Appendix A. Ruby source files overview
ruby language core
- class.c : classes and modules
- error.c : exception classes and exception mechanism
- gc.c : memory management
- load.c : library loading
- object.c : objects
- variable.c : variables and constants
-
-ruby syntax parser
- parse.y
- -> parse.c : automatically generated
- keywords : reserved keywords
- -> lex.c : automatically generated
-
-ruby evaluator (a.k.a. YARV)
- compile.c
+ class.c
+ error.c
eval.c
- eval_error.c
- eval_jump.c
- eval_safe.c
- insns.def : definition of VM instructions
- iseq.c : implementation of VM::ISeq
- thread.c : thread management and context swiching
- thread_win32.c : thread implementation
- thread_pthread.c : ditto
- vm.c
- vm_dump.c
- vm_eval.c
- vm_exec.c
- vm_insnhelper.c
- vm_method.c
-
- opt_insns_unif.def : instruction unification
- opt_operand.def : definitions for optimization
-
- -> insn*.inc : automatically generated
- -> opt*.inc : automatically generated
- -> vm.inc : automatically generated
-
-regular expression engine (oniguruma)
- regex.c
- regcomp.c
- regenc.c
- regerror.c
- regexec.c
- regparse.c
- regsyntax.c
+ gc.c
+ object.c
+ parse.y
+ variable.c
utility functions
- debug.c : debug symbols for C debuggger
- dln.c : dynamic loading
- st.c : general purpose hash table
- strftime.c : formatting times
- util.c : misc utilities
+ dln.c
+ regex.c
+ st.c
+ util.c
ruby interpreter implementation
dmyext.c
- dmydln.c
- dmyencoding.c
- id.c
inits.c
main.c
ruby.c
version.c
- gem_prelude.rb
- prelude.rb
-
-
class library
- array.c : Array
- bignum.c : Bignum
- compar.c : Comparable
- complex.c : Complex
- cont.c : Fiber, Continuation
- dir.c : Dir
- enum.c : Enumerable
- enumerator.c : Enumerator
- file.c : File
- hash.c : Hash
- io.c : IO
- marshal.c : Marshal
- math.c : Math
- numeric.c : Numeric, Integer, Fixnum, Float
- pack.c : Array#pack, String#unpack
- proc.c : Binding, Proc
- process.c : Process
- random.c : random number
- range.c : Range
- rational.c : Rational
- re.c : Regexp, MatchData
- signal.c : Signal
- sprintf.c :
- string.c : String
- struct.c : Struct
- time.c : Time
-
- defs/known_errors.def : Errno::* exception classes
- -> known_errors.inc : automatically generated
-
-multilingualization
- encoding.c : Encoding
- transcode.c : Encoding::Converter
- enc/*.c : encoding classes
- enc/trans/* : codepoint mapping tables
-
-goruby interpreter implementation
-
- goruby.c
- golf_prelude.rb : goruby specific libraries.
- -> golf_prelude.c : automatically generated
-
+ array.c
+ bignum.c
+ compar.c
+ dir.c
+ enum.c
+ file.c
+ hash.c
+ io.c
+ marshal.c
+ math.c
+ numeric.c
+ pack.c
+ prec.c
+ process.c
+ random.c
+ range.c
+ re.c
+ signal.c
+ sprintf.c
+ string.c
+ struct.c
+ time.c
Appendix B. Ruby extension API reference
@@ -980,17 +793,10 @@ void Check_SafeStr(VALUE value)
** Data type conversion
-FIX2INT(value), INT2FIX(i)
-FIX2LONG(value), LONG2FIX(l)
-NUM2INT(value), INT2NUM(i)
-NUM2UINT(value), UINT2NUM(ui)
-NUM2LONG(value), LONG2NUM(l)
-NUM2ULONG(value), ULONG2NUM(ul)
-NUM2LL(value), LL2NUM(ll)
-NUM2ULL(value), ULL2NUM(ull)
-NUM2OFFT(value), OFFT2NUM(off)
-NUM2SIZET(value), SIZET2NUM(size)
-NUM2SSIZET(value), SSIZET2NUM(ssize)
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
NUM2DBL(value)
rb_float_new(f)
StringValue(value)
@@ -1037,15 +843,15 @@ it can't be seen from Ruby programs.
void rb_define_readonly_variable(const char *name, VALUE *var)
Defines a read-only global variable. Works just like
-rb_define_variable(), except the defined variable is read-only.
+rb_define_variable(), except defined variable is read-only.
void rb_define_virtual_variable(const char *name,
VALUE (*getter)(), VALUE (*setter)())
Defines a virtual variable, whose behavior is defined by a pair of C
functions. The getter function is called when the variable is
-referenced. The setter function is called when the variable is set to a
-value. The prototype for getter/setter functions are:
+referred. The setter function is called when the value is set to the
+variable. The prototype for getter/setter functions are:
VALUE getter(ID id)
void setter(VALUE val, ID id)
@@ -1103,55 +909,11 @@ Defines a singleton method. Arguments are same as rb_define_method().
rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-Retrieve argument from argc and argv to given VALUE references
-according to the format string. The format can be described in ABNF
-as follows:
-
---
-scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
-
-param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
-pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
-post-arg-spec := sym-for-variable-length-args [num-of-trailing-mandatory-args]
-pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
-option-hash-arg-spec := sym-for-option-hash-arg
-block-arg-spec := sym-for-block-arg
-
-num-of-leading-mandatory-args := DIGIT ; The number of leading
- ; mandatory arguments
-num-of-optional-args := DIGIT ; The number of optional
- ; arguments
-sym-for-variable-length-args := "*" ; Indicates that variable
- ; length arguments are
- ; captured as a ruby array
-num-of-trailing-mandatory-args := DIGIT ; The number of trailing
- ; mandatory arguments
-sym-for-option-hash-arg := ":" ; Indicates that an option
- ; hash is captured if the last
- ; argument is a hash or can be
- ; converted to a hash with
- ; #to_hash. When the last
- ; argument is nil, it is
- ; captured if it is not
- ; ambiguous to take it as
- ; empty option hash; i.e. '*'
- ; is not specified and
- ; arguments are given more
- ; than sufficient.
-sym-for-block-arg := "&" ; Indicates that an iterator
- ; block should be captured if
- ; given
---
-
-For example, "12" means that the method requires at least one
-argument, and at most receives three (1+2) arguments. So, the format
-string must be followed by three variable references, which are to be
-assigned to captured arguments. For omitted arguments, variables are
-set to Qnil. NULL can be put in place of a variable reference, which
-means the corresponding captured argument(s) should be just dropped.
-
-The number of given arguments, excluding an option hash or iterator
-block, is returned.
+Retrieve argument from argc, argv. The fmt is the format string for
+the arguments, such as "12" for 1 non-optional argument, 2 optional
+arguments. If `*' appears at the end of fmt, it means the rest of
+the arguments are assigned to the corresponding variable, packed in
+an array.
** Invoking Ruby method
@@ -1196,56 +958,28 @@ Sets the value of the instance variable.
** Control Structure
- VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv,
- VALUE (*func) (ANYARGS), VALUE data2)
-
-Calls a method on the recv, with the method name specified by the
-symbol mid, with argc arguments in argv, supplying func as the
-block. When func is called as the block, it will receive the value
-from yield as the first argument, and data2 as the second argument.
-When yielded with multiple values (in C, rb_yield_values(),
-rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
-whereas yielded values can be gotten via argc/argv of the third/fourth
-arguments.
-
- [OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
Calls the function func1, supplying func2 as the block. func1 will be
called with the argument arg1. func2 receives the value from yield as
the first argument, arg2 as the second argument.
-When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
-This function is obsolete since 1.9; use rb_block_call instead.
-
VALUE rb_yield(VALUE val)
Evaluates the block with value val.
- VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+ VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
Calls the function func1, with arg1 as the argument. If an exception
occurs during func1, it calls func2 with arg2 as the argument. The
return value of rb_rescue() is the return value from func1 if no
exception occurs, from func2 otherwise.
- VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+ VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
Calls the function func1 with arg1 as the argument, then calls func2
with arg2 if execution terminated. The return value from
-rb_ensure() is that of func1 when no exception occured.
-
- VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
-
-Calls the function func with arg as the argument. If no exception
-occured during func, it returns the result of func and *state is zero.
-Otherwise, it returns Qnil and sets *state to nonzero. If state is
-NULL, it is not set in both cases.
-
- void rb_jump_tag(int state)
-
-Continues the exception caught by rb_protect() and rb_eval_string_protect().
-state must be the returned value from those functions. This function
-never return to the caller.
+rb_ensure() is that of func1.
** Exceptions and Errors
@@ -1277,7 +1011,7 @@ Terminates the interpreter immediately. This function should be
called under the situation caused by the bug in the interpreter. No
exception handling nor ensure execution will be done.
-** Initialize and Start the Interpreter
+** Initialize and Starts the Interpreter
The embedding API functions are below (not needed for extension libraries):
@@ -1297,76 +1031,6 @@ Starts execution of the interpreter.
Specifies the name of the script ($0).
-** Hooks for the Interpreter Events
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
-
-Adds a hook function for the specified interpreter events.
-events should be Or'ed value of:
-
- RUBY_EVENT_LINE
- RUBY_EVENT_CLASS
- RUBY_EVENT_END
- RUBY_EVENT_CALL
- RUBY_EVENT_RETURN
- RUBY_EVENT_C_CALL
- RUBY_EVENT_C_RETURN
- RUBY_EVENT_RAISE
- RUBY_EVENT_ALL
-
-The definition of rb_event_hook_func_t is below:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
- VALUE self, ID id, VALUE klass)
-
-The third argument `data' to rb_add_event_hook() is passed to the hook
-function as the second argument, which was the pointer to the current
-NODE in 1.8. See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-Removes the specified hook function.
-
-** Macros for the Compatibilities
-
-Some macros to check API compatibilities are available by default.
-
- NORETURN_STYLE_NEW
-
-Means that NORETURN macro is functional style instead of prefix.
-
- HAVE_RB_DEFINE_ALLOC_FUNC
-
-Means that function rb_define_alloc_func() is provided, that means the
-allocation framework is used. This is same as the result of
-have_func("rb_define_alloc_func", "ruby.h").
-
- HAVE_RB_REG_NEW_STR
-
-Means that function rb_reg_new_str() is provided, that creates Regexp
-object from String object. This is same as the result of
-have_func("rb_reg_new_str", "ruby.h").
-
- HAVE_RB_IO_T
-
-Means that type rb_io_t is provided.
-
- USE_SYMBOL_AS_METHOD_NAME
-
-Means that Symbols will be returned as method names, e.g.,
-Module#methods, #singleton_methods and so on.
-
- HAVE_RUBY_*_H
-
-Defined in ruby.h and means correspoinding header is available. For
-instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
-mere st.h.
-
- RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
-
-Means that rb_add_event_hook() takes the third argument `data', to be
-passed to the given event hook function.
-
Appendix C. Functions Available in extconf.rb
These functions are available in extconf.rb:
@@ -1430,7 +1094,7 @@ this method, the compilation will not be done.
find_executable(bin, path)
Finds command in path, which is File::PATH_SEPARATOR-separated list of
-directories. If path is nil or omitted, environment variable PATH
+directories. If path is nil or omitted, environment varialbe PATH
will be used. Returns the path name of the command if it is found,
otherwise nil.
@@ -1458,8 +1122,8 @@ Returns an array of the added directories ([include_dir, lib_dir]).
pkg_config(pkg)
-Obtains the information for pkg by pkg-config command. The actual
-command name can be overridden by --with-pkg-config command line
+Obtains the information of pkg by pkg-config command. The actual
+command name can be overriden by --with-pkg-config command line
option.
/*
diff --git a/README.EXT.ja b/README.EXT.ja
index f2d7609ff5..30c4d520ba 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -35,12 +35,10 @@ Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
T_STRING ʸ»úÎó
T_REGEXP Àµµ¬É½¸½
T_ARRAY ÇÛÎó
+ T_FIXNUM Fixnum(31bitĹÀ°¿ô)
T_HASH Ï¢ÁÛÇÛÎó
T_STRUCT (Ruby¤Î)¹½Â¤ÂÎ
T_BIGNUM ¿ÇÜĹÀ°¿ô
- T_FIXNUM Fixnum(31bit¤Þ¤¿¤Ï63bitĹÀ°¿ô)
- T_COMPLEX Ê£ÁÇ¿ô
- T_RATIONAL Í­Íý¿ô
T_FILE Æþ½ÐÎÏ
T_TRUE ¿¿
T_FALSE µ¶
@@ -52,8 +50,9 @@ Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
T_ICLASS
T_MATCH
T_UNDEF
+ T_VARMAP
+ T_SCOPE
T_NODE
- T_ZOMBIE
¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
@@ -96,40 +95,28 @@ FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL¡¤T_FALSE¡¤T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
-¤ìnil¡¤false¡¤true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
+¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Þ¤¿¤Ï63bit¤Î¥µ¥¤¥º¤ò
-»ý¤ÄÀ°¿ô¤Ç¤¹¡¥long¤Î¥µ¥¤¥º¤¬32bit¤Î¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¤Ç¤¢¤ì¤Ð
-31bit¤Ë¡¤long¤Î¥µ¥¤¥º¤¬64bit¤Î¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¤Ç¤¢¤ì¤Ð63bit
-¤Ë¤Ê¤ê¤Þ¤¹. FIXNUM ¤ò C ¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í
-¡ÖFIX2INT()¡×¤Þ¤¿¤Ï¡ÖFIX2LONG()¡×¤ò»È¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥Þ¥¯¥í
-¤ò»ÈÍѤ¹¤ëºÝ¤Ë¤Ï»öÁ°¤Ë¥Ç¡¼¥¿¥¿¥¤¥×¤¬FIXNUM¤Ç¤¢¤ë¤³¤È¤ò³Îǧ¤¹
-¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¤¬¡¤Èæ³ÓŪ¹â®¤ËÊÑ´¹¤ò¹Ô¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥¤Þ
-¤¿¡¤¡ÖFIX2LONG()¡×¤ÏÎã³°¤òȯÀ¸¤·¤Þ¤»¤ó¤¬¡¤¡ÖFIX2INT()¡×¤ÏÊÑ
-´¹·ë²Ì¤¬int¤Î¥µ¥¤¥º¤Ë¼ý¤Þ¤é¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤òȯÀ¸¤·¤Þ¤¹¡¥
-¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
-¡ÖNUM2INT()¡×¤ª¤è¤Ó¡ÖNUM2LONG()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³
-¤ì¤é¤Î¥Þ¥¯¥í¤Ï¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹
-(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬È¯À¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ
-¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡¥
-
-char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¤ StringValue() ¤È StringValuePtr()
-¤ò»È¤¤¤Þ¤¹¡¥
-StringValue(var) ¤Ï var ¤¬ String
-¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¤¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì
-¤ËÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¤StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤ò
-String ¤ËÃÖ¤­´¹¤¨¤Æ¤«¤é var ¤Î¥Ð¥¤¥ÈÎóɽ¸½¤ËÂФ¹¤ë char* ¤ò
-ÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡¥var ¤ÎÆâÍÆ¤òľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¤
-var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-¤Þ¤¿¡¤StringValuePtr() ¤ËÎà»÷¤·¤¿ StringValueCStr() ¤È¤¤¤¦¥Þ
-¥¯¥í¤â¤¢¤ê¤Þ¤¹¡¥StringValueCStr(var) ¤Ï var ¤ò String ¤ËÃÖ¤­
-´¹¤¨¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤·¤Þ¤¹¡¥ÊÖ¤µ¤ì
-¤ëʸ»úÎó¤ÎËöÈø¤Ë¤Ï nul ʸ»ú¤¬Éղ䵤ì¤Þ¤¹¡¥¤Ê¤ª¡¤ÅÓÃæ¤Ë nul
-ʸ»ú¤¬´Þ¤Þ¤ì¤ë¾ì¹ç¤Ï ArgumentError ¤¬È¯À¸¤·¤Þ¤¹¡¥
-°ìÊý¡¤StringValuePtr() ¤Ç¤Ï¡¤ËöÈø¤Ë nul ʸ»ú¤¬¤¢¤ëÊݾڤϤʤ¯¡¤
-ÅÓÃæ¤Ë nul ʸ»ú¤¬´Þ¤Þ¤ì¤Æ¤¤¤ë²ÄǽÀ­¤â¤¢¤ê¤Þ¤¹¡¥
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
+¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
+¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
+¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
+¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
+ȯÀ¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò
+¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡£
+
+char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¢version 1.6 °ÊÁ°¤Ç¤Ï¡ÖSTR2CSTR()¡×¤È
+¤¤¤¦¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤·¤¿¤¬¡¢¤³¤ì¤Ï to_str() ¤Ë¤è¤ë°ÅÌÛ¤Î
+·¿ÊÑ´¹·ë²Ì¤¬ GC ¤µ¤ì¤ë²ÄǽÀ­¤¬¤¢¤ë¤¿¤á¡¢version 1.7 °Ê¹ß¤Ç¤Ï
+obsolete ¤È¤Ê¤ê¡¢Âå¤ï¤ê¤Ë StringValue() ¤È StringValuePtr()
+¤ò»È¤¦»ö¤ò¿ä¾©¤·¤Æ¤¤¤Þ¤¹¡£StringValue(var) ¤Ï var ¤¬ String
+ ¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¢¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì¤Ë
+ÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¢StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤òÃÖ¤­´¹¤¨
+¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡£var ¤Î
+ÆâÍÆ¤òľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¢var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬
+¤¢¤ê¤Þ¤¹¡£
¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
@@ -142,11 +129,10 @@ var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
-¹½Â¤ÂΤ«¤é¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¥Þ¥¯¥í¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥Ê¸»úÎó
-str¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING_LEN(str)¡×¤È¤·¡¤Ê¸»úÎóstr¤ò
-char*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING_PTR(str)¡×¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î
-¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY_LEN(ary)¡×¡¤¡ÖRARRAY_PTR(ary)¡×¤È
-¤Ê¤ê¤Þ¤¹¡¥
+Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
+¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
+¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(ary)->len¡×¡¤
+¡ÖRARRAY(ary)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
@@ -179,8 +165,7 @@ FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
- INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit¤Þ¤¿¤Ï63bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®
- ¤¬¤¢¤ë»þ
+ INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
INT2NUM() Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
@@ -202,7 +187,6 @@ Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
rb_str_new2(const char *ptr)
- rb_str_new_cstr(const char *ptr)
C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
@@ -214,59 +198,13 @@ Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
¤Ç¤¢¤ë¡¥
rb_tainted_str_new2(const char *ptr)
- rb_tainted_str_new_cstr(const char *ptr)
C¤Îʸ»úÎ󤫤鱸À÷¥Þ¡¼¥¯¤¬Éղ䵤줿Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
- rb_sprintf(const char *format, ...)
- rb_vsprintf(const char *format, va_list ap)
-
- C¤Îʸ»úÎóformat¤È³¤¯°ú¿ô¤òprintf(3)¤Î¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë¤·¤¿¤¬¤Ã¤Æ
- À°·Á¤·¡¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
rb_str_cat(VALUE str, const char *ptr, long len)
Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
- rb_str_cat2(VALUE str, const char* ptr)
-
- Ruby¤Îʸ»úÎóstr¤ËC¤Îʸ»úÎóptr¤òÄɲ乤롥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
- rb_str_cat(str, ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_str_catf(VALUE str, const char* format, ...)
- rb_str_vcatf(VALUE str, const char* format, va_list ap)
-
- C¤Îʸ»úÎóformat¤È³¤¯°ú¿ô¤òprintf(3)¤Î¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë¤·¤¿¤¬¤Ã¤Æ
- À°·Á¤·¡¤Ruby¤Îʸ»úÎóstr¤ËÄɲ乤롥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï¡¤¤½¤ì¤¾¤ì
- rb_str_cat2(str, rb_sprintf(format, ...)) ¤ä
- rb_str_cat2(str, rb_vsprintf(format, ap)) ¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
-
- »ØÄꤵ¤ì¤¿¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¤ÇRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë.
-
- rb_usascii_str_new(const char *ptr, long len)
- rb_usascii_str_new_cstr(const char *ptr)
-
- ¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¤¬US-ASCII¤ÎRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë.
-
- rb_str_resize(VALUE str, long len)
-
- Ruby¤Îʸ»úÎó¤Î¥µ¥¤¥º¤òlen¥Ð¥¤¥È¤ËÊѹ¹¤¹¤ë¡¥str¤ÎŤµ¤ÏÁ°
- °Ê¤Æ¥»¥Ã¥È¤µ¤ì¤Æ¤¤¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥len¤¬¸µ¤ÎŤµ¤è¤ê¤âû
- ¤¤»þ¤Ï¡¤len¥Ð¥¤¥È¤ò±Û¤¨¤¿Éôʬ¤ÎÆâÍÆ¤Ï¼Î¤Æ¤é¤ì¤ë¡¥len¤¬¸µ
- ¤ÎŤµ¤è¤ê¤âŤ¤»þ¤Ï¡¤¸µ¤ÎŤµ¤ò±Û¤¨¤¿Éôʬ¤ÎÆâÍÆ¤ÏÊݸ¤µ
- ¤ì¤Ê¤¤¤Ç¥´¥ß¤Ë¤Ê¤ë¤À¤í¤¦¡¥¤³¤Î´Ø¿ô¤Î¸Æ¤Ó½Ð¤·¤Ë¤è¤Ã¤Æ
- RSTRING_PTR(str)¤¬Êѹ¹¤µ¤ì¤ë¤«¤â¤·¤ì¤Ê¤¤¤³¤È¤ËÃí°Õ¡¥
-
- rb_str_set_len(VALUE str, long len)
-
- Ruby¤Îʸ»úÎó¤Î¥µ¥¤¥º¤òlen¥Ð¥¤¥È¤Ë¥»¥Ã¥È¤¹¤ë¡¥str¤¬Êѹ¹²Ä
- ǽ¤Ç¤Ê¤±¤ì¤ÐÎã³°¤¬È¯À¸¤¹¤ë¡¥RSTRING_LEN(str)¤È¤Ï̵´Ø·¸¤Ë¡¤
- len¥Ð¥¤¥È¤Þ¤Ç¤ÎÆâÍÆ¤ÏÊݸ¤µ¤ì¤ë¡¥len¤Ïstr¤ÎÍÆÎ̤ò±Û¤¨¤Æ¤¤
- ¤Æ¤Ï¤Ê¤é¤Ê¤¤¡¥
-
-
ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
rb_ary_new()
@@ -286,32 +224,14 @@ Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
- rb_ary_to_ary(VALUE obj)
-
- ¥ª¥Ö¥¸¥§¥¯¥È¤òÇÛÎó¤ËÊÑ´¹¤¹¤ë.
- Object#to_ary¤ÈƱÅù¤Ç¤¢¤ë.
-
- ¾¤Ë¤âÇÛÎó¤òÁàºî¤¹¤ë´Ø¿ô¤¬Â¿¿ô¤¢¤ë. ¤³¤ì¤é¤Ï
- °ú¿ôary¤ËÇÛÎó¤òÅϤµ¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤. ¤µ¤â¤Ê¤¤¤È
- ¥³¥¢¤òÅǤ¯.
-
- rb_ary_aref(argc, VALUE *argv, VALUE ary)
-
- Array#[]¤ÈƱÅù.
-
- rb_ary_entry(VALUE ary, long offset)
-
- ary[offset]
-
- rb_ary_subseq(VALUE ary, long beg, long len)
-
- ary[beg, len]
-
rb_ary_push(VALUE ary, VALUE val)
rb_ary_pop(VALUE ary)
rb_ary_shift(VALUE ary)
rb_ary_unshift(VALUE ary, VALUE val)
+ Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
+ ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
+
2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
@@ -374,26 +294,19 @@ argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤Þ¤À¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹. ¤Ò¤È¤Ä¤Ï¥á¥½¥Ã¥É
-̾¤È¤·¤ÆID¤ò¼è¤ê¤Þ¤¹. ID¤Ë¤Ä¤¤¤Æ¤Ï2.2.2¤ò»²¾È.
-
- void rb_define_method_id(VALUE klass, ID name,
- VALUE (*func)(ANYARGS), int argc)
-
-private/protected¤Ê¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Õ¤¿¤Ä¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹.
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
+¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
void rb_define_private_method(VALUE klass, const char *name,
VALUE (*func)(), int argc)
- void rb_define_protected_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
¥É¤Ç¤¹¡¥
-ºÇ¸å¤Ë¡¤ rb_define_module´Ø¿ô¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥
-¥â¥¸¥å¡¼¥ë´Ø¿ô¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ë
-private¥á¥½¥Ã¥É¤Ç¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë
-¤Îsqrt()¤Ê¤É¤¬¤¢¤²¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
+¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
+¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
+¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
+¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
Math.sqrt(4)
@@ -414,24 +327,20 @@ private¥á¥½¥Ã¥É¤Ç¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë
void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
+¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
void rb_define_alias(VALUE module, const char* new, const char* old);
-°À­¤Î¼èÆÀ¡¦ÀßÄê¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï
-
- void rb_define_attr(VALUE klass, const char *name, int read, int write)
-
¥¯¥é¥¹¥á¥½¥Ã¥Éallocate¤òÄêµÁ¤·¤¿¤êºï½ü¤·¤¿¤ê¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï
-°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
+°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
void rb_undef_alloc_func(VALUE klass);
-func¤Ï¥¯¥é¥¹¤ò°ú¿ô¤È¤·¤Æ¼õ¤±¼è¤Ã¤Æ¡¤¿·¤·¤¯³ä¤êÅö¤Æ¤é¤ì¤¿¥¤¥ó
-¥¹¥¿¥ó¥¹¤òÊÖ¤µ¤Ê¤¯¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡¥¤³¤Î¥¤¥ó¥¹¥¿¥ó¥¹¤Ï¡¤³°Éô¥ê
-¥½¡¼¥¹¤Ê¤É¤ò´Þ¤Þ¤Ê¤¤¡¤¤Ç¤­¤ë¤À¤±¡Ö¶õ¡×¤Î¤Þ¤Þ¤Ë¤·¤Æ¤ª¤¤¤¿¤Û¤¦
-¤¬¤è¤¤¤Ç¤·¤ç¤¦¡¥
+func¤Ï¥¯¥é¥¹¤ò°ú¿ô¤È¤·¤Æ¼õ¤±¼è¤Ã¤Æ¡¢¿·¤·¤¯³ä¤êÅö¤Æ¤é¤ì¤¿¥¤¥ó
+¥¹¥¿¥ó¥¹¤òÊÖ¤µ¤Ê¤¯¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡£¤³¤Î¥¤¥ó¥¹¥¿¥ó¥¹¤Ï¡¢³°Éô¥ê
+¥½¡¼¥¹¤Ê¤É¤ò´Þ¤Þ¤Ê¤¤¡¢¤Ç¤­¤ë¤À¤±¡Ö¶õ¡×¤Î¤Þ¤Þ¤Ë¤·¤Æ¤ª¤¤¤¿¤Û¤¦
+¤¬¤è¤¤¤Ç¤·¤ç¤¦¡£
2.1.3 Äê¿ôÄêµÁ
@@ -465,26 +374,16 @@ C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
-ɾ²Á¤ÏÎã³°¤òȯÀ¸¤¹¤ë¤«¤â¤·¤ì¤Ê¤¤¤³¤È¤ËÃí°Õ¤·¤Þ¤·¤ç¤¦. ¤è¤ê°ÂÁ´
-¤Ê´Ø¿ô¤â¤¢¤ê¤Þ¤¹.
-
- VALUE rb_eval_string_protect(const char *str, int *state)
-
-¤³¤Î´Ø¿ô¤Ï¥¨¥é¡¼¤¬È¯À¸¤¹¤ë¤Ènil¤òÊÖ¤·¤Þ¤¹¡¥¤½¤·¤Æ¡¤À®¸ù»þ¤Ë¤Ï
-*state¤Ï¥¼¥í¤Ë¡¤¤µ¤â¤Ê¤¯¤ÐÈó¥¼¥í¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-
2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
-ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
+ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤Ç¤ÏID¤ËÂбþ¤¹¤ë
+¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¥·¥ó¥Ü¥ë(Symbol)¤¬¤¢¤ê¡¤
:¼±ÊÌ»Ò
-¤Þ¤¿¤Ï
- :"Ǥ°Õ¤Îʸ»úÎó"
¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
@@ -495,6 +394,14 @@ ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
rb_to_id(VALUE symbol)
+ID¤«¤é¥·¥ó¥Ü¥ë¤òÆÀ¤ë¤¿¤á¤Ë¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
+
+ VALUE ID2SYM(ID id)
+
+¥·¥ó¥Ü¥ë¤«¤éID¤òÆÀ¤ë¤¿¤á¤Ë¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
+
+ ID SYM2ID(VALUE symbol)
+
2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
@@ -576,17 +483,11 @@ C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
-# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-
-getter¤Èsetter¤Î»ÅÍͤϼ¡¤ÎÄ̤ê¤Ç¤¹¡¥
-
- VALUE (*getter)(ID id, VALUE *var);
- void (*setter)(VALUE val, ID id, VALUE *var);
+# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-¤½¤ì¤«¤é¡¤Âбþ¤¹¤ëC¤ÎÊÑ¿ô¤ò»ý¤¿¤Ê¤¤Ruby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-¤³¤È¤â¤Ç¤­¤Þ¤¹. ¤½¤ÎÊÑ¿ô¤ÎÃͤϥե寴ؿô¤Î¤ß¤Ë¤è¤Ã¤Æ¼èÆÀ¡¦ÀßÄê
-¤µ¤ì¤Þ¤¹.
+¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
+´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
void rb_define_virtual_variable(const char *name,
VALUE (*getter)(), void (*setter)())
@@ -596,8 +497,8 @@ getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
- (*getter)(ID id);
- (*setter)(VALUE val, ID id);
+ (*getter)(ID id, void *data, struct global_entry* entry);
+ (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
@@ -624,11 +525,6 @@ free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥¤³¤ì¤¬-1¤Î¾ì¹ç¤Ï¡¤Ã±
½ã¤Ë³«Êü¤µ¤ì¤Þ¤¹¡¥
-mark¤ª¤è¤Ófree´Ø¿ô¤ÏGC¼Â¹ÔÃæ¤Ë¸Æ¤Ó½Ð¤µ¤ì¤Þ¤¹.
-¤Ê¤ª, GC¼Â¹ÔÃæ¤ÏRuby¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¢¥í¥±¡¼¥·¥ç¥ó¤Ï¶Ø»ß¤µ¤ì¤Þ
-¤¹. ¤è¤Ã¤Æ, mark¤ª¤è¤Ófree´Ø¿ô¤ÇRuby¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¢¥í¥±¡¼¥·
-¥ç¥ó¤Ï¹Ô¤ï¤Ê¤¤¤Ç¤¯¤À¤µ¤¤.
-
C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
@@ -680,10 +576,7 @@ Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤È¤¤¤¦¥Õ¥¡
¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥é¥¤¥Ö¥é¥ê̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥¤Þ¤¿¡¤¸å½Ò¤¹¤ë mkmf ¥é¥¤¥Ö¥é¥ê¤Î¤¤¤¯¤Ä
-¤«¤Î´Ø¿ô¤¬¥³¥ó¥Ñ¥¤¥ë¤òÍפ¹¤ë¥Æ¥¹¥È¤Î¤¿¤á¤Ë¡Öconftest.c¡×¤È¤¤
-¤¦¥Õ¥¡¥¤¥ë̾¤ò»ÈÍѤ¹¤ë¤³¤È¤ËÃí°Õ¤·¤Æ¤¯¤À¤µ¤¤¡¥¥½¡¼¥¹¥Õ¥¡¥¤¥ë
-̾¤È¤·¤Æ¡Öconftest.c¡×¤ò»ÈÍѤ·¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡¥
+¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤Î¾ì¹ç¡ÖInit_dbm¡×
@@ -691,8 +584,7 @@ Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
--
-void
-Init_dbm(void)
+Init_dbm()
{
/* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
cDBM = rb_define_class("DBM", rb_cObject);
@@ -754,7 +646,8 @@ fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
--
static VALUE
-fdbm_delete(VALUE obj, VALUE keystr)
+fdbm_delete(obj, keystr)
+ VALUE obj, keystr;
{
:
}
@@ -770,7 +663,10 @@ fdbm_delete(VALUE obj, VALUE keystr)
--
static VALUE
-fdbm_s_open(int argc, VALUE *argv, VALUE klass)
+fdbm_s_open(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
{
:
if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -785,17 +681,22 @@ fdbm_s_open(int argc, VALUE *argv, VALUE klass)
¤¨¤é¤ì¤Þ¤¹¡¥
¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë½¾
-¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿VALUE¤Ø¤Î»²¾È¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ
-¤¹¡¥
-
-
-°ú¿ô¤òRuby¤ÎÇÛÎó¤È¤·¤Æ¼õ¤±¼è¤ë¥á¥½¥Ã¥É¤ÎÎã¤Ë¤Ï
-Thread#initialize¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³¤¦¤Ç¤¹¡¥
+¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
+½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
+¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
+¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
+¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
+¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
+¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
+ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
+¤¦¤Ç¤¹¡¥
--
static VALUE
-thread_initialize(VALUE thread, VALUE args)
+fdbm_indexes(obj, args)
+ VALUE obj, args;
{
:
}
@@ -834,9 +735,9 @@ Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
$LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
$objs: ¥ê¥ó¥¯¤µ¤ì¤ë¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë̾¤Î¥ê¥¹¥È
-¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤Î¥ê¥¹¥È¤Ï¡¤Ä̾ï¤Ï¥½¡¼¥¹¥Õ¥¡¥¤¥ë¤ò¸¡º÷¤·
-¤Æ¼«Æ°Åª¤ËÀ¸À®¤µ¤ì¤Þ¤¹¤¬¡¤make¤ÎÅÓÃæ¤Ç¥½¡¼¥¹¤òÀ¸À®¤¹¤ë¤è¤¦¤Ê
-¾ì¹ç¤ÏÌÀ¼¨Åª¤Ë»ØÄꤹ¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤Î¥ê¥¹¥È¤Ï¡¢Ä̾ï¤Ï¥½¡¼¥¹¥Õ¥¡¥¤¥ë¤ò¸¡º÷¤·
+¤Æ¼«Æ°Åª¤ËÀ¸À®¤µ¤ì¤Þ¤¹¤¬¡¢make¤ÎÅÓÃæ¤Ç¥½¡¼¥¹¤òÀ¸À®¤¹¤ë¤è¤¦¤Ê
+¾ì¹ç¤ÏÌÀ¼¨Åª¤Ë»ØÄꤹ¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡£
¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤º¡¤¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó
¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤ÏÀ¸
@@ -864,12 +765,6 @@ Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-site_ruby ¥Ç¥£¥ì¥¯¥È¥ê¤Ç¤Ê¤¯¡¤
-vendor_ruby ¥Ç¥£¥ì¥¯¥È¥ê¤Ë¥¤¥ó¥¹¥È¡¼¥ë¤¹¤ë¾ì¹ç¤Ë¤Ï
-°Ê²¼¤Î¤è¤¦¤Ë --vendor ¥ª¥×¥·¥ç¥ó¤ò²Ã¤¨¤Æ¤¯¤À¤µ¤¤¡¥
-
- ruby extconf.rb --vendor
-
¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍѰդ·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
@@ -912,119 +807,53 @@ Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
Ruby¸À¸ì¤Î¥³¥¢
- class.c : ¥¯¥é¥¹¤È¥â¥¸¥å¡¼¥ë
- error.c : Îã³°¥¯¥é¥¹¤ÈÎã³°µ¡¹½
- gc.c : µ­²±Îΰè´ÉÍý
- load.c : ¥é¥¤¥Ö¥é¥ê¤Î¥í¡¼¥É
- object.c : ¥ª¥Ö¥¸¥§¥¯¥È
- variable.c : ÊÑ¿ô¤ÈÄê¿ô
-
-Ruby¤Î¹½Ê¸²òÀÏ´ï
- parse.y : »ú¶ç²òÀÏ´ï¤È¹½Ê¸ÄêµÁ
- -> parse.c : ¼«Æ°À¸À®
- keywords : ͽÌó¸ì
- -> lex.c : ¼«Æ°À¸À®
-
-Ruby¤Îɾ²Á´ï (Ä̾ÎYARV)
- compile.c
+ class.c
+ error.c
eval.c
- eval_error.c
- eval_jump.c
- eval_safe.c
- insns.def : ²¾ÁÛµ¡³£¸ì¤ÎÄêµÁ
- iseq.c : VM::ISeq¤Î¼ÂÁõ
- thread.c : ¥¹¥ì¥Ã¥É´ÉÍý¤È¥³¥ó¥Æ¥­¥¹¥ÈÀÚ¤êÂØ¤¨
- thread_win32.c : ¥¹¥ì¥Ã¥É¼ÂÁõ
- thread_pthread.c : Ʊ¾å
- vm.c
- vm_dump.c
- vm_eval.c
- vm_exec.c
- vm_insnhelper.c
- vm_method.c
-
- opt_insns_unif.def : Ì¿ÎáÍ»¹ç
- opt_operand.def : ºÇŬ²½¤Î¤¿¤á¤ÎÄêµÁ
-
- -> insn*.inc : ¼«Æ°À¸À®
- -> opt*.inc : ¼«Æ°À¸À®
- -> vm.inc : ¼«Æ°À¸À®
-
-Àµµ¬É½¸½¥¨¥ó¥¸¥ó (µ´¼Ö)
- regex.c
- regcomp.c
- regenc.c
- regerror.c
- regexec.c
- regparse.c
- regsyntax.c
+ gc.c
+ object.c
+ parse.y
+ variable.c
¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
- debug.c : C¥Ç¥Ð¥Ã¥¬ÍѤΥǥХå°¥·¥ó¥Ü¥ë
- dln.c : ưŪ¥í¡¼¥Ç¥£¥ó¥°
- st.c : ÈÆÍѥϥå·¥åɽ
- strftime.c : »þ¹ïÀ°·Á
- util.c : ¤½¤Î¾¤Î¥æ¡¼¥Æ¥£¥ê¥Æ¥£
+ dln.c
+ regex.c
+ st.c
+ util.c
Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
dmyext.c
- dmydln.c
- dmyencoding.c
- id.c
inits.c
main.c
ruby.c
version.c
- gem_prelude.rb
- prelude.rb
-
¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
- array.c : Array
- bignum.c : Bignum
- compar.c : Comparable
- complex.c : Complex
- cont.c : Fiber, Continuation
- dir.c : Dir
- enum.c : Enumerable
- enumerator.c : Enumerator
- file.c : File
- hash.c : Hash
- io.c : IO
- marshal.c : Marshal
- math.c : Math
- numeric.c : Numeric, Integer, Fixnum, Float
- pack.c : Array#pack, String#unpack
- proc.c : Binding, Proc
- process.c : Process
- random.c : Íð¿ô
- range.c : Range
- rational.c : Rational
- re.c : Regexp, MatchData
- signal.c : Signal
- sprintf.c :
- string.c : String
- struct.c : Struct
- time.c : Time
-
- defs/known_errors.def : Îã³°¥¯¥é¥¹ Errno::*
- -> known_errors.inc : ¼«Æ°À¸À®
-
-¿¸À¸ì²½
- encoding.c : Encoding
- transcode.c : Encoding::Converter
- enc/*.c : ¥¨¥ó¥³¡¼¥Ç¥£¥ó¥°¥¯¥é¥¹·²
- enc/trans/* : ¥³¡¼¥É¥Ý¥¤¥ó¥ÈÂбþɽ
-
-goruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
-
- goruby.c
- golf_prelude.rb : goruby¸ÇÍ­¤Î¥é¥¤¥Ö¥é¥ê
- -> golf_prelude.c : ¼«Æ°À¸À®
-
+ array.c
+ bignum.c
+ compar.c
+ dir.c
+ enum.c
+ file.c
+ hash.c
+ io.c
+ marshal.c
+ math.c
+ numeric.c
+ pack.c
+ prec.c
+ process.c
+ random.c
+ range.c
+ re.c
+ signal.c
+ sprintf.c
+ string.c
+ struct.c
+ time.c
Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
@@ -1082,17 +911,10 @@ void Check_SafeStr(VALUE value)
** ·¿ÊÑ´¹
-FIX2INT(value), INT2FIX(i)
-FIX2LONG(value), LONG2FIX(l)
-NUM2INT(value), INT2NUM(i)
-NUM2UINT(value), UINT2NUM(ui)
-NUM2LONG(value), LONG2NUM(l)
-NUM2ULONG(value), ULONG2NUM(ul)
-NUM2LL(value), LL2NUM(ll)
-NUM2ULL(value), ULL2NUM(ull)
-NUM2OFFT(value), OFFT2NUM(off)
-NUM2SIZET(value), SIZET2NUM(size)
-NUM2SSIZET(value), SSIZET2NUM(ssize)
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
NUM2DBL(value)
rb_float_new(f)
StringValue(value)
@@ -1196,48 +1018,13 @@ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int a
rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
- argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿»ØÄꤵ¤ì¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë½¾¤Ã¤Æ°ú
- ¿ô¤òʬ²ò¤·¡¤Â³¤¯VALUE¤Ø¤Î»²¾È¤Ë¥»¥Ã¥È¤·¤Þ¤¹¡¥¤³¤Î¥Õ¥©¡¼¥Þ¥Ã
- ¥È¤Ï¡¤ABNF¤Çµ­½Ò¤¹¤ë¤È°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
---
-scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
-
-param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
-pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
-post-arg-spec := sym-for-variable-length-args [num-of-trailing-mandatory-args]
-pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
-option-hash-arg-spec := sym-for-option-hash-arg
-block-arg-spec := sym-for-block-arg
-
-num-of-leading-mandatory-args := DIGIT ; ÀèÆ¬¤ËÃÖ¤«¤ì¤ë¾ÊάÉÔǽ¤Ê°ú¿ô¤Î¿ô
-num-of-optional-args := DIGIT ; ³¤¤¤ÆÃÖ¤«¤ì¤ë¾Êά²Äǽ¤Ê°ú¿ô¤Î¿ô
-sym-for-variable-length-args := "*" ; ³¤¤¤ÆÃÖ¤«¤ì¤ë²ÄÊÑŰú¿ô¤ò
- ; Ruby¤ÎÇÛÎó¤Ç¼èÆÀ¤¹¤ë¤¿¤á¤Î»ØÄê
-num-of-trailing-mandatory-args := DIGIT ; ½ªÃ¼¤ËÃÖ¤«¤ì¤ë¾ÊάÉÔǽ¤Ê°ú¿ô¤Î¿ô
-sym-for-option-hash-arg := ":" ; ¥ª¥×¥·¥ç¥ó¥Ï¥Ã¥·¥å¤ò¼èÆÀ¤¹¤ë
- ; ¤¿¤á¤Î»ØÄê; ¾ÊάÉÔǽ¤Ê°ú¿ô¤Î
- ; ¿ô¤è¤ê¤â¿¤¯¤Î°ú¿ô¤¬»ØÄꤵ¤ì¡¤
- ; ºÇ¸å¤Î°ú¿ô¤¬¥Ï¥Ã¥·¥å¡Ê¤Þ¤¿¤Ï
- ; #to_hash¤ÇÊÑ´¹²Äǽ¡Ë¤Î¾ì¹ç¤Ë
- ; ¼èÆÀ¤µ¤ì¤ë¡¥ºÇ¸å¤Î°ú¿ô¤¬nil¤Î
- ; ¾ì¹ç¡¤²ÄÊÑŰú¿ô»ØÄ꤬¤Ê¤¯¡¤
- ; ¾ÊάÉÔǽ°ú¿ô¤Î¿ô¤è¤ê¤â¿¤¯¤Î
- ; °ú¿ô¤¬»ØÄꤵ¤ì¤¿¾ì¹ç¤Ë¼èÆÀ¤µ¤ì¤ë
-sym-for-block-arg := "&" ; ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¼èÆÀ¤¹¤ë¤¿¤á¤Î
- ; »ØÄê
---
-
- ¥Õ¥©¡¼¥Þ¥Ã¥È¤¬"12"¤Î¾ì¹ç¡¤°ú¿ô¤ÏºÇÄã1¤Ä¤Ç¡¤3¤Ä(1+2)¤Þ¤Çµö¤µ
- ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥½¾¤Ã¤Æ¡¤¥Õ¥©¡¼¥Þ¥Ã¥Èʸ»úÎó¤Ë³¤¤
- ¤Æ3¤Ä¤ÎVALUE¤Ø¤Î»²¾È¤òÃÖ¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤½¤ì¤é¤Ë¤Ï¼èÆÀ¤·¤¿
- ÊÑ¿ô¤¬¥»¥Ã¥È¤µ¤ì¤Þ¤¹¡¥ÊÑ¿ô¤Ø¤Î»²¾È¤ÎÂå¤ï¤ê¤ËNULL¤ò»ØÄꤹ¤ë
- ¤³¤È¤â¤Ç¤­¡¤¤½¤Î¾ì¹ç¤Ï¼èÆÀ¤·¤¿°ú¿ô¤ÎÃͤϼΤƤé¤ì¤Þ¤¹¡¥¤Ê¤ª¡¤
- ¾Êά²Äǽ°ú¿ô¤¬¾Êά¤µ¤ì¤¿»þ¤ÎÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤Ï
- Qnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
- ÊÖ¤êÃͤÏÍ¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¤Ç¤¹¡¥¥ª¥×¥·¥ç¥ó¥Ï¥Ã¥·¥å¤ª¤è¤Ó¥¤
- ¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤Ï¿ô¤¨¤Þ¤»¤ó¡¥
+ argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô,
+ Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú
+ ¿ô»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Ä
+ ǽ¤Ç¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê
+ ¹ß¤ÏÊÑ¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥
+ Éղðú¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬
+ ÂåÆþ¤µ¤ì¤ë¡¥
** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
@@ -1264,12 +1051,12 @@ char *rb_id2name(ID id)
char *rb_class2name(VALUE klass)
- ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë
- ¤Ï, ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
+ ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï,
+ ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
int rb_respond_to(VALUE obj, ID id)
- obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡¥
+ obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡£
** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
@@ -1286,26 +1073,12 @@ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
** À©¸æ¹½Â¤
-VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv,
- VALUE (*func) (ANYARGS), VALUE data2)
-
- func¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ¡¤obj¤ò¥ì¥·¡¼¥Ð¡¤argc¤Èargv¤ò°ú¿ô
- ¤È¤·¤Æmid¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¡¥func¤ÏÂè°ì°ú¿ô¤Ëyield¤µ¤ì¤¿ÃÍ¡¤
- ÂèÆó°ú¿ô¤Ëdata2¤ò¼õ¤±¼è¤ë¡¥Ê£¿ô¤ÎÃͤ¬yield¤µ¤ì¤¿¾ì¹ç(C¤Ç¤Ï
- rb_yield_values()¤Èrb_yield_values2(), rb_yield_splat())¡¤
- data2¤ÏArray¤È¤·¤Æ¥Ñ¥Ã¥¯¤µ¤ì¤Æ¤¤¤ë¡¥Âè»°, Âè»Í°ú¿ô¤Îargc¤È
- argv¤Ë¤è¤Ã¤Æyield¤µ¤ì¤¿Ãͤò¼è¤ê½Ð¤¹¤³¤È¤¬¤Ç¤­¤ë¡¥
-
-[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
- 1.9¤Çrb_iterate¤ò»È¤¦¾ì¹ç¤Ï, func1¤ÎÃæ¤ÇRuby¥ì¥Ù¥ë¤Î¥á¥½¥Ã¥É
- ¤ò¸Æ¤Ó½Ð¤µ¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤.
- 1.9¤Çobsolete¤È¤Ê¤Ã¤¿. Âå¤ï¤ê¤Ërb_block_call¤¬ÍѰդµ¤ì¤¿.
-
VALUE rb_yield(VALUE val)
val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
@@ -1317,24 +1090,12 @@ VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
¤·¤Ê¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá
¤êÃͤǤ¢¤ë¡¥
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬
ȯÀ¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1
¤ÎÌá¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
-VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
-
- ´Ø¿ôfunc¤òarg¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, Îã³°¤¬È¯À¸¤·¤Ê¤±¤ì¤Ð¤½¤ÎÌá
- ¤êÃͤòÊÖ¤¹¡¥Îã³°¤¬È¯À¸¤·¤¿¾ì¹ç¤Ï, *state¤ËÈó0¤ò¥»¥Ã¥È¤·¤Æ
- Qnil¤òÊÖ¤¹¡¥
-
-void rb_jump_tag(int state)
-
- rb_protect()¤ärb_eval_string_protect()¤ÇÊ᪤µ¤ì¤¿Îã³°¤òºÆ
- Á÷¤¹¤ë¡¥state¤Ï¤½¤ì¤é¤Î´Ø¿ô¤«¤éÊÖ¤µ¤ì¤¿ÃͤǤʤ±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
- ¤³¤Î´Ø¿ô¤ÏľÀܤθƤӽФ·¸µ¤ËÌá¤é¤Ê¤¤¡¥
-
** Îã³°¡¦¥¨¥é¡¼
void rb_warning(const char *fmt, ...)
@@ -1384,77 +1145,6 @@ void ruby_script(char *name)
Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
-** ¥¤¥ó¥¿¥×¥ê¥¿¤Î¥¤¥Ù¥ó¥È¤Î¥Õ¥Ã¥¯
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
-
-»ØÄꤵ¤ì¤¿¥¤¥ó¥¿¥×¥ê¥¿¤Î¥¤¥Ù¥ó¥È¤ËÂФ¹¤ë¥Õ¥Ã¥¯´Ø¿ô¤òÄɲä·¤Þ¤¹¡¥
-events¤Ï°Ê²¼¤ÎÃͤÎor¤Ç¤Ê¤±¤ì¤Ð¤Ê¤ê¤Þ¤»¤ó:
-
- RUBY_EVENT_LINE
- RUBY_EVENT_CLASS
- RUBY_EVENT_END
- RUBY_EVENT_CALL
- RUBY_EVENT_RETURN
- RUBY_EVENT_C_CALL
- RUBY_EVENT_C_RETURN
- RUBY_EVENT_RAISE
- RUBY_EVENT_ALL
-
-rb_event_hook_func_t¤ÎÄêµÁ¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
- VALUE self, ID id, VALUE klass)
-
-rb_add_event_hook() ¤ÎÂè3°ú¿ô data ¤Ï¡¤¥Õ¥Ã¥¯´Ø¿ô¤ÎÂè2°ú¿ô¤È
-¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥¤³¤ì¤Ï1.8¤Ç¤Ï¸½ºß¤ÎNODE¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç¤·¤¿¡¥°Ê
-²¼¤Î RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ¤â»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-»ØÄꤵ¤ì¤¿¥Õ¥Ã¥¯´Ø¿ô¤òºï½ü¤·¤Þ¤¹¡¥
-
-** ¸ß´¹À­¤Î¤¿¤á¤Î¥Þ¥¯¥í
-
-API¤Î¸ß´¹À­¤ò¥Á¥§¥Ã¥¯¤¹¤ë¤¿¤á¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤¬¥Ç¥Õ¥©¥ë¥È¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-NORETURN_STYLE_NEW
-
- NORETURN ¥Þ¥¯¥í¤¬´Ø¿ô·¿¥Þ¥¯¥í¤È¤·¤ÆÄêµÁ¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-HAVE_RB_DEFINE_ALLOC_FUNC
-
- rb_define_alloc_func() ´Ø¿ô¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¡¤¤Ä¤Þ¤ê
- allocation framework ¤¬»È¤ï¤ì¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
- have_func("rb_define_alloc_func", "ruby.h")
- ¤Î·ë²Ì¤ÈƱ¤¸¡¥
-
-HAVE_RB_REG_NEW_STR
-
- String¥ª¥Ö¥¸¥§¥¯¥È¤«¤éRegexp¥ª¥Ö¥¸¥§¥¯¥È¤òºî¤ë
- rb_reg_new_str() ´Ø¿ô¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
- have_func("rb_reg_new_str", "ruby.h").
- ¤Î·ë²Ì¤ÈƱ¤¸¡¥
-
-HAVE_RB_IO_T
-
- rb_io_t ·¿¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-USE_SYMBOL_AS_METHOD_NAME
-
- ¥á¥½¥Ã¥É̾¤òÊÖ¤¹¥á¥½¥Ã¥É¡¤Module#methods, #singleton_methods
- ¤Ê¤É¤¬Symbol¤òÊÖ¤¹¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
-
-HAVE_RUBY_*_H
-
- ruby.h ¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¡¥Âбþ¤¹¤ë¥Ø¥Ã¥À¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë¤³¤È
- ¤ò°ÕÌ£¤¹¤ë¡¥¤¿¤È¤¨¤Ð¡¤HAVE_RUBY_ST_H ¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë¾ì¹ç¤Ï
- ñ¤Ê¤ë st.h ¤Ç¤Ï¤Ê¤¯ ruby/st.h ¤ò»ÈÍѤ¹¤ë¡¥
-
-RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
-
- rb_add_event_hook() ¤¬¥Õ¥Ã¥¯´Ø¿ô¤ËÅϤ¹ data ¤òÂè3°ú¿ô¤È¤·¤Æ
- ¼õ¤±¼è¤ë¤³¤È¤ò°ÕÌ£¤¹¤ë¡¥
Appendix C. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
@@ -1479,10 +1169,10 @@ find_library(lib, func, path...)
have_func(func, header)
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§
- ¥Ã¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç
- ¤¢¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª
- ¤¯»ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
+ ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã
+ ¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
+ ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
+ »ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
have_var(var, header)
@@ -1533,8 +1223,7 @@ find_executable(command, path)
with_config(withval[, default=nil])
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃÍ
- ¤òÆÀ¤ë¡¥
+ ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃͤòÆÀ¤ë¡¥
enable_config(config, *defaults)
disable_config(config, *defaults)
@@ -1543,9 +1232,8 @@ disable_config(config, *defaults)
--disable-<config>¤Ç»ØÄꤵ¤ì¤¿¿¿µ¶ÃͤòÆÀ¤ë¡¥
--enable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïtrue¡¤
--disable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïfalse¤òÊÖ¤¹¡¥
- ¤É¤Á¤é¤â»ØÄꤵ¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤Ï¡¤¥Ö¥í¥Ã¥¯¤Ä¤­¤Ç¸Æ¤Ó½Ð¤µ¤ì¤Æ
- ¤¤¤ë¾ì¹ç¤Ï*defaults¤òyield¤·¤¿·ë²Ì¡¤¥Ö¥í¥Ã¥¯¤Ê¤·¤Ê¤é
- *defaults¤òÊÖ¤¹¡¥
+ ¤É¤Á¤é¤â»ØÄꤵ¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤Ï¡¤¥Ö¥í¥Ã¥¯¤Ä¤­¤Ç¸Æ¤Ó½Ð¤µ¤ì¤Æ¤¤¤ë¾ì¹ç¤Ï
+ *defaults¤òyield¤·¤¿·ë²Ì¡¤¥Ö¥í¥Ã¥¯¤Ê¤·¤Ê¤é*defaults¤òÊÖ¤¹¡¥
dir_config(target[, default_dir])
dir_config(target[, default_include, default_lib])
@@ -1554,8 +1242,8 @@ dir_config(target[, default_include, default_lib])
--with-<target>-lib¤Î¤¤¤º¤ì¤«¤Ç»ØÄꤵ¤ì¤ë¥Ç¥£¥ì¥¯¥È¥ê¤ò
$CFLAGS ¤ä $LDFLAGS ¤ËÄɲ乤롥--with-<target>-dir=/path¤Ï
--with-<target>-include=/path/include --with-<target>-lib=/path/lib
- ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì
- ¥¯¥È¥ê¤ÎÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
+ ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì¥¯¥È¥ê¤Î
+ ÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
pkg_config(pkg)
diff --git a/README.ja b/README.ja
index dd7f67ca59..df8cfc03f4 100644
--- a/README.ja
+++ b/README.ja
@@ -20,9 +20,9 @@ Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
+ ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
+ ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
+ ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
- + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUnix-like/POSIX¸ß´¹¥×¥é¥Ã¥È¥Õ¥©¡¼¥à¾å¤Ç
- ư¤¯¤À¤±¤Ç¤Ê¤¯¡¤Windows¡¤ Mac OS X¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
- cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatformsJa
+ + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤Çư¤¯¤À¤±¤Ç¤Ê¤¯¡¤DOS¤äWindows¡¤
+ Mac¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
+
* Æþ¼êË¡
@@ -34,6 +34,10 @@ Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
** Subversion¤Ç
+ËÜ¥Ö¥é¥ó¥Á¤ÎRuby¤ÎºÇ¿·¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
+
+ $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
+
³«È¯Àèü¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
$ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
@@ -88,10 +92,6 @@ Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
2. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
- ´Ä¶­¤Ë¤è¤Ã¤Æ¤Ï¥Ç¥Õ¥©¥ë¥È¤ÎC¥³¥ó¥Ñ¥¤¥éÍÑ¥ª¥×¥·¥ç¥ó¤¬ÉÕ¤­
- ¤Þ¤¹¡¥configure¥ª¥×¥·¥ç¥ó¤Ç optflags=.. warnflags=.. Åù
- ¤Ç¾å½ñ¤­¤Ç¤­¤Þ¤¹¡¥
-
3. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
@@ -116,32 +116,6 @@ Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
7. make install
- °Ê²¼¤Î¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤Ã¤Æ¡¤¤½¤³¤Ë¥Õ¥¡¥¤¥ë¤ò¥¤¥ó¥¹¥È¡¼
- ¥ë¤·¤Þ¤¹¡¥
-
- * ${DESTDIR}${prefix}/bin
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib
- * ${DESTDIR}${prefix}/lib/ruby
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
- * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
- * ${DESTDIR}${prefix}/share/man/man1
- * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
-
- Ruby¤ÎAPI¥Ð¡¼¥¸¥ç¥ó¤¬`x.y.z'¤Ç¤¢¤ì¤Ð¡¤((|${MAJOR}|))¤Ï
- `x'¤Ç¡¤((|${MINOR}|))¤Ï`y'¡¤((|${TEENY}|))¤Ï`z'¤Ç¤¹¡¥
-
- Ãí°Õ: API¥Ð¡¼¥¸¥ç¥ó¤Îteeny¤Ï¡¤Ruby¥×¥í¥°¥é¥à¤Î¥Ð¡¼¥¸¥ç
- ¥ó¤È¤Ï°Û¤Ê¤ë¤³¤È¤¬¤¢¤ê¤Þ¤¹¡¥
-
root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
@@ -156,14 +130,15 @@ UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
-¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Þ¤¿¤Ïgetcontext()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì
-¥¸¥¹¥¿¤òjmp_buf¤äucontext_t¤Ë³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤ä
-ucontext_t¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò²¾Äê
-¤·¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó¾ï¤Ëº¤Æñ¤Ç¤·¤ç
-¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò¥Þ¡¼¥¯¤·¤Æ¤¤¤ë
-Éôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼¥¯¤¹¤ë¥³¡¼¥É¤ò
-Äɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(__mc68000__)¡×¤Ç³ç¤é¤ì¤Æ¤¤
-¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤¡¥
+¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
+³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
+¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
+¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
+¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
+¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
+³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
+
+# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
diff --git a/ToDo b/ToDo
index 7e5ef523a8..b55e399edf 100644
--- a/ToDo
+++ b/ToDo
@@ -2,10 +2,6 @@ Language Spec.
- Class#allocate - basicNew
- class Foo::Bar<Baz .. end, module Boo::Bar .. end
-- raise exception by `` error
-- a +1 to be a+1, not a(+1).
-- clarify evaluation order of operator argument (=~, .., ...)
-- :symbol => value hash in the form of {symbol: value, ...} ??
* operator !! for rescue. ???
* objectify characters
* ../... outside condition invokes operator method too.
@@ -18,6 +14,7 @@ Language Spec.
* def Class#method .. end ??
* def Foo::Bar::baz() .. end ??
* I18N (or M17N) script/string/regexp
+* Fixnum 0 as false ????
* discourage use of symbol variables (e.g. $/, etc.) in manual
* discourage use of Perlish features by giving warnings.
* non confusing in-block local variable (is it possible?)
@@ -25,9 +22,12 @@ Language Spec.
+ variables appears within block may have independent values.
* Regexp: make /o thread safe.
* decide whether begin with rescue or ensure make do..while loop.
+* a +1 to be a+1, not a(+1).
* unify == and eql? again
* to_i returns nil if str contains no digit.
+* raise exception by `` error
* jar like combined library package. -> RubyGems?
+* resumable Exception via Exception#resume.
* method combination, e.g. before, after, around, etc.
* .. or something like defadvice in Emacs.
* property - for methods, or for objects in general.
@@ -35,6 +35,8 @@ Language Spec.
* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
* warn/error "bare word" method, like "foo", you should type "foo()"
+* clarify evaluation order of operator argument (=~, .., ...)
+* :symbol => value hash in the form of {symbol: value, ...} ??
Hacking Interpreter
@@ -81,7 +83,7 @@ Standard Libraries
- use Mersenne Twister RNG for random.
- deprecate Array#indexes, and Array#indices.
- remove dependency on MAXPATHLEN.
-- String#scanf(?)
+* String#scanf(?)
* Object#fmt(?)
* Time::strptime
* Integer[num], Float[num]; Fixnum[num]?
@@ -115,7 +117,7 @@ Extension Libraries
Ruby Libraries
-- urllib.rb, nttplib.rb, etc.
+* urllib.rb, nttplib.rb, etc.
* format like perl's
Tools
diff --git a/addr2line.c b/addr2line.c
deleted file mode 100644
index 219d1d4b47..0000000000
--- a/addr2line.c
+++ /dev/null
@@ -1,610 +0,0 @@
-/**********************************************************************
-
- addr2line.h -
-
- $Author$
-
- Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#include "ruby/config.h"
-#include "addr2line.h"
-
-#include <stdio.h>
-#include <errno.h>
-
-#ifdef USE_ELF
-
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-#include <fcntl.h>
-#include <limits.h>
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <sys/mman.h>
-#include <sys/types.h>
-#include <sys/stat.h>
-#include <unistd.h>
-
-#if defined(HAVE_ALLOCA_H)
-#include <alloca.h>
-#endif
-
-#ifdef HAVE_DL_ITERATE_PHDR
-# ifndef _GNU_SOURCE
-# define _GNU_SOURCE
-# endif
-# include <link.h>
-#endif
-
-#define DW_LNS_copy 0x01
-#define DW_LNS_advance_pc 0x02
-#define DW_LNS_advance_line 0x03
-#define DW_LNS_set_file 0x04
-#define DW_LNS_set_column 0x05
-#define DW_LNS_negate_stmt 0x06
-#define DW_LNS_set_basic_block 0x07
-#define DW_LNS_const_add_pc 0x08
-#define DW_LNS_fixed_advance_pc 0x09
-#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
-#define DW_LNS_set_isa 0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence 0x01
-#define DW_LNE_set_address 0x02
-#define DW_LNE_define_file 0x03
-#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
-
-#ifndef ElfW
-# if SIZEOF_VOIDP == 8
-# define ElfW(x) Elf64##_##x
-# else
-# define ElfW(x) Elf32##_##x
-# endif
-#endif
-
-typedef struct {
- const char *dirname;
- const char *filename;
- int line;
-
- int fd;
- void *mapped;
- size_t mapped_size;
- unsigned long base_addr;
-} line_info_t;
-
-/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
-
-static unsigned long
-uleb128(char **p) {
- unsigned long r = 0;
- int s = 0;
- for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
- if (b < 0x80) {
- r += (unsigned long)b << s;
- break;
- }
- r += (b & 0x7f) << s;
- s += 7;
- }
- return r;
-}
-
-static long
-sleb128(char **p) {
- long r = 0;
- int s = 0;
- for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
- if (b < 0x80) {
- if (b & 0x40) {
- r -= (0x80 - b) << s;
- }
- else {
- r += (b & 0x3f) << s;
- }
- break;
- }
- r += (b & 0x7f) << s;
- s += 7;
- }
- return r;
-}
-
-static const char *
-get_nth_dirname(unsigned long dir, char *p)
-{
- if (!dir--) {
- return "";
- }
- while (dir--) {
- while (*p) p++;
- p++;
- if (!*p) {
- fprintf(stderr, "Unexpected directory number %lu in %s\n",
- dir, binary_filename);
- return "";
- }
- }
- return p;
-}
-
-static void
-fill_filename(int file, char *include_directories, char *filenames,
- line_info_t *line)
-{
- int i;
- char *p = filenames;
- char *filename;
- unsigned long dir;
- for (i = 1; i <= file; i++) {
- filename = p;
- if (!*p) {
- /* Need to output binary file name? */
- fprintf(stderr, "Unexpected file number %d in %s\n",
- file, binary_filename);
- return;
- }
- while (*p) p++;
- p++;
- dir = uleb128(&p);
- /* last modified. */
- uleb128(&p);
- /* size of the file. */
- uleb128(&p);
-
- if (i == file) {
- line->filename = filename;
- line->dirname = get_nth_dirname(dir, include_directories);
- }
- }
-}
-
-static int
-get_path_from_symbol(const char *symbol, const char **p, size_t *len)
-{
- if (symbol[0] == '0') {
- /* libexecinfo */
- *p = strchr(symbol, '/');
- if (*p == NULL) return 0;
- *len = strlen(*p);
- }
- else {
- /* glibc */
- const char *q;
- *p = symbol;
- q = strchr(symbol, '(');
- if (q == NULL) return 0;
- *len = q - symbol;
- }
- return 1;
-}
-
-static void
-fill_line(int num_traces, void **traces,
- unsigned long addr, int file, int line,
- char *include_directories, char *filenames, line_info_t *lines)
-{
- int i;
- for (i = 0; i < num_traces; i++) {
- unsigned long a = (unsigned long)traces[i] - lines[i].base_addr;
- /* We assume one line code doesn't result >100 bytes of native code.
- We may want more reliable way eventually... */
- if (addr < a && a < addr + 100) {
- fill_filename(file, include_directories, filenames, &lines[i]);
- lines[i].line = line;
- }
- }
-}
-
-static void
-parse_debug_line_cu(int num_traces, void **traces,
- char **debug_line, line_info_t *lines)
-{
- char *p, *cu_end, *cu_start, *include_directories, *filenames;
- unsigned long unit_length;
- int default_is_stmt, line_base;
- unsigned int header_length, minimum_instruction_length, line_range,
- opcode_base;
- unsigned char *standard_opcode_lengths;
-
- /* The registers. */
- unsigned long addr = 0;
- unsigned int file = 1;
- unsigned int line = 1;
- unsigned int column = 0;
- int is_stmt;
- int basic_block = 0;
- int end_sequence = 0;
- int prologue_end = 0;
- int epilogue_begin = 0;
- unsigned int isa = 0;
-
- p = *debug_line;
-
- unit_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
- if (unit_length == 0xffffffff) {
- unit_length = *(unsigned long *)p;
- p += sizeof(unsigned long);
- }
-
- cu_end = p + unit_length;
-
- /*dwarf_version = *(unsigned short *)p;*/
- p += 2;
-
- header_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
-
- cu_start = p + header_length;
-
- minimum_instruction_length = *(unsigned char *)p;
- p++;
-
- is_stmt = default_is_stmt = *(unsigned char *)p;
- p++;
-
- line_base = *(char *)p;
- p++;
-
- line_range = *(unsigned char *)p;
- p++;
-
- opcode_base = *(unsigned char *)p;
- p++;
-
- standard_opcode_lengths = (unsigned char *)p - 1;
- p += opcode_base - 1;
-
- include_directories = p;
-
- /* skip include directories */
- while (*p) {
- while (*p) p++;
- p++;
- }
- p++;
-
- filenames = p;
-
- p = cu_start;
-
-#define FILL_LINE() \
- do { \
- fill_line(num_traces, traces, addr, file, line, \
- include_directories, filenames, lines); \
- basic_block = prologue_end = epilogue_begin = 0; \
- } while (0)
-
- while (p < cu_end) {
- unsigned long a;
- unsigned char op = *p++;
- switch (op) {
- case DW_LNS_copy:
- FILL_LINE();
- break;
- case DW_LNS_advance_pc:
- a = uleb128(&p);
- addr += a;
- break;
- case DW_LNS_advance_line: {
- long a = sleb128(&p);
- line += a;
- break;
- }
- case DW_LNS_set_file:
- file = (unsigned int)uleb128(&p);
- break;
- case DW_LNS_set_column:
- column = (unsigned int)uleb128(&p);
- break;
- case DW_LNS_negate_stmt:
- is_stmt = !is_stmt;
- break;
- case DW_LNS_set_basic_block:
- basic_block = 1;
- break;
- case DW_LNS_const_add_pc:
- a = ((255 - opcode_base) / line_range) *
- minimum_instruction_length;
- addr += a;
- break;
- case DW_LNS_fixed_advance_pc:
- a = *(unsigned char *)p++;
- addr += a;
- break;
- case DW_LNS_set_prologue_end:
- prologue_end = 1;
- break;
- case DW_LNS_set_epilogue_begin:
- epilogue_begin = 1;
- break;
- case DW_LNS_set_isa:
- isa = (unsigned int)uleb128(&p);
- break;
- case 0:
- a = *(unsigned char *)p++;
- op = *p++;
- switch (op) {
- case DW_LNE_end_sequence:
- end_sequence = 1;
- FILL_LINE();
- addr = 0;
- file = 1;
- line = 1;
- column = 0;
- is_stmt = default_is_stmt;
- end_sequence = 0;
- isa = 0;
- break;
- case DW_LNE_set_address:
- addr = *(unsigned long *)p;
- p += sizeof(unsigned long);
- break;
- case DW_LNE_define_file:
- fprintf(stderr, "Unsupported operation in %s\n",
- binary_filename);
- break;
- case DW_LNE_set_discriminator:
- /* TODO:currently ignore */
- uleb128(&p);
- break;
- default:
- fprintf(stderr, "Unknown extended opcode: %d in %s\n",
- op, binary_filename);
- }
- break;
- default: {
- unsigned long addr_incr;
- unsigned long line_incr;
- a = op - opcode_base;
- addr_incr = (a / line_range) * minimum_instruction_length;
- line_incr = line_base + (a % line_range);
- addr += (unsigned int)addr_incr;
- line += (unsigned int)line_incr;
- FILL_LINE();
- }
- }
- }
- *debug_line = p;
-}
-
-static void
-parse_debug_line(int num_traces, void **traces,
- char *debug_line, unsigned long size, line_info_t *lines)
-{
- char *debug_line_end = debug_line + size;
- while (debug_line < debug_line_end) {
- parse_debug_line_cu(num_traces, traces, &debug_line, lines);
- }
- if (debug_line != debug_line_end) {
- fprintf(stderr, "Unexpected size of .debug_line in %s\n",
- binary_filename);
- }
-}
-
-/* read file and fill lines */
-static void
-fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
- line_info_t *current_line, line_info_t *lines);
-
-static void
-follow_debuglink(char *debuglink, int num_traces, void **traces, char **syms,
- line_info_t *current_line, line_info_t *lines)
-{
- /* Ideally we should check 4 paths to follow gnu_debuglink,
- but we handle only one case for now as this format is used
- by some linux distributions. See GDB's info for detail. */
- static const char global_debug_dir[] = "/usr/lib/debug";
- char *p, *subdir;
-
- p = strrchr(binary_filename, '/');
- if (!p) {
- return;
- }
- p[1] = '\0';
-
- subdir = (char *)alloca(strlen(binary_filename) + 1);
- strcpy(subdir, binary_filename);
- strcpy(binary_filename, global_debug_dir);
- strncat(binary_filename, subdir,
- PATH_MAX - strlen(binary_filename) - 1);
- strncat(binary_filename, debuglink,
- PATH_MAX - strlen(binary_filename) - 1);
-
- munmap(current_line->mapped, current_line->mapped_size);
- close(current_line->fd);
- fill_lines(num_traces, traces, syms, 0, current_line, lines);
-}
-
-/* read file and fill lines */
-static void
-fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
- line_info_t *current_line, line_info_t *lines)
-{
- int i;
- char *shstr;
- char *section_name;
- ElfW(Ehdr) *ehdr;
- ElfW(Shdr) *shdr, *shstr_shdr;
- ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
- int fd;
- off_t filesize;
- char *file;
-
- fd = open(binary_filename, O_RDONLY);
- if (fd < 0) {
- return;
- }
- filesize = lseek(fd, 0, SEEK_END);
- if (filesize < 0) {
- int e = errno;
- close(fd);
- fprintf(stderr, "lseek: %s\n", strerror(e));
- return;
- }
- lseek(fd, 0, SEEK_SET);
- /* async-signal unsafe */
- file = (char *)mmap(NULL, filesize, PROT_READ, MAP_SHARED, fd, 0);
- if (file == MAP_FAILED) {
- int e = errno;
- close(fd);
- fprintf(stderr, "mmap: %s\n", strerror(e));
- return;
- }
-
- current_line->fd = fd;
- current_line->mapped = file;
- current_line->mapped_size = filesize;
-
- for (i = 0; i < num_traces; i++) {
- const char *path;
- size_t len;
- if (get_path_from_symbol(syms[i], &path, &len) &&
- !strncmp(path, binary_filename, len)) {
- lines[i].line = -1;
- }
- }
-
- ehdr = (ElfW(Ehdr) *)file;
- shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
-
- shstr_shdr = shdr + ehdr->e_shstrndx;
- shstr = file + shstr_shdr->sh_offset;
-
- for (i = 0; i < ehdr->e_shnum; i++) {
- section_name = shstr + shdr[i].sh_name;
- if (!strcmp(section_name, ".debug_line")) {
- debug_line_shdr = shdr + i;
- break;
- } else if (!strcmp(section_name, ".gnu_debuglink")) {
- gnu_debuglink_shdr = shdr + i;
- }
- }
-
- if (!debug_line_shdr) {
- /* This file doesn't have .debug_line section,
- let's check .gnu_debuglink section instead. */
- if (gnu_debuglink_shdr && check_debuglink) {
- follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
- num_traces, traces, syms,
- current_line, lines);
- }
- return;
- }
-
- parse_debug_line(num_traces, traces,
- file + debug_line_shdr->sh_offset,
- debug_line_shdr->sh_size,
- lines);
-}
-
-#ifdef HAVE_DL_ITERATE_PHDR
-
-typedef struct {
- int num_traces;
- char **syms;
- line_info_t *lines;
-} fill_base_addr_state_t;
-
-static int
-fill_base_addr(struct dl_phdr_info *info, size_t size, void *data)
-{
- int i;
- fill_base_addr_state_t *st = (fill_base_addr_state_t *)data;
- for (i = 0; i < st->num_traces; i++) {
- const char *path;
- size_t len;
- size_t name_len = strlen(info->dlpi_name);
-
- if (get_path_from_symbol(st->syms[i], &path, &len) &&
- (len == name_len || (len > name_len && path[len-name_len-1] == '/')) &&
- !strncmp(path+len-name_len, info->dlpi_name, name_len)) {
- st->lines[i].base_addr = info->dlpi_addr;
- }
- }
- return 0;
-}
-
-#endif /* HAVE_DL_ITERATE_PHDR */
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **trace, char **syms)
-{
- int i;
- /* async-signal unsafe */
- line_info_t *lines = (line_info_t *)calloc(num_traces,
- sizeof(line_info_t));
-
- /* Note that line info of shared objects might not be shown
- if we don't have dl_iterate_phdr */
-#ifdef HAVE_DL_ITERATE_PHDR
- fill_base_addr_state_t fill_base_addr_state;
-
- fill_base_addr_state.num_traces = num_traces;
- fill_base_addr_state.syms = syms;
- fill_base_addr_state.lines = lines;
- /* maybe async-signal unsafe */
- dl_iterate_phdr(fill_base_addr, &fill_base_addr_state);
-#endif /* HAVE_DL_ITERATE_PHDR */
-
- for (i = 0; i < num_traces; i++) {
- const char *path;
- size_t len;
- if (lines[i].line) {
- continue;
- }
-
- if (!get_path_from_symbol(syms[i], &path, &len)) {
- continue;
- }
-
- strncpy(binary_filename, path, len);
- binary_filename[len] = '\0';
-
- fill_lines(num_traces, trace, syms, 1, &lines[i], lines);
- }
-
- /* fprintf may not be async-signal safe */
- for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
-
- if (line->line > 0) {
- fprintf(stderr, "%s ", syms[i]);
- if (line->filename) {
- if (line->dirname && line->dirname[0]) {
- fprintf(stderr, "%s/", line->dirname);
- }
- fprintf(stderr, "%s", line->filename);
- } else {
- fprintf(stderr, "???");
- }
- fprintf(stderr, ":%d\n", line->line);
- } else {
- fprintf(stderr, "%s\n", syms[i]);
- }
- }
-
- for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
- if (line->fd) {
- munmap(line->mapped, line->mapped_size);
- close(line->fd);
- }
- }
- free(lines);
-}
-
-#else /* defined(USE_ELF) */
-#error not supported
-#endif
diff --git a/addr2line.h b/addr2line.h
deleted file mode 100644
index 3782d89e07..0000000000
--- a/addr2line.h
+++ /dev/null
@@ -1,21 +0,0 @@
-/**********************************************************************
-
- addr2line.h -
-
- $Author$
-
- Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces, char **syms);
-
-#endif /* USE_ELF */
-
-#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index e427cb3320..baae2706e5 100644
--- a/array.c
+++ b/array.c
@@ -2,37 +2,29 @@
array.c -
- $Author$
+ $Author: akr $
+ $Date: 2006/06/24 14:53:36 $
created at: Fri Aug 6 09:46:12 JST 1993
- Copyright (C) 1993-2007 Yukihiro Matsumoto
+ Copyright (C) 1993-2003 Yukihiro Matsumoto
Copyright (C) 2000 Network Applied Communication Laboratory, Inc.
Copyright (C) 2000 Information-technology Promotion Agency, Japan
**********************************************************************/
-#include "ruby/ruby.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
-#include "ruby/encoding.h"
-#include "internal.h"
-
-#ifndef ARRAY_DEBUG
-# define NDEBUG
-#endif
-#include <assert.h>
-
-#define numberof(array) (int)(sizeof(array) / sizeof((array)[0]))
+#include "ruby.h"
+#include "util.h"
+#include "st.h"
VALUE rb_cArray;
-
static ID id_cmp;
#define ARY_DEFAULT_SIZE 16
-#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_mem_clear(mem, size)
+ register VALUE *mem;
+ register long size;
{
while (size--) {
*mem++ = Qnil;
@@ -40,311 +32,134 @@ rb_mem_clear(register VALUE *mem, register long size)
}
static inline void
-memfill(register VALUE *mem, register long size, register VALUE val)
+memfill(mem, size, val)
+ register VALUE *mem;
+ register long size;
+ register VALUE val;
{
while (size--) {
*mem++ = val;
}
}
-# define ARY_SHARED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
-
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
-#define ARY_EMBED_LEN(a) \
- (assert(ARY_EMBED_P(a)), \
- (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
- (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
-#define FL_SET_EMBED(a) do { \
- assert(!ARY_SHARED_P(a)); \
- assert(!OBJ_FROZEN(a)); \
- FL_SET((a), RARRAY_EMBED_FLAG); \
-} while (0)
-#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
-#define FL_SET_SHARED(ary) do { \
- assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), ELTS_SHARED); \
-} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
-
-#define ARY_SET_PTR(ary, p) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.ptr = (p); \
-} while (0)
-#define ARY_SET_EMBED_LEN(ary, n) do { \
- long tmp_n = (n); \
- assert(ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
- RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
-} while (0)
-#define ARY_SET_HEAP_LEN(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- RARRAY(ary)->as.heap.len = (n); \
-} while (0)
-#define ARY_SET_LEN(ary, n) do { \
- if (ARY_EMBED_P(ary)) { \
- ARY_SET_EMBED_LEN((ary), (n)); \
- } \
- else { \
- ARY_SET_HEAP_LEN((ary), (n)); \
- } \
- assert(RARRAY_LEN(ary) == (n)); \
-} while (0)
-#define ARY_INCREASE_PTR(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.ptr += (n); \
-} while (0)
-#define ARY_INCREASE_LEN(ary, n) do { \
- assert(!OBJ_FROZEN(ary)); \
- if (ARY_EMBED_P(ary)) { \
- ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
- } \
- else { \
- RARRAY(ary)->as.heap.len += (n); \
- } \
-} while (0)
-
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
- ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SET_CAPA(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!ARY_SHARED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.aux.capa = (n); \
-} while (0)
-
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
-#define ARY_SET_SHARED(ary, value) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(ARY_SHARED_P(ary)); \
- assert(ARY_SHARED_ROOT_P(value)); \
- RARRAY(ary)->as.heap.aux.shared = (value); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
- (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
- assert(ARY_SHARED_ROOT_P(ary)); \
- RARRAY(ary)->as.heap.aux.capa = (value); \
-} while (0)
-#define FL_SET_SHARED_ROOT(ary) do { \
- assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
-} while (0)
-
-static void
-ary_resize_capa(VALUE ary, long capacity)
-{
- assert(RARRAY_LEN(ary) <= capacity);
- assert(!OBJ_FROZEN(ary));
- assert(!ARY_SHARED_P(ary));
- if (capacity > RARRAY_EMBED_LEN_MAX) {
- if (ARY_EMBED_P(ary)) {
- long len = ARY_EMBED_LEN(ary);
- VALUE *ptr = ALLOC_N(VALUE, (capacity));
- MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ptr);
- ARY_SET_HEAP_LEN(ary, len);
- }
- else {
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, (capacity));
- }
- ARY_SET_CAPA(ary, (capacity));
- }
- else {
- if (!ARY_EMBED_P(ary)) {
- long len = RARRAY_LEN(ary);
- VALUE *ptr = RARRAY_PTR(ary);
- if (len > capacity) len = capacity;
- MEMCPY(RARRAY(ary)->as.ary, ptr, VALUE, len);
- FL_SET_EMBED(ary);
- ARY_SET_LEN(ary, len);
- xfree(ptr);
- }
- }
-}
-
-static void
-ary_double_capa(VALUE ary, long min)
-{
- long new_capa = ARY_CAPA(ary) / 2;
-
- if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
- }
- if (new_capa >= ARY_MAX_SIZE - min) {
- new_capa = (ARY_MAX_SIZE - min) / 2;
- }
- new_capa += min;
- ary_resize_capa(ary, new_capa);
-}
-
-static void
-rb_ary_decrement_share(VALUE shared)
-{
- if (shared) {
- long num = ARY_SHARED_NUM(shared) - 1;
- if (num == 0) {
- rb_ary_free(shared);
- rb_gc_force_recycle(shared);
- }
- else if (num > 0) {
- ARY_SET_SHARED_NUM(shared, num);
- }
- }
-}
-
-static void
-rb_ary_unshare(VALUE ary)
-{
- VALUE shared = RARRAY(ary)->as.heap.aux.shared;
- rb_ary_decrement_share(shared);
- FL_UNSET_SHARED(ary);
-}
+#define ARY_TMPLOCK FL_USER1
static inline void
-rb_ary_unshare_safe(VALUE ary)
-{
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- }
-}
-
-static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_modify_check(ary)
+ VALUE ary;
{
- long num = ARY_SHARED_NUM(shared);
- if (num >= 0) {
- ARY_SET_SHARED_NUM(shared, num + 1);
- }
- return shared;
+ if (OBJ_FROZEN(ary)) rb_error_frozen("array");
+ if (FL_TEST(ary, ARY_TMPLOCK))
+ rb_raise(rb_eRuntimeError, "can't modify array during iteration");
+ if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
+ rb_raise(rb_eSecurityError, "Insecure: can't modify array");
}
static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
-{
- rb_ary_increment_share(shared);
- FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, shared);
-}
-
-static inline void
-rb_ary_modify_check(VALUE ary)
+rb_ary_modify(ary)
+ VALUE ary;
{
- rb_check_frozen(ary);
- if (!OBJ_UNTRUSTED(ary) && rb_safe_level() >= 4)
- rb_raise(rb_eSecurityError, "Insecure: can't modify array");
-}
+ VALUE *ptr;
-void
-rb_ary_modify(VALUE ary)
-{
rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- long len = RARRAY_LEN(ary);
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE *ptr = ARY_HEAP_PTR(ary);
- VALUE shared = ARY_SHARED(ary);
- FL_UNSET_SHARED(ary);
- FL_SET_EMBED(ary);
- MEMCPY(ARY_EMBED_PTR(ary), ptr, VALUE, len);
- rb_ary_decrement_share(shared);
- ARY_SET_EMBED_LEN(ary, len);
- }
- else {
- VALUE *ptr = ALLOC_N(VALUE, len);
- MEMCPY(ptr, RARRAY_PTR(ary), VALUE, len);
- rb_ary_unshare(ary);
- ARY_SET_CAPA(ary, len);
- ARY_SET_PTR(ary, ptr);
- }
+ if (FL_TEST(ary, ELTS_SHARED)) {
+ ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
+ FL_UNSET(ary, ELTS_SHARED);
+ RARRAY(ary)->aux.capa = RARRAY(ary)->len;
+ MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ RARRAY(ary)->ptr = ptr;
}
}
VALUE
-rb_ary_freeze(VALUE ary)
+rb_ary_freeze(ary)
+ VALUE ary;
{
return rb_obj_freeze(ary);
}
/*
* call-seq:
- * ary.frozen? -> true or false
+ * array.frozen? -> true or false
*
* Return <code>true</code> if this array is frozen (or temporarily frozen
* while being sorted).
*/
static VALUE
-rb_ary_frozen_p(VALUE ary)
+rb_ary_frozen_p(ary)
+ VALUE ary;
{
if (OBJ_FROZEN(ary)) return Qtrue;
+ if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
return Qfalse;
}
+static VALUE ary_alloc _((VALUE));
static VALUE
-ary_alloc(VALUE klass)
+ary_alloc(klass)
+ VALUE klass;
{
NEWOBJ(ary, struct RArray);
OBJSETUP(ary, klass, T_ARRAY);
- FL_SET_EMBED((VALUE)ary);
- ARY_SET_EMBED_LEN((VALUE)ary, 0);
+
+ ary->len = 0;
+ ary->ptr = 0;
+ ary->aux.capa = 0;
return (VALUE)ary;
}
static VALUE
-ary_new(VALUE klass, long capa)
+ary_new(klass, len)
+ VALUE klass;
+ long len;
{
- VALUE ary;
+ VALUE ary = ary_alloc(klass);
- if (capa < 0) {
+ if (len < 0) {
rb_raise(rb_eArgError, "negative array size (or size too big)");
}
- if (capa > ARY_MAX_SIZE) {
+ if (len > 0 && len * sizeof(VALUE) <= len) {
rb_raise(rb_eArgError, "array size too big");
}
- ary = ary_alloc(klass);
- if (capa > RARRAY_EMBED_LEN_MAX) {
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ALLOC_N(VALUE, capa));
- ARY_SET_CAPA(ary, capa);
- ARY_SET_HEAP_LEN(ary, 0);
- }
+ if (len == 0) len++;
+ RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
+ RARRAY(ary)->aux.capa = len;
return ary;
}
VALUE
-rb_ary_new2(long capa)
+rb_ary_new2(len)
+ long len;
{
- return ary_new(rb_cArray, capa);
+ return ary_new(rb_cArray, len);
}
VALUE
-rb_ary_new(void)
+rb_ary_new()
{
- return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+ return rb_ary_new2(ARY_DEFAULT_SIZE);
}
+#ifdef HAVE_STDARG_PROTOTYPES
#include <stdarg.h>
+#define va_init_list(a,b) va_start(a,b)
+#else
+#include <varargs.h>
+#define va_init_list(a,b) va_start(a)
+#endif
VALUE
+#ifdef HAVE_STDARG_PROTOTYPES
rb_ary_new3(long n, ...)
+#else
+rb_ary_new3(n, va_alist)
+ long n;
+ va_dcl
+#endif
{
va_list ar;
VALUE ary;
@@ -352,152 +167,63 @@ rb_ary_new3(long n, ...)
ary = rb_ary_new2(n);
- va_start(ar, n);
+ va_init_list(ar, n);
for (i=0; i<n; i++) {
- RARRAY_PTR(ary)[i] = va_arg(ar, VALUE);
+ RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
}
va_end(ar);
- ARY_SET_LEN(ary, n);
+ RARRAY(ary)->len = n;
return ary;
}
VALUE
-rb_ary_new4(long n, const VALUE *elts)
+rb_ary_new4(n, elts)
+ long n;
+ const VALUE *elts;
{
VALUE ary;
ary = rb_ary_new2(n);
if (n > 0 && elts) {
- MEMCPY(RARRAY_PTR(ary), elts, VALUE, n);
- ARY_SET_LEN(ary, n);
+ MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
}
+ /* This assignment to len will be moved to the above "if" block in Ruby 1.9 */
+ RARRAY(ary)->len = n;
+
return ary;
}
VALUE
-rb_ary_tmp_new(long capa)
+rb_assoc_new(car, cdr)
+ VALUE car, cdr;
{
- return ary_new(0, capa);
-}
-
-void
-rb_ary_free(VALUE ary)
-{
- if (ARY_OWNS_HEAP_P(ary)) {
- xfree(ARY_HEAP_PTR(ary));
- }
-}
-
-RUBY_FUNC_EXPORTED size_t
-rb_ary_memsize(VALUE ary)
-{
- if (ARY_OWNS_HEAP_P(ary)) {
- return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
- }
- else {
- return 0;
- }
-}
-
-static inline void
-ary_discard(VALUE ary)
-{
- rb_ary_free(ary);
- RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
-static VALUE
-ary_make_shared(VALUE ary)
-{
- assert(!ARY_EMBED_P(ary));
- if (ARY_SHARED_P(ary)) {
- return ARY_SHARED(ary);
- }
- else if (ARY_SHARED_ROOT_P(ary)) {
- return ary;
- }
- else if (OBJ_FROZEN(ary)) {
- ary_resize_capa(ary, ARY_HEAP_LEN(ary));
- FL_SET_SHARED_ROOT(ary);
- ARY_SET_SHARED_NUM(ary, 1);
- return ary;
- }
- else {
- NEWOBJ(shared, struct RArray);
- OBJSETUP(shared, 0, T_ARRAY);
- FL_UNSET_EMBED(shared);
-
- ARY_SET_LEN((VALUE)shared, RARRAY_LEN(ary));
- ARY_SET_PTR((VALUE)shared, RARRAY_PTR(ary));
- FL_SET_SHARED_ROOT(shared);
- ARY_SET_SHARED_NUM((VALUE)shared, 1);
- FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, (VALUE)shared);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
- }
-}
-
+ VALUE ary;
-static VALUE
-ary_make_substitution(VALUE ary)
-{
- if (RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX) {
- VALUE subst = rb_ary_new2(RARRAY_LEN(ary));
- MEMCPY(ARY_EMBED_PTR(subst), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
- ARY_SET_EMBED_LEN(subst, RARRAY_LEN(ary));
- return subst;
- }
- else {
- return rb_ary_increment_share(ary_make_shared(ary));
- }
-}
+ ary = rb_ary_new2(2);
+ RARRAY(ary)->ptr[0] = car;
+ RARRAY(ary)->ptr[1] = cdr;
+ RARRAY(ary)->len = 2;
-VALUE
-rb_assoc_new(VALUE car, VALUE cdr)
-{
- return rb_ary_new3(2, car, cdr);
+ return ary;
}
static VALUE
-to_ary(VALUE ary)
+to_ary(ary)
+ VALUE ary;
{
return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
VALUE
-rb_check_array_type(VALUE ary)
+rb_check_array_type(ary)
+ VALUE ary;
{
return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
-/*
- * call-seq:
- * Array.try_convert(obj) -> array or nil
- *
- * Tries to convert +obj+ into an array, using +to_ary+ method. Returns the
- * converted array or +nil+ if +obj+ cannot be converted for any reason.
- * This method can be used to check if an argument is an array.
- *
- * Array.try_convert([1]) #=> [1]
- * Array.try_convert("1") #=> nil
- *
- * if tmp = Array.try_convert(arg)
- * # the argument is an array
- * elsif tmp = String.try_convert(arg)
- * # the argument is a string
- * end
- *
- */
-
-static VALUE
-rb_ary_s_try_convert(VALUE dummy, VALUE ary)
-{
- return rb_check_array_type(ary);
-}
+static VALUE rb_ary_replace _((VALUE, VALUE));
/*
* call-seq:
@@ -505,76 +231,56 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
* Array.new(array)
* Array.new(size) {|index| block }
*
- * Returns a new array.
- *
- * In the first form, if no arguments are sent, the new array will be empty.
- * When a +size+ and an optional +obj+ are sent, an array is created with
- * +size+ copies of +obj+. Take notice that all elements will reference the
- * same object +obj+.
- *
- * The second form creates a copy of the array passed as a parameter (the
- * array is generated by calling to_ary on the parameter).
- *
- * first_array = ["Matz", "Guido"]
- *
- * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
- *
- * first_array.equal? second_array #=> false
- *
- * In the last form, an array of the given size is created. Each element in
- * this array is created by passing the element's index to the given block
- * and storing the return value.
- *
- * Array.new(3){ |index| index ** 2 }
- * # => [0, 1, 4]
- *
- * == Common gotchas
- *
- * When sending the second parameter, the same object will be used as the
- * value for all the array elements:
- *
+ * Returns a new array. In the first form, the new array is
+ * empty. In the second it is created with _size_ copies of _obj_
+ * (that is, _size_ references to the same
+ * _obj_). The third form creates a copy of the array
+ * passed as a parameter (the array is generated by calling
+ * to_ary on the parameter). In the last form, an array
+ * of the given size is created. Each element in this array is
+ * calculated by passing the element's index to the given block and
+ * storing the return value.
+ *
+ * Array.new
+ * Array.new(2)
+ * Array.new(5, "A")
+ *
+ * # only one copy of the object is created
* a = Array.new(2, Hash.new)
- * # => [{}, {}]
- *
* a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
+ * a
* a[1]['cat'] = 'Felix'
- * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- * Since all the Array elements store the same hash, changes to one of them
- * will affect them all.
- *
- * If multiple copies are what you want, you should use the block
- * version which uses the result of that block each time an element
- * of the array needs to be initialized:
- *
+ * a
+ *
+ * # here multiple copies are created
* a = Array.new(2) { Hash.new }
* a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {}]
- *
+ * a
+ *
+ * squares = Array.new(5) {|i| i*i}
+ * squares
+ *
+ * copy = Array.new(squares)
*/
static VALUE
-rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+rb_ary_initialize(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long len;
VALUE size, val;
rb_ary_modify(ary);
- if (argc == 0) {
- if (ARY_OWNS_HEAP_P(ary) && RARRAY_PTR(ary)) {
- xfree(RARRAY_PTR(ary));
- }
- rb_ary_unshare_safe(ary);
- FL_SET_EMBED(ary);
- ARY_SET_EMBED_LEN(ary, 0);
+ if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
+ RARRAY(ary)->len = 0;
if (rb_block_given_p()) {
rb_warning("given block not used");
}
return ary;
}
- rb_scan_args(argc, argv, "02", &size, &val);
+
if (argc == 1 && !FIXNUM_P(size)) {
val = rb_check_array_type(size);
if (!NIL_P(val)) {
@@ -587,11 +293,13 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
if (len < 0) {
rb_raise(rb_eArgError, "negative array size");
}
- if (len > ARY_MAX_SIZE) {
+ if (len > 0 && len * (long)sizeof(VALUE) <= len) {
rb_raise(rb_eArgError, "array size too big");
}
- rb_ary_modify(ary);
- ary_resize_capa(ary, len);
+ if (len > RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
+ RARRAY(ary)->aux.capa = len;
+ }
if (rb_block_given_p()) {
long i;
@@ -600,19 +308,20 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
}
for (i=0; i<len; i++) {
rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- ARY_SET_LEN(ary, i + 1);
+ RARRAY(ary)->len = i + 1;
}
}
else {
- memfill(RARRAY_PTR(ary), len, val);
- ARY_SET_LEN(ary, len);
+ memfill(RARRAY(ary)->ptr, len, val);
+ RARRAY(ary)->len = len;
}
+
return ary;
}
-/*
-* Returns a new array populated with the given objects.
+/*
+* Returns a new array populated with the given objects.
*
* Array.[]( 1, 'a', /^A/ )
* Array[ 1, 'a', /^A/ ]
@@ -620,113 +329,65 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
*/
static VALUE
-rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+rb_ary_s_create(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
{
- VALUE ary = ary_new(klass, argc);
- if (argc > 0 && argv) {
- MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
- ARY_SET_LEN(ary, argc);
+ VALUE ary = ary_alloc(klass);
+
+ if (argc > 0) {
+ RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
+ MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
}
+ RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
return ary;
}
void
-rb_ary_store(VALUE ary, long idx, VALUE val)
+rb_ary_store(ary, idx, val)
+ VALUE ary;
+ long idx;
+ VALUE val;
{
if (idx < 0) {
- idx += RARRAY_LEN(ary);
+ idx += RARRAY(ary)->len;
if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- idx - RARRAY_LEN(ary), -RARRAY_LEN(ary));
+ rb_raise(rb_eIndexError, "index %ld out of array",
+ idx - RARRAY(ary)->len);
}
}
- else if (idx >= ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", idx);
- }
rb_ary_modify(ary);
- if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
- }
- if (idx > RARRAY_LEN(ary)) {
- rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary),
- idx-RARRAY_LEN(ary) + 1);
- }
-
- if (idx >= RARRAY_LEN(ary)) {
- ARY_SET_LEN(ary, idx + 1);
- }
- RARRAY_PTR(ary)[idx] = val;
-}
-
-static VALUE
-ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
-{
- assert(offset >= 0);
- assert(len >= 0);
- assert(offset+len <= RARRAY_LEN(ary));
+ if (idx >= RARRAY(ary)->aux.capa) {
+ long new_capa = RARRAY(ary)->aux.capa / 2;
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE result = ary_alloc(klass);
- MEMCPY(ARY_EMBED_PTR(result), RARRAY_PTR(ary) + offset, VALUE, len);
- ARY_SET_EMBED_LEN(result, len);
- return result;
+ if (new_capa < ARY_DEFAULT_SIZE) {
+ new_capa = ARY_DEFAULT_SIZE;
+ }
+ new_capa += idx;
+ if (new_capa * (long)sizeof(VALUE) <= new_capa) {
+ rb_raise(rb_eArgError, "index too big");
+ }
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
+ RARRAY(ary)->aux.capa = new_capa;
}
- else {
- VALUE shared, result = ary_alloc(klass);
- FL_UNSET_EMBED(result);
-
- shared = ary_make_shared(ary);
- ARY_SET_PTR(result, RARRAY_PTR(ary));
- ARY_SET_LEN(result, RARRAY_LEN(ary));
- rb_ary_set_shared(result, shared);
-
- ARY_INCREASE_PTR(result, offset);
- ARY_SET_LEN(result, len);
- return result;
+ if (idx > RARRAY(ary)->len) {
+ rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
+ idx-RARRAY(ary)->len + 1);
}
-}
-
-static VALUE
-ary_make_shared_copy(VALUE ary)
-{
- return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
-}
-
-enum ary_take_pos_flags
-{
- ARY_TAKE_FIRST = 0,
- ARY_TAKE_LAST = 1
-};
-static VALUE
-ary_take_first_or_last(int argc, VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
-{
- VALUE nv;
- long n;
- long offset = 0;
-
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
- if (n > RARRAY_LEN(ary)) {
- n = RARRAY_LEN(ary);
- }
- else if (n < 0) {
- rb_raise(rb_eArgError, "negative array size");
+ if (idx >= RARRAY(ary)->len) {
+ RARRAY(ary)->len = idx + 1;
}
- if (last) {
- offset = RARRAY_LEN(ary) - n;
- }
- return ary_make_partial(ary, rb_cArray, offset, n);
+ RARRAY(ary)->ptr[idx] = val;
}
-static VALUE rb_ary_push_1(VALUE ary, VALUE item);
-
/*
* call-seq:
- * ary << obj -> ary
- *
+ * array << obj -> array
+ *
* Append---Pushes the given object on to the end of this array. This
* expression returns the array itself, so several appends
* may be chained together.
@@ -737,262 +398,240 @@ static VALUE rb_ary_push_1(VALUE ary, VALUE item);
*/
VALUE
-rb_ary_push(VALUE ary, VALUE item)
-{
- rb_ary_modify(ary);
- return rb_ary_push_1(ary, item);
-}
-
-static VALUE
-rb_ary_push_1(VALUE ary, VALUE item)
+rb_ary_push(ary, item)
+ VALUE ary;
+ VALUE item;
{
- long idx = RARRAY_LEN(ary);
-
- if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
- }
- RARRAY_PTR(ary)[idx] = item;
- ARY_SET_LEN(ary, idx + 1);
+ rb_ary_store(ary, RARRAY(ary)->len, item);
return ary;
}
-/*
+/*
* call-seq:
- * ary.push(obj, ... ) -> ary
- *
+ * array.push(obj, ... ) -> array
+ *
* Append---Pushes the given object(s) on to the end of this array. This
* expression returns the array itself, so several appends
* may be chained together.
*
* a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
+ * a.push("d", "e", "f")
* #=> ["a", "b", "c", "d", "e", "f"]
*/
static VALUE
-rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_push_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- rb_ary_modify(ary);
while (argc--) {
- rb_ary_push_1(ary, *argv++);
+ rb_ary_push(ary, *argv++);
}
return ary;
}
-VALUE
-rb_ary_pop(VALUE ary)
-{
- long n;
- rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) == 0) return Qnil;
- if (ARY_OWNS_HEAP_P(ary) &&
- RARRAY_LEN(ary) * 3 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
- {
- ary_resize_capa(ary, RARRAY_LEN(ary) * 2);
- }
- n = RARRAY_LEN(ary)-1;
- ARY_SET_LEN(ary, n);
- return RARRAY_PTR(ary)[n];
-}
-
/*
* call-seq:
- * ary.pop -> obj or nil
- * ary.pop(n) -> new_ary
- *
- * Removes the last element from +self+ and returns it, or
+ * array.pop -> obj or nil
+ *
+ * Removes the last element from <i>self</i> and returns it, or
* <code>nil</code> if the array is empty.
- *
- * If a number _n_ is given, returns an array of the last n elements
- * (or less) just like <code>array.slice!(-n, n)</code> does.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.pop #=> "d"
- * a.pop(2) #=> ["b", "c"]
- * a #=> ["a"]
+ *
+ * a = [ "a", "m", "z" ]
+ * a.pop #=> "z"
+ * a #=> ["a", "m"]
*/
-static VALUE
-rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_pop(ary)
+ VALUE ary;
{
- VALUE result;
-
- if (argc == 0) {
- return rb_ary_pop(ary);
- }
-
rb_ary_modify_check(ary);
- result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
- ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
- return result;
+ if (RARRAY(ary)->len == 0) return Qnil;
+ if (!FL_TEST(ary, ELTS_SHARED) &&
+ RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
+ RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
+ RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+ }
+ return RARRAY(ary)->ptr[--RARRAY(ary)->len];
}
-VALUE
-rb_ary_shift(VALUE ary)
+static VALUE
+ary_make_shared(ary)
+ VALUE ary;
{
- VALUE top;
-
- rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) == 0) return Qnil;
- top = RARRAY_PTR(ary)[0];
- if (!ARY_SHARED_P(ary)) {
- if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
- MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
- ARY_INCREASE_LEN(ary, -1);
- return top;
- }
- assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+ if (!FL_TEST(ary, ELTS_SHARED)) {
+ NEWOBJ(shared, struct RArray);
+ OBJSETUP(shared, rb_cArray, T_ARRAY);
- RARRAY_PTR(ary)[0] = Qnil;
- ary_make_shared(ary);
+ shared->len = RARRAY(ary)->len;
+ shared->ptr = RARRAY(ary)->ptr;
+ shared->aux.capa = RARRAY(ary)->aux.capa;
+ RARRAY(ary)->aux.shared = (VALUE)shared;
+ FL_SET(ary, ELTS_SHARED);
+ OBJ_FREEZE(shared);
+ return (VALUE)shared;
}
- else if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
- RARRAY_PTR(ary)[0] = Qnil;
+ else {
+ return RARRAY(ary)->aux.shared;
}
- ARY_INCREASE_PTR(ary, 1); /* shift ptr */
- ARY_INCREASE_LEN(ary, -1);
-
- return top;
}
/*
* call-seq:
- * ary.shift -> obj or nil
- * ary.shift(n) -> new_ary
- *
- * Returns the first element of +self+ and removes it (shifting all
+ * array.shift -> obj or nil
+ *
+ * Returns the first element of <i>self</i> and removes it (shifting all
* other elements down by one). Returns <code>nil</code> if the array
* is empty.
- *
- * If a number _n_ is given, returns an array of the first n elements
- * (or less) just like <code>array.slice!(0, n)</code> does.
- *
+ *
* args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
- *
- * args = [ "-m", "-q", "filename" ]
- * args.shift(2) #=> ["-m", "-q"]
- * args #=> ["filename"]
+ * args.shift #=> "-m"
+ * args #=> ["-q", "filename"]
*/
-static VALUE
-rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_shift(ary)
+ VALUE ary;
{
- VALUE result;
- long n;
-
- if (argc == 0) {
- return rb_ary_shift(ary);
- }
+ VALUE top;
rb_ary_modify_check(ary);
- result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
- n = RARRAY_LEN(result);
- if (ARY_SHARED_P(ary)) {
- if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
- rb_mem_clear(RARRAY_PTR(ary), n);
+ if (RARRAY(ary)->len == 0) return Qnil;
+ top = RARRAY(ary)->ptr[0];
+ ary_make_shared(ary);
+ RARRAY(ary)->ptr++; /* shift ptr */
+ RARRAY(ary)->len--;
+
+ return top;
+}
+
+VALUE
+rb_ary_unshift(ary, item)
+ VALUE ary, item;
+{
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
+ long capa_inc = RARRAY(ary)->aux.capa / 2;
+ if (capa_inc < ARY_DEFAULT_SIZE) {
+ capa_inc = ARY_DEFAULT_SIZE;
}
- ARY_INCREASE_PTR(ary, n);
- }
- else {
- MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+n, VALUE, RARRAY_LEN(ary)-n);
+ RARRAY(ary)->aux.capa += capa_inc;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
}
- ARY_INCREASE_LEN(ary, -n);
- return result;
+ /* sliding items */
+ MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+
+ RARRAY(ary)->len++;
+ RARRAY(ary)->ptr[0] = item;
+
+ return ary;
}
/*
* call-seq:
- * ary.unshift(obj, ...) -> ary
- *
- * Prepends objects to the front of +self+,
- * moving other elements upwards.
- *
+ * array.unshift(obj, ...) -> array
+ *
+ * Prepends objects to the front of <i>array</i>.
+ * other elements up one.
+ *
* a = [ "b", "c", "d" ]
* a.unshift("a") #=> ["a", "b", "c", "d"]
* a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
*/
static VALUE
-rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_unshift_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- long len;
+ long len = RARRAY(ary)->len;
- rb_ary_modify(ary);
if (argc == 0) return ary;
- if (ARY_CAPA(ary) <= (len = RARRAY_LEN(ary)) + argc) {
- ary_double_capa(ary, len + argc);
- }
- /* sliding items */
- MEMMOVE(RARRAY_PTR(ary) + argc, RARRAY_PTR(ary), VALUE, len);
- MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
- ARY_INCREASE_LEN(ary, argc);
+ /* make rooms by setting the last item */
+ rb_ary_store(ary, len + argc - 1, Qnil);
+ /* sliding items */
+ MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
+ MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+
return ary;
}
-VALUE
-rb_ary_unshift(VALUE ary, VALUE item)
-{
- return rb_ary_unshift_m(1,&item,ary);
-}
-
/* faster version - use this if you don't need to treat negative offset */
static inline VALUE
-rb_ary_elt(VALUE ary, long offset)
+rb_ary_elt(ary, offset)
+ VALUE ary;
+ long offset;
{
- if (RARRAY_LEN(ary) == 0) return Qnil;
- if (offset < 0 || RARRAY_LEN(ary) <= offset) {
+ if (RARRAY(ary)->len == 0) return Qnil;
+ if (offset < 0 || RARRAY(ary)->len <= offset) {
return Qnil;
}
- return RARRAY_PTR(ary)[offset];
+ return RARRAY(ary)->ptr[offset];
}
VALUE
-rb_ary_entry(VALUE ary, long offset)
+rb_ary_entry(ary, offset)
+ VALUE ary;
+ long offset;
{
if (offset < 0) {
- offset += RARRAY_LEN(ary);
+ offset += RARRAY(ary)->len;
}
return rb_ary_elt(ary, offset);
}
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+static VALUE
+rb_ary_subseq(ary, beg, len)
+ VALUE ary;
+ long beg, len;
{
- VALUE klass;
+ VALUE klass, ary2, shared;
+ VALUE *ptr;
- if (beg > RARRAY_LEN(ary)) return Qnil;
+ if (beg > RARRAY(ary)->len) return Qnil;
if (beg < 0 || len < 0) return Qnil;
- if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
- len = RARRAY_LEN(ary) - beg;
+ if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
+ len = RARRAY(ary)->len - beg;
+ if (len < 0)
+ len = 0;
}
klass = rb_obj_class(ary);
if (len == 0) return ary_new(klass, 0);
- return ary_make_partial(ary, klass, beg, len);
+ shared = ary_make_shared(ary);
+ ptr = RARRAY(ary)->ptr;
+ ary2 = ary_alloc(klass);
+ RARRAY(ary2)->ptr = ptr + beg;
+ RARRAY(ary2)->len = len;
+ RARRAY(ary2)->aux.shared = shared;
+ FL_SET(ary2, ELTS_SHARED);
+
+ return ary2;
}
-/*
+/*
* call-seq:
- * ary[index] -> obj or nil
- * ary[start, length] -> new_ary or nil
- * ary[range] -> new_ary or nil
- * ary.slice(index) -> obj or nil
- * ary.slice(start, length) -> new_ary or nil
- * ary.slice(range) -> new_ary or nil
+ * array[index] -> obj or nil
+ * array[start, length] -> an_array or nil
+ * array[range] -> an_array or nil
+ * array.slice(index) -> obj or nil
+ * array.slice(start, length) -> an_array or nil
+ * array.slice(range) -> an_array or nil
*
* Element Reference---Returns the element at _index_,
* or returns a subarray starting at _start_ and
* continuing for _length_ elements, or returns a subarray
* specified by _range_.
* Negative indices count backward from the end of the
- * array (-1 is the last element). Returns +nil+ if the index
+ * array (-1 is the last element). Returns nil if the index
* (or starting index) are out of range.
*
* a = [ "a", "b", "c", "d", "e" ]
@@ -1011,16 +650,22 @@ rb_ary_subseq(VALUE ary, long beg, long len)
*/
VALUE
-rb_ary_aref(int argc, VALUE *argv, VALUE ary)
+rb_ary_aref(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE arg;
long beg, len;
if (argc == 2) {
+ if (SYMBOL_P(argv[0])) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
beg = NUM2LONG(argv[0]);
len = NUM2LONG(argv[1]);
if (beg < 0) {
- beg += RARRAY_LEN(ary);
+ beg += RARRAY(ary)->len;
}
return rb_ary_subseq(ary, beg, len);
}
@@ -1032,8 +677,11 @@ rb_ary_aref(int argc, VALUE *argv, VALUE ary)
if (FIXNUM_P(arg)) {
return rb_ary_entry(ary, FIX2LONG(arg));
}
+ if (SYMBOL_P(arg)) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
/* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+ switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
case Qfalse:
break;
case Qnil:
@@ -1044,13 +692,15 @@ rb_ary_aref(int argc, VALUE *argv, VALUE ary)
return rb_ary_entry(ary, NUM2LONG(arg));
}
-/*
+/*
* call-seq:
- * ary.at(index) -> obj or nil
+ * array.at(index) -> obj or nil
*
* Returns the element at _index_. A
- * negative index counts from the end of +self+. Returns +nil+
+ * negative index counts from the end of _self_. Returns +nil+
* if the index is out of range. See also <code>Array#[]</code>.
+ * (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
+ * as it does not accept ranges and so on.)
*
* a = [ "a", "b", "c", "d", "e" ]
* a.at(0) #=> "a"
@@ -1058,75 +708,101 @@ rb_ary_aref(int argc, VALUE *argv, VALUE ary)
*/
static VALUE
-rb_ary_at(VALUE ary, VALUE pos)
+rb_ary_at(ary, pos)
+ VALUE ary, pos;
{
return rb_ary_entry(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * ary.first -> obj or nil
- * ary.first(n) -> new_ary
+ * array.first -> obj or nil
+ * array.first(n) -> an_array
*
* Returns the first element, or the first +n+ elements, of the array.
* If the array is empty, the first form returns <code>nil</code>, and the
* second form returns an empty array.
*
* a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(2) #=> ["q", "r"]
+ * a.first #=> "q"
+ * a.first(1) #=> ["q"]
+ * a.first(3) #=> ["q", "r", "s"]
*/
static VALUE
-rb_ary_first(int argc, VALUE *argv, VALUE ary)
+rb_ary_first(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_PTR(ary)[0];
+ if (RARRAY(ary)->len == 0) return Qnil;
+ return RARRAY(ary)->ptr[0];
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ VALUE nv, result;
+ long n, i;
+
+ rb_scan_args(argc, argv, "01", &nv);
+ n = NUM2LONG(nv);
+ if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
+ result = rb_ary_new2(n);
+ for (i=0; i<n; i++) {
+ rb_ary_push(result, RARRAY(ary)->ptr[i]);
+ }
+ return result;
}
}
/*
* call-seq:
- * ary.last -> obj or nil
- * ary.last(n) -> new_ary
- *
- * Returns the last element(s) of +self+. If the array is empty,
+ * array.last -> obj or nil
+ * array.last(n) -> an_array
+ *
+ * Returns the last element(s) of <i>self</i>. If the array is empty,
* the first form returns <code>nil</code>.
- *
- * a = [ "w", "x", "y", "z" ]
- * a.last #=> "z"
- * a.last(2) #=> ["y", "z"]
+ *
+ * [ "w", "x", "y", "z" ].last #=> "z"
*/
-VALUE
-rb_ary_last(int argc, VALUE *argv, VALUE ary)
+static VALUE
+rb_ary_last(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_PTR(ary)[RARRAY_LEN(ary)-1];
+ if (RARRAY(ary)->len == 0) return Qnil;
+ return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ VALUE nv, result;
+ long n, i;
+
+ rb_scan_args(argc, argv, "01", &nv);
+ n = NUM2LONG(nv);
+ if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
+ result = rb_ary_new2(n);
+ for (i=RARRAY(ary)->len-n; n--; i++) {
+ rb_ary_push(result, RARRAY(ary)->ptr[i]);
+ }
+ return result;
}
}
/*
* call-seq:
- * ary.fetch(index) -> obj
- * ary.fetch(index, default ) -> obj
- * ary.fetch(index) {|index| block } -> obj
- *
+ * array.fetch(index) -> obj
+ * array.fetch(index, default ) -> obj
+ * array.fetch(index) {|index| block } -> obj
+ *
* Tries to return the element at position <i>index</i>. If the index
* lies outside the array, the first form throws an
* <code>IndexError</code> exception, the second form returns
* <i>default</i>, and the third form returns the value of invoking
* the block, passing in the index. Negative values of <i>index</i>
* count from the end of the array.
- *
+ *
* a = [ 11, 22, 33, 44 ]
* a.fetch(1) #=> 22
* a.fetch(-1) #=> 44
@@ -1135,7 +811,10 @@ rb_ary_last(int argc, VALUE *argv, VALUE ary)
*/
static VALUE
-rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+rb_ary_fetch(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE pos, ifnone;
long block_given;
@@ -1149,61 +828,40 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
idx = NUM2LONG(pos);
if (idx < 0) {
- idx += RARRAY_LEN(ary);
+ idx += RARRAY(ary)->len;
}
- if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+ if (idx < 0 || RARRAY(ary)->len <= idx) {
if (block_given) return rb_yield(pos);
if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
- idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+ rb_raise(rb_eIndexError, "index %ld out of array", idx);
}
return ifnone;
}
- return RARRAY_PTR(ary)[idx];
+ return RARRAY(ary)->ptr[idx];
}
/*
* call-seq:
- * ary.index(obj) -> int or nil
- * ary.index {|item| block} -> int or nil
- * ary.index -> an_enumerator
- *
- * Returns the index of the first object in +self+ such that the object is
- * <code>==</code> to <i>obj</i>. If a block is given instead of an
- * argument, returns index of first object for which <em>block</em> is true.
- * Returns <code>nil</code> if no match is found.
- * See also <code>Array#rindex</code>.
- *
- * If neither block nor argument is given, an enumerator is returned instead.
- *
+ * array.index(obj) -> int or nil
+ *
+ * Returns the index of the first object in <i>self</i> such that is
+ * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
+ * no match is found.
+ *
* a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
- * a.index{|x|x=="b"} #=> 1
- *
- * This is an alias of <code>#find_index</code>.
+ * a.index("b") #=> 1
+ * a.index("z") #=> nil
*/
static VALUE
-rb_ary_index(int argc, VALUE *argv, VALUE ary)
-{
+rb_ary_index(ary, val)
+ VALUE ary;
VALUE val;
+{
long i;
- if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
- return LONG2NUM(i);
- }
- }
- return Qnil;
- }
- rb_scan_args(argc, argv, "1", &val);
- if (rb_block_given_p())
- rb_warn("given block not used");
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_PTR(ary)[i], val))
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ if (rb_equal(RARRAY(ary)->ptr[i], val))
return LONG2NUM(i);
}
return Qnil;
@@ -1211,173 +869,144 @@ rb_ary_index(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.rindex(obj) -> int or nil
- * ary.rindex {|item| block} -> int or nil
- * ary.rindex -> an_enumerator
- *
- * Returns the index of the last object in +self+
- * <code>==</code> to <i>obj</i>. If a block is given instead of an
- * argument, returns index of first object for which <em>block</em> is
- * true, starting from the last object.
- * Returns <code>nil</code> if no match is found.
- * See also <code>Array#index</code>.
- *
- * If neither block nor argument is given, an enumerator is returned instead.
- *
+ * array.rindex(obj) -> int or nil
+ *
+ * Returns the index of the last object in <i>array</i>
+ * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
+ * no match is found.
+ *
* a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
- * a.rindex { |x| x == "b" } #=> 3
+ * a.rindex("b") #=> 3
+ * a.rindex("z") #=> nil
*/
static VALUE
-rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
-{
+rb_ary_rindex(ary, val)
+ VALUE ary;
VALUE val;
- long i = RARRAY_LEN(ary);
+{
+ long i = RARRAY(ary)->len;
- if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- while (i--) {
- if (RTEST(rb_yield(RARRAY_PTR(ary)[i])))
- return LONG2NUM(i);
- if (i > RARRAY_LEN(ary)) {
- i = RARRAY_LEN(ary);
- }
- }
- return Qnil;
- }
- rb_scan_args(argc, argv, "1", &val);
- if (rb_block_given_p())
- rb_warn("given block not used");
while (i--) {
- if (rb_equal(RARRAY_PTR(ary)[i], val))
- return LONG2NUM(i);
- if (i > RARRAY_LEN(ary)) {
- i = RARRAY_LEN(ary);
+ if (i > RARRAY(ary)->len) {
+ i = RARRAY(ary)->len;
+ continue;
}
+ if (rb_equal(RARRAY(ary)->ptr[i], val))
+ return LONG2NUM(i);
}
return Qnil;
}
-VALUE
-rb_ary_to_ary(VALUE obj)
+/*
+ * call-seq:
+ * array.indexes( i1, i2, ... iN ) -> an_array
+ * array.indices( i1, i2, ... iN ) -> an_array
+ *
+ * Deprecated; use <code>Array#values_at</code>.
+ */
+
+static VALUE
+rb_ary_indexes(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE tmp = rb_check_array_type(obj);
+ VALUE new_ary;
+ long i;
- if (!NIL_P(tmp)) return tmp;
+ rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
+ new_ary = rb_ary_new2(argc);
+ for (i=0; i<argc; i++) {
+ rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
+ }
+
+ return new_ary;
+}
+
+VALUE
+rb_ary_to_ary(obj)
+ VALUE obj;
+{
+ if (TYPE(obj) == T_ARRAY) {
+ return obj;
+ }
+ if (rb_respond_to(obj, rb_intern("to_ary"))) {
+ return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
+ }
return rb_ary_new3(1, obj);
}
static void
-rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
+rb_ary_splice(ary, beg, len, rpl)
+ VALUE ary;
+ long beg, len;
+ VALUE rpl;
{
long rlen;
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
if (beg < 0) {
- beg += RARRAY_LEN(ary);
+ beg += RARRAY(ary)->len;
if (beg < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- beg - RARRAY_LEN(ary), -RARRAY_LEN(ary));
+ beg -= RARRAY(ary)->len;
+ rb_raise(rb_eIndexError, "index %ld out of array", beg);
}
}
- if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
- len = RARRAY_LEN(ary) - beg;
+ if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
+ len = RARRAY(ary)->len - beg;
}
- if (rpl == Qundef) {
+ if (NIL_P(rpl)) {
rlen = 0;
}
else {
rpl = rb_ary_to_ary(rpl);
- rlen = RARRAY_LEN(rpl);
+ rlen = RARRAY(rpl)->len;
}
rb_ary_modify(ary);
- if (beg >= RARRAY_LEN(ary)) {
- if (beg > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", beg);
- }
+
+ if (beg >= RARRAY(ary)->len) {
len = beg + rlen;
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
+ if (len >= RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
+ RARRAY(ary)->aux.capa = len;
}
- rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), beg - RARRAY_LEN(ary));
+ rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
if (rlen > 0) {
- MEMCPY(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
+ MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
}
- ARY_SET_LEN(ary, len);
+ RARRAY(ary)->len = len;
}
else {
long alen;
- alen = RARRAY_LEN(ary) + rlen - len;
- if (alen >= ARY_CAPA(ary)) {
- ary_double_capa(ary, alen);
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
}
- if (len != rlen) {
- MEMMOVE(RARRAY_PTR(ary) + beg + rlen, RARRAY_PTR(ary) + beg + len,
- VALUE, RARRAY_LEN(ary) - (beg + len));
- ARY_SET_LEN(ary, alen);
+ alen = RARRAY(ary)->len + rlen - len;
+ if (alen >= RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
+ RARRAY(ary)->aux.capa = alen;
}
- if (rlen > 0) {
- MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
- }
- }
-}
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary an array
- * \param len new size
- * \return \a ary
- * \post the size of \a ary is \a len.
- */
-VALUE
-rb_ary_resize(VALUE ary, long len)
-{
- long olen;
-
- rb_ary_modify(ary);
- olen = RARRAY_LEN(ary);
- if (len == olen) return ary;
- if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", len);
- }
- if (len > olen) {
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
+ if (len != rlen) {
+ MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
+ VALUE, RARRAY(ary)->len - (beg + len));
+ RARRAY(ary)->len = alen;
}
- rb_mem_clear(RARRAY_PTR(ary) + olen, len - olen);
- ARY_SET_LEN(ary, len);
- }
- else if (ARY_EMBED_P(ary)) {
- ARY_SET_EMBED_LEN(ary, len);
- }
- else if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE tmp[RARRAY_EMBED_LEN_MAX];
- MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
- ary_discard(ary);
- MEMCPY(ARY_EMBED_PTR(ary), tmp, VALUE, len);
- ARY_SET_EMBED_LEN(ary, len);
- }
- else {
- if (olen > len + ARY_DEFAULT_SIZE) {
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len);
- ARY_SET_CAPA(ary, len);
+ if (rlen > 0) {
+ MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
}
- ARY_SET_HEAP_LEN(ary, len);
}
- return ary;
}
-/*
+/*
* call-seq:
- * ary[index] = obj -> obj
- * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
- * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
+ * array[index] = obj -> obj
+ * array[start, length] = obj or an_array or nil -> obj or an_array or nil
+ * array[range] = obj or an_array or nil -> obj or an_array or nil
*
* Element Assignment---Sets the element at _index_,
* or replaces a subarray starting at _start_ and
@@ -1386,10 +1015,11 @@ rb_ary_resize(VALUE ary, long len)
* the current capacity of the array, the array grows
* automatically. A negative indices will count backward
* from the end of the array. Inserts elements if _length_ is
- * zero. An +IndexError+ is raised if a negative index points
- * past the beginning of the array. See also
+ * zero. If +nil+ is used in the second and third form,
+ * deletes elements from _self_. An +IndexError+ is raised if a
+ * negative index points past the beginning of the array. See also
* <code>Array#push</code>, and <code>Array#unshift</code>.
- *
+ *
* a = Array.new
* a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
* a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -1397,31 +1027,38 @@ rb_ary_resize(VALUE ary, long len)
* a[0, 2] = "?" #=> ["?", 2, nil, "4"]
* a[0..2] = "A" #=> ["A", "4"]
* a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A", nil]
- * a[1..-1] = [] #=> ["A"]
+ * a[1..-1] = nil #=> ["A"]
*/
static VALUE
-rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+rb_ary_aset(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long offset, beg, len;
if (argc == 3) {
- rb_ary_modify_check(ary);
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- rb_ary_splice(ary, beg, len, argv[2]);
+ if (SYMBOL_P(argv[0])) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
+ if (SYMBOL_P(argv[1])) {
+ rb_raise(rb_eTypeError, "Symbol as subarray length");
+ }
+ rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
return argv[2];
}
if (argc != 2) {
rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
}
- rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
offset = FIX2LONG(argv[0]);
goto fixnum;
}
- if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+ if (SYMBOL_P(argv[0])) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
+ if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
/* check if idx is Range */
rb_ary_splice(ary, beg, len, argv[1]);
return argv[1];
@@ -1435,29 +1072,31 @@ fixnum:
/*
* call-seq:
- * ary.insert(index, obj...) -> ary
- *
+ * array.insert(index, obj...) -> array
+ *
* Inserts the given values before the element with the given index
* (which may be negative).
- *
+ *
* a = %w{ a b c d }
* a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
* a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
*/
static VALUE
-rb_ary_insert(int argc, VALUE *argv, VALUE ary)
+rb_ary_insert(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long pos;
+ if (argc == 1) return ary;
if (argc < 1) {
rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
}
- rb_ary_modify_check(ary);
- if (argc == 1) return ary;
pos = NUM2LONG(argv[0]);
if (pos == -1) {
- pos = RARRAY_LEN(ary);
+ pos = RARRAY(ary)->len;
}
if (pos < 0) {
pos++;
@@ -1468,61 +1107,53 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.each {|item| block } -> ary
- * ary.each -> an_enumerator
- *
- * Calls <i>block</i> once for each element in +self+, passing that
+ * array.each {|item| block } -> array
+ *
+ * Calls <i>block</i> once for each element in <i>self</i>, passing that
* element as a parameter.
- *
- * If no block is given, an enumerator is returned instead.
- *
+ *
* a = [ "a", "b", "c" ]
* a.each {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* a -- b -- c --
*/
VALUE
-rb_ary_each(VALUE array)
+rb_ary_each(ary)
+ VALUE ary;
{
long i;
- volatile VALUE ary = array;
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_PTR(ary)[i]);
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ rb_yield(RARRAY(ary)->ptr[i]);
}
return ary;
}
/*
* call-seq:
- * ary.each_index {|index| block } -> ary
- * ary.each_index -> an_enumerator
- *
+ * array.each_index {|index| block } -> array
+ *
* Same as <code>Array#each</code>, but passes the index of the element
* instead of the element itself.
- *
- * If no block is given, an enumerator is returned instead.
- *
- *
+ *
* a = [ "a", "b", "c" ]
* a.each_index {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* 0 -- 1 -- 2 --
*/
static VALUE
-rb_ary_each_index(VALUE ary)
+rb_ary_each_index(ary)
+ VALUE ary;
{
long i;
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
+ for (i=0; i<RARRAY(ary)->len; i++) {
rb_yield(LONG2NUM(i));
}
return ary;
@@ -1530,31 +1161,29 @@ rb_ary_each_index(VALUE ary)
/*
* call-seq:
- * ary.reverse_each {|item| block } -> ary
- * ary.reverse_each -> an_enumerator
- *
- * Same as <code>Array#each</code>, but traverses +self+ in reverse
+ * array.reverse_each {|item| block }
+ *
+ * Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
* order.
- *
+ *
* a = [ "a", "b", "c" ]
* a.reverse_each {|x| print x, " " }
- *
+ *
* produces:
- *
+ *
* c b a
*/
static VALUE
-rb_ary_reverse_each(VALUE ary)
+rb_ary_reverse_each(ary)
+ VALUE ary;
{
- long len;
+ long len = RARRAY(ary)->len;
- RETURN_ENUMERATOR(ary, 0, 0);
- len = RARRAY_LEN(ary);
while (len--) {
- rb_yield(RARRAY_PTR(ary)[len]);
- if (RARRAY_LEN(ary) < len) {
- len = RARRAY_LEN(ary);
+ rb_yield(RARRAY(ary)->ptr[len]);
+ if (RARRAY(ary)->len < len) {
+ len = RARRAY(ary)->len;
}
}
return ary;
@@ -1562,268 +1191,286 @@ rb_ary_reverse_each(VALUE ary)
/*
* call-seq:
- * ary.length -> int
- *
- * Returns the number of elements in +self+. May be zero.
- *
+ * array.length -> int
+ *
+ * Returns the number of elements in <i>self</i>. May be zero.
+ *
* [ 1, 2, 3, 4, 5 ].length #=> 5
*/
static VALUE
-rb_ary_length(VALUE ary)
+rb_ary_length(ary)
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- return LONG2NUM(len);
+ return LONG2NUM(RARRAY(ary)->len);
}
/*
* call-seq:
- * ary.empty? -> true or false
- *
- * Returns <code>true</code> if +self+ contains no elements.
- *
+ * array.empty? -> true or false
+ *
+ * Returns <code>true</code> if <i>self</i> array contains no elements.
+ *
* [].empty? #=> true
*/
static VALUE
-rb_ary_empty_p(VALUE ary)
+rb_ary_empty_p(ary)
+ VALUE ary;
{
- if (RARRAY_LEN(ary) == 0)
+ if (RARRAY(ary)->len == 0)
return Qtrue;
return Qfalse;
}
VALUE
-rb_ary_dup(VALUE ary)
+rb_ary_dup(ary)
+ VALUE ary;
{
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
- MEMCPY(RARRAY_PTR(dup), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
- ARY_SET_LEN(dup, RARRAY_LEN(ary));
- return dup;
-}
+ VALUE dup = rb_ary_new2(RARRAY(ary)->len);
-VALUE
-rb_ary_resurrect(VALUE ary)
-{
- return rb_ary_new4(RARRAY_LEN(ary), RARRAY_PTR(ary));
+ DUPSETUP(dup, ary);
+ MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ RARRAY(dup)->len = RARRAY(ary)->len;
+ return dup;
}
extern VALUE rb_output_fs;
-static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
-
static VALUE
-recursive_join(VALUE obj, VALUE argp, int recur)
-{
- VALUE *arg = (VALUE *)argp;
- VALUE ary = arg[0];
- VALUE sep = arg[1];
- VALUE result = arg[2];
- int *first = (int *)arg[3];
-
- if (recur) {
- rb_raise(rb_eArgError, "recursive array join");
- }
- else {
- ary_join_1(obj, ary, sep, 0, result, first);
- }
- return Qnil;
-}
-
-static void
-ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+inspect_join(ary, arg)
+ VALUE ary;
+ VALUE *arg;
{
- long i;
- VALUE val;
-
- if (max > 0) rb_enc_copy(result, RARRAY_PTR(ary)[0]);
- for (i=0; i<max; i++) {
- val = RARRAY_PTR(ary)[i];
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, val);
- if (OBJ_TAINTED(val)) OBJ_TAINT(result);
- if (OBJ_UNTRUSTED(val)) OBJ_TAINT(result);
- }
+ return rb_ary_join(arg[0], arg[1]);
}
-static void
-ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+VALUE
+rb_ary_join(ary, sep)
+ VALUE ary, sep;
{
- VALUE val, tmp;
+ long len = 1, i;
+ int taint = Qfalse;
+ VALUE result, tmp;
- for (; i<RARRAY_LEN(ary); i++) {
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
+ if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+ if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
- val = RARRAY_PTR(ary)[i];
- switch (TYPE(val)) {
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
+ len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
+ }
+ if (!NIL_P(sep)) {
+ StringValue(sep);
+ len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
+ }
+ result = rb_str_buf_new(len);
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ tmp = RARRAY(ary)->ptr[i];
+ switch (TYPE(tmp)) {
case T_STRING:
- str_join:
- rb_str_buf_append(result, val);
- *first = FALSE;
break;
case T_ARRAY:
- obj = val;
- ary_join:
- if (val == ary) {
- rb_raise(rb_eArgError, "recursive array join");
+ if (rb_inspecting_p(tmp)) {
+ tmp = rb_str_new2("[...]");
}
else {
- VALUE args[4];
+ VALUE args[2];
- args[0] = val;
+ args[0] = tmp;
args[1] = sep;
- args[2] = result;
- args[3] = (VALUE)first;
- rb_exec_recursive(recursive_join, obj, (VALUE)args);
+ tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
}
break;
default:
- tmp = rb_check_string_type(val);
- if (!NIL_P(tmp)) {
- val = tmp;
- goto str_join;
- }
- tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
- if (!NIL_P(tmp)) {
- obj = val;
- val = tmp;
- goto ary_join;
- }
- val = rb_obj_as_string(val);
- if (*first) {
- rb_enc_copy(result, val);
- *first = FALSE;
- }
- goto str_join;
- }
- }
-}
-
-VALUE
-rb_ary_join(VALUE ary, VALUE sep)
-{
- long len = 1, i;
- int taint = FALSE;
- int untrust = FALSE;
- VALUE val, tmp, result;
-
- if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
- if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = TRUE;
- if (OBJ_UNTRUSTED(ary) || OBJ_UNTRUSTED(sep)) untrust = TRUE;
-
- if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
- }
- for (i=0; i<RARRAY_LEN(ary); i++) {
- val = RARRAY_PTR(ary)[i];
- tmp = rb_check_string_type(val);
-
- if (NIL_P(tmp) || tmp != val) {
- int first;
- result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
- rb_enc_associate(result, rb_usascii_encoding());
- if (taint) OBJ_TAINT(result);
- if (untrust) OBJ_UNTRUST(result);
- ary_join_0(ary, sep, i, result);
- first = i == 0;
- ary_join_1(ary, ary, sep, i, result, &first);
- return result;
+ tmp = rb_obj_as_string(tmp);
}
-
- len += RSTRING_LEN(tmp);
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, tmp);
+ if (OBJ_TAINTED(tmp)) taint = Qtrue;
}
- result = rb_str_buf_new(len);
if (taint) OBJ_TAINT(result);
- if (untrust) OBJ_UNTRUST(result);
- ary_join_0(ary, sep, RARRAY_LEN(ary), result);
-
return result;
}
/*
* call-seq:
- * ary.join(sep=$,) -> str
- *
+ * array.join(sep=$,) -> str
+ *
* Returns a string created by converting each element of the array to
* a string, separated by <i>sep</i>.
- *
+ *
* [ "a", "b", "c" ].join #=> "abc"
* [ "a", "b", "c" ].join("-") #=> "a-b-c"
*/
static VALUE
-rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_join_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE sep;
rb_scan_args(argc, argv, "01", &sep);
if (NIL_P(sep)) sep = rb_output_fs;
-
+
return rb_ary_join(ary, sep);
}
+/*
+ * call-seq:
+ * array.to_s -> string
+ *
+ * Returns _self_<code>.join</code>.
+ *
+ * [ "a", "e", "i", "o" ].to_s #=> "aeio"
+ *
+ */
+
+VALUE
+rb_ary_to_s(ary)
+ VALUE ary;
+{
+ if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+
+ return rb_ary_join(ary, rb_output_fs);
+}
+
+static ID inspect_key;
+
+struct inspect_arg {
+ VALUE (*func)();
+ VALUE arg1, arg2;
+};
+
+static VALUE
+inspect_call(arg)
+ struct inspect_arg *arg;
+{
+ return (*arg->func)(arg->arg1, arg->arg2);
+}
+
static VALUE
-inspect_ary(VALUE ary, VALUE dummy, int recur)
+get_inspect_tbl(create)
+ int create;
+{
+ VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
+
+ if (NIL_P(inspect_tbl)) {
+ if (create) {
+ tbl_init:
+ inspect_tbl = rb_ary_new();
+ rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
+ }
+ }
+ else if (TYPE(inspect_tbl) != T_ARRAY) {
+ rb_warn("invalid inspect_tbl value");
+ if (create) goto tbl_init;
+ rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
+ return Qnil;
+ }
+ return inspect_tbl;
+}
+
+static VALUE
+inspect_ensure(obj)
+ VALUE obj;
+{
+ VALUE inspect_tbl;
+
+ inspect_tbl = get_inspect_tbl(Qfalse);
+ if (!NIL_P(inspect_tbl)) {
+ rb_ary_pop(inspect_tbl);
+ }
+ return 0;
+}
+
+VALUE
+rb_protect_inspect(func, obj, arg)
+ VALUE (*func)(ANYARGS);
+ VALUE obj, arg;
+{
+ struct inspect_arg iarg;
+ VALUE inspect_tbl;
+ VALUE id;
+
+ inspect_tbl = get_inspect_tbl(Qtrue);
+ id = rb_obj_id(obj);
+ if (rb_ary_includes(inspect_tbl, id)) {
+ return (*func)(obj, arg);
+ }
+ rb_ary_push(inspect_tbl, id);
+ iarg.func = func;
+ iarg.arg1 = obj;
+ iarg.arg2 = arg;
+
+ return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
+}
+
+VALUE
+rb_inspecting_p(obj)
+ VALUE obj;
+{
+ VALUE inspect_tbl;
+
+ inspect_tbl = get_inspect_tbl(Qfalse);
+ if (NIL_P(inspect_tbl)) return Qfalse;
+ return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
+}
+
+static VALUE
+inspect_ary(ary)
+ VALUE ary;
{
int tainted = OBJ_TAINTED(ary);
- int untrust = OBJ_UNTRUSTED(ary);
long i;
VALUE s, str;
- if (recur) return rb_usascii_str_new_cstr("[...]");
str = rb_str_buf_new2("[");
- for (i=0; i<RARRAY_LEN(ary); i++) {
- s = rb_inspect(RARRAY_PTR(ary)[i]);
- if (OBJ_TAINTED(s)) tainted = TRUE;
- if (OBJ_UNTRUSTED(s)) untrust = TRUE;
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ s = rb_inspect(RARRAY(ary)->ptr[i]);
+ if (OBJ_TAINTED(s)) tainted = Qtrue;
if (i > 0) rb_str_buf_cat2(str, ", ");
- else rb_enc_copy(str, s);
rb_str_buf_append(str, s);
}
rb_str_buf_cat2(str, "]");
if (tainted) OBJ_TAINT(str);
- if (untrust) OBJ_UNTRUST(str);
return str;
}
/*
* call-seq:
- * ary.to_s -> string
- * ary.inspect -> string
+ * array.inspect -> string
*
- * Creates a string representation of +self+.
+ * Create a printable version of <i>array</i>.
*/
static VALUE
-rb_ary_inspect(VALUE ary)
-{
- if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
- return rb_exec_recursive(inspect_ary, ary, 0);
-}
-
-VALUE
-rb_ary_to_s(VALUE ary)
+rb_ary_inspect(ary)
+ VALUE ary;
{
- return rb_ary_inspect(ary);
+ if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
+ if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
+ return rb_protect_inspect(inspect_ary, ary, 0);
}
/*
* call-seq:
- * ary.to_a -> ary
- *
- * Returns +self+. If called on a subclass of Array, converts
+ * array.to_a -> array
+ *
+ * Returns _self_. If called on a subclass of Array, converts
* the receiver to an Array object.
*/
static VALUE
-rb_ary_to_a(VALUE ary)
+rb_ary_to_a(ary)
+ VALUE ary;
{
if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+ VALUE dup = rb_ary_new2(RARRAY(ary)->len);
rb_ary_replace(dup, ary);
return dup;
}
@@ -1832,448 +1479,267 @@ rb_ary_to_a(VALUE ary)
/*
* call-seq:
- * ary.to_ary -> ary
- *
- * Returns +self+.
+ * array.to_ary -> array
+ *
+ * Returns _self_.
*/
static VALUE
-rb_ary_to_ary_m(VALUE ary)
+rb_ary_to_ary_m(ary)
+ VALUE ary;
{
return ary;
}
-static void
-ary_reverse(p1, p2)
- VALUE *p1, *p2;
-{
- while (p1 < p2) {
- VALUE tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
- }
-}
-
VALUE
-rb_ary_reverse(VALUE ary)
+rb_ary_reverse(ary)
+ VALUE ary;
{
VALUE *p1, *p2;
+ VALUE tmp;
rb_ary_modify(ary);
- if (RARRAY_LEN(ary) > 1) {
- p1 = RARRAY_PTR(ary);
- p2 = p1 + RARRAY_LEN(ary) - 1; /* points last item */
- ary_reverse(p1, p2);
+ if (RARRAY(ary)->len > 1) {
+ p1 = RARRAY(ary)->ptr;
+ p2 = p1 + RARRAY(ary)->len - 1; /* points last item */
+
+ while (p1 < p2) {
+ tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
+ }
}
return ary;
}
/*
* call-seq:
- * ary.reverse! -> ary
- *
- * Reverses +self+ in place.
- *
+ * array.reverse! -> array
+ *
+ * Reverses _self_ in place.
+ *
* a = [ "a", "b", "c" ]
* a.reverse! #=> ["c", "b", "a"]
* a #=> ["c", "b", "a"]
*/
static VALUE
-rb_ary_reverse_bang(VALUE ary)
+rb_ary_reverse_bang(ary)
+ VALUE ary;
{
return rb_ary_reverse(ary);
}
/*
* call-seq:
- * ary.reverse -> new_ary
- *
- * Returns a new array containing +self+'s elements in reverse order.
- *
+ * array.reverse -> an_array
+ *
+ * Returns a new array containing <i>self</i>'s elements in reverse order.
+ *
* [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
* [ 1 ].reverse #=> [1]
*/
static VALUE
-rb_ary_reverse_m(VALUE ary)
-{
- long len = RARRAY_LEN(ary);
- VALUE dup = rb_ary_new2(len);
-
- if (len > 0) {
- VALUE *p1 = RARRAY_PTR(ary);
- VALUE *p2 = RARRAY_PTR(dup) + len - 1;
- do *p2-- = *p1++; while (--len > 0);
- }
- ARY_SET_LEN(dup, RARRAY_LEN(ary));
- return dup;
-}
-
-static inline long
-rotate_count(long cnt, long len)
-{
- return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
-}
-
-VALUE
-rb_ary_rotate(VALUE ary, long cnt)
-{
- rb_ary_modify(ary);
-
- if (cnt != 0) {
- VALUE *ptr = RARRAY_PTR(ary);
- long len = RARRAY_LEN(ary);
-
- if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
- --len;
- if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
- if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
- if (len > 0) ary_reverse(ptr, ptr + len);
- return ary;
- }
- }
-
- return Qnil;
-}
-
-/*
- * call-seq:
- * ary.rotate!(cnt=1) -> ary
- *
- * Rotates +self+ in place so that the element at +cnt+ comes first,
- * and returns +self+. If +cnt+ is negative then it rotates in
- * the opposite direction.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate! #=> ["b", "c", "d", "a"]
- * a #=> ["b", "c", "d", "a"]
- * a.rotate!(2) #=> ["d", "a", "b", "c"]
- * a.rotate!(-3) #=> ["a", "b", "c", "d"]
- */
-
-static VALUE
-rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
-{
- long n = 1;
-
- switch (argc) {
- case 1: n = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
- rb_ary_rotate(ary, n);
- return ary;
-}
-
-/*
- * call-seq:
- * ary.rotate(cnt=1) -> new_ary
- *
- * Returns new array by rotating +self+ so that the element at
- * +cnt+ in +self+ is the first element of the new array. If +cnt+
- * is negative then it rotates in the opposite direction.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate #=> ["b", "c", "d", "a"]
- * a #=> ["a", "b", "c", "d"]
- * a.rotate(2) #=> ["c", "d", "a", "b"]
- * a.rotate(-3) #=> ["b", "c", "d", "a"]
- */
-
-static VALUE
-rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_reverse_m(ary)
+ VALUE ary;
{
- VALUE rotated, *ptr, *ptr2;
- long len, cnt = 1;
-
- switch (argc) {
- case 1: cnt = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
-
- len = RARRAY_LEN(ary);
- rotated = rb_ary_new2(len);
- if (len > 0) {
- cnt = rotate_count(cnt, len);
- ptr = RARRAY_PTR(ary);
- ptr2 = RARRAY_PTR(rotated);
- len -= cnt;
- MEMCPY(ptr2, ptr + cnt, VALUE, len);
- MEMCPY(ptr2 + len, ptr, VALUE, cnt);
- }
- ARY_SET_LEN(rotated, RARRAY_LEN(ary));
- return rotated;
+ return rb_ary_reverse(rb_ary_dup(ary));
}
struct ary_sort_data {
VALUE ary;
- int opt_methods;
- int opt_inited;
-};
-
-enum {
- sort_opt_Fixnum,
- sort_opt_String,
- sort_optimizable_count
+ VALUE *ptr;
+ long len;
};
-#define STRING_P(s) (TYPE(s) == T_STRING && CLASS_OF(s) == rb_cString)
-
-#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
-#define SORT_OPTIMIZABLE(data, type) \
- (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
- ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
- (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
- rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
- ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
-
-static VALUE
-sort_reentered(VALUE ary)
+static void
+ary_sort_check(data)
+ struct ary_sort_data *data;
{
- if (RBASIC(ary)->klass) {
- rb_raise(rb_eRuntimeError, "sort reentered");
+ if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
+ rb_raise(rb_eArgError, "array modified during sort");
}
- return Qnil;
}
static int
-sort_1(const void *ap, const void *bp, void *dummy)
+sort_1(a, b, data)
+ VALUE *a, *b;
+ struct ary_sort_data *data;
{
- struct ary_sort_data *data = dummy;
- VALUE retval = sort_reentered(data->ary);
- VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ VALUE retval = rb_yield_values(2, *a, *b);
int n;
- retval = rb_yield_values(2, a, b);
- n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ n = rb_cmpint(retval, *a, *b);
+ ary_sort_check(data);
return n;
}
static int
-sort_2(const void *ap, const void *bp, void *dummy)
+sort_2(ap, bp, data)
+ VALUE *ap, *bp;
+ struct ary_sort_data *data;
{
- struct ary_sort_data *data = dummy;
- VALUE retval = sort_reentered(data->ary);
- VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ VALUE retval;
+ VALUE a = *ap, b = *bp;
int n;
- if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
+ if (FIXNUM_P(a) && FIXNUM_P(b)) {
if ((long)a > (long)b) return 1;
if ((long)a < (long)b) return -1;
return 0;
}
- if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
- return rb_str_cmp(a, b);
+ if (TYPE(a) == T_STRING) {
+ if (TYPE(b) == T_STRING) return rb_str_cmp(a, b);
}
retval = rb_funcall(a, id_cmp, 1, b);
n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ ary_sort_check(data);
return n;
}
+static VALUE
+sort_internal(ary)
+ VALUE ary;
+{
+ struct ary_sort_data data;
+
+ data.ary = ary;
+ data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
+ qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
+ return ary;
+}
+
+static VALUE
+sort_unlock(ary)
+ VALUE ary;
+{
+ FL_UNSET(ary, ARY_TMPLOCK);
+ return ary;
+}
+
/*
* call-seq:
- * ary.sort! -> ary
- * ary.sort! {| a,b | block } -> ary
- *
- * Sorts +self+. Comparisons for
+ * array.sort! -> array
+ * array.sort! {| a,b | block } -> array
+ *
+ * Sorts _self_. Comparisons for
* the sort will be done using the <code><=></code> operator or using
* an optional code block. The block implements a comparison between
* <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
* <code>Enumerable#sort_by</code>.
- *
+ *
* a = [ "d", "a", "e", "c", "b" ]
- * a.sort! #=> ["a", "b", "c", "d", "e"]
- * a.sort! {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * a.sort #=> ["a", "b", "c", "d", "e"]
+ * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
VALUE
-rb_ary_sort_bang(VALUE ary)
+rb_ary_sort_bang(ary)
+ VALUE ary;
{
rb_ary_modify(ary);
- assert(!ARY_SHARED_P(ary));
- if (RARRAY_LEN(ary) > 1) {
- VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
- struct ary_sort_data data;
-
- RBASIC(tmp)->klass = 0;
- data.ary = tmp;
- data.opt_methods = 0;
- data.opt_inited = 0;
- ruby_qsort(RARRAY_PTR(tmp), RARRAY_LEN(tmp), sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
-
- if (ARY_EMBED_P(tmp)) {
- assert(ARY_EMBED_P(tmp));
- if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
- rb_ary_unshare(ary);
- }
- FL_SET_EMBED(ary);
- MEMCPY(RARRAY_PTR(ary), ARY_EMBED_PTR(tmp), VALUE, ARY_EMBED_LEN(tmp));
- ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
- }
- else {
- assert(!ARY_EMBED_P(tmp));
- if (ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
- assert(!ARY_EMBED_P(ary));
- FL_UNSET_SHARED(ary);
- ARY_SET_CAPA(ary, ARY_CAPA(tmp));
- }
- else {
- assert(!ARY_SHARED_P(tmp));
- if (ARY_EMBED_P(ary)) {
- FL_UNSET_EMBED(ary);
- }
- else if (ARY_SHARED_P(ary)) {
- /* ary might be destructively operated in the given block */
- rb_ary_unshare(ary);
- }
- else {
- xfree(ARY_HEAP_PTR(ary));
- }
- ARY_SET_PTR(ary, RARRAY_PTR(tmp));
- ARY_SET_HEAP_LEN(ary, RARRAY_LEN(tmp));
- ARY_SET_CAPA(ary, ARY_CAPA(tmp));
- }
- /* tmp was lost ownership for the ptr */
- FL_UNSET(tmp, FL_FREEZE);
- FL_SET_EMBED(tmp);
- ARY_SET_EMBED_LEN(tmp, 0);
- FL_SET(tmp, FL_FREEZE);
- }
- /* tmp will be GC'ed. */
- RBASIC(tmp)->klass = rb_cArray;
+ if (RARRAY(ary)->len > 1) {
+ FL_SET(ary, ARY_TMPLOCK); /* prohibit modification during sort */
+ rb_ensure(sort_internal, ary, sort_unlock, ary);
}
return ary;
}
/*
* call-seq:
- * ary.sort -> new_ary
- * ary.sort {| a,b | block } -> new_ary
- *
- * Returns a new array created by sorting +self+. Comparisons for
+ * array.sort -> an_array
+ * array.sort {| a,b | block } -> an_array
+ *
+ * Returns a new array created by sorting <i>self</i>. Comparisons for
* the sort will be done using the <code><=></code> operator or using
* an optional code block. The block implements a comparison between
* <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
* <code>Enumerable#sort_by</code>.
- *
+ *
* a = [ "d", "a", "e", "c", "b" ]
* a.sort #=> ["a", "b", "c", "d", "e"]
* a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
VALUE
-rb_ary_sort(VALUE ary)
+rb_ary_sort(ary)
+ VALUE ary;
{
ary = rb_ary_dup(ary);
rb_ary_sort_bang(ary);
return ary;
}
-
-static VALUE
-sort_by_i(VALUE i)
-{
- return rb_yield(i);
-}
-
/*
* call-seq:
- * ary.sort_by! {| obj | block } -> ary
- * ary.sort_by! -> an_enumerator
- *
- * Sorts +self+ in place using a set of keys generated by mapping the
- * values in +self+ through the given block.
- *
- * If no block is given, an enumerator is returned instead.
- *
- */
-
-static VALUE
-rb_ary_sort_by_bang(VALUE ary)
-{
- VALUE sorted;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- rb_ary_modify(ary);
- sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
- rb_ary_replace(ary, sorted);
- return ary;
-}
-
-
-/*
- * call-seq:
- * ary.collect {|item| block } -> new_ary
- * ary.map {|item| block } -> new_ary
- * ary.collect -> an_enumerator
- * ary.map -> an_enumerator
- *
- * Invokes <i>block</i> once for each element of +self+. Creates a
+ * array.collect {|item| block } -> an_array
+ * array.map {|item| block } -> an_array
+ *
+ * Invokes <i>block</i> once for each element of <i>self</i>. Creates a
* new array containing the values returned by the block.
* See also <code>Enumerable#collect</code>.
- *
- * If no block is given, an enumerator is returned instead.
- *
+ *
* a = [ "a", "b", "c", "d" ]
* a.collect {|x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
* a #=> ["a", "b", "c", "d"]
*/
static VALUE
-rb_ary_collect(VALUE ary)
+rb_ary_collect(ary)
+ VALUE ary;
{
long i;
VALUE collect;
- RETURN_ENUMERATOR(ary, 0, 0);
- collect = rb_ary_new2(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_push(collect, rb_yield(RARRAY_PTR(ary)[i]));
+ if (!rb_block_given_p()) {
+ return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
+ }
+
+ collect = rb_ary_new2(RARRAY(ary)->len);
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
}
return collect;
}
-
-/*
+/*
* call-seq:
- * ary.collect! {|item| block } -> ary
- * ary.map! {|item| block } -> ary
- * ary.collect -> an_enumerator
- * ary.map -> an_enumerator
+ * array.collect! {|item| block } -> array
+ * array.map! {|item| block } -> array
*
- * Invokes the block once for each element of +self+, replacing the
+ * Invokes the block once for each element of _self_, replacing the
* element with the value returned by _block_.
* See also <code>Enumerable#collect</code>.
- *
- * If no block is given, an enumerator is returned instead.
- *
+ *
* a = [ "a", "b", "c", "d" ]
* a.collect! {|x| x + "!" }
* a #=> [ "a!", "b!", "c!", "d!" ]
*/
static VALUE
-rb_ary_collect_bang(VALUE ary)
+rb_ary_collect_bang(ary)
+ VALUE ary;
{
long i;
- RETURN_ENUMERATOR(ary, 0, 0);
rb_ary_modify(ary);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY_PTR(ary)[i]));
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
}
return ary;
}
VALUE
-rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VALUE, long))
+rb_values_at(obj, olen, argc, argv, func)
+ VALUE obj;
+ long olen;
+ int argc;
+ VALUE *argv;
+ VALUE (*func) _((VALUE,long));
{
VALUE result = rb_ary_new2(argc);
long beg, len, i, j;
@@ -2300,15 +1766,15 @@ rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VAL
return result;
}
-/*
+/*
* call-seq:
- * ary.values_at(selector,... ) -> new_ary
+ * array.values_at(selector,... ) -> an_array
*
* Returns an array containing the elements in
- * +self+ corresponding to the given selector(s). The selectors
- * may be either integer indices or ranges.
+ * _self_ corresponding to the given selector(s). The selectors
+ * may be either integer indices or ranges.
* See also <code>Array#select</code>.
- *
+ *
* a = %w{ a b c d e f }
* a.values_at(1, 3, 5)
* a.values_at(1, 3, 5, 7)
@@ -2317,37 +1783,36 @@ rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VAL
*/
static VALUE
-rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+rb_ary_values_at(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+ return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
}
-
/*
* call-seq:
- * ary.select {|item| block } -> new_ary
- * ary.select -> an_enumerator
- *
- * Invokes the block passing in successive elements from +self+,
+ * array.select {|item| block } -> an_array
+ *
+ * Invokes the block passing in successive elements from <i>array</i>,
* returning an array containing those elements for which the block
* returns a true value (equivalent to <code>Enumerable#select</code>).
- *
- * If no block is given, an enumerator is returned instead.
- *
+ *
* a = %w{ a b c d e f }
* a.select {|v| v =~ /[aeiou]/} #=> ["a", "e"]
*/
static VALUE
-rb_ary_select(VALUE ary)
+rb_ary_select(ary)
+ VALUE ary;
{
VALUE result;
long i;
- RETURN_ENUMERATOR(ary, 0, 0);
- result = rb_ary_new2(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
+ result = rb_ary_new2(RARRAY(ary)->len);
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
rb_ary_push(result, rb_ary_elt(ary, i));
}
}
@@ -2356,76 +1821,14 @@ rb_ary_select(VALUE ary)
/*
* call-seq:
- * ary.select! {|item| block } -> ary or nil
- * ary.select! -> an_enumerator
- *
- * Invokes the block passing in successive elements from
- * +self+, deleting elements for which the block returns a
- * false value. It returns +self+ if changes were made,
- * otherwise it returns <code>nil</code>.
- * See also <code>Array#keep_if</code>
- *
- * If no block is given, an enumerator is returned instead.
- *
- */
-
-static VALUE
-rb_ary_select_bang(VALUE ary)
-{
- long i1, i2;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE v = RARRAY_PTR(ary)[i1];
- if (!RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- i2++;
- }
-
- if (RARRAY_LEN(ary) == i2) return Qnil;
- if (i2 < RARRAY_LEN(ary))
- ARY_SET_LEN(ary, i2);
- return ary;
-}
-
-/*
- * call-seq:
- * ary.keep_if {|item| block } -> ary
- * ary.keep_if -> an_enumerator
- *
- * Deletes every element of +self+ for which <i>block</i> evaluates
- * to false.
- * See also <code>Array#select!</code>
- *
- * If no block is given, an enumerator is returned instead.
- *
- * a = %w{ a b c d e f }
- * a.keep_if {|v| v =~ /[aeiou]/} #=> ["a", "e"]
- */
-
-static VALUE
-rb_ary_keep_if(VALUE ary)
-{
- RETURN_ENUMERATOR(ary, 0, 0);
- rb_ary_select_bang(ary);
- return ary;
-}
-
-/*
- * call-seq:
- * ary.delete(obj) -> obj or nil
- * ary.delete(obj) { block } -> obj or nil
- *
- * Deletes items from +self+ that are equal to <i>obj</i>.
- * If any items are found, returns <i>obj</i>. If
+ * array.delete(obj) -> obj or nil
+ * array.delete(obj) { block } -> obj or nil
+ *
+ * Deletes items from <i>self</i> that are equal to <i>obj</i>. If
* the item is not found, returns <code>nil</code>. If the optional
* code block is given, returns the result of <i>block</i> if the item
- * is not found. (To remove <code>nil</code> elements and
- * get an informative return value, use #compact!)
- *
+ * is not found.
+ *
* a = [ "a", "b", "b", "b", "c" ]
* a.delete("b") #=> "b"
* a #=> ["a", "c"]
@@ -2434,24 +1837,22 @@ rb_ary_keep_if(VALUE ary)
*/
VALUE
-rb_ary_delete(VALUE ary, VALUE item)
+rb_ary_delete(ary, item)
+ VALUE ary;
+ VALUE item;
{
- VALUE v = item;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_PTR(ary)[i1];
+ for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+ VALUE e = RARRAY(ary)->ptr[i1];
- if (rb_equal(e, item)) {
- v = e;
- continue;
- }
+ if (rb_equal(e, item)) continue;
if (i1 != i2) {
rb_ary_store(ary, i2, e);
}
i2++;
}
- if (RARRAY_LEN(ary) == i2) {
+ if (RARRAY(ary)->len == i2) {
if (rb_block_given_p()) {
return rb_yield(item);
}
@@ -2459,21 +1860,24 @@ rb_ary_delete(VALUE ary, VALUE item)
}
rb_ary_modify(ary);
- if (RARRAY_LEN(ary) > i2) {
- ARY_SET_LEN(ary, i2);
- if (i2 * 2 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
- ary_resize_capa(ary, i2*2);
+ if (RARRAY(ary)->len > i2) {
+ RARRAY(ary)->len = i2;
+ if (i2 * 2 < RARRAY(ary)->aux.capa &&
+ RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
+ RARRAY(ary)->aux.capa = i2 * 2;
}
}
- return v;
+ return item;
}
VALUE
-rb_ary_delete_at(VALUE ary, long pos)
+rb_ary_delete_at(ary, pos)
+ VALUE ary;
+ long pos;
{
- long len = RARRAY_LEN(ary);
+ long i, len = RARRAY(ary)->len;
VALUE del;
if (pos >= len) return Qnil;
@@ -2483,22 +1887,23 @@ rb_ary_delete_at(VALUE ary, long pos)
}
rb_ary_modify(ary);
- del = RARRAY_PTR(ary)[pos];
- MEMMOVE(RARRAY_PTR(ary)+pos, RARRAY_PTR(ary)+pos+1, VALUE,
- RARRAY_LEN(ary)-pos-1);
- ARY_INCREASE_LEN(ary, -1);
+ del = RARRAY(ary)->ptr[pos];
+ for (i = pos + 1; i < len; i++, pos++) {
+ RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
+ }
+ RARRAY(ary)->len = pos;
return del;
}
/*
* call-seq:
- * ary.delete_at(index) -> obj or nil
- *
+ * array.delete_at(index) -> obj or nil
+ *
* Deletes the element at the specified index, returning that element,
* or <code>nil</code> if the index is out of range. See also
* <code>Array#slice!</code>.
- *
+ *
* a = %w( ant bat cat dog )
* a.delete_at(2) #=> "cat"
* a #=> ["ant", "bat", "dog"]
@@ -2506,21 +1911,28 @@ rb_ary_delete_at(VALUE ary, long pos)
*/
static VALUE
-rb_ary_delete_at_m(VALUE ary, VALUE pos)
+rb_ary_delete_at_m(ary, pos)
+ VALUE ary, pos;
{
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * ary.slice!(index) -> obj or nil
- * ary.slice!(start, length) -> new_ary or nil
- * ary.slice!(range) -> new_ary or nil
- *
+ * array.slice!(index) -> obj or nil
+ * array.slice!(start, length) -> sub_array or nil
+ * array.slice!(range) -> sub_array or nil
+ *
* Deletes the element(s) given by an index (optionally with a length)
- * or by a range. Returns the deleted object (or objects), or
- * <code>nil</code> if the index is out of range.
- *
+ * or by a range. Returns the deleted object, subarray, or
+ * <code>nil</code> if the index is out of range. Equivalent to:
+ *
+ * def slice!(*args)
+ * result = self[*args]
+ * self[*args] = nil
+ * result
+ * end
+ *
* a = [ "a", "b", "c" ]
* a.slice!(1) #=> "b"
* a #=> ["a", "c"]
@@ -2531,269 +1943,194 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
*/
static VALUE
-rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_slice_bang(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE arg1, arg2;
- long pos, len, orig_len;
+ long pos, len;
- rb_ary_modify_check(ary);
- if (argc == 2) {
- pos = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
+ if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
+ pos = NUM2LONG(arg1);
+ len = NUM2LONG(arg2);
delete_pos_len:
- if (len < 0) return Qnil;
- orig_len = RARRAY_LEN(ary);
if (pos < 0) {
- pos += orig_len;
- if (pos < 0) return Qnil;
- }
- else if (orig_len < pos) return Qnil;
- if (orig_len < pos + len) {
- len = orig_len - pos;
+ pos = RARRAY(ary)->len + pos;
}
- if (len == 0) return rb_ary_new2(0);
- arg2 = rb_ary_new4(len, RARRAY_PTR(ary)+pos);
- RBASIC(arg2)->klass = rb_obj_class(ary);
- rb_ary_splice(ary, pos, len, Qundef);
+ arg2 = rb_ary_subseq(ary, pos, len);
+ rb_ary_splice(ary, pos, len, Qnil); /* Qnil/rb_ary_new2(0) */
return arg2;
}
- if (argc != 1) {
- /* error report */
- rb_scan_args(argc, argv, "11", NULL, NULL);
- }
- arg1 = argv[0];
-
- if (!FIXNUM_P(arg1)) {
- switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
- case Qtrue:
- /* valid range */
- goto delete_pos_len;
- case Qnil:
- /* invalid range */
- return Qnil;
- default:
- /* not a range */
- break;
- }
+ if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
+ goto delete_pos_len;
}
return rb_ary_delete_at(ary, NUM2LONG(arg1));
}
-static VALUE
-ary_reject(VALUE orig, VALUE result)
-{
- long i;
-
- for (i = 0; i < RARRAY_LEN(orig); i++) {
- VALUE v = RARRAY_PTR(orig)[i];
- if (!RTEST(rb_yield(v))) {
- rb_ary_push_1(result, v);
- }
- }
- return result;
-}
-
-static VALUE
-ary_reject_bang(VALUE ary)
-{
- long i;
- VALUE result = Qnil;
-
- rb_ary_modify_check(ary);
- for (i = 0; i < RARRAY_LEN(ary); ) {
- VALUE v = RARRAY_PTR(ary)[i];
- if (RTEST(rb_yield(v))) {
- rb_ary_delete_at(ary, i);
- result = ary;
- }
- else {
- i++;
- }
- }
- return result;
-}
-
/*
* call-seq:
- * ary.reject! {|item| block } -> ary or nil
- * ary.reject! -> an_enumerator
- *
+ * array.reject! {|item| block } -> array or nil
+ *
* Equivalent to <code>Array#delete_if</code>, deleting elements from
- * +self+ for which the block evaluates to true, but returns
- * <code>nil</code> if no changes were made.
- * The array is changed instantly every time the block is called and
- * not after the iteration is over.
- * See also <code>Enumerable#reject</code> and <code>Array#delete_if</code>.
- *
- * If no block is given, an enumerator is returned instead.
- *
+ * _self_ for which the block evaluates to true, but returns
+ * <code>nil</code> if no changes were made. Also see
+ * <code>Enumerable#reject</code>.
*/
static VALUE
-rb_ary_reject_bang(VALUE ary)
+rb_ary_reject_bang(ary)
+ VALUE ary;
{
- RETURN_ENUMERATOR(ary, 0, 0);
- return ary_reject_bang(ary);
+ long i1, i2;
+
+ rb_ary_modify(ary);
+ for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+ VALUE v = RARRAY(ary)->ptr[i1];
+ if (RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ i2++;
+ }
+ if (RARRAY(ary)->len == i2) return Qnil;
+ if (i2 < RARRAY(ary)->len)
+ RARRAY(ary)->len = i2;
+
+ return ary;
}
/*
* call-seq:
- * ary.reject {|item| block } -> new_ary
- * ary.reject -> an_enumerator
- *
- * Returns a new array containing the items in +self+
+ * array.reject {|item| block } -> an_array
+ *
+ * Returns a new array containing the items in _self_
* for which the block is not true.
- * See also <code>Array#delete_if</code>
- *
- * If no block is given, an enumerator is returned instead.
- *
*/
static VALUE
-rb_ary_reject(VALUE ary)
+rb_ary_reject(ary)
+ VALUE ary;
{
- VALUE rejected_ary;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- rejected_ary = rb_ary_new();
- ary_reject(ary, rejected_ary);
- return rejected_ary;
+ ary = rb_ary_dup(ary);
+ rb_ary_reject_bang(ary);
+ return ary;
}
/*
* call-seq:
- * ary.delete_if {|item| block } -> ary
- * ary.delete_if -> an_enumerator
- *
- * Deletes every element of +self+ for which <i>block</i> evaluates
- * to true.
- * The array is changed instantly every time the block is called and
- * not after the iteration is over.
- * See also <code>Array#reject!</code>
- *
- * If no block is given, an enumerator is returned instead.
- *
+ * array.delete_if {|item| block } -> array
+ *
+ * Deletes every element of <i>self</i> for which <i>block</i> evaluates
+ * to <code>true</code>.
+ *
* a = [ "a", "b", "c" ]
* a.delete_if {|x| x >= "b" } #=> ["a"]
*/
static VALUE
-rb_ary_delete_if(VALUE ary)
+rb_ary_delete_if(ary)
+ VALUE ary;
{
- RETURN_ENUMERATOR(ary, 0, 0);
- ary_reject_bang(ary);
+ rb_ary_reject_bang(ary);
return ary;
}
-static VALUE
-take_i(VALUE val, VALUE *args, int argc, VALUE *argv)
-{
- if (args[1]-- == 0) rb_iter_break();
- if (argc > 1) val = rb_ary_new4(argc, argv);
- rb_ary_push(args[0], val);
- return Qnil;
-}
-
-static VALUE
-take_items(VALUE obj, long n)
-{
- VALUE result = rb_check_array_type(obj);
- VALUE args[2];
-
- if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
- result = rb_ary_new2(n);
- args[0] = result; args[1] = (VALUE)n;
- rb_block_call(obj, rb_intern("each"), 0, 0, take_i, (VALUE)args);
- return result;
-}
-
-
/*
* call-seq:
- * ary.zip(arg, ...) -> new_ary
- * ary.zip(arg, ...) {| arr | block } -> nil
- *
+ * array.zip(arg, ...) -> an_array
+ * array.zip(arg, ...) {| arr | block } -> nil
+ *
* Converts any arguments to arrays, then merges elements of
- * +self+ with corresponding elements from each argument. This
+ * <i>self</i> with corresponding elements from each argument. This
* generates a sequence of <code>self.size</code> <em>n</em>-element
* arrays, where <em>n</em> is one more that the count of arguments. If
* the size of any argument is less than <code>enumObj.size</code>,
- * <code>nil</code> values are supplied. If a block is given, it is
+ * <code>nil</code> values are supplied. If a block given, it is
* invoked for each output array, otherwise an array of arrays is
* returned.
- *
+ *
* a = [ 4, 5, 6 ]
* b = [ 7, 8, 9 ]
+ *
* [1,2,3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
* [1,2].zip(a,b) #=> [[1, 4, 7], [2, 5, 8]]
* a.zip([1,2],[8]) #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
*/
static VALUE
-rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+rb_ary_zip(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
int i, j;
long len;
- VALUE result = Qnil;
+ VALUE result;
- len = RARRAY_LEN(ary);
for (i=0; i<argc; i++) {
- argv[i] = take_items(argv[i], len);
- }
- if (!rb_block_given_p()) {
- result = rb_ary_new2(len);
+ argv[i] = to_ary(argv[i]);
}
+ if (rb_block_given_p()) {
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
- for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_ary_push(tmp, rb_ary_elt(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_yield(tmp);
+ }
+ return Qnil;
+ }
+ len = RARRAY(ary)->len;
+ result = rb_ary_new2(len);
+ for (i=0; i<len; i++) {
VALUE tmp = rb_ary_new2(argc+1);
rb_ary_push(tmp, rb_ary_elt(ary, i));
for (j=0; j<argc; j++) {
rb_ary_push(tmp, rb_ary_elt(argv[j], i));
}
- if (NIL_P(result)) {
- rb_yield(tmp);
- }
- else {
- rb_ary_push(result, tmp);
- }
+ rb_ary_push(result, tmp);
}
return result;
}
/*
* call-seq:
- * ary.transpose -> new_ary
- *
- * Assumes that +self+ is an array of arrays and transposes the
+ * array.transpose -> an_array
+ *
+ * Assumes that <i>self</i> is an array of arrays and transposes the
* rows and columns.
- *
+ *
* a = [[1,2], [3,4], [5,6]]
* a.transpose #=> [[1, 3, 5], [2, 4, 6]]
*/
static VALUE
-rb_ary_transpose(VALUE ary)
+rb_ary_transpose(ary)
+ VALUE ary;
{
long elen = -1, alen, i, j;
VALUE tmp, result = 0;
- alen = RARRAY_LEN(ary);
+ alen = RARRAY(ary)->len;
if (alen == 0) return rb_ary_dup(ary);
for (i=0; i<alen; i++) {
tmp = to_ary(rb_ary_elt(ary, i));
if (elen < 0) { /* first element */
- elen = RARRAY_LEN(tmp);
+ elen = RARRAY(tmp)->len;
result = rb_ary_new2(elen);
for (j=0; j<elen; j++) {
rb_ary_store(result, j, rb_ary_new2(alen));
}
}
- else if (elen != RARRAY_LEN(tmp)) {
- rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
- RARRAY_LEN(tmp), elen);
+ else if (elen != RARRAY(tmp)->len) {
+ rb_raise(rb_eIndexError, "element size differs (%d should be %d)",
+ RARRAY(tmp)->len, elen);
}
for (j=0; j<elen; j++) {
rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
@@ -2804,102 +2141,75 @@ rb_ary_transpose(VALUE ary)
/*
* call-seq:
- * ary.replace(other_ary) -> ary
- *
- * Replaces the contents of +self+ with the contents of
- * <i>other_ary</i>, truncating or expanding if necessary.
- *
+ * array.replace(other_array) -> array
+ *
+ * Replaces the contents of <i>self</i> with the contents of
+ * <i>other_array</i>, truncating or expanding if necessary.
+ *
* a = [ "a", "b", "c", "d", "e" ]
* a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
* a #=> ["x", "y", "z"]
*/
-VALUE
-rb_ary_replace(VALUE copy, VALUE orig)
+static VALUE
+rb_ary_replace(copy, orig)
+ VALUE copy, orig;
{
- rb_ary_modify_check(copy);
+ VALUE shared;
+
+ rb_ary_modify(copy);
orig = to_ary(orig);
if (copy == orig) return copy;
+ shared = ary_make_shared(orig);
+ if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
+ free(RARRAY(copy)->ptr);
+ RARRAY(copy)->ptr = RARRAY(orig)->ptr;
+ RARRAY(copy)->len = RARRAY(orig)->len;
+ RARRAY(copy)->aux.shared = shared;
+ FL_SET(copy, ELTS_SHARED);
- if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
- VALUE *ptr;
- VALUE shared = 0;
-
- if (ARY_OWNS_HEAP_P(copy)) {
- xfree(RARRAY_PTR(copy));
- }
- else if (ARY_SHARED_P(copy)) {
- shared = ARY_SHARED(copy);
- FL_UNSET_SHARED(copy);
- }
- FL_SET_EMBED(copy);
- ptr = RARRAY_PTR(orig);
- MEMCPY(RARRAY_PTR(copy), ptr, VALUE, RARRAY_LEN(orig));
- if (shared) {
- rb_ary_decrement_share(shared);
- }
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- }
- else {
- VALUE shared = ary_make_shared(orig);
- if (ARY_OWNS_HEAP_P(copy)) {
- xfree(RARRAY_PTR(copy));
- }
- else {
- rb_ary_unshare_safe(copy);
- }
- FL_UNSET_EMBED(copy);
- ARY_SET_PTR(copy, RARRAY_PTR(orig));
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- rb_ary_set_shared(copy, shared);
- }
return copy;
}
-/*
+/*
* call-seq:
- * ary.clear -> ary
+ * array.clear -> array
*
- * Removes all elements from +self+.
+ * Removes all elements from _self_.
*
* a = [ "a", "b", "c", "d", "e" ]
* a.clear #=> [ ]
*/
VALUE
-rb_ary_clear(VALUE ary)
+rb_ary_clear(ary)
+ VALUE ary;
{
- rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
- if (ARY_SHARED_P(ary)) {
- if (!ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
- }
- else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ rb_ary_modify(ary);
+ RARRAY(ary)->len = 0;
+ if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
+ RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
}
return ary;
}
/*
* call-seq:
- * ary.fill(obj) -> ary
- * ary.fill(obj, start [, length]) -> ary
- * ary.fill(obj, range ) -> ary
- * ary.fill {|index| block } -> ary
- * ary.fill(start [, length] ) {|index| block } -> ary
- * ary.fill(range) {|index| block } -> ary
- *
- * The first three forms set the selected elements of +self+ (which
+ * array.fill(obj) -> array
+ * array.fill(obj, start [, length]) -> array
+ * array.fill(obj, range ) -> array
+ * array.fill {|index| block } -> array
+ * array.fill(start [, length] ) {|index| block } -> array
+ * array.fill(range) {|index| block } -> array
+ *
+ * The first three forms set the selected elements of <i>self</i> (which
* may be the entire array) to <i>obj</i>. A <i>start</i> of
* <code>nil</code> is equivalent to zero. A <i>length</i> of
* <code>nil</code> is equivalent to <i>self.length</i>. The last three
* forms fill the array with the value of the block. The block is
* passed the absolute index of each element to be filled.
- * Negative values of <i>start</i> count from the end of the array.
- *
+ *
* a = [ "a", "b", "c", "d" ]
* a.fill("x") #=> ["x", "x", "x", "x"]
* a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
@@ -2909,15 +2219,18 @@ rb_ary_clear(VALUE ary)
*/
static VALUE
-rb_ary_fill(int argc, VALUE *argv, VALUE ary)
+rb_ary_fill(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE item, arg1, arg2;
long beg = 0, end = 0, len = 0;
VALUE *p, *pend;
- int block_p = FALSE;
+ int block_p = Qfalse;
if (rb_block_given_p()) {
- block_p = TRUE;
+ block_p = Qtrue;
rb_scan_args(argc, argv, "02", &arg1, &arg2);
argc += 1; /* hackish */
}
@@ -2927,36 +2240,34 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
switch (argc) {
case 1:
beg = 0;
- len = RARRAY_LEN(ary);
+ len = RARRAY(ary)->len;
break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
break;
}
/* fall through */
case 3:
beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
if (beg < 0) {
- beg = RARRAY_LEN(ary) + beg;
+ beg = RARRAY(ary)->len + beg;
if (beg < 0) beg = 0;
}
- len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+ len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
break;
}
rb_ary_modify(ary);
- if (len < 0) {
- return ary;
- }
- if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+ end = beg + len;
+ if (end < 0) {
rb_raise(rb_eArgError, "argument too big");
}
- end = beg + len;
- if (RARRAY_LEN(ary) < end) {
- if (end >= ARY_CAPA(ary)) {
- ary_resize_capa(ary, end);
+ if (end > RARRAY(ary)->len) {
+ if (end >= RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
+ RARRAY(ary)->aux.capa = end;
}
- rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), end - RARRAY_LEN(ary));
- ARY_SET_LEN(ary, end);
+ rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
+ RARRAY(ary)->len = end;
}
if (block_p) {
@@ -2965,12 +2276,12 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
for (i=beg; i<end; i++) {
v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY_LEN(ary)) break;
- RARRAY_PTR(ary)[i] = v;
+ if (i>=RARRAY(ary)->len) break;
+ RARRAY(ary)->ptr[i] = v;
}
}
else {
- p = RARRAY_PTR(ary) + beg;
+ p = RARRAY(ary)->ptr + beg;
pend = p + len;
while (p < pend) {
*p++ = item;
@@ -2979,61 +2290,62 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
return ary;
}
-/*
+/*
* call-seq:
- * ary + other_ary -> new_ary
+ * array + other_array -> an_array
*
* Concatenation---Returns a new array built by concatenating the
* two arrays together to produce a third array.
- *
+ *
* [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
*/
VALUE
-rb_ary_plus(VALUE x, VALUE y)
+rb_ary_plus(x, y)
+ VALUE x, y;
{
VALUE z;
long len;
y = to_ary(y);
- len = RARRAY_LEN(x) + RARRAY_LEN(y);
+ len = RARRAY(x)->len + RARRAY(y)->len;
z = rb_ary_new2(len);
- MEMCPY(RARRAY_PTR(z), RARRAY_PTR(x), VALUE, RARRAY_LEN(x));
- MEMCPY(RARRAY_PTR(z) + RARRAY_LEN(x), RARRAY_PTR(y), VALUE, RARRAY_LEN(y));
- ARY_SET_LEN(z, len);
+ MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
+ MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
+ RARRAY(z)->len = len;
return z;
}
-/*
+/*
* call-seq:
- * ary.concat(other_ary) -> ary
- *
- * Appends the elements of <i>other_ary</i> to +self+.
+ * array.concat(other_array) -> array
*
+ * Appends the elements in other_array to _self_.
+ *
* [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
*/
VALUE
-rb_ary_concat(VALUE x, VALUE y)
+rb_ary_concat(x, y)
+ VALUE x, y;
{
- rb_ary_modify_check(x);
y = to_ary(y);
- if (RARRAY_LEN(y) > 0) {
- rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+ if (RARRAY(y)->len > 0) {
+ rb_ary_splice(x, RARRAY(x)->len, 0, y);
}
return x;
}
-/*
+/*
* call-seq:
- * ary * int -> new_ary
- * ary * str -> new_string
+ * array * int -> an_array
+ * array * str -> a_string
*
* Repetition---With a String argument, equivalent to
* self.join(str). Otherwise, returns a new array
- * built by concatenating the _int_ copies of +self+.
+ * built by concatenating the _int_ copies of _self_.
*
*
* [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -3042,10 +2354,11 @@ rb_ary_concat(VALUE x, VALUE y)
*/
static VALUE
-rb_ary_times(VALUE ary, VALUE times)
+rb_ary_times(ary, times)
+ VALUE ary, times;
{
- VALUE ary2, tmp, *ptr, *ptr2;
- long t, len;
+ VALUE ary2, tmp;
+ long i, len;
tmp = rb_check_string_type(times);
if (!NIL_P(tmp)) {
@@ -3053,43 +2366,29 @@ rb_ary_times(VALUE ary, VALUE times)
}
len = NUM2LONG(times);
- if (len == 0) {
- ary2 = ary_new(rb_obj_class(ary), 0);
- goto out;
- }
+ if (len == 0) return ary_new(rb_obj_class(ary), 0);
if (len < 0) {
rb_raise(rb_eArgError, "negative argument");
}
- if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+ if (LONG_MAX/len < RARRAY(ary)->len) {
rb_raise(rb_eArgError, "argument too big");
}
- len *= RARRAY_LEN(ary);
+ len *= RARRAY(ary)->len;
ary2 = ary_new(rb_obj_class(ary), len);
- ARY_SET_LEN(ary2, len);
-
- ptr = RARRAY_PTR(ary);
- ptr2 = RARRAY_PTR(ary2);
- t = RARRAY_LEN(ary);
- if (0 < t) {
- MEMCPY(ptr2, ptr, VALUE, t);
- while (t <= len/2) {
- MEMCPY(ptr2+t, ptr2, VALUE, t);
- t *= 2;
- }
- if (t < len) {
- MEMCPY(ptr2+t, ptr2, VALUE, len-t);
- }
- }
- out:
+ RARRAY(ary2)->len = len;
+
+ for (i=0; i<len; i+=RARRAY(ary)->len) {
+ MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ }
OBJ_INFECT(ary2, ary);
return ary2;
}
-/*
+/*
* call-seq:
- * ary.assoc(obj) -> new_ary or nil
+ * array.assoc(obj) -> an_array or nil
*
* Searches through an array whose elements are also arrays
* comparing _obj_ with the first element of each contained array
@@ -3108,15 +2407,17 @@ rb_ary_times(VALUE ary, VALUE times)
*/
VALUE
-rb_ary_assoc(VALUE ary, VALUE key)
+rb_ary_assoc(ary, key)
+ VALUE ary, key;
{
long i;
VALUE v;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = rb_check_array_type(RARRAY_PTR(ary)[i]);
- if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
- rb_equal(RARRAY_PTR(v)[0], key))
+ for (i = 0; i < RARRAY(ary)->len; ++i) {
+ v = RARRAY(ary)->ptr[i];
+ if (TYPE(v) == T_ARRAY &&
+ RARRAY(v)->len > 0 &&
+ rb_equal(RARRAY(v)->ptr[0], key))
return v;
}
return Qnil;
@@ -3124,50 +2425,38 @@ rb_ary_assoc(VALUE ary, VALUE key)
/*
* call-seq:
- * ary.rassoc(obj) -> new_ary or nil
- *
+ * array.rassoc(key) -> an_array or nil
+ *
* Searches through the array whose elements are also arrays. Compares
- * _obj_ with the second element of each contained array using
+ * <em>key</em> with the second element of each contained array using
* <code>==</code>. Returns the first contained array that matches. See
* also <code>Array#assoc</code>.
- *
+ *
* a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
* a.rassoc("two") #=> [2, "two"]
* a.rassoc("four") #=> nil
*/
VALUE
-rb_ary_rassoc(VALUE ary, VALUE value)
+rb_ary_rassoc(ary, value)
+ VALUE ary, value;
{
long i;
VALUE v;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = RARRAY_PTR(ary)[i];
+ for (i = 0; i < RARRAY(ary)->len; ++i) {
+ v = RARRAY(ary)->ptr[i];
if (TYPE(v) == T_ARRAY &&
- RARRAY_LEN(v) > 1 &&
- rb_equal(RARRAY_PTR(v)[1], value))
+ RARRAY(v)->len > 1 &&
+ rb_equal(RARRAY(v)->ptr[1], value))
return v;
}
return Qnil;
}
-static VALUE
-recursive_equal(VALUE ary1, VALUE ary2, int recur)
-{
- long i;
-
- if (recur) return Qtrue; /* Subtle! */
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
- return Qfalse;
- }
- return Qtrue;
-}
-
-/*
+/*
* call-seq:
- * ary == other_ary -> bool
+ * array == other_array -> bool
*
* Equality---Two arrays are equal if they contain the same number
* of elements and if each element is equal to (according to
@@ -3180,8 +2469,11 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
*/
static VALUE
-rb_ary_equal(VALUE ary1, VALUE ary2)
+rb_ary_equal(ary1, ary2)
+ VALUE ary1, ary2;
{
+ long i;
+
if (ary1 == ary2) return Qtrue;
if (TYPE(ary2) != T_ARRAY) {
if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
@@ -3189,18 +2481,9 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
}
return rb_equal(ary2, ary1);
}
- if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
-}
-
-static VALUE
-recursive_eql(VALUE ary1, VALUE ary2, int recur)
-{
- long i;
-
- if (recur) return Qtrue; /* Subtle! */
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
return Qfalse;
}
return Qtrue;
@@ -3208,76 +2491,74 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
/*
* call-seq:
- * ary.eql?(other) -> true or false
+ * array.eql?(other) -> true or false
*
- * Returns <code>true</code> if +self+ and _other_ are the same object,
+ * Returns <code>true</code> if _array_ and _other_ are the same object,
* or are both arrays with the same content.
*/
static VALUE
-rb_ary_eql(VALUE ary1, VALUE ary2)
-{
- if (ary1 == ary2) return Qtrue;
- if (TYPE(ary2) != T_ARRAY) return Qfalse;
- if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
-}
-
-static VALUE
-recursive_hash(VALUE ary, VALUE dummy, int recur)
+rb_ary_eql(ary1, ary2)
+ VALUE ary1, ary2;
{
long i;
- st_index_t h;
- VALUE n;
- h = rb_hash_start(RARRAY_LEN(ary));
- if (recur) {
- h = rb_hash_uint(h, NUM2LONG(rb_hash(rb_cArray)));
- }
- else {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- n = rb_hash(RARRAY_PTR(ary)[i]);
- h = rb_hash_uint(h, NUM2LONG(n));
- }
+ if (ary1 == ary2) return Qtrue;
+ if (TYPE(ary2) != T_ARRAY) return Qfalse;
+ if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ return Qfalse;
}
- h = rb_hash_end(h);
- return LONG2FIX(h);
+ return Qtrue;
}
/*
* call-seq:
- * ary.hash -> fixnum
+ * array.hash -> fixnum
*
* Compute a hash-code for this array. Two arrays with the same content
* will have the same hash code (and will compare using <code>eql?</code>).
*/
static VALUE
-rb_ary_hash(VALUE ary)
+rb_ary_hash(ary)
+ VALUE ary;
{
- return rb_exec_recursive_outer(recursive_hash, ary, 0);
+ long i, h;
+ VALUE n;
+
+ h = RARRAY(ary)->len;
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ h = (h << 1) | (h<0 ? 1 : 0);
+ n = rb_hash(RARRAY(ary)->ptr[i]);
+ h ^= NUM2LONG(n);
+ }
+ return LONG2FIX(h);
}
/*
* call-seq:
- * ary.include?(obj) -> true or false
- *
+ * array.include?(obj) -> true or false
+ *
* Returns <code>true</code> if the given object is present in
- * +self+ (that is, if any object <code>==</code> <i>anObject</i>),
+ * <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
* <code>false</code> otherwise.
- *
+ *
* a = [ "a", "b", "c" ]
* a.include?("b") #=> true
* a.include?("z") #=> false
*/
VALUE
-rb_ary_includes(VALUE ary, VALUE item)
+rb_ary_includes(ary, item)
+ VALUE ary;
+ VALUE item;
{
long i;
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_PTR(ary)[i], item)) {
+
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ if (rb_equal(RARRAY(ary)->ptr[i], item)) {
return Qtrue;
}
}
@@ -3285,32 +2566,13 @@ rb_ary_includes(VALUE ary, VALUE item)
}
-static VALUE
-recursive_cmp(VALUE ary1, VALUE ary2, int recur)
-{
- long i, len;
-
- if (recur) return Qundef; /* Subtle! */
- len = RARRAY_LEN(ary1);
- if (len > RARRAY_LEN(ary2)) {
- len = RARRAY_LEN(ary2);
- }
- for (i=0; i<len; i++) {
- VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
- if (v != INT2FIX(0)) {
- return v;
- }
- }
- return Qundef;
-}
-
-/*
+/*
* call-seq:
- * ary <=> other_ary -> -1, 0, +1 or nil
+ * array <=> other_array -> -1, 0, +1
*
* Comparison---Returns an integer (-1, 0,
* or +1) if this array is less than, equal to, or greater than
- * <i>other_ary</i>. Each object in each array is compared
+ * other_array. Each object in each array is compared
* (using <=>). If any value isn't
* equal, then that inequality is the return value. If all the
* values found are equal, then the return is based on a
@@ -3318,120 +2580,86 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
* ``equal'' according to <code>Array#<=></code> if and only if they have
* the same length and the value of each element is equal to the
* value of the corresponding element in the other array.
- *
+ *
* [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
* [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
*
*/
VALUE
-rb_ary_cmp(VALUE ary1, VALUE ary2)
+rb_ary_cmp(ary1, ary2)
+ VALUE ary1, ary2;
{
- long len;
- VALUE v;
+ long i, len;
- ary2 = rb_check_array_type(ary2);
- if (NIL_P(ary2)) return Qnil;
- if (ary1 == ary2) return INT2FIX(0);
- v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
- if (v != Qundef) return v;
- len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+ ary2 = to_ary(ary2);
+ len = RARRAY(ary1)->len;
+ if (len > RARRAY(ary2)->len) {
+ len = RARRAY(ary2)->len;
+ }
+ for (i=0; i<len; i++) {
+ VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
+ if (v != INT2FIX(0)) {
+ return v;
+ }
+ }
+ len = RARRAY(ary1)->len - RARRAY(ary2)->len;
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
return INT2FIX(-1);
}
static VALUE
-ary_add_hash(VALUE hash, VALUE ary)
-{
- long i;
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_hash_aset(hash, RARRAY_PTR(ary)[i], Qtrue);
- }
- return hash;
-}
-
-static inline VALUE
-ary_tmp_hash_new(void)
+ary_make_hash(ary1, ary2)
+ VALUE ary1, ary2;
{
VALUE hash = rb_hash_new();
-
- RBASIC(hash)->klass = 0;
- return hash;
-}
-
-static VALUE
-ary_make_hash(VALUE ary)
-{
- VALUE hash = ary_tmp_hash_new();
- return ary_add_hash(hash, ary);
-}
-
-static VALUE
-ary_add_hash_by(VALUE hash, VALUE ary)
-{
long i;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
- if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
- rb_hash_aset(hash, k, v);
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+ }
+ if (ary2) {
+ for (i=0; i<RARRAY(ary2)->len; i++) {
+ rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
}
}
return hash;
}
-static VALUE
-ary_make_hash_by(VALUE ary)
-{
- VALUE hash = ary_tmp_hash_new();
- return ary_add_hash_by(hash, ary);
-}
-
-static inline void
-ary_recycle_hash(VALUE hash)
-{
- if (RHASH(hash)->ntbl) {
- st_table *tbl = RHASH(hash)->ntbl;
- RHASH(hash)->ntbl = 0;
- st_free_table(tbl);
- }
-}
-
-/*
+/*
* call-seq:
- * ary - other_ary -> new_ary
+ * array - other_array -> an_array
*
* Array Difference---Returns a new array that is a copy of
* the original array, removing any items that also appear in
- * <i>other_ary</i>. (If you need set-like behavior, see the
+ * other_array. (If you need set-like behavior, see the
* library class Set.)
*
* [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
*/
static VALUE
-rb_ary_diff(VALUE ary1, VALUE ary2)
+rb_ary_diff(ary1, ary2)
+ VALUE ary1, ary2;
{
VALUE ary3;
volatile VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2));
+ hash = ary_make_hash(to_ary(ary2), 0);
ary3 = rb_ary_new();
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (st_lookup(RHASH_TBL(hash), RARRAY_PTR(ary1)[i], 0)) continue;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
- ary_recycle_hash(hash);
return ary3;
}
-/*
+/*
* call-seq:
- * ary & other_ary -> new_ary
+ * array & other_array
*
* Set Intersection---Returns a new array
* containing elements common to the two arrays, with no duplicates.
@@ -3441,231 +2669,168 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
static VALUE
-rb_ary_and(VALUE ary1, VALUE ary2)
+rb_ary_and(ary1, ary2)
+ VALUE ary1, ary2;
{
- VALUE hash, ary3, v;
- st_data_t vv;
+ VALUE hash, ary3, v, vv;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY_LEN(ary1) < RARRAY_LEN(ary2) ?
- RARRAY_LEN(ary1) : RARRAY_LEN(ary2));
- hash = ary_make_hash(ary2);
-
- if (RHASH_EMPTY_P(hash))
- return ary3;
+ ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
+ RARRAY(ary1)->len : RARRAY(ary2)->len);
+ hash = ary_make_hash(ary2, 0);
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- vv = (st_data_t)(v = rb_ary_elt(ary1, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ v = vv = rb_ary_elt(ary1, i);
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
rb_ary_push(ary3, v);
}
}
- ary_recycle_hash(hash);
return ary3;
}
-/*
+/*
* call-seq:
- * ary | other_ary -> new_ary
+ * array | other_array -> an_array
*
* Set Union---Returns a new array by joining this array with
- * <i>other_ary</i>, removing duplicates.
+ * other_array, removing duplicates.
*
* [ "a", "b", "c" ] | [ "c", "d", "a" ]
* #=> [ "a", "b", "c", "d" ]
*/
static VALUE
-rb_ary_or(VALUE ary1, VALUE ary2)
+rb_ary_or(ary1, ary2)
+ VALUE ary1, ary2;
{
- VALUE hash, ary3, v;
- st_data_t vv;
+ VALUE hash, ary3;
+ VALUE v, vv;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY_LEN(ary1)+RARRAY_LEN(ary2));
- hash = ary_add_hash(ary_make_hash(ary1), ary2);
+ ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
+ hash = ary_make_hash(ary1, ary2);
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- vv = (st_data_t)(v = rb_ary_elt(ary1, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ v = vv = rb_ary_elt(ary1, i);
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
rb_ary_push(ary3, v);
}
}
- for (i=0; i<RARRAY_LEN(ary2); i++) {
- vv = (st_data_t)(v = rb_ary_elt(ary2, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+ for (i=0; i<RARRAY(ary2)->len; i++) {
+ v = vv = rb_ary_elt(ary2, i);
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
rb_ary_push(ary3, v);
}
}
- ary_recycle_hash(hash);
return ary3;
}
-static int
-push_value(st_data_t key, st_data_t val, st_data_t ary)
-{
- rb_ary_push((VALUE)ary, (VALUE)val);
- return ST_CONTINUE;
-}
-
/*
* call-seq:
- * ary.uniq! -> ary or nil
- * ary.uniq! { |item| ... } -> ary or nil
- *
- * Removes duplicate elements from +self+. If a block is given,
- * it will use the return value of the block for comparison.
+ * array.uniq! -> array or nil
+ *
+ * Removes duplicate elements from _self_.
* Returns <code>nil</code> if no changes are made (that is, no
* duplicates are found).
- *
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! # => ["a", "b", "c"]
- *
+ * a.uniq! #=> ["a", "b", "c"]
* b = [ "a", "b", "c" ]
- * b.uniq! # => nil
- *
- * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
+ * b.uniq! #=> nil
*/
static VALUE
-rb_ary_uniq_bang(VALUE ary)
+rb_ary_uniq_bang(ary)
+ VALUE ary;
{
- VALUE hash, v;
+ VALUE hash, v, vv;
long i, j;
- rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) <= 1)
- return Qnil;
- if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- if (RARRAY_LEN(ary) == (i = RHASH_SIZE(hash))) {
- return Qnil;
- }
- ARY_SET_LEN(ary, 0);
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
- ary_resize_capa(ary, i);
- st_foreach(RHASH_TBL(hash), push_value, ary);
+ hash = ary_make_hash(ary, 0);
+
+ if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
+ return Qnil;
}
- else {
- hash = ary_make_hash(ary);
- if (RARRAY_LEN(ary) == (long)RHASH_SIZE(hash)) {
- return Qnil;
+ for (i=j=0; i<RARRAY(ary)->len; i++) {
+ v = vv = rb_ary_elt(ary, i);
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+ rb_ary_store(ary, j++, v);
}
- for (i=j=0; i<RARRAY_LEN(ary); i++) {
- st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_store(ary, j++, v);
- }
- }
- ARY_SET_LEN(ary, j);
}
- ary_recycle_hash(hash);
+ RARRAY(ary)->len = j;
return ary;
}
/*
* call-seq:
- * ary.uniq -> new_ary
- * ary.uniq { |item| ... } -> new_ary
- *
- * Returns a new array by removing duplicate values in +self+. If a block
- * is given, it will use the return value of the block for comparison.
- *
+ * array.uniq -> an_array
+ *
+ * Returns a new array by removing duplicate values in <i>self</i>.
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq # => ["a", "b", "c"]
- *
- * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
+ * a.uniq #=> ["a", "b", "c"]
*/
static VALUE
-rb_ary_uniq(VALUE ary)
+rb_ary_uniq(ary)
+ VALUE ary;
{
- VALUE hash, uniq, v;
- long i;
-
- if (RARRAY_LEN(ary) <= 1)
- return rb_ary_dup(ary);
- if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
- st_foreach(RHASH_TBL(hash), push_value, uniq);
- }
- else {
- hash = ary_make_hash(ary);
- uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
- for (i=0; i<RARRAY_LEN(ary); i++) {
- st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
- if (st_delete(RHASH_TBL(hash), &vv, 0)) {
- rb_ary_push(uniq, v);
- }
- }
- }
- ary_recycle_hash(hash);
-
- return uniq;
+ ary = rb_ary_dup(ary);
+ rb_ary_uniq_bang(ary);
+ return ary;
}
-/*
+/*
* call-seq:
- * ary.compact! -> ary or nil
+ * array.compact! -> array or nil
*
- * Removes +nil+ elements from the array.
- * Returns +nil+ if no changes were made, otherwise returns
- * <i>ary</i>.
+ * Removes +nil+ elements from array.
+ * Returns +nil+ if no changes were made.
*
* [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
* [ "a", "b", "c" ].compact! #=> nil
*/
static VALUE
-rb_ary_compact_bang(VALUE ary)
+rb_ary_compact_bang(ary)
+ VALUE ary;
{
VALUE *p, *t, *end;
- long n;
rb_ary_modify(ary);
- p = t = RARRAY_PTR(ary);
- end = p + RARRAY_LEN(ary);
-
+ p = t = RARRAY(ary)->ptr;
+ end = p + RARRAY(ary)->len;
+
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- n = p - RARRAY_PTR(ary);
- if (RARRAY_LEN(ary) == n) {
+ if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
return Qnil;
}
- ARY_SET_LEN(ary, n);
- if (n * 2 < ARY_CAPA(ary) && ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, n * 2);
- }
+ RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
return ary;
}
/*
* call-seq:
- * ary.compact -> new_ary
+ * array.compact -> an_array
*
- * Returns a copy of +self+ with all +nil+ elements removed.
+ * Returns a copy of _self_ with all +nil+ elements removed.
*
* [ "a", nil, "b", nil, "c", nil ].compact
* #=> [ "a", "b", "c" ]
*/
static VALUE
-rb_ary_compact(VALUE ary)
+rb_ary_compact(ary)
+ VALUE ary;
{
ary = rb_ary_dup(ary);
rb_ary_compact_bang(ary);
@@ -3674,1015 +2839,146 @@ rb_ary_compact(VALUE ary)
/*
* call-seq:
- * ary.count -> int
- * ary.count(obj) -> int
- * ary.count { |item| block } -> int
- *
- * Returns the number of elements. If an argument is given, counts
- * the number of elements which equals to <i>obj</i>. If a block is
- * given, counts the number of elements yielding a true value.
- *
- * ary = [1, 2, 4, 2]
- * ary.count #=> 4
- * ary.count(2) #=> 2
- * ary.count{|x|x%2==0} #=> 3
- *
+ * array.nitems -> int
+ *
+ * Returns the number of non-<code>nil</code> elements in _self_.
+ * May be zero.
+ *
+ * [ 1, nil, 3, nil, 5 ].nitems #=> 3
*/
static VALUE
-rb_ary_count(int argc, VALUE *argv, VALUE ary)
+rb_ary_nitems(ary)
+ VALUE ary;
{
long n = 0;
+ VALUE *p, *pend;
- if (argc == 0) {
- VALUE *p, *pend;
-
- if (!rb_block_given_p())
- return LONG2NUM(RARRAY_LEN(ary));
-
- for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
- if (RTEST(rb_yield(*p))) n++;
- }
- }
- else {
- VALUE obj, *p, *pend;
+ p = RARRAY(ary)->ptr;
+ pend = p + RARRAY(ary)->len;
- rb_scan_args(argc, argv, "1", &obj);
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
- if (rb_equal(*p, obj)) n++;
- }
+ while (p < pend) {
+ if (!NIL_P(*p)) n++;
+ p++;
}
-
return LONG2NUM(n);
}
-static VALUE
-flatten(VALUE ary, int level, int *modified)
+static long
+flatten(ary, idx, ary2, memo)
+ VALUE ary;
+ long idx;
+ VALUE ary2, memo;
{
- long i = 0;
- VALUE stack, result, tmp, elt;
- st_table *memo;
- st_data_t id;
-
- stack = ary_new(0, ARY_DEFAULT_SIZE);
- result = ary_new(0, RARRAY_LEN(ary));
- memo = st_init_numtable();
- st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
- *modified = 0;
-
- while (1) {
- while (i < RARRAY_LEN(ary)) {
- elt = RARRAY_PTR(ary)[i++];
- tmp = rb_check_array_type(elt);
- if (RBASIC(result)->klass) {
- rb_raise(rb_eRuntimeError, "flatten reentered");
- }
- if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
- rb_ary_push(result, elt);
- }
- else {
- *modified = 1;
- id = (st_data_t)tmp;
- if (st_lookup(memo, id, 0)) {
- st_free_table(memo);
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- st_insert(memo, id, (st_data_t)Qtrue);
- rb_ary_push(stack, ary);
- rb_ary_push(stack, LONG2NUM(i));
- ary = tmp;
- i = 0;
- }
- }
- if (RARRAY_LEN(stack) == 0) {
- break;
- }
- id = (st_data_t)ary;
- st_delete(memo, &id, 0);
- tmp = rb_ary_pop(stack);
- i = NUM2LONG(tmp);
- ary = rb_ary_pop(stack);
+ VALUE id;
+ long i = idx;
+ long n, lim = idx + RARRAY(ary2)->len;
+
+ id = rb_obj_id(ary2);
+ if (rb_ary_includes(memo, id)) {
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
}
+ rb_ary_push(memo, id);
+ rb_ary_splice(ary, idx, 1, ary2);
+ while (i < lim) {
+ VALUE tmp;
- st_free_table(memo);
+ tmp = rb_check_array_type(rb_ary_elt(ary, i));
+ if (!NIL_P(tmp)) {
+ n = flatten(ary, i, tmp, memo);
+ i += n; lim += n;
+ }
+ i++;
+ }
+ rb_ary_pop(memo);
- RBASIC(result)->klass = rb_class_of(ary);
- return result;
+ return lim - idx - 1; /* returns number of increased items */
}
/*
* call-seq:
- * ary.flatten! -> ary or nil
- * ary.flatten!(level) -> array or nil
- *
- * Flattens +self+ in place.
+ * array.flatten! -> array or nil
+ *
+ * Flattens _self_ in place.
* Returns <code>nil</code> if no modifications were made (i.e.,
- * <i>ary</i> contains no subarrays.) If the optional <i>level</i>
- * argument determines the level of recursion to flatten.
- *
+ * <i>array</i> contains no subarrays.)
+ *
* a = [ 1, 2, [3, [4, 5] ] ]
* a.flatten! #=> [1, 2, 3, 4, 5]
* a.flatten! #=> nil
* a #=> [1, 2, 3, 4, 5]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
-rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_flatten_bang(ary)
+ VALUE ary;
{
- int mod = 0, level = -1;
- VALUE result, lv;
+ long i = 0;
+ int mod = 0;
+ VALUE memo = Qnil;
- rb_scan_args(argc, argv, "01", &lv);
- rb_ary_modify_check(ary);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return Qnil;
+ while (i<RARRAY(ary)->len) {
+ VALUE ary2 = RARRAY(ary)->ptr[i];
+ VALUE tmp;
- result = flatten(ary, level, &mod);
- if (mod == 0) {
- ary_discard(result);
- return Qnil;
+ tmp = rb_check_array_type(ary2);
+ if (!NIL_P(tmp)) {
+ if (NIL_P(memo)) {
+ memo = rb_ary_new();
+ }
+ i += flatten(ary, i, tmp, memo);
+ mod = 1;
+ }
+ i++;
}
- if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
- rb_ary_replace(ary, result);
- if (mod) ARY_SET_EMBED_LEN(result, 0);
-
+ if (mod == 0) return Qnil;
return ary;
}
/*
* call-seq:
- * ary.flatten -> new_ary
- * ary.flatten(level) -> new_ary
- *
+ * array.flatten -> an_array
+ *
* Returns a new array that is a one-dimensional flattening of this
* array (recursively). That is, for every element that is an array,
- * extract its elements into the new array. If the optional
- * <i>level</i> argument determines the level of recursion to flatten.
- *
+ * extract its elements into the new array.
+ *
* s = [ 1, 2, 3 ] #=> [1, 2, 3]
* t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
* a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten(1) #=> [1, 2, 3, [4, 5]]
- */
-
-static VALUE
-rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
-{
- int mod = 0, level = -1;
- VALUE result, lv;
-
- rb_scan_args(argc, argv, "01", &lv);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return ary_make_shared_copy(ary);
-
- result = flatten(ary, level, &mod);
- OBJ_INFECT(result, ary);
-
- return result;
-}
-
-#define OPTHASH_GIVEN_P(opts) \
- (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static VALUE sym_random;
-
-#define RAND_UPTO(max) (long)(rb_random_real(randgen)*(max))
-
-/*
- * call-seq:
- * ary.shuffle! -> ary
- * ary.shuffle!(random: rng) -> ary
- *
- * Shuffles elements in +self+ in place.
- * If +rng+ is given, it will be used as the random number generator.
- */
-
-static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
-{
- VALUE *ptr, opts, *snap_ptr, randgen = rb_cRandom;
- long i, snap_len;
-
- if (OPTHASH_GIVEN_P(opts)) {
- randgen = rb_hash_lookup2(opts, sym_random, randgen);
- }
- if (argc > 0) {
- rb_raise(rb_eArgError, "wrong number of arguments (%d for 0)", argc);
- }
- rb_ary_modify(ary);
- i = RARRAY_LEN(ary);
- ptr = RARRAY_PTR(ary);
- snap_len = i;
- snap_ptr = ptr;
- while (i) {
- long j = RAND_UPTO(i);
- VALUE tmp;
- if (snap_len != RARRAY_LEN(ary) || snap_ptr != RARRAY_PTR(ary)) {
- rb_raise(rb_eRuntimeError, "modified during shuffle");
- }
- tmp = ptr[--i];
- ptr[i] = ptr[j];
- ptr[j] = tmp;
- }
- return ary;
-}
-
-
-/*
- * call-seq:
- * ary.shuffle -> new_ary
- * ary.shuffle(random: rng) -> new_ary
- *
- * Returns a new array with elements of this array shuffled.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle #=> [2, 3, 1]
- *
- * If +rng+ is given, it will be used as the random number generator.
- *
- * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
*/
static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_flatten(ary)
+ VALUE ary;
{
ary = rb_ary_dup(ary);
- rb_ary_shuffle_bang(argc, argv, ary);
+ rb_ary_flatten_bang(ary);
return ary;
}
-/*
- * call-seq:
- * ary.sample -> obj
- * ary.sample(random: rng) -> obj
- * ary.sample(n) -> new_ary
- * ary.sample(n, random: rng) -> new_ary
- *
- * Choose a random element or +n+ random elements from the array. The elements
- * are chosen by using random and unique indices into the array in order to
- * ensure that an element doesn't repeat itself unless the array already
- * contained duplicate elements. If the array is empty the first form returns
- * <code>nil</code> and the second form returns an empty array.
- *
- * If +rng+ is given, it will be used as the random number generator.
- */
-
-
-static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
-{
- VALUE nv, result, *ptr;
- VALUE opts, randgen = rb_cRandom;
- long n, len, i, j, k, idx[10];
- double rnds[numberof(idx)];
-
- if (OPTHASH_GIVEN_P(opts)) {
- randgen = rb_hash_lookup2(opts, sym_random, randgen);
- }
- ptr = RARRAY_PTR(ary);
- len = RARRAY_LEN(ary);
- if (argc == 0) {
- if (len == 0) return Qnil;
- if (len == 1) {
- i = 0;
- }
- else {
- double x = rb_random_real(randgen);
- if ((len = RARRAY_LEN(ary)) == 0) return Qnil;
- i = (long)(x * len);
- }
- return RARRAY_PTR(ary)[i];
- }
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
- if (n < 0) rb_raise(rb_eArgError, "negative sample number");
- if (n > len) n = len;
- if (n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- rnds[i] = rb_random_real(randgen);
- }
- }
- len = RARRAY_LEN(ary);
- ptr = RARRAY_PTR(ary);
- if (n > len) n = len;
- switch (n) {
- case 0:
- return rb_ary_new2(0);
- case 1:
- i = (long)(rnds[0] * len);
- return rb_ary_new4(1, &ptr[i]);
- case 2:
- i = (long)(rnds[0] * len);
- j = (long)(rnds[1] * (len-1));
- if (j >= i) j++;
- return rb_ary_new3(2, ptr[i], ptr[j]);
- case 3:
- i = (long)(rnds[0] * len);
- j = (long)(rnds[1] * (len-1));
- k = (long)(rnds[2] * (len-2));
- {
- long l = j, g = i;
- if (j >= i) l = i, g = ++j;
- if (k >= l && (++k >= g)) ++k;
- }
- return rb_ary_new3(3, ptr[i], ptr[j], ptr[k]);
- }
- if (n <= numberof(idx)) {
- VALUE *ptr_result;
- long sorted[numberof(idx)];
- sorted[0] = idx[0] = (long)(rnds[0] * len);
- for (i=1; i<n; i++) {
- k = (long)(rnds[i] * --len);
- for (j = 0; j < i; ++j) {
- if (k < sorted[j]) break;
- ++k;
- }
- memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
- sorted[j] = idx[i] = k;
- }
- result = rb_ary_new2(n);
- ptr_result = RARRAY_PTR(result);
- for (i=0; i<n; i++) {
- ptr_result[i] = ptr[idx[i]];
- }
- }
- else {
- VALUE *ptr_result;
- result = rb_ary_new4(len, ptr);
- RBASIC(result)->klass = 0;
- ptr_result = RARRAY_PTR(result);
- RB_GC_GUARD(ary);
- for (i=0; i<n; i++) {
- j = RAND_UPTO(len-i) + i;
- nv = ptr_result[j];
- ptr_result[j] = ptr_result[i];
- ptr_result[i] = nv;
- }
- RBASIC(result)->klass = rb_cArray;
- }
- ARY_SET_LEN(result, n);
-
- return result;
-}
-
-
-/*
- * call-seq:
- * ary.cycle(n=nil) {|obj| block } -> nil
- * ary.cycle(n=nil) -> an_enumerator
- *
- * Calls <i>block</i> for each element repeatedly _n_ times or
- * forever if none or +nil+ is given. If a non-positive number is
- * given or the array is empty, does nothing. Returns +nil+ if the
- * loop has finished without getting interrupted.
- *
- * If no block is given, an enumerator is returned instead.
- *
- *
- * a = ["a", "b", "c"]
- * a.cycle {|x| puts x } # print, a, b, c, a, b, c,.. forever.
- * a.cycle(2) {|x| puts x } # print, a, b, c, a, b, c.
- *
- */
-
-static VALUE
-rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
-{
- long n, i;
- VALUE nv = Qnil;
-
- rb_scan_args(argc, argv, "01", &nv);
-
- RETURN_ENUMERATOR(ary, argc, argv);
- if (NIL_P(nv)) {
- n = -1;
- }
- else {
- n = NUM2LONG(nv);
- if (n <= 0) return Qnil;
- }
-
- while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_PTR(ary)[i]);
- }
- }
- return Qnil;
-}
-
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC(s)->klass = rb_cString)
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC(a)->klass = rb_cArray)
-
-/*
- * Recursively compute permutations of r elements of the set [0..n-1].
- * When we have a complete permutation of array indexes, copy the values
- * at those indexes into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * index: what index we're filling in now
- * used: an array of booleans: whether a given index is already used
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-permute0(long n, long r, long *p, long index, char *used, VALUE values)
-{
- long i,j;
- for (i = 0; i < n; i++) {
- if (used[i] == 0) {
- p[index] = i;
- if (index < r-1) { /* if not done yet */
- used[i] = 1; /* mark index used */
- permute0(n, r, p, index+1, /* recurse */
- used, values);
- used[i] = 0; /* index unused */
- }
- else {
- /* We have a complete permutation of array indexes */
- /* Build a ruby array of the corresponding values */
- /* And yield it to the associated block */
- VALUE result = rb_ary_new2(r);
- VALUE *result_array = RARRAY_PTR(result);
- const VALUE *values_array = RARRAY_PTR(values);
-
- for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- if (RBASIC(values)->klass) {
- rb_raise(rb_eRuntimeError, "permute reentered");
- }
- }
- }
- }
-}
-
-/*
- * call-seq:
- * ary.permutation { |p| block } -> ary
- * ary.permutation -> an_enumerator
- * ary.permutation(n) { |p| block } -> ary
- * ary.permutation(n) -> an_enumerator
- *
- * When invoked with a block, yield all permutations of length <i>n</i>
- * of the elements of <i>ary</i>, then return the array itself.
- * If <i>n</i> is not specified, yield all permutations of all elements.
- * The implementation makes no guarantees about the order in which
- * the permutations are yielded.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(1).to_a #=> [[1],[2],[3]]
- * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(0).to_a #=> [[]] # one permutation of length 0
- * a.permutation(4).to_a #=> [] # no permutations of length 4
- */
-
-static VALUE
-rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
-{
- VALUE num;
- long r, n, i;
-
- n = RARRAY_LEN(ary); /* Array length */
- RETURN_ENUMERATOR(ary, argc, argv); /* Return enumerator if no block */
- rb_scan_args(argc, argv, "01", &num);
- r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
-
- if (r < 0 || n < r) {
- /* no permutations: yield nothing */
- }
- else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
- }
- else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
- }
- else { /* this is the general case */
- volatile VALUE t0 = tmpbuf(n,sizeof(long));
- long *p = (long*)RSTRING_PTR(t0);
- volatile VALUE t1 = tmpbuf(n,sizeof(char));
- char *used = (char*)RSTRING_PTR(t1);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC(ary0)->klass = 0;
-
- MEMZERO(used, char, n); /* initialize array */
-
- permute0(n, r, p, 0, used, ary0); /* compute and yield permutations */
- tmpbuf_discard(t0);
- tmpbuf_discard(t1);
- RBASIC(ary0)->klass = rb_cArray;
- }
- return ary;
-}
-
-/*
- * call-seq:
- * ary.combination(n) { |c| block } -> ary
- * ary.combination(n) -> an_enumerator
- *
- * When invoked with a block, yields all combinations of length <i>n</i>
- * of elements from <i>ary</i> and then returns <i>ary</i> itself.
- * The implementation makes no guarantees about the order in which
- * the combinations are yielded.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3, 4]
- * a.combination(1).to_a #=> [[1],[2],[3],[4]]
- * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- * a.combination(4).to_a #=> [[1,2,3,4]]
- * a.combination(0).to_a #=> [[]] # one combination of length 0
- * a.combination(5).to_a #=> [] # no combinations of length 5
- *
- */
-
-static VALUE
-rb_ary_combination(VALUE ary, VALUE num)
-{
- long n, i, len;
-
- n = NUM2LONG(num);
- RETURN_ENUMERATOR(ary, 1, &num);
- len = RARRAY_LEN(ary);
- if (n < 0 || len < n) {
- /* yield nothing */
- }
- else if (n == 0) {
- rb_yield(rb_ary_new2(0));
- }
- else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
- }
- else {
- volatile VALUE t0 = tmpbuf(n+1, sizeof(long));
- long *stack = (long*)RSTRING_PTR(t0);
- volatile VALUE cc = tmpary(n);
- VALUE *chosen = RARRAY_PTR(cc);
- long lev = 0;
-
- MEMZERO(stack, long, n);
- stack[0] = -1;
- for (;;) {
- chosen[lev] = RARRAY_PTR(ary)[stack[lev+1]];
- for (lev++; lev < n; lev++) {
- chosen[lev] = RARRAY_PTR(ary)[stack[lev+1] = stack[lev]+1];
- }
- rb_yield(rb_ary_new4(n, chosen));
- if (RBASIC(t0)->klass) {
- rb_raise(rb_eRuntimeError, "combination reentered");
- }
- do {
- if (lev == 0) goto done;
- stack[lev--]++;
- } while (stack[lev+1]+n == len+lev+1);
- }
- done:
- tmpbuf_discard(t0);
- tmpary_discard(cc);
- }
- return ary;
-}
-
-/*
- * Recursively compute repeated permutations of r elements of the set
- * [0..n-1].
- * When we have a complete repeated permutation of array indexes, copy the
- * values at those indexes into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * index: what index we're filling in now
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-rpermute0(long n, long r, long *p, long index, VALUE values)
-{
- long i, j;
- for (i = 0; i < n; i++) {
- p[index] = i;
- if (index < r-1) { /* if not done yet */
- rpermute0(n, r, p, index+1, values); /* recurse */
- }
- else {
- /* We have a complete permutation of array indexes */
- /* Build a ruby array of the corresponding values */
- /* And yield it to the associated block */
- VALUE result = rb_ary_new2(r);
- VALUE *result_array = RARRAY_PTR(result);
- const VALUE *values_array = RARRAY_PTR(values);
-
- for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- if (RBASIC(values)->klass) {
- rb_raise(rb_eRuntimeError, "repeated permute reentered");
- }
- }
- }
-}
-
-/*
- * call-seq:
- * ary.repeated_permutation(n) { |p| block } -> ary
- * ary.repeated_permutation(n) -> an_enumerator
- *
- * When invoked with a block, yield all repeated permutations of length
- * <i>n</i> of the elements of <i>ary</i>, then return the array itself.
- * The implementation makes no guarantees about the order in which
- * the repeated permutations are yielded.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2]
- * a.repeated_permutation(1).to_a #=> [[1], [2]]
- * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
- * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
- */
-
-static VALUE
-rb_ary_repeated_permutation(VALUE ary, VALUE num)
-{
- long r, n, i;
-
- n = RARRAY_LEN(ary); /* Array length */
- RETURN_ENUMERATOR(ary, 1, &num); /* Return enumerator if no block */
- r = NUM2LONG(num); /* Permutation size from argument */
-
- if (r < 0) {
- /* no permutations: yield nothing */
- }
- else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
- }
- else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
- }
- else { /* this is the general case */
- volatile VALUE t0 = tmpbuf(r, sizeof(long));
- long *p = (long*)RSTRING_PTR(t0);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC(ary0)->klass = 0;
-
- rpermute0(n, r, p, 0, ary0); /* compute and yield repeated permutations */
- tmpbuf_discard(t0);
- RBASIC(ary0)->klass = rb_cArray;
- }
- return ary;
-}
-
-static void
-rcombinate0(long n, long r, long *p, long index, long rest, VALUE values)
-{
- long j;
- if (rest > 0) {
- for (; index < n; ++index) {
- p[r-rest] = index;
- rcombinate0(n, r, p, index, rest-1, values);
- }
- }
- else {
- VALUE result = rb_ary_new2(r);
- VALUE *result_array = RARRAY_PTR(result);
- const VALUE *values_array = RARRAY_PTR(values);
-
- for (j = 0; j < r; ++j) result_array[j] = values_array[p[j]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- if (RBASIC(values)->klass) {
- rb_raise(rb_eRuntimeError, "repeated combination reentered");
- }
- }
-}
-
-/*
- * call-seq:
- * ary.repeated_combination(n) { |c| block } -> ary
- * ary.repeated_combination(n) -> an_enumerator
- *
- * When invoked with a block, yields all repeated combinations of
- * length <i>n</i> of elements from <i>ary</i> and then returns
- * <i>ary</i> itself.
- * The implementation makes no guarantees about the order in which
- * the repeated combinations are yielded.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
- * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
- *
- */
-
-static VALUE
-rb_ary_repeated_combination(VALUE ary, VALUE num)
-{
- long n, i, len;
-
- n = NUM2LONG(num); /* Combination size from argument */
- RETURN_ENUMERATOR(ary, 1, &num); /* Return enumerator if no block */
- len = RARRAY_LEN(ary);
- if (n < 0) {
- /* yield nothing */
- }
- else if (n == 0) {
- rb_yield(rb_ary_new2(0));
- }
- else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
- }
- }
- else if (len == 0) {
- /* yield nothing */
- }
- else {
- volatile VALUE t0 = tmpbuf(n, sizeof(long));
- long *p = (long*)RSTRING_PTR(t0);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC(ary0)->klass = 0;
-
- rcombinate0(len, n, p, 0, n, ary0); /* compute and yield repeated combinations */
- tmpbuf_discard(t0);
- RBASIC(ary0)->klass = rb_cArray;
- }
- return ary;
-}
-
-/*
- * call-seq:
- * ary.product(other_ary, ...) -> new_ary
- * ary.product(other_ary, ...) { |p| block } -> ary
- *
- * Returns an array of all combinations of elements from all arrays.
- * The length of the returned array is the product of the length
- * of +self+ and the argument arrays.
- * If given a block, <i>product</i> will yield all combinations
- * and return +self+ instead.
- *
- *
- * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
- * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- * [1,2].product() #=> [[1],[2]]
- * [1,2].product([]) #=> []
- */
-
-static VALUE
-rb_ary_product(int argc, VALUE *argv, VALUE ary)
-{
- int n = argc+1; /* How many arrays we're operating on */
- volatile VALUE t0 = tmpary(n);
- volatile VALUE t1 = tmpbuf(n, sizeof(int));
- VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
- int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
- VALUE result = Qnil; /* The array we'll be returning, when no block given */
- long i,j;
- long resultlen = 1;
-
- RBASIC(t0)->klass = 0;
- RBASIC(t1)->klass = 0;
-
- /* initialize the arrays of arrays */
- ARY_SET_LEN(t0, n);
- arrays[0] = ary;
- for (i = 1; i < n; i++) arrays[i] = Qnil;
- for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
-
- /* initialize the counters for the arrays */
- for (i = 0; i < n; i++) counters[i] = 0;
-
- /* Otherwise, allocate and fill in an array of results */
- if (rb_block_given_p()) {
- /* Make defensive copies of arrays; exit if any is empty */
- for (i = 0; i < n; i++) {
- if (RARRAY_LEN(arrays[i]) == 0) goto done;
- arrays[i] = ary_make_shared_copy(arrays[i]);
- }
- }
- else {
- /* Compute the length of the result array; return [] if any is empty */
- for (i = 0; i < n; i++) {
- long k = RARRAY_LEN(arrays[i]), l = resultlen;
- if (k == 0) {
- result = rb_ary_new2(0);
- goto done;
- }
- resultlen *= k;
- if (resultlen < k || resultlen < l || resultlen / k != l) {
- rb_raise(rb_eRangeError, "too big to product");
- }
- }
- result = rb_ary_new2(resultlen);
- }
- for (;;) {
- int m;
- /* fill in one subarray */
- VALUE subarray = rb_ary_new2(n);
- for (j = 0; j < n; j++) {
- rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
- }
-
- /* put it on the result array */
- if(NIL_P(result)) {
- FL_SET(t0, FL_USER5);
- rb_yield(subarray);
- if (! FL_TEST(t0, FL_USER5)) {
- rb_raise(rb_eRuntimeError, "product reentered");
- }
- else {
- FL_UNSET(t0, FL_USER5);
- }
- }
- else {
- rb_ary_push(result, subarray);
- }
-
- /*
- * Increment the last counter. If it overflows, reset to 0
- * and increment the one before it.
- */
- m = n-1;
- counters[m]++;
- while (counters[m] == RARRAY_LEN(arrays[m])) {
- counters[m] = 0;
- /* If the first counter overflows, we are done */
- if (--m < 0) goto done;
- counters[m]++;
- }
- }
-done:
- tmpary_discard(t0);
- tmpbuf_discard(t1);
-
- return NIL_P(result) ? ary : result;
-}
-
-/*
- * call-seq:
- * ary.take(n) -> new_ary
- *
- * Returns first n elements from <i>ary</i>.
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take(3) #=> [1, 2, 3]
- *
- */
-
-static VALUE
-rb_ary_take(VALUE obj, VALUE n)
-{
- long len = NUM2LONG(n);
- if (len < 0) {
- rb_raise(rb_eArgError, "attempt to take negative size");
- }
- return rb_ary_subseq(obj, 0, len);
-}
-
-/*
- * call-seq:
- * ary.take_while {|arr| block } -> new_ary
- * ary.take_while -> an_enumerator
- *
- * Passes elements to the block until the block returns +nil+ or +false+,
- * then stops iterating and returns an array of all prior elements.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take_while {|i| i < 3 } #=> [1, 2]
- *
- */
-
-static VALUE
-rb_ary_take_while(VALUE ary)
-{
- long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
- }
- return rb_ary_take(ary, LONG2FIX(i));
-}
-
-/*
- * call-seq:
- * ary.drop(n) -> new_ary
- *
- * Drops first n elements from +ary+ and returns the rest of
- * the elements in an array.
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop(3) #=> [4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop(VALUE ary, VALUE n)
-{
- VALUE result;
- long pos = NUM2LONG(n);
- if (pos < 0) {
- rb_raise(rb_eArgError, "attempt to drop negative size");
- }
-
- result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
- if (result == Qnil) result = rb_ary_new();
- return result;
-}
-
-/*
- * call-seq:
- * ary.drop_while {|arr| block } -> new_ary
- * ary.drop_while -> an_enumerator
- *
- * Drops elements up to, but not including, the first element for
- * which the block returns +nil+ or +false+ and returns an array
- * containing the remaining elements.
- *
- * If no block is given, an enumerator is returned instead.
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop_while(VALUE ary)
-{
- long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
- }
- return rb_ary_drop(ary, LONG2FIX(i));
-}
-
-
-
-/* Arrays are ordered, integer-indexed collections of any object.
- * Array indexing starts at 0, as in C or Java. A negative index is
- * assumed to be relative to the end of the array---that is, an index of -1
- * indicates the last element of the array, -2 is the next to last
- * element in the array, and so on.
+/* Arrays are ordered, integer-indexed collections of any object.
+ * Array indexing starts at 0, as in C or Java. A negative index is
+ * assumed to be relative to the end of the array---that is, an index of -1
+ * indicates the last element of the array, -2 is the next to last
+ * element in the array, and so on.
*/
void
-Init_Array(void)
+Init_Array()
{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
rb_define_alloc_func(rb_cArray, ary_alloc);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
- rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
+ rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
- rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
@@ -4700,8 +2996,8 @@ Init_Array(void)
rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
- rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
- rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+ rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
+ rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
@@ -4710,24 +3006,20 @@ Init_Array(void)
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
rb_define_alias(rb_cArray, "size", "length");
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
- rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
- rb_define_method(rb_cArray, "index", rb_ary_index, -1);
- rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+ rb_define_method(rb_cArray, "index", rb_ary_index, 1);
+ rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
+ rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
+ rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
- rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
- rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
- rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "select", rb_ary_select, 0);
- rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
- rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -4759,24 +3051,10 @@ Init_Array(void)
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
- rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
- rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
- rb_define_method(rb_cArray, "count", rb_ary_count, -1);
- rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
- rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
- rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
- rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
- rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
- rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
- rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
- rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
- rb_define_method(rb_cArray, "product", rb_ary_product, -1);
-
- rb_define_method(rb_cArray, "take", rb_ary_take, 1);
- rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
- rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
- rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+ rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
+ rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
+ rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
id_cmp = rb_intern("<=>");
- sym_random = ID2SYM(rb_intern("random"));
+ inspect_key = rb_intern("__inspect_key__");
}
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
index 1cd26a8643..de7a2beeb8 100644
--- a/bcc32/Makefile.sub
+++ b/bcc32/Makefile.sub
@@ -3,19 +3,9 @@
SHELL = $(COMSPEC)
MKFILES = Makefile
-!ifndef MFLAGS
-MFLAGS=-
-!endif
-
#### Start of system configuration section. ####
-!ifndef OS
OS = bccwin32
-!endif
-!if !defined(RT)
-!error RT not defined. Retry from configure pass.
-!endif
-
-arch = $(ARCH)-$(OS)
+RT = $(OS)
## variables may be overridden by $(compile_dir)/Makefile
!ifndef srcdir
@@ -33,7 +23,7 @@ RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
!endif
!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)$(TEENY)
+RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
!endif
!ifndef icondirs
!ifdef ICONDIRS
@@ -46,6 +36,7 @@ iconinc=-I$(icondirs: = -I)
!endif
###############
+VPATH = $(srcdir):$(srcdir)/missing
.SUFFIXES: .y
!ifndef CC
@@ -58,21 +49,15 @@ CPP = cpp32
RC = brcc32
!endif
!ifndef YACC
-YACC = bison
+YACC = byacc
!endif
!ifndef AR
AR = tlib
!endif
-!ifndef BASERUBY
-BASERUBY = ruby
-!endif
PURIFY =
AUTOCONF = autoconf
-IFCHANGE = $(srcdir:/=\)\win32\ifchange.bat
RM = $(srcdir:/=\)\win32\rm.bat
-CP = copy > nul
-MV = move > nul
!if !defined(PROCESSOR_ARCHITECTURE)
PROCESSOR_ARCHITECTURE = x86
@@ -109,11 +94,14 @@ exec_prefix = $(prefix)
libdir = $(exec_prefix)/lib
!endif
!if !defined(datadir)
-datadir = $(prefix)/share
+datadir = /share
!endif
!ifndef EXTOUT
EXTOUT = .ext
!endif
+!ifndef RIDATADIR
+RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
+!endif
!ifndef TESTUI
TESTUI = console
!endif
@@ -121,24 +109,13 @@ TESTUI = console
TESTS =
!endif
!ifndef RDOCTARGET
-RDOCTARGET = install-doc
+RDOCTARGET = install-nodoc
!endif
OUTFLAG = -o
-COUTFLAG = -o
!ifndef CFLAGS
CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
!endif
-!ifndef DEFS
-DEFS =
-!endif
-!ifndef CPPFLAGS
-CPPFLAGS =
-!endif
-CPPFLAGS = $(DEFS) $(CPPFLAGS)
-!ifndef CXXFLAGS
-CXXFLAGS = $(CFLAGS)
-!endif
!ifndef LDFLAGS
LDFLAGS = -S:$(STACK)
!endif
@@ -152,15 +129,15 @@ EXTLIBS =
MEMLIB =
!endif
LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj cbrt.obj crypt.obj erf.obj lgamma_r.obj strlcat.obj strlcpy.obj tgamma.obj win32.obj
+MISSING = acosh.obj crypt.obj erf.obj win32.obj
!ifndef STACK
STACK = 0x2000000
!endif
-XCFLAGS = -DRUBY_EXPORT -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir) -I$(srcdir)/missing
+XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)/missing
-ARFLAGS = /a /p32
+ARFLAGS = /a
LD = ilink32 -q -Gn
LDSHARED = $(LD)
XLDFLAGS = -Tpe c0x32.obj
@@ -176,8 +153,8 @@ EXEEXT = .exe
PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT) -I$(srcdir)/lib $(MINIRUBYOPT)
-RUNRUBY = .\$(PROGRAM) -i"$(EXTOUT)/$(arch)" "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
+MINIRUBY = .\miniruby$(EXEEXT)
+RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
ORGLIBPATH = $(LIB)
@@ -187,43 +164,30 @@ LIBRUBY_A = $(RUBY_SO_NAME)-static.lib
LIBRUBY_SO = $(RUBY_SO_NAME).dll
LIBRUBY = $(RUBY_SO_NAME).lib
LIBRUBYARG = $(LIBRUBY)
-THREAD_MODEL = win32
PREP = miniruby$(EXEEXT)
OBJEXT = obj
-ASMEXT = asm
-
-INSTALLED_LIST= .installed.list
-
-MKMAIN_CMD = mkmain.bat
-
-SRC_FILE = $(<:\=/)
WINMAINOBJ = winmain.$(OBJEXT)
-ARCHMINIOBJS = dmydln.$(OBJEXT)
+MINIOBJS = dmydln.$(OBJEXT)
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-hdrdir = $(srcdir)/include
-VPATH = $(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/enc;$(srcdir)/missing;$(srcdir)/win32
-
-.path.c = .;$(srcdir);$(srcdir)/enc;$(srcdir)/win32;$(srcdir)/missing
-.path.ci = $(srcdir)
-.path.inc = .;$(srcdir)
-.path.def = .;$(srcdir)
-.path.h = .;$(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
+.path.c = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
+.path.h = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
.path.y = $(srcdir)
.path. = $(srcdir)
.c.obj:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -c $(<:/=\)
-
-.c.asm:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -S $(<:\=/)
+ $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
.rc.res:
$(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
+.y.c:
+ $(YACC) $(YFLAGS) $(<:\=/)
+ sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
+ @del y.tab.c
+
all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
ruby: $(PROGRAM)
@@ -231,52 +195,32 @@ rubyw: $(WPROGRAM)
!include $(srcdir)/common.mk
-$(MKFILES): $(srcdir)/bcc32/Makefile.sub $(srcdir)/bcc32/configure.bat $(srcdir)/bcc32/setup.mak
- $(COMSPEC) /C $(srcdir:/=\)\bcc32\configure.bat $(configure_args)
- @echo $(MKFILES) should be updated, re-run $(MAKE).
- @$(MAKE) > nul -q -f &&|
-PHONY: nul
- @exit
-|
-
-PHONY: nul
+PHONY: Makefile
-RUBY_CONFIG_H = $(arch_hdrdir)/ruby/config.h
CONFIG_H = ./.config.h.time
config: config.status
config.status: $(CONFIG_H)
-guard = INCLUDE_RUBY_CONFIG_H
-
$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
- @if not exist $(arch_hdrdir:/=\) md $(arch_hdrdir:/=\)
- @if not exist $(arch_hdrdir:/=\)\ruby md $(arch_hdrdir:/=\)\ruby
- @$(IFCHANGE) $(RUBY_CONFIG_H:/=\) &&|
-\#ifndef $(guard)
-\#define $(guard) 1
-\#define NO_BIG_INLINE 1
+ @$(srcdir:/=\)\win32\ifchange.bat config.h &&|
\#define HAVE_SYS_TYPES_H 1
\#define HAVE_SYS_STAT_H 1
\#define HAVE_STDLIB_H 1
\#define HAVE_STRING_H 1
\#define HAVE_MEMORY_H 1
-\#define HAVE_LONG_LONG 1
\#define HAVE_OFF_T 1
\#define SIZEOF_INT 4
\#define SIZEOF_SHORT 2
\#define SIZEOF_LONG 4
\#define SIZEOF_LONG_LONG 0
\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 8
+\#define SIZEOF_OFF_T 4
\#define SIZEOF_VOIDP 4
\#define SIZEOF_FLOAT 4
\#define SIZEOF_DOUBLE 8
\#define SIZEOF_TIME_T 4
-\#define SIZEOF_RLIM_T 0
-\#define SIZEOF_SIZE_T 4
-\#define SIZEOF_PTRDIFF_T 4
\#define HAVE_PROTOTYPES 1
\#define TOKEN_PASTE(x,y) x\#\#y
\#define HAVE_STDARG_PROTOTYPES 1
@@ -292,32 +236,6 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
\#define rb_pid_t int
\#define HAVE_STRUCT_STAT_ST_RDEV 1
\#define HAVE_ST_RDEV 1
-!if $(BORLANDC) < 0x0580
-\#define int8_t signed char
-\#define uint8_t unsigned char
-\#define int16_t short
-\#define uint16_t unsigned short
-\#define int32_t int
-\#define uint32_t unsigned int
-\#define int64_t __int64
-\#define uint64_t unsigned __int64
-\#define ssize_t int
-!endif
-\#define HAVE_INT8_T 1
-\#define HAVE_UINT8_T 1
-\#define SIZEOF_INT8_T 1
-\#define HAVE_INT16_T 1
-\#define HAVE_UINT16_T 1
-\#define SIZEOF_INT32_T 2
-\#define HAVE_INT32_T 1
-\#define HAVE_UINT32_T 1
-\#define SIZEOF_INT32_T 4
-\#define HAVE_INT64_T 1
-\#define HAVE_UINT64_T 1
-\#define SIZEOF_INT64_T 8
-\#define HAVE_INTPTR_T 1
-\#define HAVE_UINTPTR_T 1
-\#define HAVE_SSIZE_T 1
\#define GETGROUPS_T int
\#define RETSIGTYPE void
\#define HAVE_ALLOCA 1
@@ -333,8 +251,6 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
\#define HAVE_STRTOD 1
\#define HAVE_STRTOL 1
\#define HAVE_STRTOUL 1
-\#define HAVE_SNPRINTF 1
-\#define HAVE_VSNPRINTF 1
\#define HAVE_ISNAN 1
\#define HAVE_FINITE 1
\#define HAVE_HYPOT 1
@@ -342,10 +258,7 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
\#define HAVE_WAITPID 1
\#define HAVE_FSYNC 1
\#define HAVE_GETCWD 1
-\#define HAVE_TRUNCATE 1
-\#define HAVE_FTRUNCATE 1
-\#define HAVE_FSEEKO 1
-\#define HAVE_FTELLO 1
+\#define HAVE_CHSIZE 1
\#define HAVE_TIMES 1
\#define HAVE_FCNTL 1
\#define HAVE_LINK 1
@@ -357,20 +270,19 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
\#define RSHIFT(x,y) ((x)>>(int)y)
\#define FILE_COUNT level
\#define FILE_READPTR curp
-\#define RUBY_SETJMP(env) setjmp(env)
-\#define RUBY_LONGJMP(env,val) longjmp(env,val)
-\#define RUBY_JMP_BUF jmp_buf
\#define inline __inline
\#define NEED_IO_SEEK_BETWEEN_RW 1
\#define STACK_GROW_DIRECTION -1
\#define DEFAULT_KCODE KCODE_NONE
-\#define LOAD_RELATIVE 1
\#define DLEXT ".so"
-\#define RUBY_LIB_PREFIX "/lib/ruby"
+\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
+\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#endif /* $(guard) */
+\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
|
- @exit > $(@:/=\)
+ @exit > $@
config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
@echo Creating $@
@@ -380,14 +292,13 @@ s,@SHELL@,$$(COMSPEC),;t t
s,@BUILD_FILE_SEPARATOR@,\,;t t
s,@PATH_SEPARATOR@,;,;t t
s,@CFLAGS@,$(CFLAGS),;t t
-s,@DEFS@,$(DEFS),;t t
s,@CPPFLAGS@,$(CPPFLAGS),;t t
s,@CXXFLAGS@,$(CXXFLAGS),;t t
s,@FFLAGS@,$(FFLAGS),;t t
s,@LDFLAGS@,,;t t
s,@LIBS@,$(LIBS),;t t
s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,$(prefix),;t t
+s,@prefix@,,;t t
s,@program_transform_name@,s,,,,;t t
s,@bindir@,$${exec_prefix}/bin,;t t
s,@sbindir@,$${exec_prefix}/sbin,;t t
@@ -401,7 +312,6 @@ s,@includedir@,$${prefix}/include,;t t
s,@oldincludedir@,/usr/include,;t t
s,@infodir@,$${prefix}/info,;t t
s,@mandir@,$${prefix}/man,;t t
-s,@ridir@,$${prefix}/share/ri,;t t
s,@build@,$(CPU)-pc-$(OS),;t t
s,@build_alias@,$(CPU)-$(OS),;t t
s,@build_cpu@,$(CPU),;t t
@@ -419,17 +329,17 @@ s,@target_vendor@,pc,;t t
s,@target_os@,$(OS),;t t
s,@CC@,$(CC),;t t
s,@CPP@,cpp32,;t t
-s,@CXX@,$$(CC),;t t
-s,@LD@,$(LD),;t t
s,@YACC@,$(YACC),;t t
s,@RANLIB@,,;t t
s,@AR@,$(AR),;t t
s,@ARFLAGS@,$(ARFLAGS) ,;t t
s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,MFLAGS = -$$(MAKEFLAGS),;t t
-s,@RM@,$$(top_srcdir:/=\)\win32\rm.bat,;t t
+s,@SET_MAKE@,$(SET_MAKE),;t t
s,@CP@,copy > nul,;t t
-s,@LIBOBJS@, $(MISSING),;t t
+s,@INSTALL@,copy > nul,;t t
+s,@INSTALL_PROG@,$$(INSTALL),;t t
+s,@INSTALL_DATA@,$$(INSTALL),;t t
+s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
s,@ALLOCA@,$(ALLOCA),;t t
s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
s,@EXEEXT@,.exe,;t t
@@ -469,30 +379,23 @@ s,@SOLIBS@,$(SOLIBS),;t t
s,@DLDLIBS@,$(DLDLIBS),;t t
s,@ENABLE_SHARED@,yes,;t t
s,@OUTFLAG@,$(OUTFLAG),;t t
-s,@COUTFLAG@,$(COUTFLAG),;t t
s,@CPPOUTFILE@,,;t t
s,@LIBPATHFLAG@, -L"%s",;t t
s,@RPATHFLAG@,,;t t
s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS:/=\), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE:/=\), $$(RESFILE:/=\),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
+s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
+s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
+s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
-s,@cleanlibs@,$$*.tds,;t t
-s,@cleanobjs@,$$*-$$(arch).def $$*.il? $$*.lib,;t t
s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
s,@EXPORT_PREFIX@,_,;t t
s,@arch@,$(ARCH)-$(OS),;t t
s,@sitearch@,$(ARCH)-$(OS),;t t
s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
-s,@vendordir@,$${prefix}/lib/ruby/vendor_ruby,;t t
-s,@rubyhdrdir@,$$(includedir)/ruby-$$(MAJOR).$$(MINOR).$$(TEENY),;t t
-s,@sitehdrdir@,$$(rubyhdrdir)/site_ruby,;t t
-s,@vendorhdrdir@,$$(rubyhdrdir)/vendor_ruby,;t t
s,@configure_args@,--enable-shared $(configure_args),;t t
s,@configure_input@,$$configure_input,;t t
s,@srcdir@,$(srcdir),;t t
@@ -501,7 +404,7 @@ s,@top_srcdir@,$(srcdir),;t t
miniruby$(EXEEXT):
@echo $(LIBS)
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS) $(COMMONOBJS:/=\) $(DMYEXT),$@,nul,$(LIBS)
+ $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
$(PROGRAM): $(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
@@ -518,7 +421,6 @@ $(LIBRUBY_A): $(OBJS) $(DMYEXT)
$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
@echo $(DLDOBJS)
- @$(PRE_LIBRUBY_UPDATE)
$(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
$(LIBRUBY): $(LIBRUBY_SO)
@@ -526,51 +428,30 @@ $(LIBRUBY): $(LIBRUBY_SO)
$(RUBYDEF): $(LIBRUBY_A) $(PREP)
$(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb $(srcdir)/revision.h $(srcdir)/win32/resource.rb
+$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
@$(MINIRUBY) $(srcdir)/win32/resource.rb \
-ruby_name=$(RUBY_INSTALL_NAME) \
-rubyw_name=$(RUBYW_INSTALL_NAME) \
-so_name=$(RUBY_SO_NAME) \
. $(icondirs) $(srcdir)/win32
-lex.c: {$(srcdir)}lex.c.blt
- copy "$(?:/=\)" $@
-
-post-install-bin::
- @$(NULLCMD)
-post-install-lib::
- @$(NULLCMD)
-post-install-ext-comm::
- @$(NULLCMD)
-post-install-ext-arch::
- @$(NULLCMD)
-post-install-man::
- @$(NULLCMD)
-post-install-doc::
- @$(NULLCMD)
+post-install-ext::
+ $(MINIRUBY) -I$(srcdir)lib -rrbconfig -rfileutils \
+ -e "FileUtils.rm_f(Dir[ARGV[0]+Config::CONFIG['archdir']+'/**/*.tds'])" "$(DESTDIR:\=/)"
clean-local::
- @$(RM) $(WINMAINOBJ) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
+ @$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
- @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF) ext\ripper\y.output
distclean-local::
@$(RM) ext\config.cache $(RBCONFIG:/=\)
+ @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
-clean-ext distclean-ext realclean-ext::
- @for /R ext %I in (.) do @if exist %I\Makefile ( \
- echo $(@:-ext=)ing %~nI & \
- cd %I & \
- $(MAKE) $(MFLAGS) $(@:-ext=) & \
- cd %CD% \
- )
-
ext/extinit.obj: ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+ $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
main.$(OBJEXT): win32.h
-ascii.$(OBJEXT): win32.h
array.$(OBJEXT): win32.h
bignum.$(OBJEXT): win32.h
class.$(OBJEXT): win32.h
@@ -579,7 +460,6 @@ dir.$(OBJEXT): dir.h win32.h
dln.$(OBJEXT): win32.h
enum.$(OBJEXT): win32.h
error.$(OBJEXT): win32.h
-euc_jp.$(OBJEXT): win32.h
eval.$(OBJEXT): win32.h
file.$(OBJEXT): win32.h
gc.$(OBJEXT): win32.h
@@ -597,21 +477,14 @@ prec.$(OBJEXT): win32.h
random.$(OBJEXT): win32.h
range.$(OBJEXT): win32.h
re.$(OBJEXT): win32.h
-regcomp.$(OBJEXT): win32.h
-regenc.$(OBJEXT): win32.h
-regerror.$(OBJEXT): win32.h
-regexec.$(OBJEXT): win32.h
-reggnu.$(OBJEXT): win32.h
-regparse.$(OBJEXT): win32.h
+regex.$(OBJEXT): win32.h
ruby.$(OBJEXT): win32.h
signal.$(OBJEXT): win32.h
-sjis.$(OBJEXT): win32.h
sprintf.$(OBJEXT): win32.h
st.$(OBJEXT): win32.h
string.$(OBJEXT): win32.h
struct.$(OBJEXT): win32.h
time.$(OBJEXT): win32.h
-utf_8.$(OBJEXT): win32.h
util.$(OBJEXT): win32.h
variable.$(OBJEXT): win32.h
version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
index cd33eec0a1..c27a1261f1 100644
--- a/bcc32/README.bcc32
+++ b/bcc32/README.bcc32
@@ -16,7 +16,7 @@
* ilink32
(3) If you want to build from CVS source, following commands are required.
- * bison ((<URL:http://gnuwin32.sourceforge.net/packages/bison.htm>))
+ * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
* sed ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
(4) We strongly recommend to build ruby on C++Builder, to link following files.
@@ -30,13 +30,7 @@
== How to compile and install
(1) Execute bcc32\configure.bat on your build directory.
- ex. c:\src\ruby> bcc32\configure.bat
- You can specify the target platform as an argument.
- For example, run `((%configure i686-bccwin32%))'
- You can also specify the install directory.
- For example, run `((%configure --prefix=<install_directory>%))'
- Default of the install directory is /usr .
- The default ((|<PLATFORM>|)) is `(({i386-bccwin32}))'.
+ ex. c:\ruby-1.6.7>bcc32\configure.bat
(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
if you want to change the name of the executable files.
@@ -47,7 +41,20 @@
(4) Run `((%make test%))'
-(5) Run `((%make install%))'
+(5) Run `((%make DESTDIR=<install_directory> install%))'
+
+ This command will create following directories and install files onto them.
+ * <install_directory>\bin
+ * <install_directory>\lib
+ * <install_directory>\lib\ruby
+ * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
+ * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
+ * <install_directory>\lib\ruby\site_ruby
+ * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
+ * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
+ * <install_directory>\man\man1
+ If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
+ The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
@@ -83,10 +90,10 @@ in Japanese, but you can download at least.
C:
cd \ruby
- bcc32\configure --prefix=/usr/local
+ bcc32\configure
make
make test
- make install
+ make DESTDIR=/usr/local install
* Build on the relative directory from the ruby source directory and CPU type
i386.
@@ -101,10 +108,10 @@ in Japanese, but you can download at least.
cd \ruby
mkdir bccwin32
cd bccwin32
- ..\bcc32\configure --prefix=/usr/local
+ ..\bcc32\configure target i386-bccwin32
make
make test
- make install
+ make DESTDIR=/usr/local install
* Build on the different drive.
@@ -115,10 +122,10 @@ in Japanese, but you can download at least.
D:
cd D:\build\ruby
- C:\src\ruby\bcc32\configure --prefix=C:/usr/local
+ C:\src\ruby\bcc32\configure
make
make test
- make install
+ make DESTDIR=C:/usr/local install
== Bugs
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
index 8cdfc64b03..123a3f23c8 100755
--- a/bcc32/configure.bat
+++ b/bcc32/configure.bat
@@ -6,120 +6,70 @@
echo> ~tmp~.mak ####
echo>> ~tmp~.mak conf = %0
echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak @del ~setup~.mak
+echo>> ~tmp~.mak @del ~tmp~.mak
echo>> ~tmp~.mak @-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
-if exist pathlist.tmp del pathlist.tmp
-if exist confargs.mk del confargs.mk
:loop
if "%1" == "" goto :end
if "%1" == "--prefix" goto :prefix
-if "%1" == "prefix" goto :prefix
if "%1" == "--srcdir" goto :srcdir
if "%1" == "srcdir" goto :srcdir
if "%1" == "--target" goto :target
if "%1" == "target" goto :target
if "%1" == "--with-static-linked-ext" goto :extstatic
if "%1" == "--program-suffix" goto :suffix
-if "%1" == "RUBY_SUFFIX" goto :suffix
-if "%1" == "--program-name" goto :installname
-if "%1" == "--install-name" goto :installname
-if "%1" == "RUBY_INSTALL_NAME" goto :installname
-if "%1" == "--so-name" goto :soname
-if "%1" == "RUBY_SO_NAME" goto :soname
+if "%1" == "--program-name" goto :progname
if "%1" == "--enable-install-doc" goto :enable-rdoc
if "%1" == "--disable-install-doc" goto :disable-rdoc
if "%1" == "--extout" goto :extout
-if "%1" == "EXTOUT" goto :extout
-if "%1" == "--with-baseruby" goto :baseruby
-if "%1" == "BASERUBY" goto :baseruby
-if "%1" == "--path" goto :path
if "%1" == "-h" goto :help
if "%1" == "--help" goto :help
- echo>>confargs.tmp %1 \
+ echo>> ~tmp~.mak "%1" \
shift
goto :loop
:srcdir
- echo>> ~tmp~.mak -Dsrcdir=%2 \
- echo>>confargs.tmp --srcdir=%2 \
+ echo>> ~tmp~.mak -D"srcdir=%2" \
shift
shift
goto :loop
:prefix
- echo>> ~tmp~.mak -Dprefix=%2 \
- echo>>confargs.tmp %1=%2 \
+ echo>> ~tmp~.mak -D"prefix=%2" \
shift
shift
goto :loop
:suffix
- echo>>confargs.mk !ifndef RUBY_SUFFIX
- echo>>confargs.mk RUBY_SUFFIX = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
+ echo>> ~tmp~.mak -D"RUBY_SUFFIX=%2" \
shift
shift
goto :loop
:installname
- echo>>confargs.mk !ifndef RUBY_INSTALL_NAME
- echo>>confargs.mk RUBY_INSTALL_NAME = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
+ echo>> ~tmp~.mak -D"RUBY_INSTALL_NAME=%2" \
shift
shift
goto :loop
:soname
- echo>>confargs.mk !ifndef RUBY_SO_NAME
- echo>>confargs.mk RUBY_SO_NAME = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
+ echo>> ~tmp~.mak -D"RUBY_SO_NAME=%2" \
shift
shift
goto :loop
:target
- echo>> ~tmp~.mak %2 \
- echo>>confargs.tmp --target=%2 \
+ echo>> ~tmp~.mak "%2" \
shift
shift
goto :loop
:extstatic
- echo>>confargs.mk !ifndef EXTSTATIC
- echo>>confargs.mk EXTSTATIC = static
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1 \
+ echo>> ~tmp~.mak -D"EXTSTATIC=static" \
shift
goto :loop
:enable-rdoc
- echo>>confargs.mk !ifndef RDOCTARGET
- echo>>confargs.mk RDOCTARGET = install-doc
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1 \
+ echo>> ~tmp~.mak -D"RDOCTARGET=install-doc" \
shift
goto :loop
:disable-rdoc
- echo>>confargs.mk !ifndef RDOCTARGET
- echo>>confargs.mk RDOCTARGET = install-nodoc
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1 \
+ echo>> ~tmp~.mak -D"RDOCTARGET=install-nodoc" \
shift
goto :loop
:extout
- echo>>confargs.mk !ifndef EXTOUT
- echo>>confargs.mk EXTOUT = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:baseruby
- echo>>confargs.mk !ifndef BASERUBY
- echo>>confargs.mk BASERUBY = %2
- echo>>confargs.mk !endif
- echo>>confargs.tmp %1=%2 \
- shift
- shift
-goto :loop
-:path
- echo>>pathlist.tmp %2;\
- echo>>confargs.tmp %1=%2 \
+ echo>> ~tmp~.mak "EXTOUT=%2" \
shift
shift
goto :loop
@@ -132,32 +82,11 @@ goto :loop
echo System types:
echo --target=TARGET configure for TARGET [i386-bccwin32]
echo Optional Package:
- echo --with-baseruby=RUBY use RUBY as baseruby [ruby]
echo --with-static-linked-ext link external modules statically
echo --enable-install-doc install rdoc indexes during install
- del *.tmp
del ~tmp~.mak
goto :exit
:end
-echo>> ~tmp~.mak -Dbcc32dir=$(@D)
-if not exist confargs.tmp goto :noconfargs
- echo>>confargs.mk configure_args = \
- type>>confargs.mk confargs.tmp
- echo.>>confargs.mk
- echo>>confargs.mk ####
-:noconfargs
-if not exist pathlist.tmp goto :nopathlist
- echo>>confargs.mk pathlist = \
- type>>confargs.mk pathlist.tmp
- echo.>>confargs.mk
- echo>>confargs.mk ####
- echo>>confargs.mk PATH = $(pathlist:;=/bin;)$(PATH)
- echo>>confargs.mk INCLUDE = $(pathlist:;=/include;)
- echo>>confargs.mk LIB = $(pathlist:;=/lib;)
-:nopathlist
-if exist confargs.mk copy confargs.mk ~setup~.mak > nul
-type>>~setup~.mak ~tmp~.mak
-del *.tmp > nul
-del ~tmp~.mak > nul
-make -s -f ~setup~.mak
+echo>> ~tmp~.mak bcc32dir="$(@D)"
+make -s -f ~tmp~.mak
:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
index 888ab2e2a6..e34b441e2f 100755..100644
--- a/bcc32/mkexports.rb
+++ b/bcc32/mkexports.rb
@@ -1,26 +1,25 @@
#!./miniruby -s
-$:.unshift(File.expand_path("../..", __FILE__))
-require 'win32/mkexports'
-
-class Exports::Bcc < Exports
- def forwarding(internal, export)
- internal[/\A_?/]+export
+SYM = {}
+STDIN.reopen(open("nul"))
+ARGV.each do |obj|
+ IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
+ next unless /(?:PUBDEF|PUBD32)/ =~ l
+ SYM[$1] = true if /'(.*?)'/ =~ l
end
+end
- def each_line(objs, &block)
- objs.each do |obj|
- opt = /\.(?:so|dll)\z/i =~ obj ? "-ee" : "-oiPUBDEF -oiPUBD32"
- IO.foreach("|tdump -q #{opt} #{obj.tr('/', '\\')} < nul", &block)
- end
- end
+exports = []
+if $name
+ exports << "Name " + $name
+elsif $library
+ exports << "Library " + $library
+end
+exports << "Description " + $description.dump if $description
+exports << "EXPORTS" << SYM.keys.sort
- def each_export(objs)
- objdump(objs) do |l|
- next unless /(?:PUBDEF|PUBD32|EXPORT)/ =~ l
- yield $1 if /'(.*?)'/ =~ l
- end
- yield "_strcasecmp", "_stricmp"
- yield "_strncasecmp", "_strnicmp"
- end
+if $output
+ open($output, 'w') {|f| f.puts exports.join("\n")}
+else
+ puts exports.join("\n")
end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
index df2fd3c128..b7a2539d0a 100644
--- a/bcc32/setup.mak
+++ b/bcc32/setup.mak
@@ -15,7 +15,7 @@ prefix = /usr
OS = bccwin32
RT = $(OS)
BANG = !
-APPEND = echo.>>$(MAKEFILE)
+APPEND = echo>>$(MAKEFILE)
!ifdef MAKEFILE
MAKE = $(MAKE) -f $(MAKEFILE)
!else
@@ -30,9 +30,7 @@ i586-$(OS): -prologue- -i586- -epilogue-
i686-$(OS): -prologue- -i686- -epilogue-
alpha-$(OS): -prologue- -alpha- -epilogue-
--prologue-: -basic-vars- -version- -system-vars-
-
--basic-vars-: nul
+-prologue-: nul
@echo Creating $(MAKEFILE)
@type > $(MAKEFILE) &&|
\#\#\# Makefile for ruby $(OS) \#\#\#
@@ -42,79 +40,36 @@ $(BANG)endif
$(BANG)ifndef prefix
prefix = $(prefix:\=/)
$(BANG)endif
-$(BANG)if !defined(BASERUBY)
-!if defined(BASERUBY)
-BASERUBY = $(BASERUBY)
-!endif
-|
-!if !defined(BASERUBY)
- @for %I in (ruby.exe) do @echo BASERUBY = "%~$$PATH:I" >> $(MAKEFILE)
+$(BANG)ifndef EXTSTATIC
+EXTSTATIC = $(EXTSTATIC)
+$(BANG)endif
+!if defined(RDOCTARGET)
+$(BANG)ifndef RDOCTARGET
+RDOCTARGET = $(RDOCTARGET)
+$(BANG)endif
!endif
- @type >> $(MAKEFILE) &&|
+!if defined(EXTOUT)
+$(BANG)ifndef EXTOUT
+EXTOUT = $(EXTOUT)
$(BANG)endif
-|
-!if exist(confargs.mk)
- @type confargs.mk >> $(MAKEFILE)
- @del confargs.mk
!endif
-
--system-vars-: -runtime- -bormm-
-
--bormm-: nul
- @-ilink32 -q -Gn -x usebormm.lib > nul
- @-if exist usebormm.tds $(APPEND) MEMLIB = usebormm.lib
- @if exist usebormm.* del usebormm.*
-
--osname-: nul
- @echo OS = >>$(MAKEFILE)
-
--runtime-: nul
- type > conftest.c &&|
-\#include <stdio.h>
-int main(){printf("");return 0;}
|
- bcc32 conftest.c cw32i.lib > nul
- tdump conftest.exe < nul > conftest.i
- grep "^Imports from CC" conftest.i > conftest.c
- cpp32 -P- -DFile=\# -DImports=RTNAME -Dfrom== conftest.c > nul
- $(MAKE) > nul -DBANG=$(BANG) -f &&|
--runtime-: nul
-$(BANG)include conftest.i
-RT = $$(RTNAME:.DLL=)
-OS = $$(RT:CC32=)
--runtime-:
- del conftest.*
-$(BANG)if "$$(OS)" == "50"
- echo OS = bccwin32 >> $(MAKEFILE)
-$(BANG)else
- echo OS = bccwin32_$$(OS) >> $(MAKEFILE)
-$(BANG)endif
+ @type > usebormm.bat &&|
+@echo off
+ilink32 -Gn -x usebormm.lib > nul
+if exist usebormm.tds echo MEMLIB = usebormm.lib
|
- @echo RT = $$(OS) >> $(MAKEFILE)
+ @usebormm.bat >> $(MAKEFILE)
+ @del usebormm.*
--version-: nul
@cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
-\#define RUBY_REVISION 0
\#include "version.h"
-MAJOR = RUBY_API_VERSION_MAJOR
-MINOR = RUBY_API_VERSION_MINOR
-TEENY = RUBY_API_VERSION_TEENY
-
-BORLANDC = __BORLANDC__
+MAJOR = RUBY_VERSION_MAJOR
+MINOR = RUBY_VERSION_MINOR
+TEENY = RUBY_VERSION_TEENY
|
- @$(MAKE) > nul -DBANG=$(BANG) -f &&,
--version-: nul
-$(BANG)include $(MAKEFILE)
-$(BANG)include $(MAKEFILE).i
--version-:
+ @type $(MAKEFILE).i >> $(MAKEFILE)
@del $(MAKEFILE).i
- @type >> $(MAKEFILE) &&|
-MAJOR = $$(MAJOR)
-MINOR = $$(MINOR)
-TEENY = $$(TEENY)
-BORLANDC = $$(BORLANDC)
-|
-,
-generic-: nul
!if defined(PROCESSOR_ARCHITECTURE) || defined(PROCESSOR_LEVEL)
@@ -129,6 +84,7 @@ $(BANG)ifndef PROCESSOR_LEVEL
PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
$(BANG)endif
!endif
+
|
!endif
@@ -158,14 +114,11 @@ $(BANG)endif
@$(APPEND) PROCESSOR_LEVEL = 6
@$(APPEND) !endif
--epilogue-: -encs-
-
--encs-: nul
- @$(MAKE) -f $(srcdir)/win32/enc-setup.mak srcdir="$(srcdir)" MAKEFILE=$(MAKEFILE)
-
-epilogue-: nul
@type >> $(MAKEFILE) &&|
+\# OS = $(OS)
+\# RT = $(RT)
\# RUBY_INSTALL_NAME = ruby
\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
@@ -176,4 +129,5 @@ $(BANG)endif
\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
$(BANG)include $$(srcdir)/bcc32/Makefile.sub
|
+ @$(srcdir:/=\)\win32\rm.bat config.h config.status
@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
deleted file mode 100644
index 3cd8a8fd37..0000000000
--- a/benchmark/bm_app_answer.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-def the_answer_to_life_the_universe_and_everything
- (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
-end
-
-answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
deleted file mode 100644
index 45f471dfdb..0000000000
--- a/benchmark/bm_app_factorial.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-def fact(n)
- if(n > 1)
- n * fact(n-1)
- else
- 1
- end
-end
-
-100.times {
- fact(5000)
-}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/bm_app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
- if n < 3
- 1
- else
- fib(n-1) + fib(n-2)
- end
-end
-
-fib(34)
-
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
deleted file mode 100644
index 89069db7ab..0000000000
--- a/benchmark/bm_app_mandelbrot.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-require 'complex'
-
-def mandelbrot? z
- i = 0
- while i<100
- i+=1
- z = z * z
- return false if z.abs > 2
- end
- true
-end
-
-ary = []
-
-(0..1000).each{|dx|
- (0..1000).each{|dy|
- x = dx / 50.0
- y = dy / 50.0
- c = Complex(x, y)
- ary << c if mandelbrot?(c)
- }
-}
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
- nb.each{|x|
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- [-ROW, -1, 1, ROW].each{|d|
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- }
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- }
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- (0...ROW*COL).each{|i|
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- }
-end
-
-def pboard
- return # skip print
- print "No. #$no\n"
- (0...COL).each{|i|
- print "|"
- (0...ROW-NP).each{|j|
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- }
- print "\n"
- }
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- x.each{|s|
- if $b[pos+s] != -1
- f=1
- break
- end
- }
- if f == 0 then
- x.each{|s|
- $b[pos+s] = i
- }
- a << i
- setpiece(a.dup, pos)
- a.pop
- x.each{|s|
- $b[pos+s] = -1
- }
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
- for x in nb
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- for d in [-ROW, -1, 1, ROW]
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- end
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- end
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- for i in 0...ROW*COL
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- end
-end
-
-def pboard
- print "No. #$no\n"
- for i in 0...COL
- print "|"
- for j in 0...ROW-NP
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- end
- print "\n"
- end
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- for s in x do
- if $b[pos+s] != -1
- f=1
- break
- end
- end
- if f == 0 then
- for s in x do
- $b[pos+s] = i
- end
- a << i
- setpiece(a.dup, pos)
- a.pop
- for s in x do
- $b[pos+s] = -1
- end
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
deleted file mode 100644
index 01d2ae3219..0000000000
--- a/benchmark/bm_app_raise.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i=0
-while i<300000
- i+=1
- begin
- raise
- rescue
- end
-end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
deleted file mode 100644
index 7b2f2da5a7..0000000000
--- a/benchmark/bm_app_strconcat.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i=0
-while i<2_000_000
- "#{1+1} #{1+1} #{1+1}"
- i+=1
-end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/bm_app_tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
- unless y < x
- z
- else
- tak( tak(x-1, y, z),
- tak(y-1, z, x),
- tak(z-1, x, y))
- end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
deleted file mode 100644
index 4c146f5ccf..0000000000
--- a/benchmark/bm_app_tarai.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def tarai( x, y, z )
- if x <= y
- then y
- else tarai(tarai(x-1, y, z),
- tarai(y-1, z, x),
- tarai(z-1, x, y))
- end
-end
-
-tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
deleted file mode 100644
index 586edfd5dc..0000000000
--- a/benchmark/bm_app_uri.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-require 'uri'
-
-100_000.times{
- uri = URI.parse('http://www.ruby-lang.org')
- uri.scheme
- uri.host
- uri.port
-}
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
deleted file mode 100644
index 2f205c1333..0000000000
--- a/benchmark/bm_io_file_create.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-#
-# Create files
-#
-
-max = 200_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
- f = open(file, 'w')
- f.close#(true)
-}
-File.unlink(file)
-
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
deleted file mode 100644
index b9e796ed30..0000000000
--- a/benchmark/bm_io_file_read.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
- f.seek 0
- f.read
-}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
deleted file mode 100644
index aa1be0e5fe..0000000000
--- a/benchmark/bm_io_file_write.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
- f.seek 0
- f.write str
-}
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
deleted file mode 100644
index 19248daeb1..0000000000
--- a/benchmark/bm_io_select.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# IO.select performance
-
-w = [ IO.pipe[1] ];
-
-nr = 1000000
-nr.times {
- IO.select nil, w
-}
-
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
deleted file mode 100644
index 7b167af774..0000000000
--- a/benchmark/bm_io_select2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-# IO.select performance. worst case of single fd.
-
-ios = []
-nr = 1000000
-max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-((max / 2) - 10).times do
- ios.concat IO.pipe
-end
-
-last = [ ios[-1] ]
-puts "last IO: #{last[0].inspect}"
-
-nr.times do
- IO.select nil, last
-end
-
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
deleted file mode 100644
index fcdbb96e0e..0000000000
--- a/benchmark/bm_io_select3.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-# IO.select performance. a lot of fd
-
-ios = []
-nr = 100
-max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-(max - 10).times do
- r, w = IO.pipe
- r.close
- ios.push w
-end
-
-nr.times do
- IO.select nil, ios
-end
-
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
deleted file mode 100644
index 0fc4cc1511..0000000000
--- a/benchmark/bm_loop_for.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-for i in 1..30_000_000
- #
-end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/bm_loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
- gen = (1..max).each
- loop do
- gen.next
- end
-else
- require 'generator'
- gen = Generator.new((0..max))
- while gen.next?
- gen.next
- end
-end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
deleted file mode 100644
index 521f72ad1a..0000000000
--- a/benchmark/bm_loop_times.rb
+++ /dev/null
@@ -1 +0,0 @@
-30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
deleted file mode 100644
index 43d35e1131..0000000000
--- a/benchmark/bm_loop_whileloop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i=0
-while i<30_000_000 # benchmark loop 1
- i+=1
-end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
deleted file mode 100644
index e514989661..0000000000
--- a/benchmark/bm_loop_whileloop2.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i=0
-while i< 6_000_000 # benchmark loop 2
- i+=1
-end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
- x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
- (n-1).step(0,-1) do |bi|
- y[bi] += x.at(bi)
- end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
deleted file mode 100644
index 6a26465578..0000000000
--- a/benchmark/bm_so_binary_trees.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-def STDOUT.write_ *args
-end
-
-def item_check(tree)
- if tree[0] == nil
- tree[1]
- else
- tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
- item_item = 2 * item
- depth -= 1
- [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
- [nil, item, nil]
- end
-end
-
-max_depth = 12 # 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
- temp_tree = bottom_up_tree(i, depth)
- check += item_check(temp_tree)
-
- temp_tree = bottom_up_tree(-i, depth)
- check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 56b9410632..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i=0
-while i<10
- i+=1
- hello = ''
- 4_000_000.times do |e|
- hello << STUFF
- end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index d8b461290c..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-class Hi_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-def some_function(num)
- begin
- hi_function(num)
- rescue
- print "We shouldn't get here, exception is: #{$!.type}\n"
- end
-end
-
-def hi_function(num)
- begin
- lo_function(num)
- rescue Hi_Exception
- $HI = $HI + 1
- end
-end
-
-def lo_function(num)
- begin
- blowup(num)
- rescue Lo_Exception
- $LO = $LO + 1
- end
-end
-
-def blowup(num)
- if num % 2 == 0
- raise Lo_Exception.new(num)
- else
- raise Hi_Exception.new(num)
- end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
- i+=1
- some_function(i+1)
-end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
deleted file mode 100644
index bac5ecd44c..0000000000
--- a/benchmark/bm_so_fannkuch.rb
+++ /dev/null
@@ -1,45 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
- maxFlips, m, r, check = 0, n-1, n, 0
- count = (1..n).to_a
- perm = (1..n).to_a
-
- while true
- if check < 30
- puts "#{perm}"
- check += 1
- end
-
- while r != 1
- count[r-1] = r
- r -= 1
- end
-
- if perm[0] != 1 and perm[m] != n
- perml = perm.clone #.dup
- flips = 0
- while (k = perml.first ) != 1
- perml = perml.slice!(0, k).reverse + perml
- flips += 1
- end
- maxFlips = flips if flips > maxFlips
- end
- while true
- if r==n then return maxFlips end
- perm.insert r,perm.shift
- break if (count[r] -= 1) > 0
- r += 1
- end
- end
-end
-
-def puts *args
-end
-
-N = 9 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
deleted file mode 100644
index f8d26797aa..0000000000
--- a/benchmark/bm_so_lists.rb
+++ /dev/null
@@ -1,47 +0,0 @@
-#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
-
-NUM = 300
-SIZE = 10000
-
-def test_lists()
- # create a list of integers (Li1) from 1 to SIZE
- li1 = (1..SIZE).to_a
- # copy the list to li2 (not by individual items)
- li2 = li1.dup
- # remove each individual item from left side of li2 and
- # append to right side of li3 (preserving order)
- li3 = Array.new
- while (not li2.empty?)
- li3.push(li2.shift)
- end
- # li2 must now be empty
- # remove each individual item from right side of li3 and
- # append to right side of li2 (reversing list)
- while (not li3.empty?)
- li2.push(li3.pop)
- end
- # li3 must now be empty
- # reverse li1 in place
- li1.reverse!
- # check that first item is now SIZE
- if li1[0] != SIZE then
- p "not SIZE"
- 0
- else
- # compare li1 and li2 for equality
- if li1 != li2 then
- return(0)
- else
- # return the length of the list
- li1.length
- end
- end
-end
-
-i = 0
-while i<NUM
- i+=1
- result = test_lists()
-end
-
-result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
deleted file mode 100644
index 76331c64b8..0000000000
--- a/benchmark/bm_so_mandelbrot.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-# The Computer Language Benchmarks Game
-# http://shootout.alioth.debian.org/
-#
-# contributed by Karl von Laudermann
-# modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49 # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1 # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
- for x in 0..count_size
- zr = 0.0
- zi = 0.0
- cr = (2.0*x/size)-1.5
- ci = (2.0*y/size)-1.0
- escape = false
-
- # To make use of the for..in code, we use a dummy variable,
- # like one would in C
- for dummy in 0..ITER
- tr = zr*zr - zi*zi + cr
- ti = 2*zr*zi + ci
- zr, zi = tr, ti
-
- if (zr*zr+zi*zi) > LIMIT_SQUARED
- escape = true
- break
- end
- end
-
- byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
- bit_num += 1
-
- # Code is very similar for these cases, but using separate blocks
- # ensures we skip the shifting when it's unnecessary, which is most cases.
- if (bit_num == 8)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- elsif (x == count_size)
- byte_acc <<= (8 - bit_num)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- end
- end
-end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
- count = 1
- mx = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- row[j] = count
- count += 1
- end
- mx[bi] = row
- end
- mx
-end
-
-def mmult(rows, cols, m1, m2)
- m3 = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- val = 0
- (0 .. (cols - 1)).each do |k|
- val += m1.at(bi).at(k) * m2.at(k).at(j)
- end
- row[j] = val
- end
- m3[bi] = row
- end
- m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
- mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 99cf6a91cc..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,564 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is invalid at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values ( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop accross the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the curent row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # follwing reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is acheived via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
- end
-
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
-end
-
-def energy(bodies)
- e = 0.0
- nbodies = bodies.size
-
- for i in 0 ... nbodies
- b = bodies[i]
- e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
- for j in (i + 1) ... nbodies
- b2 = bodies[j]
- dx = b.x - b2.x
- dy = b.y - b2.y
- dz = b.z - b2.z
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- e -= (b.mass * b2.mass) / distance
- end
- end
- e
-end
-
-def offset_momentum(bodies)
- px, py, pz = 0.0, 0.0, 0.0
-
- for b in bodies
- m = b.mass
- px += b.vx * m
- py += b.vy * m
- pz += b.vz * m
- end
-
- b = bodies[0]
- b.vx = - px / SOLAR_MASS
- b.vy = - py / SOLAR_MASS
- b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
- # sun
- Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
- # jupiter
- Planet.new(
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03,
- 7.69901118419740425e-03,
- -6.90460016972063023e-05,
- 9.54791938424326609e-04),
-
- # saturn
- Planet.new(
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03,
- 4.99852801234917238e-03,
- 2.30417297573763929e-05,
- 2.85885980666130812e-04),
-
- # uranus
- Planet.new(
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03,
- 2.37847173959480950e-03,
- -2.96589568540237556e-05,
- 4.36624404335156298e-05),
-
- # neptune
- Planet.new(
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03,
- 1.62824170038242295e-03,
- -9.51592254519715870e-05,
- 5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
- i = 0
- while i < nbodies
- b = BODIES[i]
- b.move_from_i(BODIES, nbodies, dt, i + 1)
- i += 1
- end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644