summaryrefslogtreecommitdiff
path: root/lib/erb/compiler.rb
diff options
context:
space:
mode:
Diffstat (limited to 'lib/erb/compiler.rb')
-rw-r--r--lib/erb/compiler.rb25
1 files changed, 20 insertions, 5 deletions
diff --git a/lib/erb/compiler.rb b/lib/erb/compiler.rb
index 7096c8dcea..6d70288b4f 100644
--- a/lib/erb/compiler.rb
+++ b/lib/erb/compiler.rb
@@ -80,10 +80,16 @@ class ERB::Compiler # :nodoc:
end
class Scanner # :nodoc:
- @scanner_map = {}
+ @scanner_map = defined?(Ractor) ? Ractor.make_shareable({}) : {}
class << self
- def register_scanner(klass, trim_mode, percent)
- @scanner_map[[trim_mode, percent]] = klass
+ if defined?(Ractor)
+ def register_scanner(klass, trim_mode, percent)
+ @scanner_map = Ractor.make_shareable({ **@scanner_map, [trim_mode, percent] => klass })
+ end
+ else
+ def register_scanner(klass, trim_mode, percent)
+ @scanner_map[[trim_mode, percent]] = klass
+ end
end
alias :regist_scanner :register_scanner
end
@@ -219,7 +225,7 @@ class ERB::Compiler # :nodoc:
end
end
- ERB_STAG = %w(<%= <%# <%)
+ ERB_STAG = %w(<%= <%# <%).freeze
def is_erb_stag?(s)
ERB_STAG.member?(s)
end
@@ -466,7 +472,16 @@ class ERB::Compiler # :nodoc:
return enc, frozen
end
+ # :stopdoc:
+ WARNING_UPLEVEL = Class.new {
+ attr_reader :c
+ def initialize from
+ @c = caller.length - from.length
+ end
+ }.new(caller(0)).c
+ private_constant :WARNING_UPLEVEL
+
def warn_invalid_trim_mode(mode, uplevel:)
- warn "Invalid ERB trim mode: #{mode.inspect} (trim_mode: nil, 0, 1, 2, or String composed of '%' and/or '-', '>', '<>')", uplevel: uplevel + 1
+ warn "Invalid ERB trim mode: #{mode.inspect} (trim_mode: nil, 0, 1, 2, or String composed of '%' and/or '-', '>', '<>')", uplevel: uplevel + WARNING_UPLEVEL
end
end
td>COPYING366
-rw-r--r--COPYING.ja51
-rw-r--r--ChangeLog12619
-rw-r--r--GPL339
-rw-r--r--KNOWNBUGS.rb7
-rw-r--r--LEGAL686
-rw-r--r--MANIFEST251
-rw-r--r--Makefile.in746
-rw-r--r--NEWS209
-rw-r--r--README155
-rw-r--r--README.EXT1027
-rw-r--r--README.EXT.ja1
-rw-r--r--README.EXT.jp1187
-rw-r--r--README.ja.md171
-rw-r--r--README.jp204
-rw-r--r--README.md167
-rw-r--r--ToDo129
-rw-r--r--acinclude.m446
-rw-r--r--aclocal.m415
-rw-r--r--addr2line.c1205
-rw-r--r--addr2line.h21
-rw-r--r--appveyor.yml37
-rw-r--r--array.c6311
-rwxr-xr-xbasictest/runner.rb33
-rwxr-xr-xbasictest/test.rb2367
-rw-r--r--benchmark/bm_app_answer.rb15
-rw-r--r--benchmark/bm_app_aobench.rb291
-rw-r--r--benchmark/bm_app_erb.rb26
-rw-r--r--benchmark/bm_app_factorial.rb11
-rw-r--r--benchmark/bm_app_fib.rb10
-rw-r--r--benchmark/bm_app_lc_fizzbuzz.rb52
-rw-r--r--benchmark/bm_app_mandelbrot.rb23
-rw-r--r--benchmark/bm_app_pentomino.rb259
-rw-r--r--benchmark/bm_app_raise.rb8
-rw-r--r--benchmark/bm_app_strconcat.rb5
-rw-r--r--benchmark/bm_app_tak.rb13
-rw-r--r--benchmark/bm_app_tarai.rb10
-rw-r--r--benchmark/bm_app_uri.rb8
-rw-r--r--benchmark/bm_array_shift.rb14
-rw-r--r--benchmark/bm_hash_aref_dsym.rb4
-rw-r--r--benchmark/bm_hash_aref_dsym_long.rb21
-rw-r--r--benchmark/bm_hash_aref_fix.rb4
-rw-r--r--benchmark/bm_hash_aref_flo.rb4
-rw-r--r--benchmark/bm_hash_aref_miss.rb5
-rw-r--r--benchmark/bm_hash_aref_str.rb4
-rw-r--r--benchmark/bm_hash_aref_sym.rb9
-rw-r--r--benchmark/bm_hash_aref_sym_long.rb13
-rw-r--r--benchmark/bm_hash_flatten.rb9
-rw-r--r--benchmark/bm_hash_ident_flo.rb4
-rw-r--r--benchmark/bm_hash_ident_num.rb4
-rw-r--r--benchmark/bm_hash_ident_obj.rb4
-rw-r--r--benchmark/bm_hash_ident_str.rb4
-rw-r--r--benchmark/bm_hash_ident_sym.rb4
-rw-r--r--benchmark/bm_hash_keys.rb9
-rw-r--r--benchmark/bm_hash_shift.rb10
-rw-r--r--benchmark/bm_hash_shift_u16.rb10
-rw-r--r--benchmark/bm_hash_shift_u24.rb10
-rw-r--r--benchmark/bm_hash_shift_u32.rb10
-rw-r--r--benchmark/bm_hash_to_proc.rb9
-rw-r--r--benchmark/bm_hash_values.rb9
-rw-r--r--benchmark/bm_io_file_create.rb13
-rw-r--r--benchmark/bm_io_file_read.rb15
-rw-r--r--benchmark/bm_io_file_write.rb14
-rw-r--r--benchmark/bm_io_nonblock_noex.rb22
-rw-r--r--benchmark/bm_io_nonblock_noex2.rb21
-rw-r--r--benchmark/bm_io_select.rb9
-rw-r--r--benchmark/bm_io_select2.rb22
-rw-r--r--benchmark/bm_io_select3.rb21
-rw-r--r--benchmark/bm_loop_for.rb3
-rw-r--r--benchmark/bm_loop_generator.rb14
-rw-r--r--benchmark/bm_loop_times.rb1
-rw-r--r--benchmark/bm_loop_whileloop.rb4
-rw-r--r--benchmark/bm_loop_whileloop2.rb4
-rw-r--r--benchmark/bm_marshal_dump_flo.rb2
-rw-r--r--benchmark/bm_marshal_dump_load_geniv.rb10
-rw-r--r--benchmark/bm_marshal_dump_load_time.rb1
-rw-r--r--benchmark/bm_require.rb7
-rw-r--r--benchmark/bm_require_thread.rb15
-rw-r--r--benchmark/bm_securerandom.rb5
-rw-r--r--benchmark/bm_so_ackermann.rb19
-rw-r--r--benchmark/bm_so_array.rb23
-rw-r--r--benchmark/bm_so_binary_trees.rb62
-rw-r--r--benchmark/bm_so_concatenate.rb18
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_exception.rb61
-rw-r--r--benchmark/bm_so_fannkuch.rb45
-rw-r--r--benchmark/bm_so_fasta.rb81
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_lists.rb47
-rw-r--r--benchmark/bm_so_mandelbrot.rb57
-rw-r--r--benchmark/bm_so_matrix.rb48
-rw-r--r--benchmark/bm_so_meteor_contest.rb563
-rw-r--r--benchmark/bm_so_nbody.rb148
-rw-r--r--benchmark/bm_so_nested_loop.rb24
-rw-r--r--benchmark/bm_so_nsieve.rb35
-rw-r--r--benchmark/bm_so_nsieve_bits.rb43
-rw-r--r--benchmark/bm_so_object.rb56
-rw-r--r--benchmark/bm_so_partial_sums.rb31
-rw-r--r--benchmark/bm_so_pidigits.rb92
-rw-r--r--benchmark/bm_so_random.rb20
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rw-r--r--benchmark/bm_so_sieve.rb24
-rw-r--r--benchmark/bm_so_spectralnorm.rb50
-rw-r--r--benchmark/bm_vm1_attr_ivar.rb14
-rw-r--r--benchmark/bm_vm1_attr_ivar_set.rb14
-rw-r--r--benchmark/bm_vm1_block.rb10
-rw-r--r--benchmark/bm_vm1_const.rb8
-rw-r--r--benchmark/bm_vm1_ensure.rb11
-rw-r--r--benchmark/bm_vm1_float_simple.rb7
-rw-r--r--benchmark/bm_vm1_gc_short_lived.rb10
-rw-r--r--benchmark/bm_vm1_gc_short_with_complex_long.rb27
-rw-r--r--benchmark/bm_vm1_gc_short_with_long.rb13
-rw-r--r--benchmark/bm_vm1_gc_short_with_symbol.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_ary.rb12
-rw-r--r--benchmark/bm_vm1_gc_wb_ary_promoted.rb14
-rw-r--r--benchmark/bm_vm1_gc_wb_obj.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_obj_promoted.rb17
-rw-r--r--benchmark/bm_vm1_ivar.rb8
-rw-r--r--benchmark/bm_vm1_ivar_set.rb6
-rw-r--r--benchmark/bm_vm1_length.rb9
-rw-r--r--benchmark/bm_vm1_lvar_init.rb18
-rw-r--r--benchmark/bm_vm1_lvar_set.rb5
-rw-r--r--benchmark/bm_vm1_neq.rb8
-rw-r--r--benchmark/bm_vm1_not.rb7
-rw-r--r--benchmark/bm_vm1_rescue.rb7
-rw-r--r--benchmark/bm_vm1_simplereturn.rb9
-rw-r--r--benchmark/bm_vm1_swap.rb8
-rw-r--r--benchmark/bm_vm1_yield.rb10
-rw-r--r--benchmark/bm_vm2_array.rb5
-rw-r--r--benchmark/bm_vm2_bigarray.rb106
-rw-r--r--benchmark/bm_vm2_bighash.rb5
-rw-r--r--benchmark/bm_vm2_case.rb14
-rw-r--r--benchmark/bm_vm2_case_lit.rb19
-rw-r--r--benchmark/bm_vm2_defined_method.rb9
-rw-r--r--benchmark/bm_vm2_dstr.rb6
-rw-r--r--benchmark/bm_vm2_eval.rb6
-rw-r--r--benchmark/bm_vm2_method.rb9
-rw-r--r--benchmark/bm_vm2_method_missing.rb12
-rw-r--r--benchmark/bm_vm2_method_with_block.rb9
-rw-r--r--benchmark/bm_vm2_mutex.rb9
-rw-r--r--benchmark/bm_vm2_newlambda.rb5
-rw-r--r--benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_raise1.rb18
-rw-r--r--benchmark/bm_vm2_raise2.rb18
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_string_literal.rb5
-rw-r--r--benchmark/bm_vm2_struct_big_aref_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aref_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_href_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_href_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_hset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aref.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_href.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_hset.rb7
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rw-r--r--benchmark/bm_vm3_backtrace.rb22
-rw-r--r--benchmark/bm_vm3_clearmethodcache.rb8
-rw-r--r--benchmark/bm_vm3_gc.rb6
-rw-r--r--benchmark/bm_vm3_gc_old_full.rb4
-rw-r--r--benchmark/bm_vm3_gc_old_immediate.rb4
-rw-r--r--benchmark/bm_vm3_gc_old_lazy.rb4
-rw-r--r--benchmark/bm_vm_symbol_block_pass.rb13
-rw-r--r--benchmark/bm_vm_thread_alive_check1.rb6
-rw-r--r--benchmark/bm_vm_thread_close.rb6
-rw-r--r--benchmark/bm_vm_thread_create_join.rb6
-rw-r--r--benchmark/bm_vm_thread_mutex1.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex2.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex3.rb20
-rw-r--r--benchmark/bm_vm_thread_pass.rb15
-rw-r--r--benchmark/bm_vm_thread_pass_flood.rb8
-rw-r--r--benchmark/bm_vm_thread_pipe.rb17
-rw-r--r--benchmark/bm_vm_thread_queue.rb18
-rw-r--r--benchmark/driver.rb427
-rw-r--r--benchmark/gc/aobench.rb1
-rw-r--r--benchmark/gc/binary_trees.rb1
-rw-r--r--benchmark/gc/gcbench.rb56
-rw-r--r--benchmark/gc/hash1.rb11
-rw-r--r--benchmark/gc/hash2.rb7
-rw-r--r--benchmark/gc/null.rb1
-rw-r--r--benchmark/gc/pentomino.rb1
-rw-r--r--benchmark/gc/rdoc.rb13
-rw-r--r--benchmark/gc/redblack.rb366
-rw-r--r--benchmark/gc/ring.rb29
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/memory_wrapper.rb16
-rw-r--r--benchmark/other-lang/ack.pl11
-rw-r--r--benchmark/other-lang/ack.py16
-rw-r--r--benchmark/other-lang/ack.rb12
-rw-r--r--benchmark/other-lang/ack.scm7
-rw-r--r--benchmark/other-lang/eval.rb66
-rw-r--r--benchmark/other-lang/fact.pl13
-rw-r--r--benchmark/other-lang/fact.py18
-rw-r--r--benchmark/other-lang/fact.rb13
-rw-r--r--benchmark/other-lang/fact.scm8
-rw-r--r--benchmark/other-lang/fib.pl11
-rw-r--r--benchmark/other-lang/fib.py7
-rw-r--r--benchmark/other-lang/fib.rb9
-rw-r--r--benchmark/other-lang/fib.scm7
-rw-r--r--benchmark/other-lang/loop.pl3
-rw-r--r--benchmark/other-lang/loop.py2
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/other-lang/loop.scm1
-rw-r--r--benchmark/other-lang/loop2.rb1
-rw-r--r--benchmark/other-lang/tak.pl11
-rw-r--r--benchmark/other-lang/tak.py8
-rw-r--r--benchmark/other-lang/tak.rb13
-rw-r--r--benchmark/other-lang/tak.scm10
-rw-r--r--benchmark/prepare_require.rb25
-rw-r--r--benchmark/prepare_require_thread.rb2
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/wc.input.base25
-rw-r--r--bignum.c7217
-rwxr-xr-xbin/erb171
-rwxr-xr-xbin/gem25
-rwxr-xr-xbin/irb11
-rwxr-xr-xbin/rdoc44
-rwxr-xr-xbin/ri12
-rw-r--r--bootstraptest/pending.rb39
-rwxr-xr-xbootstraptest/runner.rb512
-rw-r--r--bootstraptest/test_attr.rb36
-rw-r--r--bootstraptest/test_autoload.rb70
-rw-r--r--bootstraptest/test_block.rb613
-rw-r--r--bootstraptest/test_class.rb169
-rw-r--r--bootstraptest/test_eval.rb324
-rw-r--r--bootstraptest/test_exception.rb432
-rw-r--r--bootstraptest/test_finalizer.rb8
-rw-r--r--bootstraptest/test_flip.rb1
-rw-r--r--bootstraptest/test_flow.rb591
-rw-r--r--bootstraptest/test_fork.rb75
-rw-r--r--bootstraptest/test_gc.rb34
-rw-r--r--bootstraptest/test_io.rb112
-rw-r--r--bootstraptest/test_jump.rb308
-rw-r--r--bootstraptest/test_literal.rb231
-rw-r--r--bootstraptest/test_literal_suffix.rb54
-rw-r--r--bootstraptest/test_load.rb27
-rw-r--r--bootstraptest/test_marshal.rb5
-rw-r--r--bootstraptest/test_massign.rb183
-rw-r--r--bootstraptest/test_method.rb1192
-rw-r--r--bootstraptest/test_objectspace.rb46
-rw-r--r--bootstraptest/test_proc.rb483
-rw-r--r--bootstraptest/test_string.rb3
-rw-r--r--bootstraptest/test_struct.rb5
-rw-r--r--bootstraptest/test_syntax.rb904
-rw-r--r--bootstraptest/test_thread.rb484
-rw-r--r--ccan/build_assert/build_assert.h40
-rw-r--r--ccan/check_type/check_type.h63
-rw-r--r--ccan/container_of/container_of.h142
-rw-r--r--ccan/licenses/BSD-MIT17
-rw-r--r--ccan/licenses/CC028
-rw-r--r--ccan/list/list.h773
-rw-r--r--ccan/str/str.h16
-rw-r--r--class.c2093
-rw-r--r--common.mk2669
-rw-r--r--compar.c253
-rw-r--r--compile.c8501
-rw-r--r--complex.c2352
-rw-r--r--config.guess1116
-rw-r--r--config.sub1228
-rw-r--r--configure.in5102
-rw-r--r--constant.h50
-rw-r--r--cont.c1718
-rw-r--r--coverage/README17
-rw-r--r--cygwin/GNUmakefile.in105
-rw-r--r--debug.c134
-rw-r--r--defines.h84
-rw-r--r--defs/gmake.mk127
-rw-r--r--defs/id.def179
-rw-r--r--defs/keywords53
-rw-r--r--defs/known_errors.def148
-rw-r--r--defs/lex.c.src53
-rw-r--r--defs/opt_insn_unif.def27
-rw-r--r--defs/opt_operand.def22
-rw-r--r--dir.c2977
-rw-r--r--djgpp/README.djgpp21
-rw-r--r--djgpp/config.hin72
-rw-r--r--djgpp/config.sed80
-rw-r--r--djgpp/configure.bat21
-rw-r--r--djgpp/mkver.sed1
-rw-r--r--dln.c877
-rw-r--r--dln.h38
-rw-r--r--dln_find.c290
-rw-r--r--dmydln.c10
-rw-r--r--dmyenc.c10
-rw-r--r--dmyext.c2
-rw-r--r--doc/.document4
-rw-r--r--doc/ChangeLog-0.06_to_0.521147
-rw-r--r--doc/ChangeLog-0.50_to_0.60462
-rw-r--r--doc/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog-1.8.024350
-rw-r--r--doc/ChangeLog-1.9.392772
-rw-r--r--doc/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog-2.3.012187
-rw-r--r--doc/ChangeLog-YARV6917
-rw-r--r--doc/NEWS-1.8.7669
-rw-r--r--doc/NEWS-1.9.1429
-rw-r--r--doc/NEWS-1.9.2509
-rw-r--r--doc/NEWS-1.9.3341
-rw-r--r--doc/NEWS-2.0.0531
-rw-r--r--doc/NEWS-2.1.0376
-rw-r--r--doc/NEWS-2.2.0361
-rw-r--r--doc/NEWS-2.3.0404
-rw-r--r--doc/contributing.rdoc462
-rw-r--r--doc/contributors.rdoc778
-rw-r--r--doc/dtrace_probes.rdoc178
-rw-r--r--doc/etc.rd.ja75
-rw-r--r--doc/extension.ja.rdoc1802
-rw-r--r--doc/extension.rdoc1841
-rw-r--r--doc/forwardable.rd84
-rw-r--r--doc/forwardable.rd.ja80
-rw-r--r--doc/forwardable.rd.jp81
-rw-r--r--doc/globals.rdoc70
-rw-r--r--doc/images/boottime-classes.pngbin28677 -> 0 bytes-rw-r--r--doc/irb/irb-tools.rd.ja184
-rw-r--r--doc/irb/irb-tools.rd.jp185
-rw-r--r--doc/irb/irb.rd377
-rw-r--r--doc/irb/irb.rd.ja412
-rw-r--r--doc/irb/irb.rd.jp391
-rw-r--r--doc/keywords.rdoc158
-rw-r--r--doc/maintainers.rdoc252
-rw-r--r--doc/marshal.rdoc313
-rw-r--r--doc/pty/README.expect.ja21
-rw-r--r--doc/pty/README.ja76
-rw-r--r--doc/regexp.rdoc703
-rw-r--r--doc/security.rdoc152
-rw-r--r--doc/shell.rd348
-rw-r--r--doc/shell.rd.ja335
-rw-r--r--doc/shell.rd.jp336
-rw-r--r--doc/standard_library.rdoc112
-rw-r--r--doc/syntax.rdoc34
-rw-r--r--doc/syntax/assignment.rdoc454
-rw-r--r--doc/syntax/calling_methods.rdoc352
-rw-r--r--doc/syntax/control_expressions.rdoc499
-rw-r--r--doc/syntax/exceptions.rdoc95
-rw-r--r--doc/syntax/literals.rdoc368
-rw-r--r--doc/syntax/methods.rdoc455
-rw-r--r--doc/syntax/miscellaneous.rdoc106
-rw-r--r--doc/syntax/modules_and_classes.rdoc344
-rw-r--r--doc/syntax/precedence.rdoc60
-rw-r--r--doc/syntax/refinements.rdoc262
-rw-r--r--enc/Makefile.in84
-rw-r--r--enc/ascii.c101
-rw-r--r--enc/big5.c376
-rw-r--r--enc/cp949.c222
-rw-r--r--enc/depend688
-rw-r--r--enc/ebcdic.h11
-rw-r--r--enc/emacs_mule.c342
-rw-r--r--enc/encdb.c26
-rw-r--r--enc/encinit.c.erb37
-rw-r--r--enc/euc_jp.c616
-rw-r--r--enc/euc_kr.c195
-rw-r--r--enc/euc_tw.c228
-rw-r--r--enc/gb18030.c604
-rw-r--r--enc/gb2312.c13
-rw-r--r--enc/gbk.c225
-rw-r--r--enc/iso_2022_jp.h47
-rw-r--r--enc/iso_8859.h1
-rw-r--r--enc/iso_8859_1.c321
-rw-r--r--enc/iso_8859_10.c293
-rw-r--r--enc/iso_8859_11.c114
-rw-r--r--enc/iso_8859_13.c288
-rw-r--r--enc/iso_8859_14.c305
-rw-r--r--enc/iso_8859_15.c295
-rw-r--r--enc/iso_8859_16.c300
-rw-r--r--enc/iso_8859_2.c291
-rw-r--r--enc/iso_8859_3.c300
-rw-r--r--enc/iso_8859_4.c296
-rw-r--r--enc/iso_8859_5.c265
-rw-r--r--enc/iso_8859_6.c110
-rw-r--r--enc/iso_8859_7.c284
-rw-r--r--enc/iso_8859_8.c110
-rw-r--r--enc/iso_8859_9.c289
-rw-r--r--enc/jis/props.h227
-rw-r--r--enc/jis/props.h.blt227
-rw-r--r--enc/jis/props.kwd52
-rw-r--r--enc/jis/props.src52
-rw-r--r--enc/koi8_r.c222
-rw-r--r--enc/koi8_u.c224
-rwxr-xr-xenc/make_encmake.rb151
-rw-r--r--enc/mktable.c1162
-rw-r--r--enc/prelude.rb4
-rw-r--r--enc/shift_jis.c584
-rw-r--r--enc/trans/CP/CP932UDA%UCS.src1912
-rw-r--r--enc/trans/CP/CP932VDC@IBM%UCS.src420
-rw-r--r--enc/trans/CP/CP932VDC@NEC_IBM%UCS.src406
-rw-r--r--enc/trans/CP/UCS%CP932UDA.src1912
-rw-r--r--enc/trans/CP/UCS%CP932VDC@IBM.src420
-rw-r--r--enc/trans/CP/UCS%CP932VDC@NEC_IBM.src406
-rw-r--r--enc/trans/EMOJI/EMOJI_ISO-2022-JP-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-DOCOMO%UCS.src293
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI-UNDOC%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-SOFTBANK%UCS.src496
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-DOCOMO.src293
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-SOFTBANK.src496
-rw-r--r--enc/trans/GB/GB12345%UCS.src7618
-rw-r--r--enc/trans/GB/GB2312%UCS.src7535
-rw-r--r--enc/trans/GB/UCS%GB12345.src7620
-rw-r--r--enc/trans/GB/UCS%GB2312.src7531
-rw-r--r--enc/trans/JIS/JISX0201-KANA%UCS.src124
-rw-r--r--enc/trans/JIS/JISX0208@1990%UCS.src6964
-rw-r--r--enc/trans/JIS/JISX0208@MS%UCS.src6893
-rw-r--r--enc/trans/JIS/JISX0208UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0208VDC@NEC%UCS.src97
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src6159
-rw-r--r--enc/trans/JIS/JISX0212@MS%UCS.src6081
-rw-r--r--enc/trans/JIS/JISX0212UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0212VDC@IBM%UCS.src120
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@BMP.src1926
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@SIP.src60
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@BMP.src2193
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@SIP.src311
-rw-r--r--enc/trans/JIS/UCS%JISX0201-KANA.src125
-rw-r--r--enc/trans/JIS/UCS%JISX0208@1990.src6965
-rw-r--r--enc/trans/JIS/UCS%JISX0208@MS.src6894
-rw-r--r--enc/trans/JIS/UCS%JISX0208UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0208VDC@NEC.src98
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src6163
-rw-r--r--enc/trans/JIS/UCS%JISX0212@MS.src6082
-rw-r--r--enc/trans/JIS/UCS%JISX0212UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0212VDC@IBM.src121
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-1.src1922
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-2.src2189
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-1.src56
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-2.src307
-rw-r--r--enc/trans/big5-hkscs-tbl.rb37302
-rw-r--r--enc/trans/big5-uao-tbl.rb19784
-rw-r--r--enc/trans/big5.trans32
-rw-r--r--enc/trans/chinese.trans31
-rw-r--r--enc/trans/cp850-tbl.rb130
-rw-r--r--enc/trans/cp852-tbl.rb130
-rw-r--r--enc/trans/cp855-tbl.rb130
-rw-r--r--enc/trans/cp949-tbl.rb8831
-rw-r--r--enc/trans/ebcdic.trans278
-rw-r--r--enc/trans/emoji-exchange-tbl.rb8407
-rw-r--r--enc/trans/emoji.trans36
-rw-r--r--enc/trans/emoji_iso2022_kddi.trans216
-rw-r--r--enc/trans/emoji_sjis_docomo.trans32
-rw-r--r--enc/trans/emoji_sjis_kddi.trans33
-rw-r--r--enc/trans/emoji_sjis_softbank.trans32
-rw-r--r--enc/trans/escape.trans93
-rw-r--r--enc/trans/euckr-tbl.rb8230
-rw-r--r--enc/trans/gb18030-tbl.rb63362
-rw-r--r--enc/trans/gb18030.trans183
-rw-r--r--enc/trans/gbk-tbl.rb21794
-rw-r--r--enc/trans/gbk.trans15
-rw-r--r--enc/trans/ibm437-tbl.rb130
-rw-r--r--enc/trans/ibm737-tbl.rb130
-rw-r--r--enc/trans/ibm775-tbl.rb130
-rw-r--r--enc/trans/ibm852-tbl.rb130
-rw-r--r--enc/trans/ibm855-tbl.rb130
-rw-r--r--enc/trans/ibm857-tbl.rb127
-rw-r--r--enc/trans/ibm860-tbl.rb130
-rw-r--r--enc/trans/ibm861-tbl.rb130
-rw-r--r--enc/trans/ibm862-tbl.rb130
-rw-r--r--enc/trans/ibm863-tbl.rb130
-rw-r--r--enc/trans/ibm865-tbl.rb130
-rw-r--r--enc/trans/ibm866-tbl.rb130
-rw-r--r--enc/trans/ibm869-tbl.rb121
-rw-r--r--enc/trans/iso-8859-1-tbl.rb98
-rw-r--r--enc/trans/iso-8859-10-tbl.rb98
-rw-r--r--enc/trans/iso-8859-11-tbl.rb90
-rw-r--r--enc/trans/iso-8859-13-tbl.rb98
-rw-r--r--enc/trans/iso-8859-14-tbl.rb98
-rw-r--r--enc/trans/iso-8859-15-tbl.rb98
-rw-r--r--enc/trans/iso-8859-16-tbl.rb98
-rw-r--r--enc/trans/iso-8859-2-tbl.rb98
-rw-r--r--enc/trans/iso-8859-3-tbl.rb91
-rw-r--r--enc/trans/iso-8859-4-tbl.rb98
-rw-r--r--enc/trans/iso-8859-5-tbl.rb98
-rw-r--r--enc/trans/iso-8859-6-tbl.rb53
-rw-r--r--enc/trans/iso-8859-7-tbl.rb95
-rw-r--r--enc/trans/iso-8859-8-tbl.rb62
-rw-r--r--enc/trans/iso-8859-9-tbl.rb98
-rw-r--r--enc/trans/iso2022.trans567
-rw-r--r--enc/trans/japanese.trans97
-rw-r--r--enc/trans/japanese_euc.trans57
-rw-r--r--enc/trans/japanese_sjis.trans33
-rw-r--r--enc/trans/koi8-r-tbl.rb130
-rw-r--r--enc/trans/koi8-u-tbl.rb130
-rw-r--r--enc/trans/korean.trans18
-rw-r--r--enc/trans/maccroatian-tbl.rb129
-rw-r--r--enc/trans/maccyrillic-tbl.rb130
-rw-r--r--enc/trans/macgreek-tbl.rb129
-rw-r--r--enc/trans/maciceland-tbl.rb129
-rw-r--r--enc/trans/macroman-tbl.rb129
-rw-r--r--enc/trans/macromania-tbl.rb129
-rw-r--r--enc/trans/macturkish-tbl.rb128
-rw-r--r--enc/trans/macukraine-tbl.rb130
-rw-r--r--enc/trans/newline.trans135
-rw-r--r--enc/trans/single_byte.trans91
-rw-r--r--enc/trans/tis-620-tbl.rb89
-rw-r--r--enc/trans/transdb.c18
-rw-r--r--enc/trans/ucm/glibc-BIG5-2.3.3.ucm14087
-rw-r--r--enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm18332
-rw-r--r--enc/trans/ucm/windows-950-2000.ucm20379
-rw-r--r--enc/trans/ucm/windows-950_hkscs-2001.ucm23446
-rw-r--r--enc/trans/utf8_mac-tbl.rb23154
-rw-r--r--enc/trans/utf8_mac.trans256
-rw-r--r--enc/trans/utf_16_32.trans556
-rw-r--r--enc/trans/windows-1250-tbl.rb125
-rw-r--r--enc/trans/windows-1251-tbl.rb129
-rw-r--r--enc/trans/windows-1252-tbl.rb125
-rw-r--r--enc/trans/windows-1253-tbl.rb113
-rw-r--r--enc/trans/windows-1254-tbl.rb123
-rw-r--r--enc/trans/windows-1255-tbl.rb141
-rw-r--r--enc/trans/windows-1256-tbl.rb130
-rw-r--r--enc/trans/windows-1257-tbl.rb118
-rw-r--r--enc/trans/windows-874-tbl.rb99
-rw-r--r--enc/unicode.c812
-rw-r--r--enc/unicode/9.0.0/casefold.h7068
-rw-r--r--enc/unicode/9.0.0/name2ctype.h35389
-rwxr-xr-xenc/unicode/case-folding.rb412
-rw-r--r--enc/us_ascii.c38
-rw-r--r--enc/utf_16_32.h5
-rw-r--r--enc/utf_16be.c256
-rw-r--r--enc/utf_16le.c248
-rw-r--r--enc/utf_32be.c195
-rw-r--r--enc/utf_32le.c194
-rw-r--r--enc/utf_7.h5
-rw-r--r--enc/utf_8.c447
-rw-r--r--enc/windows_1250.c270
-rw-r--r--enc/windows_1251.c252
-rw-r--r--enc/windows_1252.c259
-rw-r--r--enc/windows_1253.c296
-rw-r--r--enc/windows_1254.c245
-rw-r--r--enc/windows_1257.c304
-rw-r--r--enc/windows_31j.c81
-rw-r--r--enc/x_emoji.h26
-rw-r--r--encindex.h67
-rw-r--r--encoding.c1966
-rw-r--r--enum.c3890
-rw-r--r--enumerator.c2162
-rw-r--r--env.h60
-rw-r--r--error.c2948
-rw-r--r--eval.c9533
-rw-r--r--eval_error.c327
-rw-r--r--eval_intern.h315
-rw-r--r--eval_jump.c145
-rw-r--r--ext/-test-/array/resize/depend12
-rw-r--r--ext/-test-/array/resize/extconf.rb2
-rw-r--r--ext/-test-/array/resize/resize.c14
-rw-r--r--ext/-test-/auto_ext.rb10
-rw-r--r--ext/-test-/bignum/big2str.c53
-rw-r--r--ext/-test-/bignum/bigzero.c26
-rw-r--r--ext/-test-/bignum/depend109
-rw-r--r--ext/-test-/bignum/div.c35
-rw-r--r--ext/-test-/bignum/extconf.rb3
-rw-r--r--ext/-test-/bignum/init.c11
-rw-r--r--ext/-test-/bignum/intpack.c87
-rw-r--r--ext/-test-/bignum/mul.c65
-rw-r--r--ext/-test-/bignum/str2big.c38
-rw-r--r--ext/-test-/bug-3571/bug.c23
-rw-r--r--ext/-test-/bug-3571/extconf.rb2
-rw-r--r--ext/-test-/bug-5832/bug.c14
-rw-r--r--ext/-test-/bug-5832/extconf.rb2
-rw-r--r--ext/-test-/bug_reporter/bug_reporter.c24
-rw-r--r--ext/-test-/bug_reporter/extconf.rb2
-rw-r--r--ext/-test-/class/class2name.c14
-rw-r--r--ext/-test-/class/depend23
-rw-r--r--ext/-test-/class/extconf.rb3
-rw-r--r--ext/-test-/class/init.c11
-rw-r--r--ext/-test-/debug/depend35
-rw-r--r--ext/-test-/debug/extconf.rb3
-rw-r--r--ext/-test-/debug/init.c11
-rw-r--r--ext/-test-/debug/inspector.c32
-rw-r--r--ext/-test-/debug/profile_frames.c43
-rw-r--r--ext/-test-/dln/empty/depend3
-rw-r--r--ext/-test-/dln/empty/empty.c4
-rw-r--r--ext/-test-/dln/empty/extconf.rb2
-rw-r--r--ext/-test-/exception/dataerror.c31
-rw-r--r--ext/-test-/exception/depend47
-rw-r--r--ext/-test-/exception/enc_raise.c15
-rw-r--r--ext/-test-/exception/ensured.c25
-rw-r--r--ext/-test-/exception/extconf.rb3
-rw-r--r--ext/-test-/exception/init.c11
-rw-r--r--ext/-test-/fatal/extconf.rb2
-rw-r--r--ext/-test-/fatal/rb_fatal.c19
-rw-r--r--ext/-test-/file/depend39
-rw-r--r--ext/-test-/file/extconf.rb17
-rw-r--r--ext/-test-/file/fs.c80
-rw-r--r--ext/-test-/file/init.c11
-rw-r--r--ext/-test-/file/stat.c27
-rw-r--r--ext/-test-/float/depend3
-rw-r--r--ext/-test-/float/extconf.rb3
-rw-r--r--ext/-test-/float/init.c11
-rw-r--r--ext/-test-/float/nextafter.c36
-rw-r--r--ext/-test-/funcall/extconf.rb3
-rw-r--r--ext/-test-/funcall/passing_block.c30
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c34
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend13
-rw-r--r--ext/-test-/gvl/call_without_gvl/extconf.rb2
-rw-r--r--ext/-test-/hash/delete.c16
-rw-r--r--ext/-test-/hash/extconf.rb3
-rw-r--r--ext/-test-/hash/init.c11
-rw-r--r--ext/-test-/integer/core_ext.c29
-rw-r--r--ext/-test-/integer/depend39
-rw-r--r--ext/-test-/integer/extconf.rb3
-rw-r--r--ext/-test-/integer/init.c11
-rw-r--r--ext/-test-/integer/my_integer.c16
-rw-r--r--ext/-test-/iseq_load/extconf.rb2
-rw-r--r--ext/-test-/iseq_load/iseq_load.c21
-rw-r--r--ext/-test-/iter/break.c25
-rw-r--r--ext/-test-/iter/extconf.rb3
-rw-r--r--ext/-test-/iter/init.c11
-rw-r--r--ext/-test-/iter/yield.c16
-rw-r--r--ext/-test-/load/dot.dot/depend3
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c1
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb2
-rw-r--r--ext/-test-/marshal/compat/extconf.rb2
-rw-r--r--ext/-test-/marshal/compat/usrcompat.c32
-rw-r--r--ext/-test-/marshal/internal_ivar/extconf.rb2
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c39
-rw-r--r--ext/-test-/marshal/usr/extconf.rb2
-rw-r--r--ext/-test-/marshal/usr/usrmarshal.c50
-rw-r--r--ext/-test-/method/arity.c22
-rw-r--r--ext/-test-/method/extconf.rb3
-rw-r--r--ext/-test-/method/init.c11
-rw-r--r--ext/-test-/notimplement/bug.c16
-rw-r--r--ext/-test-/notimplement/extconf.rb2
-rw-r--r--ext/-test-/num2int/extconf.rb2
-rw-r--r--ext/-test-/num2int/num2int.c136
-rw-r--r--ext/-test-/path_to_class/extconf.rb7
-rw-r--r--ext/-test-/path_to_class/path_to_class.c15
-rw-r--r--ext/-test-/popen_deadlock/extconf.rb5
-rw-r--r--ext/-test-/popen_deadlock/infinite_loop_dlsym.c50
-rw-r--r--ext/-test-/postponed_job/depend1
-rw-r--r--ext/-test-/postponed_job/extconf.rb2
-rw-r--r--ext/-test-/postponed_job/postponed_job.c53
-rw-r--r--ext/-test-/printf/depend3
-rw-r--r--ext/-test-/printf/extconf.rb2
-rw-r--r--ext/-test-/printf/printf.c101
-rw-r--r--ext/-test-/proc/extconf.rb3
-rw-r--r--ext/-test-/proc/init.c11
-rw-r--r--ext/-test-/proc/receiver.c21
-rw-r--r--ext/-test-/proc/super.c27
-rw-r--r--ext/-test-/rational/depend21
-rw-r--r--ext/-test-/rational/extconf.rb8
-rw-r--r--ext/-test-/rational/rat.c37
-rw-r--r--ext/-test-/recursion/extconf.rb3
-rw-r--r--ext/-test-/recursion/recursion.c28
-rw-r--r--ext/-test-/st/foreach/extconf.rb2
-rw-r--r--ext/-test-/st/foreach/foreach.c175
-rw-r--r--ext/-test-/st/numhash/extconf.rb2
-rw-r--r--ext/-test-/st/numhash/numhash.c138
-rw-r--r--ext/-test-/st/update/extconf.rb2
-rw-r--r--ext/-test-/st/update/update.c34
-rw-r--r--ext/-test-/string/capacity.c17
-rw-r--r--ext/-test-/string/coderange.c47
-rw-r--r--ext/-test-/string/cstr.c146
-rw-r--r--ext/-test-/string/depend164
-rw-r--r--ext/-test-/string/ellipsize.c13
-rw-r--r--ext/-test-/string/enc_associate.c22
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c14
-rw-r--r--ext/-test-/string/extconf.rb3
-rw-r--r--ext/-test-/string/fstring.c15
-rw-r--r--ext/-test-/string/init.c11
-rw-r--r--ext/-test-/string/modify.c22
-rw-r--r--ext/-test-/string/nofree.c13
-rw-r--r--ext/-test-/string/normalize.c17
-rw-r--r--ext/-test-/string/qsort.c61
-rw-r--r--ext/-test-/string/set_len.c14
-rw-r--r--ext/-test-/struct/duplicate.c24
-rw-r--r--ext/-test-/struct/extconf.rb3
-rw-r--r--ext/-test-/struct/init.c11
-rw-r--r--ext/-test-/struct/member.c18
-rw-r--r--ext/-test-/symbol/extconf.rb4
-rw-r--r--ext/-test-/symbol/init.c25
-rw-r--r--ext/-test-/symbol/type.c78
-rw-r--r--ext/-test-/time/extconf.rb3
-rw-r--r--ext/-test-/time/init.c11
-rw-r--r--ext/-test-/time/new.c34
-rw-r--r--ext/-test-/tracepoint/depend24
-rw-r--r--ext/-test-/tracepoint/extconf.rb2
-rw-r--r--ext/-test-/tracepoint/gc_hook.c80
-rw-r--r--ext/-test-/tracepoint/tracepoint.c96
-rw-r--r--ext/-test-/typeddata/extconf.rb2
-rw-r--r--ext/-test-/typeddata/typeddata.c20
-rw-r--r--ext/-test-/vm/at_exit.c44
-rw-r--r--ext/-test-/vm/depend13
-rw-r--r--ext/-test-/vm/extconf.rb1
-rw-r--r--ext/-test-/wait_for_single_fd/depend15
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb2
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c30
-rw-r--r--ext/-test-/win32/console/attribute.c64
-rw-r--r--ext/-test-/win32/console/depend1
-rw-r--r--ext/-test-/win32/console/extconf.rb5
-rw-r--r--ext/-test-/win32/console/init.c11
-rw-r--r--ext/-test-/win32/dln/depend9
-rw-r--r--ext/-test-/win32/dln/dlntest.c17
-rw-r--r--ext/-test-/win32/dln/extconf.rb33
-rw-r--r--ext/-test-/win32/dln/libdlntest.c4
-rw-r--r--ext/-test-/win32/dln/libdlntest.def2
-rw-r--r--ext/-test-/win32/fd_setsize/depend1
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb4
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c55
-rw-r--r--ext/.cvsignore1
-rw-r--r--ext/.document103
-rw-r--r--ext/Setup44
-rw-r--r--ext/Setup.atheos29
-rw-r--r--ext/Setup.dj15
-rw-r--r--ext/Setup.emx16
-rw-r--r--ext/Setup.nacl44
-rw-r--r--ext/Setup.nt27
-rw-r--r--ext/Setup.x6812
-rw-r--r--ext/Win32API/MANIFEST7
-rw-r--r--ext/Win32API/Win32API.c307
-rw-r--r--ext/Win32API/depend1
-rw-r--r--ext/Win32API/extconf.rb7
-rw-r--r--ext/Win32API/getch.rb5
-rw-r--r--ext/Win32API/point.rb18
-rw-r--r--ext/aix_mksym.rb33
-rw-r--r--ext/bigdecimal/bigdecimal.c6300
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec31
-rw-r--r--ext/bigdecimal/bigdecimal.h336
-rw-r--r--ext/bigdecimal/depend14
-rw-r--r--ext/bigdecimal/extconf.rb11
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb88
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb89
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb232
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb80
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb128
-rw-r--r--ext/bigdecimal/sample/linear.rb73
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb40
-rw-r--r--ext/bigdecimal/sample/pi.rb21
-rw-r--r--ext/cgi/escape/depend15
-rw-r--r--ext/cgi/escape/escape.c421
-rw-r--r--ext/cgi/escape/extconf.rb3
-rw-r--r--ext/configsub.rb32
-rw-r--r--ext/continuation/continuation.c13
-rw-r--r--ext/continuation/depend12
-rw-r--r--ext/continuation/extconf.rb4
-rw-r--r--ext/coverage/coverage.c118
-rw-r--r--ext/coverage/depend43
-rw-r--r--ext/coverage/extconf.rb5
-rw-r--r--ext/curses/.cvsignore1
-rw-r--r--ext/curses/MANIFEST7
-rw-r--r--ext/curses/curses.c848
-rw-r--r--ext/curses/depend1
-rw-r--r--ext/curses/extconf.rb27
-rw-r--r--ext/curses/hello.rb30
-rw-r--r--ext/curses/rain.rb76
-rw-r--r--ext/curses/view.rb91
-rw-r--r--ext/date/date_core.c9629
-rw-r--r--ext/date/date_parse.c3045
-rw-r--r--ext/date/date_strftime.c638
-rw-r--r--ext/date/date_strptime.c703
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend60
-rw-r--r--ext/date/extconf.rb4
-rw-r--r--ext/date/lib/date.rb61
-rw-r--r--ext/date/prereq.mk8
-rw-r--r--ext/date/zonetab.h902
-rw-r--r--ext/date/zonetab.list181
-rw-r--r--ext/dbm/.cvsignore1
-rw-r--r--ext/dbm/MANIFEST4
-rw-r--r--ext/dbm/dbm.c972
-rw-r--r--ext/dbm/depend14
-rw-r--r--ext/dbm/extconf.rb293
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c146
-rw-r--r--ext/digest/bubblebabble/depend14
-rw-r--r--ext/digest/bubblebabble/extconf.rb6
-rw-r--r--ext/digest/defs.h19
-rw-r--r--ext/digest/depend14
-rw-r--r--ext/digest/digest.c746
-rw-r--r--ext/digest/digest.h51
-rw-r--r--ext/digest/digest_conf.rb32
-rw-r--r--ext/digest/extconf.rb11
-rw-r--r--ext/digest/lib/digest.rb109
-rw-r--r--ext/digest/md5/depend18
-rw-r--r--ext/digest/md5/extconf.rb19
-rw-r--r--ext/digest/md5/md5.c424
-rw-r--r--ext/digest/md5/md5.h80
-rw-r--r--ext/digest/md5/md5cc.h12
-rw-r--r--ext/digest/md5/md5init.c48
-rw-r--r--ext/digest/md5/md5ossl.h15
-rw-r--r--ext/digest/rmd160/depend18
-rw-r--r--ext/digest/rmd160/extconf.rb19
-rw-r--r--ext/digest/rmd160/rmd160.c463
-rw-r--r--ext/digest/rmd160/rmd160.h56
-rw-r--r--ext/digest/rmd160/rmd160init.c46
-rw-r--r--ext/digest/rmd160/rmd160ossl.h20
-rw-r--r--ext/digest/sha1/depend18
-rw-r--r--ext/digest/sha1/extconf.rb19
-rw-r--r--ext/digest/sha1/sha1.c271
-rw-r--r--ext/digest/sha1/sha1.h39
-rw-r--r--ext/digest/sha1/sha1cc.h14
-rw-r--r--ext/digest/sha1/sha1init.c48
-rw-r--r--ext/digest/sha1/sha1ossl.h22
-rw-r--r--ext/digest/sha2/depend18
-rw-r--r--ext/digest/sha2/extconf.rb21
-rw-r--r--ext/digest/sha2/lib/sha2.rb108
-rw-r--r--ext/digest/sha2/sha2.c1081
-rw-r--r--ext/digest/sha2/sha2.h225
-rw-r--r--ext/digest/sha2/sha2cc.h31
-rw-r--r--ext/digest/sha2/sha2init.c61
-rw-r--r--ext/digest/sha2/sha2ossl.h27
-rw-r--r--ext/digest/test.sh30
-rw-r--r--ext/etc/.cvsignore1
-rw-r--r--ext/etc/MANIFEST6
-rw-r--r--ext/etc/depend22
-rw-r--r--ext/etc/etc.c1137
-rw-r--r--ext/etc/etc.txt72
-rw-r--r--ext/etc/etc.txt.jp72
-rw-r--r--ext/etc/extconf.rb65
-rw-r--r--ext/etc/mkconstants.rb332
-rwxr-xr-xext/extmk.rb844
-rw-r--r--ext/extmk.rb.in779
-rw-r--r--ext/fcntl/.cvsignore1
-rw-r--r--ext/fcntl/MANIFEST3
-rw-r--r--ext/fcntl/depend14
-rw-r--r--ext/fcntl/extconf.rb3
-rw-r--r--ext/fcntl/fcntl.c156
-rw-r--r--ext/fiber/depend1
-rw-r--r--ext/fiber/extconf.rb4
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c344
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c141
-rw-r--r--ext/fiddle/conversions.h44
-rw-r--r--ext/fiddle/depend152
-rw-r--r--ext/fiddle/extconf.rb182
-rw-r--r--ext/fiddle/extlibs2
-rw-r--r--ext/fiddle/fiddle.c454
-rw-r--r--ext/fiddle/fiddle.h138
-rw-r--r--ext/fiddle/function.c315
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/handle.c479
-rw-r--r--ext/fiddle/lib/fiddle.rb56
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb49
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb194
-rw-r--r--ext/fiddle/lib/fiddle/function.rb18
-rw-r--r--ext/fiddle/lib/fiddle/import.rb318
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb129
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb244
-rw-r--r--ext/fiddle/lib/fiddle/types.rb72
-rw-r--r--ext/fiddle/lib/fiddle/value.rb113
-rw-r--r--ext/fiddle/pointer.c721
-rwxr-xr-xext/fiddle/win32/fficonfig.h29
-rw-r--r--ext/fiddle/win32/libffi-3.2.1-mswin.patch191
-rwxr-xr-xext/fiddle/win32/libffi-config.rb48
-rwxr-xr-xext/fiddle/win32/libffi.mk.tmpl96
-rw-r--r--ext/gdbm/.cvsignore1
-rw-r--r--ext/gdbm/MANIFEST5
-rw-r--r--ext/gdbm/depend14
-rw-r--r--ext/gdbm/extconf.rb12
-rw-r--r--ext/gdbm/gdbm.c1185
-rwxr-xr-xext/io/console/buildgem.sh5
-rw-r--r--ext/io/console/console.c989
-rw-r--r--ext/io/console/depend36
-rw-r--r--ext/io/console/extconf.rb29
-rw-r--r--ext/io/console/io-console.gemspec21
-rw-r--r--ext/io/console/lib/console/size.rb23
-rw-r--r--ext/io/console/win32_vk.chksum1
-rw-r--r--ext/io/console/win32_vk.inc1400
-rw-r--r--ext/io/console/win32_vk.list166
-rw-r--r--ext/io/nonblock/depend16
-rw-r--r--ext/io/nonblock/extconf.rb9
-rw-r--r--ext/io/nonblock/nonblock.c140
-rw-r--r--ext/io/wait/depend16
-rw-r--r--ext/io/wait/extconf.rb19
-rw-r--r--ext/io/wait/wait.c254
-rw-r--r--ext/json/extconf.rb2
-rw-r--r--ext/json/fbuffer/fbuffer.h190
-rw-r--r--ext/json/generator/depend22
-rw-r--r--ext/json/generator/extconf.rb4
-rw-r--r--ext/json/generator/generator.c1443
-rw-r--r--ext/json/generator/generator.h172
-rw-r--r--ext/json/json.gemspecbin5473 -> 0 bytes-rw-r--r--ext/json/lib/json.rb63
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb29
-rw-r--r--ext/json/lib/json/add/complex.rb29
-rw-r--r--ext/json/lib/json/add/core.rb12
-rw-r--r--ext/json/lib/json/add/date.rb34
-rw-r--r--ext/json/lib/json/add/date_time.rb50
-rw-r--r--ext/json/lib/json/add/exception.rb31
-rw-r--r--ext/json/lib/json/add/ostruct.rb31
-rw-r--r--ext/json/lib/json/add/range.rb29
-rw-r--r--ext/json/lib/json/add/rational.rb28
-rw-r--r--ext/json/lib/json/add/regexp.rb30
-rw-r--r--ext/json/lib/json/add/struct.rb30
-rw-r--r--ext/json/lib/json/add/symbol.rb25
-rw-r--r--ext/json/lib/json/add/time.rb38
-rw-r--r--ext/json/lib/json/common.rb456
-rw-r--r--ext/json/lib/json/ext.rb15
-rw-r--r--ext/json/lib/json/generic_object.rb71
-rw-r--r--ext/json/lib/json/version.rb9
-rw-r--r--ext/json/parser/depend21
-rw-r--r--ext/json/parser/extconf.rb6
-rw-r--r--ext/json/parser/parser.c2084
-rw-r--r--ext/json/parser/parser.h90
-rw-r--r--ext/json/parser/parser.rl844
-rw-r--r--ext/json/parser/prereq.mk10
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb4
-rw-r--r--ext/mathn/rational/extconf.rb4
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/md5/.cvsignore1
-rw-r--r--ext/md5/MANIFEST8
-rw-r--r--ext/md5/depend2
-rw-r--r--ext/md5/extconf.rb3
-rw-r--r--ext/md5/md5.h86
-rw-r--r--ext/md5/md5.txt50
-rw-r--r--ext/md5/md5.txt.jp50
-rw-r--r--ext/md5/md5c.c337
-rw-r--r--ext/md5/md5init.c114
-rw-r--r--ext/nkf/.cvsignore1
-rw-r--r--ext/nkf/MANIFEST7
-rw-r--r--ext/nkf/depend24
-rw-r--r--ext/nkf/extconf.rb1
-rw-r--r--ext/nkf/lib/kconv.rb288
-rw-r--r--ext/nkf/nkf-utf8/config.h51
-rw-r--r--ext/nkf/nkf-utf8/nkf.c7192
-rw-r--r--ext/nkf/nkf-utf8/nkf.h189
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c14628
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h72
-rw-r--r--ext/nkf/nkf.c615
-rw-r--r--ext/nkf/nkf1.7/nkf.c1900
-rw-r--r--ext/nkf/test.rb318
-rw-r--r--ext/objspace/depend72
-rw-r--r--ext/objspace/extconf.rb4
-rw-r--r--ext/objspace/object_tracing.c492
-rw-r--r--ext/objspace/objspace.c996
-rw-r--r--ext/objspace/objspace.h20
-rw-r--r--ext/objspace/objspace_dump.c494
-rw-r--r--ext/openssl/depend1123
-rw-r--r--ext/openssl/deprecation.rb26
-rw-r--r--ext/openssl/extconf.rb156
-rw-r--r--ext/openssl/lib/openssl.rb21
-rw-r--r--ext/openssl/lib/openssl/bn.rb39
-rw-r--r--ext/openssl/lib/openssl/buffering.rb451
-rw-r--r--ext/openssl/lib/openssl/cipher.rb67
-rw-r--r--ext/openssl/lib/openssl/config.rb473
-rw-r--r--ext/openssl/lib/openssl/digest.rb78
-rw-r--r--ext/openssl/lib/openssl/pkey.rb44
-rw-r--r--ext/openssl/lib/openssl/ssl.rb404
-rw-r--r--ext/openssl/lib/openssl/x509.rb176
-rw-r--r--ext/openssl/openssl.gemspec45
-rw-r--r--ext/openssl/openssl_missing.c173
-rw-r--r--ext/openssl/openssl_missing.h244
-rw-r--r--ext/openssl/ossl.c1201
-rw-r--r--ext/openssl/ossl.h222
-rw-r--r--ext/openssl/ossl_asn1.c1992
-rw-r--r--ext/openssl/ossl_asn1.h66
-rw-r--r--ext/openssl/ossl_bio.c87
-rw-r--r--ext/openssl/ossl_bio.h19
-rw-r--r--ext/openssl/ossl_bn.c1153
-rw-r--r--ext/openssl/ossl_bn.h23
-rw-r--r--ext/openssl/ossl_cipher.c1085
-rw-r--r--ext/openssl/ossl_cipher.h20
-rw-r--r--ext/openssl/ossl_config.c89
-rw-r--r--ext/openssl/ossl_config.h19
-rw-r--r--ext/openssl/ossl_digest.c453
-rw-r--r--ext/openssl/ossl_digest.h20
-rw-r--r--ext/openssl/ossl_engine.c580
-rw-r--r--ext/openssl/ossl_engine.h19
-rw-r--r--ext/openssl/ossl_hmac.c398
-rw-r--r--ext/openssl/ossl_hmac.h18
-rw-r--r--ext/openssl/ossl_ns_spki.c406
-rw-r--r--ext/openssl/ossl_ns_spki.h19
-rw-r--r--ext/openssl/ossl_ocsp.c2013
-rw-r--r--ext/openssl/ossl_ocsp.h23
-rw-r--r--ext/openssl/ossl_pkcs12.c261
-rw-r--r--ext/openssl/ossl_pkcs12.h13
-rw-r--r--ext/openssl/ossl_pkcs5.c180
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c1125
-rw-r--r--ext/openssl/ossl_pkcs7.h20
-rw-r--r--ext/openssl/ossl_pkey.c435
-rw-r--r--ext/openssl/ossl_pkey.h245
-rw-r--r--ext/openssl/ossl_pkey_dh.c650
-rw-r--r--ext/openssl/ossl_pkey_dsa.c672
-rw-r--r--ext/openssl/ossl_pkey_ec.c1806
-rw-r--r--ext/openssl/ossl_pkey_rsa.c768
-rw-r--r--ext/openssl/ossl_rand.c238
-rw-r--r--ext/openssl/ossl_rand.h18
-rw-r--r--ext/openssl/ossl_ssl.c2721
-rw-r--r--ext/openssl/ossl_ssl.h41
-rw-r--r--ext/openssl/ossl_ssl_session.c352
-rw-r--r--ext/openssl/ossl_version.h15
-rw-r--r--ext/openssl/ossl_x509.c186
-rw-r--r--ext/openssl/ossl_x509.h119
-rw-r--r--ext/openssl/ossl_x509attr.c328
-rw-r--r--ext/openssl/ossl_x509cert.c860
-rw-r--r--ext/openssl/ossl_x509crl.c565
-rw-r--r--ext/openssl/ossl_x509ext.c480
-rw-r--r--ext/openssl/ossl_x509name.c547
-rw-r--r--ext/openssl/ossl_x509req.c492
-rw-r--r--ext/openssl/ossl_x509revoked.c279
-rw-r--r--ext/openssl/ossl_x509store.c846
-rw-r--r--ext/openssl/ruby_missing.h32
-rw-r--r--ext/pathname/depend15
-rw-r--r--ext/pathname/extconf.rb4
-rw-r--r--ext/pathname/lib/pathname.rb591
-rw-r--r--ext/pathname/pathname.c1463
-rw-r--r--ext/psych/.gitignore11
-rw-r--r--ext/psych/depend92
-rw-r--r--ext/psych/extconf.rb39
-rw-r--r--ext/psych/lib/psych.rb510
-rw-r--r--ext/psych/lib/psych/class_loader.rb102
-rw-r--r--ext/psych/lib/psych/coder.rb95
-rw-r--r--ext/psych/lib/psych/core_ext.rb36
-rw-r--r--ext/psych/lib/psych/deprecated.rb86
-rw-r--r--ext/psych/lib/psych/exception.rb14
-rw-r--r--ext/psych/lib/psych/handler.rb250
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb23
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb40
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb20
-rw-r--r--ext/psych/lib/psych/json/stream.rb17
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb13
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb30
-rw-r--r--ext/psych/lib/psych/nodes.rb78
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb19
-rw-r--r--ext/psych/lib/psych/nodes/document.rb61
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb57
-rw-r--r--ext/psych/lib/psych/nodes/node.rb56
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb68
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb82
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb38
-rw-r--r--ext/psych/lib/psych/omap.rb5
-rw-r--r--ext/psych/lib/psych/parser.rb52
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb150
-rw-r--r--ext/psych/lib/psych/set.rb5
-rw-r--r--ext/psych/lib/psych/stream.rb38
-rw-r--r--ext/psych/lib/psych/streaming.rb28
-rw-r--r--ext/psych/lib/psych/syntax_error.rb22
-rw-r--r--ext/psych/lib/psych/tree_builder.rb97
-rw-r--r--ext/psych/lib/psych/versions.rb4
-rw-r--r--ext/psych/lib/psych/visitors.rb7
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb27
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb52
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb25
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb406
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb20
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb598
-rw-r--r--ext/psych/lib/psych/y.rb10
-rw-r--r--ext/psych/psych.c34
-rw-r--r--ext/psych/psych.gemspec41
-rw-r--r--ext/psych/psych.h20
-rw-r--r--ext/psych/psych_emitter.c570
-rw-r--r--ext/psych/psych_emitter.h8
-rw-r--r--ext/psych/psych_parser.c597
-rw-r--r--ext/psych/psych_parser.h6
-rw-r--r--ext/psych/psych_to_ruby.c43
-rw-r--r--ext/psych/psych_to_ruby.h8
-rw-r--r--ext/psych/psych_yaml_tree.c24
-rw-r--r--ext/psych/psych_yaml_tree.h8
-rw-r--r--ext/psych/yaml/LICENSE19
-rw-r--r--ext/psych/yaml/api.c1415
-rw-r--r--ext/psych/yaml/config.h10
-rw-r--r--ext/psych/yaml/dumper.c394
-rw-r--r--ext/psych/yaml/emitter.c2329
-rw-r--r--ext/psych/yaml/loader.c459
-rw-r--r--ext/psych/yaml/parser.c1370
-rw-r--r--ext/psych/yaml/reader.c469
-rw-r--r--ext/psych/yaml/scanner.c3576
-rw-r--r--ext/psych/yaml/writer.c141
-rw-r--r--ext/psych/yaml/yaml.h1971
-rw-r--r--ext/psych/yaml/yaml_private.h664
-rw-r--r--ext/pty/.cvsignore1
-rw-r--r--ext/pty/MANIFEST12
-rw-r--r--ext/pty/README93
-rw-r--r--ext/pty/README.expect22
-rw-r--r--ext/pty/README.expect.jp21
-rw-r--r--ext/pty/README.jp89
-rw-r--r--ext/pty/depend19
-rw-r--r--ext/pty/expect_sample.rb56
-rw-r--r--ext/pty/extconf.rb15
-rw-r--r--ext/pty/lib/expect.rb46
-rw-r--r--ext/pty/pty.c997
-rw-r--r--ext/pty/script.rb38
-rw-r--r--ext/pty/shl.rb96
-rw-r--r--ext/racc/cparse/README11
-rw-r--r--ext/racc/cparse/cparse.c857
-rw-r--r--ext/racc/cparse/depend12
-rw-r--r--ext/racc/cparse/extconf.rb6
-rw-r--r--ext/rbconfig/sizeof/depend21
-rw-r--r--ext/rbconfig/sizeof/extconf.rb36
-rw-r--r--ext/readline/.cvsignore1
-rw-r--r--ext/readline/MANIFEST5
-rw-r--r--ext/readline/README61
-rw-r--r--ext/readline/README.ja386
-rw-r--r--ext/readline/depend19
-rw-r--r--ext/readline/extconf.rb111
-rw-r--r--ext/readline/readline.c2008
-rw-r--r--ext/ripper/README30
-rw-r--r--ext/ripper/depend79
-rw-r--r--ext/ripper/eventids2.c306
-rw-r--r--ext/ripper/extconf.rb22
-rw-r--r--ext/ripper/lib/ripper.rb74
-rw-r--r--ext/ripper/lib/ripper/core.rb72
-rw-r--r--ext/ripper/lib/ripper/filter.rb78
-rw-r--r--ext/ripper/lib/ripper/lexer.rb215
-rw-r--r--ext/ripper/lib/ripper/sexp.rb146
-rwxr-xr-xext/ripper/tools/generate-param-macros.rb15
-rwxr-xr-xext/ripper/tools/generate.rb162
-rwxr-xr-xext/ripper/tools/preproc.rb92
-rwxr-xr-xext/ripper/tools/strip.rb12
-rw-r--r--ext/sdbm/.cvsignore1
-rw-r--r--ext/sdbm/MANIFEST6
-rw-r--r--ext/sdbm/_sdbm.c261
-rw-r--r--ext/sdbm/depend27
-rw-r--r--ext/sdbm/extconf.rb2
-rw-r--r--ext/sdbm/init.c930
-rw-r--r--ext/sdbm/sdbm.h10
-rw-r--r--ext/socket/.cvsignore1
-rw-r--r--ext/socket/.document17
-rw-r--r--ext/socket/MANIFEST8
-rw-r--r--ext/socket/addrinfo.h54
-rw-r--r--ext/socket/ancdata.c1732
-rw-r--r--ext/socket/basicsocket.c733
-rw-r--r--ext/socket/constants.c145
-rw-r--r--ext/socket/depend315
-rw-r--r--ext/socket/extconf.rb801
-rw-r--r--ext/socket/getaddrinfo.c138
-rw-r--r--ext/socket/getnameinfo.c90
-rw-r--r--ext/socket/ifaddr.c459
-rw-r--r--ext/socket/init.c683
-rw-r--r--ext/socket/ipsocket.c341
-rw-r--r--ext/socket/lib/socket.rb1351
-rw-r--r--ext/socket/mkconstants.rb805
-rw-r--r--ext/socket/option.c1476
-rw-r--r--ext/socket/raddrinfo.c2629
-rw-r--r--ext/socket/rubysocket.h441
-rw-r--r--ext/socket/socket.c3697
-rw-r--r--ext/socket/sockport.h84
-rw-r--r--ext/socket/sockssocket.c68
-rw-r--r--ext/socket/tcpserver.c146
-rw-r--r--ext/socket/tcpsocket.c82
-rw-r--r--ext/socket/udpsocket.c242
-rw-r--r--ext/socket/unixserver.c126
-rw-r--r--ext/socket/unixsocket.c546
-rw-r--r--ext/stringio/README.md10
-rw-r--r--ext/stringio/depend16
-rw-r--r--ext/stringio/extconf.rb3
-rw-r--r--ext/stringio/stringio.c1669
-rw-r--r--ext/strscan/depend18
-rw-r--r--ext/strscan/extconf.rb4
-rw-r--r--ext/strscan/strscan.c1398
-rw-r--r--ext/syslog/depend13
-rw-r--r--ext/syslog/extconf.rb11
-rw-r--r--ext/syslog/lib/syslog/logger.rb209
-rw-r--r--ext/syslog/syslog.c590
-rw-r--r--ext/syslog/syslog.txt124
-rw-r--r--ext/tcltklib/.cvsignore1
-rw-r--r--ext/tcltklib/MANIFEST16
-rw-r--r--ext/tcltklib/MANUAL.euc124
-rw-r--r--ext/tcltklib/README.euc133
-rw-r--r--ext/tcltklib/demo/lines0.tcl42
-rw-r--r--ext/tcltklib/demo/lines1.rb54
-rw-r--r--ext/tcltklib/demo/lines2.rb50
-rw-r--r--ext/tcltklib/depend2
-rw-r--r--ext/tcltklib/extconf.rb71
-rw-r--r--ext/tcltklib/lib/tcltk.rb367
-rw-r--r--ext/tcltklib/sample/batsu.gifbin0 -> 538 bytes-rw-r--r--ext/tcltklib/sample/maru.gifbin0 -> 481 bytes-rw-r--r--ext/tcltklib/sample/sample0.rb39
-rw-r--r--ext/tcltklib/sample/sample1.rb634
-rw-r--r--ext/tcltklib/sample/sample2.rb449
-rw-r--r--ext/tcltklib/stubs.c86
-rw-r--r--ext/tcltklib/tcltklib.c527
-rw-r--r--ext/tk/.cvsignore1
-rw-r--r--ext/tk/MANIFEST25
-rw-r--r--ext/tk/depend1
-rw-r--r--ext/tk/extconf.rb2
-rw-r--r--ext/tk/lib/tk.rb3427
-rw-r--r--ext/tk/lib/tkafter.rb316
-rw-r--r--ext/tk/lib/tkbgerror.rb17
-rw-r--r--ext/tk/lib/tkcanvas.rb941
-rw-r--r--ext/tk/lib/tkclass.rb38
-rw-r--r--ext/tk/lib/tkdialog.rb141
-rw-r--r--ext/tk/lib/tkentry.rb213
-rw-r--r--ext/tk/lib/tkfont.rb1026
-rw-r--r--ext/tk/lib/tkmenubar.rb137
-rw-r--r--ext/tk/lib/tkmngfocus.rb27
-rw-r--r--ext/tk/lib/tkpalette.rb48
-rw-r--r--ext/tk/lib/tkscrollbox.rb29
-rw-r--r--ext/tk/lib/tktext.rb1085
-rw-r--r--ext/tk/lib/tkvirtevent.rb81
-rw-r--r--ext/tk/sample/tkbiff.rb149
-rw-r--r--ext/tk/sample/tkbrowse.rb79
-rw-r--r--ext/tk/sample/tkdialog.rb62
-rw-r--r--ext/tk/sample/tkfrom.rb132
-rw-r--r--ext/tk/sample/tkhello.rb10
-rw-r--r--ext/tk/sample/tkline.rb45
-rw-r--r--ext/tk/sample/tktimer.rb50
-rw-r--r--ext/tk/tkutil.c45
-rw-r--r--ext/win32/extconf.rb4
-rw-r--r--ext/win32/lib/Win32API.rb47
-rw-r--r--ext/win32/lib/win32/importer.rb9
-rw-r--r--ext/win32/lib/win32/registry.rb911
-rw-r--r--ext/win32/lib/win32/resolv.rb134
-rw-r--r--ext/win32/lib/win32/resolv9x.rb253
-rw-r--r--ext/win32/lib/win32/sspi.rb331
-rw-r--r--ext/win32/resolv/extconf.rb3
-rw-r--r--ext/win32/resolv/resolv.c65
-rw-r--r--ext/win32ole/depend12
-rw-r--r--ext/win32ole/extconf.rb45
-rw-r--r--ext/win32ole/lib/win32ole/property.rb17
-rw-r--r--ext/win32ole/sample/excel1.rb37
-rw-r--r--ext/win32ole/sample/excel2.rb31
-rw-r--r--ext/win32ole/sample/excel3.rb21
-rw-r--r--ext/win32ole/sample/ie.rb12
-rw-r--r--ext/win32ole/sample/ieconst.rb33
-rw-r--r--ext/win32ole/sample/ienavi.rb41
-rw-r--r--ext/win32ole/sample/ienavi2.rb41
-rw-r--r--ext/win32ole/sample/oledirs.rb24
-rw-r--r--ext/win32ole/sample/olegen.rb348
-rw-r--r--ext/win32ole/sample/xml.rb7307
-rw-r--r--ext/win32ole/win32ole.c4067
-rw-r--r--ext/win32ole/win32ole.h155
-rw-r--r--ext/win32ole/win32ole_error.c83
-rw-r--r--ext/win32ole/win32ole_error.h8
-rw-r--r--ext/win32ole/win32ole_event.c1280
-rw-r--r--ext/win32ole/win32ole_event.h6
-rw-r--r--ext/win32ole/win32ole_method.c950
-rw-r--r--ext/win32ole/win32ole_method.h16
-rw-r--r--ext/win32ole/win32ole_param.c438
-rw-r--r--ext/win32ole/win32ole_param.h8
-rw-r--r--ext/win32ole/win32ole_record.c604
-rw-r--r--ext/win32ole/win32ole_record.h10
-rw-r--r--ext/win32ole/win32ole_type.c915
-rw-r--r--ext/win32ole/win32ole_type.h8
-rw-r--r--ext/win32ole/win32ole_typelib.c844
-rw-r--r--ext/win32ole/win32ole_typelib.h11
-rw-r--r--ext/win32ole/win32ole_variable.c380
-rw-r--r--ext/win32ole/win32ole_variable.h8
-rw-r--r--ext/win32ole/win32ole_variant.c732
-rw-r--r--ext/win32ole/win32ole_variant.h9
-rw-r--r--ext/win32ole/win32ole_variant_m.c149
-rw-r--r--ext/win32ole/win32ole_variant_m.h7
-rw-r--r--ext/zlib/depend17
-rw-r--r--ext/zlib/extconf.rb62
-rw-r--r--ext/zlib/zlib.c4689
-rw-r--r--file.c5824
-rw-r--r--gc.c10086
-rw-r--r--gc.h114
-rw-r--r--gem_prelude.rb8
-rw-r--r--gems/bundled_gems7
-rw-r--r--golf_prelude.rb123
-rw-r--r--goruby.c61
-rw-r--r--hash.c4368
-rw-r--r--ia64.s42
-rw-r--r--id_table.c1592
-rw-r--r--id_table.h31
-rw-r--r--include/ruby.h35
-rw-r--r--include/ruby/backward.h20
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h47
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h110
-rw-r--r--include/ruby/defines.h365
-rw-r--r--include/ruby/encoding.h422
-rw-r--r--include/ruby/intern.h988
-rw-r--r--include/ruby/io.h177
-rw-r--r--include/ruby/missing.h268
-rw-r--r--include/ruby/oniguruma.h880
-rw-r--r--include/ruby/re.h72
-rw-r--r--include/ruby/regex.h46
-rw-r--r--include/ruby/ruby.h2485
-rw-r--r--include/ruby/st.h157
-rw-r--r--include/ruby/subst.h19
-rw-r--r--include/ruby/thread.h45
-rw-r--r--include/ruby/thread_native.h56
-rw-r--r--include/ruby/util.h90
-rw-r--r--include/ruby/version.h74
-rw-r--r--include/ruby/vm.h64
-rw-r--r--include/ruby/win32.h798
-rw-r--r--inits.c115
-rw-r--r--insns.def2186
-rw-r--r--install-sh (renamed from lib/rdoc/generator/template/darkfish/.document)0
-rw-r--r--instruby.rb102
-rw-r--r--intern.h387
-rw-r--r--internal.h1700
-rw-r--r--io.c12963
-rw-r--r--iseq.c2470
-rw-r--r--iseq.h252
-rw-r--r--keywords42
-rw-r--r--lex.c132
-rw-r--r--lex.c.blt310
-rw-r--r--lib/English.rb164
-rw-r--r--lib/Env.rb18
-rw-r--r--lib/README48
-rw-r--r--lib/abbrev.rb132
-rw-r--r--lib/base64.rb126
-rw-r--r--lib/benchmark.rb562
-rw-r--r--lib/cgi-lib.rb270
-rw-r--r--lib/cgi.rb2243
-rw-r--r--lib/cgi/cookie.rb188
-rw-r--r--lib/cgi/core.rb881
-rw-r--r--lib/cgi/html.rb1035
-rw-r--r--lib/cgi/session.rb563
-rw-r--r--lib/cgi/session/pstore.rb101
-rw-r--r--lib/cgi/util.rb219
-rw-r--r--lib/cmath.rb435
-rw-r--r--lib/complex.rb502
-rw-r--r--lib/csv.rb2381
-rw-r--r--lib/date.rb345
-rw-r--r--lib/date2.rb5
-rw-r--r--lib/debug.rb1270
-rw-r--r--lib/delegate.rb458
-rw-r--r--lib/drb.rb3
-rw-r--r--lib/drb/acl.rb233
-rw-r--r--lib/drb/drb.rb1872
-rw-r--r--lib/drb/eq.rb15
-rw-r--r--lib/drb/extserv.rb44
-rw-r--r--lib/drb/extservm.rb94
-rw-r--r--lib/drb/gw.rb161
-rw-r--r--lib/drb/invokemethod.rb35
-rw-r--r--lib/drb/observer.rb26
-rw-r--r--lib/drb/ssl.rb346
-rw-r--r--lib/drb/timeridconv.rb97
-rw-r--r--lib/drb/unix.rb118
-rw-r--r--lib/e2mmap.rb134
-rw-r--r--lib/erb.rb1052
-rw-r--r--lib/eregex.rb37
-rw-r--r--lib/fileutils.rb1630
-rw-r--r--lib/final.rb4
-rw-r--r--lib/finalize.rb201
-rw-r--r--lib/find.rb108
-rw-r--r--lib/forwardable.rb329
-rw-r--r--lib/ftools.rb186
-rw-r--r--lib/ftplib.rb14
-rw-r--r--lib/getoptlong.rb439
-rw-r--r--lib/getopts.rb127
-rw-r--r--lib/importenv.rb32
-rw-r--r--lib/ipaddr.rb659
-rw-r--r--lib/irb.rb755
-rw-r--r--lib/irb/cmd/chws.rb34
-rw-r--r--lib/irb/cmd/fork.rb39
-rw-r--r--lib/irb/cmd/help.rb42
-rw-r--r--lib/irb/cmd/load.rb67
-rw-r--r--lib/irb/cmd/nop.rb39
-rw-r--r--lib/irb/cmd/pushws.rb41
-rw-r--r--lib/irb/cmd/subirb.rb43
-rw-r--r--lib/irb/completion.rb327
-rw-r--r--lib/irb/context.rb445
-rw-r--r--lib/irb/ext/change-ws.rb46
-rw-r--r--lib/irb/ext/history.rb119
-rw-r--r--lib/irb/ext/loader.rb129
-rw-r--r--lib/irb/ext/math-mode.rb48
-rw-r--r--lib/irb/ext/multi-irb.rb266
-rw-r--r--lib/irb/ext/save-history.rb105
-rw-r--r--lib/irb/ext/tracer.rb72
-rw-r--r--lib/irb/ext/use-loader.rb74
-rw-r--r--lib/irb/ext/workspaces.rb67
-rw-r--r--lib/irb/extend-command.rb361
-rw-r--r--lib/irb/frame.rb28
-rw-r--r--lib/irb/help.rb36
-rw-r--r--lib/irb/init.rb315
-rw-r--r--lib/irb/input-method.rb150
-rw-r--r--lib/irb/inspector.rb132
-rw-r--r--lib/irb/lc/.document4
-rw-r--r--lib/irb/lc/error.rb26
-rw-r--r--lib/irb/lc/help-message68
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb11
-rw-r--r--lib/irb/lc/ja/error.rb38
-rw-r--r--lib/irb/lc/ja/help-message72
-rw-r--r--lib/irb/loader.rb118
-rw-r--r--lib/irb/locale.rb205
-rw-r--r--lib/irb/magic-file.rb38
-rw-r--r--lib/irb/multi-irb.rb232
-rw-r--r--lib/irb/notifier.rb232
-rw-r--r--lib/irb/output-method.rb92
-rw-r--r--lib/irb/ruby-lex.rb872
-rw-r--r--lib/irb/ruby-token.rb66
-rw-r--r--lib/irb/slex.rb429
-rw-r--r--lib/irb/src_encoding.rb5
-rw-r--r--lib/irb/version.rb12
-rw-r--r--lib/irb/workspace.rb145
-rw-r--r--lib/irb/ws-for-case-2.rb12
-rw-r--r--lib/irb/xmp.rb128
-rw-r--r--lib/jcode.rb213
-rw-r--r--lib/logger.rb849
-rw-r--r--lib/mailread.rb48
-rw-r--r--lib/mathn.rb375
-rw-r--r--lib/matrix.rb2520
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb883
-rw-r--r--lib/matrix/lup_decomposition.rb219
-rw-r--r--lib/mkmf.rb3067
-rw-r--r--lib/monitor.rb416
-rw-r--r--lib/mutex_m.rb169
-rw-r--r--lib/net/ftp.rb1541
-rw-r--r--lib/net/http.rb2357
-rw-r--r--lib/net/http/backward.rb26
-rw-r--r--lib/net/http/exceptions.rb26
-rw-r--r--lib/net/http/generic_request.rb338
-rw-r--r--lib/net/http/header.rb462
-rw-r--r--lib/net/http/proxy_delta.rb17
-rw-r--r--lib/net/http/request.rb21
-rw-r--r--lib/net/http/requests.rb123
-rw-r--r--lib/net/http/response.rb417
-rw-r--r--lib/net/http/responses.rb278
-rw-r--r--lib/net/https.rb23
-rw-r--r--lib/net/imap.rb4888
-rw-r--r--lib/net/pop.rb1213
-rw-r--r--lib/net/protocol.rb1005
-rw-r--r--lib/net/smtp.rb1158
-rw-r--r--lib/net/telnet.rb604
-rw-r--r--lib/observer.rb180
-rw-r--r--lib/open-uri.rb806
-rw-r--r--lib/open3.rb703
-rw-r--r--lib/optionparser.rb2
-rw-r--r--lib/optparse.rb2150
-rw-r--r--lib/optparse/ac.rb51
-rw-r--r--lib/optparse/date.rb18
-rw-r--r--lib/optparse/shellwords.rb7
-rw-r--r--lib/optparse/time.rb11
-rw-r--r--lib/optparse/uri.rb7
-rw-r--r--lib/optparse/version.rb71
-rw-r--r--lib/ostruct.rb341
-rw-r--r--lib/parsearg.rb83
-rw-r--r--lib/parsedate.rb181
-rw-r--r--lib/ping.rb64
-rw-r--r--lib/pp.rb548
-rw-r--r--lib/prettyprint.rb556
-rw-r--r--lib/prime.rb467
-rw-r--r--lib/profile.rb64
-rw-r--r--lib/profiler.rb149
-rw-r--r--lib/pstore.rb485
-rw-r--r--lib/racc/parser.rb623
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc219
-rw-r--r--lib/rational.rb390
-rw-r--r--lib/rbconfig/.document1
-rw-r--r--lib/rbconfig/datadir.rb14
-rw-r--r--lib/rdoc.rb187
-rw-r--r--lib/rdoc/alias.rb112
-rw-r--r--lib/rdoc/anon_class.rb11
-rw-r--r--lib/rdoc/any_method.rb317
-rw-r--r--lib/rdoc/attr.rb176
-rw-r--r--lib/rdoc/class_module.rb800
-rw-r--r--lib/rdoc/code_object.rb428
-rw-r--r--lib/rdoc/code_objects.rb6
-rw-r--r--lib/rdoc/comment.rb229
-rw-r--r--lib/rdoc/constant.rb187
-rw-r--r--lib/rdoc/context.rb1214
-rw-r--r--lib/rdoc/context/section.rb245
-rw-r--r--lib/rdoc/cross_reference.rb184
-rw-r--r--lib/rdoc/encoding.rb108
-rw-r--r--lib/rdoc/erb_partial.rb19
-rw-r--r--lib/rdoc/erbio.rb38
-rw-r--r--lib/rdoc/extend.rb10
-rw-r--r--lib/rdoc/generator.rb52
-rw-r--r--lib/rdoc/generator/darkfish.rb759
-rw-r--r--lib/rdoc/generator/json_index.rb297
-rw-r--r--lib/rdoc/generator/markup.rb170
-rw-r--r--lib/rdoc/generator/pot.rb98
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb68
-rw-r--r--lib/rdoc/generator/pot/po.rb84
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb141
-rw-r--r--lib/rdoc/generator/ri.rb31
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml5
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml20
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_navigation.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_search.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml174
-rw-r--r--lib/rdoc/generator/template/darkfish/css/fonts.css167
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css590
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Light.ttfbin94668 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-LightItalic.ttfbin94196 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Regular.ttfbin96184 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-RegularItalic.ttfbin95316 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin71200 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin71692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/add.pngbin733 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/arrow_up.pngbin372 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin452 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin764 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin774 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin211 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin209 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin626 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/delete.pngbin715 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin659 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin5886 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin853 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin621 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin342 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin309 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin591 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin592 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_blue.pngbin1880 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin613 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/transparent.pngbin97 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin610 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin584 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml23
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js161
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js4
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js109
-rw-r--r--lib/rdoc/generator/template/darkfish/page.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_not_found.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml63
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml58
-rw-r--r--lib/rdoc/generator/template/json_index/.document1
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js142
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js229
-rw-r--r--lib/rdoc/ghost_method.rb7
-rw-r--r--lib/rdoc/i18n.rb10
-rw-r--r--lib/rdoc/i18n/locale.rb102
-rw-r--r--lib/rdoc/i18n/text.rb126
-rw-r--r--lib/rdoc/include.rb10
-rw-r--r--lib/rdoc/known_classes.rb73
-rw-r--r--lib/rdoc/markdown.rb16125
-rw-r--r--lib/rdoc/markdown/entities.rb2132
-rw-r--r--lib/rdoc/markdown/literals.rb417
-rw-r--r--lib/rdoc/markup.rb870
-rw-r--r--lib/rdoc/markup/attr_changer.rb23
-rw-r--r--lib/rdoc/markup/attr_span.rb30
-rw-r--r--lib/rdoc/markup/attribute_manager.rb344
-rw-r--r--lib/rdoc/markup/attributes.rb71
-rw-r--r--lib/rdoc/markup/blank_line.rb28
-rw-r--r--lib/rdoc/markup/block_quote.rb15
-rw-r--r--lib/rdoc/markup/document.rb165
-rw-r--r--lib/rdoc/markup/formatter.rb265
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb764
-rw-r--r--lib/rdoc/markup/hard_break.rb32
-rw-r--r--lib/rdoc/markup/heading.rb79
-rw-r--r--lib/rdoc/markup/include.rb43
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb48
-rw-r--r--lib/rdoc/markup/inline.rb2
-rw-r--r--lib/rdoc/markup/list.rb102
-rw-r--r--lib/rdoc/markup/list_item.rb100
-rw-r--r--lib/rdoc/markup/paragraph.rb29
-rw-r--r--lib/rdoc/markup/parser.rb543
-rw-r--r--lib/rdoc/markup/pre_process.rb294
-rw-r--r--lib/rdoc/markup/raw.rb70
-rw-r--r--lib/rdoc/markup/rule.rb21
-rw-r--r--lib/rdoc/markup/special.rb41
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb115
-rw-r--r--lib/rdoc/markup/to_ansi.rb94
-rw-r--r--lib/rdoc/markup/to_bs.rb79
-rw-r--r--lib/rdoc/markup/to_html.rb399
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb161
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb285
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb72
-rw-r--r--lib/rdoc/markup/to_label.rb75
-rw-r--r--lib/rdoc/markup/to_markdown.rb192
-rw-r--r--lib/rdoc/markup/to_rdoc.rb334
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb88
-rw-r--r--lib/rdoc/markup/to_test.rb70
-rw-r--r--lib/rdoc/markup/to_tt_only.rb121
-rw-r--r--lib/rdoc/markup/verbatim.rb84
-rw-r--r--lib/rdoc/meta_method.rb7
-rw-r--r--lib/rdoc/method_attr.rb419
-rw-r--r--lib/rdoc/mixin.rb121
-rw-r--r--lib/rdoc/normal_class.rb93
-rw-r--r--lib/rdoc/normal_module.rb74
-rw-r--r--lib/rdoc/options.rb1240
-rw-r--r--lib/rdoc/parser.rb311
-rw-r--r--lib/rdoc/parser/c.rb1272
-rw-r--r--lib/rdoc/parser/changelog.rb204
-rw-r--r--lib/rdoc/parser/markdown.rb24
-rw-r--r--lib/rdoc/parser/rd.rb23
-rw-r--r--lib/rdoc/parser/ruby.rb2158
-rw-r--r--lib/rdoc/parser/ruby_tools.rb168
-rw-r--r--lib/rdoc/parser/simple.rb61
-rw-r--r--lib/rdoc/parser/text.rb12
-rw-r--r--lib/rdoc/rd.rb100
-rw-r--r--lib/rdoc/rd/block_parser.rb1055
-rw-r--r--lib/rdoc/rd/inline.rb72
-rw-r--r--lib/rdoc/rd/inline_parser.rb1207
-rw-r--r--lib/rdoc/rdoc.gemspec61
-rw-r--r--lib/rdoc/rdoc.rb570
-rw-r--r--lib/rdoc/require.rb52
-rw-r--r--lib/rdoc/ri.rb21
-rw-r--r--lib/rdoc/ri/driver.rb1482
-rw-r--r--lib/rdoc/ri/formatter.rb6
-rw-r--r--lib/rdoc/ri/paths.rb185
-rw-r--r--lib/rdoc/ri/store.rb7
-rw-r--r--lib/rdoc/ri/task.rb71
-rw-r--r--lib/rdoc/ruby_lex.rb1371
-rw-r--r--lib/rdoc/ruby_token.rb461
-rw-r--r--lib/rdoc/rubygems_hook.rb252
-rw-r--r--lib/rdoc/servlet.rb442
-rw-r--r--lib/rdoc/single_class.rb26
-rw-r--r--lib/rdoc/stats.rb462
-rw-r--r--lib/rdoc/stats/normal.rb60
-rw-r--r--lib/rdoc/stats/quiet.rb60
-rw-r--r--lib/rdoc/stats/verbose.rb46
-rw-r--r--lib/rdoc/store.rb973
-rw-r--r--lib/rdoc/task.rb329
-rw-r--r--lib/rdoc/test_case.rb204
-rw-r--r--lib/rdoc/text.rb309
-rw-r--r--lib/rdoc/token_stream.rb96
-rw-r--r--lib/rdoc/tom_doc.rb258
-rw-r--r--lib/rdoc/top_level.rb283
-rw-r--r--lib/readbytes.rb36
-rw-r--r--lib/resolv-replace.rb76
-rw-r--r--lib/resolv.rb2855
-rw-r--r--lib/rexml/attlistdecl.rb63
-rw-r--r--lib/rexml/attribute.rb192
-rw-r--r--lib/rexml/cdata.rb68
-rw-r--r--lib/rexml/child.rb97
-rw-r--r--lib/rexml/comment.rb80
-rw-r--r--lib/rexml/doctype.rb270
-rw-r--r--lib/rexml/document.rb291
-rw-r--r--lib/rexml/dtd/attlistdecl.rb11
-rw-r--r--lib/rexml/dtd/dtd.rb47
-rw-r--r--lib/rexml/dtd/elementdecl.rb18
-rw-r--r--lib/rexml/dtd/entitydecl.rb57
-rw-r--r--lib/rexml/dtd/notationdecl.rb40
-rw-r--r--lib/rexml/element.rb1241
-rw-r--r--lib/rexml/encoding.rb51
-rw-r--r--lib/rexml/entity.rb174
-rw-r--r--lib/rexml/formatters/default.rb112
-rw-r--r--lib/rexml/formatters/pretty.rb142
-rw-r--r--lib/rexml/formatters/transitive.rb58
-rw-r--r--lib/rexml/functions.rb395
-rw-r--r--lib/rexml/instruction.rb71
-rw-r--r--lib/rexml/light/node.rb196
-rw-r--r--lib/rexml/namespace.rb48
-rw-r--r--lib/rexml/node.rb76
-rw-r--r--lib/rexml/output.rb30
-rw-r--r--lib/rexml/parent.rb166
-rw-r--r--lib/rexml/parseexception.rb52
-rw-r--r--lib/rexml/parsers/baseparser.rb533
-rw-r--r--lib/rexml/parsers/lightparser.rb59
-rw-r--r--lib/rexml/parsers/pullparser.rb197
-rw-r--r--lib/rexml/parsers/sax2parser.rb273
-rw-r--r--lib/rexml/parsers/streamparser.rb53
-rw-r--r--lib/rexml/parsers/treeparser.rb101
-rw-r--r--lib/rexml/parsers/ultralightparser.rb57
-rw-r--r--lib/rexml/parsers/xpathparser.rb657
-rw-r--r--lib/rexml/quickpath.rb266
-rw-r--r--lib/rexml/rexml.rb32
-rw-r--r--lib/rexml/sax2listener.rb98
-rw-r--r--lib/rexml/security.rb28
-rw-r--r--lib/rexml/source.rb297
-rw-r--r--lib/rexml/streamlistener.rb93
-rw-r--r--lib/rexml/syncenumerator.rb33
-rw-r--r--lib/rexml/text.rb426
-rw-r--r--lib/rexml/undefinednamespaceexception.rb9
-rw-r--r--lib/rexml/validation/relaxng.rb539
-rw-r--r--lib/rexml/validation/validation.rb144
-rw-r--r--lib/rexml/validation/validationexception.rb10
-rw-r--r--lib/rexml/xmldecl.rb116
-rw-r--r--lib/rexml/xmltokens.rb85
-rw-r--r--lib/rexml/xpath.rb81
-rw-r--r--lib/rexml/xpath_parser.rb704
-rw-r--r--lib/rinda/rinda.rb328
-rw-r--r--lib/rinda/ring.rb481
-rw-r--r--lib/rinda/tuplespace.rb642
-rw-r--r--lib/rss.rb92
-rw-r--r--lib/rss/0.9.rb462
-rw-r--r--lib/rss/1.0.rb485
-rw-r--r--lib/rss/2.0.rb143
-rw-r--r--lib/rss/atom.rb840
-rw-r--r--lib/rss/content.rb34
-rw-r--r--lib/rss/content/1.0.rb10
-rw-r--r--lib/rss/content/2.0.rb12
-rw-r--r--lib/rss/converter.rb171
-rw-r--r--lib/rss/dublincore.rb164
-rw-r--r--lib/rss/dublincore/1.0.rb13
-rw-r--r--lib/rss/dublincore/2.0.rb13
-rw-r--r--lib/rss/dublincore/atom.rb17
-rw-r--r--lib/rss/image.rb198
-rw-r--r--lib/rss/itunes.rb413
-rw-r--r--lib/rss/maker.rb79
-rw-r--r--lib/rss/maker/0.9.rb509
-rw-r--r--lib/rss/maker/1.0.rb436
-rw-r--r--lib/rss/maker/2.0.rb224
-rw-r--r--lib/rss/maker/atom.rb173
-rw-r--r--lib/rss/maker/base.rb945
-rw-r--r--lib/rss/maker/content.rb22
-rw-r--r--lib/rss/maker/dublincore.rb122
-rw-r--r--lib/rss/maker/entry.rb164
-rw-r--r--lib/rss/maker/feed.rb427
-rw-r--r--lib/rss/maker/image.rb112
-rw-r--r--lib/rss/maker/itunes.rb243
-rw-r--r--lib/rss/maker/slash.rb34
-rw-r--r--lib/rss/maker/syndication.rb19
-rw-r--r--lib/rss/maker/taxonomy.rb119
-rw-r--r--lib/rss/maker/trackback.rb62
-rw-r--r--lib/rss/parser.rb571
-rw-r--r--lib/rss/rexmlparser.rb50
-rw-r--r--lib/rss/rss.rb1353
-rw-r--r--lib/rss/slash.rb52
-rw-r--r--lib/rss/syndication.rb69
-rw-r--r--lib/rss/taxonomy.rb148
-rw-r--r--lib/rss/trackback.rb291
-rw-r--r--lib/rss/utils.rb200
-rw-r--r--lib/rss/xml-stylesheet.rb106
-rw-r--r--lib/rss/xml.rb72
-rw-r--r--lib/rss/xmlparser.rb95
-rw-r--r--lib/rss/xmlscanner.rb122
-rw-r--r--lib/rubygems.rb1366
-rw-r--r--lib/rubygems/LICENSE.txt54
-rw-r--r--lib/rubygems/available_set.rb165
-rw-r--r--lib/rubygems/basic_specification.rb328
-rw-r--r--lib/rubygems/command.rb594
-rw-r--r--lib/rubygems/command_manager.rb219
-rw-r--r--lib/rubygems/commands/build_command.rb65
-rw-r--r--lib/rubygems/commands/cert_command.rb277
-rw-r--r--lib/rubygems/commands/check_command.rb94
-rw-r--r--lib/rubygems/commands/cleanup_command.rb171
-rw-r--r--lib/rubygems/commands/contents_command.rb191
-rw-r--r--lib/rubygems/commands/dependency_command.rb218
-rw-r--r--lib/rubygems/commands/environment_command.rb160
-rw-r--r--lib/rubygems/commands/fetch_command.rb78
-rw-r--r--lib/rubygems/commands/generate_index_command.rb85
-rw-r--r--lib/rubygems/commands/help_command.rb375
-rw-r--r--lib/rubygems/commands/install_command.rb303
-rw-r--r--lib/rubygems/commands/list_command.rb41
-rw-r--r--lib/rubygems/commands/lock_command.rb111
-rw-r--r--lib/rubygems/commands/mirror_command.rb26
-rw-r--r--lib/rubygems/commands/open_command.rb81
-rw-r--r--lib/rubygems/commands/outdated_command.rb33
-rw-r--r--lib/rubygems/commands/owner_command.rb99
-rw-r--r--lib/rubygems/commands/pristine_command.rb176
-rw-r--r--lib/rubygems/commands/push_command.rb103
-rw-r--r--lib/rubygems/commands/query_command.rb359
-rw-r--r--lib/rubygems/commands/rdoc_command.rb97
-rw-r--r--lib/rubygems/commands/search_command.rb41
-rw-r--r--lib/rubygems/commands/server_command.rb87
-rw-r--r--lib/rubygems/commands/setup_command.rb484
-rw-r--r--lib/rubygems/commands/sources_command.rb211
-rw-r--r--lib/rubygems/commands/specification_command.rb146
-rw-r--r--lib/rubygems/commands/stale_command.rb39
-rw-r--r--lib/rubygems/commands/uninstall_command.rb165
-rw-r--r--lib/rubygems/commands/unpack_command.rb183
-rw-r--r--lib/rubygems/commands/update_command.rb279
-rw-r--r--lib/rubygems/commands/which_command.rb91
-rw-r--r--lib/rubygems/commands/yank_command.rb103
-rw-r--r--lib/rubygems/compatibility.rb60
-rw-r--r--lib/rubygems/config_file.rb494
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb74
-rwxr-xr-xlib/rubygems/core_ext/kernel_require.rb141
-rw-r--r--lib/rubygems/defaults.rb196
-rw-r--r--lib/rubygems/dependency.rb330
-rw-r--r--lib/rubygems/dependency_installer.rb491
-rw-r--r--lib/rubygems/dependency_list.rb244
-rw-r--r--lib/rubygems/deprecate.rb71
-rw-r--r--lib/rubygems/doctor.rb132
-rw-r--r--lib/rubygems/errors.rb182
-rw-r--r--lib/rubygems/exceptions.rb270
-rw-r--r--lib/rubygems/ext.rb19
-rw-r--r--lib/rubygems/ext/build_error.rb7
-rw-r--r--lib/rubygems/ext/builder.rb221
-rw-r--r--lib/rubygems/ext/cmake_builder.rb17
-rw-r--r--lib/rubygems/ext/configure_builder.rb24
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb94
-rw-r--r--lib/rubygems/ext/rake_builder.rb37
-rw-r--r--lib/rubygems/gem_runner.rb82
-rw-r--r--lib/rubygems/gemcutter_utilities.rb168
-rw-r--r--lib/rubygems/indexer.rb434
-rw-r--r--lib/rubygems/install_default_message.rb13
-rw-r--r--lib/rubygems/install_message.rb13
-rw-r--r--lib/rubygems/install_update_options.rb239
-rw-r--r--lib/rubygems/installer.rb857
-rw-r--r--lib/rubygems/installer_test_case.rb196
-rw-r--r--lib/rubygems/local_remote_options.rb149
-rw-r--r--lib/rubygems/mock_gem_ui.rb89
-rw-r--r--lib/rubygems/name_tuple.rb124
-rw-r--r--lib/rubygems/package.rb629
-rw-r--r--lib/rubygems/package/digest_io.rb65
-rw-r--r--lib/rubygems/package/file_source.rb34
-rw-r--r--lib/rubygems/package/io_source.rb46
-rw-r--r--lib/rubygems/package/old.rb178
-rw-r--r--lib/rubygems/package/source.rb4
-rw-r--r--lib/rubygems/package/tar_header.rb229
-rw-r--r--lib/rubygems/package/tar_reader.rb123
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb154
-rw-r--r--lib/rubygems/package/tar_test_case.rb147
-rw-r--r--lib/rubygems/package/tar_writer.rb339
-rw-r--r--lib/rubygems/package_task.rb129
-rw-r--r--lib/rubygems/path_support.rb80
-rw-r--r--lib/rubygems/platform.rb206
-rw-r--r--lib/rubygems/psych_additions.rb10
-rw-r--r--lib/rubygems/psych_tree.rb32
-rw-r--r--lib/rubygems/rdoc.rb335
-rw-r--r--lib/rubygems/remote_fetcher.rb416
-rw-r--r--lib/rubygems/request.rb248
-rw-r--r--lib/rubygems/request/connection_pools.rb88
-rw-r--r--lib/rubygems/request/http_pool.rb48
-rw-r--r--lib/rubygems/request/https_pool.rb11
-rw-r--r--lib/rubygems/request_set.rb424
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb849
-rw-r--r--lib/rubygems/request_set/lockfile.rb238
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb354
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb112
-rw-r--r--lib/rubygems/requirement.rb285
-rw-r--r--lib/rubygems/resolver.rb292
-rw-r--r--lib/rubygems/resolver/activation_request.rb186
-rw-r--r--lib/rubygems/resolver/api_set.rb126
-rw-r--r--lib/rubygems/resolver/api_specification.rb86
-rw-r--r--lib/rubygems/resolver/best_set.rb79
-rw-r--r--lib/rubygems/resolver/composed_set.rb67
-rw-r--r--lib/rubygems/resolver/conflict.rb160
-rw-r--r--lib/rubygems/resolver/current_set.rb14
-rw-r--r--lib/rubygems/resolver/dependency_request.rb120
-rw-r--r--lib/rubygems/resolver/git_set.rb123
-rw-r--r--lib/rubygems/resolver/git_specification.rb59
-rw-r--r--lib/rubygems/resolver/index_set.rb81
-rw-r--r--lib/rubygems/resolver/index_specification.rb70
-rw-r--r--lib/rubygems/resolver/installed_specification.rb59
-rw-r--r--lib/rubygems/resolver/installer_set.rb229
-rw-r--r--lib/rubygems/resolver/local_specification.rb42
-rw-r--r--lib/rubygems/resolver/lock_set.rb83
-rw-r--r--lib/rubygems/resolver/lock_specification.rb88
-rw-r--r--lib/rubygems/resolver/molinillo.rb2
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb10
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb50
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb80
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb203
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb35
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb58
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb61
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb53
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb114
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb45
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb35
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb123
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb75
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb5
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb100
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb65
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb460
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb45
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb54
-rw-r--r--lib/rubygems/resolver/requirement_list.rb82
-rw-r--r--lib/rubygems/resolver/set.rb57
-rw-r--r--lib/rubygems/resolver/source_set.rb48
-rw-r--r--lib/rubygems/resolver/spec_specification.rb57
-rw-r--r--lib/rubygems/resolver/specification.rb111
-rw-r--r--lib/rubygems/resolver/stats.rb45
-rw-r--r--lib/rubygems/resolver/vendor_set.rb88
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb25
-rw-r--r--lib/rubygems/security.rb596
-rw-r--r--lib/rubygems/security/policies.rb116
-rw-r--r--lib/rubygems/security/policy.rb295
-rw-r--r--lib/rubygems/security/signer.rb157
-rw-r--r--lib/rubygems/security/trust_dir.rb119
-rw-r--r--lib/rubygems/server.rb867
-rw-r--r--lib/rubygems/source.rb235
-rw-r--r--lib/rubygems/source/git.rb241
-rw-r--r--lib/rubygems/source/installed.rb41
-rw-r--r--lib/rubygems/source/local.rb130
-rw-r--r--lib/rubygems/source/lock.rb49
-rw-r--r--lib/rubygems/source/specific_file.rb73
-rw-r--r--lib/rubygems/source/vendor.rb28
-rw-r--r--lib/rubygems/source_list.rb150
-rw-r--r--lib/rubygems/source_local.rb6
-rw-r--r--lib/rubygems/source_specific_file.rb5
-rw-r--r--lib/rubygems/spec_fetcher.rb270
-rw-r--r--lib/rubygems/specification.rb3021
-rw-r--r--lib/rubygems/ssl_certs/.document1
-rw-r--r--lib/rubygems/ssl_certs/index.rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/ssl_certs/rubygems.global.ssl.fastly.net/DigiCertHighAssuranceEVRootCA.pem23
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/AddTrustExternalCARoot.pem25
-rw-r--r--lib/rubygems/stub_specification.rb212
-rw-r--r--lib/rubygems/syck_hack.rb77
-rw-r--r--lib/rubygems/test_case.rb1516
-rw-r--r--lib/rubygems/test_utilities.rb384
-rw-r--r--lib/rubygems/text.rb73
-rw-r--r--lib/rubygems/uninstaller.rb346
-rw-r--r--lib/rubygems/uri_formatter.rb50
-rw-r--r--lib/rubygems/user_interaction.rb700
-rw-r--r--lib/rubygems/util.rb135
-rw-r--r--lib/rubygems/util/licenses.rb343
-rw-r--r--lib/rubygems/util/list.rb37
-rw-r--r--lib/rubygems/validator.rb166
-rw-r--r--lib/rubygems/version.rb374
-rw-r--r--lib/rubygems/version_option.rb72
-rw-r--r--lib/scanf.rb776
-rw-r--r--lib/securerandom.rb251
-rw-r--r--lib/set.rb806
-rw-r--r--lib/shell.rb329
-rw-r--r--lib/shell/builtin-command.rb79
-rw-r--r--lib/shell/command-processor.rb728
-rw-r--r--lib/shell/error.rb16
-rw-r--r--lib/shell/filter.rb95
-rw-r--r--lib/shell/process-controller.rb347
-rw-r--r--lib/shell/system-command.rb153
-rw-r--r--lib/shell/version.rb16
-rw-r--r--lib/shellwords.rb250
-rw-r--r--lib/singleton.rb202
-rw-r--r--lib/sync.rb386
-rw-r--r--lib/telnet.rb9
-rw-r--r--lib/tempfile.rb393
-rw-r--r--lib/thread.rb282
-rw-r--r--lib/thwait.rb158
-rw-r--r--lib/time.rb684
-rw-r--r--lib/timeout.rb150
-rw-r--r--lib/tmpdir.rb140
-rw-r--r--lib/tracer.rb278
-rw-r--r--lib/tsort.rb452
-rw-r--r--lib/ubygems.rb11
-rw-r--r--lib/un.rb379
-rw-r--r--lib/unicode_normalize.rb79
-rw-r--r--lib/unicode_normalize/normalize.rb161
-rw-r--r--lib/unicode_normalize/tables.rb1167
-rw-r--r--lib/uri.rb112
-rw-r--r--lib/uri/common.rb721
-rw-r--r--lib/uri/ftp.rb267
-rw-r--r--lib/uri/generic.rb1568
-rw-r--r--lib/uri/http.rb109
-rw-r--r--lib/uri/https.rb23
-rw-r--r--lib/uri/ldap.rb261
-rw-r--r--lib/uri/ldaps.rb21
-rw-r--r--lib/uri/mailto.rb294
-rw-r--r--lib/uri/rfc2396_parser.rb544
-rw-r--r--lib/uri/rfc3986_parser.rb125
-rw-r--r--lib/weakref.rb156
-rw-r--r--lib/webrick.rb227
-rw-r--r--lib/webrick/accesslog.rb159
-rw-r--r--lib/webrick/cgi.rb309
-rw-r--r--lib/webrick/compat.rb36
-rw-r--r--lib/webrick/config.rb152
-rw-r--r--lib/webrick/cookie.rb172
-rw-r--r--lib/webrick/htmlutils.rb30
-rw-r--r--lib/webrick/httpauth.rb96
-rw-r--r--lib/webrick/httpauth/authenticator.rb117
-rw-r--r--lib/webrick/httpauth/basicauth.rb108
-rw-r--r--lib/webrick/httpauth/digestauth.rb408
-rw-r--r--lib/webrick/httpauth/htdigest.rb132
-rw-r--r--lib/webrick/httpauth/htgroup.rb94
-rw-r--r--lib/webrick/httpauth/htpasswd.rb125
-rw-r--r--lib/webrick/httpauth/userdb.rb53
-rw-r--r--lib/webrick/httpproxy.rb338
-rw-r--r--lib/webrick/httprequest.rb587
-rw-r--r--lib/webrick/httpresponse.rb471
-rw-r--r--lib/webrick/https.rb87
-rw-r--r--lib/webrick/httpserver.rb280
-rw-r--r--lib/webrick/httpservlet.rb23
-rw-r--r--lib/webrick/httpservlet/abstract.rb154
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb47
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb122
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb88
-rw-r--r--lib/webrick/httpservlet/filehandler.rb523
-rw-r--r--lib/webrick/httpservlet/prochandler.rb47
-rw-r--r--lib/webrick/httpstatus.rb198
-rw-r--r--lib/webrick/httputils.rb510
-rw-r--r--lib/webrick/httpversion.rb76
-rw-r--r--lib/webrick/log.rb156
-rw-r--r--lib/webrick/server.rb380
-rw-r--r--lib/webrick/ssl.rb202
-rw-r--r--lib/webrick/utils.rb270
-rw-r--r--lib/webrick/version.rb18
-rw-r--r--lib/yaml.rb60
-rw-r--r--lib/yaml/dbm.rb280
-rw-r--r--lib/yaml/store.rb82
-rw-r--r--load.c1208
-rw-r--r--loadpath.c92
-rw-r--r--localeinit.c114
-rw-r--r--main.c50
-rw-r--r--man/erb.1157
-rw-r--r--man/goruby.139
-rw-r--r--man/irb.1173
-rw-r--r--man/ri.1181
-rw-r--r--man/ruby.1651
-rw-r--r--marshal.c2175
-rw-r--r--math.c1010
-rw-r--r--method.h213
-rw-r--r--miniinit.c49
-rw-r--r--misc/README17
-rw-r--r--misc/inf-ruby.el243
-rw-r--r--misc/rb_optparse.bash20
-rwxr-xr-xmisc/rb_optparse.zsh38
-rw-r--r--misc/rdoc-mode.el166
-rw-r--r--misc/ruby-additional.el181
-rw-r--r--misc/ruby-electric.el569
-rw-r--r--misc/ruby-mode.el1880
-rw-r--r--misc/ruby-style.el81
-rw-r--r--misc/rubydb3x.el42
-rw-r--r--missing/acosh.c93
-rw-r--r--missing/alloca.c23
-rw-r--r--missing/cbrt.c11
-rw-r--r--missing/close.c72
-rw-r--r--missing/crt_externs.h8
-rw-r--r--missing/crypt.c1159
-rw-r--r--missing/crypt.h248
-rw-r--r--missing/des_tables.c1616
-rw-r--r--missing/dir.h66
-rw-r--r--missing/dup2.c5
-rw-r--r--missing/erf.c89
-rw-r--r--missing/explicit_bzero.c88
-rw-r--r--missing/ffs.c49
-rw-r--r--missing/file.h2
-rw-r--r--missing/fileblocks.c1
-rw-r--r--missing/finite.c7
-rw-r--r--missing/flock.c28
-rw-r--r--missing/hypot.c17
-rw-r--r--missing/isinf.c51
-rw-r--r--missing/isnan.c39
-rw-r--r--missing/langinfo.c148
-rw-r--r--missing/lgamma_r.c80
-rw-r--r--missing/memcmp.c15
-rw-r--r--missing/memmove.c38
-rw-r--r--missing/mkdir.c104
-rw-r--r--missing/nextafter.c77
-rw-r--r--missing/os2.c111
-rw-r--r--missing/setproctitle.c176
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/strcasecmp.c12
-rw-r--r--missing/strchr.c57
-rw-r--r--missing/strerror.c13
-rw-r--r--missing/strftime.c888
-rw-r--r--missing/strlcat.c56
-rw-r--r--missing/strlcpy.c51
-rw-r--r--missing/strncasecmp.c18
-rw-r--r--missing/strstr.c82
-rw-r--r--missing/strtod.c271
-rw-r--r--missing/strtol.c87
-rw-r--r--missing/strtoul.c184
-rw-r--r--missing/tgamma.c92
-rw-r--r--missing/vsnprintf.c1131
-rw-r--r--missing/x68.c38
-rw-r--r--missing/x86_64-chkstk.s10
-rw-r--r--mkconfig.rb118
-rw-r--r--nacl/GNUmakefile.in100
-rw-r--r--nacl/README.nacl51
-rw-r--r--nacl/create_nmf.rb70
-rw-r--r--nacl/dirent.h15
-rw-r--r--nacl/example.html150
-rwxr-xr-xnacl/nacl-config.rb61
-rw-r--r--nacl/package.rb113
-rw-r--r--nacl/pepper_main.c732
-rw-r--r--nacl/resource.h8
-rw-r--r--nacl/select.h7
-rw-r--r--nacl/signal.h6
-rw-r--r--nacl/stat.h10
-rw-r--r--nacl/unistd.h9
-rw-r--r--nacl/utime.h11
-rw-r--r--node.c1164
-rw-r--r--node.h460
-rw-r--r--numeric.c5413
-rw-r--r--object.c3722
-rw-r--r--pack.c2282
-rw-r--r--parse.y12569
-rw-r--r--prec.c81
-rw-r--r--prelude.rb135
-rw-r--r--probes.d234
-rw-r--r--probes_helper.h43
-rw-r--r--proc.c3168
-rw-r--r--process.c8205
-rw-r--r--random.c1678
-rw-r--r--range.c1378
-rw-r--r--rational.c2617
-rw-r--r--re.c4151
-rw-r--r--re.h44
-rw-r--r--regcomp.c6753
-rw-r--r--regenc.c1011
-rw-r--r--regenc.h237
-rw-r--r--regerror.c408
-rw-r--r--regex.c4522
-rw-r--r--regex.h228
-rw-r--r--regexec.c4513
-rw-r--r--regint.h995
-rw-r--r--regparse.c6506
-rw-r--r--regparse.h367
-rw-r--r--regsyntax.c387
-rw-r--r--ruby-runner.c35
-rw-r--r--ruby.1291
-rw-r--r--ruby.c2469
-rw-r--r--ruby.h606
-rw-r--r--ruby_assert.h54
-rw-r--r--ruby_atomic.h233
-rw-r--r--rubyio.h66
-rw-r--r--rubysig.h88
-rw-r--r--rubystub.c60
-rw-r--r--rubytest.rb44
-rw-r--r--safe.c128
-rw-r--r--sample/README12
-rw-r--r--sample/benchmark.rb19
-rw-r--r--sample/biorhythm.rb143
-rw-r--r--sample/cal.rb243
-rw-r--r--sample/cbreak.rb4
-rw-r--r--sample/cgi-session-pstore.rb11
-rw-r--r--sample/clnt.rb12
-rw-r--r--sample/coverage.rb62
-rw-r--r--sample/dbmtest.rb14
-rw-r--r--sample/delegate.rb31
-rw-r--r--sample/dir.rb6
-rw-r--r--sample/drb/README.ja.rdoc59
-rw-r--r--sample/drb/README.rdoc56
-rw-r--r--sample/drb/acl.rb15
-rw-r--r--sample/drb/darray.rb12
-rw-r--r--sample/drb/darrayc.rb47
-rw-r--r--sample/drb/dbiff.rb51
-rw-r--r--sample/drb/dcdbiff.rb43
-rw-r--r--sample/drb/dchatc.rb41
-rw-r--r--sample/drb/dchats.rb70
-rw-r--r--sample/drb/dhasen.rb42
-rw-r--r--sample/drb/dhasenc.rb14
-rw-r--r--sample/drb/dlogc.rb16
-rw-r--r--sample/drb/dlogd.rb39
-rw-r--r--sample/drb/dqin.rb13
-rw-r--r--sample/drb/dqlib.rb14
-rw-r--r--sample/drb/dqout.rb14
-rw-r--r--sample/drb/dqueue.rb12
-rw-r--r--sample/drb/drbc.rb45
-rw-r--r--sample/drb/drbch.rb48
-rw-r--r--sample/drb/drbm.rb60
-rw-r--r--sample/drb/drbmc.rb22
-rw-r--r--sample/drb/drbs-acl.rb51
-rw-r--r--sample/drb/drbs.rb64
-rw-r--r--sample/drb/drbssl_c.rb19
-rw-r--r--sample/drb/drbssl_s.rb31
-rw-r--r--sample/drb/extserv_test.rb80
-rw-r--r--sample/drb/gw_ct.rb29
-rw-r--r--sample/drb/gw_cu.rb28
-rw-r--r--sample/drb/gw_s.rb10
-rw-r--r--sample/drb/holderc.rb22
-rw-r--r--sample/drb/holders.rb63
-rw-r--r--sample/drb/http0.rb77
-rw-r--r--sample/drb/http0serv.rb119
-rw-r--r--sample/drb/name.rb117
-rw-r--r--sample/drb/namec.rb36
-rw-r--r--sample/drb/old_tuplespace.rb214
-rw-r--r--sample/drb/rinda_ts.rb7
-rw-r--r--sample/drb/rindac.rb17
-rw-r--r--sample/drb/rindas.rb18
-rw-r--r--sample/drb/ring_echo.rb30
-rw-r--r--sample/drb/ring_inspect.rb30
-rw-r--r--sample/drb/ring_place.rb25
-rw-r--r--sample/drb/simpletuple.rb91
-rw-r--r--sample/drb/speedc.rb21
-rw-r--r--sample/drb/speeds.rb31
-rw-r--r--sample/dualstack-fetch.rb48
-rw-r--r--sample/dualstack-httpd.rb55
-rw-r--r--sample/eval.rb17
-rw-r--r--sample/exyacc.rb34
-rw-r--r--sample/fact.rb5
-rw-r--r--sample/fib.awk8
-rw-r--r--sample/fib.pl4
-rw-r--r--sample/fib.scm4
-rw-r--r--sample/freq.rb2
-rw-r--r--sample/from.rb161
-rw-r--r--sample/fullpath.rb16
-rw-r--r--sample/getopts.test36
-rw-r--r--sample/goodfriday.rb48
-rw-r--r--sample/io.rb44
-rw-r--r--sample/irb.rb21
-rw-r--r--sample/iseq_loader.rb243
-rw-r--r--sample/list.rb3
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb2
-rw-r--r--sample/logger/app.rb46
-rw-r--r--sample/logger/log.rb27
-rw-r--r--sample/logger/shifting.rb26
-rw-r--r--[-rwxr-xr-x]sample/mine.rb39
-rw-r--r--sample/mkproto.rb30
-rw-r--r--sample/mrshtest.rb13
-rw-r--r--sample/net-imap.rb167
-rw-r--r--sample/observ.rb8
-rw-r--r--sample/occur.pl8
-rw-r--r--sample/occur.rb6
-rw-r--r--sample/occur2.rb13
-rw-r--r--sample/open3.rb12
-rw-r--r--sample/openssl/c_rehash.rb174
-rw-r--r--sample/openssl/cert2text.rb23
-rw-r--r--sample/openssl/certstore.rb161
-rw-r--r--sample/openssl/cipher.rb54
-rw-r--r--sample/openssl/crlstore.rb122
-rw-r--r--sample/openssl/echo_cli.rb44
-rw-r--r--sample/openssl/echo_svr.rb65
-rw-r--r--sample/openssl/gen_csr.rb51
-rw-r--r--sample/openssl/smime_read.rb23
-rw-r--r--sample/openssl/smime_write.rb23
-rw-r--r--sample/openssl/wget.rb34
-rwxr-xr-xsample/optparse/opttest.rb125
-rwxr-xr-xsample/optparse/subcommand.rb19
-rw-r--r--sample/philos.rb4
-rw-r--r--sample/pi.rb2
-rw-r--r--sample/pstore.rb19
-rw-r--r--sample/pty/expect_sample.rb48
-rw-r--r--sample/pty/script.rb37
-rw-r--r--sample/pty/shl.rb92
-rw-r--r--sample/rcs.awk54
-rw-r--r--sample/rcs.rb20
-rw-r--r--sample/rdoc/markup/rdoc2latex.rb15
-rw-r--r--sample/rdoc/markup/sample.rb40
-rw-r--r--sample/regx.rb23
-rw-r--r--sample/rename.rb297
-rw-r--r--sample/rinda-ring.rb22
-rw-r--r--sample/ripper/ruby2html.rb112
-rw-r--r--sample/ripper/strip-comment.rb19
-rwxr-xr-xsample/rss/blend.rb79
-rwxr-xr-xsample/rss/convert.rb69
-rwxr-xr-xsample/rss/list_description.rb91
-rwxr-xr-xsample/rss/re_read.rb64
-rwxr-xr-xsample/rss/rss_recent.rb85
-rw-r--r--sample/sieve.rb2
-rw-r--r--sample/simple-bench.rb140
-rw-r--r--sample/svr.rb12
-rw-r--r--sample/tempfile.rb8
-rw-r--r--[-rwxr-xr-x]sample/test.rb1206
-rw-r--r--sample/testunit/adder.rb13
-rw-r--r--sample/testunit/subtracter.rb12
-rw-r--r--sample/testunit/tc_adder.rb18
-rw-r--r--sample/testunit/tc_subtracter.rb18
-rw-r--r--sample/testunit/ts_examples.rb7
-rw-r--r--sample/time.rb16
-rw-r--r--sample/timeout.rb42
-rw-r--r--sample/trick2013/README.md15
-rw-r--r--sample/trick2013/kinaba/authors.markdown3
-rw-r--r--sample/trick2013/kinaba/entry.rb1
-rw-r--r--sample/trick2013/kinaba/remarks.markdown37
-rw-r--r--sample/trick2013/mame/authors.markdown3
-rw-r--r--sample/trick2013/mame/entry.rb97
-rw-r--r--sample/trick2013/mame/music-box.mp4bin580724 -> 0 bytes-rw-r--r--sample/trick2013/mame/remarks.markdown47
-rw-r--r--sample/trick2013/shinh/authors.markdown2
-rw-r--r--sample/trick2013/shinh/entry.rb10
-rw-r--r--sample/trick2013/shinh/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/authors.markdown3
-rw-r--r--sample/trick2013/yhara/entry.rb28
-rw-r--r--sample/trick2013/yhara/remarks.en.markdown23
-rw-r--r--sample/trick2013/yhara/remarks.markdown24
-rw-r--r--sample/trick2015/README.md16
-rw-r--r--sample/trick2015/eregon/authors.markdown3
-rw-r--r--sample/trick2015/eregon/entry.rb16
-rw-r--r--sample/trick2015/eregon/remarks.markdown70
-rw-r--r--sample/trick2015/kinaba/authors.markdown4
-rw-r--r--sample/trick2015/kinaba/entry.rb150
-rw-r--r--sample/trick2015/kinaba/remarks.markdown85
-rw-r--r--sample/trick2015/ksk_1/authors.markdown3
-rw-r--r--sample/trick2015/ksk_1/entry.rb1
-rw-r--r--sample/trick2015/ksk_1/remarks.markdown120
-rw-r--r--sample/trick2015/ksk_2/abnormal.cnf6
-rw-r--r--sample/trick2015/ksk_2/authors.markdown3
-rw-r--r--sample/trick2015/ksk_2/entry.rb1
-rw-r--r--sample/trick2015/ksk_2/quinn.cnf21
-rw-r--r--sample/trick2015/ksk_2/remarks.markdown204
-rw-r--r--sample/trick2015/ksk_2/sample.cnf9
-rw-r--r--sample/trick2015/ksk_2/uf20-01.cnf99
-rw-r--r--sample/trick2015/ksk_2/unsat.cnf11
-rw-r--r--sample/trick2015/monae/authors.markdown1
-rw-r--r--sample/trick2015/monae/entry.rb26
-rw-r--r--sample/trick2015/monae/remarks.markdown25
-rw-r--r--sample/trojan.rb4
-rw-r--r--sample/tsvr.rb8
-rw-r--r--sample/uumerge.rb12
-rw-r--r--sample/weakref.rb9
-rw-r--r--sample/webrick/demo-app.rb66
-rw-r--r--sample/webrick/demo-multipart.cgi12
-rw-r--r--sample/webrick/demo-servlet.rb6
-rw-r--r--sample/webrick/demo-urlencoded.cgi12
-rw-r--r--sample/webrick/hello.cgi11
-rw-r--r--sample/webrick/hello.rb8
-rw-r--r--sample/webrick/httpd.rb23
-rw-r--r--sample/webrick/httpproxy.rb25
-rw-r--r--sample/webrick/httpsd.rb33
-rw-r--r--signal.c1579
-rw-r--r--siphash.c484
-rw-r--r--siphash.h48
-rw-r--r--sparc.c40
-rw-r--r--spec/README31
-rw-r--r--spec/default.mspec25
-rw-r--r--sprintf.c1551
-rw-r--r--st.c1791
-rw-r--r--st.h46
-rw-r--r--strftime.c1265
-rw-r--r--string.c10274
-rw-r--r--struct.c1305
-rw-r--r--symbol.c1135
-rw-r--r--symbol.h108
-rw-r--r--template/Doxyfile.tmpl265
-rw-r--r--template/GNUmakefile.in7
-rw-r--r--template/encdb.h.tmpl91
-rw-r--r--template/fake.rb.in40
-rw-r--r--template/id.c.tmpl43
-rw-r--r--template/id.h.tmpl85
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/known_errors.inc.tmpl14
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/prelude.c.tmpl195
-rw-r--r--template/ruby-runner.h.in3
-rw-r--r--template/ruby.pc.in56
-rw-r--r--template/sizes.c.tmpl51
-rw-r--r--template/transdb.h.tmpl59
-rw-r--r--template/unicode_norm_gen.tmpl220
-rw-r--r--template/verconf.h.tmpl63
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yarvarch.en7
-rw-r--r--template/yarvarch.ja454
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/array/test_resize.rb30
-rw-r--r--test/-ext-/bignum/test_big2str.rb30
-rw-r--r--test/-ext-/bignum/test_bigzero.rb14
-rw-r--r--test/-ext-/bignum/test_div.rb29
-rw-r--r--test/-ext-/bignum/test_mul.rb138
-rw-r--r--test/-ext-/bignum/test_pack.rb399
-rw-r--r--test/-ext-/bignum/test_str2big.rb38
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb24
-rw-r--r--test/-ext-/class/test_class2name.rb19
-rw-r--r--test/-ext-/debug/test_debug.rb59
-rw-r--r--test/-ext-/debug/test_profile_frames.rb122
-rw-r--r--test/-ext-/exception/test_data_error.rb14
-rw-r--r--test/-ext-/exception/test_enc_raise.rb16
-rw-r--r--test/-ext-/exception/test_ensured.rb32
-rw-r--r--test/-ext-/file/test_stat.rb15
-rw-r--r--test/-ext-/float/test_nextafter.rb65
-rw-r--r--test/-ext-/funcall/test_passing_block.rb23
-rw-r--r--test/-ext-/gvl/test_last_thread.rb23
-rw-r--r--test/-ext-/hash/test_delete.rb20
-rw-r--r--test/-ext-/integer/test_integer.rb15
-rw-r--r--test/-ext-/integer/test_my_integer.rb48
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb117
-rw-r--r--test/-ext-/iter/test_iter_break.rb16
-rw-r--r--test/-ext-/iter/test_yield_block.rb22
-rw-r--r--test/-ext-/load/test_dot_dot.rb11
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb20
-rw-r--r--test/-ext-/marshal/test_usrmarshal.rb33
-rw-r--r--test/-ext-/method/test_arity.rb38
-rw-r--r--test/-ext-/num2int/test_num2int.rb269
-rw-r--r--test/-ext-/path_to_class/test_path_to_class.rb13
-rw-r--r--test/-ext-/popen_deadlock/test_popen_deadlock.rb36
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb29
-rw-r--r--test/-ext-/proc/test_bmethod.rb38
-rw-r--r--test/-ext-/rational/test_rat.rb32
-rw-r--r--test/-ext-/st/test_foreach.rb16
-rw-r--r--test/-ext-/st/test_numhash.rb50
-rw-r--r--test/-ext-/st/test_update.rb51
-rw-r--r--test/-ext-/string/test_capacity.rb32
-rw-r--r--test/-ext-/string/test_coderange.rb60
-rw-r--r--test/-ext-/string/test_cstr.rb164
-rw-r--r--test/-ext-/string/test_ellipsize.rb47
-rw-r--r--test/-ext-/string/test_enc_associate.rb24
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb16
-rw-r--r--test/-ext-/string/test_fstring.rb65
-rw-r--r--test/-ext-/string/test_modify_expand.rb26
-rw-r--r--test/-ext-/string/test_nofree.rb13
-rw-r--r--test/-ext-/string/test_normalize.rb110
-rw-r--r--test/-ext-/string/test_qsort.rb20
-rw-r--r--test/-ext-/string/test_set_len.rb26
-rw-r--r--test/-ext-/struct/test_duplicate.rb22
-rw-r--r--test/-ext-/struct/test_member.rb14
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb505
-rw-r--r--test/-ext-/symbol/test_type.rb139
-rw-r--r--test/-ext-/test_bug-3571.rb21
-rw-r--r--test/-ext-/test_bug-5832.rb22
-rw-r--r--test/-ext-/test_notimplement.rb15
-rw-r--r--test/-ext-/test_printf.rb187
-rw-r--r--test/-ext-/test_recursion.rb36
-rw-r--r--test/-ext-/time/test_new.rb44
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb80
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb20
-rw-r--r--test/-ext-/vm/test_at_exit.rb19
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb46
-rw-r--r--test/-ext-/win32/test_console_attr.rb44
-rw-r--r--test/-ext-/win32/test_dln.rb35
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb115
-rw-r--r--test/benchmark/test_benchmark.rb162
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1595
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb51
-rw-r--r--test/bigdecimal/test_bigmath.rb81
-rw-r--r--test/bigdecimal/testbase.rb28
-rw-r--r--test/cgi/test_cgi_cookie.rb118
-rw-r--r--test/cgi/test_cgi_core.rb303
-rw-r--r--test/cgi/test_cgi_header.rb184
-rw-r--r--test/cgi/test_cgi_modruby.rb149
-rw-r--r--test/cgi/test_cgi_multipart.rb386
-rw-r--r--test/cgi/test_cgi_session.rb169
-rw-r--r--test/cgi/test_cgi_tag_helper.rb355
-rw-r--r--test/cgi/test_cgi_util.rb178
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin156414 -> 0 bytes-rw-r--r--test/cgi/testdata/small.pngbin82 -> 0 bytes-rw-r--r--test/cgi/update_env.rb9
-rw-r--r--test/colors3
-rw-r--r--test/coverage/test_coverage.rb122
-rw-r--r--test/csv/base.rb9
-rw-r--r--test/csv/line_endings.gzbin59 -> 0 bytes-rwxr-xr-xtest/csv/test_csv_parsing.rb222
-rwxr-xr-xtest/csv/test_csv_writing.rb98
-rwxr-xr-xtest/csv/test_data_converters.rb264
-rwxr-xr-xtest/csv/test_encodings.rb338
-rwxr-xr-xtest/csv/test_features.rb351
-rwxr-xr-xtest/csv/test_headers.rb298
-rwxr-xr-xtest/csv/test_interface.rb369
-rwxr-xr-xtest/csv/test_row.rb380
-rwxr-xr-xtest/csv/test_table.rb497
-rw-r--r--test/csv/ts_all.rb21
-rw-r--r--test/date/test_date.rb151
-rw-r--r--test/date/test_date_arith.rb265
-rw-r--r--test/date/test_date_attr.rb104
-rw-r--r--test/date/test_date_base.rb443
-rw-r--r--test/date/test_date_compat.rb22
-rw-r--r--test/date/test_date_conv.rb153
-rw-r--r--test/date/test_date_marshal.rb42
-rw-r--r--test/date/test_date_new.rb272
-rw-r--r--test/date/test_date_parse.rb1125
-rw-r--r--test/date/test_date_strftime.rb431
-rw-r--r--test/date/test_date_strptime.rb513
-rw-r--r--test/date/test_switch_hitter.rb665
-rw-r--r--test/dbm/test_dbm.rb632
-rw-r--r--test/digest/digest/foo.rb11
-rw-r--r--test/digest/test_digest.rb273
-rw-r--r--test/digest/test_digest_extend.rb159
-rw-r--r--test/drb/drbtest.rb363
-rw-r--r--test/drb/ignore_test_drb.rb14
-rw-r--r--test/drb/test_acl.rb198
-rw-r--r--test/drb/test_drb.rb400
-rw-r--r--test/drb/test_drbssl.rb77
-rw-r--r--test/drb/test_drbunix.rb60
-rw-r--r--test/drb/ut_array.rb17
-rw-r--r--test/drb/ut_array_drbssl.rb39
-rw-r--r--test/drb/ut_array_drbunix.rb17
-rw-r--r--test/drb/ut_drb.rb168
-rw-r--r--test/drb/ut_drb_drbssl.rb40
-rw-r--r--test/drb/ut_drb_drbunix.rb18
-rw-r--r--test/drb/ut_eq.rb37
-rw-r--r--test/drb/ut_eval.rb37
-rw-r--r--test/drb/ut_large.rb62
-rw-r--r--test/drb/ut_port.rb16
-rw-r--r--test/drb/ut_safe1.rb17
-rw-r--r--test/drb/ut_timerholder.rb74
-rw-r--r--test/dtrace/dummy.rb2
-rw-r--r--test/dtrace/helper.rb83
-rw-r--r--test/dtrace/test_array_create.rb36
-rw-r--r--test/dtrace/test_cmethod.rb50
-rw-r--r--test/dtrace/test_function_entry.rb88
-rw-r--r--test/dtrace/test_gc.rb27
-rw-r--r--test/dtrace/test_hash_create.rb53
-rw-r--r--test/dtrace/test_load.rb53
-rw-r--r--test/dtrace/test_method_cache.rb29
-rw-r--r--test/dtrace/test_object_create_start.rb36
-rw-r--r--test/dtrace/test_raise.rb30
-rw-r--r--test/dtrace/test_require.rb35
-rw-r--r--test/dtrace/test_singleton_function.rb56
-rw-r--r--test/dtrace/test_string.rb28
-rw-r--r--test/erb/hello.erb4
-rw-r--r--test/erb/test_erb.rb552
-rw-r--r--test/erb/test_erb_command.rb12
-rw-r--r--test/erb/test_erb_m17n.rb124
-rw-r--r--test/etc/test_etc.rb172
-rw-r--r--test/excludes/TestException.rb8
-rw-r--r--test/excludes/TestIO_Console.rb2
-rw-r--r--test/excludes/TestISeq.rb1
-rw-r--r--test/excludes/TestThread.rb2
-rw-r--r--test/fiddle/helper.rb126
-rw-r--r--test/fiddle/test_c_struct_entry.rb77
-rw-r--r--test/fiddle/test_c_union_entity.rb35
-rw-r--r--test/fiddle/test_closure.rb85
-rw-r--r--test/fiddle/test_cparser.rb211
-rw-r--r--test/fiddle/test_fiddle.rb17
-rw-r--r--test/fiddle/test_func.rb93
-rw-r--r--test/fiddle/test_function.rb102
-rw-r--r--test/fiddle/test_handle.rb194
-rw-r--r--test/fiddle/test_import.rb151
-rw-r--r--test/fiddle/test_pointer.rb238
-rw-r--r--test/fileutils/clobber.rb92
-rw-r--r--test/fileutils/fileasserts.rb112
-rw-r--r--test/fileutils/test_dryrun.rb18
-rw-r--r--test/fileutils/test_fileutils.rb1594
-rw-r--r--test/fileutils/test_nowrite.rb18
-rw-r--r--test/fileutils/test_verbose.rb18
-rw-r--r--test/fileutils/visibility_tests.rb42
-rw-r--r--test/gdbm/test_gdbm.rb728
-rw-r--r--test/io/console/test_io_console.rb370
-rw-r--r--test/io/nonblock/test_flush.rb53
-rw-r--r--test/io/wait/test_io_wait.rb167
-rw-r--r--test/irb/test_completion.rb22
-rw-r--r--test/irb/test_option.rb12
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb14
-rw-r--r--test/json/fixtures/fail10.json1
-rw-r--r--test/json/fixtures/fail11.json1
-rw-r--r--test/json/fixtures/fail12.json1
-rw-r--r--test/json/fixtures/fail13.json1
-rw-r--r--test/json/fixtures/fail14.json1
-rw-r--r--test/json/fixtures/fail18.json1
-rw-r--r--test/json/fixtures/fail19.json1
-rw-r--r--test/json/fixtures/fail2.json1
-rw-r--r--test/json/fixtures/fail20.json1
-rw-r--r--test/json/fixtures/fail21.json1
-rw-r--r--test/json/fixtures/fail22.json1
-rw-r--r--test/json/fixtures/fail23.json1
-rw-r--r--test/json/fixtures/fail24.json1
-rw-r--r--test/json/fixtures/fail25.json1
-rw-r--r--test/json/fixtures/fail27.json2
-rw-r--r--test/json/fixtures/fail28.json2
-rw-r--r--test/json/fixtures/fail3.json1
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail5.json1
-rw-r--r--test/json/fixtures/fail6.json1
-rw-r--r--test/json/fixtures/fail7.json1
-rw-r--r--test/json/fixtures/fail8.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/obsolete_fail1.json1
-rw-r--r--test/json/fixtures/pass1.json56
-rw-r--r--test/json/fixtures/pass15.json1
-rw-r--r--test/json/fixtures/pass16.json1
-rw-r--r--test/json/fixtures/pass17.json1
-rw-r--r--test/json/fixtures/pass2.json1
-rw-r--r--test/json/fixtures/pass26.json1
-rw-r--r--test/json/fixtures/pass3.json6
-rw-r--r--test/json/json_addition_test.rb193
-rw-r--r--test/json/json_common_interface_test.rb126
-rw-r--r--test/json/json_encoding_test.rb105
-rw-r--r--test/json/json_ext_parser_test.rb15
-rw-r--r--test/json/json_fixtures_test.rb32
-rw-r--r--test/json/json_generator_test.rb376
-rw-r--r--test/json/json_generic_object_test.rb82
-rw-r--r--test/json/json_parser_test.rb466
-rw-r--r--test/json/json_string_matching_test.rb38
-rw-r--r--test/json/test_helper.rb21
-rw-r--r--test/lib/-test-/integer.rb14
-rw-r--r--test/lib/envutil.rb273
-rw-r--r--test/lib/find_executable.rb22
-rw-r--r--test/lib/iseq_loader_checker.rb75
-rw-r--r--test/lib/leakchecker.rb201
-rw-r--r--test/lib/memory_status.rb144
-rw-r--r--test/lib/minitest/README.txt457
-rw-r--r--test/lib/minitest/autorun.rb14
-rw-r--r--test/lib/minitest/benchmark.rb418
-rw-r--r--test/lib/minitest/mock.rb196
-rw-r--r--test/lib/minitest/unit.rb1402
-rw-r--r--test/lib/profile_test_all.rb91
-rw-r--r--test/lib/test/unit.rb1035
-rw-r--r--test/lib/test/unit/assertions.rb859
-rw-r--r--test/lib/test/unit/parallel.rb191
-rw-r--r--test/lib/test/unit/testcase.rb36
-rw-r--r--test/lib/tracepointchecker.rb119
-rw-r--r--test/lib/with_different_ofs.rb18
-rw-r--r--test/lib/zombie_hunter.rb9
-rw-r--r--test/logger/test_logdevice.rb594
-rw-r--r--test/logger/test_logger.rb337
-rw-r--r--test/logger/test_severity.rb16
-rw-r--r--test/matrix/test_matrix.rb612
-rw-r--r--test/matrix/test_vector.rb220
-rw-r--r--test/minitest/metametameta.rb71
-rw-r--r--test/minitest/test_minitest_benchmark.rb131
-rw-r--r--test/minitest/test_minitest_mock.rb404
-rw-r--r--test/minitest/test_minitest_unit.rb1778
-rw-r--r--test/misc/test_ruby_mode.rb183
-rw-r--r--test/mkmf/base.rb145
-rw-r--r--test/mkmf/test_config.rb17
-rw-r--r--test/mkmf/test_constant.rb38
-rw-r--r--test/mkmf/test_convertible.rb35
-rw-r--r--test/mkmf/test_find_executable.rb58
-rw-r--r--test/mkmf/test_flags.rb57
-rw-r--r--test/mkmf/test_framework.rb49
-rw-r--r--test/mkmf/test_have_func.rb17
-rw-r--r--test/mkmf/test_have_library.rb56
-rw-r--r--test/mkmf/test_have_macro.rb36
-rw-r--r--test/mkmf/test_libs.rb87
-rw-r--r--test/mkmf/test_signedness.rb30
-rw-r--r--test/mkmf/test_sizeof.rb48
-rw-r--r--test/monitor/test_monitor.rb244
-rw-r--r--test/net/ftp/test_buffered_socket.rb42
-rw-r--r--test/net/ftp/test_ftp.rb1669
-rw-r--r--test/net/ftp/test_mlsx_entry.rb98
-rw-r--r--test/net/http/test_buffered_io.rb18
-rw-r--r--test/net/http/test_http.rb1001
-rw-r--r--test/net/http/test_http_request.rb80
-rw-r--r--test/net/http/test_httpheader.rb398
-rw-r--r--test/net/http/test_httpresponse.rb395
-rw-r--r--test/net/http/test_httpresponses.rb25
-rw-r--r--test/net/http/test_https.rb195
-rw-r--r--test/net/http/test_https_proxy.rb47
-rw-r--r--test/net/http/utils.rb110
-rw-r--r--test/net/imap/Makefile15
-rw-r--r--test/net/imap/cacert.pem66
-rw-r--r--test/net/imap/server.crt48
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb609
-rw-r--r--test/net/imap/test_imap_response_parser.rb294
-rw-r--r--test/net/pop/test_pop.rb137
-rw-r--r--test/net/protocol/test_protocol.rb29
-rw-r--r--test/net/smtp/test_response.rb100
-rw-r--r--test/net/smtp/test_smtp.rb102
-rw-r--r--test/net/smtp/test_ssl_socket.rb92
-rw-r--r--test/nkf/test_kconv.rb82
-rw-r--r--test/nkf/test_nkf.rb23
-rw-r--r--test/objspace/test_objspace.rb396
-rw-r--r--test/open-uri/test_open-uri.rb872
-rw-r--r--test/open-uri/test_ssl.rb389
-rw-r--r--test/openssl/test_asn1.rb624
-rw-r--r--test/openssl/test_bn.rb61
-rw-r--r--test/openssl/test_buffering.rb88
-rw-r--r--test/openssl/test_cipher.rb340
-rw-r--r--test/openssl/test_config.rb299
-rw-r--r--test/openssl/test_digest.rb139
-rw-r--r--test/openssl/test_engine.rb106
-rw-r--r--test/openssl/test_fips.rb15
-rw-r--r--test/openssl/test_hmac.rb46
-rw-r--r--test/openssl/test_ns_spki.rb52
-rw-r--r--test/openssl/test_ocsp.rb300
-rw-r--r--test/openssl/test_pair.rb499
-rw-r--r--test/openssl/test_pkcs12.rb321
-rw-r--r--test/openssl/test_pkcs5.rb98
-rw-r--r--test/openssl/test_pkcs7.rb292
-rw-r--r--test/openssl/test_pkey.rb49
-rw-r--r--test/openssl/test_pkey_dh.rb120
-rw-r--r--test/openssl/test_pkey_dsa.rb180
-rw-r--r--test/openssl/test_pkey_ec.rb311
-rw-r--r--test/openssl/test_pkey_rsa.rb237
-rw-r--r--test/openssl/test_random.rb15
-rw-r--r--test/openssl/test_ssl.rb1291
-rw-r--r--test/openssl/test_ssl_session.rb380
-rw-r--r--test/openssl/test_x509attr.rb67
-rw-r--r--test/openssl/test_x509cert.rb224
-rw-r--r--test/openssl/test_x509crl.rb222
-rw-r--r--test/openssl/test_x509ext.rb79
-rw-r--r--test/openssl/test_x509name.rb365
-rw-r--r--test/openssl/test_x509req.rb164
-rw-r--r--test/openssl/test_x509store.rb234
-rw-r--r--test/openssl/ut_eof.rb129
-rw-r--r--test/openssl/utils.rb370
-rw-r--r--test/optparse/test_acceptable.rb196
-rw-r--r--test/optparse/test_autoconf.rb64
-rw-r--r--test/optparse/test_bash_completion.rb43
-rw-r--r--test/optparse/test_cclass.rb18
-rw-r--r--test/optparse/test_getopts.rb35
-rw-r--r--test/optparse/test_noarg.rb58
-rw-r--r--test/optparse/test_optarg.rb47
-rw-r--r--test/optparse/test_optparse.rb78
-rw-r--r--test/optparse/test_placearg.rb57
-rw-r--r--test/optparse/test_reqarg.rb78
-rw-r--r--test/optparse/test_summary.rb47
-rw-r--r--test/optparse/test_zsh_completion.rb23
-rw-r--r--test/ostruct/test_ostruct.rb185
-rw-r--r--test/pathname/test_pathname.rb1399
-rw-r--r--test/psych/handlers/test_recorder.rb26
-rw-r--r--test/psych/helper.rb122
-rw-r--r--test/psych/json/test_stream.rb110
-rw-r--r--test/psych/nodes/test_enumerable.rb44
-rw-r--r--test/psych/test_alias_and_anchor.rb97
-rw-r--r--test/psych/test_array.rb58
-rw-r--r--test/psych/test_boolean.rb37
-rw-r--r--test/psych/test_class.rb37
-rw-r--r--test/psych/test_coder.rb207
-rw-r--r--test/psych/test_date_time.rb39
-rw-r--r--test/psych/test_deprecated.rb215
-rw-r--r--test/psych/test_document.rb47
-rw-r--r--test/psych/test_emitter.rb112
-rw-r--r--test/psych/test_encoding.rb269
-rw-r--r--test/psych/test_exception.rb158
-rw-r--r--test/psych/test_hash.rb95
-rw-r--r--test/psych/test_json_tree.rb66
-rw-r--r--test/psych/test_marshalable.rb55
-rw-r--r--test/psych/test_merge_keys.rb181
-rw-r--r--test/psych/test_nil.rb19
-rw-r--r--test/psych/test_null.rb20
-rw-r--r--test/psych/test_numeric.rb46
-rw-r--r--test/psych/test_object.rb45
-rw-r--r--test/psych/test_object_references.rb72
-rw-r--r--test/psych/test_omap.rb76
-rw-r--r--test/psych/test_parser.rb340
-rw-r--r--test/psych/test_psych.rb185
-rw-r--r--test/psych/test_safe_load.rb98
-rw-r--r--test/psych/test_scalar.rb12
-rw-r--r--test/psych/test_scalar_scanner.rb111
-rw-r--r--test/psych/test_serialize_subclasses.rb39
-rw-r--r--test/psych/test_set.rb50
-rw-r--r--test/psych/test_stream.rb94
-rw-r--r--test/psych/test_string.rb231
-rw-r--r--test/psych/test_struct.rb50
-rw-r--r--test/psych/test_symbol.rb26
-rw-r--r--test/psych/test_tainted.rb131
-rw-r--r--test/psych/test_to_yaml_properties.rb64
-rw-r--r--test/psych/test_tree_builder.rb80
-rw-r--r--test/psych/test_yaml.rb1293
-rw-r--r--test/psych/test_yamldbm.rb193
-rw-r--r--test/psych/test_yamlstore.rb86
-rw-r--r--test/psych/visitors/test_depth_first.rb50
-rw-r--r--test/psych/visitors/test_emitter.rb145
-rw-r--r--test/psych/visitors/test_to_ruby.rb332
-rw-r--r--test/psych/visitors/test_yaml_tree.rb180
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Amps and angle encoding.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Auto links.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Backslash escapes.text120
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Blockquotes with code blocks.text11
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Blocks.text14
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Spans.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Hard-wrapped paragraphs with list-like lines.text8
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Horizontal rules.text67
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Advanced).text15
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Simple).text69
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML comments.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, inline style.text12
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, reference style.text71
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, shortcut references.text20
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Literal quotes in titles.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text306
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text888
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Nested blockquotes.text5
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Ordered and unordered lists.text131
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Strong and em together.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tabs.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tidyness.text5
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin1024 -> 0 bytes-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/test.ja.largedoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_rdoc_alias.rb14
-rw-r--r--test/rdoc/test_rdoc_any_method.rb461
-rw-r--r--test/rdoc/test_rdoc_attr.rb191
-rw-r--r--test/rdoc/test_rdoc_class_module.rb1493
-rw-r--r--test/rdoc/test_rdoc_code_object.rb446
-rw-r--r--test/rdoc/test_rdoc_comment.rb496
-rw-r--r--test/rdoc/test_rdoc_constant.rb182
-rw-r--r--test/rdoc/test_rdoc_context.rb902
-rw-r--r--test/rdoc/test_rdoc_context_section.rb155
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb193
-rw-r--r--test/rdoc/test_rdoc_encoding.rb236
-rw-r--r--test/rdoc/test_rdoc_extend.rb95
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb225
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb322
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb60
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb92
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb52
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb140
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb76
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb74
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb124
-rw-r--r--test/rdoc/test_rdoc_include.rb109
-rw-r--r--test/rdoc/test_rdoc_markdown.rb981
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb1883
-rw-r--r--test/rdoc/test_rdoc_markup.rb96
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb365
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb208
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb176
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb30
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb20
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb54
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1668
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb471
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb23
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb370
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb352
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb663
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb232
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb712
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb113
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb390
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb378
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb127
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb247
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb30
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb194
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb48
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb43
-rw-r--r--test/rdoc/test_rdoc_options.rb759
-rw-r--r--test/rdoc/test_rdoc_parser.rb323
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1941
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb316
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb62
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb56
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb3318
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb116
-rw-r--r--test/rdoc/test_rdoc_rd.rb31
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb536
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb64
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb178
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb455
-rw-r--r--test/rdoc/test_rdoc_require.rb26
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1468
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb156
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb422
-rw-r--r--test/rdoc/test_rdoc_ruby_token.rb20
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb250
-rw-r--r--test/rdoc/test_rdoc_servlet.rb538
-rw-r--r--test/rdoc/test_rdoc_single_class.rb21
-rw-r--r--test/rdoc/test_rdoc_stats.rb723
-rw-r--r--test/rdoc/test_rdoc_store.rb991
-rw-r--r--test/rdoc/test_rdoc_task.rb174
-rw-r--r--test/rdoc/test_rdoc_text.rb541
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb43
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb521
-rw-r--r--test/rdoc/test_rdoc_top_level.rb288
-rw-r--r--test/rdoc/xref_data.rb77
-rw-r--r--test/rdoc/xref_test_case.rb68
-rw-r--r--test/readline/test_readline.rb534
-rw-r--r--test/readline/test_readline_history.rb293
-rw-r--r--test/resolv/test_addr.rb30
-rw-r--r--test/resolv/test_dns.rb224
-rw-r--r--test/resolv/test_resource.rb22
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin50154 -> 0 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin161690 -> 0 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/utf16.xmlbin207464 -> 0 bytes-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb51
-rw-r--r--test/rexml/parse/test_document_type_declaration.rb50
-rw-r--r--test/rexml/parse/test_notation_declaration.rb100
-rw-r--r--test/rexml/parser/test_sax2.rb203
-rw-r--r--test/rexml/parser/test_tree.rb43
-rw-r--r--test/rexml/parser/test_ultra_light.rb70
-rw-r--r--test/rexml/rexml_test_utils.rb7
-rw-r--r--test/rexml/test_attributes.rb223
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb45
-rw-r--r--test/rexml/test_comment.rb26
-rw-r--r--test/rexml/test_contrib.rb585
-rw-r--r--test/rexml/test_core.rb1468
-rw-r--r--test/rexml/test_doctype.rb107
-rw-r--r--test/rexml/test_document.rb416
-rw-r--r--test/rexml/test_elements.rb119
-rw-r--r--test/rexml/test_encoding.rb108
-rw-r--r--test/rexml/test_entity.rb206
-rw-r--r--test/rexml/test_functions.rb225
-rw-r--r--test/rexml/test_functions_number.rb35
-rw-r--r--test/rexml/test_jaxen.rb130
-rw-r--r--test/rexml/test_light.rb107
-rw-r--r--test/rexml/test_lightparser.rb16
-rw-r--r--test/rexml/test_listener.rb131
-rw-r--r--test/rexml/test_martin_fowler.rb40
-rw-r--r--test/rexml/test_namespace.rb41
-rw-r--r--test/rexml/test_order.rb110
-rw-r--r--test/rexml/test_preceding_sibling.rb41
-rw-r--r--test/rexml/test_pullparser.rb103
-rw-r--r--test/rexml/test_rexml_issuezilla.rb19
-rw-r--r--test/rexml/test_sax.rb287
-rw-r--r--test/rexml/test_stream.rb130
-rw-r--r--test/rexml/test_text.rb22
-rw-r--r--test/rexml/test_ticket_80.rb59
-rw-r--r--test/rexml/test_validation_rng.rb793
-rw-r--r--test/rexml/test_xml_declaration.rb36
-rw-r--r--test/rexml/xpath/test_attribute.rb30
-rw-r--r--test/rexml/xpath/test_axis_preceding_sibling.rb40
-rw-r--r--test/rexml/xpath/test_base.rb1090
-rw-r--r--test/rexml/xpath/test_node.rb43
-rw-r--r--test/rexml/xpath/test_predicate.rb83
-rw-r--r--test/rexml/xpath/test_text.rb75
-rw-r--r--test/rinda/test_rinda.rb830
-rw-r--r--test/rinda/test_tuplebag.rb173
-rw-r--r--test/ripper/dummyparser.rb221
-rw-r--r--test/ripper/test_files.rb24
-rw-r--r--test/ripper/test_filter.rb84
-rw-r--r--test/ripper/test_parser_events.rb1342
-rw-r--r--test/ripper/test_ripper.rb101
-rw-r--r--test/ripper/test_scanner_events.rb918
-rw-r--r--test/ripper/test_sexp.rb85
-rw-r--r--test/rss/dot.pngbin111 -> 0 bytes-rw-r--r--test/rss/rss-assertions.rb2091
-rw-r--r--test/rss/rss-testcase.rb479
-rw-r--r--test/rss/test_1.0.rb308
-rw-r--r--test/rss/test_2.0.rb412
-rw-r--r--test/rss/test_accessor.rb104
-rw-r--r--test/rss/test_atom.rb684
-rw-r--r--test/rss/test_content.rb105
-rw-r--r--test/rss/test_dublincore.rb270
-rw-r--r--test/rss/test_image.rb215
-rw-r--r--test/rss/test_inherit.rb41
-rw-r--r--test/rss/test_itunes.rb348
-rw-r--r--test/rss/test_maker_0.9.rb475
-rw-r--r--test/rss/test_maker_1.0.rb517
-rw-r--r--test/rss/test_maker_2.0.rb758
-rw-r--r--test/rss/test_maker_atom_entry.rb394
-rw-r--r--test/rss/test_maker_atom_feed.rb455
-rw-r--r--test/rss/test_maker_content.rb48
-rw-r--r--test/rss/test_maker_dc.rb150
-rw-r--r--test/rss/test_maker_image.rb63
-rw-r--r--test/rss/test_maker_itunes.rb470
-rw-r--r--test/rss/test_maker_slash.rb38
-rw-r--r--test/rss/test_maker_sy.rb45
-rw-r--r--test/rss/test_maker_taxo.rb82
-rw-r--r--test/rss/test_maker_trackback.rb42
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb84
-rw-r--r--test/rss/test_parser.rb65
-rw-r--r--test/rss/test_parser_1.0.rb529
-rw-r--r--test/rss/test_parser_2.0.rb123
-rw-r--r--test/rss/test_parser_atom_entry.rb164
-rw-r--r--test/rss/test_parser_atom_feed.rb277
-rw-r--r--test/rss/test_setup_maker_0.9.rb247
-rw-r--r--test/rss/test_setup_maker_1.0.rb551
-rw-r--r--test/rss/test_setup_maker_2.0.rb309
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb410
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb446
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb39
-rw-r--r--test/rss/test_slash.rb65
-rw-r--r--test/rss/test_syndication.rb126
-rw-r--r--test/rss/test_taxonomy.rb173
-rw-r--r--test/rss/test_to_s.rb677
-rw-r--r--test/rss/test_trackback.rb136
-rw-r--r--test/rss/test_version.rb10
-rw-r--r--test/rss/test_xml-stylesheet.rb109
-rw-r--r--test/ruby/allpairs.rb103
-rw-r--r--test/ruby/beginmainend.rb79
-rw-r--r--test/ruby/bug-11928.rb14
-rw-r--r--test/ruby/enc/test_big5.rb29
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb302
-rw-r--r--test/ruby/enc/test_case_mapping.rb173
-rw-r--r--test/ruby/enc/test_case_options.rb81
-rw-r--r--test/ruby/enc/test_cp949.rb29
-rw-r--r--test/ruby/enc/test_emoji.rb443
-rw-r--r--test/ruby/enc/test_euc_jp.rb25
-rw-r--r--test/ruby/enc/test_euc_kr.rb37
-rw-r--r--test/ruby/enc/test_euc_tw.rb29
-rw-r--r--test/ruby/enc/test_gb18030.rb127
-rw-r--r--test/ruby/enc/test_gbk.rb29
-rw-r--r--test/ruby/enc/test_iso_8859.rb166
-rw-r--r--test/ruby/enc/test_koi8.rb23
-rw-r--r--test/ruby/enc/test_regex_casefold.rb118
-rw-r--r--test/ruby/enc/test_shift_jis.rb28
-rw-r--r--test/ruby/enc/test_utf16.rb385
-rw-r--r--test/ruby/enc/test_utf32.rb94
-rw-r--r--test/ruby/enc/test_windows_1251.rb17
-rw-r--r--test/ruby/enc/test_windows_1252.rb26
-rw-r--r--test/ruby/lbtest.rb50
-rw-r--r--test/ruby/marshaltestlib.rb437
-rw-r--r--test/ruby/sentence.rb669
-rw-r--r--test/ruby/test_alias.rb234
-rw-r--r--test/ruby/test_argf.rb922
-rw-r--r--test/ruby/test_arity.rb70
-rw-r--r--test/ruby/test_array.rb2828
-rw-r--r--test/ruby/test_assignment.rb784
-rw-r--r--test/ruby/test_autoload.rb253
-rw-r--r--test/ruby/test_backtrace.rb301
-rw-r--r--test/ruby/test_basicinstructions.rb723
-rw-r--r--test/ruby/test_beginendblock.rb151
-rw-r--r--test/ruby/test_bignum.rb792
-rw-r--r--test/ruby/test_call.rb93
-rw-r--r--test/ruby/test_case.rb146
-rw-r--r--test/ruby/test_class.rb609
-rw-r--r--test/ruby/test_clone.rb29
-rw-r--r--test/ruby/test_comparable.rb115
-rw-r--r--test/ruby/test_complex.rb950
-rw-r--r--test/ruby/test_complex2.rb736
-rw-r--r--test/ruby/test_complexrational.rb408
-rw-r--r--test/ruby/test_condition.rb17
-rw-r--r--test/ruby/test_const.rb68
-rw-r--r--test/ruby/test_continuation.rb135
-rw-r--r--test/ruby/test_defined.rb252
-rw-r--r--test/ruby/test_dir.rb357
-rw-r--r--test/ruby/test_dir_m17n.rb439
-rw-r--r--test/ruby/test_econv.rb924
-rw-r--r--test/ruby/test_encoding.rb127
-rw-r--r--test/ruby/test_enum.rb939
-rw-r--r--test/ruby/test_enumerator.rb655
-rw-r--r--test/ruby/test_env.rb529
-rw-r--r--test/ruby/test_eval.rb520
-rw-r--r--test/ruby/test_exception.rb858
-rw-r--r--test/ruby/test_extlibs.rb85
-rw-r--r--test/ruby/test_fiber.rb348
-rw-r--r--test/ruby/test_file.rb469
-rw-r--r--test/ruby/test_file_exhaustive.rb1625
-rw-r--r--test/ruby/test_fixnum.rb352
-rw-r--r--test/ruby/test_flip.rb43
-rw-r--r--test/ruby/test_float.rb813
-rw-r--r--test/ruby/test_fnmatch.rb132
-rw-r--r--test/ruby/test_gc.rb400
-rw-r--r--test/ruby/test_hash.rb1451
-rw-r--r--test/ruby/test_ifunless.rb15
-rw-r--r--test/ruby/test_integer.rb373
-rw-r--r--test/ruby/test_integer_comb.rb610
-rw-r--r--test/ruby/test_io.rb3347
-rw-r--r--test/ruby/test_io_m17n.rb2652
-rw-r--r--test/ruby/test_iseq.rb255
-rw-r--r--test/ruby/test_iterator.rb498
-rw-r--r--test/ruby/test_keyword.rb600
-rw-r--r--test/ruby/test_lambda.rb181
-rw-r--r--test/ruby/test_lazy_enumerator.rb547
-rw-r--r--test/ruby/test_literal.rb509
-rw-r--r--test/ruby/test_m17n.rb1686
-rw-r--r--test/ruby/test_m17n_comb.rb1644
-rw-r--r--test/ruby/test_marshal.rb760
-rw-r--r--test/ruby/test_math.rb342
-rw-r--r--test/ruby/test_metaclass.rb168
-rw-r--r--test/ruby/test_method.rb952
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb26
-rw-r--r--test/ruby/test_module.rb2224
-rw-r--r--test/ruby/test_not.rb13
-rw-r--r--test/ruby/test_notimp.rb85
-rw-r--r--test/ruby/test_numeric.rb356
-rw-r--r--test/ruby/test_object.rb904
-rw-r--r--test/ruby/test_objectspace.rb206
-rw-r--r--test/ruby/test_optimization.rb423
-rw-r--r--test/ruby/test_pack.rb815
-rw-r--r--test/ruby/test_parse.rb964
-rw-r--r--test/ruby/test_path.rb263
-rw-r--r--test/ruby/test_pipe.rb30
-rw-r--r--test/ruby/test_primitive.rb424
-rw-r--r--test/ruby/test_proc.rb1352
-rw-r--r--test/ruby/test_process.rb2277
-rw-r--r--test/ruby/test_rand.rb572
-rw-r--r--test/ruby/test_range.rb634
-rw-r--r--test/ruby/test_rational.rb951
-rw-r--r--test/ruby/test_rational2.rb1387
-rw-r--r--test/ruby/test_readpartial.rb73
-rw-r--r--test/ruby/test_refinement.rb1698
-rw-r--r--test/ruby/test_regexp.rb1187
-rw-r--r--test/ruby/test_require.rb765
-rw-r--r--test/ruby/test_rubyoptions.rb905
-rw-r--r--test/ruby/test_rubyvm.rb18
-rw-r--r--test/ruby/test_settracefunc.rb1491
-rw-r--r--test/ruby/test_signal.rb310
-rw-r--r--test/ruby/test_sleep.rb17
-rw-r--r--test/ruby/test_sprintf.rb440
-rw-r--r--test/ruby/test_sprintf_comb.rb554
-rw-r--r--test/ruby/test_string.rb2458
-rw-r--r--test/ruby/test_stringchar.rb182
-rw-r--r--test/ruby/test_struct.rb395
-rw-r--r--test/ruby/test_super.rb533
-rw-r--r--test/ruby/test_symbol.rb438
-rw-r--r--test/ruby/test_syntax.rb872
-rw-r--r--test/ruby/test_system.rb163
-rw-r--r--test/ruby/test_thread.rb1163
-rw-r--r--test/ruby/test_threadgroup.rb58
-rw-r--r--test/ruby/test_time.rb1075
-rw-r--r--test/ruby/test_time_tz.rb403
-rw-r--r--test/ruby/test_trace.rb62
-rw-r--r--test/ruby/test_transcode.rb2132
-rw-r--r--test/ruby/test_undef.rb38
-rw-r--r--test/ruby/test_unicode_escape.rb271
-rw-r--r--test/ruby/test_variable.rb163
-rw-r--r--test/ruby/test_weakmap.rb134
-rw-r--r--test/ruby/test_whileuntil.rb83
-rw-r--r--test/ruby/test_yield.rb425
-rw-r--r--test/ruby/ut_eof.rb129
-rw-r--r--test/rubygems/alternate_cert.pem19
-rw-r--r--test/rubygems/alternate_cert_32.pem19
-rw-r--r--test/rubygems/alternate_key.pem27
-rw-r--r--test/rubygems/bad_rake.rb2
-rw-r--r--test/rubygems/bogussources.rb9
-rw-r--r--test/rubygems/ca_cert.pem68
-rw-r--r--test/rubygems/child_cert.pem20
-rw-r--r--test/rubygems/child_cert_32.pem20
-rw-r--r--test/rubygems/child_key.pem27
-rw-r--r--test/rubygems/client.pem49
-rw-r--r--test/rubygems/data/gem-private_key.pem27
-rw-r--r--test/rubygems/data/gem-public_cert.pem20
-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin554 -> 0 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem30
-rw-r--r--test/rubygems/expired_cert.pem19
-rw-r--r--test/rubygems/fake_certlib/openssl.rb8
-rw-r--r--test/rubygems/fix_openssl_warnings.rb13
-rw-r--r--test/rubygems/foo/discover.rb1
-rw-r--r--test/rubygems/future_cert.pem19
-rw-r--r--test/rubygems/future_cert_32.pem19
-rw-r--r--test/rubygems/good_rake.rb2
-rw-r--r--test/rubygems/grandchild_cert.pem20
-rw-r--r--test/rubygems/grandchild_cert_32.pem20
-rw-r--r--test/rubygems/grandchild_key.pem27
-rw-r--r--test/rubygems/invalid_client.pem49
-rw-r--r--test/rubygems/invalid_issuer_cert.pem20
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem20
-rw-r--r--test/rubygems/invalid_key.pem27
-rw-r--r--test/rubygems/invalid_signer_cert.pem19
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem19
-rw-r--r--test/rubygems/invalidchild_cert.pem20
-rw-r--r--test/rubygems/invalidchild_cert_32.pem20
-rw-r--r--test/rubygems/invalidchild_key.pem27
-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb4
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb3
-rw-r--r--test/rubygems/private_key.pem27
-rw-r--r--test/rubygems/public_cert.pem20
-rw-r--r--test/rubygems/public_cert_32.pem19
-rw-r--r--test/rubygems/public_key.pem9
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb6
-rw-r--r--test/rubygems/rubygems_plugin.rb26
-rw-r--r--test/rubygems/sff/discover.rb1
-rw-r--r--test/rubygems/simple_gem.rb67
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec9
-rw-r--r--test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspecbin269 -> 0 bytes-rw-r--r--test/rubygems/ssl_cert.pem19
-rw-r--r--test/rubygems/ssl_key.pem15
-rw-r--r--test/rubygems/test_bundled_ca.rb63
-rw-r--r--test/rubygems/test_config.rb24
-rw-r--r--test/rubygems/test_deprecate.rb77
-rw-r--r--test/rubygems/test_gem.rb1763
-rw-r--r--test/rubygems/test_gem_available_set.rb130
-rw-r--r--test/rubygems/test_gem_command.rb248
-rw-r--r--test/rubygems/test_gem_command_manager.rb264
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb121
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb671
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb69
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb197
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb240
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb230
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb154
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb127
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb51
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb75
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb1007
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb34
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb69
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb20
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb70
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb212
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb491
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb330
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb677
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb18
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb60
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb136
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb249
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb251
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb43
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb283
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb209
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb514
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb87
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb100
-rw-r--r--test/rubygems/test_gem_config_file.rb491
-rw-r--r--test/rubygems/test_gem_dependency.rb362
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb1235
-rw-r--r--test/rubygems/test_gem_dependency_list.rb260
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb29
-rw-r--r--test/rubygems/test_gem_doctor.rb169
-rw-r--r--test/rubygems/test_gem_ext_builder.rb341
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb87
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb87
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb211
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb65
-rw-r--r--test/rubygems/test_gem_gem_runner.rb69
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb235
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb62
-rw-r--r--test/rubygems/test_gem_indexer.rb367
-rw-r--r--test/rubygems/test_gem_install_update_options.rb197
-rw-r--r--test/rubygems/test_gem_installer.rb1739
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb134
-rw-r--r--test/rubygems/test_gem_name_tuple.rb45
-rw-r--r--test/rubygems/test_gem_package.rb882
-rw-r--r--test/rubygems/test_gem_package_old.rb90
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb147
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb90
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb142
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb288
-rw-r--r--test/rubygems/test_gem_package_task.rb84
-rw-r--r--test/rubygems/test_gem_path_support.rb121
-rw-r--r--test/rubygems/test_gem_platform.rb308
-rw-r--r--test/rubygems/test_gem_rdoc.rb270
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb1039
-rw-r--r--test/rubygems/test_gem_request.rb363
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb130
-rw-r--r--test/rubygems/test_gem_request_set.rb595
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb831
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb470
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb549
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb306
-rw-r--r--test/rubygems/test_gem_requirement.rb387
-rw-r--r--test/rubygems/test_gem_resolver.rb727
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb74
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb209
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb145
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb138
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb46
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb88
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb85
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb190
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb114
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb90
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb90
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb50
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb258
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb46
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb64
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb100
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb21
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb65
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb84
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb84
-rw-r--r--test/rubygems/test_gem_security.rb307
-rw-r--r--test/rubygems/test_gem_security_policy.rb541
-rw-r--r--test/rubygems/test_gem_security_signer.rb217
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb101
-rw-r--r--test/rubygems/test_gem_server.rb409
-rw-r--r--test/rubygems/test_gem_silent_ui.rb117
-rw-r--r--test/rubygems/test_gem_source.rb242
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb28
-rw-r--r--test/rubygems/test_gem_source_git.rb309
-rw-r--r--test/rubygems/test_gem_source_installed.rb37
-rw-r--r--test/rubygems/test_gem_source_list.rb118
-rw-r--r--test/rubygems/test_gem_source_local.rb107
-rw-r--r--test/rubygems/test_gem_source_lock.rb115
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb76
-rw-r--r--test/rubygems/test_gem_source_vendor.rb32
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb311
-rw-r--r--test/rubygems/test_gem_specification.rb3530
-rw-r--r--test/rubygems/test_gem_stream_ui.rb239
-rw-r--r--test/rubygems/test_gem_stub_specification.rb217
-rw-r--r--test/rubygems/test_gem_text.rb77
-rw-r--r--test/rubygems/test_gem_uninstaller.rb485
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb33
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb29
-rw-r--r--test/rubygems/test_gem_util.rb40
-rw-r--r--test/rubygems/test_gem_validator.rb46
-rw-r--r--test/rubygems/test_gem_version.rb222
-rw-r--r--test/rubygems/test_gem_version_option.rb152
-rw-r--r--test/rubygems/test_kernel.rb93
-rw-r--r--test/rubygems/test_remote_fetch_error.rb21
-rw-r--r--test/rubygems/test_require.rb350
-rw-r--r--test/rubygems/wrong_key_cert.pem19
-rw-r--r--test/rubygems/wrong_key_cert_32.pem19
-rw-r--r--test/runner.rb45
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb304
-rw-r--r--test/scanf/test_scanfblocks.rb82
-rw-r--r--test/scanf/test_scanfio.rb21
-rw-r--r--test/sdbm/test_sdbm.rb542
-rw-r--r--test/shell/test_command_processor.rb69
-rw-r--r--test/socket/test_addrinfo.rb684
-rw-r--r--test/socket/test_ancdata.rb68
-rw-r--r--test/socket/test_basicsocket.rb155
-rw-r--r--test/socket/test_nonblock.rb397
-rw-r--r--test/socket/test_socket.rb726
-rw-r--r--test/socket/test_sockopt.rb80
-rw-r--r--test/socket/test_tcp.rb89
-rw-r--r--test/socket/test_udp.rb101
-rw-r--r--test/socket/test_unix.rb702
-rw-r--r--test/stringio/test_stringio.rb703
-rw-r--r--test/strscan/test_stringscanner.rb721
-rw-r--r--test/syslog/test_syslog_logger.rb573
-rw-r--r--test/test_abbrev.rb55
-rw-r--r--test/test_cmath.rb76
-rw-r--r--test/test_delegate.rb241
-rw-r--r--test/test_find.rb313
-rw-r--r--test/test_forwardable.rb328
-rw-r--r--test/test_ipaddr.rb274
-rw-r--r--test/test_mathn.rb120
-rw-r--r--test/test_mutex_m.rb27
-rw-r--r--test/test_observer.rb66
-rw-r--r--test/test_open3.rb287
-rw-r--r--test/test_pp.rb197
-rw-r--r--test/test_prettyprint.rb521
-rw-r--r--test/test_prime.rb196
-rw-r--r--test/test_pstore.rb145
-rw-r--r--test/test_pty.rb242
-rw-r--r--test/test_rbconfig.rb54
-rw-r--r--test/test_securerandom.rb201
-rw-r--r--test/test_set.rb811
-rw-r--r--test/test_shellwords.rb114
-rw-r--r--test/test_singleton.rb104
-rw-r--r--test/test_syslog.rb190
-rw-r--r--test/test_tempfile.rb349
-rw-r--r--test/test_time.rb502
-rw-r--r--test/test_timeout.rb111
-rw-r--r--test/test_tmpdir.rb59
-rw-r--r--test/test_tracer.rb56
-rw-r--r--test/test_tsort.rb115
-rw-r--r--test/test_unicode_normalize.rb198
-rw-r--r--test/test_weakref.rb72
-rw-r--r--test/test_win32api.rb24
-rw-r--r--test/testunit/test4test_hideskip.rb10
-rw-r--r--test/testunit/test4test_redefinition.rb14
-rw-r--r--test/testunit/test4test_sorting.rb18
-rw-r--r--test/testunit/test_assertion.rb17
-rw-r--r--test/testunit/test_hideskip.rb17
-rw-r--r--test/testunit/test_parallel.rb192
-rw-r--r--test/testunit/test_redefinition.rb16
-rw-r--r--test/testunit/test_sorting.rb18
-rw-r--r--test/testunit/tests_for_parallel/ptest_first.rb8
-rw-r--r--test/testunit/tests_for_parallel/ptest_forth.rb30
-rw-r--r--test/testunit/tests_for_parallel/ptest_second.rb12
-rw-r--r--test/testunit/tests_for_parallel/ptest_third.rb11
-rw-r--r--test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--test/thread/test_cv.rb225
-rw-r--r--test/thread/test_queue.rb547
-rw-r--r--test/thread/test_sync.rb64
-rw-r--r--test/uri/test_common.rb175
-rw-r--r--test/uri/test_ftp.rb67
-rw-r--r--test/uri/test_generic.rb891
-rw-r--r--test/uri/test_http.rb65
-rw-r--r--test/uri/test_ldap.rb101
-rw-r--r--test/uri/test_mailto.rb142
-rw-r--r--test/uri/test_parser.rb48
-rw-r--r--test/webrick/.htaccess1
-rw-r--r--test/webrick/test_cgi.rb170
-rw-r--r--test/webrick/test_cookie.rb132
-rw-r--r--test/webrick/test_do_not_reverse_lookup.rb71
-rw-r--r--test/webrick/test_filehandler.rb324
-rw-r--r--test/webrick/test_htmlutils.rb21
-rw-r--r--test/webrick/test_httpauth.rb204
-rw-r--r--test/webrick/test_httpproxy.rb290
-rw-r--r--test/webrick/test_httprequest.rb417
-rw-r--r--test/webrick/test_httpresponse.rb160
-rw-r--r--test/webrick/test_httpserver.rb418
-rw-r--r--test/webrick/test_httputils.rb101
-rw-r--r--test/webrick/test_httpversion.rb41
-rw-r--r--test/webrick/test_server.rb162
-rw-r--r--test/webrick/test_ssl_server.rb40
-rw-r--r--test/webrick/test_utils.rb110
-rw-r--r--test/webrick/utils.rb72
-rw-r--r--test/webrick/webrick.cgi38
-rw-r--r--test/webrick/webrick_long_filename.cgi36
-rw-r--r--test/win32ole/err_in_callback.rb10
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb56
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb66
-rw-r--r--test/win32ole/test_nil2vtempty.rb37
-rw-r--r--test/win32ole/test_ole_methods.rb37
-rw-r--r--test/win32ole/test_propertyputref.rb31
-rw-r--r--test/win32ole/test_thread.rb34
-rw-r--r--test/win32ole/test_win32ole.rb568
-rw-r--r--test/win32ole/test_win32ole_event.rb401
-rw-r--r--test/win32ole/test_win32ole_method.rb147
-rw-r--r--test/win32ole/test_win32ole_param.rb107
-rw-r--r--test/win32ole/test_win32ole_record.rb213
-rw-r--r--test/win32ole/test_win32ole_type.rb250
-rw-r--r--test/win32ole/test_win32ole_typelib.rb117
-rw-r--r--test/win32ole/test_win32ole_variable.rb62
-rw-r--r--test/win32ole/test_win32ole_variant.rb722
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb36
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb69
-rw-r--r--test/win32ole/test_word.rb68
-rw-r--r--test/zlib/test_zlib.rb1130
-rw-r--r--thread.c5015
-rw-r--r--thread_pthread.c1763
-rw-r--r--thread_pthread.h54
-rw-r--r--thread_sync.c1325
-rw-r--r--thread_win32.c795
-rw-r--r--thread_win32.h36
-rw-r--r--time.c5047
-rw-r--r--timev.h42
-rw-r--r--tool/asm_parse.rb53
-rwxr-xr-xtool/bisect.sh42
-rwxr-xr-xtool/build-transcode16
-rwxr-xr-xtool/change_maker.rb47
-rwxr-xr-xtool/checksum.rb72
-rw-r--r--tool/downloader.rb253
-rw-r--r--tool/enc-emoji-citrus-gen.rb131
-rw-r--r--tool/enc-emoji4unicode.rb133
-rwxr-xr-xtool/enc-unicode.rb487
-rw-r--r--tool/eval.rb160
-rwxr-xr-xtool/expand-config.rb35
-rwxr-xr-xtool/extlibs.rb157
-rw-r--r--tool/fake.rb70
-rwxr-xr-xtool/file2lastrev.rb97
-rwxr-xr-xtool/gem-unpack.rb21
-rwxr-xr-xtool/gen_dummy_probes.rb32
-rwxr-xr-xtool/gen_ruby_tapset.rb106
-rw-r--r--tool/generic_erb.rb59
-rwxr-xr-xtool/id2token.rb27
-rwxr-xr-xtool/ifchange87
-rwxr-xr-xtool/insns2vm.rb18
-rw-r--r--tool/install-sh17
-rwxr-xr-xtool/instruction.rb1354
-rw-r--r--tool/jisx0208.rb86
-rwxr-xr-xtool/make-snapshot423
-rw-r--r--tool/make_hgraph.rb95
-rwxr-xr-xtool/mdoc2man.rb473
-rwxr-xr-xtool/merger.rb274
-rw-r--r--tool/mk_call_iseq_optimized.rb72
-rwxr-xr-xtool/mkconfig.rb283
-rwxr-xr-xtool/mkrunnable.rb137
-rwxr-xr-xtool/node_name.rb10
-rw-r--r--tool/parse.rb16
-rw-r--r--tool/probes_to_wiki.rb16
-rwxr-xr-xtool/rbinstall.rb834
-rwxr-xr-xtool/rbuninstall.rb71
-rwxr-xr-xtool/redmine-backporter.rb599
-rwxr-xr-xtool/release.sh38
-rwxr-xr-xtool/rmdirs14
-rwxr-xr-xtool/runruby.rb109
-rwxr-xr-xtool/strip-rdoc.rb26
-rw-r--r--tool/test/test_jisx0208.rb40
-rw-r--r--tool/transcode-tblgen.rb1114
-rwxr-xr-xtool/update-deps625
-rw-r--r--tool/vcs.rb359
-rw-r--r--tool/vpath.rb87
-rw-r--r--tool/vtlh.rb17
-rwxr-xr-xtool/ytab.sed60
-rw-r--r--transcode.c4575
-rw-r--r--transcode_data.h139
-rw-r--r--util.c4311
-rw-r--r--util.h53
-rw-r--r--variable.c3317
-rw-r--r--version.c102
-rw-r--r--version.h77
-rw-r--r--vm.c3337
-rw-r--r--vm_args.c828
-rw-r--r--vm_backtrace.c1434
-rw-r--r--vm_core.h1642
-rw-r--r--vm_debug.h37
-rw-r--r--vm_dump.c1083
-rw-r--r--vm_eval.c2218
-rw-r--r--vm_exec.c170
-rw-r--r--vm_exec.h182
-rw-r--r--vm_insnhelper.c2828
-rw-r--r--vm_insnhelper.h227
-rw-r--r--vm_method.c2105
-rw-r--r--vm_opts.h57
-rw-r--r--vm_trace.c1616
-rw-r--r--vsnprintf.c1315
-rw-r--r--win32/Makefile.sub1335
-rw-r--r--win32/README.win3280
-rw-r--r--win32/config.h.in59
-rw-r--r--win32/config.status.in66
-rwxr-xr-xwin32/configure.bat226
-rw-r--r--win32/dir.h44
-rw-r--r--win32/enc-setup.mak10
-rw-r--r--win32/file.c759
-rw-r--r--win32/file.h47
-rwxr-xr-xwin32/ifchange.bat75
-rwxr-xr-xwin32/makedirs.bat3
-rw-r--r--[-rwxr-xr-x]win32/mkexports.rb189
-rw-r--r--[-rwxr-xr-x]win32/resource.rb54
-rwxr-xr-xwin32/rm.bat18
-rwxr-xr-xwin32/rmdirs.bat30
-rw-r--r--win32/rtname.cmd35
-rw-r--r--win32/setup.mak236
-rw-r--r--win32/win32.c8450
-rw-r--r--win32/win32.h446
-rw-r--r--win32/winmain.c4
-rw-r--r--x68/_dtos18.c250
-rw-r--r--x68/_round.c45
-rw-r--r--x68/fconvert.c81
-rw-r--r--x68/select.c167
3500 files changed, 101109 insertions, 1552584 deletions
diff --git a/.cvsignore b/.cvsignore
new file mode 100644
index 0000000000..35fff17b58
--- /dev/null
+++ b/.cvsignore
@@ -0,0 +1,20 @@
+*.bak
+*.orig
+*.rej
+*.sav
+*~
+.cvsignore
+Makefile
+README.fat-patch
+archive
+config.cache
+config.h
+config.log
+config.status
+configure
+miniruby
+newver.rb
+parse.c
+ppack
+rbconfig.rb
+ruby
diff --git a/.document b/.document
deleted file mode 100644
index fb27ba325d..0000000000
--- a/.document
+++ /dev/null
@@ -1,26 +0,0 @@
-# This file determines which files in the
-# Ruby hierarchy will be processed by the RDoc
-# tool when it is given the top-level directory
-# as an argument
-
-# Process all the C source files
-*.c
-
-# prelude
-prelude.rb
-
-# the lib/ directory (which has its own .document file)
-lib
-
-# and some of the ext/ directory (which has its own .document file)
-ext
-
-# rdoc files
-ChangeLog
-
-NEWS
-
-README.md
-README.ja.md
-
-doc
diff --git a/.editorconfig b/.editorconfig
deleted file mode 100644
index 67abf4b978..0000000000
--- a/.editorconfig
+++ /dev/null
@@ -1,16 +0,0 @@
-root = true
-
-[*]
-end_of_line = lf
-insert_final_newline = true
-trim_trailing_whitespace = true
-tab_width = 8
-indent_style = tab
-indent_size = 4
-
-[**.bat]
-end_of_line = crlf
-
-[**.rb]
-indent_style = space
-indent_size = 2
diff --git a/.gdbinit b/.gdbinit
deleted file mode 100644
index d31ccaa7df..0000000000
--- a/.gdbinit
+++ /dev/null
@@ -1,1210 +0,0 @@
-define hook-run
- set $color_type = 0
- set $color_highlite = 0
- set $color_end = 0
-end
-
-define ruby_gdb_init
- if !$color_type
- set $color_type = "\033[31m"
- end
- if !$color_highlite
- set $color_highlite = "\033[36m"
- end
- if !$color_end
- set $color_end = "\033[m"
- end
- if ruby_dummy_gdb_enums.special_consts
- end
-end
-
-# set prompt \033[36m(gdb)\033[m\040
-
-define rp
- ruby_gdb_init
- if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
- printf "FIXNUM: %ld\n", (long)($arg0) >> 1
- else
- if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
- set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
- printf "%sSYMBOL%s: ", $color_type, $color_end
- rp_id $id
- else
- if ($arg0) == RUBY_Qfalse
- echo false\n
- else
- if ($arg0) == RUBY_Qtrue
- echo true\n
- else
- if ($arg0) == RUBY_Qnil
- echo nil\n
- else
- if ($arg0) == RUBY_Qundef
- echo undef\n
- else
- if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
- if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
- printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
- else
- echo immediate\n
- end
- else
- set $flags = ((struct RBasic*)($arg0))->flags
- if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
- printf "[PROMOTED] "
- end
- if ($flags & RUBY_T_MASK) == RUBY_T_NONE
- printf "%sT_NONE%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_NIL
- printf "%sT_NIL%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
- printf "%sT_OBJECT%s: ", $color_type, $color_end
- print (struct RObject *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
- printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
- rp_class $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
- printf "%sT_ICLASS%s: ", $color_type, $color_end
- rp_class $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
- printf "%sT_MODULE%s: ", $color_type, $color_end
- rp_class $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
- printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
- print (struct RFloat *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_STRING
- printf "%sT_STRING%s: ", $color_type, $color_end
- rp_string $arg0 $flags
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
- set $regsrc = ((struct RRegexp*)($arg0))->src
- set $rsflags = ((struct RBasic*)$regsrc)->flags
- printf "%sT_REGEXP%s: ", $color_type, $color_end
- set print address off
- output (char *)(($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary)
- set print address on
- printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if $flags & RUBY_FL_USER6
- printf "(none) "
- end
- if $flags & RUBY_FL_USER5
- printf "(literal) "
- end
- if $flags & RUBY_FL_USER4
- printf "(fixed) "
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- print (struct RRegexp *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
- if ($flags & RUBY_FL_USER1)
- set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
- printf "(embed) "
- if ($len == 0)
- printf "{(empty)} "
- else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
- printf " "
- end
- else
- set $len = ((struct RArray*)($arg0))->as.heap.len
- printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
- if ($flags & RUBY_FL_USER2)
- printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared
- printf " "
- else
- printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
- end
- if ($len == 0)
- printf "{(empty)} "
- else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
- printf " "
- end
- end
- print (struct RArray *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
- printf "%sT_FIXNUM%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_HASH
- printf "%sT_HASH%s: ", $color_type, $color_end,
- if ((struct RHash *)($arg0))->ntbl
- printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
- end
- print (struct RHash *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
- printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
- (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
- ((struct RStruct *)($arg0))->as.heap.len)
- print (struct RStruct *)($arg0)
- x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ((struct RStruct *)($arg0))->as.ary : \
- ((struct RStruct *)($arg0))->as.heap.ptr)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
- printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
- (($flags & RUBY_FL_USER1) != 0), \
- (($flags & RUBY_FL_USER2) ? \
- ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
- ((struct RBignum*)($arg0))->as.heap.len)
- if $flags & RUBY_FL_USER2
- printf "(embed) "
- end
- print (struct RBignum *)($arg0)
- x/xw (($flags & RUBY_FL_USER2) ? \
- ((struct RBignum*)($arg0))->as.ary : \
- ((struct RBignum*)($arg0))->as.heap.digits)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
- printf "%sT_RATIONAL%s: ", $color_type, $color_end
- print (struct RRational *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
- printf "%sT_COMPLEX%s: ", $color_type, $color_end
- print (struct RComplex *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FILE
- printf "%sT_FILE%s: ", $color_type, $color_end
- print (struct RFile *)($arg0)
- output *((struct RFile *)($arg0))->fptr
- printf "\n"
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
- printf "%sT_TRUE%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
- printf "%sT_FALSE%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_DATA
- if ((struct RTypedData *)($arg0))->typed_flag == 1
- printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
- print (struct RTypedData *)($arg0)
- else
- printf "%sT_DATA%s: ", $color_type, $color_end
- print (struct RData *)($arg0)
- end
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
- printf "%sT_MATCH%s: ", $color_type, $color_end
- print (struct RMatch *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
- printf "%sT_SYMBOL%s: ", $color_type, $color_end
- print (struct RSymbol *)($arg0)
- set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
- if $id_type == RUBY_ID_LOCAL
- printf "l"
- else
- if $id_type == RUBY_ID_INSTANCE
- printf "i"
- else
- if $id_type == RUBY_ID_GLOBAL
- printf "G"
- else
- if $id_type == RUBY_ID_ATTRSET
- printf "a"
- else
- if $id_type == RUBY_ID_CONST
- printf "C"
- else
- if $id_type == RUBY_ID_CLASS
- printf "c"
- else
- printf "j"
- end
- end
- end
- end
- end
- end
- set $id_fstr = ((struct RSymbol *)($arg0))->fstr
- rp_string $id_fstr
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
- printf "%sT_UNDEF%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
- printf "%sT_IMEMO%s(", $color_type, $color_end
- output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
- printf "): "
- rp_imemo $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_NODE
- printf "%sT_NODE%s(", $color_type, $color_end
- output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
- printf "): "
- print *(NODE *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
- printf "%sT_ZOMBIE%s: ", $color_type, $color_end
- print (struct RData *)($arg0)
- else
- printf "%sunknown%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
-end
-document rp
- Print a Ruby's VALUE.
-end
-
-define rp_id
- set $id = (ID)$arg0
- if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
- printf "(:%c)\n", $id
- else
- if $id == idDot2
- printf "(:..)\n"
- else
- if $id == idDot3
- printf "(:...)\n"
- else
- if $id == idUPlus
- printf "(:+@)\n"
- else
- if $id == idUMinus
- printf "(:-@)\n"
- else
- if $id == idPow
- printf "(:**)\n"
- else
- if $id == idCmp
- printf "(:<=>)\n"
- else
- if $id == idLTLT
- printf "(:<<)\n"
- else
- if $id == idLE
- printf "(:<=)\n"
- else
- if $id == idGE
- printf "(:>=)\n"
- else
- if $id == idEq
- printf "(:==)\n"
- else
- if $id == idEqq
- printf "(:===)\n"
- else
- if $id == idNeq
- printf "(:!=)\n"
- else
- if $id == idEqTilde
- printf "(:=~)\n"
- else
- if $id == idNeqTilde
- printf "(:!~)\n"
- else
- if $id == idAREF
- printf "(:[])\n"
- else
- if $id == idASET
- printf "(:[]=)\n"
- else
- if $id <= tLAST_OP_ID
- printf "O"
- else
- set $id_type = $id & RUBY_ID_SCOPE_MASK
- if $id_type == RUBY_ID_LOCAL
- printf "l"
- else
- if $id_type == RUBY_ID_INSTANCE
- printf "i"
- else
- if $id_type == RUBY_ID_GLOBAL
- printf "G"
- else
- if $id_type == RUBY_ID_ATTRSET
- printf "a"
- else
- if $id_type == RUBY_ID_CONST
- printf "C"
- else
- if $id_type == RUBY_ID_CLASS
- printf "c"
- else
- printf "j"
- end
- end
- end
- end
- end
- end
- end
- printf "(%ld): ", $id
- set $str = lookup_id_str($id)
- if $str
- rp_string $str
- else
- echo undef\n
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
-end
-document rp_id
- Print an ID.
-end
-
-define output_string
- set $flags = ((struct RBasic*)($arg0))->flags
- printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
-end
-
-define rp_string
- set $flags = ((struct RBasic*)($arg0))->flags
- set print address off
- output (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
- set print address on
- printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if !($flags & RUBY_FL_USER1)
- printf "(embed) "
- else
- if ($flags & RUBY_FL_USER2)
- printf "(shared) "
- end
- if ($flags & RUBY_FL_USER3)
- printf "(assoc) "
- end
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
- printf "coderange:unknown "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
- printf "coderange:7bit "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
- printf "coderange:valid "
- else
- printf "coderange:broken "
- end
- end
- end
- print (struct RString *)($arg0)
-end
-document rp_string
- Print the content of a String.
-end
-
-define rp_class
- printf "(struct RClass *) %p", (void*)$arg0
- if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
- printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
- end
- printf "\n"
- rb_classname $arg0
- print *(struct RClass *)($arg0)
- print *((struct RClass *)($arg0))->ptr
-end
-document rp_class
- Print the content of a Class/Module.
-end
-
-define rp_imemo
- set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask)
- if $flags == imemo_cref
- printf "(rb_cref_t *) %p\n", (void*)$arg0
- print *(rb_cref_t *)$arg0
- else
- if $flags == imemo_svar
- printf "(struct vm_svar *) %p\n", (void*)$arg0
- print *(struct vm_svar *)$arg0
- else
- if $flags == imemo_throw_data
- printf "(struct vm_throw_data *) %p\n", (void*)$arg0
- print *(struct vm_throw_data *)$arg0
- else
- if $flags == imemo_ifunc
- printf "(struct vm_ifunc *) %p\n", (void*)$arg0
- print *(struct vm_ifunc *)$arg0
- else
- if $flags == imemo_memo
- printf "(struct MEMO *) %p\n", (void*)$arg0
- print *(struct MEMO *)$arg0
- else
- if $flags == imemo_ment
- printf "(rb_method_entry_t *) %p\n", (void*)$arg0
- print *(rb_method_entry_t *)$arg0
- else
- if $flags == imemo_iseq
- printf "(rb_iseq_t *) %p\n", (void*)$arg0
- print *(rb_iseq_t *)$arg0
- else
- printf "(struct RIMemo *) %p\n", (void*)$arg0
- print *(struct RIMemo *)$arg0
- end
- end
- end
- end
- end
- end
- end
-end
-document rp_imemo
- Print the content of a memo
-end
-
-define nd_type
- print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-end
-document nd_type
- Print a Ruby' node type.
-end
-
-define nd_file
- print ((NODE*)($arg0))->nd_file
-end
-document nd_file
- Print the source file name of a node.
-end
-
-define nd_line
- print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
-end
-document nd_line
- Print the source line number of a node.
-end
-
-# Print members of ruby node.
-
-define nd_head
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_alen
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-define nd_next
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_cond
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_body
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_else
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_orig
- printf "%su3.value%s: ", $color_highlite, $color_end
- rp ($arg0).u3.value
-end
-
-
-define nd_resq
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_ensr
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_1st
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_2nd
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-
-define nd_stts
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-
-define nd_entry
- printf "%su3.entry%s: ", $color_highlite, $color_end
- p ($arg0).u3.entry
-end
-
-define nd_vid
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_cflag
- printf "%su2.id%s: ", $color_highlite, $color_end
- p ($arg0).u2.id
-end
-
-define nd_cval
- printf "%su3.value%s: ", $color_highlite, $color_end
- rp ($arg0).u3.value
-end
-
-
-define nd_cnt
- printf "%su3.cnt%s: ", $color_highlite, $color_end
- p ($arg0).u3.cnt
-end
-
-define nd_tbl
- printf "%su1.tbl%s: ", $color_highlite, $color_end
- p ($arg0).u1.tbl
-end
-
-
-define nd_var
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_ibdy
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_iter
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_value
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_aid
- printf "%su3.id%s: ", $color_highlite, $color_end
- p ($arg0).u3.id
-end
-
-
-define nd_lit
- printf "%su1.value%s: ", $color_highlite, $color_end
- rp ($arg0).u1.value
-end
-
-
-define nd_frml
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_rest
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-define nd_opt
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-
-define nd_recv
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_mid
- printf "%su2.id%s: ", $color_highlite, $color_end
- p ($arg0).u2.id
-end
-
-define nd_args
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_noex
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_defn
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_old
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_new
- printf "%su2.id%s: ", $color_highlite, $color_end
- p ($arg0).u2.id
-end
-
-
-define nd_cfnc
- printf "%su1.cfunc%s: ", $color_highlite, $color_end
- p ($arg0).u1.cfunc
-end
-
-define nd_argc
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-
-define nd_cname
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_super
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_modl
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_clss
- printf "%su1.value%s: ", $color_highlite, $color_end
- rp ($arg0).u1.value
-end
-
-
-define nd_beg
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_end
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_state
- printf "%su3.state%s: ", $color_highlite, $color_end
- p ($arg0).u3.state
-end
-
-define nd_rval
- printf "%su2.value%s: ", $color_highlite, $color_end
- rp ($arg0).u2.value
-end
-
-
-define nd_nth
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-
-define nd_tag
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_tval
- printf "%su2.value%s: ", $color_highlite, $color_end
- rp ($arg0).u2.value
-end
-
-define nd_tree
- set $buf = (struct RString *)rb_str_buf_new(0)
- call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
- printf "%s\n", $buf->as.heap.ptr
-end
-
-define rb_p
- call rb_p($arg0)
-end
-
-define rb_numtable_entry
- set $rb_numtable_tbl = $arg0
- set $rb_numtable_id = (st_data_t)$arg1
- set $rb_numtable_key = 0
- set $rb_numtable_rec = 0
- if $rb_numtable_tbl->entries_packed
- set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
- while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
- if $rb_numtable_p.k == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p.k
- set $rb_numtable_rec = $rb_numtable_p.v
- set $rb_numtable_p = 0
- else
- set $rb_numtable_p = $rb_numtable_p + 1
- end
- end
- else
- set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
- while $rb_numtable_p
- if $rb_numtable_p->key == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p->key
- set $rb_numtable_rec = $rb_numtable_p->record
- set $rb_numtable_p = 0
- else
- set $rb_numtable_p = $rb_numtable_p->next
- end
- end
- end
-end
-
-define rb_id2name
- ruby_gdb_init
- printf "%sID%s: ", $color_type, $color_end
- rp_id $arg0
-end
-document rb_id2name
- Print the name of id
-end
-
-define rb_method_entry
- set $rb_method_entry_klass = (struct RClass *)$arg0
- set $rb_method_entry_id = (ID)$arg1
- set $rb_method_entry_me = (rb_method_entry_t *)0
- while !$rb_method_entry_me && $rb_method_entry_klass
- rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
- set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
- if !$rb_method_entry_me
- set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
- end
- end
- if $rb_method_entry_me
- print *$rb_method_entry_klass
- print *$rb_method_entry_me
- else
- echo method not found\n
- end
-end
-document rb_method_entry
- Search method entry by class and id
-end
-
-define rb_classname
- # up to 128bit int
- set $rb_classname_permanent = "0123456789ABCDEF"
- set $rb_classname = classname($arg0, $rb_classname_permanent)
- if $rb_classname != RUBY_Qnil
- rp $rb_classname
- else
- echo anonymous class/module\n
- end
-end
-
-define rb_ancestors
- set $rb_ancestors_module = $arg0
- while $rb_ancestors_module
- rp_class $rb_ancestors_module
- set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
- end
-end
-document rb_ancestors
- Print ancestors.
-end
-
-define rb_backtrace
- call rb_backtrace()
-end
-
-define iseq
- if ruby_dummy_gdb_enums.special_consts
- end
- if ($arg0)->type == ISEQ_ELEMENT_NONE
- echo [none]\n
- end
- if ($arg0)->type == ISEQ_ELEMENT_LABEL
- print *(LABEL*)($arg0)
- end
- if ($arg0)->type == ISEQ_ELEMENT_INSN
- print *(INSN*)($arg0)
- if ((INSN*)($arg0))->insn_id != YARVINSN_jump
- set $i = 0
- set $operand_size = ((INSN*)($arg0))->operand_size
- set $operands = ((INSN*)($arg0))->operands
- while $i < $operand_size
- rp $operands[$i++]
- end
- end
- end
- if ($arg0)->type == ISEQ_ELEMENT_ADJUST
- print *(ADJUST*)($arg0)
- end
-end
-
-define rb_ps
- rb_ps_vm ruby_current_vm
-end
-document rb_ps
-Dump all threads and their callstacks
-end
-
-define rb_ps_vm
- print $ps_vm = (rb_vm_t*)$arg0
- set $ps_thread_ln = $ps_vm->living_threads.n.next
- set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
- while 1
- set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
- set $ps_thread = (VALUE)($ps_thread_th->self)
- rb_ps_thread $ps_thread
- if $ps_thread_ln == $ps_thread_ln_last
- loop_break
- end
- set $ps_thread_ln = $ps_thread_ln->next
- end
-end
-document rb_ps_vm
-Dump all threads in a (rb_vm_t*) and their callstacks
-end
-
-define print_lineno
- set $cfp = $arg0
- set $iseq = $cfp->iseq
- set $pos = $cfp->pc - $iseq->body->iseq_encoded
- if $pos != 0
- set $pos = $pos - 1
- end
-
- set $i = 0
- set $size = $iseq->body->line_info_size
- set $table = $iseq->body->line_info_table
- #printf "size: %d\n", $size
- if $size == 0
- else
- set $i = 1
- while $i < $size
- #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $table[$i].position, $table[$i].line_no, $pos
- if $table[$i].position > $pos
- loop_break
- end
- set $i = $i + 1
- if $table[$i].position == $pos
- loop_break
- end
- end
- printf "%d", $table[$i-1].line_no
- end
-end
-
-define check_method_entry
- # get $immeo and $can_be_svar and return $me
- set $imemo = (struct RBasic *)$arg0
- set $can_be_svar = $arg1
- if $imemo != RUBY_Qfalse
- set $type = ($imemo->flags >> 12) & 0x07
- if $type == imemo_ment
- set $me = (rb_callable_method_entry_t *)$imemo
- else
- if $type == imemo_svar
- set $imemo == ((struct vm_svar *)$imemo)->cref_or_me
- check_method_entry $imemo 0
- end
- end
- end
-end
-
-define output_id
- set $id = $arg0
- # rb_id_to_serial
- if $id > tLAST_OP_ID
- set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
- else
- set $serial = (rb_id_serial_t)$id
- end
- if $serial && $serial <= global_symbols.last_id
- set $idx = $serial / ID_ENTRY_UNIT
- set $ids = (struct RArray *)global_symbols.ids
- set $flags = $ids->basic.flags
- if ($flags & RUBY_FL_USER1)
- set $idsptr = $ids->as.ary
- set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- else
- set $idsptr = $ids->as.heap.ptr
- set $idslen = $ids->as.heap.len
- end
- if $idx < $idslen
- set $t = 0
- set $ary = (struct RArray *)$idsptr[$idx]
- if $ary != RUBY_Qnil
- set $flags = $ary->basic.flags
- if ($flags & RUBY_FL_USER1)
- set $aryptr = $ary->as.ary
- set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- else
- set $aryptr = $ary->as.heap.ptr
- set $arylen = $ary->as.heap.len
- end
- set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
- output_string $result
- end
- end
- end
-end
-
-define rb_ps_thread
- set $ps_thread = (struct RTypedData*)$arg0
- set $ps_thread_th = (rb_thread_t*)$ps_thread->data
- printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
- $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
- set $cfp = $ps_thread_th->cfp
- set $cfpend = (rb_control_frame_t *)($ps_thread_th->stack + $ps_thread_th->stack_size)-1
- while $cfp < $cfpend
- if $cfp->iseq
- if $cfp->pc
- set $location = $cfp->iseq->body->location
- output_string $location.path
- printf ":"
- print_lineno $cfp
- printf ":in `"
- output_string $location.label
- printf "'\n"
- else
- printf "???.rb:???:in `???'\n"
- end
- else
- # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
- set $ep = $cfp->ep
- if ($ep[0] & 0xffff0001) == 0x55550001
- #define VM_ENV_FLAG_LOCAL 0x02
- #define VM_ENV_PREV_EP(ep) GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
- set $me = 0
- set $env_specval = $ep[-1]
- set $env_me_cref = $ep[-2]
- while ($env_specval & 0x02) != 0
- check_method_entry $env_me_cref 0
- if $me != 0
- loop_break
- end
- set $ep = $ep[0]
- set $env_specval = $ep[-1]
- set $env_me_cref = $ep[-2]
- end
- if $me == 0
- check_method_entry $env_me_cref 1
- end
- set print symbol-filename on
- output/a $me->def->body.cfunc.func
- set print symbol-filename off
- set $mid = $me->def->original_id
- printf ":in `"
- output_id $mid
- printf "'\n"
- else
- printf "unknown_frame:???:in `???'\n"
- end
- end
- set $cfp = $cfp + 1
- end
-end
-
-define rb_count_objects
- set $objspace = ruby_current_vm->objspace
- set $counts_00 = 0
- set $counts_01 = 0
- set $counts_02 = 0
- set $counts_03 = 0
- set $counts_04 = 0
- set $counts_05 = 0
- set $counts_06 = 0
- set $counts_07 = 0
- set $counts_08 = 0
- set $counts_09 = 0
- set $counts_0a = 0
- set $counts_0b = 0
- set $counts_0c = 0
- set $counts_0d = 0
- set $counts_0e = 0
- set $counts_0f = 0
- set $counts_10 = 0
- set $counts_11 = 0
- set $counts_12 = 0
- set $counts_13 = 0
- set $counts_14 = 0
- set $counts_15 = 0
- set $counts_16 = 0
- set $counts_17 = 0
- set $counts_18 = 0
- set $counts_19 = 0
- set $counts_1a = 0
- set $counts_1b = 0
- set $counts_1c = 0
- set $counts_1d = 0
- set $counts_1e = 0
- set $counts_1f = 0
- set $total = 0
- set $i = 0
- while $i < $objspace->heap_pages.allocated_pages
- printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
- set $page = $objspace->heap_pages.sorted[$i]
- set $p = $page->start
- set $pend = $p + $page->total_slots
- while $p < $pend
- set $flags = $p->as.basic.flags & 0x1f
- eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
- set $p = $p + 1
- end
- set $total = $total + $page->total_slots
- set $i = $i + 1
- end
- printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
- printf "T_OBJECT: %d\n", $counts_01
- printf "T_CLASS: %d\n", $counts_02
- printf "T_MODULE: %d\n", $counts_03
- printf "T_FLOAT: %d\n", $counts_04
- printf "T_STRING: %d\n", $counts_05
- printf "T_REGEXP: %d\n", $counts_06
- printf "T_ARRAY: %d\n", $counts_07
- printf "T_HASH: %d\n", $counts_08
- printf "T_STRUCT: %d\n", $counts_09
- printf "T_BIGNUM: %d\n", $counts_0a
- printf "T_FILE: %d\n", $counts_0b
- printf "T_DATA: %d\n", $counts_0c
- printf "T_MATCH: %d\n", $counts_0d
- printf "T_COMPLEX: %d\n", $counts_0e
- printf "T_RATIONAL: %d\n", $counts_0f
- #printf "UNKNOWN_10: %d\n", $counts_10
- printf "T_NIL: %d\n", $counts_11
- printf "T_TRUE: %d\n", $counts_12
- printf "T_FALSE: %d\n", $counts_13
- printf "T_SYMBOL: %d\n", $counts_14
- printf "T_FIXNUM: %d\n", $counts_15
- printf "T_UNDEF: %d\n", $counts_16
- #printf "UNKNOWN_17: %d\n", $counts_17
- #printf "UNKNOWN_18: %d\n", $counts_18
- #printf "UNKNOWN_19: %d\n", $counts_19
- printf "T_IMEMO: %d\n", $counts_1a
- printf "T_NODE: %d\n", $counts_1b
- printf "T_ICLASS: %d\n", $counts_1c
- printf "T_ZOMBIE: %d\n", $counts_1d
- #printf "UNKNOWN_1E: %d\n", $counts_1e
- printf "T_MASK: %d\n", $counts_1f
-end
-document rb_count_objects
- Counts all objects grouped by type.
-end
-
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
-define trace_machine_instructions
- set logging on
- set height 0
- set width 0
- display/i $pc
- while !$exit_code
- info line *$pc
- si
- end
-end
-
-define SDR
- call rb_vmdebug_stack_dump_raw_current()
-end
-
-define rbi
- if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
- p *(LABEL*)$arg0
- else
- if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
- p *(INSN*)$arg0
- else
- if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
- p *(ADJUST*)$arg0
- else
- print *$arg0
- end
- end
- end
-end
-
-define dump_node
- set $str = rb_parser_dump_tree($arg0, 0)
- set $flags = ((struct RBasic*)($str))->flags
- printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)$str)->as.heap.ptr : \
- ((struct RString*)$str)->as.ary)
-end
diff --git a/.gitattributes b/.gitattributes
deleted file mode 100644
index d9785fad00..0000000000
--- a/.gitattributes
+++ /dev/null
@@ -1,5 +0,0 @@
-*.gemspec diff=ruby
-*.rb diff=ruby
-bin/* diff=ruby
-tool/update-deps diff=ruby
-tool/make-snapshot diff=ruby
diff --git a/.gitignore b/.gitignore
deleted file mode 100644
index 9757768786..0000000000
--- a/.gitignore
+++ /dev/null
@@ -1,183 +0,0 @@
-*-*-*.def
-*-*-*.exp
-*-*-*.lib
-*.a
-*.bak
-*.bc
-*.dSYM
-*.dmyh
-*.dylib
-*.elc
-*.i
-*.inc
-*.log
-*.o
-*.obj
-*.orig
-*.pdb
-*.rej
-*.s
-*.sav
-*.swp
-*.yarb
-*~
-.*-*
-.*.list
-.*.time
-.DS_Store
-.ccmalloc
-.ext
-.pc
-.ppack
-.svn
-Makefile
-Makefile.old
-cygruby*.def
-extconf.h
-y.output
-y.tab.c
-
-# /
-/*-fake.rb
-/*.dll
-/*.exe
-/*.res
-/*.pc
-/*.rc
-/*_prelude.c
-/COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
-/Doxyfile
-/GNUmakefile
-/GNUmakefile.old
-/README.atheos
-/README.fat-patch
-/README.v6
-/TAGS
-/archive
-/autom4te*.cache
-/automake
-/beos
-/bmlog-*
-/breakpoints.gdb
-/config.cache
-/config.h
-/config.h.in
-/config.status
-/config.status.lineno
-/configure
-/coverage/simplecov
-/coverage/simplecov-html
-/coverage/doclie
-/coverage/.last_run.json
-/coverage/.resultset.json*
-/coverage/assets
-/coverage/index.html
-/doc/capi
-/enc.mk
-/encdb.h
-/exts.mk
-/goruby
-/id.[ch]
-/largefile.h
-/lex.c
-/libruby*.*
-/miniprelude.c
-/miniruby
-/newdate.rb
-/newline.c
-/newver.rb
-/parse.c
-/parse.h
-/patches
-/patches-master
-/pitest.rb
-/ppack
-/prelude.c
-/preview
-/probes.h
-/rbconfig.rb
-/rename2.h
-/repack
-/revision.h
-/riscos
-/rubicon
-/ruby
-/ruby-runner
-/ruby-runner.h
-/ruby-man.rd.gz
-/sizes.c
-/test.rb
-/tmp
-/transdb.h
-/uncommon.mk
-/verconf.h
-/verconf.mk
-/web
-/yasmdata.rb
-
-# /benchmark/
-/benchmark/bmx_*.rb
-/benchmark/fasta.output.*
-/benchmark/wc.input
-
-/enc/*.def
-/enc/*.exp
-/enc/*.lib
-/enc/unicode/data
-
-# /enc/trans/
-/enc/trans/*.c
-/enc/trans/*.def
-/enc/trans/*.exp
-/enc/trans/*.lib
-/enc/trans/.time
-
-# /ext/
-/ext/extinit.c
-
-# /ext/-test-/win32/dln/
-/ext/-test-/win32/dln/dlntest.exp
-/ext/-test-/win32/dln/dlntest.lib
-
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
-
-# /ext/etc/
-/ext/etc/constdefs.h
-
-# /ext/fiddle/
-/ext/fiddle/libffi-*
-
-# /ext/rbconfig/
-/ext/rbconfig/sizeof/sizes.c
-
-# /ext/ripper/
-/ext/ripper/eventids1.c
-/ext/ripper/eventids2table.c
-/ext/ripper/ripper.*
-/ext/ripper/ids1
-/ext/ripper/ids2
-
-# /ext/socket/
-/ext/socket/constants.h
-/ext/socket/constdefs.h
-/ext/socket/constdefs.c
-
-# /gems
-/gems/*.gem
-
-# /spec/
-/spec/mspec
-/spec/rubyspec
-
-# /tool/
-/tool/config.guess
-/tool/config.sub
-
-# /win32/
-/win32/*.ico
-/win32/.time
diff --git a/.indent.pro b/.indent.pro
deleted file mode 100644
index 6a207a0554..0000000000
--- a/.indent.pro
+++ /dev/null
@@ -1,21 +0,0 @@
--bap
--nbbb
--nbc
--br
--nbs
--ncdb
--ce
--cli0.5
--ndj
--ei
--nfc1
--i4
--l120
--lp
--npcs
--psl
--sc
--sob
-
--TID
--TVALUE
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 24ce0c9113..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,102 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
-#
-# This file is a part of the programming language Ruby. Permission is hereby
-# granted, to either redistribute or modify this file, provided that the
-# conditions mentioned in the file COPYING are met. Consult the file for
-# details.
-
-# This is a Travis-CI build configuration file. The list of configurations
-# available is located in
-#
-# http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-# http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-# Language specification.
-language: c
-sudo: false
-
-# Compilers. Several compilers are provided in Travis, so we try them all.
-# The value set here is visible via $CC environment variable.
-compiler:
- - gcc
-
-os:
- - linux
-
-# Dependencies. Some header files are missing in a Travis' worker VM, so we
-# have to install them. The "1.9.1" here is OK. It is the most adopted
-# version string for Debian/Ubuntu, and no dependencies have been changed so
-# far since the 1.9.1 release.
-before_install:
- - "CONFIG_FLAG="
- - "JOBS='-j 4'"
-
-# Script is where the test runs. Note we just do "make test", not other tests
-# like test-all, test-rubyspec. This is because they take too much time,
-# enough for Travis to shut down the VM as being stalled.
-before_script:
- - "uname -a"
- - "uname -r"
- - "rm -fr .ext autom4te.cache"
- - "echo $TERM"
- - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
- - "autoconf"
- - "mkdir config_1st config_2nd"
- - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
- - "cp -pr config.status .ext/include config_1st"
- - "make reconfig"
- - "cp -pr config.status .ext/include config_2nd"
- - "diff -ru config_1st config_2nd"
- - "make after-update BASERUBY=ruby"
- - "make -s $JOBS"
- - "make update-rubyspec"
-script:
- - "make test TESTOPTS=--color=never"
- - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
- - "make test-rubyspec MSPECOPT=-fm"
-
-# Branch matrix. Not all branches are Travis-ready so we limit branches here.
-branches:
- only:
- - trunk
- - ruby_2_1
- - ruby_2_2
- - ruby_2_3
- - /^feature\//
- - /^bug\//
-
-# We want to be notified when something happens.
-notifications:
- irc:
- channels:
- - "irc.freenode.org#ruby-core"
- - "irc.freenode.org#ruby-ja"
- on_success: change # [always|never|change] # default: always
- on_failure: always # [always|never|change] # default: always
- template:
- - "%{message} by @%{author}: See %{build_url}"
-
- # Update ruby-head installed on Travis CI so other projects can test against it.
- webhooks:
- urls:
- - "https://rubies.travis-ci.org/rebuild/ruby-head"
- on_success: always
- on_failure: never
-
- email:
- - ko1c-failure@atdot.net
- - shibata.hiroshi@gmail.com
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
deleted file mode 100644
index a009caefea..0000000000
--- a/BSDL
+++ /dev/null
@@ -1,22 +0,0 @@
-Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions
-are met:
-1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
-
-THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
deleted file mode 100644
index ffdf2dd4b8..0000000000
--- a/CONTRIBUTING.md
+++ /dev/null
@@ -1,4 +0,0 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 426810a7fb..eeb586b392 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,340 @@
-Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the
-2-clause BSDL (see the file BSDL), or the conditions below:
+ GNU GENERAL PUBLIC LICENSE
+ Version 2, June 1991
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.
+ 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
+ Preamble
- a) place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
+ The licenses for most software are designed to take away your
+freedom to share and change it. By contrast, the GNU General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users. This
+General Public License applies to most of the Free Software
+Foundation's software and to any other program whose authors commit to
+using it. (Some other Free Software Foundation software is covered by
+the GNU Library General Public License instead.) You can apply it to
+your programs, too.
- b) use the modified software only within your corporation or
- organization.
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+this service if you wish), that you receive source code or can get it
+if you want it, that you can change the software or use pieces of it
+in new free programs; and that you know you can do these things.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
- d) make other distribution arrangements with the author.
+ For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have. You must make sure that they, too, receive or can get the
+source code. And you must show them these terms so they know their
+rights.
- 3. You may distribute the software in object code or binary form,
- provided that you do at least ONE of the following:
+ We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
- a) distribute the binaries and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
+ Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software. If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
- b) accompany the distribution with the machine-readable source of
- the software.
+ Finally, any free program is threatened constantly by software
+patents. We wish to avoid the danger that redistributors of a free
+program will individually obtain patent licenses, in effect making the
+program proprietary. To prevent this, we have made it clear that any
+patent must be licensed for everyone's free use or not licensed at all.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ The precise terms and conditions for copying, distribution and
+modification follow.
+
+ GNU GENERAL PUBLIC LICENSE
+ TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
- d) make other distribution arrangements with the author.
+ 0. This License applies to any program or other work which contains
+a notice placed by the copyright holder saying it may be distributed
+under the terms of this General Public License. The "Program", below,
+refers to any such program or work, and a "work based on the Program"
+means either the Program or any derivative work under copyright law:
+that is to say, a work containing the Program or a portion of it,
+either verbatim or with modifications and/or translated into another
+language. (Hereinafter, translation is included without limitation in
+the term "modification".) Each licensee is addressed as "you".
- 4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under these terms.
+Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope. The act of
+running the Program is not restricted, and the output from the Program
+is covered only if its contents constitute a work based on the
+Program (independent of having been made by running the Program).
+Whether that is true depends on what the Program does.
- For the list of those files and their copying conditions, see the
- file LEGAL.
+ 1. You may copy and distribute verbatim copies of the Program's
+source code as you receive it, in any medium, provided that you
+conspicuously and appropriately publish on each copy an appropriate
+copyright notice and disclaimer of warranty; keep intact all the
+notices that refer to this License and to the absence of any warranty;
+and give any other recipients of the Program a copy of this License
+along with the Program.
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
+You may charge a fee for the physical act of transferring a copy, and
+you may at your option offer warranty protection in exchange for a fee.
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
+ 2. You may modify your copy or copies of the Program or any portion
+of it, thus forming a work based on the Program, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+ a) You must cause the modified files to carry prominent notices
+ stating that you changed the files and the date of any change.
+
+ b) You must cause any work that you distribute or publish, that in
+ whole or in part contains or is derived from the Program or any
+ part thereof, to be licensed as a whole at no charge to all third
+ parties under the terms of this License.
+
+ c) If the modified program normally reads commands interactively
+ when run, you must cause it, when started running for such
+ interactive use in the most ordinary way, to print or display an
+ announcement including an appropriate copyright notice and a
+ notice that there is no warranty (or else, saying that you provide
+ a warranty) and that users may redistribute the program under
+ these conditions, and telling the user how to view a copy of this
+ License. (Exception: if the Program itself is interactive but
+ does not normally print such an announcement, your work based on
+ the Program is not required to print an announcement.)
+
+These requirements apply to the modified work as a whole. If
+identifiable sections of that work are not derived from the Program,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works. But when you
+distribute the same sections as part of a whole which is a work based
+on the Program, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Program.
+
+In addition, mere aggregation of another work not based on the Program
+with the Program (or with a work based on the Program) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+ 3. You may copy and distribute the Program (or a work based on it,
+under Section 2) in object code or executable form under the terms of
+Sections 1 and 2 above provided that you also do one of the following:
+
+ a) Accompany it with the complete corresponding machine-readable
+ source code, which must be distributed under the terms of Sections
+ 1 and 2 above on a medium customarily used for software interchange; or,
+
+ b) Accompany it with a written offer, valid for at least three
+ years, to give any third party, for a charge no more than your
+ cost of physically performing source distribution, a complete
+ machine-readable copy of the corresponding source code, to be
+ distributed under the terms of Sections 1 and 2 above on a medium
+ customarily used for software interchange; or,
+
+ c) Accompany it with the information you received as to the offer
+ to distribute corresponding source code. (This alternative is
+ allowed only for noncommercial distribution and only if you
+ received the program in object code or executable form with such
+ an offer, in accord with Subsection b above.)
+
+The source code for a work means the preferred form of the work for
+making modifications to it. For an executable work, complete source
+code means all the source code for all modules it contains, plus any
+associated interface definition files, plus the scripts used to
+control compilation and installation of the executable. However, as a
+special exception, the source code distributed need not include
+anything that is normally distributed (in either source or binary
+form) with the major components (compiler, kernel, and so on) of the
+operating system on which the executable runs, unless that component
+itself accompanies the executable.
+
+If distribution of executable or object code is made by offering
+access to copy from a designated place, then offering equivalent
+access to copy the source code from the same place counts as
+distribution of the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+ 4. You may not copy, modify, sublicense, or distribute the Program
+except as expressly provided under this License. Any attempt
+otherwise to copy, modify, sublicense or distribute the Program is
+void, and will automatically terminate your rights under this License.
+However, parties who have received copies, or rights, from you under
+this License will not have their licenses terminated so long as such
+parties remain in full compliance.
+
+ 5. You are not required to accept this License, since you have not
+signed it. However, nothing else grants you permission to modify or
+distribute the Program or its derivative works. These actions are
+prohibited by law if you do not accept this License. Therefore, by
+modifying or distributing the Program (or any work based on the
+Program), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Program or works based on it.
+
+ 6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the
+original licensor to copy, distribute or modify the Program subject to
+these terms and conditions. You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties to
+this License.
+
+ 7. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Program at all. For example, if a patent
+license would not permit royalty-free redistribution of the Program by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Program.
+
+If any portion of this section is held invalid or unenforceable under
+any particular circumstance, the balance of the section is intended to
+apply and the section as a whole is intended to apply in other
+circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system, which is
+implemented by public license practices. Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+ 8. If the distribution and/or use of the Program is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Program under this License
+may add an explicit geographical distribution limitation excluding
+those countries, so that distribution is permitted only in or among
+countries not thus excluded. In such case, this License incorporates
+the limitation as if written in the body of this License.
+
+ 9. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time. Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number. If the Program
+specifies a version number of this License which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation. If the Program does not specify a version number of
+this License, you may choose any version ever published by the Free Software
+Foundation.
+
+ 10. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission. For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this. Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+ NO WARRANTY
+
+ 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+ 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
+
+ If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+ To do so, attach the following notices to the program. It is safest
+to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+ <one line to give the program's name and a brief idea of what it does.>
+ Copyright (C) 19yy <name of author>
+
+ This program is free software; you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation; either version 2 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program; if not, write to the Free Software
+ Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+ Gnomovision version 69, Copyright (C) 19yy name of author
+ Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+ This is free software, and you are welcome to redistribute it
+ under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License. Of course, the commands you use may
+be called something other than `show w' and `show c'; they could even be
+mouse-clicks or menu items--whatever suits your program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary. Here is a sample; alter the names:
+
+ Yoyodyne, Inc., hereby disclaims all copyright interest in the program
+ `Gnomovision' (which makes passes at compilers) written by James Hacker.
+
+ <signature of Ty Coon>, 1 April 1989
+ Ty Coon, President of Vice
+
+This General Public License does not permit incorporating your program into
+proprietary programs. If your program is a subroutine library, you may
+consider it more useful to permit linking proprietary applications with the
+library. If this is what you want to do, use the GNU Library General
+Public License instead of this License.
diff --git a/COPYING.ja b/COPYING.ja
deleted file mode 100644
index e50d01c8d1..0000000000
--- a/COPYING.ja
+++ /dev/null
@@ -1,51 +0,0 @@
-本プログラムã¯ãƒ•リーソフトウェアã§ã™ï¼Ž2-clause BSDL
-ã¾ãŸã¯ä»¥ä¸‹ã«ç¤ºã™æ¡ä»¶ã§æœ¬ãƒ—ログラムをå†é…布ã§ãã¾ã™
-2-clause BSDLã«ã¤ã„ã¦ã¯BSDLファイルをå‚ç…§ã—ã¦ä¸‹ã•ã„.
-
- 1. 複製ã¯åˆ¶é™ãªã自由ã§ã™ï¼Ž
-
- 2. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムã®ã‚½ãƒ¼ã‚¹ã‚’
- 自由ã«å¤‰æ›´ã§ãã¾ã™ï¼Ž
-
- (a) ãƒãƒƒãƒˆãƒ‹ãƒ¥ãƒ¼ã‚ºã«ãƒã‚¹ãƒˆã—ãŸã‚Šï¼Œä½œè€…ã«å¤‰æ›´ã‚’é€ä»˜ã™ã‚‹
- ãªã©ã®æ–¹æ³•ã§ï¼Œå¤‰æ›´ã‚’公開ã™ã‚‹ï¼Ž
-
- (b) 変更ã—ãŸæœ¬ãƒ—ãƒ­ã‚°ãƒ©ãƒ ã‚’è‡ªåˆ†ã®æ‰€å±žã™ã‚‹çµ„織内部ã ã‘ã§
- 使ã†ï¼Ž
-
- (c) 変更点を明示ã—ãŸã†ãˆï¼Œã‚½ãƒ•トウェアã®åå‰ã‚’変更ã™ã‚‹ï¼Ž
- ãã®ã‚½ãƒ•トウェアをé…布ã™ã‚‹æ™‚ã«ã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラ
- ãƒ ã‚‚åŒæ™‚ã«é…布ã™ã‚‹ï¼Žã¾ãŸã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラムã®ã‚½ãƒ¼
- スã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
-
- (d) ãã®ä»–ã®å¤‰æ›´æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
-
- 3. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムをコンパイ
- ルã—ãŸã‚ªãƒ–ジェクトコードや実行形å¼ã§ã‚‚é…布ã§ãã¾ã™ï¼Ž
-
- (a) ãƒã‚¤ãƒŠãƒªã‚’å—ã‘å–ã£ãŸäººãŒã‚½ãƒ¼ã‚¹ã‚’入手ã§ãるよã†ã«ï¼Œ
- ソースã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
-
- (b) 機械å¯èª­ãªã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’添付ã™ã‚‹ï¼Ž
-
- (c) 変更を行ã£ãŸãƒã‚¤ãƒŠãƒªã¯åå‰ã‚’変更ã—ãŸã†ãˆï¼Œã‚ªãƒªã‚¸ãƒŠ
- ルã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
-
- (d) ãã®ä»–ã®é…布æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
-
- 4. ä»–ã®ãƒ—ログラムã¸ã®å¼•用ã¯ã„ã‹ãªã‚‹ç›®çš„ã§ã‚れ自由ã§ã™ï¼ŽãŸ
- ã ã—,本プログラムã«å«ã¾ã‚Œã‚‹ä»–ã®ä½œè€…ã«ã‚ˆã‚‹ã‚³ãƒ¼ãƒ‰ã¯ï¼Œã
- れãžã‚Œã®ä½œè€…ã®æ„å‘ã«ã‚ˆã‚‹åˆ¶é™ãŒåŠ ãˆã‚‰ã‚Œã‚‹å ´åˆãŒã‚りã¾ã™ï¼Ž
-
- ãれらファイルã®ä¸€è¦§ã¨ãれãžã‚Œã®é…布æ¡ä»¶ãªã©ã«ä»˜ã„ã¦ã¯
- LEGALファイルをå‚ç…§ã—ã¦ãã ã•ã„.
-
- 5. 本プログラムã¸ã®å…¥åŠ›ã¨ãªã‚‹ã‚¹ã‚¯ãƒªãƒ—トãŠã‚ˆã³ï¼Œæœ¬ãƒ—ログラ
- ムã‹ã‚‰ã®å‡ºåŠ›ã®æ¨©åˆ©ã¯æœ¬ãƒ—ログラムã®ä½œè€…ã§ã¯ãªã,ãれãž
- れã®å…¥å‡ºåŠ›ã‚’ç”Ÿæˆã—ãŸäººã«å±žã—ã¾ã™ï¼Žã¾ãŸï¼Œæœ¬ãƒ—ログラムã«
- 組ã¿è¾¼ã¾ã‚Œã‚‹ãŸã‚ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¤ã„ã¦ã‚‚åŒæ§˜ã§ã™ï¼Ž
-
- 6. 本プログラムã¯ç„¡ä¿è¨¼ã§ã™ï¼Žä½œè€…ã¯æœ¬ãƒ—ログラムをサãƒãƒ¼ãƒˆ
- ã™ã‚‹æ„å¿—ã¯ã‚りã¾ã™ãŒï¼Œãƒ—ログラム自身ã®ãƒã‚°ã‚ã‚‹ã„ã¯æœ¬ãƒ—
- ログラムã®å®Ÿè¡Œãªã©ã‹ã‚‰ç™ºç”Ÿã™ã‚‹ã„ã‹ãªã‚‹æå®³ã«å¯¾ã—ã¦ã‚‚責
- 任をæŒã¡ã¾ã›ã‚“.
diff --git a/ChangeLog b/ChangeLog
index 284eb61051..2ba8c07285 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,8042 +1,10419 @@
-Fri Sep 9 10:10:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 24 16:08:21 2001 WATANABE Hirofumi <eban@ruby-lang.org>
- * variable.c (rb_const_search): warn with the actual class/module
- name which defines the deprecated constant.
+ * mkconfig.rb: autoconf 2.50 support.
- * variable.c (rb_const_search): raise with the actual class/module
- name which defines the private constant.
+Thu May 24 14:23:35 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Sep 8 17:47:18 2016 Kazuki Tsujimoto <kazuki@callcc.net>
+ * eval.c (rb_yield_0): need argument adjustment for C defined
+ blocks too.
- * array.c (flatten): use rb_obj_class instead of rb_class_of
- because rb_class_of may return a singleton class.
- [ruby-dev:49781] [Bug #12738]
+Tue May 22 17:10:35 2001 K.Kosako <kosako@sofnec.co.jp>
-Thu Sep 8 17:40:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (rb_alias_variable): should not allow variable
+ aliasing if $SAFE >= 4.
- * tool/rbinstall.rb (gem): use the bindir of each gemspec instead
- of hardcoded 'bin', since rdoc 5.0.0 overrides it.
+Mon May 21 15:26:05 JST 2001 Keiju Ishitsuka <keiju@ishitsuka.com>
-Thu Sep 8 16:47:03 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * lib/irb/multi-irb.rb: delete japanese messages.
- * eval.c (rb_mod_s_used_modules): rename Module.used_refinements to
- Module.used_modules. [Feature #7418] [ruby-core:49805]
+Mon May 21 13:15:25 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
-Thu Sep 8 14:21:48 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * bignum.c (rb_big2str): t should be protected from GC.
- * ext/psych/psych.gemspec, lib/rdoc/rdoc.gemspec: Use file list instead of
- git output. It shows warning message when invoke `make install`
- [Bug #12736][ruby-dev:49778]
+Sun May 20 00:28:43 2001 Akinori MUSHA <knu@iDaemons.org>
-Thu Sep 8 13:41:46 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * ext/socket/extconf.rb: do not clobber $CFLAGS when setting
+ -DSOCKS.
- * insns.def (setclassvariable, setconstant): warn when self is a
- refinement. [Bug #10103] [ruby-core:64143]
+Fri May 18 05:42:28 2001 Akinori MUSHA <knu@iDaemons.org>
-Thu Sep 8 11:29:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * lib/thread.rb: rescue ThreadError in case the thread is dead
+ just before calling Thread#run.
- * hash.c (rb_hash_transform_values, rb_hash_transform_values_bang):
- Rename map_v to transform_values.
- [Feature #12512] [ruby-core:76095]
+Fri May 18 05:29:21 2001 Akinori MUSHA <knu@iDaemons.org>
- * test/ruby/test_hash.rb: ditto.
+ * lib/mkmf.rb (xsystem): make a temporary fix to get $(...) macros
+ properly expanded on a command execution.
-Thu Sep 8 10:08:35 2016 Kazuki Yamaguchi <k@rhe.jp>
+Fri May 18 03:49:55 2001 Brian F. Feldman <green@FreeBSD.org>
- * {ext,test}/openssl: Import Ruby/OpenSSL 2.0.0.beta.2. The full commit
- history since v2.0.0.beta.1 can be found at:
- https://github.com/ruby/openssl/compare/v2.0.0.beta.1...v2.0.0.beta.2
+ * lib/mkmf.rb: unbreak "make install". lib/* must be installed
+ under $rubylibdir, not under $libdir.
-Thu Sep 8 07:23:34 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Thu May 17 19:36:47 2001 Akinori MUSHA <knu@iDaemons.org>
- * lib/rdoc/*, test/rdoc/*: Update rdoc-5.0.0.beta2
- Fixed ri parse defect with left-hand matched classes.
- https://github.com/rdoc/rdoc/pull/420
+ * lib/shell.rb, lib/shell/process-controller.rb,
+ lib/shell/command-processor.rb: translate Japanese comments into
+ English.
-Thu Sep 8 01:12:47 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * doc/shell.rd.jp: RD'ify and make some fixes.
- * eval.c (rb_mod_s_used_refinements): new method
- Module.used_refinements. based on the patch by Charlie
- Somerville. [Feature #7418] [ruby-core:49805]
+ * doc/shell.rd: RD'ify, delete Japanese leftovers, make overall
+ English fixes, and sync with doc/shell.rd.jp.
-Wed Sep 7 17:50:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 17 19:34:11 2001 Akinori MUSHA <knu@iDaemons.org>
- * include/ruby/util.h (setenv): remove POSIX-noncompliant
- definition with 2 arguments.
+ * doc/shell.rd*, lib/shell*: bring shell.rb 0.6 onto the ruby_1_6
+ branch.
-Wed Sep 7 17:35:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu May 17 17:35:04 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
- * unicode/8.0.0/casefold.h, name2ctype.h, unicode/data/8.0.0:
- removing directories/files related to Unicode version 8.0.0
+ * eval.c (rb_call0): address of local_vars might change during eval.
-Wed Sep 7 17:21:55 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 17 07:30:15 2001 Akinori MUSHA <knu@iDaemons.org>
- * lib/timeout.rb (Timeout#timeout): add custom error message
- argument. [Feature #11650]
+ * ext/md5/md5.txt, ext/md5/md5.txt.jp: s/SuperClass/Superclass/.
-Wed Sep 7 17:13:05 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu May 17 06:37:14 2001 Akinori MUSHA <knu@iDaemons.org>
- * common.mk: Updated Unicode version to 9.0.0 [Feature #12513]
+ * ext/md5/md5.txt: make wording fixes.
- * unicode/9.0.0/casefold.h, name2ctype.h, unicode/data/9.0.0:
- new directories/files for Unicode version 9.0.0
+ * ext/md5/md5.txt.jp: ditto.
-Wed Sep 7 16:00:45 2016 Tanaka Akira <akr@fsij.org>
+Thu May 17 05:23:52 2001 Keiju Ishitsuka <keiju@ishitsuka.com>
+ * lib/irb.rb lib/irb/multi-irb.rb lib/irb/ruby-lex.rb lib/irb/version.rb
+ resolve ctrl-c problem
- * lib/open-uri.rb: Allow http to https redirection.
- Note that https to http is still forbidden.
- [ruby-core:20485] [Feature #859] by Roman Shterenzon.
+Tue May 15 17:46:37 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Sep 7 14:56:59 2016 Kazuki Tsujimoto <kazuki@callcc.net>
+ * array.c (rb_ary_and): should not push frozen key string.
- * lib/csv.rb (CSV::{Row,Table}#{each,delete_if}): returns an enumerator
- if no block is given. [ruby-core:75346] [Feature #12347]
+ * array.c (rb_ary_or): ditto.
- * test/csv/test_row.rb: add test for above.
+Mon May 14 13:50:22 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
- * test/csv/test_table.rb: ditto.
+ * eval.c (rb_thread_schedule): should save context before raising
+ deadlock, saved context for current thread might be obsolete.
-Wed Sep 7 14:50:01 2016 Kazuki Tsujimoto <kazuki@callcc.net>
+ * time.c (make_time_t): non DST timezone shift supported (hopefully).
- * gems/bundled_gems: update to power_assert 0.3.1.
+Mon May 14 11:54:20 2001 Tanaka Akira <akr@m17n.org>
-Wed Sep 7 12:16:09 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * signal.c: SIGINFO added.
- * ext/psych/*, test/psych/*: Update psych-2.1.1
- This version fixed following pull requests.
- https://github.com/tenderlove/psych/pull/284
- https://github.com/tenderlove/psych/pull/276
+Mon May 14 08:57:06 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Sep 7 11:51:06 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (rb_ensure): should not SEGV when prot_tag is NULL.
- * lib/rdoc/*, test/rdoc/*: Update rdoc-5.0.0.beta1
- This version is mostly same as r56072. It contains to remove code
- for Ruby 1.8
+Sun May 13 23:49:25 2001 Usaku Nakamura <usa@osb.att.ne.jp>
-Tue Sep 6 09:23:06 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * win32/resource.rb: Modify copyright in resource script.
- * lib/rdoc/rdoc.gemspec: partly reverted for default gem installer.
- upstream configuration is not working on ruby core repository.
+Fri May 11 23:51:54 2001 Usaku Nakamura <usa@osb.att.ne.jp>
-Mon Sep 5 19:35:22 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * process.c: silence VC++ warnings.
- * lib/rdoc/*, test/rdoc/*: Update rdoc/rdoc master(f191513)
- https://github.com/rdoc/rdoc/blob/master/History.rdoc#423--2016--
- https://github.com/rdoc/rdoc/blob/master/History.rdoc#422--2016-02-09
+ * sprintf.c: ditto.
-Sun Sep 4 00:17:55 2016 Sho Hashimoto <sho-h@ruby-lang.org>
+Fri May 11 03:38:11 2001 Akinori MUSHA <knu@iDaemons.org>
- * proc.c: [DOC] fix Object#define_singleton_method and
- main.define_method return value. [ci skip]
+ * README.EXT: Document find_library(), with_config() and
+ dir_config().
-Sat Sep 3 11:28:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 11 03:37:53 2001 Akinori MUSHA <knu@iDaemons.org>
- * thread_pthread.c (ruby_init_stack): check stack bounds even if
- get_main_stack succeeded, on the "co-routine" case.
- https://github.com/ruby/ruby/commit/53953ee#commitcomment-18887413
+ * README.EXT.jp: Remove the description of find_header() because
+ such a function does not actually exist.
+
+ * README.EXT.jp: Update the description of dir_config().
-Fri Sep 2 16:06:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 11 02:42:40 2001 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * internal.h (MEMO_V1_SET, MEMO_V2_SET): fix typos. use the macro
- parameter, not the local variable.
+ * README, README.jp: Fix CVS access and mailing lists info.
-Fri Sep 2 00:55:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 11 02:00:44 2001 Ryo HAYASAKA <ryoh@jaist.ac.jp>
- * ext/extmk.rb (timestamp_file): move extmk.rb specific tricks
- from lib/mkmf.rb. keep RUBYCOMMONDIR prefix not to conflict
- with a timestamp file in the toplevel.
+ * bignum.c (bigdivrem): access boundary bug.
-Thu Sep 1 14:24:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue May 8 17:12:43 2001 K.Kosako <kosako@sofnec.co.jp>
- * ext/extmk.rb (gems): move dirty hacks for bundled gems from
- mkmf.rb.
+ * eval.c (is_defined): core dumped during instance_eval for
+ special constants.
- * lib/mkmf.rb (create_makefile): yield all configuration strings.
+ * eval.c (rb_eval): ditto.
-Wed Aug 31 17:39:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue May 8 08:59:01 2001 Akinori MUSHA <knu@iDaemons.org>
- * ext/extmk.rb (create_makefile): make gem.build_complete file
- under TARGET_SO_DIR and install it only when the gem build
- succeeded. [ruby-core:77057] [Bug #12681]
+ * doc/forwardable.rd, doc/forwardable.rd.jp: Hit `=begin' and
+ `=end' in proper places so rd2 can format them without a problem.
-Wed Aug 31 15:36:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * doc/irb/irb-tools.rd.jp, doc/irb/irb.rd, doc/irb/irb.rd.jp:
+ ditto.
+
+Tue May 8 08:56:05 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * doc/forwardable.rd, doc/forwardable.rd.jp, lib/forwardable.rb:
+ Bring forwardable 1.1 onto the ruby_1_6 branch.
+
+Tue May 8 08:35:09 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * doc/irb/irb-tools.rd.jp, doc/irb/irb.rd.jp: Convert from JIS to
+ EUC.
+
+Tue May 8 03:46:24 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * sample/rbc.rb: Obsoleted by IRB.
+
+Mon May 7 15:58:45 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (arg): "||=" should not warn for uninitialized instance
+ variables.
+
+ * eval.c (rb_eval): ditto.
+
+ * eval.c (eval): preserve and restore ruby_cref as well.
+
+Mon May 7 15:45:48 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/ftools.rb (syscopy): chmod destination file only if
+ it does not exist.
+
+Thu May 3 03:41:01 2001 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
+
+ * configure.in: get --enable-shared to work on MacOS X.
+
+ * Makefile.in: make $(LIBRUBY_SO) depend on miniruby properly.
+ Now `make -jN' should work without a problem.
+
+Wed May 2 20:39:35 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * dir.c (rb_glob, rb_iglob): remove unnecessary FNM_PATHNAME.
+
+Wed May 2 11:46:13 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (block_pass): should not downgrade safe level.
+
+Tue May 1 17:55:58 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): lex_state after RESCUE_MOD should be EXPR_BEG.
+
+Tue May 1 03:36:50 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * sample/irb.rb, lib/irb.rb, lib/irb/*, doc/irb/*: Merge from irb
+ 0.7.3 and irb-tools 0.7.1.
+
+ * instruby.rb: Install help-message's too.
+
+ * lib/irb/main.rb: This file is not needed anymore.
+
+Thu Apr 26 22:36:11 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: don't use tzname on cygwin 1.3.1+.
+
+ * configure.in: add -mieee/-ieee to CFLAGS on OSF1/Alpha
+ to disable "DIVISION BY ZERO" exception.
+
+Thu Apr 26 22:30:43 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): should preserve value of ruby_errinfo.
+
+Thu Apr 26 10:36:09 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_schedule): infinite sleep should not cause
+ dead lock.
+
+Wed Apr 25 16:40:44 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_flatten_bang): proper recursive detection.
+
+Wed Apr 25 15:36:15 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (yield_under): need not to prohibit at safe level 4.
+
+Tue Apr 24 16:03:25 2001 Hiroshi Igarashi <iga@ruby-lang.org>
+
+ * ext/extmk.rb.in: add target `distclean' in Makefile for extlib.
+ target `clean' doesn't remove Makefile.
+
+Tue Apr 24 15:57:45 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * ext/extmk.rb.in, lib/mkmf.rb: (dir_config) do not add the
+ specified include directory if already included in $CPPFLAGS.
+
+ * ext/extmk.rb.in, lib/mkmf.rb: (dir_config) return a more useful
+ value, [include_dir, lib_dir].
+
+Tue Apr 24 15:35:32 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ruby.c (set_arg0): wrong predicate when new $0 value is bigger
+ than original space.
+
+Mon Apr 23 14:43:59 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (id2ref): should use NUM2ULONG()
+
+ * object.c (rb_mod_const_get): check whether name is a class
+ variable name.
+
+ * object.c (rb_mod_const_set): ditto.
+
+ * object.c (rb_mod_const_defined): ditto.
+
+Sun Apr 22 17:44:37 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: add -mieee to CFLAGS on Linux/Alpha
+ to disable "DIVISION BY ZERO" exception.
+
+ * configure.in: remove -ansi on OSF/1.
+
+Sat Apr 21 22:33:26 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_float): precision changed to "%.16g"
+
+Sat Apr 21 22:07:58 2001 Guy Decoux <decoux@moulon.inra.fr>
+
+ * eval.c (rb_call0): wrong retry behavior.
+
+Fri Apr 20 19:12:20 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * numeric.c (fix_aref): a bug on long>int architecture.
+
+Fri Apr 20 14:57:15 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (rb_eval_string_wrap): should restore ruby_wrapper.
+
+Wed Apr 18 04:37:51 2001 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: CGI::Cookie: no use PATH_INFO.
+
+Wed Apr 18 00:24:40 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * regex.c (re_compile_pattern): char class at either edge of range
+ should be invalid.
+
+Tue Apr 17 16:54:39 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (safe_getter): should use INT2NUM().
+
+Tue Apr 17 15:12:56 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big2long): 2**31 cannot fit in 31 bit long.
+
+Sat Apr 14 22:46:43 2001 Guy Decoux <decoux@moulon.inra.fr>
+
+ * regex.c (calculate_must_string): wrong length calculation.
+
+Sat Apr 14 13:33:32 2001 Usaku Nakamura <usa@osb.att.ne.jp>
+
+ * win32/config.status.in: no longer use missing/alloca.c.
+
+ * win32/Makefile.sub: ditto.
+
+Fri Apr 13 12:40:48 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (rb_thread_start_0): fixed memory leak.
+
+Fri Apr 13 16:41:18 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (none): should clear cmdarg_stack too.
+
+Fri Apr 13 06:19:29 2001 GOTOU YUUZOU <gotoyuzo@notwork.org>
+
+ * io.c (rb_fopen): use setvbuf() to avoid recursive malloc() on
+ some platforms.
+
+Wed Apr 11 23:36:26 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (rb_stat_dev): device functions should honor stat field
+ types (except long long such as dev_t).
+
+Wed Apr 11 18:07:53 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (rb_mod_nesting): should not push nil for nesting array.
+
+ * eval.c (rb_mod_s_constants): should not search array by
+ rb_mod_const_at() for nil (happens for singleton class).
+
+Wed Apr 11 13:29:26 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * class.c (rb_singleton_class_attached): should modify iv_tbl by
+ itself, no longer use rb_iv_set() to avoid freeze check error.
+
+ * variable.c (rb_const_get): error message "uninitialized constant
+ Foo at Bar::Baz" instead of "uninitialized constant Bar::Baz::Foo".
+
+Tue Apr 10 02:24:40 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * io.c (opt_i_set): should strdup() inplace_edit string.
+
+Mon Apr 9 23:29:54 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (exec_under): need to push cref too.
+
+Mon Apr 9 12:05:44 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (Init_File): should redifine "new" class method.
+
+Mon Apr 9 11:56:52 2001 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb: fix typo.
+
+Thu Apr 5 22:40:12 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_const_get): no recursion to show full class path
+ for modules.
+
+ * eval.c (rb_set_safe_level): should set safe level in curr_thread
+ as well.
+
+ * eval.c (safe_setter): ditto.
+
+Thu Apr 5 13:46:06 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * object.c (rb_obj_is_instance_of): nil belongs to false, not true.
+
+Thu Apr 5 02:19:03 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (make_time_t): proper (I hope) daylight saving time
+ handling for both US and Europe. I HATE SUMMER TIME!
+
+ * eval.c (rb_thread_wait_for): non blocked signal interrupt should
+ stop the interval.
+
+Wed Apr 4 03:47:03 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * class.c (rb_mod_clone): should copy method bodies too.
+
+ * bignum.c (bigdivrem): should trim trailing zero bdigits of
+ remainder, even if dd == 0.
+
+Tue Apr 3 15:29:10 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * Makefile.in: Introduce MAINLIBS.
+
+ * configure.in: Link libc_r against the ruby executable on
+ FreeBSD, which is the first attempt to work around a certain
+ problem regarding pthread on FreeBSD. It should make ruby/libruby
+ happy when it loads an extention to a library compiled and linked
+ with -pthread. Note, however, that libruby is _not_ linked with
+ libc_r so as not to mess up pthread unfriendly stuff including
+ apache+mod_ruby and vim6+ruby_interp.
+
+Tue Apr 3 09:56:20 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/extmk.rb.in (create_makefile): create def file only if
+ it does not yet exist.
+
+ * lib/mkmf.rb: ditto.
+
+Tue Apr 3 00:05:07 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (make_time_t): remove HAVE_TM_ZONE code since it
+ sometimes reports wrong time.
+
+ * time.c (make_time_t): remove unnecessary range check for
+ platforms where negative time_t is available.
+
+Mon Apr 2 14:25:49 2001 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/monitor.rb (wait): ensure reentrance.
+
+ * lib/monitor.rb (wait): fix timeout support.
+
+Mon Apr 2 12:44:53 2001 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb: backport from ruby-1.7.
+
+Mon Apr 2 01:16:24 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c: use ruby's opendir on mingw32.
+
+ * missing/dir.h, dir.c, Makefile: ditto.
+
+Sun Apr 1 23:26:14 2001 TOYOFUKU Chikanobu <toyofuku@juice.or.jp>
+
+ * numeric.c (flodivmod): a bug in no fmod case.
+
+Sun Apr 1 18:36:14 2001 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * process.c (pst_wifsignaled): should apply WIFSIGNALED for status
+ (int), not st (VALUE).
+
+Sat Mar 31 03:24:10 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * class.c (rb_include_module): module inclusion should be check
+ taints.
+
+Fri Mar 30 12:51:19 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * class.c (rb_include_module): freeze check at first.
+
+Thu Mar 29 17:05:09 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_attr): sprintf() and rb_intern() moved into
+ conditional body.
+
+Wed Mar 28 23:43:00 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * ext/extmk.rb.in, lib/mkmf.rb: add C++ rules in addition to C
+ rules for the mswin32 platforms.
+
+Wed Mar 28 19:29:21 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * ext/extmk.rb.in, lib/mkmf.rb: move C++ rules to the right place.
+
+Wed Mar 28 17:39:04 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (rb_str2cstr): warn if string contains \0 and length
+ value is ignored.
+
+Wed Mar 28 15:00:31 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * class.c (rb_singleton_class_clone): should copy class constant
+ table as well.
+
+Wed Mar 28 15:03:23 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * class.c (rb_include_module): sometimes cache was mistakenly left
+ uncleared - based on the patch by K.Kosako.
+
+Wed Mar 28 09:52:33 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/Makefile.sub: disable global optimization.
+
+Tue Mar 27 15:00:54 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (rb_mod_define_method): should have clear method cache.
+
+ * eval.c (rb_mod_define_method): should have raised exception for
+ type error.
+
+Tue Mar 27 14:48:17 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ruby.h: changed "extern INLINE" to "static inline".
+
+Mon Mar 26 23:19:33 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * time.c (rb_strftime): check whether strftime returns empty string.
+
+Mon Mar 26 18:14:47 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * dir.c (rb_glob_helper): part of 1.7 globber backported to proper
+ following of symlinks.
+
+Mon Mar 26 17:21:07 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c: remove TMP_PROTECT_END to prevent C_ALLOCA crash.
+
+Mon Mar 26 14:04:41 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/Win32API/Win32API.c: remove Init_win32api().
+
+Sat Mar 24 23:44:50 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ev_const_defined): should ignore toplevel cbase (Object).
+
+ * eval.c (ev_const_get): ditto.
+
+Fri Mar 23 12:18:44 2001 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
+
+ * ext/curses/curses.c: curses on Mac OS X public beta does not
+ have _maxx etc.
+
+Fri Mar 23 10:50:31 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): should truncate trailing zero short for
+ bignums.
+
+Thu Mar 22 22:15:45 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/Win32API/extconf.rb: add -fno-omit-frame-pointer.
+
+Thu Mar 22 17:43:44 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ruby.h: better inline function support.
+
+ * configure.in (NO_C_INLINE): check if inline is available for the
+ C compiler.
+
+Wed Mar 21 23:07:45 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c (win32_stat): WinNT/2k "//host/share" support.
+
+Wed Mar 21 01:26:14 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (id2ref): sometimes confused symbol and reference.
+
+Tue Mar 20 23:09:33 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c (win32_stat): UNC support.
+
+ * dir.c (extract_path): fix "./*" problem.
+
+Mon Mar 19 19:14:47 2001 Guy Decoux <decoux@moulon.inra.fr>
+
+ * marshal.c (shortlen): shortlen should return number of bytes
+ written.
+
+Mon Mar 19 18:56:55 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * stable version 1.6.3 released.
+
+Mon Mar 19 16:52:23 2001 K.Kosako <kosako@sofnec.co.jp>
+
+ * eval.c (ev_const_defined): need not to check if cbase->nd_class
+ is rb_cObject.
+
+ * eval.c (ev_const_get): ditto.
+
+Mon Mar 19 16:27:32 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (THREAD_ALLOC): flags should be initialized.
+
+ * signal.c (rb_f_kill): should use FIX2INT, not FIX2UINT.
+
+Mon Mar 19 11:03:10 2001 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * marshal.c (r_object): len calculation patch was wrong for
+ machines SIZEOF_BDIGITS == SIZEOF_SHORT.
+
+ * gc.c: alloca prototype reorganized for C_ALLOCA machine.
+
+Sun Mar 18 08:58:18 2001 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: // === '' --> //.match('')
+
+ * lib/cgi.rb: cgi#header(): improvement for mod_ruby.
+
+ * lib/cgi.rb: cgi#rfc1123date(): improvement.
+ thanks to TADA Tadashi <sho@spc.gr.jp>.
+
+ * lib/cgi.rb: cgi#rfc1123date(): document bug fix.
+ thanks to Kazuhiro NISHIYAMA <zn@mbf.nifty.com>.
+
+ * lib/cgi.rb: cgi#header(): bug fix.
+ thanks to IWATSUKI Hiroyuki <don@na.rim.or.jp>.
+
+Fri Mar 16 17:21:25 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * configure.in: Set SOLIBS properly for all ELF and
+ FreeBSD/NetBSD/OpenBSD a.out platforms so that the shlib
+ dependencies are recorded in the libruby shlib.
+
+Wed Mar 14 16:41:45 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_schedule): raise FATAL just once to
+ THREAD_TO_KILL.
+
+Wed Mar 14 10:41:34 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): 0 (= Qfalse) is a valid value, so that
+ default self should be checked by klass == 0.
+
+ * bignum.c (rb_cstr2inum): should disallow '++1', '+-1', etc.
+
+Tue Mar 13 17:51:09 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ev_const_defined): add new parameter self for special
+ const fallback.
+
+ * eval.c (ev_const_get): ditto.
+
+Tue Mar 13 16:39:45 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * dir.c (rb_glob_helper): fix drive letter handling on DOSISH.
+
+Tue Mar 13 15:01:12 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: add HTTPRequest#basic_auth.
+
+ * lib/net/smtp.rb: raise if only account or password is given.
+
+ * lib/net/protocol.rb: WriteAdapter#<< returns self.
+
+Tue Mar 13 14:41:16 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (argf_seek): wrong calling sequence of rb_io_seek().
+
+Mon Mar 12 18:59:38 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/mkmf.rb (create_makefile): save/restore $libs and $LIBPATH.
+
+Sun Mar 11 00:55:31 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/mkmf.rb (install_rb): fix handling of destination path.
+
+Sat Mar 10 02:34:18 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * math.c (math_log, math_log10): use nan() instead of 0.0/0.0 on Cygwin.
+
+Thu Mar 8 17:43:59 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: one write(2) per one line.
+
+Wed Mar 7 14:26:11 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * math.c (math_log, math_log10): should return NaN if x < 0.0
+ on Cygwin.
+
+Thu Mar 7 10:31:26 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * parse.y (stmt): while/until modifier must work for empty body.
+
+Tue Mar 6 22:53:58 2001 Kazuhiro Yoshida <moriq.kazuhiro@nifty.ne.jp>
+
+ * ruby.c (ruby_set_argv): clear ARGV contents before adding args.
+
+Tue Mar 6 10:50:29 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (primary): rescue and ensure clauses should be allowed
+ to appear in singleton method body.
+
+Mon Mar 5 17:25:13 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_eq): compare Procs using blocktag equality.
+
+ * eval.c (proc_to_s): stringify according to block tag address.
+
+Mon Mar 5 17:19:56 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c (gettimeofday): use GetLocalTime() instead of ftime()
+ for high-resolution timing.
+
+Sun Mar 4 20:45:20 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * ext/extmk.rb.in, lib/mkmf.rb: add C++ rules in addition to C
+ rules.
+
+Sun Mar 4 17:01:09 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * string.c (trnext): support backslash escape in String#tr.
+
+Wed Feb 28 11:02:41 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_delete_bang): delete! should take at least 1
+ argument.
+
+Tue Feb 27 16:38:15 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ev_const_get): retrieve Object's caonstat if no current
+ class is available (e.g. defining singleton class for Fixnums).
+
+ * eval.c (ev_const_defined): check Object's constant if no current
+ class is available (e.g. defining singleton class for Fixnums).
+
+ * eval.c (proc_call): ignore block to `call' always, despite of
+ being orphan or not.
+
+Wed Feb 27 10:16:32 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * eval.c (rb_yield_0): should check based on rb_block_given_p()
+ and rb_f_block_given_p().
+
+Mon Feb 26 16:20:27 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ruby.c (proc_options): call ruby_show_version() just once.
+
+Mon Feb 26 00:04:52 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_call): should not modify ruby_block->frame.iter
+ based on ruby_frame->iter altered by PUSH_ITER().
+
+Mon Feb 26 05:27:52 2001 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/net/telnet.rb: #telnetmode(), #binmode(): bug fix.
+ thanks to nobu.nakada@nifty.ne.jp.
+
+Mon Feb 26 04:55:50 2001 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: CGI#form(): bug fix.
+ thanks to MoonWolf <moonwolf@moonwolf.com>.
+
+ * lib/cgi.rb: CGI#rfc1123_date(): improvement.
+ thanks to Tomoyasu Akita <genzo-@dm4lab.to>.
+
+ * lib/cgi.rb: CGI#header(): improvement for mod_ruby.
+ thanks to Shugo Maeda <shugo@ruby-lang.org>.
+
+Sun Feb 25 02:45:30 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * file.c (rb_file_s_rename): avoid Cygwin's bug.
+
+Sat Feb 24 23:32:55 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_fd_close): should save current context before
+ raising exception.
+
+Sat Feb 24 22:14:00 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c (myrename): fix error handling.
+
+Sat Feb 24 15:43:31 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: use net 1.2 for also ruby 1.6 branch.
+
+ * lib/net/smtp.rb: ditto.
+
+ * lib/net/pop.rb: ditto.
+
+ * lib/net/http.rb: ditto.
+
+Fri Feb 23 16:36:09 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: always close connection if body is not exist.
+
+Fri Feb 23 13:27:05 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: keep-alive detection was incomplete.
+
+Fri Feb 23 08:24:53 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: clear read buffer after reopen.
+
+ * lib/net/http.rb: update RD document.
+
+Tue Feb 20 16:37:58 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big2long): should not raise RangeError for Bignum
+ LONG_MIN value.
+
+Mon Feb 19 17:46:37 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_substr): "a"[1,2] should return ""; need
+ rubicon upgrade.
+
+Mon Feb 19 01:55:43 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (secure_visibility): visibility check for untainted modules.
+
+Mon Feb 19 00:29:29 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * signal.c (sigpipe): sighandler which does nothing.
+
+ * signal.c (trap): set sigpipe function for SIGPIPE.
+
+ * signal.c (Init_signal): default SIGPIPE handler should be
+ sigpipe function.
+
+Sun Feb 18 15:42:38 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/curses/extconf.rb: add dir_config.
+
+ * missing/flock.c: use fcntl(2) instead of lockf(2).
+
+Sun Feb 18 13:02:03 2001 Yasushi Shoji <yashi@yashi.com>
+
+ * array.c (rb_ary_subseq): wrong boundary check.
+
+Fri Feb 16 01:44:56 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (set_outfile): f should be the FILE* from the assigning value.
+
+Thu Feb 15 11:33:49 2001 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/cgi/session.rb (close): fixed reversed condition.
+
+Wed Feb 14 17:28:24 2001 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb: supports unknown resp_text_code.
+
+Wed Feb 14 00:44:17 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * dir.c (dir_s_glob): call rb_yield directly (via push_pattern) if
+ block is given to the method.
+
+ * dir.c (push_pattern): do not call rb_ary_push; yield directly.
+
+Tue Feb 13 23:05:38 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * dir.c (lstat): should use rb_sys_stat if lstat(2) is not
+ available.
+
+Tue Feb 13 17:00:18 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: supports HTTP 1.0 server.
+
+Tue Feb 13 01:13:43 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (primary): preserve and clear in_single and in_def using
+ stack to prevent nested method errors in singleton class bodies.
+
+Sun Feb 11 16:00:30 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * eval.c (stack_length): use __builtin_frame_address() only if
+ GCC and i386 CPU.
+
+ * gc.c (rb_gc, Init_stack): ditto.
+
+ * configure.in: add ac_cv_func_getpgrp_void=yes on DJGPP.
+
+Sat Feb 10 23:43:49 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * hash.c (rb_any_hash): dumped core on machines sizeof(int) != sizeof(long).
+
+Sat Feb 10 23:07:15 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * regex.c (PREV_IS_A_LETTER): should not treat c>0x7f as a word
+ character if -Kn.
+
+Sat Feb 10 00:06:28 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * win32/win32.c (win32_stat): replace stat for enable when pathname
+ ends with '/' or '\' for mswin32 on Win9X / Win2k.
+
+ * win32/win32.h: ditto.
+
+ * ruby.h: ditto.
+
+ * dir.c (rb_glob_helper): ditto.
+
+ * file.c (rb_stat, rb_file_s_stat, eaccess, check3rdbyte): ditto.
+
+Fri Feb 9 22:54:57 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ruby.c (ruby_init_loadpath): convert '\\' to '/'
+ before finding executable file path.
+
+Fri Feb 9 17:41:53 2001 Triet H. Lai <thlai@mail.usyd.edu.au>
+
+ * dir.c (rb_glob_helper): do not follow symbolic links.
+
+Fri Feb 8 23:53:08 2001 Usaku Nakamura <usa@osb.att.ne.jp>
+
+ * win32/config.h.in (inline): add inline definition.
+
+Thu Feb 8 21:27:24 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/mkmf.rb (install_rb): fix handling of relative path.
+
+ * lib/mkmf.rb (create_makefile): add srcdir.
+
+Wed Feb 7 16:05:22 2001 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * parse.y (parse_quotedwords): %w should allow parenthesis escape.
+
+Wed Feb 7 00:57:42 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (parse_qstring): %q should allow terminator escape.
+
+Wed Feb 7 00:57:42 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * re.c (rb_reg_equal): all option flags should be same to be equal.
+
+Tue Feb 6 21:01:29 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: ignore EOFError on only specified case.
+
+ * lib/net/http.rb: take HTTP 1.0 server into account.
+
+Mon Feb 5 00:39:06 2001 KANEKO Naoshi <wbs01621@mail.wbs.ne.jp>
+
+ * dir.c: use ISXXX() instead of isxxx().
+
+ * dln.c (aix_loaderror): ditto.
+
+ * file.c (rb_file_s_expand_path): ditto.
+
+ * string.c (rb_str_upcase_bang): ditto.
+
+ * win32/win32.c (do_spawn): ditto.
+
+ * win32/win32.c (NtMakeCmdVector): ditto.
+
+ * win32/win32.c (opendir): ditto.
+
+Fri Feb 3 00:48:50 2001 Usaku Nakamura <usa@osb.att.ne.jp>
+
+ * win32/win32.c (isInternalCmd): ignore case for shell's internal
+ command. (marge from HEAD)
+
+Fri Feb 2 16:14:51 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (POP_VARS): propagate DVAR_DONT_RECYCLE, if
+ SCOPE_DONT_RECYCLE of ruby_scope is set.
+
+Wed Jan 31 22:27:29 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: gcc-2.95.2-7(cygwin) support.
+ add -mwin32 if available.
+
+ * cygwin/GNUmakefile: ditto.
+
+Mon Jan 29 17:36:19 2001 TOYOFUKU Chikanobu <toyofuku@juice.or.jp>
+
+ * eval.c (rb_eval): nd_iter evaluation should be wrapped by
+ BEGIN_CALLARGS and END_CALLARGS.
+
+Mon Jan 29 01:40:27 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (str_independent): should not clear str->orig here.
+ it's too early.
+
+Wed Jan 24 01:45:49 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (POP_BLOCK_TAG): call rb_gc_force_recycle() if block has
+ not been objectified.
+
+ * eval.c (rb_callcc): should nail down block->tag history to avoid
+ rb_gc_force_recycle().
+
+Tue Jan 23 18:51:57 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (rb_gc_call_finalizer_at_exit): should finalize objects in
+ deferred_final_list too.
+
+Tue Jan 23 16:10:12 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (os_live_obj): do not list terminated object.
+
+ * gc.c (os_obj_of): ditto.
+
+ * gc.c (rb_gc_mark): support new T_BLKTAG tag.
+
+ * gc.c (obj_free): ditto.
+
+ * eval.c (new_blktag): creation of new block tag, which holds
+ destination of global jump and orphan status.
+
+ * eval.c (block_pass): break from orphan Proc object will raise a
+ LocalJumpError exception.
+
+Mon Jan 22 16:33:16 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * mkconfig.rb: autoconf 2.49 support.
+
+Sat Jan 20 03:54:00 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): fixed serious syntax misbehavior. do's
+ preceding was too high. a block in `foo bar do .. end' should
+ be passed to `foo', not `bar'.
+
+ * parse.y (block_call): syntax restructure.
+
+Fri Jan 19 04:04:31 2001 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/irb/ruby-lex.rb: Merge from HEAD: rev.1.4
+
+Wed Jan 17 13:28:26 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: remove DEFS definition.
+
+ * mkconfig.rb: ditto.
+
+ * win32/config.status.in: ditto.
+
+Tue Jan 16 16:59:14 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: ignore EOFError for read
+
+Sun Jan 14 21:49:28 2001 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * sprintf.c (rb_f_sprintf): simple typo. binary base should be 2,
+ not '2'.
+
+Sun Jan 14 02:49:57 2001 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb (adding): too few "yield" in case of arg is
+ not String/File.
+
+Sat Jan 13 19:18:18 2001 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * re.c (rb_reg_desc): separate RE_OPTION_MULTILINE
+
+ * re.c (rb_reg_options): add RE_OPTION_{POSIXLINE,RE_OPTION_MULTILINE,
+ RE_OPTION_EXTENDED}
+
+Thu Jan 11 06:45:55 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (rb_mod_dup): should propagate FL_SINGLETON.
+
+ * object.c (inspect_obj): handles the case of no instance variable.
+
+Wed Jan 10 01:50:45 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_reverse_bang): forgot to call rb_str_modify().
+
+Tue Jan 9 17:41:40 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (rb_obj_taint): check frozen status before modifying
+ taint status.
+
+ * object.c (rb_obj_untaint): ditto.
+
+Mon Jan 8 21:35:10 2001 Guy Decoux <decoux@moulon.inra.fr>
+
+ * file.c (path_check_1): should restore modified path.
+
+Mon Jan 8 21:24:37 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (bigdivrem): t2 might be too big for signed long; do
+ not use rb_int2big(), but rb_uint2big().
+
+Mon Jan 8 03:09:58 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * error.c (rb_load_fail): new func to report LoadError.
+
+ * ruby.c (load_file): use rb_load_fail.
+
+Sat Jan 6 00:55:59 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c (pack_pack): template "m2" or "u2" caused inifinite loop.
+
+Fri Jan 5 01:02:17 2001 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ruby_finalize): should enclosed by PUSH_TAG/POP_TAG.
+
+Sun Dec 31 01:39:16 2000 Guy Decoux <decoux@moulon.inra.fr>
+
+ * eval.c (rb_mod_define_method): wrong comparison for blocks.
+
+Sat Dec 30 19:28:50 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (id2ref): should handle Symbol too.
+
+ * gc.c (id2ref): should print original ptr value
+
+Sat Dec 30 03:14:22 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_iterate): NODE_CFUNC does not protect its data
+ (nd_tval), so create new node NODE_IFUNC for iteration C
+ function.
+
+ * eval.c (rb_yield_0): use NODE_IFUNC.
+
+ * gc.c (rb_gc_mark): support NODE_IFUNC.
+
+Fri Dec 29 11:41:55 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (mem_error): prohibit recursive mem_error().
+ (ruby-bugs-ja:PR#36)
+
+Fri Dec 29 11:05:41 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_fd_writable): should not switch context if
+ rb_thread_critical is set.
+
+ * eval.c (rb_thread_wait_fd): ditto.
+
+ * eval.c (rb_thread_wait_for): ditto.
+
+ * eval.c (rb_thread_select): ditto.
+
+ * eval.c (rb_thread_join): join during critical section causes
+ deadlock.
+
+Tue Dec 26 18:46:41 2000 NAKAMURA Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/debug.rb: Avoid thread deadlock in debugging stopped thread.
+
+ * lib/debug.rb: Uncleared 'finish' state.
+
+Tue Dec 26 16:53:55 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): remove dvar node by rb_gc_force_recycle()
+ more eagerly.
+
+ * eval.c (rb_f_binding): recycling should be stopped for outer
+ scope too.
+
+ * eval.c (proc_new): ditto.
+
+Tue Dec 26 15:45:35 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_inspect): should treat multibyte chracters
+ properly.
+
+Mon Dec 25 17:49:08 2000 K.Kosako <kosako@sofnec.co.jp>
+
+ * string.c (rb_str_replace_m): unexpected string share happens if
+ replace is done for associated (STR_NO_ORIG) string.
+
+Tue Dec 26 15:01:53 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_f_p): should not call rb_io_flush() if rb_defout is not
+ a IO (T_FILE).
+
+Mon Dec 25 15:52:39 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * stable version 1.6.2 released.
+
+Mon Dec 25 05:11:04 2000 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: version 2.1.2 (some bug fixes).
+
+ * lib/cgi.rb: Regexp::last_match[1] --> $1
+
+ * lib/net/telnet.rb: ditto.
+
+Mon Dec 25 04:43:02 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: does not send HEAD on closing socket.
+
+Mon Dec 25 00:44:48 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * hash.c (rb_any_cmp): should use rb_str_cmp() if TYPE == T_STRING
+ and CLASS_OF == rb_cString.
+
+ * string.c (rb_str_new4): should copy class of original too.
+
+Mon Dec 25 00:04:54 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * eval.c (rb_thread_schedule): initial value of `max' changed to -1.
+
+Mon Dec 25 00:16:14 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_replace_m): copy-on-write replace.
+
+ * parse.y (yylex): should handle => after identifier as well as ==
+ and =~.
+
+Sat Dec 23 23:55:57 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_cstr2inum): Integer("") should not return 0.
+
+Sat Dec 23 11:55:57 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_and): Array#& should preverve original order.
+
+Sat Dec 23 03:44:16 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: set @closed false in Socket#reopen.
+
+ * lib/net/pop.rb: add POP3.foreach, delete_all.
+
+ * lib/net/pop.rb: add POP3#delete_all.
+
+ * lib/net/http.rb: add HTTP.version_1_1, version_1_2
+
+ * lib/net/http.rb: refactoring.
+
+Fri Dec 22 23:11:12 2000 Ueno Katsuhiro <unnie@blue.sky.or.jp>
+
+ * eval.c (rb_feature_p): ext might be null.
+
+Fri Dec 22 17:04:12 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * win32/win32.c (myselect): avoid busy loop by adjusting fd_count.
+
+Fri Dec 22 15:07:55 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_cstr2inum): prefix like '0x' had removed too much.
+
+Thu Dec 21 13:01:46 2000 Tanaka Akira <akr@m17n.org>
+
+ * lib/net/ftp.rb (makeport): don't use TCPsocket.getaddress.
+
+Wed Dec 20 12:00:15 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big_lshift): should cast up to BDIGIT_DBL.
+
+ * parse.y (yylex): disallow trailing '_' for numeric litrals.
+
+ * bignum.c (rb_cstr2inum): allow `_' within converting string.
+
+ * eval.c (specific_eval): should take no argument if block is
+ supplied.
+
+Tue Dec 19 13:44:50 2000 K.Kosako <kosako@sofnec.co.jp>
+
+ * io.c (rb_f_p): should flush rb_defout, not stdout.
+
+Tue Dec 19 00:57:10 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (time_minus): usec might overflow. (ruby-bugs-ja:PR#35)
+
+ * eval.c (rb_obj_extend): Object#extend should take at least one
+ argument.
+
+ * parse.y (mrhs_basic): should check value_expr($3), not $1.
+
+Mon Dec 18 23:18:39 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * util.c (mblen, __crt0_glob_function): add for multibyte
+ on DJGPP 2.03.
+
+Mon Dec 18 18:10:30 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (time_plus): usec might underflow (ruby-bugs-ja:#PR33).
+
+Mon Dec 18 08:11:20 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * hash.c (rb_hash_set_default): should call rb_hash_modify().
+
+Sat Dec 16 02:58:26 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * eval.c (rb_eval): should clear ruby_errinfo on retry.
+
+ * eval.c (rb_rescue2): ditto.
+
+Thu Dec 14 13:06:18 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * class.c (rb_include_module): prohibit fronzen class/module.
+
+ * eval.c (rb_frozen_class_p): make external.
+
+ * intern.h (rb_frozen_class_p): prototyped.
+
+ * intern.h (rb_undef): prototyped not but rb_undef_method()
+ which is also in ruby.h.
+
+Thu Dec 14 09:20:26 2000 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: support -T1 on ruby 1.6.2
+
+ * lib/cgi.rb: $1 --> Regexp::last_match[1]
+
+ * lib/net/telnet.rb: ditto.
+
+Wed Dec 13 23:27:06 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): handles case statement without expr, which
+ looks for any TRUE (non nil, non false) when expression.
+
+ * parse.y (primary): case expression should not be compstmt, but
+ mere expr.
+
+ * parse.y (primary): case without following expression is now
+ separated rule.
+
+Wed Dec 13 12:41:27 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ruby.c (proc_options): accept "--^M" for DOS line endings.
+
+Tue Dec 12 15:45:42 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (newline_node): cancel newline unification.
+
+Mon Dec 11 23:01:57 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): supports cases `?' precedes EOF and newline.
+
+Mon Dec 11 12:11:25 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (call_end_proc): some frame members were left
+ uninitialized.
+
+Mon Dec 11 01:14:58 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_fptr_finalize): do not fclose stdin, stdout and
+ stderr at exit.
+
+Sat Dec 9 17:34:48 2000 Tachino Nobuhiro <tachino@open.nm.fujitsu.co.jp>
+
+ * time.c (time_cmp): should check with kind_of?, not instance_of?
+
+ * time.c (time_eql): ditto.
+
+ * time.c (time_minus): ditto.
+
+Fri Dec 8 17:23:25 2000 Tachino Nobuhiro <tachino@open.nm.fujitsu.co.jp>
+
+ * sprintf.c (rb_f_sprintf): proper string precision treat.
+
+Fri Dec 8 10:44:05 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_mod_remove_cvar): Module#remove_class_variable
+ added.
+
+Thu Dec 7 17:35:51 2000 Shugo Maeda <shugo@ruby-lang.org>
+
+ * eval.c (stack_length): don't use __builtin_frame_address() on alpha.
+
+Wed Dec 6 18:07:13 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * djgpp/config.sed, win32/Makefile.sub: typo.
+
+ * eval.c (rb_mod_define_method): avoid VC4.0 warnings.
+
+Wed Dec 6 13:38:08 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_and): tuning, make hash from shorter operand.
+
+Wed Dec 6 01:28:50 2000 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
+
+ * gc.c (rb_gc): __builtin_frame_address() should not be used on
+ MacOS X.
+
+ * gc.c (Init_stack): ditto.
+
+Mon Dec 4 13:44:01 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/jcode.rb: consider multibyte. not /n.
+
+Mon Dec 4 09:49:36 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_inspect): output whole string contents. no more `...'
+
+ * string.c (rb_str_dump): should propagate taintness.
+
+ * hash.c (env_inspect): hash like human readable output.
+
+ * variable.c (rb_ivar_get): prohibiting instance variable access
+ is too much restriction.
+
+ * class.c (method_list): retrieving information should not be
+ restricted where $SAFE=4.
+
+ * class.c (rb_obj_singleton_methods): ditto.
+
+ * eval.c (rb_thread_priority): ditto.
+
+ * eval.c (rb_thread_local_aref): ditto.
+
+ * variable.c (rb_obj_instance_variables): ditto.
+
+ * variable.c (rb_mod_const_at): ditto.
+
+ * variable.c (rb_mod_class_variables): ditto.
+
+ * eval.c (rb_exec_end_proc): end_proc should be preserved.
+
+Sat Dec 2 22:32:43 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): || should accept exactly zero argument.
+
+ * parse.y (stmt): multiple right hand side for single assignment
+ (e.g. a = 1,2) is allowed.
+
+Wed Nov 29 07:55:29 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_long): dumping long should be smaller than 32bit max.
+
+ * marshal.c (w_long): shorter long format for small integers(-123..122).
+
+ * marshal.c (r_long): ditto.
+
+Tue Nov 28 18:10:51 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_mod_define_method): quick hack to implement
+ on-the-fly method definition. experimental.
+
+Mon Nov 27 17:00:35 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): should not redefine builtin classes/modules
+ from within wrapped load.
+
+Mon Nov 27 08:57:33 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (call_end_proc): should be isolated from outer block.
+
+Mon Nov 27 00:10:08 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_ctl): call ioctl/fcntl for fptr->f2 too.
+
+ * process.c (rb_f_fork): call rb_thread_atfork() after creating
+ child process.
+
+ * eval.c (rb_thread_atfork): kill all other threads immediately,
+ then turn the current thread into the main thread.
+
+Sat Nov 25 23:12:22 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ruby_run): move calling point of rb_trap_exit after
+ cleaning up threads.
+
+ * eval.c (ruby_finalize): new function to call EXIT trap, END
+ procs and GC finalizers.
+
+ * eval.c (rb_exec_end_proc): prevent recursion.
+
+ * gc.c (rb_gc_call_finalizer_at_exit): ditto.
+
+ * signal.c (rb_trap_exit): ditto. made static.
+
+ * process.c (rb_f_fork): should swallow all exceptions from block
+ execution.
+
+ * process.c (fork_rescue): should call ruby_finalize().
+
+ * parse.y (yycompile): rb_gc() removed. I don't remember why I put
+ this here. test code?
+
+Fri Nov 24 22:03:48 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * range.c (EXCL): exclusive infomation is now stored in an
+ instance variable. this enables proper marshal dump.
+
+ * process.c (proc_waitpid): should clear rb_last_status ($?) if
+ no pid was given by waitpid(2).
+
+Thu Nov 23 01:35:38 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * process.c (proc_waitpid2): returns nil if no pid found.
+
+Wed Nov 22 23:45:15 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * range.c (range_eq): new method. Compares start and end of range
+ respectively.
+
+Wed Nov 22 11:01:32 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_mod_class_variables): should honor singleton
+ class variable rule defined yesterday.
+
+Tue Nov 21 23:24:14 2000 Mitsuteru S Nakao <nakao@kuicr.kyoto-u.ac.jp>
+
+ * numeric.c (flodivmod): missing second operand (typo).
+
+Tue Nov 21 03:39:41 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (marshal_load): marshal format compatibility check
+ revised. greater minor revision is UPWARD compatibile;
+ downward compatibility is not assured.
+
+ * eval.c (is_defined): clarify class variable behavior for
+ singleton classes. class variables within singleton class
+ should be treated like within singleton method.
+
+Mon Nov 20 13:45:21 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): set ruby_sourceline before evaluating
+ exceptions.
+
+ * gc.c (gc_sweep): defer finalization in GC during compilation or
+ interrupt prohibit section.
+
+ * gc.c (gc_sweep): mark all nodes before sweeping if GC happened
+ during compilation.
+
+ * eval.c (rb_eval): should treat class variables specially in a
+ method defined in the singleton class.
+
+Mon Nov 20 10:20:21 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * dir.c, win32/win32.c, ruby.h: add rb_iglob().
+
+Mon Nov 20 00:18:16 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_subseq): should return nil for outbound start
+ index.
+
+ * marshal.c (marshal_load): show format versions explicitly when
+ format version mismatch happens.
+
+Sun Nov 19 06:13:24 2000 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * marshal.c: use long for string/array length.
+
+ * pack.c (swaps): use bit-or(|) instead of plus(+).
+
+ * pack.c (swapl): ditto.
+
+Sat Nov 18 15:18:16 2000 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * array.c (rb_ary_replace): array size should be in long.
+
+ * array.c (rb_ary_concat): ditto.
+
+ * array.c (rb_ary_hash): ditto.
+
+Sat Nov 18 14:07:20 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: Socket#readline() reads until "\n", not "\r\n"
+
+Fri Nov 17 14:55:18 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * string.c (rb_str_succ): output should be NUL terminated.
+
+Fri Nov 17 02:54:15 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_close): need not to flush before closing.
+
+ * eval.c (rb_thread_join): should preserve last thread status when
+ THREAD_TO_KILL.
+
+ * eval.c (rb_thread_stop): ditto.
+
+ * io.c (io_fflush): wrap fflush by TRAP_BEG, TRAP_END.
+
+ * eval.c (rb_eval): method defined within singleton class
+ definition should behave like singleton method about class
+ variables.
+
+ * eval.c (is_defined): ditto.
+
+Thu Nov 16 23:06:07 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: can call {old,new}_implementation any times.
+
+ * lib/net/http.rb: HTTP#connecting, receive ->
+ common_oper, connecting.
+
+ * lib/net/http.rb: output warning if u_header includes
+ duplicated header.
+
+ * lib/net/http.rb: not check Connection:/Proxy-Connection;
+ always read until eof.
+
+ * lib/net/protocol.rb: detects and catches "break" from block.
+
+Thu Nov 16 16:32:45 2000 Masahiro Tanaka <masa@stars.gsfc.nasa.gov>
+
+ * bignum.c (bigdivrem): should have incremented ny first.
+
+Thu Nov 16 14:58:00 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * ext/socket/socket.c (sock_new): duplicates file descriptor
+ with myfddup() on mswin32/mingw32.
+
+ * win32/win32.h: uses system original fdopen().
+
+ * win32/win32.c (myfddup): newly added instead of myfdopen().
+
+ * win32/win32.c (mybind, myconnect, mygetsockname, mygetsockopt,
+ mylisten, mysetsockopt): now accept file descriptor only, not
+ SOCKET.
+
+ * win32/win32.c (myaccept, mysocket): return file descriptor,
+ instead of SOCKET.
+
+Thu Nov 16 10:23:24 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (massign): too strict check for nameless rest argument.
+
+ * eval.c (method_arity): mere * should return -1.
+
+ * eval.c (intersect_fds): should check all FDs in the fd_set.
+
+Wed Nov 15 19:33:20 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * eval.c (rb_attr): should clear method cache before calling hook.
+
+ * eval.c (rb_eval): ditto.
+
+ * eval.c (rb_mod_modfunc): ditto.
+
+Mon Nov 13 22:44:52 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * error.c (rb_bug): print version to stderr.
+
+Mon Nov 13 19:02:08 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c, io.c, process.c: the exit status of program must be
+ multiplied 256 on mswin32 and msdosdjgpp(system(), ``).
+
+Sat Nov 11 22:57:38 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (arg): uniformed treatment of -a**b, where a is a
+ number literal; hacky but behavior appears more consistent.
+
+ * parse.y (newline_node): reduce newline node (one per line).
+
+ * random.c (rb_f_srand): should be prohibited in safe level
+ greater than 4.
+
+Sat Nov 11 22:37:36 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * rubysig.h: do not use rb_trap_immediate on win32.
+
+ * rubysig.h: new macros, ATOMIC_TEST, ATOMIC_SET, ATOMIC_INC,
+ ATOMIC_DEC, RUBY_CRITICAL and new definition of TRAP_BEG,
+ TRAP_END.
+
+ * gc.c (ruby_xmalloc): should wrap malloc() by RUBY_CRITICAL.
+
+ * signal.c (sighandle): better win32 sig handling.
+
+ * win32/win32.c (flock): better implementation.
+
+ * win32/win32.c (myselect): ditto.
+
+ * win32/win32.c (myaccept): ditto.
+
+ * win32/win32.c (waitpid): ditto.
+
+ * win32/win32.c (myrename): ditto.
+
+ * win32/win32.c (wait_events): support function for win32 signal
+ handling.
+
+Sat Nov 11 08:34:18 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.31.
+
+ * lib/net/http.rb: initializes header in HTTP, not HTTPCommand.
+
+ * lib/net/protocol.rb, http.rb: rewrites proxy code.
+
+Fri Nov 10 16:15:53 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * numeric.c (rb_num2long): use to_int, not to_i.
+
+ * error.c: T_SYMBOL was misplaced by T_UNDEF.
+
+ * parse.y (yylex): eval("^") caused infinite loop.
+
+Thu Nov 9 14:22:13 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_taint_check): should check IO taintness; no
+ operation for untainted IO should be allowed in the sandbox.
+
+ * rubyio.h (GetOpenFile): check IO taintness inside using
+ rb_io_taint_check().
+
+Wed Nov 8 03:08:53 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (io_fflush): ensure fflush(3) would not block by calling
+ rb_thread_fd_writable().
+
+Tue Nov 7 20:29:56 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.30.
+
+ * lib/net/protocol.rb, smtp.rb: Command#critical_ok -> error_ok
+
+ * lib/net/http.rb: reads header when also "100 Continue".
+
+Tue Nov 7 04:32:19 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (bigdivrem): use bit shift to make y's MSB set.
+
+Mon Nov 6 1:22:49 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * error.c (warn_print): do not use err_append(), to ensure output
+ to stderr.
+
+ * error.c (rb_warn): use warn_print() instead of err_print().
+
+ * error.c (rb_warning): ditto.
+
+ * error.c (rb_bug): ditto.
+
+ * eval.c (rb_load): re-raise exceptions during load.
+
+ * time.c (make_time_t): remove useless adjust
+
+Thu Nov 2 18:01:16 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * random.c (rb_f_rand): half-baked float support fixed. This fix
+ was originally proposed by K.Kosako <kosako@sofnec.co.jp>.
+
+Tue Oct 31 17:27:17 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c: change digit size to `long|int' if long long is
+ available.
+
+ * marshal.c (w_object): support `long|int' digits.
+
+ * marshal.c (r_object): ditto.
+
+Sat Oct 28 23:54:22 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): allow =end at the end of file (without a
+ newline at the end).
+
+Fri Oct 27 10:00:27 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_cstr2inum): should ignore trailing white spaces.
+
+ * bignum.c (rb_str2inum): string may not have sentinel NUL.
+
+Fri Oct 27 02:37:22 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_cstr2inum): wrongly assigned base to c before
+ badcheck check.
+
+Thu Oct 26 02:42:50 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: Command#critical_ok
+
+ * lib/net/smtp.rb: clear critical flag before go to SMTP
+
+Wed Oct 25 12:30:19 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_concat): replacing array might be the receiver
+ itself. do not call rb_ary_push_m.
+
+ * array.c (rb_ary_replace): replacing array might be the receiver
+ itself. use memmove.
+
+Fri Oct 20 07:56:23 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): ARGSPUSH should not modify args array.
+
+Thu Oct 19 14:58:17 2000 WATANABE Tetsuya <tetsu@jpn.hp.com>
+
+ * pack.c (NUM2U32): should use NUM2ULONG().
+
+Tue Oct 17 17:30:34 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * eval.c (error_print): ruby_sourcefile may be NULL.
+
+Tue Oct 17 16:36:28 2000 Wes Nakamura <wknaka@pobox.com>
+
+ * pack.c (NATINT_U32): wrong use of sizeof.
+
+Tue Oct 17 12:48:20 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * eval.c (rb_abort): nil check against ruby_errinfo.
+
+ * eval.c (rb_thread_schedule): use FOREACH_THREAD_FROM instead of
+ FOREACH_THREAD, since curr_thread may be removed from thread ring.
+
+ * eval.c (THREAD_ALLOC): errinfo should be Qnil.
+
+ * eval.c (rb_callcc): th->prev,th->next are now already
+ initialized in THREAD_ALLOC.
+
+Mon Oct 16 15:37:33 2000 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * eval.c (rb_thread_inspect): tag size was shorter than required.
+
+ * object.c (rb_obj_inspect): ditto.
+
+Mon Oct 16 14:25:18 2000 Shugo Maeda <shugo@ruby-lang.org>
+
+ * object.c (sym_inspect): used `name' before initialization.
+
+Mon Oct 16 14:06:00 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c (pack_pack): use NATINT_U32 for 'l', 'L', and 'N'.
+
+ * pack.c (I32,U32): 32 bit sized integer.
+
+ * pack.c (OFF16,OFF32B): big endian offset for network byteorder.
+
+Mon Oct 16 06:39:32 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: hex-alpha is not [a-h] but [a-f].
+
+Mon Oct 16 01:02:02 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_start_0): should not abort on exception if
+ $SAFE >= 4.
+
+ * parse.y (sym): symbols for class variable names.
+
+Sun Oct 15 01:49:18 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (rb_file_flock): should accept interrupt.
+
+ * process.c (rb_waitpid): ditto.
+
+ * process.c (rb_waitpid): ditto.
+
+ * process.c (proc_wait): ditto.
+
+ * process.c (proc_waitpid2): wrong recursion.
+
+Sat Oct 14 03:32:13 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_alloc): should not link a new thread in the
+ live thread ring before initialization.
+
+Fri Oct 13 17:08:09 2000 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb: new file.
+
+Thu Oct 12 18:56:28 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/pop.rb: POP3#reset
+
+ * lib/net/http.rb: a code for "Switch Protocol" was wrongly 100.
+
+Thu Oct 12 01:23:38 2000 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: bug fix: CGI::html(): PRETTY option didn't work.
+
+Thu Oct 12 00:03:02 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (sym_inspect): should adjust string length.
+
+ * struct.c (rb_struct_to_s): ditto.
+
+ * struct.c (rb_struct_inspect): ditto.
+
+Wed Oct 11 22:15:47 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * eval.c (rb_thread_inspect): should adjust string length.
+
+ * object.c (rb_any_to_s): ditto.
+
+ * object.c (rb_obj_inspect): ditto.
+
+Wed Oct 11 18:13:50 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_start_0): should check insecure exit.
+
+Wed Oct 11 14:29:51 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb: 2nd arg for ProtocolError#initialize is
+ optional.
+
+ * lib/net/http.rb: code refining.
+
+Wed Oct 11 11:13:03 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (primary): setter method (e.g. foo=) should always be
+ public.
+
+ * eval.c (rb_thread_raise): should not raise SecurityError if
+ exception raised by the interpreter.
+
+ * eval.c (rb_thread_cleanup): skip all THREAD_KILLED threads
+ before FOREACH_THREAD.
+
+Tue Oct 10 16:11:54 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * dln.c (dln_load): remove unused code for cygwin.
+
+Tue Oct 10 09:49:23 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (Init_File): FileTest.size should return 0 (not nil) for
+ empty files.
+
+Sun Oct 8 13:20:26 2000 Guy Decoux <decoux@moulon.inra.fr>
+
+ * eval.c (POP_SCOPE): not just set SCOPE_DONT_RECYCLE, but do
+ scope_dup().
+
+Sat Oct 7 15:10:50 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_reverse_bang): unnecessary ALLOCA_N() was
+ removed.
+
+Fri Oct 6 14:50:24 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/extmk.rb.in, lib/mkmf.rb: remove "DESTDIR =".
+
+ * Makefile.in, win32/Makefile.sub, ruby.1: renamed -X to -C.
+
+Fri Oct 6 12:50:52 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * array.c (rb_ary_plus): use to_ary(), not Check_Type().
+
+ * array.c (rb_ary_concat): ditto.
+
+ * gc.c (rb_gc): use __builtin_frame_address() for gcc.
+
+ * eval.c (stack_length): ditto.
+
+ * parse.y (assign_in_cond): stop warning till some better warning
+ condition will be found.
+
+Thu Oct 5 18:02:39 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (rb_obj_dup): should have propagated taint flag.
+ (ruby-bugs:#PR64,65)
+
+Wed Oct 4 00:26:11 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_arity): proc{|a|}'s arity should be -1.
+
+Mon Oct 2 05:28:58 2000 akira yamada <akira@ruby-lang.org>
+
+ * string.c (trnext): minus at the end of pattern.
+
+Sun Oct 1 00:43:34 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: exp-name was wrong on cygwin and mingw32.
+
+Thu Sep 28 14:57:09 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * regex.c (re_compile_pattern): should try must_string calculation
+ every time.
+
+Tue Sep 19 23:47:44 2000 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
+
+ * configure.in, config.guess, config.sub: MacOS X support.
+
+Wed Sep 27 18:40:05 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * stable version 1.6.1 released.
+
+Wed Sep 27 16:13:05 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * mkconfig.rb: variables should be expanded only if /\$\{?\w+\}?/.
+
+Tue Sep 26 18:09:51 2000 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * string.c: include <math.h>
+
+Tue Sep 26 15:59:50 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (rb_mod_dup): metaclasses of class/module should not be
+ cleared by rb_obj_dup.
+
+Tue Sep 26 02:44:54 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (GC_MALLOC_LIMIT): size extended.
+
+ * regex.c (DOUBLE_STACK): use machine's stack region for regex
+ stack if its size is small enough.
+
+Mon Sep 25 18:13:07 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * regex.c: include <defines.h>.
+
+ * eval.c (rb_add_method): cache mismatch by method
+ definition. need to clear_cache_by_id every time.
+
+Mon Sep 25 13:31:45 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * win32/win32.c (NtCmdGlob): substitute '\\' with '/'.
+
+Mon Sep 25 00:35:01 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * defines.h: #undef HAVE_SETITIMER on cygwin.
+
+Sun Sep 24 03:01:53 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, http.rb: typo.
+
+Sat Sep 23 07:33:20 2000 Aleksi Niemela <aleksi.niemela@cinnober.com>
+
+ * regex.c (re_compile_pattern): nicer regexp error messages for
+ invalid patterns.
+
+Sat Sep 23 03:06:25 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_autoload_load): should not require already
+ provided features.
+
+Fri Sep 22 15:46:21 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/http.rb: too early parameter expansion in string.
+
+Fri Sep 22 13:58:51 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/extmk.rb.in: don't use default $:
+
+Fri Sep 22 13:42:50 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * regex.c (PUSH_FAILURE_COUNT): avoid casting warning on alpha.
+
+ * regex.c (PUSH_FAILURE_POINT): ditto.
+
+Fri Sep 22 10:16:21 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * win32/config.h.in: add HAVE_TELLDIR, HAVE_SEEKDIR
+
+Thu Sep 21 19:04:34 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/extmk.rb, lib/mkmf.rb (install_rb): check whether libdir is
+ directory or not.
+
+Thu Sep 21 17:23:05 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (rb_file_s_symlink): use HAVE_SYMLINK.
+
+ * file.c (rb_file_s_readlink): use HAVE_READLINK.
+
+ * dir.c (dir_tell): use HAVE_TELLDIR.
+
+ * dir.c (dir_seek): use HAVE_SEEKDIR.
+
+ * configure.in (AC_CHECK_FUNCS): lstat, symlink, readlink,
+ telldir, seekdir checks added.
+
+ * file.c (lstat): should use stat(2) if lstat(2) is not
+ available.
+
+Thu Sep 21 15:59:23 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.29.
+
+ * lib/net/http.rb: HTTPReadAdapter -> HTTPResponseReceiver
+
+ * lib/net/http.rb (connecting): response is got in receive()
+
+Thu Sep 21 15:49:07 2000 Wayne Scott <wscott@ichips.intel.com>
+
+ * lib/find.rb (find): should not follow symbolic links;
+ tuned performance too.
+
+Wed Sep 20 23:21:38 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ruby.c (load_file): two Ctrl-D was required to stop ruby at the
+ beginning of stdin script read.
+
+Wed Sep 20 14:01:45 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_provided): detect infinite load loop.
+
+ * eval.c (rb_provided): too weak filename comparison.
+
+ * eval.c (rb_thread_alloc): avoid recycling still referenced
+ dvar structures.
+
+ * eval.c (rb_callcc): ditto.
+
+ * eval.c (THREAD_ALLOC): fiil dyna_vars field by ruby_dyna_vars.
+
+Tue Sep 19 17:47:03 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * stable version 1.6.0 released.
+
+Tue Sep 19 16:24:52 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (Init_marshal): provide marshal.so no more.
+
+Tue Sep 19 14:01:01 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in, win32/setup.mak: include version number
+ in RUBY_SO_NAME.
+
+Tue Sep 19 13:07:47 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): was confusing $~ and $_.
+
+Tue Sep 19 13:06:53 2000 GOTOU YUUZOU <gotoyuzo@notwork.org>
+
+ * signal.c (rb_f_kill): signum may be a negative number, should be
+ treated by signed number.
+
+Tue Sep 19 01:14:56 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_provide): better feature handling.
+
+ * eval.c (rb_f_require): loading ruby library may be partial
+ state. checks in rb_thread_loading is integrated.
+
+ * eval.c (rb_provided): better thread awareness.
+
+ * lib/irb/frame.rb: 6 (not 5) parameters for trace_func proc.
+
+ * eval.c (error_print): should print error position even if
+ get_backtrace() failed.
+
+Sat Sep 16 03:29:59 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_require): rb_provided() was called too early; does
+ not work well with threads.
+
+ * parse.y (ensure): should distinguish empty ensure and non
+ existing ensure.
+
+ * file.c (Init_File): extending File by class of FileTest was
+ serious mistake.
+
+Thu Sep 14 02:46:54 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_yield): array strip should be done in this
+ function.
+
+Wed Sep 13 17:01:03 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big_eq): incomplete value comparison of bignums.
+
+Wed Sep 13 06:39:54 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_mod_class_variables): Module#class_variables added.
+
+Wed Sep 13 06:09:26 2000 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: bug fix: CGI::header(): output status header.
+
+Wed Sep 13 01:09:12 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): allow global variables like '$__a'.
+
+Tue Sep 12 22:28:43 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/socket/extconf.rb: avoid using terrible <netinet/tcp.h>
+ on cygwin 1.1.5.
+
+Tue Sep 12 16:01:58 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * array.c (rb_ary_unshift_m): typo.
+
+Tue Sep 12 15:37:55 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): stripped array too much, should remove just
+ for proc_call().
+
+Tue Sep 12 07:05:24 2000 Wakou Aoyama <wakou@fsinet.or.jp>
+
+ * lib/cgi.rb: version 2.0.0: require ruby1.5.4 or later.
+
+ * lib/net/telnet.rb: version 1.6.0
+
+Tue Sep 12 03:26:07 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (massign): use to_ary to get an array if available.
+
+ * object.c (rb_Array): ditto.
- * ext/extmk.rb: move TARGET_SO_DIR stuffs to mkmf.rb.
+Mon Sep 11 14:24:47 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
- * lib/mkmf.rb (create_makefile): create target shared object files
- under $(TARGET_SO_DIR) which is $sodir if it is defined with
- $extout. [ruby-core:77058] [Bug #12681]
+ * hash.c (ruby_setenv): should not free the element of
+ origenvironment.
-Wed Aug 31 01:56:55 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * parse.y (command_call): kYIELD moved to this rule to allow
+ 'a = yield b'. (ruby-bugs-ja:#PR15)
- * doc/extension.ja.rdoc: [DOC] Fix a typo. [ci skip]
+Mon Sep 11 01:27:54 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Aug 31 00:52:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_yield_0): proc#call([]) should pass single value to
+ the block.
- * ext/extmk.rb: make the gems target directory under the expanded
- name. [ruby-core:77102] [Bug #12714]
+ * eval.c (callargs): reduce array allocation.
-Tue Aug 30 15:27:27 2016 Kouhei Yanagita <yanagi@shakenbu.org>
+ * eval.c (massign): precise check for argument number.
- * ext/json/lib/json/add/ostruct.rb (OpenStruct.json_create):
- Correct documentation, fix the name of values. [Fix GH-1421]
+Fri Sep 8 10:05:17 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Aug 30 14:53:34 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * gc.c (STR_NO_ORIG): should be FL_USER2.
- * io.c (nogvl_fsync, nogvl_fdatasync): on Windows, just ignore if the
- fd is associated to non-disk device. if call fsync and/or fdatasync
- with such fds, it causes Errno::EBADF exception and the behavior is
- incompatible with ruby 2.1 and earlier unintentionally introduced.
+Thu Sep 7 14:17:51 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
-Tue Aug 30 03:38:35 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (rb_str_cat): should work even for concatenating same
+ string.
- * vm_dump.c (backtrace): use rip in the saved context for the case
- the SIGSEGV is received when the process is in userland.
- Note that ip in the stack should be used if the signal is received
- when it is in kernel (when it is calling syscall) [Bug #12711]
+Wed Sep 6 17:06:38 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
-Sat Aug 27 10:26:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (rb_cvar_declare): should check superclass's class
+ variable first.
- * array.c (rb_ary_concat_multi): take multiple arguments. based
- on the patch by Satoru Horie. [Feature #12333]
+Wed Sep 6 10:42:02 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
- * string.c (rb_str_concat_multi, rb_str_prepend_multi): ditto.
+ * misc/ruby-mode.el (ruby-calculate-indent): shift continuing line
+ if previous line ends with modifier keyword.
-Thu Aug 25 00:42:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * misc/ruby-mode.el (ruby-parse-region): should not give up if
+ modifiers are at the end of line.
- * win32/file.c (append_wstr): remove a codepage argument, and use
- INVALID_CODE_PAGE for conversion by econv.
+ * misc/ruby-mode.el (ruby-expr-beg): indented wrongly if modified
+ statement was size 1.
- * win32/file.c (append_wstr): exclude the terminator from the
- result length when input len == -1.
+Wed Sep 6 10:41:19 2000 Kenichi Komiya <kom@mail1.accsnet.ne.jp>
-Wed Aug 24 22:41:30 2016 Kouhei Sutou <kou@cozmixng.org>
+ * misc/ruby-mode.el (ruby-parse-region): modifier was not handled
+ well on emacs19.
- * gc.c (gc_reset_malloc_info): Remove too much ";".
+Tue Sep 5 17:10:12 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Aug 24 20:07:57 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * time.c (time_to_s): fixed zone string UTC for utc time object.
- * include/ruby/defines.h (ALWAYS_INLINE): Add alternative definition.
- Fix compile error with compilers that do not have force inline
- attribute, including old version of fcc on Solaris 10.
- [ruby-dev:49773] [Bug #12701]
+Tue Sep 5 00:26:06 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Aug 24 16:56:26 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (re_search): range worked wrongly on bm_search().
- * .gdbinit: follow r55766's VM change.
+Mon Sep 4 13:40:40 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Wed Aug 24 12:57:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: renamed libruby.a to libruby.{cygwin,mingw32}.a
+ on cygwin and mingw32.
- * object.c (rb_mod_initialize, rb_class_initialize): [DOC] these
- methods do not invoke module_eval/class_eval, just eval the
- given block under the new module/class but sharing the context
- with the surrounding scope like those methods.
- [ruby-core:77023] [Bug #12696]
+Sun Sep 3 23:44:04 2000 Noriaki Harada <tenmei@maoh.office.ne.jp>
-Tue Aug 23 10:34:40 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (NO_SAFE_RENAME): for BeOS too.
- * test/psych/test_psych.rb (test_load_file_with_fallback): fix
- Tempfile leak. https://github.com/tenderlove/psych/pull/288
+Sun Sep 3 11:31:53 2000 Takaaki Tateishi <ttate@jaist.ac.jp>
-Tue Aug 23 10:15:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (rescue): no assignment was done if rescue body was
+ empty.
- * string.c (rb_fs_setter): check and convert $; value at
+Sat Sep 2 10:52:21 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (call_args,aref_args): block_call can be the last
+ argument.
+
+ * parse.y (COND_PUSH,COND_POP): maintain condition stack to allow
+ kDO2 in parentheses in while/until/for conditions.
+
+ * parse.y (yylex): generate kDO2 for EXPR_ARG outside of
+ while/until/for condition.
+
+Fri Sep 1 10:36:29 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (aref_args,opt_call_args): add block_call to allow a
+ method without parentheses and with block as a last argument.
+
+ * hash.c (rb_hash_sort): should not return nil.
+
+ * re.c (match_aref): should use rb_reg_nth_match().
+
+ * eval.c (POP_SCOPE): recycled scopes too much
+
+ * eval.c (Init_eval): extend room for stack allowance.
+
+ * eval.c (POP_SCOPE): frees scope too much.
+
+Thu Aug 31 14:28:39 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (rb_gc_mark): T_SCOPE condition must be more precise.
+
+ * eval.c (scope_dup): should not make all duped scope orphan.
+
+Thu Aug 31 10:11:47 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (stmt): allow stmt_rhs to be right hand side of multiple
assignment.
-Tue Aug 23 02:09:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (rb_time_timeval): type error should not mention the word
+ 'interval'.
+
+Wed Aug 30 23:21:20 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * numeric.c (rb_num2long): use rb_Integer() instead of independent
+ convert routine.
+
+ * eval.c (rb_rescue2): now takes arbitrary number of exception types.
+
+ * object.c (rb_convert_type): use rb_rescue2 now to handle NameError.
+
+ * object.c (rb_convert_type): better error message.
+
+Wed Aug 30 17:09:14 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/Win32API/Win32API.c (Win32API_initialize): AlphaNT support.
+
+Wed Aug 30 14:19:07 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (node_assign): should support NODE_CVASGN2 too.
+
+Wed Aug 30 11:31:47 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * ext/Win32API/Win32API.c (Win32API_initialize): add the
+ arguments checking.
+
+ * ext/Win32API/Win32API.c (Win32API_initialize): add taint
+ checking. allow String object in the third argument.
+
+Wed Aug 30 10:29:40 2000 Masahiro Tomita <tommy@tmtm.org>
+
+ * io.c (rb_f_p): flush output buffer.
+
+Tue Aug 29 16:29:15 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (assignable): remove NODE_CVASGN3.
+
+ * parse.y (gettable): remove NODE_CVAR3.
+
+Tue Aug 29 02:02:14 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/mkmf.rb (create_makefile): handles create_makefile("a/b").
+
+ * ext/extmk.rb.in (create_makefile): ditto
+
+Mon Aug 28 18:43:54 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (is_defined): now handles class variables.
+
+ * eval.c (rb_eval): class variable behavior revisited.
+
+ * parse.y (assignable): ditto.
+
+ * parse.y (gettable): ditto.
+
+ * regex.c (PUSH_FAILURE_COUNT): push/pop interval count on failure
+ stack. this fix is inspired by the Emacs21 patch from Stefan
+ Monnier <monnier@cs.yale.edu>.
+
+Fri Aug 25 15:24:39 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_cvar_get): should not follow __attached__.
+
+ * variable.c (rb_cvar_set): ditto.
+
+ * variable.c (rb_cvar_declare): ditto.
+
+ * variable.c (mod_av_set): second class variable assignment at the
+ toplevel should not give warning.
+
+Fri Aug 25 01:18:36 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (next_argv): prepare path for open file.
+
+ * string.c (rb_str_setter): moved from io.c.
+
+ * io.c (next_argv): filename should be "-" for refreshed ARGF.
+
+Thu Aug 24 15:27:39 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/socket/socketport.h: use `extern int h_errno' if needed.
+
+Sat Aug 19 01:34:02 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/sdbm/_sdbm.c (sdbm_prep): flags should be or-ed by O_BINARY on
+ Win32 too.
+
+ * ext/sdbm/_sdbm.c (makroom): fill hole with 0 on Win32 too.
+
+Fri Aug 18 13:23:59 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): should preserve and clear $! value before
+ compilation.
+
+ * eval.c (eval): ditto.
+
+Fri Aug 18 11:06:19 2000 Shugo Maeda <shugo@ruby-lang.org>
+
+ * ext/socket/socket.c (s_accept): start GC on EMFILE/ENFILE.
+
+Thu Aug 17 16:04:48 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (is_defined): should clear ruby_errinfo.
+
+Thu Aug 17 04:26:31 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.27.
+
+ * lib/net/protocol.rb: writing methods returns written byte size.
+
+ * lib/net/smtp.rb: send_mail accepts many destinations.
+
+Wed Aug 16 00:43:47 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (time_s_times): use CLK_TCK for HZ if it's defined.
+
+Tue Aug 15 17:30:59 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (frame_dup): should set flag FRAME_MALLOC after
+ argv allocation.
+
+ * eval.c (blk_free): should not free argv if GC was called before
+ frame_dup.
+
+Tue Aug 15 16:08:40 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in: add ac_cv_func_times=yes for mingw32.
+
+ * win32/win32.c (mytimes): typo.
+
+Tue Aug 15 01:45:28 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (argf_eof): should return true at the end of ARGF without
+ checking stdout if arguments are given.
+
+Mon Aug 14 10:34:32 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_status): status should return false for normal
+ termination, nil for termination by exception.
+
+Fri Aug 11 15:43:46 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_undef): give warning for undefining __id__, __send__.
+
+Thu Aug 10 08:05:03 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_callcc): returned current thread instead of
+ continuation wrongly.
+
+Thu Aug 10 05:40:28 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/extmk.rb.in: $CPPFLAGS should be initialized.
+
+ * ext/tcltklib/depend: add stubs.o.
+
+ * ext/tcltklib/extconf.rb: use $CPPFLAGS instead of $CFLAGS.
+
+Wed Aug 9 16:31:48 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_callcc): thread status for continuations must be
+ THREAD_KILLED, otherwise thread_free() breaks other threads.
+
+Wed Aug 9 13:24:25 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * win32/win32.[ch]: emulate rename(2).
+
+Tue Aug 8 14:01:46 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/tcltklib/tcltklib.c: support --enable-tcltk_stubs
+
+ * ext/tcltklib/extconf.rb: ditto.
+
+ * ext/tcltklib/stubs.c: created. examine candidate shared libraries.
+
+Mon Aug 7 13:59:12 2000 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ruby.h (CLONESETUP): should copy flags before any potential
+ object allocation.
+
+ * regex.c (re_match): check for stack depth was needed.
+
+Sat Aug 5 16:43:43 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * djgpp/*: convert DOS line endings to UNIX style.
+
+ * djgpp/config.status: rename to config.sed for SFN.
+
+ * lib/ftools.rb (compare, safe_unlink, chmod): avoid warnings.
+
+ * lib/ftools.rb (move): typo. not `tpath', but `to'.
+
+Fri Aug 4 23:26:48 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (proc_call): gives warning if a block is supplied.
+
+ * eval.c (rb_eval): no warning for discarding if an alias for the
+ method is already made.
+
+Fri Aug 4 16:32:29 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * array.c (rb_ary_reject_bang): returns nil if no element removed.
+
+ * hash.c (rb_hash_reject_bang): returns nil if no element removed.
+
+Thu Aug 3 19:44:26 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_fd_writable): should return integer value.
+
+ * array.c (rb_ary_assoc): search array element whose length is
+ longer than 0 (not 1).
+
+Wed Aug 2 18:27:47 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_wait_fd): prohibit thread context switch
+ during compilation.
+
+ * eval.c (rb_cont_call): prohibit Continuation#call across threads.
+
+Wed Aug 2 08:22:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * gc.c (rb_gc): clear malloc_memories to zero, to avoid potential
+ super frequent GC invocation. (ruby-bugs:#PR48)
+
+ * gc.c (rb_gc): only add_heap() if GC trigger condition is
+ satisfied.
+
+Tue Aug 1 16:41:58 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (proc_options): global load path setting moved from
+ ruby_prog_init().
+
+ * ruby.c (incpush): renamed. push path entry at the END of the
+ load path array. This makes -I directories sorted in order in
+ the arguments.
+
+Sat Jul 29 23:42:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * dir.c (dir_each): should check whether dir is closed during the
+ block execution. (ruby-bugs:#PR47)
+
+Sat Jul 29 21:57:30 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ruby.c (rubylib_mangle): provide another buffer for the result.
+
+Wed Jul 26 10:09:01 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in: set SOLIBS to LIBS on Cygwin.
+
+ * configure.in: LIBRUBY_SO='$(RUBY_INSTALL_NAME)'.$target_os.dll
+ on cygwin and mingw32. ruby-cygwin.dll is bad. why?
+
+Wed Jul 26 10:04:03 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * gc.c (gc_sweep): avoid full scan during compilation.
+
+ * gc.c (rb_gc): add heap during no gc period (including
+ compilation).
+
+Tue Jul 25 19:03:04 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * cygwin/GNUmakefile: use puts instead of print, because
+ Cygwin DLL's behavior is changed(or bug?).
+
+ * configure.in: LIBRUBY_SO='$(RUBY_INSTALL_NAME)'-$target_os.dll
+ on cygwin and mingw32.
+
+ * cygwin/GNUmakefile: ditto.
+
+ * Makefile.in: $(SOLIBS) should be put after dmyext.@OBJEXT@.
+
+ * instruby.rb: install $(LIBRUBY) to libdir
+ if $(LIBRUBY) != $(LIBRUBY_A_).
+
+Tue Jul 25 15:16:00 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_p): redirect to $defout.
+
+Mon Jul 24 18:52:55 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * win32/win32.c (win32_getenv): should remove `static'.
+
+ * ruby.c (rubylib_mangle): support "/hoge;/foo"
+
+Mon Jul 24 10:28:55 2000 GOTO Kentaro <gotoken@math.sci.hokudai.ac.jp>
+
+ * string.c (rb_str_count): raise exception if no argument is
+ given.
+
+Sun Jul 23 12:55:04 2000 Dave Thomas <Dave@Thomases.com>
+
+ * string.c (rb_str_rindex): Support negative end position.
+
+Fri Jul 21 17:35:01 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (aref_args): command_call now be permitted as
+ aref_args.
+
+ * process.c (proc_getpriority): getpriority(2) may return valid
+ negative number. use errno to detect error.
+
+ * marshal.c (dump_ensure): dumped string should be tainted if
+ any among target objects is tainted.
+
+ * marshal.c (r_regist): restored object should be tainted if and
+ only if the source is a file or a tainted string.
+
+Wed Jul 19 15:14:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * bignum.c (bigdivrem): should use rb_int2big(), not rb_uint2big().
+
+Tue Jul 18 14:58:30 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (ruby_options): should treat SystemExit etc. properly.
+
+ * parse.y (yycompile): should check compile_for_eval, not
+ ruby_in_eval.
+
+Mon Jul 17 04:29:50 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/mkmf.rb: converts extension of $objs into $OBJEXT.
+
+Sun Jul 16 03:02:34 2000 Dave Thomas <dave@thomases.com>
+
+ * lib/weakref.rb: Change to use new ObjectSpace calls.
+
+Sat Jul 15 21:59:58 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_eval): should not redefine __id__ nor __send__.
+
+ * gc.c (define_final): integrate final.rb features into the
+ interpreter. define_finalizer and undefine_finalizer was
+ added to ObjectSpace. plus, add_finalizer, remove_finalizer,
+ and call_finalizer are deprecated now.
+
+Sat Jul 15 01:32:34 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_mod_method): implements unbound method.
+
+ * eval.c (Init_eval): should prohibit `module_function' for class
+ Class.
+
+Fri Jul 14 17:19:59 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * cygwin/GNUmakefile.in: use miniruby instead of sed.
+
+Fri Jul 14 12:49:50 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (argf_eof): need to check stdin, when next_p == -1.
+
+ * io.c (read_all): use io_fread() instead of fread(3).
+
+ * io.c (io_reopen): should clearerr FILE if fd < 3.
+
+ * re.c (rb_reg_match_m): the result is exported, so it should be
+ declared as busy.
+
+ * eval.c (rb_eval): should preserve errinfo even if return, break,
+ etc. is called in rescue clause.
+
+ * instruby.rb: install irb too.
+
+Wed Jul 12 15:32:57 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * variable.c (rb_const_get): constants for builtin classes must
+ have higher priority than constants from included modules at
+ Object class.
+
+ * bignum.c (bigdivrem): small embarrassing typo.
+
+Wed Jul 12 15:06:28 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_eval): use rb_const_get_at().
+
+ * variable.c (top_const_get): retrieve toplevel constants only,
+ not ones of Object (and its included modules) in general.
+
+Wed Jul 12 15:04:11 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.26.
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb:
+ add module Net::NetPrivate and its inner classes
+ {Read,Write}Adapter, Command, Socket,
+ SMTPCommand, POP3Command, APOPCommand, HTTPCommand
+
+Wed Jul 12 13:10:30 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * bignum.c (bigdivrem): defer bignorm().
+
+ * bignum.c (bignorm): accepts accidental fixnums.
+
+Tue Jul 11 16:54:17 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (yylex): `@<digit>' is no longer a valid instance
+ variable name.
+
+Tue Jul 11 01:51:50 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * bignum.c (rb_big_divmod): should not use Integer(float) for
+ the right operand.
+
+ * bignum.c (rb_big_remainder): ditto.
+
+ * bignum.c (rb_big_modulo): ditto.
+
+Mon Jul 10 15:27:16 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * io.c (pipe_finalize): should set rb_last_status when pclose().
+
+Mon Jul 10 09:07:54 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * error.c (rb_bug): print version number and such too.
+
+Sat Jul 8 23:08:40 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_start_0): should copy previous scopes to
+ prevent rb_gc_force_recycle().
+
+Fri Jul 7 23:36:36 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ext/socket/addrinfo.h: move IN_EXPERIMENTAL and IN_LOOPBACKNET
+ definitions to ext/socket/sockport.h.
+
+ * ext/socket/extconf.rb: add getservbyport() and arpa/inet.h check.
+
+ * ext/socket/getaddrinfo.c (getaddrinfo): SOCK_RAW may not be
+ defined (ex. BeOS, Palm OS 2.x or before).
+
+ * ext/socket/getnameinfo.c (getnameinfo): getservbyport() may not
+ exist (ex. BeOS, Palm OS).
+
+ * ext/socket/sockport.h: add IN_EXPERIMENTAL, IN_CLASSA_NSHIFT,
+ IN_LOOPBACKNET, AF_UNSPEC, PF_UNSPEC and PF_INET.
+
+Fri Jul 7 03:30:00 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (aref_args): should allow Hash[:a=>2] etc.
+
+ * numeric.c (fix_aref): convert index by NUM2INT, not FIX2INT.
+ (ruby-bugs:#PR37)
+
+ * time.c (time_localtime): should prohibit for frozen time.
+
+ * time.c (time_gmtime): ditto.
+
+Thu Jul 6 19:12:12 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_file_s_open): should not terminate fptr; just clear it.
+
+ * ruby.c (proc_options): should not call require_libraries()
+ twice.
+
+ * ruby.c (require_libraries): clear req_list_head.next after
+ execution.
+
+Thu Jul 6 13:51:57 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * object.c (rb_to_id): name may not be symbol nor fixnum.
+
+ * struct.c (rb_struct_s_def): name may be nil.
+
+Thu Jul 6 02:09:06 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * bignum.c (bigdivrem): new function to return remainder.
+
+ * numeric.c (fixdivmod): now returns modulo, not remainder.
+
+ * numeric.c (flodivmod): ditto.
+
+ * bignum.c (bigdivmod): ditto.
+
+ * numeric.c (num_modulo): new method; alias to '%'.
+
+Thu Jul 6 00:51:43 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * string.c (rb_str_split_m): show $; name in error message when it
- is a wrong object.
+ * win32/win32.c (NtCmdGlob): patterns should be separated and
+ NUL terminated.
-Mon Aug 22 16:29:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 5 22:27:56 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * lib/csv.rb (CSV#shift): store partial quoted strings in an array
- and join at last, to improve performance with very long quoted
- lines. [ruby-core:76987] [Bug #12691]
+ * cygwin/GNUmakefile: use ruby.def to make rubycw.dll.
-Mon Aug 22 14:35:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/extmk.rb.in: create target.def.
- * man/irb.1: remove useless -width option.
- [ruby-dev:49767] [Bug #12692]
+ * lib/mkmf.rb: ditto.
-Mon Aug 22 09:02:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 5 09:47:14 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * iseq.c (Init_ISeq): undefine allocator of InstructionSequence,
- to get rid of segfaults at method call on uninitialized object.
+ * time.c (time_arg): Time::local, Time::gm now take 7th optional
+ argument for usec.
-Sat Aug 21 05:47:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * numeric.c (num_ceil, etc): default ceil, floor, round, truncate
+ implementation for Numeric, using `to_f'.
- * enum.c (enum_sort): prevent wasteful array duplication.
+ * io.c (rb_io_reopen): clear fptr->path after free() to prevent
+ potential GC crash.
-Sat Aug 20 11:20:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_file_s_open): terminate fptr unless null.
- * rubystub.c: generalize win32/stub.c.
+ * io.c (rb_file_initialize): ditto.
-Fri Aug 19 11:39:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/tempfile.rb: specify FILE::CREAT|File::EXCL to open for
+ better security.
- * parse.y (primary): allow parenthesised statement as a method
- argument. [Feature #12686]
+ * numeric.c (flo_truncate): new method.
-Fri Aug 19 09:12:45 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 5 01:02:53 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * vm.c (vm_set_main_stack): TOPLEVEL_BINDING must be built.
- http://www.viva64.com/en/b/0414/#ID0EQ1CI [ruby-core:76973]
+ * ext/extmk.rb.in: join ' ' -> join(' ').
-Fri Aug 19 01:00:53 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * lib/mkmf.rb: ditto.
- * proc.c (mnew_missing): Remove an unused argument.
- After r51126 rid is not used.
+Tue Jul 4 13:51:29 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Aug 18 09:26:52 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * ext/dbm/dbm.c: add methods added to Hash in 1.5.x.
- * gems/bundled_gems: bump to test-unit-3.2.1
+ * ext/gdbm/gdbm.c: ditto.
-Thu Aug 18 02:36:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/sdbm/init.c: ditto.
- * tool/rbinstall.rb: skip gems which failed to build extensions.
- [ruby-dev:49764] [Bug #12683]
+ * eval.c (proc_call): args may be Qundef (means no argument), do
+ not call TYPE() for args.
-Wed Aug 17 23:35:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 4 13:20:56 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * gems/bundled_gems (tk): bump up to 0.1.1.
+ * ext/extmk.rb.in: make command line must be single-quoted.
+ $(RUBY_INSTALL_NAME) is command substitution in the POSIX sh.
-Wed Aug 17 23:14:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 4 13:16:02 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/extmk.rb: build gem extensions into separate directories
+ * util.c (rb_type): should add T_UNDEF.
- * tool/rbinstall.rb: install pre-built gem extension files gem
- extension directories. [ruby-core:76931] [Bug #12681]
+Tue Jul 4 09:30:35 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Aug 16 21:04:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (here_document): supports EOF right after terminator.
- * common.mk (UNICODE_HDR_DIR): separate unicode header files from
- unicode data files. [ruby-core:76879] [Bug #12677]
+ * random.c (rb_f_rand): argument is now optional (rand(max=0)).
-Tue Aug 16 11:17:51 2016 Koichi ITO <koic.ito@gmail.com>
+Tue Jul 4 01:50:49 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * lib/net/http/header.rb: Fix typo. [ci skip][fix GH-1407]
- * transcode.c: ditto.
+ * win32/ruby.def: remove ruby_mktemp.
-Tue Aug 16 11:02:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 4 01:27:13 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * tool/make-snapshot (package): save generated header files from
- unicode data. [ruby-core:76879] [Bug #12677]
+ * eval.c (rb_rescue2): new function to rescue arbitrary exception.
-Mon Aug 15 20:31:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * numeric.c (do_coerce): should catch NameError explicitly.
- * node.c (dump_array): show nd_alen field in NODE_ARRAY only in
- the first node. it is nd_end in the rest nodes.
+Tue Jul 4 00:15:23 2000 Dave Thomas <Dave@thomases.com>
-Mon Aug 15 16:41:32 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * numeric.c (Init_Numeric): forgot to register Numeric#remainder.
- * appveyor.yml: Update libressl version to 2.3.7.
+Mon Jul 3 23:46:56 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Mon Aug 15 11:46:50 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32/win32.c (myselect, myaccept): disable interrupt while
+ executing accept() or select() to avoid Ctrl-C causes
+ "unknown software exception (0xc0000029)".
- * ext/extmk.rb (extmake): extension libraries in gems cannot link
- statically.
+Mon Jul 3 18:35:41 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Sun Aug 14 22:35:40 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb: use null device if it exists for cross-compiling.
- * id_table.c (hash_table_extend): should not shrink the table than
- the previous capacity. [ruby-core:76534] [Bug #12614]
+Mon Jul 3 18:19:51 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
-Sun Aug 14 18:51:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.26.
- * gems/bundled_gems: add gemified tk 0.1.0.
- this needs `extract-gems` to build.
+ * lib/net/protocol.rb (finish): do nothing unless active.
-Sun Aug 14 14:54:14 2016 Kouhei Sutou <kou@cozmixng.org>
+ * lib/net/http.rb: HTTP#{get,post}2 again (for new impl).
- * object.c (InitVM_Object): Update referenced document path.
+Mon Jul 3 16:47:22 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Sat Aug 13 23:08:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * cygwin/GNUmakefile: librubys.a -> lib$(RUBY_INSTALL_NAME)s.a
- * numeric.c (num_funcall0, num_funcall1): get rid of infinite
- recursion in fallback methods of Numeric.
+ * configure.in: use AC_CANONICAL_{HOST,TARGET,BUILD}.
-Sat Aug 13 11:10:08 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jul 3 13:15:02 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (command_asgn, arg): fix syntax errors with chained
- assignment with op assign. [Bug #12669]
+ * numeric.c (fix_divmod): x * d + m = y where d, m = x.divmod(y).
-Sat Aug 13 10:52:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bignum.c (rb_big_divmod): ditto.
- * parse.y (stmt, arg): rescue modifier in command op assignment
- should be limited to rhs only. [ruby-core:75621] [Bug #12402]
+ * numeric.c (fixdivmod): does not depend C's undefined %
+ behavior. adopt to fmod(3m) behavior.
-Sat Aug 13 07:51:40 2016 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * numeric.c (flo_mod): modulo now reserves fmod(3m) behavior.
- * ext/win32ole/win32ole.c (ole_val2variant): fix integer conversion in
- cygwin64.
+ * numeric.c (num_remainder): 'deprecated' warning.
-Fri Aug 12 21:05:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Jul 3 10:27:28 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * lib/webrick/config.rb (WEBrick::Config::General):
- disable reverse lookup by default. [ruby-core:45514] [Feature #6559]
- Socket.do_not_reverse_lookup is true by default but WEBrick
- overwrote it.
- patch by Eric Hodel [ruby-core:45527]
+ * configure.in: use AC_CANONICAL_SYSTEM.
-Fri Aug 12 12:50:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jul 2 21:17:37 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * error.c (rb_syntax_error_append): fix newline in syntax error
- message to the beginning, not after file name and line number.
- [Feature #11951]
+ * configure.in: support without --enable-shared for cygwin/mingw32.
-Thu Aug 11 16:24:23 2016 Ferdinand Niedermann <nerdinand@nerdinand.com>
+ * cygwin/GNUmakefile: ditto.
- * compar.c (cmp_clamp): Introduce Comparable#clamp. [Feature #10594]
+ * ext/extmk.rb.in: use null device if it exists for cross-compiling.
-Thu Aug 11 03:16:59 2016 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * lib/mkmf.rb: ditto.
- * lib/prime.rb: Optimize prime?
- Adapted from patch by Jabari Zakiya [#12665]
+ * util.c (ruby_mktemp): remove unused ruby_mktemp().
- * test/test_prime.rb: Improve test
+Sun Jul 2 14:18:04 2000 Koji Arai <JCA02266@nifty.ne.jp>
-Wed Aug 10 22:37:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (TMP_PROTECT_END): tmp__protect_tmp may be NULL.
- * parse.y (command_rhs, arg_rhs): introduce new rules to reduce
- repeated rules with rescue modifier.
+Sun Jul 2 03:37:50 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
-Wed Aug 10 17:26:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.25.
- * parse.y (command_asgn): rescue modifier in command assignment
- should be limited to rhs only. [ruby-core:75621] [Bug #12402]
+ * lib/net/protocol.rb (each_crlf_line): beg = 0 is needed in adding{}
-Wed Aug 10 15:35:03 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/smtp.rb: allow String for to_addr of SMTP#sendmail
- * ext/win32/resolv/resolv.c: needs windows.h for iphlpapi.h on
- cygwin. [ruby-core:76791] [Bug #12663]
+Sat Jul 1 15:22:35 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/win32/resolv/resolv.c (w32error_make_error): use
- Win32::Resolv::Error, an alias of Win32::Registry::Error.
+ * numeric.c (fix_rshift): should handle shift value more than
+ sizeof(long).
-Tue Aug 9 17:50:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Sat Jul 1 15:22:35 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * hash.c (rb_hash_map_v, rb_hash_map_v_bang): implement Hash#map_v and
- Hash#map_v! [Feature #12512] [ruby-core:76095]
+ * eval.c (rb_eval): the value from RTEST() is not valid Ruby
+ object. result should be either true or false.
- * test/ruby/test_hash.rb: add tests for above change.
+Sat Jul 1 09:30:06 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Tue Aug 9 16:09:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * re.c (rb_reg_initialize): was freeing invalid pointer.
- * vm_insnhelper.c (vm_getivar): use always_inline because
- gcc7 doesn't inline this without always_inline.
+Sat Jul 1 03:25:56 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Aug 9 15:41:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (call_args): command_call can be the last argument of
+ call_args. It had to be the only argument.
- * ext/tk: Tk is removed from stdlib. [Feature #8539]
- https://github.com/ruby/tk is the new upstream.
+ * re.c (rb_reg_s_quote): should not dump core even for unsane mbc
+ string.
-Tue Aug 9 00:12:31 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Fri Jun 30 01:36:20 2000 Aleksi Niemela <aleksi.niemela@cinnober.com>
- * doc/maintainers.rdoc: Remove moved file section.
+ * parse.y (f_norm_arg): better, nicer error message.
-Mon Aug 8 20:56:46 2016 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+Thu Jun 29 07:45:33 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/win32ole/sample/excel1.rb, ext/win32ole/sample/excel2.rb,
- ext/win32ole/sample/excel3.rb, ext/win32ole/sample/ie.rb,
- ext/win32ole/sample/ienavi.rb, ext/win32ole/sample/ienavi2.rb: use
- true instead of deprecated TRUE. [ci skip]
+ * ext/socket/socket.c (udp_send): destination may be packed
+ struct sockaddr.
-Mon Aug 8 12:51:12 2016 Zarko Todorovski <zarko@ca.ibm.com>
+ * object.c (rb_Integer): Integer(nil) should be invalid, on the
+ other hand, nil.to_i is OK.
- * internal.h (RBASIC_CLEAR_CLASS): Reroute ANSI C's strict
- aliasing rule.
- [ruby-core:74427][Bug #12191][ruby-core:76747][Bug #12657]
+Wed Jun 28 17:26:06 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Aug 7 18:08:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (ip_recvfrom): udp_recvfrom and tcp_recvfrom
+ is merged and moved to IPSocket#recvfrom.
- * object.c (InitVM_Object): deprecate toplevel constants TRUE,
- FALSE, and NIL. [Feature #12574]
+ * ext/socket/socket.c (sock_s_getaddrinfo): family can be a
+ strings such as "AF_INET" etc.
-Sun Aug 7 06:48:21 2016 Eric Wong <e@80x24.org>
+ * ruby.c (require_libraries): . and RUBYLIB added to $load_path
+ just before -r procedure.
- * ext/openssl/ossl_ssl.c (ossl_ssl_write_internal):
- avoid undefined behavior
- * test/openssl/test_pair.rb (test_write_zero): new test
- [ruby-core:76751] [Bug #12660]
+ * ruby.c (proc_options): -e, - did not exec -r.
-Sat Aug 6 09:35:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 28 14:52:28 2000 Koga Youichirou <y-koga@mms.mt.nec.co.jp>
- * id_table.h (rb_id_table_iterator_result): add dummy sentinel
- member because C standard prohibits a trailing comma.
+ * config.sub: NetBSD/hpcmips support.
-Sat Aug 6 00:39:44 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 28 10:11:06 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * hash.c (env_enc_str_new): make string for an environment
- variable name or value.
+ * gc.c: gc trigger threshold changed; GC_NEWOBJ_LIMIT removed,
+ FREE_MIN is increased to 4096.
- * hash.c (env_name_new): make environment value string with the
- encoding for its name.
+Tue Jun 27 22:39:28 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
-Fri Aug 5 23:18:35 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.24.
- * hash.c (env_str_new): taint the string. get rid of a test failure
- introduced at r55811.
+ * lib/net/protocol.rb: modified each_crlf_line again.
-Fri Aug 5 17:04:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/protocol.rb: do_write_beg,do_write_end -> writing{}
+ do_write_do -> do_write
- * hash.c (w32_getenv): call rb_w32_getenv and rb_w32_ugetenv via
- this pointer without further comparisons.
+ * lib/net/http.rb: can make proxy connection by passing
+ addresses to HTTP.new, start.
-Thu Aug 4 11:54:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/http.rb: HTTP.new_implementation, old_implementation:
+ can use 1.2 implementation of head, get, post, put.
+ (see document)
- * hash.c (env_assoc): the encoding of the value should be the
- locale, as well as other methods, [], fetch, values, etc.
+Tue Jun 27 12:05:10 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Wed Aug 3 21:31:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * win32.c (myfdclr): new function.
- * parse.y (reg_fragment_enc_error): compile_error is different
- between parser and ripper. [ruby-core:76397] [Bug #12651]
+ * win32.h: add FD_CLR.
-Wed Aug 3 17:15:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 26 23:41:41 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * object.c (rb_obj_clone2): restrict freeze option to true other
- than false which only has the effect. [Feature #12300]
+ * ruby.h: add cast for ANSI style.
-Wed Aug 3 10:47:07 2016 Koichi Sasada <ko1@atdot.net>
+ * gc.c (rb_data_object_alloc): use RUBY_DATA_FUNC.
- * vm_core.h: introduce VM_FRAME_RUBYFRAME_P()
- and VM_FRAME_CFRAME_P().
- Most of case, RUBY_VM_NORMAL_ISEQ_P() is no
- longer needed.
+Mon Jun 26 22:20:03 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * vm_core.h: introduce rb_obj_is_iseq().
+ * win32/win32.c (is_socket, extract_file_fd): New function.
- * cont.c, vm.c: VM_FRAME_MAGIC_DUMMY with
- VM_FRAME_FLAG_CFRAME.
+ * win32/win32.c (myfdopen): use is_socket().
-Wed Aug 3 09:25:16 2016 Koichi Sasada <ko1@atdot.net>
+ * win32/win32.c (myselect): return non socket files immediately
+ if file and socket handles are mixed.
- * vm_core.h: rename macros and make them inline functions.
+Mon Jun 26 16:21:30 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * rename VM_FRAME_TYPE_FINISH_P() to VM_FRAME_FINISHED_P().
- * rename VM_FRAME_TYPE_BMETHOD_P() to VM_FRAME_BMETHOD_P().
+ * eval.c (rb_thread_schedule): wait_for cleared too early.
-Wed Aug 03 09:15:02 2016 Koichi Sasada <ko1@atdot.net>
+Mon Jun 26 09:15:31 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_core.h: introduce VM_FRAME_FLAG_CFRAME to represent cfp->iseq
- type.
+ * pack.c: remove obsolete 'F', 'D' specifiers.
-Tue Aug 2 21:42:40 2016 Chia-sheng Chen <qitar888@gmail.com>
+Sun Jun 25 00:55:03 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * math.c (tanh): make faster by the extract form if three
- hyperbolic functions are unavailable. [Feature #12647]
+ * ext/socket/socket.c (sock_s_getnameinfo): `res' would not
+ be assigned if TYPE(sa) == T_STRING.
-Tue Aug 2 12:37:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jun 24 14:36:29 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * ext/socket/option.c, ext/socket/rubysocket.h (inet_ntop): share
- the fallback definition. [ruby-core:76646] [Bug #12645]
+ * config*.dj, configure.bat, top.sed: move to djgpp/.
-Tue Aug 2 04:07:29 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Jun 24 02:34:17 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * win32/win32.c (set_pioinfo_extra): use more reliable way to search
- the position of pioinfo of VC14, and also support debug library of it.
- patched by davispuh AT gmail.com
- [ruby-core:76644] [Bug #12644]
- this fixes also [Bug #12631]
+ * ruby.c (load_file): call require_libraries() here to let
+ debug.rb work properly.
-Mon Aug 1 21:39:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jun 23 22:34:51 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * ext/extmk.rb: [EXPERIMENTAL] build extension libraries in
- extracted gems.
+ * bignum.c (rb_big_lshift): reorder xds assignment to avoid
+ reusing `x' as `len' by VC++ 6.0 SP3 compiler with -Ox switch.
-Mon Aug 1 16:07:18 2016 URABE Shyouhei <shyouhei@ruby-lang.org>
+Fri Jun 23 01:11:27 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/ruby.h (struct RStruct): no longer.
+ * string.c (rb_str_substr): should return empty string (""),
+ if beg == str.size and len == zero, mostly for convenience and
+ backward compatibility.
- * internal.h (struct RStruct): moved here.
+ * parse.y (new_super): should tweak block_pass node for super too.
- * struct.c (rb_struct_ptr): a compensation function for the lack
- of RSTRUCT_PTR. But now that we have RSTRUCT_GET/SET, that must
- not be used anyway. I mark this deprecated. Dont use it.
+ * string.c (rb_str_split_m): last split element should not be nil,
+ but "" when limit is specified.
-Mon Aug 1 14:50:06 2016 Jeremy Evans <code@jeremyevans.net>
+Thu Jun 22 17:27:46 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * object.c (rb_obj_clone2): Allow Object#clone to take freeze:
- false keyword argument to not freeze the clone.
- [ruby-core:75017][Feature #12300]
+ * string.c (rb_str_substr): str[n,m] now returns nil when n equals
+ to str.size.
- * test/ruby/test_object.rb (TestObject): test for it.
+Thu Jun 22 13:49:02 2000 Uechi Yasumasa <uechi@ryucom.ne.jp>
-Mon Aug 1 12:16:19 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * lib/net/ftp.rb: support resuming.
- * ext/json/*, test/json/json_parser_test.rb: Update json-2.0.2.
+Thu Jun 22 13:37:19 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Sun Jul 31 16:17:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_sleep_forever): merge pause() macro.
- * ext/win32/resolv/resolv.c (get_dns_server_list): [Win32] get DNS
- servers only for connected network devices by GetNetworkParams
- API. [Bug #12604]
+Wed Jun 21 08:49:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jul 30 12:13:26 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_eval): should not raise exception just by defining
+ singleton class.
- * string.c (String#downcase), NEWS: Mentioned that case mapping for all
- of ISO-8859-1~16 is now supported. [ci skip]
+Wed Jun 21 01:18:03 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jul 30 12:00:01 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * ruby.h: two macros RUBY_DATA_FUNC and RUBY_METHOD_FUNC are added
+ to make writing C++ extensions easier.
- * enc/iso_8859_2.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-2, by Yushiro Ishii.
+ * array.c (rb_ary_dup): internal classes should not be shared by dup.
-Fri Jul 29 20:57:12 2016 chuanshuo <lilijreey@126.com>
+ * hash.c (rb_hash_dup): ditto.
- * *.c: rename rb_funcall2 to rb_funcallv, except for extensions
- which are/will be/may be gems. [Fix GH-1406]
+ * object.c (rb_obj_dup): ditto.
-Fri Jul 29 10:51:34 2016 Koichi Sasada <ko1@atdot.net>
+ * string.c (rb_str_dup): ditto.
- * proc.c (env_write): remove unused function.
+ * error.c (Init_Exception): renamed NotImplementError to
+ NotImplementedError.
-Fri Jul 29 10:49:52 2016 Koichi Sasada <ko1@atdot.net>
+Tue Jun 20 16:22:38 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_core.h (VM_LOCAL_P): should return an integer value.
- reported at
- http://d.hatena.ne.jp/nagachika/20160728/ruby_trunk_changes_55764_55770
+ * time.c (make_time_t): bug in DST boundary.
-Fri Jul 29 04:23:08 2016 Koichi Sasada <ko1@atdot.net>
+Tue Jun 20 10:54:19 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * vm_core.h (VM_ENV_LOCAL_P): return truthy (0 or not) value.
+ * configure.in: add eval sitedir.
- * vm.c (rb_vm_make_proc_lambda): use VM_ENV_ESCAPED_P() macro.
+Tue Jun 20 06:14:43 2000 Wakou Aoyama <wakou@fsinet.or.jp>
-Fri Jul 29 03:49:04 2016 Koichi Sasada <ko1@atdot.net>
+ * lib/cgi.rb: change: version syntax. old: x.yz, now: x.y.z
- * vm.c, internal.h: remove RubyVM::Env class and all of env objects
- are imemo objects (imemo_env).
+ * lib/net/telnet.rb: ditto.
- * NEWS: describe this change. I believe nobody touch these objects
- because there are no method defined.
+Tue Jun 20 00:37:45 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_core.h: remove the following definitions.
- * rb_cEnv decl.
- * GetEnvPtr() because Env is no longer T_DATA object.
+ * re.c (rb_reg_kcode_m): Regexp#kcode returns nil for code unfixed
+ regexp object.
- * vm_core.h (rb_env_t): fix layout for imemo values.
+ * bignum.c (bigdivmod): bignum zero check was wrong.
- * vm_core.h (vm_assert_env): added.
+Mon Jun 19 10:48:28 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_core.h (vm_env_new): added.
+ * variable.c (rb_cvar_set): forgot to add security check for class
+ variable assignment.
-Thu Jul 28 19:53:21 2016 Koichi Sasada <ko1@atdot.net>
+Sun Jun 18 22:49:13 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * vm_core.h: revisit the structure of frame, block and env.
- [Bug #12628]
+ * configure.in: single quoted sitedir.
- This patch introduce many changes.
+ * mkconfig.rb: add DESTDIR for cross-compiling.
- * Introduce concept of "Block Handler (BH)" to represent
- passed blocks.
+ * lib/mkmf.rb: add DESTDIR.
- * move rb_control_frame_t::flag to ep[0] (as a special local
- variable). This flags represents not only frame type, but also
- env flags such as escaped.
+ * ruby.c (load_file): force binmode if fname includes ".exe"
+ on DOSISH.
- * rename `rb_block_t` to `struct rb_block`.
+Sat Jun 17 23:22:17 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * Make Proc, Binding and RubyVM::Env objects wb-protected.
+ * sprintf.c (rb_f_sprintf): should ignore negative precision given
+ by <%.*>.
- Check [Bug #12628] for more details.
+ * sprintf.c (rb_f_sprintf): should allow zero precision.
-Thu Jul 28 15:05:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jun 17 03:13:29 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/ruby.h (ruby_fl_type): use __extension__ to get rid
- of pedantic warning against RUBY_FL_USER19.
- https://github.com/skylightio/skylight-ruby/issues/64
+ * time.c (time_localtime): avoid unnecessary call of localtime.
- * include/ruby/ruby.h (rb_mul_size_overflow): ditto for use of
- int128.
+ * time.c (time_gmtime): avoid unnecessary call of gmtime.
-Wed Jul 27 10:32:59 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * process.c (proc_wait2): new method.
- * enc/windows_1253.c: Remove dead code found by Coverity Scan.
+ * process.c (proc_waitpid): second argument made optional.
-Tue Jul 26 22:43:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (proc_waitpid2): new method.
- * gc.c (run_finalizer): make saved running finalizer state
- volatile to ensure not to be clobbered by longjmp.
+Sat Jun 17 00:05:00 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jul 26 19:26:00 2016 Koichi Sasada <ko1@atdot.net>
+ * re.c (rb_reg_clone): should initialize member fields.
- * vm_insnhelper.c: introduce rb_vm_pop_frame() and use it
- instead of setting rb_thread_t::cfp directly.
+Fri Jun 16 22:49:34 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_insnhelper.c (vm_pop_frame): return the result of
- finish frame or not.
+ * io.c (rb_io_rewind): set lineno to zero.
-Tue Jul 26 19:06:39 2016 Koichi Sasada <ko1@atdot.net>
+Fri Jun 16 22:47:47 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * gc.c (rb_raw_obj_info): support to show Proc obj.
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.23.
-Tue Jul 26 18:55:55 2016 Koichi Sasada <ko1@atdot.net>
+ * lib/net/protocol.rb: too many CRLF in last line.
- * gc.c (gc_mark): add `inline' explicitly.
- I expected to inline this function implicitly at the loop
- (ex: marking T_ARRAY objects) but sometimes it remains as
- normal call.
+Fri Jun 16 21:23:59 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Tue Jul 26 16:33:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * configure.in: add pause(2) checking.
- * enc/windows_1257.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1257, by Sho Koike.
+ * eval.c: define pause() if missing.
-Tue Jul 26 16:19:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Fri Jun 16 18:41:58 2000 Koji Arai <JCA02266@nifty.ne.jp>
- * enc/windows_1250.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1250, by Sho Koike.
+ * process.c (proc_setsid): BSD-style setpgrp() don't return
+ process group ID, but 0 or -1.
- * ChangeLog: Fixed order of previous two entries.
+Fri Jun 16 16:23:35 2000 Koji Arai <JCA02266@nifty.ne.jp>
-Tue Jul 26 15:54:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * file.c (rb_stat_inspect): gives detailed information;
+ compatibility with ruby-1.4.x.
- * enc/windows_1253.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1253, by Takumi Koyama.
+Fri Jun 16 05:18:45 2000 Yasuhiro Fukuma <yasuf@bsdclub.org>
-Tue Jul 26 15:30:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * configure.in: FreeBSD: do not link dummy libxpg4 which was
+ merged into libc.
- * enc/windows_1251.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1251, by Shunsuke Sato.
+Fri Jun 16 03:17:36 2000 Satoshi Nojo <nojo@t-samukawa.or.jp>
-Tue Jul 26 13:04:59 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * ext/dbm/dbm.c (fdbm_length): use GetDBM. empty?, [] too.
- * test/ruby/enc/test_case_comprehensive.rb: Add explicit skip test for
- availability of Unicode data files.
+ * ext/gdbm/gdbm.c (fgdbm_length): ditto.
-Mon Jul 25 21:33:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/sdbm/init.c (fsdbm_length): ditto.
- * range.c (check_step_domain): check step argument domain by <=>
- method, instead of < and >.
+Fri Jun 16 01:57:31 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jul 25 21:11:32 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * eval.c (rb_thread_sleep_forever): pause(2) instead of sleep(3).
- * doc/maintainers.rdoc: fix filenames.
+Thu Jun 15 10:46:36 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jul 25 16:59:00 2016 Koichi Sasada <ko1@atdot.net>
+ * string.c (rb_str_sub_bang): should probagate taintness from
+ replacement string.
- * debug.c (ruby_debug_printf): use rb_raw_obj_info()
- instead of rb_inspect() because it is more robust way
- to see object internal.
+Wed Jun 14 17:01:41 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Sun Jul 24 16:33:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * rubytest.rb: add CONFIG['EXEEXT'] to the executable file name.
- * regenc.h/c, include/ruby/oniguruma.h, enc/ascii.c, big5.c, cp949.c,
- emacs_mule.c, euc_jp.c, euc_kr.c, euc_tw.c, gb18030.c, gbk.c,
- iso_8859_1|2|3|4|5|6|7|8|9|10|11|13|14|15|16.c, koi8_r.c, koi8_u.c,
- shift_jis.c, unicode.c, us_ascii.c, utf_16|32be|le.c, utf_8.c,
- windows_1250|51|52|53|54|57.c, windows_31j.c, unicode.c:
- Remove conditional compilation macro ONIG_CASE_MAPPING. [Feature #12386].
+Wed Jun 14 14:50:00 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jul 24 12:53:42 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * string.c (rb_f_sub): assign to $_ only if modification happens.
- * doc/maintainers.rdoc: xmlrpc is bundled gem from Ruby 2.4.
+ * string.c (rb_f_gsub): ditto.
-Sun Jul 24 12:07:39 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * string.c (rb_f_chop): ditto.
- * doc/maintainers.rdoc: Update OpenSSL maintainer.
+ * string.c (rb_f_chomp): ditto.
-Sat Jul 23 22:43:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_reopen): preserve file position by ftell/fseek, if io
+ is a seekable.
- * internal.h (Check_Type): inline check for the object type.
+ * eval.c (method_arity): wrong arity number for the methods with
+ optional arguments.
-Sat Jul 23 04:06:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (make_time_t): opposite timezone shift (should be negative).
- * include/ruby/ruby.h (RTEST, NIL_P): use RUBY prefixed name in
- macros.
+Wed Jun 14 14:07:38 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Sat Jul 23 01:41:29 2016 Eric Wong <e@80x24.org>
+ * io.c: typo(ig/if).
- * lib/webrick/httpservlet/cgihandler.rb (do_GET): delete HTTP_PROXY
- * test/webrick/test_cgi.rb (test_cgi_env): new test
- * test/webrick/webrick.cgi (do_GET): new endpoint to dump env
- [ruby-core:76511] [Bug #12610]
+ * re.c: typo(re/reg). add rb_reg_check().
-Fri Jul 22 19:55:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c: remove unneeded declare(daylight, timezone).
- * vm.c (vm_set_main_stack): remove unnecessary check. toplevel
- binding must be initialized. [Bug #12611] (N1)
+ * configure.in: add include <time.h> when daylight checking.
- * win32/win32.c (w32_symlink): fix return type. [Bug #12611] (N3)
+Wed Jun 14 11:36:52 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * string.c (rb_str_split_m): simplify the condition.
- [Bug #12611](N4)
+ * marshal.c (r_object): modified for symbols.
-Fri Jul 22 17:13:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * marshal.c (w_object): ditto.
- * string.c (String#dump): Change escaping of non-ASCII characters in
- UTF-8 to use upper-case four-digit hexadecimal escapes without braces
- where possible [Feature #12419].
+Wed Jun 14 10:04:58 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_string.rb (test_dump): Add tests for above.
+ * re.c (rb_memcmp): should compare according to ruby_ignorecase.
-Fri Jul 22 10:35:35 2016 Kouhei Sutou <kou@cozmixng.org>
+ * string.c (rb_str_cmp): use rb_memcmp.
- * lib/rexml/attribute.rb (REXML::Attribute#to_string): Fix wrong
- entry reference name of double quote.
- [Bug #12609][ruby-core:76509]
- Patch by Joseph Marrero. Thanks!!!
+ * string.c (rb_str_index): ditto.
-Fri Jul 22 10:32:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (rb_str_rindex): ditto.
- * template/unicode_norm_gen.tmpl: Remove
- UnicodeNormalize::UNICODE_VERSION at origin [Feature #12546].
+ * string.c (rb_str_each_line): ditto.
-Fri Jul 22 09:23:51 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Jun 14 04:58:53 2000 Dave Thomas <dave@thomases.com>
- * LEGAL: Added entries for files under the USD license.
- [Bug #12598][ruby-core:76428][ci skip]
+ * io.c (rb_io_set_lineno): should have returned VALUE, not
+ integer.
-Fri Jul 22 09:19:57 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Jun 14 09:29:42 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * LEGAL: Added entry for `lib/rdoc/generator/template/darkfish/css/fonts.css`
- [Misc #12550][ruby-core:76255][ci skip]
+ * string.c (rb_str_dup): dup should always propagate taintness.
-Fri Jul 22 06:28:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 14 00:50:14 2000 Wakou Aoyama <wakou@fsinet.or.jp>
- * gc.c (run_finalizer): push and exec tag just once, instead of
- protecting for each finalizer.
+ * lib/cgi.rb: read_multipart(): if no content body then raise EOFError.
- * gc.c (gc_start_internal, rb_gc_start): set finalizing flag
- whenever calling deferred finalizers not to recurse.
+Tue Jun 13 11:46:17 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Jul 21 22:26:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * process.c (proc_setsid): try implement it using setpgrp() and
+ ioctl(fd, TIOCNOTTY, NULL).
- * missing/strl{cat,cpy}.c: Update latest upstream files.
- [Misc #12205][ruby-core:74487]
- * LEGAL: Update license for missing/strl{cat,cpy}.c.
+ * re.c (rb_reg_prepare_re): magic variable $= should affect regex
+ pattern match.
-Thu Jul 21 21:53:30 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * time.c (make_time_t): use tm.tm_gmtoff if possible.
- * LEGAL: added file list with Public domain license.
- [ruby-core:76254][Bug #12549]
+ * time.c (time_zone): use tm.tm_zone if available.
-Wed Jul 20 17:44:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 13 01:50:57 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * enumerator.c (lazy_uniq): new method Enumerator::Lazy#uniq.
- [Feature #11090]
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.22.
- * enum.c (enum_uniq): new method Enumerable#uniq.
- [Feature #11090]
+ * lib/net/http.rb: HTTPResponse#body returns body.
-Wed Jul 20 17:35:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 12 23:41:54 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * hash.c (rb_hash_add_new_element): add new element or do nothing
- if it is contained already.
+ * configure.in (daylight): avoid GCC optimization.
- * array.c (ary_add_hash, ary_add_hash_by): use
- rb_hash_add_new_element.
+Mon Jun 12 19:02:27 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Tue Jul 19 18:21:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * configure.in: cygwin has strange timezone.
- * lib/unicode_normalize/tables.rb: Remove
- UnicodeNormalize::UNICODE_VERSION (#12546).
+ * time.c (time_zone): use tzname and daylight.
-Tue Jul 19 15:38:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jun 10 23:10:32 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * variable.c (rb_local_constants_i): exclude private constants
- when excluding inherited constants too. [Bug #12345]
+ * io.c (rb_io_seek): whence is optional, default is SEEK_SET.
-Sun Jul 17 23:42:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Fri Jun 9 17:00:29 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * numeric.c (num_finite_p, num_infinite_p): Add Numeric#finite? and
- Numeric#infinite? [Feature #12039] [ruby-core:73618]
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.21.
- * complex.c (rb_complex_finite_p): Add Complex#finite?
+ * lib/net/http.rb: exception is raised with response object.
- * complex.c (rb_complex_infinite_p): Add Complex#infinite?
+Fri Jun 9 15:11:35 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_bignum.rb: Add test for Integer#finite? and
- Integer#infinite?
+ * time.c (make_time_t): supports daylight saving time.
- * test/ruby/test_fixnum.rb: ditto.
+ * eval.c (rb_thread_safe_level): should retrieve current $SAFE
+ value if a thread is the current thread.
- * test/ruby/test_rational.rb: Add test for Rational#finite? and
- Rational#infinite?
+Thu Jun 8 14:25:45 2000 Hiroshi Igarashi <iga@ruby-lang.org>
- * test/ruby/test_complex.rb: Add test for Complex#finite? and
- Complex#infinite?
+ * lib/mkmf.rb: add target `distclean' in Makefile for extlib.
+ target `clean' doesn't remove Makefile.
-Sun Jul 17 20:59:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 8 13:34:03 2000 Dave Thomas <dave@thomases.com>
- * common.mk, enc/depend (casefold.h, name2ctype.h): move to
- unicode data directory per version.
+ * numeric.c: add nan?, infinite?, and finite? to Float
-Sat Jul 16 06:26:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 8 00:31:04 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * common.mk, enc/Makefile.in: moved timestamp files for
- directories under the specific directory, to get rid of match
- with files under the source directory.
+ * regex.h: export re_mbctab properly on cygwin.
-Fri Jul 15 22:05:13 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * dln.c: use dlopen instead of LoadLibrary on cygwin.
- * string.c (str_buf_cat): Fix potential integer overflow of capa.
- In addition, termlen is used instead of +1.
+Thu Jun 8 13:41:34 2000 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Fri Jul 15 21:30:38 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * file.c (rb_file_s_basename): might dump core.
- * string.c (str_buf_cat): Fix capa size for embed string.
- Fix bug in r55547. [Bug #12536]
+Tue Jun 6 03:29:12 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jul 15 18:13:15 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * dir.c (dir_foreach): now returns nil for consistency.
- * gems/bundled_gems: update latest gems.
+ * bignum.c (bigdivmod): modulo by small numbers was wrong.
-Fri Jul 15 17:08:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 5 00:18:08 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * util.c (ruby_strtod): do not underflow only by preceding zeros,
- which may be canceled out by the exponent.
- http://twitter.com/kazuho/status/753829998767714305
+ * bignum.c: avoid conflict with USHORT on mingw32.
-Fri Jul 15 09:53:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jun 5 00:13:35 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * enc/unicode/case-folding.rb, tool/enc-unicode.rb: check if
- Unicode versions are consistent with each other.
+ * eval.c (rb_thread_schedule): =/== typo.
-Fri Jul 15 08:25:15 2016 Jeremy Evans <code@jeremyevans.net>
+Sun Jun 4 03:17:36 2000 Wakou Aoyama <wakou@fsinet.or.jp>
- * string.c (STR_BUF_MIN_SIZE): reduce from 128 to 127
- [ruby-core:76371] [Feature #12025]
- * string.c (rb_str_buf_new): adjust for above reduction
+ * lib/cgi.rb: improve: CGI::pretty()
-Thu Jul 14 17:26:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Jun 4 02:01:10 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * Makefile.in (enc/unicode/name2ctype.h): remove stale recipe,
- which did not support Unicode age properties.
+ * lib/mkmf.rb: do not need to add -L$(topdir) in --enable-shared case.
- * common.mk (enc/unicode/name2ctype.h): update by --header option
- of tool/enc-unicode.rb. enc/unicode/name2ctype.kwd file has not
- been used.
+Sat Jun 3 13:50:06 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * common.mk (enc/unicode/name2ctype.kwd): rule to create from
- Unicode data files, used only when the target does not exist.
+ * parse.y (rb_id2name): should support constant attrset
+ identifiers.
-Thu Jul 14 13:10:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bignum.c (rb_big_eq): Bignum#== should not raise exception.
- * ext/json/lib/json/ext: remove stale directory. bundled
- extension libraries are placed under the directory for each
- architectures, but not mixed with plain text script libraries.
+Fri Jun 2 11:24:48 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Jul 14 12:48:47 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * io.c (rb_io_popen): open with a block returns the value from the
+ block. old behavior was back.
- * ext/json/**/*.rb: merge original files from upstream repository.
- It only fixes styles of frozen string literal.
+Fri Jun 2 00:42:31 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jul 13 22:23:03 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
- * test/json/json_common_interface_test.rb: use assert_raise instead of
- assert_raises.
+ * eval.c (rb_thread_cleanup): should clear priority for thread
+ termination.
-Wed Jul 13 22:14:23 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Thu Jun 01 22:39:41 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * test/lib/test/unit.rb: added test files with `_test` suffix for json
- upstream.
- * test/json: merge original test files from json upstream.
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.20.
-Wed Jul 13 18:09:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * lib/net/http.rb: wrongly closed the socket twice
+ when no Content-Length: was given.
- * enc/iso_8859_9.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-9, by Kazuki Iijima.
+Thu Jun 1 00:59:15 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/iso_8859_9.c: Exclude dotless i/I with dot from case-insensitive
- matching because they are not a case pair.
+ * eval.c (rb_yield_0): convert Qundef to [].
- * test/ruby/enc/test_iso_8859.rb: Make test coverage for ISO-8859-9
- a bit more complete.
+Wed May 31 20:45:59 2000 Dave Thomas <Dave@Thomases.com>
-Wed Jul 13 17:21:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (rb_str_slice_bang): wrong argument number.
- * enc/windows_1252.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1252, by Serina Tai.
+Wed May 31 12:37:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
+ * eval.c (rb_exec_end_proc): print error message from END procs.
-Wed Jul 13 16:19:14 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed May 31 04:06:41 2000 Wakou Aoyama <wakou@fsinet.or.jp>
- * enc/iso_8859_7.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-7, by Kosuke Kurihara.
+ * lib/cgi.rb: change: CGI#out() if "HEAD" == REQUEST_METHOD then
+ output only HTTP header.
- * test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
+Wed May 31 01:54:21 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jul 13 16:08:08 2016 Koichi Sasada <ko1@atdot.net>
+ * eval.c (rb_thread_schedule): set main_thread->status to
+ THREAD_TO_KILL, before raising deadlock error.
- * gc.c (gc_mark_roots): should mark the VM object itself to mark
- singleton class of the VM object.
- Before this patch, we only set mark bit for the VM object and
- invoke mark function separately.
- [Bug #12583]
+ * eval.c (rb_thread_deadlock): if curr_thread == main_thread, do
+ not call rb_thread_restore_context()
- * test/ruby/test_gc.rb: add a test.
+Tue May 30 23:33:41 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Wed Jul 13 15:59:59 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/mkmf.rb (create_makefile): add $(TARGET).ilk and *.pdb
+ to cleanup files for mswin32.
- * math.c (_USE_MATH_DEFINES): it must be set before including internal.h
- because internal.h includes ruby.h, ruby.h includes win32.h, and
- win32.h includes system's math.h.
- this change is to get rid of a compiler warning (redefinition of
- a macro) introduced at r55641.
+Mon May 29 10:41:10 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
-Wed Jul 13 15:19:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * file.c (rb_file_s_basename): should propagate taintness.
- * enc/iso_8859_1.c, enc/iso_8859_4.c: Avoid setting modification flag if
- there is no modification.
+Sun May 28 21:37:13 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Wed Jul 13 14:40:04 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c: bug fix: DLEXT2.
- * enc/iso_8859_5.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-5, by Masaru Onodera.
+Sun May 28 19:21:43 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
+ * win32/win32.c: use ruby's glob.
-Wed Jul 13 14:28:33 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * dir.c: "glob" exported and renamed to "rb_glob".
- * math.c (rb_math_sqrt): r55646 must use f_signbit.
+ * ruby.h: ditto.
-Wed Jul 13 14:22:50 2016 Koichi Sasada <ko1@atdot.net>
+ * main.c: turn off command line mingw32's globbing.
- * iseq.c (Init_ISeq): undef ISeq.translate and ISeq.load_iseq
- to prevent calling super classes' methods.
+Wed May 25 22:25:13 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- Without this patch, you can write workaround like:
+ * ext/extmk.rb.in: use "ftools" instead of "rm -f".
- class << RubyVM::InstructionSequence
- def translate; end
- undef translate
- end
+ * lib/mkmf.rb: ditto.
- * test/ruby/test_iseq.rb: add a test.
+Thu May 25 22:01:32 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Wed Jul 13 14:16:03 2016 Koichi Sasada <ko1@atdot.net>
+ * defines.h: mswin32: remove obsolete USHORT definition.
- * vm_method.c (method_entry_get_without_cache): check
- undefined method even if ruby_running is FALSE.
+ * re.h: mswin32: use EXTERN instead of extern.
- We haven't call "undef"ed methods before ruby_running.
- So that this issue does not make troubles.
+ * regex.h: mswin32: export re_mbctab properly.
-Wed Jul 13 14:15:22 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * win32/ruby.def: add ruby_ignorecase and regex.c's exports.
- * enc/windows_1254.c: Adjust variable/macro names.
+Thu May 25 21:28:44 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
-Wed Jul 13 13:19:12 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * re.c (rb_reg_expr_str): escape un-printable character.
- * enc/iso_8859_9.c, enc/windows_1254.c: Split Windows-1254 from
- ISO-8859-9 to be able to implement different case conversions.
+Thu May 25 01:35:15 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jul 13 13:08:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * parse.y (tokadd_escape): forgot to add `\x' to hexadecimal
+ escape sequences.
- * enc/iso_8859_7.c, enc/windows_1253.c: Split Windows-1253 from
- ISO-8859-7 to be able to implement different case conversions.
+ * object.c (rb_obj_dup): dup for normal object (T_OBJECT) copies
+ instance variables only.
-Wed Jul 13 10:50:12 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed May 24 23:49:47 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/iso_8859_13.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-13, by Kanon Shindo.
+ * object.c (rb_mod_initialize): should provide initialize.
-Wed Jul 13 10:31:39 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed May 24 23:17:50 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * enc/iso_8859_13.c, enc/windows_1257.c: Split Windows-1257 from
- ISO-8859-13 to be able to implement different case conversions.
+ * win32/Makefile: remove unnecessary mv and rm command call.
-Wed Jul 13 09:02:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed May 24 21:01:04 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * enc/iso_8859_3.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-3, by Takuya Miyamoto.
+ * ext/pty/pty.c: use "" instead of <> to include ruby.h and rubyio.h
+ for BeOS (PowerPC).
- * test/ruby/enc/test_case_comprehensive.rb: Extend special treatment
- for Turkic.
+ * file.c (rb_find_file): should check dln_find_file() result.
- * enc/iso_8859_3.c: Exclude dotless i/I with dot from case-insensitive
- matching because they are not a case pair.
+ * win32/ruby.def: add rb_block_given_p.
-Wed Jul 13 08:40:21 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed May 24 16:32:45 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_iso_8859.rb: Exclude dotless i/I with dot from
- case-insensitive matching because they are not a case pair.
+ * io.c (rb_io_popen): popen does not take 3rd argument anymore.
-Tue Jul 12 23:13:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (rb_reg_desc): re may be zero, check before dereferencing.
- * math.c (rb_math_sqrt): [EXPERIMENTAL] move Complex sqrt support
- from mathn.rb.
+Wed May 24 16:03:06 2000 Wakou Aoyama <wakou@fsinet.or.jp>
-Tue Jul 12 01:25:09 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/cgi.rb: bug fix: CGI::escape(), CGI::Cookie::new()
- * configure.in, lib/mkmf.rb, win32/Makefile.sub (CSRCFLAG): make the
- compiler option replacable in Makefile.
+ * lib/net/telnet.rb: improve: binmode(), telnetmode() interface
- * win32/Makefile.sub (OUTFLAG, COUTFLAG): ditto.
+Wed May 24 13:12:31 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * win32/Makeile.sub, win32/setup.mak (CC): should not append `-nologo`
- option forcely.
+ * misc/ruby-mode.el (ruby-parse-region): support `while .. do'
+ etc. But corresponding keywords must be at the beginning of
+ line.
-Mon Jul 11 18:05:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue May 23 23:50:12 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/iso_8859_1.c: Moved test for lowercase characters without
- uppercase equivalent.
+ * re.c (rb_reg_initialize_m): wrong kcode value.
-Mon Jul 11 17:49:25 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * re.c (rb_reg_s_new): forgot to initialize re->ptr.
- * enc/iso_8859_4.c, enc/iso_8859_10.c, enc/iso_8859_14.c,
- enc/iso_8859_15.c, enc/iso_8859_16.c: Replace case-by-case code with
- lookup in ENC_ISO_8859_xx_TO_LOWER_CASE table.
+Tue May 23 08:36:24 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jul 11 16:00:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_compile_pattern): forgot to restore old option
+ status by (?ix-ix).
- * ext/stringio/stringio.c (strio_each, strio_readlines): convert
- arguments just once before reading, instead of conversions for
- each lines, as r55603.
+ * regex.c (re_compile_fastmap): anychar may match newline if
+ RE_OPTION_MULTILINE or RE_OPTION_POSIXLINE is set.
-Sun Jul 10 19:53:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon May 22 22:45:06 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * enc/iso_8859_10.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-10, by Toya Hosokawa.
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.19.
-Sun Jul 10 19:33:47 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * lib/net/http.rb: do not use Regexp "p" option.
- * test/ruby/enc/test_case_comprehensive.rb: Changed testing logic to
- catch unintended modifications of characters that do not have a case
- equivalent in the respective encoding.
- * enc/iso_8859_1.c, enc/iso_8859_15.c: Fixed unintended modifications of
- micro sign and y with diaeresis.
+Mon May 22 21:56:43 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
-Sun Jul 10 17:05:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * struct.c (rb_struct_getmember): should use ID2SYM, not INT2NUM.
- * enc/iso_8859_4.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-4, by Kotaro Yoshida.
+Mon May 22 15:07:37 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jul 10 16:17:47 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * file.c (rb_find_file): should check if the file really exists.
- * test/ruby/enc/test_case_comprehensive.rb: Fixed a comment
- (message belongs to last commit). [ci skip]
+Mon May 22 09:08:12 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jul 10 14:27:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_io_popen): _exit(0) after processing block under the
+ child process.
- * util.c (ruby_dtoa): [EXPERIMENTAL] adjust the case that the
- Float value is close to the exact but unrepresentable middle
- value of two values in the given precision, as r55604.
+ * io.c (rb_io_popen): flush stdout/stderr before subprocess
+ termination.
-Sun Jul 10 08:57:20 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (rb_check_safe_str): insert rb_secure(4); operation
+ requires untainted string should be prohibited in level 4.
- * thread.c: Fixed implicit conversion error with Apple clang-800.0.31
+Sun May 21 21:17:00 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Sat Jul 9 12:43:09 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * configure.in: add Setup.dj for djgpp cross-compiling.
- * lib/getoptlong.rb: use false instead of FALSE.
+ * Setup.dj: add readline.
-Fri Jul 8 21:49:28 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * instruby.rb: copy win32/win32.h to archlibdir on mingw32.
- * thread.c (rb_wait_for_single_fd): Clean up fds.revents every time
- before calling ppoll(2). [Bug #12575] [ruby-dev:49725]
+Sun May 21 20:58:08 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Fri Jul 8 14:16:48 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * pack.c: fix OFF16 and OFF32 definitions for Alpha and IRIX64.
- * vm_args.c (vm_caller_setup_arg_block): call rb_sym_to_proc()
- directly to reduce method dispatch overhead.
+Sun May 21 17:31:37 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Fri Jul 8 08:43:31 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * instruby.rb: support "make install" for cross-compiling.
- * io.c (rb_io_s_read): add description of pipes to the documentation
- of IO.read.
+ * ext/extmk.rb.in: ditto.
-Fri Jul 8 03:54:22 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Sun May 21 14:22:49 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * vm_args.c (setup_parameters_complex): don't raise ArgumentError
- if an array is given for instance_exec with optional argument.
- [ruby-core:76300] [Bug #12568]
- https://github.com/rails/rails/pull/25699
+ * Makefile.in: rename prep.rb to fake.rb.
-Fri Jul 8 00:47:36 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in: ditto.
- * vm_eval.c (yield_under): change prototype to get argc/argv.
+Sat May 20 23:29:14 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_eval.c (specific_eval): change for above.
+ * dir.c (dir_s_new): does not take block; "open" does.
- * vm_eval.c (rb_obj_instance_exec): avoid object allocation.
+ * io.c (rb_io_s_new): ditto.
- * vm_eval.c (rb_mod_module_exec): ditto.
+Fri May 19 07:44:26 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Jul 7 20:08:37 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * dir.c (dir_s_open): Dir#open does not returns closed Dir if a
+ block is given to the method.
- * vm_args.c (vm_caller_setup_arg_block): disable symbol block
- argument optimization when tail call optimization is enabled,
- in order to avoid SEGV. [ruby-core:76288] [Bug #12565]
+ * re.c (rb_reg_initialize_m): Regexp::new calls initialize now.
-Thu Jul 7 16:37:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (Init_String): String#delete_at removed.
- * numeric.c (flo_round): [EXPERIMENTAL] adjust the case that the
- receiver is close to the exact but unrepresentable middle value
- of two values in the given precision.
- http://d.hatena.ne.jp/hnw/20160702
+ * string.c (rb_str_aset_m): should have checked argc != 2.
-Thu Jul 7 16:31:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_schedule): select(2) was called too many.
- * io.c (rb_io_s_foreach, rb_io_s_readlines): convert arguments
- just once before reading, instead of conversions for each lines.
+ * regex.c (re_compile_pattern): a bug in (?m) support. Pointed
+ out by Dave Thomas <Dave@thomases.com>.
-Wed Jul 6 19:54:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu May 18 23:55:26 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * enc/iso_8859_14.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-14, by Yutaro Tada.
+ * dln.c (search_undef): st_lookup()'s 3rd parameter should be
+ a pointer of the variable which has the same size and alignment
+ as `char *'.
-Wed Jul 6 19:24:48 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * marshal.c (w_symbol, w_object): ditto.
- * enc/iso_8859_1.c, enc/iso_8859_15.c, enc/iso_8859_16.c:
- Align indenting to onigmo convention.
+ * parse.y (rb_intern): ditto.
-Wed Jul 6 18:59:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu May 18 18:00:35 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * enc/iso_8859_15.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-15, by Maho Harada.
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.18.
-Wed Jul 6 18:34:21 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * lib/net/protocol.rb: Net::Version was removed.
- * enc/iso_8859_16.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-16, by Satoshi Kayama.
+ * lib/net/smtp.rb: use Socket.gethostname to get local host name.
-Wed Jul 6 14:44:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 18 13:34:57 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/mkmf.rb (create_makefile): store $headers in LOCAL_HDRS for
- depend files.
+ * ext/socket/socket.c (ruby_connect): should not have replaced
+ thread_write_select() by rb_thread_fd_writable().
- * ext/digest/digest_conf.rb (digest_conf): add implementation
- specific headers to $header.
+Thu May 18 09:01:25 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * ext/digest/{md5,rmd160,sha1,sha2}/depend: add LOCAL_HDRS to the
- dependencies.
+ * configure.in, ext/extmk.rb.in, lib/mkmf.rb: remove BeOS R3 support.
+ Make a shared library (libruby.so) only if the --enable-shared
+ option is specified.
-Wed Jul 6 08:59:35 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * instruby.rb: no longer use libruby.so.LIB and import.h.
- * lib/net/http/generic_request.rb (write_header): A Request-Line must
- not contain CR or LF.
+ * io.c: fix READ_DATA_PENDING definition for BeOS (PowerPC).
-Wed Jul 6 07:11:27 2016 Shugo Maeda <shugo@ruby-lang.org>
+Wed May 17 14:14:23 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/net/ftp.rb (putline): raise an ArgumentError when
- CR or LF is included in a line.
+ * re.c (rb_reg_new_1): use /m instead of /p.
-Tue Jul 5 20:49:30 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed May 17 02:22:03 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/json/*, test/json/*: Update json-2.0.1.
- Changes of 2.0.0: https://github.com/flori/json/blob/f679ebd0c69a94e3e70a897ac9a229f5779c2ee1/CHANGES.md#2015-09-11-200
- Changes of 2.0.1: https://github.com/flori/json/blob/f679ebd0c69a94e3e70a897ac9a229f5779c2ee1/CHANGES.md#2016-07-01-201
- [Feature #12542][ruby-dev:49706][fix GH-1395]
+ * eval.c (rb_thread_polling): wait 0.06 second to let other
+ processes run.
-Tue Jul 5 19:39:49 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * process.c (rb_waitpid): avoid busy wait using rb_thread_polling.
- * string.c (rb_str_change_terminator_length): New function to change
- termlen and resize heap for the terminator. This is split from
- rb_str_fill_terminator (str_fill_term) because filling terminator
- and changing terminator length are different things. [Bug #12536]
+ * file.c (rb_thread_flock): ditto.
- * internal.h: declaration for rb_str_change_terminator_length.
+ * parse.y (expr): avoid calling value_expr() twice.
- * string.c (str_fill_term): Simplify only to zero-fill the terminator.
- For non-shared strings, it assumes that (capa + termlen) bytes of
- heap is allocated. This partially reverts r55557.
+Wed May 17 00:45:57 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * encoding.c (rb_enc_associate_index): rb_str_change_terminator_length
- is used, and it should be called whenever the termlen is changed.
+ * io.c (rb_io_binmode): should check PLATFORMs, not O_BINARY, sigh...
- * string.c (str_capacity): New static function to return capacity
- of a string with the given termlen, because the termlen may
- sometimes be different from TERM_LEN(str) especially during
- changing termlen or filling terminator with specific termlen.
+Wed May 17 00:40:15 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * string.c (rb_str_capacity): Use str_capacity.
+ * win32/config.h: add DLEXT2, now DLEXT on mswin32 is "so".
-Tue Jul 5 11:07:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * win32/config.status: ditto.
- * pack.c (pack_pack): use union instead of bare variable to ease
- optimizations and avoid assigning x87 floating point number.
- [ruby-core:74496] [Bug #12209]
+ * win32/ruby.def: add symbol "rb_big_divmod".
+
+Tue May 16 19:45:32 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * intern.h: use EXTERN instead of extern.
+
+ * win32/ruby.def: add rb_defout, rb_stdout, ruby_errinfo,
+ ruby_sourceline, ruby_sourcefile to work with eruby
+ reported by Hiroshi Saito <HiroshiSaito@pob.org>.
+ Export both ruby_xmalloc and xmalloc etc.
+
+Tue May 16 17:00:05 2000 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
+
+ * eval.c (rb_thread_select): should check whether fds are null.
+
+Tue May 16 11:51:31 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (pipe_open): synchronize subprocess stdout/stderr.
+
+Mon May 15 15:38:09 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.h: exported symbols should be for xmalloc etc. are now
+ prefixed by 'ruby_', e.g. ruby_xmalloc().
+
+ * eval.c (rb_thread_select): remove busy wait for select.
+
+ * dir.c (glob): trailing path may be null, e.g. glob("**").
+
+Mon May 15 14:48:41 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * io.c (rb_io_pid): new method; returns nil if no process attached
+ to the IO.
+
+Mon May 15 01:18:20 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_s_popen): _exit after Proc execution.
+
+Sun May 14 18:05:59 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * Makefile.in: missing/nt.c -> win32/win32.c
+
+ * configure.in: bug fix; static linking on mingw32.
+
+ * cygwin/GNUmakefile.in: remove VPATH.
+
+ * ext/extmk.rb.in: Makefile set binmode with mingw32 on cygwin32.
+
+ * lib/mkmf.rb: ditto.
+
+ * win32/config.h: undef HAVE_SYS_FILE_H.
+
+Sun May 14 02:02:48 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * lib/irb/ruby-lex.rb: '/' should be escaped in character class.
+
+Sun May 14 00:54:43 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in, ...: support mingw32.
+
+ * defines.h: ditto. undef EXTERN for tcl/tk on cygwin.
+
+ * ext/*/extconf.rb: replace PLATFORM with RUBY_PLATFORM.
+
+ * ext/socket/sockport.h: define IN_MULTICAST for missing IN_MULTICAST.
+
+ * ext/tcltklib/tcltklib.c: remove declaration of rb_argv0.
+
+ * file.c: should check S_IXGRP, S_ISGID, not NT.
+
+ * io.c (rb_io_binmode): should check _IOBIN, O_BINARY, not PLATFORMs.
+
+Sat May 13 14:21:15 2000 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * io.c (rb_io_s_popen): should check whether a block is given.
+
+Fri May 12 17:33:44 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_compile_pattern): charset_not should not exclude
+ newline from matching set.
+
+Thu May 11 22:51:05 2000 Ryunosuke Ohshima <ryu@jaist.ac.jp>
+
+ * pack.c (pack_pack): Bignum support.
* pack.c (pack_unpack): ditto.
-Mon Jul 4 13:56:34 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * process.c: define sig_t if not exist.
- at least Solaris 10 and 11 doesn't have sig_t.
-
-Mon Jul 4 13:08:48 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * random.c (random_ulong_limited): avoid left shift count >= width of
- type on 32bit environment.
-
-Sun Jul 3 18:51:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb, test_regex_casefold.rb,
- test/test_unicode_normalize.rb: Replace UNICODE_VERSION from
- UnicodeNormalize with RbConfig::CONFIG['UNICODE_VERSION'] from
- feature 12460.
-
-Sun Jul 3 06:04:09 2016 Eric Wong <e@80x24.org>
-
- * process.c (disable_child_handler_fork_child): simplify
- [ruby-core:75781] [Misc #12439]
-
-Sun Jul 3 05:25:46 2016 Eric Wong <e@80x24.org>
-
- * tool/asm_parse.rb: add description
- * tool/change_maker.rb: ditto
- * tool/downloader.rb: ditto
- * tool/eval.rb: ditto
- * tool/expand-config.rb: ditto
- * tool/extlibs.rb: ditto
- * tool/fake.rb: ditto
- * tool/file2lastrev.rb: ditto
- * tool/gem-unpack.rb: ditto
- * tool/gen_dummy_probes.rb: ditto
- * tool/gen_ruby_tapset.rb: ditto
- * tool/generic_erb.rb: ditto
- * tool/id2token.rb: ditto
- * tool/ifchange: ditto
- * tool/insns2vm.rb: ditto
- * tool/instruction.rb: ditto
- * tool/jisx0208.rb: ditto
- * tool/merger.rb: ditto
- * tool/mkrunnable.rb: ditto
- * tool/node_name.rb: ditto
- * tool/parse.rb: ditto
- * tool/rbinstall.rb: ditto
- * tool/rbuninstall.rb: ditto
- * tool/rmdirs: ditto
- * tool/runruby.rb: ditto
- * tool/strip-rdoc.rb: ditto
- * tool/vcs.rb: ditto
- * tool/vtlh.rb: ditto
- * tool/ytab.sed: ditto
- * tool/enc-unicode.rb: fix typo
- * tool/mk_call_iseq_optimized.rb: ditto
- * tool/update-deps: ditto
- [ruby-core:76215] [Bug #12539]
- by Noah Gibbs <the.codefolio.guy@gmail.com>
+Thu May 11 21:19:29 2000 Hiroshi Igarashi <iga@ruby-lang.org>
+
+ * intern.h: add missing declarations of ruby API functions.
+
+ * ruby.h: fix function name in declarations.
+
+Thu May 11 22:29:25 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ext/md5/depend: add $(topdir)/config.h dependency to md5c.o.
+
+ * ext/md5/extconf.rb: new file to add -DHAVE_CONFIG_H flag for Alpha.
+
+Thu May 11 10:55:52 2000 Ryunosuke Ohshima <ryu@jaist.ac.jp>
+
+ * pack.c (pack_pack): packing BER compressed integer by `w'.
+
+ * pack.c (pack_unpack): unpacking BER.
+
+Thu May 11 00:37:55 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (parse_regx): remove in_brack.
+
+Wed May 10 12:51:18 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (proc_options): move adding RUBYLIB and "." to the load
+ path after #! line parsing.
+
+ * parse.y (parse_regx): should parse backslash escape like `\c['
+ here to avoid causing `unterminated regexp' error.
+
+Wed May 10 00:19:53 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * MANIFEST, beos/GNUmakefile.in, configure.in: no longer need
+ beos/GNUmakefile.in to support BeOS R4.5.2 (Intel) as a result
+ of eban's Makefile.in change.
+
+ * io.c: NOFILE is already defined on BeOS R4.5 (Intel) or later.
+
+ * lib/matrix.rb: remove debug print.
+
+ * regex.c: don't use nested comment.
+
+Tue May 9 17:08:43 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (massign): no longer convert nil into empty array.
+
+ * io.c (rb_io_s_popen): optional 3rd argument to give proc, which
+ will be executed in spawned child process.
+
+Mon May 8 23:47:39 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * eval.c (rb_callcc): prev & next should be initialized to zero.
+
+Mon May 8 23:17:36 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * dln.c (dln_init): remove possible buffer overrun. This is
+ suggested by Aleksi Niemela <aleksi.niemela@cinnober.com>.
+
+ * dln.c (init_funcname): ditto.
+
+Sat May 6 23:35:47 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (lhs): should allow `obj.Attr = 5' type expression.
+
+Sat May 6 15:46:08 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ext/socket/extconf.rb: add a new configure option to force use
+ of the WIDE Project's getaddrinfo(): --enbale-wide-getaddrinfo.
+
+Fri May 5 21:19:22 2000 MOROHOSHI Akihiko <moro@remus.dti.ne.jp>
+
+ * parse.y (yylex): allow '$1foo' and such.
+
+Fri May 5 17:57:24 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.17.
+
+ * lib/net/http.rb: write also port number in Host: field.
+
+ * lib/net/http.rb: see Proxy-Connection: to decide socket connection.
+
+Fri May 5 03:25:15 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_compile_fastmap): charset_not for multibyte
+ characters excluded too many characters.
+
+Tue May 2 13:23:43 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_schedule): little bit more impartial context
+ switching.
+
+Tue May 2 09:50:03 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * configure.in: add DLDLIBS to set platform specific library
+ for extensions.
+
+ * ext/extmk.rb.in: use @DLDLIBS@ instead of RUBY_PLATFORM choice.
+
+ * lib/mkmf.rb: use CONFIG["DLDLIBS"] instead of RUBY_PLATFORM choice.
+
+ * config_s.dj: add @DLDLIBS@.
+
+ * win32/config.status: ditto.
+
+ * win32/ruby.def: regular maintenance.
+
+Mon May 1 23:42:44 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in, eval.c: add DLEXT2. now DLEXT on Cygwin is "so".
+
+ * defines.h: use dllimport, dllexport for Cygwin 1.1.x.
+
+ * ruby.h: ditto.
+
+ * cygwin/GNUmakefile.in: ditto.
+
+ * ext/Win32API/Win32API.c: directly "call" in asm statement for
+ gcc 2.95.x or newer.
+
+Sat Apr 29 04:58:12 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * array.c (rb_ary_unshift_m): performance improvement.
+
+Fri Apr 28 00:19:22 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * array.c (rb_ary_unshift_m): takes items to push.
+
+Wed Apr 26 15:23:02 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (rb_str_succ): insert carrying character just before
+ the leftmost alpha numeric character.
+
+ * string.c (rb_str_succ): proper behavior for "".succ and "\377".succ.
+
+ * string.c (rb_str_succ): use realloc and memmove.
+
+Tue Apr 25 18:28:45 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.16.
+
+ * lib/net/smtp.rb: add SMTP AUTH
+
+Tue Apr 25 14:30:13 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_gets_internal): shortcut when rs == rb_default_rs.
+
+Sat Apr 22 23:14:41 2000 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
+
+ * configure.in: MacOS X support.
+
+Sat Apr 22 16:37:10 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.15.
+
+ * lib/net/http.rb: closing socket by watching both
+ user header and server response
+
+Fri Apr 21 21:44:34 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * io.c (rb_io_s_pipe): should set FMODE_SYNC.
+
+Thu Apr 20 16:59:22 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * eval.c (massign): `*lvalue = false' should assign `[false]' to
+ lvalue.
+
+Wed Apr 19 08:35:08 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * class.c (rb_singleton_class): generate singleton class for
+ special constants: nil, true, false.
+
+Wed Apr 19 02:09:30 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * class.c (rb_singleton_class): singleton method for nil, true,
+ false is possible now.
+
+ * eval.c (rb_eval): ditto.
+
+Tue Apr 18 18:54:25 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.14.
+
+ * lib/net/http.rb: new method HTTP#head2.
+
+ * lib/net/http.rb: get2/post2 does not raise exceptions.
+
+Mon Apr 17 15:16:31 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_close): to detect some exceptional status, writable
+ IO should be flushed before close;
+
+Sat Apr 15 18:29:00 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * array.c (rb_ary_collect_bang): Array#filter renamed.
+
+Fri Apr 14 19:47:11 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.13.
+
+ * lib/net/pop.rb: accept illegal timestamp
+
+ * lib/net/http.rb: when body was chunked, does not set Content-Length:
+
+Tue Apr 11 21:14:42 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * config_s.dj: add @sitedir@.
+ * configure.in: add --with-sitedir=DIR option.
+ * instruby.rb: use CONFIG["sitedir"].
+ * lib/mkmf.rb: support 'make site-install'.
+ * win32/config.status: add @sitedir@.
+
+Tue Apr 11 16:25:15 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * bignum.c (rb_big_2comp): unnecessary lvalue cast removed.
+
+Tue Apr 11 02:25:53 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * hash.c (env_fetch): new method.
+
+ * marshal.c (marshal_dump): accepts depth = nil for unlimited depth.
+
+Sun Apr 9 20:49:19 2000 Dave Thomas <Dave@Thomases.com>
+
+ * parse.y (str_extend): Allow class variables to be expanded.
+
+Fri Apr 7 02:03:54 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * error.c (rb_sys_fail): escape non-printable characters.
+
+Thu Apr 6 20:10:47 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ext/extmk.rb.in (create_makefile): BeOS --program-suffix support.
+ * lib/mkmf.rb (create_makefile): ditto.
+
+Thu Apr 6 09:55:26 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * error.c (rb_sys_fail): need rb_exc_new2() call on BeOS.
+
+Mon Apr 3 17:22:27 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_reopen): support tempfile.
+
+ * eval.c (catch_i): should supply argument.
+
+Sat Apr 1 22:50:28 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * marshal.c (r_object): wrong symbol restoration.
+
+Sat Apr 1 21:30:53 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * io.c(rb_io_printf, rb_f_printf): should use rb_io_write.
+
+Sat Apr 1 00:16:05 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * gc.c (rb_gc_call_finalizer_at_exit): should be clear flags
+ before calling finalizers.
+
+ * eval.c (specific_eval): can be called without SecurityError, if
+ $SAFE >= 4.
+
+ * object.c (sym_inspect): inspect gives ":sym", to_s gives "sym".
+
+Fri Mar 31 22:07:04 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.12.
+
+ * lib/net/protocol.rb: update Net::Protocol::Proxy#connect
+
+ * lib/net/protocol.rb: ReplyCode is not a class
+
+ * lib/net/http.rb: header value format was change:
+ values do not include header name
+
+ * lib/net/http.rb: header is not a Hash, but HTTPResponse
+
+Thu Mar 30 12:19:44 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * enum.c (enum_find): rb_eval_cmd() should be called with array.
+
+Tue Mar 28 13:57:05 2000 Clemens Hintze <c.hintze@gmx.net>
+
+ * ext/dbm/dbm.c (fdbm_invert): should return new hash.
+
+ * ext/gdbm/gdbm.c (fgdbm_invert): ditto.
+
+Tue Mar 28 00:58:03 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.11.
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: does not
+ dispatch any commands while dispatching command.
+
+ * lib/net/protocol.rb: failed to get error class of
+ inherited ReplyCode
+
+ * lib/net/http.rb: change feature of "get2", "post2"
+
+Mon Mar 27 01:34:58 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.10.
+
+ * lib/net/http.rb: return value of 'head' was wrong.
+
+Sun Mar 26 17:47:35 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.9.
+
+ * lib/net/smtp.rb: SMTP#do_ready wrongly took no arguments
+
+Sat Mar 25 23:21:10 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * marshal.c (w_object): symbols should be converted to ID before
+ dumping out.
+
+Sun Mar 25 16:52:48 2001 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * file.c (rb_file_flock): do not trap EINTR.
+
+ * missing/flock.c (flock): returns the value from lockf(2)
+ directly.
+
+Fri Mar 24 18:26:51 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * file.c (test_check): should have checked exact number of arguments.
+
+Fri Mar 24 21:02:11 2000 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * signal.c (trap): should treat some symbols as the signal.
+
+Fri Mar 24 06:58:03 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.8.
+
+ * lib/net/http.rb: post, get2, post2, get_body
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: separate
+ Command/Socket documentation.
+
+Thu Mar 23 02:26:14 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_fptr_finalize): fptr may be null.
+
+ * io.c (rb_io_s_new): now calls `initialize'.
+
+ * io.c (rb_io_initialize): actual open done in this method.
+
+ * io.c (rb_file_initialize): ditto.
+
+ * eval.c (rb_eval): class variables in singleton class definition
+ is now handled properly (I hope).
+
+Wed Mar 22 21:49:36 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * st.c (st_delete_safe): skip already deleted entry.
+
+ * hash.c (rb_hash_delete): modify brace miss.
+
+Wed Mar 22 08:53:58 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (exec_under): do not push cbase if ruby_cbase == under.
+
+ * node.h (NEW_CREF0): preserve cbase nesting.
+
+Tue Mar 21 12:57:50 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * object.c (rb_class_s_new): Class::new should call `inherited'.
+
+Sat Mar 18 12:36:09 2000 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+
+ * eval.c (rb_backtrace, make_backtrace): removed unused variable
+ `lev'.
+
+ * eval.c (rb_attr): calls `method_added' at attribute definition.
+
+ * eval.c (rb_mod_modfunc): calls `singleton_method_added' while
+ `module_function'.
+
+ * eval.c (rb_eval): parameter to `method_added' and
+ `singleton_method_added' is Symbol.
+
+ * eval.c (Init_eval): caches IDs for `method_added' and
+ `singleton_method_added'.
+
+Sat Mar 18 11:25:10 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (rescue): allows `rescue Error in foo'. experimental.
+ which is better this or preparing alias `exception' for `$!'?
+
+Fri Mar 17 15:02:45 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * variable.c (rb_autoload_id): defining new autoload should be
+ prohibited for $SAFE > 4.
+
+ * variable.c (rb_autoload_load): autoload should be possible for
+ $SAFE > 4.
+
+ * eval.c (call_trace_func): should handle T_ICLASS properly.
+
+Fri Mar 17 14:34:30 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (str_gsub): forgot to initialize str->orig.
+
+Fri Mar 17 01:24:59 2000 Dave Thomas <Dave@thomases.com>
+
+ * string.c (rb_str_clone): forgot to copy str->orig if STR_NO_ORIG
+ is set by Array#pack.
+
+Wed Mar 15 21:25:04 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * array.c (rb_ary_join): 'result' is always duplicated
+ before concat string.
-Sat Jul 2 18:04:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Mar 15 17:26:05 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/uri/mailto.rb (initialize): RFC3986_Parser#split sets opaque
- only if the URI has path-rootless, not path-empty.
- [ruby-core:76055] [Bug #12498]
- patched by Chris Heisterkamp <cheister@squareup.com>
+ * hash.c (rb_hash_s_create): unexpected recursive call removed.
+ this bug was found by Satoshi Nojo <nojo@t-samukawa.or.jp>.
-Sat Jul 2 04:26:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Mar 15 13:12:39 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * regcomp.c (noname_disable_map): don't optimize out group 0
- Ruby's Regexp doesn't allow normal numbered groups if the regexp
- has named groups. On such case it optimizes out related NT_ENCLOSE.
- But even on the case it can use \g<0>.
- This fix not to remove NT_ENCLOSE whose regnum is 0.
- [ruby-core:75828] [Bug #12454]
+ * eval.c (Init_Thread): Thread.join removed finally.
-Sat Jul 2 03:09:27 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * string.c (rb_str_chomp_bang): forgot to call rb_str_modify().
- * string.c: Partially reverts r55547 and r55555.
- ChangeLog about the reverted changes are also deleted in this file.
- [Bug #12536] [ruby-dev:49699] [ruby-dev:49702]
+Mon Mar 13 16:12:13 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jul 2 02:22:22 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * eval.c (block_pass): distinguish real orphan block and still
+ on-stack block passed by block argument.
- * string.c (str_fill_term): When termlen increases, re-allocation
- of memory for termlen should always be needed.
- In this fix, if possible, decrease capa instead of realloc.
- [Bug #12536] [ruby-dev:49699]
+Mon Mar 13 00:20:25 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jul 1 20:20:20 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * parse.y (f_norm_arg): proper error message when constant comes
+ in formal argument list. this message is suggested by Muvaw
+ Pnazte <bugathlon@yahoo.com>.
- * string.c: Specify termlen as far as possible.
- Additional fix for [Bug #12536] [ruby-dev:49699].
+ * eval.c (rb_f_raise): proper error message when the first
+ argument is not an exception class/object.
- * string.c (str_new_static): Specify termlen from the given encoding
- when creating a new String object is needed.
+ * string.c (rb_str_dup): dup now postpone buffer copy as long as
+ possible. performance improved by lazy copying.
- * string.c (rb_tainted_str_new_with_enc): New function to create a
- tainted String object with the given encoding. This means that
- the termlen is correctly specified. Currently static function.
- The function name might be renamed to rb_tainted_enc_str_new
- or rb_enc_tainted_str_new.
+Sun Mar 12 13:58:52 2000 Koji Arai <JCA02266@nifty.ne.jp>
- * string.c (rb_external_str_new_with_enc): Use encoding by using the
- above rb_tainted_str_new_with_enc().
+ * signal.c (rb_f_kill): should treat some symbols as the signal.
-Fri Jul 1 19:38:57 2016 Naohisa Goto <ngotogenome@gmail.com>
+Sat Mar 11 22:03:03 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/fiddle/test_pointer.rb (test_to_str, test_to_s, test_aref_aset):
- Attempt to use independent strings for destructive tests that
- directly modify values on memory by using Fiddle::Pointer.
- [Bug #12537] [ruby-dev:49700]
+ * string.c (rb_str_gsub): performance tune by avoiding buffer copy.
-Fri Jul 1 18:20:00 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_f_missing): check if argv[0] is ID.
- * .gdbinit (rb_ps_thread): show the detail of cfunc in ruby level
- backtrace.
+Sat Mar 11 15:49:41 2000 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Fri Jul 1 13:26:39 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * struct.c (rb_struct_aref): struct aref by symbol.
- * string.c (rb_str_subseq, str_substr): When RSTRING_EMBED_LEN_MAX
- is used, TERM_LEN(str) should be considered with it because
- embedded strings are also processed by TERM_FILL.
- Additional fix for [Bug #12536] [ruby-dev:49699].
+Sat Mar 11 05:07:11 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jul 1 12:11:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * process.c (proc_setpriority): should return 0, not nil.
- * .gdbinit (rb_count_objects): added gdb version of count_objects().
+ * process.c (proc_setpgid): ditto.
-Fri Jul 1 04:32:52 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Mar 10 18:14:54 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * .gdbinit (rb_ps_thread): show ruby level backtrace.
- Usually you can call `rb_ps` to show ruby level backtraces
- for all living threads.
- Note that it can call with core file like `gcore <pid>`
- and `gdb ruby core.<pid>`.
+ * file.c (path_check_1): confusing buf and path. this bug found
+ by <decoux@moulon.inra.fr>.
-Thu Jun 30 19:15:13 2016 Naohisa Goto <ngotogenome@gmail.com>
+Fri Mar 10 09:37:49 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * string.c: Fix memory corruptions when using UTF-16/32 strings.
- [Bug #12536] [ruby-dev:49699]
+ * MANIFEST: add beos/GNUmakefile.in.
+ * configure.in: support BeOS R4.5.2 (Intel).
+ * beos/GNUmakefile.in: new file to support BeOS R4.5.2 (Intel).
- * string.c (rb_str_new_with_class): Use TERM_LEN of the "obj".
+Thu Mar 9 11:13:32 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (rb_str_plus, rb_str_justify): Use str_new0 which is aware
- of termlen.
+ * regex.c (re_compile_fastmap): fixed embarrassing brace bug.
- * string.c (str_shared_replace): Copy +termlen bytes instead of +1.
+Thu Mar 9 01:36:32 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
- * string.c (rb_str_times): termlen should not be included in capa.
+ * missing/flock.c: emulate missing flock() with fcntl().
- * string.c (RESIZE_CAPA_TERM): When using RSTRING_EMBED_LEN_MAX,
- termlen should be counted with it because embedded strings are
- also processed by TERM_FILL.
+Thu Mar 9 00:29:35 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (rb_str_capacity, str_shared_replace, str_buf_cat): ditto.
+ * object.c (sym_to_s): returns ":sym".
- * string.c (rb_str_drop_bytes, rb_str_setbyte, str_byte_substr): ditto.
+ * object.c (sym_id2name): separated from to_s; returns "sym".
-Wed Jun 29 22:24:37 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Mar 8 19:16:19 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * ext/psych/lib/psych_jars.rb: removed needless file required to JRuby.
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.7.
-Wed Jun 29 22:21:38 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * lib/net/http.rb (connecting): returns header
- * ext/openssl/ossl_ocsp.c: The "reuse" behavior of d2i_ functions does
- not work well with OpenSSL 1.0.0t. So avoid it.
+Wed Mar 8 02:08:43 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jun 29 15:18:28 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y: escape expansion too early.
- * insns.def (opt_succ): optimize like r55515. (but this argument is
- constant)
+ * string.c (rb_f_scan): Kernel#scan added.
-Wed Jun 29 12:41:58 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * regex.c (re_compile_pattern): support \cX et al.
- * test/ruby/test_refinement.rb: skip
- test_prepend_after_refine_wb_miss on ARM or MIPS.
- [ruby-core:76031] [Bug #12491]
+Tue Mar 7 01:44:27 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jun 29 08:45:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (set_stdin): simplified procedure, allows $stdin = DATA;
+ experimental.
- * proc.c (passed_block): convert passed block symbol to proc.
- based on the patch by Daisuke Sato in [ruby-dev:49695].
- [Bug #12531]
+ * io.c (set_outfile): ditto.
-Wed Jun 29 03:34:41 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * re.c (Init_Regexp): new method Regexp#last_match added; it's an
+ alternative for $~.
- * bignum.c (rb_big2ulong): the old logic seems to try to avoid
- calculating `-(long)(num-1)-1` if `num` is not LONG_MIN. (Note that
- `-LONG_MIN` may be larger than LONG_MAX) But C compilers can
- optimize it into single NEG instruction.
- Therefore those two conditions can be single if-body.
+ * configure.in (DEFAULT_KCODE): KCODE_NONE should be the default.
- * bignum.c (rb_big2long): ditto.
+ * dir.c (dir_s_rmdir): should return 0 on success.
- * bignum.c (rb_big2ull): ditto.
+ * signal.c: remove CWGUSI support.
- * bignum.c (rb_big2ll): ditto.
+Mon Mar 6 12:28:37 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 28 22:55:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * marshal.c (w_symbol): support symbol object.
- * lib/pstore.rb (PStore::CHECKSUM_ALGO): extract the algorithm for
- checksum, instead of qualified names for each times.
+ * util.c: make symbol as separated class.
-Tue Jun 28 22:29:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (Init_Exception): new exception RangeError.
- * bootstraptest/runner.rb: do not use safe navigation operator.
- this runner may run on older ruby. partially revert r53110
- (GH-1142 patched by @mlarraz).
+ * ext/socket/socket.c (ip_addrsetup): should check length of hostname.
-Tue Jun 28 22:09:09 2016 Akio Tajima <artonx@yahoo.co.jp>
+ * ext/socket/socket.c (ip_addrsetup): check newline at the end of
+ hostname. These fixes suggested by Muvaw Pnazte <bugathlon@yahoo.com>.
- * lib/fileutils.rb: rescue Errno:EACCES for chown.
- [Bug #12520]
+Sun Mar 5 20:35:45 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
-Tue Jun 28 18:38:09 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * ext/Win32API/Win32API.c (Win32API_initialize): should call
+ LoadLibrary() everytime and should assign the hdll to Win32API
+ object(protect the hdll from GC).
- * ext/digest/md5/md5ossl.h: Remove excess semicolons.
- Suppress warning on Solaris with Oracle Solaris Studio 12.
- [ruby-dev:49692] [Bug #12524]
+Sun Mar 5 18:49:06 2000 Nakada.Nobuyoshi <nobu.nokada@softhome.net>
- * ext/digest/md5/md5cc.h: ditto.
- * ext/digest/sha1/sha1cc.h: ditto.
- * ext/digest/sha1/sha1ossl.h: ditto.
- * ext/digest/sha2/sha2cc.h: ditto.
- * ext/digest/sha2/sha2ossl.h: ditto.
- * ext/openssl/ossl_pkey_rsa.c: ditto.
+ * misc/ruby-mode.el (ruby-parse-region): not treat method `begin'
+ and `end' as reserved words.
-Tue Jun 28 15:56:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * misc/ruby-mode.el (ruby-font-lock-docs): ignore after `=begin'
+ and `=end'.
- * test/ruby/enc/test_case_comprehensive.rb: noting to test if
- Unicode data files are available.
- [ruby-core:76160] [Bug #12433]
+ * misc/ruby-mode.el (ruby-font-lock-keywords, hilit-set-mode-patterns):
+ added `yield' to keywords.
- * test/test_unicode_normalize.rb: ditto.
+ * misc/ruby-mode.el (ruby-font-lock-keywords, hilit-set-mode-patterns):
+ matches keywords at end of buffer.
-Tue Jun 28 15:20:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Mar 5 18:08:53 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * lib/net/http.rb (Net::HTTP#proxy_uri): cache the case no proxy
- is used.
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.6.
-Tue Jun 28 09:56:29 2016 Stefan Schussler <mail@stefanschuessler.de>
+ * lib/net/http.rb: allow to omit 'start'
- * object.c (rb_mod_eqq): [DOC] Fix typo in RDoc. [Fix GH-1393]
+Tue Feb 29 01:08:26 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 28 02:41:32 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * range.c (range_initialize): initialization done in `initialize';
+ `initialize' should not be called more than once.
- * insns.def (opt_plus): use `- 1` instead of `& (~1)` to allow
- compilers to use x86 LEA instruction (3 operand).
- Even if 3 operand LEA's latency is 3 cycle after SandyBridge,
- it reduces code size and can be faster because of super scalar.
+ * object.c (Init_Object): default `initialize' should take zero
+ argument.
+
+ * time.c (time_s_new): call `initialize' in Time::new.
+
+Sat Feb 26 22:39:31 2000 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+
+ * string.c (rb_str_times): fix String#* with huge string.
+
+Sat Feb 26 00:14:59 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * dir.c (dir_s_new): call `initialize' in Dir::new.
+
+Fri Feb 25 23:01:49 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ruby.h: export ruby_safe_level by EXTERN for mswin32.
+ * win32/ruby.def: regular maintenance.
+
+Fri Feb 25 22:12:46 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_reopen): IO#reopen should accept path as well.
+
+ * string.c (rb_str_s_new): call `initialize' in String::new.
+
+ * hash.c (rb_hash_s_new): call `initialize' in Hash::new.
+
+ * array.c (rb_ary_s_new): call `initialize' in Array::new.
+
+Fri Feb 25 12:50:20 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_start_timer): interval changed to 10ms from 50ms.
+
+Fri Feb 25 06:42:26 2000 GOTOU YUUZOU <gotoyuzo@notwork.org>
+
+ * ext/socket/socket.c (ip_addrsetup): hostp should remain NULL if
+ host is nil.
+
+Thu Feb 24 16:53:47 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_schedule): priority check for sleep expired
+ threads needed.
+
+Wed Feb 23 14:22:32 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * array.c (rb_ary_join): forgot to initialize a local variable
+ `taint'.
+
+Tue Feb 22 07:40:55 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * re.c (Init_Regexp): renamed to MatchData, old name MatchingData
+ remain as alias.
+
+Tue Feb 22 00:20:21 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/protocol.rb, smtp.rb, pop.rb, http.rb: 1.1.5.
+
+ * lib/net/session.rb: rename to protocol.rb
+
+ * lib/net/protocol.rb: ProtocolSocket -> Net::Socket
+
+ * lib/net/protocol.rb: Net::Socket#write, write_pendstr
+ can take block
+
+ * lib/net/smtp.rb: new methods SMTP#ready SMTPCommand#write_mail
+
+ * lib/net/pop.rb: POPMail#pop can take block
+
+Sat Feb 19 23:58:51 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_match): pop_loop should not pop at forward jump.
+
+Fri Feb 18 17:15:40 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (method_clone): method objects are now clonable.
+
+Fri Feb 18 00:27:34 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * variable.c (rb_shared_variable_declare): shared variable (aka
+ class/module variable) introduced. prefix `@@'. experimental.
+
+ * class.c (rb_scan_args): new format char '&'.
+
+Thu Feb 17 19:09:05 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * win32/win32.c (mypopen): don't close handle if it is not assigned.
+ * win32/win32.c (my_open_osfhandle): support O_NOINHERIT flag.
+ * win32/win32.c (win32_getcwd): rename getcwd to win32_getcwd
+ in order to avoid using the C/C++ runtime DLL's getcwd.
+ Use CharNext() to process directory name.
+ * win32/win32.h: map getcwd to win32_getcwd.
+
+Wed Feb 16 00:32:49 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (method_arity): nd_rest is -1 for no rest argument.
+
+ * process.c (proc_waitpid): returns nil when waitpid(2) returns 0.
+
+Tue Feb 15 01:47:00 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * process.c (rb_f_waitpid): pid_t should be signed.
+
+Mon Feb 14 13:59:01 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (yylex): yylex yields wrong tokens for `:foo=~expr'.
+
+ * ruby.c (load_file): exit if reading file is empty.
+
+Mon Feb 14 03:34:52 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (yylex): `foo.bar=1' should be <foo><.><bar><=><1>,
+ not <foo><.><bar=><1>.
+
+ * eval.c (rb_thread_restore_context): process according to
+ RESTORE_* is moved after longjmp().
+
+ * eval.c (thread_switch): new function to process RESTORE_*.
+
+Sun Feb 13 16:19:49 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * ruby.c (require_libraries): don't access freed memory.
+
+ * ruby.c (add_modules): ditto.
+
+Fri Feb 11 12:06:22 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (parse_quotedwords): %w() need to split not only by mere
+ spaces, but by all whitespaces.
+
+Thu Feb 10 02:12:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (rb_str_index_m): did not support negative offset.
+
+Wed Feb 9 21:54:26 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ext/socket/getaddrinfo.c: gcc --traditional support.
+ Rearrange headers to work AC_C_CONST.
+ * ext/socket/getnameinfo.c: ditto.
+ * ext/socket/socket.c: mswin32: use double instead of long long.
+
+Wed Feb 9 16:30:41 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * numeric.c (num_coerce): should return [y, x].
+
+Wed Feb 9 11:07:30 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (ruby_prog_init): loadpath structure changed.
+
+Tue Feb 8 02:07:33 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_search): optimize for \G at top.
+
+ * regex.c (re_compile_pattern): \G introduced.
+
+ * regex.c (re_match): ditto.
+
+ * string.c (str_sub_bang): old behavior restored: bang method
+ returns nil if string not changed.
+
+ * regex.c (re_compile_pattern): support independent subexpression
+ `(?>pattern)'.
+
+ * regex.c (re_match): ditto.
+
+Mon Feb 7 15:51:08 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_match): now understands interrupts under Ruby.
+
+Mon Feb 7 07:51:52 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * array.c (rb_ary_uniq_bang): always return an Array.
+
+ * array.c (rb_ary_compact_bang): ditto.
+
+ * array.c (rb_ary_flatten_bang): ditto.
+
+ * hash.c (rb_hash_reject): returns a Hash, not an Array.
+
+ * hash.c (env_reject): ditto.
+
+Fri Feb 4 10:20:25 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (scan_once): scan now leaves information about the last
+ successful pattern match in $&.
+
+ * io.c (rb_io_close): should not check closed IO.
+
+Fri Feb 4 05:44:01 2000 Kentaro Inagaki <inagaki@tg.rim.or.jp>
+
+ * ext/socket/socket.c (s_recv): TRAP_BEG after retry entry.
+
+Wed Feb 2 22:33:45 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * eval.c (rb_thread_start): receives argument from outside, like
+ `Thread::start(1,2,3){|a,b,c| ... }'.
+
+Wed Feb 2 22:14:40 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * re.c (rb_reg_regsub): should check regs->num_regs.
+
+ * re.c (rb_reg_search): remove matchcache, use static struct
+ re_register instead.
+
+ * re.c (match_getter): avoid cloning match data.
+
+Wed Feb 2 17:12:15 2000 Dave Thomas <Dave@Thomases.com>
+
+ * samples/eval.rb: Rescue new ScriptError exception
+
+Wed Feb 2 02:06:07 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (str_gsub_bang): gsub! now leaves information about the
+ last successful pattern match in $&.
+
+Mon Jan 31 15:24:58 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (str_sub_bang): bang method returns string always.
+ experimental.
+
+Sun Jan 30 17:58:09 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * eval.c: arrange to use setitimer(2) for BOW, DJGPP
+
+ * defines.h: ditto. use random(3) on cygwin b20.1.
+
+Sun Jan 30 17:20:16 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * eval.c: use getrlimit(2) on DJGPP.
+
+Thu Jan 27 01:27:10 2000 GOTO Kentaro <gotoken@math.sci.hokudai.ac.jp>
+
+ * dir.c (glob): glob pattern "/*" did not match.
+
+Wed Jan 26 22:30:47 2000 Shigeo Kobayashi <shigeo@tinyforest.gr.jp>
+
+ * numeric.c (flo_modulo): wrong result for negative modulo.
+
+Wed Jan 26 02:01:57 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * file.c (test_c): should use S_ISCHR.
+
+ * file.c (rb_stat_c): ditto.
+
+ * string.c (rb_str_each_line): should propagate tainting.
+
+Tue Jan 25 04:01:34 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * object.c (rb_obj_freeze): all objects made freezable.
+
+Tue Jan 25 00:37:01 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in: use AC_CHECK_TOOL for cross compiling.
+
+Mon Jan 24 19:01:54 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * array.c (rb_protect_inspect): should be checked by id of
+ objects; not by object themselves.
+
+Mon Jan 24 18:48:08 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * eval.c (rb_eval): too many warnings; warned on every method
+ overriding. should be on method discarding.
+
+Mon Jan 24 02:56:44 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (yylex): -2.abs should be `(-2).abs' to accomplish the
+ principle of less surprise. `+2' too.
+
+ * eval.c (rb_eval): when defining class is already there, and
+ superclass differ, throw away the old class.
+
+ * variable.c (rb_const_set): gives warning again on constant
+ redefinition.
+
+ * error.c (Init_Exception): SyntaxError, NameError, LoadError and
+ NotImplementError are subclasses of ScriptError<Exception, not
+ StandardError. experimental.
+
+Sat Jan 22 00:00:41 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (parse_quotedwords): no longer use `String#split'.
+ and enable space escape within quoted word list.
+ e.g. %w(a\ b\ c abc) => ["a b c", "abc"].
+
+ * string.c (rb_str_slice_bang): new method `slice!'.
+
+Fri Jan 21 21:56:08 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/session.rb, smtp.rb, pop.rb, http.rb: 1.1.4.
+
+ * lib/net/http.rb: can receive messages which have
+ no Content-Length:.
+
+Fri Jan 21 16:15:59 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (thgroup_s_new): new class ThreadGroup.
+
+Tue Jan 18 12:24:28 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * struct.c (Init_Struct): remove Struct's own hash and eql?.
+
+Sat Jan 15 22:21:08 2000 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * eval.c (search_method): argument klass may be 0.
+
+Sat Jan 15 15:03:46 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * enum.c (enum_index): remove this method.
+
+ * enum.c: remove use of pointers to local variables. find,
+ find_all, min, max, index, member?, each_with_index,
+
+ * eval.c (massign): multiple assignment does not use to_a anymore.
+ experimental.
+
+Fri Jan 14 12:22:04 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (rb_str_replace): use memmove instead of memcpy for
+ overwrapping strings (e.g. a[1] = a).
+
+Thu Jan 13 11:12:40 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (arg_add): use new node, ARGSPUSH.
+
+Mon Jan 10 18:32:28 2000 Koji Arai <JCA02266@nifty.ne.jp>
+
+ * marshal.c (w_object): forgot an argument to call w_ivar().
+
+Sun Jan 9 18:13:51 2000 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * random.c: first was not defined unless HAVE_RANDOM.
+
+Sat Jan 8 19:02:49 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (rb_io_sysread): raise IOError for buffered IO.
+
+ * ext/socket/socket.c (s_recv): ditto.
+
+Fri Jan 7 00:59:29 2000 Masahiro Tomita <tommy@tmtm.org>
+
+ * io.c (io_fread): TRAP_BEG/TRAP_END added around getc().
+
+Thu Jan 6 00:39:54 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * random.c (rb_f_rand): should be initialized unless srand is
+ called before.
+
+Wed Jan 5 16:59:34 2000 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/session.rb, smtp.rb, pop.rb, http.rb: 1.1.3.
+
+ * lib/net/session.rb: Session -> Protocol, ...
+
+ * lib/net/http.rb: HTTPCommand implementation was changed.
+
+Wed Jan 5 02:14:46 2000 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+
+ * parse.y: Fix SEGV on empty parens with UMINUS or UPLUS.
+
+Tue Jan 4 22:25:54 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (stmt): `() while cond' dumped core.
+
+Tue Jan 4 06:04:14 2000 WATANABE Hirofumi <eban@os.rim.or.jp>
+
+ * configure.in: modify for cross-compiling.
+ use target_* instead of host_*.
+ use AC_CANONICAL_TARGET.
+
+ * Makefile.in: ditto.
+
+ * cygwin/GNUmakefile.in: ditto.
+
+Sat Jan 1 13:26:14 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_yield_0): force_recycle ruby_dyna_vars to gain
+ performance.
+
+ * array.c (rb_ary_delete_at_m): takes same argument pattern with
+ rb_ary_aref.
+
+Sat Jan 1 10:12:26 2000 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+
+ * ruby.h,util.c (rb_special_const_p): peep hole optimization.
+
+ * ruby.h,util.c (rb_test_false_or_nil): removed.
+
+ * ruby.h (RTEST, SPECIAL_CONST_P): peep hole optimization.
+
+ * ruby.h (FL_ABLE, FL_SET, FL_UNSET, FL_REVERSE): made expressions
+ not statements.
+
+ * ruby.h (OBJ_INFECT): newly added macro which copies taint from
+ `s' to `x'.
+
+Sat Jan 1 02:04:18 2000 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_thread_safe_level): new method.
+
+ * eval.c (rb_yield_0): recycle dyna_var_map to reduce object
+ allocation.
+
+Fri Dec 31 00:52:48 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c: thread independent trace_func not needed.
+
+Thu Dec 30 14:47:31 1999 akira yamada <akira@ruby-lang.org>
+
+ * configure.in: specifies -soname in LIBRUBY_DLDFLAGS on linux
+ platforms.
+
+Thu Dec 30 10:51:27 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * array.c,io.c,hash,c,re.c,string.c: `_m' suffix instead of
+ `_method' for wrapper functions to implement method,
+ e.g. `rb_str_join_m()'.
+
+Thu Dec 30 02:08:02 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * bignum.c (rb_cstr2inum): non-numeric format check added.
+ currently it works only with base == 0 (i.e. Integer()).
+
+ * bignum.c (rb_str2inum): now takes VALUE to 1st argument. null
+ byte check added.
+
+ * array.c (rb_ary_replace): unless replacement is an array,
+ replacement shall be converted to array by `[replacement]', not
+ by `replacement.to_a'.
+
+ * array.c (rb_ary_plus): right operand must be an array.
+
+ * array.c (rb_ary_concat): argument must be an array.
+
+Mon Dec 27 12:35:47 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ext/socket/socket.c (sock_finalize): mswin32: fix socket handle leak.
+
+ * win32/win32.c (myfdclose): ditto.
+
+Sun Dec 26 23:15:13 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * win32/win32.c (mypopen): raise catchable error instead of rb_fatal.
+ * win32/win32.c (mypclose): fix process handle leak.
+
+Sun Dec 26 16:17:11 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * ext/Win32API/Win32API.c (Win32API_initialize): use UINT2NUM
+ instead of INT2NUM to set __dll__ and __proc__.
+
+Sat Dec 25 00:08:59 1999 KANEKO Naoshi <wbs01621@mail.wbs.ne.jp>
+
+ * ext/Win32API/Win32API.c (Win32API_Call): remove 'dword ptr'
+ from _asm.
+
+Fri Dec 24 10:26:47 1999 Koji Oda <oda@bsd1.qnes.nec.co.jp>
+
+ * win32/win32.h: use "C++" linkage.
+
+Fri Dec 24 02:00:57 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (THREAD_ALLOC): should initialize th->trace.
+
+Fri Dec 24 00:43:39 1999 KANEKO Naoshi <wbs01621@mail.wbs.ne.jp>
+
+ * io.c (pipe_open): check for `fptr->f == NULL'.
+ * win32/win32.c (mypopen): STDERR does not work during ` function.
+
+Wed Dec 22 22:50:40 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/session.rb, smtp.rb, pop.rb, http.rb: 1.1.2.
+
+ * lib/net/http.rb: HTTP support is enhanced a little
+
+ * lib/net/http.rb: support proxy
+
+Tue Dec 21 17:21:28 1999 Koji Oda <oda@bsd1.qnes.nec.co.jp>
+
+ * ext/socket/socket.c (sock_finalize): mswin32: fix FILE* leak.
+
+Tue Dec 21 05:33:56 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/session.rb, smtp.rb, pop.rb, http.rb: 1.1.1.
+
+ * lib/net/http.rb: support HTTP chunk
+
+Mon Dec 20 19:08:12 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
+
+ * file.c (rb_file_s_expand_path): handle dir separator correctly.
+
+Sun Dec 19 22:56:31 1999 KANEKO Naoshi <wbs01621@mail.wbs.ne.jp>
+
+ * lib/find.rb: support dosish root directory.
+ * win32/Makefile: ditto.
+ * win32/config.status: ditto.
+ * win32/win32.c (opendir): ditto.
+ * win32/win32.c (opendir): use CharPrev() to get last character
+ of the directory name.
+
+Sat Dec 18 03:00:01 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * file.c (path_check_1): check should be done by absolute path.
+
+ * marshal.c (r_ivar): should restore generic_ivar too.
+
+ * marshal.c (w_ivar): should dump generic_ivar too.
+
+Fri Dec 17 22:46:46 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
+
+ * lib/net/session.rb, smtp.rb, pop.rb, http.rb: 1.1.0.
- * insns.def (opt_plus): calculate and use rb_int2big.
- On positive Fixnum overflow, `recv - 1 + obj` doesn't carry
- because recv's msb and obj's msb are 0, and resulted msb is 1.
- Therefore simply rshift and cast as signed long works fine.
- On negative Fixnum overflow, it will carry because both arguments'
- msb are 1, and resulted msb is also 1.
- In this case it needs to restore carried sign bit after rshift.
+ * lib/net/http.rb: test release
-Mon Jun 27 16:58:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/session.rb: support class swapping
- * lib/fileutils.rb (FileUtils#install): accecpt symbolic mode, as
- well as chmod.
+ * lib/net/session.rb: Socket#flush_rbuf
- * lib/fileutils.rb (FileUtils#install): add owner and group
- options.
+ * lib/net/session.rb: doquote -> Net.quote
-Mon Jun 27 08:56:55 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 17 19:27:43 1999 IWAMURO Motonori <iwa@mmp.fujitsu.co.jp>
- * compile.c (ADD_TRACE): ignore trace instruction on non-positive
+ * eval.c (rb_load): should initialize ruby_frame->last_class.
+
+Wed Dec 15 01:35:29 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (proc_options): option to change directory changed to
+ `-C' like tar.
+
+ * ruby.c (proc_options): argv boundary check for `-X'.
+
+Mon Dec 13 15:15:31 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_adjust_startpos): separate startpos adjustment
+ because of major performance drawback.
+
+ * class.c (rb_singleton_class): tainted status of the singleton
+ class must be synchronized with the object.
+
+ * eval.c (rb_thread_schedule): implement thread priority.
+
+Sat Dec 11 03:34:38 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * gc.c (mark_hashentry): key should be VALUE, not ID.
+
+ * io.c (argf_eof): should check next_p too.
+
+Thu Dec 9 18:09:13 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+
+ * error.c (exc_set_backtrace): forgot to declare a VALUE argument.
+
+Thu Dec 9 14:19:31 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * object.c (rb_obj_taint): explicit tainting must be prohibited at
+ level 4 to prevent polluting trusted object by untrusted code.
+
+ * file.c: file operations (stat, lstat, chmod, chown, umask,
+ truncate, flock) are prohibited in level 2 (was level 4).
+
+Wed Dec 8 11:48:23 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_f_require): prohibiting require() in the secure mode
+ cause serious autoloading error.
+
+ * variable.c (rb_obj_instance_variables): don't need to prohibit
+ to get list of instance variable names of untainted objects.
+
+ * variable.c (rb_ivar_get): don't need to prohibit to get instance
+ variables of untainted objects.
+
+ * variable.c (rb_mod_remove_const): should prohibit constant
+ removals too.
+
+Wed Dec 8 09:23:01 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (rb_eval): should try autoloading before defining
+ class/module at the toplevel.
+
+Tue Dec 7 22:15:30 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+
+ * configure.in: Modified rb_cv_rshift_sign detect routine and
+ more simple/fast RSHIFT() for hpux-10.x.
+
+Tue Dec 7 11:16:30 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (Init_eval): calculate stack limit from rlimit where
+ getrlimit(2) is available.
+
+Tue Dec 7 09:57:33 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
+
+ * file.c (rb_file_ftype): should have removed mode_t.
+
+Mon Dec 6 15:55:30 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+
+ * numeric.c (fix_rshift): Fix -1 >> 32 returned 0 (should be -1).
+
+ * numeric.c (fix_rshift): Fix 1 >> -1 returned 0 (should be 2).
+
+Mon Dec 6 11:47:23 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * sprintf.c (rb_f_sprintf): formatted string must be tainted if
+ any of parameters is a tainted string.
+
+ * file.c (rb_file_s_expand_path): expanded file path need not to
+ be tainted always.
+
+Sun Dec 5 20:25:29 1999 Katsuhiro Ueno <unnie@blue.sky.or.jp>
+
+ * eval.c (Init_Proc): simple typo.
+
+ * gc.c (add_heap): sizeof(RVALUE*), not sizeof(RVALUE).
+
+Sat Dec 4 01:40:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_search): adjust startpos for multibyte match unless
+ the first pattern is forced byte match.
+
+ * bignum.c (rb_big_rand): should not use rand/random where drand48
+ may be available. RANDOM_NUMBER should be provided from outside.
+
+Fri Dec 3 09:54:59 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (moreswitches): there may be trailing garbage at #!
line.
- * parse.y (coverage): get rid of ArgumentError when the starting
- line number is not positive. [ruby-core:76141] [Bug #12517]
+ * eval.c (rb_f_require): should check require 'feature.o' too.
-Sun Jun 26 10:20:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 2 11:58:15 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * ext/win32/lib/Win32API.rb (Win32API#initialize): Cygwin
- 2.5.2-1 (perhaps) seems to no longer append ".dll" suffix
- implicitly.
+ * eval.c (rb_thread_loading): should maintain loading_tbl.
- * ext/win32/lib/win32/resolv.rb (Win32::Resolv): ditto. Fix the
- error reported by yamataka AT u08.itscom.net in
- [ruby-list:50339], and pointed out and patched by cerberus AT
- m3.kcn.ne.jp in [ruby-list:50341].
+Thu Dec 2 10:21:43 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jun 25 10:07:52 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * eval.c (rb_thread_loading_done): wrong parameter to st_delete().
- * test/openssl/test_ocsp.rb: Ignore errors caused by bugs that exist in
- LibreSSL >= 2.3.1.
+Wed Dec 1 11:24:06 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
-Sat Jun 25 02:33:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (process_sflag): process -s properly (should not force `--').
- * vm_method.c (vm_respond_to): try method_missing if respond_to?
- is undefined, as if it is the default definition.
- [ruby-core:75377] [Bug #12353]
+Wed Dec 1 09:47:33 1999 Kazunori NISHI <kazunori@swlab.csce.kyushu-u.ac.jp>
-Fri Jun 24 17:04:21 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * string.c (rb_str_split_method): should increment end too.
- * ext/psych/*, test/psych/*: Update psych 2.1.0
- This version fixed [Bug #11988][ruby-core:72850]
+Tue Nov 30 18:00:45 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jun 24 13:12:41 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * marshal.c: MARSHAL_MINOR incremented; format version is 4.2.
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*:
- Update rubygems 2.6.5 and 2.6.6.
- Release note of 2.6.5: https://github.com/rubygems/rubygems/commit/656f5d94dc888d78d0d00f3598a4fa37391aac80
- Release note of 2.6.6: https://github.com/rubygems/rubygems/commit/ccb9c3300c063f5b5656669972d24a10ef8afbf5
+ * marshal.c (w_object): distinguish class and module.
-Fri Jun 24 09:17:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * marshal.c (w_object): save hash's default value.
- * common.mk (lib/unicode_normalize/tables.rb): should not depend
- on Unicode data files unless ALWAYS_UPDATE_UNICODE=yes, to get
- rid of downloading Unicode data unnecessary. [ruby-dev:49681]
+ * marshal.c (r_object): restore hash's default value.
- * common.mk (enc/unicode/casefold.h): update Unicode files in a
- sub-make, not to let the header depend on the files always.
+Tue Nov 30 01:46:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode/case-folding.rb: if gperf is not usable, assume the
- existing file is OK.
+ * re.c (rb_reg_source): generated source string must be tainted if
+ regex is tainted.
-Tue Jun 21 19:44:54 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * file.c (rb_file_s_basename): basename should not be tainted
+ unless the original path is tainted.
- * test/ruby/enc/test_regex_casefold.rb: Add Windows-1251, KOI8-R, and
- KOI8-U to encodings; definitely removed EUC-JP.
+ * file.c (rb_file_s_dirname): ditto.
-Tue Jun 21 19:32:23 2016 Mark St.Godard <markstgodard@gmail.com>
+Mon Nov 29 20:42:13 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
- * lib/webrick/httprequest.rb (setup_forwarded_info): Use the first
- value in X-Forwarded-Proto, if header contains multiple comma
- separated values. Some middlewares may add these values to the
- list, not replacing. [Fix GH-1386]
+ * file.c (stat_new): Struct::Stat -> File::Stat; Stat is no longer
+ a Struct.
-Tue Jun 21 17:17:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Nov 29 15:28:52 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_io.rb: Skip test_readpartial_with_not_empty_buffer,
- test_read_buffer_error, test_read_unlocktmp_ensure,
- test_readpartial_unlocktmp_ensure, and
- test_sysread_unlocktmp_ensure on cygwin,
- because these tests repeatedly hang. This makes test_io.rb
- complete in finite time on cygwin.
+ * variable.c (rb_path2class): evaluated value from path should be
+ module or class.
- * ChangeLog: Fix test_in.rb -> test_io.rb (two instances).
+Fri Nov 26 18:12:49 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 21 16:38:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_exec_end_proc): should remove only end_procs defined
+ within load wrapper.
- * string.c (rb_str_casemap): do not put code with side effects
- inside RSTRING_PTR() macro which evaluates the argument multiple
- times.
+ * eval.c (rb_load): save and restore ruby_wrapper around loading.
-Tue Jun 21 16:13:45 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_mark_end_proc): mark end procs registered by END{} or
+ at_exit{}.
- * string.c (rb_str_casemap): fix memory leak.
+ * eval.c (rb_set_end_proc): should not call rb_global_variable()
+ on heap address; it crashed mod_ruby.
-Tue Jun 21 16:12:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Nov 22 14:07:24 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * string.c (rb_str_casemap): int is too small for string size.
+ * ruby.c (proc_options): variable e_script should be visited by
+ garbage collector.
-Tue Jun 21 15:42:22 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat Nov 20 10:10:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_io.rb: Skip test_read_buffer_error on cygwin,
- because this test repeatedly hangs.
+ * hash.c (inspect_i): value may be nil, check revised.
-Tue Jun 21 15:35:14 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Fri Nov 19 18:06:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * LEGAL: Added filenames and copyrights for some files in
- enc/trans/JIS.
+ * dir.c (glob): recursive wildcard match by `**' ala zsh.
-Tue Jun 21 00:56:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 19 11:44:26 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * win32/win32.c (get_special_folder): fix calling convention of
- SHGetPathFromIDListEx, which should be WINAPI. pointed out by
- @arton at http://twitter.com/arton/status/744884064277016576
+ * variable.c: was returning void value.
-Tue Jun 21 00:22:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 19 03:57:22 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
- * configure.in, include/ruby/defines.h (RUBY_USE_SETJMPEX):
- include setjmpex.h only when using setjmpex() for RUBY_SETJMP.
- the header of mingw32 overrides setjmp() by setjmpex().
+ * file.c: add methods Stat struct class to reduce stat(2).
-Mon Jun 20 18:39:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu Nov 18 16:18:27 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_io.rb: Skip test_open_fifo_does_not_block_other_threads
- on cygwin. Fifos seem to work okay in cygwin, but this test repeatedly
- hangs.
+ * lib/pstore.rb: mutual lock by flock(2).
-Mon Jun 20 13:35:06 2016 Shugo Maeda <shugo@ruby-lang.org>
+Thu Nov 18 11:44:13 1999 Masahiro Tomita <tommy@tmtm.org>
- * vm.c (invoke_bmethod, invoke_block_from_c_0): revert r52104
- partially to avoid "self has wrong type to call super in this
- context" errors.
- [ruby-core:72724] [Bug #11954]
+ * io.c (read_all): should check bytes too.
-Mon Jun 20 12:53:38 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Nov 17 02:40:40 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/rubygems/test_gem_remote_fetcher.rb: OpenSSL::PKey::DH#priv_key=
- is not defined when ext/openssl is built with OpenSSL 1.1.0.
- https://github.com/rubygems/rubygems/pull/1648
- [ruby-core:75225] [Feature #12324]
+ * io.c (Init_IO): $defout (alias of $>) added.
-Sun Jun 19 21:25:43 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Nov 16 09:47:14 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_ocsp.c: Add OCSP::SingleResponse that represents an
- OCSP SingleResponse structure. Also add two new methods #responses
- and #find_response to OCSP::BasicResponse. A BasicResponse has one or
- more SingleResponse. We have OCSP::BasicResponse#status that returns
- them as an array of arrays, each containing the content of a
- SingleResponse, but this is not useful. When validating an OCSP
- response, we need to look into the each SingleResponse and check their
- validity but it is not simple. For example, when validating for a
- certificate 'cert', the code would be like:
+ * lib/pstore.rb: add mutual lock using symlink.
- # certid_target is an OpenSSL::OCSP::CertificateId for cert
- basic = res.basic
- result = basic.status.any? do |ary|
- ary[0].cmp(certid_target) &&
- ary[4] <= Time.now && (!ary[5] || Time.now <= ary[5])
- end
+Mon Nov 15 16:50:34 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- Adding OCSP::SingleResponse at the same time allows exposing
- OCSP_check_validity(). With this, the code above can be rewritten as:
+ * enum.c (enum_grep): non matching grep returns an empty array, no
+ longer returns nil.
- basic = res.basic
- single = basic.find_response(certid_target)
- result = single.check_validity
+ * enum.c (enum_grep): grep with block returns collection of
+ evaluated values of block over matched elements.
- * test/openssl/test_ocsp.rb: Test this.
+Mon Nov 15 04:50:33 1999 Koji Arai <JCA02266@nifty.ne.jp>
-Sun Jun 19 18:40:19 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * re.c (rb_reg_source): should not call rb_reg_expr_str()
+ everytime.
- * ext/openssl/ossl_ocsp.c (ossl_ocspbres_add_status): Allow specifying
- the times (thisUpdate, nextUpdate and revocationTime) with Time
- objects. Currently they accepts only relative seconds from the current
- time. This is inconvenience, especially for revocationTime. When
- Integer is passed, they are still treated as relative times. Since the
- type check is currently done with rb_Integer(), this is a slightly
- incompatible change. Hope no one passes a relative time as String or
- Time object...
- Also, allow passing nil as nextUpdate. It is optional.
+Sat Nov 13 07:34:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ruby_missing.h: Define RB_INTEGER_TYPE_P() if not defined.
- openssl gem will be released before Ruby 2.4.0.
+ * variable.c (rb_mod_constants): traverse superclasses to collect
+ constants.
-Sun Jun 19 18:39:38 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * eval.c (assign): modified for shared variables.
- * ext/openssl/ossl_ocsp.c: Implement OCSP::{CertificateId,Request,
- BasicResponse,Response}#initialize_copy.
- [ruby-core:75504] [Bug #12381]
+ * eval.c (rb_eval): search nested scope, then superclasses to
+ assign shared variables within methods.
- * test/openssl/test_ocsp.rb: Test them.
+ * eval.c (rb_eval): remove warnings from constants modification,
+ because they are no longer constants.
-Sun Jun 19 18:29:50 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * parse.y (node_assign): modified for shared variables.
- * ext/openssl/ossl_pkey_dh.c, ext/openssl/ossl_pkey_dsa.c,
- ext/openssl/ossl_pkey_ec.c, ext/openssl/ossl_pkey_rsa.c: Implement
- initialize_copy method for OpenSSL::PKey::*.
- [ruby-core:75504] [Bug #12381]
+ * parse.y (assignable): allow constant assignment in methods;
+ constants should be called `shared variable'.
- * test/openssl/test_pkey_dh.rb, test/openssl/test_pkey_dsa.rb,
- test/openssl/test_pkey_ec.rb, test/openssl/test_pkey_rsa.rb: Test they
- actually copy the OpenSSL objects, and modifications to cloned object
- don't affect the original object.
+Fri Nov 12 23:52:19 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Sun Jun 19 16:55:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * process.c (rb_f_system): argument check for NT, __EMX__, DJGPP.
- * test/ruby/test_dir_m17n.rb: Skip tests with non-UTF-8 encodings
- on cygwin. Cygwin can use the Unicode PUA (private use area) to store
- bytes from non-UTF-8 filenames (see
- https://cygwin.com/cygwin-ug-net/using-specialnames.html#pathnames-specialchars),
- but we are not supporting this. [Bug #12443]
+Wed Nov 10 21:54:11 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Sun Jun 19 15:01:18 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * hash.c (rb_any_cmp): Fixed return without value.
- * localeinit.c: Fix filesystem encoding for cygwin to UTF-8 (see
- https://cygwin.com/cygwin-ug-net/using-specialnames.html#pathnames-unusual)
+Wed Nov 10 17:57:06 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jun 19 14:31:07 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * sprintf.c: incorporate <yasuf@big.or.jp>'s sprintf patch at
+ [ruby-dev:7754].
- * ext/openssl/ossl_pkey.h, ext/openssl/ossl_pkey_dh.c,
- ext/openssl/ossl_pkey_dsa.c, ext/openssl/ossl_pkey_rsa.c: A few days
- ago, OpenSSL changed {DH,DSA,RSA}_get0_*() to take const BIGNUM **.
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=fd809cfdbd6e32b6b67b68c59f6d55fbed7a9327
- [ruby-core:75225] [Feature #12324]
+Wed Nov 10 08:28:53 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jun 19 11:19:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_call0): supply class parameter for each invocation.
- * variable.c (rb_path_to_class): consider the string length
- instead of a terminator.
+Tue Nov 9 13:21:04 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * variable.c (rb_path_to_class): search the constant at once
- instead of checking if defined and then getting it.
+ * configure.in: AC_MINIX move to before AC_EXEEXT and AC_OBJEXT.
-Sat Jun 18 14:01:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Mon Nov 8 19:52:29 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * test/rubygems/test_gem_installer.rb: Fixed broken test with extension
- build. https://github.com/rubygems/rubygems/pull/1645
+ * configure.in: Renamed AC_CHAR_UNSIGNED to AC_C_CHAR_UNSIGNED.
-Sat Jun 18 13:59:54 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * configure.in: Added default to AC_CHECK_SIZEOF().
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems
- HEAD(2c6d256). It contains to update vendored Molinillo to 0.5.0.
- https://github.com/rubygems/rubygems/pull/1638
+Mon Nov 8 14:28:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jun 18 10:13:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (stmt): rescue modifier added to the syntax.
- * common.mk (build-ext), ext/extmk.rb: use variable EXTENCS
- different than ENCOBJS, to get rid of circular dependency.
- build libencs when linking encodings statically.
- [ruby-core:75618] [Bug #12401]
+ * keywords: kRESCUE_MOD added.
-Sat Jun 18 08:52:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_f_eval): fake outer scope when eval() called without
+ bindings.
- * ext/stringio/stringio.c (strio_getline): fix pointer index
- overflow. reported by Guido Vranken <guido AT guidovranken.nl>.
+ * eval.c (rb_f_binding): should copy last_class in the outer frame too.
-Thu Jun 16 16:35:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Nov 7 18:31:04 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
- * class.c (Init_class_hierarchy): prevent rb_cObject which is the
- class tree root, from GC. [ruby-dev:49666] [Bug #12492]
+ * eval.c (is_defined): last_class may be 0.
-Thu Jun 16 12:17:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Nov 6 19:26:55 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * string.c (tr_trans): adjust buffer size by processed and rest
- lengths, instead of doubling repeatedly.
+ * Makefile.in: Added depend entry make parse.@OBJEXT@ from parse.c
+ for UCB make
-Thu Jun 16 11:15:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Nov 4 17:41:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (tr_trans): consider terminator length and fix heap
- overflow. reported by Guido Vranken <guido AT guidovranken.nl>.
+ * regex.c (re_compile_pattern): \< (wordbeg), \> (wordend) disabled.
-Thu Jun 16 00:02:32 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Nov 3 08:52:57 1999 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify, ossl_ocspbres_verify):
- Use ossl_clear_error() so that they don't print warnings to stderr and
- leak errors in the OpenSSL error queue. Also, check the return value
- of OCSP_*_verify() correctly. They can return -1 on verification
- failure.
+ * io.c (Init_IO): forgot to use INT2FIX() around SEEK_SET, etc.
-Wed Jun 15 19:52:23 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Nov 3 00:25:20 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_sign, ossl_ocspbres_sign): Allow
- specifying hash algorithm used in signing. They are hard coded to use
- SHA-1.
- Based on a patch provided by Tim Shirley <tidoublemy@gmail.com>.
- [ruby-core:70915] [Feature #11552] [GH ruby/openssl#28]
+ * string.c (rb_str_split_method): use mbclen2() to handle kcode
+ option of regexp objects.
- * test/openssl/test_ocsp.rb: Test sign-verify works.
+Mon Nov 1 14:22:15 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Wed Jun 15 01:46:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_eval): reduce recursive calls to rb_eval()
+ case of ||= and &&= .
- * numeric.c: [DOC] fix rdoc directive, and an example of negative
- value. [ruby-core:76025] [Bug #12487]
+Sun Oct 31 13:12:42 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
-Wed Jun 15 01:44:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_compile_pattern): wrong [\W] match.
- * tool/mkconfig.rb: provide Unicode Version information as
- RbConfig::CONFIG['UNICODE_VERSION'].
- [ruby-core:75845] [Feature #12460]
+Fri Oct 29 16:57:30 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jun 15 00:01:18 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * ext/nkf/lib/kconv.rb: new String methods (kconv, tojis, toeuc,
+ tosjis).
- * test/ruby/enc/test_case_comprehensive.rb
- (TestComprehensiveCaseFold::read_data): use \A and \z instead of
- ^ and $ in regexp.
+ * time.c (time_s_at): now accepts optional second argument to
+ specify micro second.
-Tue Jun 14 23:43:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Oct 28 13:35:40 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/backward.h (rb_cFixnum, rb_cBignum): remove the
- backward compatibility macros, to fail incompatible extension
- libraries early. [Bug #12427]
+ * string.c (rb_str_split_method): should be mbchar aware with
+ single char separators.
-Tue Jun 14 22:22:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Oct 27 12:57:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * strftime.c (rb_strftime_with_timespec): limit the result string
- size by the format length, to get rid of unlimited memory use.
+ * random.c (rb_f_srand): random seed should be unsigned.
-Tue Jun 14 22:11:11 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Oct 26 23:58:15 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_ocsp.c (ossl_ocspcid_get_issuer_name_hash,
- ossl_ocspcid_get_issuer_key_hash, ossl_ocspcid_get_hash_algorithm):
- Add accessor methods OCSP::CertificateId#issuer_name_hash,
- #issuer_key_hash, #hash_algorithm.
- Based on a patch provided by Paul Kehrer <paul.l.kehrer@gmail.com>.
- [ruby-core:48062] [Feature #7181]
+ * array.c (rb_ary_collect): collect for better performance.
- * test/openssl/test_ocsp.rb: Test these new methods.
+Tue Oct 26 19:20:54 1999 Koji Arai <JCA02266@nifty.ne.jp>
-Tue Jun 14 22:07:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * marshal.c (r_object): should register class/module objects.
- * ext/date/date_strftime.c (date_strftime_with_tmx): reject too
- large precision to get rid of buffer overflow.
- reported by Guido Vranken <guido AT guidovranken.nl>.
+Sat Oct 23 15:59:39 1999 Takaaki Tateishi <ttate@jaist.ac.jp>
-Tue Jun 14 21:40:42 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * process.c (rb_f_system): should require at least one argument.
- * ext/openssl/ossl_ocsp.c (ossl_ocspbres_to_der, ossl_ocspcid_to_der):
- Implement #to_der methods for OCSP::BasicResponse and
- OCSP::CertificateId.
+Sat Oct 23 12:42:44 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
- (ossl_ocspreq_initialize, ossl_ocspres_initialize): Use GetOCSP*()
- instead of raw DATA_PTR().
+ * enum.c (enum_collect): collect without block will collect
+ elements in enumerable.
- (ossl_ocspbres_initialize, ossl_ocspcid_initialize): Allow
- initializing from DER string.
+Thu Oct 21 16:14:19 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- (Init_ossl_ocsp): Define new #to_der methods.
+ * ruby.c (moreswitches): function to process string option;
+ the name is stolen from perl (not implementation).
- * test/openssl/test_ocsp.rb: Test these changes. Also add missing tests
- for OCSP::{Response,Request}#to_der.
+ * ruby.c (proc_options): use RUBYOPT environment variable to
+ retrieve the default options.
-Tue Jun 14 21:35:00 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * dir.c (fnmatch): use eban's fnmatch; do not depend on system's
+ fnmatch (which may have portability problem) anymore.
- * ext/openssl/openssl_missing.h (DH_set0_pqg, RSA_set0_key):
- DH_set0_pqg() allows 'q' to be NULL. Fix a typo in RSA_set0_key().
- Fixes r55285. [ruby-core:75225] [Feature #12324]
+Wed Oct 20 15:14:24 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jun 14 10:19:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * marshal.c (marshal_load): should protect the generated object
+ table (arg->data) from GC.
- * NEWS: describe Integer#digits.
+Mon Oct 18 16:15:52 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jun 13 21:09:40 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/nkf/nkf.c (rb_nkf_kconv): output should be NUL terminated.
- * thread.c (debug_deadlock_check): show thread lock dependency and
- backtrace [Feature #8214] [ruby-dev:47217]
+Mon Oct 18 09:03:01 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * thread.c (thread_status_name): show "sleep_forever" instead of
- "sleep" if called from inspect.
+ * lib/net/session.rb, smtp.rb, pop.rb: 1.0.3
-Mon Jun 13 20:50:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/pop.rb: new methods POP3Command#uidl, POPMail#uidl.
- * parse.y (reg_named_capture_assign_iter): remove named capture
- conflict warnings. it is just annoying rather than useful.
- [ruby-core:75416] [Bug #12359]
+Sun Oct 17 03:35:33 1999 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
-Mon Jun 13 20:04:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * array.c (rb_ary_pop): forgot some freeze checks.
- * numeric.c (rb_int_digits, rb_fix_digits, rb_int_digits_bigbase):
- Add Integer#digits to extract columns in place-value notation
- [Feature #12447] [ruby-core:75799]
+Sat Oct 16 12:57:53 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * test/ruby/test_integer.rb: Add tests for the above change.
+ * array.c (rb_ary_sort): always returns the copied array.
- * test/ruby/test_bignum.rb: ditto.
+Fri Oct 15 22:50:41 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
-Mon Jun 13 20:34:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (sys_nerr): on CYGWIN, it is _sys_nerr.
- * include/ruby/ruby.h (RUBY_INTEGER_UNIFICATION): macro to tell if
- Integer is integrated. [ruby-core:75718][Bug #12427]
+Fri Oct 15 01:32:31 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
- * include/ruby/backward.h, internal.h (rb_cFixnum, rb_cBignum):
- fallback to rb_cInteger.
+ * io.c (rb_io_ctl) :need to use NUM2ULONG, not NUM2INT.
- * bignum.c, numeric.c, ext/json/generator/generator.{c,h}: use the
- macro.
+ * ext/Win32API/Win32API.c (Win32API_Call): need to use NUM2ULONG,
+ not NUM2INT.
-Mon Jun 13 16:58:53 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Fri Oct 15 00:22:30 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Add tests for full Unicode
- swapcase.
+ * re.c (Init_Regexp): super class of the MatchingData, which was
+ Data, to be Object.
-Sun Jun 12 14:48:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (ruby_run): evaluate required libraries before load &
+ compiling the script.
- * test/ruby/enc/test_case_comprehensive.rb: Add tests for ASCII-only
- swapcase; store calculated values in hashes.
+ * parse.y (lex_getline): retrieve a line from the stream, saving
+ lines in the table in debug mode.
-Sun Jun 12 14:05:45 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * eval.c (call_trace_func): treat the case ruby_sourcefile is null.
- * ext/openssl/ossl_cipher.c (ossl_cipher_get_auth_tag,
- ossl_cipher_set_auth_tag): Check if the cipher flags retrieved by
- EVP_CIPHER_CTX_flags() includes EVP_CIPH_FLAG_AEAD_CIPHER to see if
- the cipher supports AEAD. AES-GCM was the only supported in OpenSSL
- 1.0.1.
+Thu Oct 14 02:00:10 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- (Init_ossl_cipher): Fix doc; OpenSSL::Cipher::AES.new(128, :GCM) can't
- work.
+ * parse.y (string): compile time string concatenation.
- * ext/openssl/openssl_missing.h: Define EVP_CTRL_AEAD_{GET,SET}_TAG if
- missing. They are added in OpenSSL 1.1.0, and have the same value as
- EVP_CTRL_GCM_{GET,SET}_TAG and EVP_CTRL_CCM_{GET,SET}_TAG.
+Wed Oct 13 07:28:09 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
-Sun Jun 12 13:47:42 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * lib/net/session.rb, smtp.rb, pop.rb: 1.0.2
- * test/openssl/test_engine.rb (test_openssl_engine_builtin,
- test_openssl_engine_by_id_string): Skip test if 'openssl' engine is
- already loaded. And test the number increased by Engine.load{_by_id,},
- not the total count of loaded engines. Previously, we called
- OpenSSL::Engine.cleanup every time running a test case, but we no
- longer can do it.
- [ruby-core:75225] [Feature #12324]
+ * lib/net/session.rb: new method Session#set_pipe.
-Sun Jun 12 09:24:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/net/session.rb, smtp.rb, pop.rb: add RD documentation.
- * file.c (append_fspath): normalize directory name to be appended
- on OS X. [ruby-core:75957] [Ruby trunk Bug#12483]
- https://github.com/rails/rails/issues/25303#issuecomment-224834804
+Wed Oct 13 02:17:05 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Sat Jun 11 23:07:32 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * array.c (rb_ary_plus): remove recursion.
- * lib/forwardable.rb (_delegator_method): get rid of a warning which
- causes test failures introduced at r55376.
+ * array.c (rb_ary_sort_bang): detect modify attempt.
-Sat Jun 11 18:37:58 2016 Marcus Stollsteimer <sto.mar@web.de>
+Wed Oct 13 02:17:05 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/json/lib/*.rb: Removed some comments. Because these are unnecessary
- class description. [ci skip][Bug #12255][ruby-core:74835]
+ * eval.c (block_pass): should copy block to prevent modifications.
+ tag in the structure should be updated from latest prot_tag.
-Sat Jun 11 15:19:38 2016 takiy33 <takiy33@users.noreply.github.com>
+ * eval.c (proc_s_new): tag in struct BLOCK should not point into
+ unused stack.
- * lib/net/smtp.rb: [DOC] Remove dead link on documentation for
- Japanese of SMTP. [Fix GH-1380]
+ * dir.c (dir_s_glob): iterate over generated matching filenames if
+ the block is given to the method.
-Sat Jun 11 15:02:45 2016 Grant Hutchins <github@nertzy.com>
+ * array.c (rb_ary_at): new methods; at, first, last.
- * string.c (rb_str_oct): [DOC] fix typo, hornored -> honored.
- [Fix GH-1379]
+ * hash.c (rb_hash_fetch): raises exception unless the default
+ value is supplied.
-Sat Jun 11 14:04:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_hash_s_create): need not remove nil from value.
- * ext/objspace/objspace_dump.c: generate valid JSON for dump_all.
+ * hash.c (rb_hash_aset): setting value to nil does not remove key
+ anymore.
-Sat Jun 11 13:52:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 12 22:29:04 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/forwardable.rb (_delegator_method): remove __send__ call if
- possible, so that more optimizations will be enabled.
+ * io.c (io_read): length may be 0 or negative.
-Sat Jun 11 11:24:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Oct 12 13:26:27 1999 Jun-ichiro itojun Hagino <itojun@itojun.org>
- * enc/iso_8859.h (SHARP_s): name frequently used codepoint.
+ * signal.c (posix_signal): RETSIGTYPE may be void.
-Sat Jun 11 09:58:45 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue Oct 12 03:28:03 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * enc/iso_8859_1.c: Revert to older version of code.
+ * array.c (rb_ary_delete_at): allows negative position.
-Sat Jun 11 09:46:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Oct 11 17:42:25 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
- * enc/iso_8859_1.c: Implement non-ASCII case mapping.
+ * parse.y (rb_intern): should generate distinct ID_ATTRSET symbols
+ for the name with multiple `='s at the end.
- * test/ruby/enc/test_case_comprehensive.rb: Tests for above.
+ * Makefile.in (CPPFLAGS): separate cpp flags from CFLAGS.
- * string.c: Add iso-8859-1 to supported encodings.
+Mon Oct 11 07:27:05 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jun 11 09:31:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_eval): should not execute the `else' clause on the
+ case the exceptions are handled by the `rescue' clause.
- * lib/forwardable.rb (_delegator_method): leave the backtrace
- untouched during accessor. forwardable.rb does not appear in
- the backtrace during delegated method because of tail-call
- optimization.
+ * signal.c (Init_signal): ignore SIGPIPE by default.
-Sat Jun 11 01:38:31 2016 Naohisa Goto <ngotogenome@gmail.com>
+Wed Oct 6 17:13:19 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
- * include/ruby/defines.h (GCC_VERSION_SINCE): Fix logic error by
- adding parentheses. Fix failures of TestMkmf::TestConvertible
- with GCC 3.4.3 on Solaris 10. [Bug #12479] [ruby-dev:49660]
+ * ruby.c (addpath): rubylib_mangled_path() modified.
-Fri Jun 10 21:54:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 4 12:42:32 1999 Kazuhiko Izawa <izawa@erec.che.tohoku.ac.jp>
- * lib/forwardable.rb (Forwardable._delegator_method): extract
- method generator and deal with non-module objects.
- [ruby-dev:49656] [Bug #12478]
+ * pack.c (pack_unpack): % in printf format should be %%.
-Fri Jun 10 17:35:11 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Oct 4 10:01:40 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c: Special-case :ascii option in rb_str_capitalize_bang and
- rb_str_swapcase_bang.
+ * variable.c (rb_obj_instance_variables): should always return
+ array for all object can have instance variables now.
-Fri Jun 10 17:12:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Oct 4 00:08:34 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c: Special-case :ascii option in rb_str_upcase_bang (retry).
+ * pack.c (OFF16): need to adjust pointer address to pack/unpack on
+ 64bit machines.
-Fri Jun 10 14:48:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 03 03:05:59 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
- * hash.c (get_env_cstr): ensure NUL-terminated.
- [ruby-dev:49655] [Bug #12475]
+ * time.c (time_arg): mktime y2k problem.
- * string.c (rb_str_fill_terminator): return the pointer to the
- NUL-terminated content.
+Sun Sep 26 16:54:45 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
-Thu Jun 9 21:42:00 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * parse.y (here_document): `\r' handling for here documents.
- * ext/openssl/ossl_asn1.c (asn1integer_to_num): Use
- ASN1_ENUMERATED_to_BN() to convert an ASN1_ENUMERATED to a BN.
- Starting from OpenSSL 1.1.0, ASN1_INTEGER_to_BN() rejects
- non-ASN1_INTEGER objects. The format of INTEGER and ENUMERATED are
- almost identical so they behaved in the same way in OpenSSL <= 1.0.2.
- [ruby-core:75225] [Feature #12324]
+Wed Sep 22 09:20:11 1999 Masahiro Tomita <tommy@tmtm.org>
- * test/openssl/test_asn1.rb (test_decode_enumerated): Test that it
- works.
+ * ext/socket/socket.c: SOCKS5 support.
-Thu Jun 9 21:10:04 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Wed Sep 22 07:33:23 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * tool/ifchange: fix timestamp error when target without
- directory.
+ * lib/net/session.rb, smtp.rb, pop.rb: 1.0.1
-Thu Jun 9 19:46:22 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * lib/net/pop.rb: APOP did not work.
- * ext/openssl/ossl_ssl.c: Add define guards for OPENSSL_NO_EC.
- SSL_CTX_set_ecdh_auto() is defined even when ECDH is disabled in
- OpenSSL's configuration. This fixes r55214.
+ * lib/net/pop.rb: modify the way to make APOP challenge.
- * test/openssl/test_pair.rb (test_ecdh_curves): Skip if the OpenSSL does
- not support ECDH.
+Wed Sep 22 00:35:30 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/openssl/utils.rb (start_server): Ignore error in
- SSLContext#ecdh_curves=.
+ * string.c (rb_str_include): should return boolean value.
-Thu Jun 9 18:12:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_compile_fastmap): wrong comparison with mbc.
- * Makefile.in (un-runnable): fail with proper error message.
- [ruby-core:75905] [Bug #12472]
+ * eval.c (specific_eval): default sourcefile name should be
+ "(eval)" for module_eval etc.
-Thu Jun 9 15:32:17 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Sep 22 00:06:07 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * common.mk (RBCONFIG): use ifchange tool to see if the content is
- changed and update the timestamp file.
+ * win32/Makefile: update rules.
- * tool/mkconfig.rb: remove ifchange features.
+ * io.c (io_fread): should not assign in char, it maybe -1.
- * tool/ifchange: make target directory if it does not exist with
- its parent directories.
+Tue Sep 21 23:57:54 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * win32/ifchange.bat: drop support for command.com used on old
- systems.
+ * eval.c (call_trace_func): should not propagate retval in
+ trace_func.
-Thu Jun 9 15:03:35 2016 Kazuki Yamaguchi <k@rhe.jp>
+Mon Sep 20 21:35:39 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * ext/openssl/extconf.rb: Check for CRYPTO_malloc() and SSL_new().
- OpenSSL_add_all_digests() and SSL_library_init() are deprecated and
- converted to macros in OpenSSL 1.1.0.
- [ruby-core:75225] [Feature #12324]
+ * win32/win32.c (myselect): assume non socket files are always
+ readable/writable.
-Wed Jun 8 23:09:51 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Mon Sep 20 01:08:02 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (rb_str_ascii_casemap): fix compile error.
+ * io.c (io_fread): should not block other threads.
-Wed Jun 8 22:22:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (rb_io_synchronized): renamed from rb_io_unbuffered(); do
+ not call setbuf(NULL) anymore.
- * string.c: Revert previous commit (possibility of endless loop).
+Sat Sep 18 13:45:43 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jun 8 21:57:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * stable version 1.4.2 released.
- * string.c: Special-case :ascii option in rb_str_upcase_bang.
+Fri Sep 17 23:24:17 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Wed Jun 8 21:28:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_f_missing): dumped core if no argument given.
- * string.c: New static function rb_str_ascii_casemap; special-casing
- :ascii option in rb_str_upcase_bang and rb_str_downcase_bang.
+Fri Sep 17 23:21:06 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * regenc.c: Fix a bug (wrong use of unnecessary slack at end of string).
+ * win32/win32.c (myselect): translate WSAEINTR, WSAENOTSOCK into
+ UNIX errno constants.
- * regenc.h -> include/ruby/oniguruma.h: Move declaration of
- onigenc_ascii_only_case_map so that it is visible in string.c.
+Fri Sep 17 00:52:27 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jun 8 20:33:44 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * parse.y (arg): assignable() may return 0.
- * include/ruby/intern.h: Remove excess semicolons in PUREFUNC().
- Fix failure of TestMkmf::TestConvertible on Solaris with
- Oracle Solaris Studio 12. [ruby-dev:49651] [Bug #12470]
- * internal.h: ditto.
+Thu Sep 16 20:46:23 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Wed Jun 8 16:03:09 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * eval.c (rb_eval): was doubly evaluating the return expression.
- * lib/net/smtp.rb (getok, get_response): raise an ArgumentError when
- CR or LF is included in a line, because they are not allowed in
- RFC5321. Thanks, Jeremy Daer.
+Thu Sep 16 18:40:08 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 7 21:27:25 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * stable version 1.4.1 released.
- * test/rubygems/*_{cert,cert_32}.pem: Regenerate test certificates for
- OpenSSL 1.1.0. This is already in upstream.
- https://github.com/rubygems/rubygems/commit/9be5c53939440a61c4bba73cfffbeb5cfadf72be
- [ruby-core:75225] [Feature #12324]
+Thu Sep 16 11:33:22 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Tue Jun 7 21:27:17 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * string.c (rb_str_match): should return nil.
- * test/open-uri/test_ssl.rb: Regenerate test certificates. The test CA
- certificate was incorrectly generated. A CA certificate must have the
- basic constraints extension with cA bit set to TRUE. OpenSSL <= 1.0.2
- allowed the error when the certificate is in the trusted store but
- OpenSSL 1.1.0 no longer does.
- [ruby-core:75225] [Feature #12324]
+Wed Sep 15 22:46:37 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 7 21:20:38 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * re.c (rb_reg_s_quote): should quote `-' too.
- * test/openssl/test_x509name.rb: Don't register OID for 'emailAddress'
- and 'serialNumber'. A recent change in OpenSSL made OBJ_create()
- reject an already existing OID. They were needed to run tests with
- OpenSSL 0.9.6 which is now unsupported.
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=52832e470f5fe8c222249ae5b539aeb3c74cdb25
- [ruby-core:75225] [Feature #12324]
+Tue Sep 14 15:23:22 1999 Nobuyoshi Nakada <nobu.nakada@nifty.ne.jp>
- * test/openssl/test_ssl_session.rb (test_server_session): Duplicate
- SSL::Session before re-adding to the session store. OpenSSL 1.1.0
- starts rejecting SSL_SESSION once removed by SSL_CTX_remove_session().
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=7c2d4fee2547650102cd16d23f8125b76112ae75
+ * parse.y (yylex): no need to ignore `\r' here.
- * test/openssl/test_pkey_ec.rb (setup): Remove X25519 from @keys. X25519
- is new in OpenSSL 1.1.0 but this is for key agreement and not for
- signing.
+ * parse.y (nextc): strip `\r' from text.
- * test/openssl/test_pair.rb, test/openssl/test_ssl.rb,
- test/openssl/utils.rb: Set security level to 0 when using aNULL cipher
- suites.
+ * parse.y (nextc): support `__END__\r\n' type terminator.
- * test/openssl/utils.rb: Use 1024 bits DSA key for client certificates.
+Mon Sep 13 10:49:19 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * test/openssl/test_engine.rb: Run each test in separate process.
- We can no longer cleanup engines explicitly as ENGINE_cleanup() was
- removed.
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=6d4fb1d59e61aacefa25edc4fe5acfe1ac93f743
+ * eval.c (rb_eval): needless RTEST(ruby_verbose) removed.
- * ext/openssl/ossl_engine.c (ossl_engine_s_cleanup): Add a note to the
- RDoc for Engine.cleanup.
+Mon Sep 13 09:10:11 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * ext/openssl/lib/openssl/digest.rb: Don't define constants for DSS,
- DSS1 and SHA(-0) when using with OpenSSL 1.1.0. They are removed.
+ * lib/net/session.rb, smtp.rb, pop.rb: 1.0.0
- * test/openssl/test_digest.rb, test/openssl/test_pkey_dsa.rb,
- test/openssl/test_pkey_dsa.rb, test/openssl/test_ssl.rb,
- test/openssl/test_x509cert.rb, test/openssl/test_x509req.rb: Don't
- test unsupported hash functions.
+Wed Sep 8 11:37:38 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Tue Jun 7 17:49:52 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * time.c (make_time_t): bit more strict comparison.
- * test/ruby/enc/test_case_comprehensive: Change test for encodings
- without any non-ASCII case conversions from ASCII-only test
- to full test.
+Tue Sep 7 00:50:56 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 7 17:18:39 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * range.c (range_each): use rb_str_upto() for strings.
- * string.c (rb_str_upcase_bang, rb_str_capitalize_bang,
- rb_str_swapcase_bang): Switch to use primitive.
+ * string.c (rb_str_upto): set upper limit by comparing curr <= end.
-Tue Jun 7 16:44:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * range.c (range_each): should check equality to handle magic
+ increment.
- * string.c (rb_str_downcase_bang): Switch to use primitive except if
- conversion can be done ASCII-only.
+Mon Sep 6 22:43:33 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 7 16:13:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_eval): break/next/redo available within -n/-p loop.
- * test/ruby/enc/test_case_comprehensive: Add regression tests for
- current ASCII-only case conversion.
+Fri Sep 3 11:14:31 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jun 7 15:28:38 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * compar.c (cmp_equal): should not raise exception; protect by
+ rb_rescue().
- * test/ruby/enc/test_case_comprehensive: Fix method name
- (generate_casefold_tests -> generate_case_mapping_tests).
+Thu Sep 2 05:23:05 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
-Tue Jun 7 15:05:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * file.c (rb_file_s_expand_path): use dirsep, instead of character
+ literal '/'.
- * regenc.h/c: Rename onigenc_not_support_case_map to
- onigenc_ascii_only_case_map.
+ * file.c (rb_file_s_expand_path): reduce multiple dirsep at the top.
- * regenc.h: Add definition of onigenc_single_byte_ascii_only_case_map.
+Wed Sep 1 00:28:27 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/iso_8859_X.c, windows_125X.c, ascii.c, us-ascii.c, koi8_x.c:
- Replace onigenc_not_support_case_map by
- onigenc_single_byte_ascii_only_case_map.
+ * eval.c (rb_call): call rb_undefined() if a method appears not to
+ be exist explicitly from cache.
- * enc/big5.c, cp949.c, emacs_mule.c, euc_X.c, gbX.c, shift_jis.c,
- windows_31j.c: Replace onigenc_not_support_case_map by
- onigenc_ascii_only_case_map.
+ * eval.c (rb_method_boundp): check method cache before calling
+ rb_get_method_body().
-Tue Jun 7 14:57:09 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * eval.c (rb_get_method_body): store method non-existence
+ information in the cache.
- * ext/openssl/extconf.rb: Check for SSL_CTX_set_min_proto_version()
- macro added in OpenSSL 1.1.0. Version-specific methods, such as
- TLSv1_method(), are deprecated in OpenSSL 1.1.0. We need to use
- version-flexible methods (TLS_*method() or SSLv23_*method()) and
- disable other protocol versions as necessary.
- [ruby-core:75225] [Feature #12324]
+ * random.c (rb_f_srand): use getpid(2) to generate seed.
- * ext/openssl/ossl_ssl.c: Use SSL_CTX_set_{min,max}_proto_version() to
- fix the protocol version.
+ * regex.c (re_match): do not apply partial mbc match for
+ charset_not.
-Tue Jun 7 12:55:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * regex.c (re_compile_pattern): put extended literal prefix (0xff)
+ only before numeric literals, not before all >0x80 char.
- * regenc.c (onigenc_not_support_case_map): Move to end of file;
- (onigenc_single_byte_ascii_only_case_map): Add new function.
+ * regex.c (re_compile_pattern): put numeric literal in extended
+ charset region, not normal charset bits.
-Tue Jun 7 09:26:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * regex.c (re_compile_fastmap): calculate fastmap for charset and
+ charset_not to treat numeric literal (e.g. \246) specially.
- * regenc.c (onigenc_not_support_case_map): Rewrite to work correctly
- in ASCII range.
+Fri Aug 28 17:32:55 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
-Mon Jun 6 23:00:00 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * eval.c (rb_eval): should set return value (nil) explicitly if a
+ value is omitted for return statement.
- * appveyor.yml: Update libressl version to 2.3.5.
+Thu Aug 26 15:06:11 1999 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
-Mon Jun 6 18:37:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * gc.c (rb_gc): local variables may be placed beyond stack_end, so
+ use an address from alloca(1) on non C_ALLOCA platforms.
- * vm_insnhelper.c (vm_throw_start): check if the iseq is symbol
- proc, class definition should not be a symbol proc.
- [ruby-core:75856] [Bug #12462]
+Thu Aug 26 01:24:17 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jun 6 18:36:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * sprintf.c (rb_f_sprintf): "%%" is legal, but "%3.14%" is not.
- * string.c: Added UTF-16BE/LE and UTF-32BE/LE to supported encodings
- for Unicode case mapping.
+Mon Aug 23 00:00:54 1999 Tsukada Takuya <tsukada@fminn.nagano.nagano.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Tests for above
- functionality; fixed an encoding issue in assertion error message.
+ * regex.c (re_compile_fastmap): wrong macro caused memory leak.
-Mon Jun 6 17:29:35 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat Aug 21 11:30:51 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Speed up testing for small
- encodings by preselecting codepoints.
+ * eval.c (ADJ): should not adjust addresses to data on heap.
-Mon Jun 6 17:10:50 2016 Kazuki Yamaguchi <k@rhe.jp>
+Fri Aug 20 20:50:58 1999 Kenji Nagasawa <kenn@hma.att.ne.jp>
- * ext/openssl/ossl_cipher.c (ossl_cipher_free): Use EVP_CIPHER_CTX_free()
- to free EVP_CIPHER_CTX allocated by EVP_CIPHER_CTX_new().
- [ruby-core:75225] [Feature #12324]
+ * defines.h (PATH_SEP): path separator is ";" for OS/2.
-Mon Jun 6 13:37:08 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu Aug 19 10:50:43 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * string.c Change rb_str_casemap to use encoding primitive
- case_map instead of directly calling onigenc_unicode_case_map.
+ * gc.c (rb_gc): add volatile to avoid GCC optimize bug(?).
-Mon Jun 6 13:16:46 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed Aug 18 23:48:10 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_mapping.rb:
- Remove :lithuanian guard for Unicode case mapping.
+ * due to disk trouble, some change records were lost. several
+ modification made to eval.c, gc.c, io.c, pack.c,
+ ext/extmk.rb.in, and lib/mkmf.rb.
-Mon Jun 6 10:39:56 2016 Kazuki Yamaguchi <k@rhe.jp>
+Fri Aug 13 15:41:39 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/openssl_missing.h: Include ruby/config.h. r55285 added
- some inline functions but VC does not recognize 'inline' keyword.
+ * stable version 1.4.0 released.
-Mon Jun 6 09:25:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Aug 13 03:16:07 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * thread.c (thread_start_func_2): report raised exception if
- report_on_exception flag is set. [Feature #6647]
+ * io.c (argf_forward): since $stdout may be non-IO, ARGF.file is
+ not guaranteed to be IO. check and forwarding added to every ARGF
+ method.
-Mon Jun 6 01:36:24 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * io.c (set_outfile): $stdout/$stderr may not be IO now.
- * ext/openssl/extconf.rb: Check existence of SSL_is_server(). This
- function was introduced in OpenSSL 1.0.2.
- [ruby-core:75225] [Feature #12324]
+ * io.c (set_stdin): $stdin may not be IO now.
- * ext/openssl/openssl_missing.h: Implement SSL_is_server() if missing.
+ * range.c (rb_range_beg_len): round `end' to length as documented.
- * ext/openssl/ossl_ssl.c (ssl_info_cb): Use SSL_is_server() to see if
- the SSL is server. The state machine in OpenSSL was rewritten and
- SSL_get_state() no longer returns SSL_ST_ACCEPT.
+ * io.c (Init_IO): preserve original stdin/stdout/stderr.
- (ossl_ssl_cipher_to_ary, ossl_sslctx_session_get_cb): Add some
- `const`s to suppress warning.
+Thu Aug 12 13:44:33 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jun 6 01:18:10 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * eval.c (Init_load): require receives 1 argument.
- * ext/openssl/ossl_asn1.c (decode_bool): Do the same thing as
- d2i_ASN1_BOOLEAN() does by ourselves. This function is removed in
- OpenSSL 1.1.0.
- [ruby-core:75225] [Feature #12324]
+ * eval.c (frame_dup): should clear tmp to avoid dangling
+ references.
-Mon Jun 6 00:34:16 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Aug 11 13:33:13 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * ext/openssl/extconf.rb: Check existence of accessor functions that
- don't exist in OpenSSL 0.9.8. OpenSSL 1.1.0 made most of its
- structures opaque and requires use of these accessor functions.
- [ruby-core:75225] [Feature #12324]
+ * eval.c (rb_eval): no automatic aggregate initialization.
- * ext/openssl/openssl_missing.[ch]: Implement them if missing.
+ * eval.c (module_setup): ditto.
- * ext/openssl/ossl*.c: Use these accessor functions.
+Wed Aug 11 18:18:41 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * test/openssl/test_hmac.rb: Add missing test for HMAC#reset.
+ * eval.c (yield_under_i): automatic aggregate initialization is an
+ ANSI feature.
-Mon Jun 6 00:00:13 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Aug 11 10:10:02 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/openssl_missing.[ch]: Implement EVP_PKEY_get0_*() and
- {RSA,DSA,EC_KEY,DH}_get0_*() functions.
- OpenSSL 1.1.0 makes EVP_PKEY/RSA/DSA/DH opaque. We used to provide
- setter methods for each parameter of each PKey type, for example
- PKey::RSA#e=, but this is no longer possible because the new API
- RSA_set0_key() requires the 'n' at the same time. This commit adds
- deprecation warning to them and adds PKey::*#set_* methods as direct
- wrapper for those new APIs. For example, 'rsa.e = 3' now needs to be
- rewritten as 'rsa.set_key(rsa.n, 3, rsa.d)'.
- [ruby-core:75225] [Feature #12324]
+ * parse.y (yylex): parse `[].length==0' as `([].length)==0', not
+ `([].length=)=0'
- * ext/openssl/ossl_pkey*.[ch]: Use the new accessor functions. Implement
- RSA#set_{key,factors,crt_params}, DSA#set_{key,pqg}, DH#set_{key,pqg}.
- Emit a warning with rb_warning() when old setter methods are used.
+ * parse.y (yylex): parse `[].length!=0' as `([].length)!=0', not
+ `([].length!)=0'
- * test/drb/ut_array_drbssl.rb, test/drb/ut_drb_drbssl.rb,
- test/rubygems/test_gem_remote_fetcher.rb: Don't set a priv_key for DH
- object that are used in tmp_dh_callback. Generating a new key pair
- every time should be fine - actually the private exponent is ignored
- in OpenSSL >= 1.0.2f/1.0.1r even if we explicitly set.
- https://www.openssl.org/news/secadv/20160128.txt
+ * parse.y (peek): peek-in lexical buffer.
-Sun Jun 5 22:06:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Wed Aug 11 00:34:05 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in: Fix the timing to detect the appropriate C++ compiler
- in OS X.
+ * regex.c (re_match): bug on backward jump adjustment concerning
+ stop_paren.
-Sun Jun 5 21:42:24 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Aug 10 14:54:25 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/extconf.rb: Check absence of CRYPTO_lock() to see if the
- OpenSSL has the new threading API. In OpenSSL <= 1.0.2, an application
- had to set locking callbacks to use OpenSSL in a multi-threaded
- environment. OpenSSL 1.1.0 now finds pthreads or Windows threads so we
- don't need to do something special.
- [ruby-core:75225] [Feature #12324]
+ * ext/nkf/nkf.c (rb_nkf_guess): binary detection was wrong.
- Also check existence of *_up_ref(). Some structures in OpenSSL have
- a reference counter. We used to increment it with CRYPTO_add() which
- is a part of the old API.
+Tue Aug 10 00:07:36 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/openssl_missing.h: Implement *_up_ref() if missing.
+ * io.c (rb_io_clone): should use CLONESETUP().
- * ext/openssl/ossl.c: Don't set locking callbacks if unneeded.
+Mon Aug 9 23:57:07 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_pkey.c, ext/openssl/ossl_ssl.c,
- ext/openssl/ossl_x509cert.c, ext/openssl/ossl_x509crl.c,
- ext/openssl/ossl_x509store.c: Use *_up_ref() instead of CRYPTO_add().
+ * ruby.h (CLONESETUP): should have copied generic instance
+ variables too.
-Sun Jun 5 21:38:13 2016 Kazuki Yamaguchi <k@rhe.jp>
+Mon Aug 9 10:46:54 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * ext/openssl/extconf.rb: Check if RAND_pseudo_bytes() is usable. It is
- marked as deprecated in OpenSSL 1.1.0.
- [ruby-core:75225] [Feature #12324]
+ * ext/socket/extconf.rb: add check for <arpa/nameser.h> and
+ <resolv.h>.
- * ext/openssl/ossl_rand.c: Disable Random.pseudo_bytes if
- RAND_pseudo_bytes() is unavailable.
+Sat Aug 7 13:19:06 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * test/openssl/test_random.rb: Don't test Random.pseudo_bytes if not
- defined.
+ * numeric.c (flo_cmp): comparing NaN should not return value.
+ raises FloatDomainError.
-Sun Jun 5 19:06:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat Aug 7 03:09:08 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * NEWS: Add news about Unicode-wide case mapping for
- String/Symbol#upcase/downcase/swapcase/capitalize(!).
+ * eval.c (blk_free): free copied frames too.
-Sun Jun 5 15:24:33 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (frame_dup): should copy previous frames from stack to
+ heap to preserve frame information.
- * test/ruby/enc/test_case_comprehensive.rb:
- Remove :lithuanian guard for Unicode case mapping.
+Fri Aug 6 15:01:07 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jun 5 14:46:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * version 1.3.7 - version 1.4 beta
- * string.c: Remove :lithuanian guard for Unicode case mapping.
+ * ext/socket/socket.c (s_recv): UDPsocket#recvfrom now returns
+ IPsocket#addr information.
-Sat Jun 4 10:54:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_subary): ary[-3,3] should not return nil.
- * missing/crypt.h (struct crypt_data): remove unnecessary member
- "initialized".
+Thu Aug 5 10:58:01 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * missing/crypt.c (des_setkey_r): nothing to be initialized in
- crypt_data.
+ * eval.c (thread_mark): protect old ruby_frame from GC during it
+ replaced by eval().
- * configure.in (struct crypt_data): check for "initialized" in
- struct crypt_data, which may be only in glibc, and isn't on AIX
- at least.
+ * eval.c (eval): do not modify frame.prev; binding should preserve
+ information about calling() too.
-Sat Jun 4 10:38:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_yield_0): no arity check for mere yield; but only for
+ Proc#call.
- * win32/win32.c: unify MAX_PATH, _MAX_PATH, and MAXPATHLEN to
- PATH_MAX, except for MAX_PATH in get_special_folder for an API
- limit.
+Tue Aug 3 22:07:13 1999 Kazuhiro HIWADA <hiwada@kuee.kyoto-u.ac.jp>
-Fri Jun 3 21:27:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * object.c (rb_mod_clone): should check if iv_tbl, m_tbl are
+ initialized.
- * ruby.c (process_options): rb_str_conv_enc() never set encoding
- of the source string, but returns the string itself if the
- conversion failed. then the instance variable does not need to
- be set again.
+Tue Aug 3 19:03:02 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jun 3 18:04:37 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * hash.c (rb_any_cmp): use rb_with_disable_interrupt() to ensure
+ clearance of rb_prohibit_interrupt even on failure.
- * ruby.c (process_options): need to duplicate path before passing it to
- rb_str_conv_enc() because the function might call rb_enc_associate()
- internally. this fixes test failures on Windows introduced at r55260.
+ * eval.c (rb_with_disable_interrupt): new function added.
-Fri Jun 3 17:44:25 2016 Reiner Herrmann <reiner@reiner-h.de>
+Sat Jul 31 23:23:44 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/mkmf.rb (create_makefile): sort lists of source and object
- files in generated Makefile, unless given by extconf.rb.
- [Fix GH-1367]
+ * eval.c (rb_thread_create_0): set THREAD_RAISED flag on thread
+ termination by exception.
-Thu Jun 2 21:18:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_join): `$!' may not be nil for the threads
+ created in rescue clause.
- * win32/win32.c (get_special_folder): use SHGetPathFromIDListEx if
- available instead of old SHGetPathFromIDListW, to check the
- buffer size.
+ * eval.c (rb_thread_status): ditto.
-Thu Jun 2 17:05:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_join): should re-raise exception for already
+ dead threads too.
- * ruby.c (ruby_init_loadpath_safe): remove MAXPATHLEN restriction
- for Windows 10.
+Fri Jul 30 17:56:54 1999 GOTO Kentaro <gotoken@math.sci.hokudai.ac.jp>
-Thu Jun 2 16:51:35 2016 Koichi ITO <koic.ito@gmail.com>
+ * object.c (rb_mod_ge): wrong comparison.
- * misc/ruby-mode.el (ruby-here-doc-beg-re),
- (ruby-here-doc-beg-match, ruby-parse-partial): Support for
- `squiggly heredoc' syntax in ruby-mode. [Fix GH-1372]
+Fri Jul 30 12:15:44 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Thu Jun 2 10:24:48 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * ext/tcltklib/extconf.rb: win32 support.
- * string.c: Raise ArgumentError when invalid string is detected in
- case mapping methods.
+ * lib/mkmf.rb: use append_library().
- * enc/unicode.c: Check for invalid string and signal with negative
- length value.
+ * ext/extmk.rb.in: ditto.
- * test/ruby/enc/test_case_mapping.rb: Add tests for above.
+Fri Jul 30 02:11:48 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_m17n_comb.rb: Add a message to clarify test failure.
+ * array.c (rb_ary_delete): should return nil for deleting non
+ existing item.
-Wed Jun 1 21:41:05 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * io.c (rb_io_close): call rb_sys_wait() on explicit close.
- * ext/openssl/extconf.rb: Check existence of ASN1_TIME_adj(). The old
- ASN1_TIME_set() is not Year 2038 ready on sizeof(time_t) == 4
- environment. This function was added in OpenSSL 1.0.0.
- [ruby-core:45552] [Bug #6571]
+ * io.c (rb_io_fptr_close): do not call rb_sys_wait() on finalize.
- * ext/openssl/ossl_asn1.c (ossl_time_split): Added. Split the argument
- (Time) into the number of days elapsed since the epoch and the
- remainder seconds to conform to ASN1_TIME_adj().
- (obj_to_asn1utime, obj_to_asn1gtime): Use ossl_time_split() and
- ASN1_*TIME_adj().
+ * eval.c (yield_under_i): cbase context should be maintained for
+ Module#module_eval(). suggested by <inaba@st.rim.or.jp>.
- * ext/openssl/ossl_asn1.h: Add the function prototype for
- ossl_time_split().
+Wed Jul 28 01:18:28 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * ext/openssl/ossl_x509.[ch]: Add ossl_x509_time_adjust(). Similarly to
- obj_to_asn1*time(), use X509_time_adj_ex() instead of X509_time_adj().
+ * Makefile.in: add -I$(hdrdir)/lib to install using ftools.
- * ext/openssl/ossl_x509cert.c, ext/openssl/ossl_x509crl.c,
- ext/openssl/ossl_x509revoked.c: Use ossl_x509_time_adjust().
+ * util.c: use HAVE_FCNTL_H, not HAVE_FCNTL
-Wed Jun 1 15:58:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jul 28 18:24:45 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in: revert r55237. replace crypt, not crypt_r, and
- check if crypt is broken more.
+ * version 1.3.6 - version 1.4 alpha
- * missing/crypt.c: move crypt_r.c
+Tue Jul 27 09:38:08 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * string.c (rb_str_crypt): use crypt_r if provided by the system.
+ * eval.c (rb_eval): reduce recursive rb_eval() calls by
+ NODE_BLOCKs.
-Wed Jun 1 14:07:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 27 01:20:40 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * missing/crypt_r.c (a64toi): initialize statically and fix out of
- bounds access when salt is not 7bit clean.
+ * file.c (rb_file_s_expand_path): drive letter patch.
-Wed Jun 1 11:34:59 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jul 26 02:36:31 1999 Shugo Maeda <shugo@netlab.co.jp>
- * win32/Makefile.sub (MISSING): fixed build error introduced at r55237.
+ * eval.c (rb_load): should clear ruby_nerr.
-Wed Jun 1 09:48:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_join): oldbt should not be empty to unshift.
- * string.c (rb_str_crypt): use reentrant crypt_r.
+Sun Jul 25 12:09:16 1999 Koji Arai <JCA02266@nifty.ne.jp>
-Wed Jun 1 09:37:26 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * dir.c (push_braces): should treat nested braces.
- * missing/crypt.c (des_setkey): void function never returns any value.
+Fri Jul 23 02:49:49 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jun 1 09:16:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_hash_clear): dummy argument added; suggested by
+ <eguchi@shizuokanet.ne.jp>. thanks.
- * crypt.h: separate header file from missing/crypt.c.
+Thu Jul 22 19:37:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * missing/crypt.c (crypt_r, setkey_r, encrypt_r): add reentrant
- versions.
+ * eval.c (rb_thread_join): get_backtrace() may return Qnil.
+ typecheck added.
-Wed Jun 1 02:25:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 20 14:36:43 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * missing/crypt.c: fix size macros to use configured values
- for platforms long is larger than 32bit.
- [ruby-core:75792] [Bug #12446]
+ * range.c (range_each): do not treat String specially (for future
+ override).
-Tue May 31 17:28:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 20 02:28:34 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/optparse.rb (OptionParser::Completion.candidate): get rid of
- nil as key names. [ruby-core:75773] [Bug #12438]
+ * io.c (rb_gets): $_ should be nil, when get returns nil.
- * lib/optparse.rb (OptionParser#make_switch): char class option
- cannot be NoArgument, default to RequiredArgument.
+ * io.c (rb_f_gets): ditto.
-Tue May 31 00:30:11 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Jul 19 17:13:09 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/socket/raddrinfo.c (host_str, port_str): Use StringValueCStr
- instead of (Safe)StringValue, to detect NUL byte in the string.
+ * regex.c (re_compile_fastmap): should continue fastmap compile
+ for anychar_repeat, for it's repeat anyway.
-Mon May 30 22:02:01 2016 Kazuki Yamaguchi <k@rhe.jp>
+Mon Jul 26 13:33:45 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * ext/openssl/ossl_asn1.c (time_to_time_t): Use NUM2TIMET() instead of
- NUM2LONG(). time_t may be larger than long.
- [ruby-core:45552] [Bug #6571]
+ * lib/jcode.rb: replaced by faster code.
-Mon May 30 21:15:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Jul 19 01:57:28 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c: Document current behavior for other case mapping methods
- on String. [ci skip]
+ * lib/mkmf.rb: no longer use install program.
-Mon May 30 20:00:25 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * ext/extmk.rb.in: use miniruby to install programs.
- * string.c: Document current situation for String#downcase. [ci skip]
+Sat Jul 17 00:06:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 30 18:29:28 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * ext/socket/socket.c (ipaddr): don't do reverse lookup if
+ attribute do_not_reverse_lookup is set for socket classes.
+ Experimental. Note this is a global attribute.
- * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): Enable the automatic
- curve selection for ECDH by calling SSL_CTX_set_ecdh_auto(). With
- this a TLS server automatically selects a curve which both the client
- and the server support to use in ECDH. This changes the default
- behavior but users can still disable ECDH by excluding 'ECDH' cipher
- suites from the cipher list (with SSLContext#ciphers=). This commit
- also deprecate #tmp_ecdh_callback=. It was added in Ruby 2.3.0. It
- wraps SSL_CTX_set_tmp_ecdh_callback() which will be removed in OpenSSL
- 1.1.0. Its callback receives two values 'is_export' and 'keylength'
- but both are completely useless for determining a curve to use in
- ECDH. The automatic curve selection was introduced to replace this.
+Fri Jul 16 22:18:29 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- (ossl_sslctx_setup): Deprecate SSLContext#tmp_ecdh_callback=. Emit a
- warning if this is in use.
+ * io.c (rb_io_eof): use feof() to check EOF already met.
- (ossl_sslctx_set_ecdh_curves): Add SSLContext#ecdh_curves=. Wrap
- SSL_CTX_set1_curves_list(). If it is not available, this falls back
- to SSL_CTX_set_tmp_ecdh().
+ * io.c (read_all): should return nil at EOF.
- (Init_ossl_ssl): Define SSLContext#ecdh_curves=.
+Fri Jul 16 13:39:42 1999 Wakou Aoyama <wakou@fsinet.or.jp>
- * ext/openssl/extconf.rb: Check the existence of EC_curve_nist2nid(),
- SSL_CTX_set1_curves_list(), SSL_CTX_set_ecdh_auto() and
- SSL_CTX_set_tmp_ecdh_callback().
+ * lib/telnet.rb: version 0.231.
- * ext/openssl/openssl_missing.[ch]: Implement EC_curve_nist2nid() if
- missing.
+Fri Jul 16 10:58:22 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * test/openssl/test_pair.rb (test_ecdh_callback): Use
- EnvUtil.suppress_warning to suppress deprecated warning.
+ * regex.c (re_match): debug print removed.
- (test_ecdh_curves): Test that SSLContext#ecdh_curves= works.
+Fri Jul 16 09:58:15 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * test/openssl/utils.rb (start_server): Use SSLContext#ecdh_curves=.
+ * many files: clean up unused variables found by gcc -Wall.
-Mon May 30 16:28:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * lib/mkmf.rb: better cygwin support etc.
- * ext/socket/raddrinfo.c (host_str, port_str): use RSTRING_LEN
- instead of strlen, since RSTRING_PTR StringValueCStr may not be
- NUL-terminated when SHARABLE_MIDDLE_SUBSTRING=1. reported by
- @tmtms, http://twitter.com/tmtms/status/736910516229005312
+ * ext/extmk.rb.in: ditto.
-Mon May 30 16:20:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * instruby.rb: ditto.
- * string.c (str_fill_term): return new pointer reallocated by
- filling terminator.
+Fri Jul 16 01:37:50 1999 Koji Arai <JCA02266@nifty.ne.jp>
-Mon May 30 14:54:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_squeeze_bang): the type of local variable `c'
+ should be int, not char.
- * ext/stringio/stringio.c (enc_subseq): share the return value and
- the buffer as possible.
+ * string.c (rb_str_reverse): should always return copy.
-Mon May 30 14:50:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jul 15 23:25:57 1999 NAKAMURA Hiroshi <nakahiro@sarion.co.jp>
- * string.c (str_substr, rb_str_aref): refactor not to create
- unnecessary empty string.
+ * lib/debug.rb: better display & frame treatment.
- * string.c (str_byte_substr, str_byte_aref): ditto.
+Thu Jul 15 21:16:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 30 00:09:37 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * array.c (rb_ary_each): returns self for normal termination;
+ returns nil for break.
- * ext/-test-/auto_ext.rb: fixed a heedless bug introduced at r55198.
- this change will make RubyCI green.
+ * string.c: non bang methods (e.g. String#sub) should always
+ return copy of the receiver.
-Sun May 29 22:58:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jul 15 21:09:15 1999 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
- * regexec.c (ONIGENC_IS_MBC_ASCII_WORD): redefine optimized one.
- WORD of Ruby's ascii compatible encoding is always [a-zA-Z0-9_].
+ * eval.c (find_file): do not add empty string to the path.
-Sun May 29 22:44:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in (with-search-path): should not add empty string if
+ the option is not supplied.
- * regexec.c (match_at): make compilers optimize harder.
+Thu Jul 15 17:49:08 1999 Ryo HAYASAKA <hayasaka@univ21.u-aizu.ac.jp>
-Sun May 29 12:08:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c: move `#include "ruby.h"' forward.
- * ext/-test-/auto_ext.rb (auto_ext): utility method to create
- extension libraries for tests.
+Thu Jul 15 16:54:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat May 28 20:40:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * version 1.3.5 - version 1.4 alpha
- * misc/ruby-additional.el (ruby-insert-heredoc-code-block): insert
- here document code block for assert_separately mainly.
+Wed Jul 14 23:45:33 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
-Sat May 28 20:34:19 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (ruby_init): initialize for the first time only.
- * test/test_unicode_normalize.rb: Add test to check for availability of
- Unicode data file; refactoring; fix an error with tests for destructive
- method (unicode_normalize!).
+Tue Jul 13 00:15:19 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat May 28 19:08:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * hash.c (rb_hash_index): re-defined; method to retrieve a key
+ from the value.
- * test/ruby/enc/test_case_comprehensive.rb: Add error messages to tests
- for data file availability; refactoring.
+ * hash.c (Init_Hash): member? should be re-defined for Hash.
-Sat May 28 14:00:10 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Jul 12 13:54:51 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * ext/openssl/lib/openssl/ssl.rb (SSLSocket): Move the implementation of
- SSLSocket#initialize to C. Initialize the SSL (OpenSSL object) in it.
- Currently this is delayed until ossl_ssl_setup(), which is called from
- SSLSocket#accept or #connect. Say we call SSLSocket#hostname= with an
- illegal value. We expect an exception to be raised in #hostname= but
- actually we get it in the later SSLSocket#connect. Because the SSL is
- not ready at #hostname=, the actual call of SSL_set_tlsext_host_name()
- is also delayed.
- This also fixes: [ruby-dev:49376] [Bug #11724]
+ * io.c (rb_file_sysopen): wrong number of argument.
- * ext/openssl/ossl_ssl.c (ossl_ssl_initialize): Added. Almost the same
- as the Ruby version but this instantiate the SSL object at the same
- time.
+Mon Jul 12 11:52:35 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- (ossl_ssl_setup): Adjust to the changes. Just set the underlying IO to
- the SSL.
+ * eval.c (rb_f_missing): class name included in message.
- (ssl_started): Added. Make use of SSL_get_fd(). This returns -1 if not
- yet set by SSL_set_fd().
+ * eval.c (print_undef): better error message.
- (ossl_ssl_data_get_struct): Removed. Now GetSSL() checks that the SSL
- exists.
+Sun Jul 11 05:36:17 1999 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
- (ossl_ssl_set_session): Don't call ossl_ssl_setup() here as now the
- SSL is already instantiated in #initialize.
+ * lib/debug.rb: patch to show proper position.
- (ossl_ssl_shutdown, ossl_start_ssl, ossl_ssl_read_internal,
- ossl_ssl_write_internal, ossl_ssl_stop, ossl_ssl_get_cert,
- ossl_ssl_get_peer_cert, ossl_ssl_get_peer_cert_chain,
- ossl_ssl_get_version, ossl_ssl_get_cipher, ossl_ssl_get_state,
- ossl_ssl_pending, ossl_ssl_session_reused,
- ossl_ssl_get_verify_result, ossl_ssl_get_client_ca_list,
- ossl_ssl_npn_protocol, ossl_ssl_alpn_protocol, ossl_ssl_tmp_key): Use
- GetSSL() instead of ossl_ssl_data_get_struct(). Use ssl_started().
+Fri Jul 9 23:56:14 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
- (Init_ossl_ssl): Add method declarations of SSLSocket#{initialize,
- hostname=}.
+ * dln.c (dln_find_1): path conv. moved to conv_to_posix_path.
- * ext/openssl/ossl_ssl.h (GetSSL): Check that the SSL is not NULL. It
- should not be NULL because we now set it in #initialize.
+ * dln.c (conv_to_posix_path): path conv. should be done.
- * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_initialize): No need
- to check if the SSL is NULL.
+Fri Jul 9 10:26:47 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Sat May 28 10:47:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * random.c (RANDOM_NUMBER): should place parentheses.
- * gems/bundled_gems: Update latest releases, power_assert-0.3.0,
- test-unit 3.1.9, minitest 5.9.0, did_you_mean 1.0.1
+Fri Jul 8 11:00:51 1999 Shugo Maeda <shugo@netlab.co.jp>
-Sat May 28 10:45:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * numeric.c (fix_div): division may be out of fixnum range.
- * addr2line.c: drop support for ATARI ST platform. It was
- discontinued more than two decades ago. [fix GH-1350] Patch by
- @cremno
- * include/ruby/ruby.h: ditto.
- * io.c: ditto.
+ * bignum.c (bigdivmod): proper sign calculation to result.
-Sat May 28 10:39:47 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed Jul 7 18:27:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Converted exception for
- unavailable Unicode data files to failed assertion.
+ * st.c (st_delete_safe): was modifying wrong slot.
-Sat May 28 10:26:18 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Mon Jul 5 13:17:46 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/cgi/util.rb: added missing quote.
- [fix GH-1363][ci skip] Patch by @dwaller
+ * gc.c (rb_gc_call_finalizer_at_exit): close all files at exit.
-Fri May 27 17:38:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 2 18:00:21 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * variable.c (rb_local_constants_i): exclude hidden constants.
- [ruby-core:75575] [Bug #12389]
+ * lib/Mail/README: Mail-0.3.0 added to the distribution.
-Fri May 27 17:09:44 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 2 01:45:32 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * transcode.c (str_transcode0): scrub in the given encoding when
- the source encoding is given, not in the encoding of the
- receiver. [ruby-core:75732] [Bug #12431]
+ * regex.c (re_compile_fastmap): avoid allocation of register
+ variables for each invocation of re_match(). Suggested by
+ Zasukhin Ruslan <ruslan@paradigmasoft.com>. Thanks.
-Fri May 27 15:07:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 29 20:39:24 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * include/ruby/ruby.h (rb_scan_args): remove nul padding which
- caused syntax error if fmt is not a string literal.
+ * ext/tk/lib/tk.rb (TkVariable): bug fix; should value type check
+ be added?
- * include/ruby/ruby.h (rb_scan_args_verify): suppress array-bounds
- warnings by old clang.
+ * string.c (rb_str_each_line): a bug in paragraph mode.
- * include/ruby/ruby.h (rb_scan_args0): make extractor macros
- inline functions, which do not validate the format and are
- unnecessary to be expanded.
+ * ruby.c (load_file): shifted too much to skip #!.
-Fri May 27 01:00:36 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Jun 29 06:50:21 1999 Wakou Aoyama <wakou@fsinet.or.jp>
- * symbol.c (is_identchar): use ISDIGIT instead of rb_enc_isalnum.
- Though rb_enc_isalnum is encoding aware function, its argument here
- is *m, which is a single byte. Therefore ISDIGIT is faster.
+ * lib/CGI.rb: 0.30 - cleanup release, incompatible.
- * symbol.c (is_special_global_name): ditto.
+ * lib/telnet.rb: 0.22 - timeout added.
- * symbol.c (rb_enc_symname_type): ditto.
+Tue Jun 29 10:49:25 1999 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
-Fri May 27 00:39:40 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: better Rhapsody support.
- * include/ruby/ruby.h (rb_scan_args): add nul padding here to
- apply to all references.
+ * lib/mkmf.rb: Rhapsody/NEXTSTEP support.
- * include/ruby/ruby.h (rb_scan_args_verify): move length mismatch
- check outside conditional operators.
+Tue Jun 29 01:42:13 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu May 26 14:21:10 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * ext/pty/pty.c (chld_changed): should use POSIX.1 style wait.
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_compute_key): Check that the DH
- has 'p' (the prime) before calling DH_size(). We can create a DH with
- no parameter but DH_size() does not check and dereferences NULL.
- [ruby-core:75720] [Bug #12428]
+Mon Jun 28 21:07:36 1999 KIMURA Koichi <kbk@kt.rim.or.jp>
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_sign): Ditto. DSA_size() does
- not check dsa->q.
+ * ext/extmk.rb.nt: wrong result for have_library().
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
- ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
- ossl_rsa_private_decrypt): Ditto. RSA_size() does not check rsa->n.
+Mon Jun 28 15:24:05 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu May 26 14:13:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * missing/isinf.c: OSF/1 raises SIGFPE on one()/zero().
- * include/ruby/ruby.h (rb_scan_args_count): verify length with
- counting variables together.
+ * regex.c (re_search): should search til EOS, for patterns may
+ match beyond the end of range.
-Thu May 26 09:45:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Jun 28 12:49:12 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_comprehensive.rb: Add set of comprehensive
- (across most Unicode characters; later across most character encodings)
- tests for case mapping.
+ * io.c (rb_f_select): should not accept Time objects as an
+ argument for it is time interval.
-Thu May 26 05:00:13 2016 Benoit Daloze <eregontp@gmail.com>
+ * process.c (rb_f_sleep): ditto.
- * class.c (rb_define_class): Fix documentation.
+ * file.c (test_s): should return nil for false condition.
-Wed May 25 20:50:12 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Jun 28 12:23:52 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * re.c (unescape_nonascii): scan hex up to only 3 characters.
- [Bug #12420] [Bug #12423]
+ * bignum.c (rb_dbl2big): typo.
-Wed May 25 19:07:19 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * file.c (rb_f_test): ditto.
- * enc/unicode.c: Handle DOTLESS_i by hand because it isn't involved in folding.
+ * string.c (rb_str_crypt): wrong message.
-Wed May 25 18:30:53 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Sun Jun 27 19:50:11 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * regparse.c (fetch_token_in_cc): raise error if given octal escaped
- character is too big. [Bug #12420] [Bug #12423]
+ * eval.c (rb_f_exit): should have treat signed integer status, not
+ VALUE.
-Wed May 25 17:45:15 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * process.c (rb_f_exit_bang): should work like exit().
- * ext/openssl, test/openssl: Drop OpenSSL < 0.9.8 support.
+Sun Jun 27 16:21:32 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
-Wed May 25 17:43:30 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * string.c (rb_str_rindex): wrong position to search.
- * ext/openssl/openssl_missing.h, ext/openssl/ossl.h: Remove
- unnecessary 'extern "C"' blocks. We don't use C++ and these headers
- are local to ext/openssl, so there is no need to enclose with it.
+Sat Jun 26 04:05:30 1999 Takaaki Tateishi <ttate@jaist.ac.jp>
-Wed May 25 17:42:58 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * configure.in (configure_args): --with-search-path to specify
+ additional ruby search path.
- * ext/openssl/extconf.rb: Remove check of OPENSSL_FIPS macro. This is
- unneeded because we can check the macro directly in source code,
- just as we already do for OPENSSL_NO_* macros.
+ * ruby.c (ruby_prog_init): additional search path.
- * ext/openssl/ossl.c: Replace occurrences of HAVE_OPENSSL_FIPS with
- OPENSSL_FIPS.
+Fri Jun 25 13:09:12 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 25 17:13:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * pack.c (pack_unpack): needed to initialize natint.
- * class.c (rb_scan_args): merge code for n_trail.
+ * regex.c (re_compile_pattern): add start_paren to avoid too much
+ finalization on maybe_finalize_jump.
-Wed May 25 17:11:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jun 25 13:07:20 1999 Koji Oda <oda@bsd1.qnes.nec.co.jp>
- * include/ruby/ruby.h (rb_scan_args_validate): move failed
- condition to the terminal. [ruby-core:75714] [Bug #12426]
+ * missing/isinf.c: include "config.h" added.
-Wed May 25 13:13:37 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Jun 25 07:25:05 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * regcomp.c: remove condition for debug output because prelude
- doesn't use regexp now.
+ * lib/mkmf.rb: initialize $(topdir).
-Wed May 25 13:10:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/extmk.rb.in (install_rb): install lib/*.rb properly.
- * regcomp.c (compile_length_tree): return error code immediately
- if compile_length_tree raised error [Bug #12418]
+ * configure.in (linux): specifies -rpath on --enable-shared.
-Wed May 25 08:01:39 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * configure.in (aix): ruby.imp must reside in $(topdir).
- * enc/unicode.c: Fix flag error for switch from titlecase to lowercase.
+Thu Jun 24 19:11:29 1999 Yoshida Masato <yoshidam@yoshidam.net>
- * test/ruby/enc/test_case_mapping.rb: Tests for above error.
+ * parse.y (rb_str_extend): multi-byte identifier in expression
+ interpolation in strings.
-Wed May 25 01:13:55 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * parse.y (yylex): support multi-byte char identifiers.
- * ext/openssl/ossl_pkey_ec.c (ec_key_new_from_group): Create a new
- EC_KEY on given EC group. Extracted from ossl_ec_key_initialize().
- (ossl_ec_key_s_generate): Added. Create a new EC instance and
- generate a random private and public key.
- (ossl_ec_key_initialize): Use ec_key_new_from_group().
- (Init_ossl_ec): Define the new method EC.generate. This change is
- for consistency with other PKey types. [ruby-core:45541] [Bug #6567]
+Thu Jun 24 15:27:13 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/openssl/test_pkey_ec.rb: Test that EC.generate works.
+ * parse.y (f_arg): check duplicate argument names.
-Wed May 25 00:37:16 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * gc.c (rb_gc_mark): marking wrong member for NODE_ARGS.
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_key_generate_key): Fix up RDoc.
- (Init_ossl_ec): Rename EC#generate_key to EC#generate_key!. Make the
- old name an alias of #generate_key!. This change is for consistency
- with other PKey types. [ruby-core:45541] [Bug #6567]
+ * string.c (rb_str_rindex): POSITION specifies start point, not
+ end point.
- * test/openssl/test_pkey_ec.rb: Use EC#generate_key! instead of
- EC#generate_key.
+Thu Jun 24 13:00:17 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 25 00:23:05 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (print_mbc): wrong boundary.
- * include/ruby/ruby.h (rb_scan_args_set): check the arity after
- adjusting argc for an option hash, for optimization in simpler
- cases.
+ * pack.c (uv_to_utf8): raises ArgError for too big value.
-Wed May 25 00:21:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 24 11:02:51 1999 Yoshida Masato <yoshidam@yoshidam.net>
- * configure.in (XCFLAGS): merge flags only for ruby itself from
- ruby_cflags.
+ * pack.c (uv_to_utf8): mask needed.
-Tue May 24 22:04:15 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Jun 23 21:03:56 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * ext/openssl/ossl_cipher.c (ossl_cipher_set_key, ossl_cipher_set_iv):
- Reject too long values as well as too short ones. Currently they
- just truncate the input but this would hide bugs and lead to
- unexpected encryption/decryption results.
+ * ruby.h (struct RFile): remove iv_tbl from struct. instance
+ variables are handled as generic ivs.
- * test/openssl/test_cipher.rb: Test that Cipher#key= and #iv= reject
- Strings with invalid length.
+Wed Jun 23 22:06:26 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Tue May 24 21:32:21 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * pack.c (utf8_to_uv): pack to 7 bytes sequence.
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): Use
- ASN1_OCTET_STRING_set() instead of M_ASN1_OCTET_STRING_set(). Macros
- prefixed by "M_" are discouraged to be used from outside OpenSSL
- library[1].
- (ossl_x509ext_get_value): Likewise, use ASN1_STRING_print() instead
- of M_ASN1_OCTET_STRING_print().
- [1] https://git.openssl.org/gitweb/?p=openssl.git;a=blob;f=CHANGES;h=bf61913d7b01212b4d8b2f3c13d71d645914f67c;hb=b6079a7835f61daa9fb2cbf9addfa86049523933#l878
+ * pack.c (uv_to_utf8): wrong boundary.
- * ext/openssl/ossl.h: Include openssl/asn1.h instead of
- openssl/asn1_mac.h. It just includes openssl/asn1.h and defines some
- additional "M_" macros.
+ * pack.c (pack_unpack): should treat as unsigned long.
-Tue May 24 18:52:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 23 15:10:11 1999 Inaba Hiroto <inaba@sdd.tokyo-sc.toshiba.co.jp>
- * include/ruby/ruby.h (rb_scan_args_verify): verify the format to
- scan if no invalid chars and variable argument length matching,
- at the compile time if possible.
+ * parse.y (parse_string): failed to parse nested braces.
-Tue May 24 17:18:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (parse_regx): nested braces within #{} available.
- * include/ruby/defines.h (ERRORFUNC, WARNINGFUNC): add fallback
- definitions.
+Wed Jun 23 11:18:38 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue May 24 16:37:43 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (slow_search): wrong shift width for mbcs.
- * configure.in (ruby_cflags): separate from optflags [Bug #12409]
- -fexcess-precision=standard and -fp-model precise are set to this now.
+ * eval.c (rb_thread_save_context): should not clear th->locals.
- * configure.in (cflags): use ruby_cflags.
+Wed Jun 23 02:06:14 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue May 24 16:20:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yylex): UMINUS binds too tight with digits. changed so
+ that -2**2 => -4.
- * configure.in (ERRORFUNC, WARNINGFUNC): __error__ and __warning__
- attributes take a parenthesized string literal.
+ * parse.y (close_paren): `do' for expr termination now works it
+ used to be.
-Tue May 24 12:35:56 2016 URABE Shyouhei <shyouhei@ruby-lang.org>
+Wed Jun 22 18:26:42 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * common.mk: sort lines, and add missing dependencies suggested
- by tool/update-deps
+ * pack.c (pack_pack): should initialize local variable `j'.
-Mon May 23 21:33:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Jun 22 15:24:59 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * include/ruby/missing.h (isfinite): move from numeric.c.
+ * parse.y (here_document): a bug for multiline heredoc.
-Mon May 23 21:09:06 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Jun 22 15:06:36 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * ext/openssl/ossl.c (Init_openssl): Avoid reference to unset global
- variable. ossl_raise() may be called before dOSSL is set. Since
- global variables default to 0 and the default value of dOSSL set in
- Init_openssl() is also Qfalse, there is no real issue but confusing.
- Patch by Bertram Scharpf <software@bertram-scharpf.de>
- [ruby-core:58264] [Bug #9101]
+ * ext/socket/socket.c (ruby_socket): forgot to return fd
+ explicitly.
-Mon May 23 20:32:16 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Jun 22 13:34:12 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_asn1.c, ext/openssl/ossl_bn.c,
- ext/openssl/ossl_cipher.c, ext/openssl/ossl_digest.c
- ext/openssl/ossl_engine.c, ext/openssl/ossl_ns_spki.c
- ext/openssl/ossl_pkcs12.c, ext/openssl/ossl_pkcs7.c
- ext/openssl/ossl_pkey.c, ext/openssl/ossl_pkey_ec.c
- ext/openssl/ossl_rand.c, ext/openssl/ossl_ssl.c
- ext/openssl/ossl_x509attr.c, ext/openssl/ossl_x509cert.c
- ext/openssl/ossl_x509ext.c, ext/openssl/ossl_x509store.c: Use
- StringValueCStr() where NUL-terminated string is expected.
+ * rubyio.h (MakeOpenFile): should initialize member `iv_tbl'.
-Mon May 23 20:20:12 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Jun 22 10:35:51 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * ext/bigdecimal/bigdecimal.c (isfinite): get rid of a warning on
- cygwin. [Bug #12417][ruby-core:75691]
+ * io.c (rb_io_gets_internal): getc(3) may not set errno on
+ interrupt.
-Mon May 23 19:41:27 2016 Kazuki Yamaguchi <k@rhe.jp>
+Mon Jun 21 22:39:28 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_rand.c (ossl_rand_egd, ossl_rand_egd_bytes):
- RAND_egd{_bytes,}() return -1 on failure, not 0.
- Patch by cremno phobia <cremno@mail.ru>
- [ruby-core:63795] [Bug #10053]
- (ossl_pseudo_bytes): Similar, RAND_pseudo_bytes() may return 0 or
- -1 on failure.
+ * eval.c (call_required_libraries): ruby_sourceline should be
+ cleared before loading libraries.
-Mon May 23 15:52:07 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * io.c (set_stdin): do not use reopen(), so that we don't need to
+ dup original stdin before assigning $stdin.
- * ext/bigdecimal/bigdecimal.c (isfinite): isfinite does not always
- exist. fixed build error on Windows introduced at r55123.
+Mon Jun 21 18:04:27 1999 Ryo HAYASAKA <hayasaka@univ21.u-aizu.ac.jp>
-Mon May 23 13:19:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/dbm/dbm.c: include <cdefs.h> for solaris 2.6.
- * include/ruby/ruby.h (rb_scan_args0): make compile error if the
- format is wrong or does not match with the variable argument
- length if possible.
+Mon Jun 21 15:59:47 1999 Nobuyoshi Nakada <nobu.nokada@softhome.net>
-Mon May 23 12:47:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (ip_addrsetup): forgot to put `else'.
- * include/ruby/ruby.h (rb_scan_args0): raise fatal error if
- variable argument length does not match, it is a bug in the code
- which uses rb_scan_args, not a runtime error.
+Mon Jun 21 15:38:37 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 23 12:30:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (fptr_finalize): remove rb_syswait() invocation to avoid
+ wait4(2) within GC. rb_syswait() moved to rb_io_fptr_close().
- * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): consider
- non-finite float values not to raise FloatDomainError.
- [ruby-core:75682] [Bug #12414]
+Mon Jun 21 12:05:59 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Mon May 23 12:21:18 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * dir.c (dir_s_glob): remove MAXPATHLEN restriction.
- * array.c (rb_ary_fill): suppress warnings: 'item' may be used
- uninitialized in this function
+ * ext/md5/md5init.c (md5_hexdigest): should have used "%02x".
-Mon May 23 07:41:49 2016 Eric Wong <e@80x24.org>
+Sun Jun 20 19:50:38 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * dir.c (dir_close): update RDoc for 2.3 #close change
- [ruby-core:75679] [Bug #12413]
+ * string.c (rb_str_each_line): should have checked string
+ boundary.
-Sun May 22 20:01:21 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Sat Jun 19 22:24:12 1999 Kenji Nagasawa <kenn@hma.att.ne.jp>
- * lib/drb/timeridconv.rb: use finalizer trick instead of thread.
+ * OS/2 patch improved.
- * test/drb/ut_timerholder.rb: ditto.
+Fri Jun 18 08:30:17 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 22 17:25:18 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * marshal.c (r_byte): add data length check.
- * test/ruby/enc/test_case_options.rb: adjust test class name
- to match file name
+ * ext/tcltklib/tcltklib.c (_timer_for_tcl): was doing busy-wait.
-Sun May 22 17:24:07 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue Jun 15 10:01:21 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * rename test/ruby/enc/test_casing_options.rb to test_case_options.rb
- for consistency
+ * configure.in: remove trailing slash from interpreter embedded
+ shared library path.
-Sun May 22 17:06:55 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in (INSTALL_DLLIB): install shared lib with 0555.
- * transcode.c (enc_arg, str_transcode_enc_args, econv_args):
- remove volatile, and add GC guards in callers.
- [ruby-core:75664] [Bug #12411]
+ * instruby.rb: changed mode for shared library into 0555.
-Sun May 22 16:27:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jun 11 23:27:00 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * ext/-test-/integer/core_ext.c: move testutil/integer.c.
+ * ext/etc/etc.c (etc_passwd): should return nil, not exception for
+ call after last passwd entry.
- * test/lib/-test-/integer.rb: extract implementation details from
- test/unit/assertions.rb. [Bug #12408]
+Fri Jun 11 15:21:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 22 14:57:43 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * gc.c (rb_gc_mark_locations): add safety margin 1.
- * include/ruby/oniguruma.h: Extend OnigEncodingTypeDefine to define a
- new encoding primitive 'case_map' for case mapping
+ * eval.c (ruby_run): should protect toplevel node tree.
- * enc/utf-8.c, utf_16be/le.c, utf_32be/le.c:
- add onigenc_unicode_case_map as case_map primitive
+ * ext/etc/etc.c (etc_group): dumps core if there's no more group.
- * enc/ascii.c, big5.c, cp949.c, emacs_mule.c, euc_jp/kr/tw.c, gb18030.c,
- gbk.c, iso_8859_1/2/3/4/5/6/7/8/9/10/11/13/14/15/16.c, koi8_r/u.c,
- shift_jis.c, us_ascii.c, windows_1250/1251/1252.c:
- add onigenc_not_support_case_map as case_map primitive
+Fri Jun 11 01:50:25 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 22 14:45:45 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (ruby_run): Init_stack() was called too late; local
+ variables happened to be higher (or lower) than stack_start.
- * regenc.h/c: Define new function onigenc_not_support_case_map
+Thu Jun 10 16:41:48 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 22 12:14:06 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c: do not call `initialize' for IO objects. So with Array,
+ Hash, Range, and Time objects.
- * include/ruby/ruby.h (rb_scan_args): use original rb_scan_args
- when fmt is dynamic.
+ * ext/curses/curses.c (curses_getch): made thread aware using
+ rb_read_check().
-Sun May 22 11:41:12 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/curses/curses.c (window_getch): ditto.
- * class.c (rb_scan_args): moved to bottom of the file to make the
- effect of `#undef rb_scan_args` the minimum.
+ * ext/curses/curses.c (curses_getstr): made (partially) thread
+ aware using rb_read_check().
- * include/ruby/ruby.h (rb_scan_args): overwrite only if GCC and
- optimized. Visual C++ 14 or later can compile it but make it
- conservative.
+ * ext/curses/curses.c (window_getstr): ditto.
-Sat May 21 22:45:50 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * io.c (rb_read_check): new function to help making something
+ (like extension libraries) thread aware.
- * include/ruby/ruby.h (rb_scan_args): don't use ALWAYS_INLINE with
- `inline`. if gcc needs this duplication, do in ALWAYS_INLINE macro.
+ * eval.c (is_defined): `defined? super' should be true even for
+ private superclass methods.
-Sat May 21 21:11:56 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Jun 10 13:42:10 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * include/ruby/ruby.h (rb_scan_args): use __VA_ARGS__ instead of
- va_arg to allow compilers optimize more aggressive.
- https://gustedt.wordpress.com/2011/07/10/avoid-writing-va_arg-functions/
- rb_scan_args is now expected to be statically resolved.
+ * pack.c (pack_pack): template `Z' should be allowed.
-Sun May 22 02:41:52 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Jun 9 13:26:38 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/zlib/zlib.c: remove hacky macro introduced at r30437.
+ * eval.c (rb_thread_loading): modified to avoid nested race
+ condition of require().
- * ext/zlib/zlib.c (gzfile_make_header): cast as long (instead of int).
+ * ext/tcltklib/tcltklib.c (ip_invoke): queue invocation on non
+ main threads.
- * ext/zlib/zlib.c (gzfile_make_footer): ditto.
+ * ext/tcltklib/tcltklib.c (lib_mainloop): flush invocation
+ queues periodically.
-Sat May 21 21:07:18 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * version.c (ruby_show_version): now print the message to stdout.
- * configure.in (ALWAYS_INLINE): force compilers the function inlined.
+ * version.c (ruby_show_copyright): ditto.
-Sat May 21 16:16:03 2016 Kazuki Yamaguchi <k@rhe.jp>
+Tue Jun 8 00:00:34 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_ssl.c (ossl_ssl_stop): Don't free the SSL struct
- here. Since some methods such as SSLSocket#connect releases GVL,
- there is a chance of use after free if we free the SSL from another
- thread. SSLSocket#stop was documented as "prepares it for another
- connection" so this is a slightly incompatible change. However when
- this sentence was added (r30090, Add toplevel documentation for
- OpenSSL, 2010-12-06), it didn't actually. The current behavior is
- from r40304 (Correct shutdown behavior w.r.t GC., 2013-04-15).
- [ruby-core:74978] [Bug #12292]
+ * pack.c (pack_unpack): append sentinel (NUL) to the string.
- * ext/openssl/lib/openssl/ssl.rb (sysclose): Update doc.
+ * ext/md5/md5init.c (md5_hexdigest): new method to obtain
+ printable hash string.
- * test/openssl/test_ssl.rb: Test this.
+ * ext/md5/md5init.c (md5_update): should return self.
-Sat May 21 14:41:14 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * pack.c (pack_pack): undocumented template 'U' for UTF8.
- * ext/openssl/ossl.c: [DOC] Fix SSL client example. The variable name
- was wrong. Patch by Andreas Tiefenthaler <at@an-ti.eu> (@pxlpnk).
- [GH ruby/openssl#32]
+ * pack.c (pack_unpack): ditto.
-Sat May 21 14:25:38 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * marshal.c (r_byte): should replace getc() with rb_getc().
- * ext/openssl/ossl_pkey_ec.c: rename PKey::EC#private_key? and
- #public_key? to #private? and #public? for consistency with other
- PKey types. Old names remain as alias. [ruby-core:45541] [Bug #6567]
+ * io.c (rb_getc): getc() replacement uses READ_DATA_PENDING() and
+ rb_thread_wait_fd().
- * test/openssl/test_pkey_ec.rb (test_check_key): check private? and
- public? works correctly.
+Mon Jun 7 23:23:38 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat May 21 12:40:36 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * object.c (rb_mod_clone): should call CLOSESETUP().
- * ext/openssl/lib/openssl/buffering.rb (read_nonblock, readpartial):
- Remove impossible EOFError raise. Patch by Zach Anker
- <zanker@squareup.com>. [GH ruby/openssl#23]
+ * eval.c (bind_clone): should call CLONESETUP() for new clone.
-Sat May 21 11:18:42 2016 Evgeni Golov <evgeni@golov.de>
+Sat Jun 5 10:32:40 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/ipaddr.rb: [DOC] fix documentation of IN6MASK to mention
- IPv6. [Fix GH-1349]
+ * string.c (rb_str_oct): binary (e.g. 0b10111) support.
-Sat May 21 11:12:53 2016 Dan Martinez <dfm@razorwind.org>
+ * variable.c (rb_const_set): raise warning, not exception.
- * io.c (Init_IO): [DOC] define dummy ARGF instead of ARGF.class to
- re-enable the generation of ARGF documentation. [Fix GH-1358]
+ * parse.y (yycompile): initialize parser internal variables.
-Sat May 21 11:07:29 2016 0x01f7 <souk.0x01f7@gmail.com>
+ * parse.y (close_paren): set lex_state to EXPR_PAREN after closing
+ parenthesis.
- * doc/syntax/methods.rdoc (Method Names): add proper closing tag.
- [Fix GH-1356]
+ * parse.y (yylex): returns kDO for `do' right after method_call.
-Sat May 21 09:26:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 3 11:05:30 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * configure.in (RUBY_CHECK_SETJMP): fix missing macro definition
- for the configured result. fix up r55021.
+ * regex.c (read_backslash): should decode \b within class.
-Sat May 21 00:36:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jun 3 01:06:18 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * process.c (rb_execarg_commandline): build command line string
- from argument vector in rb_execarg.
- [ruby-core:75611] [Bug #12398]
+ * dln.c (dln_load): AIX improvement (aix_findmain removed).
-Fri May 20 23:25:42 2016 Kazuki Yamaguchi <k@rhe.jp>
+Wed Jun 2 00:41:31 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl.c (ossl_pem_passwd_value): Added. Convert the
- argument to String with StringValue() and validate the length is in
- 4..PEM_BUFSIZE. PEM_BUFSIZE is a macro defined in OpenSSL headers.
- (ossl_pem_passwd_cb): When reading/writing encrypted PEM format, we
- used to pass the password to PEM_def_callback() directly but it was
- problematic. It is not NUL character safe. And surprisingly, it
- silently truncates the password to 1024 bytes. [GH ruby/openssl#51]
+ * pack.c (pack_unpack): new undocumented template Z which strips
+ stuff after first null.
- * ext/openssl/ossl.h: Add function prototype declaration of newly
- added ossl_pem_passwd_value().
+ * pack.c (pack_pack): should preserve specified length of the
+ resulting string.
- * ext/openssl/ossl_pkey.c (ossl_pkey_new_from_data): Use
- ossl_pem_passwd_value() to validate the password String.
+Tue Jun 1 15:29:33 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize, ossl_dsa_export):
- ditto.
+ * ext/socket/socket.c (ruby_socket): retry after GC, if socket(2)
+ failed on EMFILE or ENFILE.
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_key_initialize,
- ossl_ec_key_to_string): ditto.
+ * ext/socket/socket.c (sock_s_socketpair): ditto.
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize, ossl_rsa_export):
- ditto.
+ * eval.c (module_setup): need to add PUSH_VAR/POP_VAR to clear
+ dyna vars link list.
- * test/openssl/test_pkey_{dsa,ec,rsa}.rb: test this.
+ * version.h (RUBY_RELEASE_CODE): integer macro constant for source
+ version detection.
-Fri May 20 23:45:53 2016 Naohisa Goto <ngotogenome@gmail.com>
+Sun May 30 22:19:12 1999 Kenji Nagasawa <kenn@tcp-ip.or.jp>
- * id_table.c (list_id_table_init): When unaligned word access is
- prohibited and sizeof(VALUE) is 8 (64-bit machines),
- capa should always be even number for 8-byte word alignment
- of the values of a table. This code assumes that sizeof(ID) is 4,
- sizeof(VALUE) is 8, and xmalloc() returns 8-byte aligned memory.
- This fixes bus error on 64-bit SPARC Solaris 10.
- [Bug #12406][ruby-dev:49631]
+ * ext/socket/socket.c: emx/gcc 0.9d now fixes things about
+ AF_UNIX.
-Fri May 20 22:30:09 2016 Naohisa Goto <ngotogenome@gmail.com>
+ * process.c: OS/2 EMX kludge.
- * symbol.h (rb_id2sym): Use HAVE_BUILTIN___BUILTIN_CONSTANT_P
+ * Makefile.in (strncasecmp.o): added dependency.
-Fri May 20 22:19:00 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Mon May 31 16:06:28 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/date/date_core.c: [DOC] fix typos.
- [fix GH-1360] patched by @soundasleep
+ * version 1.3.4 - preliminary release for 1.4
-Fri May 20 21:26:58 2016 Naohisa Goto <ngotogenome@gmail.com>
+Mon May 31 15:57:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/defines.h (RB_GNUC_EXTENSION, RB_GNUC_EXTENSION_BLOCK):
- macros for skipping __extension__ on non-GCC compilers.
- * eval_error.c (warn_print): use RB_GNUC_EXTENSION_BLOCK instead of
- __extension__ because __extension__ is a GNU extension.
- Fix compile error on Solaris 10 with Oracle Solaris Studio 12.x.
- [Bug #12397] [ruby-dev:49629].
- * internal.h (rb_fstring_cstr, rb_fstring_enc_cstr): ditto
- * include/ruby/encoding.h (rb_enc_str_new, rb_enc_str_new_cstr): ditto
- * include/ruby/intern.h (rb_str_new, rb_str_new_cstr,
- rb_usascii_str_new, rb_utf8_str_new, rb_tainted_str_new_cstr,
- rb_usascii_str_new_cstr, rb_utf8_str_new_cstr,
- rb_external_str_new_cstr, rb_locale_str_new_cstr,
- rb_str_buf_new_cstr, rb_str_cat_cstr, rb_exc_new_cstr): ditto
+ * io.c (rb_io_fptr_close): close on IO which main_thread is
+ waiting cause serious exception, that vanishes the actual fd
+ closing. Invocation of rb_thread_fd_close() is deferred
+ a little.
-Fri May 20 21:17:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat May 29 18:27:13 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * ext/win32ole/win32ole.c (fole_missing): make substring or dup to
- share the content if possible.
+ * regex.c (re_match): stack boundary check needed.
-Fri May 20 19:48:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat May 29 12:27:00 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (NEW_PARTIAL_MEMO_FOR): shrink buffer array not to
- mark non-VALUE fields. fix check_rvalue_consistency abort with
- RGENGC_CHECK_MODE=2.
+ * ext/tcltklib/tcltklib.c (ip_invoke): proper ref count management
+ to avoid leak. I HATE REF COUNTING!!
- * internal.h (NEW_CMP_OPT_MEMO): exclude struct cmp_opt_data from
- the valid array range.
+ * eval.c (ruby_run): moved ruby_require_libraries() to handle `-r'
+ from ruby_options() to avoid stack corruption for threads
+ created in libraries.
- * enum.c (slicewhen_i): exclude inverted too.
+Sat May 29 02:22:12 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu May 19 21:21:57 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * eval.c (rb_yield_0): when `for' appeared in blocks, it
+ introduced new scope for local variables.
- * re.c (rb_reg_match_m_p): [DOC] fix return value in rdoc.
+Fri May 28 17:16:49 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_regexp.rb (TestRegexp#test_match_p): add some
- tests from document.
+ * string.c (rb_str_squeeze_bang): squeeze AND of the arguments.
+ UNDOCUMENTED.
-Thu May 19 13:22:44 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * string.c (rb_str_count): new UNDOCUMENTED method.
- * ext/openssl/ossl.c (Init_openssl): register an ex_data index for
- X509_STORE and X509_STORE_CTX respectively. Since they don't share
- the ex_data index registry, we can't use the same index.
- (ossl_verify_cb): use the the correct index.
+ * string.c (rb_str_delete_bang): delete AND of the arg ranges.
+ UNDOCUMENTED FEATURE for 1.3.x.
- * ext/openssl/ossl_ssl.c (ossl_ssl_verify_callback): ditto.
+ * ext/socket/socket.c (setipaddr): re-wrote using ip_addrsetup().
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_vfy_cb): ditto.
- (ossl_x509stctx_verify): ditto.
+ * ext/socket/socket.c (ip_addrsetup): decode symbolic address
+ <broadcast>.
- * ext/openssl/ossl.h (void ossl_clear_error): add extern declarations
- of ossl_store_{ctx_,}ex_verify_cb_idx.
+Thu May 27 12:27:42 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/openssl_missing.c: remove X509_STORE_set_ex_data and
- X509_STORE_get_ex_data.
+ * string.c (tr_trans): should handle NUL (\0) within strings.
- * ext/openssl/openssl_missing.h: implement X509_STORE_get_ex_data,
- X509_STORE_set_ex_data and X509_STORE_get_ex_new_index as macros.
+Tue May 25 16:45:11 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu May 19 13:11:35 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * io.c (rb_f_syscall): syscall may return values other than zero
+ on success.
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): check that the
- argument is an OpenSSL::ASN1::Data before converting to ASN1_TYPE.
- This fixes SEGV on OpenSSL::X509::Attribute#value=(non-asn1-value).
+ * regex.c (re_match): handle empty loop properly (hopefully).
- * test/openssl/test_x509attr.rb: add tests for OpenSSL::X509::Attribute.
+ * regex.c (re_match): remove empty group check, because it does
+ not help non-grouping parentheses (?:..).
-Thu May 19 12:10:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_compile_fastmap): treating try_next, finalize_push
+ wrong way.
- * re.c (rb_reg_match_m_p): fix match against empty string.
- rb_str_offset returns the end when the position exceeds the
- length. fix the range parameter of onig_search.
- [ruby-core:75604] [Bug #12394]
+ * regex.c: remove some obsolete functions such as
+ group_match_null_string_p().
-Thu May 19 11:37:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 24 14:47:54 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * re.c (rb_reg_match_m_p): should return false if no match, as the
- document says. [Feature #8110]
+ * regex.c (read_backslash): read backslash by regex.
-Thu May 19 00:17:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Sun May 23 19:44:58 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
- * re.c (reg_names_iter): specify capacify
+ * ext/pty/pty.c (getDevice): portability patch.
-Wed May 18 21:29:59 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri May 21 23:01:26 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * thread.c (recursive_list_access): a object id may be a Bignum. so,
- the list must be a objhash, instead of a identhash.
- this fixes many test errors on mswin64 CI.
+ * ext/socket/getaddrinfo.c (GET_AI): should set error code.
-Wed May 18 19:33:54 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu May 20 03:43:44 1999 Jun-ichiro itojun Hagino <itojun@itojun.org>
- * re.c (rb_reg_match_m_p): Introduce Regexp#match?, which returns
- bool and doesn't save backref.
+ * ext/socket/socket.c: you should use sockaddr_storage to handle
+ IPv6 addresses.
-Wed May 18 16:52:03 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * ext/socket/getaddrinfo.c (getaddrinfo): prevent retrieving
+ AF_INET6 address if hints.ai_flags == AI_PASSIVE.
- * ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): pop errors
- leaked by PKCS12_parse(). This is a bug in OpenSSL, which exists
- in the versions before the version 1.0.0t, 1.0.1p, 1.0.2d.
+Wed May 19 12:27:07 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 18 16:04:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (exec_end_proc): should protect exceptions.
- * tool/downloader.rb (Downloader::RubyGems.download): verify gems
- only if RubyGems is 2.4 or later. old RubyGems fails to verify
- almost all of bundled gems.
+ * gc.c (run_final): ditto.
-Wed May 18 14:52:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (f_rest_arg): allow just * for rest arg.
- * string.c (rb_str_modify_expand): check integer overflow.
- [ruby-core:75592] [Bug #12390]
+ * parse.y (mlhs_basic): allow * without formal argument.
-Wed May 18 13:11:44 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (re_match): the variable `part' should be initialized.
- * re.c (match_ary_subseq): get subseq of match array without creating
- temporary array.
+Tue May 18 15:25:45 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * re.c (match_ary_aref): get element(s) of match array without creating
- temporary array.
+ * regex.c (re_search): a bug in range adjustment.
- * re.c (match_aref): Use match_ary_subseq with handling irregulars.
+Tue May 18 11:35:59 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * re.c (match_values_at): Use match_ary_aref.
+ * dln.c (conv_to_posix_path): path_len argument added.
-Wed May 18 13:03:07 2016 Kazuki Yamaguchi <k@rhe.jp>
+Mon May 17 12:26:31 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_x509cert.c (ossl_x509_verify): X509_verify()
- family may put errors on 0 return (0 means verification failure).
- Clear OpenSSL error queue before return to Ruby. Since the queue is
- thread global, remaining errors in the queue can cause an unexpected
- error in the next OpenSSL operation. [ruby-core:48284] [Bug #7215]
+ * numeric.c (fix_rev): should treat Fixnum as signed long.
- * ext/openssl/ossl_x509crl.c (ossl_x509crl_verify): ditto.
+ * eval.c (massign): add strict number check for yield (and call).
- * ext/openssl/ossl_x509req.c (ossl_x509req_verify): ditto.
+ * eval.c (proc_arity): new method to return number of arguments.
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_verify): ditto.
+ * eval.c (method_arity): new method to return number of arguments.
- * ext/openssl/ossl_pkey_dh.c (dh_generate): clear the OpenSSL error
- queue before re-raising exception.
+ * parse.y (read_escape): char may be unsigned.
- * ext/openssl/ossl_pkey_dsa.c (dsa_generate): ditto.
+ * string.c (rb_str_succ): ditto.
- * ext/openssl/ossl_pkey_rsa.c (rsa_generate): ditto.
+ * string.c (tr_trans): ditto.
- * ext/openssl/ossl_ssl.c (ossl_start_ssl): ditto.
+ * object.c (Init_Object): methods `&', `|', `^' are added to nil.
- * test/openssl: check that OpenSSL.errors is empty every time after
- running a test case.
+ * range.c (rb_range_beg_len): it should be OK for [0..-len-1].
-Wed May 18 12:07:42 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * regex.c (re_search): search for byte literal within mbcs.
- * ext/openssl/ossl.c (ossl_clear_error): Extracted from
- ossl_make_error(). This prints errors in the OpenSSL error queue if
- OpenSSL.debug is true, and clears the queue.
- (ossl_make_error): use ossl_clear_error().
+ * regex.c (is_in_list): parsh
- * ext/openssl/ossl.h: add prototype declaration of ossl_make_error().
- (OSSL_BIO_reset) use ossl_clear_error() to clear the queue. Clearing
- silently makes debugging difficult.
+ * regex.c (re_compile_fastmap): should have not alter the loop
+ variable `j' if TRASLATE_P().
- * ext/openssl/ossl_engine.c (ossl_engine_s_by_id): ditto.
+ * regex.c (re_compile_pattern): escaped characters should be read
+ by PATFETCH_RAW(c).
- * ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): ditto.
+Sat May 15 11:23:51 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_verify): ditto.
+ * regex.c (re_match): endline2 (\Z) should not match at the point
+ between a newline and end-of-line, like endline ($).
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
+ * class.c (include_class_new): should initialize iv_tbl to share
+ between module and iclass.
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_key_initialize): ditto.
- (ossl_ec_group_initialize): ditto.
+Fri May 14 08:50:27 1999 Akira Endo <akendo@t3.rim.or.jp>
- * ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): ditto.
+ * regex.c (re_compile_fastmap): it should be k != 0 to skip.
-Wed May 18 11:53:49 2016 Kazuki Yamaguchi <k@rhe.jp>
+Fri May 14 12:46:56 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_point_mul): Validate the
- arguments before passing to EC_POINT(s)_mul(). Add description of this
- method. [ruby-core:65152] [Bug #10268]
+ * time.c (time_load): a bug in old marshal format support.
- * test/openssl/test_pkey_ec.rb (test_ec_point_mul): Test that
- OpenSSL::PKey::EC::Point#mul works.
+ * instruby.rb: make site_ruby directory.
-Wed May 18 11:19:59 2016 Kazuki Yamaguchi <k@rhe.jp>
+Fri May 14 10:18:02 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * ext/openssl/ossl_bn.c (try_convert_to_bnptr): Extracted from
- GetBNPtr(). This doesn't raise exception but returns NULL on error.
- (GetBNPtr): Raise TypeError if conversion fails.
- (ossl_bn_eq): Implement BN#==.
- (ossl_bn_eql): #eql? should not raise TypeError even if the argument
- is not compatible with BN.
- (ossl_bn_hash): Implement BN#hash.
+ * regex.c (re_match): a bug in inline `.*' etc.
- * ext/openssl/ossl_bn.c (Init_ossl_bn): Define #== and #hash.
+Fri May 14 09:58:46 1999 Minero Aoki <aamine@dp.u-netsurf.ne.jp>
- * test/openssl/test_bn.rb: Test BN#eql?, #== and #hash
+ * ruby.c (addpath): should have specified string length.
-Wed May 18 10:17:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 13 10:40:44 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/ruby.h (RB_INTEGER_TYPE_P): new macro and
- underlying inline function to check if the object is an
- Integer (Fixnum or Bignum).
+ * eval.c (rb_eval_string_wrap): new function.
-Wed May 18 09:52:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * regex.c (re_compile_pattern): POSIX line match should alter
+ behavior for `^' and `$' to begbuf and endbuf2 respectively.
- * enum.c (enum_sum, hash_sum, hash_sum_i, enum_sum_i, sum_iter):
- Optimize for hashes when each method isn't redefined.
+ * ext/pty/pty.c: un-ANSI-fy function arguments.
-Wed May 18 09:14:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Wed May 12 14:19:38 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enum.c (enum_sum, int_range_sum): Extract int_range_sum from
- enum_sum.
+ * struct.c (iv_get): in case of inheritance of generated struct
+ class, __member__ and __size__ should also be inherited.
+ Thanks for Pros Yeboah <yeboah@tu-harburg.de>.
-Wed May 18 03:16:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_f_gets_internal): should check number of arguments
+ before checking rb_rs == rb_default_rs. Thanks for Koji Arai
+ <JCA02266@nifty.ne.jp>.
- * re.c (match_values_at): fix regression at r55036.
- MatchData#values_at accepts Range.
+Tue May 11 08:29:28 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 18 02:02:58 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (re_compile_pattern): .?, .+ did not work.
- * re.c (match_aref): remove useless condition and call rb_fix2int.
- rb_reg_nth_match handles negative index.
+Mon May 10 00:59:33 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 18 01:57:43 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/jcode.rb: forgot to squeeze on reverse (complement) case.
- * re.c (match_values_at): MatchData#values_at supports named captures
- [Feature #9179]
+ * string.c (tr_squeeze): should not set modify flag to be honest,
+ if the string is not modified.
- * re.c (namev_to_backref_number): separated.
+ * signal.c (Init_signal): SIGTERM should not be handled.
-Wed May 18 00:05:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * regex.c (re_match): seeking for longest match is now optional,
+ which can be set using RE_OPTION_POSIXMATCH. This satisfies
+ POSIX longest match as much as Emacs's posix-* functions, which
+ are known to be incomplete.
- * enum.c (enum_sum): Optimize for a range from int to int.
+Sun May 9 13:04:01 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * test/ruby/test_enum.rb (test_range_sum): Move from test_range.rb,
- and add assertions for some conditions.
+ * ext/socket/socket.c (sock_s_getaddrinfo): conversion from
+ Fixnums to C integers needed.
- * test/ruby/test_enum.rb (test_hash_sum): Move from test_hash.rb.
+Sun May 9 11:51:43 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * test/ruby/test_hash.rb, test/ruby/test_range.rb: Remove test_sum.
+ * range.c (range_eqq): reverse condition.
-Tue May 17 23:08:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * range.c (range_s_new): default should be end inclusive.
- * enum.c (enum_sum): [DOC] Write documentation.
+Sat May 8 03:27:51 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue May 17 22:53:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * ext/socket/socket.c (thread_connect): replace nasty
+ rb_thread_fd_writable() with rb_thread_select().
- * enum.c (enum_sum): Implement Enumerable#sum.
+Fri May 7 20:49:00 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * test/ruby/test_enum.rb (test_sum): Test sum for Enumerable.
+ * ext/socket/getaddrinfo.c (inet_pton): wrong parameter to
+ inet_aton().
- * test/ruby/test_hash.rb (test_sum): Test sum for Hash.
+ * ext/socket/addrinfo.h (__P): silly cut and paste typo.
- * test/ruby/test_range.rb (test_sum): Test sum for Range.
+Fri May 7 17:03:57 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue May 17 22:11:41 2016 Tanaka Akira <akr@fsij.org>
+ * dir.c (glob): removed GPL'ed glob.c completely.
- * object.c, numeric.c, enum.c, ext/-test-/bignum/mul.c,
- lib/rexml/quickpath.rb, lib/rexml/text.rb, lib/rexml/xpath_parser.rb,
- lib/rubygems/specification.rb, lib/uri/generic.rb,
- bootstraptest/test_eval.rb, basictest/test.rb,
- test/-ext-/bignum/test_big2str.rb, test/-ext-/bignum/test_div.rb,
- test/-ext-/bignum/test_mul.rb, test/-ext-/bignum/test_str2big.rb,
- test/csv/test_data_converters.rb, test/date/test_date.rb,
- test/json/test_json_generate.rb, test/minitest/test_minitest_mock.rb,
- test/openssl/test_cipher.rb, test/rexml/test_jaxen.rb,
- test/ruby/test_array.rb, test/ruby/test_basicinstructions.rb,
- test/ruby/test_bignum.rb, test/ruby/test_case.rb,
- test/ruby/test_class.rb, test/ruby/test_complex.rb,
- test/ruby/test_enum.rb, test/ruby/test_eval.rb,
- test/ruby/test_iseq.rb, test/ruby/test_literal.rb,
- test/ruby/test_math.rb, test/ruby/test_module.rb,
- test/ruby/test_numeric.rb, test/ruby/test_range.rb,
- test/ruby/test_rational.rb, test/ruby/test_refinement.rb,
- test/ruby/test_rubyvm.rb, test/ruby/test_struct.rb,
- test/ruby/test_variable.rb, test/rubygems/test_gem_specification.rb,
- test/thread/test_queue.rb: Use Integer instead of Fixnum and Bignum.
+Fri May 7 08:17:19 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue May 17 15:26:10 2016 Tanaka Akira <akr@fsij.org>
+ * ext/sdbm/extconf.rb: sdbm extension added to the distribution.
- * [Feature #12005] Unify Fixnum and Bignum into Integer
+Fri May 7 01:42:20 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/ruby.h (rb_class_of): Return rb_cInteger for fixnums.
+ * ext/socket/socket.c (tcp_s_gethostbyname): avoid using struct
+ sockaddr_storage.
- * insns.def (INTEGER_REDEFINED_OP_FLAG): Unified from
- FIXNUM_REDEFINED_OP_FLAG and BIGNUM_REDEFINED_OP_FLAG.
+Thu May 6 13:21:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_core.h: Ditto.
+ * array.c (rb_ary_indexes): should not use rb_ary_concat().
- * vm_insnhelper.c (opt_eq_func): Use INTEGER_REDEFINED_OP_FLAG instead
- of FIXNUM_REDEFINED_OP_FLAG.
+Thu May 4 12:34:18 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * vm.c (vm_redefinition_check_flag): Use rb_cInteger instead of
- rb_cFixnum and rb_cBignum.
- (C): Use Integer instead of Fixnum and Bignum.
+ * parse.y (parse_string): there should be newline escape by
+ backslashes in strings.
- * numeric.c (fix_succ): Removed.
- (Init_Numeric): Define Fixnum as Integer.
+ * parse.y (parse_qstring): ditto.
- * bignum.c (bignew): Use rb_cInteger instead of rb_cBignum.
- (rb_int_coerce): replaced from rb_big_coerce and return fixnums
- as-is.
- (Init_Bignum): Define Bignum as Integer.
- Don't define ===.
+Mon May 3 04:37:20 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * error.c (builtin_class_name): Return "Integer" for fixnums.
+ * ext/tcltklib/extconf.rb: better search for libX11.
- * sprintf.c (ruby__sfvextra): Use rb_cInteger instead of rb_cFixnum.
+ * range.c (range_s_new): embarrassing =/== typo.
- * ext/-test-/testutil: New directory to test.
- Currently it provides utilities for fixnum and bignum.
+ * re.c (Init_Regexp): failed to set default kcode.
- * ext/json/generator/generator.c: Define mInteger_to_json.
+Mon May 3 02:39:55 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * lib/mathn.rb (Fixnum#/): Redefinition removed.
+ * ext/socket/socket.c (open_inet): typo (res and res0).
-Tue May 17 11:58:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue May 4 02:07:49 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in (RUBY_CHECK_BUILTIN_SETJMP): declare t as NORETURN
- to suppress warnings by -Wsuggest-attribute=noreturn.
- [ruby-core:75510] [Bug #12383]
+ * mkconfig.rb: leave undefined $(VARIABLE) unexpanded in the
+ Config::CONFIG hash table.
-Tue May 17 10:40:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon May 3 09:37:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in (RUBY_CHECK_SETJMP): needs the header and proper
- arguments for builtin setjmp functions.
+ * regex.c (re_compile_pattern): expand exactn{n} at compile time.
+ handles stop_paren specially.
-Mon May 16 20:00:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * regex.c (re_compile_pattern): expand x{n} at compile time.
- * enc/unicode.h: Additional uses of ONIG_CASE_MAPPING compilation switch
+ * regex.c (re_search): posix line match should be checked.
-Mon May 16 19:46:33 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * regex.c (re_search): a bug in anchor condition.
- * include/ruby/oniguruma.h: Introducing ONIG_CASE_MAPPING compilation
- switch
+Fri Apr 30 18:57:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/oniguruma.h, enc/unicode.h: Using ONIG_CASE_MAPPING
- compilation switch
+ * version 1.3.3
-Mon May 16 19:29:31 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * string.c (rb_str_rindex): position should be END point, not
+ START point.
- * gems/bundled_gems: Update xmlrpc-0.1.1. xmlrpc-0.1.0 didn't allow
- to install on 2.4.0dev.
+ * re.c (rb_reg_search): pos means end point on reverse now.
-Mon May 16 13:28:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_s_create): should clear ary->ptr to avoid
+ potential gc crash.
- * configure.in (FUNC_STDCALL, FUNC_CDECL, FUNC_FASTCALL): set
- macro names explicitly to the old names, which are accidentally
- changed at r54985, for backward compatibilities.
- fiddle also depends on these names to fallback to ANSI names.
- [ruby-core:75494] [Bug #12377]
+Fri Apr 30 15:24:58 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 16 11:39:02 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * ext/socket/addrinfo.h: compatibility hack for ipv4.
- * lib/xmlrpc.rb, lib/xmlrpc/*, test/xmlrpc: XMLRPC is bundled gem
- on Ruby 2.4. It is extracted to https://github.com/ruby/xmlrpc
- [Feature #12160][ruby-core:74239]
- * gems/bundled_gems: ditto.
+ * ext/socket/socket.c: itojun's ipv6 patches applied.
-Mon May 16 06:06:21 2016 Eric Wong <e@80x24.org>
+ * ext/socket/extconf.rb: detect ipv6 features based on itojun's
+ ipv6 patches.
- * proc.c: fix RDoc of Proc#===/call/yield/[]
- [Bug #12332]
+ * ext/extmk.rb.in (enable_config): can handle --enable-xxx now.
-Sun May 15 20:55:31 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+ * lib/mkmf.rb (enable_config): ditto.
- * lib/drb/timeridconv.rb: don't use keeper thread. [Bug #12342]
+Fri Apr 30 05:22:23 1999 Shugo Maeda <shugo@netlab.co.jp>
- * test/drb/ut_timerholder.rb: ditto.
+ * string.c (rb_str_aset): last index should not append.
-Sun May 15 16:15:25 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Apr 29 18:55:31 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
- * array.c (rb_ary_entry): extract rb_ary_elt to organize if-conditions
- and check whether is embedded at once.
+ * dln.c (conv_to_posix_path): remove const from args.
-Sun May 15 10:57:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (rubylib_mangle): remove Fatal(), the obsolete function.
- * vm_insnhelper.c (vm_get_ev_const): warn deprecated constant even
- in the class context. [ruby-core:75505] [Bug #12382]
+Tue Apr 27 14:11:45 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 15 03:13:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (fname): lazy workaround for keywords did not work well.
- * iseq.h (struct iseq_compile_data): use struct rb_id_table
- instead of st_table.
+ * ext/extmk.rb.in: `--with-xxx=yyy' argument configuration.
- * iseq.c (prepare_iseq_build): don't allocate ivar_cache_table
- until it has at least one element.
+ * lib/mkmf.rb: ditto.
- * iseq.c (compile_data_free): free ivar_cache_table only if it
- is allocated.
+ * misc/ruby-mode.el: forgot to handle $`.
- * compile.c (get_ivar_ic_value): allocate if the table is not
- allocated yet.
+ * ext/extmk.rb.in: better AIX link support proposed by
+ <komatsu@sarion.co.jp>.
-Sat May 14 09:04:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 26 16:46:59 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/mkmf.rb (pkg_config): use xsystem consistently to set up
- library path environment variable as well as latter pkg-config
- calls. [ruby-dev:49619] [Bug #12379]
+ * ext/extmk.rb.in: AIX shared library support modified.
-Sat May 14 00:16:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/aix_mksym.rb: ditto.
- * random.c (make_seed_value): append leading-zero-guard and get
- rid of making a local copy of the seed.
+ * configure.in: ditto.
-Fri May 13 08:46:42 2016 cremno <cremno@mail.ru>
+ * sprintf.c (rb_f_sprintf): should allocate proper sized buffer
+ for float numbers.
- * NEWS: drop FreeBSD < 4 support. [Fix GH-1339]
- The most recent version affected by this is 3.5 and was released
- in 2000.
- https://www.freebsd.org/releases/3.5R/announce.html
- https://en.wikipedia.org/wiki/History_of_FreeBSD#Version_history
+Sat Apr 24 00:00:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri May 13 03:12:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (operation): syntax like `a.[]=(1,2)' is allowed.
- * include/ruby/defines.h (GCC_VERSION_SINCE): moved from internal.h.
+Fri Apr 23 23:54:09 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri May 13 03:11:20 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c (argf_binmode): binmode method added to ARGF.
- * configure.in (__builtin_constant_p): check.
+Fri Apr 23 13:55:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h: Use HAVE_BUILTIN___BUILTIN_CONSTANT_P
+ * string.c (rb_f_chomp): should assign the result to $_. or maybe
+ sub/gsub/chop/chomp should NOT assign $_ altogether.
-Fri May 13 03:10:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Apr 22 16:50:54 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in: use alternative keyword
- to avoid macros conflicts with them.
+ * eval.c (rb_callcc): call scope_dup() for all scopes in
+ the interpreter stack.
-Thu May 12 01:54:08 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Apr 20 11:24:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/mkmf.rb (try_func): get rid of conflict of declarations of
- main(). checking local symbol reference does not make sense.
+ * string.c (rb_str_dump): `#' should be escaped.
-Thu May 12 00:18:19 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Apr 20 02:32:42 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * win32/Makefile.sub (HAVE_QSORT_S): use qsort_s only for Visual Studio
- 2012 or later, because VS2010 seems to causes a SEGV in
- test/ruby/test_enum.rb.
+ * parse.y (parse_regx): option /p for posix match added.
-Wed May 11 23:59:47 2016 Masaya Tarui <tarui@ruby-lang.org>
+ * re.c (rb_reg_desc): did not print options properly.
- * vm_insnhelper.c (vm_getivar): describe fast-path explicit
- (compiler friendly). [Bug #12274].
+ * io.c (rb_file_s_open): initialize was called twice.
-Wed May 11 21:30:07 2016 Masaya Tarui <tarui@ruby-lang.org>
+Mon Apr 19 18:56:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * compile.c (iseq_compile_each): share InlineCache during same
- instance variable accesses. Reducing memory consumption,
- rising cache hit rate and rising branch prediction hit rate
- are expected. A part of [Bug #12274].
+ * configure.in (DEFAULT_KCODE): can specify default code for
+ $KCODE by --with-default-kcode=(euc|sjis|utf8|none).
- * iseq.h (struct iseq_compile_data): introduce instance
- variable IC table for sharing.
+ * regex.c (IS_A_LETTER): a byte sequence shorter than mbc should
+ not match with \w etc.
- * iseq.c (prepare_iseq_build, compile_data_free):
- construct/destruct above table.
+Mon Apr 19 13:49:11 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 11 17:18:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (eval): should restore ruby_dyna_vars.
- * util.c (ruby_qsort): use qsort_s if available, for Microsoft
- Visual Studio 2005 (msvcr80.dll) and mingw.
+Fri Apr 16 21:40:43 1999 Nobuyoshi Nakada <gea02117@nifty.ne.jp>
-Wed May 11 10:33:26 2016 Marcus Stollsteimer <sto.mar@web.de>
+ * io.c (f_backquote): pipe_open may return nil.
- * COPYING: Remove trailing-whitespaces.
- [ci skip][fix GH-1348]
+ * io.c (f_open): rb_io_open may return nil.
-Tue May 10 21:05:45 2016 Benoit Daloze <eregontp@gmail.com>
+ * io.c (io_s_foreach): ditto.
- * insns.def (defineclass): Also raise an error when redeclaring the
- superclass of a class as Object and it has another superclass.
- [Bug #12367] [ruby-core:75446]
+ * io.c (io_s_readlines): ditto.
- * test/ruby/test_class.rb: test for above.
+ * io.c (io_defset): wrong message.
-Tue May 10 14:57:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 16 15:09:20 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * random.c (obj_random_bytes): base on bytes method instead of
- rand method, not to call toplevel rand method.
+ * bignum.c (rb_str2inum): strtoul() returns long, not int.
-Tue May 10 13:07:28 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_load): size of VALUE and ID may be different.
- * configure.in (-fexcess-precision=standard): before r54895 -std=c99
- is specified and it implied -fexcess-precision=standard.
- Now with -std=gnu99, it should be explicitly specified.
- https://gcc.gnu.org/onlinedocs/gcc/Optimize-Options.html
+ * util.c (mmprepare): int is too small to cast from pointers.
-Mon May 9 10:51:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * config.guess: avoid 'linux-gnu' for alpha-unknown-linux.
- * thread.c (rb_thread_atfork_internal): move th to an argument.
+Thu Apr 15 23:46:20 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * thread.c (rb_thread_atfork): do not repeat GET_THREAD().
+ * ruby.c (rubylib_mangle): mangle path by RUBYLIB_PREFIX.
-Mon May 9 10:46:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Apr 14 23:52:51 1999 SHIROYAMA Takayuki <psi@fortune.nest.or.jp>
- * thread.c (rb_thread_atfork, rb_thread_atfork_before_exec): do
- nothing unless working fork is available.
+ * node.h (NODE_LMASK): should be long to avoid overflow.
- * thread_sync.c (rb_mutex_abandon_all): define only if working
- fork is available.
+Wed Apr 14 13:14:35 1999 Katsuyuki Komatsu <komatsu@sarion.co.jp>
- * thread_sync.c (rb_mutex_abandon_keeping_mutexes): ditto.
+ * dln.c: AIX dynamic link.
- * thread_sync.c (rb_mutex_abandon_locking_mutex): ditto.
+ * ext/aix_ld.rb: ditto.
- * thread_win32.c (gvl_init): never used.
+Wed Apr 14 12:19:09 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 9 07:18:06 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * lib/thread.rb: Queue#{enq,deq} added.
- * include/ruby/{defines,ruby}.h: need to define function attributes
- alternatives in defines.h instead of ruby.h, because they are used
- in oniguruma.h and the header used without including ruby.h at
- encoding library sources.
+Tue Apr 13 17:43:56 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 9 06:30:12 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * hash.c (rb_hash_s_create): Hash::[] acts more like casting.
- * include/ruby/ruby.h (CONSTFUNC, PUREFUNC): fixed build errors on
- non-gcc build environments introduced at r54952.
+Tue Apr 13 00:33:52 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 9 02:51:51 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * io.c (rb_io_stdio_set): warning for assignment to the variables
+ $std{in,out,err}.
- * gc.c (rb_gc_unprotect_logging): throw rb_memerror when it cannot
- allocate memory. This is pointed out by Facebook's Infer.
+Mon Apr 12 23:12:32 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (gc_prof_setup_new_record): ditto.
+ * io.c (rb_io_reopen): check for reopening same IO.
- * regparse.c (parse_regexp): ditto.
+Fri Apr 9 17:45:11 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * util.c (MALLOC): use xmalloc and xfree like above.
+ * parse.y (rb_compile_string): bug for nested eval().
-Mon May 9 02:39:16 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (re_match): should pop non-greedy stack items on
+ failure, after best_regs are fixed.
- * configure.in: check function attribute const and pure,
- and define CONSTFUNC and PUREFUNC if available.
- Note that I don't add those options as default because
- it still shows many false-positive (it seems not to consider
- longjmp).
+Thu Apr 8 17:30:40 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_eval.c (stack_check): get rb_thread_t* as an argument
- to avoid duplicate call of GET_THREAD().
+ * pack.c (PACK_LENGTH_ADJUST): need to adjust for `*' length.
-Sun May 8 21:01:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Apr 6 23:28:44 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/openssl/extconf.rb: assume it doesn't have SSLv2 related
- functions when OPENSSL_NO_SSL2 is defined.
- Usually openssl's header and the library (libssl) have the same
- set of functions, but on some environment the library has functions
- whose headers doesn't declare. (openssl/opensslconf.h and libssl.so
- aren't be synchronized)
- To detect such case explicitly check feature macro and remove
- related functions.
+ * parse.y (void_check): add void context checks.
-Sun May 8 18:51:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 5 12:23:42 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * file.c (rb_home_dir_of): return the default home path if the
- user name is the current user name, on platforms where struct
- pwd is not supported. a temporary measure against
- [Bug #12226].
+ * time.c (time_s_at): should copy gmt-mode.
-Sun May 8 08:51:38 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (eval_node): preserve ruby_eval_tree.
- * configure.in: add -Wsuggest-attribute=format and suppress warnings.
+Fri Apr 2 14:00:34 1999 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
-Sun May 8 08:31:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/debug.rb: wrong command interpreting.
- * configure.in: add -Wsuggest-attribute=noreturn and suppress warnings.
+Fri Apr 2 11:46:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 8 08:19:16 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * version 1.3.2
- * configure.in: add -Werror=implicit-int to avoid missing type of
- function declaration.
+Fri Apr 2 10:40:04 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat May 7 22:22:37 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * io.c (rb_io_s_pipe): forgot to define IO::pipe.
- * lib/webrick/ssl.rb: Accept string value for SSLCertName. It is used
- to invoke ssl server with command line.
- [fix GH-1329] Patch by @kerlin
- * test/webrick/test_ssl_server.rb: Added test for GH-1329
+Thu Apr 1 14:40:46 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat May 7 21:55:12 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (assign): modified for rhs change.
- * test/webrick/test_ssl_server.rb: Added basic test for `webrick/ssl`
+ * parse.y (stmt): unparenthesisized method calls can be right hand
+ side expression of the assignment.
-Sat May 7 16:22:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Mar 27 22:42:47 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * random.c (int_pair_to_real_inclusive): optimize to multiply
- without Bignum.
+ * ext/nkf/nkf.c (rb_nkf_kconv): check size output_ctr before
+ decrement.
-Sat May 7 07:58:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Mar 25 09:11:03 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * process.c (rb_exec_getargs): honor the expected argument types
- over the conversion method. the basic language functionality
- should be robust. [ruby-core:75388] [Bug #12355]
+ * time.c (time_s_at): preserve gmt-mode for result.
-Fri May 6 08:16:26 2016 David Silva <david.silva@digital.cabinet-office.gov.uk>
+ * parse.y (rb_compile_string): do not use cur_mid, use
+ compile_for_eval instead.
- * enum.c (enum_find): [DOC] add more examples to the documentation
- of Enumerable#detect, to show that it equals to Enumerable#find.
- [Fix GH-1340]
+ * st.c (PTR_NOT_EQUAL): wrong logical condition.
-Thu May 5 18:08:31 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+Wed Mar 24 13:06:43 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_complexrational.rb: Remove duplicated raise.
+ * parse.y (yycompile): should clear cur_mid after compilation.
-Thu May 5 14:41:05 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * io.c (next_argv): need to check type for ARGV.shift.
- * string.c (rb_str_sub): Fix a special match variable name.
- [ci skip]
+ * eval.c (blk_copy_prev): need to preserve outer scope as well as
+ outer frames.
-Thu May 5 12:22:17 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (rb_compile_string): return can appear within eval().
- * vm_eval.c (rb_eval_cmd, rb_catch_obj): use TH_JUMP_TAG with the
- same rb_thread_t used for TH_PUSH_TAG, instead of JUMP_TAG with
- the current thread global variable.
+Tue Mar 23 10:15:07 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Thu May 5 10:49:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * configure.in: AC_C_CONST check added.
- * random.c (fill_random_bytes_syscall): use arc4random_buf if
- available.
+Tue Mar 23 02:07:35 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed May 4 23:13:58 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * time.c (time_plus): preserve gmt-mode for result.
- * numeric.c (fix_plus): Remove rb_nucomp_add prototype
- declaration.
+Mon Mar 22 01:32:37 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (fix_mul): Remove rb_nucomp_mul prototype
- declaration.
+ * eval.c (rb_eval): adjust line numbers before expression
+ interpolation within strings.
- * internal.h (rb_nucomp_add, rb_nucomp_mul): add prototype
- declarations.
+ * eval.c (rb_eval): defined? returns nil for false condition.
-Wed May 4 18:38:00 2016 Kazuki Tsujimoto <kazuki@callcc.net>
+ * numeric.c (num_nonzero_p): returns nil for false condition.
- * lib/net/http/header.rb (Net::HTTPHeader#{each_header,each_name,
- each_capitalized_name,each_value,each_capitalized}): Return
- sized enumerators.
+Sat Mar 20 13:07:43 1999 Keiju Ishitsuka <keiju@rational.com>
- * test/net/http/test_httpheader.rb: add test for above.
+ * lib/weakref.rb: avoid leak for two weakrefs for one object.
-Wed May 4 17:53:15 2016 Kazuki Tsujimoto <kazuki@callcc.net>
+Fri Mar 19 11:26:45 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * lib/set.rb (Set#{delete_if,keep_if,collect!,reject!,select!,classify,divide},
- SortedSet#{delete_if,keep_if}): Return sized enumerators.
+ * eval.c (ruby_run): needed to eval END{} on exit.
- * test/test_set.rb: add test for above.
+ * eval.c (rb_exit): ditto.
-Tue May 3 23:25:48 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Fri Mar 19 02:17:27 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c: [DOC] Update result of 123456789 ** -2.
- [ruby-dev:49606] [Bug #12339]
+ * signal.c (Init_signal): handles terminating signals HUP, TERM,
+ QUIT, PIPE, etc.
-Tue May 3 23:13:16 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+Thu Mar 18 15:47:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (RCOMPLEX_SET_IMAG): undef RCOMPLEX_SET_IMAG
- instead of duplicated undef RCOMPLEX_SET_REAL.
+ * bignum.c (rb_big_and): bug in sign calculation.
-Tue May 3 22:55:07 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * bignum.c (rb_big_or): ditto.
- * complex.c (rb_complex_set_imag): Fix to properly set imag
- of complex.
+ * io.c (rb_f_select): forgot to use to_io to retrieve IO, after
+ calling select(2).
-Tue May 3 22:19:55 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Mar 16 19:54:31 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * configure.in (warnflags): use -std=gnu99 instead of
- -std=iso9899:1999. [Feature #12336]
+ * ext/extmk.rb.in: static linking cause infinite make loop.
-Tue May 3 22:10:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Mar 16 18:50:04 1999 Yoshida Masato <yoshidam@yoshidam.net>
- * string.c (count_utf8_lead_bytes_with_word): Use __builtin_popcount
- only if it can use SSE 4.2 POPCNT whose latency is 3 cycle.
+ * ext/socket/socket.c (tcp_s_gethostbyname): typo, not NUM2INT(),
+ but INT2NUM().
- * internal.h (rb_popcount64): use __builtin_popcountll because now
- it is in fast path.
+ * ext/socket/socket.c (mkhostent): ditto.
-Tue May 3 14:19:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 16 12:31:44 1999 Ryo HAYASAKA <hayasaka@cheer.u-aizu.ac.jp>
- * parse.y (new_if_gen): set newline flag to NODE_IF to trace all
- if/elsif statements. [ruby-core:67720] [Bug #10763]
+ * file.c (utime_internal): suppress warning by const.
-Tue May 3 05:35:54 2016 Eric Wong <e@80x24.org>
+ * time.c (time_gmtime): ditto.
- * process.c (disable_child_handler_fork_child):
- initialize handler for SIGPIPE for !POSIX_SIGNAL
+Tue Mar 16 10:23:05 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 2 23:03:42 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * time.c (time_clone): Time object can be cloned.
- * win32/win32.c, include/ruby/win32.h (rb_w32_utruncate): implements new
- truncate alternative which accepts UTF-8 path.
+Tue Mar 16 03:13:10 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * file.c (truncate): use above function.
- [Bug #12340]
+ * ruby.c (load_file): argv[argc] should be NULL.
-Mon May 2 20:59:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Mar 15 22:12:08 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * re.c (str_coderange): to avoid function call when the string already
- has coderange information.
+ * sprintf.c (rb_f_sprintf): typo in arg_num check at exit.
- * re.c (rb_reg_prepare_enc): add shortcut path when the regexp has
- the same encoding of given string.
+Mon Mar 15 16:42:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * re.c (rb_reg_prepare_re): avoid duplicated allocation of
- onig_errmsg_buffer.
+ * array.c (rb_ary_dup): dup2 should copy class too.
+Mon Mar 15 15:12:53 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
-Mon May 2 12:34:52 2016 Tanaka Akira <akr@fsij.org>
+ * lib/mkmf.rb: install program relative path check.
- * test/ruby/test_refinement.rb (test_inspect): Use Integer instead of
- Fixnum.
+Mon Mar 15 14:05:25 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 2 06:58:38 2016 Tanaka Akira <akr@fsij.org>
+ * re.c (rb_reg_s_new): 2nd argument is now option.
+ Regexp::EXTENDED can be specified.
- * complex.c: Don't refer rb_cFixnum and rb_cBignum.
- (k_fixnum_p): Use FIXNUM_P.
- (k_bignum_p): Use RB_TYPE_P.
+Fri Mar 12 10:47:49 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon May 2 01:27:59 2016 Tanaka Akira <akr@fsij.org>
+ * string.c (rb_str_index): str.index("") should always match at
+ offset point.
- * test/ruby/test_numeric.rb (test_step): Use Integer::FIXNUM_MAX.
+ * string.c (rb_str_upto): can specify end point exclusion.
-Mon May 2 01:15:01 2016 Tanaka Akira <akr@fsij.org>
+ * string.c (rb_str_index): negative offset.
- * test/ruby/test_module.rb (test_name): Use Integer instead of Fixnum.
+ * regex.c (re_match): begline should not match at the point
+ between a newline and end-of-string. endline neither.
-Mon May 2 01:00:04 2016 Tanaka Akira <akr@fsij.org>
+ * regex.c (re_compile_pattern): context_indep_anchors .
- * test/lib/test/unit/assertions.rb (assert_fixnum): Defined.
- (assert_bignum): Defined.
+ * parse.y (parse_regx): need not to push backslashes before
+ escaped characters.
- * test/ruby/test_bignum.rb: Use assert_bignum.
+ * eval.c (rb_thread_join): re-raises exception within target.
- * test/ruby/test_integer_comb.rb: Use assert_fixnum and assert_bignum.
+Fri Mar 12 01:09:36 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * test/ruby/test_optimization.rb: Ditto.
+ * ext/readline/readline.c (readline_s_vi_editing_mode): wrong
+ number of arguments.
-Mon May 2 00:41:53 2016 Tanaka Akira <akr@fsij.org>
+Fri Mar 12 02:12:50 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_trace.c (recalc_remove_ruby_vm_event_flags): Add a cast to
- avoid signed integer overflow.
+ * pack.c (PACK_ITEM_ADJUST): "a".unpack("C3") => [97, nil, nil]
-Mon May 2 00:06:04 2016 Tanaka Akira <akr@fsij.org>
+Thu Mar 11 18:23:50 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * test/lib/envutil.rb: Define Integer::{FIXNUM_MIN,FIXNUM_MAX}.
+ * ext/socket/socket.c (Init_socket): UDPsocket was omitted.
- * test/ruby/test_bignum.rb: Use Integer::{FIXNUM_MIN,FIXNUM_MAX}.
+Thu Mar 11 16:43:30 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_bignum.rb: Ditto.
+ * pack.c (PACK_LENGTH_ADJUST): push fixed number of items per
+ template to result array.
- * test/ruby/test_integer_comb.rb: Ditto.
+ * pack.c (pack_unpack): I/N/C etc. push nil in the array for "".
- * test/ruby/test_marshal.rb: Ditto.
+Tue Mar 9 00:19:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_optimization.rb: Ditto.
+ * hash.c (ruby_unsetenv): use ruby_setenv(name, 0).
-Sun May 1 23:59:59 2016 Kenta Murata <mrkn@mrkn.jp>
+ * hash.c (env_delete): ditto.
- * array.c (rb_ary_sum): fix for mathn
+ * string.c (rb_str_upto): do not check `beg<end' to generate
+ strings for the pattern like "a".upto("#a").
- * test/ruby/test_array.rb (test_sum): ditto.
+ * range.c (range_each): treat strings as special case.
-Sun May 1 23:51:54 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * range.c (range_each): no longer use upto for generic cases.
- * test/lib/test/unit.rb (Options#non_options): fixed wrong regexp.
- if both positives and negatives were specified, positives had to
- be specified from the beginning.
+Sun Mar 7 14:21:32 1999 IKARASHI Akira <ikarashi@itlb.te.noda.sut.ac.jp>
-Sun May 1 21:00:07 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * string.c (rb_str_index): wrong end point calculation.
- * win32/win32.c: drop Win2K support.
+Sat Mar 6 02:19:12 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun May 1 20:39:47 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * re.c (match_index): MatchingData#index(n) added.
- * cont.c, hash.c, random.c, win32/win32.c: cleanup some Win9x/ME/NT4
- support leftovers.
- [fix GH-1328] patched by @cremno
+ * array.c (rb_ary_subseq): ary[n..-1] returns an sub-array unless
+ n is too small negative index.
-Sun May 1 07:30:44 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * re.c (rb_reg_match_method): Regexp#match(str) added.
- * string.c (search_nonascii): use nlz on big endian environments.
+ * array.c (rb_ary_indexes): understands ranges as indexes.
- * internal.h (nlz_intptr): defined.
+ * re.c (match_size): MatchingData#size added.
-Sun May 1 00:03:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Mar 5 01:04:57 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in (__builtin_ctz): check.
+ * array.c (rb_ary_fill): modified for range.
- * configure.in (__builtin_ctzll): check.
+ * array.c (rb_ary_aset): a[n..m] revisited.
- * internal.h (rb_popcount32): defined for ntz_int32.
- it can use __builtin_popcount but this function is not used on
- GCC environment because it uses __builtin_ctz.
- When another function uses this, using __builtin_popcount
- should be re-considered.
+Thu Mar 4 14:23:29 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (rb_popcount64): ditto.
+ * string.c (rb_str_subseq): a[n..m] revisited.
- * internal.h (ntz_int32): defined for ntz_intptr.
+ * parse.y (method_call): allow Const::method{}.
- * internal.h (ntz_int64): defined for ntz_intptr.
+ * array.c (rb_ary_replace_method): should replace original array.
- * internal.h (ntz_intptr): defined as ntz for uintptr_t.
+Thu Mar 4 02:30:22 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (search_nonascii): unroll and use ntz.
+ * configure.in: remove --disable-thread, thread feature is no
+ longer optional.
-Sat Apr 30 21:54:13 2016 Tanaka Akira <akr@fsij.org>
+Thu Mar 4 00:32:17 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
- * numeric.c (Init_Numeric): Gather Fixnum method definitions.
+ * parse.y (read_escape): wrong arguments for scan_oct,scan_hex.
-Sat Apr 30 21:28:14 2016 Tanaka Akira <akr@fsij.org>
+Wed Mar 3 11:51:53 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (rb_int_div): Define Integer#/.
+ * ext/socket/socket.c (Init_socket): rename class names as
+ TCPsocket -> TCPSocket etc.
- * bignum.c (rb_big_div): Don't define Bignum#/.
+Tue Mar 2 19:46:42 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * lib/mathn.rb (Integer#/): Replace Integer#/ instead of Bignum#/.
+ * configure.in (LDSHARED): use gcc -Wl,-G for solaris with gcc.
-Sat Apr 30 21:11:08 2016 Tanaka Akira <akr@fsij.org>
+Tue Mar 2 17:04:19 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (rb_int_plus): Define Integer#+.
+ * parse.y (yylex): backslashes do not concatenate comment lines
+ anymore.
- * bignum.c (rb_big_plus): Don't define Bignum#+.
+Mon Mar 1 14:05:12 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 21:01:20 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_call0): adjust argv for optional arguments. super
+ without arguments emit superclass method with the value from
+ optional arguments. enabled as experiment.
- * numeric.c (rb_int_minus): Define Integer#-.
+Sun Feb 28 14:04:07 1999 WATANABE Hirofumi <eban@os.rim.or.jp>
- * bignum.c (rb_big_minus): Don't define Bignum#-.
+ * parse.y (nextc): backslash at the eof cause infinite loop
-Sat Apr 30 20:53:33 2016 Tanaka Akira <akr@fsij.org>
+Sun Feb 28 11:01:26 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * numeric.c (rb_int_mul): Define Integer#*.
+ * time.c (make_time_t): month range check added.
- * bignum.c (rb_big_mul): Don't define Bignum#*.
+Sat Feb 27 02:36:05 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 20:30:44 2016 Tanaka Akira <akr@fsij.org>
+ * re.c (Init_Regexp): add escape as alias of quote.
- * numeric.c (rb_int_modulo): Define Integer#%.
+ * re.c (rb_reg_s_quote): char-code can be specified now.
- * bignum.c (rb_big_modulo): Don't define Bignum#%.
+Fri Feb 26 18:45:36 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
-Sat Apr 30 20:17:08 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (error_print): bug for error message with newlines.
- * numeric.c (int_equal): Define Integer#==.
+Fri Feb 26 12:00:04 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_eq): Don't define Bignum#==.
+ * time.c (make_time_t): future check modified to allow 1969-12-31
+ at certain timezone.
-Sat Apr 30 19:41:15 2016 Tanaka Akira <akr@fsij.org>
+ * time.c (time_arg): year >= 1000 should be past.
- * numeric.c (int_gt): Define Integer#>.
+ * version.c (Init_version): constant RELEASE_DATE added.
- * bignum.c (rb_big_gt): Don't define Bignum#>.
- Renamed from big_gt.
+Fri Feb 26 01:08:30 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (rb_big_gt): Declared.
+ * string.c (rb_str_substr): returns nil for out-of-range access.
-Sat Apr 30 19:24:40 2016 Tanaka Akira <akr@fsij.org>
+ * array.c (rb_ary_subseq): returns nil for out-of-range access.
- * numeric.c (int_ge): Define Integer#>=.
+ * array.c (rb_ary_store): negative index message has changed.
- * bignum.c (rb_big_ge): Don't define Bignum#>=.
- Renamed from big_ge.
+ * string.c (rb_str_aset): reallocation needed.
- * internal.h (rb_big_ge): Declared.
+ * string.c (rb_str_aset): allow char append to the string.
-Sat Apr 30 19:20:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Thu Feb 25 23:30:17 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * doc/standard_library.rdoc: Remove obsoleted classes and modules.
+ * time.c (time_load): tm_year should be packed in 17 bits, not 18.
-Sat Apr 30 19:09:23 2016 Tanaka Akira <akr@fsij.org>
+Thu Feb 25 12:50:25 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (int_lt): Define Integer#<.
+ * missing/dup2.c: replaced by public domain version.
- * bignum.c (rb_big_lt): Don't define Bignum#<.
- Renamed from big_lt.
+ * time.c (make_time_t): add `future check' in loops.
- * internal.h (rb_big_lt): Declared.
+ * object.c (rb_num2dbl): forbid implicit conversion from nil, or
+ strings. thus `Time.now + str' should raise error.
-Sat Apr 30 18:44:05 2016 Tanaka Akira <akr@fsij.org>
+ * object.c (rb_Float): convert nil into 0.0.
- * numeric.c (int_le): Define Integer#<=.
+ * object.c (rb_Integer): conversion method improved.
- * bignum.c (rb_big_le): Don't define Bignum#<=.
- Renamed from big_le.
+Thu Feb 25 03:27:50 1999 Shugo Maeda <shugo@netlab.co.jp>
- * internal.h (rb_big_le): Declared.
+ * eval.c (rb_call): should handle T_ICLASS properly.
-Sat Apr 30 18:11:44 2016 Tanaka Akira <akr@fsij.org>
+Thu Feb 25 00:04:00 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (Init_Bignum): Define Integer::GMP_VERSION.
+ * error.c (Init_Exception): global function Exception() removed.
-Sat Apr 30 16:58:18 2016 Tanaka Akira <akr@fsij.org>
+ * variable.c (rb_class2name): returns "nil"/"true"/"false" for them.
- * numeric.c (int_remainder): Define Integer#remainder.
+ * time.c (time_dump): time marshaling format compressed size from
+ 11 bytes to 8 bytes. thanx to tadf@kt.rim.or.jp.
- * bignum.c (rb_big_remainder): Don't define Bignum#remainder.
+ * eval.c (rb_obj_call_init): should specify arguments explicitly.
- * internal.h (rb_big_remainder): Declared.
+Wed Feb 24 15:43:28 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 15:29:24 2016 Tanaka Akira <akr@fsij.org>
+ * parse.y (yylex): comment concatenation requires preceding space
+ before backslash at the end of line.
- * numeric.c (rb_int_uminus): {Fixnum,Bignum}#-@ is unified into
- Integer.
+ * io.c (rb_f_pipe): global pipe is obsolete now.
- * bignum.c (rb_big_uminus): Don't define Bignum#-@.
+ * object.c (Init_Object): remove true.to_i, false.to_i.
-Sat Apr 30 14:42:20 2016 Tanaka Akira <akr@fsij.org>
+Tue Feb 23 14:21:41 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (rb_int_idiv): {Fixnum,Bignum}#div is unified into
- Integer.
+ * parse.y (yylex): warn if identifier! immediately followed by `='.
- * bignum.c (rb_big_idiv): Don't define Bignum#div.
+Tue Feb 23 12:32:41 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Sat Apr 30 14:25:55 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (rb_load): tilde expansion moved to find_file.
- * numeric.c (rb_int_modulo): {Fixnum,Bignum}#modulo is unified into
- Integer.
+ * eval.c (find_file): tilde expansion added.
- * bignum.c (rb_big_modulo): Don't define Bignum#modulo.
+Tue Feb 23 10:50:20 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 14:04:30 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (require_method): require can handle multiple fnames.
- * numeric.c (int_divmod): {Fixnum,Bignum}#divmod is unified into
- Integer.
+ * hash.c (rb_hash_foreach_iter): hash key may be nil.
- * bignum.c (rb_big_divmod): Don't define Bignum#divmod.
+Mon Feb 22 17:44:02 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 13:20:00 2016 Tanaka Akira <akr@fsij.org>
+ * regex.c (re_match): should not pop failure point on success for
+ non-greedy matches.
- * numeric.c (int_fdiv): {Fixnum,Bignum}#fdiv is unified into
- Integer.
+ * io.c (Init_IO): remove global_functions getc, readchar, ungetc,
+ seek, tell, rewind.
- * bignum.c (rb_big_fdiv): Don't define Bignum#fdiv.
+Sat Feb 20 22:54:26 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 12:25:43 2016 Tanaka Akira <akr@fsij.org>
+ * numeric.c (rb_num2long): no implicit conversion from boolean.
- * numeric.c (rb_int_pow): {Fixnum,Bignum}#** is unified into
- Integer.
+Sat Feb 20 09:58:42 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * bignum.c (rb_big_pow): Don't define Bignum#**.
+ * numeric.c (flo_to_s): portable Infinity and NaN support.
-Sat Apr 30 12:28:59 2016 Tanaka Akira <akr@fsij.org>
+Sat Feb 20 07:13:31 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * bignum.c (rb_big_comp): Renamed from rb_big_neg.
+ * io.c (rb_file_sysopen): forgot to initialize a local variable.
- * numeric.c (fix_comp): Renamed from fix_rev.
+Fri Feb 19 23:05:07 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 30 12:25:43 2016 Tanaka Akira <akr@fsij.org>
+ * string.c (rb_str_subseq): range check changed.
- * numeric.c (int_comp): {Fixnum,Bignum}#~ is unified into
- Integer.
+ * marshal.c: increment MARSHAL_MINOR for Time format change.
- * bignum.c (rb_big_neg): Don't define Bignum#~.
+ * time.c (time_old_load): support old marshal format.
- * internal.h (rb_big_neg): Declared.
+ * time.c (time_load): changed for new format Y/M/D/h/m/s/usec.
-Sat Apr 30 12:07:42 2016 Tanaka Akira <akr@fsij.org>
+ * time.c (time_dump): marshal dump format has changed.
- * numeric.c (int_and): {Fixnum,Bignum}#& is unified into
- Integer.
+Fri Feb 19 00:25:57 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_and): Don't define Bignum#&.
+ * time.c (time_arg): should reject "sep\0" and such.
-Sat Apr 30 11:56:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (time_plus): Time#+ should not receive Time object
+ operand.
- * ext/thread: removed dummy extension library. thread_sync.c
- provides "thread.rb" already.
+ * string.c (rb_str_substr): negative length raises exception now.
-Sat Apr 30 11:53:48 2016 Tanaka Akira <akr@fsij.org>
+ * array.c (beg_len): if end == -1, it points end of the array.
- * numeric.c (int_or): {Fixnum,Bignum}#| is unified into
- Integer.
+ * array.c (rb_ary_subseq): negative length raises exception now.
- * bignum.c (rb_big_or): Don't define Bignum#|.
+Thu Feb 18 20:57:04 1999 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Sat Apr 30 11:18:47 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * time.c (rb_strftime): strftime() may return 0 on success too.
- * vm_trace.c: Fix typos. [ci skip]
+ * time.c (time_strftime): `\0' within format string should not be
+ omitted in the result.
-Sat Apr 30 10:09:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (rb_strftime): zero length format.
- * ext/pty/pty.c (establishShell): honor USER environment variable
- and login name over uid, one uid can be shared by some login
- names.
+ * time.c (time_to_a): yday start with 1 now.
-Fri Apr 29 22:40:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * time.c (time_zone): support for long timezone name.
- * doc/maintainers.rdoc (ext/io/nonblock): still maintained, as
- well as ext/io/wait, which is the origin.
+ * time.c (time_yday): yday start with 1 now.
-Fri Apr 29 21:18:12 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * time.c (time_minus): minus calculation was wrong.
- * doc/maintainers.rdoc (ext/win32): of course, it's still maintained.
+ * time.c (time_minus): sec, usec should be at least `long', maybe
+ they should be `time_t'.
-Fri Apr 29 21:03:10 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * time.c (time_plus): addition with float was wrong.
- * gems/bundled_gems: Update latest gems, test-unit-3.1.8 and rake-11.1.2.
+ * time.c (time_to_s): support for long timezone name.
-Fri Apr 29 20:43:02 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * time.c (time_gm_or_local): too far future check moved.
- * doc/maintainers.rdoc: Update latest maintainers list on Ruby 2.4
+ * time.c (time_arg): treat 2 digit year as 69-99 => 1969-1999,
+ 00-68 => 2000-2068
-Fri Apr 29 19:52:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Thu Feb 18 03:56:47 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * doc/maintainers.rdoc: Removed deprecated entries. These are already deleted.
+ * missing/fnmatch.c: moved to missing directory.
-Fri Apr 29 19:48:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Feb 17 16:22:26 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * doc/maintainers.rdoc: Removed Ruby 1.8 entries. It's not necessary to
- Ruby 2.4 or later.
+ * struct.c (rb_struct_alloc): actual initialization now be done in
+ `initialize'.
-Thu Apr 28 17:03:17 2016 Nicholas Maccharoli <nmaccharoli@gmail.com>
+Wed Feb 17 09:47:15 1999 okabe katsuyuki <hgc02147@nifty.ne.jp>
- * hash.c (rb_hash_update_{block,func}_callback): dry up hash
- update callback code. [Fix GH-1338]
+ * regex.c (re_search): use mbclen() instead of ismbchar().
-Thu Apr 28 16:52:05 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * re.c (rb_reg_s_quote): should handle mbchars properly.
- * re.c (rb_reg_prepare_enc): use rb_enc_asciicompat(enc) instead of
- rb_enc_str_asciicompat_p(str) to avoid useless rb_enc_get(str) call.
+Wed Feb 17 01:25:26 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Apr 28 16:33:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yylex): stop comment concatenation by backslash follows
+ after >= 0x80 char. may cause problem with Latin chars.
- * lib/optparse.rb: [DOC] fix example code. base on the code by
- Semyon Gaivoronskiy in [ruby-core:75224]. [Bug #12323]
+ * eval.c (error_print): exception in rb_obj_as_string() caused
+ SEGV. protect it by PUSH_TAG/POP_TAG.
-Thu Apr 28 09:33:03 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * error.c (exc_exception): `Exception#exception' should return self.
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.4.
- Please see entries of 2.6.4 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
+Wed Feb 17 01:12:22 1999 Hirotaka Ichikawa <hirotaka.ichikawa@tosmec.toshiba.co.jp>
-Thu Apr 28 04:49:07 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * configure.in: BeOS patch.
- * configure.in (rb_cv_lgamma_r_pm0): check if lgamma_r(+0.0)
- returns positive infinity, in addition to lgamma_r(-0.0).
- AIX returns an incorrect result of negative infinity.
+Tue Feb 16 14:25:00 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * math.c (ruby_lgamma_r): handle +0.0, in addition to -0.0.
+ * regex.c (re_compile_pattern): should reallocate mbc space for
+ character class unless current_mbctype is ASCII.
-Thu Apr 28 01:11:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Feb 15 15:48:30 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * time.c: define _DEFAULT_SOURCE because glibc 2.20 deprecates
- _BSD_SOURCE.
- https://sourceware.org/glibc/wiki/Release/2.20
+ * configure.in: specify `-Wl,-E' only for GNU ld.
-Thu Apr 28 00:27:55 2016 Tanaka Akira <akr@fsij.org>
+Mon Feb 15 11:43:22 1999 GOTO Kentaro <gotoken@math.sci.hokudai.ac.jp>
- * numeric.c (int_xor): {Fixnum,Bignum}#^ is unified into
- Integer.
+ * array.c (rb_inspecting_p): should return Qfalse.
- * bignum.c (rb_big_xor): Don't define Bignum#^.
+Sun Feb 14 22:36:40 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Wed Apr 27 20:53:59 2016 Tanaka Akira <akr@fsij.org>
+ * sprintf.c (rb_f_sprintf): `%G' was omitted.
- * numeric.c (int_aref): {Fixnum,Bignum}#[] is unified into
- Integer.
+Sun Feb 14 12:47:48 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * bignum.c (rb_big_aref): Don't define Bignum#<<.
+ * numeric.c (Init_Numeric): allow divide by zero on FreeBSD.
- * internal.h (rb_big_aref): Declared.
+ * numeric.c (Init_Numeric): FloatDomainError added.
-Wed Apr 27 16:10:35 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * configure.in (AC_REPLACE_FUNCS): add checks for functions
+ isinf, isnan, and finite.
- * tool/instruction.rb: fix to follow current implementation.
+Sat Feb 13 01:24:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Apr 27 15:47:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_thread_create_0): should protect th->thread.
- * ext/stringio/stringio.c (strio_s_new): warn if a block is given,
- as well as IO.new.
+Fri Feb 12 16:16:47 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
-Wed Apr 27 14:29:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_inspect): wrong mbc position.
- * error.c (ruby_only_for_internal_use): raise fatal error when
- deprecated function only for internal use is called, not just a
- warning.
+Fri Feb 12 16:21:17 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Apr 26 23:42:30 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * eval.c (rb_thread_fd_close):
- * tool/redmine-backporter.rb (rel): should not raise exceptions even if
- the user input is wrong. only reports the error and continue process.
+ * io.c (rb_io_fptr_close): tell scheduler that fd is closed.
-Tue Apr 26 23:35:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_io_reopen): ditto.
- * ruby.c (process_options): convert -e script to the encoding
- given by a command line option on Windows. assume it is the
- expected encoding. [ruby-dev:49461] [Bug #11900]
+ * io.c (READ_CHECK): check if closed after thread context switch.
-Tue Apr 26 21:11:02 2016 Tanaka Akira <akr@fsij.org>
+ * ext/socket/socket.c (bsock_close_read): do not check
+ the return value from shutdown(2).
- * numeric.c (rb_int_lshift): {Fixnum,Bignum}#<< is unified into
- Integer.
+ * ext/socket/socket.c (bsock_close_write): ditto.
- * bignum.c (rb_big_lshift): Don't define Bignum#<<.
+ * ext/socket/socket.c (sock_new): need to dup(fd) for close_read
+ and close_write.
-Tue Apr 26 20:59:40 2016 Tanaka Akira <akr@fsij.org>
+ * parse.y (here_document): handle newlines within #{}.
- * numeric.c (rb_int_rshift): {Fixnum,Bignum}#>> is unified into
- Integer.
+ * regex.h: should replace symbols for ruby.
- * bignum.c (rb_big_rshift): Don't define Bignum#>>.
+Fri Feb 12 00:46:28 1999 Shugo Maeda <shugo@netlab.co.jp>
-Tue Apr 26 20:46:16 2016 Tanaka Akira <akr@fsij.org>
+ * marshal.c (r_object): should update the method name in message.
- * numeric.c (int_size): {Fixnum,Bignum}#size is unified into Integer.
+ * marshal.c (w_object): limit should be converted into Fixnum.
- * bignum.c (rb_big_size_m): Don't define Bignum#size.
+Wed Feb 10 15:20:03 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (rb_big_size_m): Declared.
+ * regex.c (re_match): empty pattern should not cause infinite
+ pattern match loop.
-Tue Apr 26 20:09:08 2016 Tanaka Akira <akr@fsij.org>
+ * regex.c (re_compile_pattern): RE_OPTIMIZE_ANCHOR for /.*/, not
+ for /(.|\n)/.
- * numeric.c (rb_int_bit_length): {Fixnum,Bignum}#bit_length is
- unified into Integer.
+ * numeric.c (fix_pow): `fixnum**nil' should raise TypeError.
- * bignum.c (rb_big_bit_length): Don't define Bignum#bit_length.
+ * bignum.c (rb_big_pow): need to normalize results.
- * internal.h (rb_big_bit_length): Declared.
+Wed Feb 10 01:42:41 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Tue Apr 26 19:56:16 2016 Tanaka Akira <akr@fsij.org>
+ * numeric.c (fix_pow): `(5**1).type' should be Integer.
- * numeric.c (int_abs): Integer#{abs,magnitude} moved from
- Fixnum and Bignum.
+Tue Feb 9 01:22:49 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_abs): Don't define Bignum#{abs,magnitude}.
+ * parse.y (yylex): do not ignore newlines in mbchars.
- * internal.h (rb_big_abs): Declared.
+ * io.c (rb_file_s_open): mode can be specified by flags like
+ open(2), e.g. File::open(path, File::CREAT|File::WRONLY).
-Mon Apr 25 14:39:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (rb_f_open): bit-wise mode flags for pipes
- * ext/rbconfig/sizeof/extconf.rb: just check the existence of each
- types, to reduce configuration time, especially cross-compiling.
+ * io.c (Init_IO): bit flags for open.
- * template/sizes.c.tmpl: calculate sizes of checked types at
- compilation time.
+Sat Feb 6 22:56:21 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Apr 25 11:27:27 2016 Marcus Stollsteimer <sto.mar@web.de>
+ * string.c (rb_str_sub_bang): should not overwrite match data by
+ regexp match within the block.
- * doc/extension.rdoc: Improvements to english grammars.
- [Bug #12246][ruby-core:74792][ci skip]
+ * string.c (rb_str_gsub_bang): ditto.
-Mon Apr 25 11:17:50 2016 Marcus Stollsteimer <sto.mar@web.de>
+Sat Feb 6 03:06:17 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * encoding.c: Fix return value of `Encoding::ISO8859_1.name`
- [Bug #12313][ruby-core:75147][ci skip]
- * ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
+ * re.c (match_getter): accessing $~ without matching caused SEGV.
-Sun Apr 24 23:29:16 2016 Rei Odaira <Rei.Odaira@gmail.com>
+Fri Feb 5 22:11:08 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * configure.in: add missing -lm for AIX.
+ * parse.y (yylex): binary literal support, like 0b01001.
-Sun Apr 24 18:33:58 2016 Kazuki Tsujimoto <kazuki@callcc.net>
+ * parse.y (yylex): octal numbers can contain `_'s.
- * vm_insnhelper.c (INLINE): disable r54738 if __NO_INLINE__ is defined.
- It caused "undefined reference to `vm_getivar'".
+ * parse.y (yylex): warns if non-octal number follows immediately
+ after octal literal.
-Sun Apr 24 09:32:12 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * parse.y (yylex): now need at least one digit after prefix such
+ as 0x, or 0b.
- * test/ruby/test_array.rb: Add test cases for Array#sum with
- non-numeric objects.
+ * bignum.c (rb_str2inum): recognize binary numbers like 0b0101.
-Sun Apr 24 04:21:27 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Feb 5 03:26:56 1999 Yasuhiro Fukuma <yasuf@big.or.jp>
- * vm_insnhelper.c (INLINE): define as `inline` when it is optimized.
- define as `static inline` when it is not optimized to keep
- the symbol generated.
+ * ruby.c (proc_options): -e without program prints error.
- * vm_insnhelper.c (vm_getivar): use `INLINE` to force inline
- so that a compiler inlines it into vm_getinstancevariable
- and optimizes out is_attr and related branches.
+Fri Feb 5 00:01:50 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * vm_insnhelper.c (vm_getivar): use `inline` to recommend inline.
- Without this vm1_ivar_set is degraded.
+ * parse.y (terms): needed to clear heredoc_end.
- benchmark results:
- minimum results in each 5 measurements.
- Execution time (sec)
- name ruby 2.4.0dev (2016-04-23 trunk 54727) [x86_64-linux] ruby 2.4.0dev (2016-04-23 trunk 54733) [x86_64-linux] built-ruby
- loop_whileloop 0.641 0.642 0.646
- vm1_ivar* 1.002 0.999 0.831
- vm1_ivar_set* 0.369 1.106 0.362
+ * numeric.c (flo_div): allow float division by zero.
- Speedup ratio: compare with the result of `ruby 2.4.0dev (2016-04-23
- trunk 54727) [x86_64-linux]' (greater is better)
- name ruby 2.4.0dev (2016-04-23 trunk 54733) [x86_64-linux]
- built-ruby
- loop_whileloop
- 0.998 0.991
- vm1_ivar*
- 1.003 1.205
- vm1_ivar_set*
- 0.334 1.018
+Thu Feb 4 11:56:24 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 23 18:01:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * missing/strtod.c: for compatibility.
- * vm_insnhelper.c (vm_getivar): specify inline instead of static inline.
- vm_getivar is called by vm_call_ivar and vm_getinstancevariable.
- At least with GCC 4.8 and 5.3 on Linux, they are inlining it into
- vm_call_ivar but not vm_getinstancevariable.
- By `inline`, they correctly inline it and gains performance.
+ * configure.in (strtod): add strtod compatible check.
- Speedup ratio: compare with the result of `ruby 2.4.0dev (2016-04-23
- trunk 54727) [x86_64-linux]' (greater is better)
- name built-ruby
- loop_whileloop 1.001
- vm1_ivar* 1.189
- vm1_ivar_set* 1.024
+ * numeric.c (rb_num2long): missing/vsnprintf.c does not support
+ floating points.
- Note the `inline`'s meaning is different between old GCC
- and C99. Old GCC's inline means C99's extern inline.
- https://gcc.gnu.org/onlinedocs/gcc/Inline.html
- Since Ruby specify -std=iso9899:1999, it works like C99.
+ * numeric.c (flo_to_s): ditto.
-Sat Apr 23 16:11:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Feb 3 23:02:12 1999 Yoshida Masato <yoshidam@yoshidam.net>
- * include/ruby/ruby.h (rb_mul_size_overflow): use UNLIKELY
- by user side to improve generality.
+ * regex.c (re_compile_pattern): use ismbchar() to get next char.
-Sat Apr 23 16:10:02 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (re_search): wrong mbchar shift.
- * include/ruby/ruby.h (RB_LIKELY): use prefix in ruby.h.
+ * re.c (rb_reg_search): needed to reset $KCODE after match.
- * intern.h (LIKELY): define with RB_LIKELY.
+ * regex.c (re_compile_fastmap): mbchars should match with \w.
-Sat Apr 23 13:27:25 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+Wed Feb 3 22:35:12 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * NEWS: Add descriptions for Time#to_time updates.
- [Bug #12271]
+ * parse.y (yylex): too big float raise warning, not error.
-Sat Apr 23 13:21:24 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+Tue Feb 2 23:41:42 1999 Yoshida Masato <yoshidam@yoshidam.net>
- * NEWS: Add descriptions for DateTime#to_time updates.
- [Bug #12189]
+ * regex.c (re_match): wrong boundary.
-Sat Apr 23 11:21:27 2016 Marcus Stollsteimer <sto.mar@web.de>
+ * regex.c (IS_A_LETTER): re_mbctab[c] may not be 1 for mbc.
- * ext/date/date_core.c (Init_date_core): [DOC] Convert DateTime
- documentation to RDoc from Markdown.
- [ruby-core:75136] [Bug #12311]
+ * regex.c (re_search): mbchar support for shifting ranges.
-Sat Apr 23 09:03:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (MBC2WC): wrong conversion.
- * ruby.c: cygwin does not use w32_cmdvector, command line can be
- other than UTF-8. [ruby-dev:49519] [Bug #12184]
+Wed Feb 3 15:03:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Apr 23 01:00:03 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * parse.y (parse_regx): need to escape parens if terminators are
+ not any kind of parenthesis.
- * configure.in: don't use the system-provided round(3) on AIX.
- In AIX, round(0.49999999999999994) returns 1.0.
- Use round() in numeric.c instead.
+ * parse.y (parse_qstring): ditto.
-Fri Apr 22 21:00:44 2016 Tanaka Akira <akr@fsij.org>
+ * parse.y (parse_string): ditto.
- * test/ruby/test_time_tz.rb: Tests depends on Europe/Moscow removed
- to avoid test failures due to the tzdata change.
- https://github.com/eggert/tz/commit/8ee11a301cf173afb0c76e0315b9f9ec8ebb9d95
- Found by naruse.
+Tue Feb 2 17:11:26 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
-Fri Apr 22 20:18:40 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (rb_str_gsub_bang): too small realloc condition.
- * include/ruby/ruby.h (rb_mul_size_overflow): added to handle
- mul overflow efficiently.
+Mon Feb 1 10:01:17 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * include/ruby/ruby.h (rb_alloc_tmp_buffer2): use rb_mul_size_overflow
- and avoid division where it can define DSIZE_T.
+ * parse.y (yylex): range check for the float literal.
- * gc.c (xmalloc2_size): moved from ruby.h and use rb_mul_size_overflow.
+Sat Jan 30 18:34:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 22 20:34:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (usage): -h option to show brief command description.
- * time.c (time_asctime): [DOC] add ctime example, not only
- asctime. [ruby-core:75126] [Bug #12310]
+Sat Jan 30 08:45:16 1999 IKARASHI Akira <ikarashi@itlb.te.noda.sut.ac.jp>
-Fri Apr 22 18:44:32 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/cgi-lib.rb: cookie support added.
- * variable.c: use uint32_t instead of long to avoid confusion about
- the type of ivtbl->numiv.
+Sat Jan 30 13:38:24 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 22 15:09:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_compile_pattern): mbchars should match with \w
+ within character class. Was matching with \W.
- * eval_jump.c (exec_end_procs_chain): restore previous error info
- for each end procs. [ruby-core:75038] [Bug #12302]
+ * regex.c (re_match): \w should match with multi byte characters,
+ not its first byte.
-Fri Apr 22 15:04:56 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Sat Jan 30 10:06:41 1999 Yoshida Masato <yoshidam@yoshidam.net>
- * tool/redmine-backporter.rb: the fullpath of merger.rb is too long to
- copy&paste on Windows. show shorter name instead on the platform.
- I'm sure that the user of this command on Windows is only me.
+ * re.c (rb_reg_s_new): UTF-8 flag handle (/u, /U).
-Fri Apr 22 14:52:04 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * re.c (rb_kcode): $KCODE handle for UTF-8.
- * tool/merger.rb: remove temporary file.
+Sat Jan 30 01:51:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 22 11:27:03 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * array.c (rb_ary_delete_if): RTEST() missing.
- * lib/net/http.rb: Improve documentation for SSL requests via GET method.
- [fix GH-1325][ci skip] Patch by @jsyeo
+ * hash.c (delete_if_i): ditto.
-Fri Apr 22 10:51:13 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * enum.c (Init_Enumerable): select (=find_all), detect (=find)
+ added as aliases.
- * lib/webrick/ssl.rb: Support to add SSLCiphers option.
- [fix GH-1321] Patch by @rhadoo
+Fri Jan 29 21:32:19 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
-Fri Apr 22 10:43:19 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * hash.c (rb_f_setenv): SEGV caused by small typo.
- * file.c, win32/file.c: Removed obsoleted safe level checks.
- [fix GH-1327] Patch by @cremno
+Fri Jan 29 00:15:58 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 22 10:01:48 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * lib/parsedate.rb (parsedate): support date format like
+ 23-Feb-93, which is required by HTTP/1.1.
- * benchmark/bm_so_meteor_contest.rb: fix a typo.
- [fix GH-1330][ci skip] Patch by @sachin21
+ * variable.c (find_class_path): avoid calling rb_iv_set().
-Fri Apr 22 04:57:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (backtrace): do not need to modify $SAFE internally.
- * gc.c (rb_alloc_tmp_buffer_with_count): added like xmalloc2 to
- avoid duplicated check of size.
+ * variable.c (classname): inline __classid__ access.
- * gc.c (ruby_xmalloc2): added to keep separate layers.
+ * eval.c (THREAD_ALLOC): needed to initialize wrapper.
- * include/ruby/ruby.h (rb_alloc_tmp_buffer2): added to check
- the size more statically.
+ * lib/ftools.rb (makedirs): allows slash at the end of the path.
-Fri Apr 22 04:54:40 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * numeric.c (rb_fix_induced_from): ensure result to be Fixnum.
- * include/ruby/ruby.h (LIKELY): moved from internal.h.
+Thu Jan 28 17:31:43 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/ruby.h (UNLIKELY): ditto.
+ * numeric.c (flo_to_s): float format changed to "%16.10g".
-Thu Apr 21 01:44:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Jan 28 02:13:11 1999 Yoshinori Toki <toki@freedom.ne.jp>
- * gc.c (objspace_malloc_prepare): remove size check because it is
- used by objspace_xmalloc and objspace_xcalloc.
- objspace_xmalloc introduces its own check in this commit.
- objspace_xcalloc checks with xmalloc2_size (ruby_xmalloc2_size).
+ * array.c (rb_ary_store): expand allocated buffer by 3/2.
- * gc.c (objspace_xmalloc0): common xmalloc function.
+Wed Jan 27 17:50:02 1999 Kazuhiro HIWADA <hiwada@kuee.kyoto-u.ac.jp>
- * gc.c (objspace_xmalloc): introduce its own size check.
+ * bignum.c (dbl2big): raised error if double is too big to cast
+ into long. check added.
- * gc.c (objspace_xmalloc2): separated from ruby_xmalloc2 to clarify
- the layer who has the responsibility to check the size.
+Wed Jan 27 03:16:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (objspace_xrealloc): remove duplicated size check.
+ * variable.c (rb_mod_const_at): can't list constants of the
+ untainted objects in safe mode.
- * gc.c (ruby_xmalloc2): use objspace_xmalloc2.
+ * class.c (method_list): can't list methods of untainted objects
+ in safe mode.
- * include/ruby/ruby.h (ruby_xmalloc2_size): follow the size limit
- as SSIZE_MAX. Note that ISO C says size_t is unsigned integer.
+Tue Jan 26 02:40:41 1999 GOTO Kentaro <gotoken@math.sci.hokudai.ac.jp>
-Thu Apr 21 12:14:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * prec.c: Precision support for numbers.
- * configure.in: check if succeeded in creating config.h.
+Thu Jan 21 19:08:14 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * tool/ifchange: ignore failures when TEST_COLORS unmatched. just
- use the default value if expected name is not contained in it.
- [ruby-core:75046] [Bug #12303]
+ * eval.c (rb_f_raise): calls `exception' method, not `new'.
-Wed Apr 20 17:33:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (exc_exception): renamed from `new'.
- * ext/cgi/escape/escape.c (cgiesc_unescape): define unescape
- method instead of _unescape, and should pass the optional
- argument to the super method.
+Wed Jan 20 03:39:48 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/cgi/util.rb (CGI::Util#_unescape): remove intermediate
- method.
+ * parse.y (yycompile): rb_in_compile renamed to ruby_in_compile.
-Wed Apr 20 15:52:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (load_file): define DATA if __END__ appeared in script.
- * error.c (syntax_error_initialize): move the default message,
- "compile error", from parse.y. the default parameter should
- belong to the class definition.
+Tue Jan 19 14:57:51 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (yycompile0): use the default parameter.
+ * parse.y (here_document): need to protect lex_lastline.
-Wed Apr 20 10:25:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yylex): disable %//, %'', %``.
- * compile.c (append_compile_error): use rb_syntax_error_append.
+Tue Jan 19 05:01:16 1999 Koji Arai <JCA02266@nifty.ne.jp>
- * error.c (rb_syntax_error_append): append messages into a
- SyntaxError exception instance.
+ * array.c (beg_len): round range value too much.
- * parse.y (yycompile0): make new SyntaxError instance in main
- mode, otherwise error_buffer should be a SyntaxError if error
- has occurred.
+Mon Jan 18 13:02:27 1999 Kuroda Jun <jkuro@dwe.co.jp>
-Tue Apr 19 17:42:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (env_keys): strchr() may return NULL.
- * error.c (err_vcatf): rename, and separate appending message from
- creating a string buffer.
+Mon Jan 18 17:51:47 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * error.c (rb_syntax_error_append): merge rb_error_vsprintf and
- rb_compile_err_append.
+ * instruby.rb (wdir): install libruby.a in archdir.
- * parse.y (parser_compile_error): use rb_syntax_error_append.
+ * lib/ftools.rb (install): removes file before installing.
-Tue Apr 19 13:46:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Jan 18 16:55:31 1999 MAEDA shugo <shugo@aianet.ne.jp>
- * compile.c (append_compile_error, compile_bug): pass iseq and get
- error info and file from it, not by the thread error info.
+ * eval.c (rb_callcc): experimental continuation support.
- * error.c (rb_report_bug_valist): take va_list instead of variadic
- arguments, and just report the bug but not abort.
+Sun Jan 17 19:45:37 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Tue Apr 19 13:18:12 2016 Naotoshi Seo <sonots@gmail.com>
+ * pack.c (pack_pack): nil packing caused SEGV.
- * lib/time.rb: revert r54167 because it would break
- backward compatibilities, and it is documented that
- Time.parse does not take into account time zone
- abbreations other than ones described in RFC 822
+Sat Jan 16 13:18:03 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Apr 19 13:12:03 2016 Naotoshi Seo <sonots@gmail.com>
+ * string.c (rb_str_concat): character (fixnum) can be append to
+ strings
- * ChangeLog: Fix dates of previous commits
+ * array.c (rb_ary_unshift): unshift returns array.
-Tue Apr 19 12:45:03 2016 Naotoshi Seo <sonots@gmail.com>
+Sat Jan 16 01:39:19 1999 Yoshida Masato <yoshidam@tau.bekkoame.ne.jp>
- * ChangeLog: Add descriptions for logger updates
- * NEWS: Add descriptions for logger updates
+ * string.c (rb_str_split_method): UTF-8 support.
-Tue Apr 19 12:45:02 2016 Naotoshi Seo <sonots@gmail.com>
+ * regex.c: UTF-8 support.
- * lib/logger.rb: Add shift_period_suffix option
+Thu Jan 14 00:42:55 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Apr 19 12:45:01 2016 Naotoshi Seo <sonots@gmail.com>
+ * string.c (rb_str_gsub_bang): forget to add offset for null match.
- * lib/logger.rb: Allow specifying logger parameters in constructor
- such as level, progname, datetime_format, formatter.
+ * eval.c (rb_thread_local_aset): can't modify in tainted mode.
-Mon Apr 18 16:07:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (env_each_key): avoid generating temporary array.
- * compile.c (iseq_peephole_optimize): should not replace the
- current target INSN, not to follow the replaced dangling link in
- the caller. [ruby-core:74993] [Bug #11816]
+Wed Jan 13 23:58:50 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Apr 18 12:56:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_f_setenv): name and value can be tainted.
- * numeric.c (flo_truncate): add an optional parameter, digits, as
- well as Float#round. [Feature #12245]
+Wed Jan 6 02:42:08 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (int_truncate): add an optional parameter, digits, as
- well as Integer#round. [Feature #12245]
+ * bignum.c (Init_Bignum): forgot to define Bignum#===.
-Sun Apr 17 04:18:56 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * gc.c (gc_sweep): if add_heap() is called during GC, objects on
+ allocated heap page(s) are not marked, should not be recycled.
- * tool/redmine-backporter.rb: revisions are strings.
+ * gc.c (gc_sweep): should refer latest freelist.
-Sat Apr 16 14:26:49 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * gc.c (id2ref): modified to support performance patch.
- * ext/date/date_core.c : remove not used f_getlocal macro.
- After r54553 f_getlocal macro is not used.
+ * object.c (rb_obj_id): performance patch (no bignum for id).
-Sat Apr 16 14:15:24 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+Tue Jan 5 01:56:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/date/date_core.c : remove not used f_utc6 macro.
- After r54169 f_utc6 macro is not used.
+ * config.guess: merge up-to-date from autoconf 2.12.
-Sat Apr 16 10:00:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_join): avoid calling rb_protect_inspect() till
+ it is really needed.
- * struct.c (struct_make_members_list, rb_struct_s_def): member
- names should be unique. [ruby-core:74971] [Bug #12291]
+ * object.c (rb_obj_inspect): show detailed information for the
+ instance variables (infinite loop can avoid now).
- * struct.c (struct_make_members_list): extract making member name
- list from char* va_list, with creating symbols without
- intermediate IDs.
+ * struct.c (rb_struct_inspect): avoid infinite loop.
-Sat Apr 16 01:33:27 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+Sun Jan 3 01:37:58 1999 Takao KAWAMURA <kawamura@ike.tottori-u.ac.jp>
- * tool/redmine-backporter.rb: sort revisions.
+ * misc/ruby-mode.el (ruby-end-of-defun): moved too much.
-Sat Apr 16 01:16:02 2016 Tanaka Akira <akr@fsij.org>
+ * misc/ruby-mode.el (ruby-mode-variables): set paragraph-separator
+ for the mode.
- * array.c (rb_ary_sum): Don't yield same element twice.
- Found by nagachika.
+ * misc/ruby-mode.el: proper font-lock for `def' and `nil' etc.
-Sat Apr 16 01:03:32 2016 Tanaka Akira <akr@fsij.org>
+Sat Jan 2 17:09:06 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
- * array.c (rb_ary_sum): Fix SEGV by [1/2r, 1].sum.
+ * eval.c (rb_jump_tag): new api to invoke JUMP_TAG. tag values
+ can obtained from rb_eval_string_protect()/rb_load_protect().
-Fri Apr 15 23:52:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (rb_rescue): now catches all exceptions but SystemExit.
- * rational.c (rb_rational_plus): rename from rb_rational_add
- to be aligned with rb_fix_plus.
+ * eval.c (rb_eval_string_protect): eval string with protection.
- * array.c (rb_ary_sum): ditto.
+ * eval.c (rb_load_protect): load file with protection.
- * internal.h: ditto.
+ * io.c (rb_io_puts): avoid infinite loop for cyclic arrays.
-Fri Apr 15 23:42:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (rb_thread_local_aref): thread local hash tables.
- * rational.c (rb_rational_add): rename from nurat_add.
+ * object.c (rb_equal): check exact equal before calling `=='.
- * array.c (rb_ary_sum): use rb_rational_add directly.
+Thu Dec 31 22:28:53 1998 MAEDA shugo <shugo@aianet.ne.jp>
- * test/ruby/test_array.rb (test_sum): add assertions for an array of
- Rational values.
+ * eval.c (rb_f_require): feature names should be provided with
+ DLEXT extension.
-Fri Apr 15 22:31:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * marshal.c (Init_marshal): need to provide `marshal.so'.
- * array.c (rb_ary_sum): apply the precision compensated algorithm
- for an array in which Rational and Float values are mixed.
+Wed Dec 30 02:29:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_array.rb (test_sum): add assertions for the above
- change.
+ * variable.c (classname): do not call rb_ivar_set().
-Fri Apr 15 22:30:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (ruby_run): finalizers were called too early.
- * thread.c (rb_thread_setname): defer setting native thread name
- set in initialize until the native thread is created.
- [ruby-core:74963] [Bug #12290]
+Fri Dec 25 12:19:30 1998 Fukuda Masaki <fukuda@wni.co.jp>
-Fri Apr 15 20:27:16 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * gc.c (rb_gc_mark): should not return on FL_EXIVAR.
- * lib/irb/ext/save-history.rb: Fix NoMethodError when method is not defined.
+Fri Dec 25 11:56:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 15 15:38:58 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * gc.c (gc_mark): proper scanning for temporary region.
- * common.mk (benchmark): order options for built-ruby and compare-ruby.
+ * eval.c (TMP_ALLOC): protection for C_ALLOCA was broken.
-Fri Apr 15 14:14:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Thu Dec 24 18:26:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_array.rb (test_sum): add assertions for Rational and
- Complex numbers.
+ * development version 1.3 released.
-Fri Apr 15 10:07:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 24 00:17:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/io/console/console.c (console_key_pressed_p): raise the same
- exception, "unknown virtual key code", for names with nul chars.
- though console_win32_vk() considers the length and can deal with
- nul chars, rb_sprintf() raised at PRIsVALUE previously, so quote
- it if it is unprintable.
+ * eval.c (rb_load): top self should be set properly.
-Fri Apr 15 09:02:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (classname): check __classpath__ if it is defined.
- * ext/io/console/console.c (rb_sym2str): fallback definition for
- older ruby. [ruby-core:74953] [Bug #12284]
+ * variable.c (classname): invalid warning at -v with static linked
+ ruby interpreter.
-Thu Apr 14 21:46:36 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (is_defined): modified for expr::Const support.
- * array.c (rb_ary_sum): Support the optional argument, init, and
- block.
+ * eval.c (rb_eval): invoke method expr::Const if expr is not class
+ nor module.
-Thu Apr 14 19:02:41 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (primary): enable expr::identifier as method
+ invocation.
- * lib/irb/ext/save-history.rb: suppress warning: method redefined;
- discarding old save_history=.
+Wed Dec 23 03:04:36 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Apr 14 14:58:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_match): avoid too many loop pops for (?:..).
- * ext/tk/tkutil/tkutil.c (tk_hash_kv): the third argument can be
- nil not only an Array. reported by @windwiny at
- https://github.com/ruby/ruby/commit/cdaa94e#commitcomment-17096618
+Tue Dec 22 18:01:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Apr 14 14:28:55 2016 cremno phobia <cremno@mail.ru>
+ * experimental version 1.1d1 released.
- * cont.c (fiber_initialize_machine_stack_context): fix wrong
- _MSC_VER check, should be decimal but not hexadecimal.
- [ruby-core:74936] [Bug #12279]
+Mon Dec 21 01:33:03 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Apr 13 22:51:38 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (TMP_PROTECT): add volatile to ensure GC protection.
- * array.c (rb_ary_sum): Array#sum is implemented.
- Kahan's compensated summation algorithm for precise sum of float
- numbers is moved from ary_inject_op in enum.c.
+ * string.c (rb_str_gsub_bang): calculate buffer size properly.
- * enum.c (ary_inject_op): Don't specialize for float numbers.
+ * parse.y (lex_get_str): needed to return Qnil at EOS.
- [ruby-core:74569] [Feature #12217] proposed by mrkn.
+ * eval.c (find_file): check policy modified, raise exception
+ immediately for tainted load_path.
-Wed Apr 13 15:56:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (rb_f_setenv): do not depend on setenv() nor putenv().
- * numeric.c (flo_ceil): add an optional parameter, digits, as
- well as Float#round. [Feature #12245]
+Thu Dec 17 06:29:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (flo_floor): add an optional parameter, digits, as
- well as Float#round. [Feature #12245]
+ * ext/tk/tkutil.c (tk_s_new): use rb_obj_instance_eval(), instead
+ of rb_yield_0().
- * numeric.c (int_ceil): add an optional parameter, digits, as
- well as Integer#round. [Feature #12245]
+ * eval.c (rb_f_require): forgot to call find_file in some cases.
- * numeric.c (int_floor): add an optional parameter, digits, as
- well as Integer#round. [Feature #12245]
+ * eval.c (rb_f_require): `require "feature.so"' to load dynamic
+ libraries. old `require "feature.o"' is still OK.
-Wed Apr 13 14:47:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_eval): yield without value dumped core.
- * file.c (Init_File): add alias File.empty? to File.zero?.
- [Feature #9969]
+Wed Dec 16 16:28:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Apr 13 14:36:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * experimental version 1.1d0 (pre1.2) released.
- * parse.y (assign_in_cond): allow multiple assignment in
- conditional expression. [Feature #10617]
+Wed Dec 16 10:43:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Apr 13 14:11:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_search): bound check before calling re_match().
- * bignum.c (rb_big_size): add wrapper function of BIGSIZE and
- rename the method function with _m suffix.
+Tue Dec 15 13:59:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (int_round_zero_p): extracted from rb_int_round.
- optimize for Bignum, and convert VALUE returned by Numeric#size
- to long.
+ * error.c (exc_to_s): returns class name for unset mesg.
-Wed Apr 13 12:00:08 2016 Koichi Sasada <ko1@atdot.net>
+ * error.c (exc_initialize): do not initialize @mesg by "".
- * test/ruby/test_basicinstructions.rb: add a test to check access
- instance variables on special const objects.
+ * parse.y (nextc): __END__ should handle CR+LF newlines.
- All of such objects are frozen, so that we can not set instance
- variables for them. But we can read instance variables and return
- default value (nil).
+Wed Dec 9 13:37:12 1998 MAEDA shugo <shugo@aianet.ne.jp>
-Tue Apr 12 20:40:35 2016 Kaneko Yuichiro <spiketeika@gmail.com>
+ * pack.c (encodes): use buffering for B-encoding.
- * ext/date/date_core.c (time_to_time): should preserve timezone
- info. [ruby-core:74889] [Bug #12271]
+ * pack.c (pack_pack): Q-encoding by 'M'.
-Tue Apr 12 11:51:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Dec 8 14:10:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * compile.c (new_label_body): initialize bit fields, since
- compile_data_alloc does not clear the memory. [Bug #12082]
+ * variable.c (generic_ivar_get): any object can have instance
+ variables now. great improvement.
-Mon Apr 11 20:18:43 2016 Koichi Sasada <ko1@atdot.net>
+ * variable.c (rb_name_class): do not set __classpath__ by default,
+ use __classid__ instead.
- * vm_backtrace.c (frame2klass): filter only for imemo_ment.
- T_IMEMO/imemo_iseq can be passed here.
+Mon Dec 7 22:08:22 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Apr 11 17:43:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.h (struct RFile): IO objects can have instance variables now.
- * compile.c (iseq_optimize): disable tail call optimization in
- rescued, rescue, and ensure blocks.
- [ruby-core:73871] [Bug #12082]
+ * parse.y (primary): allows `def obj::foo; .. end'.
-Mon Apr 11 06:54:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Dec 7 18:24:50 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * file.c (apply2files): apply to a VALUE vector instead of a
- temporary array.
+ * ruby.c (set_arg0): $0 support for HP-UX.
-Sun Apr 10 20:54:16 2016 Joe Swatosh <joe.swatosh@gmail.com>
+Mon Dec 7 01:30:28 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
- API names. [ruby-core:74863] [Bug #12264]
+ * dln.c (dln_strerror): better error messages on win32.
-Sun Apr 10 17:47:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Dec 5 23:27:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * file.c (rb_realpath_internal): no argument conversions since
- this internal function does not need to_path and encoding
- conversions, not to be affected by the default internal
- encoding.
+ * parse.y (here_document): indentable here-doc delimiter by
+ `<<-'. Proposed by Clemens <c.hintze@gmx.net>. Thanks.
-Sat Apr 9 10:03:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 3 16:50:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * load.c (rb_f_load): raise with the original path name before
- encoding conversion.
+ * ext/extmk.rb.in (realclean): trouble on install.
-Sat Apr 9 02:05:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Nov 29 22:25:39 1998 Takaaki Tateishi <ttate@jaist.ac.jp>
- * bignum.c (rb_cstr_parse_inum): [EXPERIMENTAL] new function to
- parse integer in C-string with length. the name and the
- arguments may be changed in the future.
+ * process.c (f_exec): check number of argument.
- * bignum.c (rb_str_to_inum): preserve encoding of the argument in
- error messages, and no longer needs to copy non-terminated
- strings.
+Thu Nov 26 17:27:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_str2big_{poweroftwo,normal,karatsuba,gmp}): ditto.
+ * version 1.1c9 released.
-Thu Apr 7 19:04:03 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Nov 25 13:07:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
- comments. [ruby-core:74838] [Bug #12256]
+ * string.c (rb_str_dup): do not copy additional data (STR_NO_ORIG).
-Thu Apr 7 11:24:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yycompile): reduce known memory leak (hard to remove).
- * ext/tk/tkutil/tkutil.c (cbsubst_initialize): fix out-of-bound
- access when no arguments given. `p Tk::Event.new` crashed.
+Wed Nov 25 03:41:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 1 01:26:00 2016 Benoit Daloze <eregontp@gmail.com>
+ * st.c (st_init_table_with_size): round size up to prime number.
- * ext/coverage/coverage.c: Fully reset coverage to not persist global state.
- It was returning old file coverages as empty arrays to the user.
- [ruby-core:74596] [Bug #12220]
+Sat Nov 21 23:27:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/coverage/coverage.c (rb_coverages): remove unused static state.
+ * hash.c (rb_hash_aset): reduce copying key strings.
- * thread.c: Moved and renamed coverage_clear_result_i to reset_coverage_i.
+ * gc.c (looks_pointerp): declare as inline function if possible.
- * test/coverage/test_coverage.rb: improve precision of tests.
+ * st.c (PTR_NOT_EQUAL): compare hash values first before calling
+ comparing function.
-Wed Apr 6 22:41:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * st.c (ADD_DIRECT): save hash value in entries to reduce hash
+ calculation.
- * configure.in (rb_cv_lgamma_r_m0): fix the condition for
- lgamma_r(-0.0). [Bug #12249]
+ * string.c (rb_str_gsub_bang): avoid rb_scan_args() to speed-up.
-Wed Apr 6 17:38:42 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * string.c (rb_str_sub_bang): ditto.
- * tool/downloader.rb (RubyGems.download): follow the change of the
- rubygems ssl_certs directory tree introduced by previous commit.
+Sat Nov 21 18:44:06 1998 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
-Wed Apr 6 15:00:27 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * time.c (time_s_now): had memory leak.
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.3.
- Please see entries of 2.6.3 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
+ * ext/md5/md5init.c (md5_new): had memory leak.
-Wed Apr 6 14:13:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/md5/md5init.c (md5_clone): ditto.
- * configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
- returns negative infinity. [Bug #12249]
+Fri Nov 20 23:23:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * math.c (ruby_lgamma_r): define by the configured result.
+ * lib/delegate.rb: do not propagate hash and eql?.
-Wed Apr 6 10:56:15 2016 Anton Davydov <antondavydov.o@gmail.com>
+Thu Nov 19 01:40:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/logger.rb (Logger#level=): remove unnecessary local
- variable.
+ * sample/ruby-mode.el (ruby-expr-beg): failed to find reserved
+ word boundary.
- * lib/logger.rb (Logger#initialize, Logger#reopen): [DOC] mention
- the default values. cherrypicked from [GH-1319].
+ * eval.c (rb_eval): avoid calling `concat' method. calls
+ rb_ary_concat() directly for efficiency.
-Wed Apr 6 10:17:53 2016 cremno phobia <cremno@mail.ru>
+ * eval.c (rb_eval): actual rest arguments extended arrays too much.
- * math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
- since msvcrt does not provide it.
+Wed Nov 18 14:30:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
- [ruby-core:74823] [Bug #12249]
+ * class.c (rb_define_global_function): global functions now be
+ module function of the Kernel.
-Wed Apr 6 01:22:55 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Wed Nov 18 10:48:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
- cf. [Bug #12249]
+ * io.c (read_all): SEGV on large files.
-Wed Apr 6 00:53:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Nov 17 18:11:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * math.c (ruby_lgamma_r): fix lgamma(-0.0) on mingw and OSX.
+ * version 1.1c8 released.
- * math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
- [ruby-core:74817] [Bug #12249]
+Tue Nov 17 16:58:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Apr 5 14:50:28 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (arg): assignment to attribute name start with capital
+ should be allowed.
- * ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
- [Bug #12202] [ruby-core:74802]
+ * eval.c (thread_alloc): needed to mark terminated threads too.
-Tue Apr 5 00:06:44 2016 Aeris <aeris@imirhil.fr>
+Tue Nov 17 12:33:48 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
- * ext/openssl/ossl_ssl.c (ossl_ssl_tmp_key): Access to ephemeral
- TLS session key in case of forward secrecy cipher. Only
- available since OpenSSL 1.0.2. [Fix GH-1318]
+ * ext/extmk.rb.in (create_makefile): Set `libdir' to `@libdir@',
+ Set `pkglibdir' to `$libdir/$(RUBY_INSTALL_NAME)'.
- * ext/openssl/extconf.rb: Check for SSL_get_server_tmp_key.
+Tue Nov 17 10:30:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Apr 4 23:37:05 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * sprintf.c (f_sprintf): %l%%c -> %%l%c
- * vm_core.h (rb_vm_struct): make at_exit a single linked list but
- not RArray, not to mark the registered functions by the write
- barrier. based on the patches by Evan Phoenix.
- [ruby-core:73908] [Bug #12095]
+Tue Nov 17 01:08:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Apr 4 17:43:45 2016 Koichi Sasada <ko1@atdot.net>
+ * parse.y (ret_args): distinguish `a' and `*a' for the arguments
+ of yield and return.
- * gc.c: change default value of
- RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO 0.3 -> 0.2
- RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO 0.8 -> 0.65
+ * eval.c (rb_eval): flip3 should work like sed.
- These values are same as Ruby 2.0.0.
+ * eval.c (rb_eval): flip{2,3} now have independent state for each
+ scope to work fine with thread.
- This change cause GC counts.
- However, generational GC reduced each (minor) GC time and
- increase memory locality. So that not so big impact on my
- benchmarking results.
- (surprisingly, this fix speed up programs on some cases)
+Mon Nov 16 23:26:29 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- You can change these values by environment variables
- if you feel wrong.
+ * parse.y (primary): exec else clause if no exception raised.
-Mon Apr 4 17:36:52 2016 Koichi Sasada <ko1@atdot.net>
+Sun Nov 15 15:44:07 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * gc.c (get_envparam_double): take an upper_bound.
+ * ext/extmk.rb.in (install): bug in target.
- And also take an accept_zero flag which allow to accept zero
- even if lower_bound is set.
+Sat Nov 14 11:02:05 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
- * gc.c (ruby_gc_set_params): fix parameters.
+ * Makefile.in (install): Give the argument `$(DESTDIR)' to
+ `instruby.rb'.
- RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO set 0.9 as *lower_bound*, so that
- it should be upper_bound.
- Set RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO as lower bound.
+ * instruby.rb: Recognize ARG[0] as `destdir'.
- Also set lower/upper bound of RUBY_GC_HEAP_FREE_SLOTS_GOAL_RATIO to
- RUBY_GC_HEAP_FREE_SLOTS_MIN/MAX_RATIO.
+ * instruby.rb: Give the argument `destdir' to `extmk.rb'.
-Mon Apr 4 16:41:32 2016 Koichi Sasada <ko1@atdot.net>
+ * ext/extmk.rb.in: Recognize ARG[1] as `$destdir'.
- * vm.c (Init_VM): should pass tokens.
+ * instruby.rb: Create the installation directories (bindir, libdir,
+ archdir, pkglibdir, archdir, and mandir) under `destdir', and
+ install all files under there.
-Sun Apr 3 09:34:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/extmk.rb.in: Likewise.
- * numeric.c (flodivmod): round division if it is a finite number
- and module is required.
+Sat Nov 14 10:56:55 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
- * numeric.c (dbl2ival): do not round here.
+ * instruby.rb: Add the variable `pkglibdir'.
- * numeric.c (flo_ceil): use dbl2ival.
+ * instruby.rb: Set the variable `libdir' to `$(libdir)', not
+ `$(libdir)/$(ruby_install_name)'. `libruby.so' and `libruby.so.LIB'
+ are installed at `libdir'.
- * numeric.c (flo_round): round explicitly.
+ * instruby.rb: Set the variable `archdir' to `$(pkglibdir)/$(arch)'.
-Sat Apr 2 15:24:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Nov 13 19:43:29 1998 KIMURA Koichi <kbk@kt.rim.or.jp>
- * include/ruby/intern.h (rb_check_arity): returns argc.
+ * missing/nt.c (SafeFree): wrong free offset.
-Fri Apr 1 20:58:33 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu Nov 12 20:11:53 1998 Koji Arai <JCA02266@nifty.ne.jp>
- * enc/unicode/case-folding.rb, casefold.h: Data generation to implement
- swapcase functionality for titlecase characters. Swapcase isn't defined
- by Unicode, because the purpose/usage of swapcase is unclear anyway.
- The implementation follows a proposal from Nobu, swapping the case of
- each component of a titlecase character individually.
- This means that the titlecase characters have to be decomposed.
+ * sample/ruby-mode.el: wrong highlight.
- * enc/unicode.c: Code using the above data.
+ * parse.y (parse_regx): newline in regexp was ignored.
- * test/ruby/enc/test_case_mapping.rb: Tests for the above.
+Wed Nov 11 10:54:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Apr 1 14:55:28 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * parse.y (here_document): <<'FOO' should not escape anything.
- * configure.in (AC_CONFIG_FILES): $srcdir/.git can be a file pointing
- the real git_dir, such as when the git working tree is a "linked
- working tree" (a working tree created by git-worktree). So use
- git-rev-parse --git-dir to check if $srcdir is the top-level of a git
- repository, not just checking if the $srcdir/.git directory does exist
- or not. [ruby-core:74759] [Bug #12239]
+ * parse.y (here_document): bare << here-doc available, even though
+ it's deprecated.
- * tool/change_maker.rb: use tool/vcs.rb to detect VCS. This used to have
- its own VCS detection code, while we have tool/vcs.rb.
+ * file.c (rb_file_s_readlink): return value should be tainted.
- * tool/vcs.rb (detect): remove code duplication
+ * ext/etc/etc.c (setup_passwd): information (eg. GCOS name) should
+ be tainted (modified at Perl Conference).
-Fri Apr 1 04:50:44 2016 Eric Wong <e@80x24.org>
+Tue Nov 10 00:22:11 1998 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc):
- enable SSL_MODE_ACCEPT_MOVING_WRITE_BUFFER by default
- [Bug #12126]
+ * configure.in: elf support for FreeBSD 3.x
-Fri Apr 1 01:13:55 2016 Benoit Daloze <eregontp@gmail.com>
+Tue Nov 10 00:05:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * thread.c (update_coverage): Do not track coverage in loaded files
- after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
+ * parse.y (yylex): here document available in eval.
- * ext/coverage/coverage.c (coverage_clear_result_i): document.
+Mon Nov 9 17:55:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 31 19:16:16 2016 Koichi Sasada <ko1@atdot.net>
+ * version 1.1c7 released.
- * gc.c: need to set initial value of GC_HEAP_FREE_SLOTS_GOAL_RATIO.
+Fri Nov 6 19:25:27 1998 Takao KAWAMURA <kawamura@ike.tottori-u.ac.jp>
-Thu Mar 31 17:50:27 2016 Koichi Sasada <ko1@atdot.net>
+ * sample/ruby-mode.el: font-lock patch.
- * gc.c: change additional allocation policy.
+Thu Nov 5 15:42:22 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- Introduce new environment variable
- RUBY_GC_HEAP_FREE_SLOTS_GOAL_RATIO (goal_ratio) to calculate the
- ratio of additional memory.
+ * sample/README, lib/README: simple description for each file.
- Before this change, we add pages with the following formula
- (when free_slots < total_pages * RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO):
- next_pages = total_pages * RUBY_GC_HEAP_GROWTH_FACTOR
+Wed Nov 4 18:14:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- This addition can allocate too much.
+ * eval.c (assign): attribute assignment should be called as public.
- With this change, we increase pages to satisfy the following formula:
- next_free_slots = next_total_slots * goal_ratio
- where
- next_free_slots = free_slots + adding_slots
- next_total_slots = total_slots + adding_slots.
+Tue Nov 3 23:36:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- If you want to prepare many free slots, increase this ratio.
+ * string.c (rb_str_dump): dumps core for negative char value.
- If this variable is 0, then simply multiply
- RUBY_GC_HEAP_GROWTH_FACTOR.
+ * regex.c (re_compile_pattern): out of boundary access for empty
+ regexp.
- * gc.c (get_envparam_double): enable to accept 0.
+Mon Nov 2 22:54:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 31 17:48:25 2016 Koichi Sasada <ko1@atdot.net>
+ * string.c (rb_str_aset): `str[str]' replaces first match.
- * gc.c (gc_marks_finish): fix syntax error.
+Mon Nov 2 18:24:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 31 16:49:36 2016 Koichi Sasada <ko1@atdot.net>
+ * eval.c (thread_create): was accessing modified status.
- * gc.c: simplify allocate/free detecting logic at the end of marking.
+Sun Nov 1 01:18:52 1998 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
- Before this change, heap_pages_min_slots are calculated at the
- beginning sweeping phase. And this value is used at the end of
- *next* marking phase.
+ * gc.c (xrealloc): size 0 needs round up to 1.
- To simplify it, we use this value at the end of this marking phase.
- It means that we don't need to store this value as global state.
+Sat Oct 31 23:18:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- Also heap_pages_max_slots is calculated at the begging of sweeping
- phase and used at the end of sweeping phase.
- To simplify this logic, we introduced new global value
- heap_pages_freeable_pages it means extra pages count we can free.
- gc_sweep_step() checks this value and moves empty pages to tomb_heap
- not more than this value.
+ * string.c (rb_str_split_method): negative LIMIT means number of
+ split fields are unlimited, as in perl.
- Because of this fix, heap_pages_swept_slots is no longer needed.
+ * string.c (rb_str_split_method): if LIMIT is unspecified,
+ trailing null fields are stripped.
- * gc.c (rb_objspace_t::heap_pages): restruct the objspace global
- status.
+Sat Oct 31 04:16:14 1998 Inaba Hiroto <inaba@st.rim.or.jp>
- remove the following fields
- * swept_slots (and heap_pages_swept_slots)
- * min_free_slots (and heap_pages_min_free_slots)
- * max_free_slots (and heap_pages_max_free_slots)
- And add the following filed.
- * freeable_pages (and heap_pages_freeable_pages)
+ * string.c (str_aref): regexp index SEGVed.
- * gc.c (heap_pages_free_unused_pages): unlink tomb heap pages
- because tomb heap should have only freeable pages.
+Fri Oct 30 14:33:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (heap_extend_pages): add parameters for future extension.
+ * re.c (reg_match): returns nil for unmatch.
-Thu Mar 31 16:43:02 2016 Koichi Sasada <ko1@atdot.net>
+ * dir.c (dir_entries): new method.
- * gc.c: add GC parameters to configure the following values:
- * RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO:
- allocate additional pages when free slots is lower than
- the value (total_slots * (this ratio)).
- * RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO:
- allow to free pages when free slots is greater than
- the value (total_slots * (this ratio)).
+ * eval.c (block_pass): do not push block, substitute it.
- Before this change, these values are hard coded.
+Fri Oct 30 01:28:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (ruby_gc_params_t): ditto.
+ * range.c (range_check): avoid <=> check for Fixnums.
- * gc.c (ruby_gc_set_params): ditto.
+ * array.c (rb_ary_aset): accept negative index.
-Thu Mar 31 15:59:17 2016 Koichi Sasada <ko1@atdot.net>
+Wed Oct 28 22:00:54 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (gc_verify_heap_page): check the number of zombies.
+ * regex.c (re_match): access out of boundary fixed.
- * gc.c (gc_verify_heap_pages): check also tomb heap.
+Wed Oct 28 11:37:42 1998 TAMITO <tommy@valley.ne.jp>
-Thu Mar 31 15:48:18 2016 Koichi Sasada <ko1@atdot.net>
+ * io.c (f_select): fd number comparison bug.
- * gc.c (gc_page_sweep): return free slots count.
+Tue Oct 27 23:07:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (gc_sweep_step): use returned free slots count.
+ * sample/ruby-mode.el (ruby-parse-region): forgot to support %w()
+ style array literal.
- * gc.c (gc_sweep_step): change variable name `next'
- to `next_sweep_page'.
+ * eval.c (rb_eval): unused block raises warning.
-Thu Mar 31 11:33:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Oct 26 09:37:53 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/date/date_core.c (d_lite_strftime, dt_lite_strftime): [DOC]
- fix indent not to be a big sole verbatim.
+ * eval.c (dvar_asgn_push): dvar pushed too many times if
+ variable-in-block first appear in loops.
-Thu Mar 31 11:18:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sun Oct 25 22:59:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
- of DateTime. [ruby-core:74729] [Bug #12233]
+ * regex.c (set_list_bits): was using wrong offset.
-Thu Mar 31 03:41:02 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu Oct 22 00:07:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/nkf/nkf-utf8/nkf.c: Merge upstream 69f7e74dde.
- fix indent.
+ * eval.c (rb_obj_method): method retrieved from tainted object
+ should be tainted too.
-Wed Mar 30 16:33:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (method_call): safe_level should be restored during
+ Method#call.
- * extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
- Renamed files, wrong method names or argument types; the example
- GetDBM macro is now updated to the current version of the actual
- code. patch by Marcus Stollsteimer in [ruby-core:74690].
- [Bug #12228]
+Wed Oct 21 14:21:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 30 09:46:01 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * io.c (Init_IO): new constants IO::SEEK_{SET,CUR,END}.
- * lib/open-uri.rb: Use `userinfo` for authenticated proxy.
- [fix GH-1148] Patch by @SokichiFujita
- * test/open-uri/test_open-uri.rb: ditto.
- [fix GH-1309] Patch by @jdamick
+ * io.c (rb_f_ungetc): ungetc pushes a char back into STDIN.
-Wed Mar 30 01:56:06 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Oct 19 11:50:00 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
- * ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
- patched by Anton Sivakov [Bug #12201] [Bug #12202]
+ * ext/extmk.rb: Load '@top_srcdir@/lib/find.rb', not
+ '../lib/find.rb'.
-Wed Mar 30 01:54:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/extmk.rb: Distinguish between `top_srcdir' and `topdir'.
- * tool/redmine-backporter.rb: add given revision to current changesets
- on associating the revision to the related ticket.
+ * Makefile.in (CFLAGS): Add `-I.'.
-Wed Mar 30 01:53:17 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * Makefile.in (lex.c): Give `@srcdir@/keywords' to gperf, not
+ `keywords'.
- * tool/merger.rb: update revision.h before merge.
+ * instruby.rb: Use `CONFIG["bindir"]', instead of `prefix + "/bin"'.
-Tue Mar 29 19:33:54 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * instruby.rb: Use `CONFIG["libdir"]', instead of `prefix + "/lib"'.
- * addr2line.c: define toupper for its use. fix r54391.
+ * instruby.rb Use `CONFIG["mandir"]', instead of `prefix + "/man"'.
-Tue Mar 29 19:23:46 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * instruby.rb (wdir): Add the variable to preserve the current
+ working directory.
- * include/ruby/ruby.h (rb_isupper, rb_islower, rb_isalpha, rb_isdigit,
- rb_isalnum, rb_isxdigit, rb_isblank, rb_isspace, rb_isblank,
- rb_iscntrl, rb_isprint, rb_ispunct, rb_isgraph,
- rb_tolower, rb_toupper): use inline function to avoid function call.
+ * instruby.rb: Chdir to wdir before install `config.h' and
+ `rbconfig.rb'.
- * include/ruby/ruby.h (rb_isascii): use inline function to clarify
- the logic.
+Mon Oct 19 10:07:01 1998 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
-Tue Mar 29 18:56:55 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_eval): reduce recursive calls to rb_eval().
- * tool/redmine-backporter.rb (backport): show merger.rb's path.
+Fri Oct 16 15:31:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * tool/redmine-backporter.rb (show): show current issue again if no
- ticket number is given.
+ * time.c (time_new_internal): timeval must be positive.
- * tool/redmine-backporter.rb (rel): show error message if current
- bugs.ruby-lang.org doesn't support the API.
+Thu Oct 15 13:54:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 29 18:54:34 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (arg): local variables can be accessed within right side
+ expression in assignment, notably in blocks.
- * tool/merger.rb: support to backport header as backport identifier.
- Now you can specify by 'merge revision(s) 49254: [Backport #10738]'.
+Wed Oct 14 00:18:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 29 16:53:44 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * array.c (Init_Array): Array#=== is now for equal check, not
+ inclusion check.
- * enc/unicode/case-folding.rb, casefold.h: Tweaked handling of 6
- special cases in CaseUnfold_11_Table.
+ * parse.y (when_args): `when a, *b' style new syntax for array
+ expansion in `case'.
- * enc/unicode.c: Adjustments for above.
+Tue Oct 13 14:30:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_mapping.rb: Tests for the above: Some tests in
- test_titlecase activated; test_greek added. A test in test_cherokee fixed.
+ * object.c (rb_obj_untaint): taint marks can be unset.
-Tue Mar 29 13:31:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_eval): taint propagation for embedded strings.
- * enc/unicode.c: Cleaned up some comments.
+Mon Oct 12 13:27:15 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 29 13:24:56 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_call0): check stack depth more frequently.
- * enc/unicode/case-folding.rb, casefold.h: Removing data for idempotent
- titlecasing.
+Mon Oct 12 08:08:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Adjust code to data removal.
+ * io.c (rb_p): can print even in secure mode.
-Tue Mar 29 12:45:18 2016 Laurent Arnoud <laurent@spkdev.net>
+Sun Oct 11 22:50:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/webrick/httpresponse.rb: Move error_body to method. It allow to
- override the body more easily. [fix GH-1307]
- * test/webrick/test_httpresponse.rb: ditto.
+ * variable.c (rb_const_set): taint check for modification.
-Tue Mar 29 06:40:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (rb_ivar_set): taint check for modification.
- * error.c (rb_compile_err_append): rb_thread_t::base_block is no
- longer used.
+ * string.c (rb_str_modify): taint check for modification.
- * iseq.c (rb_iseq_compile_with_option): ditto, no protection is
- needed.
+ * hash.c (rb_hash_modify): taint check for modification.
-Tue Mar 29 06:39:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (rb_ary_modify): taint check for modification.
- * parse.y (struct parser_params): move parse_in_eval flag from
- rb_thread_t.
+ * ruby.h (FL_TAINT): taint for all objects, not only strings.
- * parse.y (rb_parser_set_context): set parsing context, not only
- mild error flag.
+Fri Oct 9 17:01:14 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * iseq.c (rb_iseq_compile_with_option): the parser now refers no
- thread local states to be restored.
+ * io.c (read_all): read() returns "" at immediate EOF.
- * vm_eval.c (eval_string_with_cref): ditto.
+ * io.c (io_read): read(nil) read all until EOF.
-Mon Mar 28 21:24:02 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+Thu Oct 8 13:32:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (int_pos_p): fix typos.
+ * time.c (time_dump): marshal can dump Time object now.
-Mon Mar 28 14:54:49 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * marshal.c (Init_marshal): rename marshal methods `_dump_to' to
+ `_dump', `_load_from' to `_load'.
- * enc/unicode.c: Refactoring in preparation for data reduction for
- titlecase.
+ * parse.y (rb_intern): "+=".intern generates proper symbol.
-Mon Mar 28 14:36:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Oct 5 18:31:53 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Minor refactoring for I WITH DOT ABOVE.
+ * version 1.1c6 released.
-Mon Mar 28 14:26:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Fri Oct 2 14:22:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Removed code now covered by data from table.
+ * regex.c (re_search): `/\s*(--)$/ =~ "- --"' did not match,
+ because of wrong optimize condition.
-Mon Mar 28 11:49:21 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Oct 1 01:55:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Adding comments. [ci skip]
+ * parse.y (rb_intern): should not raise exceptions.
-Mon Mar 28 11:30:23 2016 Shinichi Maeshima <netwillnet@gmail.com>
+ * parse.y (yylex): symbol like `:foo?=' should not be allowed.
- * lib/rubygems.rb: Fix `Gem.find_spec_for_exe` picks oldest gem.
- https://github.com/travis-ci/travis-ci/issues/5798
- https://github.com/rubygems/rubygems/pull/1566
- * test/rubygems/test_gem.rb: ditto.
+ * ext/extmk.rb.in: makes *.a for static link modules.
-Mon Mar 28 11:26:31 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Sep 30 14:13:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.2.
- Please see entries of 2.6.2 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
+ * eval.c (rb_thread_start): supports making a subclass of the
+ Thread class.
-Mon Mar 28 11:02:31 2016 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+Tue Sep 29 17:46:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
- https://github.com/rubygems/rubygems/pull/1554
- [Bug #12193][ruby-core:74431]
+ * eval.c (rb_thread_join): join is now an instance method.
-Mon Mar 28 08:19:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Sep 25 12:01:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * sprintf.c (rb_str_format): refactor floating point format of
- Rational by using generic Integer functions.
+ * parse.y (yylex): `@foo!' should be an error.
- * sprintf.c (rb_str_format): fix buffer overflow, length must be
- greater than precision. reported by William Bowling <will AT
- wbowling.info>.
+Thu Sep 24 14:55:06 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
-Sun Mar 27 12:13:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/etc/etc.c (Init_etc): wrong field definition.
- * sprintf.c (rb_str_format): convert Rational to floating point
- format by using generic Integer functions, not by methods which
- can be overwritten.
+Thu Sep 17 17:09:05 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Mar 26 10:55:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_reopen): was creating FILE* for wrong fd.
- * numeric.c (rb_int2str): conversion function to String for
- generic Integer.
+Tue Sep 15 05:28:11 1998 Koji Arai <JCA02266@nifty.ne.jp>
- * numeric.c (rb_int_round): rounding function for generic
- Integers.
+ * regex.c (re_compile_pattern): forgot to fixup for the pattern
+ like (?=(A)|(B)).
- * numeric.c (rb_int_{uminus,plus,minus,mul,idiv,modulo}): basic
- arithmetic functions for generic Integers.
+Tue Sep 15 01:06:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (FIXNUM_{POSITIVE,NEGATIVE,ZERO}_P): predict macros
- only for Fixnum.
+ * io.c (rb_io_gets_internal): do not set $_ by default, only
+ gets/readline set the variable.
-Sat Mar 26 06:34:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_f_load): load toplevel class is set to anonymous
+ module if safe_level >= 5, to encapsulate modification.
- * localeinit.c (rb_locale_charmap_index): fix prototype.
- patched by Andreas Schwab [Bug #12218]
+ * eval.c (rb_f_load): set frame properly.
-Fri Mar 25 16:40:48 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (rb_str_each_line): do not set $_.
- * test/ruby/enc/test_case_mapping.rb: Additional tests title case;
- some not yet activated.
+Mon Sep 14 14:42:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 25 13:38:11 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * regex.c (re_match): beginning and end of the string, do not
+ automatically match `\b'.
- * ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
- function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
- even if it is disabled by OpenSSL configuration.
- [ruby-core:74384] [Bug #12182]
+ * string.c (scan_once): consume at least on character.
- * ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
+ * regex.c (re_search): wrong behavior for negative range.
- * test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
+Sat Sep 12 21:21:26 1998 Koji Arai <JCA02266@nifty.ne.jp>
-Fri Mar 25 11:08:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_search): range value should be maintained.
- * lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
- missing mandatory arguments. [ruby-core:74540] [Bug #12215]
+Thu Sep 10 10:55:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 25 01:50:58 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (backref_error): yyerror does not understand formats.
- * thread_pthread.c (reserve_stack): fix reserving position where
- the stack growing bottom to top. [Bug #12118]
+Tue Sep 8 18:05:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 25 01:10:42 2016 Sebastian Schuberth <sschuberth@gmail.com>
+ * version 1.1c5 released.
- * lib/mkmf.rb (find_executable0): On Windows, it is actually valid
- to surround individual PATH directory entries with double
- quotes. Remove these before joining the path as otherwise the
- literal quotes would become part of the path, resulting in the
- executable not to be found. [Fix GH-1305]
+Tue Sep 8 10:03:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 24 22:38:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (str_each_line): wrong line splitting with newline at
+ top of the string.
- * strftime.c (FMT, FMTV): remove recursive-assignments to get rid
- of undefined behavior. [ruby-core:74532] [Bug #12213]
+ * string.c: non bang methods return copied string.
-Thu Mar 24 17:44:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (f_END): needed to initialize frame->argc;
- * strftime.c (FMT_PADDING): extract format for padding.
+Fri Sep 4 11:27:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * strftime.c (FMT_PRECISION): extract precision formula.
+ * bignum.c (bigadd): proper sign combination.
- * strftime.c (FMTV): append formatted string to expand the result.
+ * regex.c (re_search): wrong return value for \A.
-Thu Mar 24 14:20:21 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Sep 3 14:08:14 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * strftime.c (STRFTIME): deal with case conversion flags for
- recursive formats.
+ * version 1.1c4 released.
-Thu Mar 24 12:43:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Sep 1 10:47:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/date/date_core.c (dt_lite_iso8601): strftimev() always
- returns a String, so append them directly.
+ * regex.c (slow_search): do not compare llen and blen. llen may
+ be longer than blen, if little contains 0xff.
- * ext/date/date_core.c (d_lite_jisx0301, iso8601_timediv),
- (dt_lite_jisx0301): format by the format string in local buffer
- to prevent intermediate strings from GC.
+ * regex.c (mbctab_euc): set 0x8e as multibyte character.
- * ext/date/date_core.c (mk_inspect_raw, mk_inspect): inspect by
- "%+"PRIsVALUE, to prevent intermediate strings from GC.
+ * string.c (str_inspect): mask character for octal output.
-Thu Mar 24 11:43:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 31 15:32:41 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * strftime.c (rb_strftime_with_timespec): remove unnecessary
- check, as `s` equals to `endp` when recursed STRFTIME resized
- the capacity same as the size.
+ * regex.c (re_search): use calculated offset if exactn is the
+ first opcode in the compiled regexp.
-Wed Mar 23 21:48:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * regex.c (bm_search): use Boyer-Moore search for simple search.
- * enum.c (ary_inject_op): put subtract operation out of if-clause.
+ * regex.c (must_instr): wrong length check if pattern includes
+ byte escape by 0xff.
-Wed Mar 23 21:38:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * regex.c (re_compile_pattern): need not to check current_mbctype.
- * enum.c (ary_inject_op): Use Kahan's compensated summation algorithm
- for summing up float values.
+Sat Aug 29 16:31:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 23 20:56:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_check_safe_str): avoid calling rb_id2name() in normal
+ cases to speed-up.
- * strftime.c (rb_strftime_with_timespec): append formatted results
- to the given string with expanding, and also deal with NUL chars.
+ * eval.c (thread_raise): do not save context of terminated thread.
- * strftime.c (rb_strftime, rb_strftime_timespec): return formatted
- string, not the length put in the given buffer.
+ * regex.c (re_compile_pattern): mask \nnn over 256.
- * time.c (rb_strftime_alloc): no longer needs to retry with
- reallocating buffers.
+Sat Aug 29 02:09:46 1998 Koji Arai <JCA02266@nifty.ne.jp>
- * time.c (time_strftime): no longer needs to split by NUL chars.
+ * sprintf.c (f_sprintf): wrong buffer size check.
-Wed Mar 23 14:23:54 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Aug 28 01:57:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/rdoc/ri/driver.rb (interactive): rescue NotFoundError raised in
- expand_name. (display_name rescues NotFoundError by itself,
- the original logic looks buggy...)
+ * regex.c (re_compile_pattern): accepts (?ix-ix) and (?ix-ix:...).
-Wed Mar 23 11:44:53 2016 cremno <cremno@mail.ru>
+Fri Aug 28 12:25:33 1998 Hiroshi Igarashi <igarashi@ueda.info.waseda.ac.jp>
- * marshal.c (r_long): cast to `signed char`, which is used
- already, instead of SIGN_EXTEND_CHAR.
+ * ruby.c (ruby_require_modules): load modules in appearing order.
- * parse.y: SIGN_EXTEND_CHAR is no longer used. [Fix GH-1302]
+Fri Aug 28 01:57:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 23 11:38:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * regex.c (re_compile_pattern): accepts (?ix-ix) and (?ix-ix:...).
- * cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL_PARAM):
- * add missing parentheses and remove double quotes.
- * rename to get rid of recursive references.
- * as --excludes-dir option is for a path name, its argument
- should be converted.
- [ruby-dev:49526] [Bug #12199]
+Thu Aug 27 12:54:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 23 10:39:38 2016 Koichi ITO <koic.ito@gmail.com>
+ * version 1.1c3 released.
- * variable.c: Added documentation about order of `Module#constants`
- [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
+Wed Aug 26 14:40:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 22 21:08:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_eval): check whether ruby_class is properly set,
+ before accessing it.
- * include/ruby/oniguruma.h: Additional flag for characters that are titlecase.
+ * eval.c (rb_obj_instance_eval): ruby_class should be Qnil for
+ special objects like Fixnums.
- * enc/unicode/case-folding.rb, casefold.h: Using above flag in data.
+ * ext/tkutil/tkutil.c (Init_tkutil): removes calls to
+ rb_yield_0(). used instance_eval() instead in the tk.rb.
- * enc/unicode.c: Marking capitalized character as unmodified if it is
- already titlecase.
+Wed Aug 26 11:47:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_mapping.rb: Tests for above functionality.
+ * regex.c (re_match): pop non-greedy stack elements on success.
-Tue Mar 22 14:18:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Aug 26 09:25:35 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * parse.y (lambda_body, parser_yylex): warn mismatched indentation
- of lambda block.
+ * ruby.h: add #define environ for cygwin32.
-Tue Mar 22 11:36:49 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Tue Aug 25 08:57:41 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (wmul): wrong condition.
- fixed many test failures on 32bit and LLP64 platforms.
+ * array.c (rb_ary_sort_bang): temporarily freeze sorting array.
-Tue Mar 22 10:31:34 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Aug 24 18:46:44 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * time.c (wdiv, wmod): wdivmod0() assumes the 3rd and the 4th arguments
- are valid pointers.
- maybe checking them in wdivmod0() is better manner, but I guess that
- passing real dummy pointers may be faster than checking and branching
- in wdivmod0().
- this commit fixes SEGV on 32bit and LLP64 platforms.
+ * dln.c (dln_find_1): path check was too strict.
-Tue Mar 22 10:24:04 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Mon Aug 24 15:28:11 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * time.c (divmodv): void function never returns any value.
+ * parse.y (f_arglist): opt_nl added after f_args.
-Tue Mar 22 10:11:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Aug 21 01:06:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/lib/test/unit.rb (Test::Unit::StatusLine#failed): print
- failed messages only if replacing mode, otherwise defer them
- until the end, to get rid of interleaving failures with progress
- messages. refix r54195.
+ * ext/socket/socket.c: grand renaming on socket.c.
-Tue Mar 22 03:45:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * ext/socket/socket.c (inet_aton): supply inet_aton for those
+ systems that do not have it.
- * time.c (MUL_OVERFLOW_FIXWV_P): defined for FIXWV.
+ * ext/socket/socket.c (setipaddr): use inet_aton instead of
+ inet_addr.
- * time.c (wmul): use MUL_OVERFLOW_FIXWV_P and only switch.
+ * ext/socket/socket.c (tcp_s_gethostbyname): new method: works
+ like Socket.gethostbyname but returning array contains ip-addrs
+ as octet decimal string format like "127.0.0.1".
- * time.c (wmul): use mul which has Fixnum optimization.
+ * ext/socket/socket.c (mkhostent): return format changed to
+ [host, aliases, type, ipaddr..] as documented.
- * time.c (rb_time_magnify): If WIDEVALUE_IS_WIDER, wmul() has the same
- optimized logic, else mul() has also the similar logic for Fixnum.
+Wed Aug 19 00:31:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (rb_time_unmagnify): almost ditto.
+ * io.c (io_ctl): forgot to place TRAP_END at right position.
-Tue Mar 22 03:10:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Fri Aug 14 11:01:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (divmodv): add the case both arguments are Fixnum.
+ * eval.c (call_trace_func): save __FILE__, __LINE__ before
+ executing trace_func, since trace function should not corrupt
+ line number information.
- * time.c (wquo): use quo which has Fixnum optimization.
+Thu Aug 13 15:09:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (wdivmod0): added for WIDEVALUE_IS_WIDER.
+ * array.c (ary_s_new): was marking unallocated region on GC.
- * time.c (wdivmod): use wdivmod0 and divmodv.
- divmodv has Fixnum optimization.
+Tue Aug 11 11:57:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (wdiv): use wdivmod0 and div to avoid the use of divmodv which
- calls id_quo whose return value is array.
+ * version 1.1c2 released.
- * time.c (wmod): use wdivmod0 and mod to avoid the use of divmodv which
- calls id_quo whose return value is array.
+Mon Aug 10 14:05:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Mar 21 22:32:50 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * process.c (f_system): removed fflush(stdin).
- * internal.h (rb_fix_divmod_fix): like r54213, use FIX2NUM only if
- x == FIXNUM_MIN && y == -1. This must be a rare case and it is
- expected compiler to handle well.
+Fri Aug 7 17:44:44 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Mar 21 22:15:11 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * error.c (err_snprintf): replace sprintf for fixed sized buffer,
+ with snprintf to avoid buffer over-run. For systems which does
+ dot provide snprintf, missing/snprintf.c added.
- * time.c (mod): Add Fixnum case.
+Wed Aug 5 00:47:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (quo): c can be Fixnum except a == FIXNUM_MIN && b == -1.
- Such case can be optimized out because quo()'s argument is constant.
+ * re.c (rb_reg_search): recycle match object.
-Mon Mar 21 22:09:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Aug 3 09:17:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (rb_fix_mul_fix): multiply converted values, not
- object VALUEs.
+ * string.c (rb_str_gsub_bang): do not allocate temporary string.
-Mon Mar 21 20:18:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (rb_str_sub_bang): use inline replace.
- * common.mk (TEST_EXCLUDES, EXCLUDE_TESTFRAMEWORK): use full spell
- long option.
+Wed Jul 29 00:36:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL): suppress path name
- conversions by msys2. [ruby-dev:49525] [Bug #12199]
+ * hash.c (hash_s_new): the default value can be specified.
-Mon Mar 21 19:09:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (hash_default): method to set the default value.
- * string.c (enc_succ_alnum_char): try to skip an invalid character
- gap between GREEK CAPITAL RHO and SIGMA.
- [ruby-core:74478] [Bug #12204]
+ * hash.c (hash_aref): now returns the default value.
-Mon Mar 21 18:55:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 28 13:03:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * node.c (rb_gc_mark_node): NODE_MATCH2 can have nd_args, u3,
- since r54100.
+ * array.c (ary_s_new): argument to specify initial value is added.
-Sun Mar 20 21:17:13 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * array.c (ary_s_new): specifies size, not capacity.
- * internal.h (rb_int128t2big): declare only when HAVE_INT128_T.
- fixed a compile error with VC++ introduced at r54203.
+Mon Jul 27 12:39:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Mar 20 20:10:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (str_replace): zero fill for expansion gap.
- * internal.h (DLONG): defined if long is 32bit (and LONG_LONG is 64bit;
- but LONG_LONG is always defined as 64bit), or there's int128_t.
+ * regex.c (mbctab_euc): set flags on for 0xA1-0xFE. suggested by
+ <inaba@st.rim.or.jp>.
- * internal.h (DL2NUM): defined if DLONG is defined.
+ * string.c (str_inspect): consider current_mbctype.
- * internal.h (rb_fix_mul_fix): defined for `Fixnum * Fixnum`.
+Sun Jul 26 15:37:11 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * insns.def (opt_mul): use rb_fix_mul_fix().
+ * array.c (ary_s_new): Array.new(1<<30) dumps core.
- * numeric.c (fix_mul): ditto.
+Fri Jul 24 13:40:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (mul): ditto.
+ * version 1.1c1 released.
-Sun Mar 20 18:53:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jul 24 02:10:22 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (fix_gt, fix_ge, fix_lt, fix_le): optimize comparisons
- Fixnum against Bignum by rb_big_cmp in inversed order without
- new Bignum instance.
+ * marshal.c (r_bytes2): allocated buffer size was too short.
-Sun Mar 20 18:44:52 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * marshal.c (w_object): saves all options, not only casefold flag.
- * time.c (add): remove FIXABLE() which is in LONG2NUM().
+ * re.c (reg_clone): now copies options properly.
- * time.c (sub): ditto.
+ * re.c (reg_get_kcode): code number was wrong.
- * time.c (mul): ditto.
+Thu Jul 23 13:11:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Mar 20 04:46:02 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_attr): argument should be symbol or string.
- * bignum.c (rb_big_cmp): reduce the code.
+Wed Jul 22 11:59:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_eq): If normalized bignum is still bignum,
- it must be larger than fixnum.
+ * regex.c (calculate_must_string): wrong offset added.
-Sat Mar 20 00:58:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Wed Jul 22 11:59:59 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/intern.h (rb_big_odd_p, rb_big_even_p): move to
- internal.h so that they are exported only for ruby itself.
+ * st.c (rehash): still had a GC problem. fixed.
- * internal.h (rb_big_odd_p, rb_big_even_p): ditto.
+Tue Jul 21 13:19:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Mar 19 21:56:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (gc_mark_threads): crashed on GC before thread allocation.
- * test/lib/test/unit.rb (Test::Unit::StatusLine#failed): defer
- failed messages until the end in verbose mode, to get rid of
- interleaving failures with progress messages.
+ * st.c (rehash): GC during rehash caused SEGV.
-Sat Mar 19 21:53:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jul 21 01:25:10 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (fix_cmp): invert the result as the comparison is
- inverted.
+ * sprintf.c (f_sprintf): integer formatter totally re-written.
-Sat Mar 19 18:32:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * sprintf.c (remove_sign_bits): support uppercase hexadecimal.
- * numeric.c (int_to_f): raise NotImplementedError when a receiver
- class is unknown.
+Sat Jul 18 00:14:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/-ext-/integer/test_my_integer.rb (test_my_integer_to_f): modify
- a test for the above change.
+ * sprintf.c (f_sprintf): proper sign position for %X and %O.
-Sat Mar 19 18:21:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Fri Jul 17 14:10:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (Bignum#<=>): remove it because they are unified with
- Integer#<=>.
+ * version 1.1c0 released.
- * numeric.c (Integer#<=>, Fixnum#<=>): move <=> method from Fixnum to
- Integer.
+Fri Jul 17 08:01:49 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * numeric.c (int_cmp): add this method for Integer#<=>.
+ * process.c (f_exec): Check_SafeStr() added.
- * test/-ext-/integer/test_my_integer.rb (test_my_integer_cmp): add a
- test to examine Integer#<=> for unknown subclasses.
+ * process.c (f_system): Check_SafeStr() moved before fork().
-Sat Mar 19 14:46:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jul 16 22:58:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * iseq.c (rb_iseq_compile_with_option): make the parser in mild
- error.
+ * string.c (scan_once): substrings to the block should not be
+ tainted. use reg_nth_match(), not str_substr().
- * load.c (rb_load_internal0): ditto.
+ * string.c (str_substr): needed to transfer taint.
- * parse.y (yycompile0): return the error message within the error
- to be raised. [Feature #11951]
+Thu Jul 16 16:15:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (parser_compile_error): accumulate error messages in the
- error_buffer.
+ * gc.c (xmalloc): object allocation count added to GC trigger.
-Sat Mar 19 03:57:13 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (thread_save_context): avoid marking uninitialized stack
+ in thread_mark. GC may be triggered by REALLOC_N().
- * time.c (LOCALTIME): organize #ifdefs.
+Wed Jul 15 15:11:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * time.c (GMTIME): define only ifndef HAVE_STRUCT_TM_TM_GMTOFF.
+ * experimental release 1.1b9_31.
-Sat Mar 19 03:53:31 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Wed Jul 15 15:05:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in (rb_cv_member_struct_tm_tm_gmtoff): For Linux (glibc)
- define _BSD_SOURCE for time.h to define struct tm.tm_gmtoff.
+ * eval.c (thread_create): exit() and abort() in threads now
+ forwarded to main_thread.
- * time.c: define _BSD_SOURCE at the top.
+Tue Jul 14 14:03:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Mar 19 03:00:50 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * variable.c (obj_instance_variables): list names that is not
+ instance variables.
- * test/-ext-/time/test_new.rb (test_timespec_new): change a gmtoff
- test to a better one that does not depend on whether the current
- time is in summer time or not.
+ * gc.c (GC_MALLOC_LIMIT): choose smaller limit value.
-Fri Mar 19 00:00:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Mon Jul 13 12:39:38 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_to_f, Bignum#to_f): removed them because they are
- unified with int_to_f and Integer#to_f.
+ * object.c (str2cstr): should not return NULL.
- * numeric.c (int_to_f): treat Bignum values directly.
+Fri Jul 10 11:51:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 18 23:41:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * parse.y (gettable): needed to add dyna_in_block() check.
- * numeric.c (int_to_f, fix_to_f): rename fix_to_f to int_to_f, and add
- treatment for subclasses which don't have definitions of to_f method.
+Thu Jul 9 17:38:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (Integer#to_f, Fixnum#to_f): move to_f method from Fixnum
- to Integer.
+ * experimental release 1.1b9_30.
- * ext/-test-/integer/my_integer.c: define helper class for testing
- to_f method for a subclass of Integer.
+Thu Jul 9 16:01:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/-test-/integer/extconf.rb: ditto.
+ * sprintf.c (fmt_setup): format specifier for long needed.
- * ext/-test-/integer/init.c: ditto.
+ * sprintf.c (f_sprintf): ditto.
- * test/-ext-/integer/test_my_integer.rb: examine to_f method for a
- subclass of Integer.
+ * numeric.c (fix2str): ditto.
-Fri Mar 18 22:32:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (thread_create): no more ITIMER_REAL.
- * include/ruby/intern.h (rb_big_hash): Move to internal.h.
+ * eval.c (thread_create): thread finalization needed before
+ aborting thread if thread_abort is set.
- * internal.h: ditto.
+Wed Jul 8 18:17:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 18 22:10:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * bignum.c (big_pow): abandon power by bignum (too big).
- * bignum.c (Bignum#eql?): remove its definition because it is unified
- with Numeric#eql?.
+Tue Jul 7 13:58:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (num_eql): treat Bignum values directly.
+ * eval.c (rb_catch): add C level catch/throw feature.
-Fri Mar 18 21:57:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Mon Jul 6 15:18:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_to_s, Bignum#to_s): remove its definition because
- it is unified with Integer#to_s.
+ * parse.y (arg): proper return values for `||=' and `&&='.
- * numeric.c (int_to_s): treat Bignum values directly.
+Fri Jul 3 16:05:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 18 21:30:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * experimental release 1.1b9_29.
- * numeric.c (int_to_s): Move from fix_to_s.
+Fri Jul 3 11:20:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (Integer#to_s): Move from Fixnum#to_s.
+ * marshal.c (r_byte): byte should not extend sign bit.
-Fri Mar 18 16:22:24 2016 Victor Nawothnig <Victor.Nawothnig@gmail.com>
+ * numeric.c (fix_mul): use FIX2LONG() instead of FIX2INT() for
+ 64bit architectures.
- * parse.y (parse_numvar): NTH_REF must be less than a half of
- INT_MAX, as it is left-shifted to be ORed with back-ref flag.
- [ruby-core:74444] [Bug#12192] [Fix GH-1296]
+ * marshal.c (r_bytes): remove weird casting between pointer and int.
-Fri Mar 18 12:25:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (proc_setsid): new method Process#setsid().
- * gc.c (tick): fix missing close parenthesis. [Fix GH-1291]
+Thu Jul 2 12:49:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 18 10:24:12 2016 Naotoshi Seo <sonots@gmail.com>
+ * marshal.c (w_object): remove `write_bignum' label for 64bit
+ architectures.
- * ext/date/date_core.c (datetime_to_time): preserve timezone info
- [Bug #12189] [Fix GH-1295]
+ * marshal.c (r_bytes): needs int, not long.
-Fri Mar 18 10:17:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Wed Jul 1 14:21:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_big_hash): make it public function to be available in
- other source files, and remove documentation comment for Bignum#hash.
+ * numeric.c (flo_plus): should not allow addition with strings.
- * bignum.c (Bignum#hash): remove its definition because it is unified
- with Object#hash.
+Wed Jul 1 13:09:01 1998 Keiju ISHITSUKA <keiju@rational.com>
- * include/ruby/intern.h (rb_big_hash): add a prototype declaration.
+ * numeric.c (num_uminus): wrong coerce direction.
- * hash.c (any_hash): treat Bignum values directly.
+Tue Jun 30 10:13:44 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 18 02:35:12 2016 Naotoshi Seo <sonots@gmail.com>
+ * io.c (f_p): accepts arbitrary number of arguments.
- * lib/time.rb (parse, strptime): Fix Time.parse/strptime does not
- have compatibility with DateTime.parse/strptime in terms of parsing
- timezone [Bug #12190] [Fix GH-1297]
+ * eval.c (rb_yield_0): there's some case that iterator_p() returns
+ true even if the_block was not set. check added.
-Fri Mar 18 02:17:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Tue Jun 30 01:05:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (fix_zero_p, fix_even_p, fix_odd_p): remove needless
- functions.
+ * eval.c (BEGIN_CALLARGS): adjust the_block before evaluating the
+ receiver's value and the arguments.
-Fri Mar 18 02:15:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Fri Jun 26 18:02:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (int_even_p): treat Fixnum and Bignum values directly.
+ * experimental release 1.1b9_28.
-Fri Mar 18 02:07:00 2016 Kenta Murata <mrkn@mrkn.jp>
+Fri Jun 26 11:01:26 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * bignum.c (Bignum#even?, Bignum#odd?): remove definitions
- because they are unified with Integer#even? and Integer#odd?.
+ * string.c (str_aset_method): needed to convert to string.
- * numeric.c (Fixnum#zero?, Fixnum#even?, Fixnum#odd?): remove
- definitions because they are unified with Numeric#zero?,
- Integer#even?, and Integer#odd?.
+Thu Jun 25 02:05:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (num_zero_p, int_odd_p): treat Fixnum and
- Bignum values directly.
+ * regex.c (re_search): optimize for `.*' at beginning of the
+ pattern.
- * test/ruby/test_integer.rb (test_odd_p_even_p): remove meaningless
- test case.
+ * regex.c (re_search): optimize for character class repeat at
+ beginning of the pattern.
-Fri Mar 18 01:51:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * regex.c (re_compile_pattern): detect optimization potential for
+ the compiled patterns.
- * bignum.c (rb_big_even_p, rb_big_odd_p): make them public functions
- to be available in other source files.
+Thu Jun 25 00:02:26 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * include/ruby/intern.h (rb_big_even_p, rb_big_odd_p): add prototype
- declarations.
+ * re.c (reg_s_new): flag value was wrong.
-Fri Mar 18 00:25:56 2016 Tanaka Akira <akr@fsij.org>
+Wed Jun 24 23:45:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enum.c (ary_inject_op): Implement the specialized code for sum of
- float numbers.
+ * regex.c (re_search): wrong anchor handling for reverse search.
-Fri Mar 18 00:15:05 2016 Yusuke Endoh <mame@ruby-lang.org>
+Wed Jun 24 02:18:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (num_step): use rb_equal for zero check. rb_num_coerce_cmp
- created an object which caused extra overhead.
+ * parse.y (mlhs): `((a,b)),c = [[1,2]],3' assigns a=1,b=2,c=3.
-Thu Mar 17 22:21:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jun 23 11:46:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * include/ruby/ruby.h (RB_GC_GUARD_PTR): remove intermediate
- macro, and expand for each RB_GC_GUARD. [Fix GH-1293]
+ * parse.y (yylex): `&&=' and `||=' added.
-Thu Mar 17 22:08:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Jun 20 02:53:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * compile.c (iseq_specialized_instruction): move specialization
- for opt_newarray_max/min from translation phase.
+ * parse.y (assignable): nesting local variables should have higher
+ priority than normal local variables for assignment too.
-Thu Mar 17 21:52:09 2016 Yusuke Endoh <mame@ruby-lang.org>
+Fri Jun 19 18:28:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * array.c, enum.c: make rdoc format consistent.
+ * experimental release 1.1b9_27.
-Thu Mar 17 21:47:57 2016 Yusuke Endoh <mame@ruby-lang.org>
+Fri Jun 19 14:34:49 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * NEWS: add Array#max, #min, and the optimization. [Feature #12172]
+ * eval.c (assign): support hack for nested multiple assignment.
-Thu Mar 17 21:45:02 2016 Yusuke Endoh <mame@ruby-lang.org>
+ * parse.y (mlhs): nested multiple assignment.
- * compile.c (NODE_CALL): add optimization shortcut for Array#max/min.
- Now `[x, y].max` is optimized so that a temporal array object is not
- created in some condition. [Feature #12172]
+ * eval.c (rb_eval): in-block variables now honors static scope.
- * insns.def (opt_newarray_max, opt_newarray_min): added.
+ * configure.in: RSHIFT check moved to configure.
-Thu Mar 17 21:35:52 2016 Yusuke Endoh <mame@ruby-lang.org>
+Thu Jun 18 16:46:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * array.c (rb_ary_max, rb_ary_min): implement Array#max and min with
- arguments. replace super call with rb_nmin_run.
+ * experimental release 1.1b9_26.
- * enum.c (nmin_run): exported (as rb_nmin_run).
+Thu Jun 18 13:37:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h: added a prototype for rb_nmin_run.
+ * file.c (file_s_ftype): uses lstat(2) instead of stat(2).
-Thu Mar 17 21:24:52 2016 Yusuke Endoh <mame@ruby-lang.org>
+ * dir.c (dir_s_glob): there can be buffer overrun, check added.
- * array.c (rb_ary_max, rb_ary_min): implement a block by itself instead
- of delegating Enumerable#max/min.
+ * eval.c (f_binding): handles in-block variables declared after
+ binding's generation.
-Thu Mar 17 21:09:34 2016 Yusuke Endoh <mame@ruby-lang.org>
+ * numeric.c (flo_floor): floor, ceil, round added to Float.
- * array.c (rb_ary_max, rb_ary_min): Array#max and Array#min added.
- [Feature #12172]
+Wed Jun 17 11:20:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (OPTIMIZED_CMP): moved from enum.c so that array.c can
- use it.
+ * parse.y (gettable): nesting local variables should have higher
+ priority than normal local variables.
- * test/ruby/test_array.rb (test_max, test_min): tests for Array#max
- and Array#min.
+Tue Jun 16 12:30:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_enum.rb (test_max, test_min): revised a bit to test
- Enumerable#max and #min explicitly.
+ * bignum.c (str2inum): handles `+ddd'.
-Thu Mar 17 21:02:42 2016 Yusuke Endoh <mame@ruby-lang.org>
+ * struct.c (make_struct): name parameter can be nil for unnamed
+ structures.
- * internal.c: struct cmp_opt_data added for refactoring out a data
- structure for CMP_OPTIMIZABLE
+Mon Jun 15 16:30:10 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * array.c (struct ary_sort_data): use struct cmp_opt_data.
+ * object.c (class_s_inherited): prohibiting to make subclass of
+ class Class.
- * enum.c (struct min_t, max_t, min_max_t): use struct cmp_opt_data.
+ * object.c (module_s_new): support for making subclass of Module.
-Thu Mar 17 20:55:21 2016 Tanaka Akira <akr@fsij.org>
+ * parse.y (yycompile): clear eval_tree before compiling.
- * enum.c (ary_inject_op): Extracted from enum_inject.
+Fri Jun 12 17:58:18 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 17 18:39:04 2016 Tanaka Akira <akr@fsij.org>
+ * eval.c (eval): write back the_dyna_var into the block.
- * enum.c (enum_inject): Implement the specialized code for sum of
- integers including Bignums.
+Thu Jun 11 18:19:18 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * internal.h (rb_fix_plus): Declared to be usable from enum_inject.
+ * experimental release 1.1b9_25.
- * numeric.c (rb_fix_plus): Defined.
+ * eval.c (dvar_add_compiling): register dyna_var at compile time.
-Thu Mar 17 17:20:28 2016 Anton Davydov <antondavydov.o@gmail.com>
+ * regex.c (re_compile_pattern): RE_DUP_MAX iteration is too big.
- * thread_sync.c: [DOC] Update documentation for Queue class
- description. [Fix GH-1292]
+Wed Jun 10 15:12:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 17 17:14:51 2016 Dinar Valeev <dvaleev@suse.com>
+ * io.c (io_eof): do not block other threads.
- * gc.c (tick): Use __builtin_ppc_get_timebase for POWER arch.
- [Fix GH-1291]
+ * signal.c (trap): reserve SIGALRM for thread.
-Thu Mar 17 11:51:48 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (thread_create): use ITIMER_REAL also to avoid system
+ call blocking.
- * lib/securerandom.rb (gen_random): to avoid blocking on Windows.
- On Windows OpenSSL RAND_bytes (underlying implementation is
- RAND_poll in crypto/rand/rand_win.c) may be blocked at
- NetStatisticsGet.
- https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
- Instead of this, use Random.raw_seed directly (whose implementation
- CryptGenRandom is one of the source of
- entropy of RAND_poll on Windows).
- https://wiki.openssl.org/index.php/Random_Numbers
- Note: CryptGenRandom function is PRNG and doesn't check its entropy,
- so it won't block. [Bug #12139]
- https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
- https://tools.ietf.org/html/rfc4086#section-7.1.3
- https://eprint.iacr.org/2007/419.pdf
- http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
+ * io.c (f_syscall): add TRAP_BEG, TRAP_END around system calls.
-Thu Mar 17 12:09:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (io_ctl): add TRAP_BEG, TRAP_END around system calls.
- * enc/unicode.c: Fixed two macro definitions.
- * test/ruby/enc/test_case_mapping.rb: Test cases that detected
- the above bugs.
+ * enum.c (enum_collect): did not collect false values.
-Thu Mar 17 11:36:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (ary_new2): forgot to initialize capa field.
- * ext/socket/option.c (inspect_tcpi_msec): more accurate condition
- for TCPI msec member inspection function.
- [ruby-core:74388] [Bug #12185]
+Tue Jun 9 18:36:15 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Mar 17 08:13:43 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * string.c (str_split_method): split dumped core for "\xff".
- * test/-ext-/time/test_new.rb (test_timespec_new): Time#gmtoff values
- are the same only when both or neither of the Time objects are in
- summer time (daylight-saving time).
+Tue Jun 9 16:22:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Mar 17 07:17:36 2016 Eric Hodel <drbrain@segment7.net>
+ * experimental release 1.1b9_24.
- * marshal.c (r_object0): raise ArgumentError when linking to undefined
- object.
+Tue Jun 9 16:04:07 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Mar 17 00:45:00 2016 Kenta Murata <mrkn@mrkn.jp>
+ * ext/kconv/kconv.c (kconv_guess): more precise decision for EUC,
+ using jless algorithm (3 sequential EUC hiragana characters).
- * test/ruby/test_bignum.rb: Make sure to use Bignum values in the tests.
+Tue Jun 9 15:12:44 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 16 23:10:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/kconv/kconv.c (kconv_guess): wrong guess for EUC as SJIS in
+ some cases (0xe0 - 0xef).
- * defs/keywords (alias, undef): symbol literals are allowed.
+ * gc.c (xmalloc): insert size check for big (negative in signed)
+ allocation size.
- * parse.y (parse_percent): should parse symbol literals for alias
- and undef. [ruby-dev:47681] [Bug #8851]
+Tue Jun 9 02:54:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 16 21:39:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * lib/parsedate.rb: wday moved to the last in the return values.
- * enc/trans/JIS: update Unicode's notice. [Bug #11844]
+Mon Jun 8 10:40:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 16 20:03:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (str_split_method): split dumped core for "\0".
- * proc.c (proc_binding): proc from symbol can not make a binding.
- [ruby-core:74100] [Bug #12137]
+Sat Jun 6 22:50:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 16 18:42:45 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * regex.c (calculate_must_string): wrong condition for
+ {start,stop}_nowidth.
- * test/ruby/enc/test_case_mapping.rb: Fixed and activated a test for Cherokee.
+ * regex.c (re_match): various features imported from GNU regex.c
+ 0.12, such as nested grouping, avoiding infinite loop with empty
+ match, etc.
-Wed Mar 16 17:58:56 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * regex.c (register_info_type): now use union.
- * test/ruby/enc/test_case_mapping.rb: Fixed a logical error.
+ * regex.c (re_search): more precise anchor(^) check.
-Wed Mar 16 17:57:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Wed Jun 3 18:07:54 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_case_mapping.rb: Adding tests for Cherokee.
- One test not yet working.
- (with Kimihito Matsui)
+ * re.c (reg_raise): check rb_in_compile, not rb_in_eval.
-Wed Mar 16 15:44:05 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Jun 1 05:26:06 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * test/ruby/enc/test_case_mapping.rb: Adding tests for actual Unicode
- case mapping. Fixing some aliasing issues.
- (with Kimihito Matsui)
+ * string.c (trnext): casting to signed char* needed.
-Tue Mar 15 21:38:28 2016 Tanaka Akira <akr@fsij.org>
+Tue Jun 2 16:00:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enum.c (enum_inject): Consider redefinition of Fixnum#+.
- [ruby-dev:49510] [Bug#12178] Reported by usa.
+ * ext/socket/socket.c (udp_addrsetup): error check enhanced.
-Tue Mar 15 20:32:57 2016 Tanaka Akira <akr@fsij.org>
+ * ext/socket/socket.c (sock_s_getservbyaname): use strtoul(), if
+ possible.
- * enum.c (enum_inject): Implement the specialized code for :+ operator
- for Fixnums.
+Sat May 30 07:10:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 15 20:21:01 2016 Tanaka Akira <akr@fsij.org>
+ * re.c (reg_prepare_re): no more needless regular expression
+ recompile on casefold conditions.
- * enum.c (enum_inject): Implement the specialized code for self is an
- array and a symbol operator is given.
+Thu May 28 18:02:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 15 16:29:51 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * object.c (nil_plus): no more `+' method for nil.
- * enc/unicode.c: Eliminating common code.
- (with Kimihito Matsui)
+Wed May 27 17:33:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 15 16:17:09 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * hash.c (hash_fetch): new method.
- * enc/unicode.c: Expansion of some code repetition in preparation for
- elimination of common code pieces.
- (with Kimihito Matsui)
+ * regex.c (re_search): check whether translate table is set.
-Tue Mar 15 13:49:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue May 26 11:39:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Additional macros and code to use mapping data in
- CaseMappingSpecials array.
- (with Kimihito Matsui)
+ * experimental release 1.1b9_23.
-Tue Mar 15 13:41:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yylex): no UPLUS/UMINUS for 1st argument if
+ parenthesises are omitted.
- * internal.h (rb_gc_mark_global_tbl): should be private,
- but was accidentally exported.
+Tue May 26 01:09:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 15 12:51:06 2016 Marcus Stollsteimer <sto.mar@web.de>
+ * regex.c (re_compile_pattern): (?XI) for turns off the
+ corresponding option.
- * doc/extension.ja.rdoc: Fix RDoc markup in doc/extension*.rdoc.
- [ci skip][Bug #12143][ruby-core:74143]
- * doc/extension.rdoc: ditto.
+Mon May 25 12:38:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 15 09:56:41 2016 Ian Lunderskov <ian.lunderskov@gmail.com>
+ * regex.c (re_compile_pattern): inline i option (?i).
- * time.c: Minor typo in Time#dst? documentation.
- [ci skip][fix GH-1290]
+ * regex.c (re_compile_pattern): inline x option (?x).
-Tue Mar 15 04:36:41 2016 Charles Oliver Nutter <headius@headius.com>
+ * regex.c (re_compile_pattern): x option for regexp.
- * test/ruby/test_rubyoptions.rb (test_disable): add tests for
- --disable-gems and --disable-did_you_mean.
+ * dir.c (dir_s_open): returns block's evaluated value.
-Tue Mar 15 03:35:04 2016 Eric Hodel <drbrain@segment7.net>
+ * io.c (f_open): returns block's evaluated value.
- * marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
+ * ext/curses/curses.c (curses_addstr): nil argument caused SEGV.
-Tue Mar 15 01:22:27 2016 Charles Oliver Nutter <headius@headius.com>
+Fri May 22 11:52:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_rubyoptions.rb: make version matching support
- JRuby's version output.
+ * regex.c (re_compile_pattern): push mark on (?:), so that
+ laststart check for {a,b} can be done.
-Mon Mar 14 19:05:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Thu May 21 17:31:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (big2str_2bdigits): reduce div instruction.
+ * regex.c (re_match): wrong match (too non-greedy) for `{a,b}?'.
-Mon Mar 14 18:39:53 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (io_lineno): new method IO#lineno, IO#lineno=.
- * include/ruby/oniguruma.h, enc/unicode.c: Adjusting flag assignments
- and macros to work with unified CaseMappingSpecials array.
- (with Kimihito Matsui)
+Wed May 20 06:04:43 1998 MAEDA shugo <shugo@aianet.ne.jp>
-Mon Mar 14 16:53:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * BeOS patch.
- * compile.c (compile_named_capture_assign): optimize named capture
- assignments, by replacing repeating global variable accesses
- with `dup`, and by returning the matched result instead of
- re-getting it from the MatchData.
+Wed May 20 16:32:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (reg_named_capture_assign_gen): build just assignment
- nodes for the optimization.
+ * bignum.c (BIGDN): use RSHIFT(), instead of mere `>>'.
-Mon Mar 14 16:02:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue May 19 16:36:26 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * file.c (ruby_is_fd_loadable): now return -1 if loadable but
- may block.
+ * experimental release 1.1b9_22.
- * ruby.c (open_load_file): wait to read by the result of
- ruby_is_fd_loadable, without fstat.
+Tue May 19 16:31:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Mar 14 13:38:38 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (assignable): specification changed for in-block
+ variable definition.
- * numeric.c (fix2str): improve r54092 like rb_int2big().
+ * eval.c (dyna_var_asgn): error in in-block variables' compile
+ time definition.
-Mon Mar 14 10:02:23 2016 Eric Wong <e@80x24.org>
+ * parse.y (str_extend): wrong nesting detection.
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
- [ruby-core:73803] [Bug #12069]
+Tue May 19 09:47:55 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Sun Mar 13 09:43:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * numeric.c (num2int): re-defined (extensions may use this).
- * include/ruby/win32.h (O_SHARE_DELETE): change to fit Fixnum
- limit. [ruby-core:74285] [Bug #12171]
+Mon May 18 16:40:50 1998 MAEDA shugo <shugo@aianet.ne.jp>
-Sun Mar 13 09:15:45 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (get_syserr): BeOS support.
- * numeric.c (rb_fix2str): fix edge case, accidentally generated
- wrong Fixnum from LONG_MIN.
+ * configure.in: modified for BeOS.
-Sat Mar 12 09:50:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (str_dump): do not call isascii().
- * vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
- cannot enclose non-identifier characters.
- a patch by Sebastian S in [ruby-core:74278]. [Bug#12170]
+ * sprintf.c (remove_sign_bits): forgot to initialize end pointer.
-Sat Mar 12 02:44:48 2016 Tanaka Akira <akr@fsij.org>
+ * glob.c: #include <alloca.h> added.
- * test/lib/test/unit.rb: describe !/REGEXP/ in the help message.
+Mon May 18 14:52:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 11 17:03:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * experimental release 1.1b9_21.
- * test/lib/test/unit.rb (Options#non_options): make regexp name
- options prefixed with "!" negative filters.
+Mon May 18 03:27:57 1998 MAEDA shugo <shugo@aianet.ne.jp>
- * common.mk (TEST_EXCLUDES): use negative filter to exclude memory
- leak tests. -x option excludes test files, not test methods.
+ * file.c (file_s_expand_path): optional second argument
+ `default_directory' added.
-Fri Mar 11 16:11:27 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat May 16 22:06:52 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * enc/unicode/case-folding.rb, casefold.h: Streamlining approach to
- case mapping data not available from case folding by unifying all
- three cases (special title, special upper, special lower).
- * enc/unicode.c: Adjust macro names for above (macros are currently inactive).
- (with Kimihito Matsui)
+ * error.c (RAISE_ERROR): wrong error message
-Thu Mar 10 17:34:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri May 15 14:43:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * iseq.c (prepare_iseq_build): enable coverage by coverage_enabled
- option, not by parse_in_eval flag in the thread context.
+ * experimental release 1.1b9_20.
- * iseq.h (rb_compile_option_struct): add coverage_enabled flag.
+Thu May 14 14:44:21 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * parse.y (yycompile0): set coverage_enabled flag if coverage
- array is made.
+ * sun4 cc patches for intern.h and regex.h.
-Thu Mar 10 15:19:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu May 14 14:03:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * node.c (dump_option): nd_compile_option is a hidden hash object,
- cannot call inspect on it.
+ * random.c (RANDOM_MAX): guessing proper maximum value for random
+ numbers.
-Thu Mar 10 09:49:54 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * random.c (f_rand): use drand48 if possible.
- * test/socket/test_socket.rb (test_udp_recvmsg_truncation):
- AIX does not set the MSG_TRUNC flag for a message partially read
- by recvmsg(2) with the MSG_PEEK flag set.
+Wed May 13 19:05:20 1998 MAEDA shugo <shugo@aianet.ne.jp>
-Wed Mar 9 16:48:45 2016 Koichi Sasada <ko1@atdot.net>
+ * BeOS patches for io.c, error.c and config.guess.
- * benchmark/driver.rb: fix my last commit (syntax error).
+Wed May 13 14:56:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 9 16:41:44 2016 Koichi Sasada <ko1@atdot.net>
+ * experimental release 1.1b9_19.
- * benchmark/driver.rb: fix output messages.
+ * most of the Mac and BeOS patches merged, except path separators.
- * benchmark/memory_wrapper.rb: use respond_to? because
- member? does not work well.
+ * error.c (err_append): generated SyntaxError was String.
-Wed Mar 9 16:20:25 2016 Koichi Sasada <ko1@atdot.net>
+ * ruby.h: xxx2INT, xxx2UINT checks values as int, not long.
- * benchmark/driver.rb: support memory usage benchmark.
- use `--measure-target=[target]'.
- Now, we can use the following targets:
- * real (default): real time which returns process time in sec.
- * peak: peak memory usage (physical memory) in bytes.
- * size: last memory usage (physical memory) in bytes.
+ * ruby.h: remove typedef's. INT, UINT, UCHAR, USHORT.
- * benchmark/memory_wrapper.rb: ditto.
+Tue May 12 17:38:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 9 15:04:22 2016 Koichi Sasada <ko1@atdot.net>
+ * experimental release 1.1b9_18.
- * benchmark/bm_vm3_gc_old_full.rb: add GC.start benchmark.
+Tue May 12 11:38:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * benchmark/bm_vm3_gc_old_immediate.rb: ditto.
+ * error.c (syserr_errno): returns errno of the SystemCallError.
- * benchmark/bm_vm3_gc_old_lazy.rb: ditto.
+ * error.c (rb_sys_fail): saves errno in the Exception.
-Wed Mar 9 14:59:11 2016 Koichi Sasada <ko1@atdot.net>
+ * error.c (set_syserr): no need to protect syserr_list.
- * benchmark/driver.rb: exit benchmarking if a benchmark process
- receives signals.
+ * error.c (rb_sys_fail): no more bufsize limit.
-Wed Mar 9 13:22:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (set_syserr): integer value of errno can be accessed by
+ Errno::EXXX::Errno.
- * test/lib/memory_status.rb: make Memory::Status independent of
- MiniTest::Skip.
+Sun May 10 03:10:33 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
- * test/lib/test/unit/assertions.rb (assert_no_memory_leak): skip
- if Memory::Status is not available.
+ * io.c (io_tell etc.): moved from File class to IO class.
-Wed Mar 9 09:19:55 2016 Rei Odaira <Rei.Odaira@gmail.com>
+Fri May 8 12:26:37 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/io/wait/test_io_wait.rb (test_wait_readwrite_timeout):
- select(2) in AIX returns "readable" for the write-side fd
- of a pipe, so it is not possible to use a pipe to test
- the read-write timeout of IO#wait on AIX.
+ * pack.c (pack_unpack): should be unsigned int (was signed int).
-Wed Mar 9 03:35:22 2016 Charles Oliver Nutter <headius@headius.com>
+Thu May 7 16:34:10 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_require.rb (test_require_with_loaded_features_pop):
- Only remove PATH so threads don't accidentally double-pop.
+ * pack.c (pack_pack): `V', `N' uses newly created NUM2UINT().
-Wed Mar 9 00:29:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.h (NUM2UINT): new macro.
- * vm_method.c (rb_alias): the original name should be properly
- available method_added method, set the name before calling the
- hook.
+ * bignum.c (big2uint): try to convert bignum into UINT.
-Wed Mar 9 00:07:03 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (reg_match): needed to return false for match with nil.
- * lib/logger.rb (Logger::LogDevice#initialize): define using
- keyword arguments.
+ * gc.c (obj_free): wrong condition to free string.
-Tue Mar 8 23:37:07 2016 Charles Oliver Nutter <headius@headius.com>
+Wed May 6 21:08:08 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * test/ruby/test_array.rb: split out the test for no stack error
- on large input for test_permutation, test_repeated_permutation,
- and test_repeated_combination, and make them all timeout:30.
+ * ruby.c (ruby_process_options): modified for DJGPP.
-Tue Mar 8 17:20:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Wed May 6 15:48:03 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * intern.h (rb_divmod): assume compilers `/` and `%` comply C99
- and reduce branching. If a compiler doesn't comply, add #ifdefs.
+ * experimental release 1.1b9_17.
- * intern.h (rb_div): added for Ruby's behavior.
+Wed May 6 01:37:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * intern.h (rb_mod): added for Ruby's behavior.
+ * eval.c: remove global variable `errat'.
- * insns.def (opt_div): use rb_div.
+ * eval.c (rb_longjmp): embed error position information in the
+ exception object.
- * insns.def (opt_mod): use rb_mod.
+Sat May 2 12:20:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * numeric.c (fixdivmod): removed.
+ * re.c (reg_search): supports reverse search.
- * numeric.c (fix_divide): use rb_div.
+ * string.c (str_index_method): does update $~ etc.
- * numeric.c (fix_mod): use rb_mod.
+ * eval.c (f_load): needed to clear the_dyna_vars.
- * numeric.c (fix_divmod): use rb_divmod.
+ * eval.c (dyna_var_asgn): do not push dyna_var, which is id == 0.
-Tue Mar 8 17:53:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * error.c (Init_Exception): NotImplementError is no longer
+ StandardError, which is not handled by default rescue.
- * insns.def (opt_mod): show its method name on ZeroDivisionError.
- [Bug #12158]
+Fri May 1 00:35:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 8 17:33:38 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * ruby.c (proc_options): `-d' turns on verbose flag too.
- * win32/win32.c (rb_w32_write_console): now no need to check
- ERROR_CALL_NOT_IMPLEMENTED because it is for old Win9X.
+ * error.c (exception): last argument may be the superclass of the
+ defining exception(s).
-Tue Mar 8 16:54:29 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * io.c (Init_IO): EOFError is now subclass of the IOError.
- * win32/win32.c (rb_w32_write_console): stop the VT100 emulation if the
- console supports it natively.
+ * io.c (Init_IO): forgot to define IOError.
-Tue Mar 8 08:13:01 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * error.c (Init_Exception): old Exception class renamed to
+ StandardError. Exception now replaces old GlobalExit.
- * test/net/imap/test_imap.rb (test_idle_timeout): Because of the
- timeout specified in "imap.idle(0.2)", there is no guarantee that
- the server thread has done all the work before the client thread
- performs the assertions. It depends on the thread scheduling.
- Add checks to avoid false positives (on AIX, particularly).
+ * error.c (Init_Exception): Exception is now the root of the
+ Global Exits. There's no longer GlobalExit class.
-Tue Mar 8 00:42:22 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * util.c (ruby_mktemp): check TMP, TMPDIR first.
- * ruby.c (warn_cr_in_shebang): meaningless check on DOSISH platforms.
- fixed a test failure introduced at r53998.
+Thu Apr 30 01:08:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 8 00:27:53 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * lib/tk.rb: call 'unknown', if proc not defined.
- * ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
- [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
+ * eval.c (handle_rescue): default rescue handles `Exceptional' not
+ only the instance of the `Exception's.
+ * eval.c (f_raise): exception can be any object.
-Tue Mar 8 00:25:08 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * time.c (time_gm_or_local): call time_gmtime or time_localtime.
- * ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
- [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
+ * eval.c (f_raise): raises TypeError if the class which is not a
+ subclass of String is specified (checked in exc_new()).
+ * error.c (exc_new): need to check whether invalid class (not a
+ subclass of String) is specified.
-Tue Mar 8 00:21:58 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+Wed Apr 29 21:05:44 1998 WATANABE Hirofumi <eban@os.rim.or.jp>
- * ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
- [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
+ * ruby.c (proc_options): option '-e' via tempfile.
+Tue Apr 28 15:27:58 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 8 00:11:47 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * experimental release 1.1b9_16.
- * ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
- [Bug #11886] The patch provided by Akira Matsuda.
+Tue Apr 28 00:07:38 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/tk/sample/*.rb: ditto.
+ * eval.c (obj_is_proc): type check predicate.
-Mon Mar 7 13:32:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (obj_is_block): ditto.
- * class.c (rb_define_class, rb_define_class_id_under): raise
- ArgumentError if super is 0, deprecated behavior which has been
- warned long time.
+Mon Apr 27 16:59:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Mar 7 13:28:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/gtk/gtk.c (Init_gtk): use timeout, not idle to avoid
+ consuming CPU too much.
- * internal.h: move function declarations for class internals from
- include/ruby/intern.h.
+ * lib/tk.rb: use tcltklib#_invoke instead of `_eval'.
-Mon Mar 7 10:58:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 27 16:59:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/win32ole/win32ole_event.c (rescue_callback): use
- rb_write_error_str instead of rb_write_error, to respect
- the encoding and prevent the message from GC.
+ * array.c (ary_sort): use dup, not clone.
- * internal.h (rb_write_error_str): export.
+Mon Apr 27 13:46:27 1998 Tadahiro Maebashi <maebashi@iij.ad.jp>
-Mon Mar 7 01:38:41 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * ext/tcltklib/tcltklib.c (ip_invoke): invoke tcl command
+ directly. need not worry about escaping tcl characters.
- * test/ruby/test_process.rb (test_execopts_gid): Skip a test
- that is known to fail on AIX. AIX allows setgid to
- a supplementary group, but Ruby does not allow the "-e"
- option when setgid'ed, so the test does not work as intended.
+Mon Apr 27 12:04:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Mar 6 22:43:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * random.c (f_rand): do not call srand() implicitly.
- * io.c (rb_obj_display): [DOC] fix output of Array, as Array#to_s
- is same as Array#inspect since 1.9.
+Fri Apr 24 14:35:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Mar 5 09:50:58 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * experimental release 1.1b9_15.
- * test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
- IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
- on AIX, so skip related tests.
+ * parse.y (assignable): dyna_var_asgn actually defines nested
+ local variables in outer context.
-Sat Mar 5 09:17:54 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * random.c (f_rand): call srand(), if it has not called yet.
- * test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
- The fifth argument to getsockopt(2) should be modified to
- indicate the actual size of the value on return,
- but not in AIX. This is a know bug. Skip related tests.
- * test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
- ditto.
- * test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
- * test/socket/test_basicsocket.rb (test_getsockopt): ditto.
- * test/socket/test_sockopt.rb (test_bool): ditto.
+ * random.c (f_srand): use tv_usec as the default seed.
-Sat Mar 5 07:36:27 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * eval.c (rb_eval): values of nested local variables should be
+ independent.
- * test/-ext-/float/test_nextafter.rb: In AIX,
- nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
- but they should return -0.0 and +0.0, respectively. This is
- a known bug in nextafter(3) on AIX, so skip related tests.
+ * eval.c (rb_yield_0): local variables wrong nested conditions.
-Sat Mar 5 07:14:10 2016 Rei Odaira <Rei.Odaira@gmail.com>
+Wed Apr 22 23:27:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
- Skip two tests on AIX because zconf.h in zlib does not correctly
- recognize _LARGE_FILES in AIX. The problem was already reported
- to zlib, and skip these tests until it is fixed.
+ * io.c (select_get_io): get IO object by `to_io'.
-Sat Mar 5 03:07:40 2016 Rei Odaira <Rei.Odaira@gmail.com>
+ * io.c (io_to_io): method to retrieve IO object, from delegating
+ object for example.
- * thread_pthread.c (getstack): __pi_stacksize returned by
- pthread_getthrds_np() is wrong on AIX. Use
- __pi_stackend - __pi_stackaddr instead.
+Wed Apr 22 16:52:37 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Mar 4 19:19:42 2016 Koichi Sasada <ko1@atdot.net>
+ * experimental release 1.1b9_14.
- * gc.c: use 2 bits with unsigned int for rb_objspace::flags::mode
- because it always returns 0 to 2 (non-negative value).
+ * string.c (str_modify): check for embedded pointer reference.
-Fri Mar 4 18:42:08 2016 Koichi Sasada <ko1@atdot.net>
+ * gc.c (obj_free): ditto.
- * gc.c: rename "enum gc_stat" to "enum gc_mode"
- because there is a same name (no related) function gc_stat().
+ * pack.c (pack_pack): p/P template to embed pointers.
- Also gc_stat_* are renamed to gc_mode_*,
- gc_stat_transition() to gc_mode_transition(),
- rb_objspace::flags::stat is renamed to rb_objspace::flags::mode.
+Wed Apr 22 00:07:10 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- Change rb_objspace::flags::mode from 2 bits to 3 bits because VC++
- returns negative enum value with 2 bits.
+ * array.c (ary_rindex): embarrassing typo.
- * gc.c (gc_mode): add a macro to access rb_objspace::flags::mode
- with verification code (verification is enabled only on
- RGENGC_CHECK_MODE > 0).
+Tue Apr 21 12:31:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c (gc_mode_set): same macro for setter.
+ * experimental release 1.1b9_13.
-Fri Mar 4 09:28:18 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * configure.in (RUBY_LIB): supports --program-{prefix,suffix}.
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.1.
- Please see entries of 2.6.0 and 2.6.1 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
- [fix GH-1270] Patch by @segiddins
+ * array.c (ary_rindex): new method.
-Thu Mar 3 14:09:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_binmode): should return self.
- * lib/ostruct.rb (modifiable?, new_ostruct_member!, table!):
- rename methods for internal use with suffixes and make private,
- [ruby-core:71069] [Bug #11587]
+Tue Apr 21 08:23:04 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Wed Mar 2 16:28:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (here_document): calling parse_string with wrong
+ arguments.
- * vm_eval.c (method_missing): call by found method entry and get
- rid of searching the same method entry twice.
+ * struct.c (struct_aset): problem member assignment with name.
- * vm_eval.c (vm_call0_body): calling method_missing method is
- method_missing().
+Mon Apr 20 14:47:49 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Mar 2 15:13:33 2016 herwinw <herwin@quarantainenet.nl>
+ * experimental release 1.1b9_12.
- * lib/xmlrpc.rb: Removed broken parser named XMLScanStreamParser.
- It's not works with current Ruby version.
- [fix GH-1271][ruby-core:59588][Bug #9369]
- * lib/xmlrpc/config.rb: ditto.
- * lib/xmlrpc/parser.rb: ditto.
+ * time.c (time_arg): args may be string (support for reduced
+ implicit type conversion).
-Wed Mar 2 15:08:33 2016 herwinw <herwin@quarantainenet.nl>
+ * lib/base64.rb: changed to use pack/unpack with `m' template.
- * lib/xmlrpc.rb: Removed broken parser named XMLTreeParser.
- Required gem of its parser didn't compile on newer Ruby versions.
- [fix GH-1271][ruby-core:59590][Bug #9370]
- * lib/xmlrpc/config.rb: ditto.
- * lib/xmlrpc/parser.rb: ditto.
+Mon Apr 20 06:23:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Mar 1 11:25:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (mod_remove_const): new method.
- * lib/fileutils.rb: use keyword arguments instead of option
- hashes.
+Sat Apr 18 03:53:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Feb 29 16:50:20 2016 hanachin <hanachin@gmail.com>
+ * hash.c (hash_each_with_index): removed. use Enumerable's
+ each_with_index instead.
- * array.c (rb_ary_push_m): [DOC] Remove trailing comma from
- Array#push example, as other Array examples doesn't put trailing
- comma. [Fix GH-1279]
+ * class.c (rb_include_module): check for super modules, since
+ module's included modules may be changed.
-Mon Feb 29 16:31:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 17 21:50:47 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * common.mk, tool/mkconfig.rb: set cross_compiling option from
- Makefile, but not from rbconfig.rb, which is just going to be
- created by this command.
+ * marshal.c (r_long): r_byte() may return signed byte.
-Sun Feb 28 23:13:49 2016 C.J. Collier <cjcollier@linuxfoundation.org>
+Fri Apr 17 11:58:30 1998 NAGAI Hidetoshi <nagai@dumbo.ai.kyutech.ac.jp>
- * configure.in: Add summary to end of configure output.
- [Fix GH-1275]
+ * ext/tcltklib/tcltklib.c (lib_mainloop): thread and interrupt check.
-Sun Feb 28 20:23:36 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Fri Apr 17 11:06:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/drb/drb.rb (error_print): Add verbose failure messages and
- avoid infamous DRb::DRbConnError. [Feature #12101]
+ * eval.c (find_file): try to fopen() to check whether file exists.
-Sun Feb 28 13:40:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (load_file): ditto.
- * error.c (nometh_err_initialize): add private_call? parameter.
+ * struct.c (struct_aset): struct member can be set by member name.
- * error.c (nometh_err_private_call_p): add private_call? method,
- to tell if the exception raised in private form FCALL or VCALL.
- [Feature #12043]
+Fri Apr 17 00:47:19 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * vm_eval.c (make_no_method_exception): append private_call?
- argument.
+ * ext/extmk.rb.in: added m68k-human support
- * vm_insnhelper.c (ci_missing_reason): copy FCALL flag.
+ * file.c (LOCK_SH): defines moved.
-Sun Feb 28 10:19:47 2016 Ryan T. Hosford <tad.hosford@gmail.com>
+ * array.c (ary_flatten_bang): simplified loop.
- * array.c (rb_ary_and): clarify that set intersection returns the
- unique elements common to both arrays.
+Thu Apr 16 16:52:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * array.c (rb_ary_or): clarify that union preserves the order from
- the given arrays.
+ * experimental release 1.1b9_11.
-Sat Feb 27 17:05:29 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * lib/tk.rb: thread support (experimental - maybe slow).
- * enc/unicode/case-folding.rb, casefold.h: Reducing size of TitleCase
- table by eliminating duplicates.
- (with Kimihito Matsui)
+ * eval.c (rb_longjmp): trace event on exception in raising
+ context, just before raising exception.
-Fri Feb 26 14:40:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * struct.c (struct_s_members): forgot to check singletons.
- * numeric.c (num_step_scan_args): comparison String with Numeric
- should raise TypeError. it is an invalid type, but not a
- mismatch the number of arguments. [ruby-core:62430] [Bug #9810]
+ * struct.c (struct_aref): members can be accessed by names too.
-Fri Feb 26 14:39:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (ary_flatten): new method.
- * doc/extension.rdoc, doc/extension.ja.rdoc: add editor local
- variables, with commenting out by :enddoc: directives which are
- just ignored unless code object mode. [Bug #12111]
+ * eval.c (rb_longjmp): prints exception information with `-d'.
-Fri Feb 26 12:25:56 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * object.c (any_to_s): remove class name restriction.
- * doc/extension.ja.rdoc: removed rendering error caused by editor specific
- configuration on http://docs.ruby-lang.org/en/trunk/extension_rdoc.html .
- [Bug #12111][ruby-core:73990]
+Thu Apr 16 01:38:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Feb 26 11:21:41 2016 herwinw <herwin@quarantainenet.nl>
+ * file.c (thread_flock): do not block other threads.
- * lib/xmlrpc.rb: Removed references to NQXML. It's obsoleted parser.
- [fix GH-1245][ruby-core:59593][Feature #9371]
- * lib/xmlrpc/config.rb: ditto.
- * lib/xmlrpc/parser.rb: ditto.
+ * eval.c (thread_trap_eval): signals are now delivered to the
+ current thread again. In case that the current thread is dead,
+ signals are forwarded to the main thread.
-Fri Feb 26 11:10:19 2016 Rick Salevsky <rsalevsky@suse.com>
+ * string.c (str_new4): need not to duplicate frozen strings.
- * lib/tmpdir.rb: Unify to coding-style for method definition.
- [fix GH-1252]
+Wed Apr 15 08:33:47 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Fri Feb 26 11:02:04 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * struct.c (struct_inspect): remove restriction for struct names.
- * README.md: update markdown syntax for anchor tag.
- [fix GH-1265] Patch by @lukBarros
+Wed Apr 15 02:55:02 1998 Kazuya 'Sharl' Masuda <sharl@www.ufo.co.jp>
-Fri Feb 26 10:52:29 2016 Alex Boyd <alex@opengroove.org>
+ * x68 patches to config.sub, ext/extmk.rb.in
- * lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
- [fix GH-1205][ruby-core:72773][Bug #11969]
+Wed Apr 15 01:22:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Feb 26 08:11:58 2016 Aaron Patterson <tenderlove@ruby-lang.org>
+ * string.c (str_dup_frozen): do not duplicate frozen strings.
- * gem_prelude.rb: Reduce system calls by activating the `did_you_mean`
- gem before requiring the gem. Activating the gem puts the gem on
- the load path, where simply requiring the file will search every gem
- that's installed until it can find a gem that contains the
- `did_you_mean` file.
+ * parse.y (yylex): allow nested parenthesises.
-Thu Feb 25 19:04:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (obj_displayln): prints newline after `display'ing the
+ receiver.
- * enc/unicode/case-folding.rb: Adding possibility for debugging output
- for TitleCase table in casefold.h.
- (with Kimihito Matsui)
+ * io.c (io_puts): avoid generating "\n" each time. use RS_default
+ instead.
-Wed Feb 24 22:31:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (f_p): ditto.
- * include/ruby/oniguruma.h: Rearranging flag assignments and making
- space for titlecase indices; adding additional macros to add or
- extract titlecase index; adding comments for better documentation.
- * enc/unicode.c: Moving some macros to include/ruby/oniguruma.h;
- activating use of titlecase indices.
- (with Kimihito Matsui)
+Tue Apr 14 22:18:17 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Wed Feb 24 21:03:04 2016 Tanaka Akira <akr@fsij.org>
+ * struct.c (struct_aref): should not subtract negative index.
- * random.c (limited_rand): Add a specialized path for when the limit fits
- in 32 bit.
+Tue Apr 14 11:34:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Feb 23 21:52:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * experimental release 1.1b9_10.
- * enc/unicode/case-folding.rb, casefold.h: Outputting actual titlecase
- data (new table, with indices from other tables).
- * enc/unicode.c: Ignoring titlecase data indices for the moment.
- (with Kimihito Matsui)
+ * parse.y: token names prefixed by `t'.
-Tue Feb 23 15:21:14 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * struct.c (struct_s_def): supports subclassing of Struct.
- * enc/unicode/case-folding.rb, casefold.h: Reading casing data from
- SpecialCasing.txt.
- (with Kimihito Matsui)
+ * io.c (io_s_new): supports subclassing of IO.
-Mon Feb 22 18:33:55 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Apr 13 11:07:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode/case-folding.rb, casefold.h: Adding flag for title-case,
- not yet operational.
- (with Kimihito Matsui)
+ * eval.c (f_binding): need to restore method name.
-Mon Feb 22 18:17:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_call0): raises SystemStackError, not Fatal.
- * enc/unicode/case-folding.rb, casefold.h: Fixed bug that avoided inclusion
- of compatibility characters in upper-/lower-case mappings.
- (with Kimihito Matsui)
+ * io.c (obj_display): same as `print self'.
-Sun Feb 21 13:57:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (f_p): can now be called in the method form.
- * cgi/escape/escape.c: Optimize CGI.unescape performance by C ext
- for ASCII-compatible encodings. [Fix GH-1250]
+ * re.c (reg_regsub): needed to be mbchar aware.
-Sun Feb 21 13:56:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Apr 13 13:18:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * cgi/escape/escape.c: Optimize CGI.unescapeHTML performance by C
- ext for ASCII-compatible encodings. [Fix GH-1242]
+ * eval.c (thread_trap_eval): all signals delivered to main_thread.
-Sat Feb 20 15:38:16 2016 Eric Wong <e@80x24.org>
+Mon Apr 13 12:47:03 1998 TAKAHASHI Masayoshi <maki@inac.co.jp>
- * doc/extension.rdoc: update paths for defs/ directory
+ * re.c (kcode_set_option): did not set SJIS on SJIS condition.
-Sat Feb 20 14:44:15 2016 Lucas Buchala <lucasbuchala@gmail.com>
+Sun Apr 12 22:14:07 1998 Kazunori NISHI <kazunori@swlab.csce.kyushu-u.ac.jp>
- * vm_eval.c (rb_mod_module_eval): [DOC] Fix documentation
- signature for Module#module_eval. [Fix GH-1258]
+ * array.c (ary_uniq_bang): should be `==', not `='. embarrassing.
-Sat Feb 20 14:40:44 2016 Adam O'Connor <northband@gmail.com>
+Sat Apr 11 02:13:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * README.md: a few grammatical changes to the main Ruby README.md.
- [Fix GH-1259]
+ * array.c (ary_subseq): SEGVed for `[][1,1]'.
-Sat Feb 20 13:04:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 10 21:29:06 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * dir.c (push_pattern, push_glob): deal with read paths as UTF-8
- to stat later, on Windows as well as OS X.
- [ruby-core:73868] [Bug #12081]
+ * array.c (ary_subseq): add check for beg larger than array length.
-Sat Feb 20 01:53:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Apr 8 17:24:11 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
- * object.c (rb_mod_const_get): make error message at uninterned
- string consistent with symbols. [ruby-dev:49498] [Bug #12089]
+ * dir.c (dir_s_open): can be called with block (like IO#open).
-Fri Feb 19 23:37:52 2016 Masahiro Tomita <tommy@tmtm.org>
+ * dir.c (dir_s_chdir): print directory path on error.
- * lib/find.rb (Find#find): raise with the given path name if it
- does not exist. [ruby-dev:49497] [Bug #12087]
+ * dir.c (dir_s_chroot): ditto
-Fri Feb 19 12:44:57 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * dir.c (Init_Dir): needed to override `new'.
- * enc/unicode.c: Activated use of case mapping data in CaseUnfold_11 array.
- (with Kimihito Matsui)
+Thu Apr 9 18:24:58 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Feb 19 11:08:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * experimental release 1.1b9_09.
- * ext/extmk.rb: add cygwin case, nothing excluded.
- [ruby-core:73806] [Bug#12071]
+ * string.c (str_cmp): do not depend on sentinel at the end of the
+ strings.
-Thu Feb 18 21:32:15 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * string.c (str_chomp_bang): forgot to set the sentinel.
- * man/irb.1: fix output in EXAMPLES.
+Wed Apr 8 00:59:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Feb 18 21:05:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * bignum.c (big2int): converted int may be too big to fit in
+ signed int.
- * string.c (sym_match_m): delegate to String#match but not
- String#=~. [ruby-core:72864] [Bug #11991]
+ * parse.y (arg): `foo += 1' should not cause an error.
-Thu Feb 18 14:15:38 2016 Shota Fukumori <her@sorah.jp>
+ * variable.c (rb_const_defined): returned false even if the
+ constant is defined at the top level.
- * re.c: Add MatchData#named_captures
- [Feature #11999] [ruby-core:72897]
+ * eval.c (f_local_variables): dyna_var->id may be null. should
+ have checked before calling str_new2().
- * test/ruby/test_regexp.rb(test_match_data_named_captures): Test for above.
+Tue Apr 7 01:15:15 1998 Kaneko Naoshi <wbs01621@mail.wbs.or.jp>
- * NEWS: News about MatchData#named_captures.
+ * re.c (reg_regsub): need to check string boundary.
-Wed Feb 17 21:41:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Apr 7 19:19:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * defs/id.def (predefined): add idLASTLINE and idBACKREF for $_
- and $~ respectively.
+ * string.c (str_cmp): returns either 1, 0, -1.
- * parse.y: use idLASTLINE and idBACKREF instead of rb_intern.
+ * array.c (ary_cmp): should check array length, too
-Wed Feb 17 20:23:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Apr 7 18:50:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (rb_str_init): fix segfault and memory leak, consider
- wide char encoding terminator.
+ * experimental release 1.1b9_08.
-Wed Feb 17 12:14:59 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Tue Apr 7 18:31:27 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * string.c (rb_str_init): introduce String.new(capacity: size)
- [Feature #12024]
+ * instruby.rb (mandir): dll installation for cygwin32
-Tue Feb 16 19:10:08 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue Apr 7 01:16:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode/case-folding.rb, casefold.h: Used only first element
- (rather than all) of target in CaseUnfold_11 array.
- (with Kimihito Matsui)
+ * config.sub (maybe_os): TOWNS support?
-Tue Feb 16 18:24:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * config.guess: too strict check for libc versions on linuxes.
- * numeric.c (compare_with_zero): fix variable name, rb_cmperr
- requires VALUEs but not an ID.
+ * experimental release 1.1b9_07.
-Tue Feb 16 17:34:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (ary_cmp): compare each element using `<=>'.
- * dir.c (rb_dir_s_empty_p): add Dir.empty? method, which tells the
- argument is the name of an empty directory. [Feature #10121]
+ * hash.c (hash_each_with_index): yields [value, key] pair.
-Tue Feb 16 09:51:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * class.c (class_protected_instance_methods): list protected
+ method names.
- * tool/rbinstall.rb (without_destdir): just strip a drive letter
- which is prepended by with_destdir.
- pointed out by @DavidEGrayson.
- https://github.com/ruby/ruby/commit/0e5f9ae#commitcomment-16101763
+ * class.c (ins_methods_i): exclude protected methods.
-Tue Feb 16 04:42:13 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (PUSH_BLOCK): dynamic variables can be accessed from
+ eval() with bindings.
- * insns.def (opt_plus): simply use LONG2NUM() instead of wrongly
- complex overflow case.
+Mon Apr 6 14:49:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * insns.def (opt_sub): ditto.
+ * eval.c (thread_yield): must return evaluated value.
-Tue Feb 16 02:49:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Apr 3 13:07:29 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * tool/rbinstall.rb (without_destdir): compare with the destdir
- after stripping a drive letter, on dosish platforms.
- pointed out by @DavidEGrayson.
- https://github.com/ruby/ruby/commit/d0cf23b#commitcomment-16100407
+ * eval.c (thread_schedule): context switch bypassed on wrong
+ conditions.
-Mon Feb 15 15:44:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (rb_name_class): set classname by id before String
+ class is initialized (1.0 behavior restored).
- * parse.y (parse_ident): allow keyword arguments just after a
- method where the same name local variable is defined.
- [ruby-core:73816] [Bug#12073]
+Fri Apr 3 11:25:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Feb 15 14:43:28 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * numeric.c (num2int): no implicit conversion from string.
- * enc/unicode/case-folding.rb: Added debugging option
- (with Kimihito Matsui)
+ * numeric.c (num2int): check whether `to_i' returns an Integer.
-Sun Feb 14 17:31:50 2016 Lars Kanis <lars@greiz-reinsdorf.de>
+ * numeric.c (num_zero_p): new method.
- * lib/mkmf.rb (with_{cpp,c,ld}flags): copy caller strings not to
- be modified, in append_{cpp,c,ld}flags respectively.
- [Fix GH-1246]
+ * numeric.c (num_nonzero_p): new method. returns the receiver if
+ it's not zero.
-Sun Feb 14 16:18:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (obj_instance_eval): the_class should be the object's
+ singleton class.
- * eval.c (setup_exception): set the cause only if it is explicitly
- given or not set yet. [Bug #12068]
+ * error.c (exc_s_new): message is converted into a string.
-Sat Feb 13 21:44:58 2016 Tanaka Akira <akr@fsij.org>
+Thu Apr 2 18:31:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * hash.c (rb_hash_invert): [DOC] more examples.
+ * eval.c (obj_call_init): every object call `initialize'.
-Sat Feb 13 17:30:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Apr 1 08:51:53 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * lib/uri/generic.rb (URI::Generic#find_proxy): support CIDR in
- no_proxy. [ruby-core:73769] [Feature#12062]
+ * parse.y (stmt): UNTIL_MOD should be for stmt, not only for expr.
-Sat Feb 13 17:11:58 2016 Fabian Wiesel <fabian.wiesel@sap.com>
+Wed Apr 1 01:20:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/uri/generic.rb (find_proxy): exclude white-spaces and allow
- for a leading dot in the domain name in no_proxy.
- [ruby-core:54542] [Feature #8317]
+ * object.c (true_and): boolean operators &, | and ^.
-Fri Feb 12 12:20:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 31 13:23:58 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * error.c (name_err_initialize, nometh_err_initialize): [DOC] fix
- argument positions. optional parameters except for the message
- are placed at the last.
+ * array.c (ary_compact_bang): returns nil, if it does not modify
+ the array like String's bang methods.
-Fri Feb 12 11:49:49 2016 Anthony Dmitriyev <antstorm@gmail.com>
+ * array.c (ary_uniq_bang): new method to remove duplicate items.
- * net/ftp.rb: add NullSocket#closed? to fix closing not opened
- connection. [Fix GH-1232]
+ * eval.c (bind_s_new): new method.
-Fri Feb 12 11:17:38 2016 Bogdan <bogdanvlviv@gmail.com>
+ * numeric.c (num2int): raise exception if Fixnums too big to
+ convert into `int' in case that sizeof(int) < sizeof(INT).
- * re.c (rb_reg_initialize_m): [DOC] fix missing right bracket.
- [Fix GH-1243]
+ * string.c (str_center): SEGV on negative width.
-Thu Feb 11 14:57:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (eval): forgot to set sourcefile.
- * configure.in (RUBY_CHECK_SIZEOF, RUBY_DEFINT): fix for types
- which are conditionally available depending on architectures
- when universal binary, e.g., __int128.
+Mon Mar 30 11:12:29 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Feb 11 06:26:18 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * file.c (f_test): raises exception for unknown command.
- * configure.in (RUBY_DEFINT): use Parameter Expansion.
+ * eval.c (Init_eval): `class_eval': alias to the module_eval.
-Thu Feb 11 05:33:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Mar 30 18:50:42 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
- * configure.in (int128_t): don't check HAVE_XXX (for example
- HAVE___INT128) because RUBY_CHECK_SIZEOF() don't define it for
- config.h and use of $ac_cv_sizeof___int128 alternates the check.
- (and don't need to define because users shouldn't know that)
+ * string.c (str_capitalize_bang): did not check string modification.
-Wed Feb 10 12:03:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (str_delete_bang): wrong conversion.
- * configure.in (ARFLAGS): check if deterministic mode flag is
- effective, which is on by default on Ubuntu.
+ * string.c (str_intern): typo in error message.
-Tue Feb 9 16:36:23 2016 Naotoshi Seo <sonots@gmail.com>
+Mon Mar 30 01:44:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/logger.rb: Remove block from Logger.add as it's not needed
- patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
+ * eval.c (obj_instance_eval): accepts block as evaluation body.
+ No compilation needed each time.
-Tue Feb 9 14:32:23 2016 Zachary Scott <zzak@ruby-lang.org>
+ * eval.c (mod_module_eval): ditto
- * ext/zlib/zlib.c: Document mtime header behavior with patch by @schneems
- Fixes [GH-1129]: https://github.com/ruby/ruby/pull/1129
+ * file.c (file_s_umask): umask did not return old values, if no
+ argument given.
-Tue Feb 9 13:52:49 2016 Zachary Scott <zzak@ruby-lang.org>
+Sun Mar 29 00:54:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * re.c: Remove deprecated kcode argument from Regexp.new and compile
- patch provided by Dylan Pulliam [Bug #11495]
+ * eval.c (f_throw): nil returned always.
-Mon Feb 8 21:26:19 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat Mar 28 20:40:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode/case-folding.rb, enc/unicode/casefold.h: Flags for
- upper/lower conversion added (titlecase and SpecialCasing still missing)
- (with Kimihito Matsui)
+ * experimental release 1.1b9_06.
-Mon Feb 8 20:43:57 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat Mar 28 16:07:11 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * string.c, enc/unicode.c: Disassociating ONIGENC_CASE_FOLD flag from
- ONIGENC_CASE_DOWNCASE.
- (with Kimihito Matsui)
+ * io.c (io_closed): should not cause exception for closed IO.
-Mon Feb 8 13:00:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (str_tr): returned nil for success.
- * enc/unicode.c: Shortened macros for enc/unicode/casefold.h to
- single-letter; use flags in casefold.h for logic.
+Sat Mar 28 00:47:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode/case-folding.rb: Added flag for case folding.
- Changed parameter passing.
+ * eval.c (f_local_variables): new method to return an array of
+ local variable names.
- * enc/unicode/casefold.h: New flags added.
- (with Kimihito Matsui)
+ * variable.c (obj_instance_variables): now returns an array of
+ variable names, as described in the reference.
-Mon Feb 8 10:30:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_attr): honors default method visibility of the
+ current scope.
- * ruby.c (feature_option): raise a runtime error if ambiguous
- feature name is given, in the future. [Bug #12050]
+Fri Mar 27 13:49:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Feb 8 09:43:57 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * experimental release 1.1b9_05.
- * common.mk: Removed enc/unicode/casefold.h from automatic build because
- some CI systems don't have gperf. Creation of enc/unicode/casefold.h
- is now possible with make unicode-up. This is intended as a temporary measure.
+ * ruby.c (ruby_prog_init): `site_ruby' added to load_path.
-Sun Feb 7 22:10:08 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * ruby.c (ruby_prog_init): load-path order changed. Paths in
+ the RUBYLIB environment variable comes first in non-tainted
+ mode.
- * common.mk: Added two more precondition files for enc/unicode/casefold.h
+Thu Mar 26 11:51:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Added shortening macros for enc/unicode/casefold.h
+ * eval.c (rb_call): new feature: `protected' methods.
- * enc/unicode/case-folding.rb: Fixed file encoding for CaseFolding.txt
- to ASCII-8BIT (should fix some ci errors). Clarified usage. Created
- class MapItem. Partially implemented class CaseMapping.
- (with Kimihito Matsui)
+ * string.c (str_dump): new method.
-Sun Feb 7 14:12:32 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (block_pass): block argument can be nil, which means no
+ block is supplied for the method.
- * enc/unicode/case-folding.rb: Fixing parameter passing.
- (with Kimihito Matsui)
+Wed Mar 25 21:20:13 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Sun Feb 7 11:44:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (str_reverse_bang): string copied to wrong place.
- * enc/unicode/case-folding.rb: New classes CaseMapping/CaseMappingDummy
- to pass as parameters; not yet implemented or used.
- (with Kimihito Matsui)
+Wed Mar 25 08:12:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Feb 7 11:16:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * numeric.c (flo_modulo): caused SEGV if left operand is not a
+ float value.
- * common.mk: using new option in recipe for enc/unicode/casefold.h
+ * eval.c (f_eval): optional third and fourth argument to specify
+ file-name and line-number.
- * enc/unicode/case-folding.rb: Correctly specify argument to new option.
- (with Kimihito Matsui)
+ * eval.c (eval): file-name and line-number set properly.
-Sun Feb 7 10:43:27 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * parse.y (assign_in_cond): literal assignment is now warning, not
+ compile error.
- (this commit message applies to the previous commit)
- * common.mk: explicit recipe for enc/unicode/casefold.h
+ * error.c (Warn): Warn() always print message, OTOH Waring()
+ prints when verbose flag is set.
- * enc/unicode/case-folding.rb: Adding -m option to prepare for using
- multiple data files.
- (with Kimihito Matsui)
+Tue Mar 24 12:50:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Feb 6 22:30:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (ruby_prog_init): `.' should come last in the load-path.
- * lib/cgi/util.rb (escapeHTML, unescapeHTML): consider
- ASCII-incompatible encodings. [Fix GH-1239]
+ * eval.c (Init_eval): `__send__', alias for `send'.
-Sat Feb 6 15:18:28 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Mar 23 12:44:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/enc/test_regex_casefold.rb: Added data-based testing for
- String#downcase :fold.
+ * string.c (str_chomp_bang): now takes `rs' as an argument.
- * enc/unicode.c: Fixed a range error (lowest non-ASCII character affected
- by case operations is U+00B5, MICRO SIGN)
+ * eval.c (thread_free): main_thread should not be freed.
- * test/ruby/enc/test_case_mapping.rb: Explicit test for case folding of
- MICRO SIGN to Greek mu.
- (with Kimihito Matsui)
+Fri Mar 20 16:40:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Feb 6 14:51:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (str_chomp_bang): chomp! (and other ! methods) returns
+ nil if it does not modify the string.
- * test/ruby/enc/test_regex_casefold.rb: Tests for three case folding
- primitives (mbc_case_fold, get_case_fold_codes_by_str,
- apply_all_case_fold) in the various encodings. Currently only known
- good encodings are tested to avoid test failures. For bug hunting,
- start by adding more encodings with
- generate_test_casefold encoding
- (with Kimihito Matsui)
+ * string.c (str_sub_iter_s): should check last pattern since it
+ may be matched to null.
-Sat Feb 6 14:37:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu Mar 19 13:48:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c, test/ruby/enc/test_case_mapping.rb: Implemented :fold
- option for String#downcase by using case folding data from
- regular expression engine, and added a few simple tests.
- (with Kimihito Matsui)
+ * experimental release 1.1b9_04.
-Fri Feb 5 20:08:59 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * parse.y (yylex): `10e0.9' should cause syntax error.
- * test/ruby/enc/test_case_mapping.rb: added tests for :ascii option.
- (with Kimihito Matsui)
+Wed Mar 18 17:46:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Feb 5 12:22:20 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * ruby.c (load_file): new file object constant DATA. Only
+ available for the script from the file.
- * insns.def (opt_mult): Use int128_t for overflow detection.
+ * regex.c (re_match): forwarding failure point popped too much.
- * bignum.c (rb_uint128t2big): added for opt_mult.
+Tue Mar 17 18:23:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * bignum.c (rb_uint128t2big): added for rb_uint128t2big..
+ * math.c (math_frexp): newly added.
- * configure.in: define int128_t, uint128_t and related MACROs.
- Initially introduced by r41379 but reverted by r50749.
+ * math.c (math_ldexp): ditto.
-Thu Feb 4 21:05:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * bignum.c (bigdivmod): calculates modulo.
- * enc/unicode.c: Activated :ascii flag for ASCII-only case conversion
- (with Kimihito Matsui)
+ * numeric.c (fix_remainder): returns reminder, formerly introduced
+ as modulo.
-Thu Feb 4 17:38:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * numeric.c (fix_modulo): calculates proper `modulo'.
- * re.c (reg_set_source): make source string frozen without
- copying.
+ * bignum.c (bigdivmod): wrong sign for reminder.
- * re.c (rb_reg_initialize_m): refactor initialization with
- encoding.
+Mon Mar 16 17:07:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Feb 4 15:35:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * experimental release 1.1b9_03.
- * string.c (rb_fstring_enc_new, rb_fstring_enc_cstr): functions to
- make fstring with encoding.
+Mon Mar 16 16:33:53 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Feb 4 14:42:29 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (pipe_finalize): needed to add pipe_finalize to pipes on
+ cygwin32.
- * common.mk: Added Unicode data file SpecialCasing.txt to be additionally
- downloaded (with Kimihito Matsui)
+Mon Mar 16 14:11:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Feb 4 12:39:08 2016 joker1007 <kakyoin.hierophant@gmail.com>
+ * class.c (ins_methods_i): needed to consider NOEX_UNDEF.
- * cgi/escape/escape.c: Optimize CGI.escape performance by C ext
- for ASCII-compatible encodings. [Fix GH-1238]
+Mon Mar 16 13:23:53 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Feb 4 11:53:56 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (io_check_closed): check for `fptr->f2 == NULL'.
- * common.mk: Introduce two variables (UNICODE_DATA_DIR and
- UNICODE_SRC_DATA_DIR) to eliminate repetitions.
+ * io.c (io_fptr_close): ditto.
-Wed Feb 3 12:13:20 2016 NARUSE, Yui <naruse@ruby-lang.org>
+Mon Mar 16 11:49:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (str_new_frozen): if the given string is embeddedable
- but not embedded, embed a new copied string. [Bug #11946]
+ * io.c (pipe_atexit): free()ing referencing pipe_list.
-Wed Feb 3 08:25:38 2016 boshan <boshan@subsplash.com>
+ * range.c (range_length): returns zero, if the first is greater
+ than the last.
- * ext/openssl/ossl_pkey.c (Init_ossl_pkey): [DOC] Fix typo
- "encrypted" to "decrypted". [Fix GH-1235]
+ * signal.c (trap_restore_mask): restore signal mask before raising
+ exceptions and throws.
-Wed Feb 3 08:21:32 2016 Seiei Miyagi <hanachin@gmail.com>
+Fri Mar 13 13:49:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): Fix
- Ripper.lex error in dedenting squiggly heredoc. heredoc tree is
- also an array of Elem in the outer tree. [Fix GH-1234]
+ * experimental release 1.1b9_02.
-Wed Feb 3 02:33:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * object.c (mod_clone): need to dups constants and instance
+ variables.
- * re.c (rb_reg_prepare_enc): use already compiled US-ASCII regexp
- if given string is ASCII only.
- 121.2s to 113.9s on my x86_64-freebsd10.2 Intel Core i5 661
+ * eval.c (rb_eval): forgot to initialize body for NODE_DEFS.
-Tue Feb 2 13:02:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * eval.c (rb_eval): retrieve self from calling frame, since self
+ changes sometimes.
- * re.c: Introduce RREGEXP_PTR.
- patch by dbussink.
- partially merge https://github.com/ruby/ruby/pull/497
+ * env.h (FRAME): need to save self in the calling frame.
- * include/ruby/ruby.h: ditto.
+ * io.c (f_gets_method): rs should be initialized by RS.
- * gc.c: ditto.
+Thu Mar 12 15:33:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/strscan/strscan.c: ditto.
+ * experimental release 1.1b9_01.
- * parse.y: ditto.
+ * range.c (range_s_new): check values by `first <= last'.
- * string.c: ditto.
+ * parse.y (lastline_set): fixed offset for $_ and $~ in the local
+ variable space.
-Tue Feb 2 09:08:27 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Mar 11 02:14:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/rubygems/specification.rb: `coding` is effective only first
- line except shebang.
+ * io.c (io_gets): handle normal case specially for speed.
- * lib/rubygems/package.rb, lib/rubygems/package/*: ditto.
+ * eval.c (rb_disable_super): function to disable superclass's
+ method explicitly.
-Mon Feb 1 21:41:58 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (rb_eval): inherits previous method definition's
+ NOEX_UNDEF-ness, if exists.
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.5.2.
- It supports to enable frozen string literal and add `--norc` option for
- disable to `.gemrc` configuration.
- See 2.5.2 release notes for other fixes and enhancements.
- https://github.com/rubygems/rubygems/blob/a8aa3bac723f045c52471c7b9328310a048561e0/History.txt#L3
+ * class.c (rb_define_method): disables superclass's overriding
+ method by default.
-Sun Jan 31 12:33:13 2016 Dan Kreiger <dan@dankreiger.com>
+Wed Mar 11 01:40:48 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
- * test/drb/ut_large.rb (multiply, avg, median): add additional
- math operations to DRbLarge. [Fix GH-1086]
+ * numeric.c (flo_gt,etc.): do not depend on `<=>', to handle NaN.
-Sun Jan 31 12:19:15 2016 Kuniaki IGARASHI <igaiga@gmail.com>
+Tue Mar 10 00:03:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_file_exhaustive.rb (test_lstat): Add lacking test
- for File#lstat. [Fix GH-1231]
+ * ruby.c (load_file): understands multiple options in #! line.
-Sun Jan 31 12:15:33 2016 Prayag Verma <prayag.verma@gmail.com>
+ * regex.c (re_compile_pattern): support for [:alpha:] etc.
- * doc/standard_library.rdoc: fix typo [Fix GH-1230]
- Spelling mistakes -
- outputing > outputting
- publich > publish
+Mon Mar 9 16:53:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 30 15:18:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.h (GetOpenFile): embed io_check_closed in GetOpenFile.
- * vm_eval.c (rb_check_funcall_with_hook): also should call the
- given hook before returning Qundef when overridden respond_to?
- method returned false. [ruby-core:73556] [Bug #12030]
+ * sprintf.c (f_sprintf): zero padding failed for negative
+ integers.
-Fri Jan 29 17:40:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * sprintf.c (remove_sign_bits): failed to remove some bits.
- * win32/file.c (rb_readlink): drop garbage after the substitute
- name, as rb_w32_read_reparse_point returns the expected buffer
- size but "\??\" prefix is dropped from the result.
+Sat Mar 7 21:51:46 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
- * win32/win32.c (w32_readlink): ditto, including NUL-terminator.
+ * class.c (ins_methods_i): body may be NULL for some case.
-Fri Jan 29 17:07:27 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+Fri Mar 6 17:23:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * win32/win32.c (fileattr_to_unixmode, rb_w32_reparse_symlink_p): volume
- mount point should be treated as directory, not symlink.
- [ruby-core:72483] [Bug #11874]
+ * regex.c (mbcinit): table driven mbchar detection.
- * win32/win32.c (rb_w32_read_reparse_point): check the reparse point is
- a volume mount point or not.
+ * object.c (obj_alloc): check for allocating instance for the
+ primitive classes (mostly perfect).
- * win32/file.c (rb_readlink): follow above change (but this pass won't
- be used).
+ * ext/curses/curses.c (curses_finalize): restore original state at
+ interpreter termination.
-Fri Jan 29 16:17:07 2016 Lucas Buchala <lucasbuchala@gmail.com>
+ * ext/curses/curses.c (curses_addstr): forgot to check argument
+ type (caused SEGV). now uses STR2CSTR() macro.
- * enum.c (enum_take_while, enum_drop_while): rename block
- parameter to obj, since they are generic objects. [Fix GH-1226]
+Thu Mar 5 13:47:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jan 29 14:15:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (block_pass): accepts method object as block args.
- * lib/erb.rb (ERB::Compiler#detect_magic_comment): allow
- frozen-string-literal in comment as well as encoding.
+ * eval.c (f_missing): use any_to_s() for stringify.
- * lib/erb.rb (ERB#def_method): insert def line just before the
- first non-comment and non-empty line, not to leave duplicated
- and stale magic comments.
+Wed Mar 4 01:39:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jan 29 11:13:33 2016 Jeremy Evans <code@jeremyevans.net>
+ * parse.y (block_arg): new syntax - block argument in the
+ calling arglist.
- * lib/erb.rb (ERB#set_eoutvar): explicitly make mutable string as
- a buffer to make ERB work with --enable-frozen-string-literal.
- [ruby-core:73561] [Bug #12031]
+ * eval.c (rb_call): no module search. simplified a lot.
-Fri Jan 29 10:44:56 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (rb_eval): block arg support.
- * lib/net/http/header.rb: Warn nil variable on HTTP Header.
- It caused to NoMethodError. [fix GH-952][fix GH-641] Patch by @teosz
- * test/net/http/test_httpheader.rb: Added test for nil HTTP Header.
+ * parse.y (f_block_arg): new syntax - block argument in the
+ formal arglist.
-Thu Jan 28 17:31:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Mar 3 14:20:15 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/socket/socket.c (sock_gethostname): support unlimited size
- hostname.
+ * eval.c (obj_method): returns bound method object.
-Wed Jan 27 21:03:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (rb_call): argument check for empty methods.
- * test/-ext-/string/test_capacity.rb: Added missing library.
+ * ruby.h (NUM2CHR): new macro, originally from curses module.
-Wed Jan 27 18:53:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue Mar 3 13:03:35 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
- * enc/unicode.c: Fixed bit mask in macro OnigCodePointCount
+ * io.c (io_putc): new method.
-Wed Jan 27 17:54:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Tue Mar 3 11:21:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Protect code point count by macro, in order to
- be able to use the remaining bits for flags.
- (with Kimihito Matsui)
+ * string.c (str_inspect): more strict charcode detection.
-Wed Jan 27 16:34:35 2016 boshan <boshan@subsplash.com>
+ * eval.c (thread_stop): stopping only thread raises ThreadError
+ exception.
- * lib/tempfile.rb (Tempfile#initialize): [DOC] the first parameter
- `basename` is optional and defaulted to an empty string since
- [GH-523]. [Fix GH-1225]
+Tue Mar 3 08:04:56 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
-Wed Jan 27 16:25:54 2016 Koichi ITO <koic.ito@gmail.com>
+ * struct.c (struct_alloc): incomplete struct initialization made
+ GC to access unallocated addresses.
- * array.c (rb_ary_dig): [DOC] fix the exception class to be raised
- when intermediate object does not have dig method. TypeError
- will be raised now. [Fix GH-1224]
+Mon Mar 2 16:28:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 26 19:36:15 2016 Aggelos Avgerinos <evaggelos.avgerinos@gmail.com>
+ * eval.c (thread_stop_method): remove Thread#stop.
- * array.c (permute0, rpermute0): [DOC] Substitute indexes ->
- indices in documentation for consistency. [Fix GH-1222]
+Fri Feb 27 18:16:26 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 26 15:21:37 2016 Eric Wong <e@80x24.org>
+ * version 1.1b9 released.
- * compile.c (caller_location): use rb_fstring_cstr for "<compiled>"
- (it is converted to fstring anyways inside rb_iseq_new_with_opt)
- * iseq.c (iseqw_s_compile): ditto
- * iseq.c (rb_iseq_new_main): use rb_fstring_cstr for "<main>"
- * vm.c (Init_VM): ditto, share with with above
- * iseq.c (iseqw_s_compile_file): rb_fstring before rb_io_t->pathv
- share "<main>" with above
- * vm.c (rb_binding_add_dynavars): fstring "<temp>" immediately
+Fri Feb 27 09:36:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 26 15:14:01 2016 Kazuki Yamaguchi <k@rhe.jp>
+ * hash.c (hash_delete_nil): needed to compare value to nil, since
+ nil is the valid key for hashes.
- * compile.c (iseq_peephole_optimize): don't apply tailcall
- optimization to send/invokesuper instructions with blockiseq.
- This is a follow-up to the changes in r51903; blockiseq is now
- the third operand of send/invokesuper instructions.
- [ruby-core:73413] [Bug #12018]
+ * hash.c (hash_foreach_iter): rehashing causes IndexError.
-Tue Jan 26 14:26:46 2016 Eric Wong <e@80x24.org>
+ * hash.c (hash_foreach_iter): rehash check by pointer comparison.
- * signal.c (sig_list): use fstring for hash key
- * test/ruby/test_signal.rb (test_signal_list_dedupe_keys): added
+Thu Feb 26 17:22:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 26 13:08:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (fname): convert reswords into symbols.
- * signal.c (rb_f_kill): should immediately deliver reserved
- signals SIGILL and SIGFPE, not only SIGSEGV and SIGBUS.
+ * parse.y (reswords): reserved words are now embedded in the
+ syntax (sigh).
-Tue Jan 26 07:57:28 2016 Joseph Tibbertsma <josephtibbertsma@gmail.com>
+ * parse.y: now reserved words can be method names safely.
- * gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
- [Fix GH-1221]
+Wed Feb 25 15:50:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jan 25 17:26:54 2016 Eric Wong <e@80x24.org>
+ * eval.c (mod_module_eval): clear the_scope's PRIVATE flag before
+ calling eval().
- * ruby_assert.h (RUBY_ASSERT_WHEN): fix reference to macro name
- * vm_core.h: include ruby_assert.h before using
- [ruby-core:73371]
+ * gc.c (gc_call_finalizer_at_exit): run finalizers before any data
+ object being freed.
-Mon Jan 25 15:55:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_eval): needed to keep prot_tag->retval before
+ evaluating the ensure clause.
- * symbol.c (sym_check_asciionly): more informative error message
- with the encoding name and the inspected content.
- [ruby-core:73398] [Feature #12016]
+Tue Feb 24 11:16:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jan 25 09:38:26 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * parse.y (yylex): reserved words can be appear as method names at
+ right after 'def' and `.'(dot), like foo.next.
- * test/ruby/test_string.rb: added testcase for next!, succ and succ!
- [fix GH-1213] Patch by @K0mAtoru
+ * eval.c (return_check): checks for return out of thread (formerly
+ done in return_value).
-Mon Jan 25 09:32:25 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (POP_TAG): copy retval to outer level.
- * lib/webrick/httpservlet/filehandler.rb: fix documentation for namespace.
- [fix GH-1219][ci skip] Patch by @leafac
+ * eval.c (return_value): just set retval, no check, no unwinding.
-Sun Jan 24 19:34:23 2016 Eric Wong <e@80x24.org>
+ * parse.y (nextc): line continuation by backslash at end of line.
- * vm_insnhelper.c (vm_check_if_namespace): tiny size reduction
+ * regex.c (re_compile_pattern): forgot to clear pending_exact on
+ closing parentheses.
-Sun Jan 24 18:12:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * parse.y (assignable): should not assign dyna_var to true, if it
+ is already defined.
- * common.mk: Simplifying Unicode data file download logic to make
- it more reliable (including additional fix not in r53633) [Bug #12007]
+Mon Feb 23 14:35:03 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jan 24 16:54:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * object.c (obj_is_kind_of): no longer accepts true/false/nil.
- * ext/io/wait/wait.c (io_wait_readwrite): [EXPERIMENTAL] allow to
- wait for multiple modes, readable and writable, at once. the
- arguments may change in the future. [Feature #12013]
+ * object.c ({true,false,nil}_to_i): can be converted into integers.
-Sat Jan 23 22:30:59 2016 K0mA <mctj1218@gmail.com>
+Mon Feb 23 12:11:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_array.rb (test_keep_if): Add test for
- Array#keep_if separate from Array#select! [Fix GH-1218]
+ * re.c (reg_s_quote): needed to be mbchar aware.
-Sat Jan 23 20:54:26 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (proc_s_new): wrong iter mark.
- * common.mk: revert r53633. It broke rubyci and travis.
- https://travis-ci.org/ruby/ruby/builds/104259623
+Sat Feb 21 22:59:30 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
-Sat Jan 23 20:10:29 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * io.c (f_syscall): no argument check.
- * range.c (range_eqq): revert r51585 because rb_call_super() is
- called in range_include() and thus r51585 doesn't work when the
- receiver Range object consists of non linear objects such as Date
- objects.
- [ruby-core:72908] [Bug #12003]
+Fri Feb 20 10:17:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 23 18:37:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * version 1.1b8 released.
- * ChangeLog: Fixing wrong time on previous commit, and adding
- previous commit message to svn [ci skip]
+ * ext/kconv/kconv.c (kconv_kconv): default output code now be
+ determined according to the value of $KCODE.
-Sat Jan 23 18:30:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * re.c (rb_get_kcode): can retrieve $KCODE from C code.
- * common.mk: Simplifying Unicode data file download logic to make
- it more reliable [Bug #12007]
+ * parse.y (stmt): if/unless modifiers returns nil, if condition is
+ not established.
-Sat Jan 23 16:29:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Thu Feb 19 11:06:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * tool/downloader.rb: Fixed a logical error, improved documentation
+ * ext/kconv/kconv.c (kconv_kconv): charcode can be specified by
+ code name (JIS, SJIS, EUC like value of $KCODE).
-Sat Jan 23 11:42:43 2016 Peter Suschlik <ps@neopoly.de>
+ * regex.c (re_compile_pattern): forgot to fixup_jump for (?:..).
- * README.md: Use SVG Travis badge over PNG for better quality and
- device support. [Fix GH-1214] [Fix GH-1216]
+ * regex.c (re_compile_pattern): needed to clear pending_exact on
+ non-registering grouping (?:...).
-Sat Jan 23 11:29:16 2016 Pascal Betz <pascal.betz@simplificator.com>
+Wed Feb 18 19:54:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/csv.rb: Update documentation of CSV header converter for
- r45498, [GH-575]. [Fix GH-1215]
+ * parse.y (here_document): needed to set lex_state to EXPR_END.
-Fri Jan 22 17:36:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Feb 18 18:45:10 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * vm_core.h (VM_ASSERT): use RUBY_ASSERT instead of rb_bug.
+ * patches for cygwin32 applied.
- * error.c (rb_assert_failure): assertion with stack dump.
+Wed Feb 18 00:41:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ruby_assert.h (RUBY_ASSERT): new header for the assertion.
+ * string.c (str_sub_s): needed to be mbchar aware to increment one
+ character.
-Fri Jan 22 00:25:57 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * regex.c (re_match): \Z matches newline just before the end of
+ the string.
- * regparse.c (fetch_name_with_level): allow non word characters
- at the first character. [Feature #11949]
+Tue Feb 17 00:04:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * regparse.c (fetch_name): ditto.
+ * time.c (time_arg): Time.gm and Time.local now understands
+ Time#to_a format.
-Thu Jan 21 17:34:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * string.c (str_sub_s): replace happened twice for null pattern.
- * marshal.c (r_object0): honor Marshal.load post proc
- value for TYPE_LINK. by Hiroshi Nakamura <nahi@ruby-lang.org>
- https://github.com/ruby/ruby/pull/1204 fix GH-1204
+ * regex.c (re_search): null pattern should not match after newline
+ at the end of string.
-Thu Jan 21 16:37:50 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * time.c (time_isdst): now returns boolean value.
- * Makefile.in (update-rubyspec): fix r53208 like r53451.
+ * error.c (rb_check_type): treat special constants in messages.
-Wed Jan 20 20:58:25 2016 NAKAMURA Usaku <usa@ruby-lang.org>
+ * parse.y (yylex): new form `::Const' to see toplevel constants.
- * common.mk, Makefile.in: update-config_files is only for Unix
- platforms.
+ * parse.y (cond): SEGV on `if ()'.
+
+ * gc.c (obj_free): some data needed explicit free().
+
+Mon Feb 16 23:55:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (blk_free): release duplicated block informations.
+
+ * eval.c (blk_copy_prev): duplicate outer block information into
+ the heap, when proc/binding created.
+
+Mon Feb 16 14:38:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * time.c (time_mon): now 1 for January and so on.
+
+ * time.c (time_year): year in 19xx (no + 1900 needed anymore).
+
+Mon Feb 16 13:28:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_compile_pattern): need to fetch mbchar's second byte
+ without translation.
+
+Mon Feb 16 12:29:27 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+
+ * eval.c (f_pass_block): pass iterator block to other method.
+
+Fri Feb 13 08:16:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (parse_regx): handle \s before read_escape().
+
+ * parse.y (read_escape): `\s' in strings as space.
+
+Tue Feb 10 17:29:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * version 1.1b7 released.
+
+ * string.c (str_aset): string insertion by `str[n] = str2'.
+
+ * string.c (str_oct): does recognize `0x'.
+
+ * sprintf.c (f_sprintf): use base 10 for conversion from string to
+ integer.
+
+Mon Feb 9 14:51:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * numeric.c (do_coerce): proper error message.
+
+ * string.c (str_sum): bug - masked by wrong value. (sigh..)
+
+Sat Feb 7 15:11:14 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (str_empty): new method
+
+Fri Feb 6 01:42:15 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * time.c (time_asctime): use asctime(3), not strftime(3).
+
+Thu Feb 5 18:58:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (io_fptr_close): do not free path on close().
+
+ * array.c (ary_filter): new method.
+
+ * enum.c (enum_each_with_index): new method.
+
+Thu Feb 5 14:10:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (primary): singleton class def can be appeared inside
+ method bodies.
+
+ * hash.c (hash_replace): replace content.
+
+ * string.c (str_replace_method): replace content.
+
+ * array.c (ary_replace_method): replace elements.
+
+ * string.c (str_succ_bang): String#succ!
+
+Thu Feb 5 18:20:30 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * string.c (str_upcase_bang): multi byte character support.
+
+Wed Feb 4 13:55:26 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * array.c (ary_reverse): SEGV on empty array reverse.
+
+Tue Feb 3 12:24:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * re.c (match_to_a): non matching element should be nil.
+
+ * ruby.c (ruby_load_script): load script after all initialization.
+
+ * bignum.c (str2inum): need to interpret prefix `0' of `0x'.
+
+Tue Feb 3 10:00:18 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * numeric.c (fix_rshift): use `sizeof(INT)*8' instead of 32.
+
+Mon Feb 2 14:09:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (set_arg0): grab environment region too.
+
+Thu Jan 29 18:36:25 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * process.c (rb_proc_exec): check `sh' to be exist.
+
+Thu Jan 29 18:18:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (io_stdio_set): assignment to $stdin or $stdout does
+ reopen() as well as $stderr.
+
+Thu Jan 29 14:18:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * class.c (mod_ancestors): should not include singleton classes.
+
+ * object.c (obj_type): should not return internal class.
+
+ * io.c (io_reopen): unwillingly closes stdio streams.
+
+Thu Jan 29 11:50:35 1998 Toshihiko SHIMOKAWA <toshi@csce.kyushu-u.ac.jp>
+
+ * ext/socket/socket.c (udp_addrsetup): forgot to use htons().
+
+Tue Jan 27 23:15:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * keywords: __FILE__, __LINE__ are available again.
-Wed Jan 20 17:13:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Jan 23 14:19:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * tool/extlibs.rb: add --cache option to change cache directory.
+ * version 1.1b6 released.
-Tue Jan 19 17:03:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * object.c (mod_to_s): need to duplicate classpath.
- * common.mk: Added Unicode data file CaseFolding.txt to be additionally
- downloaded (with Kimihito Matsui)
+ * error.c (exc_inspect): need to duplicate classpath.
-Tue Jan 19 10:09:58 2016 Sho Hashimoto <sho-h@ruby-lang.org>
+Thu Jan 22 00:37:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/shell.rb (Shell.debug_output_exclusive_unlock): remove
- because Mutex#exclusive_unlock was already deleted. [fix GH-1185]
+ * ruby.h (STR2CSTR): new macro to retrieve char*.
-Tue Jan 19 09:38:27 2016 Nick Cox <nick@nickcox.me>
+ * class.c (rb_define_method): `initialize' should always be
+ private, even if it defined by C extensions.
- * vm_method.c: fix grammar in respond_to? warning.
- [fix GH-1047]
+ * eval.c (rb_eval): `initialize' should always be private.
-Mon Jan 18 14:37:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Jan 22 16:21:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (parser_here_document): an escaped newline is not an
- actual newline, and the rest part should not be dedented.
- [ruby-core:72855] [Bug #11989]
+ * eval.c (rb_eval): some singleton class def cause SEGV.
-Mon Jan 18 12:04:34 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (TMP_ALLOC): replace ALLOCA_N, where thread context
+ switch may happen.
- * test/ruby/test_string.rb: Added extra testcase for test_rstrip_bang
- and test_lstrip_bang. [fix GH-1178] Patch by @Matrixbirds
+Wed Jan 21 01:43:42 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jan 18 11:47:27 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (PUSH_FRAME): do not use ALLOCA_N(). crash on some
+ platforms that use missing/alloca.c.
- * string.c: fix a typo. [fix GH-1202][ci skip] Patch by @sunboshan
+ * regex.c (re_compile_pattern): too many pops for non register
+ subexpr.
-Sun Jan 17 21:15:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * parse.y (yylex): open parentheses after identifiers are argument
+ list, even if whitespaces have seen.
- * configure.in: improve ICC (Intel C Compiler) support.
+Tue Jan 20 15:19:59 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in (CXX): The name of icc's c++ compiler is `icpc`.
+ * parse.y (terms): quoted word list by %w(a b c).
- * configure.in (warnings): Add `-diag-disable=2259` to suppress
- noisy warnings: "non-pointer conversion from "..." to "..." may
- lose significant bits".
+ * ext/tcltklib/extconf.rb: more accurate check for tcl/tk libs.
- * configure.in (optflags): Add `-fp-model precise` like -fno-fast-math.
+ * file.c (rb_stat): most of the FileTest methods (and function
+ `test') accept File objects as the argument.
- * lib/mkmf.rb: icc supports -Werror=division-by-zero
- and -Werror=deprecated-declarations, but doesn't support
- -Wdivision-by-zero and -Wdeprecated-declarations.
+Tue Jan 19 18:19:24 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Sun Jan 17 20:40:10 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * ext/extmk.rb.in (install): there should be no newline after install:
- * string.c: Any kind of option is now taking the new code path for
- upcase/downcase/capitalize/swapcase. :lithuanian can be used for
- testing if no specific option is desired.
- * test/ruby/enc/test_case_mapping.rb: Adjusted to above.
- (with Kimihito Matsui)
+ * re.c (MIN): renamed from min(). there's a local variable named
+ min in the file, so that some cpp will raise an error.
-Sun Jan 17 20:10:10 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Mon Jan 19 16:30:05 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Fixed a logical error and some comments.
- * test/ruby/enc/test_case_mapping.rb: Made tests more general.
- (with Kimihito Matsui)
+ * version 1.1b5 released.
-Sun Jan 17 17:41:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * process.c (rb_syswait): no exception raised.
- * enc/unicode.c: Removed artificial expansion for Turkic,
- added hand-coded support for Turkic, fixed logic for swapcase.
- * string.c: Made use of new case mapping code possible from upcase,
- capitalize, and swapcase (with :lithuanian as a guard).
- * test/ruby/enc/test_case_mapping.rb: Adjusted for above.
- (with Kimihito Matsui)
+Fri Jan 16 00:43:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jan 17 15:30:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.h (CLONESETUP): copies its singleton classes too.
- * ext/socket/option.c (sockopt_bool): relax boolean size to be one
- too not only sizeof(int). Winsock getsockopt() returns a single
- byte as a boolean socket option. [ruby-core:72730] [Bug #11958]
+ * class.c (singleton_class_attached): saves binded object in the
+ singleton classes.
-Sun Jan 17 14:43:01 2016 Kuniaki IGARASHI <igaiga@gmail.com>
+ * eval.c (rb_eval): calls singleton_method_added even in the
+ singleton class clauses.
- * test/ruby/test_env.rb: [Fix GH-1201]
- * Extract test code for ENV#keep_if from ENV#select_bang
- * Add a test case for ENV#select_bang,keep_if
+Fri Jan 15 23:22:43 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Sun Jan 17 14:42:25 2016 Kuniaki IGARASHI <igaiga@gmail.com>
+ * ruby.c (proc_options): -S does not recognize PATH.
- * test/ruby/test_env.rb: [Fix GH-1201]
- * Extract test code for ENV#delete_if from ENV#reject_bang
- * Add a test case for ENV#reject_bang,delete_if
+Thu Jan 15 02:03:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jan 17 14:40:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (rb_clear_cache_by_id): clear only affected cache
+ entries.
- * ext/socket/option.c (check_size): extract a macro to check
- binary data size, with a consistent message.
+Wed Jan 14 02:14:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ext/socket/option.c (sockopt_byte): fix error message,
- sizeof(int) differs from sizeof(unsigned char) in general.
+ * ext/socket/socket.c: new UDP/IP socket classes.
-Sat Jan 16 21:16:21 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Jan 13 10:00:18 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (xstring): reset heredoc indent after dedenting,
- so that following string literal would not be dedented.
- [ruby-core:72857] [Bug #11990]
+ * string.c (str_cmp): ignorecase($=) works wrong.
-Sat Jan 16 17:24:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Fri Jan 9 13:19:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/unicode.c: Artificial mapping to test buffer expansion code.
- * string.c: Fixed buffer expansion logic.
- * test/ruby/enc/test_case_mapping.rb: Tests for above.
- (with Kimihito Matsui)
+ * version 1.1b4 released.
-Sat Jan 16 16:47:14 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (f_missing): class name omitted from the error message.
- * ext/openssl/lib/openssl/pkey.rb: Added 2048 bit DH parameter.
- * test/openssl/test_pkey_dh.rb: ditto.
+ * error.c (exc_inspect): description changed.
-Sat Jan 16 10:51:19 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * string.c (Init_String): GlobalExit's superclass did not filled,
+ since GlobalExit created earlier than String.
- * enc/unicode.c: fix implicit conversion error with clang. fixup r53548.
- * string.c: ditto.
+Thu Jan 8 12:10:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 16 10:31:00 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * parse.y (aryset): expr in the brackets can be null.
- * common.mk: test-sample was changed to test-basic.
- [Feature #11982][ruby-core:72823]
- * basictest/runner.rb: ditto. rename from tool/rubytest.rb.
- * basictest/test.rb: ditto. rename from sample/test.rb.
- * defs/gmake.mk: picked from r53540
- * sample/test.rb: backward compatibility for chkbuild.
+Wed Jan 7 21:13:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 16 10:23:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (io_reopen): keep stderr unclosed.
- * string.c, enc/unicode.c: New code path as a preparation for Unicode-wide
- case mapping. The code path is currently guarded by the :lithuanian
- option to avoid accidental problems in daily use.
- * test/ruby/enc/test_case_mapping.rb: Test for above.
- * string.c: function 'check_case_options': fixed logical errors
- (with Kimihito Matsui)
+ * io.c (io_errset): keep stderr unclosed.
-Fri Jan 15 20:20:20 2016 Naohisa Goto <ngotogenome@gmail.com>
+Tue Jan 6 00:27:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
- * regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): The value of
- UNALIGNED_WORD_ACCESS should be used to determine whether
- unaligned word access is allowed or not. After this commit,
- ./configure CPPFLAGS="-DUNALIGNED_WORD_ACCESS=0" disables
- unaligned word access even on platforms that support the feature.
+ * parse.y: syntax modified for `while expr do .. end' etc.
-Fri Jan 15 16:12:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * process.c (f_exec,f_system): can supply arbitrary name for the
+ new process.
- * parse.y (string1): reset heredoc indent for each string literal
- so that concatenated string would not be dedented.
- [ruby-core:72857] [Bug #11990]
+Mon Jan 5 16:59:13 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Jan 14 20:01:00 2016 NARUSE, Yui <naruse@ruby-lang.org>
+ * file.c (file_s_basename): removes any extension by ".*".
- * lib/uri/generic.rb (URI::Generic#to_s): change encoding to
- UTF-8 as Ruby 2.2/ by Koichi ITO <koic.ito@gmail.com>
- https://github.com/ruby/ruby/pull/1188 fix GH-1188
+Sun Jan 4 19:36:22 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Jan 14 17:36:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (yylex): needed to update lex_p (reading point).
- * variable.c (rb_f_global_variables): add matched back references
- only, as well as defined? operator.
+Sat Jan 3 19:14:14 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Thu Jan 14 16:12:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * class.c,object.c: duplicate defines mKernel and cFinxnum.
- * sprintf.c (rb_str_format): format exact number more exactly.
+Fri Jan 2 20:38:59 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Jan 14 15:08:43 2016 Tony Arcieri <bascule@gmail.com>
+ * ext/curses/curses.c (NUM2CHAR): uses the first character for
+ string arguments.
- * Remove 512-bit DH group. It's affected by LogJam Attack.
- https://weakdh.org/
- [fix GH-1196][Bug #11968][ruby-core:72766]
+ * array.c (ary_fill): did not extend array for ranges.
-Thu Jan 14 11:44:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * array.c (beg_len): did not return end pos bigger than size.
- * variable.c (rb_f_global_variables): add $1..$9 only if $~ is
- set. fix the condition removed at r14014.
+Fri Jan 2 02:09:16 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Wed Jan 13 17:21:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * dir.c (dir_s_chdir): bug in nil check.
- * .travis.yml: removed commented-out code.
+ * array.c (ary_fill): bug in nil check.
-Wed Jan 13 17:14:54 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Tue Dec 30 11:46:23 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * .travis.yml: removed osx code. follow up with r53517
+ * hash.c (env_path_tainted): checks directories in PATH
+ environment variable are not world writable.
-Wed Jan 13 16:56:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (load_file): invoke specified interpreter if the #! line
+ does not contain the word `ruby'.
- * iseq.c (rb_iseq_mark): mark parent iseq to prevent dynamically
- generated iseq by eval from GC. [ruby-core:72620] [Bug #11928]
+Fri Dec 26 03:26:41 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Jan 13 03:42:58 2016 Eric Wong <e@80x24.org>
+ * string.c (uscore_get): type information included in the error
+ message.
- * class.c (Init_class_hierarchy): resolve name for rb_cObject ASAP
- * object.c (rb_mod_const_set): move name resolution to rb_const_set
- * variable.c (rb_const_set): do class resolution here
- [ruby-core:72807] [Bug #11977]
+ * variable.c (f_untrace_var): does not free trace-data within
+ trace procedure.
-Wed Jan 13 00:37:12 2016 Satoshi Ohmori <sachin21dev@gmail.com>
+Thu Dec 25 02:50:29 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * man/ruby.1: fix double word typo. [Fix GH-1194]
+ * version 1.1b3 released.
-Tue Jan 12 21:01:09 2016 Benoit Daloze <eregontp@gmail.com>
+ * ruby.h: inlining some functions on gcc 2.x
- * common.mk: update URL and name for the Ruby spec suite.
+Tue Dec 23 02:47:33 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 12 19:52:19 2016 sorah (Shota Fukumori) <her@sorah.jp>
+ * eval.c (rb_eval): public/private information kept in the current
+ scope, to remove undesired state from the class/module.
- * lib/forwardable.rb: Convert given accessors to String.
+ * time.c (time_strftime): remove hidden limit of 100 bytes of
+ result string, using malloc'ed buffer.
- r53381 changed to accept only Symbol or String for accessors, but
- there are several rubygems that pass classes (e.g. Array,
- Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
- returns its class name. After r53381 given accessors are checked
- with define_method, but it accepts only Symbol or String, otherwise
- raises TypeError.
+ * hash.c (hash_update): merges the contents of another hash,
+ overriding existing keys.
- def_delegator Foo, :some_method
+ * regex.c (must_instr): totally re-written.
- This change is to revert unexpected incompatibility. But this behavior
- may change in the future.
+ * io.c (read_all): try to allocate proper sized buffer using
+ fstat(2) for speedup.
-Mon Jan 12 18:41:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Sat Dec 20 00:27:28 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c: made a variable name more grammatically correct
+ * regex.c (must_instr): need to skip 2 bytes for mbchars.
-Mon Jan 12 18:34:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+Fri Dec 19 01:18:29 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c: minor grammar fix [ci skip]
+ * version 1.1b2 released.
-Mon Jan 12 16:09:09 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (check_errat): check and convert (if necessary) traceback
+ information before assigning to the variable $@.
- * test/ruby/enc/test_casing_options.rb: Tests for option
- parsing/checking for upcase/downcase/capitalize/swapcase
- (see r53503; with Kimihito Matsui)
+ * eval.c (f_raise): optional third argument to specify traceback
+ information.
-Mon Jan 12 16:03:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * io.c (f_open): prevent infinite recursive call.
- * string.c: Added option parsing/checking for upcase/downcase/
- capitalize/swapcase (with Kimihito Matsui)
+Thu Dec 18 19:33:47 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jan 11 21:28:28 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * string.c (str_rindex): now accepts regexp as index.
- * include/ruby/oniguruma.h: Added flags needed for upcase/downcase
- Unicode addition (with Kimihito Matsui)
+Thu Dec 18 18:42:50 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Mon Jan 11 09:50:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/extconf.rb: modified to detect win32 socket lib.
- * configure.in: check if the API version number is consistent with
- the program version number.
+Thu Dec 18 00:25:03 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jan 10 20:57:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (reg_equal): checks for source and casefold and kcode matching.
- * compile.c (compile_massign_lhs): when index ends with splat,
- append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
- splats the last argument only. [ruby-core:72777] [Bug #11970]
+ * marshal.c: became built-in module.
-Sun Jan 10 15:45:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/marshal/marshal.c (r_object): displays struct name for
+ non-compatible struct.
- * include/ruby/missing.h (explicit_bzero_by_memset_s): remove
- inline implementation by memset_s, which needs a macro before
- including headers and can cause problems in extension libraries
- by the order of the macro and headers.
+ * string.c (str_index_method): now searches character (fixnum) in
+ the string.
-Sun Jan 10 13:41:36 2016 Eric Wong <e@80x24.org>
+ * string.c (str_include): redefine `include?'.
- * io.c (rb_deferr): remove long obsolete global
+ * regex.c (re_match): start_nowidth saves current stack position
+ to stop_nowidth.
-Sun Jan 10 09:14:42 2016 Eric Wong <e@80x24.org>
+ * regex.c (re_compile_pattern): add space to stop_nowidth to save
+ runtime stack position.
- * ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
- eliminate chomp
- * lib/net/http.rb (connect): eliminate delete
- * lib/net/http/header.rb (basic_encode): ditto
- * lib/net/imap.rb (authenticate): eliminate gsub
- (self.encode_utf7): shorten delete arg
- * lib/net/smtp.rb (base64_encode): eliminate gsub
- * lib/open-uri.rb (OpenURI.open_http): eliminate delete
- * lib/rss/rss.rb: ditto
- * lib/securerandom.rb (base64): ditto
- (urlsafe_base64): eliminate delete!
- * lib/webrick/httpauth/digestauth.rb (split_param_value):
- eliminate chop
- * lib/webrick/httpproxy.rb (do_CONNECT): eliminate delete
- (setup_upstream_proxy_authentication): ditto
- [ruby-core:72666] [Feature #11938]
+Tue Dec 16 14:57:43 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 9 23:19:14 2016 Kuniaki IGARASHI <igaiga@gmail.com>
+ * string.c (scan_once): wrong exception for regexp that match with
+ null string (use substr instead of subseq).
- * test/ruby/test_hash.rb (test_try_convert): Add test for
- Hash.try_convert. [Fix GH-1190]
+Sat Dec 13 00:13:32 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 9 23:15:25 2016 Jon Moss <maclover7@users.noreply.github.com>
+ * parse.y (expr): remove bare assocs from expr rule.
- * ext/openssl/ossl.c: Add missing variables to documentation
- examples. [Fix GH-1189]
+ * rbconfig.rb: renamed from config.rb (it was too generic name).
-Sat Jan 9 18:25:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Fri Dec 12 00:50:25 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * symbol.h (is_attrset_id): ASET is an attrset ID. fix
- unexpected safe call instead of an ordinary ASET.
+ * parse.y (expr): warns if BEGIN or END appear in the method
+ bodies.
-Sat Jan 9 10:44:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * string.c (str_match): calls y =~ x if y is neither String nor
+ Regexp so that eregex.rb works.
- * configure.in, win32/setup.mak: extract RUBY_PROGRAM_VERSION from
- RUBY_VERSION in version.h instead of RUBY_API_VERSION numbers in
- include/ruby/version.h, and cut it into version numbers.
+ * eval.c (f_at_exit): to register end proc.
-Sat Jan 9 07:13:33 2016 Koichi Sasada <ko1@atdot.net>
+ * class.c (rb_define_module_function): define 'function' method
+ for the Module, not private method.
- * gc.c: rename PAGE_* to HEAP_PAGE_* because PAGE_SIZE is used
- in Mac OS X.
+ * class.c (rb_define_function): function to define `function' method.
- * test/ruby/test_gc.rb: catch up this fix.
+ * eval.c (rb_eval): inherit visibility from superclass's method
+ except when it is set to `function'
-Sat Jan 9 05:45:40 2016 Koichi Sasada <ko1@atdot.net>
+ * eval.c (rb_eval): new visibility status `function'.
- * gc.c: PAGE_BITMAP_PLANES (the number of bitmap) is 4, not 3.
+ * parse.y (yycompile): do not clear eval_tree. thus enable multiple
+ command line script by option `-e'.
-Sat Jan 9 05:42:57 2016 Koichi Sasada <ko1@atdot.net>
+ * eval.c (rb_eval): END execute just once.
- * gc.c: rename constant names HEAP_* to PAGE_*.
+ * parse.y (expr): BEGIN/END built in the syntax.
- Keys of GC::INTERNAL_CONSTANTS are also renamed.
+Thu Dec 11 13:14:35 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_gc.rb: catch up this fix.
+ * object.c (mod_le): Module (or Class) comparison.
-Fri Jan 8 22:30:06 2016 Akinori MUSHA <knu@iDaemons.org>
+ * eval.c (rb_remove_method): raises NameError if named method does
+ not exist.
- * doc/regexp.rdoc: [DOC] Elaborate on the \G anchor. [ci skip]
+ * ext/curses/curses.c: remove CHECK macro for BSD curses.
-Fri Jan 8 19:49:27 2016 Koichi Sasada <ko1@atdot.net>
+Thu Dec 11 12:44:01 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * gc.c: remove heap_page::body. Instead of this field,
- heap_page::start field works well.
+ * pack.c: sun4 cc patch
-Fri Jan 8 19:31:52 2016 Koichi Sasada <ko1@atdot.net>
+Wed Dec 10 15:21:36 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c: rename rb_heap_t::page_length to rb_heap_t::total_pages.
+ * ext/marshal/marshal.c (marshal_load): can supply evolution proc
+ object as optional second argument.
- `page_length' is not clear (we may understand with length of
- a page).
+ * re.c (reg_source): get source string of the regular expression.
-Fri Jan 8 17:07:14 2016 Koichi Sasada <ko1@atdot.net>
+Tue Dec 9 10:05:17 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * gc.c: remove heap_page::heap. This field is only used to recognize
- whether a page is in a tomb or not. Instead of this field,
- heap_page::flags::in_tomb (1 bit field) is added.
+ * version 1.1b1 released.
- Also type of heap_page::(total|free|final)_slots are changed from
- int to short. 2B is enough for them.
+ * parse.y (tokadd): token buffer overrun.
-Fri Jan 8 09:33:59 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * ruby.c (ruby_prog_init): forgot to protect rb_argv0 from gc.
- * iseq.c (rb_iseq_compile_with_option): move variable initialization
- code to avoid maybe-uninitialized warnings by gcc 4.8.
+ * eval.c (ruby_run): call finalizers at process termination.
-Fri Jan 8 00:03:22 2016 Shugo Maeda <shugo@ruby-lang.org>
+ * gc.c (gc_call_finalizer_at_exit): call free proc for every Data
+ Wrapper, and finalizer for specified objects at termination.
- * enum.c (enum_min, enum_max): do the same optimization as r53454.
+ * version.c (show_version): version format changed.
-Thu Jan 7 22:32:21 2016 Kenta Murata <mrkn@mrkn.jp>
+ * regex.c (re_match): wrong match with non-greedy if they appear
+ more than once in regular expressions.
- * ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
- and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
- [ruby-core:72736] [Bug #11962]
+ * sample/ruby-mode.el (ruby-expr-beg): forgot to handle modifiers.
-Thu Jan 7 22:02:21 2016 Shugo Maeda <shugo@ruby-lang.org>
+Mon Dec 8 19:00:15 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enum.c (enum_minmax): optimize object comparison in
- Enumerable#minmax.
+ * io.c (io_puts): just put a newline if no argument given.
-Thu Jan 7 14:49:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/tcltklib/tcltklib.c (lib_mainloop): thread-aware tk handle
+ when $tk_thread_safe is set.
- * thread.c (rb_thread_pending_interrupt_p): no pending interrupt
- before initialization.
+ * ext/tcltklib/tcltklib.c (lib_mainloop): use Tcl_DoOneEvent()
+ instead of Tk_MainLoop().
- * thread.c (thread_raise_m, rb_thread_kill): uninitialized thread
- cannot interrupt. [ruby-core:72732] [Bug #11959]
+Mon Dec 6 07:11:16 1997 MAEDA shugo <shugo@po.aianet.ne.jp>
-Thu Jan 7 11:34:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * io.c (io_puts): core dumped without any argument.
- * include/ruby/backward.h (ruby_show_copyright_to_die): for source
- code backward compatibility.
+Fri Dec 5 18:17:17 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ruby.c (process_options): return Qtrue to exit the process
- successfully.
+ * eval.c (mod_remove_method): remove (not undef) a method from the
+ class/module.
- * version.c (ruby_show_copyright): no longer exit.
+ * variable.c (obj_remove_instance_variable): method to remove
+ instance variables.
-Wed Jan 6 17:22:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Dec 4 13:50:29 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/optparse.rb (OptionParser#order!): add `into` optional
- keyword argument to store the results. [Feature #11191]
+ * version 1.1b0 released.
-Tue Jan 5 21:44:37 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * string.c (str_aref): called str_index for regexp.
- * ChangeLog: fix wrong class name.
+Mon Dec 1 15:24:41 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 5 21:43:50 2016 Kuniaki IGARASHI <igaiga@gmail.com>
+ * compar.c (cmp_between): wrong comparison made.
- * test/ruby/test_string.rb(test_chr): added test for String#chr
- [fix GH-1179]
+Wed Nov 26 18:18:05 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 5 21:32:26 2016 Kuniaki IGARASHI <igaiga@gmail.com>
+ * lib/mkmf.rb: generate Makefile for extension modules out of ruby
+ source tree. use like `ruby -r mkmf extconf.rb'.
- * test/ruby/test_numeric.rb (test_nonzero_p): added test for Numeric#nonzero?
- [fix GH-1187]
+ * numeric.c (fix2str): enlarge buffer to prevent overflow on some
+ machines.
-Tue Jan 5 11:47:23 2016 Damir Gaynetdinov <damir.gaynetdinov@gmail.com>
+ * parse.y (here_document): wrong line number generated after here-doc.
- * doc/marshal.rdoc: Clarify object references example, that the
- reference is same object. [Fix GH-1156]
+Fri Nov 21 13:17:12 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Tue Jan 5 05:06:51 2016 Eric Wong <e@80x24.org>
+ * parse.y (yylex): skip multibyte characters in comments.
- * ext/stringio/stringio.c (strio_binmode): implement to set encoding
- * test/stringio/test_stringio.rb (test_binmode): new test
- [ruby-core:72699] [Bug #11945]
+Wed Nov 19 17:19:20 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Mon Jan 4 15:44:37 2016 Sho Hashimoto <sho-h@ruby-lang.org>
+ * object.c (nil_to_a): nil.to_a => [].
- * variable.c (rb_mod_deprecate_constant): [DOC] added
- documentation for Module#deprecate_constant. [ci skip]
+ * parse.y (call_args): wrong node generation.
-Mon Jan 4 15:36:38 2016 Sho Hashimoto <sho-h@ruby-lang.org>
+Tue Nov 18 10:13:08 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * thread_sync.c: [DOC] remove SizedQueue#close argument.
- [ci skip]
+ * array.c (Init_Array): Array#=== works as Array#include?
-Mon Jan 4 10:14:24 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * regex.c (re_compile_pattern): insert initialize code for jump_n,
+ before entering loops.
- * test/coverage/test_coverage.rb: ignored test when enabled to coverage.
- It lead to crash with `make test-all`.
+ * re.c (reg_search): does not save registers unless $& etc appear
+ in the script.
-Mon Jan 4 08:10:44 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+Mon Nov 17 13:01:43 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * insns.def (opt_case_dispatch): Move a comment to the
- appropriate position.
- [ci skip]
+ * eval.c (is_defined): add defined? check for receivers and
+ arguments for calls.
-Sun Jan 3 23:55:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * re.c (reg_search): cache last match object.
- * lib/rubygems/security.rb (DIGEST_ALGORITHM, KEY_ALGORITHM):
- should check same name as the used constants.
- [ruby-core:72674] [Bug #11940]
+ * re.c (match_aref): $[0] etc. are available.
-Sun Jan 3 19:22:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Nov 15 00:11:36 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * io.c (io_s_popen): "rb" detection
+
+Fri Nov 14 18:28:40 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (scan_once): returns whole match if the pattern does
+ not contain any parentheses.
+
+Thu Nov 13 14:39:06 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * string.c (str_sub): returns copy of the receiver string, even if
+ any substitution occurred.
+
+ * regex.c (re_compile_pattern): no-width match by (?=..), (?!..).
+
+Wed Nov 12 13:44:47 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * time.c: remove coerce from Time class.
+
+ * regex.c (re_match): non-greedy match by ??, *? +?, {n,m}?.
+
+Mon Nov 10 11:24:51 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_compile_pattern): non-registering parens (?:..).
+
+ * regex.c (re_compile_pattern): new meta character \< (wordbeg)
+ and \> (wordend).
+
+ * regex.c (re_compile_pattern): embedded comment for regular
+ expression by (?#...).
+
+Fri Nov 7 16:58:24 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * regex.c (re_compile_pattern): perl5 regxp \A and \Z available.
+
+ * regex.c (re_compile_pattern): can expand compile stack dynamically.
+
+ * regex.c (PUSH_FAILURE_POINT): wrong compare condition.
+
+Wed Nov 2 16:00:00 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * string.c (str_sub_s): "".sub! "", "" => "\000"
+
+Fri Oct 31 15:52:10 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (assoc): keyword assoc like {fg->"black"}.
+
+Thu Oct 30 17:33:38 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (io_println): print with newline, which is not affected by
+ the values of $/ and $\.
+
+Thu Oct 30 16:54:01 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * string.c (str_chop_bang): "".chop caused SEGV.
+
+ * string.c (str_chomp_bang): method to chop out last newline.
+
+Mon Oct 27 13:49:13 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ext/extmk.rb.in: library may have pathname contains `.'
+
+ * eval.c (rb_rescue): should not protect SystemError.
+
+Fri Oct 24 10:58:53 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (io_s_with_open_stream): ensures to close stream.
+
+Thu Oct 23 11:17:44 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * io.c (io_errset): value of $stderr can be changed (to any IO
+ object).
+
+ * io.c (next_argv): $< can be anything that responds to `write'.
+
+ * file.c (file_s_with_open_file): ensures to close file.
+
+ * error.c (exception): create error under the current class/module.
+
+ * range.c (range_eqq): fixnum check for last needed too.
+
+Wed Oct 22 12:52:30 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ext/socket/socket.c: Socket::Constants added.
+
+ * file.c: File::Constants added for inclusion.
+
+ * array.c (ary_join): call ary_join() recursively for the 1st
+ array element.
+
+Mon Oct 20 12:18:29 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * ruby.c (load_file): wrong condition for #! check with -x.
+
+ * file.c (file_s_dirname): did return "" for "/a".
+
+Fri Oct 17 14:29:09 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c: now works on alpha-linux.
+
+ * bignum.c (bigadd): some undefined side effect order assumed.
+
+Wed Oct 15 17:49:24 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * intern.h: function prototypes added.
+
+Mon Oct 13 16:54:18 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * class.c (rb_define_class_id): call superclass's `inherited'
+ method when making subclasses.
+
+ * parse.y (nextc): clear lex_lastline at the end of file.
+
+ * object.c (Init_Object): need to undef Class#append_features.
+
+ * eval.c (rb_eval): no warning on extending classes or modules.
+
+Thu Oct 9 11:17:50 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (error_print): the exception name follows after the error
+ message.
+
+ * eval.c (compile_error): error message slightly changed.
+
+ * parse.y (nextc): script parsing will be terminated by __END__ at
+ beginning of line.
+
+ * eval.c (compile_error): `__END__' is no longer a keyword.
+
+ * parse.y (nextc): protect lastline read from script stream.
+
+Tue Oct 7 14:06:06 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * version 1.1 alpha9 released.
+
+ * eval.c (mod_append_features): renamed from extend_class.
+
+ * eval.c (rb_eval): defining method calls `method_added'.
+
+ * eval.c (ruby_options): exception while processing options must
+ terminate the interpreter.
+
+ * error.c (Init_Exception): wrong method configuration. `new'
+ should have been a singleton method.
+
+Mon Oct 6 18:55:38 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ext/kconv/kconv.c (kconv_guess): code to guess character code
+ from string.
+
+Mon Oct 6 18:38:17 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * pack.c: now encode/decode base64 by `m' template.
+
+Fri Oct 3 10:51:10 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * MANIFEST: needed to include lex.c in the distribution.
+
+ * eval.c (ruby_options): f_require() called too early.
+
+ * eval.c (rb_provide): module extensions should always be `.o'.
+
+Thu Oct 2 11:38:31 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * version 1.1 alpha8 released.
+
+ * ext/marshal/marshal.c (r_object): remove temporal regist for
+ structs. (caused problem if structs form cycles.)
+
+ * parse.y (match_gen): static binding for match(=~) calls
+ with regexp literals.
+
+Wed Oct 1 15:26:55 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c: protect retval in struct tag from GC for C_ALLOCA.
+
+ * eval.c: no more pointer value from setjmp/longjmp.
+
+Wed Oct 1 14:01:49 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * ext/marshal/marshal.c (w_byte): argument must be char.
+
+Wed Oct 1 10:30:22 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * variable.c (mod_const_at): global constants now belongs to the
+ class Object.
+
+ * object.c (Init_Object): new global constant NIL.
+
+ * ext/marshal/marshal.c (marshal_dump): try to set binmode.
+
+ * ext/marshal/marshal.c (r_object): forgot to re-regist structs in
+ the object table.
+
+ * eval.c (ruby_options): call Init_ext() before any require()
+ calls by `-r'.
+
+Fri Sep 30 14:29:22 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * ext/marshal/marshal.c (w_object): marshal dumped core.
+
+Tue Sep 30 10:27:39 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * sample/test.rb: bignum test suits added.
+
+ * eval.c (rb_eval): new pseudo variable `true' and `false'.
+
+ * parse.y: new keywords `true' and `false' added.
+
+Mon Sep 29 13:37:58 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * ruby.c (forbid_setid): forbid some options in suid mode.
+
+ * ruby.h (NUM2DBL): new macro to convert into doubles.
+
+Mon Sep 27 09:53:48 1997 EGUCHI Osamu <eguchi@shizuokanet.or.jp>
+
+ * bignum.c: modified for speeding.
+
+Fri Sep 26 18:27:59 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * sample/from.rb: some extensions.
+
+Mon Sep 29 13:15:56 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * parse.y (lhs): no more syntax error on `obj.CONSTANT = value'.
+
+Fri Sep 26 14:41:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+
+ * eval.c (ruby_run): deferred calling Init_ext() just before eval_node.
+
+Fri Sep 26 13:27:24 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+
+ * io.c (io_isatty): forgot to return TRUE value.
+
+Fri Sep 25 11:10:58 1997 EGUCHI Osamu <eguchi@shizuokanet.or.jp>
+
+ * eval.c: use _setjmp/_longjmp instead of setjmp/longjmp on some
+ platforms.
- * aclocal.m4: add fallback file for non-aclocal environments.
- [ruby-core:72683] [Bug #11942]
+Wed Sep 24 17:43:13 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Jan 3 13:56:49 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
+ * string.c (Init_String): String#taint and String#taint? added.
- * eval_error.c (rb_print_undef): Use `rb_method_visibility_t`
- instead of `int`.
- * eval_intern.h (rb_print_undef): ditto
- * proc.c (mnew_internal): ditto
- * vm_method.c (rb_export_method): ditto
- [Misc #11649] [ruby-core:71311] [fix GH-1078]
+ * class.c (mod_ancestors): ancestors include the class itself.
-Sun Jan 3 12:12:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Wed Sep 24 00:57:00 1997 Katsuyuki Okabe <HGC02147@niftyserve.or.jp>
- * acinclude.m4: rename aclocal.m4, which should be generated by
- aclocal. [ruby-core:72675] [Bug #11941]
+ * X68000 patch.
-Sat Jan 2 21:07:55 2016 Eric Wong <e@80x24.org>
+Tue Sep 23 20:42:30 1997 EGUCHI Osamu <eguchi@shizuokanet.or.jp>
- * thread_sync.c (queue_do_pop): avoid cast with Qfalse
- (rb_szqueue_push): ditto, use queue_sleep wrapper
+ * parse.y (node_newnode): SEGV on null node setup.
-Sat Jan 2 16:16:14 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+Mon Sep 22 11:22:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/erb.rb: Allow ERB subclass to add token easily.
- [Feature #11936]
+ * ruby.c (ruby_prog_init): wrong safe condition check.
- * test/erb/test_erb.rb: ditto.
+Sun Sep 21 14:46:02 1997 MAEDA shugo <shugo@po.aianet.ne.jp>
-Sat Jan 2 14:44:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (exc_inspect): garbage added to classpath.
- * parse.y (regexp): set_yylval_num sets u1, should use nd_tag
- instead of nd_state. [ruby-core:72638] [Bug #11932]
+Fri Sep 19 11:49:23 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Jan 2 02:27:22 2016 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * parse.y (newtok): forgot to adjust buffer size when shrinking
+ the token buffer.
- * lib/ostruct.rb: Fix case of frozen object with initializer.
- Bug revealed by RubySpec [ruby-core:72639]
+ * enum.c (enum_find): rb_eval_cmd() does not return value.
-Fri Jan 1 22:01:52 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+ * io.c (pipe_open): close fds on pipe exec. fcntl(fd, F_SETFD, 1)
+ no longer used.
- * NEWS: mention CSV's liberal_parsing option.
+Tue Sep 16 17:54:25 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Fri Jan 1 19:38:23 2016 okkez <okkez000@gmail.com>
+ * file.c (f_test): problem if wrong command specified.
- * doc/NEWS-2.3.0: fix double words typo.
- [ci skip][fix GH-1183]
+ * ruby.c (ruby_prog_init): close stdaux and stdprn for MSDOS.
-Fri Jan 1 15:28:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ruby.c (ruby_prog_init): should not add path from environment
+ variable, if ruby is running under setuid.
- * compile.c (remove_unreachable_chunk): decrease count of
- call_info in removed instructions. fix up r53402.
+ * process.c (init_ids): check suid check for setuid/seteuid etc.
-Fri Jan 1 12:05:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Mon Sep 15 00:42:04 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * compile.c (remove_unreachable_chunk): remove unreferred label
- to optimize away unreachable chunk.
+ * regex.c (re_compile_pattern): \w{3} and \W{3} did not work.
-Fri Jan 1 11:42:57 2016 James Edward Gray II <james@graysoftinc.com>
+Thu Sep 11 10:31:48 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/csv.rb (CSV): Add a liberal_parsing option.
- Patch by Braden Anderson. [#11839]
- * test/csv/test_features.rb: test liberal_parsing
+ * version 1.1 alpha7 released.
-Fri Jan 1 10:27:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * ext/socket/socket.c (sock_new): no setbuf() for NT.
- * tool/mkconfig.rb (RbConfig): prefix SDKROOT to oldincludedir
- not includedir, the latter is outside the ruby installation.
- [ruby-core:72496] [Bug #11881]
+ * io.c (rb_fopen,rb_fdopen): set close-on-exec for every fd.
-Fri Jan 1 08:53:02 2016 Yuki Kurihara <co000ri@gmail.com>
+Wed Sep 10 15:55:31 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_lazy_enumerator.rb (test_take_bad_arg): Add test
- code in case of Enumerator::Lazy#take called with negative number.
- [ruby-dev:49467] [Bug #11933]
+ * ext/marshal/marshal.c (r_bytes0): extra big length check.
-Fri Jan 1 05:06:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Tue Sep 9 16:27:14 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * parse.y (parser_here_document): update indent for each line in
- indented here document with single-quotes.
- [ruby-core:72479] [Bug #11871]
+ * io.c (pipe_fptr_atexit): clean up popen()'ed fptr.
-Fri Jan 1 03:26:44 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * error.c (set_syserr): some system has error code that is bigger
+ than sys_nerr. grrr.
- * lib/ostruct.rb (freeze): define deferred accessors before
- freezing to get rid of an error when just reading frozen
- OpenStruct.
+Mon Sep 8 18:33:33 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Dec 31 14:36:45 2015 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+ * io.c (io_s_new): dereferenced nil for optional mode.
- * lib/ostruct.rb: Fix new_ostruct_member to correctly avoid
- redefinition [#11901]
+Fri Sep 5 10:26:03 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Dec 31 02:45:12 2015 NARUSE, Yui <naruse@ruby-lang.org>
+ * class.c (class_instance_methods): do not include methods which
+ are changed to private in subclasses.
- * test/ruby/test_module.rb (test_classpath): r53376 may change
- the order of m.constants.
- `make TESTS='-v ruby/test_class.rb ruby/test_module.rb' test-all`
- may fail after that.
- http://rubyci.s3.amazonaws.com/tk2-243-31075/ruby-trunk/log/20151230T164202Z.log.html.gz
+Thu Sep 4 12:38:53 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Thu Dec 31 02:20:00 2015 Benoit Daloze <eregontp@gmail.com>
+ * variable.c (f_global_variables): list name of the global
+ variables.
- * common.mk (help): Fix typo.
+ * object.c (obj_id): returns unique integer.
-Wed Dec 30 20:53:09 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Wed Sep 3 14:05:16 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/net/http/responses.rb: Added new response class for 451 status code.
- * lib/net/http.rb: documentation for HTTPUnavailableForLegalReasons
+ * version 1.1 alpha6 released.
-Wed Dec 30 20:45:45 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * eval.c (mod_s_constants): context sensitive constant list.
- * lib/webrick/httpstatus.rb: Added HTTP 451 Status Code.
- [fix GH-1167] Patch by @MuhammetDilmac
- https://tools.ietf.org/html/draft-tbray-http-legally-restricted-status-00
+ * variable.c (mod_constants): no more `all' option.
-Wed Dec 30 20:25:52 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+ * variable.c (mod_const_of): the values for autoload classes are
+ their name strings.
- * doc/syntax/calling_methods.rdoc: fix old operator for safe navigation
- operator. [ci skip][fix GH-1182] Patch by @dougo
+ * class.c (class_instance_methods): no special treatment for
+ singleton classes.
-Wed Dec 30 16:43:23 2015 Kuniaki IGARASHI <igaiga@gmail.com>
+ * object.c (obj_singleton_methods): returns list of singleton
+ method names.
- * test/ruby/test_string.rb (test_ord): Add test for String#ord.
- [Fix GH-1181]
+ * parse.y (yylex): no here document after `class' keyword.
-Wed Dec 30 11:28:57 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (f_load): expand path if fname begins with `~'.
- * lib/forwardable.rb (def_instance_delegator): adjust backtrace of
- method body by tail call optimization. adjusting the delegated
- target is still done by deleting backtrace.
+Tue Sep 2 13:19:48 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/forwardable.rb (def_single_delegator): ditto.
+ * class.c (ins_methods_i): do not list undef'ed methods.
-Wed Dec 30 11:18:42 2015 Elliot Winkler <elliot.winkler@gmail.com>
+Mon Sep 1 13:42:48 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * lib/forwardable.rb (def_instance_delegator) fix delegating to
- 'args' and 'block', clashing with local variables in generated
- methods. [ruby-core:72579] [Bug #11916]
+ * version 1.1 alpha5 released.
- * lib/forwardable.rb (def_single_delegator): ditto.
+ * object.c (mod_attr_reader): create methods to define attribute
+ reader/write/accessor.
-Wed Dec 30 09:58:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * class.c (rb_define_attr): always defines accessors.
- * object.c (rb_class_inherited_p): search the corresponding
- ancestor to prepended module from prepending class itself.
- [ruby-core:72493] [Bug #11878]
+ * eval.c (rb_call): alias occurred in the module body caused SEGV.
-Wed Dec 30 09:20:00 2015 Yuki Kurihara <co000ri@gmail.com>
+ * parse.y: did not generate here document strings properly.
- * test/stringio/test_io.rb (test_flag): add assertion for error when
- text and binary mode are mixed.
- [ruby-dev:49465] [Feature #11921]
+Mon Sep 1 11:43:57 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-Wed Dec 30 08:43:59 2015 Yuki Kurihara <co000ri@gmail.com>
+ * parse.y (yylex): heredoc dropped an extra character.
- * test/stringio/test_stringio.rb (test_initialize): add test for
- StringIO#initialize. [ruby-core:72585] [Feature #11920]
+Fri Aug 29 11:10:21 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Wed Dec 30 05:19:24 2015 Eric Wong <e@80x24.org>
+ * class.c (class_instance_methods): same method names should not
+ appear more than once.
- * class.c (struct clone_const_arg): adjust for id_table
- (clone_const): ditto
- (clone_const_i): ditto
- (rb_mod_init_copy): ditto
- (rb_singleton_class_clone_and_attach): ditto
- (rb_include_class_new): ditto
- (include_modules_at): ditto
- * constant.h (rb_free_const_table): ditto
- * gc.c (free_const_entry_i): ditto
- (rb_free_const_table): ditto
- (obj_memsize_of): ditto
- (mark_const_entry_i): ditto
- (mark_const_tbl): ditto
- * internal.h (struct rb_classext_struct): ditto
- * object.c (rb_mod_const_set): resolve class name on assignment
- * variable.c (const_update): replace with const_tbl_update
- (const_tbl_update): new function
- (fc_i): adjust for id_table
- (find_class_path): ditto
- (autoload_const_set): st_update => const_tbl_update
- (rb_const_remove): adjust for id_table
- (sv_i): ditto
- (rb_local_constants_i): ditto
- (rb_local_constants): ditto
- (rb_mod_const_at): ditto
- (rb_mod_const_set): ditto
- (rb_const_lookup): ditto
- [ruby-core:72112] [Feature #11614]
+ * parse.y (yylex): spaces can follow =begin/=end.
-Wed Dec 30 04:10:13 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
+ * variable.c (find_class_path): look for class_tbl also for
+ unnamed fundamental classes, such as Object, String, etc.
- * thread_pthread.c (rb_thread_create_timer_thread): destroy attr even
- if pthread_create() failed.
+ * variable.c (rb_name_class): can't name class before String class
+ is initialized.
-Wed Dec 30 02:55:09 2015 Eric Wong <e@80x24.org>
+ * inits.c (rb_call_inits): unrecognized dependency from GC to
+ Array.
- * thread_pthread.c (setup_communication_pipe): delay setting owner
- (rb_thread_create_timer_thread): until thread creation succeeds
- [ruby-core:72590] [Bug #11922]
+ * variable.c (find_class_path): could not find class if Object's
+ iv_tbl is NULL.
-Tue Dec 29 19:12:46 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Thu Aug 28 13:12:05 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * ruby.c (proc_options): -W command line option should be able to
- override -w in RUBYOPT environment variable.
+ * version 1.1 alpha4 released.
-Tue Dec 29 17:54:16 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * variable.c (mod_constants): wrong condition for singleton
+ class.
- * eval.c (ignored_block): warn if a block is given to `using`,
- which is probably for `Module.new`.
+ * parse.y (yylex): revised `=begin' skip code.
-Tue Dec 29 12:48:34 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * parse.y (here_document): forgot to free(eos).
- * lib/ostruct.rb (OpenStruct): make respond_to? working on
- just-allocated objects for workaround of Psych.
- [ruby-core:72501] [Bug #11884]
+ * parse.y (yylex): spaces after `<<' prohibited for here
+ documents to avoid confusing with operator `<<'.
-Tue Dec 29 10:35:00 2015 Kenta Murata <mrkn@mrkn.jp>
+ * eval.c (is_defined): separated from rb_eval().
- * test/mkmf/test_have_func.rb (test_have_func):
- Add assertion to examine the existence of HAVE_RUBY_INIT.
+Wed Aug 27 11:32:42 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/mkmf/test_have_func.rb (test_not_have_func):
- Add assertion to examine the absence of HAVE_RUBY_INIT.
+ * version 1.1 alpha3 released.
-Tue Dec 29 06:50:42 2015 Eric Wong <e@80x24.org>
+ * variable.c (mod_name): returns name of the class/module.
- * thread_sync.c: static classes
+ * parse.y (here_document): finally here document available now.
-Tue Dec 29 05:30:30 2015 Eric Wong <e@80x24.org>
+ * variable.c (fc_i): some classes/modules does not have iv_tbl.
- * lib/resolv.rb (Resolv::IPv6.create): avoid modifying frozen
- * test/resolv/test_dns.rb (test_ipv6_create): test for above
- [Bug #11910] [ruby-core:72559]
+ * variable.c (find_class_path): avoid infinite loop.
-Mon Dec 28 14:55:57 2015 Kuniaki IGARASHI <igaiga@gmail.com>
+Tue Aug 26 13:43:47 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_string.rb (TestString#test_rstrip_bang): Add test
- for String#rstrip!. [Fix GH-1176]
+ * eval.c (rb_eval): undef'ing non-existing method will raise
+ NameError exception.
-Mon Dec 28 09:18:53 2015 Kuniaki IGARASHI <igaiga@gmail.com>
+ * object.c (class_s_new): needed to create metaclass too.
- * test/ruby/test_string.rb (TestString#test_lstrip_bang): Add test
- for String#lstrip!. [Fix GH-1176]
+ * eval.c (error_print): no class name print for anonymous class.
-Sun Dec 27 23:32:26 2015 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * eval.c (rb_longjmp): proper exception raised if raise() called
+ without arguments, with $! or $@ set.
- * ext/win32ole/win32ole.c (ole_variant2val): refactoring.
+ * object.c (Init_Object): superclass()'s method argument setting
+ was wrong again.
-Sun Dec 27 21:14:42 2015 NAKAMURA Usaku <usa@ruby-lang.org>
+ * class.c (mod_ancestors): list superclasses and included modules
+ in priority order.
- * process.c (rb_execarg_parent_start1): need to convert the encoding to
- ospath's one.
+Mon Aug 25 11:53:11 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Dec 27 20:54:22 2015 NAKAMURA Usaku <usa@ruby-lang.org>
+ * version 1.1 alpha2 released.
- * process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
- reported by naruse via twitter.
+ * sample/ruby-mode.el (ruby-parse-region): auto-indent now
+ supports "\\" in the strings.
- * process.c (rb_execarg_addopt): need to convert the encoding to
- ospath's one.
+ * struct.c (struct_getmember): new API to get member value from C
+ language side.
-Sun Dec 27 20:00:31 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Sat Aug 23 21:39:05 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * enc/x_emoji.h: fix dead-link.
+ * parse.y (assignable): remove unnecessary local variable
+ initialize by nil.
-Sun Dec 27 19:55:55 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
+Fri Aug 22 14:26:40 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * doc/NEWS-2.3.0: fix a typo.
+ * eval.c (error_print): modified exception print format.
-Sun Dec 27 18:08:15 2015 Kuniaki IGARASHI <igaiga@gmail.com>
+Thu Aug 21 16:10:58 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * string.c (rb_str_lstrip_bang, rb_str_rstrip_bang): [DOC] Fix
- ruby-doc comments for String#rstrip! and lstrip!. It looks like
- dropped bang. [Fix GH-1175]
+ * sample/ruby-mode.el (ruby-calculate-indent): wrong indent level
+ calculated with keyword operators.
-Sun Dec 27 15:14:20 2015 Eric Wong <e@80x24.org>
+Thu Aug 21 11:36:58 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * io.c (io_getpartial): remove unused kwarg from template
- * test/ruby/test_io.rb (test_readpartial_bad_args): new
- [Bug #11885]
+ * parse.y (arg): ary[0] += 1 cause SEGV
-Sun Dec 27 11:50:53 2015 Kuniaki IGARASHI <igaiga@gmail.com>
+Wed Aug 20 17:28:50 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * test/ruby/test_string.rb (test_rstrip, test_lstrip): Add tests
- for String#lstrip and rstrip. The test cases are used from
- string.c ruby-doc comments. [Fix GH-1174]
+ * ruby.c (ruby_process_options): require() all modules after
+ processing all options
-Sun Dec 27 11:47:46 2015 Kuniaki IGARASHI <igaiga@gmail.com>
+ * process.c (rb_proc_exec): more security checks added.
- * test/ruby/test_string.rb (test_insert): Add test for
- String#insert. The test cases are written in string.c
- comments as a reference. [Fix GH-1173]
+ * process.c (rb_proc_exec): insecure path on exec.
-Sun Dec 27 11:03:33 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * hash.c (f_getenv): PATH modification security check.
- * parse.y (show_bitstack): trace stack_type value if yydebug.
+Tue Aug 19 00:15:38 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sun Dec 27 10:03:14 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * version 1.1 alpha1 released.
- * enc/depend (enc, trans): fix version dependency, shared object
- files depend on the RUBY_SO_NAME value for runtime link.
+ * eval.c (mod_eval): work as normal eval() if second binding
+ argument given.
-Sun Dec 27 09:47:20 2015 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+ * eval.c (rb_call): did not raise ArgumentError if too many
+ arguments more than optional arguments (without rest arg).
- * ext/win32ole/win32ole.c (ole_vstr2wc, ole_variant2val): fix blank
- string conversion.
- [Bug #11880]
- Thanks Akio Tajima for the patch!
+ * eval.c (rb_eval): did not work well for op_asgn2 (attribute
+ self assignment).
-Sun Dec 27 09:34:53 2015 craft4coder <yooobuntu@163.com>
+ * eval.c (Init_Thread): returns main thread.
- * doc/extension.rdoc: [DOC] `nul` should be uppercase.
- change 'nul' => 'NUL'. [Fix GH-1172]
+Mon Aug 18 09:25:56 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-Sat Dec 26 18:29:01 2015 Kouhei Sutou <kou@cozmixng.org>
+ * object.c (inspect_i): did not display T_DATA instance variables.
- * lib/xmlrpc/client.rb: Support SSL options in async methods of
- XMLRPC::Client.
- [Bug #11489]
- Reported by Aleksandar Kostadinov. Thanks!!!
+ * parse.y: provides more accurate line number information.
-Sat Dec 26 11:26:38 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+ * eval.c (thread_value): include value's backtrace information in
+ the variable `$@'.
- * miniinit.c (Init_enc): add some common aliases of built-in
- encodings. [ruby-core:72481] [Bug #11872]
+ * eval.c (f_abort): print backtrace and exit.
-Fri Dec 25 22:43:26 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
+Sat Aug 16 00:17:44 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * configure.in: extract RUBY_RELEASE_DAY at generating Makefile.
+ * eval.c (class_new_instance): do not make instance from virtual
+ classes.
- * version.h (RUBY_RELEASE_DATE): construct from RUBY_RELEASE_YEAR,
- RUBY_RELEASE_MONTH, and RUBY_RELEASE_DAY.
+ * object.c (class_s_new): do not make subclass of singleton class.
-Fri Dec 25 21:33:06 2015 Yukihiro Matsumoto <matz@ruby-lang.org>
+Fri Aug 15 15:49:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
- * version.h (RUBY_VERSION): 2.4.0 development has started.
+ * eval.c (call_trace_func): block context switch in the trace
+ function.
-Fri Dec 25 14:12:12 2015 Martin Duerst <duerst@it.aoyama.ac.jp>
+ * eval.c (rb_eval): clear method cache at class extension.
- * doc/ChangeLog-2.3.0, ext/tk/lib/tkextlib/SUPPORT_STATUS,
- include/ruby/version.h: minor grammar fixes [ci skip]
+ * object.c (obj_type): returns object's class even if it defines
+ singleton methods.
-Fri Dec 25 08:23:22 2015 Tadashi Saito <tad.a.digger@gmail.com>
+Fri Aug 15 19:40:43 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
- * compile.c, cont.c, doc, man: fix common misspelling.
- [ruby-core:72466] [Bug #11870]
+ * ext/socket/socket.c (Init_socket): small typo caused SEGV.
+Wed Aug 13 17:51:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
-For the changes before 2.3.0, see doc/ChangeLog-2.3.0
-For the changes before 2.2.0, see doc/ChangeLog-2.2.0
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
+ * version 1.1 alpha0 released.
-Local variables:
-coding: us-ascii
-add-log-time-format: (lambda ()
- (let* ((time (current-time))
- (system-time-locale "C")
- (diff (+ (cadr time) 32400))
- (lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
- (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
-vim: tabstop=8 shiftwidth=2
diff --git a/GPL b/GPL
deleted file mode 100644
index d159169d10..0000000000
--- a/GPL
+++ /dev/null
@@ -1,339 +0,0 @@
- GNU GENERAL PUBLIC LICENSE
- Version 2, June 1991
-
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
- 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
- Preamble
-
- The licenses for most software are designed to take away your
-freedom to share and change it. By contrast, the GNU General Public
-License is intended to guarantee your freedom to share and change free
-software--to make sure the software is free for all its users. This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it. (Some other Free Software Foundation software is covered by
-the GNU Lesser General Public License instead.) You can apply it to
-your programs, too.
-
- When we speak of free software, we are referring to freedom, not
-price. Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-this service if you wish), that you receive source code or can get it
-if you want it, that you can change the software or use pieces of it
-in new free programs; and that you know you can do these things.
-
- To protect your rights, we need to make restrictions that forbid
-anyone to deny you these rights or to ask you to surrender the rights.
-These restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
-
- For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must give the recipients all the rights that
-you have. You must make sure that they, too, receive or can get the
-source code. And you must show them these terms so they know their
-rights.
-
- We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
-
- Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software. If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
-
- Finally, any free program is threatened constantly by software
-patents. We wish to avoid the danger that redistributors of a free
-program will individually obtain patent licenses, in effect making the
-program proprietary. To prevent this, we have made it clear that any
-patent must be licensed for everyone's free use or not licensed at all.
-
- The precise terms and conditions for copying, distribution and
-modification follow.
-
- GNU GENERAL PUBLIC LICENSE
- TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
- 0. This License applies to any program or other work which contains
-a notice placed by the copyright holder saying it may be distributed
-under the terms of this General Public License. The "Program", below,
-refers to any such program or work, and a "work based on the Program"
-means either the Program or any derivative work under copyright law:
-that is to say, a work containing the Program or a portion of it,
-either verbatim or with modifications and/or translated into another
-language. (Hereinafter, translation is included without limitation in
-the term "modification".) Each licensee is addressed as "you".
-
-Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope. The act of
-running the Program is not restricted, and the output from the Program
-is covered only if its contents constitute a work based on the
-Program (independent of having been made by running the Program).
-Whether that is true depends on what the Program does.
-
- 1. You may copy and distribute verbatim copies of the Program's
-source code as you receive it, in any medium, provided that you
-conspicuously and appropriately publish on each copy an appropriate
-copyright notice and disclaimer of warranty; keep intact all the
-notices that refer to this License and to the absence of any warranty;
-and give any other recipients of the Program a copy of this License
-along with the Program.
-
-You may charge a fee for the physical act of transferring a copy, and
-you may at your option offer warranty protection in exchange for a fee.
-
- 2. You may modify your copy or copies of the Program or any portion
-of it, thus forming a work based on the Program, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
- a) You must cause the modified files to carry prominent notices
- stating that you changed the files and the date of any change.
-
- b) You must cause any work that you distribute or publish, that in
- whole or in part contains or is derived from the Program or any
- part thereof, to be licensed as a whole at no charge to all third
- parties under the terms of this License.
-
- c) If the modified program normally reads commands interactively
- when run, you must cause it, when started running for such
- interactive use in the most ordinary way, to print or display an
- announcement including an appropriate copyright notice and a
- notice that there is no warranty (or else, saying that you provide
- a warranty) and that users may redistribute the program under
- these conditions, and telling the user how to view a copy of this
- License. (Exception: if the Program itself is interactive but
- does not normally print such an announcement, your work based on
- the Program is not required to print an announcement.)
-
-These requirements apply to the modified work as a whole. If
-identifiable sections of that work are not derived from the Program,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works. But when you
-distribute the same sections as part of a whole which is a work based
-on the Program, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Program.
-
-In addition, mere aggregation of another work not based on the Program
-with the Program (or with a work based on the Program) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
- 3. You may copy and distribute the Program (or a work based on it,
-under Section 2) in object code or executable form under the terms of
-Sections 1 and 2 above provided that you also do one of the following:
-
- a) Accompany it with the complete corresponding machine-readable
- source code, which must be distributed under the terms of Sections
- 1 and 2 above on a medium customarily used for software interchange; or,
-
- b) Accompany it with a written offer, valid for at least three
- years, to give any third party, for a charge no more than your
- cost of physically performing source distribution, a complete
- machine-readable copy of the corresponding source code, to be
- distributed under the terms of Sections 1 and 2 above on a medium
- customarily used for software interchange; or,
-
- c) Accompany it with the information you received as to the offer
- to distribute corresponding source code. (This alternative is
- allowed only for noncommercial distribution and only if you
- received the program in object code or executable form with such
- an offer, in accord with Subsection b above.)
-
-The source code for a work means the preferred form of the work for
-making modifications to it. For an executable work, complete source
-code means all the source code for all modules it contains, plus any
-associated interface definition files, plus the scripts used to
-control compilation and installation of the executable. However, as a
-special exception, the source code distributed need not include
-anything that is normally distributed (in either source or binary
-form) with the major components (compiler, kernel, and so on) of the
-operating system on which the executable runs, unless that component
-itself accompanies the executable.
-
-If distribution of executable or object code is made by offering
-access to copy from a designated place, then offering equivalent
-access to copy the source code from the same place counts as
-distribution of the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
- 4. You may not copy, modify, sublicense, or distribute the Program
-except as expressly provided under this License. Any attempt
-otherwise to copy, modify, sublicense or distribute the Program is
-void, and will automatically terminate your rights under this License.
-However, parties who have received copies, or rights, from you under
-this License will not have their licenses terminated so long as such
-parties remain in full compliance.
-
- 5. You are not required to accept this License, since you have not
-signed it. However, nothing else grants you permission to modify or
-distribute the Program or its derivative works. These actions are
-prohibited by law if you do not accept this License. Therefore, by
-modifying or distributing the Program (or any work based on the
-Program), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Program or works based on it.
-
- 6. Each time you redistribute the Program (or any work based on the
-Program), the recipient automatically receives a license from the
-original licensor to copy, distribute or modify the Program subject to
-these terms and conditions. You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties to
-this License.
-
- 7. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Program at all. For example, if a patent
-license would not permit royalty-free redistribution of the Program by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Program.
-
-If any portion of this section is held invalid or unenforceable under
-any particular circumstance, the balance of the section is intended to
-apply and the section as a whole is intended to apply in other
-circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system, which is
-implemented by public license practices. Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
- 8. If the distribution and/or use of the Program is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Program under this License
-may add an explicit geographical distribution limitation excluding
-those countries, so that distribution is permitted only in or among
-countries not thus excluded. In such case, this License incorporates
-the limitation as if written in the body of this License.
-
- 9. The Free Software Foundation may publish revised and/or new versions
-of the General Public License from time to time. Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
-Each version is given a distinguishing version number. If the Program
-specifies a version number of this License which applies to it and "any
-later version", you have the option of following the terms and conditions
-either of that version or of any later version published by the Free
-Software Foundation. If the Program does not specify a version number of
-this License, you may choose any version ever published by the Free Software
-Foundation.
-
- 10. If you wish to incorporate parts of the Program into other free
-programs whose distribution conditions are different, write to the author
-to ask for permission. For software which is copyrighted by the Free
-Software Foundation, write to the Free Software Foundation; we sometimes
-make exceptions for this. Our decision will be guided by the two goals
-of preserving the free status of all derivatives of our free software and
-of promoting the sharing and reuse of software generally.
-
- NO WARRANTY
-
- 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
-FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
-OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
-PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
-OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
-MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS
-TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE
-PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
-REPAIR OR CORRECTION.
-
- 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
-REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
-INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
-OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
-TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
-YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
-PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGES.
-
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
-
- If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
-
- To do so, attach the following notices to the program. It is safest
-to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least
-the "copyright" line and a pointer to where the full notice is found.
-
- <one line to give the program's name and a brief idea of what it does.>
- Copyright (C) <year> <name of author>
-
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License along
- with this program; if not, write to the Free Software Foundation, Inc.,
- 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
-
-Also add information on how to contact you by electronic and paper mail.
-
-If the program is interactive, make it output a short notice like this
-when it starts in an interactive mode:
-
- Gnomovision version 69, Copyright (C) year name of author
- Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
- This is free software, and you are welcome to redistribute it
- under certain conditions; type `show c' for details.
-
-The hypothetical commands `show w' and `show c' should show the appropriate
-parts of the General Public License. Of course, the commands you use may
-be called something other than `show w' and `show c'; they could even be
-mouse-clicks or menu items--whatever suits your program.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the program, if
-necessary. Here is a sample; alter the names:
-
- Yoyodyne, Inc., hereby disclaims all copyright interest in the program
- `Gnomovision' (which makes passes at compilers) written by James Hacker.
-
- <signature of Ty Coon>, 1 April 1989
- Ty Coon, President of Vice
-
-This General Public License does not permit incorporating your program into
-proprietary programs. If your program is a subroutine library, you may
-consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Lesser General
-Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
deleted file mode 100644
index 35a8e75876..0000000000
--- a/KNOWNBUGS.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-#
-# IMPORTANT: Always keep the first 7 lines (comments),
-# even if this file is otherwise empty.
-#
-# This test file includes tests which point out known bugs.
-# So all tests will cause failure.
-#
diff --git a/LEGAL b/LEGAL
deleted file mode 100644
index cd1cce2de1..0000000000
--- a/LEGAL
+++ /dev/null
@@ -1,686 +0,0 @@
-LEGAL NOTICE INFORMATION
-------------------------
-
-All the files in this distribution are covered under either the Ruby's
-license (see the file COPYING) or public-domain except some files
-mentioned below.
-
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
-
- These files are licensed under the CC0.
-
- http://creativecommons.org/choose/zero/
-
-ccan/list/list.h
-
- This file is licensed under the MIT License.
-
- Permission is hereby granted, free of charge, to any person obtaining a copy
- of this software and associated documentation files (the "Software"), to deal
- in the Software without restriction, including without limitation the rights
- to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
- copies of the Software, and to permit persons to whom the Software is
- furnished to do so, subject to the following conditions:
-
- The above copyright notice and this permission notice shall be included in
- all copies or substantial portions of the Software.
-
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
- THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
- When this software is partly used or it is distributed with Ruby,
- this of Ruby follows the license of Ruby.
-
-enc/trans/GB/GB12345%UCS.src:
-enc/trans/GB/UCS%GB12345.src:
-
- Copyright (c) 1991-1994 Unicode, Inc. All Rights reserved.
-
- This file is provided as-is by Unicode, Inc. (The Unicode Consortium).
- No claims are made as to fitness for any particular purpose. No
- warranties of any kind are expressed or implied. The recipient
- agrees to determine applicability of information provided. If this
- file has been provided on magnetic media by Unicode, Inc., the sole
- remedy for any claim will be exchange of defective media within 90
- days of receipt.
-
- Recipient is granted the right to make copies in any form for
- internal distribution and to freely use the information supplied
- in the creation of products supporting Unicode. Unicode, Inc.
- specifically excludes the right to re-distribute this file directly
- to third parties or other organizations whether for profit or not.
-
-
-enc/trans/GB/GB2312%UCS.src:
-enc/trans/GB/UCS%GB2312.src:
-
- Copyright (c) 1991-1999 Unicode, Inc. All Rights reserved.
-
- This file is provided as-is by Unicode, Inc. (The Unicode Consortium).
- No claims are made as to fitness for any particular purpose. No
- warranties of any kind are expressed or implied. The recipient
- agrees to determine applicability of information provided. If this
- file has been provided on optical media by Unicode, Inc., the sole
- remedy for any claim will be exchange of defective media within 90
- days of receipt.
-
- Unicode, Inc. hereby grants the right to freely use the information
- supplied in this file in the creation of products supporting the
- Unicode Standard, and to make copies of this file in any form for
- internal or external distribution as long as this notice remains
- attached.
-
-enc/trans/JIS/JISX0201-KANA%UCS.src:
-enc/trans/JIS/JISX0208@1990%UCS.src:
-enc/trans/JIS/JISX0212%UCS.src:
-enc/trans/JIS/UCS%JISX0201-KANA.src:
-enc/trans/JIS/UCS%JISX0208@1990.src:
-enc/trans/JIS/UCS%JISX0212.src:
-
- © 2015 Unicode®, Inc.
- For terms of use, see http://www.unicode.org/terms_of_use.html
-
-enc/trans/JIS/JISX0213-1%UCS@BMP.src:
-enc/trans/JIS/JISX0213-1%UCS@SIP.src:
-enc/trans/JIS/JISX0213-2%UCS@BMP.src:
-enc/trans/JIS/JISX0213-2%UCS@SIP.src:
-
- Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- Copyright (C) 2001 I'O, All Rights Reserved.
- Copyright (C) 2006 Project X0213, All Rights Reserved.
- You can use, modify, distribute this table freely.
-
-enc/trans/JIS/UCS@BMP%JISX0213-1.src:
-enc/trans/JIS/UCS@BMP%JISX0213-2.src:
-enc/trans/JIS/UCS@SIP%JISX0213-1.src:
-enc/trans/JIS/UCS@SIP%JISX0213-2.src:
-
- Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- Copyright (C) 2001 I'O, All Rights Reserved.
- You can use, modify, distribute this table freely.
-
-configure:
-
- This file is free software.
-
- Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
-
- This configure script is free software; the Free Software Foundation
- gives unlimited permission to copy, distribute and modify it.
-
-tool/config.guess:
-tool/config.sub:
-
- As long as you distribute these files with the file configure, they
- are covered under the Ruby's license.
-
- Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
- Free Software Foundation, Inc.
-
- This file is free software; you can redistribute it and/or modify it
- under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful, but
- WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
- General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
-
- As a special exception to the GNU General Public License, if you
- distribute this file as part of a program that contains a
- configuration script generated by Autoconf, you may include it under
- the same distribution terms that you use for the rest of that program.
-
-parse.c:
-
- This file is licensed under the GPL, but is incorporated into Ruby and
- redistributed under the terms of the Ruby license, as permitted by the
- exception to the GPL below.
-
- Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
- Free Software Foundation, Inc.
-
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2, or (at your option)
- any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 51 Franklin Street, Fifth Floor,
- Boston, MA 02110-1301, USA. */
-
- /* As a special exception, you may create a larger work that contains
- part or all of the Bison parser skeleton and distribute that work
- under terms of your choice, so long as that work isn't itself a
- parser generator using the skeleton or a modified version thereof
- as a parser skeleton. Alternatively, if you modify or redistribute
- the parser skeleton itself, you may (at your option) remove this
- special exception, which will cause the skeleton and the resulting
- Bison output files to be licensed under the GNU General Public
- License without this special exception.
-
- This special exception was added by the Free Software Foundation in
- version 2.2 of Bison. */
-
-util.c (partly):
-
- Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
-
- Permission to use, copy, modify, and distribute this software for any
- purpose without fee is hereby granted, provided that this entire notice
- is included in all copies of any software which is or includes a copy
- or modification of this software and in all copies of the supporting
- documentation for such software.
-
- THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
- WARRANTY. IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
- REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
- OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-
-win32/win32.[ch]:
-
- You can apply the Artistic License to these files. (or GPL,
- alternatively)
-
- Copyright (c) 1993, Intergraph Corporation
-
- You may distribute under the terms of either the GNU General Public
- License or the Artistic License, as specified in the perl README file.
-
-util.c (partly):
-
- Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-random.c
-
- This file is under the new-style BSD license.
-
- A C-program for MT19937, with initialization improved 2002/2/10.
- Coded by Takuji Nishimura and Makoto Matsumoto.
- This is a faster version by taking Shawn Cokus's optimization,
- Matthe Bellew's simplification, Isaku Wada's real version.
-
- Before using, initialize the state by using init_genrand(seed)
- or init_by_array(init_key, key_length).
-
- Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
-
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
-
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- 3. The names of its contributors may not be used to endorse or promote
- products derived from this software without specific prior written
- permission.
-
- THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
- "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
- LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
- A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR
- CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
- EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
- PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
- PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF
- LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
- NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
- SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-
- Any feedback is very welcome.
- http://www.math.keio.ac.jp/matumoto/emt.html
- email: matumoto@math.keio.ac.jp
-
-vm_dump.c:procstat_vm
-
- This file is under the new-style BSD license.
-
- Copyright (c) 2007 Robert N. M. Watson
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
- $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-
-vsnprintf.c:
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
-
- This code is derived from software contributed to Berkeley by
- Chris Torek.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
- IMPORTANT NOTE:
- --------------
- From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
- paragraph 3 above is now null and void.
-
-st.c:
-strftime.c:
-include/ruby/st.h:
-missing/acosh.c:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strerror.c:
-missing/strstr.c:
-missing/strtol.c:
-missing/tgamma.c:
-ext/date/date_strftime.c:
-ext/digest/sha1/sha1.[ch]:
-ext/sdbm/_sdbm.c:
-ext/sdbm/sdbm.h:
-
- These files are all under public domain.
-
-missing/crypt.c:
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- Copyright (c) 1989, 1993
- The Regents of the University of California. All rights reserved.
-
- This code is derived from software contributed to Berkeley by
- Tom Truscott.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-missing/setproctitle.c
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- Copyright 2003 Damien Miller
- Copyright (c) 1983, 1995-1997 Eric P. Allman
- Copyright (c) 1988, 1993
- The Regents of the University of California. All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-missing/strlcat.c
-missing/strlcpy.c
-
- These files are under an ISC-style license.
-
- Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
-
- Permission to use, copy, modify, and distribute this software for any
- purpose with or without fee is hereby granted, provided that the above
- copyright notice and this permission notice appear in all copies.
-
- THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
- WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
- MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
- ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
- WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
- ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
- OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
-
-missing/langinfo.c
-
- This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
- Ruby uses a modified version. The file contains the following
- author/copyright notice:
-
- Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
- Permission to use, copy, modify, and distribute this software
- for any purpose and without fee is hereby granted. The author
- disclaims all warranties with regard to this software.
-
-ext/digest/md5/md5.[ch]:
-
- These files are under the following license. Ruby uses modified
- versions of them.
-
- Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
-
- This software is provided 'as-is', without any express or implied
- warranty. In no event will the authors be held liable for any damages
- arising from the use of this software.
-
- Permission is granted to anyone to use this software for any purpose,
- including commercial applications, and to alter it and redistribute it
- freely, subject to the following restrictions:
-
- 1. The origin of this software must not be misrepresented; you must not
- claim that you wrote the original software. If you use this software
- in a product, an acknowledgment in the product documentation would be
- appreciated but is not required.
- 2. Altered source versions must be plainly marked as such, and must not be
- misrepresented as being the original software.
- 3. This notice may not be removed or altered from any source distribution.
-
- L. Peter Deutsch
- ghost@aladdin.com
-
-ext/digest/rmd160/rmd160.[ch]:
-
- These files have the following copyright information, and by the
- author we are allowed to use it under the new-style BSD license.
-
- AUTHOR: Antoon Bosselaers, ESAT-COSIC
- (Arranged for libc by Todd C. Miller)
- DATE: 1 March 1996
-
- Copyright (c) Katholieke Universiteit Leuven
- 1996, All Rights Reserved
-
-ext/digest/sha2/sha2.[ch]:
-
- These files are under the new-style BSD license.
-
- Copyright 2000 Aaron D. Gifford. All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the copyright holder nor the names of contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR(S) AND CONTRIBUTOR(S) ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR(S) OR CONTRIBUTOR(S) BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-ext/json/generator/generator.c:
-
- Copyright 2001-2004 Unicode, Inc.
-
- Disclaimer
-
- This source code is provided as is by Unicode, Inc. No claims are
- made as to fitness for any particular purpose. No warranties of any
- kind are expressed or implied. The recipient agrees to determine
- applicability of information provided. If this file has been
- purchased on magnetic or optical media from Unicode, Inc., the
- sole remedy for any claim will be exchange of defective media
- within 90 days of receipt.
-
- Limitations on Rights to Redistribute This Code
-
- Unicode, Inc. hereby grants the right to freely use the information
- supplied in this file in the creation of products supporting the
- Unicode Standard, and to make copies of this file in any form
- for internal or external distribution as long as this notice
- remains attached.
-
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
-
- These files are under the following license. So to speak, it is
- copyrighted semi-public-domain software.
-
- Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
- Everyone is permitted to do anything on this program
- including copying, modifying, improving,
- as long as you don't try to pretend that you wrote it.
- i.e., the above copyright notice has to appear in all copies.
- Binary distribution requires original version messages.
- You don't have to ask before copying, redistribution or publishing.
- THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
-
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
-
- These files are under the new-style BSD license.
-
- Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the project nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-ext/win32ole/win32ole.c:
-
- You can apply the Artistic License to this file. (or GPL,
- alternatively)
-
- (c) 1995 Microsoft Corporation. All rights reserved.
- Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
-
- Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
- <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
-
- You may distribute under the terms of either the GNU General Public
- License or the Artistic License, as specified in the README file
- of the Perl distribution.
-
-lib/rdoc/generator/template/darkfish/css/fonts.css:
-
- This file is licensed under the SIL Open Font License.
-
- http://scripts.sil.org/OFL
diff --git a/MANIFEST b/MANIFEST
new file mode 100644
index 0000000000..17e8924bb7
--- /dev/null
+++ b/MANIFEST
@@ -0,0 +1,251 @@
+COPYING
+COPYING.LIB
+ChangeLog
+MANIFEST
+Makefile.in
+README
+README.jp
+README.EXT
+README.EXT.jp
+ToDo
+array.c
+bignum.c
+class.c
+compar.c
+configure
+configure.in
+config.guess
+config.sub
+defines.h
+dir.c
+dln.c
+dln.h
+dmyext.c
+enum.c
+env.h
+error.c
+eval.c
+file.c
+gc.c
+hash.c
+inits.c
+install-sh
+instruby.rb
+intern.h
+io.c
+keywords
+lex.c
+main.c
+marshal.c
+math.c
+mkconfig.rb
+node.h
+numeric.c
+object.c
+pack.c
+parse.c
+parse.y
+prec.c
+process.c
+random.c
+range.c
+re.c
+re.h
+regex.c
+regex.h
+ruby.1
+ruby.c
+ruby.h
+rubyio.h
+rubysig.h
+rubytest.rb
+signal.c
+sprintf.c
+st.c
+st.h
+string.c
+struct.c
+time.c
+util.h
+util.c
+variable.c
+version.c
+version.h
+djgpp/README.djgpp
+djgpp/config.hin
+djgpp/config.sed
+djgpp/configure.bat
+djgpp/mkver.sed
+cygwin/GNUmakefile.in
+ext/Setup
+ext/Setup.dj
+ext/Setup.emx
+ext/Setup.x68
+ext/aix_mksym.rb
+ext/configsub.rb
+ext/extmk.rb.in
+lib/English.rb
+lib/Env.rb
+lib/README
+lib/base64.rb
+lib/cgi.rb
+lib/cgi/session.rb
+lib/cgi-lib.rb
+lib/complex.rb
+lib/date.rb
+lib/date2.rb
+lib/debug.rb
+lib/delegate.rb
+lib/e2mmap.rb
+lib/eregex.rb
+lib/find.rb
+lib/final.rb
+lib/finalize.rb
+lib/ftplib.rb
+lib/ftools.rb
+lib/getopts.rb
+lib/getoptlong.rb
+lib/importenv.rb
+lib/irb/completion.rb
+lib/irb/frame.rb
+lib/irb/input-method.rb
+lib/irb/irb.rb
+lib/irb/loader.rb
+lib/irb/main.rb
+lib/irb/multi-irb.rb
+lib/irb/ruby-lex.rb
+lib/irb/ruby-token.rb
+lib/irb/slex.rb
+lib/irb/version.rb
+lib/irb/workspace-binding-2.rb
+lib/irb/workspace-binding.rb
+lib/irb/xmp.rb
+lib/jcode.rb
+lib/mailread.rb
+lib/mathn.rb
+lib/matrix.rb
+lib/mkmf.rb
+lib/monitor.rb
+lib/mutex_m.rb
+lib/net/ftp.rb
+lib/net/http.rb
+lib/net/imap.rb
+lib/net/pop.rb
+lib/net/protocol.rb
+lib/net/smtp.rb
+lib/net/telnet.rb
+lib/observer.rb
+lib/open3.rb
+lib/ostruct.rb
+lib/parsearg.rb
+lib/parsedate.rb
+lib/ping.rb
+lib/profile.rb
+lib/pstore.rb
+lib/rational.rb
+lib/readbytes.rb
+lib/shellwords.rb
+lib/singleton.rb
+lib/sync.rb
+lib/telnet.rb
+lib/tempfile.rb
+lib/thread.rb
+lib/thwait.rb
+lib/timeout.rb
+lib/tracer.rb
+lib/weakref.rb
+misc/README
+misc/inf-ruby.el
+misc/ruby-mode.el
+misc/rubydb2x.el
+misc/rubydb3x.el
+missing/alloca.c
+missing/crypt.c
+missing/dir.h
+missing/dup2.c
+missing/file.h
+missing/finite.c
+missing/flock.c
+missing/isinf.c
+missing/isnan.c
+missing/memcmp.c
+missing/memmove.c
+missing/mkdir.c
+missing/os2.c
+missing/strcasecmp.c
+missing/strncasecmp.c
+missing/strchr.c
+missing/strdup.c
+missing/strerror.c
+missing/strftime.c
+missing/strstr.c
+missing/strtod.c
+missing/strtol.c
+missing/strtoul.c
+missing/vsnprintf.c
+missing/x68.c
+sample/README
+sample/biorhythm.rb
+sample/cal.rb
+sample/cbreak.rb
+sample/clnt.rb
+sample/dbmtest.rb
+sample/dir.rb
+sample/dualstack-fetch.rb
+sample/dualstack-httpd.rb
+sample/eval.rb
+sample/export.rb
+sample/exyacc.rb
+sample/fact.rb
+sample/fib.awk
+sample/fib.pl
+sample/fib.py
+sample/fib.rb
+sample/fib.scm
+sample/freq.rb
+sample/from.rb
+sample/fullpath.rb
+sample/getopts.test
+sample/goodfriday.rb
+sample/irb.rb
+sample/less.rb
+sample/list.rb
+sample/list2.rb
+sample/list3.rb
+sample/mine.rb
+sample/mkproto.rb
+sample/mpart.rb
+sample/mrshtest.rb
+sample/observ.rb
+sample/occur.pl
+sample/occur.rb
+sample/occur2.rb
+sample/philos.rb
+sample/pi.rb
+sample/rename.rb
+sample/rcs.awk
+sample/rcs.dat
+sample/rcs.rb
+sample/regx.rb
+sample/sieve.rb
+sample/svr.rb
+sample/test.rb
+sample/time.rb
+sample/trojan.rb
+sample/tsvr.rb
+sample/uumerge.rb
+win32/Makefile.sub
+win32/README.win32
+win32/config.h.in
+win32/config.status.in
+win32/configure.bat
+win32/mkexports.rb
+win32/resource.rb
+win32/setup.mak
+win32/win32.c
+win32/win32.h
+win32/winmain.c
+x68/fconvert.c
+x68/select.c
+x68/_dtos18.c
+x68/_round.c
diff --git a/Makefile.in b/Makefile.in
index 9c8748aa4d..37f644d786 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,549 +1,277 @@
SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
#### Start of system configuration section. ####
srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
+VPATH = $(srcdir):$(srcdir)/missing
CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
+YACC = @YACC@
PURIFY =
AUTOCONF = autoconf
-ACLOCAL = aclocal
-CONFIGURE = @CONFIGURE@
@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+CFLAGS = @CFLAGS@
+CPPFLAGS = -I. -I$(srcdir) -I@includedir@
LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
+XLDFLAGS = @XLDFLAGS@
+EXTLIBS =
LIBS = @LIBS@ $(EXTLIBS)
MISSING = @LIBOBJS@ @ALLOCA@
LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
+DLDFLAGS = @LIBRUBY_DLDFLAGS@
SOLIBS = @SOLIBS@
MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
+
RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
RUBY_SO_NAME=@RUBY_SO_NAME@
EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
- $(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
- $(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
#### End of system configuration section. ####
MAJOR= @MAJOR@
MINOR= @MINOR@
TEENY= @TEENY@
-RUBY_PROGRAM_VERSION = @RUBY_PROGRAM_VERSION@
LIBRUBY_A = @LIBRUBY_A@
LIBRUBY_SO = @LIBRUBY_SO@
LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
LIBRUBY = @LIBRUBY@
LIBRUBYARG = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
- eval.$(OBJEXT) \
- gc.$(OBJEXT) \
- hash.$(OBJEXT) \
- load.$(OBJEXT) \
- object.$(OBJEXT) \
- parse.$(OBJEXT) \
- string.$(OBJEXT) \
- symbol.$(OBJEXT) \
- vm.$(OBJEXT)
-
-THREAD_MODEL = @THREAD_MODEL@
-
-PREP = @PREP@
-ARCHFILE = @ARCHFILE@
-SETUP =
-EXTSTATIC = @EXTSTATIC@
-ENCSTATIC = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS = @MKDIR_P@
-CP = cp
-MV = mv
-RM = rm -f
-RMDIR = @RMDIR@
-RMDIRS = @RMDIRS@
-RMALL = @RMALL@
-NM = @NM@
-AR = @AR@
-ARFLAGS = @ARFLAGS@
-RANLIB = @RANLIB@
-AS = @AS@
-ASFLAGS = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP = @OBJDUMP@
-OBJCOPY = @OBJCOPY@
-VCS = @VCS@
-VCSUP = @VCSUP@
-DTRACE = @DTRACE@
-DTRACE_EXT = @DTRACE_EXT@
-DTRACE_OBJ = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT = @OBJEXT@
-ASMEXT = S
-DLEXT = @DLEXT@
-MANTYPE = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C = prelude.c
-RBCONFIG = .rbconfig.time
-
-SRC_FILE = $<
-OS_SRC_FILE = $<
-DEST_FILE = $@
-OS_DEST_FILE = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-miniruby$(EXEEXT):
- @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
- @$(RM) $@
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
- $(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
- @$(RM) $@
- $(ECHO) linking static-library $@
- $(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
- @-$(RANLIB) $@ 2> /dev/null || true
- $(ECHO) verifying static-library $@
- @$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
- @$(RM) conftest$(EXEEXT) conftest.c
-
-$(LIBRUBY_SO):
- @-$(PRE_LIBRUBY_UPDATE)
- $(ECHO) linking shared-library $@
- $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
- -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
- -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
- $(Q) $(POSTLINK)
- @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
+EXTOBJS =
+
+MAINOBJ = main.@OBJEXT@
+
+OBJS = array.@OBJEXT@ \
+ bignum.@OBJEXT@ \
+ class.@OBJEXT@ \
+ compar.@OBJEXT@ \
+ dir.@OBJEXT@ \
+ dln.@OBJEXT@ \
+ enum.@OBJEXT@ \
+ error.@OBJEXT@ \
+ eval.@OBJEXT@ \
+ file.@OBJEXT@ \
+ gc.@OBJEXT@ \
+ hash.@OBJEXT@ \
+ inits.@OBJEXT@ \
+ io.@OBJEXT@ \
+ marshal.@OBJEXT@ \
+ math.@OBJEXT@ \
+ numeric.@OBJEXT@ \
+ object.@OBJEXT@ \
+ pack.@OBJEXT@ \
+ parse.@OBJEXT@ \
+ process.@OBJEXT@ \
+ prec.@OBJEXT@ \
+ random.@OBJEXT@ \
+ range.@OBJEXT@ \
+ re.@OBJEXT@ \
+ regex.@OBJEXT@ \
+ ruby.@OBJEXT@ \
+ signal.@OBJEXT@ \
+ sprintf.@OBJEXT@ \
+ st.@OBJEXT@ \
+ string.@OBJEXT@ \
+ struct.@OBJEXT@ \
+ time.@OBJEXT@ \
+ util.@OBJEXT@ \
+ variable.@OBJEXT@ \
+ version.@OBJEXT@ \
+ $(MISSING)
+
+all: miniruby$(EXEEXT) @PREP@ rbconfig.rb $(LIBRUBY)
+ @@MINIRUBY@ -Cext extmk.rb @EXTSTATIC@
+
+miniruby$(EXEEXT): config.status $(LIBRUBY_A) $(MAINOBJ) dmyext.@OBJEXT@
+ @rm -f $@
+ $(PURIFY) $(CC) $(LDFLAGS) $(MAINOBJ) dmyext.@OBJEXT@ $(LIBRUBY_A) $(LIBS) -o $@
+
+$(PROGRAM): $(LIBRUBY) $(MAINOBJ) $(EXTOBJS)
+ @rm -f $@
+ $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) -o $@
+
+$(LIBRUBY_A): $(OBJS) dmyext.@OBJEXT@
+ @AR@ rcu $@ $(OBJS) dmyext.@OBJEXT@
+ @-@RANLIB@ $@ 2> /dev/null || true
+
+$(LIBRUBY_SO): $(OBJS) dmyext.@OBJEXT@ miniruby$(EXEEXT)
+ $(LDSHARED) $(DLDFLAGS) $(OBJS) dmyext.@OBJEXT@ $(SOLIBS) -o $@
+ @-@MINIRUBY@ -e 'ARGV.each{|link| File.delete link if File.exist? link; \
File.symlink "$(LIBRUBY_SO)", link}' \
$(LIBRUBY_ALIASES) || true
-ruby_pc = @ruby_pc@
-$(ruby_pc):
- @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-ruby-runner.h: template/ruby-runner.h.in
- @./config.status --file=$@:$(srcdir)/template/$(@F).in
-
-ruby-runner$(EXEEXT): ruby-runner.c ruby-runner.h
- $(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ $<
-
-$(RBCONFIG): $(PREP)
-
-rbconfig.rb: $(RBCONFIG)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
- $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
- $(ECHO) installing cross-compiling stuff
- $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
- $(Q) $(BASERUBY) -p \
- -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
- -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
- rbconfig.rb > fake-rbconfig.rb
- $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
- $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
- @$(RM) fake.rb fake-rbconfig.rb
- $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
- $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
- $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
- @[ -f $@ ] && mv $@ $@.old
- MAKE=$(MAKE) $(SHELL) ./config.status $@
- @cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
- { \
- echo "all:; -@rm -f conftest.mk"; \
- echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
- echo ".force:"; \
- } > conftest.mk || exit 1; \
- $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
- { echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
- sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status: $(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
- $(srcdir)/include/ruby/version.h
- @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
- set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
- $(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-$(srcdir)/aclocal.m4:
- $(CHDIR) $(srcdir) && \
- type $(ACLOCAL) >/dev/null 2>&1 && exec $(ACLOCAL); \
- touch $(@F)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
- @\
- if cmp -s $(srcdir)/defs/lex.c.src $?; then \
- [ $(Q) ] && echo copying $@ || set -x; \
- $(CP) $(srcdir)/lex.c.blt $@; \
- else \
- [ $(Q) ] && echo generating $@ || set -x; \
- gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
- | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
- > $@.tmp && \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(srcdir)/defs/lex.c.src && \
- $(CP) $@ $(srcdir)/lex.c.blt; \
- fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
- $(MAKEDIRS) $(@D)
- @set +e; \
- if cmp -s $(?:.kwd=.src) $?; then \
- set -x; \
- $(CP) $(?:.kwd=.h.blt) $@; \
- else \
- set -x; \
- gperf $(JIS_PROPS_OPTIONS) $? | \
- sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
- $(CP) $? $(?:.kwd=.src) && \
- $(CP) $@ $(?:.kwd=.h.blt); \
- fi
+install: rbconfig.rb
+ @MINIRUBY@ $(srcdir)/instruby.rb $(DESTDIR)
+
+clean:; @rm -f $(OBJS) $(LIBRUBY_A) $(LIBRUBY_SO) $(LIBRUBY_ALIASES) $(MAINOBJ) rbconfig.rb
+ @rm -f ext/extinit.c ext/extinit.@OBJEXT@ dmyext.@OBJEXT@
+ @-@MINIRUBY@ -Cext extmk.rb clean 2> /dev/null || true
+ @rm -f $(PROGRAM) miniruby$(EXEEXT)
+
+distclean: clean
+ @rm -f Makefile ext/extmk.rb config.h
+ @rm -f ext/config.cache config.cache config.log config.status
+ @rm -f *~ core *.core gmon.out y.tab.c y.output ruby.imp
+
+realclean: distclean
+ @rm -f parse.c
+ @rm -f lex.c
+
+test: miniruby$(EXEEXT)
+ @./miniruby$(EXEEXT) $(srcdir)/rubytest.rb
+
+rbconfig.rb: miniruby$(EXEEXT) $(srcdir)/mkconfig.rb config.status
+ @@MINIRUBY@ $(srcdir)/mkconfig.rb rbconfig.rb
+
+fake.rb: miniruby$(EXEEXT)
+ @echo ' \
+ class Object; \
+ remove_const :RUBY_PLATFORM; \
+ RUBY_PLATFORM = "@arch@"; \
+ if defined? PLATFORM; \
+ remove_const :PLATFORM; \
+ PLATFORM = "@arch@"; \
+ end; \
+ CROSS_COMPILING = true; \
+ end \
+ ' > $@
+
+config.status: $(srcdir)/configure
+ $(SHELL) ./config.status --recheck
+
+$(srcdir)/configure: $(srcdir)/configure.in
+ cd $(srcdir) && $(AUTOCONF)
.c.@OBJEXT@:
- @$(ECHO) compiling $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
- @$(ECHO) assembling $<
- $(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
- @$(ECHO) translating $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
- @$(ECHO) preprocessing $<
- $(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
- @$(ECHO) translating probes $<
- $(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
- $(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
- $(Q) $(RM) $@.tmp
-
-.dmyh.h:
- @$(ECHO) making dummy $(DEST_FILE)
- $(Q)echo '#include "$(*F).dmyh"' > $@
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
- $(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
- $(RM) $(DTRACE_REBUILD_OBJS) $@; \
- $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
- $(MAKE) $(DTRACE_REBUILD_OBJS); \
- fi
- $(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
- @$(ECHO) processing probes in object files
- $(Q) $(RM) $@
- $(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
- @$(ECHO) generating a glommed object with DTrace probes for static library
- $(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
- $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
- enc/encinit.c enc/encinit.$(OBJEXT)
- -$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
- $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
- -$(Q)$(RM) run.gdb
- -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
- -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
- @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
- test "$$#" = 0 && set .; \
- set dummy `\
- find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
- `; shift; \
- cd ..; \
- for dir do \
- echo $(@:-ext=)ing "$$dir"; \
- (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
- case "$@" in \
- *distclean-ext*|*realclean-ext*) \
- $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
- esac; \
- done
- -$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
- -$(Q)$(RM) ext/extinit.c
- -$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
- @test -f "$(ENC_MK)" || exit 0; \
- echo $(@:-enc=ing) encodings; \
- exec $(MAKE) $(MAKE_ENC) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(ECHO) compiling $@
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-update-src::
- @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-update-download:: update-config_files
-
-after-update:: common-srcs
-
-update-mspec:
- @$(CHDIR) $(srcdir); \
- if [ -d spec/mspec ]; then \
- echo updating mspec ...; \
- $(Q1:0=:) set -x; \
- cd spec/mspec && \
- exec git pull; \
- else \
- echo retrieving mspec ...; \
- $(Q1:0=:) set -x; \
- exec git clone $(MSPEC_GIT_URL) spec/mspec; \
- fi
- $(Q)cd $(srcdir)/spec/mspec && exec git --no-pager log -1 --oneline
-
-update-rubyspec: update-mspec
- @$(CHDIR) $(srcdir); \
- if [ -d spec/rubyspec ]; then \
- echo updating rubyspec ...; \
- $(Q1:0=:) set -x; \
- cd spec/rubyspec && \
- exec git pull; \
- else \
- echo retrieving rubyspec ...; \
- $(Q1:0=:) set -x; \
- exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
- fi
- $(Q)cd $(srcdir)/spec/rubyspec && exec git --no-pager log -1 --oneline
-
-test-rubyspec-precheck:
- @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
-
-update-doclie:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/doclie ]; then \
- echo updating doclie ...; \
- $(Q1:0=:) set -x; \
- cd coverage/doclie && \
- git fetch && \
- exec git checkout $(DOCLIE_GIT_REF); \
- else \
- echo retrieving doclie ...; \
- $(Q1:0=:) set -x; \
- exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
- fi
-
-update-simplecov-html:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/simplecov-html ]; then \
- echo updating simplecov-html ...; \
- $(Q1:0=:) set -x; \
- cd coverage/simplecov-html && \
- git fetch && \
- exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
- else \
- echo retrieving simplecov-html ...; \
- exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
- fi
-
-update-simplecov:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/simplecov ]; then \
- echo updating simplecov ...; \
- $(Q1:0=:) set -x; \
- cd coverage/simplecov && \
- git fetch && \
- exec git checkout $(SIMPLECOV_GIT_REF); \
- else \
- echo retrieving simplecov ...; \
- $(Q1:0=:) set -x; \
- exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
- fi
-
-update-coverage: update-simplecov update-simplecov-html update-doclie
-
-INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
- vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
- $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
- $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
- $(ECHO) generating $@
- $(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
- @$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
- sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
- -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
-
-un-runnable:
- $(ECHO) cannot make runnable, configure with --enable-load-relative.
- $(Q) exit 1
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $<
+
+lex.c: keywords
+ gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $(srcdir)/keywords > lex.c
+
+parse.c: parse.y
+ $(YACC) $<
+ mv -f y.tab.c parse.c
+
+parse.@OBJEXT@: parse.c
+
+alloca.@OBJEXT@: $(srcdir)/missing/alloca.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/alloca.c
+
+crypt.@OBJEXT@: $(srcdir)/missing/crypt.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/crypt.c
+
+dup2.@OBJEXT@: $(srcdir)/missing/dup2.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/dup2.c
+
+finite.@OBJEXT@: $(srcdir)/missing/finite.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/finite.c
+
+flock.@OBJEXT@: $(srcdir)/missing/flock.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/flock.c
+
+isinf.@OBJEXT@: $(srcdir)/missing/isinf.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/isinf.c
+
+isnan.@OBJEXT@: $(srcdir)/missing/isnan.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/isnan.c
+
+fnmatch.@OBJEXT@: $(srcdir)/missing/fnmatch.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/fnmatch.c
+
+memcmp.@OBJEXT@: $(srcdir)/missing/memcmp.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/memcmp.c
+
+memmove.@OBJEXT@: $(srcdir)/missing/memmove.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/memmove.c
+
+mkdir.@OBJEXT@: $(srcdir)/missing/mkdir.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/mkdir.c
+
+vsnprintf.@OBJEXT@: $(srcdir)/missing/vsnprintf.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/vsnprintf.c
+
+strcasecmp.@OBJEXT@: $(srcdir)/missing/strcasecmp.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strcasecmp.c
+
+strncasecmp.@OBJEXT@: $(srcdir)/missing/strncasecmp.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strncasecmp.c
+
+strchr.@OBJEXT@: $(srcdir)/missing/strchr.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strchr.c
+
+strerror.@OBJEXT@: $(srcdir)/missing/strerror.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strerror.c
+
+strftime.@OBJEXT@: $(srcdir)/missing/strftime.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strftime.c
+
+strstr.@OBJEXT@: $(srcdir)/missing/strstr.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strstr.c
+
+strtod.@OBJEXT@: $(srcdir)/missing/strtod.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strtod.c
+
+strtol.@OBJEXT@: $(srcdir)/missing/strtol.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strtol.c
+
+strtoul.@OBJEXT@: $(srcdir)/missing/strtoul.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strtoul.c
+
+x68.@OBJEXT@: $(srcdir)/missing/x68.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/x68.c
+
+os2.@OBJEXT@: $(srcdir)/missing/os2.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/os2.c
+
+dl_os2.@OBJEXT@: $(srcdir)/missing/dl_os2.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/dl_os2.c
+
+win32.@OBJEXT@: $(srcdir)/win32/win32.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -I$(srcdir)/missing -c $(srcdir)/win32/win32.c
+
+# Prevent GNU make v3 from overflowing arg limit on SysV.
+.NOEXPORT:
+###
+parse.@OBJEXT@: parse.y ruby.h config.h defines.h intern.h env.h node.h st.h regex.h util.h lex.c
+###
+array.@OBJEXT@: array.c ruby.h config.h defines.h intern.h util.h st.h
+bignum.@OBJEXT@: bignum.c ruby.h config.h defines.h intern.h
+class.@OBJEXT@: class.c ruby.h config.h defines.h intern.h rubysig.h node.h st.h
+compar.@OBJEXT@: compar.c ruby.h config.h defines.h intern.h
+dir.@OBJEXT@: dir.c ruby.h config.h defines.h intern.h
+dln.@OBJEXT@: dln.c config.h defines.h dln.h
+dmyext.@OBJEXT@: dmyext.c
+enum.@OBJEXT@: enum.c ruby.h config.h defines.h intern.h node.h
+error.@OBJEXT@: error.c ruby.h config.h defines.h intern.h env.h version.h
+eval.@OBJEXT@: eval.c ruby.h config.h defines.h intern.h node.h env.h rubysig.h st.h dln.h
+file.@OBJEXT@: file.c ruby.h config.h defines.h intern.h rubyio.h rubysig.h dln.h
+gc.@OBJEXT@: gc.c ruby.h config.h defines.h intern.h rubysig.h st.h node.h env.h re.h regex.h
+hash.@OBJEXT@: hash.c ruby.h config.h defines.h intern.h st.h rubysig.h util.h
+inits.@OBJEXT@: inits.c ruby.h config.h defines.h intern.h
+io.@OBJEXT@: io.c ruby.h config.h defines.h intern.h rubyio.h rubysig.h env.h util.h
+main.@OBJEXT@: main.c ruby.h config.h defines.h intern.h
+marshal.@OBJEXT@: marshal.c ruby.h config.h defines.h intern.h rubyio.h st.h
+prec.@OBJEXT@: prec.c ruby.h config.h defines.h intern.h
+math.@OBJEXT@: math.c ruby.h config.h defines.h intern.h
+numeric.@OBJEXT@: numeric.c ruby.h config.h defines.h intern.h
+object.@OBJEXT@: object.c ruby.h config.h defines.h intern.h st.h
+pack.@OBJEXT@: pack.c ruby.h config.h defines.h intern.h
+process.@OBJEXT@: process.c ruby.h config.h defines.h intern.h rubysig.h st.h
+random.@OBJEXT@: random.c ruby.h config.h defines.h intern.h
+range.@OBJEXT@: range.c ruby.h config.h defines.h intern.h
+re.@OBJEXT@: re.c ruby.h config.h defines.h intern.h re.h regex.h
+regex.@OBJEXT@: regex.c config.h regex.h
+ruby.@OBJEXT@: ruby.c ruby.h config.h defines.h intern.h dln.h node.h util.h
+signal.@OBJEXT@: signal.c ruby.h config.h defines.h intern.h rubysig.h
+sprintf.@OBJEXT@: sprintf.c ruby.h config.h defines.h intern.h
+st.@OBJEXT@: st.c config.h st.h
+string.@OBJEXT@: string.c ruby.h config.h defines.h intern.h re.h regex.h
+struct.@OBJEXT@: struct.c ruby.h config.h defines.h intern.h
+time.@OBJEXT@: time.c ruby.h config.h defines.h intern.h
+util.@OBJEXT@: util.c ruby.h config.h defines.h intern.h util.h
+variable.@OBJEXT@: variable.c ruby.h config.h defines.h intern.h env.h node.h st.h
+version.@OBJEXT@: version.c ruby.h config.h defines.h intern.h version.h
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 6a9dbd3f91..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,209 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.4.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with. For a full list of changes
-with all sufficient information, see the ChangeLog file or Redmine
-(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
-
-== Changes since the 2.3.0 release
-
-=== Language changes
-
-* Multiple assignment in conditional expression is now allowed.
- [Feature #10617]
-
-=== Core classes updates (outstanding ones only)
-
-* Array
-
- * Array#max and Array#min. [Feature #12172]
- This may cause a tiny incompatibility: if you redefine
- Enumerable#max and call max to an Array, your redefinition will be
- now ignored. You should also redefine Array#max.
-
- * Array#sum [Feature #12217]
- This is different from Enumerable#sum in that Array#sum doesn't depend on
- the definition of each method.
-
-* Comparable
-
- * Comparable#clamp. [Feature #10594]
-
-* Dir
-
- * Dir.empty?. [Feature #10121]
-
-* Enumerable
-
- * Enumerable#sum [Feature #12217]
- * Enumerable#uniq [Feature #11090]
-
-* Enumerator::Lazy
-
- * Enumerator::Lazy#uniq [Feature #11090]
-
-* File
-
- * File.empty?. [Feature #9969]
-
-* Float
-
- * Float#ceil, Float#floor, and Float#truncate now take an optional
- digits, as well as Float#round. [Feature #12245]
-
-* Hash
-
- * Hash#transform_values and Hash#transform_values! [Feature #12512]
-
-* Integer
-
- * Integer#ceil, Integer#floor, and Integer#truncate now take an optional
- digits, as well as Integer#round. [Feature #12245]
-
- * Fixnum and Bignum are unified into Integer [Feature #12005]
-
- * Integer#digits for extracting columns of place-value notation [Feature #12447]
-
-* Kernel
-
- * Kernel#clone now takes an optional keyword argument, freeze flag.
- [Feature #12300]
-
-* MatchData
-
- * MatchData#named_captures [Feature #11999]
- * MatchData#values_at supports named captures [Feature #9179]
-
-* Regexp
-
- * Regexp#match? [Feature #8110]
- This returns bool and doesn't save backref.
-
-* RubyVM::Env
-
- * RubyVM::Env was removed.
-
-* String
-
- * String#upcase, String#downcase, String#capitalize, String#swapcase and
- their bang variants work for all of Unicode, and are no longer limited
- to ASCII. Supported encodings are UTF-8, UTF-16BE/LE, UTF-32BE/LE, and
- ISO-8859-1~16. Variations are available with options. See the documentation
- of String#downcase for details. [Feature #10085]
-
- * String.new(capacity: size) [Feature #12024]
-
-* Symbol
-
- * Symbol#match now returns MatchData. [Bug #11991]
-
- * Symbol#upcase, Symbol#downcase, Symbol#capitalize, and Symbol#swapcase now
- work for all of Unicode. See the documentation of String#downcase
- for details. [Feature #10085]
-
-* Thread
-
- * Thread#report_on_exception and Thread.report_on_exception
- [Feature #6647]
-
-=== Stdlib updates (outstanding ones only)
-
-* CSV
-
- * Add a liberal_parsing option. [Feature #11839]
-
-* Logger
-
- * Allow specifying logger parameters in constructor such
- as level, progname, datetime_format, formatter. [Feature #12224]
- * Add shift_period_suffix option. [Feature #10772]
-
-* OpenSSL
-
- * OpenSSL is extracted as a gem and the upstream has been migrated to
- https://github.com/ruby/openssl. OpenSSL still remains as a default gem.
- Refer to its History.md for the full release note. [Feature #9612]
-
-* optparse
-
- * Add an into option. [Feature #11191]
-
-=== Compatibility issues (excluding feature bug fixes)
-
-* Array#sum and Enumerable#sum are implemented. [Feature #12217]
- Ruby itself has no compatibility problem because Ruby didn't have sum method
- for arrays before Ruby 2.4.
- However many third party gems, activesupport, facets, simple_stats, etc,
- defines sum method. These implementations are mostly compatible but
- there are subtle differences.
- Ruby's sum method should be mostly compatible but it is impossible to
- be perfectly compatible with all of them.
-
-* Fixnum and Bignum are unified into Integer [Feature #12005]
- Fixnum class and Bignum class is removed.
- Integer class is changed from abstract class to concrete class.
- For example, 0 is an instance of Integer: 0.class returns Integer.
- The constants Fixnum and Bignum is bound to Integer.
- So obj.kind_of?(Fixnum) works as obj.kind_of?(Integer).
- At C-level, Fixnum object and Bignum object should be distinguished by
- FIXNUM_P(obj) and RB_TYPE_P(obj, T_BIGNUM).
- RUBY_INTEGER_UNIFICATION can be used to detect this feature.
- ruby-2.4.0-preview1 (temporally) removes rb_cFixnum and rb_cBignum
- to check the effect of incompatibility.
- (rb_cFixnum and rb_cBignum may be defined as rb_cInteger later if
- compilation failure of extension library is too big problem.)
-
-* String/Symbol#upcase/downcase/swapcase/capitalize(!) now work for all of
- Unicode, not only for ASCII. [Feature #10085]
- No change is needed if the data is in ASCII anyway or if the limitation
- to ASCII was only tolerated while waiting for a more extensive implementation.
- A change (using the :ascii option) is needed in cases where Unicode data
- is processed, but the operation has to be limited to ASCII only.
- A good example of this are internationalized domain names.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* DateTime
-
- * DateTime#to_time now preserves timezone. [Bug #12189]
-
-* Time
-
- * Time#to_time now preserves timezone. [Bug #12271]
-
-* thread
-
- * the extension library is removed. Till 2.0 it was a pure ruby script
- "thread.rb", which has precedence over "thread.so", and has been provided
- in $LOADED_FEATURES since 2.1.
-
-* Tk
- * Tk is removed from stdlib. [Feature #8539]
- https://github.com/ruby/tk is the new upstream.
-
-=== C API updates
-
-* ruby_show_version() will no longer exits the process, if
- RUBY_SHOW_COPYRIGHT_TO_DIE is set to 0. This will be the default in
- the future.
-
-=== Supported platform changes
-
-* FreeBSD < 4 is no longer supported
-
-=== Implementation improvements
-
-* In some condition, `[x, y].max` and `[x, y].min` are optimized
- so that a temporal array is not created. The concrete condition is
- an implementation detail: currently, the array literal must have no
- splat, must have at least one expression but literal, the length must
- be <= 0x100, and Array#max and min must not be redefined. It will work
- in most casual and real-life use case where it is written with intent
- to `Math.max(x, y)`.
-
-* Thread deadlock detection now shows their backtrace and dependency. [Feature #8214]
diff --git a/README b/README
new file mode 100644
index 0000000000..760291d1ba
--- /dev/null
+++ b/README
@@ -0,0 +1,155 @@
+* What's Ruby
+
+Ruby is the interpreted scripting language for quick and
+easy object-oriented programming. It has many features to
+process text files and to do system management tasks (as in
+Perl). It is simple, straight-forward, and extensible.
+
+* Features of Ruby
+
+ + Simple Syntax
+ + *Normal* Object-Oriented features(ex. class, method calls)
+ + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
+ + Operator Overloading
+ + Exception Handling
+ + Iterators and Closures
+ + Garbage Collection
+ + Dynamic Loading of Object files(on some architecture)
+ + Highly Portable(works on many UNIX machines, and on DOS,
+ Windows, Mac, BeOS etc.)
+
+* How to get Ruby
+
+The Ruby distribution can be found on:
+
+ ftp://ftp.netlab.co.jp/pub/lang/ruby/
+
+You can get it by anonymous CVS. How to check out is:
+
+ $ cvs -d :pserver:anonymous@cvs.ruby-lang.org:/src login
+ (Logging in to anonymous@cvs.ruby-lang.org)
+ CVS password: anonymous
+ $ cvs -z4 -d :pserver:anonymous@cvs.ruby-lang.org:/src checkout ruby
+
+* Mailing list
+
+There is a mailing list to talk about Ruby.
+To subscribe this list, please send the following phrase
+
+ subscribe YourFirstName YourFamilyName
+e.g.
+ subscribe Joseph Smith
+
+in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
+
+* How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+ 1. If ./configure does not exist or is older than configure.in,
+ run autoconf to (re)generate configure.
+
+ 2. Run ./configure, which will generate config.h and Makefile.
+
+ 3. Edit defines.h if you need. Probably this step will not need.
+
+ 4. Remove comment mark(#) before the module names from ext/Setup (or
+ add module names if not present), if you want to link modules
+ statically.
+
+ If you don't want to compile non static extension modules
+ (probably on architectures which does not allow dynamic loading),
+ remove comment mark from the line "#option nodynamic" in
+ ext/Setup.
+
+ 5. Run make.
+
+ 6. Optionally, run 'make test' to check whether the compiled Ruby
+ interpreter works well. If you see the message "test succeeded",
+ your ruby works as it should (hopefully).
+
+ 7. Run 'make install'
+
+ You may have to be a super user to install ruby.
+
+If you fail to compile ruby, please send the detailed error report with
+the error log and machine/OS type, to help others.
+
+* Copying
+
+Ruby is copyrighted free software by Yukihiro Matsumoto <matz@zetabits.com>.
+You can redistribute it and/or modify it under either the terms of the GPL
+(see COPYING file), or the conditions below:
+
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
+
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
+
+ a) place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
+
+ b) use the modified software only within your corporation or
+ organization.
+
+ c) rename any non-standard executables so the names do not conflict
+ with standard executables, which must also be provided.
+
+ d) make other distribution arrangements with the author.
+
+ 3. You may distribute the software in object code or executable
+ form, provided that you do at least ONE of the following:
+
+ a) distribute the executables and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
+
+ b) accompany the distribution with the machine-readable source of
+ the software.
+
+ c) give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d) make other distribution arrangements with the author.
+
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under this terms.
+
+ They are gc.c(partly), utils.c(partly), regex.[ch], st.[ch] and some
+ files under the ./missing directory. See each file for the copying
+ condition.
+
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
+
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
+
+* Ruby home-page
+
+The URL of the Ruby home-page is:
+
+ http://www.ruby-lang.org/
+
+* The Author
+
+Feel free to send comments and bug reports to the author. Here is the
+author's latest mail address:
+
+ matz@zetabits.com
+
+-------------------------------------------------------
+created at: Thu Aug 3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.EXT b/README.EXT
index 48b8d964c4..f3db6fa45b 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1 +1,1026 @@
-Moved to doc/extension.rdoc
+.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
+
+This document explains how to make extension libraries for Ruby.
+
+1. Basic knowledge
+
+In C, variables have types and data do not have types. In contrast,
+Ruby variables do not have static type and data themselves have
+types. So, data need to be converted across the languages.
+
+Data in Ruby represented C type `VALUE'. Each VALUE data have its
+data-type.
+
+To retrieve an C data from the VALUE, you need to:
+
+ (1) Identify VALUE's data type
+ (2) Convert VALUE into C data
+
+Converting to wrong data type may cause serious problems.
+
+
+1.1 Data-types
+
+Ruby interpreter has data-types as below:
+
+ T_NIL nil
+ T_OBJECT ordinary object
+ T_CLASS class
+ T_MODULE module
+ T_FLOAT floating point number
+ T_STRING string
+ T_REGEXP regular expression
+ T_ARRAY array
+ T_FIXNUM Fixnum(31bit integer)
+ T_HASH associative array
+ T_STRUCT (Ruby) structure
+ T_BIGNUM multi precision integer
+ T_TRUE true
+ T_FALSE false
+ T_DATA data
+ T_SYMBOL symbol
+
+Otherwise, there are several other types used internally:
+
+ T_ICLASS
+ T_MATCH
+ T_UNDEF
+ T_VARMAP
+ T_SCOPE
+ T_NODE
+
+Most of the types are represented by C structures.
+
+1.2 Check Data Type of the VALUE
+
+The macro TYPE() defined in ruby.h shows data-type of the VALUE.
+TYPE() returns the constant number T_XXXX described above. To handle
+data-types, the code will be like:
+
+ switch (TYPE(obj)) {
+ case T_FIXNUM:
+ /* process Fixnum */
+ break;
+ case T_STRING:
+ /* process String */
+ break;
+ case T_ARRAY:
+ /* process Array */
+ break;
+ default:
+ /* raise exception */
+ rb_raise(rb_eTypeError, "not valid value");
+ break;
+ }
+
+There is the data-type check function.
+
+ void Check_Type(VALUE value, int type)
+
+It raises an exception, if the VALUE does not have the type specified.
+
+There are faster check-macros for fixnums and nil.
+
+ FIXNUM_P(obj)
+ NIL_P(obj)
+
+1.3 Convert VALUE into C data
+
+The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+respectively. They are singletons for the data type.
+
+The T_FIXNUM data is the 31bit length fixed integer (63bit length on
+some machines), which can be convert to the C integer by using
+FIX2INT() macro. There also be NUM2INT() which converts any Ruby
+numbers into C integer. The NUM2INT() macro includes type check, so
+the exception will be raised if conversion failed.
+
+Other data types have corresponding C structures, e.g. struct RArray
+for T_ARRAY etc. VALUE of the type which has corresponding structure
+can be cast to retrieve the pointer to the struct. The casting macro
+RXXXX for each data type like RARRAY(obj). see "ruby.h".
+
+For example, `RSTRING(size)->len' is the way to get the size of the
+Ruby String object. The allocated region can be accessed by
+`RSTRING(str)->ptr'. For arrays, `RARRAY(ary)->len' and
+`RARRAY(ary)->ptr' respectively.
+
+Notice: Do not change the value of the structure directly, unless you
+are responsible about the result. It will be the cause of interesting
+bugs.
+
+1.4 Convert C data into VALUE
+
+To convert C data to the values of Ruby:
+
+ * FIXNUM
+
+ left shift 1 bit, and turn on LSB.
+
+ * Other pointer values
+
+ cast to VALUE.
+
+You can determine whether VALUE is pointer or not, by checking LSB.
+
+Notice Ruby does not allow arbitrary pointer value to be VALUE. They
+should be pointers to the structures which Ruby knows. The known
+structures are defined in <ruby.h>.
+
+To convert C numbers to Ruby value, use these macros.
+
+ INT2FIX() for integers within 31bits.
+ INT2NUM() for arbitrary sized integer.
+
+INT2NUM() converts integers into Bignums, if it is out of FIXNUM
+range, but bit slower.
+
+1.5 Manipulate Ruby data
+
+As I already told, it is not recommended to modify object's internal
+structure. To manipulate objects, use functions supplied by Ruby
+interpreter. Useful functions are listed below (not all):
+
+ String functions
+
+ rb_str_new(const char *ptr, long len)
+
+ Creates a new Ruby string.
+
+ rb_str_new2(const char *ptr)
+
+ Creates a new Ruby string from C string. This is equivalent to
+ rb_str_new(ptr, strlen(ptr)).
+
+ rb_tainted_str_new(const char *ptr, long len)
+
+ Creates a new tainted Ruby string. Strings from external data
+ should be tainted.
+
+ rb_tainted_str_new2(const char *ptr)
+
+ Creates a new tainted Ruby string from C string.
+
+ rb_str_cat(VALUE str, const char *ptr, long len)
+
+ Appends len bytes data from ptr to the Ruby string.
+
+ Array functions
+
+ rb_ary_new()
+
+ Creates an array with no element.
+
+ rb_ary_new2(long len)
+
+ Creates an array with no element, with allocating internal buffer
+ for len elements.
+
+ rb_ary_new3(long n, ...)
+
+ Creates an n-elements array from arguments.
+
+ rb_ary_new4(long n, VALUE *elts)
+
+ Creates an n-elements array from C array.
+
+ rb_ary_push(VALUE ary, VALUE val)
+ rb_ary_pop(VALUE ary)
+ rb_ary_shift(VALUE ary)
+ rb_ary_unshift(VALUE ary, VALUE val)
+
+ Array operations. The first argument to each functions must be an
+ array. They may dump core if other types given.
+
+2. Extend Ruby with C
+
+2.1 Add new features to Ruby
+
+You can add new features (classes, methods, etc.) to the Ruby
+interpreter. Ruby provides the API to define things below:
+
+ * Classes, Modules
+ * Methods, Singleton Methods
+ * Constants
+
+2.1.1 Class/module definition
+
+To define class or module, use functions below:
+
+ VALUE rb_define_class(const char *name, VALUE super)
+ VALUE rb_define_module(const char *name)
+
+These functions return the newly created class or module. You may
+want to save this reference into the variable to use later.
+
+To define nested class or module, use functions below:
+
+ VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 Method/singleton method definition
+
+To define methods or singleton methods, use functions below:
+
+ void rb_define_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+ void rb_define_singleton_method(VALUE object, const char *name,
+ VALUE (*func)(), int argc)
+
+The `argc' represents the number of the arguments to the C function,
+which must be less than 17. But I believe you don't need that much. :-)
+
+If `argc' is negative, it specifies calling sequence, not number of
+the arguments.
+
+If argc is -1, the function will be called like:
+
+ VALUE func(int argc, VALUE *argv, VALUE obj)
+
+where argc is the actual number of arguments, argv is the C array of
+the arguments, and obj is the receiver.
+
+if argc is -2, the arguments are passed in Ruby array. The function
+will be called like:
+
+ VALUE func(VALUE obj, VALUE args)
+
+where obj is the receiver, and args is the Ruby array containing
+actual arguments.
+
+There're two more functions to define method. One is to define
+private method:
+
+ void rb_define_private_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+The other is to define module function, which is private AND singleton
+method of the module. For example, sqrt is the module function
+defined in Math module. It can be call in the form like:
+
+ Math.sqrt(4)
+
+or
+
+ include Math
+ sqrt(4)
+
+To define module function
+
+ void rb_define_module_function(VALUE module, const char *name,
+ VALUE (*func)(), int argc)
+
+Oh, in addition, function-like method, which is private method defined
+in Kernel module, can be defined using:
+
+ void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+To define alias to the method,
+
+ void rb_define_alias(VALUE module, const char* new, const char* old);
+
+2.1.3 Constant definition
+
+We have 2 functions to define constants:
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
+
+The former is to define constant under specified class/module. The
+latter is to define global constant.
+
+2.2 Use Ruby features from C
+
+There are several ways to invoke Ruby's features from C code.
+
+2.2.1 Evaluate Ruby Program in String
+
+Easiest way to call Ruby's function from C program is to evaluate the
+string as Ruby program. This function will do the job.
+
+ VALUE rb_eval_string(const char *str)
+
+Evaluation is done under current context, thus current local variables
+of the innermost method (which is defined by Ruby) can be accessed.
+
+2.2.2 ID or Symbol
+
+You can invoke methods directly, without parsing the string. First I
+need to explain about symbols (which data type is ID). ID is the
+integer number to represent Ruby's identifiers such as variable names.
+It can be accessed from Ruby in the form like:
+
+ :Identifier
+
+You can get the symbol value from string within C code, by using
+
+ rb_intern(const char *name)
+
+2.2.3 Invoke Ruby method from C
+
+To invoke methods directly, you can use the function below
+
+ VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+This function invokes the method of the recv, which name is specified
+by the symbol mid.
+
+2.2.4 Accessing the variables and constants
+
+You can access class variables, and instance variables using access
+functions. Also, global variables can be shared between both worlds.
+There's no way to access Ruby's local variables.
+
+The functions to access/modify instance variables are below:
+
+ VALUE rb_ivar_get(VALUE obj, ID id)
+ VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id must be the symbol, which can be retrieved by rb_intern().
+
+To access the constants of the class/module:
+
+ VALUE rb_const_get(VALUE obj, ID id)
+
+See 2.1.3 for defining new constant.
+
+3. Information sharing between Ruby and C
+
+3.1 Ruby constant that C can be accessed from C
+
+Following Ruby constants can be referred from C.
+
+ Qtrue
+ Qfalse
+
+Boolean values. Qfalse is false in the C also (i.e. 0).
+
+ Qnil
+
+Ruby nil in C scope.
+
+3.2 Global variables shared between C and Ruby
+
+Information can be shared between two worlds, using shared global
+variables. To define them, you can use functions listed below:
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+This function defines the variable which is shared by the both world.
+The value of the global variable pointed by `var', can be accessed
+through Ruby's global variable named `name'.
+
+You can define read-only (from Ruby, of course) variable by the
+function below.
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+You can defined hooked variables. The accessor functions (getter and
+setter) are called on access to the hooked variables.
+
+ void rb_define_hooked_variable(constchar *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+If you need to supply either setter or getter, just supply 0 for the
+hook you don't need. If both hooks are 0, rb_define_hooked_variable()
+works just like rb_define_variable().
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+This function defines the Ruby global variable without corresponding C
+variable. The value of the variable will be set/get only by hooks.
+
+The prototypes of the getter and setter functions are as following:
+
+ (*getter)(ID id, void *data, struct global_entry* entry);
+ (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 Encapsulate C data into Ruby object
+
+To wrapping and objectify the C pointer as Ruby object (so called
+DATA), use Data_Wrap_Struct().
+
+ Data_Wrap_Struct(klass, mark, free, ptr)
+
+Data_Wrap_Struct() returns a created DATA object. The klass argument
+is the class for the DATA object. The mark argument is the function
+to mark Ruby objects pointed by this data. The free argument is the
+function to free the pointer allocation. The functions, mark and
+free, will be called from garbage collector.
+
+You can allocate and wrap the structure in one step.
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+This macro returns an allocated Data object, wrapping the pointer to
+the structure, which is also allocated. This macro works like:
+
+ (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
+
+Arguments, klass, mark, free, works like their counterpart of
+Data_Wrap_Struct(). The pointer to allocated structure will be
+assigned to sval, which should be the pointer to the type specified.
+
+To retrieve the C pointer from the Data object, use the macro
+Data_Get_Struct().
+
+ Data_Get_Struct(obj, type, sval)
+
+The pointer to the structure will be assigned to the variable sval.
+
+See example below for detail.
+
+4. Example - Creating dbm extension
+
+OK, here's the example to make extension library. This is the
+extension to access dbm. The full source is included in ext/
+directory in the Ruby's source tree.
+
+(1) make the directory
+
+ % mkdir ext/dbm
+
+Make a directory for the extension library under ext directory.
+
+(2) create MANIFEST file
+
+ % cd ext/dbm
+ % touch MANIFEST
+
+There should be MANIFEST file in the directory for the extension
+library. Make empty file now.
+
+(3) design the library
+
+You need to design the library features, before making it.
+
+(4) write C code.
+
+You need to write C code for your extension library. If your library
+has only one source file, choosing ``LIBRARY.c'' as a file name is
+preferred. On the other hand, in case your library has plural source
+files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
+with intermediate file ``LIBRARY.o'' on some platforms.
+
+Ruby will execute the initializing function named ``Init_LIBRARY'' in
+the library. For example, ``Init_dbm()'' will be executed when loading
+the library.
+
+Here's the example of an initializing function.
+
+--
+Init_dbm()
+{
+ /* define DBM class */
+ cDBM = rb_define_class("DBM", rb_cObject);
+ /* DBM includes Enumerate module */
+ rb_include_module(cDBM, rb_mEnumerable);
+
+ /* DBM has class method open(): arguments are received as C array */
+ rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+ /* DBM instance method close(): no args */
+ rb_define_method(cDBM, "close", fdbm_close, 0);
+ /* DBM instance method []: 1 argument */
+ rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+ :
+
+}
+--
+
+The dbm extension wrap dbm struct in C world using Data_Make_Struct.
+
+--
+struct dbmdata {
+ int di_size;
+ DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+This code wraps dbmdata structure into Ruby object. We avoid wrapping
+DBM* directly, because we want to cache size information.
+
+To retrieve dbmdata structure from Ruby object, we define the macro below:
+
+--
+#define GetDBM(obj, dbmp) {\
+ Data_Get_Struct(obj, struct dbmdata, dbmp);\
+ if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+This sort of complicated macro do the retrieving and close check for
+the DBM.
+
+There are three kind of way to receiving method arguments. First, the
+methods with fixed number of arguments receives arguments like this:
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+ VALUE obj, keystr;
+{
+ :
+}
+--
+
+The first argument of the C function is the self, the rest are the
+arguments to the method.
+
+Second, the methods with arbitrary number of arguments receives
+arguments like this:
+
+--
+static VALUE
+fdbm_s_open(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
+{
+ :
+ if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+ mode = 0666; /* default value */
+ }
+ :
+}
+--
+
+The first argument is the number of method arguments. the second
+argument is the C array of the method arguments. And the third
+argument is the receiver of the method.
+
+You can use the function rb_scan_args() to check and retrieve the
+arguments. For example "11" means, the method requires at least one
+argument, and at most receives two arguments.
+
+The methods with arbitrary number of arguments can receives arguments
+by Ruby's array, like this:
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+ VALUE obj, args;
+{
+ :
+}
+--
+
+The first argument is the receiver, the second one is the Ruby array
+which contains the arguments to the method.
+
+** Notice
+
+GC should know about global variables which refers Ruby's objects, but
+not exported to the Ruby world. You need to protect them by
+
+ void rb_global_variable(VALUE *var)
+
+(5) prepare extconf.rb
+
+If there exists the file named extconf.rb, it will be executed to
+generate Makefile. If not, compilation scheme try to generate
+Makefile anyway.
+
+The extconf.rb is the file to check compilation condition etc. You
+need to put
+
+ require 'mkmf'
+
+at the top of the file. You can use the functions below to check the
+condition.
+
+ have_library(lib, func): check whether library containing function exists.
+ have_func(func, header): check whether function exists
+ have_header(header): check whether header file exists
+ create_makefile(target): generate Makefile
+
+The value of variables below will affect Makefile.
+
+ $CFLAGS: included in CFLAGS make variable (such as -I)
+ $LDFLAGS: included in LDFLAGS make variable (such as -L)
+
+If compilation condition is not fulfilled, you do not call
+``create_makefile''. Makefile will not generated, compilation will
+not be done.
+
+(6) prepare depend (optional)
+
+If the file named depend exists, Makefile will include that file to
+check dependency. You can make this file by invoking
+
+ % gcc -MM *.c > depend
+
+It's no harm. Prepare it.
+
+(7) put file names into MANIFEST (optional)
+
+ % find * -type f -print > MANIFEST
+ % vi MANIFEST
+
+Append file names into MANIFEST. The compilation scheme requires
+MANIFEST only to be exist. But, you'd better take this step to
+distinguish required files.
+
+(8) generate Makefile
+
+Try generate Makefile by:
+
+ ruby extconf.rb
+
+You don't need this step, if you put extension library under ext
+directory of the ruby source tree. In that case, compilation of the
+interpreter will do this step for you.
+
+(9) make
+
+Type
+
+ make
+
+to compile your extension. You don't need this step neither, if you
+put extension library under ext directory of the ruby source tree.
+
+(9) debug
+
+You may need to rb_debug the extension. The extensions can be linked
+statically by adding directory name in the ext/Setup file, so that you
+can inspect the extension with the debugger.
+
+(10) done, now you have the extension library
+
+You can do anything you want with your library. The author of Ruby
+will not claim any restriction about your code depending Ruby API.
+Feel free to use, modify, distribute or sell your program.
+
+Appendix A. Ruby source files overview
+
+ruby language core
+
+ class.c
+ error.c
+ eval.c
+ gc.c
+ object.c
+ parse.y
+ variable.c
+
+utility functions
+
+ dln.c
+ regex.c
+ st.c
+ util.c
+
+ruby interpreter implementation
+
+ dmyext.c
+ inits.c
+ main.c
+ ruby.c
+ version.c
+
+class library
+
+ array.c
+ bignum.c
+ compar.c
+ dir.c
+ enum.c
+ file.c
+ hash.c
+ io.c
+ marshal.c
+ math.c
+ numeric.c
+ pack.c
+ prec.c
+ process.c
+ random.c
+ range.c
+ re.c
+ signal.c
+ sprintf.c
+ string.c
+ struct.c
+ time.c
+
+Appendix B. Ruby extension API reference
+
+** Types
+
+ VALUE
+
+The type for Ruby object. Actual structures are defined in ruby.h,
+such as struct RString, etc. To refer the values in structures, use
+casting macros like RSTRING(obj).
+
+** Variables and constants
+
+ Qnil
+
+const: nil object
+
+ Qtrue
+
+const: true object(default true value)
+
+ Qfalse
+
+const: false object
+
+** C pointer wrapping
+
+ Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+Wrap C pointer into Ruby object. If object has references to other
+Ruby object, they should be marked by using mark function during GC
+process. Otherwise, mark should be 0. When this object is no longer
+referred by anywhere, the pointer will be discarded by free function.
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+This macro allocates memory using malloc(), assigns it to the variable
+sval, and returns the DATA encapsulating the pointer to memory region.
+
+ Data_Get_Struct(data, type, sval)
+
+This macro retrieves the pointer value from DATA, and assigns it to
+the variable sval.
+
+** defining class/module
+
+ VALUE rb_define_class(const char *name, VALUE super)
+
+Defines new Ruby class as subclass of super.
+
+ VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+Creates new Ruby class as subclass of super, under the module's
+namespace.
+
+ VALUE rb_define_module(const char *name)
+
+Defines new Ruby module.
+
+ VALUE rb_define_module_under(VALUE module, const char *name, VALUE super)
+
+Defines new Ruby module, under the module's namespace.
+
+ void rb_include_module(VALUE klass, VALUE module)
+
+Includes module into class. If class already includes it, just
+ignore.
+
+ void rb_extend_object(VALUE object, VALUE module)
+
+Extend the object with module's attribute.
+
+** Defining Global Variables
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+Defines a global variable which is shared between C and Ruby. If name
+contains the character which is not allowed to be part of the symbol,
+it can't be seen from Ruby programs.
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+Defines a read-only global variable. Works just like
+rb_define_variable(), except defined variable is read-only.
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), VALUE (*setter)())
+
+Defines a virtual variable, whose behavior is defined by pair of C
+functions. The getter function is called when the variable is
+referred. The setter function is called when the value is set to the
+variable. The prototype for getter/setter functions are:
+
+ VALUE getter(ID id)
+ void setter(VALUE val, ID id)
+
+The getter function must return the value for the access.
+
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), VALUE (*setter)())
+
+Defines hooked variable. It's virtual variable with C variable. The
+getter is called as
+
+ VALUE getter(ID id, VALUE *var)
+
+returning new value. The setter is called as
+
+ void setter(VALUE val, ID id, VALUE *var)
+
+GC requires to mark the C global variables which hold Ruby values.
+
+ void rb_global_variable(VALUE *var)
+
+Tells GC to protect these variables.
+
+** Constant Definition
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+Defines a new constant under the class/module.
+
+ void rb_define_global_const(const char *name, VALUE val)
+
+Defines global constant. This is just work as
+
+ rb_define_const(cKernal, name, val)
+
+** Method Definition
+
+ rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a method for the class. func is the function pointer. argc
+is the number of arguments. if argc is -1, the function will receive
+3 arguments argc, argv, and self. if argc is -2, the function will
+receive 2 arguments, self and args, where args is the Ruby array of
+the method arguments.
+
+ rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a private method for the class. Arguments are same as
+rb_define_method().
+
+ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a singleton method. Arguments are same as rb_define_method().
+
+ rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+Retrieve argument from argc, argv. The fmt is the format string for
+the arguments, such as "12" for 1 non-optional argument, 2 optional
+arguments. If `*' appears at the end of fmt, it means the rest of
+the arguments are assigned to corresponding variable, packed in
+array.
+
+** Invoking Ruby method
+
+ VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+Invokes the method. To retrieve mid from method name, use rb_intern().
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+Invokes method, passing arguments by array of values.
+
+ VALUE rb_eval_string(const char *str)
+
+Compiles and executes the string as Ruby program.
+
+ ID rb_intern(const char *name)
+
+Returns ID corresponding the name.
+
+ char *rb_id2name(ID id)
+
+Returns the name corresponding ID.
+
+ char *rb_class2name(VALUE klass)
+
+Returns the name of the class.
+
+ int rb_respond_to(VALUE object, ID id)
+
+Returns true if the object responds to the message specified by id.
+
+** Instance Variables
+
+ VALUE rb_iv_get(VALUE obj, const char *name)
+
+Retrieve the value of the instance variable. If the name is not
+prefixed by `@', that variable shall be inaccessible from Ruby.
+
+ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+Sets the value of the instance variable.
+
+** Control Structure
+
+ VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+Calls the function func1, supplying func2 as the block. func1 will be
+called with the argument arg1. func2 receives the value from yield as
+the first argument, arg2 as the second argument.
+
+ VALUE rb_yield(VALUE val)
+
+Evaluates the block with value val.
+
+ VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+Calls the function func1, with arg1 as the argument. If exception
+occurs during func1, it calls func2 with arg2 as the argument. The
+return value of rb_rescue() is the return value from func1 if no
+exception occurs, from func2 otherwise.
+
+ VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+
+Calls the function func1 with arg1 as the argument, then calls func2
+with arg2, whenever execution terminated. The return value from
+rb_ensure() is that of func1.
+
+** Exceptions and Errors
+
+ void rb_warn(const char *fmt, ...)
+
+Prints warning message according to the printf-like format.
+
+ void rb_warning(const char *fmt, ...)
+
+Prints warning message according to the printf-like format, if
+$VERBOSE is true.
+
+ void rb_raise(VALUE exception, const char *fmt, ...)
+
+Raises an exception of class exception. The fmt is the format string
+just like printf().
+
+ void rb_fatal(const char *fmt, ...)
+
+Raises fatal error, terminates the interpreter. No exception handling
+will be done for fatal error, but ensure blocks will be executed.
+
+ void rb_bug(const char *fmt, ...)
+
+Terminates the interpreter immediately. This function should be
+called under the situation caused by the bug in the interpreter. No
+exception handling nor ensure execution will be done.
+
+** Initialize and Starts the Interpreter
+
+The embedding API are below (not needed for extension libraries):
+
+ void ruby_init()
+
+Initializes the interpreter.
+
+ void ruby_options(int argc, char **argv)
+
+Process command line arguments for the interpreter.
+
+ void ruby_run()
+
+Starts execution of the interpreter.
+
+ void ruby_script(char *name)
+
+Specifies the name of the script ($0).
+
+Appendix B. Functions Available in extconf.rb
+
+These functions are available in extconf.rb:
+
+ have_library(lib, func)
+
+Checks whether library which contains specified function exists.
+Returns true if the library exists.
+
+ find_library(lib, func, path...)
+
+Checks whether library which contains specified function exists in
+path. Returns true if the library exists.
+
+ have_func(func, header)
+
+Checks whether func exists with header. Returns true if the function
+exists. To check functions in the additional library, you need to
+check that library first using have_library().
+
+ have_header(header)
+
+Checks whether header exists. Returns true if the header file exists.
+
+ create_makefile(target)
+
+Generates the Makefile for the extension library. If you don't invoke
+this method, the compilation will not be done.
+
+ with_config(withval[, default=nil])
+
+Parses the command line options and returns the value specified by
+--with-<withval>.
+
+ dir_config(target[, default_dir])
+ dir_config(target[, default_include, default_lib])
+
+Parses the command line options and adds the directories specified by
+--with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
+to $CFLAGS and/or $LDFLAGS. --with-<target>-dir=/path is equivalent to
+--with-<target>-include=/path/include --with-<target>-lib=/path/lib.
+Returns an array of the added directories ([include_dir, lib_dir]).
+
+/*
+ * Local variables:
+ * fill-column: 70
+ * end:
+ */
diff --git a/README.EXT.ja b/README.EXT.ja
deleted file mode 100644
index f884ecbb0e..0000000000
--- a/README.EXT.ja
+++ /dev/null
@@ -1 +0,0 @@
-doc/extension.ja.rdocã«ç§»å‹•ã—ã¾ã—ãŸ
diff --git a/README.EXT.jp b/README.EXT.jp
new file mode 100644
index 0000000000..07a9e8b39d
--- /dev/null
+++ b/README.EXT.jp
@@ -0,0 +1,1187 @@
+.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
+
+Ruby¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Îºî¤êÊý¤òÀâÌÀ¤·¤Þ¤¹¡¥
+
+1¡¥´ðÁÃÃμ±
+
+C¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤¢¤ê¡¤¥Ç¡¼¥¿¤Ë¤Ï·¿¤¬¤¢¤ê¤Þ¤»¤ó¡¥¤Ç¤¹¤«¤é¡¤¤¿
+¤È¤¨¤Ð¥Ý¥¤¥ó¥¿¤òint¤ÎÊÑ¿ô¤ËÂåÆþ¤¹¤ë¤È¡¤¤½¤ÎÃͤÏÀ°¿ô¤È¤·¤Æ¼è
+¤ê°·¤ï¤ì¤Þ¤¹¡¥µÕ¤ËRuby¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤Ê¤¯¡¤¥Ç¡¼¥¿¤Ë·¿¤¬¤¢¤ê¤Þ
+¤¹¡¥¤³¤Î°ã¤¤¤Î¤¿¤á¡¤C¤ÈRuby¤ÏÁê¸ß¤ËÊÑ´¹¤·¤Ê¤±¤ì¤Ð¡¤¤ª¸ß¤¤¤Î
+¥Ç¡¼¥¿¤ò¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤»¤ó¡¥
+
+Ruby¤Î¥Ç¡¼¥¿¤ÏVALUE¤È¤¤¤¦C¤Î·¿¤Çɽ¸½¤µ¤ì¤Þ¤¹¡¥VALUE·¿¤Î¥Ç¡¼
+¥¿¤Ï¤½¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¼«Ê¬¤ÇÃΤäƤ¤¤Þ¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤È
+¤¤¤¦¤Î¤Ï¥Ç¡¼¥¿(¥ª¥Ö¥¸¥§¥¯¥È)¤Î¼ÂºÝ¤Î¹½Â¤¤ò°ÕÌ£¤·¤Æ¤¤¤Æ¡¤Ruby
+¤Î¥¯¥é¥¹¤È¤Ï¤Þ¤¿°ã¤Ã¤¿¤â¤Î¤Ç¤¹¡¥
+
+VALUE¤«¤éC¤Ë¤È¤Ã¤Æ°ÕÌ£¤Î¤¢¤ë¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á¤Ë¤Ï
+
+ (1) VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤òÃΤë
+ (2) VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
+
+¤ÎξÊý¤¬É¬ÍפǤ¹¡¥(1)¤ò˺¤ì¤ë¤È´Ö°ã¤Ã¤¿¥Ç¡¼¥¿¤ÎÊÑ´¹¤¬¹Ô¤ï¤ì
+¤Æ¡¤ºÇ°­¥×¥í¥°¥é¥à¤¬core dump¤·¤Þ¤¹¡¥
+
+1.1 ¥Ç¡¼¥¿¥¿¥¤¥×
+
+Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+ T_NIL nil
+ T_OBJECT Ä̾ï¤Î¥ª¥Ö¥¸¥§¥¯¥È
+ T_CLASS ¥¯¥é¥¹
+ T_MODULE ¥â¥¸¥å¡¼¥ë
+ T_FLOAT ÉâÆ°¾®¿ôÅÀ¿ô
+ T_STRING ʸ»úÎó
+ T_REGEXP Àµµ¬É½¸½
+ T_ARRAY ÇÛÎó
+ T_FIXNUM Fixnum(31bitĹÀ°¿ô)
+ T_HASH Ï¢ÁÛÇÛÎó
+ T_STRUCT (Ruby¤Î)¹½Â¤ÂÎ
+ T_BIGNUM ¿ÇÜĹÀ°¿ô
+ T_FILE Æþ½ÐÎÏ
+ T_TRUE ¿¿
+ T_FALSE µ¶
+ T_DATA ¥Ç¡¼¥¿
+ T_SYMBOL ¥·¥ó¥Ü¥ë
+
+¤½¤Î¾¤ËÆâÉô¤ÇÍøÍѤµ¤ì¤Æ¤¤¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+ T_ICLASS
+ T_MATCH
+ T_UNDEF
+ T_VARMAP
+ T_SCOPE
+ T_NODE
+
+¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+1.2 VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤¹¤ë
+
+ruby.h¤Ç¤ÏTYPE()¤È¤¤¤¦¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤VALUE¤Î¥Ç¡¼¥¿
+¥¿¥¤¥×¤òÃΤ뤳¤È¤¬½ÐÍè¤Þ¤¹¡¥TYPE()¥Þ¥¯¥í¤Ï¾å¤Ç¾Ò²ð¤·¤¿T_XXXX
+¤Î·Á¼°¤ÎÄê¿ô¤òÊÖ¤·¤Þ¤¹¡¥VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Ë±þ¤¸¤Æ½èÍý¤¹¤ë
+¾ì¹ç¤Ë¤Ï¡¤TYPE()¤ÎÃͤÇʬ´ô¤¹¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+ switch (TYPE(obj)) {
+ case T_FIXNUM:
+ /* FIXNUM¤Î½èÍý */
+ break;
+ case T_STRING:
+ /* ʸ»úÎó¤Î½èÍý */
+ break;
+ case T_ARRAY:
+ /* ÇÛÎó¤Î½èÍý */
+ break;
+ default:
+ /* Îã³°¤òȯÀ¸¤µ¤»¤ë */
+ rb_raise(rb_eTypeError, "not valid value");
+ break;
+ }
+
+¤½¤ì¤È¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤·¤Æ¡¤Àµ¤·¤¯¤Ê¤±¤ì¤ÐÎã³°¤òȯÀ¸¤¹
+¤ë´Ø¿ô¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+ void Check_Type(VALUE value, int type)
+
+¤³¤Î´Ø¿ô¤Ïvalue¤¬type¤Ç̵¤±¤ì¤Ð¡¤Îã³°¤òȯÀ¸¤µ¤»¤Þ¤¹¡¥°ú¿ô¤È
+¤·¤ÆÍ¿¤¨¤é¤ì¤¿VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤¬Àµ¤·¤¤¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹
+¤ë¤¿¤á¤Ë¤Ï¡¤¤³¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+ FIXNUM_P(obj)
+ NIL_P(obj)
+
+1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
+
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
+¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
+¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
+
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
+¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
+¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
+¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
+¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
+ȯÀ¸¤¹¤ë)¡¥
+
+ƱÍͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò¼è¤ê½Ð¤¹
+¡ÖNUM2DBL()¡×¤Èchar*¤ò¼è¤ê½Ð¤¹¡ÖSTR2CSTR()¡×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
+¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
+¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
+
+¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
+¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
+¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
+
+ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
+»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
+
+Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
+¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
+¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(ary)->len¡×¡¤
+¡ÖRARRAY(ary)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
+¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
+¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍÆ¤ÎÀ°¹çÀ­¤¬
+¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+1.4 C¤Î¥Ç¡¼¥¿¤òVALUE¤ËÊÑ´¹¤¹¤ë
+
+VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
+
+ * FIXNUM¤Î¾ì¹ç
+
+ 1bitº¸¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
+
+ * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
+
+ ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
+
+¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
+¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
+¤¤¤ë)¡¥
+
+¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
+¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
+ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
+¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
+¤Î¤â¤Î)¤À¤±¤Ç¤¹¡¥
+
+FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
+¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
+¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
+
+ INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
+ INT2NUM() Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
+
+INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
+¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
+
+1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë
+
+ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍÆ¤Î¹¹¿·¤ò
+¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
+Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
+
+¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
+¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
+
+ ʸ»úÎó¤ËÂФ¹¤ë´Ø¿ô
+
+ rb_str_new(const char *ptr, long len)
+
+ ¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
+
+ rb_str_new2(const char *ptr)
+
+ C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
+ rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
+
+ rb_tainted_str_new(const char *ptr, long len)
+
+ ±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤줿¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥³°Éô
+ ¤«¤é¤Î¥Ç¡¼¥¿¤Ë´ð¤Å¤¯Ê¸»úÎó¤Ë¤Ï±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤ì¤ë¤Ù¤­
+ ¤Ç¤¢¤ë¡¥
+
+ rb_tainted_str_new2(const char *ptr)
+
+ C¤Îʸ»úÎ󤫤鱸À÷¥Þ¡¼¥¯¤¬Éղ䵤줿Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
+
+ rb_str_cat(VALUE str, const char *ptr, long len)
+
+ Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
+
+ ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
+
+ rb_ary_new()
+
+ Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+
+ rb_ary_new2(long len)
+
+ Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥lenÍ×ÁÇʬ¤ÎÎΰè¤ò¤¢¤é¤«¤¸¤á³ä¤ê
+ Åö¤Æ¤Æ¤ª¤¯¡¥
+
+ rb_ary_new3(long n, ...)
+
+ °ú¿ô¤Ç»ØÄꤷ¤¿nÍ×ÁǤò´Þ¤àÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+
+ rb_ary_new4(long n, VALUE *elts)
+
+ ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+
+ rb_ary_push(VALUE ary, VALUE val)
+ rb_ary_pop(VALUE ary)
+ rb_ary_shift(VALUE ary)
+ rb_ary_unshift(VALUE ary, VALUE val)
+
+ Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
+ ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
+
+2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
+
+¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
+½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
+¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
+²ð¤·¤Þ¤¹¡¥
+
+2.1 Ruby¤Ëµ¡Ç½¤òÄɲ乤ë
+
+Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
+¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲä¹¤ë´Ø¿ô¤¬
+Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+ * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
+ * ¥á¥½¥Ã¥É¡¤ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É
+ * Äê¿ô
+
+¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
+
+2.1.1 ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
+
+¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+ VALUE rb_define_class(const char *name, VALUE super)
+ VALUE rb_define_module(const char *name)
+
+¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
+¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
+¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
+
+¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤ò¾¤Î¥¯¥é¥¹¤ÎÆâÉô¤Ë¥Í¥¹¥È¤·¤ÆÄêµÁ¤¹¤ë»þ¤Ë
+¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+ VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 ¥á¥½¥Ã¥É/ÆÃ°Û¥á¥½¥Ã¥ÉÄêµÁ
+
+¥á¥½¥Ã¥É¤äÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+ void rb_define_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+ void rb_define_singleton_method(VALUE object, const char *name,
+ VALUE (*func)(), int argc)
+
+
+ǰ¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆÃ°Û¥á¥½¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
+¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
+¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆÃ°Û¥á¥½¥Ã¥É¤¬»È¤ï¤ì
+¤Þ¤¹¡¥
+
+¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
+·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬0°Ê¾å¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°Õ
+Ì£¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½
+¤ó¤Ê¤Ë)¡¥¼ÂºÝ¤Î´Ø¿ô¤Ë¤ÏÀèÆ¬¤Î°ú¿ô¤È¤·¤Æself¤¬Í¿¤¨¤é¤ì¤Þ¤¹¤Î
+¤Ç¡¤»ØÄꤷ¤¿¿ô¤è¤ê1¿¤¤°ú¿ô¤ò»ý¤Ä¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
+¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
+
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
+¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
+
+ void rb_define_private_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
+¥É¤Ç¤¹¡¥
+
+¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
+¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
+¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
+¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
+
+ Math.sqrt(4)
+
+¤È¤¤¤¦·Á¼°¤Ç¤â
+
+ include Math
+ sqrt(4)
+
+¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
+Ä̤ê¤Ç¤¹¡¥
+
+ void rb_define_module_function(VALUE module, const char *name,
+ VALUE (*func)(), int argc)
+
+´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivate method)¤òÄêµÁ¤¹¤ë¤¿
+¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
+
+ void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+
+¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
+
+ void rb_define_alias(VALUE module, const char* new, const char* old);
+
+2.1.3 Äê¿ôÄêµÁ
+
+³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
+¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
+
+Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
+¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
+
+2.2 Ruby¤Îµ¡Ç½¤òC¤«¤é¸Æ¤Ó½Ð¤¹
+
+´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
+»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
+¤Þ¤¹¡¥
+
+# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
+# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
+
+¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
+
+2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
+
+C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
+Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë°Ê²¼¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+
+ VALUE rb_eval_string(const char *str)
+
+¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
+¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
+
+2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
+
+C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
+¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
+»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
+
+ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
+
+ :¼±ÊÌ»Ò
+
+¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
+
+ rb_intern(const char *name)
+
+¤ò»È¤¤¤Þ¤¹¡¥Ruby¤«¤é°ú¿ô¤È¤·¤ÆÍ¿¤¨¤é¤ì¤¿¥·¥ó¥Ü¥ë(¤Þ¤¿¤Ïʸ»ú
+Îó)¤òID¤ËÊÑ´¹¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+ rb_to_id(VALUE symbol)
+
+2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
+
+C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
+¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+ VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
+¤·¤Þ¤¹¡¥¤½¤Î¾¤Ë°ú¿ô¤Î»ØÄê¤Î»ÅÊý¤¬°ã¤¦°Ê²¼¤Î´Ø¿ô¤â¤¢¤ê¤Þ¤¹¡¥
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+ VALUE rb_apply(VALUE recv, ID mid, VALUE args)
+
+apply¤Ë¤Ï°ú¿ô¤È¤·¤ÆRuby¤ÎÇÛÎó¤òÍ¿¤¨¤Þ¤¹¡¥
+
+2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
+
+C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤Äê¿ô¡¤¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ
+¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»¥¹¤Ç¤­
+¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
+
+¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
+¤ê¤Ç¤¹¡¥
+
+ VALUE rb_ivar_get(VALUE obj, ID id)
+ VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+ VALUE rb_const_get(VALUE obj, ID id)
+
+Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
+¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+3¡¥Ruby¤ÈC¤È¤Î¾ðÊó¶¦Í­
+
+C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
+
+3.1 C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
+
+°Ê²¼¤ÎRuby¤ÎÄê¿ô¤ÏC¤Î¥ì¥Ù¥ë¤«¤é»²¾È¤Ç¤­¤Þ¤¹¡¥
+
+ Qtrue
+ Qfalse
+
+ ¿¿µ¶ÃÍ¡¥Qfalse¤ÏC¸À¸ì¤Ç¤âµ¶¤È¤ß¤Ê¤µ¤ì¤Þ¤¹(¤Ä¤Þ¤ê0)¡¥
+
+ Qnil
+
+ C¸À¸ì¤«¤é¸«¤¿¡Önil¡×¡¥
+
+3.2 C¤ÈRuby¤Ç¶¦Í­¤µ¤ì¤ëÂç°èÊÑ¿ô
+
+C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
+ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
+¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
+`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
+¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
+
+¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
+ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
+¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
+Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
+
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
+¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
+¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
+setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
+
+# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
+
+¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
+´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
+getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
+
+getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
+
+ (*getter)(ID id, void *data, struct global_entry* entry);
+ (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
+
+C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
+¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
+Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
+¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
+²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
+
+ Data_Wrap_Struct(klass, mark, free, ptr)
+
+¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
+
+klass¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
+C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
+¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
+»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
+
+# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
+
+free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
+´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥
+
+C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
+¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
+
+klass, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
+¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
+¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
+¤Þ¤¹¡¥
+
+ Data_Get_Struct(obj, type, sval)
+
+C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
+
+¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
+ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+4¡¥ÎãÂê - dbm¥Ñ¥Ã¥±¡¼¥¸¤òºî¤ë
+
+¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
+Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥é¥¤¥Ö¥é¥ê¤òÎã¤Ë
+¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
+
+(1) ¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë
+
+ % mkdir ext/dbm
+
+Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
+¤ë¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤·¤¿¡¥Ruby¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¾ì¹ç¤Ë
+¤ÏRuby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥
+¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤Ë
+Áª¤ó¤Ç¹½¤¤¤Þ¤»¤ó¡¥
+
+(2) MANIFEST¥Õ¥¡¥¤¥ë¤òºî¤ë
+
+ % cd ext/dbm
+ % touch MANIFEST
+
+³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¤Ë¤ÏMANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬
+ɬÍפʤΤǡ¤¤È¤ê¤¢¤¨¤º¶õ¤Î¥Õ¥¡¥¤¥ë¤òºî¤Ã¤Æ¤ª¤­¤Þ¤¹¡¥¸å¤Ç¤³¤Î
+¥Õ¥¡¥¤¥ë¤Ë¤ÏɬÍפʥե¡¥¤¥ë°ìÍ÷¤¬Æþ¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+MANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤Ï¡¤ÀÅŪ¥ê¥ó¥¯¤Îmake¤Î»þ¤Ë¥Ç¥£¥ì¥¯¥È¥ê
+¤¬³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò´Þ¤ó¤Ç¤¤¤ë¤«¤É¤¦¤«È½Äꤹ¤ë¤¿¤á¤Ë»È¤ï¤ì¤ì¤Æ
+¤¤¤Þ¤¹¡¥¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî¤ë¾ì¹ç¤Ë¤Ïɬ¤º¤·¤âɬÍפǤÏ
+¤¢¤ê¤Þ¤»¤ó¡¥
+
+(3) À߷פ¹¤ë
+
+¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
+·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
+¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
+¤·¤Þ¤¹¡¥
+
+(4) C¥³¡¼¥É¤ò½ñ¤¯
+
+³ÈÄ¥¥é¥¤¥Ö¥é¥êËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
+¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
+¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤È¤¤¤¦¥Õ¥¡
+¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
+¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥é¥¤¥Ö¥é¥ê̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
+¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
+
+Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
+¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤Î¾ì¹ç¡ÖInit_dbm¡×
+¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
+ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
+
+--
+Init_dbm()
+{
+ /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
+ cDBM = rb_define_class("DBM", rb_cObject);
+ /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
+ rb_include_module(cDBM, rb_mEnumerable);
+
+ /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
+ rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+ /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
+ rb_define_method(cDBM, "close", fdbm_close, 0);
+ /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
+ rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+ :
+
+ /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
+ id_dbm = rb_intern("dbm");
+}
+--
+
+DBM¥é¥¤¥Ö¥é¥ê¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
+¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+
+
+dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+struct dbmdata {
+ int di_size;
+ DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
+¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
+¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
+¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+#define GetDBM(obj, dbmp) {\
+ Data_Get_Struct(obj, struct dbmdata, dbmp);\
+ if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
+¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
+¤ë¤À¤±¤Ç¤¹¡¥
+
+DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
+°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
+¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
+fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+ VALUE obj, keystr;
+{
+ :
+}
+--
+
+°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
+¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
+
+°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
+¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
+¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
+¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+static VALUE
+fdbm_s_open(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
+{
+ :
+ if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+ mode = 0666; /* default value */
+ }
+ :
+}
+--
+
+¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
+¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
+¤¨¤é¤ì¤Þ¤¹¡¥
+
+¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
+¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
+½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
+¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
+¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
+¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
+¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
+¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
+ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
+¤¦¤Ç¤¹¡¥
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+ VALUE obj, args;
+{
+ :
+}
+--
+
+Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥
+
+** Ãí°Õ»ö¹à
+
+Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
+C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
+¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
+
+ void rb_global_variable(VALUE *var)
+
+(5) extconf.rb¤òÍѰդ¹¤ë
+
+Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
+¤Þ¤¹¡¥extconf.rb¤Ï¥é¥¤¥Ö¥é¥ê¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã
+¥¯¤Ê¤É¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥¤Þ¤º¡¤
+
+ require 'mkmf'
+
+¤òextconf.rb¤ÎÀèÆ¬¤ËÃÖ¤­¤Þ¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø
+¿ô¤ò»È¤¦¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
+
+ have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
+ have_func(func, header): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
+ have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
+ create_makefile(target): Makefile¤ÎÀ¸À®
+
+°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
+
+ $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤Ê¤É)
+ $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
+
+¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤º¡¤¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó
+¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤ÏÀ¸
+À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
+
+(6) depend¤òÍѰդ¹¤ë
+
+¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
+Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
+
+ % gcc -MM *.c > depend
+
+¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤ÆÂ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
+
+(7) MANIFEST¥Õ¥¡¥¤¥ë¤Ë¥Õ¥¡¥¤¥ë̾¤òÆþ¤ì¤ë
+
+ % find * -type f -print > MANIFEST
+ % vi MANIFEST
+
+*.o, *~¤Ê¤ÉÉÔɬÍפʥե¡¥¤¥ë°Ê³°¤ÏMANIFEST¤ËÄɲ䷤Ƥª¤­¤Þ¤¹¡¥
+make»þ¤Ë¤ÏMANIFEST¤ÎÆâÍÆ¤Ï»²¾È¤·¤Þ¤»¤ó¤Î¤Ç¡¤¶õ¤Î¤Þ¤Þ¤Ç¤âÌäÂê
+¤Ïµ¯¤­¤Þ¤»¤ó¤¬¡¤¥Ñ¥Ã¥±¡¼¥¸¥ó¥°¤Î»þ¤Ë»²¾È¤¹¤ë¤³¤È¤¬¤¢¤ë¤Î¤È¡¤
+ɬÍפʥե¡¥¤¥ë¤ò¶èÊ̤Ǥ­¤ë¤Î¤Ç¡¤ÍѰդ·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤¤Ç¤·¤ç
+¤¦¡¥
+
+(8) Makefile¤òÀ¸À®¤¹¤ë
+
+Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
+
+ ruby extconf.rb
+
+¤È¤·¤Þ¤¹¡¥extconf.rb¤Ë require 'mkmf' ¤Î¹Ô¤¬¤Ê¤¤¾ì¹ç¤Ë¤Ï¥¨¥é¡¼
+¤Ë¤Ê¤ê¤Þ¤¹¤Î¤Ç¡¤°ú¿ô¤òÄɲä·¤Æ
+
+ ruby -r mkmf extconf.rb
+
+¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍѰդ·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
+¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
+
+(9) make¤¹¤ë
+
+ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤òÀ¸À®¤¹¤ë¾ì¹ç¤Ë¤Ï¤½¤Î¾ì¤Çmake¤·¤Æ¤¯¤À¤µ
+¤¤¡¥É¬ÍפǤ¢¤ì¤Ð make install ¤Ç¥¤¥ó¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
+
+ext°Ê²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òÍѰդ·¤¿¾ì¹ç¤Ï¡¤Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç
+make¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤É¬Íפˤè¤Ã¤Æ¤Ï¤½¤Î¥â
+¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
+extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®¤¬É¬Íפʻþ¤Ï¤Þ
+¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïmake install¤ÇRuby¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î
+²¼¤Ë¥³¥Ô¡¼¤µ¤ì¤Þ¤¹¡¥¤â¤·³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤È¶¨Ä´¤·¤Æ»È¤¦Ruby¤Çµ­
+½Ò¤µ¤ì¤¿¥×¥í¥°¥é¥à¤¬¤¢¤ê¡¤Ruby¥é¥¤¥Ö¥é¥ê¤ËÃÖ¤­¤¿¤¤¾ì¹ç¤Ë¤Ï¡¤
+³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤Î²¼¤Ë lib ¤È¤¤¤¦¥Ç¥£¥ì¥¯¥È¥ê
+¤òºî¤ê¡¤¤½¤³¤Ë ³ÈÄ¥»Ò .rb ¤Î¥Õ¥¡¥¤¥ë¤òÃÖ¤¤¤Æ¤ª¤±¤ÐƱ»þ¤Ë¥¤¥ó
+¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
+
+(10) ¥Ç¥Ð¥Ã¥°
+
+¤Þ¤¢¡¤¥Ç¥Ð¥Ã¥°¤·¤Ê¤¤¤Èư¤«¤Ê¤¤¤Ç¤·¤ç¤¦¤Í¡¥ext/Setup¤Ë¥Ç¥£¥ì
+¥¯¥È¥ê̾¤ò½ñ¤¯¤ÈÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¤Î¤Ç¥Ç¥Ð¥Ã¥¬¤¬»È¤¨¤ë¤è¤¦¤Ë¤Ê
+¤ê¤Þ¤¹¡¥¤½¤Îʬ¥³¥ó¥Ñ¥¤¥ë¤¬ÃÙ¤¯¤Ê¤ê¤Þ¤¹¤±¤É¡¥
+
+(11) ¤Ç¤­¤¢¤¬¤ê
+
+¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
+»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
+¼çÄ¥¤·¤Þ¤»¤ó¡¥
+
+Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
+
+Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
+¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
+¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
+»×¤¤¤Þ¤¹¡¥
+
+Ruby¸À¸ì¤Î¥³¥¢
+
+ class.c
+ error.c
+ eval.c
+ gc.c
+ object.c
+ parse.y
+ variable.c
+
+¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
+
+ dln.c
+ regex.c
+ st.c
+ util.c
+
+Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
+
+ dmyext.c
+ inits.c
+ main.c
+ ruby.c
+ version.c
+
+¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
+
+ array.c
+ bignum.c
+ compar.c
+ dir.c
+ enum.c
+ file.c
+ hash.c
+ io.c
+ marshal.c
+ math.c
+ numeric.c
+ pack.c
+ prec.c
+ process.c
+ random.c
+ range.c
+ re.c
+ signal.c
+ sprintf.c
+ string.c
+ struct.c
+ time.c
+
+Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
+
+C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+
+** ·¿
+
+VALUE
+
+ Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
+ ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
+ ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
+ ̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤ë¡¥
+
+** ÊÑ¿ô¡¦Äê¿ô
+
+Qnil
+
+ Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
+
+Qtrue
+
+ Äê¿ô: true¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
+
+Qfalse
+
+ Äê¿ô: false¥ª¥Ö¥¸¥§¥¯¥È
+
+** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
+
+Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+ C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
+ ¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
+ ´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
+ ¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
+ ¤¬¤¢¤ë¡¥
+
+Data_Make_Struct(klass, type, mark, free, sval)
+
+ type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
+ ¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
+
+Data_Get_Struct(data, type, sval)
+
+ data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
+
+** ·¿¥Á¥§¥Ã¥¯
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** ·¿ÊÑ´¹
+
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
+NUM2DBL(value)
+rb_float_new(f)
+STR2CSTR(value)
+rb_str_new2(s)
+
+** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
+
+VALUE rb_define_class(const char *name, VALUE super)
+
+ super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
+
+VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+ super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤Î
+ Äê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
+
+VALUE rb_define_module(const char *name)
+
+ ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
+
+VALUE rb_define_module_under(VALUE module, const char *name, VALUE super)
+
+ ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
+
+void rb_include_module(VALUE klass, VALUE module)
+
+ ¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯
+ ¥ë¡¼¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
+
+void rb_extend_object(VALUE object, VALUE module)
+
+ ¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
+
+** Âç°èÊÑ¿ôÄêµÁ
+
+void rb_define_variable(const char *name, VALUE *var)
+
+ Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç
+ »Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±ÊÌ»Ò
+ ¤È¤·¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é
+ ¥à¤«¤é¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
+
+void rb_define_readonly_variable(const char *name, VALUE *var)
+
+ Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥
+ read only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
+
+void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+ ´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿
+ »þ¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì
+ ¤ë¡¥
+
+void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+ ´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô
+ ¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ï
+ setter¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò
+ »ØÄꤷ¤Ê¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
+
+void rb_global_variable(VALUE *var)
+
+ GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö
+ ¥¸¥§¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
+
+** Äê¿ô
+
+void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+ Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
+
+void rb_define_global_const(const char *name, VALUE val)
+
+ Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
+
+ rb_define_const(rb_cObject, name, val)
+
+ ¤ÈƱ¤¸°ÕÌ£¡¥
+
+** ¥á¥½¥Ã¥ÉÄêµÁ
+
+rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+ ¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ,
+ ´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2
+ °ú¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ,
+ Âè1°ú¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È
+ ¤¤¤¦·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
+
+rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+ private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
+
+rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+ ÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
+
+rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+ argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô,
+ Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú
+ ¿ô»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Ä
+ ǽ¤Ç¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê
+ ¹ß¤ÏÊÑ¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥
+ Éղðú¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬
+ ÂåÆþ¤µ¤ì¤ë¡¥
+
+** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
+
+VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+ ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò
+ »È¤¦¡¥
+
+VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+ ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc, argv·Á¼°¤ÇÅϤ¹¡¥
+
+VALUE rb_eval_string(const char *str)
+
+ ʸ»úÎó¤òRuby¥¹¥¯¥ê¥×¥È¤È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
+
+ID rb_intern(const char *name)
+
+ ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
+
+char *rb_id2name(ID id)
+
+ ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
+
+char *rb_class2name(VALUE klass)
+
+ ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï,
+ ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
+
+int rb_respond_to(VALUE obj, ID id)
+
+ obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡£
+
+** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
+
+VALUE rb_iv_get(VALUE obj, const char *name)
+
+ obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó
+ ¥¹ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó
+ ¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥Äê¿ô¤ÏÂçʸ»ú¤Î̾Á°¤ò»ý¤Ä¥¯¥é¥¹(¤Þ¤¿¤Ï
+ ¥â¥¸¥å¡¼¥ë)¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤È¤·¤Æ¼ÂÁõ¤µ¤ì¤Æ¤¤¤ë¡¥
+
+VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+ obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
+
+** À©¸æ¹½Â¤
+
+VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+ func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
+ func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
+ ¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
+
+VALUE rb_yield(VALUE val)
+
+ val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
+
+VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+ ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸
+ ¤·¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸
+ ¤·¤Ê¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá
+ ¤êÃͤǤ¢¤ë¡¥
+
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
+
+ ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬
+ ȯÀ¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1
+ ¤ÎÌá¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
+
+** Îã³°¡¦¥¨¥é¡¼
+
+void rb_warning(const char *fmt, ...)
+
+ rb_verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ï
+ printf()¤ÈƱ¤¸¡¥
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+ RuntimeErrorÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+
+void rb_raise(VALUE exception, const char *fmt, ...)
+
+ exception¤Ç»ØÄꤷ¤¿Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥fmt°Ê²¼¤Î°ú¿ô¤Ï
+ printf()¤ÈƱ¤¸¡¥
+
+void rb_fatal(const char *fmt, ...)
+
+ Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
+ ¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë
+ ¼Â¹Ô¤µ¤ì¤ë)¡¥
+
+void rb_bug(const char *fmt, ...)
+
+ ¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤
+ ¾õ¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥
+ Îã³°½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
+
+** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
+
+Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
+¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë¤ÏɬÍפʤ¤¡¥
+
+void ruby_init()
+
+ Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
+
+void ruby_options(int argc, char **argv)
+
+ Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î¥³¥Þ¥ó¥É¥é¥¤¥ó°ú¿ô¤Î½èÍý¤ò¹Ô¤Ê¤¦¡¥
+
+void ruby_run()
+
+ Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
+
+void ruby_script(char *name)
+
+ Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
+
+
+Appendix B. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
+
+extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
+²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+
+have_library(lib, func)
+
+ ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥
+ ¥é¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤true¤òÊÖ¤¹¡¥
+
+find_library(lib, func, path...)
+
+ ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò -Lpath ¤òÄɲÃ
+ ¤·¤Ê¤¬¤é¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é¥¤¥Ö¥é¥ê¤¬¸«ÉÕ¤«¤Ã¤¿»þ¡¤true¤òÊÖ¤¹¡¥
+
+have_func(func, header)
+
+ ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã
+ ¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
+ ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
+ »ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
+
+have_header(header)
+
+ ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹
+ ¤ë»þtrue¤òÊÖ¤¹¡¥
+
+create_makefile(target)
+
+ ³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì
+ ¤Ð¤½¤Î¥é¥¤¥Ö¥é¥ê¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾
+ ¤òɽ¤¹¡¥
+
+with_config(withval[, default=nil])
+
+ ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃͤòÆÀ¤ë¡¥
+
+dir_config(target[, default_dir])
+dir_config(target[, default_include, default_lib])
+
+ ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<target>-dir, --with-<target>-include,
+ --with-<target>-lib¤Î¤¤¤º¤ì¤«¤Ç»ØÄꤵ¤ì¤ë¥Ç¥£¥ì¥¯¥È¥ê¤ò
+ $CFLAGS ¤ä $LDFLAGS ¤ËÄɲ乤롥--with-<target>-dir=/path¤Ï
+ --with-<target>-include=/path/include --with-<target>-lib=/path/lib
+ ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì¥¯¥È¥ê¤Î
+ ÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.ja.md b/README.ja.md
deleted file mode 100644
index 9d6131e416..0000000000
--- a/README.ja.md
+++ /dev/null
@@ -1,171 +0,0 @@
-# Rubyã¨ã¯
-
-Rubyã¯ã‚·ãƒ³ãƒ—ルã‹ã¤å¼·åŠ›ãªã‚ªãƒ–ジェクト指å‘スクリプト言語ã§ã™ï¼Ž Rubyã¯ç´”粋ãªã‚ªãƒ–ジェクト指å‘言語ã¨ã—ã¦è¨­è¨ˆã•れã¦ã„ã‚‹ã®ã§ï¼Œ
-オブジェクト指å‘プログラミングを手軽ã«è¡Œã†äº‹ãŒå‡ºæ¥ã¾ã™ï¼Žã‚‚ã¡ã‚ã‚“æ™®é€šã®æ‰‹ç¶šãåž‹ã®ãƒ—ログラミングもå¯èƒ½ã§ã™ï¼Ž
-
-Rubyã¯ãƒ†ã‚­ã‚¹ãƒˆå‡¦ç†é–¢ä¿‚ã®èƒ½åŠ›ãªã©ã«å„ªã‚Œï¼ŒPerlã¨åŒã˜ãらã„強力ã§ã™ï¼Žã•らã«ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•ã¨ï¼Œ
-例外処ç†ã‚„イテレータãªã©ã®æ©Ÿæ§‹ã«ã‚ˆã£ã¦ï¼Œã‚ˆã‚Šåˆ†ã‹ã‚Šã‚„ã™ã„プログラミングãŒå‡ºæ¥ã¾ã™ï¼Ž
-
-## Rubyã®ç‰¹é•·
-
-* ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•
-* 普通ã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(クラス,メソッドコールãªã©)
-* 特殊ãªã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(Mixin, 特異メソッドãªã©)
-* 演算å­ã‚ªãƒ¼ãƒãƒ¼ãƒ­ãƒ¼ãƒ‰
-* ä¾‹å¤–å‡¦ç†æ©Ÿèƒ½
-* イテレータã¨ã‚¯ãƒ­ãƒ¼ã‚¸ãƒ£
-* ガーベージコレクタ
-* ダイナミックローディング (アーキテクãƒãƒ£ã«ã‚ˆã‚‹)
-* ç§»æ¤æ€§ãŒé«˜ã„.多ãã®Unix-like/POSIX互æ›ãƒ—ラットフォーム上ã§å‹•ãã ã‘ã§ãªã,Windows, Mac OS
- X,BeOSãªã©ã®ä¸Šã§ã‚‚å‹•ã cf.
- http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
-
-
-## 入手法
-
-### FTPã§
-
-以下ã®å ´æ‰€ã«ãŠã„ã¦ã‚りã¾ã™ï¼Ž
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-### Subversionã§
-
-開発先端ã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§å–å¾—ã§ãã¾ã™ï¼Ž
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-ä»–ã«é–‹ç™ºä¸­ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
-
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-### Gitã§
-
-Subversionã®ãƒŸãƒ©ãƒ¼ã‚’GitHubã«å…¬é–‹ã—ã¦ã„ã¾ã™ï¼Ž 以下ã®ã‚³ãƒžãƒ³ãƒ‰ã§ãƒªãƒã‚¸ãƒˆãƒªã‚’å–å¾—ã§ãã¾ã™ï¼Ž
-
- $ git clone git://github.com/ruby/ruby.git
-
-## ホームページ
-
-Rubyã®ãƒ›ãƒ¼ãƒ ãƒšãƒ¼ã‚¸ã®URLã¯
-
-http://www.ruby-lang.org/
-
-ã§ã™ï¼Ž
-
-## メーリングリスト
-
-Rubyã®ãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆãŒã‚りã¾ã™ï¼Žå‚åŠ å¸Œæœ›ã®æ–¹ã¯
-
-mailto:ruby-list-request@ruby-lang.org
-
-ã¾ã§æœ¬æ–‡ã«
-
- subscribe
-
-ã¨æ›¸ã„ã¦é€ã£ã¦ä¸‹ã•ã„.
-
-Ruby開発者å‘ã‘メーリングリストもã‚りã¾ã™ï¼Žã“ã¡ã‚‰ã§ã¯rubyã®ãƒã‚°ï¼Œå°†æ¥ã®ä»•様拡張ãªã©å®Ÿè£…上ã®å•題ã«ã¤ã„ã¦è­°è«–ã•れã¦ã„ã¾ã™ï¼Ž å‚åŠ å¸Œæœ›ã®æ–¹ã¯
-
-mailto:ruby-dev-request@ruby-lang.org
-
-ã¾ã§ruby-listã¨åŒæ§˜ã®æ–¹æ³•ã§ãƒ¡ãƒ¼ãƒ«ã—ã¦ãã ã•ã„.
-
-Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆã¨æ•°å­¦é–¢ä¿‚ã®è©±é¡Œã«ã¤ã„ã¦è©±ã—åˆã†ruby-mathメーリングリストã¨
-英語ã§rubyã«ã¤ã„ã¦è©±ã—åˆã†ruby-talkメーリングリストもã‚りã¾ã™ï¼Žå‚加方法ã¯ã©ã‚Œã‚‚åŒã˜ã§ã™ï¼Ž
-
-## コンパイル・インストール
-
-ä»¥ä¸‹ã®æ‰‹é †ã§è¡Œã£ã¦ãã ã•ã„.
-
-1. ã‚‚ã— `configure` ファイルãŒè¦‹ã¤ã‹ã‚‰ãªã„,もã—ã㯠`configure.in` よりå¤ã„よã†ãªã‚‰ï¼Œ `autoconf` を実行ã—ã¦
- æ–°ã—ã `configure` を生æˆã™ã‚‹
-
-2. `configure` を実行ã—㦠`Makefile` ãªã©ã‚’生æˆã™ã‚‹
-
- 環境ã«ã‚ˆã£ã¦ã¯ãƒ‡ãƒ•ォルトã®Cコンパイラ用オプションãŒä»˜ãã¾ã™ï¼Ž `configure` オプション㧠`optflags=..`
- `warnflags=..` ç­‰ã§ä¸Šæ›¸ãã§ãã¾ã™ï¼Ž
-
-3. (å¿…è¦ãªã‚‰ã°)`defines.h` を編集ã™ã‚‹
-
- 多分,必è¦ç„¡ã„ã¨æ€ã„ã¾ã™ï¼Ž
-
-4. (å¿…è¦ãªã‚‰ã°)`ext/Setup` ã«é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’指定ã™ã‚‹
-
- `ext/Setup` ã«è¨˜è¿°ã—ãŸãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã¯é™çš„ã«ãƒªãƒ³ã‚¯ã•れã¾ã™ï¼Ž
-
- ダイナミックローディングをサãƒãƒ¼ãƒˆã—ã¦ã„ãªã„アーキテクãƒãƒ£ã§ã¯ `Setup` ã®1行目ã®ã€Œ`option nodynamic`ã€ã¨ã„ã†è¡Œã®ã‚³
- メントを外ã™å¿…è¦ãŒã‚りã¾ã™ï¼Žã¾ãŸï¼Œã“ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ã§æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’利用ã™ã‚‹ãŸã‚ã«ã¯ï¼Œã‚らã‹ã˜ã‚é™çš„ã«ãƒªãƒ³ã‚¯ã‚’ã—ã¦ãŠãå¿…è¦ãŒã‚りã¾ã™ï¼Ž
-
-5. `make` を実行ã—ã¦ã‚³ãƒ³ãƒ‘イルã™ã‚‹
-
-6. `make check`ã§ãƒ†ã‚¹ãƒˆã‚’行ã†ï¼Ž
-
- 「`check succeeded`ã€ã¨è¡¨ç¤ºã•ã‚Œã‚Œã°æˆåŠŸã§ã™ï¼ŽãŸã ã—ãƒ†ã‚¹ãƒˆã«æˆåŠŸã—ã¦ã‚‚完璧ã ã¨ä¿è¨¼ã•れã¦ã„る訳ã§ã¯ã‚りã¾ã›ã‚“.
-
-7. `make install`
-
- 以下ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’作ã£ã¦ï¼Œãã“ã«ãƒ•ァイルをインストー ルã—ã¾ã™ï¼Ž
-
- * `${DESTDIR}${prefix}/bin`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib`
- * `${DESTDIR}${prefix}/lib/ruby`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/share/man/man1`
- * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
- Rubyã®APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ãŒ'*x.y.z*'ã§ã‚れã°ï¼Œ`${MAJOR}`ã¯
- '*x*'ã§ï¼Œ`${MINOR}`ã¯'*y*',`${TEENY}`ã¯'*z*'ã§ã™ï¼Ž
-
- **注æ„**: APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ã® `teeny` ã¯ï¼ŒRubyプログラムã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã¨ã¯ç•°ãªã‚‹ã“ã¨ãŒã‚りã¾ã™ï¼Ž
-
- `root` ã§ä½œæ¥­ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
-
-
-ã‚‚ã—,コンパイル時ã«ã‚¨ãƒ©ãƒ¼ãŒç™ºç”Ÿã—ãŸå ´åˆã«ã¯ã‚¨ãƒ©ãƒ¼ã®ãƒ­ã‚°ã¨ãƒžã‚·ãƒ³ï¼ŒOSã®ç¨®é¡žã‚’å«ã‚€ã§ãã‚‹ã ã‘詳ã—ã„レãƒãƒ¼ãƒˆã‚’作者ã«é€ã£ã¦ä¸‹ã•ã‚‹ã¨ä»–ã®æ–¹ã®ãŸã‚ã«ã‚‚ãªã‚Šã¾ã™ï¼Ž
-
-## ç§»æ¤
-
-UNIXã§ã‚れ㰠`configure` ãŒã»ã¨ã‚“ã©ã®å·®ç•°ã‚’å¸åŽã—ã¦ãれるã¯ãšã§ã™ãŒï¼Œæ€ã‚ã¬è¦‹è½ã¨ã—ãŒã‚ã£ãŸå ´åˆ(ã‚る事ãŒå¤šã„),作者ã«ãã®
-ã“ã¨ã‚’報告ã™ã‚Œã°ï¼Œè§£æ±ºã§ãã‚‹å¯èƒ½æ€§ãŒã‚りã¾ã™ï¼Ž
-
-アーキテクãƒãƒ£ã«ã‚‚ã£ã¨ã‚‚ä¾å­˜ã™ã‚‹ã®ã¯GC部ã§ã™ï¼ŽRubyã®GCã¯å¯¾è±¡
-ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ãŒ`setjmp()`ã¾ãŸã¯`getcontext()`ã«ã‚ˆã£ã¦å…¨ã¦ã®ãƒ¬ã‚¸ã‚¹ã‚¿ã‚’ `jmp_buf` ã‚„ `ucontext_t`
-ã«æ ¼ç´ã™ã‚‹ã“ã¨ã¨ï¼Œ `jmp_buf` ã‚„ `ucontext_t` ã¨ã‚¹ã‚¿ãƒƒã‚¯ãŒ32bitアラインメントã•れã¦ã„ã‚‹ã“ã¨ã‚’仮定
-ã—ã¦ã„ã¾ã™ï¼Žç‰¹ã«å‰è€…ãŒæˆç«‹ã—ãªã„å ´åˆã®å¯¾å¿œã¯éžå¸¸ã«å›°é›£ã§ã—ょã†ï¼Ž 後者ã®è§£æ±ºã¯æ¯”較的簡å˜ã§ï¼Œ `gc.c` ã§ã‚¹ã‚¿ãƒƒã‚¯ã‚’マークã—ã¦ã„ã‚‹
-部分ã«ã‚¢ãƒ©ã‚¤ãƒ³ãƒ¡ãƒ³ãƒˆã®ãƒã‚¤ãƒˆæ•°ã ã‘ãšã‚‰ã—ã¦ãƒžãƒ¼ã‚¯ã™ã‚‹ã‚³ãƒ¼ãƒ‰ã‚’追加ã™ã‚‹ã ã‘ã§æ¸ˆã¿ã¾ã™ï¼Ž`defined(__mc68000__)`ã§æ‹¬ã‚‰ã‚Œã¦ã„
-る部分をå‚考ã«ã—ã¦ãã ã•ã„.
-
-レジスタウィンドウをæŒã¤CPUã§ã¯ï¼Œãƒ¬ã‚¸ã‚¹ã‚¿ã‚¦ã‚£ãƒ³ãƒ‰ã‚¦ã‚’スタックã«ãƒ•ラッシュã™ã‚‹ã‚¢ã‚»ãƒ³ãƒ–ラコードを追加ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
-
-## é…布æ¡ä»¶
-
-[COPYING.ja](COPYING.ja) ファイルをå‚ç…§ã—ã¦ãã ã•ã„.
-
-## フィードãƒãƒƒã‚¯
-
-Rubyã«é–¢ã™ã‚‹è³ªå•㯠Ruby-Talk(英語)や Ruby-List(日本語) (https://www.ruby-lang.org/ja/community/mailing-lists) や,
-stackoverflow (http://ja.stackoverflow.com/) ãªã©ã®Webã‚µã‚¤ãƒˆã«æŠ•ç¨¿ã—ã¦ãã ã•ã„.
-
-ãƒã‚°å ±å‘Šã¯ http://bugs.ruby-lang.org ã§å—ã‘付ã‘ã¦ã„ã¾ã™ï¼Ž
-
-
-## 著者
-
-Rubyã®ã‚ªãƒªã‚¸ãƒŠãƒ«ç‰ˆã¯ï¼Œ1995å¹´ã«ã¾ã¤ã‚‚ã¨ã‚†ãã²ã‚æ°ã«ã‚ˆã£ã¦è¨­è¨ˆãƒ»é–‹ç™ºã•れã¾ã—ãŸï¼Ž
-
-<mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug 3 11:57:36 JST 1995
diff --git a/README.jp b/README.jp
new file mode 100644
index 0000000000..9af1f15bb5
--- /dev/null
+++ b/README.jp
@@ -0,0 +1,204 @@
+* Ruby¤È¤Ï
+
+Ruby¤Ï¥·¥ó¥×¥ë¤«¤Ä¶¯ÎϤʥª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¹¡¥
+Ruby¤ÏºÇ½é¤«¤é½ã¿è¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤È¤·¤ÆÀ߷פµ¤ì¤Æ¤¤¤Þ
+¤¹¤«¤é¡¤¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥×¥í¥°¥é¥ß¥ó¥°¤ò¼ê·Ú¤Ë¹Ô¤¦»ö¤¬½ÐÍè¤Þ
+¤¹¡¥¤â¤Á¤í¤óÄ̾ï¤Î¼ê³¤­·¿¤Î¥×¥í¥°¥é¥ß¥ó¥°¤â²Äǽ¤Ç¤¹¡¥
+
+Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
+¤Ç¤¹¡¥¤µ¤é¤Ë¥·¥ó¥×¥ë¤Êʸˡ¤È¡¤Îã³°½èÍý¤ä¥¤¥Æ¥ì¡¼¥¿¤Ê¤É¤Îµ¡¹½
+¤Ë¤è¤Ã¤Æ¡¤¤è¤êʬ¤«¤ê¤ä¤¹¤¤¥×¥í¥°¥é¥ß¥ó¥°¤¬½ÐÍè¤Þ¤¹¡¥
+
+
+* Ruby¤ÎÆÃĹ
+
+ + ¥·¥ó¥×¥ë¤Êʸˡ
+ + ÉáÄ̤Υª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(¥¯¥é¥¹¡¤¥á¥½¥Ã¥É¥³¡¼¥ë¤Ê¤É)
+ + ÆÃ¼ì¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(Mixin, ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É)
+ + ±é»»»Ò¥ª¡¼¥Ð¡¼¥í¡¼¥É
+ + Îã³°½èÍýµ¡Ç½
+ + ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
+ + ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
+ + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
+ + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤Çư¤¯¤À¤±¤Ç¤Ê¤¯¡¤DOS¤äWindows¡¤
+ Mac¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
+
+
+* Æþ¼êË¡
+
+** ftp¤Ç
+
+°Ê²¼¤Î¾ì½ê¤Ë¤ª¤¤¤Æ¤¢¤ê¤Þ¤¹¡¥
+
+ ftp://ftp.netlab.co.jp/pub/lang/ruby/
+
+** CVS¤Ç
+
+ $ cvs -d :pserver:anonymous@cvs.ruby-lang.org:/src login
+ (Logging in to anonymous@cvs.ruby-lang.org)
+ CVS password: anonymous
+ $ cvs -z4 -d :pserver:anonymous@cvs.ruby-lang.org:src checkout ruby
+
+
+* ¥Û¡¼¥à¥Ú¡¼¥¸
+
+Ruby¤Î¥Û¡¼¥à¥Ú¡¼¥¸¤ÎURL¤Ï
+
+ http://www.ruby-lang.org/
+
+¤Ç¤¹¡¥
+
+
+* ¥á¡¼¥ê¥ó¥°¥ê¥¹¥È
+
+Ruby¤Î¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤¬¤¢¤ê¤Þ¤¹¡£»²²Ã´õ˾¤ÎÊý¤Ï
+
+ ruby-list-ctl@ruby-lang.org
+
+¤Þ¤ÇËÜʸ¤Ë
+
+ subscribe YourFirstName YourFamilyName
+
+¤È½ñ¤¤¤ÆÁ÷¤Ã¤Æ²¼¤µ¤¤¡£
+
+Ruby³«È¯¼Ô¸þ¤±¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£¤³¤Á¤é¤Ç¤Ïruby¤Î¥Ð
+¥°¡¢¾­Íè¤Î»ÅÍͳÈÄ¥¤Ê¤É¼ÂÁõ¾å¤ÎÌäÂê¤Ë¤Ä¤¤¤ÆµÄÏÀ¤µ¤ì¤Æ¤¤¤Þ¤¹¡£
+»²²Ã´õ˾¤ÎÊý¤Ï
+
+ ruby-dev-ctl@ruby-lang.org
+
+¤Þ¤Çruby-list¤ÈƱÍͤÎÊýË¡¤Ç¥á¡¼¥ë¤·¤Æ¤¯¤À¤µ¤¤¡£
+
+Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
+¿ô³Ø´Ø·¸¤ÎÏÃÂê¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-math¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
+±Ñ¸ì¤ÇÏ䷹礦ruby-talk¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£»²²ÃÊýË¡
+¤Ï¤É¤ì¤âƱ¤¸¤Ç¤¹¡£
+
+
+* ¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
+
+°Ê²¼¤Î¼ê½ç¤Ç¹Ô¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+ 1. ¤â¤·configure¥Õ¥¡¥¤¥ë¤¬¸«¤Ä¤«¤é¤Ê¤¤¡¢¤â¤·¤¯¤Ï
+ configure.in¤è¤ê¸Å¤¤¤è¤¦¤Ê¤é¡¢autoconf¤ò¼Â¹Ô¤·¤Æ
+ ¿·¤·¤¯configure¤òÀ¸À®¤¹¤ë
+
+ 2. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
+
+ 3. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
+
+ ¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
+
+ 4. (ɬÍפʤé¤Ð)ext/Setup¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò
+ »ØÄꤹ¤ë
+
+ ext/Setup¤Ëµ­½Ò¤·¤¿¥â¥¸¥å¡¼¥ë¤ÏÀÅŪ¤Ë¥ê¥ó¥¯¤µ¤ì¤Þ¤¹¡¥
+
+ ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥°¤ò¥µ¥Ý¡¼¥È¤·¤Æ¤¤¤Ê¤¤¥¢¡¼¥­¥Æ¥¯
+ ¥Á¥ã¤Ç¤ÏSetup¤Î1¹ÔÌܤΡÖoption nodynamic¡×¤È¤¤¤¦¹Ô¤Î¥³
+ ¥á¥ó¥È¤ò³°¤¹É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤Þ¤¿¡¤¤³¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ç
+ ³ÈÄ¥¥â¥¸¥å¡¼¥ë¤òÍøÍѤ¹¤ë¤¿¤á¤Ë¤Ï¡¤¤¢¤é¤«¤¸¤áÀÅŪ¤Ë¥ê¥ó
+ ¥¯¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
+
+ 5. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
+
+ 6. make test¤Ç¥Æ¥¹¥È¤ò¹Ô¤¦¡¥
+
+ ¡Ötest succeeded¡×¤Èɽ¼¨¤µ¤ì¤ì¤ÐÀ®¸ù¤Ç¤¹¡¥¤¿¤À¤·¥Æ¥¹¥È
+ ¤ËÀ®¸ù¤·¤Æ¤â´°àú¤À¤ÈÊݾڤµ¤ì¤Æ¤¤¤ëÌõ¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥
+
+ 7. make install
+
+ root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
+
+¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
+¥·¥ó¡¤OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¯
+¤À¤µ¤ë¤È¾¤ÎÊý¤Î¤¿¤á¤Ë¤â¤Ê¤ê¤Þ¤¹¡¥
+
+
+* °Ü¿¢
+
+UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
+¤¹¤¬¡¤»×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤)¡¤ºî¼Ô¤Ë¤½¤Î
+¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
+
+¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
+¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
+³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
+¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
+¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
+¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
+¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
+³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
+
+# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
+
+¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
+¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
+¤ì¤Þ¤»¤ó¡¥
+
+
+* ÇÛÉÛ¾ò·ï
+
+ËÜ¥×¥í¥°¥é¥à¤Ï¥Õ¥ê¡¼¥½¥Õ¥È¥¦¥§¥¢¤Ç¤¹¡¥GPL(the GNU General
+Public License)¤Þ¤¿¤Ï°Ê²¼¤Ë¼¨¤¹¾ò·ï¤ÇËÜ¥×¥í¥°¥é¥à¤òºÆÇÛÉÛ¤Ç
+¤­¤Þ¤¹¡¥GPL¤Ë¤Ä¤¤¤Æ¤ÏCOPYING¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ²¼¤µ¤¤¡¥
+
+ 1. Ê£À½¤ÏÀ©¸Â¤Ê¤¯¼«Í³¤Ç¤¹¡¥
+
+ 2. °Ê²¼¤Î¾ò·ï¤Î¤¤¤º¤ì¤«¤òËþ¤¿¤¹»þ¤ËËÜ¥×¥í¥°¥é¥à¤Î¥½¡¼¥¹¤ò
+ ¼«Í³¤ËÊѹ¹¤Ç¤­¤Þ¤¹¡¥
+
+ (a) ¥Í¥Ã¥È¥Ë¥å¡¼¥º¤Ë¥Ý¥¹¥È¤·¤¿¤ê¡¤ºî¼Ô¤ËÊѹ¹¤òÁ÷ÉÕ¤¹¤ë
+ ¤Ê¤É¤ÎÊýË¡¤Ç¡¤Êѹ¹¤ò¸ø³«¤¹¤ë¡¥
+
+ (b) Êѹ¹¤·¤¿ËÜ¥×¥í¥°¥é¥à¤ò¼«Ê¬¤Î½ê°¤¹¤ëÁÈ¿¥ÆâÉô¤À¤±¤Ç
+ »È¤¦¡¥
+
+ (c) Êѹ¹ÅÀ¤òÌÀ¼¨¤·¤¿¤¦¤¨¡¤¥½¥Õ¥È¥¦¥§¥¢¤Î̾Á°¤òÊѹ¹¤¹¤ë¡¥
+ ¤½¤Î¥½¥Õ¥È¥¦¥§¥¢¤òÇÛÉÛ¤¹¤ë»þ¤Ë¤ÏÊѹ¹Á°¤ÎËÜ¥×¥í¥°¥é
+ ¥à¤âƱ»þ¤ËÇÛÉÛ¤¹¤ë¡¥¤Þ¤¿¤ÏÊѹ¹Á°¤ÎËÜ¥×¥í¥°¥é¥à¤Î¥½¡¼
+ ¥¹¤ÎÆþ¼êË¡¤òÌÀ¼¨¤¹¤ë¡¥
+
+ (d) ¤½¤Î¾¤ÎÊѹ¹¾ò·ï¤òºî¼Ô¤È¹ç°Õ¤¹¤ë¡¥
+
+ 3. °Ê²¼¤Î¾ò·ï¤Î¤¤¤º¤ì¤«¤òËþ¤¿¤¹»þ¤ËËÜ¥×¥í¥°¥é¥à¤ò¥³¥ó¥Ñ¥¤
+ ¥ë¤·¤¿¥ª¥Ö¥¸¥§¥¯¥È¥³¡¼¥É¤ä¼Â¹Ô·Á¼°¤Ç¤âÇÛÉۤǤ­¤Þ¤¹¡¥
+
+ (a) ¥Ð¥¤¥Ê¥ê¤ò¼õ¤±¼è¤Ã¤¿¿Í¤¬¥½¡¼¥¹¤òÆþ¼ê¤Ç¤­¤ë¤è¤¦¤Ë¡¤
+ ¥½¡¼¥¹¤ÎÆþ¼êË¡¤òÌÀ¼¨¤¹¤ë¡¥
+
+ (b) µ¡³£²ÄÆÉ¤Ê¥½¡¼¥¹¥³¡¼¥É¤òźÉÕ¤¹¤ë¡¥
+
+ (c) Êѹ¹¤ò¹Ô¤Ã¤¿¥Ð¥¤¥Ê¥ê¤Ï̾Á°¤òÊѹ¹¤·¤¿¤¦¤¨¡¤¥ª¥ê¥¸¥Ê
+ ¥ë¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎÆþ¼êË¡¤òÌÀ¼¨¤¹¤ë¡¥
+
+ (d) ¤½¤Î¾¤ÎÇÛÉÛ¾ò·ï¤òºî¼Ô¤È¹ç°Õ¤¹¤ë¡¥
+
+ 4. ¾¤Î¥×¥í¥°¥é¥à¤Ø¤Î°úÍѤϤ¤¤«¤Ê¤ëÌÜŪ¤Ç¤¢¤ì¼«Í³¤Ç¤¹¡¥¤¿
+ ¤À¤·¡¤ËÜ¥×¥í¥°¥é¥à¤Ë´Þ¤Þ¤ì¤ë¾¤Îºî¼Ô¤Ë¤è¤ë¥³¡¼¥É¤Ï¡¤¤½
+ ¤ì¤¾¤ì¤Îºî¼Ô¤Î°Õ¸þ¤Ë¤è¤ëÀ©¸Â¤¬²Ã¤¨¤é¤ì¤ë¾ì¹ç¤¬¤¢¤ê¤Þ¤¹¡¥
+
+ ¶ñÂÎŪ¤Ë¤Ïgc.c(°ìÉô)¡¤util.c(°ìÉô)¡¤st.[ch]¡¤regex.[ch]
+ ¤ª¤è¤Ó ./missing¥Ç¥£¥ì¥¯¥È¥ê²¼¤Î¥Õ¥¡¥¤¥ë·²¤¬³ºÅö¤·¤Þ¤¹¡¥
+ ¤½¤ì¤¾¤ì¤ÎÇÛÉÛ¾ò·ï¤Ê¤É¤ËÉÕ¤¤¤Æ¤Ï³Æ¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ¤¯
+ ¤À¤µ¤¤¡¥
+
+ 5. ËÜ¥×¥í¥°¥é¥à¤Ø¤ÎÆþÎϤȤʤ륹¥¯¥ê¥×¥È¤ª¤è¤Ó¡¤ËÜ¥×¥í¥°¥é
+ ¥à¤«¤é¤Î½ÐÎϤθ¢Íø¤ÏËÜ¥×¥í¥°¥é¥à¤Îºî¼Ô¤Ç¤Ï¤Ê¤¯¡¤¤½¤ì¤¾
+ ¤ì¤ÎÆþ½ÐÎϤòÀ¸À®¤·¤¿¿Í¤Ë°¤·¤Þ¤¹¡¥¤Þ¤¿¡¤ËÜ¥×¥í¥°¥é¥à¤Ë
+ ÁȤ߹þ¤Þ¤ì¤ë¤¿¤á¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë¤Ä¤¤¤Æ¤âƱÍͤǤ¹¡¥
+
+ 6. ËÜ¥×¥í¥°¥é¥à¤Ï̵ÊݾڤǤ¹¡¥ºî¼Ô¤ÏËÜ¥×¥í¥°¥é¥à¤ò¥µ¥Ý¡¼¥È
+ ¤¹¤ë°Õ»Ö¤Ï¤¢¤ê¤Þ¤¹¤¬¡¤¥×¥í¥°¥é¥à¼«¿È¤Î¥Ð¥°¤¢¤ë¤¤¤ÏËÜ¥×
+ ¥í¥°¥é¥à¤Î¼Â¹Ô¤Ê¤É¤«¤éȯÀ¸¤¹¤ë¤¤¤«¤Ê¤ë»³²¤ËÂФ·¤Æ¤âÀÕ
+ Ǥ¤ò»ý¤Á¤Þ¤»¤ó¡¥
+
+* Ãø¼Ô
+
+¥³¥á¥ó¥È¡¤¥Ð¥°¥ì¥Ý¡¼¥È¤½¤Î¾¤Ï matz@zetabits.com ¤Þ¤Ç¡¥
+-------------------------------------------------------
+created at: Thu Aug 3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.md b/README.md
deleted file mode 100644
index f79ba9c718..0000000000
--- a/README.md
+++ /dev/null
@@ -1,167 +0,0 @@
-[![Build Status](https://travis-ci.org/ruby/ruby.svg)](https://travis-ci.org/ruby/ruby)
-[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/trunk?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/trunk)
-
-# What's Ruby
-
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming. It has many features to process text files and to do system
-management tasks (as in Perl). It is simple, straight-forward, and
-extensible.
-
-## Features of Ruby
-
-* Simple Syntax
-* **Normal** Object-oriented Features (e.g. class, method calls)
-* **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
-* Operator Overloading
-* Exception Handling
-* Iterators and Closures
-* Garbage Collection
-* Dynamic Loading of Object Files (on some architectures)
-* Highly Portable (works on many Unix-like/POSIX compatible platforms as
- well as Windows, Mac OS X, BeOS, etc.) cf.
- http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
-
-
-## How to get Ruby
-
-For a complete list of ways to install Ruby, including using third-party tools
-like rvm, see:
-
-http://www.ruby-lang.org/en/downloads/
-
-The Ruby distribution files can be found on the following FTP site:
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-The trunk of the Ruby source tree can be checked out with the following
-command:
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-Or if you are using git then use the following command:
-
- $ git clone git://github.com/ruby/ruby.git
-
-There are some other branches under development. Try the following command
-to see the list of branches:
-
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-Or if you are using git then use the following command:
-
- $ git ls-remote git://github.com/ruby/ruby.git
-
-## Ruby home page
-
-The URL of the Ruby home page is:
-
-http://www.ruby-lang.org/
-
-## Mailing list
-
-There is a mailing list to talk about Ruby. To subscribe to this list, please
-send the following phrase:
-
- subscribe
-
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1. If you want to use Microsoft Visual C++ to compile ruby, read
- win32/README.win32 instead of this document.
-
-2. If `./configure` does not exist or is older than configure.in, run
- `autoconf` to (re)generate configure.
-
-3. Run `./configure`, which will generate `config.h` and `Makefile`.
-
- Some C compiler flags may be added by default depending on your
- environment. Specify `optflags=..` and `warnflags=..` as necessary to
- override them.
-
-4. Edit `defines.h` if you need. Usually this step will not be needed.
-
-5. Remove comment mark(`#`) before the module names from `ext/Setup` (or add
- module names if not present), if you want to link modules statically.
-
- If you don't want to compile non static extension modules (probably on
- architectures which do not allow dynamic loading), remove comment mark
- from the line "`#option nodynamic`" in `ext/Setup`.
-
- Usually this step will not be needed.
-
-6. Run `make`.
-
-7. Optionally, run '`make check`' to check whether the compiled Ruby
- interpreter works well. If you see the message "`check succeeded`", your
- ruby works as it should (hopefully).
-
-8. Run '`make install`'
-
- This command will create the following directories and install files into
- them.
-
- * `${DESTDIR}${prefix}/bin`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib`
- * `${DESTDIR}${prefix}/lib/ruby`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/share/man/man1`
- * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
- If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
- `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
- **NOTE**: teeny of the API version may be different from one of Ruby's
- program version
-
- You may have to be a super user to install ruby.
-
-
-If you fail to compile ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
-
-## Copying
-
-See the file [COPYING](COPYING).
-
-## Feedback
-
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
-
-Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
-
-##Contributing
-
-See the file [CONTRIBUTING.md](CONTRIBUTING.md)
-
-
-## The Author
-
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
-
-<mailto:matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
new file mode 100644
index 0000000000..5f67a42b25
--- /dev/null
+++ b/ToDo
@@ -0,0 +1,129 @@
+Language Spec.
+
+- def foo; .. rescue .. end
+- compile time string concatenation, "hello" "world" => "helloworld"
+- rescue modifier; a rescue b => begin a rescue; b end
+- %w(a\ b\ c abc) => ["a b c", "abc"]
+- objectify symbols
+- class variable (prefix @@)
+- rescue RuntimeError => err
+* operator !! for rescue. ???
+* objectify characters
+* ../... outside condition invokes operator method too.
+* ... inside condition turns off just before right condition.???
+* package or access control for global variables??
+* named arguments like foo(nation:="german") or foo(nation: "german").
+* method to retrieve argument information (needs new C API)
+* multiple return values, yield values. maybe incompatible ???
+* cascading method invocation ???
+* def Class#method .. end ??
+* class Foo::Bar<Baz .. end, module Boo::Bar .. end
+* def Foo::Bar::baz() .. end ??
+* I18N (or M17N) script/string/regexp
+* Fixnum 0 as false ????
+* discourage use of symbol variable (e.g. $/, etc.) in manual
+* discourage use of Perlish features by giving warnings.
+* non confusing in-block local variable (is it possible?)
+ + remove scope by block
+ + variables appears within block may have independent values.
+* Regexp: make /o thread safe.
+* decide if begin with rescue or ensure make do..while loop.
+* a +1 to be a+1, not a(+1).
+
+Hacking Interpreter
+
+- use eban's fnmatch
+- RUBYOPT environment variable
+- alias $defout $>
+- retrieve STACK_LEVEL_MAX from users' limit.
+- remove end_proc registered out of require only
+- all object made freezable
+* non-blocking open (e.g. for named pipe) for thread
+* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
+* objectify interpreters ???
+* remove rb_eval() recursions
+* syntax tree -> bytecode ???
+* scrambled script, or script filter
+* setuid ruby
+* performance tune for in-block (dynamic) local variables.
+* generational GC
+* give warnings to assign magic variables.
+* export rb_io_{addstr,printf,puts,print}
+* autoload should work with threads [ruby-talk:4589]
+* remove stdio dependency from IOs.
+* warn for inconsistent local variable usage (lv m and method m at the same time).
+
+Standard Libraries
+
+- hash[key] = nil does not remove entry; hashes may have nil as the value.
+- hash.fetch(key) raises exception if key is not found.
+- Array#{first,last,at}
+- Dir.glob(pat){|f|...}
+- sprintf/printf's $ to specify argument order
+- Dir.glob("**/*.c") ala zsh
+- Remove Enumerable#{size,length}
+- Array#slice, Array#slice!
+- String#slice, String#slice!
+- Marshal should handle generic instance variables.
+- debugger for thread programming
+- SyntaxError, NameError, LoadError and NotImplementedError are subclasses of
+ ScriptError<Exception, not StandardError.
+- Thread::start gives arguments, not a thread object to the block
+- regexp: (?>..), \G
+- Struct::new([name,]member,...)
+- IO#reopen accepts path as well
+- Kernel#scan
+- call initialize for builtin classes too
+- performance tune for String's non-bang methods.
+- 'w' template for pack/unpack
+- alternative for interator? => block_given?
+- regex - /p (made obsolete), /m (new)
+- consistent /, %, divmod
+- unbound method object
+- integrate final.rb into the core.
+* Enumerable#sort_by for Schwartzian transformation
+* String#scanf(?)
+* Object#fmt(?)
+* Integer#{bin,oct,hex,heX}
+* Time::strptime
+* Integer[num], Float[num]; Fixnum[num]?
+* method to retrieve non-number trailer for to_i/to_f.
+* Stream or Port, abstract superclass of IO ?
+* String#{pred,prev}, String#downto
+* optional stepsize argument for succ()
+* Ruby module -- Ruby::Version, Ruby::Interpreter
+* introduce Boolean class; super of TrueClass, FalseClass
+* Process::waitall [ruby-talk:4557]
+* synchronized method - synchronized{...}, synchronized :foo, :bar
+* move Time::times to Process.
+- Module#define_method which takes a name and a body (block, proc or method).
+* IO#for_fd in general
+* Array#&, Array#| to allow duplication. ???
+- fork_and_kill_other_threads.
+* way to specify immortal (fork endurance) thread;
+* or raise ForkException to every thread but fork caller.
+* Array#fetch
+
+Extension Libraries
+
+- FastCGI ruby
+* ptk.rb pTk wrapper that is compatible to tk.rb
+* Berkeley DB extension
+* BitVector
+
+Ruby Libraries
+
+- net/http.rb
+* add uri.rb
+* urllib.rb, nttplib.rb, etc.
+* format like perl's
+
+Tools
+
+- extension library maker using SWIG
+* freeze or undump to bundle everything
+
+Misc
+
+- publish Ruby books
+- publish Ruby books in English
diff --git a/acinclude.m4 b/acinclude.m4
deleted file mode 100644
index 99b24e6d93..0000000000
--- a/acinclude.m4
+++ /dev/null
@@ -1,46 +0,0 @@
-# -*- autoconf -*-
-
-AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
- msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
- AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
- msg_begin="`tput smso 2>/dev/null`"
- AS_CASE(["$msg_begin"], ['@<:@'*m],
- [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
- msg_checking="${msg_begin}33m"
- AS_IF([test ${TEST_COLORS:+set}], [
- msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
- msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
- msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
- ])
- msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
- msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
- msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
- msg_reset="${msg_begin}m"
- ])
- AS_UNSET(msg_begin)
- ])
- AS_REQUIRE_SHELL_FN([colorize_result],
- [AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
- [AS_CASE(["$[]1"],
- [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
- [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
- [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
-])
-
-AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
- AS_LITERAL_IF([$1],
- [m4_case([$1],
- [yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
- [no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
- [AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
- [colorize_result "$1"]) dnl
-])
-
-AC_DEFUN([AC_CHECKING],[dnl
-AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
-
-AC_DEFUN([AC_MSG_RESULT], [dnl
-{ _AS_ECHO_LOG([result: $1])
-COLORIZE_RESULT([$1]); dnl
-}])
diff --git a/aclocal.m4 b/aclocal.m4
deleted file mode 100644
index 56e944be8f..0000000000
--- a/aclocal.m4
+++ /dev/null
@@ -1,15 +0,0 @@
-# generated automatically by aclocal 1.15 -*- Autoconf -*-
-
-# Copyright (C) 1996-2014 Free Software Foundation, Inc.
-
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
-m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
-m4_include([acinclude.m4])
diff --git a/addr2line.c b/addr2line.c
deleted file mode 100644
index a20e5000c4..0000000000
--- a/addr2line.c
+++ /dev/null
@@ -1,1205 +0,0 @@
-/**********************************************************************
-
- addr2line.c -
-
- $Author$
-
- Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#include "ruby/config.h"
-#include "ruby/missing.h"
-#include "addr2line.h"
-
-#include <stdio.h>
-#include <errno.h>
-
-#ifdef USE_ELF
-
-#include <fcntl.h>
-#include <limits.h>
-#include <stdio.h>
-#include <stdint.h>
-#include <stdlib.h>
-#include <string.h>
-#include <sys/mman.h>
-#include <sys/types.h>
-#include <sys/stat.h>
-#include <unistd.h>
-
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
-/* Make alloca work the best possible way. */
-#ifdef __GNUC__
-# ifndef alloca
-# define alloca __builtin_alloca
-# endif
-#else
-# ifdef HAVE_ALLOCA_H
-# include <alloca.h>
-# else
-# ifdef _AIX
-#pragma alloca
-# else
-# ifndef alloca /* predefined by HP cc +Olibcalls */
-void *alloca();
-# endif
-# endif /* AIX */
-# endif /* HAVE_ALLOCA_H */
-#endif /* __GNUC__ */
-
-#ifdef HAVE_DLADDR
-# include <dlfcn.h>
-#endif
-
-#define DW_LNS_copy 0x01
-#define DW_LNS_advance_pc 0x02
-#define DW_LNS_advance_line 0x03
-#define DW_LNS_set_file 0x04
-#define DW_LNS_set_column 0x05
-#define DW_LNS_negate_stmt 0x06
-#define DW_LNS_set_basic_block 0x07
-#define DW_LNS_const_add_pc 0x08
-#define DW_LNS_fixed_advance_pc 0x09
-#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
-#define DW_LNS_set_isa 0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence 0x01
-#define DW_LNE_set_address 0x02
-#define DW_LNE_define_file 0x03
-#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
-
-#ifndef ElfW
-# if SIZEOF_VOIDP == 8
-# define ElfW(x) Elf64##_##x
-# else
-# define ElfW(x) Elf32##_##x
-# endif
-#endif
-#ifndef ELF_ST_TYPE
-# if SIZEOF_VOIDP == 8
-# define ELF_ST_TYPE ELF64_ST_TYPE
-# else
-# define ELF_ST_TYPE ELF32_ST_TYPE
-# endif
-#endif
-#ifndef PATH_MAX
-#define PATH_MAX 4096
-#endif
-
-int kprintf(const char *fmt, ...);
-
-typedef struct {
- const char *dirname;
- const char *filename;
- const char *path; /* object path */
- int line;
-
- uintptr_t base_addr;
- uintptr_t saddr;
- const char *sname; /* function name */
-} line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
- const char *path; /* object path */
- int fd;
- void *mapped;
- size_t mapped_size;
- uintptr_t base_addr;
- obj_info_t *next;
-};
-
-/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
-
-static unsigned long
-uleb128(char **p)
-{
- unsigned long r = 0;
- int s = 0;
- for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
- if (b < 0x80) {
- r += (unsigned long)b << s;
- break;
- }
- r += (b & 0x7f) << s;
- s += 7;
- }
- return r;
-}
-
-static long
-sleb128(char **p)
-{
- long r = 0;
- int s = 0;
- for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
- if (b < 0x80) {
- if (b & 0x40) {
- r -= (0x80 - b) << s;
- }
- else {
- r += (b & 0x3f) << s;
- }
- break;
- }
- r += (b & 0x7f) << s;
- s += 7;
- }
- return r;
-}
-
-static const char *
-get_nth_dirname(unsigned long dir, char *p)
-{
- if (!dir--) {
- return "";
- }
- while (dir--) {
- while (*p) p++;
- p++;
- if (!*p) {
- kprintf("Unexpected directory number %lu in %s\n",
- dir, binary_filename);
- return "";
- }
- }
- return p;
-}
-
-static void
-fill_filename(int file, char *include_directories, char *filenames,
- line_info_t *line)
-{
- int i;
- char *p = filenames;
- char *filename;
- unsigned long dir;
- for (i = 1; i <= file; i++) {
- filename = p;
- if (!*p) {
- /* Need to output binary file name? */
- kprintf("Unexpected file number %d in %s\n",
- file, binary_filename);
- return;
- }
- while (*p) p++;
- p++;
- dir = uleb128(&p);
- /* last modified. */
- uleb128(&p);
- /* size of the file. */
- uleb128(&p);
-
- if (i == file) {
- line->filename = filename;
- line->dirname = get_nth_dirname(dir, include_directories);
- }
- }
-}
-
-static void
-fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
- char *include_directories, char *filenames,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- int i;
- addr += obj->base_addr;
- for (i = offset; i < num_traces; i++) {
- uintptr_t a = (uintptr_t)traces[i];
- /* We assume one line code doesn't result >100 bytes of native code.
- We may want more reliable way eventually... */
- if (addr < a && a < addr + 100) {
- fill_filename(file, include_directories, filenames, &lines[i]);
- lines[i].line = line;
- }
- }
-}
-
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- char *p, *cu_end, *cu_start, *include_directories, *filenames;
- unsigned long unit_length;
- int default_is_stmt, line_base;
- unsigned int header_length, minimum_instruction_length, line_range,
- opcode_base;
- /* unsigned char *standard_opcode_lengths; */
-
- /* The registers. */
- unsigned long addr = 0;
- unsigned int file = 1;
- unsigned int line = 1;
- /* unsigned int column = 0; */
- int is_stmt;
- /* int basic_block = 0; */
- /* int end_sequence = 0; */
- /* int prologue_end = 0; */
- /* int epilogue_begin = 0; */
- /* unsigned int isa = 0; */
-
- p = *debug_line;
-
- unit_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
- if (unit_length == 0xffffffff) {
- unit_length = *(unsigned long *)p;
- p += sizeof(unsigned long);
- }
-
- cu_end = p + unit_length;
-
- /*dwarf_version = *(unsigned short *)p;*/
- p += 2;
-
- header_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
-
- cu_start = p + header_length;
-
- minimum_instruction_length = *(unsigned char *)p;
- p++;
-
- is_stmt = default_is_stmt = *(unsigned char *)p;
- p++;
-
- line_base = *(signed char *)p;
- p++;
-
- line_range = *(unsigned char *)p;
- p++;
-
- opcode_base = *(unsigned char *)p;
- p++;
-
- /* standard_opcode_lengths = (unsigned char *)p - 1; */
- p += opcode_base - 1;
-
- include_directories = p;
-
- /* skip include directories */
- while (*p) {
- while (*p) p++;
- p++;
- }
- p++;
-
- filenames = p;
-
- p = cu_start;
-
-#define FILL_LINE() \
- do { \
- fill_line(num_traces, traces, addr, file, line, \
- include_directories, filenames, \
- obj, lines, offset); \
- /*basic_block = prologue_end = epilogue_begin = 0;*/ \
- } while (0)
-
- while (p < cu_end) {
- unsigned long a;
- unsigned char op = *p++;
- switch (op) {
- case DW_LNS_copy:
- FILL_LINE();
- break;
- case DW_LNS_advance_pc:
- a = uleb128(&p);
- addr += a;
- break;
- case DW_LNS_advance_line: {
- long a = sleb128(&p);
- line += a;
- break;
- }
- case DW_LNS_set_file:
- file = (unsigned int)uleb128(&p);
- break;
- case DW_LNS_set_column:
- /*column = (unsigned int)*/(void)uleb128(&p);
- break;
- case DW_LNS_negate_stmt:
- is_stmt = !is_stmt;
- break;
- case DW_LNS_set_basic_block:
- /*basic_block = 1; */
- break;
- case DW_LNS_const_add_pc:
- a = ((255 - opcode_base) / line_range) *
- minimum_instruction_length;
- addr += a;
- break;
- case DW_LNS_fixed_advance_pc:
- a = *(unsigned char *)p++;
- addr += a;
- break;
- case DW_LNS_set_prologue_end:
- /* prologue_end = 1; */
- break;
- case DW_LNS_set_epilogue_begin:
- /* epilogue_begin = 1; */
- break;
- case DW_LNS_set_isa:
- /* isa = (unsigned int)*/(void)uleb128(&p);
- break;
- case 0:
- a = *(unsigned char *)p++;
- op = *p++;
- switch (op) {
- case DW_LNE_end_sequence:
- /* end_sequence = 1; */
- FILL_LINE();
- addr = 0;
- file = 1;
- line = 1;
- /* column = 0; */
- is_stmt = default_is_stmt;
- /* end_sequence = 0; */
- /* isa = 0; */
- break;
- case DW_LNE_set_address:
- addr = *(unsigned long *)p;
- p += sizeof(unsigned long);
- break;
- case DW_LNE_define_file:
- kprintf("Unsupported operation in %s\n",
- binary_filename);
- break;
- case DW_LNE_set_discriminator:
- /* TODO:currently ignore */
- uleb128(&p);
- break;
- default:
- kprintf("Unknown extended opcode: %d in %s\n",
- op, binary_filename);
- }
- break;
- default: {
- unsigned long addr_incr;
- unsigned long line_incr;
- a = op - opcode_base;
- addr_incr = (a / line_range) * minimum_instruction_length;
- line_incr = line_base + (a % line_range);
- addr += (unsigned int)addr_incr;
- line += (unsigned int)line_incr;
- FILL_LINE();
- }
- }
- }
- *debug_line = p;
-}
-
-static void
-parse_debug_line(int num_traces, void **traces,
- char *debug_line, unsigned long size,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- char *debug_line_end = debug_line + size;
- while (debug_line < debug_line_end) {
- parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
- }
- if (debug_line != debug_line_end) {
- kprintf("Unexpected size of .debug_line in %s\n",
- binary_filename);
- }
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
- obj_info_t **objp, line_info_t *lines, int offset);
-
-static void
-append_obj(obj_info_t **objp) {
- obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
- if (*objp) (*objp)->next = newobj;
- *objp = newobj;
-}
-
-static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
- obj_info_t **objp, line_info_t *lines, int offset)
-{
- /* Ideally we should check 4 paths to follow gnu_debuglink,
- but we handle only one case for now as this format is used
- by some linux distributions. See GDB's info for detail. */
- static const char global_debug_dir[] = "/usr/lib/debug";
- char *p, *subdir;
- obj_info_t *o1 = *objp, *o2;
-
- p = strrchr(binary_filename, '/');
- if (!p) {
- return;
- }
- p[1] = '\0';
-
- subdir = (char *)alloca(strlen(binary_filename) + 1);
- strcpy(subdir, binary_filename);
- strcpy(binary_filename, global_debug_dir);
- strlcat(binary_filename, subdir, PATH_MAX);
- strlcat(binary_filename, debuglink, PATH_MAX);
-
- append_obj(objp);
- o2 = *objp;
- o2->base_addr = o1->base_addr;
- o2->path = o1->path;
- fill_lines(num_traces, traces, 0, objp, lines, offset);
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
- obj_info_t **objp, line_info_t *lines, int offset)
-{
- int i, j;
- char *shstr;
- char *section_name;
- ElfW(Ehdr) *ehdr;
- ElfW(Shdr) *shdr, *shstr_shdr;
- ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
- int fd;
- off_t filesize;
- char *file;
- ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
- ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
- obj_info_t *obj = *objp;
- uintptr_t dladdr_fbase = 0;
-
- fd = open(binary_filename, O_RDONLY);
- if (fd < 0) {
- goto fail;
- }
- filesize = lseek(fd, 0, SEEK_END);
- if (filesize < 0) {
- int e = errno;
- close(fd);
- kprintf("lseek: %s\n", strerror(e));
- goto fail;
- }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
- if (filesize > (off_t)SIZE_MAX) {
- close(fd);
- kprintf("Too large file %s\n", binary_filename);
- goto fail;
- }
-#endif
- lseek(fd, 0, SEEK_SET);
- /* async-signal unsafe */
- file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
- if (file == MAP_FAILED) {
- int e = errno;
- close(fd);
- kprintf("mmap: %s\n", strerror(e));
- goto fail;
- }
-
- ehdr = (ElfW(Ehdr) *)file;
- if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
- /*
- * Huh? Maybe filename was overridden by setproctitle() and
- * it match non-elf file.
- */
- close(fd);
- goto fail;
- }
-
- obj->fd = fd;
- obj->mapped = file;
- obj->mapped_size = (size_t)filesize;
-
- shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
-
- shstr_shdr = shdr + ehdr->e_shstrndx;
- shstr = file + shstr_shdr->sh_offset;
-
- for (i = 0; i < ehdr->e_shnum; i++) {
- section_name = shstr + shdr[i].sh_name;
- switch (shdr[i].sh_type) {
- case SHT_STRTAB:
- if (!strcmp(section_name, ".strtab")) {
- strtab_shdr = shdr + i;
- }
- else if (!strcmp(section_name, ".dynstr")) {
- dynstr_shdr = shdr + i;
- }
- break;
- case SHT_SYMTAB:
- /* if (!strcmp(section_name, ".symtab")) */
- symtab_shdr = shdr + i;
- break;
- case SHT_DYNSYM:
- /* if (!strcmp(section_name, ".dynsym")) */
- dynsym_shdr = shdr + i;
- break;
- case SHT_PROGBITS:
- if (!strcmp(section_name, ".debug_line")) {
- debug_line_shdr = shdr + i;
- }
- else if (!strcmp(section_name, ".gnu_debuglink")) {
- gnu_debuglink_shdr = shdr + i;
- }
- break;
- }
- }
-
- if (offset == -1) {
- /* main executable */
- offset = 0;
- if (dynsym_shdr && dynstr_shdr) {
- char *strtab = file + dynstr_shdr->sh_offset;
- ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
- int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- Dl_info info;
- void *h, *s;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
- h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
- if (!h) continue;
- s = dlsym(h, strtab + sym->st_name);
- if (!s) continue;
- if (dladdr(s, &info)) {
- dladdr_fbase = (uintptr_t)info.dli_fbase;
- break;
- }
- }
- if (ehdr->e_type == ET_EXEC) {
- obj->base_addr = 0;
- }
- else {
- /* PIE (position-independent executable) */
- obj->base_addr = dladdr_fbase;
- }
- }
- }
-
- if (!symtab_shdr) {
- symtab_shdr = dynsym_shdr;
- strtab_shdr = dynstr_shdr;
- }
-
- if (symtab_shdr && strtab_shdr) {
- char *strtab = file + strtab_shdr->sh_offset;
- ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
- int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
- for (i = offset; i < num_traces; i++) {
- uintptr_t d = (uintptr_t)traces[i] - saddr;
- if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
- continue;
- /* fill symbol name and addr from .symtab */
- lines[i].sname = strtab + sym->st_name;
- lines[i].saddr = saddr;
- lines[i].path = obj->path;
- lines[i].base_addr = obj->base_addr;
- }
- }
- }
-
- if (!debug_line_shdr) {
- /* This file doesn't have .debug_line section,
- let's check .gnu_debuglink section instead. */
- if (gnu_debuglink_shdr && check_debuglink) {
- follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
- num_traces, traces,
- objp, lines, offset);
- }
- goto finish;
- }
-
- parse_debug_line(num_traces, traces,
- file + debug_line_shdr->sh_offset,
- debug_line_shdr->sh_size,
- obj, lines, offset);
-finish:
- return dladdr_fbase;
-fail:
- return (uintptr_t)-1;
-}
-
-#define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
-# include <sys/sysctl.h>
-#endif
-/* ssize_t main_exe_path(void)
- *
- * store the path of the main executable to `binary_filename`,
- * and returns strlen(binary_filename).
- * it is NUL terminated.
- */
-#if defined(__linux__)
-ssize_t
-main_exe_path(void)
-{
-# define PROC_SELF_EXE "/proc/self/exe"
- ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
- binary_filename[len] = 0;
- return len;
-}
-#elif defined(__FreeBSD__)
-ssize_t
-main_exe_path(void)
-{
- int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
- size_t len = PATH_MAX;
- int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
- if (err) {
- kprintf("Can't get the path of ruby");
- return -1;
- }
- len--; /* sysctl sets strlen+1 */
- return len;
-}
-#else
-#undef HAVE_MAIN_EXE_PATH
-#endif
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces)
-{
- int i;
- /* async-signal unsafe */
- line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
- obj_info_t *obj = NULL;
- /* 2 is NULL + main executable */
- void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
-#ifdef HAVE_MAIN_EXE_PATH
- char *main_path = NULL; /* used on printing backtrace */
- ssize_t len;
- if ((len = main_exe_path()) > 0) {
- main_path = (char *)alloca(len + 1);
- if (main_path) {
- uintptr_t addr;
- memcpy(main_path, binary_filename, len+1);
- append_obj(&obj);
- obj->path = main_path;
- addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
- if (addr != (uintptr_t)-1) {
- dladdr_fbases[0] = (void *)addr;
- }
- }
- }
-#endif
-
- /* fill source lines by reading dwarf */
- for (i = 0; i < num_traces; i++) {
- Dl_info info;
- if (lines[i].line) continue;
- if (dladdr(traces[i], &info)) {
- const char *path;
- void **p;
-
- /* skip symbols which is in already checked objects */
- /* if the binary is strip-ed, this may effect */
- for (p=dladdr_fbases; *p; p++) {
- if (*p == info.dli_fbase) {
- lines[i].path = info.dli_fname;
- lines[i].sname = info.dli_sname;
- goto next_line;
- }
- }
- *p = info.dli_fbase;
-
- append_obj(&obj);
- obj->base_addr = (uintptr_t)info.dli_fbase;
- path = info.dli_fname;
- obj->path = path;
- lines[i].path = path;
- strcpy(binary_filename, path);
- fill_lines(num_traces, traces, 1, &obj, lines, i);
- }
-next_line:
- continue;
- }
-
- /* output */
- for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
- uintptr_t addr = (uintptr_t)traces[i];
- uintptr_t d = addr - line->saddr;
- if (!line->path) {
- kprintf("[0x%lx]\n", addr);
- }
- else if (!line->saddr || !line->sname) {
- kprintf("%s [0x%lx]\n", line->path, addr);
- }
- else if (line->line <= 0) {
- kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
- d, addr);
- }
- else if (!line->filename) {
- kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
- d, addr, line->line);
- }
- else if (line->dirname && line->dirname[0]) {
- kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
- d, addr, line->dirname, line->filename, line->line);
- }
- else {
- kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
- d, addr, line->filename, line->line);
- }
- /* FreeBSD's backtrace may show _start and so on */
- if (line->sname && strcmp("main", line->sname) == 0)
- break;
- }
-
- /* free */
- while (obj) {
- obj_info_t *o = obj;
- obj = o->next;
- if (o->fd) {
- munmap(o->mapped, o->mapped_size);
- close(o->fd);
- }
- free(o);
- }
- free(lines);
- free(dladdr_fbases);
-}
-
-/* From FreeBSD's lib/libstand/printf.c */
-/*-
- * Copyright (c) 1986, 1988, 1991, 1993
- * The Regents of the University of California. All rights reserved.
- * (c) UNIX System Laboratories, Inc.
- * All or some portions of this file are derived from material licensed
- * to the University of California by American Telephone and Telegraph
- * Co. or Unix System Laboratories, Inc. and are reproduced herein with
- * the permission of UNIX System Laboratories, Inc.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- * notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- * 4. Neither the name of the University nor the names of its contributors
- * may be used to endorse or promote products derived from this software
- * without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- * @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
- */
-
-#include <stdarg.h>
-#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
-#define hex2ascii(hex) (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-static inline int imax(int a, int b) { return (a > b ? a : b); }
-static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
-
-static void putce(int c)
-{
- char s[1];
- ssize_t ret;
-
- s[0] = (char)c;
- ret = write(2, s, 1);
- (void)ret;
-}
-
-int
-kprintf(const char *fmt, ...)
-{
- va_list ap;
- int retval;
-
- va_start(ap, fmt);
- retval = kvprintf(fmt, putce, NULL, 10, ap);
- va_end(ap);
- return retval;
-}
-
-/*
- * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
- * order; return an optional length and a pointer to the last character
- * written in the buffer (i.e., the first character of the string).
- * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
- */
-static char *
-ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
-{
- char *p, c;
-
- p = nbuf;
- *p = '\0';
- do {
- c = hex2ascii(num % base);
- *++p = upper ? toupper(c) : c;
- } while (num /= base);
- if (lenp)
- *lenp = (int)(p - nbuf);
- return (p);
-}
-
-/*
- * Scaled down version of printf(3).
- *
- * Two additional formats:
- *
- * The format %b is supported to decode error registers.
- * Its usage is:
- *
- * printf("reg=%b\n", regval, "<base><arg>*");
- *
- * where <base> is the output base expressed as a control character, e.g.
- * \10 gives octal; \20 gives hex. Each arg is a sequence of characters,
- * the first of which gives the bit number to be inspected (origin 1), and
- * the next characters (up to a control character, i.e. a character <= 32),
- * give the name of the register. Thus:
- *
- * kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
- *
- * would produce output:
- *
- * reg=3<BITTWO,BITONE>
- *
- * XXX: %D -- Hexdump, takes pointer and separator string:
- * ("%6D", ptr, ":") -> XX:XX:XX:XX:XX:XX
- * ("%*D", len, ptr, " " -> XX XX XX XX ...
- */
-static int
-kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
-{
-#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
- char nbuf[MAXNBUF];
- char *d;
- const char *p, *percent, *q;
- unsigned char *up;
- int ch, n;
- uintmax_t num;
- int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
- int cflag, hflag, jflag, tflag, zflag;
- int dwidth, upper;
- char padc;
- int stop = 0, retval = 0;
-
- num = 0;
- if (!func)
- d = (char *) arg;
- else
- d = NULL;
-
- if (fmt == NULL)
- fmt = "(fmt null)\n";
-
- if (radix < 2 || radix > 36)
- radix = 10;
-
- for (;;) {
- padc = ' ';
- width = 0;
- while ((ch = (unsigned char)*fmt++) != '%' || stop) {
- if (ch == '\0')
- return (retval);
- PCHAR(ch);
- }
- percent = fmt - 1;
- qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
- sign = 0; dot = 0; dwidth = 0; upper = 0;
- cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
-reswitch: switch (ch = (unsigned char)*fmt++) {
- case '.':
- dot = 1;
- goto reswitch;
- case '#':
- sharpflag = 1;
- goto reswitch;
- case '+':
- sign = 1;
- goto reswitch;
- case '-':
- ladjust = 1;
- goto reswitch;
- case '%':
- PCHAR(ch);
- break;
- case '*':
- if (!dot) {
- width = va_arg(ap, int);
- if (width < 0) {
- ladjust = !ladjust;
- width = -width;
- }
- } else {
- dwidth = va_arg(ap, int);
- }
- goto reswitch;
- case '0':
- if (!dot) {
- padc = '0';
- goto reswitch;
- }
- case '1': case '2': case '3': case '4':
- case '5': case '6': case '7': case '8': case '9':
- for (n = 0;; ++fmt) {
- n = n * 10 + ch - '0';
- ch = *fmt;
- if (ch < '0' || ch > '9')
- break;
- }
- if (dot)
- dwidth = n;
- else
- width = n;
- goto reswitch;
- case 'b':
- num = (unsigned int)va_arg(ap, int);
- p = va_arg(ap, char *);
- for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
- PCHAR(*q--);
-
- if (num == 0)
- break;
-
- for (tmp = 0; *p;) {
- n = *p++;
- if (num & (1 << (n - 1))) {
- PCHAR(tmp ? ',' : '<');
- for (; (n = *p) > ' '; ++p)
- PCHAR(n);
- tmp = 1;
- } else
- for (; *p > ' '; ++p)
- continue;
- }
- if (tmp)
- PCHAR('>');
- break;
- case 'c':
- PCHAR(va_arg(ap, int));
- break;
- case 'D':
- up = va_arg(ap, unsigned char *);
- p = va_arg(ap, char *);
- if (!width)
- width = 16;
- while(width--) {
- PCHAR(hex2ascii(*up >> 4));
- PCHAR(hex2ascii(*up & 0x0f));
- up++;
- if (width)
- for (q=p;*q;q++)
- PCHAR(*q);
- }
- break;
- case 'd':
- case 'i':
- base = 10;
- sign = 1;
- goto handle_sign;
- case 'h':
- if (hflag) {
- hflag = 0;
- cflag = 1;
- } else
- hflag = 1;
- goto reswitch;
- case 'j':
- jflag = 1;
- goto reswitch;
- case 'l':
- if (lflag) {
- lflag = 0;
- qflag = 1;
- } else
- lflag = 1;
- goto reswitch;
- case 'n':
- if (jflag)
- *(va_arg(ap, intmax_t *)) = retval;
- else if (qflag)
- *(va_arg(ap, int64_t *)) = retval;
- else if (lflag)
- *(va_arg(ap, long *)) = retval;
- else if (zflag)
- *(va_arg(ap, size_t *)) = retval;
- else if (hflag)
- *(va_arg(ap, short *)) = retval;
- else if (cflag)
- *(va_arg(ap, char *)) = retval;
- else
- *(va_arg(ap, int *)) = retval;
- break;
- case 'o':
- base = 8;
- goto handle_nosign;
- case 'p':
- base = 16;
- sharpflag = (width == 0);
- sign = 0;
- num = (uintptr_t)va_arg(ap, void *);
- goto number;
- case 'q':
- qflag = 1;
- goto reswitch;
- case 'r':
- base = radix;
- if (sign)
- goto handle_sign;
- goto handle_nosign;
- case 's':
- p = va_arg(ap, char *);
- if (p == NULL)
- p = "(null)";
- if (!dot)
- n = (int)strlen (p);
- else
- for (n = 0; n < dwidth && p[n]; n++)
- continue;
-
- width -= n;
-
- if (!ladjust && width > 0)
- while (width--)
- PCHAR(padc);
- while (n--)
- PCHAR(*p++);
- if (ladjust && width > 0)
- while (width--)
- PCHAR(padc);
- break;
- case 't':
- tflag = 1;
- goto reswitch;
- case 'u':
- base = 10;
- goto handle_nosign;
- case 'X':
- upper = 1;
- case 'x':
- base = 16;
- goto handle_nosign;
- case 'y':
- base = 16;
- sign = 1;
- goto handle_sign;
- case 'z':
- zflag = 1;
- goto reswitch;
-handle_nosign:
- sign = 0;
- if (jflag)
- num = va_arg(ap, uintmax_t);
- else if (qflag)
- num = va_arg(ap, uint64_t);
- else if (tflag)
- num = va_arg(ap, ptrdiff_t);
- else if (lflag)
- num = va_arg(ap, unsigned long);
- else if (zflag)
- num = va_arg(ap, size_t);
- else if (hflag)
- num = (unsigned short)va_arg(ap, int);
- else if (cflag)
- num = (unsigned char)va_arg(ap, int);
- else
- num = va_arg(ap, unsigned int);
- goto number;
-handle_sign:
- if (jflag)
- num = va_arg(ap, intmax_t);
- else if (qflag)
- num = va_arg(ap, int64_t);
- else if (tflag)
- num = va_arg(ap, ptrdiff_t);
- else if (lflag)
- num = va_arg(ap, long);
- else if (zflag)
- num = va_arg(ap, ssize_t);
- else if (hflag)
- num = (short)va_arg(ap, int);
- else if (cflag)
- num = (char)va_arg(ap, int);
- else
- num = va_arg(ap, int);
-number:
- if (sign && (intmax_t)num < 0) {
- neg = 1;
- num = -(intmax_t)num;
- }
- p = ksprintn(nbuf, num, base, &n, upper);
- tmp = 0;
- if (sharpflag && num != 0) {
- if (base == 8)
- tmp++;
- else if (base == 16)
- tmp += 2;
- }
- if (neg)
- tmp++;
-
- if (!ladjust && padc == '0')
- dwidth = width - tmp;
- width -= tmp + imax(dwidth, n);
- dwidth -= n;
- if (!ladjust)
- while (width-- > 0)
- PCHAR(' ');
- if (neg)
- PCHAR('-');
- if (sharpflag && num != 0) {
- if (base == 8) {
- PCHAR('0');
- } else if (base == 16) {
- PCHAR('0');
- PCHAR('x');
- }
- }
- while (dwidth-- > 0)
- PCHAR('0');
-
- while (*p)
- PCHAR(*p--);
-
- if (ladjust)
- while (width-- > 0)
- PCHAR(' ');
-
- break;
- default:
- while (percent < fmt)
- PCHAR(*percent++);
- /*
- * Since we ignore an formatting argument it is no
- * longer safe to obey the remaining formatting
- * arguments as the arguments will no longer match
- * the format specs.
- */
- stop = 1;
- break;
- }
- }
-#undef PCHAR
-}
-#else /* defined(USE_ELF) */
-#error not supported
-#endif
diff --git a/addr2line.h b/addr2line.h
deleted file mode 100644
index d99f010934..0000000000
--- a/addr2line.h
+++ /dev/null
@@ -1,21 +0,0 @@
-/**********************************************************************
-
- addr2line.h -
-
- $Author$
-
- Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces);
-
-#endif /* USE_ELF */
-
-#endif /* RUBY_ADDR2LINE_H */
diff --git a/appveyor.yml b/appveyor.yml
deleted file mode 100644
index 2cda4817a6..0000000000
--- a/appveyor.yml
+++ /dev/null
@@ -1,37 +0,0 @@
----
-shallow_clone: true
-platform: x64
-install:
- - SET
- - '"C:\Program Files (x86)\Microsoft Visual Studio 12.0\VC\vcvarsall.bat" amd64'
- - SET PATH=\usr\local\bin;C:\Ruby22-x64\bin;C:\Ruby21-x64\Devkit\mingw\bin;%PATH%;C:\msys64\usr\bin
- - ruby --version
- - 'cl'
- - SET
- - mkdir \usr\local\bin
- - mkdir \usr\local\include
- - mkdir \usr\local\lib
- - ps: Start-FileDownload 'http://ftp.openbsd.org/pub/OpenBSD/LibreSSL/libressl-2.3.7-windows.zip'
- - 7z x libressl-2.3.7-windows.zip
- - copy libressl-2.3.7-windows\x64\libcrypto-37.lib \usr\local\lib\crypto.lib
- - copy libressl-2.3.7-windows\x64\libssl-38.lib \usr\local\lib\ssl.lib
- - copy libressl-2.3.7-windows\x64\libcrypto-37.dll \usr\local\bin
- - copy libressl-2.3.7-windows\x64\libssl-38.dll \usr\local\bin
- - xcopy /e libressl-2.3.7-windows\include \usr\local\include
- - ps: Start-FileDownload 'http://zlib.net/zlib128.zip'
- - 7z x zlib128.zip
- - cd zlib-1.2.8
- - nmake -f win32/Makefile.msc
- - copy zlib1.dll \usr\local\bin
- - copy zlib.lib \usr\local\lib
- - copy zconf.h \usr\local\include
- - copy zlib.h \usr\local\include
-build_script:
- - cd %APPVEYOR_BUILD_FOLDER%
- - win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local
- - nmake -l up
- - nmake -l
- - nmake install-nodoc
-test_script:
- - nmake -l "OPTS=-v -q" btest
- - nmake -l "OPTS=-v -q" test-basic
diff --git a/array.c b/array.c
index 4e60177121..0b36460dbd 100644
--- a/array.c
+++ b/array.c
@@ -3,136 +3,27 @@
array.c -
$Author$
+ $Date$
created at: Fri Aug 6 09:46:12 JST 1993
- Copyright (C) 1993-2007 Yukihiro Matsumoto
+ Copyright (C) 1993-2000 Yukihiro Matsumoto
Copyright (C) 2000 Network Applied Communication Laboratory, Inc.
Copyright (C) 2000 Information-technology Promotion Agency, Japan
**********************************************************************/
-#include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
-#include "probes.h"
-#include "id.h"
-
-#ifndef ARRAY_DEBUG
-# define NDEBUG
-#endif
-#include "ruby_assert.h"
+#include "ruby.h"
+#include "util.h"
+#include "st.h"
VALUE rb_cArray;
-static ID id_cmp, id_div, id_power;
-
#define ARY_DEFAULT_SIZE 16
-#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
-
-# define ARY_SHARED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
-
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
-#define ARY_EMBED_LEN(a) \
- (assert(ARY_EMBED_P(a)), \
- (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
- (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
-
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
-#define FL_SET_EMBED(a) do { \
- assert(!ARY_SHARED_P(a)); \
- FL_SET((a), RARRAY_EMBED_FLAG); \
-} while (0)
-#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
-#define FL_SET_SHARED(ary) do { \
- assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), ELTS_SHARED); \
-} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
-
-#define ARY_SET_PTR(ary, p) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.ptr = (p); \
-} while (0)
-#define ARY_SET_EMBED_LEN(ary, n) do { \
- long tmp_n = (n); \
- assert(ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
- RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
-} while (0)
-#define ARY_SET_HEAP_LEN(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- RARRAY(ary)->as.heap.len = (n); \
-} while (0)
-#define ARY_SET_LEN(ary, n) do { \
- if (ARY_EMBED_P(ary)) { \
- ARY_SET_EMBED_LEN((ary), (n)); \
- } \
- else { \
- ARY_SET_HEAP_LEN((ary), (n)); \
- } \
- assert(RARRAY_LEN(ary) == (n)); \
-} while (0)
-#define ARY_INCREASE_PTR(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.ptr += (n); \
-} while (0)
-#define ARY_INCREASE_LEN(ary, n) do { \
- assert(!OBJ_FROZEN(ary)); \
- if (ARY_EMBED_P(ary)) { \
- ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
- } \
- else { \
- RARRAY(ary)->as.heap.len += (n); \
- } \
-} while (0)
-
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
- ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SET_CAPA(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!ARY_SHARED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.aux.capa = (n); \
-} while (0)
-
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
-#define ARY_SET_SHARED(ary, value) do { \
- const VALUE _ary_ = (ary); \
- const VALUE _value_ = (value); \
- assert(!ARY_EMBED_P(_ary_)); \
- assert(ARY_SHARED_P(_ary_)); \
- assert(ARY_SHARED_ROOT_P(_value_)); \
- RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
- (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
- assert(ARY_SHARED_ROOT_P(ary)); \
- RARRAY(ary)->as.heap.aux.capa = (value); \
-} while (0)
-#define FL_SET_SHARED_ROOT(ary) do { \
- assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
-} while (0)
-
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_mem_clear(mem, size)
+ register VALUE *mem;
+ register long size;
{
while (size--) {
*mem++ = Qnil;
@@ -140,6006 +31,1677 @@ rb_mem_clear(register VALUE *mem, register long size)
}
static void
-ary_mem_clear(VALUE ary, long beg, long size)
-{
- RARRAY_PTR_USE(ary, ptr, {
- rb_mem_clear(ptr + beg, size);
- });
-}
-
-static inline void
-memfill(register VALUE *mem, register long size, register VALUE val)
+memfill(mem, size, val)
+ register VALUE *mem;
+ register long size;
+ register VALUE val;
{
while (size--) {
*mem++ = val;
}
}
-static void
-ary_memfill(VALUE ary, long beg, long size, VALUE val)
-{
- RARRAY_PTR_USE(ary, ptr, {
- memfill(ptr + beg, size, val);
- RB_OBJ_WRITTEN(ary, Qundef, val);
- });
-}
-
-static void
-ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
-{
-#if 1
- assert(!ARY_SHARED_P(buff_owner_ary));
-
- if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
- rb_gc_writebarrier_remember(buff_owner_ary);
- RARRAY_PTR_USE(ary, ptr, {
- MEMCPY(ptr+beg, argv, VALUE, argc);
- });
- }
- else {
- int i;
- RARRAY_PTR_USE(ary, ptr, {
- for (i=0; i<argc; i++) {
- RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
- }
- });
- }
-#else
- /* giveup write barrier (traditional way) */
- RARRAY_PTR(buff_owner_ary);
- MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
-}
-
-static void
-ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
-{
- ary_memcpy0(ary, beg, argc, argv, ary);
-}
-
-static void
-ary_resize_capa(VALUE ary, long capacity)
-{
- assert(RARRAY_LEN(ary) <= capacity);
- assert(!OBJ_FROZEN(ary));
- assert(!ARY_SHARED_P(ary));
- if (capacity > RARRAY_EMBED_LEN_MAX) {
- if (ARY_EMBED_P(ary)) {
- long len = ARY_EMBED_LEN(ary);
- VALUE *ptr = ALLOC_N(VALUE, (capacity));
- MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ptr);
- ARY_SET_HEAP_LEN(ary, len);
- }
- else {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
- }
- ARY_SET_CAPA(ary, (capacity));
- }
- else {
- if (!ARY_EMBED_P(ary)) {
- long len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
-
- if (len > capacity) len = capacity;
- MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
- FL_SET_EMBED(ary);
- ARY_SET_LEN(ary, len);
- ruby_xfree((VALUE *)ptr);
- }
- }
-}
-
-static inline void
-ary_shrink_capa(VALUE ary)
-{
- long capacity = ARY_HEAP_LEN(ary);
- long old_capa = RARRAY(ary)->as.heap.aux.capa;
- assert(!ARY_SHARED_P(ary));
- assert(old_capa >= capacity);
- if (old_capa > capacity)
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
-}
-
-static void
-ary_double_capa(VALUE ary, long min)
-{
- long new_capa = ARY_CAPA(ary) / 2;
-
- if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
- }
- if (new_capa >= ARY_MAX_SIZE - min) {
- new_capa = (ARY_MAX_SIZE - min) / 2;
- }
- new_capa += min;
- ary_resize_capa(ary, new_capa);
-}
-
-static void
-rb_ary_decrement_share(VALUE shared)
-{
- if (shared) {
- long num = ARY_SHARED_NUM(shared) - 1;
- if (num == 0) {
- rb_ary_free(shared);
- rb_gc_force_recycle(shared);
- }
- else if (num > 0) {
- ARY_SET_SHARED_NUM(shared, num);
- }
- }
-}
-
-static void
-rb_ary_unshare(VALUE ary)
-{
- VALUE shared = RARRAY(ary)->as.heap.aux.shared;
- rb_ary_decrement_share(shared);
- FL_UNSET_SHARED(ary);
-}
-
-static inline void
-rb_ary_unshare_safe(VALUE ary)
-{
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- }
-}
-
-static VALUE
-rb_ary_increment_share(VALUE shared)
-{
- long num = ARY_SHARED_NUM(shared);
- if (num >= 0) {
- ARY_SET_SHARED_NUM(shared, num + 1);
- }
- return shared;
-}
+#define ARY_TMPLOCK FL_USER1
static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
-{
- rb_ary_increment_share(shared);
- FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, shared);
-}
-
-static inline void
-rb_ary_modify_check(VALUE ary)
-{
- rb_check_frozen(ary);
-}
-
-void
-rb_ary_modify(VALUE ary)
+rb_ary_modify(ary)
+ VALUE ary;
{
- rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- long shared_len, len = RARRAY_LEN(ary);
- VALUE shared = ARY_SHARED(ary);
- if (len <= RARRAY_EMBED_LEN_MAX) {
- const VALUE *ptr = ARY_HEAP_PTR(ary);
- FL_UNSET_SHARED(ary);
- FL_SET_EMBED(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
- rb_ary_decrement_share(shared);
- ARY_SET_EMBED_LEN(ary, len);
- }
- else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
- long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
- FL_UNSET_SHARED(ary);
- ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
- ARY_SET_CAPA(ary, shared_len);
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+shift, VALUE, len);
- });
- FL_SET_EMBED(shared);
- rb_ary_decrement_share(shared);
- }
- else {
- VALUE *ptr = ALLOC_N(VALUE, len);
- MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
- rb_ary_unshare(ary);
- ARY_SET_CAPA(ary, len);
- ARY_SET_PTR(ary, ptr);
- }
-
- rb_gc_writebarrier_remember(ary);
- }
+ if (OBJ_FROZEN(ary)) rb_error_frozen("array");
+ if (FL_TEST(ary, ARY_TMPLOCK))
+ rb_raise(rb_eTypeError, "can't modify array during sort");
+ if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
+ rb_raise(rb_eSecurityError, "Insecure: can't modify array");
}
-static VALUE
-ary_ensure_room_for_push(VALUE ary, long add_len)
-{
- long old_len = RARRAY_LEN(ary);
- long new_len = old_len + add_len;
- long capa;
-
- if (old_len > ARY_MAX_SIZE - add_len) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
- }
- if (ARY_SHARED_P(ary)) {
- if (new_len > RARRAY_EMBED_LEN_MAX) {
- VALUE shared = ARY_SHARED(ary);
- if (ARY_SHARED_OCCUPIED(shared)) {
- if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
- rb_ary_modify_check(ary);
- return shared;
- }
- else {
- /* if array is shared, then it is likely it participate in push/shift pattern */
- rb_ary_modify(ary);
- capa = ARY_CAPA(ary);
- if (new_len > capa - (capa >> 6)) {
- ary_double_capa(ary, new_len);
- }
- return ary;
- }
- }
- }
- }
- rb_ary_modify(ary);
- capa = ARY_CAPA(ary);
- if (new_len > capa) {
- ary_double_capa(ary, new_len);
- }
-
- return ary;
-}
-
-/*
- * call-seq:
- * ary.freeze -> ary
- *
- * Calls Object#freeze on +ary+ to prevent any further
- * modification. A RuntimeError will be raised if a modification
- * attempt is made.
- *
- */
-
VALUE
-rb_ary_freeze(VALUE ary)
+rb_ary_freeze(ary)
+ VALUE ary;
{
return rb_obj_freeze(ary);
}
-/*
- * call-seq:
- * ary.frozen? -> true or false
- *
- * Return +true+ if this array is frozen (or temporarily frozen
- * while being sorted). See also Object#frozen?
- */
-
static VALUE
-rb_ary_frozen_p(VALUE ary)
-{
- if (OBJ_FROZEN(ary)) return Qtrue;
- return Qfalse;
-}
-
-/* This can be used to take a snapshot of an array (with
- e.g. rb_ary_replace) and check later whether the array has been
- modified from the snapshot. The snapshot is cheap, though if
- something does modify the array it will pay the cost of copying
- it. If Array#pop or Array#shift has been called, the array will
- be still shared with the snapshot, but the array length will
- differ. */
-VALUE
-rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
+rb_ary_frozen_p(ary)
+ VALUE ary;
{
- if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
- !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
- RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
- RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+ if (FL_TEST(ary, FL_FREEZE|ARY_TMPLOCK))
return Qtrue;
- }
return Qfalse;
}
-static VALUE
-ary_alloc(VALUE klass)
-{
- NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
- /* Created array is:
- * FL_SET_EMBED((VALUE)ary);
- * ARY_SET_EMBED_LEN((VALUE)ary, 0);
- */
- return (VALUE)ary;
-}
-
-static VALUE
-empty_ary_alloc(VALUE klass)
-{
- RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
- return ary_alloc(klass);
-}
-
-static VALUE
-ary_new(VALUE klass, long capa)
+VALUE
+rb_ary_new2(len)
+ long len;
{
- VALUE ary,*ptr;
+ NEWOBJ(ary, struct RArray);
+ OBJSETUP(ary, rb_cArray, T_ARRAY);
- if (capa < 0) {
+ if (len < 0) {
rb_raise(rb_eArgError, "negative array size (or size too big)");
}
- if (capa > ARY_MAX_SIZE) {
+ if (len > 0 && len*sizeof(VALUE) <= 0) {
rb_raise(rb_eArgError, "array size too big");
}
+ ary->len = 0;
+ ary->capa = len;
+ ary->ptr = 0;
+ if (len == 0) len++;
+ ary->ptr = ALLOC_N(VALUE, len);
- RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
-
- ary = ary_alloc(klass);
- if (capa > RARRAY_EMBED_LEN_MAX) {
- ptr = ALLOC_N(VALUE, capa);
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ptr);
- ARY_SET_CAPA(ary, capa);
- ARY_SET_HEAP_LEN(ary, 0);
- }
-
- return ary;
+ return (VALUE)ary;
}
VALUE
-rb_ary_new_capa(long capa)
+rb_ary_new()
{
- return ary_new(rb_cArray, capa);
+ return rb_ary_new2(ARY_DEFAULT_SIZE);
}
-VALUE
-rb_ary_new(void)
-{
- return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
-}
+#ifdef HAVE_STDARG_PROTOTYPES
+#include <stdarg.h>
+#define va_init_list(a,b) va_start(a,b)
+#else
+#include <varargs.h>
+#define va_init_list(a,b) va_start(a)
+#endif
VALUE
-(rb_ary_new_from_args)(long n, ...)
+#ifdef HAVE_STDARG_PROTOTYPES
+rb_ary_new3(long n, ...)
+#else
+rb_ary_new3(n, va_alist)
+ long n;
+ va_dcl
+#endif
{
va_list ar;
VALUE ary;
long i;
- ary = rb_ary_new2(n);
+ if (n < 0) {
+ rb_raise(rb_eIndexError, "negative number of items(%d)", n);
+ }
+ ary = rb_ary_new2(n<ARY_DEFAULT_SIZE?ARY_DEFAULT_SIZE:n);
- va_start(ar, n);
+ va_init_list(ar, n);
for (i=0; i<n; i++) {
- ARY_SET(ary, i, va_arg(ar, VALUE));
+ RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
}
va_end(ar);
- ARY_SET_LEN(ary, n);
+ RARRAY(ary)->len = n;
return ary;
}
VALUE
-rb_ary_new_from_values(long n, const VALUE *elts)
+rb_ary_new4(n, elts)
+ long n;
+ VALUE *elts;
{
VALUE ary;
ary = rb_ary_new2(n);
- if (n > 0 && elts) {
- ary_memcpy(ary, 0, n, elts);
- ARY_SET_LEN(ary, n);
+ if (elts) {
+ MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
}
+ RARRAY(ary)->len = n;
return ary;
}
VALUE
-rb_ary_tmp_new(long capa)
-{
- return ary_new(0, capa);
-}
-
-VALUE
-rb_ary_tmp_new_fill(long capa)
+rb_assoc_new(car, cdr)
+ VALUE car, cdr;
{
- VALUE ary = ary_new(0, capa);
- ary_memfill(ary, 0, capa, Qnil);
- ARY_SET_LEN(ary, capa);
- return ary;
-}
-
-void
-rb_ary_free(VALUE ary)
-{
- if (ARY_OWNS_HEAP_P(ary)) {
- ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
- }
-}
-
-RUBY_FUNC_EXPORTED size_t
-rb_ary_memsize(VALUE ary)
-{
- if (ARY_OWNS_HEAP_P(ary)) {
- return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
- }
- else {
- return 0;
- }
-}
-
-static inline void
-ary_discard(VALUE ary)
-{
- rb_ary_free(ary);
- RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
-static VALUE
-ary_make_shared(VALUE ary)
-{
- assert(!ARY_EMBED_P(ary));
- if (ARY_SHARED_P(ary)) {
- return ARY_SHARED(ary);
- }
- else if (ARY_SHARED_ROOT_P(ary)) {
- return ary;
- }
- else if (OBJ_FROZEN(ary)) {
- ary_shrink_capa(ary);
- FL_SET_SHARED_ROOT(ary);
- ARY_SET_SHARED_NUM(ary, 1);
- return ary;
- }
- else {
- long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
- NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
- FL_UNSET_EMBED(shared);
-
- ARY_SET_LEN((VALUE)shared, capa);
- ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
- ary_mem_clear((VALUE)shared, len, capa - len);
- FL_SET_SHARED_ROOT(shared);
- ARY_SET_SHARED_NUM((VALUE)shared, 1);
- FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, (VALUE)shared);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
- }
-}
+ VALUE ary;
-static VALUE
-ary_make_substitution(VALUE ary)
-{
- long len = RARRAY_LEN(ary);
+ ary = rb_ary_new2(2);
+ RARRAY(ary)->ptr[0] = car;
+ RARRAY(ary)->ptr[1] = cdr;
+ RARRAY(ary)->len = 2;
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE subst = rb_ary_new2(len);
- ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
- ARY_SET_EMBED_LEN(subst, len);
- return subst;
- }
- else {
- return rb_ary_increment_share(ary_make_shared(ary));
- }
-}
-
-VALUE
-rb_assoc_new(VALUE car, VALUE cdr)
-{
- return rb_ary_new3(2, car, cdr);
+ return ary;
}
static VALUE
-to_ary(VALUE ary)
-{
- return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
-}
-
-VALUE
-rb_check_array_type(VALUE ary)
+rb_ary_s_new(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
{
- return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
-}
-
-/*
- * call-seq:
- * Array.try_convert(obj) -> array or nil
- *
- * Tries to convert +obj+ into an array, using +to_ary+ method. Returns the
- * converted array or +nil+ if +obj+ cannot be converted for any reason.
- * This method can be used to check if an argument is an array.
- *
- * Array.try_convert([1]) #=> [1]
- * Array.try_convert("1") #=> nil
- *
- * if tmp = Array.try_convert(arg)
- * # the argument is an array
- * elsif tmp = String.try_convert(arg)
- * # the argument is a string
- * end
- *
- */
+ VALUE ary = rb_ary_new();
+ OBJSETUP(ary, klass, T_ARRAY);
+ rb_obj_call_init(ary, argc, argv);
-static VALUE
-rb_ary_s_try_convert(VALUE dummy, VALUE ary)
-{
- return rb_check_array_type(ary);
+ return ary;
}
-/*
- * call-seq:
- * Array.new(size=0, default=nil)
- * Array.new(array)
- * Array.new(size) {|index| block }
- *
- * Returns a new array.
- *
- * In the first form, if no arguments are sent, the new array will be empty.
- * When a +size+ and an optional +default+ are sent, an array is created with
- * +size+ copies of +default+. Take notice that all elements will reference the
- * same object +default+.
- *
- * The second form creates a copy of the array passed as a parameter (the
- * array is generated by calling to_ary on the parameter).
- *
- * first_array = ["Matz", "Guido"]
- *
- * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
- *
- * first_array.equal? second_array #=> false
- *
- * In the last form, an array of the given size is created. Each element in
- * this array is created by passing the element's index to the given block
- * and storing the return value.
- *
- * Array.new(3){ |index| index ** 2 }
- * # => [0, 1, 4]
- *
- * == Common gotchas
- *
- * When sending the second parameter, the same object will be used as the
- * value for all the array elements:
- *
- * a = Array.new(2, Hash.new)
- * # => [{}, {}]
- *
- * a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
- * a[1]['cat'] = 'Felix'
- * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- * Since all the Array elements store the same hash, changes to one of them
- * will affect them all.
- *
- * If multiple copies are what you want, you should use the block
- * version which uses the result of that block each time an element
- * of the array needs to be initialized:
- *
- * a = Array.new(2) { Hash.new }
- * a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {}]
- *
- */
-
static VALUE
-rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+rb_ary_initialize(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long len;
VALUE size, val;
- rb_ary_modify(ary);
- if (argc == 0) {
- if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
- ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
- }
- rb_ary_unshare_safe(ary);
- FL_SET_EMBED(ary);
- ARY_SET_EMBED_LEN(ary, 0);
- if (rb_block_given_p()) {
- rb_warning("given block not used");
- }
+ if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
return ary;
}
- rb_scan_args(argc, argv, "02", &size, &val);
- if (argc == 1 && !FIXNUM_P(size)) {
- val = rb_check_array_type(size);
- if (!NIL_P(val)) {
- rb_ary_replace(ary, val);
- return ary;
- }
- }
+ rb_ary_modify(ary);
len = NUM2LONG(size);
- /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
if (len < 0) {
rb_raise(rb_eArgError, "negative array size");
}
- if (len > ARY_MAX_SIZE) {
+ if (len > 0 && len*sizeof(VALUE) <= 0) {
rb_raise(rb_eArgError, "array size too big");
}
- /* recheck after argument conversion */
- rb_ary_modify(ary);
- ary_resize_capa(ary, len);
- if (rb_block_given_p()) {
- long i;
-
- if (argc == 2) {
- rb_warn("block supersedes default value argument");
- }
- for (i=0; i<len; i++) {
- rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- ARY_SET_LEN(ary, i + 1);
- }
- }
- else {
- ary_memfill(ary, 0, len, val);
- ARY_SET_LEN(ary, len);
+ if (len > RARRAY(ary)->capa) {
+ RARRAY(ary)->capa = len;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
+ memfill(RARRAY(ary)->ptr, len, val);
+ RARRAY(ary)->len = len;
+
return ary;
}
-/*
- * Returns a new array populated with the given objects.
- *
- * Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
- * Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
- * [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
- */
-
static VALUE
-rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+rb_ary_s_create(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
{
- VALUE ary = ary_new(klass, argc);
- if (argc > 0 && argv) {
- ary_memcpy(ary, 0, argc, argv);
- ARY_SET_LEN(ary, argc);
+ NEWOBJ(ary, struct RArray);
+ OBJSETUP(ary, klass, T_ARRAY);
+
+ ary->len = ary->capa = 0;
+ if (argc == 0) {
+ ary->ptr = 0;
+ }
+ else {
+ ary->ptr = ALLOC_N(VALUE, argc);
+ MEMCPY(ary->ptr, argv, VALUE, argc);
}
+ ary->len = ary->capa = argc;
- return ary;
+ return (VALUE)ary;
}
void
-rb_ary_store(VALUE ary, long idx, VALUE val)
+rb_ary_store(ary, idx, val)
+ VALUE ary;
+ long idx;
+ VALUE val;
{
- long len = RARRAY_LEN(ary);
-
+ rb_ary_modify(ary);
if (idx < 0) {
- idx += len;
+ idx += RARRAY(ary)->len;
if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- idx - len, -len);
+ rb_raise(rb_eIndexError, "index %d out of array",
+ idx - RARRAY(ary)->len);
}
}
- else if (idx >= ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", idx);
- }
-
- rb_ary_modify(ary);
- if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
- }
- if (idx > len) {
- ary_mem_clear(ary, len, idx - len + 1);
- }
- if (idx >= len) {
- ARY_SET_LEN(ary, idx + 1);
+ if (idx >= RARRAY(ary)->capa) {
+ long capa_inc = RARRAY(ary)->capa / 2;
+ if (capa_inc < ARY_DEFAULT_SIZE) {
+ capa_inc = ARY_DEFAULT_SIZE;
+ }
+ RARRAY(ary)->capa = idx + capa_inc;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
- ARY_SET(ary, idx, val);
-}
-
-static VALUE
-ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
-{
- assert(offset >= 0);
- assert(len >= 0);
- assert(offset+len <= RARRAY_LEN(ary));
-
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE result = ary_alloc(klass);
- ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
- ARY_SET_EMBED_LEN(result, len);
- return result;
+ if (idx > RARRAY(ary)->len) {
+ rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len,
+ idx-RARRAY(ary)->len+1);
}
- else {
- VALUE shared, result = ary_alloc(klass);
- FL_UNSET_EMBED(result);
- shared = ary_make_shared(ary);
- ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
- ARY_SET_LEN(result, RARRAY_LEN(ary));
- rb_ary_set_shared(result, shared);
-
- ARY_INCREASE_PTR(result, offset);
- ARY_SET_LEN(result, len);
- return result;
+ if (idx >= RARRAY(ary)->len) {
+ RARRAY(ary)->len = idx + 1;
}
+ RARRAY(ary)->ptr[idx] = val;
}
-static VALUE
-ary_make_shared_copy(VALUE ary)
+VALUE
+rb_ary_push(ary, item)
+ VALUE ary;
+ VALUE item;
{
- return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+ rb_ary_store(ary, RARRAY(ary)->len, item);
+ return ary;
}
-enum ary_take_pos_flags
-{
- ARY_TAKE_FIRST = 0,
- ARY_TAKE_LAST = 1
-};
-
static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+rb_ary_push_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE nv;
- long n;
- long len;
- long offset = 0;
-
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
- len = RARRAY_LEN(ary);
- if (n > len) {
- n = len;
- }
- else if (n < 0) {
- rb_raise(rb_eArgError, "negative array size");
- }
- if (last) {
- offset = len - n;
+ if (argc == 0) {
+ rb_raise(rb_eArgError, "wrong # of arguments(at least 1)");
}
- return ary_make_partial(ary, rb_cArray, offset, n);
-}
+ if (argc > 0) {
+ long len = RARRAY(ary)->len;
-/*
- * call-seq:
- * ary << obj -> ary
- *
- * Append---Pushes the given object on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together.
- *
- * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
- *
- */
+ --argc;
+ /* make rooms by copying the last item */
+ rb_ary_store(ary, len + argc, argv[argc]);
-VALUE
-rb_ary_push(VALUE ary, VALUE item)
-{
- long idx = RARRAY_LEN(ary);
- VALUE target_ary = ary_ensure_room_for_push(ary, 1);
- RARRAY_PTR_USE(ary, ptr, {
- RB_OBJ_WRITE(target_ary, &ptr[idx], item);
- });
- ARY_SET_LEN(ary, idx + 1);
+ if (argc) { /* if any rest */
+ MEMCPY(RARRAY(ary)->ptr + len, argv, VALUE, argc);
+ }
+ }
return ary;
}
VALUE
-rb_ary_cat(VALUE ary, const VALUE *argv, long len)
-{
- long oldlen = RARRAY_LEN(ary);
- VALUE target_ary = ary_ensure_room_for_push(ary, len);
- ary_memcpy0(ary, oldlen, len, argv, target_ary);
- ARY_SET_LEN(ary, oldlen + len);
- return ary;
-}
-
-/*
- * call-seq:
- * ary.push(obj, ... ) -> ary
- *
- * Append --- Pushes the given object(s) on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together. See also Array#pop for the opposite
- * effect.
- *
- * a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
- * #=> ["a", "b", "c", "d", "e", "f"]
- * [1, 2, 3].push(4).push(5)
- * #=> [1, 2, 3, 4, 5]
- */
-
-static VALUE
-rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_pop(ary)
+ VALUE ary;
{
- return rb_ary_cat(ary, argv, argc);
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len == 0) return Qnil;
+ if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
+ RARRAY(ary)->capa = RARRAY(ary)->len * 2;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ }
+ return RARRAY(ary)->ptr[--RARRAY(ary)->len];
}
VALUE
-rb_ary_pop(VALUE ary)
+rb_ary_shift(ary)
+ VALUE ary;
{
- long n;
- rb_ary_modify_check(ary);
- n = RARRAY_LEN(ary);
- if (n == 0) return Qnil;
- if (ARY_OWNS_HEAP_P(ary) &&
- n * 3 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
- {
- ary_resize_capa(ary, n * 2);
- }
- --n;
- ARY_SET_LEN(ary, n);
- return RARRAY_AREF(ary, n);
-}
+ VALUE top;
-/*
- * call-seq:
- * ary.pop -> obj or nil
- * ary.pop(n) -> new_ary
- *
- * Removes the last element from +self+ and returns it, or
- * +nil+ if the array is empty.
- *
- * If a number +n+ is given, returns an array of the last +n+ elements
- * (or less) just like <code>array.slice!(-n, n)</code> does. See also
- * Array#push for the opposite effect.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.pop #=> "d"
- * a.pop(2) #=> ["b", "c"]
- * a #=> ["a"]
- */
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len == 0) return Qnil;
-static VALUE
-rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
-{
- VALUE result;
+ top = RARRAY(ary)->ptr[0];
+ RARRAY(ary)->len--;
- if (argc == 0) {
- return rb_ary_pop(ary);
+ /* sliding items */
+ MEMMOVE(RARRAY(ary)->ptr, RARRAY(ary)->ptr+1, VALUE, RARRAY(ary)->len);
+ if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
+ RARRAY(ary)->capa = RARRAY(ary)->len * 2;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
- rb_ary_modify_check(ary);
- result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
- ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
- return result;
+ return top;
}
VALUE
-rb_ary_shift(VALUE ary)
+rb_ary_unshift(ary, item)
+ VALUE ary, item;
{
- VALUE top;
- long len = RARRAY_LEN(ary);
-
- rb_ary_modify_check(ary);
- if (len == 0) return Qnil;
- top = RARRAY_AREF(ary, 0);
- if (!ARY_SHARED_P(ary)) {
- if (len < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+1, VALUE, len-1);
- }); /* WB: no new reference */
- ARY_INCREASE_LEN(ary, -1);
- return top;
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len >= RARRAY(ary)->capa) {
+ long capa_inc = RARRAY(ary)->capa / 2;
+ if (capa_inc < ARY_DEFAULT_SIZE) {
+ capa_inc = ARY_DEFAULT_SIZE;
}
- assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
- ARY_SET(ary, 0, Qnil);
- ary_make_shared(ary);
- }
- else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
- RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+ RARRAY(ary)->capa+=capa_inc;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
- ARY_INCREASE_PTR(ary, 1); /* shift ptr */
- ARY_INCREASE_LEN(ary, -1);
- return top;
-}
-
-/*
- * call-seq:
- * ary.shift -> obj or nil
- * ary.shift(n) -> new_ary
- *
- * Removes the first element of +self+ and returns it (shifting all
- * other elements down by one). Returns +nil+ if the array
- * is empty.
- *
- * If a number +n+ is given, returns an array of the first +n+ elements
- * (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- * containing only the remainder elements, not including what was shifted to
- * +new_ary+. See also Array#unshift for the opposite effect.
- *
- * args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
- *
- * args = [ "-m", "-q", "filename" ]
- * args.shift(2) #=> ["-m", "-q"]
- * args #=> ["filename"]
- */
-
-static VALUE
-rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
-{
- VALUE result;
- long n;
+ /* sliding items */
+ MEMMOVE(RARRAY(ary)->ptr+1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- if (argc == 0) {
- return rb_ary_shift(ary);
- }
+ RARRAY(ary)->len++;
+ RARRAY(ary)->ptr[0] = item;
- rb_ary_modify_check(ary);
- result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
- n = RARRAY_LEN(result);
- if (ARY_SHARED_P(ary)) {
- if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
- setup_occupied_shared:
- ary_mem_clear(ary, 0, n);
- }
- ARY_INCREASE_PTR(ary, n);
- }
- else {
- if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
- }); /* WB: no new reference */
- }
- else {
- ary_make_shared(ary);
- goto setup_occupied_shared;
- }
- }
- ARY_INCREASE_LEN(ary, -n);
-
- return result;
+ return ary;
}
static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+rb_ary_unshift_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- long new_len = len + argc;
- long capa;
- const VALUE *head, *sharedp;
-
- if (len > ARY_MAX_SIZE - argc) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ if (argc == 0) {
+ rb_raise(rb_eArgError, "wrong # of arguments(at least 1)");
}
+ if (argc > 0) {
+ long len = RARRAY(ary)->len;
- if (ARY_SHARED_P(ary)) {
- VALUE shared = ARY_SHARED(ary);
- capa = RARRAY_LEN(shared);
- if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
- head = RARRAY_CONST_PTR(ary);
- sharedp = RARRAY_CONST_PTR(shared);
- goto makeroom_if_need;
- }
- }
+ /* make rooms by setting the last item */
+ rb_ary_store(ary, len + argc - 1, Qnil);
- rb_ary_modify(ary);
- capa = ARY_CAPA(ary);
- if (capa - (capa >> 6) <= new_len) {
- ary_double_capa(ary, new_len);
- }
-
- /* use shared array for big "queues" */
- if (new_len > ARY_DEFAULT_SIZE * 4) {
- /* make a room for unshifted items */
- capa = ARY_CAPA(ary);
- ary_make_shared(ary);
-
- head = sharedp = RARRAY_CONST_PTR(ary);
- goto makeroom;
- makeroom_if_need:
- if (head - sharedp < argc) {
- long room;
- makeroom:
- room = capa - new_len;
- room -= room >> 4;
- MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
- head = sharedp + argc + room;
- }
- ARY_SET_PTR(ary, head - argc);
- assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
- return ARY_SHARED(ary);
- }
- else {
/* sliding items */
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr + argc, ptr, VALUE, len);
- });
-
- return ary;
+ MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
+ MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
}
-}
-
-/*
- * call-seq:
- * ary.unshift(obj, ...) -> ary
- *
- * Prepends objects to the front of +self+, moving other elements upwards.
- * See also Array#shift for the opposite effect.
- *
- * a = [ "b", "c", "d" ]
- * a.unshift("a") #=> ["a", "b", "c", "d"]
- * a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
- */
-
-static VALUE
-rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
-{
- long len = RARRAY_LEN(ary);
- VALUE target_ary;
-
- if (argc == 0) {
- rb_ary_modify_check(ary);
- return ary;
- }
-
- target_ary = ary_ensure_room_for_unshift(ary, argc);
- ary_memcpy0(ary, 0, argc, argv, target_ary);
- ARY_SET_LEN(ary, len + argc);
return ary;
}
VALUE
-rb_ary_unshift(VALUE ary, VALUE item)
+rb_ary_entry(ary, offset)
+ VALUE ary;
+ long offset;
{
- return rb_ary_unshift_m(1,&item,ary);
-}
+ if (RARRAY(ary)->len == 0) return Qnil;
-/* faster version - use this if you don't need to treat negative offset */
-static inline VALUE
-rb_ary_elt(VALUE ary, long offset)
-{
- long len = RARRAY_LEN(ary);
- if (len == 0) return Qnil;
- if (offset < 0 || len <= offset) {
- return Qnil;
- }
- return RARRAY_AREF(ary, offset);
-}
-
-VALUE
-rb_ary_entry(VALUE ary, long offset)
-{
- long len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
- if (len == 0) return Qnil;
if (offset < 0) {
- offset += len;
- if (offset < 0) return Qnil;
+ offset = RARRAY(ary)->len + offset;
}
- else if (len <= offset) {
- return Qnil;
+ if (offset < 0 || RARRAY(ary)->len <= offset) {
+ return Qnil;
}
- return ptr[offset];
+
+ return RARRAY(ary)->ptr[offset];
}
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+static VALUE
+rb_ary_subseq(ary, beg, len)
+ VALUE ary;
+ long beg, len;
{
- VALUE klass;
- long alen = RARRAY_LEN(ary);
+ VALUE ary2;
- if (beg > alen) return Qnil;
+ if (beg > RARRAY(ary)->len) return Qnil;
if (beg < 0 || len < 0) return Qnil;
- if (alen < len || alen < beg + len) {
- len = alen - beg;
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
+ }
+ if (len < 0) {
+ len = 0;
}
- klass = rb_obj_class(ary);
- if (len == 0) return ary_new(klass, 0);
+ if (len == 0) return rb_ary_new2(0);
- return ary_make_partial(ary, klass, beg, len);
-}
+ ary2 = rb_ary_new2(len);
+ MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr+beg, VALUE, len);
+ RARRAY(ary2)->len = len;
-/*
- * call-seq:
- * ary[index] -> obj or nil
- * ary[start, length] -> new_ary or nil
- * ary[range] -> new_ary or nil
- * ary.slice(index) -> obj or nil
- * ary.slice(start, length) -> new_ary or nil
- * ary.slice(range) -> new_ary or nil
- *
- * Element Reference --- Returns the element at +index+, or returns a
- * subarray starting at the +start+ index and continuing for +length+
- * elements, or returns a subarray specified by +range+ of indices.
- *
- * Negative indices count backward from the end of the array (-1 is the last
- * element). For +start+ and +range+ cases the starting index is just before
- * an element. Additionally, an empty array is returned when the starting
- * index for an element range is at the end of the array.
- *
- * Returns +nil+ if the index (or starting index) are out of range.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a[2] + a[0] + a[1] #=> "cab"
- * a[6] #=> nil
- * a[1, 2] #=> [ "b", "c" ]
- * a[1..3] #=> [ "b", "c", "d" ]
- * a[4..7] #=> [ "e" ]
- * a[6..10] #=> nil
- * a[-3, 3] #=> [ "c", "d", "e" ]
- * # special cases
- * a[5] #=> nil
- * a[6, 1] #=> nil
- * a[5, 1] #=> []
- * a[5..10] #=> []
- *
- */
+ return ary2;
+}
VALUE
-rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
+rb_ary_aref(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE arg;
+ VALUE arg1, arg2;
long beg, len;
- if (argc == 2) {
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
+ if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
+ beg = NUM2LONG(arg1);
+ len = NUM2LONG(arg2);
if (beg < 0) {
- beg += RARRAY_LEN(ary);
+ beg = RARRAY(ary)->len + beg;
}
return rb_ary_subseq(ary, beg, len);
}
- if (argc != 1) {
- rb_scan_args(argc, argv, "11", NULL, NULL);
- }
- arg = argv[0];
+
/* special case - speeding up */
- if (FIXNUM_P(arg)) {
- return rb_ary_entry(ary, FIX2LONG(arg));
+ if (FIXNUM_P(arg1)) {
+ return rb_ary_entry(ary, FIX2LONG(arg1));
}
- /* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
- case Qfalse:
- break;
- case Qnil:
- return Qnil;
- default:
- return rb_ary_subseq(ary, beg, len);
+ else if (TYPE(arg1) == T_BIGNUM) {
+ rb_raise(rb_eIndexError, "index too big");
+ }
+ else {
+ /* check if idx is Range */
+ switch (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 0)) {
+ case Qfalse:
+ break;
+ case Qnil:
+ return Qnil;
+ default:
+ return rb_ary_subseq(ary, beg, len);
+ }
}
- return rb_ary_entry(ary, NUM2LONG(arg));
+ return rb_ary_entry(ary, NUM2LONG(arg1));
}
-/*
- * call-seq:
- * ary.at(index) -> obj or nil
- *
- * Returns the element at +index+. A negative index counts from the end of
- * +self+. Returns +nil+ if the index is out of range. See also
- * Array#[].
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a.at(0) #=> "a"
- * a.at(-1) #=> "e"
- */
-
-VALUE
-rb_ary_at(VALUE ary, VALUE pos)
+static VALUE
+rb_ary_at(ary, pos)
+ VALUE ary, pos;
{
return rb_ary_entry(ary, NUM2LONG(pos));
}
-/*
- * call-seq:
- * ary.first -> obj or nil
- * ary.first(n) -> new_ary
- *
- * Returns the first element, or the first +n+ elements, of the array.
- * If the array is empty, the first form returns +nil+, and the
- * second form returns an empty array. See also Array#last for
- * the opposite effect.
- *
- * a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(2) #=> ["q", "r"]
- */
-
static VALUE
-rb_ary_first(int argc, VALUE *argv, VALUE ary)
-{
- if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_AREF(ary, 0);
- }
- else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
- }
-}
-
-/*
- * call-seq:
- * ary.last -> obj or nil
- * ary.last(n) -> new_ary
- *
- * Returns the last element(s) of +self+. If the array is empty,
- * the first form returns +nil+.
- *
- * See also Array#first for the opposite effect.
- *
- * a = [ "w", "x", "y", "z" ]
- * a.last #=> "z"
- * a.last(2) #=> ["y", "z"]
- */
-
-VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+rb_ary_first(ary)
+ VALUE ary;
{
- if (argc == 0) {
- long len = RARRAY_LEN(ary);
- if (len == 0) return Qnil;
- return RARRAY_AREF(ary, len-1);
- }
- else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
- }
+ if (RARRAY(ary)->len == 0) return Qnil;
+ return RARRAY(ary)->ptr[0];
}
-/*
- * call-seq:
- * ary.fetch(index) -> obj
- * ary.fetch(index, default) -> obj
- * ary.fetch(index) { |index| block } -> obj
- *
- * Tries to return the element at position +index+, but throws an IndexError
- * exception if the referenced +index+ lies outside of the array bounds. This
- * error can be prevented by supplying a second argument, which will act as a
- * +default+ value.
- *
- * Alternatively, if a block is given it will only be executed when an
- * invalid +index+ is referenced. Negative values of +index+ count from the
- * end of the array.
- *
- * a = [ 11, 22, 33, 44 ]
- * a.fetch(1) #=> 22
- * a.fetch(-1) #=> 44
- * a.fetch(4, 'cat') #=> "cat"
- * a.fetch(100) { |i| puts "#{i} is out of bounds" }
- * #=> "100 is out of bounds"
- */
-
static VALUE
-rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+rb_ary_last(ary)
+ VALUE ary;
{
- VALUE pos, ifnone;
- long block_given;
- long idx;
-
- rb_scan_args(argc, argv, "11", &pos, &ifnone);
- block_given = rb_block_given_p();
- if (block_given && argc == 2) {
- rb_warn("block supersedes default value argument");
- }
- idx = NUM2LONG(pos);
-
- if (idx < 0) {
- idx += RARRAY_LEN(ary);
- }
- if (idx < 0 || RARRAY_LEN(ary) <= idx) {
- if (block_given) return rb_yield(pos);
- if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
- idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
- }
- return ifnone;
- }
- return RARRAY_AREF(ary, idx);
+ if (RARRAY(ary)->len == 0) return Qnil;
+ return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
}
-/*
- * call-seq:
- * ary.find_index(obj) -> int or nil
- * ary.find_index { |item| block } -> int or nil
- * ary.find_index -> Enumerator
- * ary.index(obj) -> int or nil
- * ary.index { |item| block } -> int or nil
- * ary.index -> Enumerator
- *
- * Returns the _index_ of the first object in +ary+ such that the object is
- * <code>==</code> to +obj+.
- *
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+. Returns +nil+ if no
- * match is found.
- *
- * See also Array#rindex.
- *
- * An Enumerator is returned if neither a block nor argument is given.
- *
- * a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
- * a.index { |x| x == "b" } #=> 1
- */
-
static VALUE
-rb_ary_index(int argc, VALUE *argv, VALUE ary)
-{
- const VALUE *ptr;
+rb_ary_index(ary, val)
+ VALUE ary;
VALUE val;
- long i, len;
+{
+ long i;
- if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- return LONG2NUM(i);
- }
- }
- return Qnil;
- }
- rb_check_arity(argc, 0, 1);
- val = argv[0];
- if (rb_block_given_p())
- rb_warn("given block not used");
- len = RARRAY_LEN(ary);
- ptr = RARRAY_CONST_PTR(ary);
- for (i=0; i<len; i++) {
- VALUE e = ptr[i];
- switch (rb_equal_opt(e, val)) {
- case Qundef:
- if (!rb_equal(e, val)) break;
- case Qtrue:
- return LONG2NUM(i);
- case Qfalse:
- continue;
- }
- len = RARRAY_LEN(ary);
- ptr = RARRAY_CONST_PTR(ary);
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ if (rb_equal(RARRAY(ary)->ptr[i], val))
+ return INT2NUM(i);
}
return Qnil;
}
-/*
- * call-seq:
- * ary.rindex(obj) -> int or nil
- * ary.rindex { |item| block } -> int or nil
- * ary.rindex -> Enumerator
- *
- * Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
- *
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+, starting from the last
- * object.
- *
- * Returns +nil+ if no match is found.
- *
- * See also Array#index.
- *
- * If neither block nor argument is given, an Enumerator is returned instead.
- *
- * a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
- * a.rindex { |x| x == "b" } #=> 3
- */
-
static VALUE
-rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
-{
- const VALUE *ptr;
+rb_ary_rindex(ary, val)
+ VALUE ary;
VALUE val;
- long i = RARRAY_LEN(ary), len;
+{
+ long i = RARRAY(ary)->len;
- if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- while (i--) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
- return LONG2NUM(i);
- if (i > (len = RARRAY_LEN(ary))) {
- i = len;
- }
- }
- return Qnil;
- }
- rb_check_arity(argc, 0, 1);
- val = argv[0];
- if (rb_block_given_p())
- rb_warn("given block not used");
- ptr = RARRAY_CONST_PTR(ary);
while (i--) {
- VALUE e = ptr[i];
- switch (rb_equal_opt(e, val)) {
- case Qundef:
- if (!rb_equal(e, val)) break;
- case Qtrue:
- return LONG2NUM(i);
- case Qfalse:
- continue;
- }
- if (i > (len = RARRAY_LEN(ary))) {
- i = len;
- }
- ptr = RARRAY_CONST_PTR(ary);
+ if (rb_equal(RARRAY(ary)->ptr[i], val))
+ return INT2NUM(i);
}
return Qnil;
}
-VALUE
-rb_ary_to_ary(VALUE obj)
+static VALUE
+rb_ary_indexes(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE tmp = rb_check_array_type(obj);
+ VALUE new_ary;
+ long i;
- if (!NIL_P(tmp)) return tmp;
- return rb_ary_new3(1, obj);
+ new_ary = rb_ary_new2(argc);
+ for (i=0; i<argc; i++) {
+ rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
+ }
+
+ return new_ary;
}
static void
-rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
+rb_ary_replace(ary, beg, len, rpl)
+ VALUE ary, rpl;
+ long beg, len;
{
- long olen;
- long rofs;
+ long rlen;
- if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
- olen = RARRAY_LEN(ary);
+ if (len < 0) rb_raise(rb_eIndexError, "negative length %d", len);
if (beg < 0) {
- beg += olen;
- if (beg < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- beg - olen, -olen);
- }
+ beg += RARRAY(ary)->len;
+ }
+ if (beg < 0) {
+ beg -= RARRAY(ary)->len;
+ rb_raise(rb_eIndexError, "index %d out of array", beg);
}
- if (olen < len || olen < beg + len) {
- len = olen - beg;
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
}
- {
- const VALUE *optr = RARRAY_CONST_PTR(ary);
- rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+ if (NIL_P(rpl)) {
+ rpl = rb_ary_new2(0);
}
+ else if (TYPE(rpl) != T_ARRAY) {
+ rpl = rb_ary_new3(1, rpl);
+ }
+ rlen = RARRAY(rpl)->len;
- if (beg >= olen) {
- VALUE target_ary;
- if (beg > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", beg);
- }
- target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+ rb_ary_modify(ary);
+ if (beg >= RARRAY(ary)->len) {
len = beg + rlen;
- ary_mem_clear(ary, olen, beg - olen);
- if (rlen > 0) {
- if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
- ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+ if (len >= RARRAY(ary)->capa) {
+ RARRAY(ary)->capa=len;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
- ARY_SET_LEN(ary, len);
+ rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len, beg-RARRAY(ary)->len);
+ MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, rlen);
+ RARRAY(ary)->len = len;
}
else {
long alen;
- if (olen - len > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
- }
- rb_ary_modify(ary);
- alen = olen + rlen - len;
- if (alen >= ARY_CAPA(ary)) {
- ary_double_capa(ary, alen);
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
}
- if (len != rlen) {
- RARRAY_PTR_USE(ary, ptr,
- MEMMOVE(ptr + beg + rlen, ptr + beg + len,
- VALUE, olen - (beg + len)));
- ARY_SET_LEN(ary, alen);
- }
- if (rlen > 0) {
- if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
- MEMMOVE(RARRAY_PTR(ary) + beg, rptr, VALUE, rlen);
+ alen = RARRAY(ary)->len + rlen - len;
+ if (alen >= RARRAY(ary)->capa) {
+ RARRAY(ary)->capa=alen;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
- }
-}
-void
-rb_ary_set_len(VALUE ary, long len)
-{
- long capa;
-
- rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- rb_raise(rb_eRuntimeError, "can't set length of shared ");
- }
- if (len > (capa = (long)ARY_CAPA(ary))) {
- rb_bug("probable buffer overflow: %ld for %ld", len, capa);
- }
- ARY_SET_LEN(ary, len);
-}
-
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary an array
- * \param len new size
- * \return \a ary
- * \post the size of \a ary is \a len.
- */
-VALUE
-rb_ary_resize(VALUE ary, long len)
-{
- long olen;
-
- rb_ary_modify(ary);
- olen = RARRAY_LEN(ary);
- if (len == olen) return ary;
- if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", len);
- }
- if (len > olen) {
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
- }
- ary_mem_clear(ary, olen, len - olen);
- ARY_SET_LEN(ary, len);
- }
- else if (ARY_EMBED_P(ary)) {
- ARY_SET_EMBED_LEN(ary, len);
- }
- else if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE tmp[RARRAY_EMBED_LEN_MAX];
- MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
- ary_discard(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
- ARY_SET_EMBED_LEN(ary, len);
- }
- else {
- if (olen > len + ARY_DEFAULT_SIZE) {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
- ARY_SET_CAPA(ary, len);
+ if (len != RARRAY(rpl)->len) {
+ MEMMOVE(RARRAY(ary)->ptr+beg+rlen, RARRAY(ary)->ptr+beg+len,
+ VALUE, RARRAY(ary)->len-(beg+len));
+ RARRAY(ary)->len = alen;
}
- ARY_SET_HEAP_LEN(ary, len);
+ MEMMOVE(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, rlen);
}
- return ary;
}
-/*
- * call-seq:
- * ary[index] = obj -> obj
- * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
- * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
- *
- * Element Assignment --- Sets the element at +index+, or replaces a subarray
- * from the +start+ index for +length+ elements, or replaces a subarray
- * specified by the +range+ of indices.
- *
- * If indices are greater than the current capacity of the array, the array
- * grows automatically. Elements are inserted into the array at +start+ if
- * +length+ is zero.
- *
- * Negative indices will count backward from the end of the array. For
- * +start+ and +range+ cases the starting index is just before an element.
- *
- * An IndexError is raised if a negative index points past the beginning of
- * the array.
- *
- * See also Array#push, and Array#unshift.
- *
- * a = Array.new
- * a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
- * a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- * a[1..2] = [ 1, 2 ] #=> ["a", 1, 2, nil, "4"]
- * a[0, 2] = "?" #=> ["?", 2, nil, "4"]
- * a[0..2] = "A" #=> ["A", "4"]
- * a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A", nil]
- * a[1..-1] = [] #=> ["A"]
- * a[0, 0] = [ 1, 2 ] #=> [1, 2, "A"]
- * a[3, 0] = "B" #=> [1, 2, "A", "B"]
- */
-
static VALUE
-rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+rb_ary_aset(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long offset, beg, len;
- VALUE rpl;
if (argc == 3) {
- rb_ary_modify_check(ary);
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- goto range;
+ rb_ary_replace(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
+ return argv[2];
+ }
+ if (argc != 2) {
+ rb_raise(rb_eArgError, "wrong # of arguments(%d for 2)", argc);
}
- rb_check_arity(argc, 2, 2);
- rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
offset = FIX2LONG(argv[0]);
goto fixnum;
}
- if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+ else if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
/* check if idx is Range */
- range:
- rpl = rb_ary_to_ary(argv[argc-1]);
- rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
- RB_GC_GUARD(rpl);
- return argv[argc-1];
+ rb_ary_replace(ary, beg, len, argv[1]);
+ return argv[1];
+ }
+ if (TYPE(argv[0]) == T_BIGNUM) {
+ rb_raise(rb_eIndexError, "index too big");
}
offset = NUM2LONG(argv[0]);
-fixnum:
+ fixnum:
rb_ary_store(ary, offset, argv[1]);
return argv[1];
}
-/*
- * call-seq:
- * ary.insert(index, obj...) -> ary
- *
- * Inserts the given values before the element with the given +index+.
- *
- * Negative indices count backwards from the end of the array, where +-1+ is
- * the last element. If a negative index is used, the given values will be
- * inserted after that element, so using an index of +-1+ will insert the
- * values at the end of the array.
- *
- * a = %w{ a b c d }
- * a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
- * a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
- */
-
-static VALUE
-rb_ary_insert(int argc, VALUE *argv, VALUE ary)
-{
- long pos;
-
- rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
- rb_ary_modify_check(ary);
- if (argc == 1) return ary;
- pos = NUM2LONG(argv[0]);
- if (pos == -1) {
- pos = RARRAY_LEN(ary);
- }
- if (pos < 0) {
- pos++;
- }
- rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
- return ary;
-}
-
-static VALUE
-rb_ary_length(VALUE ary);
-
-static VALUE
-ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
-{
- return rb_ary_length(ary);
-}
-
-/*
- * call-seq:
- * ary.each { |item| block } -> ary
- * ary.each -> Enumerator
- *
- * Calls the given block once for each element in +self+, passing that element
- * as a parameter. Returns the array itself.
- *
- * If no block is given, an Enumerator is returned.
- *
- * a = [ "a", "b", "c" ]
- * a.each {|x| print x, " -- " }
- *
- * produces:
- *
- * a -- b -- c --
- */
-
VALUE
-rb_ary_each(VALUE ary)
+rb_ary_each(ary)
+ VALUE ary;
{
long i;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_AREF(ary, i));
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ rb_yield(RARRAY(ary)->ptr[i]);
}
return ary;
}
-/*
- * call-seq:
- * ary.each_index { |index| block } -> ary
- * ary.each_index -> Enumerator
- *
- * Same as Array#each, but passes the +index+ of the element instead of the
- * element itself.
- *
- * An Enumerator is returned if no block is given.
- *
- * a = [ "a", "b", "c" ]
- * a.each_index {|x| print x, " -- " }
- *
- * produces:
- *
- * 0 -- 1 -- 2 --
- */
-
static VALUE
-rb_ary_each_index(VALUE ary)
+rb_ary_each_index(ary)
+ VALUE ary;
{
long i;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(LONG2NUM(i));
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ rb_yield(INT2NUM(i));
}
return ary;
}
-/*
- * call-seq:
- * ary.reverse_each { |item| block } -> ary
- * ary.reverse_each -> Enumerator
- *
- * Same as Array#each, but traverses +self+ in reverse order.
- *
- * a = [ "a", "b", "c" ]
- * a.reverse_each {|x| print x, " " }
- *
- * produces:
- *
- * c b a
- */
-
static VALUE
-rb_ary_reverse_each(VALUE ary)
+rb_ary_reverse_each(ary)
+ VALUE ary;
{
- long len;
+ long len = RARRAY(ary)->len;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- len = RARRAY_LEN(ary);
while (len--) {
- long nlen;
- rb_yield(RARRAY_AREF(ary, len));
- nlen = RARRAY_LEN(ary);
- if (nlen < len) {
- len = nlen;
- }
+ rb_yield(RARRAY(ary)->ptr[len]);
}
return ary;
}
-/*
- * call-seq:
- * ary.length -> int
- *
- * Returns the number of elements in +self+. May be zero.
- *
- * [ 1, 2, 3, 4, 5 ].length #=> 5
- * [].length #=> 0
- */
-
static VALUE
-rb_ary_length(VALUE ary)
+rb_ary_length(ary)
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- return LONG2NUM(len);
+ return INT2NUM(RARRAY(ary)->len);
}
-/*
- * call-seq:
- * ary.empty? -> true or false
- *
- * Returns +true+ if +self+ contains no elements.
- *
- * [].empty? #=> true
- */
-
static VALUE
-rb_ary_empty_p(VALUE ary)
+rb_ary_empty_p(ary)
+ VALUE ary;
{
- if (RARRAY_LEN(ary) == 0)
+ if (RARRAY(ary)->len == 0)
return Qtrue;
return Qfalse;
}
-VALUE
-rb_ary_dup(VALUE ary)
+static VALUE
+rb_ary_clone(ary)
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- VALUE dup = rb_ary_new2(len);
- ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
- ARY_SET_LEN(dup, len);
- return dup;
+ VALUE clone = rb_ary_new2(RARRAY(ary)->len);
+
+ CLONESETUP(clone, ary);
+ MEMCPY(RARRAY(clone)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ RARRAY(clone)->len = RARRAY(ary)->len;
+ return clone;
}
-VALUE
-rb_ary_resurrect(VALUE ary)
+static VALUE
+to_ary(ary)
+ VALUE ary;
{
- return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+ return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
extern VALUE rb_output_fs;
-static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
-
static VALUE
-recursive_join(VALUE obj, VALUE argp, int recur)
+inspect_join(ary, arg)
+ VALUE ary;
+ VALUE *arg;
{
- VALUE *arg = (VALUE *)argp;
- VALUE ary = arg[0];
- VALUE sep = arg[1];
- VALUE result = arg[2];
- int *first = (int *)arg[3];
-
- if (recur) {
- rb_raise(rb_eArgError, "recursive array join");
- }
- else {
- ary_join_1(obj, ary, sep, 0, result, first);
- }
- return Qnil;
+ return rb_ary_join(arg[0], arg[1]);
}
-static void
-ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+VALUE
+rb_ary_join(ary, sep)
+ VALUE ary, sep;
{
long i;
- VALUE val;
+ int taint = 0;
+ VALUE result, tmp;
+
+ if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+ if (OBJ_TAINTED(ary)) taint = 1;
+ if (OBJ_TAINTED(sep)) taint = 1;
+
+ tmp = RARRAY(ary)->ptr[0];
+ if (OBJ_TAINTED(tmp)) taint = 1;
+ switch (TYPE(tmp)) {
+ case T_STRING:
+ result = rb_str_dup(tmp);
+ break;
+ case T_ARRAY:
+ if (rb_inspecting_p(tmp)) {
+ result = rb_str_new2("[...]");
+ }
+ else {
+ VALUE args[2];
- if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
- for (i=0; i<max; i++) {
- val = RARRAY_AREF(ary, i);
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, val);
- if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+ args[0] = tmp;
+ args[1] = sep;
+ result = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+ }
+ break;
+ default:
+ result = rb_str_dup(rb_obj_as_string(tmp));
+ break;
}
-}
-static void
-ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
-{
- VALUE val, tmp;
-
- for (; i<RARRAY_LEN(ary); i++) {
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
-
- val = RARRAY_AREF(ary, i);
- if (RB_TYPE_P(val, T_STRING)) {
- str_join:
- rb_str_buf_append(result, val);
- *first = FALSE;
- }
- else if (RB_TYPE_P(val, T_ARRAY)) {
- obj = val;
- ary_join:
- if (val == ary) {
- rb_raise(rb_eArgError, "recursive array join");
+ for (i=1; i<RARRAY(ary)->len; i++) {
+ tmp = RARRAY(ary)->ptr[i];
+ switch (TYPE(tmp)) {
+ case T_STRING:
+ break;
+ case T_ARRAY:
+ if (rb_inspecting_p(tmp)) {
+ tmp = rb_str_new2("[...]");
}
else {
- VALUE args[4];
+ VALUE args[2];
- args[0] = val;
+ args[0] = tmp;
args[1] = sep;
- args[2] = result;
- args[3] = (VALUE)first;
- rb_exec_recursive(recursive_join, obj, (VALUE)args);
- }
- }
- else {
- tmp = rb_check_string_type(val);
- if (!NIL_P(tmp)) {
- val = tmp;
- goto str_join;
- }
- tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
- if (!NIL_P(tmp)) {
- obj = val;
- val = tmp;
- goto ary_join;
- }
- val = rb_obj_as_string(val);
- if (*first) {
- rb_enc_copy(result, val);
- *first = FALSE;
+ tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
}
- goto str_join;
- }
- }
-}
-
-VALUE
-rb_ary_join(VALUE ary, VALUE sep)
-{
- long len = 1, i;
- int taint = FALSE;
- VALUE val, tmp, result;
-
- if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
- if (OBJ_TAINTED(ary)) taint = TRUE;
-
- if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
- }
- for (i=0; i<RARRAY_LEN(ary); i++) {
- val = RARRAY_AREF(ary, i);
- tmp = rb_check_string_type(val);
-
- if (NIL_P(tmp) || tmp != val) {
- int first;
- result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
- rb_enc_associate(result, rb_usascii_encoding());
- if (taint) OBJ_TAINT(result);
- ary_join_0(ary, sep, i, result);
- first = i == 0;
- ary_join_1(ary, ary, sep, i, result, &first);
- return result;
+ break;
+ default:
+ tmp = rb_obj_as_string(tmp);
}
-
- len += RSTRING_LEN(tmp);
+ if (!NIL_P(sep)) rb_str_append(result, sep);
+ rb_str_append(result, tmp);
+ if (OBJ_TAINTED(tmp)) taint = 1;
}
- result = rb_str_buf_new(len);
if (taint) OBJ_TAINT(result);
- ary_join_0(ary, sep, RARRAY_LEN(ary), result);
-
return result;
}
-/*
- * call-seq:
- * ary.join(separator=$,) -> str
- *
- * Returns a string created by converting each element of the array to
- * a string, separated by the given +separator+.
- * If the +separator+ is +nil+, it uses current $,.
- * If both the +separator+ and $, are nil, it uses empty string.
- *
- * [ "a", "b", "c" ].join #=> "abc"
- * [ "a", "b", "c" ].join("-") #=> "a-b-c"
- */
-
static VALUE
-rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_join_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE sep;
rb_scan_args(argc, argv, "01", &sep);
if (NIL_P(sep)) sep = rb_output_fs;
-
return rb_ary_join(ary, sep);
}
-static VALUE
-inspect_ary(VALUE ary, VALUE dummy, int recur)
+VALUE
+rb_ary_to_s(ary)
+ VALUE ary;
{
- int tainted = OBJ_TAINTED(ary);
- long i;
- VALUE s, str;
+ VALUE str;
- if (recur) return rb_usascii_str_new_cstr("[...]");
- str = rb_str_buf_new2("[");
- for (i=0; i<RARRAY_LEN(ary); i++) {
- s = rb_inspect(RARRAY_AREF(ary, i));
- if (OBJ_TAINTED(s)) tainted = TRUE;
- if (i > 0) rb_str_buf_cat2(str, ", ");
- else rb_enc_copy(str, s);
- rb_str_buf_append(str, s);
- }
- rb_str_buf_cat2(str, "]");
- if (tainted) OBJ_TAINT(str);
+ if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+ str = rb_ary_join(ary, rb_output_fs);
+ if (NIL_P(str)) return rb_str_new(0, 0);
return str;
}
-/*
- * call-seq:
- * ary.inspect -> string
- * ary.to_s -> string
- *
- * Creates a string representation of +self+.
- *
- * [ "a", "b", "c" ].to_s #=> "[\"a\", \"b\", \"c\"]"
- */
+static ID inspect_key;
-static VALUE
-rb_ary_inspect(VALUE ary)
-{
- if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
- return rb_exec_recursive(inspect_ary, ary, 0);
-}
+struct inspect_arg {
+ VALUE (*func)();
+ VALUE arg1, arg2;
+};
VALUE
-rb_ary_to_s(VALUE ary)
+inspect_call(arg)
+ struct inspect_arg *arg;
{
- return rb_ary_inspect(ary);
+ return (*arg->func)(arg->arg1, arg->arg2);
}
-/*
- * call-seq:
- * ary.to_a -> ary
- *
- * Returns +self+.
- *
- * If called on a subclass of Array, converts the receiver to an Array object.
- */
-
static VALUE
-rb_ary_to_a(VALUE ary)
+inspect_ensure(obj)
+ VALUE obj;
{
- if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
- rb_ary_replace(dup, ary);
- return dup;
- }
- return ary;
-}
-
-/*
- * call-seq:
- * ary.to_h -> hash
- *
- * Returns the result of interpreting <i>ary</i> as an array of
- * <tt>[key, value]</tt> pairs.
- *
- * [[:foo, :bar], [1, 2]].to_h
- * # => {:foo => :bar, 1 => 2}
- */
+ VALUE inspect_tbl;
-static VALUE
-rb_ary_to_h(VALUE ary)
-{
- long i;
- VALUE hash = rb_hash_new();
- for (i=0; i<RARRAY_LEN(ary); i++) {
- const VALUE elt = rb_ary_elt(ary, i);
- const VALUE key_value_pair = rb_check_array_type(elt);
- if (NIL_P(key_value_pair)) {
- rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
- rb_obj_class(elt), i);
- }
- if (RARRAY_LEN(key_value_pair) != 2) {
- rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
- i, RARRAY_LEN(key_value_pair));
- }
- rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
- }
- return hash;
-}
-
-/*
- * call-seq:
- * ary.to_ary -> ary
- *
- * Returns +self+.
- */
-
-static VALUE
-rb_ary_to_ary_m(VALUE ary)
-{
- return ary;
-}
-
-static void
-ary_reverse(VALUE *p1, VALUE *p2)
-{
- while (p1 < p2) {
- VALUE tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
- }
+ inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
+ rb_ary_pop(inspect_tbl);
+ return 0;
}
VALUE
-rb_ary_reverse(VALUE ary)
+rb_protect_inspect(func, obj, arg)
+ VALUE (*func)();
+ VALUE obj, arg;
{
- VALUE *p2;
- long len = RARRAY_LEN(ary);
+ struct inspect_arg iarg;
+ VALUE inspect_tbl;
+ VALUE id;
- rb_ary_modify(ary);
- if (len > 1) {
- RARRAY_PTR_USE(ary, p1, {
- p2 = p1 + len - 1; /* points last item */
- ary_reverse(p1, p2);
- }); /* WB: no new reference */
+ if (!inspect_key) {
+ inspect_key = rb_intern("__inspect_key__");
}
- return ary;
-}
-
-/*
- * call-seq:
- * ary.reverse! -> ary
- *
- * Reverses +self+ in place.
- *
- * a = [ "a", "b", "c" ]
- * a.reverse! #=> ["c", "b", "a"]
- * a #=> ["c", "b", "a"]
- */
-
-static VALUE
-rb_ary_reverse_bang(VALUE ary)
-{
- return rb_ary_reverse(ary);
-}
-
-/*
- * call-seq:
- * ary.reverse -> new_ary
- *
- * Returns a new array containing +self+'s elements in reverse order.
- *
- * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
- * [ 1 ].reverse #=> [1]
- */
-
-static VALUE
-rb_ary_reverse_m(VALUE ary)
-{
- long len = RARRAY_LEN(ary);
- VALUE dup = rb_ary_new2(len);
-
- if (len > 0) {
- const VALUE *p1 = RARRAY_CONST_PTR(ary);
- VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
- do *p2-- = *p1++; while (--len > 0);
+ inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
+ if (NIL_P(inspect_tbl)) {
+ inspect_tbl = rb_ary_new();
+ rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
}
- ARY_SET_LEN(dup, RARRAY_LEN(ary));
- return dup;
-}
+ id = rb_obj_id(obj);
+ if (rb_ary_includes(inspect_tbl, id)) {
+ return (*func)(obj, arg);
+ }
+ rb_ary_push(inspect_tbl, id);
+ iarg.func = func;
+ iarg.arg1 = obj;
+ iarg.arg2 = arg;
-static inline long
-rotate_count(long cnt, long len)
-{
- return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+ return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
}
VALUE
-rb_ary_rotate(VALUE ary, long cnt)
+rb_inspecting_p(obj)
+ VALUE obj;
{
- rb_ary_modify(ary);
-
- if (cnt != 0) {
- VALUE *ptr = RARRAY_PTR(ary);
- long len = RARRAY_LEN(ary);
+ VALUE inspect_tbl;
- if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
- --len;
- if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
- if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
- if (len > 0) ary_reverse(ptr, ptr + len);
- return ary;
- }
- }
-
- return Qnil;
+ if (!inspect_key) return Qfalse;
+ inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
+ if (NIL_P(inspect_tbl)) return Qfalse;
+ return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
}
-/*
- * call-seq:
- * ary.rotate!(count=1) -> ary
- *
- * Rotates +self+ in place so that the element at +count+ comes first, and
- * returns +self+.
- *
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of the array where +-1+ is the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate! #=> ["b", "c", "d", "a"]
- * a #=> ["b", "c", "d", "a"]
- * a.rotate!(2) #=> ["d", "a", "b", "c"]
- * a.rotate!(-3) #=> ["a", "b", "c", "d"]
- */
-
static VALUE
-rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
+inspect_ary(ary)
+ VALUE ary;
{
- long n = 1;
-
- switch (argc) {
- case 1: n = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
- rb_ary_rotate(ary, n);
- return ary;
-}
-
-/*
- * call-seq:
- * ary.rotate(count=1) -> new_ary
- *
- * Returns a new array by rotating +self+ so that the element at +count+ is
- * the first element of the new array.
- *
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of +self+ where +-1+ is the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate #=> ["b", "c", "d", "a"]
- * a #=> ["a", "b", "c", "d"]
- * a.rotate(2) #=> ["c", "d", "a", "b"]
- * a.rotate(-3) #=> ["b", "c", "d", "a"]
- */
+ int tainted = OBJ_TAINTED(ary);
+ long i = 0;
+ VALUE s, str;
-static VALUE
-rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
-{
- VALUE rotated;
- const VALUE *ptr;
- long len, cnt = 1;
+ str = rb_str_new2("[");
- switch (argc) {
- case 1: cnt = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ s = rb_inspect(RARRAY(ary)->ptr[i]);
+ tainted = OBJ_TAINTED(s);
+ if (i > 0) rb_str_cat2(str, ", ");
+ rb_str_append(str, s);
}
+ rb_str_cat(str, "]", 1);
- len = RARRAY_LEN(ary);
- rotated = rb_ary_new2(len);
- if (len > 0) {
- cnt = rotate_count(cnt, len);
- ptr = RARRAY_CONST_PTR(ary);
- len -= cnt;
- ary_memcpy(rotated, 0, len, ptr + cnt);
- ary_memcpy(rotated, len, cnt, ptr);
- }
- ARY_SET_LEN(rotated, RARRAY_LEN(ary));
- return rotated;
+ if (tainted) OBJ_TAINT(str);
+ return str;
}
-struct ary_sort_data {
- VALUE ary;
- struct cmp_opt_data cmp_opt;
-};
-
static VALUE
-sort_reentered(VALUE ary)
+rb_ary_inspect(ary)
+ VALUE ary;
{
- if (RBASIC(ary)->klass) {
- rb_raise(rb_eRuntimeError, "sort reentered");
- }
- return Qnil;
+ if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
+ if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
+ return rb_protect_inspect(inspect_ary, ary, 0);
}
-static int
-sort_1(const void *ap, const void *bp, void *dummy)
+static VALUE
+rb_ary_to_a(ary)
+ VALUE ary;
{
- struct ary_sort_data *data = dummy;
- VALUE retval = sort_reentered(data->ary);
- VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
- int n;
-
- retval = rb_yield_values(2, a, b);
- n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
- return n;
+ return ary;
}
-static int
-sort_2(const void *ap, const void *bp, void *dummy)
+VALUE
+rb_ary_reverse(ary)
+ VALUE ary;
{
- struct ary_sort_data *data = dummy;
- VALUE retval = sort_reentered(data->ary);
- VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
- int n;
-
- if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
- if ((long)a > (long)b) return 1;
- if ((long)a < (long)b) return -1;
- return 0;
- }
- if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
- return rb_str_cmp(a, b);
- }
-
- retval = rb_funcallv(a, id_cmp, 1, &b);
- n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ VALUE *p1, *p2;
+ VALUE tmp;
- return n;
-}
+ if (RARRAY(ary)->len <= 1) return ary;
+ rb_ary_modify(ary);
-/*
- * call-seq:
- * ary.sort! -> ary
- * ary.sort! { |a, b| block } -> ary
- *
- * Sorts +self+ in place.
- *
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
- *
- * The block must implement a comparison between +a+ and +b+ and return
- * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- * are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- * See also Enumerable#sort_by.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort! #=> ["a", "b", "c", "d", "e"]
- * a.sort! { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
- */
+ p1 = RARRAY(ary)->ptr;
+ p2 = p1 + RARRAY(ary)->len - 1; /* points last item */
-VALUE
-rb_ary_sort_bang(VALUE ary)
-{
- rb_ary_modify(ary);
- assert(!ARY_SHARED_P(ary));
- if (RARRAY_LEN(ary) > 1) {
- VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
- struct ary_sort_data data;
- long len = RARRAY_LEN(ary);
-
- RBASIC_CLEAR_CLASS(tmp);
- data.ary = tmp;
- data.cmp_opt.opt_methods = 0;
- data.cmp_opt.opt_inited = 0;
- RARRAY_PTR_USE(tmp, ptr, {
- ruby_qsort(ptr, len, sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
- }); /* WB: no new reference */
- rb_ary_modify(ary);
- if (ARY_EMBED_P(tmp)) {
- if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
- ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
- ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
- }
- else {
- if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
- FL_UNSET_SHARED(ary);
- ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
- }
- else {
- assert(!ARY_SHARED_P(tmp));
- if (ARY_EMBED_P(ary)) {
- FL_UNSET_EMBED(ary);
- }
- else if (ARY_SHARED_P(ary)) {
- /* ary might be destructively operated in the given block */
- rb_ary_unshare(ary);
- }
- else {
- ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
- }
- ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
- ARY_SET_HEAP_LEN(ary, len);
- ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
- }
- /* tmp was lost ownership for the ptr */
- FL_UNSET(tmp, FL_FREEZE);
- FL_SET_EMBED(tmp);
- ARY_SET_EMBED_LEN(tmp, 0);
- FL_SET(tmp, FL_FREEZE);
- }
- /* tmp will be GC'ed. */
- RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
+ while (p1 < p2) {
+ tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
}
- return ary;
-}
-
-/*
- * call-seq:
- * ary.sort -> new_ary
- * ary.sort { |a, b| block } -> new_ary
- *
- * Returns a new array created by sorting +self+.
- *
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
- *
- * The block must implement a comparison between +a+ and +b+ and return
- * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- * are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- *
- * See also Enumerable#sort_by.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
- */
-VALUE
-rb_ary_sort(VALUE ary)
-{
- ary = rb_ary_dup(ary);
- rb_ary_sort_bang(ary);
return ary;
}
-static VALUE rb_ary_bsearch_index(VALUE ary);
-
-/*
- * call-seq:
- * ary.bsearch {|x| block } -> elem
- *
- * By using binary search, finds a value from this array which meets
- * the given condition in O(log n) where n is the size of the array.
- *
- * You can use this method in two use cases: a find-minimum mode and
- * a find-any mode. In either case, the elements of the array must be
- * monotone (or sorted) with respect to the block.
- *
- * In find-minimum mode (this is a good choice for typical use case),
- * the block must return true or false, and there must be an index i
- * (0 <= i <= ary.size) so that:
- *
- * - the block returns false for any element whose index is less than
- * i, and
- * - the block returns true for any element whose index is greater
- * than or equal to i.
- *
- * This method returns the i-th element. If i is equal to ary.size,
- * it returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * ary.bsearch {|x| x >= 4 } #=> 4
- * ary.bsearch {|x| x >= 6 } #=> 7
- * ary.bsearch {|x| x >= -1 } #=> 0
- * ary.bsearch {|x| x >= 100 } #=> nil
- *
- * In find-any mode (this behaves like libc's bsearch(3)), the block
- * must return a number, and there must be two indices i and j
- * (0 <= i <= j <= ary.size) so that:
- *
- * - the block returns a positive number for ary[k] if 0 <= k < i,
- * - the block returns zero for ary[k] if i <= k < j, and
- * - the block returns a negative number for ary[k] if
- * j <= k < ary.size.
- *
- * Under this condition, this method returns any element whose index
- * is within i...j. If i is equal to j (i.e., there is no element
- * that satisfies the block), this method returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * # try to find v such that 4 <= v < 8
- * ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- * # try to find v such that 8 <= v < 10
- * ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- * You must not mix the two modes at a time; the block must always
- * return either true/false, or always return a number. It is
- * undefined which value is actually picked up at each iteration.
- */
-
static VALUE
-rb_ary_bsearch(VALUE ary)
+rb_ary_reverse_bang(ary)
+ VALUE ary;
{
- VALUE index_result = rb_ary_bsearch_index(ary);
-
- if (FIXNUM_P(index_result)) {
- return rb_ary_entry(ary, FIX2LONG(index_result));
- }
- return index_result;
+ if (RARRAY(ary)->len <= 1) return Qnil;
+ return rb_ary_reverse(ary);
}
-/*
- * call-seq:
- * ary.bsearch_index {|x| block } -> int or nil
- *
- * By using binary search, finds an index of a value from this array which
- * meets the given condition in O(log n) where n is the size of the array.
- *
- * It supports two modes, depending on the nature of the block and they are
- * exactly the same as in the case of #bsearch method with the only difference
- * being that this method returns the index of the element instead of the
- * element itself. For more details consult the documentation for #bsearch.
- */
-
static VALUE
-rb_ary_bsearch_index(VALUE ary)
+rb_ary_reverse_m(ary)
+ VALUE ary;
{
- long low = 0, high = RARRAY_LEN(ary), mid;
- int smaller = 0, satisfied = 0;
- VALUE v, val;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- while (low < high) {
- mid = low + ((high - low) / 2);
- val = rb_ary_entry(ary, mid);
- v = rb_yield(val);
- if (FIXNUM_P(v)) {
- if (v == INT2FIX(0)) return INT2FIX(mid);
- smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
- }
- else if (v == Qtrue) {
- satisfied = 1;
- smaller = 1;
- }
- else if (v == Qfalse || v == Qnil) {
- smaller = 0;
- }
- else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
- const VALUE zero = INT2FIX(0);
- switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
- case 0: return INT2FIX(mid);
- case 1: smaller = 1; break;
- case -1: smaller = 0;
- }
- }
- else {
- rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
- " (must be numeric, true, false or nil)",
- rb_obj_class(v));
- }
- if (smaller) {
- high = mid;
- }
- else {
- low = mid + 1;
- }
- }
- if (!satisfied) return Qnil;
- return INT2FIX(low);
+ return rb_ary_reverse(rb_obj_dup(ary));
}
+static ID cmp;
-static VALUE
-sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+static int
+sort_1(a, b)
+ VALUE *a, *b;
{
- return rb_yield(i);
+ VALUE retval = rb_yield(rb_assoc_new(*a, *b));
+ return NUM2INT(retval);
}
-/*
- * call-seq:
- * ary.sort_by! { |obj| block } -> ary
- * ary.sort_by! -> Enumerator
- *
- * Sorts +self+ in place using a set of keys generated by mapping the
- * values in +self+ through the given block.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- */
-
-static VALUE
-rb_ary_sort_by_bang(VALUE ary)
+static int
+sort_2(a, b)
+ VALUE *a, *b;
{
- VALUE sorted;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_modify(ary);
- sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
- rb_ary_replace(ary, sorted);
- return ary;
-}
+ VALUE retval;
+ if (FIXNUM_P(*a)) {
+ if (FIXNUM_P(*b)) return *a - *b;
+ }
+ else if (TYPE(*a) == T_STRING && TYPE(*b) == T_STRING) {
+ return rb_str_cmp(*a, *b);
+ }
-/*
- * call-seq:
- * ary.collect { |item| block } -> new_ary
- * ary.map { |item| block } -> new_ary
- * ary.collect -> Enumerator
- * ary.map -> Enumerator
- *
- * Invokes the given block once for each element of +self+.
- *
- * Creates a new array containing the values returned by the block.
- *
- * See also Enumerable#collect.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.collect { |x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
- * a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- * a #=> ["a", "b", "c", "d"]
- */
+ retval = rb_funcall(*a, cmp, 1, *b);
+ return NUM2INT(retval);
+}
static VALUE
-rb_ary_collect(VALUE ary)
+sort_internal(ary)
+ VALUE ary;
{
- long i;
- VALUE collect;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- collect = rb_ary_new2(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
- }
- return collect;
+ qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2);
+ return ary;
}
-
-/*
- * call-seq:
- * ary.collect! {|item| block } -> ary
- * ary.map! {|item| block } -> ary
- * ary.collect! -> Enumerator
- * ary.map! -> Enumerator
- *
- * Invokes the given block once for each element of +self+, replacing the
- * element with the value returned by the block.
- *
- * See also Enumerable#collect.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.map! {|x| x + "!" }
- * a #=> [ "a!", "b!", "c!", "d!" ]
- * a.collect!.with_index {|x, i| x[0...i] }
- * a #=> ["", "b", "c!", "d!"]
- */
-
static VALUE
-rb_ary_collect_bang(VALUE ary)
+sort_unlock(ary)
+ VALUE ary;
{
- long i;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_modify(ary);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
- }
+ FL_UNSET(ary, ARY_TMPLOCK);
return ary;
}
VALUE
-rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
+rb_ary_sort_bang(ary)
+ VALUE ary;
{
- VALUE result = rb_ary_new2(argc);
- long beg, len, i, j;
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len <= 1) return Qnil;
- for (i=0; i<argc; i++) {
- if (FIXNUM_P(argv[i])) {
- rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
- continue;
- }
- /* check if idx is Range */
- if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
- long end = olen < beg+len ? olen : beg+len;
- for (j = beg; j < end; j++) {
- rb_ary_push(result, (*func)(obj, j));
- }
- if (beg + len > j)
- rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
- continue;
- }
- rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
- }
- return result;
+ FL_SET(ary, ARY_TMPLOCK); /* prohibit modification during sort */
+ rb_ensure(sort_internal, ary, sort_unlock, ary);
+ return ary;
}
-/*
- * call-seq:
- * ary.values_at(selector, ...) -> new_ary
- *
- * Returns an array containing the elements in +self+ corresponding to the
- * given +selector+(s).
- *
- * The selectors may be either integer indices or ranges.
- *
- * See also Array#select.
- *
- * a = %w{ a b c d e f }
- * a.values_at(1, 3, 5) # => ["b", "d", "f"]
- * a.values_at(1, 3, 5, 7) # => ["b", "d", "f", nil]
- * a.values_at(-1, -2, -2, -7) # => ["f", "e", "e", nil]
- * a.values_at(4..6, 3...6) # => ["e", "f", nil, "d", "e", "f"]
- */
-
-static VALUE
-rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_sort(ary)
+ VALUE ary;
{
- return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+ ary = rb_obj_dup(ary);
+ rb_ary_sort_bang(ary);
+ return ary;
}
-
-/*
- * call-seq:
- * ary.select { |item| block } -> new_ary
- * ary.select -> Enumerator
- *
- * Returns a new array containing all elements of +ary+
- * for which the given +block+ returns a true value.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * [1,2,3,4,5].select { |num| num.even? } #=> [2, 4]
- *
- * a = %w{ a b c d e f }
- * a.select { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
- *
- * See also Enumerable#select.
- */
-
static VALUE
-rb_ary_select(VALUE ary)
-{
- VALUE result;
- long i;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- result = rb_ary_new2(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- rb_ary_push(result, rb_ary_elt(ary, i));
- }
- }
- return result;
-}
-
-struct select_bang_arg {
+rb_ary_collect(ary)
VALUE ary;
- long len[2];
-};
-
-static VALUE
-select_bang_i(VALUE a)
{
- volatile struct select_bang_arg *arg = (void *)a;
- VALUE ary = arg->ary;
- long i1, i2;
+ long len, i;
+ VALUE collect;
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (!RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- arg->len[1] = ++i2;
+ if (!rb_block_given_p()) {
+ return rb_obj_dup(ary);
}
- return (i1 == i2) ? Qnil : ary;
-}
-static VALUE
-select_bang_ensure(VALUE a)
-{
- volatile struct select_bang_arg *arg = (void *)a;
- VALUE ary = arg->ary;
- long len = RARRAY_LEN(ary);
- long i1 = arg->len[0], i2 = arg->len[1];
-
- if (i2 < i1) {
- if (i1 < len) {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr + i2, ptr + i1, VALUE, len - i1);
- });
- }
- ARY_SET_LEN(ary, len - i1 + i2);
+ len = RARRAY(ary)->len;
+ collect = rb_ary_new2(len);
+ for (i=0; i<len; i++) {
+ rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
}
- return ary;
+ return collect;
}
-/*
- * call-seq:
- * ary.select! {|item| block } -> ary or nil
- * ary.select! -> Enumerator
- *
- * Invokes the given block passing in successive elements from +self+,
- * deleting elements for which the block returns a +false+ value.
- *
- * The array may not be changed instantly every time the block is called.
- *
- * If changes were made, it will return +self+, otherwise it returns +nil+.
- *
- * See also Array#keep_if
- *
- * If no block is given, an Enumerator is returned instead.
- *
- */
-
static VALUE
-rb_ary_select_bang(VALUE ary)
+rb_ary_collect_bang(ary)
+ VALUE ary;
{
- struct select_bang_arg args;
+ long i;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
-
- args.ary = ary;
- args.len[0] = args.len[1] = 0;
- return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- * call-seq:
- * ary.keep_if { |item| block } -> ary
- * ary.keep_if -> Enumerator
- *
- * Deletes every element of +self+ for which the given block evaluates to
- * +false+.
- *
- * See also Array#select!
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = %w{ a b c d e f }
- * a.keep_if { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
- */
-
-static VALUE
-rb_ary_keep_if(VALUE ary)
-{
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_select_bang(ary);
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ RARRAY(ary)->ptr[i] = rb_yield(RARRAY(ary)->ptr[i]);
+ }
return ary;
}
-static void
-ary_resize_smaller(VALUE ary, long len)
+static VALUE
+rb_ary_filter(ary)
+ VALUE ary;
{
- rb_ary_modify(ary);
- if (RARRAY_LEN(ary) > len) {
- ARY_SET_LEN(ary, len);
- if (len * 2 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
- ary_resize_capa(ary, len * 2);
- }
- }
+ rb_warn("Array#filter is deprecated; use Array#collect!");
+ return rb_ary_collect_bang(ary);
}
-/*
- * call-seq:
- * ary.delete(obj) -> item or nil
- * ary.delete(obj) { block } -> item or result of block
- *
- * Deletes all items from +self+ that are equal to +obj+.
- *
- * Returns the last deleted item, or +nil+ if no matching item is found.
- *
- * If the optional code block is given, the result of the block is returned if
- * the item is not found. (To remove +nil+ elements and get an informative
- * return value, use Array#compact!)
- *
- * a = [ "a", "b", "b", "b", "c" ]
- * a.delete("b") #=> "b"
- * a #=> ["a", "c"]
- * a.delete("z") #=> nil
- * a.delete("z") { "not found" } #=> "not found"
- */
-
VALUE
-rb_ary_delete(VALUE ary, VALUE item)
+rb_ary_delete(ary, item)
+ VALUE ary;
+ VALUE item;
{
- VALUE v = item;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_AREF(ary, i1);
-
- if (rb_equal(e, item)) {
- v = e;
- continue;
- }
+ rb_ary_modify(ary);
+ for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+ if (rb_equal(RARRAY(ary)->ptr[i1], item)) continue;
if (i1 != i2) {
- rb_ary_store(ary, i2, e);
+ RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
}
i2++;
}
- if (RARRAY_LEN(ary) == i2) {
+ if (RARRAY(ary)->len == i2) {
if (rb_block_given_p()) {
return rb_yield(item);
}
return Qnil;
}
-
- ary_resize_smaller(ary, i2);
-
- return v;
-}
-
-void
-rb_ary_delete_same(VALUE ary, VALUE item)
-{
- long i1, i2;
-
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_AREF(ary, i1);
-
- if (e == item) {
- continue;
- }
- if (i1 != i2) {
- rb_ary_store(ary, i2, e);
- }
- i2++;
- }
- if (RARRAY_LEN(ary) == i2) {
- return;
+ else {
+ RARRAY(ary)->len = i2;
}
- ary_resize_smaller(ary, i2);
+ return item;
}
VALUE
-rb_ary_delete_at(VALUE ary, long pos)
+rb_ary_delete_at(ary, pos)
+ VALUE ary;
+ long pos;
{
- long len = RARRAY_LEN(ary);
- VALUE del;
+ long i, len = RARRAY(ary)->len;
+ VALUE del = Qnil;
+ rb_ary_modify(ary);
if (pos >= len) return Qnil;
- if (pos < 0) {
- pos += len;
- if (pos < 0) return Qnil;
- }
+ if (pos < 0) pos += len;
+ if (pos < 0) return Qnil;
- rb_ary_modify(ary);
- del = RARRAY_AREF(ary, pos);
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
- });
- ARY_INCREASE_LEN(ary, -1);
+ del = RARRAY(ary)->ptr[pos];
+ for (i = pos + 1; i < len; i++, pos++) {
+ RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
+ }
+ RARRAY(ary)->len = pos;
return del;
}
-/*
- * call-seq:
- * ary.delete_at(index) -> obj or nil
- *
- * Deletes the element at the specified +index+, returning that element, or
- * +nil+ if the +index+ is out of range.
- *
- * See also Array#slice!
- *
- * a = ["ant", "bat", "cat", "dog"]
- * a.delete_at(2) #=> "cat"
- * a #=> ["ant", "bat", "dog"]
- * a.delete_at(99) #=> nil
- */
-
-static VALUE
-rb_ary_delete_at_m(VALUE ary, VALUE pos)
+VALUE
+rb_ary_delete_at_m(ary, pos)
+ VALUE ary, pos;
{
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
-/*
- * call-seq:
- * ary.slice!(index) -> obj or nil
- * ary.slice!(start, length) -> new_ary or nil
- * ary.slice!(range) -> new_ary or nil
- *
- * Deletes the element(s) given by an +index+ (optionally up to +length+
- * elements) or by a +range+.
- *
- * Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- * range.
- *
- * a = [ "a", "b", "c" ]
- * a.slice!(1) #=> "b"
- * a #=> ["a", "c"]
- * a.slice!(-1) #=> "c"
- * a #=> ["a"]
- * a.slice!(100) #=> nil
- * a #=> ["a"]
- */
-
static VALUE
-rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_slice_bang(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE arg1, arg2;
- long pos, len, orig_len;
+ long pos, len, i;
- rb_ary_modify_check(ary);
- if (argc == 2) {
- pos = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
+ rb_ary_modify(ary);
+ if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
+ pos = NUM2LONG(arg1);
+ len = NUM2LONG(arg2);
delete_pos_len:
- if (len < 0) return Qnil;
- orig_len = RARRAY_LEN(ary);
if (pos < 0) {
- pos += orig_len;
- if (pos < 0) return Qnil;
+ pos = RARRAY(ary)->len + pos;
}
- else if (orig_len < pos) return Qnil;
- if (orig_len < pos + len) {
- len = orig_len - pos;
- }
- if (len == 0) return rb_ary_new2(0);
- arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
- RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
- rb_ary_splice(ary, pos, len, 0, 0);
+ arg2 = rb_ary_subseq(ary, pos, len);
+ rb_ary_replace(ary, pos, len, Qnil); /* Qnil/rb_ary_new2(0) */
return arg2;
}
- if (argc != 1) {
- /* error report */
- rb_scan_args(argc, argv, "11", NULL, NULL);
+ if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
+ goto delete_pos_len;
}
- arg1 = argv[0];
- if (!FIXNUM_P(arg1)) {
- switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
- case Qtrue:
- /* valid range */
- goto delete_pos_len;
- case Qnil:
- /* invalid range */
- return Qnil;
- default:
- /* not a range */
- break;
- }
- }
+ pos = NUM2LONG(arg1);
+ len = RARRAY(ary)->len;
- return rb_ary_delete_at(ary, NUM2LONG(arg1));
-}
-
-static VALUE
-ary_reject(VALUE orig, VALUE result)
-{
- long i;
+ if (pos >= len) return Qnil;
+ if (pos < 0) pos += len;
+ if (pos < 0) return Qnil;
- for (i = 0; i < RARRAY_LEN(orig); i++) {
- VALUE v = RARRAY_AREF(orig, i);
- if (!RTEST(rb_yield(v))) {
- rb_ary_push(result, v);
- }
+ arg2 = RARRAY(ary)->ptr[pos];
+ for (i = pos + 1; i < len; i++, pos++) {
+ RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
}
- return result;
+ RARRAY(ary)->len = pos;
+
+ return arg2;
}
static VALUE
-reject_bang_i(VALUE a)
+rb_ary_reject_bang(ary)
+ VALUE ary;
{
- volatile struct select_bang_arg *arg = (void *)a;
- VALUE ary = arg->ary;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (RTEST(rb_yield(v))) continue;
+ rb_ary_modify(ary);
+ for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+ if (RTEST(rb_yield(RARRAY(ary)->ptr[i1]))) continue;
if (i1 != i2) {
- rb_ary_store(ary, i2, v);
+ RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
}
- arg->len[1] = ++i2;
+ i2++;
}
- return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-ary_reject_bang(VALUE ary)
-{
- struct select_bang_arg args;
+ if (RARRAY(ary)->len == i2) return Qnil;
+ RARRAY(ary)->len = i2;
- rb_ary_modify_check(ary);
- args.ary = ary;
- args.len[0] = args.len[1] = 0;
- return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- * call-seq:
- * ary.reject! { |item| block } -> ary or nil
- * ary.reject! -> Enumerator
- *
- * Deletes every element of +self+ for which the block evaluates to +true+,
- * if no changes were made returns +nil+.
- *
- * The array may not be changed instantly every time the block is called.
- *
- * See also Enumerable#reject and Array#delete_if.
- *
- * If no block is given, an Enumerator is returned instead.
- */
-
-static VALUE
-rb_ary_reject_bang(VALUE ary)
-{
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- return ary_reject_bang(ary);
-}
-
-/*
- * call-seq:
- * ary.reject {|item| block } -> new_ary
- * ary.reject -> Enumerator
- *
- * Returns a new array containing the items in +self+ for which the given
- * block is not +true+. The ordering of non-rejected elements is maintained.
- *
- * See also Array#delete_if
- *
- * If no block is given, an Enumerator is returned instead.
- */
-
-static VALUE
-rb_ary_reject(VALUE ary)
-{
- VALUE rejected_ary;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rejected_ary = rb_ary_new();
- ary_reject(ary, rejected_ary);
- return rejected_ary;
-}
-
-/*
- * call-seq:
- * ary.delete_if { |item| block } -> ary
- * ary.delete_if -> Enumerator
- *
- * Deletes every element of +self+ for which block evaluates to +true+.
- *
- * The array is changed instantly every time the block is called, not after
- * the iteration is over.
- *
- * See also Array#reject!
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * scores = [ 97, 42, 75 ]
- * scores.delete_if {|score| score < 80 } #=> [97]
- */
-
-static VALUE
-rb_ary_delete_if(VALUE ary)
-{
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- ary_reject_bang(ary);
return ary;
}
static VALUE
-take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
-{
- VALUE *args = (VALUE *)cbarg;
- if (args[1]-- == 0) rb_iter_break();
- if (argc > 1) val = rb_ary_new4(argc, argv);
- rb_ary_push(args[0], val);
- return Qnil;
-}
-
-static VALUE
-take_items(VALUE obj, long n)
-{
- VALUE result = rb_check_array_type(obj);
- VALUE args[2];
-
- if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
- result = rb_ary_new2(n);
- args[0] = result; args[1] = (VALUE)n;
- if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
- rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
- rb_obj_class(obj));
- return result;
-}
-
-
-/*
- * call-seq:
- * ary.zip(arg, ...) -> new_ary
- * ary.zip(arg, ...) { |arr| block } -> nil
- *
- * Converts any arguments to arrays, then merges elements of +self+ with
- * corresponding elements from each argument.
- *
- * This generates a sequence of <code>ary.size</code> _n_-element arrays,
- * where _n_ is one more than the count of arguments.
- *
- * If the size of any argument is less than the size of the initial array,
- * +nil+ values are supplied.
- *
- * If a block is given, it is invoked for each output +array+, otherwise an
- * array of arrays is returned.
- *
- * a = [ 4, 5, 6 ]
- * b = [ 7, 8, 9 ]
- * [1, 2, 3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- * [1, 2].zip(a, b) #=> [[1, 4, 7], [2, 5, 8]]
- * a.zip([1, 2], [8]) #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
- */
-
-static VALUE
-rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+rb_ary_delete_if(ary)
+ VALUE ary;
{
- int i, j;
- long len = RARRAY_LEN(ary);
- VALUE result = Qnil;
-
- for (i=0; i<argc; i++) {
- argv[i] = take_items(argv[i], len);
- }
-
- if (rb_block_given_p()) {
- int arity = rb_block_arity();
-
- if (arity > 1) {
- VALUE work, *tmp;
-
- tmp = ALLOCV_N(VALUE, work, argc+1);
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- tmp[0] = RARRAY_AREF(ary, i);
- for (j=0; j<argc; j++) {
- tmp[j+1] = rb_ary_elt(argv[j], i);
- }
- rb_yield_values2(argc+1, tmp);
- }
-
- if (work) ALLOCV_END(work);
- }
- else {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE tmp = rb_ary_new2(argc+1);
-
- rb_ary_push(tmp, RARRAY_AREF(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_yield(tmp);
- }
- }
- }
- else {
- result = rb_ary_new_capa(len);
-
- for (i=0; i<len; i++) {
- VALUE tmp = rb_ary_new_capa(argc+1);
-
- rb_ary_push(tmp, RARRAY_AREF(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_ary_push(result, tmp);
- }
- }
-
- return result;
+ rb_ary_reject_bang(ary);
+ return ary;
}
-/*
- * call-seq:
- * ary.transpose -> new_ary
- *
- * Assumes that +self+ is an array of arrays and transposes the rows and
- * columns.
- *
- * a = [[1,2], [3,4], [5,6]]
- * a.transpose #=> [[1, 3, 5], [2, 4, 6]]
- *
- * If the length of the subarrays don't match, an IndexError is raised.
- */
-
static VALUE
-rb_ary_transpose(VALUE ary)
+rb_ary_replace_m(ary, ary2)
+ VALUE ary, ary2;
{
- long elen = -1, alen, i, j;
- VALUE tmp, result = 0;
-
- alen = RARRAY_LEN(ary);
- if (alen == 0) return rb_ary_dup(ary);
- for (i=0; i<alen; i++) {
- tmp = to_ary(rb_ary_elt(ary, i));
- if (elen < 0) { /* first element */
- elen = RARRAY_LEN(tmp);
- result = rb_ary_new2(elen);
- for (j=0; j<elen; j++) {
- rb_ary_store(result, j, rb_ary_new2(alen));
- }
- }
- else if (elen != RARRAY_LEN(tmp)) {
- rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
- RARRAY_LEN(tmp), elen);
- }
- for (j=0; j<elen; j++) {
- rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
- }
- }
- return result;
-}
-
-/*
- * call-seq:
- * ary.replace(other_ary) -> ary
- * ary.initialize_copy(other_ary) -> ary
- *
- * Replaces the contents of +self+ with the contents of +other_ary+,
- * truncating or expanding if necessary.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
- * a #=> ["x", "y", "z"]
- */
-
-VALUE
-rb_ary_replace(VALUE copy, VALUE orig)
-{
- rb_ary_modify_check(copy);
- orig = to_ary(orig);
- if (copy == orig) return copy;
-
- if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
- VALUE shared = 0;
-
- if (ARY_OWNS_HEAP_P(copy)) {
- RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
- }
- else if (ARY_SHARED_P(copy)) {
- shared = ARY_SHARED(copy);
- FL_UNSET_SHARED(copy);
- }
- FL_SET_EMBED(copy);
- ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
- if (shared) {
- rb_ary_decrement_share(shared);
- }
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- }
- else {
- VALUE shared = ary_make_shared(orig);
- if (ARY_OWNS_HEAP_P(copy)) {
- RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
- }
- else {
- rb_ary_unshare_safe(copy);
- }
- FL_UNSET_EMBED(copy);
- ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- rb_ary_set_shared(copy, shared);
- }
- return copy;
+ ary2 = to_ary(ary2);
+ rb_ary_replace(ary, 0, RARRAY(ary)->len, ary2);
+ return ary;
}
-/*
- * call-seq:
- * ary.clear -> ary
- *
- * Removes all elements from +self+.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a.clear #=> [ ]
- */
-
VALUE
-rb_ary_clear(VALUE ary)
+rb_ary_clear(ary)
+ VALUE ary;
{
- rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
- if (ARY_SHARED_P(ary)) {
- if (!ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
- }
- else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ rb_ary_modify(ary);
+ RARRAY(ary)->len = 0;
+ if (ARY_DEFAULT_SIZE*3 < RARRAY(ary)->capa) {
+ RARRAY(ary)->capa = ARY_DEFAULT_SIZE * 2;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
return ary;
}
-/*
- * call-seq:
- * ary.fill(obj) -> ary
- * ary.fill(obj, start [, length]) -> ary
- * ary.fill(obj, range ) -> ary
- * ary.fill { |index| block } -> ary
- * ary.fill(start [, length] ) { |index| block } -> ary
- * ary.fill(range) { |index| block } -> ary
- *
- * The first three forms set the selected elements of +self+ (which
- * may be the entire array) to +obj+.
- *
- * A +start+ of +nil+ is equivalent to zero.
- *
- * A +length+ of +nil+ is equivalent to the length of the array.
- *
- * The last three forms fill the array with the value of the given block,
- * which is passed the absolute index of each element to be filled.
- *
- * Negative values of +start+ count from the end of the array, where +-1+ is
- * the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.fill("x") #=> ["x", "x", "x", "x"]
- * a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
- * a.fill("y", 0..1) #=> ["y", "y", "z", "z"]
- * a.fill { |i| i*i } #=> [0, 1, 4, 9]
- * a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
- */
-
static VALUE
-rb_ary_fill(int argc, VALUE *argv, VALUE ary)
+rb_ary_fill(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE item = Qundef, arg1, arg2;
- long beg = 0, end = 0, len = 0;
+ VALUE item, arg1, arg2;
+ long beg, end, len;
+ VALUE *p, *pend;
- if (rb_block_given_p()) {
- rb_scan_args(argc, argv, "02", &arg1, &arg2);
- argc += 1; /* hackish */
- }
- else {
- rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
- }
+ rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
switch (argc) {
case 1:
beg = 0;
- len = RARRAY_LEN(ary);
+ len = RARRAY(ary)->len - beg;
break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
break;
}
/* fall through */
case 3:
- beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+ beg = NIL_P(arg1)?0:NUM2LONG(arg1);
if (beg < 0) {
- beg = RARRAY_LEN(ary) + beg;
+ beg = RARRAY(ary)->len + beg;
if (beg < 0) beg = 0;
}
- len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+ len = NIL_P(arg2)?RARRAY(ary)->len - beg:NUM2LONG(arg2);
break;
}
rb_ary_modify(ary);
- if (len < 0) {
- return ary;
- }
- if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
- rb_raise(rb_eArgError, "argument too big");
- }
end = beg + len;
- if (RARRAY_LEN(ary) < end) {
- if (end >= ARY_CAPA(ary)) {
- ary_resize_capa(ary, end);
+ if (end > RARRAY(ary)->len) {
+ if (end >= RARRAY(ary)->capa) {
+ RARRAY(ary)->capa=end;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
}
- ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
- ARY_SET_LEN(ary, end);
- }
-
- if (item == Qundef) {
- VALUE v;
- long i;
-
- for (i=beg; i<end; i++) {
- v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY_LEN(ary)) break;
- ARY_SET(ary, i, v);
+ if (beg > RARRAY(ary)->len) {
+ rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len,end-RARRAY(ary)->len);
}
+ RARRAY(ary)->len = end;
}
- else {
- ary_memfill(ary, beg, len, item);
+ p = RARRAY(ary)->ptr + beg; pend = p + len;
+
+ while (p < pend) {
+ *p++ = item;
}
return ary;
}
-/*
- * call-seq:
- * ary + other_ary -> new_ary
- *
- * Concatenation --- Returns a new array built by concatenating the
- * two arrays together to produce a third array.
- *
- * [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
- * a = [ "a", "b", "c" ]
- * c = a + [ "d", "e", "f" ]
- * c #=> [ "a", "b", "c", "d", "e", "f" ]
- * a #=> [ "a", "b", "c" ]
- *
- * Note that
- * x += y
- * is the same as
- * x = x + y
- * This means that it produces a new array. As a consequence,
- * repeated use of <code>+=</code> on arrays can be quite inefficient.
- *
- * See also Array#concat.
- */
-
VALUE
-rb_ary_plus(VALUE x, VALUE y)
+rb_ary_plus(x, y)
+ VALUE x, y;
{
VALUE z;
- long len, xlen, ylen;
y = to_ary(y);
- xlen = RARRAY_LEN(x);
- ylen = RARRAY_LEN(y);
- len = xlen + ylen;
- z = rb_ary_new2(len);
-
- ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
- ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
- ARY_SET_LEN(z, len);
+ z = rb_ary_new2(RARRAY(x)->len + RARRAY(y)->len);
+ MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
+ MEMCPY(RARRAY(z)->ptr+RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
+ RARRAY(z)->len = RARRAY(x)->len + RARRAY(y)->len;
return z;
}
-static VALUE
-ary_append(VALUE x, VALUE y)
-{
- long n = RARRAY_LEN(y);
- if (n > 0) {
- rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
- }
- return x;
-}
-
-/*
- * call-seq:
- * ary.concat(other_ary1, other_ary2,...) -> ary
- *
- * Appends the elements of +other_ary+s to +self+.
- *
- * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].concat( ["b"], ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].concat #=> [ "a" ]
- *
- * a = [ 1, 2, 3 ]
- * a.concat( [ 4, 5 ] )
- * a #=> [ 1, 2, 3, 4, 5 ]
- *
- * a = [ 1, 2 ]
- * a.concat(a, a) #=> [1, 2, 1, 2, 1, 2]
- *
- * See also Array#+.
- */
-
-static VALUE
-rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_concat(x, y)
+ VALUE x, y;
{
- rb_ary_modify_check(ary);
+ long xlen = RARRAY(x)->len;
+ long ylen;
- if (argc > 0) {
- int i;
- VALUE args = rb_ary_tmp_new(argc);
- for (i = 0; i < argc; i++) {
- rb_ary_concat(args, argv[i]);
+ y = to_ary(y);
+ ylen = RARRAY(y)->len;
+ if (ylen > 0) {
+ rb_ary_modify(x);
+ if (xlen + ylen > RARRAY(x)->capa) {
+ RARRAY(x)->capa = xlen + ylen;
+ REALLOC_N(RARRAY(x)->ptr, VALUE, RARRAY(x)->capa);
}
- ary_append(ary, args);
+ MEMCPY(RARRAY(x)->ptr+xlen, RARRAY(y)->ptr, VALUE, ylen);
+ RARRAY(x)->len = xlen + ylen;
}
-
- return ary;
-}
-
-VALUE
-rb_ary_concat(VALUE x, VALUE y)
-{
- return ary_append(x, to_ary(y));
+ return x;
}
-/*
- * call-seq:
- * ary * int -> new_ary
- * ary * str -> new_string
- *
- * Repetition --- With a String argument, equivalent to
- * <code>ary.join(str)</code>.
- *
- * Otherwise, returns a new array built by concatenating the +int+ copies of
- * +self+.
- *
- *
- * [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- * [ 1, 2, 3 ] * "," #=> "1,2,3"
- *
- */
-
static VALUE
-rb_ary_times(VALUE ary, VALUE times)
+rb_ary_times(ary, times)
+ VALUE ary;
+ VALUE times;
{
- VALUE ary2, tmp;
- const VALUE *ptr;
- long t, len;
+ VALUE ary2;
+ long i, len;
- tmp = rb_check_string_type(times);
- if (!NIL_P(tmp)) {
- return rb_ary_join(ary, tmp);
+ if (TYPE(times) == T_STRING) {
+ return rb_ary_join(ary, times);
}
len = NUM2LONG(times);
- if (len == 0) {
- ary2 = ary_new(rb_obj_class(ary), 0);
- goto out;
- }
if (len < 0) {
rb_raise(rb_eArgError, "negative argument");
}
- if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
- rb_raise(rb_eArgError, "argument too big");
- }
- len *= RARRAY_LEN(ary);
-
- ary2 = ary_new(rb_obj_class(ary), len);
- ARY_SET_LEN(ary2, len);
-
- ptr = RARRAY_CONST_PTR(ary);
- t = RARRAY_LEN(ary);
- if (0 < t) {
- ary_memcpy(ary2, 0, t, ptr);
- while (t <= len/2) {
- ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
- t *= 2;
- }
- if (t < len) {
- ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
- }
+ len *= RARRAY(ary)->len;
+
+ ary2 = rb_ary_new2(len);
+ RARRAY(ary2)->len = len;
+
+ for (i=0; i<len; i+=RARRAY(ary)->len) {
+ MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
}
- out:
- OBJ_INFECT(ary2, ary);
return ary2;
}
-/*
- * call-seq:
- * ary.assoc(obj) -> element_ary or nil
- *
- * Searches through an array whose elements are also arrays comparing +obj+
- * with the first element of each contained array using <code>obj.==</code>.
- *
- * Returns the first contained array that matches (that is, the first
- * associated array), or +nil+ if no match is found.
- *
- * See also Array#rassoc
- *
- * s1 = [ "colors", "red", "blue", "green" ]
- * s2 = [ "letters", "a", "b", "c" ]
- * s3 = "foo"
- * a = [ s1, s2, s3 ]
- * a.assoc("letters") #=> [ "letters", "a", "b", "c" ]
- * a.assoc("foo") #=> nil
- */
-
VALUE
-rb_ary_assoc(VALUE ary, VALUE key)
+rb_ary_assoc(ary, key)
+ VALUE ary;
+ VALUE key;
{
- long i;
- VALUE v;
+ VALUE *p, *pend;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = rb_check_array_type(RARRAY_AREF(ary, i));
- if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
- rb_equal(RARRAY_AREF(v, 0), key))
- return v;
+ p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
+ while (p < pend) {
+ if (TYPE(*p) == T_ARRAY
+ && RARRAY(*p)->len > 0
+ && rb_equal(RARRAY(*p)->ptr[0], key))
+ return *p;
+ p++;
}
return Qnil;
}
-/*
- * call-seq:
- * ary.rassoc(obj) -> element_ary or nil
- *
- * Searches through the array whose elements are also arrays.
- *
- * Compares +obj+ with the second element of each contained array using
- * <code>obj.==</code>.
- *
- * Returns the first contained array that matches +obj+.
- *
- * See also Array#assoc.
- *
- * a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- * a.rassoc("two") #=> [2, "two"]
- * a.rassoc("four") #=> nil
- */
-
VALUE
-rb_ary_rassoc(VALUE ary, VALUE value)
+rb_ary_rassoc(ary, value)
+ VALUE ary;
+ VALUE value;
{
- long i;
- VALUE v;
+ VALUE *p, *pend;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = RARRAY_AREF(ary, i);
- if (RB_TYPE_P(v, T_ARRAY) &&
- RARRAY_LEN(v) > 1 &&
- rb_equal(RARRAY_AREF(v, 1), value))
- return v;
+ p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
+ while (p < pend) {
+ if (TYPE(*p) == T_ARRAY
+ && RARRAY(*p)->len > 1
+ && rb_equal(RARRAY(*p)->ptr[1], value))
+ return *p;
+ p++;
}
return Qnil;
}
static VALUE
-recursive_equal(VALUE ary1, VALUE ary2, int recur)
+rb_ary_equal(ary1, ary2)
+ VALUE ary1, ary2;
{
- long i, len1;
- const VALUE *p1, *p2;
-
- if (recur) return Qtrue; /* Subtle! */
-
- p1 = RARRAY_CONST_PTR(ary1);
- p2 = RARRAY_CONST_PTR(ary2);
- len1 = RARRAY_LEN(ary1);
-
- for (i = 0; i < len1; i++) {
- if (*p1 != *p2) {
- if (rb_equal(*p1, *p2)) {
- len1 = RARRAY_LEN(ary1);
- if (len1 != RARRAY_LEN(ary2))
- return Qfalse;
- if (len1 < i)
- return Qtrue;
- p1 = RARRAY_CONST_PTR(ary1) + i;
- p2 = RARRAY_CONST_PTR(ary2) + i;
- }
- else {
- return Qfalse;
- }
- }
- p1++;
- p2++;
- }
- return Qtrue;
-}
-
-/*
- * call-seq:
- * ary == other_ary -> bool
- *
- * Equality --- Two arrays are equal if they contain the same number of
- * elements and if each element is equal to (according to Object#==) the
- * corresponding element in +other_ary+.
- *
- * [ "a", "c" ] == [ "a", "c", 7 ] #=> false
- * [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
- * [ "a", "c", 7 ] == [ "a", "d", "f" ] #=> false
- *
- */
+ long i;
-static VALUE
-rb_ary_equal(VALUE ary1, VALUE ary2)
-{
- if (ary1 == ary2) return Qtrue;
- if (!RB_TYPE_P(ary2, T_ARRAY)) {
- if (!rb_respond_to(ary2, idTo_ary)) {
+ if (TYPE(ary2) != T_ARRAY) return Qfalse;
+ if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (!rb_equal(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
return Qfalse;
- }
- return rb_equal(ary2, ary1);
}
- if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
- return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+ return Qtrue;
}
static VALUE
-recursive_eql(VALUE ary1, VALUE ary2, int recur)
+rb_ary_eql(ary1, ary2)
+ VALUE ary1, ary2;
{
long i;
- if (recur) return Qtrue; /* Subtle! */
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ if (TYPE(ary2) != T_ARRAY) return Qfalse;
+ if (RARRAY(ary1)->len != RARRAY(ary2)->len)
+ return Qfalse;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (!rb_eql(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
return Qfalse;
}
return Qtrue;
}
-/*
- * call-seq:
- * ary.eql?(other) -> true or false
- *
- * Returns +true+ if +self+ and +other+ are the same object,
- * or are both arrays with the same content (according to Object#eql?).
- */
-
-static VALUE
-rb_ary_eql(VALUE ary1, VALUE ary2)
-{
- if (ary1 == ary2) return Qtrue;
- if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
- if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
- return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
-}
-
-/*
- * call-seq:
- * ary.hash -> integer
- *
- * Compute a hash-code for this array.
- *
- * Two arrays with the same content will have the same hash code (and will
- * compare using #eql?).
- *
- * See also Object#hash.
- */
-
static VALUE
-rb_ary_hash(VALUE ary)
+rb_ary_hash(ary)
+ VALUE ary;
{
long i;
- st_index_t h;
VALUE n;
+ long h;
- h = rb_hash_start(RARRAY_LEN(ary));
- h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- n = rb_hash(RARRAY_AREF(ary, i));
- h = rb_hash_uint(h, NUM2LONG(n));
+ h = RARRAY(ary)->len;
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ h = (h<<1) | (h<0 ? 1 : 0);
+ n = rb_hash(RARRAY(ary)->ptr[i]);
+ h ^= NUM2LONG(n);
}
- h = rb_hash_end(h);
- return LONG2FIX(h);
+ return INT2FIX(h);
}
-/*
- * call-seq:
- * ary.include?(object) -> true or false
- *
- * Returns +true+ if the given +object+ is present in +self+ (that is, if any
- * element <code>==</code> +object+), otherwise returns +false+.
- *
- * a = [ "a", "b", "c" ]
- * a.include?("b") #=> true
- * a.include?("z") #=> false
- */
-
VALUE
-rb_ary_includes(VALUE ary, VALUE item)
+rb_ary_includes(ary, item)
+ VALUE ary;
+ VALUE item;
{
long i;
- VALUE e;
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- switch (rb_equal_opt(e, item)) {
- case Qundef:
- if (rb_equal(e, item)) return Qtrue;
- break;
- case Qtrue:
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ if (rb_equal(RARRAY(ary)->ptr[i], item)) {
return Qtrue;
}
}
return Qfalse;
}
-
static VALUE
-recursive_cmp(VALUE ary1, VALUE ary2, int recur)
+rb_ary_cmp(ary, ary2)
+ VALUE ary;
+ VALUE ary2;
{
long i, len;
- if (recur) return Qundef; /* Subtle! */
- len = RARRAY_LEN(ary1);
- if (len > RARRAY_LEN(ary2)) {
- len = RARRAY_LEN(ary2);
+ ary2 = to_ary(ary2);
+ len = RARRAY(ary)->len;
+ if (len > RARRAY(ary2)->len) {
+ len = RARRAY(ary2)->len;
}
for (i=0; i<len; i++) {
- VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
- VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+ VALUE v = rb_funcall(RARRAY(ary)->ptr[i],cmp,1,RARRAY(ary2)->ptr[i]);
if (v != INT2FIX(0)) {
return v;
}
}
- return Qundef;
-}
-
-/*
- * call-seq:
- * ary <=> other_ary -> -1, 0, +1 or nil
- *
- * Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- * array is less than, equal to, or greater than +other_ary+.
- *
- * Each object in each array is compared (using the <=> operator).
- *
- * Arrays are compared in an "element-wise" manner; the first element of +ary+
- * is compared with the first one of +other_ary+ using the <=> operator, then
- * each of the second elements, etc...
- * As soon as the result of any such comparison is non zero (i.e. the two
- * corresponding elements are not equal), that result is returned for the
- * whole array comparison.
- *
- * If all the elements are equal, then the result is based on a comparison of
- * the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- * and only if, they have the same length and the value of each element is
- * equal to the value of the corresponding element in the other array.
- *
- * +nil+ is returned if the +other_ary+ is not an array or if the comparison
- * of two elements returned +nil+.
- *
- * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
- * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
- * [ 1, 2 ] <=> [ 1, :two ] #=> nil
- *
- */
-
-VALUE
-rb_ary_cmp(VALUE ary1, VALUE ary2)
-{
- long len;
- VALUE v;
-
- ary2 = rb_check_array_type(ary2);
- if (NIL_P(ary2)) return Qnil;
- if (ary1 == ary2) return INT2FIX(0);
- v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
- if (v != Qundef) return v;
- len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+ len = RARRAY(ary)->len - RARRAY(ary2)->len;
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
return INT2FIX(-1);
}
static VALUE
-ary_add_hash(VALUE hash, VALUE ary)
-{
- long i;
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE elt = RARRAY_AREF(ary, i);
- rb_hash_add_new_element(hash, elt, elt);
- }
- return hash;
-}
-
-static inline VALUE
-ary_tmp_hash_new(void)
-{
- VALUE hash = rb_hash_new();
-
- RBASIC_CLEAR_CLASS(hash);
- return hash;
-}
-
-static VALUE
-ary_make_hash(VALUE ary)
-{
- VALUE hash = ary_tmp_hash_new();
- return ary_add_hash(hash, ary);
-}
-
-static VALUE
-ary_add_hash_by(VALUE hash, VALUE ary)
-{
- long i;
-
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
- rb_hash_add_new_element(hash, k, v);
- }
- return hash;
-}
-
-static VALUE
-ary_make_hash_by(VALUE ary)
-{
- VALUE hash = ary_tmp_hash_new();
- return ary_add_hash_by(hash, ary);
-}
-
-static inline void
-ary_recycle_hash(VALUE hash)
-{
- if (RHASH(hash)->ntbl) {
- st_table *tbl = RHASH(hash)->ntbl;
- RHASH(hash)->ntbl = 0;
- st_free_table(tbl);
- }
- RB_GC_GUARD(hash);
-}
-
-/*
- * call-seq:
- * ary - other_ary -> new_ary
- *
- * Array Difference
- *
- * Returns a new array that is a copy of the original array, removing any
- * items that also appear in +other_ary+. The order is preserved from the
- * original array.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
- *
- * If you need set-like behavior, see the library class Set.
- */
-
-static VALUE
-rb_ary_diff(VALUE ary1, VALUE ary2)
+rb_ary_diff(ary1, ary2)
+ VALUE ary1, ary2;
{
VALUE ary3;
- VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2));
+ ary2 = to_ary(ary2);
ary3 = rb_ary_new();
-
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
- rb_ary_push(ary3, rb_ary_elt(ary1, i));
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (rb_ary_includes(ary2, RARRAY(ary1)->ptr[i])) continue;
+ if (rb_ary_includes(ary3, RARRAY(ary1)->ptr[i])) continue;
+ rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
}
- ary_recycle_hash(hash);
return ary3;
}
-/*
- * call-seq:
- * ary & other_ary -> new_ary
- *
- * Set Intersection --- Returns a new array containing unique elements common to the
- * two arrays. The order is preserved from the original array.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ 1, 1, 3, 5 ] & [ 3, 2, 1 ] #=> [ 1, 3 ]
- * [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ] #=> [ 'a', 'b' ]
- *
- * See also Array#uniq.
- */
-
-
static VALUE
-rb_ary_and(VALUE ary1, VALUE ary2)
+ary_make_hash(ary1, ary2)
+ VALUE ary1, ary2;
{
- VALUE hash, ary3, v;
- st_table *table;
- st_data_t vv;
- long i;
+ VALUE hash = rb_hash_new();
+ int i, n;
- ary2 = to_ary(ary2);
- ary3 = rb_ary_new();
- if (RARRAY_LEN(ary2) == 0) return ary3;
- hash = ary_make_hash(ary2);
- table = rb_hash_tbl_raw(hash);
-
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- v = RARRAY_AREF(ary1, i);
- vv = (st_data_t)v;
- if (st_delete(table, &vv, 0)) {
- rb_ary_push(ary3, v);
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+ }
+ if (ary2) {
+ for (i=0; i<RARRAY(ary2)->len; i++) {
+ rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
}
}
- ary_recycle_hash(hash);
-
- return ary3;
-}
-
-static int
-ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
-{
- if (existing) return ST_STOP;
- *key = *value = (VALUE)arg;
- return ST_CONTINUE;
+ return hash;
}
-/*
- * call-seq:
- * ary | other_ary -> new_ary
- *
- * Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- * excluding any duplicates and preserving the order from the given arrays.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ "a", "b", "c" ] | [ "c", "d", "a" ] #=> [ "a", "b", "c", "d" ]
- * [ "c", "d", "a" ] | [ "a", "b", "c" ] #=> [ "c", "d", "a", "b" ]
- *
- * See also Array#uniq.
- */
-
static VALUE
-rb_ary_or(VALUE ary1, VALUE ary2)
+rb_ary_and(ary1, ary2)
+ VALUE ary1, ary2;
{
- VALUE hash, ary3;
+ VALUE hash;
+ VALUE ary3 = rb_ary_new();
long i;
ary2 = to_ary(ary2);
- hash = ary_make_hash(ary1);
+ hash = ary_make_hash(ary2, 0);
- for (i=0; i<RARRAY_LEN(ary2); i++) {
- VALUE elt = RARRAY_AREF(ary2, i);
- if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
- RB_OBJ_WRITTEN(hash, Qundef, elt);
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ VALUE v = RARRAY(ary1)->ptr[i];
+ if (st_delete(RHASH(hash)->tbl, &v, 0)) {
+ rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
}
}
- ary3 = rb_hash_values(hash);
- ary_recycle_hash(hash);
- return ary3;
-}
-
-/*
- * call-seq:
- * ary.max -> obj
- * ary.max { |a, b| block } -> obj
- * ary.max(n) -> array
- * ary.max(n) { |a, b| block } -> array
- *
- * Returns the object in _ary_ with the maximum value. The
- * first form assumes all objects implement <code>Comparable</code>;
- * the second uses the block to return <em>a <=> b</em>.
- *
- * a = %w(albatross dog horse)
- * a.max #=> "horse"
- * a.max { |a, b| a.length <=> b.length } #=> "albatross"
- *
- * If the +n+ argument is given, maximum +n+ elements are returned
- * as an array.
- *
- * a = %w[albatross dog horse]
- * a.max(2) #=> ["horse", "dog"]
- * a.max(2) {|a, b| a.length <=> b.length } #=> ["albatross", "horse"]
- */
-static VALUE
-rb_ary_max(int argc, VALUE *argv, VALUE ary)
-{
- struct cmp_opt_data cmp_opt = { 0, 0 };
- VALUE result = Qundef, v;
- VALUE num;
- long i;
-
- rb_scan_args(argc, argv, "01", &num);
- if (!NIL_P(num))
- return rb_nmin_run(ary, num, 0, 1, 1);
-
- if (rb_block_given_p()) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
- result = v;
- }
- }
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
- result = v;
- }
- }
- }
- if (result == Qundef) return Qnil;
- return result;
+ return ary3;
}
-/*
- * call-seq:
- * ary.min -> obj
- * ary.min {| a,b | block } -> obj
- * ary.min(n) -> array
- * ary.min(n) {| a,b | block } -> array
- *
- * Returns the object in _ary_ with the minimum value. The
- * first form assumes all objects implement <code>Comparable</code>;
- * the second uses the block to return <em>a <=> b</em>.
- *
- * a = %w(albatross dog horse)
- * a.min #=> "albatross"
- * a.min { |a, b| a.length <=> b.length } #=> "dog"
- *
- * If the +n+ argument is given, minimum +n+ elements are returned
- * as an array.
- *
- * a = %w[albatross dog horse]
- * a.min(2) #=> ["albatross", "dog"]
- * a.min(2) {|a, b| a.length <=> b.length } #=> ["dog", "horse"]
- */
static VALUE
-rb_ary_min(int argc, VALUE *argv, VALUE ary)
+rb_ary_or(ary1, ary2)
+ VALUE ary1, ary2;
{
- struct cmp_opt_data cmp_opt = { 0, 0 };
- VALUE result = Qundef, v;
- VALUE num;
+ VALUE hash;
+ VALUE ary3 = rb_ary_new();
+ VALUE v;
long i;
- rb_scan_args(argc, argv, "01", &num);
-
- if (!NIL_P(num))
- return rb_nmin_run(ary, num, 0, 0, 1);
+ ary2 = to_ary(ary2);
+ hash = ary_make_hash(ary1, ary2);
- if (rb_block_given_p()) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
- result = v;
- }
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ v = RARRAY(ary1)->ptr[i];
+ if (st_delete(RHASH(hash)->tbl, &v, 0)) {
+ rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
}
}
- else {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
- result = v;
- }
+ for (i=0; i<RARRAY(ary2)->len; i++) {
+ v = RARRAY(ary2)->ptr[i];
+ if (st_delete(RHASH(hash)->tbl, &v, 0)) {
+ rb_ary_push(ary3, RARRAY(ary2)->ptr[i]);
}
}
- if (result == Qundef) return Qnil;
- return result;
-}
-static int
-push_value(st_data_t key, st_data_t val, st_data_t ary)
-{
- rb_ary_push((VALUE)ary, (VALUE)val);
- return ST_CONTINUE;
+ return ary3;
}
-/*
- * call-seq:
- * ary.uniq! -> ary or nil
- * ary.uniq! { |item| ... } -> ary or nil
- *
- * Removes duplicate elements from +self+.
- *
- * If a block is given, it will use the return value of the block for
- * comparison.
- *
- * It compares values using their #hash and #eql? methods for efficiency.
- *
- * +self+ is traversed in order, and the first occurrence is kept.
- *
- * Returns +nil+ if no changes are made (that is, no duplicates are found).
- *
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! # => ["a", "b", "c"]
- *
- * b = [ "a", "b", "c" ]
- * b.uniq! # => nil
- *
- * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
- */
-
static VALUE
-rb_ary_uniq_bang(VALUE ary)
+rb_ary_uniq_bang(ary)
+ VALUE ary;
{
- VALUE hash;
- long hash_size;
-
- rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) <= 1)
- return Qnil;
- if (rb_block_given_p())
- hash = ary_make_hash_by(ary);
- else
- hash = ary_make_hash(ary);
-
- hash_size = RHASH_SIZE(hash);
- if (RARRAY_LEN(ary) == hash_size) {
+ VALUE hash = ary_make_hash(ary, 0);
+ VALUE *p, *q, *end;
+
+ if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
return Qnil;
}
- rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
+
+ rb_ary_modify(ary);
+ p = q = RARRAY(ary)->ptr;
+ end = p + RARRAY(ary)->len;
+ while (p < end) {
+ VALUE v = *p++;
+ if (st_delete(RHASH(hash)->tbl, &v, 0)) {
+ *q++ = *(p-1);
+ }
}
- ary_resize_capa(ary, hash_size);
- st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
- ary_recycle_hash(hash);
+ RARRAY(ary)->len = (q - RARRAY(ary)->ptr);
return ary;
}
-/*
- * call-seq:
- * ary.uniq -> new_ary
- * ary.uniq { |item| ... } -> new_ary
- *
- * Returns a new array by removing duplicate values in +self+.
- *
- * If a block is given, it will use the return value of the block for comparison.
- *
- * It compares values using their #hash and #eql? methods for efficiency.
- *
- * +self+ is traversed in order, and the first occurrence is kept.
- *
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq # => ["a", "b", "c"]
- *
- * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
- */
-
static VALUE
-rb_ary_uniq(VALUE ary)
+rb_ary_uniq(ary)
+ VALUE ary;
{
- VALUE hash, uniq;
-
- if (RARRAY_LEN(ary) <= 1)
- return rb_ary_dup(ary);
- if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- uniq = rb_hash_values(hash);
- }
- else {
- hash = ary_make_hash(ary);
- uniq = rb_hash_values(hash);
- }
- RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
- ary_recycle_hash(hash);
-
- return uniq;
+ ary = rb_obj_dup(ary);
+ rb_ary_uniq_bang(ary);
+ return ary;
}
-/*
- * call-seq:
- * ary.compact! -> ary or nil
- *
- * Removes +nil+ elements from the array.
- *
- * Returns +nil+ if no changes were made, otherwise returns the array.
- *
- * [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- * [ "a", "b", "c" ].compact! #=> nil
- */
-
static VALUE
-rb_ary_compact_bang(VALUE ary)
+rb_ary_compact_bang(ary)
+ VALUE ary;
{
VALUE *p, *t, *end;
- long n;
rb_ary_modify(ary);
- p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
- end = p + RARRAY_LEN(ary);
-
+ p = t = RARRAY(ary)->ptr;
+ end = p + RARRAY(ary)->len;
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- n = p - RARRAY_CONST_PTR(ary);
- if (RARRAY_LEN(ary) == n) {
+ if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
return Qnil;
}
- ary_resize_smaller(ary, n);
+ RARRAY(ary)->len = RARRAY(ary)->capa = (p - RARRAY(ary)->ptr);
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
return ary;
}
-/*
- * call-seq:
- * ary.compact -> new_ary
- *
- * Returns a copy of +self+ with all +nil+ elements removed.
- *
- * [ "a", nil, "b", nil, "c", nil ].compact
- * #=> [ "a", "b", "c" ]
- */
-
static VALUE
-rb_ary_compact(VALUE ary)
+rb_ary_compact(ary)
+ VALUE ary;
{
- ary = rb_ary_dup(ary);
+ ary = rb_obj_dup(ary);
rb_ary_compact_bang(ary);
return ary;
}
-/*
- * call-seq:
- * ary.count -> int
- * ary.count(obj) -> int
- * ary.count { |item| block } -> int
- *
- * Returns the number of elements.
- *
- * If an argument is given, counts the number of elements which equal +obj+
- * using <code>==</code>.
- *
- * If a block is given, counts the number of elements for which the block
- * returns a true value.
- *
- * ary = [1, 2, 4, 2]
- * ary.count #=> 4
- * ary.count(2) #=> 2
- * ary.count { |x| x%2 == 0 } #=> 3
- *
- */
-
-static VALUE
-rb_ary_count(int argc, VALUE *argv, VALUE ary)
-{
- long i, n = 0;
-
- if (argc == 0) {
- VALUE v;
-
- if (!rb_block_given_p())
- return LONG2NUM(RARRAY_LEN(ary));
-
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (RTEST(rb_yield(v))) n++;
- }
- }
- else {
- VALUE obj;
-
- rb_scan_args(argc, argv, "1", &obj);
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
- }
- }
-
- return LONG2NUM(n);
-}
-
-static VALUE
-flatten(VALUE ary, int level, int *modified)
-{
- long i = 0;
- VALUE stack, result, tmp, elt;
- st_table *memo;
- st_data_t id;
-
- stack = ary_new(0, ARY_DEFAULT_SIZE);
- result = ary_new(0, RARRAY_LEN(ary));
- memo = st_init_numtable();
- st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
- *modified = 0;
-
- while (1) {
- while (i < RARRAY_LEN(ary)) {
- elt = RARRAY_AREF(ary, i++);
- if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
- rb_ary_push(result, elt);
- continue;
- }
- tmp = rb_check_array_type(elt);
- if (RBASIC(result)->klass) {
- rb_raise(rb_eRuntimeError, "flatten reentered");
- }
- if (NIL_P(tmp)) {
- rb_ary_push(result, elt);
- }
- else {
- *modified = 1;
- id = (st_data_t)tmp;
- if (st_lookup(memo, id, 0)) {
- st_free_table(memo);
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- st_insert(memo, id, (st_data_t)Qtrue);
- rb_ary_push(stack, ary);
- rb_ary_push(stack, LONG2NUM(i));
- ary = tmp;
- i = 0;
- }
- }
- if (RARRAY_LEN(stack) == 0) {
- break;
- }
- id = (st_data_t)ary;
- st_delete(memo, &id, 0);
- tmp = rb_ary_pop(stack);
- i = NUM2LONG(tmp);
- ary = rb_ary_pop(stack);
- }
-
- st_free_table(memo);
-
- RBASIC_SET_CLASS(result, rb_obj_class(ary));
- return result;
-}
-
-/*
- * call-seq:
- * ary.flatten! -> ary or nil
- * ary.flatten!(level) -> ary or nil
- *
- * Flattens +self+ in place.
- *
- * Returns +nil+ if no modifications were made (i.e., the array contains no
- * subarrays.)
- *
- * The optional +level+ argument determines the level of recursion to flatten.
- *
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten! #=> [1, 2, 3, 4, 5]
- * a.flatten! #=> nil
- * a #=> [1, 2, 3, 4, 5]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
- */
-
-static VALUE
-rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
-{
- int mod = 0, level = -1;
- VALUE result, lv;
-
- rb_scan_args(argc, argv, "01", &lv);
- rb_ary_modify_check(ary);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return Qnil;
-
- result = flatten(ary, level, &mod);
- if (mod == 0) {
- ary_discard(result);
- return Qnil;
- }
- if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
- rb_ary_replace(ary, result);
- if (mod) ARY_SET_EMBED_LEN(result, 0);
-
- return ary;
-}
-
-/*
- * call-seq:
- * ary.flatten -> new_ary
- * ary.flatten(level) -> new_ary
- *
- * Returns a new array that is a one-dimensional flattening of +self+
- * (recursively).
- *
- * That is, for every element that is an array, extract its elements into
- * the new array.
- *
- * The optional +level+ argument determines the level of recursion to
- * flatten.
- *
- * s = [ 1, 2, 3 ] #=> [1, 2, 3]
- * t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
- * a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten(1) #=> [1, 2, 3, [4, 5]]
- */
-
static VALUE
-rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
-{
- int mod = 0, level = -1;
- VALUE result, lv;
-
- rb_scan_args(argc, argv, "01", &lv);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return ary_make_shared_copy(ary);
-
- result = flatten(ary, level, &mod);
- OBJ_INFECT(result, ary);
-
- return result;
-}
-
-#define OPTHASH_GIVEN_P(opts) \
- (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
-#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
-
-/*
- * call-seq:
- * ary.shuffle! -> ary
- * ary.shuffle!(random: rng) -> ary
- *
- * Shuffles elements in +self+ in place.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle! #=> [2, 3, 1]
- * a #=> [2, 3, 1]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
-{
- VALUE opts, randgen = rb_cRandom;
- long i, len;
-
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
- rb_check_arity(argc, 0, 0);
- rb_ary_modify(ary);
- i = len = RARRAY_LEN(ary);
- RARRAY_PTR_USE(ary, ptr, {
- while (i) {
- long j = RAND_UPTO(i);
- VALUE tmp;
- if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
- rb_raise(rb_eRuntimeError, "modified during shuffle");
- }
- tmp = ptr[--i];
- ptr[i] = ptr[j];
- ptr[j] = tmp;
- }
- }); /* WB: no new reference */
- return ary;
-}
-
-
-/*
- * call-seq:
- * ary.shuffle -> new_ary
- * ary.shuffle(random: rng) -> new_ary
- *
- * Returns a new array with elements of +self+ shuffled.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle #=> [2, 3, 1]
- * a #=> [1, 2, 3]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
-{
- ary = rb_ary_dup(ary);
- rb_ary_shuffle_bang(argc, argv, ary);
- return ary;
-}
-
-
-/*
- * call-seq:
- * ary.sample -> obj
- * ary.sample(random: rng) -> obj
- * ary.sample(n) -> new_ary
- * ary.sample(n, random: rng) -> new_ary
- *
- * Choose a random element or +n+ random elements from the array.
- *
- * The elements are chosen by using random and unique indices into the array
- * in order to ensure that an element doesn't repeat itself unless the array
- * already contained duplicate elements.
- *
- * If the array is empty the first form returns +nil+ and the second form
- * returns an empty array.
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- * a.sample #=> 7
- * a.sample(4) #=> [6, 4, 2, 5]
- */
-
-
-static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
-{
- VALUE nv, result;
- VALUE opts, randgen = rb_cRandom;
- long n, len, i, j, k, idx[10];
- long rnds[numberof(idx)];
-
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
- len = RARRAY_LEN(ary);
- if (argc == 0) {
- if (len < 2)
- i = 0;
- else
- i = RAND_UPTO(len);
-
- return rb_ary_elt(ary, i);
- }
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
- if (n < 0) rb_raise(rb_eArgError, "negative sample number");
- if (n > len) n = len;
- if (n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- rnds[i] = RAND_UPTO(len - i);
- }
- }
- k = len;
- len = RARRAY_LEN(ary);
- if (len < k && n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- if (rnds[i] >= len) return rb_ary_new_capa(0);
- }
- }
- if (n > len) n = len;
- switch (n) {
- case 0:
- return rb_ary_new_capa(0);
- case 1:
- i = rnds[0];
- return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
- case 2:
- i = rnds[0];
- j = rnds[1];
- if (j >= i) j++;
- return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
- case 3:
- i = rnds[0];
- j = rnds[1];
- k = rnds[2];
- {
- long l = j, g = i;
- if (j >= i) l = i, g = ++j;
- if (k >= l && (++k >= g)) ++k;
- }
- return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
- }
- if (n <= numberof(idx)) {
- long sorted[numberof(idx)];
- sorted[0] = idx[0] = rnds[0];
- for (i=1; i<n; i++) {
- k = rnds[i];
- for (j = 0; j < i; ++j) {
- if (k < sorted[j]) break;
- ++k;
- }
- memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
- sorted[j] = idx[i] = k;
- }
- result = rb_ary_new_capa(n);
- RARRAY_PTR_USE(result, ptr_result, {
- for (i=0; i<n; i++) {
- ptr_result[i] = RARRAY_AREF(ary, idx[i]);
- }
- });
- }
- else {
- result = rb_ary_dup(ary);
- RBASIC_CLEAR_CLASS(result);
- RB_GC_GUARD(ary);
- RARRAY_PTR_USE(result, ptr_result, {
- for (i=0; i<n; i++) {
- j = RAND_UPTO(len-i) + i;
- nv = ptr_result[j];
- ptr_result[j] = ptr_result[i];
- ptr_result[i] = nv;
- }
- });
- RBASIC_SET_CLASS_RAW(result, rb_cArray);
- }
- ARY_SET_LEN(result, n);
-
- return result;
-}
-
-static VALUE
-rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
-{
- long mul;
- VALUE n = Qnil;
- if (args && (RARRAY_LEN(args) > 0)) {
- n = RARRAY_AREF(args, 0);
- }
- if (RARRAY_LEN(self) == 0) return INT2FIX(0);
- if (n == Qnil) return DBL2NUM(INFINITY);
- mul = NUM2LONG(n);
- if (mul <= 0) return INT2FIX(0);
- n = LONG2FIX(mul);
- return rb_funcallv(rb_ary_length(self), '*', 1, &n);
-}
-
-/*
- * call-seq:
- * ary.cycle(n=nil) { |obj| block } -> nil
- * ary.cycle(n=nil) -> Enumerator
- *
- * Calls the given block for each element +n+ times or forever if +nil+ is
- * given.
- *
- * Does nothing if a non-positive number is given or the array is empty.
- *
- * Returns +nil+ if the loop has finished without getting interrupted.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = ["a", "b", "c"]
- * a.cycle { |x| puts x } # print, a, b, c, a, b, c,.. forever.
- * a.cycle(2) { |x| puts x } # print, a, b, c, a, b, c.
- *
- */
-
-static VALUE
-rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+rb_ary_nitems(ary)
+ VALUE ary;
{
- long n, i;
- VALUE nv = Qnil;
-
- rb_scan_args(argc, argv, "01", &nv);
+ long n = 0;
+ VALUE *p, *pend;
- RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
- if (NIL_P(nv)) {
- n = -1;
+ p = RARRAY(ary)->ptr;
+ pend = p + RARRAY(ary)->len;
+ while (p < pend) {
+ if (!NIL_P(*p)) n++;
+ p++;
}
- else {
- n = NUM2LONG(nv);
- if (n <= 0) return Qnil;
- }
-
- while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_AREF(ary, i));
- }
- }
- return Qnil;
+ return INT2NUM(n);
}
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
-/*
- * Build a ruby array of the corresponding values and yield it to the
- * associated block.
- * Return the class of +values+ for reentry check.
- */
static int
-yield_indexed_values(const VALUE values, const long r, const long *const p)
-{
- const VALUE result = rb_ary_new2(r);
- VALUE *const result_array = RARRAY_PTR(result);
- const VALUE *const values_array = RARRAY_CONST_PTR(values);
- long i;
-
- for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
- ARY_SET_LEN(result, r);
- rb_yield(result);
- return !RBASIC(values)->klass;
-}
-
-/*
- * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
- *
- * When we have a complete permutation of array indices, copy the values
- * at those indices into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * used: an array of booleans: whether a given index is already used
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
-{
- long i = 0, index = 0;
-
- for (;;) {
- const char *const unused = memchr(&used[i], 0, n-i);
- if (!unused) {
- if (!index) break;
- i = p[--index]; /* pop index */
- used[i++] = 0; /* index unused */
- }
- else {
- i = unused - used;
- p[index] = i;
- used[i] = 1; /* mark index used */
- ++index;
- if (index < r-1) { /* if not done yet */
- p[index] = i = 0;
- continue;
- }
- for (i = 0; i < n; ++i) {
- if (used[i]) continue;
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "permute reentered");
- }
- }
- i = p[--index]; /* pop index */
- used[i] = 0; /* index unused */
- p[index] = ++i;
- }
- }
-}
-
-/*
- * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
- */
-static VALUE
-descending_factorial(long from, long how_many)
-{
- VALUE cnt = LONG2FIX(how_many >= 0);
- while (how_many-- > 0) {
- VALUE v = LONG2FIX(from--);
- cnt = rb_funcallv(cnt, '*', 1, &v);
- }
- return cnt;
-}
-
-static VALUE
-binomial_coefficient(long comb, long size)
-{
- VALUE r, v;
- if (comb > size-comb) {
- comb = size-comb;
- }
- if (comb < 0) {
- return LONG2FIX(0);
- }
- r = descending_factorial(size, comb);
- v = descending_factorial(comb, comb);
- return rb_funcallv(r, id_div, 1, &v);
-}
-
-static VALUE
-rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
-
- return descending_factorial(n, k);
-}
-
-/*
- * call-seq:
- * ary.permutation { |p| block } -> ary
- * ary.permutation -> Enumerator
- * ary.permutation(n) { |p| block } -> ary
- * ary.permutation(n) -> Enumerator
- *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
- *
- * If +n+ is not specified, yield all permutations of all elements.
- *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(1).to_a #=> [[1],[2],[3]]
- * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(0).to_a #=> [[]] # one permutation of length 0
- * a.permutation(4).to_a #=> [] # no permutations of length 4
- */
-
-static VALUE
-rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+flatten(ary, idx, ary2, memo)
+ VALUE ary;
+ long idx;
+ VALUE ary2, memo;
{
- VALUE num;
- long r, n, i;
-
- n = RARRAY_LEN(ary); /* Array length */
- RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
- rb_scan_args(argc, argv, "01", &num);
- r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
+ VALUE id;
+ long i = idx;
+ long n, lim = idx + RARRAY(ary2)->len;
- if (r < 0 || n < r) {
- /* no permutations: yield nothing */
+ id = rb_obj_id(ary2);
+ if (rb_ary_includes(memo, id)) {
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
}
- else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
- }
- else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else { /* this is the general case */
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
- char *used = (char*)(p + r);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
-
- MEMZERO(used, char, n); /* initialize array */
-
- permute0(n, r, p, used, ary0); /* compute and yield permutations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
- return ary;
-}
-
-static void
-combinate0(const long len, const long n, long *const stack, const VALUE values)
-{
- long lev = 0;
-
- MEMZERO(stack+1, long, n);
- stack[0] = -1;
- for (;;) {
- for (lev++; lev < n; lev++) {
- stack[lev+1] = stack[lev]+1;
- }
- if (!yield_indexed_values(values, n, stack+1)) {
- rb_raise(rb_eRuntimeError, "combination reentered");
+ rb_ary_push(memo, id);
+ rb_ary_replace(ary, idx, 1, ary2);
+ while (i < lim) {
+ if (TYPE(RARRAY(ary)->ptr[i]) == T_ARRAY) {
+ n = flatten(ary, i, RARRAY(ary)->ptr[i], memo);
+ i += n; lim += n;
}
- do {
- if (lev == 0) return;
- stack[lev--]++;
- } while (stack[lev+1]+n == len+lev+1);
+ i++;
}
-}
+ rb_ary_pop(memo);
-static VALUE
-rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = NUM2LONG(RARRAY_AREF(args, 0));
-
- return binomial_coefficient(k, n);
+ return lim - idx - 1; /* returns number of increased items */
}
-/*
- * call-seq:
- * ary.combination(n) { |c| block } -> ary
- * ary.combination(n) -> Enumerator
- *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3, 4]
- * a.combination(1).to_a #=> [[1],[2],[3],[4]]
- * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- * a.combination(4).to_a #=> [[1,2,3,4]]
- * a.combination(0).to_a #=> [[]] # one combination of length 0
- * a.combination(5).to_a #=> [] # no combinations of length 5
- *
- */
-
static VALUE
-rb_ary_combination(VALUE ary, VALUE num)
+rb_ary_flatten_bang(ary)
+ VALUE ary;
{
- long i, n, len;
-
- n = NUM2LONG(num);
- RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
- len = RARRAY_LEN(ary);
- if (n < 0 || len < n) {
- /* yield nothing */
- }
- else if (n == 0) {
- rb_yield(rb_ary_new2(0));
- }
- else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else {
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- volatile VALUE t0;
- long *stack = ALLOCV_N(long, t0, n+1);
-
- RBASIC_CLEAR_CLASS(ary0);
- combinate0(len, n, stack, ary0);
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
- return ary;
-}
+ long i = 0;
+ int mod = 0;
+ VALUE memo = Qnil;
-/*
- * Compute repeated permutations of +r+ elements of the set
- * <code>[0..n-1]</code>.
- *
- * When we have a complete repeated permutation of array indices, copy the
- * values at those indices into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-rpermute0(const long n, const long r, long *const p, const VALUE values)
-{
- long i = 0, index = 0;
+ rb_ary_modify(ary);
+ while (i<RARRAY(ary)->len) {
+ VALUE ary2 = RARRAY(ary)->ptr[i];
- p[index] = i;
- for (;;) {
- if (++index < r-1) {
- p[index] = i = 0;
- continue;
- }
- for (i = 0; i < n; ++i) {
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "repeated permute reentered");
+ if (TYPE(ary2) == T_ARRAY) {
+ if (NIL_P(memo)) {
+ memo = rb_ary_new();
}
+ i += flatten(ary, i, ary2, memo);
+ mod = 1;
}
- do {
- if (index <= 0) return;
- } while ((i = ++p[--index]) >= n);
- }
-}
-
-static VALUE
-rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = NUM2LONG(RARRAY_AREF(args, 0));
- VALUE v;
-
- if (k < 0) {
- return LONG2FIX(0);
- }
-
- v = LONG2NUM(k);
- return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
-}
-
-/*
- * call-seq:
- * ary.repeated_permutation(n) { |p| block } -> ary
- * ary.repeated_permutation(n) -> Enumerator
- *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2]
- * a.repeated_permutation(1).to_a #=> [[1], [2]]
- * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
- * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
- */
-
-static VALUE
-rb_ary_repeated_permutation(VALUE ary, VALUE num)
-{
- long r, n, i;
-
- n = RARRAY_LEN(ary); /* Array length */
- RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size); /* Return Enumerator if no block */
- r = NUM2LONG(num); /* Permutation size from argument */
-
- if (r < 0) {
- /* no permutations: yield nothing */
- }
- else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
- }
- else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else { /* this is the general case */
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, r);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
-
- rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ i++;
}
+ if (mod == 0) return Qnil;
return ary;
}
-static void
-rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
-{
- long i = 0, index = 0;
-
- p[index] = i;
- for (;;) {
- if (++index < r-1) {
- p[index] = i;
- continue;
- }
- for (; i < n; ++i) {
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "repeated combination reentered");
- }
- }
- do {
- if (index <= 0) return;
- } while ((i = ++p[--index]) >= n);
- }
-}
-
static VALUE
-rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = NUM2LONG(RARRAY_AREF(args, 0));
- if (k == 0) {
- return LONG2FIX(1);
- }
- return binomial_coefficient(k, n + k - 1);
-}
-
-/*
- * call-seq:
- * ary.repeated_combination(n) { |c| block } -> ary
- * ary.repeated_combination(n) -> Enumerator
- *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
- * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
- *
- */
-
-static VALUE
-rb_ary_repeated_combination(VALUE ary, VALUE num)
+rb_ary_flatten(ary)
+ VALUE ary;
{
- long n, i, len;
-
- n = NUM2LONG(num); /* Combination size from argument */
- RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size); /* Return enumerator if no block */
- len = RARRAY_LEN(ary);
- if (n < 0) {
- /* yield nothing */
- }
- else if (n == 0) {
- rb_yield(rb_ary_new2(0));
- }
- else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else if (len == 0) {
- /* yield nothing */
- }
- else {
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, n);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
-
- rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
+ ary = rb_obj_dup(ary);
+ rb_ary_flatten_bang(ary);
return ary;
}
-/*
- * call-seq:
- * ary.product(other_ary, ...) -> new_ary
- * ary.product(other_ary, ...) { |p| block } -> ary
- *
- * Returns an array of all combinations of elements from all arrays.
- *
- * The length of the returned array is the product of the length of +self+ and
- * the argument arrays.
- *
- * If given a block, #product will yield all combinations and return +self+
- * instead.
- *
- * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
- * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- * [1,2].product() #=> [[1],[2]]
- * [1,2].product([]) #=> []
- */
-
-static VALUE
-rb_ary_product(int argc, VALUE *argv, VALUE ary)
-{
- int n = argc+1; /* How many arrays we're operating on */
- volatile VALUE t0 = tmpary(n);
- volatile VALUE t1 = tmpbuf(n, sizeof(int));
- VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
- int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
- VALUE result = Qnil; /* The array we'll be returning, when no block given */
- long i,j;
- long resultlen = 1;
-
- RBASIC_CLEAR_CLASS(t0);
- RBASIC_CLEAR_CLASS(t1);
-
- /* initialize the arrays of arrays */
- ARY_SET_LEN(t0, n);
- arrays[0] = ary;
- for (i = 1; i < n; i++) arrays[i] = Qnil;
- for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
-
- /* initialize the counters for the arrays */
- for (i = 0; i < n; i++) counters[i] = 0;
-
- /* Otherwise, allocate and fill in an array of results */
- if (rb_block_given_p()) {
- /* Make defensive copies of arrays; exit if any is empty */
- for (i = 0; i < n; i++) {
- if (RARRAY_LEN(arrays[i]) == 0) goto done;
- arrays[i] = ary_make_shared_copy(arrays[i]);
- }
- }
- else {
- /* Compute the length of the result array; return [] if any is empty */
- for (i = 0; i < n; i++) {
- long k = RARRAY_LEN(arrays[i]);
- if (k == 0) {
- result = rb_ary_new2(0);
- goto done;
- }
- if (MUL_OVERFLOW_LONG_P(resultlen, k))
- rb_raise(rb_eRangeError, "too big to product");
- resultlen *= k;
- }
- result = rb_ary_new2(resultlen);
- }
- for (;;) {
- int m;
- /* fill in one subarray */
- VALUE subarray = rb_ary_new2(n);
- for (j = 0; j < n; j++) {
- rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
- }
-
- /* put it on the result array */
- if (NIL_P(result)) {
- FL_SET(t0, FL_USER5);
- rb_yield(subarray);
- if (! FL_TEST(t0, FL_USER5)) {
- rb_raise(rb_eRuntimeError, "product reentered");
- }
- else {
- FL_UNSET(t0, FL_USER5);
- }
- }
- else {
- rb_ary_push(result, subarray);
- }
-
- /*
- * Increment the last counter. If it overflows, reset to 0
- * and increment the one before it.
- */
- m = n-1;
- counters[m]++;
- while (counters[m] == RARRAY_LEN(arrays[m])) {
- counters[m] = 0;
- /* If the first counter overflows, we are done */
- if (--m < 0) goto done;
- counters[m]++;
- }
- }
-done:
- tmpary_discard(t0);
- tmpbuf_discard(t1);
-
- return NIL_P(result) ? ary : result;
-}
-
-/*
- * call-seq:
- * ary.take(n) -> new_ary
- *
- * Returns first +n+ elements from the array.
- *
- * If a negative number is given, raises an ArgumentError.
- *
- * See also Array#drop
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take(3) #=> [1, 2, 3]
- *
- */
-
-static VALUE
-rb_ary_take(VALUE obj, VALUE n)
-{
- long len = NUM2LONG(n);
- if (len < 0) {
- rb_raise(rb_eArgError, "attempt to take negative size");
- }
- return rb_ary_subseq(obj, 0, len);
-}
-
-/*
- * call-seq:
- * ary.take_while { |obj| block } -> new_ary
- * ary.take_while -> Enumerator
- *
- * Passes elements to the block until the block returns +nil+ or +false+, then
- * stops iterating and returns an array of all prior elements.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#drop_while
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take_while { |i| i < 3 } #=> [1, 2]
- *
- */
-
-static VALUE
-rb_ary_take_while(VALUE ary)
-{
- long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
- }
- return rb_ary_take(ary, LONG2FIX(i));
-}
-
-/*
- * call-seq:
- * ary.drop(n) -> new_ary
- *
- * Drops first +n+ elements from +ary+ and returns the rest of the elements in
- * an array.
- *
- * If a negative number is given, raises an ArgumentError.
- *
- * See also Array#take
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop(3) #=> [4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop(VALUE ary, VALUE n)
-{
- VALUE result;
- long pos = NUM2LONG(n);
- if (pos < 0) {
- rb_raise(rb_eArgError, "attempt to drop negative size");
- }
-
- result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
- if (result == Qnil) result = rb_ary_new();
- return result;
-}
-
-/*
- * call-seq:
- * ary.drop_while { |obj| block } -> new_ary
- * ary.drop_while -> Enumerator
- *
- * Drops elements up to, but not including, the first element for which the
- * block returns +nil+ or +false+ and returns an array containing the
- * remaining elements.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#take_while
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop_while(VALUE ary)
-{
- long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
- }
- return rb_ary_drop(ary, LONG2FIX(i));
-}
-
-/*
- * call-seq:
- * ary.any? [{ |obj| block }] -> true or false
- *
- * See also Enumerable#any?
- */
-
-static VALUE
-rb_ary_any_p(VALUE ary)
-{
- long i, len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
-
- if (!len) return Qfalse;
- if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
- }
- }
- return Qfalse;
-}
-
-/*
- * call-seq:
- * ary.dig(idx, ...) -> object
- *
- * Extracts the nested value specified by the sequence of <i>idx</i>
- * objects by calling +dig+ at each step, returning +nil+ if any
- * intermediate step is +nil+.
- *
- * a = [[1, [2, 3]]]
- *
- * a.dig(0, 1, 1) #=> 3
- * a.dig(1, 2, 3) #=> nil
- * a.dig(0, 0, 0) #=> TypeError: Fixnum does not have #dig method
- * [42, {foo: :bar}].dig(1, :foo) #=> :bar
- */
-
-VALUE
-rb_ary_dig(int argc, VALUE *argv, VALUE self)
-{
- rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
- self = rb_ary_at(self, *argv);
- if (!--argc) return self;
- ++argv;
- return rb_obj_dig(argc, argv, self, Qnil);
-}
-
-/*
- * call-seq:
- * ary.sum(init=0) -> number
- * ary.sum(init=0) {|e| expr } -> number
- *
- * Returns the sum of elements.
- * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
- *
- * If a block is given, the block is applied to each element
- * before addition.
- *
- * If <i>ary</i> is empty, it returns <i>init</i>.
- *
- * [].sum #=> 0
- * [].sum(0.0) #=> 0.0
- * [1, 2, 3].sum #=> 6
- * [3, 5.5].sum #=> 8.5
- * [2.5, 3.0].sum(0.0) {|e| e * e } #=> 15.25
- * [Object.new].sum #=> TypeError
- *
- * The (arithmetic) mean value of an array can be obtained as follows.
- *
- * mean = ary.sum(0.0) / ary.length
- *
- * This method can be used for non-numeric objects by
- * explicit <i>init</i> argument.
- *
- * ["a", "b", "c"].sum("") #=> "abc"
- * [[1], [[2]], [3]].sum([]) #=> [1, [2], 3]
- *
- * However, Array#join and Array#flatten is faster than Array#sum.
- *
- * ["a", "b", "c"].join #=> "abc"
- * [[1], [[2]], [3]].flatten(1) #=> [1, [2], 3]
- *
- *
- * Array#sum method may not respect method redefinition of "+" methods
- * such as Fixnum#+.
- *
- */
-
-static VALUE
-rb_ary_sum(int argc, VALUE *argv, VALUE ary)
-{
- VALUE e, v, r;
- long i, n;
- int block_given;
-
- if (rb_scan_args(argc, argv, "01", &v) == 0)
- v = LONG2FIX(0);
-
- block_given = rb_block_given_p();
-
- if (RARRAY_LEN(ary) == 0)
- return v;
-
- n = 0;
- r = Qundef;
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (block_given)
- e = rb_yield(e);
- if (FIXNUM_P(e)) {
- n += FIX2LONG(e); /* should not overflow long type */
- if (!FIXABLE(n)) {
- v = rb_big_plus(LONG2NUM(n), v);
- n = 0;
- }
- }
- else if (RB_TYPE_P(e, T_BIGNUM))
- v = rb_big_plus(e, v);
- else if (RB_TYPE_P(e, T_RATIONAL)) {
- if (r == Qundef)
- r = e;
- else
- r = rb_rational_plus(r, e);
- }
- else
- goto not_exact;
- }
- if (n != 0)
- v = rb_fix_plus(LONG2FIX(n), v);
- if (r != Qundef) {
- /* r can be a Integer when mathn is loaded */
- if (FIXNUM_P(r))
- v = rb_fix_plus(r, v);
- else if (RB_TYPE_P(r, T_BIGNUM))
- v = rb_big_plus(r, v);
- else
- v = rb_rational_plus(r, v);
- }
- return v;
-
- not_exact:
- if (n != 0)
- v = rb_fix_plus(LONG2FIX(n), v);
- if (r != Qundef) {
- /* r can be a Integer when mathn is loaded */
- if (FIXNUM_P(r))
- v = rb_fix_plus(r, v);
- else if (RB_TYPE_P(r, T_BIGNUM))
- v = rb_big_plus(r, v);
- else
- v = rb_rational_plus(r, v);
- }
-
- if (RB_FLOAT_TYPE_P(e)) {
- /* Kahan's compensated summation algorithm */
- double f, c;
-
- f = NUM2DBL(v);
- c = 0.0;
- goto has_float_value;
- for (; i < RARRAY_LEN(ary); i++) {
- double x, y, t;
- e = RARRAY_AREF(ary, i);
- if (block_given)
- e = rb_yield(e);
- if (RB_FLOAT_TYPE_P(e))
- has_float_value:
- x = RFLOAT_VALUE(e);
- else if (FIXNUM_P(e))
- x = FIX2LONG(e);
- else if (RB_TYPE_P(e, T_BIGNUM))
- x = rb_big2dbl(e);
- else if (RB_TYPE_P(e, T_RATIONAL))
- x = rb_num2dbl(e);
- else
- goto not_float;
-
- y = x - c;
- t = f + y;
- c = (t - f) - y;
- f = t;
- }
- return DBL2NUM(f);
-
- not_float:
- v = DBL2NUM(f);
- }
-
- goto has_some_value;
- for (; i < RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (block_given)
- e = rb_yield(e);
- has_some_value:
- v = rb_funcall(v, idPLUS, 1, e);
- }
- return v;
-}
-
-/*
- * Arrays are ordered, integer-indexed collections of any object.
- *
- * Array indexing starts at 0, as in C or Java. A negative index is assumed
- * to be relative to the end of the array---that is, an index of -1 indicates
- * the last element of the array, -2 is the next to last element in the
- * array, and so on.
- *
- * == Creating Arrays
- *
- * A new array can be created by using the literal constructor
- * <code>[]</code>. Arrays can contain different types of objects. For
- * example, the array below contains an Integer, a String and a Float:
- *
- * ary = [1, "two", 3.0] #=> [1, "two", 3.0]
- *
- * An array can also be created by explicitly calling Array.new with zero, one
- * (the initial size of the Array) or two arguments (the initial size and a
- * default object).
- *
- * ary = Array.new #=> []
- * Array.new(3) #=> [nil, nil, nil]
- * Array.new(3, true) #=> [true, true, true]
- *
- * Note that the second argument populates the array with references to the
- * same object. Therefore, it is only recommended in cases when you need to
- * instantiate arrays with natively immutable objects such as Symbols,
- * numbers, true or false.
- *
- * To create an array with separate objects a block can be passed instead.
- * This method is safe to use with mutable objects such as hashes, strings or
- * other arrays:
- *
- * Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
- *
- * This is also a quick way to build up multi-dimensional arrays:
- *
- * empty_table = Array.new(3) { Array.new(3) }
- * #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
- *
- * An array can also be created by using the Array() method, provided by
- * Kernel, which tries to call #to_ary, then #to_a on its argument.
- *
- * Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
- *
- * == Example Usage
- *
- * In addition to the methods it mixes in through the Enumerable module, the
- * Array class has proprietary methods for accessing, searching and otherwise
- * manipulating arrays.
- *
- * Some of the more common ones are illustrated below.
- *
- * == Accessing Elements
- *
- * Elements in an array can be retrieved using the Array#[] method. It can
- * take a single integer argument (a numeric index), a pair of arguments
- * (start and length) or a range. Negative indices start counting from the end,
- * with -1 being the last element.
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr[2] #=> 3
- * arr[100] #=> nil
- * arr[-3] #=> 4
- * arr[2, 3] #=> [3, 4, 5]
- * arr[1..4] #=> [2, 3, 4, 5]
- * arr[1..-3] #=> [2, 3, 4]
- *
- * Another way to access a particular array element is by using the #at method
- *
- * arr.at(0) #=> 1
- *
- * The #slice method works in an identical manner to Array#[].
- *
- * To raise an error for indices outside of the array bounds or else to
- * provide a default value when that happens, you can use #fetch.
- *
- * arr = ['a', 'b', 'c', 'd', 'e', 'f']
- * arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
- * arr.fetch(100, "oops") #=> "oops"
- *
- * The special methods #first and #last will return the first and last
- * elements of an array, respectively.
- *
- * arr.first #=> 1
- * arr.last #=> 6
- *
- * To return the first +n+ elements of an array, use #take
- *
- * arr.take(3) #=> [1, 2, 3]
- *
- * #drop does the opposite of #take, by returning the elements after +n+
- * elements have been dropped:
- *
- * arr.drop(3) #=> [4, 5, 6]
- *
- * == Obtaining Information about an Array
- *
- * Arrays keep track of their own length at all times. To query an array
- * about the number of elements it contains, use #length, #count or #size.
- *
- * browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
- * browsers.length #=> 5
- * browsers.count #=> 5
- *
- * To check whether an array contains any elements at all
- *
- * browsers.empty? #=> false
- *
- * To check whether a particular item is included in the array
- *
- * browsers.include?('Konqueror') #=> false
- *
- * == Adding Items to Arrays
- *
- * Items can be added to the end of an array by using either #push or #<<
- *
- * arr = [1, 2, 3, 4]
- * arr.push(5) #=> [1, 2, 3, 4, 5]
- * arr << 6 #=> [1, 2, 3, 4, 5, 6]
- *
- * #unshift will add a new item to the beginning of an array.
- *
- * arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
- *
- * With #insert you can add a new element to an array at any position.
- *
- * arr.insert(3, 'apple') #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
- *
- * Using the #insert method, you can also insert multiple values at once:
- *
- * arr.insert(3, 'orange', 'pear', 'grapefruit')
- * #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
- *
- * == Removing Items from an Array
- *
- * The method #pop removes the last element in an array and returns it:
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr.pop #=> 6
- * arr #=> [1, 2, 3, 4, 5]
- *
- * To retrieve and at the same time remove the first item, use #shift:
- *
- * arr.shift #=> 1
- * arr #=> [2, 3, 4, 5]
- *
- * To delete an element at a particular index:
- *
- * arr.delete_at(2) #=> 4
- * arr #=> [2, 3, 5]
- *
- * To delete a particular element anywhere in an array, use #delete:
- *
- * arr = [1, 2, 2, 3]
- * arr.delete(2) #=> 2
- * arr #=> [1,3]
- *
- * A useful method if you need to remove +nil+ values from an array is
- * #compact:
- *
- * arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
- * arr.compact #=> ['foo', 0, 'bar', 7, 'baz']
- * arr #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
- * arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
- * arr #=> ['foo', 0, 'bar', 7, 'baz']
- *
- * Another common need is to remove duplicate elements from an array.
- *
- * It has the non-destructive #uniq, and destructive method #uniq!
- *
- * arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
- * arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
- *
- * == Iterating over Arrays
- *
- * Like all classes that include the Enumerable module, Array has an each
- * method, which defines what elements should be iterated over and how. In
- * case of Array's #each, all elements in the Array instance are yielded to
- * the supplied block in sequence.
- *
- * Note that this operation leaves the array unchanged.
- *
- * arr = [1, 2, 3, 4, 5]
- * arr.each { |a| print a -= 10, " " }
- * # prints: -9 -8 -7 -6 -5
- * #=> [1, 2, 3, 4, 5]
- *
- * Another sometimes useful iterator is #reverse_each which will iterate over
- * the elements in the array in reverse order.
- *
- * words = %w[first second third fourth fifth sixth]
- * str = ""
- * words.reverse_each { |word| str += "#{word} " }
- * p str #=> "sixth fifth fourth third second first "
- *
- * The #map method can be used to create a new array based on the original
- * array, but with the values modified by the supplied block:
- *
- * arr.map { |a| 2*a } #=> [2, 4, 6, 8, 10]
- * arr #=> [1, 2, 3, 4, 5]
- * arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
- * arr #=> [1, 4, 9, 16, 25]
- *
- * == Selecting Items from an Array
- *
- * Elements can be selected from an array according to criteria defined in a
- * block. The selection can happen in a destructive or a non-destructive
- * manner. While the destructive operations will modify the array they were
- * called on, the non-destructive methods usually return a new array with the
- * selected elements, but leave the original array unchanged.
- *
- * === Non-destructive Selection
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr.select { |a| a > 3 } #=> [4, 5, 6]
- * arr.reject { |a| a < 3 } #=> [3, 4, 5, 6]
- * arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
- * arr #=> [1, 2, 3, 4, 5, 6]
- *
- * === Destructive Selection
- *
- * #select! and #reject! are the corresponding destructive methods to #select
- * and #reject
- *
- * Similar to #select vs. #reject, #delete_if and #keep_if have the exact
- * opposite result when supplied with the same block:
- *
- * arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
- * arr #=> [4, 5, 6]
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
- * arr #=> [1, 2, 3]
- *
- */
-
void
-Init_Array(void)
+Init_Array()
{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
- rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+ rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
- rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
- rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
-
+ rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
- rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
- rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
- rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
+ rb_define_method(rb_cArray, "to_ary", rb_ary_to_a, 0);
rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
rb_define_method(rb_cArray, "hash", rb_ary_hash, 0);
+ rb_define_method(rb_cArray, "===", rb_ary_equal, 1);
rb_define_method(rb_cArray, "[]", rb_ary_aref, -1);
rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
rb_define_method(rb_cArray, "at", rb_ary_at, 1);
- rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
- rb_define_method(rb_cArray, "first", rb_ary_first, -1);
- rb_define_method(rb_cArray, "last", rb_ary_last, -1);
- rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+ rb_define_method(rb_cArray, "first", rb_ary_first, 0);
+ rb_define_method(rb_cArray, "last", rb_ary_last, 0);
+ rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
- rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
- rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+ rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
+ rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
- rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
rb_define_alias(rb_cArray, "size", "length");
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
- rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
- rb_define_method(rb_cArray, "index", rb_ary_index, -1);
- rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+ rb_define_method(rb_cArray, "index", rb_ary_index, 1);
+ rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
+ rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
+ rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
+ rb_define_method(rb_cArray, "clone", rb_ary_clone, 0);
rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
- rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
- rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
- rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
- rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
- rb_define_method(rb_cArray, "select", rb_ary_select, 0);
- rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
- rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
- rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
+ rb_define_method(rb_cArray, "filter", rb_ary_filter, 0);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
rb_define_method(rb_cArray, "delete_if", rb_ary_delete_if, 0);
- rb_define_method(rb_cArray, "reject", rb_ary_reject, 0);
rb_define_method(rb_cArray, "reject!", rb_ary_reject_bang, 0);
- rb_define_method(rb_cArray, "zip", rb_ary_zip, -1);
- rb_define_method(rb_cArray, "transpose", rb_ary_transpose, 0);
- rb_define_method(rb_cArray, "replace", rb_ary_replace, 1);
+ rb_define_method(rb_cArray, "replace", rb_ary_replace_m, 1);
rb_define_method(rb_cArray, "clear", rb_ary_clear, 0);
rb_define_method(rb_cArray, "fill", rb_ary_fill, -1);
rb_define_method(rb_cArray, "include?", rb_ary_includes, 1);
@@ -6158,38 +1720,13 @@ Init_Array(void)
rb_define_method(rb_cArray, "&", rb_ary_and, 1);
rb_define_method(rb_cArray, "|", rb_ary_or, 1);
- rb_define_method(rb_cArray, "max", rb_ary_max, -1);
- rb_define_method(rb_cArray, "min", rb_ary_min, -1);
-
rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
- rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
- rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
- rb_define_method(rb_cArray, "count", rb_ary_count, -1);
- rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
- rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
- rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
- rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
- rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
- rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
- rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
- rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
- rb_define_method(rb_cArray, "product", rb_ary_product, -1);
-
- rb_define_method(rb_cArray, "take", rb_ary_take, 1);
- rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
- rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
- rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
- rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
- rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
- rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
- rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
- rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
-
- id_cmp = rb_intern("<=>");
- id_random = rb_intern("random");
- id_div = rb_intern("div");
- id_power = rb_intern("**");
+ rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
+ rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
+ rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
+
+ cmp = rb_intern("<=>");
}
diff --git a/basictest/runner.rb b/basictest/runner.rb
deleted file mode 100755
index 0330b6d506..0000000000
--- a/basictest/runner.rb
+++ /dev/null
@@ -1,33 +0,0 @@
-#! ./miniruby
-
-exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
-ruby = ENV["RUBY"]
-unless ruby
- load './rbconfig.rb'
- ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
-end
-unless File.exist? ruby
- print "#{ruby} is not found.\n"
- print "Try `make' first, then `make test', please.\n"
- exit false
-end
-ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
-
-$stderr.reopen($stdout)
-error = ''
-
-srcdir = File.expand_path('..', File.dirname(__FILE__))
-if opt = ENV["RUBYOPT"]
- ENV["RUBYOPT"] = opt + " -W1"
-end
-`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
- if line =~ /^end of test/
- print "\ntest succeeded\n"
- exit true
- end
- error << line if %r:^(basictest/test.rb|not): =~ line
-end
-puts
-print error
-print "test failed\n"
-exit false
diff --git a/basictest/test.rb b/basictest/test.rb
deleted file mode 100755
index 8472a0d14a..0000000000
--- a/basictest/test.rb
+++ /dev/null
@@ -1,2367 +0,0 @@
-#! /usr/bin/env ruby
-# -*- coding: us-ascii -*-
-
-$testnum=0
-$ntest=0
-$failed = 0
-class Progress
- def initialize
- @color = nil
- @tty = nil
- @quiet = nil
- @verbose = nil
- ARGV.each do |arg|
- case arg
- when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
- warn "unknown --color argument: #$3" if $3
- @color = $1 ? nil : !$2
- when /\A--tty(=(?:yes|(no)|(.*)))?\z/
- warn "unknown --tty argument: #$3" if $3
- @tty = !$1 || !$2
- true
- when /\A-(q|-quiet)\z/
- @quiet = true
- when /\A-(v|-verbose)\z/
- @verbose = true
- end
- end
- @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
- @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
- case @color
- when nil
- @color = @tty
- end
- if @color
- # dircolors-like style
- colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
- begin
- File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
- colors[n] ||= c
- end
- rescue
- end
- @passed = "\e[;#{colors["pass"] || "32"}m"
- @failed = "\e[;#{colors["fail"] || "31"}m"
- @reset = "\e[m"
- else
- @passed = @failed = @reset = ""
- end
- extend(Rotator) if @tty
- end
-
- def passed_string
- "."
- end
- def failed_string
- "#{@failed}F#{@reset}"
- end
- def init_string
- end
- def finish_string
- if @quiet
- @eol
- else
- "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
- end
- end
- def pass
- STDERR.print passed_string
- end
- def fail
- @ok = false
- STDERR.print failed_string
- end
- def init
- @ok = true
- STDERR.print init_string
- end
- def finish
- STDERR.print finish_string
- end
-
- module Rotator
- ROTATOR = %w[- \\ | /]
- BS = "\b" * ROTATOR[0].size
- def passed_string
- "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
- end
- def failed_string
- "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
- end
- def init_string
- @count = 0
- " "
- end
- def finish_string
- s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
- s.gsub!(/\n/, "\r\e[2K\r") if @quiet
- s
- end
- end
-end
-PROGRESS = Progress.new
-
-def test_check(what)
- unless $ntest.zero?
- PROGRESS.finish
- end
- STDERR.print "#{$0}:#{what} "
- PROGRESS.init
- $what = what
- $testnum = 0
-end
-
-def test_ok(cond,n=1)
- $testnum+=1
- $ntest+=1
- where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
- if cond
- PROGRESS.pass
- printf "ok %d (%s)\n", $testnum, where
- else
- PROGRESS.fail
- printf "not ok %s %d -- %s\n", $what, $testnum, where
- $failed+=1
- end
- STDOUT.flush
- STDERR.flush
-end
-
-# make sure conditional operators work
-
-test_check "assignment"
-
-a=[]; a[0] ||= "bar";
-test_ok(a[0] == "bar")
-h={}; h["foo"] ||= "bar";
-test_ok(h["foo"] == "bar")
-
-aa = 5
-aa ||= 25
-test_ok(aa == 5)
-bb ||= 25
-test_ok(bb == 25)
-cc &&=33
-test_ok(cc == nil)
-cc = 5
-cc &&=44
-test_ok(cc == 44)
-
-a = nil; test_ok(a == nil)
-a = 1; test_ok(a == 1)
-a = []; test_ok(a == [])
-a = [1]; test_ok(a == [1])
-a = [nil]; test_ok(a == [nil])
-a = [[]]; test_ok(a == [[]])
-a = [1,2]; test_ok(a == [1,2])
-a = [*[]]; test_ok(a == [])
-a = [*[1]]; test_ok(a == [1])
-a = [*[1,2]]; test_ok(a == [1,2])
-
-a = *[]; test_ok(a == [])
-a = *[1]; test_ok(a == [1])
-a = *[nil]; test_ok(a == [nil])
-a = *[[]]; test_ok(a == [[]])
-a = *[1,2]; test_ok(a == [1,2])
-a = *[*[]]; test_ok(a == [])
-a = *[*[1]]; test_ok(a == [1])
-a = *[*[1,2]]; test_ok(a == [1,2])
-
-a, = nil; test_ok(a == nil)
-a, = 1; test_ok(a == 1)
-a, = []; test_ok(a == nil)
-a, = [1]; test_ok(a == 1)
-a, = [nil]; test_ok(a == nil)
-a, = [[]]; test_ok(a == [])
-a, = 1,2; test_ok(a == 1)
-a, = [1,2]; test_ok(a == 1)
-a, = [*[]]; test_ok(a == nil)
-a, = [*[1]]; test_ok(a == 1)
-a, = *[1,2]; test_ok(a == 1)
-a, = [*[1,2]]; test_ok(a == 1)
-
-a, = *[]; test_ok(a == nil)
-a, = *[1]; test_ok(a == 1)
-a, = *[nil]; test_ok(a == nil)
-a, = *[[]]; test_ok(a == [])
-a, = *[1,2]; test_ok(a == 1)
-a, = *[*[]]; test_ok(a == nil)
-a, = *[*[1]]; test_ok(a == 1)
-a, = *[*[1,2]]; test_ok(a == 1)
-
-*a = nil; test_ok(a == [nil])
-*a = 1; test_ok(a == [1])
-*a = []; test_ok(a == [])
-*a = [1]; test_ok(a == [1])
-*a = [nil]; test_ok(a == [nil])
-*a = [[]]; test_ok(a == [[]])
-*a = [1,2]; test_ok(a == [1,2])
-*a = [*[]]; test_ok(a == [])
-*a = [*[1]]; test_ok(a == [1])
-*a = [*[1,2]]; test_ok(a == [1,2])
-
-*a = *[]; test_ok(a == [])
-*a = *[1]; test_ok(a == [1])
-*a = *[nil]; test_ok(a == [nil])
-*a = *[[]]; test_ok(a == [[]])
-*a = *[1,2]; test_ok(a == [1,2])
-*a = *[*[]]; test_ok(a == [])
-*a = *[*[1]]; test_ok(a == [1])
-*a = *[*[1,2]]; test_ok(a == [1,2])
-
-a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-def f; yield nil; end; f {|a| test_ok(a == nil)}
-def f; yield 1; end; f {|a| test_ok(a == 1)}
-def f; yield []; end; f {|a| test_ok(a == [])}
-def f; yield [1]; end; f {|a| test_ok(a == [1])}
-def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
-def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
-def f; yield [*[]]; end; f {|a| test_ok(a == [])}
-def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
-def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
-def f; yield *[]; end; f {|a| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a| test_ok(a == [])}
-def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
-
-def f; yield; end; f {|a,| test_ok(a == nil)}
-def f; yield nil; end; f {|a,| test_ok(a == nil)}
-def f; yield 1; end; f {|a,| test_ok(a == 1)}
-def f; yield []; end; f {|a,| test_ok(a == nil)}
-def f; yield [1]; end; f {|a,| test_ok(a == 1)}
-def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield [[]]; end; f {|a,| test_ok(a == [])}
-def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield *[]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield; end; f {|*a| test_ok(a == [])}
-def f; yield nil; end; f {|*a| test_ok(a == [nil])}
-def f; yield 1; end; f {|*a| test_ok(a == [1])}
-def f; yield []; end; f {|*a| test_ok(a == [[]])}
-def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
-def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
-def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
-def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
-
-def f; yield *[]; end; f {|*a| test_ok(a == [])}
-def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
-def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
-def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
-
-def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
-def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def r; return; end; a = r(); test_ok(a == nil)
-def r; return nil; end; a = r(); test_ok(a == nil)
-def r; return 1; end; a = r(); test_ok(a == 1)
-def r; return []; end; a = r(); test_ok(a == [])
-def r; return [1]; end; a = r(); test_ok(a == [1])
-def r; return [nil]; end; a = r(); test_ok(a == [nil])
-def r; return [[]]; end; a = r(); test_ok(a == [[]])
-def r; return [*[]]; end; a = r(); test_ok(a == [])
-def r; return [*[1]]; end; a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; a = r(); test_ok(a == [])
-def r; return *[1]; end; a = r(); test_ok(a == [1])
-def r; return *[nil]; end; a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; a = r(); test_ok(a == [[]])
-def r; return *[*[]]; end; a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
-def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
-
-def r; return; end; *a = r(); test_ok(a == [nil])
-def r; return nil; end; *a = r(); test_ok(a == [nil])
-def r; return 1; end; *a = r(); test_ok(a == [1])
-def r; return []; end; *a = r(); test_ok(a == [])
-def r; return [1]; end; *a = r(); test_ok(a == [1])
-def r; return [nil]; end; *a = r(); test_ok(a == [nil])
-def r; return [[]]; end; *a = r(); test_ok(a == [[]])
-def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return [*[]]; end; *a = r(); test_ok(a == [])
-def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; *a = r(); test_ok(a == [])
-def r; return *[1]; end; *a = r(); test_ok(a == [1])
-def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return *[*[]]; end; *a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
-def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
-
-def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-f = lambda {|r,| test_ok([] == r)}
-f.call([], *[])
-
-f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
-f.call([], *[1])
-
-f = lambda{|x| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|x,| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|*x| x}
-test_ok(f.call(42) == [42])
-test_ok(f.call([42]) == [[42]])
-test_ok(f.call([[42]]) == [[[42]]])
-test_ok(f.call([42,55]) == [[42,55]])
-test_ok(f.call(42,55) == [42,55])
-
-f = lambda { |a, b=42, *c| [a,b,c] }
-test_ok(f.call(1 ) == [1,42,[ ]] )
-test_ok(f.call(1,43 ) == [1,43,[ ]] )
-test_ok(f.call(1,43,44) == [1,43,[44]] )
-
-f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
-test_ok(f.call(8 ) == [8,24,[ ],nil] )
-test_ok(f.call(8,43 ) == [8,43,[ ],nil] )
-test_ok(f.call(8,43,44) == [8,43,[44],nil] )
-test_ok(f.call(8 ){45} == [8,24,[ ],45 ] )
-test_ok(f.call(8,43 ){45} == [8,43,[ ],45 ] )
-test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
-
-f = lambda { |a, b=42, *c, d| [a,b,c,d] }
-test_ok(f.call(1 ,99) == [1,42,[ ],99] )
-test_ok(f.call(1,43 ,99) == [1,43,[ ],99] )
-test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
-
-f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
-test_ok(f.call(8 ) == [8,24,nil] )
-test_ok(f.call(8,43) == [8,43,nil] )
-test_ok(f.call(8,43) == [8,43,nil] )
-test_ok(f.call(8 ){45} == [8,24,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-
-f = lambda { |a, b=42, d| [a,b,d] }
-test_ok(f.call(1 ,99) == [1,42,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-
-f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
-test_ok(f.call( ) == [42,[ ],nil] )
-test_ok(f.call(43 ) == [43,[ ],nil] )
-test_ok(f.call(43,44) == [43,[44],nil] )
-test_ok(f.call( ){45} == [42,[ ],45 ] )
-test_ok(f.call(43 ){45} == [43,[ ],45 ] )
-test_ok(f.call(43,44){45} == [43,[44],45 ] )
-
-f = lambda { |b=42, *c, d| [b,c,d] }
-test_ok(f.call( 99) == [42,[ ],99] )
-test_ok(f.call(43 ,99) == [43,[ ],99] )
-test_ok(f.call(43,44,99) == [43,[44],99] )
-
-f = lambda { |b=42, &block| [b,block&&block[]] }
-test_ok(f.call( ) == [42,nil] )
-test_ok(f.call(43) == [43,nil] )
-test_ok(f.call(43) == [43,nil] )
-test_ok(f.call( ){45} == [42,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-
-f = lambda { |b=42, d| [b,d] }
-test_ok(f.call( 99) == [42,99] )
-test_ok(f.call(43,99) == [43,99] )
-test_ok(f.call(43,99) == [43,99] )
-
-
-a,=*[1]
-test_ok(a == 1)
-a,=*[[1]]
-test_ok(a == [1])
-a,=*[[[1]]]
-test_ok(a == [[1]])
-
-x, (y, z) = 1, 2, 3
-test_ok([1,2,nil] == [x,y,z])
-x, (y, z) = 1, [2,3]
-test_ok([1,2,3] == [x,y,z])
-x, (y, z) = 1, [2]
-test_ok([1,2,nil] == [x,y,z])
-
-a = loop do break; end; test_ok(a == nil)
-a = loop do break nil; end; test_ok(a == nil)
-a = loop do break 1; end; test_ok(a == 1)
-a = loop do break []; end; test_ok(a == [])
-a = loop do break [1]; end; test_ok(a == [1])
-a = loop do break [nil]; end; test_ok(a == [nil])
-a = loop do break [[]]; end; test_ok(a == [[]])
-a = loop do break [*[]]; end; test_ok(a == [])
-a = loop do break [*[1]]; end; test_ok(a == [1])
-a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-a = loop do break *[]; end; test_ok(a == [])
-a = loop do break *[1]; end; test_ok(a == [1])
-a = loop do break *[nil]; end; test_ok(a == [nil])
-a = loop do break *[[]]; end; test_ok(a == [[]])
-a = loop do break *[*[]]; end; test_ok(a == [])
-a = loop do break *[*[1]]; end; test_ok(a == [1])
-a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break; end; test_ok(a == [nil])
-*a = loop do break nil; end; test_ok(a == [nil])
-*a = loop do break 1; end; test_ok(a == [1])
-*a = loop do break []; end; test_ok(a == [])
-*a = loop do break [1]; end; test_ok(a == [1])
-*a = loop do break [nil]; end; test_ok(a == [nil])
-*a = loop do break [[]]; end; test_ok(a == [[]])
-*a = loop do break [1,2]; end; test_ok(a == [1,2])
-*a = loop do break [*[]]; end; test_ok(a == [])
-*a = loop do break [*[1]]; end; test_ok(a == [1])
-*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break *[]; end; test_ok(a == [])
-*a = loop do break *[1]; end; test_ok(a == [1])
-*a = loop do break *[nil]; end; test_ok(a == [nil])
-*a = loop do break *[[]]; end; test_ok(a == [[]])
-*a = loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = loop do break *[*[]]; end; test_ok(a == [])
-*a = loop do break *[*[1]]; end; test_ok(a == [1])
-*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = *loop do break *[[]]; end; test_ok(a == [[]])
-*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-def r(val); a = yield(); test_ok(a == val, 2); end
-r(nil){next}
-r(nil){next nil}
-r(1){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-r([]){next *[]}
-r([1]){next *[1]}
-r([nil]){next *[nil]}
-r([[]]){next *[[]]}
-r([]){next *[*[]]}
-r([1]){next *[*[1]]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); *a = yield(); test_ok(a == val, 2); end
-r([nil]){next}
-r([nil]){next nil}
-r([1]){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([1,2]){next [1,2]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-def r(val); *a = *yield(); test_ok(a == val, 2); end
-r([[]]){next *[[]]}
-r([1,2]){next *[1,2]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
-r([nil,nil,[]]){next}
-r([nil,nil,[]]){next nil}
-r([1,nil,[]]){next 1}
-r([nil,nil,[]]){next []}
-r([1,nil,[]]){next [1]}
-r([nil,nil,[]]){next [nil]}
-r([[],nil,[]]){next [[]]}
-r([1,2,[]]){next [1,2]}
-r([nil,nil,[]]){next [*[]]}
-r([1,nil,[]]){next [*[1]]}
-r([1,2,[]]){next [*[1,2]]}
-
-def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
-r([[],nil,[]]){next *[[]]}
-r([1,2,[]]){next *[1,2]}
-r([1,2,[]]){next *[*[1,2]]}
-
-test_check "condition"
-
-$x = '0';
-
-$x == $x && test_ok(true)
-$x != $x && test_ok(false)
-$x == $x || test_ok(false)
-$x != $x || test_ok(true)
-
-# first test to see if we can run the tests.
-
-test_check "if/unless";
-
-$x = 'test';
-test_ok(if $x == $x then true else false end)
-$bad = false
-unless $x == $x
- $bad = true
-end
-test_ok(!$bad)
-test_ok(unless $x != $x then true else false end)
-
-test_check "case"
-
-case 5
-when 1, 2, 3, 4, 6, 7, 8
- test_ok(false)
-when 5
- test_ok(true)
-end
-
-case 5
-when 5
- test_ok(true)
-when 1..10
- test_ok(false)
-end
-
-case 5
-when 1..10
- test_ok(true)
-else
- test_ok(false)
-end
-
-case 5
-when 5
- test_ok(true)
-else
- test_ok(false)
-end
-
-case "foobar"
-when /^f.*r$/
- test_ok(true)
-else
- test_ok(false)
-end
-
-test_check "while/until";
-
-while_tmp = "while_tmp.#{$$}"
-tmp = open(while_tmp, "w")
-tmp.print "tvi925\n";
-tmp.print "tvi920\n";
-tmp.print "vt100\n";
-tmp.print "Amiga\n";
-tmp.print "paper\n";
-tmp.close
-
-# test break
-
-tmp = open(while_tmp, "r")
-test_ok(tmp.kind_of?(File))
-
-while line = tmp.gets()
- break if /vt100/ =~ line
-end
-
-test_ok(!tmp.eof? && /vt100/ =~ line)
-tmp.close
-
-# test next
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
- next if /vt100/ =~ line
- $bad = 1 if /vt100/ =~ line
-end
-test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
-tmp.close
-
-# test redo
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
- lastline = line
- line = line.gsub(/vt100/, 'VT100')
- if lastline != line
- line.gsub!('VT100', 'Vt100')
- redo
- end
- $bad = 1 if /vt100/ =~ line
- $bad = 1 if /VT100/ =~ line
-end
-test_ok(tmp.eof? && !$bad)
-tmp.close
-
-sum=0
-for i in 1..10
- sum += i
- i -= 1
- if i > 0
- redo
- end
-end
-test_ok(sum == 220)
-
-# test interval
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
- break if 3
- case line
- when /vt100/, /Amiga/, /paper/
- $bad = true
- end
-end
-test_ok(!$bad)
-tmp.close
-
-File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
-test_ok(!File.exist?(while_tmp))
-
-i = 0
-until i>4
- i+=1
-end
-test_ok(i>4)
-
-
-# exception handling
-test_check "exception";
-
-begin
- raise "this must be handled"
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-$bad = true
-begin
- raise "this must be handled no.2"
-rescue
- if $bad
- $bad = false
- retry
- test_ok(false)
- end
-end
-test_ok(true)
-
-# exception in rescue clause
-$string = "this must be handled no.3"
-begin
- begin
- raise "exception in rescue clause"
- rescue
- raise $string
- end
- test_ok(false)
-rescue => e
- test_ok($! == e)
- test_ok(e.message == $string)
- test_ok(e != $string)
-end
-
-# exception in ensure clause
-begin
- begin
- raise "this must be handled no.4"
- ensure
- raise "exception in ensure clause"
- end
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-$bad = true
-begin
- begin
- raise "this must be handled no.5"
- ensure
- $bad = false
- end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-begin
- begin
- raise "this must be handled no.6"
- ensure
- $bad = false
- end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-while true
- begin
- break
- ensure
- $bad = false
- end
-end
-test_ok(!$bad)
-
-test_ok(catch(:foo) {
- loop do
- loop do
- throw :foo, true
- break
- end
- break
- test_ok(false) # should not reach here
- end
- false
- })
-
-test_check "array"
-test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
-test_ok([1, 2] * 2 == [1, 2, 1, 2])
-test_ok([1, 2] * ":" == "1:2")
-
-test_ok([1, 2].hash == [1, 2].hash)
-
-test_ok([1,2,3] & [2,3,4] == [2,3])
-test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
-test_ok([1,2,3] - [2,3] == [1])
-
-$x = [0, 1, 2, 3, 4, 5]
-test_ok($x[2] == 2)
-test_ok($x[1..3] == [1, 2, 3])
-test_ok($x[1,3] == [1, 2, 3])
-
-$x[0, 2] = 10
-test_ok($x[0] == 10 && $x[1] == 2)
-
-$x[0, 0] = -1
-test_ok($x[0] == -1 && $x[1] == 10)
-
-$x[-1, 1] = 20
-test_ok($x[-1] == 20 && $x.pop == 20)
-
-# array and/or
-test_ok(([1,2,3]&[2,4,6]) == [2])
-test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
-
-# compact
-$x = [nil, 1, nil, nil, 5, nil, nil]
-$x.compact!
-test_ok($x == [1, 5])
-
-# uniq
-$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
-$x.uniq!
-test_ok($x == [1, 4, 2, 5])
-
-# empty?
-test_ok(!$x.empty?)
-$x = []
-test_ok($x.empty?)
-
-# sort
-$x = ["it", "came", "to", "pass", "that", "..."]
-$x = $x.sort.join(" ")
-test_ok($x == "... came it pass that to")
-$x = [2,5,3,1,7]
-$x.sort!{|a,b| a<=>b} # sort with condition
-test_ok($x == [1,2,3,5,7])
-$x.sort!{|a,b| b-a} # reverse sort
-test_ok($x == [7,5,3,2,1])
-
-# split test
-$x = "The Book of Mormon"
-test_ok($x.split(//).reverse!.join == $x.reverse)
-test_ok($x.reverse == $x.reverse!)
-test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
-$x = "a b c d"
-test_ok($x.split == ['a', 'b', 'c', 'd'])
-test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
-test_ok(defined? "a".chomp)
-test_ok("abc".scan(/./) == ["a", "b", "c"])
-test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
-# non-greedy match
-test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
-
-$x = [1]
-test_ok(($x * 5).join(":") == '1:1:1:1:1')
-test_ok(($x * 1).join(":") == '1')
-test_ok(($x * 0).join(":") == '')
-
-*$x = *(1..7).to_a
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-$x = [1,2,3]
-$x[1,0] = $x
-test_ok($x == [1,1,2,3,2,3])
-
-$x = [1,2,3]
-$x[-1,0] = $x
-test_ok($x == [1,2,1,2,3,3])
-
-$x = [1,2,3]
-$x.concat($x)
-test_ok($x == [1,2,3,1,2,3])
-
-test_check "hash"
-$x = {1=>2, 2=>4, 3=>6}
-
-test_ok($x[1] == 2)
-
-test_ok(begin
- for k,v in $x
- raise if k*2 != v
- end
- true
- rescue
- false
- end)
-
-test_ok($x.length == 3)
-test_ok($x.has_key?(1))
-test_ok($x.has_value?(4))
-test_ok($x.values_at(2,3) == [4,6])
-test_ok($x == {1=>2, 2=>4, 3=>6})
-
-$z = $x.keys.sort.join(":")
-test_ok($z == "1:2:3")
-
-$z = $x.values.sort.join(":")
-test_ok($z == "2:4:6")
-test_ok($x == $x)
-
-$x.shift
-test_ok($x.length == 2)
-
-$z = [1,2]
-$x[$z] = 256
-test_ok($x[$z] == 256)
-
-$x = Hash.new(0)
-$x[1] = 1
-test_ok($x[1] == 1)
-test_ok($x[2] == 0)
-
-$x = Hash.new([])
-test_ok($x[22] == [])
-test_ok($x[22].equal?($x[22]))
-
-$x = Hash.new{[]}
-test_ok($x[22] == [])
-test_ok(!$x[22].equal?($x[22]))
-
-$x = Hash.new{|h,k| $z = k; h[k] = k*2}
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-$x.default = 5
-test_ok($x[23] == 5)
-
-$x = Hash.new
-def $x.default(k)
- $z = k
- self[k] = k*2
-end
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-
-test_check "iterator"
-
-test_ok(!iterator?)
-
-def ttt
- test_ok(iterator?)
-end
-ttt{}
-
-# yield at top level
-test_ok(!defined?(yield))
-
-$x = [1, 2, 3, 4]
-$y = []
-
-# iterator over array
-for i in $x
- $y.push i
-end
-test_ok($x == $y)
-
-# nested iterator
-def tt
- 1.upto(10) {|i|
- yield i
- }
-end
-
-i=0
-tt{|i| break if i == 5}
-test_ok(i == 0)
-
-def tt2(dummy)
- yield 1
-end
-
-def tt3(&block)
- tt2(raise(ArgumentError,""),&block)
-end
-
-$x = false
-begin
- tt3{}
-rescue ArgumentError
- $x = true
-rescue Exception
-end
-test_ok($x)
-
-def tt4 &block
- tt2(raise(ArgumentError,""),&block)
-end
-$x = false
-begin
- tt4{}
-rescue ArgumentError
- $x = true
-rescue Exception
-end
-test_ok($x)
-
-# iterator break/redo/next/retry
-done = true
-loop{
- break
- done = false # should not reach here
-}
-test_ok(done)
-
-done = false
-$bad = false
-loop {
- break if done
- done = true
- next
- $bad = true # should not reach here
-}
-test_ok(!$bad)
-
-done = false
-$bad = false
-loop {
- break if done
- done = true
- redo
- $bad = true # should not reach here
-}
-test_ok(!$bad)
-
-$x = []
-for i in 1 .. 7
- $x.push i
-end
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-# append method to built-in class
-class Array
- def iter_test1
- collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
- end
- def iter_test2
- a = collect{|e| [e, yield(e)]}
- a.sort{|a,b|a[1]<=>b[1]}
- end
-end
-$x = [[1,2],[3,4],[5,6]]
-test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
-
-class IterTest
- def initialize(e); @body = e; end
-
- def each0(&block); @body.each(&block); end
- def each1(&block); @body.each {|*x| block.call(*x) } end
- def each2(&block); @body.each {|*x| block.call(x) } end
- def each3(&block); @body.each {|x| block.call(*x) } end
- def each4(&block); @body.each {|x| block.call(x) } end
- def each5; @body.each {|*x| yield(*x) } end
- def each6; @body.each {|*x| yield(x) } end
- def each7; @body.each {|x| yield(*x) } end
- def each8; @body.each {|x| yield(x) } end
-
- def f(a)
- a
- end
-end
-test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
-m = /\w+/.match("abc")
-test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
-
-IterTest.new([0]).each0 {|x| test_ok(x == 0)}
-IterTest.new([1]).each1 {|x| test_ok(x == 1)}
-IterTest.new([2]).each2 {|x| test_ok(x == [2])}
-#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
-IterTest.new([4]).each4 {|x| test_ok(x == 4)}
-IterTest.new([5]).each5 {|x| test_ok(x == 5)}
-IterTest.new([6]).each6 {|x| test_ok(x == [6])}
-#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
-IterTest.new([8]).each8 {|x| test_ok(x == 8)}
-
-IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
-IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
-IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
-IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
-IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
-IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
-IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
-IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
-IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
-
-IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
-IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
-
-def m0(v)
- v
-end
-
-def m1
- m0(block_given?)
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-def m
- m0(block_given?,&Proc.new{})
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-class C
- include Enumerable
- def initialize
- @a = [1,2,3]
- end
- def each(&block)
- @a.each(&block)
- end
-end
-
-test_ok(C.new.collect{|n| n} == [1,2,3])
-
-test_ok(Proc == lambda{}.class)
-test_ok(Proc == Proc.new{}.class)
-lambda{|a|test_ok(a==1)}.call(1)
-def block_test(klass, &block)
- test_ok(klass === block)
-end
-
-block_test(NilClass)
-block_test(Proc){}
-
-def call_argument_test(state, proc, *args)
- x = state
- begin
- proc.call(*args)
- rescue ArgumentError
- x = !x
- end
- test_ok(x,2)
-end
-
-call_argument_test(true, lambda{||})
-call_argument_test(false, lambda{||}, 1)
-call_argument_test(true, lambda{|a,|}, 1)
-call_argument_test(false, lambda{|a,|})
-call_argument_test(false, lambda{|a,|}, 1,2)
-
-call_argument_test(true, Proc.new{||})
-call_argument_test(true, Proc.new{||}, 1)
-call_argument_test(true, Proc.new{|a,|}, 1)
-call_argument_test(true, Proc.new{|a,|})
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-def block_get(&block)
- block
-end
-
-test_ok(Proc == block_get{}.class)
-call_argument_test(true, block_get{||})
-call_argument_test(true, block_get{||}, 1)
-call_argument_test(true, block_get{|a,|}, 1)
-call_argument_test(true, block_get{|a,|})
-call_argument_test(true, block_get{|a,|}, 1,2)
-
-call_argument_test(true, block_get(&lambda{||}))
-call_argument_test(false, block_get(&lambda{||}),1)
-call_argument_test(true, block_get(&lambda{|a,|}),1)
-call_argument_test(false, block_get(&lambda{|a,|}),1,2)
-
-blk = block_get{11}
-test_ok(blk.class == Proc)
-test_ok(blk.to_proc.class == Proc)
-test_ok(blk.clone.call == 11)
-test_ok(block_get(&blk).class == Proc)
-
-lmd = lambda{44}
-test_ok(lmd.class == Proc)
-test_ok(lmd.to_proc.class == Proc)
-test_ok(lmd.clone.call == 44)
-test_ok(block_get(&lmd).class == Proc)
-
-test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
-test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
-
-def test_return1
- Proc.new {
- return 55
- }.yield + 5
-end
-test_ok(test_return1() == 55)
-def test_return2
- lambda {
- return 55
- }.call + 5
-end
-test_ok(test_return2() == 60)
-
-def proc_call(&b)
- b.call
-end
-def proc_yield()
- yield
-end
-def proc_return1
- lambda{return 42}.call+1
-end
-test_ok(proc_return1() == 43)
-def proc_return2
- ->{return 42}.call+1
-end
-test_ok(proc_return2() == 43)
-def proc_return3
- proc_call{return 42}+1
-end
-test_ok(proc_return3() == 42)
-def proc_return4
- proc_yield{return 42}+1
-end
-test_ok(proc_return4() == 42)
-
-def ljump_test(state, proc, *args)
- x = state
- begin
- proc.call(*args)
- rescue LocalJumpError
- x = !x
- end
- test_ok(x,2)
-end
-
-ljump_test(false, block_get{break})
-ljump_test(true, lambda{break})
-
-def exit_value_test(&block)
- block.call
-rescue LocalJumpError
- $!.exit_value
-end
-
-test_ok(45 == exit_value_test{break 45})
-
-test_ok(55 == begin
- block_get{break 55}.call
- rescue LocalJumpError
- $!.exit_value
- end)
-
-def block_call(&block)
- block.call
-end
-
-def test_b1
- block_call{break 11}
-end
-test_ok(test_b1() == 11)
-
-def ljump_rescue(r)
- begin
- yield
- rescue LocalJumpError => e
- r if /from proc-closure/ =~ e.message
- end
-end
-
-def test_b2
- ljump_rescue(22) do
- block_get{break 21}.call
- end
-end
-test_ok(test_b2() == 22)
-
-def test_b3
- ljump_rescue(33) do
- Proc.new{break 31}.yield
- end
-end
-test_ok(test_b3() == 33)
-
-def test_b4
- lambda{break 44}.call
-end
-test_ok(test_b4() == 44)
-
-def test_b5
- ljump_rescue(55) do
- b = block_get{break 54}
- block_call(&b)
- end
-end
-test_ok(test_b5() == 55)
-
-def test_b6
- b = lambda{break 67}
- block_call(&b)
- 66
-end
-test_ok(test_b6() == 66)
-
-def util_r7
- block_get{break 78}
-end
-
-def test_b7
- b = util_r7()
- ljump_rescue(77) do
- block_call(&b)
- end
-end
-test_ok(test_b7() == 77)
-
-def util_b8(&block)
- block_call(&block)
-end
-
-def test_b8
- util_b8{break 88}
-end
-test_ok(test_b8() == 88)
-
-def util_b9(&block)
- lambda{block.call; 98}.call
-end
-
-def test_b9
- util_b9{break 99}
-end
-test_ok(test_b9() == 99)
-
-def util_b10
- util_b9{break 100}
-end
-
-def test_b10
- util_b10()
-end
-test_ok(test_b10() == 100)
-
-def test_b11
- ljump_rescue(111) do
- loop do
- Proc.new{break 110}.yield
- break 112
- end
- end
-end
-test_ok(test_b11() == 111)
-
-def test_b12
- loop do
- break lambda{break 122}.call
- break 121
- end
-end
-test_ok(test_b12() == 122)
-
-def test_b13
- ljump_rescue(133) do
- while true
- Proc.new{break 130}.yield
- break 131
- end
- end
-end
-test_ok(test_b13() == 133)
-
-def test_b14
- while true
- break lambda{break 144}.call
- break 143
- end
-end
-test_ok(test_b14() == 144)
-
-def test_b15
- [0].each {|c| yield 1 }
- 156
-end
-test_ok(test_b15{|e| break 155 } == 155)
-
-def marity_test(m)
- method = method(m)
- test_ok(method.arity == method.to_proc.arity, 2)
-end
-marity_test(:test_ok)
-marity_test(:marity_test)
-marity_test(:p)
-
-lambda(&method(:test_ok)).call(true)
-lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
-
-class ITER_TEST1
- def a
- block_given?
- end
-end
-
-class ITER_TEST2 < ITER_TEST1
- def a
- test_ok(super)
- super
- end
-end
-test_ok(ITER_TEST2.new.a {})
-
-class ITER_TEST3
- def foo x
- return yield if block_given?
- x
- end
-end
-
-class ITER_TEST4 < ITER_TEST3
- def foo x
- test_ok(super == yield)
- test_ok(super(x, &nil) == x)
- end
-end
-
-ITER_TEST4.new.foo(44){55}
-
-class ITER_TEST5
- def tt(aa)
- aa
- end
-
- def uu(a)
- class << self
- define_method(:tt) do |sym|
- super(sym)
- end
- end
- end
-
- def xx(*x)
- x.size
- end
-end
-
-a = ITER_TEST5.new
-a.uu(12)
-test_ok(a.tt(1) == 1)
-
-class ITER_TEST6 < ITER_TEST5
- def xx(*a)
- a << 12
- super
- end
-end
-
-test_ok(ITER_TEST6.new.xx([24]) == 2)
-
-test_check "float"
-test_ok(2.6.floor == 2)
-test_ok((-2.6).floor == -3)
-test_ok(2.6.ceil == 3)
-test_ok((-2.6).ceil == -2)
-test_ok(2.6.truncate == 2)
-test_ok((-2.6).truncate == -2)
-test_ok(2.6.round == 3)
-test_ok((-2.4).truncate == -2)
-test_ok((13.4 % 1 - 0.4).abs < 0.0001)
-nan = 0.0/0
-def nan_test(x,y)
- test_ok(x != y)
- test_ok((x < y) == false)
- test_ok((x > y) == false)
- test_ok((x <= y) == false)
- test_ok((x >= y) == false)
-end
-nan_test(nan, nan)
-nan_test(nan, 0)
-nan_test(nan, 1)
-nan_test(nan, -1)
-nan_test(nan, 1000)
-nan_test(nan, -1000)
-nan_test(nan, 1_000_000_000_000)
-nan_test(nan, -1_000_000_000_000)
-nan_test(nan, 100.0);
-nan_test(nan, -100.0);
-nan_test(nan, 0.001);
-nan_test(nan, -0.001);
-nan_test(nan, 1.0/0);
-nan_test(nan, -1.0/0);
-
-#s = "3.7517675036461267e+17"
-#test_ok(s == sprintf("%.16e", s.to_f))
-f = 3.7517675036461267e+17
-test_ok(f == sprintf("%.16e", f).to_f)
-
-
-test_check "bignum"
-def fact(n)
- return 1 if n == 0
- f = 1
- while n>0
- f *= n
- n -= 1
- end
- return f
-end
-$x = fact(40)
-test_ok($x == $x)
-test_ok($x == fact(40))
-test_ok($x < $x+2)
-test_ok($x > $x-2)
-test_ok($x == 815915283247897734345611269596115894272000000000)
-test_ok($x != 815915283247897734345611269596115894272000000001)
-test_ok($x+1 == 815915283247897734345611269596115894272000000001)
-test_ok($x/fact(20) == 335367096786357081410764800000)
-$x = -$x
-test_ok($x == -815915283247897734345611269596115894272000000000)
-test_ok(2-(2**32) == -(2**32-2))
-test_ok(2**32 - 5 == (2**32-3)-2)
-
-$good = true;
-for i in 1000..1014
- $good = false if ((1 << i) != (2**i))
-end
-test_ok($good)
-
-$good = true;
-n1= 1 << 1000
-for i in 1000..1014
- $good = false if ((1 << i) != n1)
- n1 *= 2
-end
-test_ok($good)
-
-$good = true;
-n2=n1
-for i in 1..10
- n1 = n1 / 2
- n2 = n2 >> 1
- $good = false if (n1 != n2)
-end
-test_ok($good)
-
-$good = true;
-for i in 4000..4096
- n1 = 1 << i;
- if (n1**2-1) / (n1+1) != (n1-1)
- $good = false
- end
-end
-test_ok($good)
-
-b = 10**80
-a = b * 9 + 7
-test_ok(7 == a.modulo(b))
-test_ok(-b + 7 == a.modulo(-b))
-test_ok(b + -7 == (-a).modulo(b))
-test_ok(-7 == (-a).modulo(-b))
-test_ok(7 == a.remainder(b))
-test_ok(7 == a.remainder(-b))
-test_ok(-7 == (-a).remainder(b))
-test_ok(-7 == (-a).remainder(-b))
-
-test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
-test_ok(10**40/10**20 == 100000000000000000000)
-
-a = 677330545177305025495135714080
-b = 14269972710765292560
-test_ok(a % b == 0)
-test_ok(-a % b == 0)
-
-def shift_test(a)
- b = a / (2 ** 32)
- c = a >> 32
- test_ok(b == c)
-
- b = a * (2 ** 32)
- c = a << 32
- test_ok(b == c)
-end
-
-shift_test(-4518325415524767873)
-shift_test(-0xfffffffffffffffff)
-
-test_check "string & char"
-
-test_ok("abcd" == "abcd")
-test_ok("abcd" =~ /abcd/)
-test_ok("abcd" === "abcd")
-# compile time string concatenation
-test_ok("ab" "cd" == "abcd")
-test_ok("#{22}aa" "cd#{44}" == "22aacd44")
-test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
-test_ok("abc" !~ /^$/)
-test_ok("abc\n" !~ /^$/)
-test_ok("abc" !~ /^d*$/)
-test_ok(("abc" =~ /d*$/) == 3)
-test_ok("" =~ /^$/)
-test_ok("\n" =~ /^$/)
-test_ok("a\n\n" =~ /^$/)
-test_ok("abcabc" =~ /.*a/ && $& == "abca")
-test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
-test_ok("abcabc" =~ /.*?a/ && $& == "a")
-test_ok("abcabc" =~ /.*?c/ && $& == "abc")
-test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
-
-test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
-
-test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-
-$x = <<END;
-ABCD
-ABCD
-END
-$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
-test_ok($x == "AC\nAC\n")
-
-test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
-test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
-
-$foo = "abc"
-test_ok("#$foo = abc" == "abc = abc")
-test_ok("#{$foo} = abc" == "abc = abc")
-
-foo = "abc"
-test_ok("#{foo} = abc" == "abc = abc")
-
-test_ok('-' * 5 == '-----')
-test_ok('-' * 1 == '-')
-test_ok('-' * 0 == '')
-
-foo = '-'
-test_ok(foo * 5 == '-----')
-test_ok(foo * 1 == '-')
-test_ok(foo * 0 == '')
-
-$x = "a.gif"
-test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
-test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
-
-# character constants(assumes ASCII)
-test_ok("a"[0] == ?a)
-test_ok(?a == ?a)
-test_ok(?\C-a == "\1")
-test_ok(?\M-a == "\341")
-test_ok(?\M-\C-a == "\201")
-test_ok("a".upcase![0] == ?A)
-test_ok("A".downcase![0] == ?a)
-test_ok("abc".tr!("a-z", "A-Z") == "ABC")
-test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
-test_ok("abcc".squeeze!("a-z") == "abc")
-test_ok("abcd".delete!("bc") == "ad")
-
-$x = "abcdef"
-$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
-$bad = false
-$x.each_byte {|i|
- if i.chr != $y.shift
- $bad = true
- break
- end
-}
-test_ok(!$bad)
-
-s = "a string"
-s[0..s.size]="another string"
-test_ok(s == "another string")
-
-s = <<EOS
-#{
-[1,2,3].join(",")
-}
-EOS
-test_ok(s == "1,2,3\n")
-test_ok("Just".to_i(36) == 926381)
-test_ok("-another".to_i(36) == -23200231779)
-test_ok(1299022.to_s(36) == "ruby")
-test_ok(-1045307475.to_s(36) == "-hacker")
-test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
-test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
-
-a = []
-(0..255).each {|n|
- ch = [n].pack("C")
- a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
-}
-test_ok(a.size == 0)
-
-test_check "assignment"
-a = nil
-test_ok(defined?(a))
-test_ok(a == nil)
-
-# multiple asignment
-a, b = 1, 2
-test_ok(a == 1 && b == 2)
-
-a, b = b, a
-test_ok(a == 2 && b == 1)
-
-a, = 1,2
-test_ok(a == 1)
-
-a, *b = 1, 2, 3
-test_ok(a == 1 && b == [2, 3])
-
-a, (b, c), d = 1, [2, 3], 4
-test_ok(a == 1 && b == 2 && c == 3 && d == 4)
-
-*a = 1, 2, 3
-test_ok(a == [1, 2, 3])
-
-*a = 4
-test_ok(a == [4])
-
-*a = nil
-test_ok(a == [nil])
-
-test_check "call"
-def aaa(a, b=100, *rest)
- res = [a, b]
- res += rest if rest
- return res
-end
-
-# not enough argument
-begin
- aaa() # need at least 1 arg
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-begin
- aaa # no arg given (exception raised)
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-test_ok(aaa(1) == [1, 100])
-test_ok(aaa(1, 2) == [1, 2])
-test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
-test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
-
-test_check "proc"
-$proc = Proc.new{|i| i}
-test_ok($proc.call(2) == 2)
-test_ok($proc.call(3) == 3)
-
-$proc = Proc.new{|i| i*2}
-test_ok($proc.call(2) == 4)
-test_ok($proc.call(3) == 6)
-
-Proc.new{
- iii=5 # nested local variable
- $proc = Proc.new{|i|
- iii = i
- }
- $proc2 = Proc.new {
- $x = iii # nested variables shared by procs
- }
- # scope of nested variables
- test_ok(defined?(iii))
-}.call
-test_ok(!defined?(iii)) # out of scope
-
-loop{iii=5; test_ok(eval("defined? iii")); break}
-loop {
- iii = 10
- def dyna_var_check
- loop {
- test_ok(!defined?(iii))
- break
- }
- end
- dyna_var_check
- break
-}
-$x=0
-$proc.call(5)
-$proc2.call
-test_ok($x == 5)
-
-if defined? Process.kill
- test_check "signal"
-
- $x = 0
- trap "SIGINT", Proc.new{|sig| $x = 2}
- Process.kill "SIGINT", $$
- 100.times {
- sleep 0.1
- break if $x != 0
- }
- test_ok($x == 2)
-
- trap "SIGINT", Proc.new{raise "Interrupt"}
-
- x = false
- begin
- Process.kill "SIGINT", $$
- sleep 0.1
- rescue
- x = $!
- end
- test_ok(x && /Interrupt/ =~ x.message)
-end
-
-test_check "eval"
-test_ok(eval("") == nil)
-$bad=false
-eval 'while false; $bad = true; print "foo\n" end'
-test_ok(!$bad)
-
-test_ok(eval('Object'))
-test_ok(eval('true'))
-test_ok(!eval('nil'))
-test_ok(!eval('false'))
-
-$foo = 'test_ok(true)'
-begin
- eval $foo
-rescue
- test_ok(false)
-end
-
-test_ok(eval("$foo") == 'test_ok(true)')
-test_ok(eval("true") == true)
-i = 5
-test_ok(eval("i == 5"))
-test_ok(eval("i") == 5)
-test_ok(eval("defined? i"))
-
-# eval with binding
-def test_ev
- local1 = "local1"
- lambda {
- local2 = "local2"
- return binding
- }.call
-end
-
-$x = test_ev
-test_ok(eval("local1", $x) == "local1") # normal local var
-test_ok(eval("local2", $x) == "local2") # nested local var
-$bad = true
-begin
- p eval("local1")
-rescue NameError # must raise error
- $bad = false
-end
-test_ok(!$bad)
-
-module EvTest
- EVTEST1 = 25
- evtest2 = 125
- $x = binding
-end
-test_ok(eval("EVTEST1", $x) == 25) # constant in module
-test_ok(eval("evtest2", $x) == 125) # local var in module
-$bad = true
-begin
- eval("EVTEST1")
-rescue NameError # must raise error
- $bad = false
-end
-test_ok(!$bad)
-
-x = binding #! YARV Limitation: Proc.new{}
-eval "i4 = 1", x
-test_ok(eval("i4", x) == 1)
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "i4 = 22", x
-test_ok(eval("i4", x) == 22)
-$x = []
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-
-x = binding
-eval "i = 1", x
-test_ok(eval("i", x) == 1)
-x = Proc.new{binding}.call
-eval "i = 22", x
-test_ok(eval("i", x) == 22)
-$x = []
-x = Proc.new{binding}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-x = Proc.new{binding}.call
-eval "for i6 in 1..1; j6=i6; end", x
-test_ok(eval("defined? i6", x))
-test_ok(eval("defined? j6", x))
-
-Proc.new {
- p = binding
- eval "foo11 = 1", p
- foo22 = 5
- Proc.new{foo11=22}.call
- Proc.new{foo22=55}.call
- test_ok(eval("foo11", p) == eval("foo11"))
- test_ok(eval("foo11") == 1)
- test_ok(eval("foo22", p) == eval("foo22"))
- test_ok(eval("foo22") == 55)
-}.call if false #! YARV Limitation
-
-#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-p1 = Proc.new{i7 = 0; binding}.call
-#! YARV Limitation: test_ok(p1.call == 0)
-eval "i7=5", p1
-#! YARV Limitation: test_ok(p1.call == 5)
-test_ok(!defined?(i7))
-
-if false #! YARV Limitation
-p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-i7 = nil
-test_ok(p1.call == 0)
-eval "i7=1", p1
-test_ok(p1.call == 1)
-eval "i7=5", p1
-test_ok(p1.call == 5)
-test_ok(i7 == nil)
-end
-
-test_check "system"
-test_ok(`echo foobar` == "foobar\n")
-test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
-
-script_tmp = "script_tmp.#{$$}"
-tmp = open(script_tmp, "w")
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
-test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
-
-tmp = open(script_tmp, "w")
-tmp.print "this is a leading junk\n";
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.print "__END__\n";
-tmp.print "this is a trailing junk\n";
-tmp.close
-
-test_ok(`./miniruby -x #{script_tmp}` == '')
-test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-for i in 1..5
- tmp.print i, "\n"
-end
-tmp.close
-
-`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
-done = true
-tmp = open(script_tmp, "r")
-while tmp.gets
- if $_.to_i % 5 != 0
- done = false
- break
- end
-end
-tmp.close
-test_ok(done)
-
-File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
-File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
-
-test_check "const"
-TEST1 = 1
-TEST2 = 2
-
-module Const
- TEST3 = 3
- TEST4 = 4
-end
-
-module Const2
- TEST3 = 6
- TEST4 = 8
-end
-
-include Const
-
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
-
-include Const2
-STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
-
-
-test_ok((String <=> Object) == -1)
-test_ok((Object <=> String) == 1)
-test_ok((Array <=> String) == nil)
-
-test_check "clone"
-foo = Object.new
-def foo.test
- "test"
-end
-bar = foo.clone
-def bar.test2
- "test2"
-end
-
-test_ok(bar.test2 == "test2")
-test_ok(bar.test == "test")
-test_ok(foo.test == "test")
-
-begin
- foo.test2
- test_ok false
-rescue NoMethodError
- test_ok true
-end
-
-module M001; end
-module M002; end
-module M003; include M002; end
-module M002; include M001; end
-module M003; include M002; end
-
-test_ok(M003.ancestors == [M003, M002, M001])
-
-test_check "marshal"
-$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
-$y = Marshal.dump($x)
-test_ok($x == Marshal.load($y))
-
-StrClone=String.clone;
-test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
-
-[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
- a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
- ma = Marshal.dump(a)
- b = Marshal.load(ma)
- test_ok(a == b)
-}
-
-test_check "pack"
-
-$format = "c2x5CCxsdils_l_a6";
-# Need the expression in here to force ary[5] to be numeric. This avoids
-# test2 failing because ary2 goes str->numeric->str and ary does not.
-ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
-$x = ary.pack($format)
-ary2 = $x.unpack($format)
-
-test_ok(ary.length == ary2.length)
-test_ok(ary.join(':') == ary2.join(':'))
-test_ok($x =~ /def/)
-
-$x = [-1073741825]
-test_ok($x.pack("q").unpack("q") == $x)
-
-test_check "math"
-test_ok(Math.sqrt(4) == 2)
-
-include Math
-test_ok(sqrt(4) == 2)
-
-test_check "struct"
-struct_test = Struct.new("Test", :foo, :bar)
-test_ok(struct_test == Struct::Test)
-
-test = struct_test.new(1, 2)
-test_ok(test.foo == 1 && test.bar == 2)
-test_ok(test[0] == 1 && test[1] == 2)
-
-a, b = test.to_a
-test_ok(a == 1 && b == 2)
-
-test[0] = 22
-test_ok(test.foo == 22)
-
-test.bar = 47
-test_ok(test.bar == 47)
-
-test_check "variable"
-test_ok($$.instance_of?(Integer))
-
-# read-only variable
-begin
- $$ = 5
- test_ok false
-rescue NameError
- test_ok true
-end
-
-foobar = "foobar"
-$_ = foobar
-test_ok($_ == foobar)
-
-class Gods
- @@rule = "Uranus" # private to Gods
- def ruler0
- @@rule
- end
-
- def self.ruler1 # <= per method definition style
- @@rule
- end
- class << self # <= multiple method definition style
- def ruler2
- @@rule
- end
- end
-end
-
-module Olympians
- @@rule ="Zeus"
- def ruler3
- @@rule
- end
-end
-
-class Titans < Gods
- @@rule = "Cronus" # do not affect @@rule in Gods
- include Olympians
- def ruler4
- @@rule
- end
-end
-
-test_ok(Gods.new.ruler0 == "Cronus")
-test_ok(Gods.ruler1 == "Cronus")
-test_ok(Gods.ruler2 == "Cronus")
-test_ok(Titans.ruler1 == "Cronus")
-test_ok(Titans.ruler2 == "Cronus")
-atlas = Titans.new
-test_ok(atlas.ruler0 == "Cronus")
-test_ok(atlas.ruler3 == "Zeus")
-test_ok(atlas.ruler4 == "Cronus")
-
-test_check "trace"
-$x = 1234
-$y = 0
-trace_var :$x, Proc.new{$y = $x}
-$x = 40414
-test_ok($y == $x)
-
-untrace_var :$x
-$x = 19660208
-test_ok($y != $x)
-
-trace_var :$x, Proc.new{$x *= 2}
-$x = 5
-test_ok($x == 10)
-
-untrace_var :$x
-
-test_check "defined?"
-
-test_ok(defined?($x)) # global variable
-test_ok(defined?($x) == 'global-variable')# returns description
-
-foo=5
-test_ok(defined?(foo)) # local variable
-
-test_ok(defined?(Array)) # constant
-test_ok(defined?(Object.new)) # method
-test_ok(!defined?(Object.print))# private method
-test_ok(defined?(1 == 2)) # operator expression
-
-class Foo
- def foo
- p :foo
- end
- protected :foo
- def bar(f)
- test_ok(defined?(self.foo))
- test_ok(defined?(f.foo))
- end
-end
-f = Foo.new
-test_ok(defined?(f.foo) == nil)
-f.bar(f)
-
-def defined_test
- return !defined?(yield)
-end
-
-test_ok(defined_test) # not iterator
-test_ok(!defined_test{}) # called as iterator
-
-test_check "alias"
-class Alias0
- def foo; "foo" end
-end
-class Alias1<Alias0
- alias bar foo
- def foo; "foo+" + super end
-end
-class Alias2<Alias1
- alias baz foo
- undef foo
-end
-
-x = Alias2.new
-test_ok(x.bar == "foo")
-test_ok(x.baz == "foo+foo")
-
-# test_check for cache
-test_ok(x.baz == "foo+foo")
-
-class Alias3<Alias2
- def foo
- defined? super
- end
- def bar
- defined? super
- end
- def quux
- defined? super
- end
-end
-x = Alias3.new
-test_ok(!x.foo)
-test_ok(x.bar)
-test_ok(!x.quux)
-
-test_check "path"
-test_ok(File.basename("a") == "a")
-test_ok(File.basename("a/b") == "b")
-test_ok(File.basename("a/b/") == "b")
-test_ok(File.basename("/") == "/")
-test_ok(File.basename("//") == "/")
-test_ok(File.basename("///") == "/")
-test_ok(File.basename("a/b////") == "b")
-test_ok(File.basename("a.rb", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".*") == "a")
-test_ok(File.basename("a.rb///", ".c") == "a.rb")
-test_ok(File.dirname("a") == ".")
-test_ok(File.dirname("/") == "/")
-test_ok(File.dirname("/a") == "/")
-test_ok(File.dirname("a/b") == "a")
-test_ok(File.dirname("a/b/c") == "a/b")
-test_ok(File.dirname("/a/b/c") == "/a/b")
-test_ok(File.dirname("/a/b/") == "/a")
-test_ok(File.dirname("/a/b///") == "/a")
-case Dir.pwd
-when %r'\A\w:'
- test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
- test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
- dosish = true
-when %r'\A//'
- test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
- test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
- dosish = true
-else
- test_ok(File.expand_path(".", "/") == "/")
- test_ok(File.expand_path("sub", "/") == "/sub")
-end
-if dosish
- test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
- test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
- test_ok(File.expand_path("/", "z:/sub") == "z:/")
- test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
-end
-test_ok(File.expand_path(".", "//") == "//")
-test_ok(File.expand_path("sub", "//") == "//sub")
-
-# test_check "Proc#binding"
-ObjectSpace.each_object(Proc){|o|
- begin
- b = o.binding
- eval 'self', b
- rescue ArgumentError
- end
-}
-
-test_check "gc"
-begin
- 1.upto(10000) {
- tmp = [0,1,2,3,4,5,6,7,8,9]
- }
- tmp = nil
- test_ok true
-rescue
- test_ok false
-end
-class S
- def initialize(a)
- @a = a
- end
-end
-l=nil
-100000.times {
- l = S.new(l)
-}
-GC.start
-test_ok true # reach here or dumps core
-l = []
-100000.times {
- l.push([l])
-}
-GC.start
-test_ok true # reach here or dumps core
-
-ObjectSpace.each_object{|o|
- o.class.name
-}
-
-test_ok true # reach here or dumps core
-
-PROGRESS.finish
-if $failed > 0
- printf "not ok/test: %d failed %d\n", $ntest, $failed
-else
- printf "end of test(test: %d)\n", $ntest
-end
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
deleted file mode 100644
index 3cd8a8fd37..0000000000
--- a/benchmark/bm_app_answer.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-def the_answer_to_life_the_universe_and_everything
- (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
-end
-
-answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index 2bd6acfaf8..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-# https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
- def initialize(x, y, z)
- @x = x
- @y = y
- @z = z
- end
-
- attr_accessor :x, :y, :z
-
- def vadd(b)
- Vec.new(@x + b.x, @y + b.y, @z + b.z)
- end
-
- def vsub(b)
- Vec.new(@x - b.x, @y - b.y, @z - b.z)
- end
-
- def vcross(b)
- Vec.new(@y * b.z - @z * b.y,
- @z * b.x - @x * b.z,
- @x * b.y - @y * b.x)
- end
-
- def vdot(b)
- @x * b.x + @y * b.y + @z * b.z
- end
-
- def vlength
- Math.sqrt(@x * @x + @y * @y + @z * @z)
- end
-
- def vnormalize
- len = vlength
- v = Vec.new(@x, @y, @z)
- if len > 1.0e-17 then
- v.x = v.x / len
- v.y = v.y / len
- v.z = v.z / len
- end
- v
- end
-end
-
-
-class Sphere
- def initialize(center, radius)
- @center = center
- @radius = radius
- end
-
- attr_reader :center, :radius
-
- def intersect(ray, isect)
- rs = ray.org.vsub(@center)
- b = rs.vdot(ray.dir)
- c = rs.vdot(rs) - (@radius * @radius)
- d = b * b - c
- if d > 0.0 then
- t = - b - Math.sqrt(d)
-
- if t > 0.0 and t < isect.t then
- isect.t = t
- isect.hit = true
- isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
- ray.org.y + ray.dir.y * t,
- ray.org.z + ray.dir.z * t)
- n = isect.pl.vsub(@center)
- isect.n = n.vnormalize
- else
- 0.0
- end
- end
- nil
- end
-end
-
-class Plane
- def initialize(p, n)
- @p = p
- @n = n
- end
-
- def intersect(ray, isect)
- d = -@p.vdot(@n)
- v = ray.dir.vdot(@n)
- v0 = v
- if v < 0.0 then
- v0 = -v
- end
- if v0 < 1.0e-17 then
- return
- end
-
- t = -(ray.org.vdot(@n) + d) / v
-
- if t > 0.0 and t < isect.t then
- isect.hit = true
- isect.t = t
- isect.n = @n
- isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
- ray.org.y + t * ray.dir.y,
- ray.org.z + t * ray.dir.z)
- end
- nil
- end
-end
-
-class Ray
- def initialize(org, dir)
- @org = org
- @dir = dir
- end
-
- attr_accessor :org, :dir
-end
-
-class Isect
- def initialize
- @t = 10000000.0
- @hit = false
- @pl = Vec.new(0.0, 0.0, 0.0)
- @n = Vec.new(0.0, 0.0, 0.0)
- end
-
- attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
- i = f * 255.5
- if i > 255.0 then
- i = 255.0
- end
- if i < 0.0 then
- i = 0.0
- end
- i.to_i
-end
-
-def otherBasis(basis, n)
- basis[2] = Vec.new(n.x, n.y, n.z)
- basis[1] = Vec.new(0.0, 0.0, 0.0)
-
- if n.x < 0.6 and n.x > -0.6 then
- basis[1].x = 1.0
- elsif n.y < 0.6 and n.y > -0.6 then
- basis[1].y = 1.0
- elsif n.z < 0.6 and n.z > -0.6 then
- basis[1].z = 1.0
- else
- basis[1].x = 1.0
- end
-
- basis[0] = basis[1].vcross(basis[2])
- basis[0] = basis[0].vnormalize
-
- basis[1] = basis[2].vcross(basis[0])
- basis[1] = basis[1].vnormalize
-end
-
-class Scene
- def initialize
- @spheres = Array.new
- @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
- @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
- @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
- @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
- end
-
- def ambient_occlusion(isect)
- basis = Array.new
- otherBasis(basis, isect.n)
-
- ntheta = NAO_SAMPLES
- nphi = NAO_SAMPLES
- eps = 0.0001
- occlusion = 0.0
-
- p0 = Vec.new(isect.pl.x + eps * isect.n.x,
- isect.pl.y + eps * isect.n.y,
- isect.pl.z + eps * isect.n.z)
- nphi.times do |j|
- ntheta.times do |i|
- r = rand
- phi = 2.0 * 3.14159265 * rand
- x = Math.cos(phi) * Math.sqrt(1.0 - r)
- y = Math.sin(phi) * Math.sqrt(1.0 - r)
- z = Math.sqrt(r)
-
- rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
- ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
- rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
- raydir = Vec.new(rx, ry, rz)
- ray = Ray.new(p0, raydir)
-
- occisect = Isect.new
- @spheres[0].intersect(ray, occisect)
- @spheres[1].intersect(ray, occisect)
- @spheres[2].intersect(ray, occisect)
- @plane.intersect(ray, occisect)
- if occisect.hit then
- occlusion = occlusion + 1.0
- else
- 0.0
- end
- end
- end
-
- occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
- Vec.new(occlusion, occlusion, occlusion)
- end
-
- def render(w, h, nsubsamples)
- cnt = 0
- nsf = nsubsamples.to_f
- h.times do |y|
- w.times do |x|
- rad = Vec.new(0.0, 0.0, 0.0)
-
- # Subsampling
- nsubsamples.times do |v|
- nsubsamples.times do |u|
-
- cnt = cnt + 1
- wf = w.to_f
- hf = h.to_f
- xf = x.to_f
- yf = y.to_f
- uf = u.to_f
- vf = v.to_f
-
- px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
- py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
- eye = Vec.new(px, py, -1.0).vnormalize
-
- ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
- isect = Isect.new
- @spheres[0].intersect(ray, isect)
- @spheres[1].intersect(ray, isect)
- @spheres[2].intersect(ray, isect)
- @plane.intersect(ray, isect)
- if isect.hit then
- col = ambient_occlusion(isect)
- rad.x = rad.x + col.x
- rad.y = rad.y + col.y
- rad.z = rad.z + col.z
- end
- end
- end
-
- r = rad.x / (nsf * nsf)
- g = rad.y / (nsf * nsf)
- b = rad.z / (nsf * nsf)
- printf("%c", clamp(r))
- printf("%c", clamp(g))
- printf("%c", clamp(b))
- end
- nil
- end
-
- nil
- end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
- printf("P6\n")
- printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
deleted file mode 100644
index 45f471dfdb..0000000000
--- a/benchmark/bm_app_factorial.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-def fact(n)
- if(n > 1)
- n * fact(n-1)
- else
- 1
- end
-end
-
-100.times {
- fact(5000)
-}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/bm_app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
- if n < 3
- 1
- else
- fib(n-1) + fib(n-2)
- end
-end
-
-fib(34)
-
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
deleted file mode 100644
index f09574bbeb..0000000000
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ /dev/null
@@ -1,52 +0,0 @@
-#
-# FizzBuzz program using only lambda calculus
-#
-# This program is quoted from
-# "Understanding Computation" by Tom Stuart
-# http://computationbook.com/
-#
-# You can understand why this program works fine by reading this book.
-#
-
-solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
-
-FIRST = -> l { LEFT[RIGHT[l]] }
-IF = -> b { b }
-LEFT = -> p { p[-> x { -> y { x } } ] }
-RIGHT = -> p { p[-> x { -> y { y } } ] }
-IS_EMPTY = LEFT
-REST = -> l { RIGHT[RIGHT[l]] }
-
-def to_integer(proc)
- proc[-> n { n + 1 }][0]
-end
-
-def to_boolean(proc)
- IF[proc][true][false]
-end
-
-def to_array(proc)
- array = []
-
- until to_boolean(IS_EMPTY[proc])
- array.push(FIRST[proc])
- proc = REST[proc]
- end
-
- array
-end
-
-def to_char(c)
- '0123456789BFiuz'.slice(to_integer(c))
-end
-
-def to_string(s)
- to_array(s).map { |c| to_char(c) }.join
-end
-
-answer = to_array(solution).map do |p|
- to_string(p)
-end
-
-answer_ary = answer.to_a
-# puts answer_ary
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
deleted file mode 100644
index 801b75e8e2..0000000000
--- a/benchmark/bm_app_mandelbrot.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-require 'complex'
-
-def mandelbrot? z
- i = 0
- while i<100
- i += 1
- z = z * z
- return false if z.abs > 2
- end
- true
-end
-
-ary = []
-
-(0..1000).each{|dx|
- (0..1000).each{|dy|
- x = dx / 50.0
- y = dy / 50.0
- c = Complex(x, y)
- ary << c if mandelbrot?(c)
- }
-}
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
- nb.each{|x|
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- [-ROW, -1, 1, ROW].each{|d|
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- }
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- }
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- (0...ROW*COL).each{|i|
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- }
-end
-
-def pboard
- return # skip print
- print "No. #$no\n"
- (0...COL).each{|i|
- print "|"
- (0...ROW-NP).each{|j|
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- }
- print "\n"
- }
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- x.each{|s|
- if $b[pos+s] != -1
- f=1
- break
- end
- }
- if f == 0 then
- x.each{|s|
- $b[pos+s] = i
- }
- a << i
- setpiece(a.dup, pos)
- a.pop
- x.each{|s|
- $b[pos+s] = -1
- }
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
- for x in nb
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- for d in [-ROW, -1, 1, ROW]
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- end
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- end
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- for i in 0...ROW*COL
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- end
-end
-
-def pboard
- print "No. #$no\n"
- for i in 0...COL
- print "|"
- for j in 0...ROW-NP
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- end
- print "\n"
- end
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- for s in x do
- if $b[pos+s] != -1
- f=1
- break
- end
- end
- if f == 0 then
- for s in x do
- $b[pos+s] = i
- end
- a << i
- setpiece(a.dup, pos)
- a.pop
- for s in x do
- $b[pos+s] = -1
- end
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
deleted file mode 100644
index 5db8f95d50..0000000000
--- a/benchmark/bm_app_raise.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<300000
- i += 1
- begin
- raise
- rescue
- end
-end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
deleted file mode 100644
index 7eed7c1aed..0000000000
--- a/benchmark/bm_app_strconcat.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<2_000_000
- "#{1+1} #{1+1} #{1+1}"
- i += 1
-end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/bm_app_tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
- unless y < x
- z
- else
- tak( tak(x-1, y, z),
- tak(y-1, z, x),
- tak(z-1, x, y))
- end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
deleted file mode 100644
index 4c146f5ccf..0000000000
--- a/benchmark/bm_app_tarai.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def tarai( x, y, z )
- if x <= y
- then y
- else tarai(tarai(x-1, y, z),
- tarai(y-1, z, x),
- tarai(z-1, x, y))
- end
-end
-
-tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
deleted file mode 100644
index 586edfd5dc..0000000000
--- a/benchmark/bm_app_uri.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-require 'uri'
-
-100_000.times{
- uri = URI.parse('http://www.ruby-lang.org')
- uri.scheme
- uri.host
- uri.port
-}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/bm_array_shift.rb
deleted file mode 100644
index 798bb9e3f4..0000000000
--- a/benchmark/bm_array_shift.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-require 'benchmark'
-
-Benchmark.bm do |x|
- [10_000,1_000_000,100_000_000].each do |n|
- ary = Array.new(n,0)
- GC.start
- x.report("#{n}:shift"){ ary.shift }
- (0..4).each do |i|
- ary = Array.new(n,0)
- GC.start
- x.report("#{n}:shift(#{i})"){ ary.shift(i) }
- end
- end
-end
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
deleted file mode 100644
index af4f8c36d4..0000000000
--- a/benchmark/bm_hash_aref_dsym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-syms = ('a'..'z').map { |s| s.to_sym }
-syms.each { |s| h[s] = 1 }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
deleted file mode 100644
index 9d7759379e..0000000000
--- a/benchmark/bm_hash_aref_dsym_long.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# [ruby-core:70129] [Bug #11396]
-collection_size = 200000
-sample_size = 10000
-
-values = (1..collection_size).to_a.map do |x|
- "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
-end
-
-symbol_hash = {}
-
-values.each do |x|
- symbol_hash[x.to_sym] = 1
-end
-
-# use the same samples each time to minimize deviations
-rng = Random.new(0)
-symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
-
-3000.times do
- symbol_sample_array.each { |x| symbol_hash[x] }
-end
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
deleted file mode 100644
index 1346890582..0000000000
--- a/benchmark/bm_hash_aref_fix.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-nums = (1..26).to_a
-nums.each { |i| h[i] = i }
-200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
deleted file mode 100644
index 2217274c82..0000000000
--- a/benchmark/bm_hash_aref_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = [*1..10000].map! {|i| i.fdiv(10)}
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
deleted file mode 100644
index b0913dd4bb..0000000000
--- a/benchmark/bm_hash_aref_miss.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-strs = ('A'..'Z').to_a
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
deleted file mode 100644
index 19439b061b..0000000000
--- a/benchmark/bm_hash_aref_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
deleted file mode 100644
index f75d163fe6..0000000000
--- a/benchmark/bm_hash_aref_sym.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-syms = ('a'..'z').to_a
-begin
- syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
- syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
deleted file mode 100644
index 9dab8df7be..0000000000
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-h = {}
-syms = %w[puts warn syswrite write stat bacon lettuce tomato
-some symbols in this array may already be interned others should not be
-hash browns make good breakfast but not cooked using prime numbers
-shift for division entries delete_if keys exist?
-]
-begin
- syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
- syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
deleted file mode 100644
index e944aae9f2..0000000000
--- a/benchmark/bm_hash_flatten.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-1000.times do
- h.flatten
-end
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
deleted file mode 100644
index 0c7edfed3e..0000000000
--- a/benchmark/bm_hash_ident_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = (1..10000).to_a.map!(&:to_f)
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
deleted file mode 100644
index b226736c6f..0000000000
--- a/benchmark/bm_hash_ident_num.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-nums = (1..26).to_a
-nums.each { |n| h[n] = n }
-200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
deleted file mode 100644
index 4b3b58edec..0000000000
--- a/benchmark/bm_hash_ident_obj.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-objs = 26.times.map { Object.new }
-objs.each { |o| h[o] = o }
-200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
deleted file mode 100644
index 8582b38e31..0000000000
--- a/benchmark/bm_hash_ident_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = ('a'..'z').to_a
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
deleted file mode 100644
index 4c81e3d28e..0000000000
--- a/benchmark/bm_hash_ident_sym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-syms = ('a'..'z').to_a.map(&:to_sym)
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
deleted file mode 100644
index 6863cd01f9..0000000000
--- a/benchmark/bm_hash_keys.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-5000.times do
- h.keys
-end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
deleted file mode 100644
index a645671a5b..0000000000
--- a/benchmark/bm_hash_shift.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-50000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb
deleted file mode 100644
index ec800d0342..0000000000
--- a/benchmark/bm_hash_shift_u16.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(16384..65536).each do |i|
- h[i] = nil
-end
-
-300000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb
deleted file mode 100644
index de4e0fa696..0000000000
--- a/benchmark/bm_hash_shift_u24.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(0xff4000..0xffffff).each do |i|
- h[i] = nil
-end
-
-300000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb
deleted file mode 100644
index 656aa55583..0000000000
--- a/benchmark/bm_hash_shift_u32.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(0xffff4000..0xffffffff).each do |i|
- h[i] = nil
-end
-
-300000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
deleted file mode 100644
index 2b675bf509..0000000000
--- a/benchmark/bm_hash_to_proc.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-5000.times do |i|
- [i].map(&h)
-end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
deleted file mode 100644
index 069441302f..0000000000
--- a/benchmark/bm_hash_values.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-5000.times do
- h.values
-end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
deleted file mode 100644
index 2f205c1333..0000000000
--- a/benchmark/bm_io_file_create.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-#
-# Create files
-#
-
-max = 200_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
- f = open(file, 'w')
- f.close#(true)
-}
-File.unlink(file)
-
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
deleted file mode 100644
index b9e796ed30..0000000000
--- a/benchmark/bm_io_file_read.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
- f.seek 0
- f.read
-}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
deleted file mode 100644
index aa1be0e5fe..0000000000
--- a/benchmark/bm_io_file_write.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
- f.seek 0
- f.write str
-}
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
deleted file mode 100644
index da9357fdc6..0000000000
--- a/benchmark/bm_io_nonblock_noex.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-noex = { exception: false }
-begin
- r, w = IO.pipe
- while i < nr
- i += 1
- w.write_nonblock(msg, noex)
- r.read_nonblock(1, buf, noex)
- end
-rescue ArgumentError # old Rubies
- while i < nr
- i += 1
- w.write_nonblock(msg)
- r.read_nonblock(1, buf)
- end
-ensure
- r.close
- w.close
-end
diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb
deleted file mode 100644
index 56819d049b..0000000000
--- a/benchmark/bm_io_nonblock_noex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-begin
- r, w = IO.pipe
- while i < nr
- i += 1
- w.write_nonblock(msg, exception: false)
- r.read_nonblock(1, buf, exception: false)
- end
-rescue ArgumentError # old Rubies
- while i < nr
- i += 1
- w.write_nonblock(msg)
- r.read_nonblock(1, buf)
- end
-ensure
- r.close
- w.close
-end
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
deleted file mode 100644
index 19248daeb1..0000000000
--- a/benchmark/bm_io_select.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# IO.select performance
-
-w = [ IO.pipe[1] ];
-
-nr = 1000000
-nr.times {
- IO.select nil, w
-}
-
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
deleted file mode 100644
index 10e37d71b2..0000000000
--- a/benchmark/bm_io_select2.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# IO.select performance. worst case of single fd.
-
-ios = []
-nr = 1000000
-if defined?(Process::RLIMIT_NOFILE)
- max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
- max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-((max / 2) - 10).times do
- ios.concat IO.pipe
-end
-
-last = [ ios[-1] ]
-puts "last IO: #{last[0].inspect}"
-
-nr.times do
- IO.select nil, last
-end
-
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
deleted file mode 100644
index 7d0ba1f092..0000000000
--- a/benchmark/bm_io_select3.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# IO.select performance. a lot of fd
-
-ios = []
-nr = 100
-if defined?(Process::RLIMIT_NOFILE)
- max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
- max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-(max - 10).times do
- r, w = IO.pipe
- r.close
- ios.push w
-end
-
-nr.times do
- IO.select nil, ios
-end
-
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
deleted file mode 100644
index 0fc4cc1511..0000000000
--- a/benchmark/bm_loop_for.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-for i in 1..30_000_000
- #
-end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/bm_loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
- gen = (1..max).each
- loop do
- gen.next
- end
-else
- require 'generator'
- gen = Generator.new((0..max))
- while gen.next?
- gen.next
- end
-end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
deleted file mode 100644
index 521f72ad1a..0000000000
--- a/benchmark/bm_loop_times.rb
+++ /dev/null
@@ -1 +0,0 @@
-30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
deleted file mode 100644
index 0072822c06..0000000000
--- a/benchmark/bm_loop_whileloop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
- i += 1
-end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
deleted file mode 100644
index 47d02dffc4..0000000000
--- a/benchmark/bm_loop_whileloop2.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i< 6_000_000 # benchmark loop 2
- i += 1
-end
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
deleted file mode 100644
index 9b8d0c6afb..0000000000
--- a/benchmark/bm_marshal_dump_flo.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-bug10761 = 10000.times.map { |x| x.to_f }
-100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
deleted file mode 100644
index 8252ad90fa..0000000000
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-a = ''
-a.instance_eval do
- @a = :a
- @b = :b
- @c = :c
-end
-100000.times do
- a = Marshal.load(Marshal.dump(a))
-end
-#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
deleted file mode 100644
index e29743b791..0000000000
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ /dev/null
@@ -1 +0,0 @@
-100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
- require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
- while true
- i = i+1 # dummy loop
- end
-end
-
-1.upto(100) do |i|
- require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb
deleted file mode 100644
index a082ea6d5b..0000000000
--- a/benchmark/bm_securerandom.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-require "securerandom"
-
-20_0000.times do
- SecureRandom.random_number(100)
-end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
- x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
- (n-1).step(0,-1) do |bi|
- y[bi] += x.at(bi)
- end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
deleted file mode 100644
index b1693e4109..0000000000
--- a/benchmark/bm_so_binary_trees.rb
+++ /dev/null
@@ -1,62 +0,0 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-alias puts_orig puts
-def puts str
- # disable puts
-end
-
-def item_check(tree)
- if tree[0] == nil
- tree[1]
- else
- tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
- item_item = 2 * item
- depth -= 1
- [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
- [nil, item, nil]
- end
-end
-
-max_depth = 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
- temp_tree = bottom_up_tree(i, depth)
- check += item_check(temp_tree)
-
- temp_tree = bottom_up_tree(-i, depth)
- check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
-
-undef puts
-alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
- i += 1
- hello = ''
- 4_000_000.times do |e|
- hello << STUFF
- end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-class Hi_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-def some_function(num)
- begin
- hi_function(num)
- rescue
- print "We shouldn't get here, exception is: #{$!.type}\n"
- end
-end
-
-def hi_function(num)
- begin
- lo_function(num)
- rescue Hi_Exception
- $HI = $HI + 1
- end
-end
-
-def lo_function(num)
- begin
- blowup(num)
- rescue Lo_Exception
- $LO = $LO + 1
- end
-end
-
-def blowup(num)
- if num % 2 == 0
- raise Lo_Exception.new(num)
- else
- raise Hi_Exception.new(num)
- end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
- i += 1
- some_function(i+1)
-end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
deleted file mode 100644
index bac5ecd44c..0000000000
--- a/benchmark/bm_so_fannkuch.rb
+++ /dev/null
@@ -1,45 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
- maxFlips, m, r, check = 0, n-1, n, 0
- count = (1..n).to_a
- perm = (1..n).to_a
-
- while true
- if check < 30
- puts "#{perm}"
- check += 1
- end
-
- while r != 1
- count[r-1] = r
- r -= 1
- end
-
- if perm[0] != 1 and perm[m] != n
- perml = perm.clone #.dup
- flips = 0
- while (k = perml.first ) != 1
- perml = perml.slice!(0, k).reverse + perml
- flips += 1
- end
- maxFlips = flips if flips > maxFlips
- end
- while true
- if r==n then return maxFlips end
- perm.insert r,perm.shift
- break if (count[r] -= 1) > 0
- r += 1
- end
- end
-end
-
-def puts *args
-end
-
-N = 9 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
deleted file mode 100644
index e8f4a2a5f7..0000000000
--- a/benchmark/bm_so_lists.rb
+++ /dev/null
@@ -1,47 +0,0 @@
-#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
-
-NUM = 300
-SIZE = 10000
-
-def test_lists()
- # create a list of integers (Li1) from 1 to SIZE
- li1 = (1..SIZE).to_a
- # copy the list to li2 (not by individual items)
- li2 = li1.dup
- # remove each individual item from left side of li2 and
- # append to right side of li3 (preserving order)
- li3 = Array.new
- while (not li2.empty?)
- li3.push(li2.shift)
- end
- # li2 must now be empty
- # remove each individual item from right side of li3 and
- # append to right side of li2 (reversing list)
- while (not li3.empty?)
- li2.push(li3.pop)
- end
- # li3 must now be empty
- # reverse li1 in place
- li1.reverse!
- # check that first item is now SIZE
- if li1[0] != SIZE then
- p "not SIZE"
- 0
- else
- # compare li1 and li2 for equality
- if li1 != li2 then
- return(0)
- else
- # return the length of the list
- li1.length
- end
- end
-end
-
-i = 0
-while i<NUM
- i += 1
- result = test_lists()
-end
-
-result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
deleted file mode 100644
index 76331c64b8..0000000000
--- a/benchmark/bm_so_mandelbrot.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-# The Computer Language Benchmarks Game
-# http://shootout.alioth.debian.org/
-#
-# contributed by Karl von Laudermann
-# modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49 # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1 # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
- for x in 0..count_size
- zr = 0.0
- zi = 0.0
- cr = (2.0*x/size)-1.5
- ci = (2.0*y/size)-1.0
- escape = false
-
- # To make use of the for..in code, we use a dummy variable,
- # like one would in C
- for dummy in 0..ITER
- tr = zr*zr - zi*zi + cr
- ti = 2*zr*zi + ci
- zr, zi = tr, ti
-
- if (zr*zr+zi*zi) > LIMIT_SQUARED
- escape = true
- break
- end
- end
-
- byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
- bit_num += 1
-
- # Code is very similar for these cases, but using separate blocks
- # ensures we skip the shifting when it's unnecessary, which is most cases.
- if (bit_num == 8)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- elsif (x == count_size)
- byte_acc <<= (8 - bit_num)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- end
- end
-end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
- count = 1
- mx = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- row[j] = count
- count += 1
- end
- mx[bi] = row
- end
- mx
-end
-
-def mmult(rows, cols, m1, m2)
- m3 = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- val = 0
- (0 .. (cols - 1)).each do |k|
- val += m1.at(bi).at(k) * m2.at(k).at(j)
- end
- row[j] = val
- end
- m3[bi] = row
- end
- m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
- mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 64a7d46afe..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is invalid at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values ( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop across the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the current row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # following reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is achieved via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticeable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
- end
-
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
-end
-
-def energy(bodies)
- e = 0.0
- nbodies = bodies.size
-
- for i in 0 ... nbodies
- b = bodies[i]
- e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
- for j in (i + 1) ... nbodies
- b2 = bodies[j]
- dx = b.x - b2.x
- dy = b.y - b2.y
- dz = b.z - b2.z
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- e -= (b.mass * b2.mass) / distance
- end
- end
- e
-end
-
-def offset_momentum(bodies)
- px, py, pz = 0.0, 0.0, 0.0
-
- for b in bodies
- m = b.mass
- px += b.vx * m
- py += b.vy * m
- pz += b.vz * m
- end
-
- b = bodies[0]
- b.vx = - px / SOLAR_MASS
- b.vy = - py / SOLAR_MASS
- b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
- # sun
- Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
- # jupiter
- Planet.new(
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03,
- 7.69901118419740425e-03,
- -6.90460016972063023e-05,
- 9.54791938424326609e-04),
-
- # saturn
- Planet.new(
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03,
- 4.99852801234917238e-03,
- 2.30417297573763929e-05,
- 2.85885980666130812e-04),
-
- # uranus
- Planet.new(
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03,
- 2.37847173959480950e-03,
- -2.96589568540237556e-05,
- 4.36624404335156298e-05),
-
- # neptune
- Planet.new(
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03,
- 1.62824170038242295e-03,
- -9.51592254519715870e-05,
- 5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
- i = 0
- while i < nbodies
- b = BODIES[i]
- b.move_from_i(BODIES, nbodies, dt, i + 1)
- i += 1
- end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- x += 1
- end
- end
- end
- end
- end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
deleted file mode 100644
index a65cc78233..0000000000
--- a/benchmark/bm_so_nsieve.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Glenn Parker, March 2005
-# modified by Evan Phoenix, Sept 2006
-
-def sieve(m)
- flags = Flags.dup[0,m]
- count = 0
- pmax = m - 1
- p = 2
- while p <= pmax
- unless flags[p].zero?
- count += 1
- mult = p
- while mult <= pmax
- flags[mult] = 0
- mult += p
- end
- end
- p += 1
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
-
-n.downto(n-2) do |exponent|
- break if exponent < 0
- m = (1 << exponent) * 10_000
- # m = (2 ** exponent) * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
deleted file mode 100644
index 6f958ee44e..0000000000
--- a/benchmark/bm_so_nsieve_bits.rb
+++ /dev/null
@@ -1,43 +0,0 @@
-#!/usr/bin/ruby
-#coding: us-ascii
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
- items = "\xFF" * ((m / BitsPerChar) + 1)
- masks = ""
- BitsPerChar.times do |b|
- masks << (1 << b).chr
- end
-
- count = 0
- pmax = m - 1
- 2.step(pmax, 1) do |p|
- if items[p >> CharExponent][p & LowMask] == 1
- count += 1
- p.step(pmax, p) do |mult|
- a = mult >> CharExponent
- b = mult & LowMask
- items[a] -= masks[b] if items[a][b] != 0
- end
- end
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
- break if exponent < 0
- m = 2 ** exponent * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
- def initialize(start_state)
- @bool = start_state
- end
-
- def value
- @bool
- end
-
- def activate
- @bool = !@bool
- self
- end
-end
-
-class NthToggle < Toggle
- def initialize(start_state, max_counter)
- super start_state
- @count_max = max_counter
- @counter = 0
- end
-
- def activate
- @counter += 1
- if @counter >= @count_max
- @bool = !@bool
- @counter = 0
- end
- self
- end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
- toggle.activate.value ? 'true' : 'false'
-end
-n.times do
- toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
- ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
- ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
deleted file mode 100644
index 630b45cb8d..0000000000
--- a/benchmark/bm_so_partial_sums.rb
+++ /dev/null
@@ -1,31 +0,0 @@
-n = 2_500_000 # (ARGV.shift || 1).to_i
-
-alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
-
-1.upto(n) do |d|
- d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
-
- s0 += (2.0 / 3.0) ** (d - 1.0)
- s1 += 1.0 / Math.sqrt(d)
- s2 += 1.0 / (d * (d + 1.0))
- s3 += 1.0 / (d3 * ds * ds)
- s4 += 1.0 / (d3 * dc * dc)
- s5 += 1.0 / d
- s6 += 1.0 / d2
- s7 += alt / d
- s8 += alt / (2.0 * d - 1.0)
-
- alt = -alt
-end
-
-if false
- printf("%.9f\t(2/3)^k\n", s0)
- printf("%.9f\tk^-0.5\n", s1)
- printf("%.9f\t1/k(k+1)\n", s2)
- printf("%.9f\tFlint Hills\n", s3)
- printf("%.9f\tCookson Hills\n", s4)
- printf("%.9f\tHarmonic\n", s5)
- printf("%.9f\tRiemann Zeta\n", s6)
- printf("%.9f\tAlternating Harmonic\n", s7)
- printf("%.9f\tGregory\n", s8)
-end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
- def initialize()
- @z = Transformation.new 1,0,0,1
- @x = Transformation.new 0,0,0,0
- @inverse = Transformation.new 0,0,0,0
- end
-
- def next!
- @y = @z.extract(3)
- if safe? @y
- @z = produce(@y)
- @y
- else
- @z = consume @x.next!()
- next!()
- end
- end
-
- def safe?(digit)
- digit == @z.extract(4)
- end
-
- def produce(i)
- @inverse.qrst(10,-10*i,0,1).compose(@z)
- end
-
- def consume(a)
- @z.compose(a)
- end
-end
-
-
-class Transformation
- attr_reader :q, :r, :s, :t
- def initialize (q, r, s, t)
- @q,@r,@s,@t,@k = q,r,s,t,0
- end
-
- def next!()
- @q = @k = @k + 1
- @r = 4 * @k + 2
- @s = 0
- @t = 2 * @k + 1
- self
- end
-
- def extract(j)
- (@q * j + @r) / (@s * j + @t)
- end
-
- def compose(a)
- self.class.new( @q * a.q,
- @q * a.r + r * a.t,
- @s * a.q + t * a.s,
- @s * a.r + t * a.t
- )
- end
-
- def qrst *args
- initialize *args
- self
- end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
- if n >= WIDTH
- WIDTH.times {print digits.next!}
- j += WIDTH
- else
- n.times {print digits.next!}
- (WIDTH-n).times {print " "}
- j += n
- end
- puts "\t:"+j.to_s
- n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
deleted file mode 100644
index a66b9e8e63..0000000000
--- a/benchmark/bm_so_random.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
-
-IM = 139968.0
-IA = 3877.0
-IC = 29573.0
-
-$last = 42.0
-
-def gen_random(max)
- (max * ($last = ($last * IA + IC) % IM)) / IM
-end
-
-N = 3_000_000
-
-i = 0
-while i<N
- i +=1
- gen_random(100.0)
-end
-# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
deleted file mode 100644
index 43dc302648..0000000000
--- a/benchmark/bm_so_sieve.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
-num = 500
-count = i = j = 0
-flags0 = Array.new(8192,1)
-k = 0
-while k < num
- k += 1
- count = 0
- flags = flags0.dup
- i = 2
- while i<8192
- i += 1
- if flags[i]
- # remove all multiples of prime: i
- j = i*i
- while j < 8192
- j += i
- flags[j] = nil
- end
- count += 1
- end
- end
-end
-count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
deleted file mode 100644
index 6b97206689..0000000000
--- a/benchmark/bm_so_spectralnorm.rb
+++ /dev/null
@@ -1,50 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-def eval_A(i,j)
- return 1.0/((i+j)*(i+j+1)/2+i+1)
-end
-
-def eval_A_times_u(u)
- v, i = nil, nil
- (0..u.length-1).collect { |i|
- v = 0
- for j in 0..u.length-1
- v += eval_A(i,j)*u[j]
- end
- v
- }
-end
-
-def eval_At_times_u(u)
- v, i = nil, nil
- (0..u.length-1).collect{|i|
- v = 0
- for j in 0..u.length-1
- v += eval_A(j,i)*u[j]
- end
- v
- }
-end
-
-def eval_AtA_times_u(u)
- return eval_At_times_u(eval_A_times_u(u))
-end
-
-n = 500 # ARGV[0].to_i
-
-u=[1]*n
-for i in 1..10
- v=eval_AtA_times_u(u)
- u=eval_AtA_times_u(v)
-end
-vBv=0
-vv=0
-for i in 0..n-1
- vBv += u[i]*v[i]
- vv += v[i]*v[i]
-end
-
-str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
-# print str
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_reader :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = obj.a
- k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_accessor :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- obj.a = 1
- obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m{
- }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = Const
- k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
- i += 1
- begin
- begin
- ensure
- end
- ensure
- end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
- i += 1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
- if n == 0
- ''
- else
- 10.times{
- h[Object.new] = nested_hash(h, n-1)
- }
- end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- short_lived_ary[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
- GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
- attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- short_lived_obj.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
- attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
- GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = @a
- k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- @a = 1
- @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a.length
- b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
- unless v
- # unreachable code
- v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
- v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
- v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
- v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
- v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
- end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
- i += 1
- m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- begin
- rescue
- end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- i = 0
- while i<30_000_000 # while loop 1
- i += 1
- yield
- end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
- i += 1
- a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
- case :foo
- when :bar
- raise
- when :baz
- raise
- when :boo
- raise
- when :foo
- i += 1
- end
-end
-
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
deleted file mode 100644
index c62b294e0e..0000000000
--- a/benchmark/bm_vm2_case_lit.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-i = 0
-@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
-def foo(i)
- @ret[i % @ret.size]
-end
-
-while i<6_000_000 # while loop 2
- case foo(i)
- when "foo" then :foo
- when true then true
- when false then false
- when :sym then :sym
- when 6 then :fix
- when nil then nil
- when 0.1 then :float
- when 0xffffffffffffffff then :big
- end
- i += 1
-end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
- define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
- i += 1
- str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def method_missing mid
- end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 5d16480c6b..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Thread::Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
- o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
-# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
- b
-end
-
-pr = m{
- a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
- if n > 0
- rec n-1
- else
- raise
- end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
-
- begin
- rec 1
- rescue
- # ignore
- end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
- if n > 0
- rec n-1
- else
- raise
- end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
-
- begin
- rec 10
- rescue
- # ignore
- end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
- /hoge/ =~ str
- i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def m
- end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
deleted file mode 100644
index 1d73036849..0000000000
--- a/benchmark/bm_vm2_string_literal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
- def m
- 1
- end
-end
-
-class CC < C
- def m
- super()
- end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- obj.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
- i += 1
- m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
- def m a
- 1
- end
-end
-
-class CC < C
- def m a
- super
- end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
- obj.m 10
- i += 1
-end
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
deleted file mode 100644
index 0fbf73e1ca..0000000000
--- a/benchmark/bm_vm3_backtrace.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# get last backtrace
-
-begin
- caller(0, 0)
-rescue ArgumentError
- alias caller_orig caller
- def caller lev, n
- caller_orig(lev)[0..n]
- end
-end
-
-def rec n
- if n < 0
- 100_000.times{
- caller(0, 1)
- }
- else
- rec(n-1)
- end
-end
-
-rec 50
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
deleted file mode 100644
index 9661323cd2..0000000000
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<200_000
- i += 1
-
- Class.new{
- def m; end
- }
-end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
deleted file mode 100644
index e668026915..0000000000
--- a/benchmark/bm_vm3_gc.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5000.times do
- 100.times do
- {"xxxx"=>"yyyy"}
- end
- GC.start
-end
diff --git a/benchmark/bm_vm3_gc_old_full.rb b/benchmark/bm_vm3_gc_old_full.rb
deleted file mode 100644
index cfdfc8c5a5..0000000000
--- a/benchmark/bm_vm3_gc_old_full.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-old_object = Array.new(1_000_000){''}
-100.times do
- GC.start
-end
diff --git a/benchmark/bm_vm3_gc_old_immediate.rb b/benchmark/bm_vm3_gc_old_immediate.rb
deleted file mode 100644
index ad22feb655..0000000000
--- a/benchmark/bm_vm3_gc_old_immediate.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-old_object = Array.new(1_000_000){''}
-30_000.times do
- GC.start(full_mark: false, immediate_sweep: true)
-end
diff --git a/benchmark/bm_vm3_gc_old_lazy.rb b/benchmark/bm_vm3_gc_old_lazy.rb
deleted file mode 100644
index b74d44baf1..0000000000
--- a/benchmark/bm_vm3_gc_old_lazy.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-old_object = Array.new(1_000_000){''}
-30_000.times do
- GC.start(full_mark: false, immediate_sweep: false)
-end
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
deleted file mode 100644
index 1d433353e1..0000000000
--- a/benchmark/bm_vm_symbol_block_pass.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-class C
- 1000.times {|i|
- eval("def i#{i};end")
- }
-end
-
-c = C.new
-m = C.instance_methods(false)
-5_000.times do
- m.each do |n|
- c.tap(&n)
- end
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644