summaryrefslogtreecommitdiff
path: root/include/ruby/internal/scan_args.h
diff options
context:
space:
mode:
Diffstat (limited to 'include/ruby/internal/scan_args.h')
-rw-r--r--include/ruby/internal/scan_args.h159
1 files changed, 146 insertions, 13 deletions
diff --git a/include/ruby/internal/scan_args.h b/include/ruby/internal/scan_args.h
index d9329e7e98..da64678db5 100644
--- a/include/ruby/internal/scan_args.h
+++ b/include/ruby/internal/scan_args.h
@@ -17,15 +17,17 @@
* recursively included from extension libraries written in C++.
* Do not expect for instance `__VA_ARGS__` is always available.
* We assume C99 for ruby itself but we don't assume languages of
- * extension libraries. They could be written in C++98.
+ * extension libraries. They could be written in C++98.
* @brief Compile-time static implementation of ::rb_scan_args().
*
* This is a beast. It statically analyses the argument spec string, and
* expands the assignment of variables into dedicated codes.
*/
+#include "ruby/assert.h"
#include "ruby/internal/attr/diagnose_if.h"
#include "ruby/internal/attr/error.h"
#include "ruby/internal/attr/forceinline.h"
+#include "ruby/internal/attr/nonnull.h"
#include "ruby/internal/attr/noreturn.h"
#include "ruby/internal/config.h"
#include "ruby/internal/dllexport.h"
@@ -38,29 +40,155 @@
#include "ruby/internal/static_assert.h"
#include "ruby/internal/stdbool.h"
#include "ruby/internal/value.h"
-#include "ruby/assert.h"
+/**
+ * @name Possible values that you should pass to rb_scan_args_kw().
+ * @{
+ */
+
+/** Same behaviour as rb_scan_args(). */
#define RB_SCAN_ARGS_PASS_CALLED_KEYWORDS 0
+
+/** The final argument must be a hash, which will be treated as keywords. */
#define RB_SCAN_ARGS_KEYWORDS 1
+
+/**
+ * Treat a final argument as keywords if it is a hash, and not as keywords
+ * otherwise.
+ */
#define RB_SCAN_ARGS_LAST_HASH_KEYWORDS 3
+
+/** @} */
+
+/**
+ * @name Possible values that you should pass to rb_funcallv_kw().
+ * @{
+ */
+
+/** Do not pass keywords. */
#define RB_NO_KEYWORDS 0
+
+/** Pass keywords, final argument must be a hash of keywords. */
#define RB_PASS_KEYWORDS 1
-#define RB_PASS_CALLED_KEYWORDS rb_keyword_given_p()
-/* rb_scan_args() format allows ':' for optional hash */
+
+/**
+ * Pass keywords if current method is called with keywords, useful for argument
+ * delegation
+ */
+#define RB_PASS_CALLED_KEYWORDS !!rb_keyword_given_p()
+
+/** @} */
+
+/**
+ * @private
+ *
+ * @deprecated This macro once was a thing in the old days, but makes no sense
+ * any longer today. Exists here for backwards compatibility
+ * only. You can safely forget about it.
+ */
#define HAVE_RB_SCAN_ARGS_OPTIONAL_HASH 1
RBIMPL_SYMBOL_EXPORT_BEGIN()
-int rb_scan_args(int, const VALUE*, const char*, ...);
-int rb_scan_args_kw(int, int, const VALUE*, const char*, ...);
+RBIMPL_ATTR_NONNULL((2, 3))
+/**
+ * Retrieves argument from argc and argv to given ::VALUE references according
+ * to the format string. The format can be described in ABNF as follows:
+ *
+ * ```
+ * scan-arg-spec := param-arg-spec [keyword-arg-spec] [block-arg-spec]
+ *
+ * param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec /
+ * pre-opt-post-arg-spec
+ * pre-arg-spec := num-of-leading-mandatory-args
+ * [num-of-optional-args]
+ * post-arg-spec := sym-for-variable-length-args
+ * [num-of-trailing-mandatory-args]
+ * pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args
+ * num-of-trailing-mandatory-args
+ * keyword-arg-spec := sym-for-keyword-arg
+ * block-arg-spec := sym-for-block-arg
+ *
+ * num-of-leading-mandatory-args := DIGIT ; The number of leading mandatory
+ * ; arguments
+ * num-of-optional-args := DIGIT ; The number of optional arguments
+ * sym-for-variable-length-args := "*" ; Indicates that variable length
+ * ; arguments are captured as a ruby
+ * ; array
+ * num-of-trailing-mandatory-args := DIGIT ; The number of trailing mandatory
+ * ; arguments
+ * sym-for-keyword-arg := ":" ; Indicates that keyword argument
+ * ; captured as a hash.
+ * ; If keyword arguments are not
+ * ; provided, returns nil.
+ * sym-for-block-arg := "&" ; Indicates that an iterator block
+ * ; should be captured if given
+ * ```
+ *
+ * For example, "12" means that the method requires at least one argument, and
+ * at most receives three (1+2) arguments. So, the format string must be
+ * followed by three variable references, which are to be assigned to captured
+ * arguments. For omitted arguments, variables are set to ::RUBY_Qnil. `NULL`
+ * can be put in place of a variable reference, which means the corresponding
+ * captured argument(s) should be just dropped.
+ *
+ * The number of given arguments, excluding an option hash or iterator block,
+ * is returned.
+ *
+ * @param[in] argc Length of `argv`.
+ * @param[in] argv Pointer to the arguments to parse.
+ * @param[in] fmt Format, in the language described above.
+ * @param[out] ... Variables to fill in.
+ * @exception rb_eFatal Malformed `fmt`.
+ * @exception rb_eArgError Arity mismatch.
+ * @return Actually parsed number of given arguments.
+ * @post Each values passed to `argv` is filled into the variadic
+ * arguments, according to the format.
+ */
+int rb_scan_args(int argc, const VALUE *argv, const char *fmt, ...);
+
+RBIMPL_ATTR_NONNULL((3, 4))
+/**
+ * Identical to rb_scan_args(), except it also accepts `kw_splat`.
+ *
+ * @param[in] kw_splat How to understand the keyword arguments.
+ * - RB_SCAN_ARGS_PASS_CALLED_KEYWORDS: Same behaviour as rb_scan_args().
+ * - RB_SCAN_ARGS_KEYWORDS: The final argument is a kwarg.
+ * - RB_SCAN_ARGS_LAST_HASH_KEYWORDS: The final argument is a kwarg, iff it
+ * is a hash.
+ * @param[in] argc Length of `argv`.
+ * @param[in] argv Pointer to the arguments to parse.
+ * @param[in] fmt Format, in the language described above.
+ * @param[out] ... Variables to fill in.
+ * @exception rb_eFatal Malformed `fmt`.
+ * @exception rb_eArgError Arity mismatch.
+ * @return Actually parsed number of given arguments.
+ * @post Each values passed to `argv` is filled into the variadic
+ * arguments, according to the format.
+ */
+int rb_scan_args_kw(int kw_splat, int argc, const VALUE *argv, const char *fmt, ...);
RBIMPL_ATTR_ERROR(("bad scan arg format"))
+/**
+ * @private
+ *
+ * This is an implementation detail of rb_scan_args(). People don't use it
+ * directly.
+ */
void rb_scan_args_bad_format(const char*);
RBIMPL_ATTR_ERROR(("variable argument length doesn't match"))
+/**
+ * @private
+ *
+ * This is an implementation detail of rb_scan_args(). People don't use it
+ * directly.
+ */
void rb_scan_args_length_mismatch(const char*,int);
RBIMPL_SYMBOL_EXPORT_END()
+/** @cond INTERNAL_MACRO */
+
/* If we could use constexpr the following macros could be inline functions
* ... but sadly we cannot. */
@@ -106,13 +234,13 @@ RBIMPL_SYMBOL_EXPORT_END()
# define rb_scan_args_verify(fmt, varc) RBIMPL_ASSERT_NOTHING
#else
# /* At one sight it _seems_ the expressions below could be written using
-# * static assrtions. The reality is no, they don't. Because fmt is a string
-# * literal, any operations against fmt cannot produce the "integer constant
-# * expression"s, as defined in ISO/IEC 9899:2018 section 6.6 paragraph #6.
-# * Static assertions need such integer constant expressions as defined in
-# * ISO/IEC 9899:2018 section 6.7.10 paragraph #3.
+# * static assertions. The reality is no, they don't. Because fmt is a
+# * string literal, any operations against fmt cannot produce the "integer
+# * constant expression"s, as defined in ISO/IEC 9899:2018 section 6.6
+# * paragraph #6. Static assertions need such integer constant expressions as
+# * defined in ISO/IEC 9899:2018 section 6.7.10 paragraph #3.
# *
-# * GCC nonetheless constant-folds this into no-op, though. */
+# * GCC nonetheless constant-folds this into a no-op, though. */
# define rb_scan_args_verify(fmt, varc) \
(sizeof(char[1-2*(rb_scan_args_count(fmt)<0)])!=1 ? \
rb_scan_args_bad_format(fmt) : \
@@ -349,7 +477,12 @@ rb_scan_args_set(int kw_flag, int argc, const VALUE *argv,
#undef rb_scan_args_next_param
}
-#if ! defined(HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P)
+/** @endcond */
+
+#if defined(__DOXYGEN__)
+# /* don't bother */
+
+#elif ! defined(HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P)
# /* skip */
#elif ! defined(HAVE_VA_ARGS_MACRO)
a0a990a4a3310dbbe15192'>benchmark/bm_app_strconcat.rb5
-rw-r--r--benchmark/bm_app_tak.rb13
-rw-r--r--benchmark/bm_app_tarai.rb10
-rw-r--r--benchmark/bm_app_uri.rb8
-rw-r--r--benchmark/bm_hash_aref_miss.rb5
-rw-r--r--benchmark/bm_hash_aref_str.rb4
-rw-r--r--benchmark/bm_hash_aref_sym.rb4
-rw-r--r--benchmark/bm_hash_aref_sym_long.rb8
-rw-r--r--benchmark/bm_hash_flatten.rb9
-rw-r--r--benchmark/bm_hash_ident_num.rb4
-rw-r--r--benchmark/bm_hash_ident_obj.rb4
-rw-r--r--benchmark/bm_hash_ident_str.rb4
-rw-r--r--benchmark/bm_hash_ident_sym.rb4
-rw-r--r--benchmark/bm_hash_keys.rb9
-rw-r--r--benchmark/bm_hash_shift.rb10
-rw-r--r--benchmark/bm_hash_values.rb9
-rw-r--r--benchmark/bm_io_file_create.rb13
-rw-r--r--benchmark/bm_io_file_read.rb15
-rw-r--r--benchmark/bm_io_file_write.rb14
-rw-r--r--benchmark/bm_io_select.rb9
-rw-r--r--benchmark/bm_io_select2.rb22
-rw-r--r--benchmark/bm_io_select3.rb21
-rw-r--r--benchmark/bm_loop_for.rb3
-rw-r--r--benchmark/bm_loop_generator.rb14
-rw-r--r--benchmark/bm_loop_times.rb1
-rw-r--r--benchmark/bm_loop_whileloop.rb4
-rw-r--r--benchmark/bm_loop_whileloop2.rb4
-rw-r--r--benchmark/bm_securerandom.rb5
-rw-r--r--benchmark/bm_so_ackermann.rb19
-rw-r--r--benchmark/bm_so_array.rb23
-rw-r--r--benchmark/bm_so_binary_trees.rb62
-rw-r--r--benchmark/bm_so_concatenate.rb18
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_exception.rb61
-rw-r--r--benchmark/bm_so_fannkuch.rb45
-rw-r--r--benchmark/bm_so_fasta.rb81
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_lists.rb47
-rw-r--r--benchmark/bm_so_mandelbrot.rb57
-rw-r--r--benchmark/bm_so_matrix.rb48
-rw-r--r--benchmark/bm_so_meteor_contest.rb564
-rw-r--r--benchmark/bm_so_nbody.rb148
-rw-r--r--benchmark/bm_so_nested_loop.rb24
-rw-r--r--benchmark/bm_so_nsieve.rb35
-rw-r--r--benchmark/bm_so_nsieve_bits.rb43
-rw-r--r--benchmark/bm_so_object.rb56
-rw-r--r--benchmark/bm_so_partial_sums.rb31
-rw-r--r--benchmark/bm_so_pidigits.rb92
-rw-r--r--benchmark/bm_so_random.rb20
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rw-r--r--benchmark/bm_so_sieve.rb24
-rw-r--r--benchmark/bm_so_spectralnorm.rb50
-rw-r--r--benchmark/bm_vm1_attr_ivar.rb14
-rw-r--r--benchmark/bm_vm1_attr_ivar_set.rb14
-rw-r--r--benchmark/bm_vm1_block.rb10
-rw-r--r--benchmark/bm_vm1_const.rb8
-rw-r--r--benchmark/bm_vm1_ensure.rb11
-rw-r--r--benchmark/bm_vm1_float_simple.rb7
-rw-r--r--benchmark/bm_vm1_gc_short_lived.rb10
-rw-r--r--benchmark/bm_vm1_gc_short_with_complex_long.rb27
-rw-r--r--benchmark/bm_vm1_gc_short_with_long.rb13
-rw-r--r--benchmark/bm_vm1_gc_short_with_symbol.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_ary.rb10
-rw-r--r--benchmark/bm_vm1_gc_wb_obj.rb13
-rw-r--r--benchmark/bm_vm1_ivar.rb8
-rw-r--r--benchmark/bm_vm1_ivar_set.rb6
-rw-r--r--benchmark/bm_vm1_length.rb9
-rw-r--r--benchmark/bm_vm1_lvar_init.rb18
-rw-r--r--benchmark/bm_vm1_lvar_set.rb5
-rw-r--r--benchmark/bm_vm1_neq.rb8
-rw-r--r--benchmark/bm_vm1_not.rb7
-rw-r--r--benchmark/bm_vm1_rescue.rb7
-rw-r--r--benchmark/bm_vm1_simplereturn.rb9
-rw-r--r--benchmark/bm_vm1_swap.rb8
-rw-r--r--benchmark/bm_vm1_yield.rb10
-rw-r--r--benchmark/bm_vm2_array.rb5
-rw-r--r--benchmark/bm_vm2_bigarray.rb106
-rw-r--r--benchmark/bm_vm2_bighash.rb5
-rw-r--r--benchmark/bm_vm2_case.rb14
-rw-r--r--benchmark/bm_vm2_defined_method.rb9
-rw-r--r--benchmark/bm_vm2_dstr.rb6
-rw-r--r--benchmark/bm_vm2_eval.rb6
-rw-r--r--benchmark/bm_vm2_method.rb9
-rw-r--r--benchmark/bm_vm2_method_missing.rb12
-rw-r--r--benchmark/bm_vm2_method_with_block.rb9
-rw-r--r--benchmark/bm_vm2_mutex.rb9
-rw-r--r--benchmark/bm_vm2_newlambda.rb5
-rw-r--r--benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_raise1.rb18
-rw-r--r--benchmark/bm_vm2_raise2.rb18
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rw-r--r--benchmark/bm_vm3_backtrace.rb22
-rw-r--r--benchmark/bm_vm3_clearmethodcache.rb8
-rwxr-xr-xbenchmark/bm_vm3_gc.rb7
-rw-r--r--benchmark/bm_vm_thread_alive_check1.rb6
-rw-r--r--benchmark/bm_vm_thread_close.rb6
-rw-r--r--benchmark/bm_vm_thread_create_join.rb6
-rw-r--r--benchmark/bm_vm_thread_mutex1.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex2.rb21
-rw-r--r--benchmark/bm_vm_thread_mutex3.rb20
-rw-r--r--benchmark/bm_vm_thread_pass.rb15
-rw-r--r--benchmark/bm_vm_thread_pass_flood.rb8
-rw-r--r--benchmark/bm_vm_thread_pipe.rb17
-rw-r--r--benchmark/bm_vm_thread_queue.rb18
-rw-r--r--benchmark/driver.rb321
-rw-r--r--benchmark/gc/aobench.rb1
-rw-r--r--benchmark/gc/binary_trees.rb1
-rw-r--r--benchmark/gc/gcbench.rb56
-rw-r--r--benchmark/gc/hash1.rb11
-rw-r--r--benchmark/gc/hash2.rb7
-rw-r--r--benchmark/gc/null.rb1
-rw-r--r--benchmark/gc/pentomino.rb1
-rw-r--r--benchmark/gc/rdoc.rb13
-rw-r--r--benchmark/gc/redblack.rb366
-rw-r--r--benchmark/gc/ring.rb29
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/other-lang/ack.pl11
-rw-r--r--benchmark/other-lang/ack.py16
-rw-r--r--benchmark/other-lang/ack.rb12
-rw-r--r--benchmark/other-lang/ack.scm7
-rw-r--r--benchmark/other-lang/eval.rb66
-rw-r--r--benchmark/other-lang/fact.pl13
-rw-r--r--benchmark/other-lang/fact.py18
-rw-r--r--benchmark/other-lang/fact.rb13
-rw-r--r--benchmark/other-lang/fact.scm8
-rw-r--r--benchmark/other-lang/fib.pl11
-rw-r--r--benchmark/other-lang/fib.py7
-rw-r--r--benchmark/other-lang/fib.rb9
-rw-r--r--benchmark/other-lang/fib.scm7
-rw-r--r--benchmark/other-lang/loop.pl3
-rw-r--r--benchmark/other-lang/loop.py2
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/other-lang/loop.scm1
-rw-r--r--benchmark/other-lang/loop2.rb1
-rw-r--r--benchmark/other-lang/tak.pl11
-rw-r--r--benchmark/other-lang/tak.py8
-rw-r--r--benchmark/other-lang/tak.rb13
-rw-r--r--benchmark/other-lang/tak.scm10
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/wc.input.base25
-rw-r--r--bignum.c7396
-rwxr-xr-xbin/erb155
-rwxr-xr-xbin/gem25
-rwxr-xr-xbin/irb11
-rwxr-xr-xbin/rake33
-rwxr-xr-xbin/rdoc44
-rwxr-xr-xbin/ri12
-rw-r--r--bootstraptest/pending.rb39
-rwxr-xr-xbootstraptest/runner.rb505
-rw-r--r--bootstraptest/test_attr.rb36
-rw-r--r--bootstraptest/test_autoload.rb70
-rw-r--r--bootstraptest/test_block.rb599
-rw-r--r--bootstraptest/test_class.rb169
-rw-r--r--bootstraptest/test_eval.rb324
-rw-r--r--bootstraptest/test_exception.rb432
-rw-r--r--bootstraptest/test_finalizer.rb8
-rw-r--r--bootstraptest/test_flip.rb1
-rw-r--r--bootstraptest/test_flow.rb591
-rw-r--r--bootstraptest/test_fork.rb75
-rw-r--r--bootstraptest/test_gc.rb34
-rw-r--r--bootstraptest/test_io.rb112
-rw-r--r--bootstraptest/test_jump.rb308
-rw-r--r--bootstraptest/test_literal.rb231
-rw-r--r--bootstraptest/test_literal_suffix.rb54
-rw-r--r--bootstraptest/test_load.rb27
-rw-r--r--bootstraptest/test_marshal.rb5
-rw-r--r--bootstraptest/test_massign.rb183
-rw-r--r--bootstraptest/test_method.rb1220
-rw-r--r--bootstraptest/test_objectspace.rb46
-rw-r--r--bootstraptest/test_proc.rb483
-rw-r--r--bootstraptest/test_struct.rb5
-rw-r--r--bootstraptest/test_syntax.rb902
-rw-r--r--bootstraptest/test_thread.rb476
-rw-r--r--ccan/build_assert/build_assert.h40
-rw-r--r--ccan/check_type/check_type.h63
-rw-r--r--ccan/container_of/container_of.h142
-rw-r--r--ccan/licenses/BSD-MIT17
-rw-r--r--ccan/licenses/CC028
-rw-r--r--ccan/list/list.h635
-rw-r--r--ccan/str/str.h16
-rw-r--r--class.c2043
-rw-r--r--common.mk1138
-rw-r--r--compar.c220
-rw-r--r--compile.c6025
-rw-r--r--complex.c2220
-rw-r--r--config.guess958
-rw-r--r--config.sub967
-rw-r--r--config_h.dj64
-rw-r--r--config_s.dj51
-rw-r--r--configure4510
-rw-r--r--configure.bat6
-rw-r--r--configure.in4491
-rw-r--r--constant.h37
-rw-r--r--cont.c1704
-rw-r--r--coverage/README17
-rw-r--r--cygwin/GNUmakefile.in109
-rw-r--r--debug.c163
-rw-r--r--defines.h62
-rw-r--r--defs/default_gems4
-rw-r--r--defs/gmake.mk63
-rw-r--r--defs/id.def118
-rw-r--r--defs/keywords53
-rw-r--r--defs/known_errors.def145
-rw-r--r--defs/lex.c.src53
-rw-r--r--defs/opt_insn_unif.def29
-rw-r--r--defs/opt_operand.def22
-rw-r--r--dir.c2339
-rw-r--r--dln.c931
-rw-r--r--dln.h43
-rw-r--r--dln_find.c295
-rw-r--r--dmydln.c9
-rw-r--r--dmyext.c7
-rw-r--r--doc/.document4
-rw-r--r--doc/ChangeLog-1.8.024350
-rw-r--r--doc/ChangeLog-1.9.392772
-rw-r--r--doc/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog-YARV6917
-rw-r--r--doc/NEWS-1.8.7669
-rw-r--r--doc/NEWS-1.9.1429
-rw-r--r--doc/NEWS-1.9.2509
-rw-r--r--doc/NEWS-1.9.3341
-rw-r--r--doc/NEWS-2.0.0531
-rw-r--r--doc/NEWS-2.1.0376
-rw-r--r--doc/contributing.rdoc466
-rw-r--r--doc/contributors.rdoc778
-rw-r--r--doc/dtrace_probes.rdoc178
-rw-r--r--doc/etc.rd.ja75
-rw-r--r--doc/forwardable.rd.ja80
-rw-r--r--doc/globals.rdoc70
-rw-r--r--doc/images/boottime-classes.pngbin0 -> 28677 bytes-rw-r--r--doc/irb/irb-tools.rd.ja184
-rw-r--r--doc/irb/irb.rd.ja412
-rw-r--r--doc/keywords.rdoc158
-rw-r--r--doc/maintainers.rdoc322
-rw-r--r--doc/marshal.rdoc313
-rw-r--r--doc/pty/README.expect.ja21
-rw-r--r--doc/pty/README.ja76
-rw-r--r--doc/regexp.rdoc688
-rw-r--r--doc/security.rdoc144
-rw-r--r--doc/shell.rd.ja335
-rw-r--r--doc/standard_library.rdoc125
-rw-r--r--doc/syntax.rdoc34
-rw-r--r--doc/syntax/assignment.rdoc455
-rw-r--r--doc/syntax/calling_methods.rdoc349
-rw-r--r--doc/syntax/control_expressions.rdoc500
-rw-r--r--doc/syntax/exceptions.rdoc96
-rw-r--r--doc/syntax/literals.rdoc308
-rw-r--r--doc/syntax/methods.rdoc437
-rw-r--r--doc/syntax/miscellaneous.rdoc107
-rw-r--r--doc/syntax/modules_and_classes.rdoc345
-rw-r--r--doc/syntax/precedence.rdoc60
-rw-r--r--doc/syntax/refinements.rdoc266
-rw-r--r--enc/Makefile.in82
-rw-r--r--enc/ascii.c96
-rw-r--r--enc/big5.c373
-rw-r--r--enc/cp949.c221
-rw-r--r--enc/depend163
-rw-r--r--enc/emacs_mule.c341
-rw-r--r--enc/encdb.c31
-rw-r--r--enc/encinit.c.erb26
-rw-r--r--enc/euc_jp.c613
-rw-r--r--enc/euc_kr.c194
-rw-r--r--enc/euc_tw.c227
-rw-r--r--enc/gb18030.c603
-rw-r--r--enc/gb2312.c13
-rw-r--r--enc/gbk.c224
-rw-r--r--enc/iso_2022_jp.h47
-rw-r--r--enc/iso_8859_1.c287
-rw-r--r--enc/iso_8859_10.c246
-rw-r--r--enc/iso_8859_11.c113
-rw-r--r--enc/iso_8859_13.c245
-rw-r--r--enc/iso_8859_14.c248
-rw-r--r--enc/iso_8859_15.c242
-rw-r--r--enc/iso_8859_16.c244
-rw-r--r--enc/iso_8859_2.c252
-rw-r--r--enc/iso_8859_3.c242
-rw-r--r--enc/iso_8859_4.c244
-rw-r--r--enc/iso_8859_5.c232
-rw-r--r--enc/iso_8859_6.c109
-rw-r--r--enc/iso_8859_7.c239
-rw-r--r--enc/iso_8859_8.c109
-rw-r--r--enc/iso_8859_9.c245
-rw-r--r--enc/jis/props.h227
-rw-r--r--enc/jis/props.h.blt227
-rw-r--r--enc/jis/props.kwd52
-rw-r--r--enc/jis/props.src52
-rw-r--r--enc/koi8_r.c221
-rw-r--r--enc/koi8_u.c223
-rwxr-xr-xenc/make_encmake.rb136
-rw-r--r--enc/mktable.c1162
-rw-r--r--enc/prelude.rb6
-rw-r--r--enc/shift_jis.c583
-rw-r--r--enc/trans/CP/CP932UDA%UCS.src1912
-rw-r--r--enc/trans/CP/CP932VDC@IBM%UCS.src420
-rw-r--r--enc/trans/CP/CP932VDC@NEC_IBM%UCS.src406
-rw-r--r--enc/trans/CP/UCS%CP932UDA.src1912
-rw-r--r--enc/trans/CP/UCS%CP932VDC@IBM.src420
-rw-r--r--enc/trans/CP/UCS%CP932VDC@NEC_IBM.src406
-rw-r--r--enc/trans/EMOJI/EMOJI_ISO-2022-JP-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-DOCOMO%UCS.src293
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI-UNDOC%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-SOFTBANK%UCS.src496
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-DOCOMO.src293
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-SOFTBANK.src496
-rw-r--r--enc/trans/GB/GB12345%UCS.src7618
-rw-r--r--enc/trans/GB/GB2312%UCS.src7535
-rw-r--r--enc/trans/GB/UCS%GB12345.src7620
-rw-r--r--enc/trans/GB/UCS%GB2312.src7531
-rw-r--r--enc/trans/JIS/JISX0201-KANA%UCS.src127
-rw-r--r--enc/trans/JIS/JISX0208@1990%UCS.src6972
-rw-r--r--enc/trans/JIS/JISX0208@MS%UCS.src6893
-rw-r--r--enc/trans/JIS/JISX0208UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0208VDC@NEC%UCS.src97
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src6167
-rw-r--r--enc/trans/JIS/JISX0212@MS%UCS.src6081
-rw-r--r--enc/trans/JIS/JISX0212UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0212VDC@IBM%UCS.src120
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@BMP.src1926
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@SIP.src60
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@BMP.src2193
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@SIP.src311
-rw-r--r--enc/trans/JIS/UCS%JISX0201-KANA.src127
-rw-r--r--enc/trans/JIS/UCS%JISX0208@1990.src6974
-rw-r--r--enc/trans/JIS/UCS%JISX0208@MS.src6894
-rw-r--r--enc/trans/JIS/UCS%JISX0208UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0208VDC@NEC.src98
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src6170
-rw-r--r--enc/trans/JIS/UCS%JISX0212@MS.src6082
-rw-r--r--enc/trans/JIS/UCS%JISX0212UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0212VDC@IBM.src121
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-1.src1922
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-2.src2189
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-1.src56
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-2.src307
-rw-r--r--enc/trans/big5-hkscs-tbl.rb37302
-rw-r--r--enc/trans/big5-uao-tbl.rb19784
-rw-r--r--enc/trans/big5.trans32
-rw-r--r--enc/trans/chinese.trans31
-rw-r--r--enc/trans/cp850-tbl.rb130
-rw-r--r--enc/trans/cp852-tbl.rb130
-rw-r--r--enc/trans/cp855-tbl.rb130
-rw-r--r--enc/trans/cp949-tbl.rb8831
-rw-r--r--enc/trans/emoji-exchange-tbl.rb8407
-rw-r--r--enc/trans/emoji.trans36
-rw-r--r--enc/trans/emoji_iso2022_kddi.trans216
-rw-r--r--enc/trans/emoji_sjis_docomo.trans32
-rw-r--r--enc/trans/emoji_sjis_kddi.trans33
-rw-r--r--enc/trans/emoji_sjis_softbank.trans32
-rw-r--r--enc/trans/escape.trans93
-rw-r--r--enc/trans/euckr-tbl.rb8230
-rw-r--r--enc/trans/gb18030-tbl.rb63362
-rw-r--r--enc/trans/gb18030.trans183
-rw-r--r--enc/trans/gbk-tbl.rb21794
-rw-r--r--enc/trans/gbk.trans15
-rw-r--r--enc/trans/ibm437-tbl.rb130
-rw-r--r--enc/trans/ibm737-tbl.rb130
-rw-r--r--enc/trans/ibm775-tbl.rb130
-rw-r--r--enc/trans/ibm852-tbl.rb130
-rw-r--r--enc/trans/ibm855-tbl.rb130
-rw-r--r--enc/trans/ibm857-tbl.rb127
-rw-r--r--enc/trans/ibm860-tbl.rb130
-rw-r--r--enc/trans/ibm861-tbl.rb130
-rw-r--r--enc/trans/ibm862-tbl.rb130
-rw-r--r--enc/trans/ibm863-tbl.rb130
-rw-r--r--enc/trans/ibm865-tbl.rb130
-rw-r--r--enc/trans/ibm866-tbl.rb130
-rw-r--r--enc/trans/ibm869-tbl.rb121
-rw-r--r--enc/trans/iso-8859-1-tbl.rb98
-rw-r--r--enc/trans/iso-8859-10-tbl.rb98
-rw-r--r--enc/trans/iso-8859-11-tbl.rb90
-rw-r--r--enc/trans/iso-8859-13-tbl.rb98
-rw-r--r--enc/trans/iso-8859-14-tbl.rb98
-rw-r--r--enc/trans/iso-8859-15-tbl.rb98
-rw-r--r--enc/trans/iso-8859-16-tbl.rb98
-rw-r--r--enc/trans/iso-8859-2-tbl.rb98
-rw-r--r--enc/trans/iso-8859-3-tbl.rb91
-rw-r--r--enc/trans/iso-8859-4-tbl.rb98
-rw-r--r--enc/trans/iso-8859-5-tbl.rb98
-rw-r--r--enc/trans/iso-8859-6-tbl.rb53
-rw-r--r--enc/trans/iso-8859-7-tbl.rb95
-rw-r--r--enc/trans/iso-8859-8-tbl.rb62
-rw-r--r--enc/trans/iso-8859-9-tbl.rb98
-rw-r--r--enc/trans/iso2022.trans567
-rw-r--r--enc/trans/japanese.trans97
-rw-r--r--enc/trans/japanese_euc.trans57
-rw-r--r--enc/trans/japanese_sjis.trans33
-rw-r--r--enc/trans/koi8-r-tbl.rb130
-rw-r--r--enc/trans/koi8-u-tbl.rb130
-rw-r--r--enc/trans/korean.trans18
-rw-r--r--enc/trans/maccroatian-tbl.rb129
-rw-r--r--enc/trans/maccyrillic-tbl.rb130
-rw-r--r--enc/trans/macgreek-tbl.rb129
-rw-r--r--enc/trans/maciceland-tbl.rb129
-rw-r--r--enc/trans/macroman-tbl.rb129
-rw-r--r--enc/trans/macromania-tbl.rb129
-rw-r--r--enc/trans/macturkish-tbl.rb128
-rw-r--r--enc/trans/macukraine-tbl.rb130
-rw-r--r--enc/trans/newline.trans135
-rw-r--r--enc/trans/single_byte.trans91
-rw-r--r--enc/trans/tis-620-tbl.rb89
-rw-r--r--enc/trans/transdb.c18
-rw-r--r--enc/trans/ucm/glibc-BIG5-2.3.3.ucm14087
-rw-r--r--enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm18332
-rw-r--r--enc/trans/ucm/windows-950-2000.ucm20379
-rw-r--r--enc/trans/ucm/windows-950_hkscs-2001.ucm23446
-rw-r--r--enc/trans/utf8_mac-tbl.rb23154
-rw-r--r--enc/trans/utf8_mac.trans256
-rw-r--r--enc/trans/utf_16_32.trans556
-rw-r--r--enc/trans/windows-1250-tbl.rb125
-rw-r--r--enc/trans/windows-1251-tbl.rb129
-rw-r--r--enc/trans/windows-1252-tbl.rb125
-rw-r--r--enc/trans/windows-1253-tbl.rb113
-rw-r--r--enc/trans/windows-1254-tbl.rb123
-rw-r--r--enc/trans/windows-1255-tbl.rb141
-rw-r--r--enc/trans/windows-1256-tbl.rb130
-rw-r--r--enc/trans/windows-1257-tbl.rb118
-rw-r--r--enc/trans/windows-874-tbl.rb99
-rw-r--r--enc/unicode.c607
-rwxr-xr-xenc/unicode/case-folding.rb196
-rw-r--r--enc/unicode/casefold.h5619
-rw-r--r--enc/unicode/name2ctype.h32679
-rw-r--r--enc/unicode/name2ctype.h.blt28722
-rw-r--r--enc/unicode/name2ctype.kwd26550
-rw-r--r--enc/unicode/name2ctype.src26550
-rw-r--r--enc/us_ascii.c33
-rw-r--r--enc/utf_16_32.h5
-rw-r--r--enc/utf_16be.c254
-rw-r--r--enc/utf_16le.c246
-rw-r--r--enc/utf_32be.c193
-rw-r--r--enc/utf_32le.c192
-rw-r--r--enc/utf_7.h5
-rw-r--r--enc/utf_8.c457
-rw-r--r--enc/windows_1251.c210
-rw-r--r--enc/windows_31j.c80
-rw-r--r--enc/x_emoji.h26
-rw-r--r--encoding.c1973
-rw-r--r--enum.c3276
-rw-r--r--enumerator.c2092
-rw-r--r--env.h52
-rw-r--r--error.c2777
-rw-r--r--eval.c7899
-rw-r--r--eval_error.c323
-rw-r--r--eval_intern.h275
-rw-r--r--eval_jump.c143
-rw-r--r--ext/-test-/array/resize/extconf.rb1
-rw-r--r--ext/-test-/array/resize/resize.c14
-rw-r--r--ext/-test-/bignum/big2str.c54
-rw-r--r--ext/-test-/bignum/bigzero.c27
-rw-r--r--ext/-test-/bignum/depend7
-rw-r--r--ext/-test-/bignum/div.c36
-rw-r--r--ext/-test-/bignum/extconf.rb7
-rw-r--r--ext/-test-/bignum/init.c11
-rw-r--r--ext/-test-/bignum/intpack.c88
-rw-r--r--ext/-test-/bignum/mul.c66
-rw-r--r--ext/-test-/bignum/str2big.c39
-rw-r--r--ext/-test-/bug-3571/bug.c23
-rw-r--r--ext/-test-/bug-3571/extconf.rb1
-rw-r--r--ext/-test-/bug-3662/bug.c16
-rw-r--r--ext/-test-/bug-3662/extconf.rb1
-rw-r--r--ext/-test-/bug-5832/bug.c14
-rw-r--r--ext/-test-/bug-5832/extconf.rb1
-rw-r--r--ext/-test-/bug_reporter/bug_reporter.c24
-rw-r--r--ext/-test-/bug_reporter/extconf.rb1
-rw-r--r--ext/-test-/class/class2name.c14
-rw-r--r--ext/-test-/class/extconf.rb7
-rw-r--r--ext/-test-/class/init.c11
-rw-r--r--ext/-test-/debug/depend3
-rw-r--r--ext/-test-/debug/extconf.rb6
-rw-r--r--ext/-test-/debug/init.c11
-rw-r--r--ext/-test-/debug/inspector.c32
-rw-r--r--ext/-test-/debug/profile_frames.c43
-rw-r--r--ext/-test-/exception/dataerror.c31
-rw-r--r--ext/-test-/exception/depend3
-rw-r--r--ext/-test-/exception/enc_raise.c15
-rw-r--r--ext/-test-/exception/ensured.c25
-rw-r--r--ext/-test-/exception/extconf.rb6
-rw-r--r--ext/-test-/exception/init.c11
-rw-r--r--ext/-test-/fatal/extconf.rb1
-rw-r--r--ext/-test-/fatal/rb_fatal.c19
-rw-r--r--ext/-test-/file/depend2
-rw-r--r--ext/-test-/file/extconf.rb7
-rw-r--r--ext/-test-/file/fs.c60
-rw-r--r--ext/-test-/file/init.c11
-rw-r--r--ext/-test-/file/stat.c27
-rw-r--r--ext/-test-/float/depend3
-rw-r--r--ext/-test-/float/extconf.rb7
-rw-r--r--ext/-test-/float/init.c11
-rw-r--r--ext/-test-/float/nextafter.c36
-rw-r--r--ext/-test-/funcall/extconf.rb2
-rw-r--r--ext/-test-/funcall/passing_block.c30
-rw-r--r--ext/-test-/iter/break.c25
-rw-r--r--ext/-test-/iter/extconf.rb7
-rw-r--r--ext/-test-/iter/init.c11
-rw-r--r--ext/-test-/iter/yield.c16
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c1
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb1
-rw-r--r--ext/-test-/marshal/compat/extconf.rb1
-rw-r--r--ext/-test-/marshal/compat/usrcompat.c32
-rw-r--r--ext/-test-/marshal/usr/extconf.rb1
-rw-r--r--ext/-test-/marshal/usr/usrmarshal.c35
-rw-r--r--ext/-test-/method/arity.c22
-rw-r--r--ext/-test-/method/extconf.rb6
-rw-r--r--ext/-test-/method/init.c11
-rw-r--r--ext/-test-/num2int/extconf.rb1
-rw-r--r--ext/-test-/num2int/num2int.c136
-rw-r--r--ext/-test-/path_to_class/extconf.rb6
-rw-r--r--ext/-test-/path_to_class/path_to_class.c15
-rw-r--r--ext/-test-/postponed_job/depend1
-rw-r--r--ext/-test-/postponed_job/extconf.rb1
-rw-r--r--ext/-test-/postponed_job/postponed_job.c53
-rw-r--r--ext/-test-/printf/depend3
-rw-r--r--ext/-test-/printf/extconf.rb1
-rw-r--r--ext/-test-/printf/printf.c110
-rw-r--r--ext/-test-/rational/depend3
-rw-r--r--ext/-test-/rational/extconf.rb7
-rw-r--r--ext/-test-/rational/rat.c38
-rw-r--r--ext/-test-/recursion/extconf.rb2
-rw-r--r--ext/-test-/recursion/recursion.c28
-rw-r--r--ext/-test-/st/numhash/extconf.rb1
-rw-r--r--ext/-test-/st/numhash/numhash.c120
-rw-r--r--ext/-test-/st/update/extconf.rb1
-rw-r--r--ext/-test-/st/update/update.c34
-rw-r--r--ext/-test-/string/coderange.c47
-rw-r--r--ext/-test-/string/cstr.c26
-rw-r--r--ext/-test-/string/depend5
-rw-r--r--ext/-test-/string/ellipsize.c13
-rw-r--r--ext/-test-/string/enc_associate.c14
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c14
-rw-r--r--ext/-test-/string/extconf.rb7
-rw-r--r--ext/-test-/string/init.c11
-rw-r--r--ext/-test-/string/modify.c22
-rw-r--r--ext/-test-/string/normalize.c18
-rw-r--r--ext/-test-/string/qsort.c61
-rw-r--r--ext/-test-/string/set_len.c14
-rw-r--r--ext/-test-/struct/extconf.rb7
-rw-r--r--ext/-test-/struct/init.c11
-rw-r--r--ext/-test-/struct/member.c18
-rw-r--r--ext/-test-/symbol/extconf.rb7
-rw-r--r--ext/-test-/symbol/init.c18
-rw-r--r--ext/-test-/symbol/type.c78
-rw-r--r--ext/-test-/tracepoint/depend1
-rw-r--r--ext/-test-/tracepoint/extconf.rb1
-rw-r--r--ext/-test-/tracepoint/gc_hook.c80
-rw-r--r--ext/-test-/tracepoint/tracepoint.c96
-rw-r--r--ext/-test-/typeddata/extconf.rb1
-rw-r--r--ext/-test-/typeddata/typeddata.c20
-rw-r--r--ext/-test-/wait_for_single_fd/depend4
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb1
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c30
-rw-r--r--ext/-test-/win32/console/attribute.c56
-rw-r--r--ext/-test-/win32/console/depend1
-rw-r--r--ext/-test-/win32/console/extconf.rb8
-rw-r--r--ext/-test-/win32/console/init.c11
-rw-r--r--ext/-test-/win32/dln/dlntest.c17
-rw-r--r--ext/-test-/win32/dln/empty/empty.c4
-rw-r--r--ext/-test-/win32/dln/empty/extconf.rb3
-rw-r--r--ext/-test-/win32/dln/extconf.rb37
-rw-r--r--ext/-test-/win32/dln/libdlntest.c4
-rw-r--r--ext/-test-/win32/dln/libdlntest.def2
-rw-r--r--ext/-test-/win32/fd_setsize/depend1
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb3
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c55
-rw-r--r--ext/.document103
-rw-r--r--ext/Setup30
-rw-r--r--ext/Setup.atheos30
-rw-r--r--ext/Setup.dj12
-rw-r--r--ext/Setup.emx32
-rw-r--r--ext/Setup.nacl48
-rw-r--r--ext/Setup.nt35
-rw-r--r--ext/Setup.x6812
-rw-r--r--ext/Win32API/MANIFEST7
-rw-r--r--ext/Win32API/Win32API.c223
-rw-r--r--ext/Win32API/depend1
-rw-r--r--ext/Win32API/extconf.rb7
-rw-r--r--ext/Win32API/getch.rb5
-rw-r--r--ext/Win32API/point.rb18
-rw-r--r--ext/aix_ld.rb73
-rw-r--r--ext/bigdecimal/README60
-rw-r--r--ext/bigdecimal/bigdecimal.c6273
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec31
-rw-r--r--ext/bigdecimal/bigdecimal.h321
-rw-r--r--ext/bigdecimal/depend1
-rw-r--r--ext/bigdecimal/extconf.rb6
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb87
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb88
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb231
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb79
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb127
-rw-r--r--ext/bigdecimal/sample/linear.rb72
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb39
-rw-r--r--ext/bigdecimal/sample/pi.rb20
-rw-r--r--ext/continuation/continuation.c8
-rw-r--r--ext/continuation/extconf.rb3
-rw-r--r--ext/coverage/coverage.c109
-rw-r--r--ext/coverage/depend11
-rw-r--r--ext/coverage/extconf.rb4
-rw-r--r--ext/curses/MANIFEST6
-rw-r--r--ext/curses/curses.c830
-rw-r--r--ext/curses/extconf.rb24
-rw-r--r--ext/curses/hello.rb30
-rw-r--r--ext/curses/rain.rb76
-rw-r--r--ext/curses/view.rb91
-rw-r--r--ext/cygwin32_ld.rb90
-rw-r--r--ext/date/date_core.c9544
-rw-r--r--ext/date/date_parse.c3128
-rw-r--r--ext/date/date_strftime.c633
-rw-r--r--ext/date/date_strptime.c701
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend7
-rw-r--r--ext/date/extconf.rb2
-rw-r--r--ext/date/lib/date.rb60
-rw-r--r--ext/dbm/MANIFEST4
-rw-r--r--ext/dbm/dbm.c1009
-rw-r--r--ext/dbm/depend1
-rw-r--r--ext/dbm/extconf.rb275
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c146
-rw-r--r--ext/digest/bubblebabble/depend1
-rw-r--r--ext/digest/bubblebabble/extconf.rb6
-rw-r--r--ext/digest/defs.h19
-rw-r--r--ext/digest/depend1
-rw-r--r--ext/digest/digest.c733
-rw-r--r--ext/digest/digest.h32
-rw-r--r--ext/digest/extconf.rb10
-rw-r--r--ext/digest/lib/digest.rb90
-rw-r--r--ext/digest/md5/depend3
-rw-r--r--ext/digest/md5/extconf.rb28
-rw-r--r--ext/digest/md5/md5.c424
-rw-r--r--ext/digest/md5/md5.h80
-rw-r--r--ext/digest/md5/md5init.c43
-rw-r--r--ext/digest/md5/md5ossl.c9
-rw-r--r--ext/digest/md5/md5ossl.h13
-rw-r--r--ext/digest/rmd160/depend3
-rw-r--r--ext/digest/rmd160/extconf.rb27
-rw-r--r--ext/digest/rmd160/rmd160.c463
-rw-r--r--ext/digest/rmd160/rmd160.h56
-rw-r--r--ext/digest/rmd160/rmd160init.c43
-rw-r--r--ext/digest/rmd160/rmd160ossl.c8
-rw-r--r--ext/digest/rmd160/rmd160ossl.h19
-rw-r--r--ext/digest/sha1/depend3
-rw-r--r--ext/digest/sha1/extconf.rb27
-rw-r--r--ext/digest/sha1/sha1.c271
-rw-r--r--ext/digest/sha1/sha1.h39
-rw-r--r--ext/digest/sha1/sha1init.c43
-rw-r--r--ext/digest/sha1/sha1ossl.c10
-rw-r--r--ext/digest/sha1/sha1ossl.h20
-rw-r--r--ext/digest/sha2/depend3
-rw-r--r--ext/digest/sha2/extconf.rb33
-rw-r--r--ext/digest/sha2/lib/sha2.rb107
-rw-r--r--ext/digest/sha2/sha2.c1081
-rw-r--r--ext/digest/sha2/sha2.h225
-rw-r--r--ext/digest/sha2/sha2init.c56
-rw-r--r--ext/digest/sha2/sha2ossl.c13
-rw-r--r--ext/digest/sha2/sha2ossl.h17
-rw-r--r--ext/digest/test.sh30
-rw-r--r--ext/dl/callback/depend15
-rw-r--r--ext/dl/callback/extconf.rb14
-rw-r--r--ext/dl/callback/mkcallback.rb242
-rw-r--r--ext/dl/cfunc.c677
-rw-r--r--ext/dl/cptr.c669
-rw-r--r--ext/dl/depend14
-rw-r--r--ext/dl/dl.c569
-rw-r--r--ext/dl/dl.h217
-rw-r--r--ext/dl/extconf.rb48
-rw-r--r--ext/dl/handle.c431
-rw-r--r--ext/dl/lib/dl.rb15
-rw-r--r--ext/dl/lib/dl/callback.rb112
-rw-r--r--ext/dl/lib/dl/cparser.rb156
-rw-r--r--ext/dl/lib/dl/func.rb251
-rw-r--r--ext/dl/lib/dl/import.rb268
-rw-r--r--ext/dl/lib/dl/pack.rb128
-rw-r--r--ext/dl/lib/dl/stack.rb116
-rw-r--r--ext/dl/lib/dl/struct.rb236
-rw-r--r--ext/dl/lib/dl/types.rb71
-rw-r--r--ext/dl/lib/dl/value.rb114
-rw-r--r--ext/etc/MANIFEST6
-rw-r--r--ext/etc/depend10
-rw-r--r--ext/etc/etc.c1009
-rw-r--r--ext/etc/etc.doc73
-rw-r--r--ext/etc/extconf.rb64
-rw-r--r--ext/etc/mkconstants.rb331
-rwxr-xr-xext/extmk.rb771
-rw-r--r--ext/extmk.rb.in571
-rw-r--r--ext/extmk.rb.nt501
-rw-r--r--ext/fcntl/MANIFEST3
-rw-r--r--ext/fcntl/depend1
-rw-r--r--ext/fcntl/extconf.rb2
-rw-r--r--ext/fcntl/fcntl.c155
-rw-r--r--ext/fiber/extconf.rb3
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c316
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c141
-rw-r--r--ext/fiddle/conversions.h44
-rw-r--r--ext/fiddle/depend4
-rw-r--r--ext/fiddle/extconf.rb60
-rw-r--r--ext/fiddle/fiddle.c454
-rw-r--r--ext/fiddle/fiddle.h143
-rw-r--r--ext/fiddle/function.c279
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/handle.c478
-rw-r--r--ext/fiddle/lib/fiddle.rb55
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb48
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb176
-rw-r--r--ext/fiddle/lib/fiddle/function.rb17
-rw-r--r--ext/fiddle/lib/fiddle/import.rb314
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb128
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb243
-rw-r--r--ext/fiddle/lib/fiddle/types.rb71
-rw-r--r--ext/fiddle/lib/fiddle/value.rb112
-rw-r--r--ext/fiddle/pointer.c721
-rw-r--r--ext/gdbm/README1
-rw-r--r--ext/gdbm/extconf.rb7
-rw-r--r--ext/gdbm/gdbm.c1286
-rw-r--r--ext/io/console/console.c798
-rw-r--r--ext/io/console/depend4
-rw-r--r--ext/io/console/extconf.rb26
-rw-r--r--ext/io/console/io-console.gemspec21
-rw-r--r--ext/io/console/lib/console/size.rb22
-rw-r--r--ext/io/nonblock/depend4
-rw-r--r--ext/io/nonblock/extconf.rb8
-rw-r--r--ext/io/nonblock/nonblock.c135
-rw-r--r--ext/io/wait/depend4
-rw-r--r--ext/io/wait/extconf.rb18
-rw-r--r--ext/io/wait/wait.c187
-rw-r--r--ext/json/extconf.rb3
-rw-r--r--ext/json/fbuffer/fbuffer.h190
-rw-r--r--ext/json/generator/depend2
-rw-r--r--ext/json/generator/extconf.rb4
-rw-r--r--ext/json/generator/generator.c1436
-rw-r--r--ext/json/generator/generator.h148
-rw-r--r--ext/json/lib/json.rb62
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb28
-rw-r--r--ext/json/lib/json/add/complex.rb22
-rw-r--r--ext/json/lib/json/add/core.rb11
-rw-r--r--ext/json/lib/json/add/date.rb34
-rw-r--r--ext/json/lib/json/add/date_time.rb50
-rw-r--r--ext/json/lib/json/add/exception.rb31
-rw-r--r--ext/json/lib/json/add/ostruct.rb31
-rw-r--r--ext/json/lib/json/add/range.rb29
-rw-r--r--ext/json/lib/json/add/rational.rb22
-rw-r--r--ext/json/lib/json/add/regexp.rb30
-rw-r--r--ext/json/lib/json/add/struct.rb30
-rw-r--r--ext/json/lib/json/add/symbol.rb25
-rw-r--r--ext/json/lib/json/add/time.rb38
-rw-r--r--ext/json/lib/json/common.rb484
-rw-r--r--ext/json/lib/json/ext.rb21
-rw-r--r--ext/json/lib/json/generic_object.rb70
-rw-r--r--ext/json/lib/json/version.rb8
-rw-r--r--ext/json/parser/depend2
-rw-r--r--ext/json/parser/extconf.rb3
-rw-r--r--ext/json/parser/parser.c2204
-rw-r--r--ext/json/parser/parser.h77
-rw-r--r--ext/json/parser/parser.rl927
-rw-r--r--ext/json/parser/prereq.mk10
-rw-r--r--ext/kconv/MANIFEST3
-rw-r--r--ext/kconv/depend1
-rw-r--r--ext/kconv/kconv.c2016
-rw-r--r--ext/mandel/MANIFEST3
-rw-r--r--ext/mandel/mandel.c59
-rw-r--r--ext/mandel/tkmandel.rb172
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb3
-rw-r--r--ext/mathn/rational/extconf.rb3
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/md5/MANIFEST7
-rw-r--r--ext/md5/depend2
-rw-r--r--ext/md5/md5.doc36
-rw-r--r--ext/md5/md5.h86
-rw-r--r--ext/md5/md5c.c337
-rw-r--r--ext/md5/md5init.c94
-rw-r--r--ext/nkf/depend6
-rw-r--r--ext/nkf/extconf.rb2
-rw-r--r--ext/nkf/lib/kconv.rb282
-rw-r--r--ext/nkf/nkf-utf8/config.h51
-rw-r--r--ext/nkf/nkf-utf8/nkf.c7191
-rw-r--r--ext/nkf/nkf-utf8/nkf.h189
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c14628
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h72
-rw-r--r--ext/nkf/nkf.c507
-rw-r--r--ext/objspace/depend14
-rw-r--r--ext/objspace/extconf.rb2
-rw-r--r--ext/objspace/object_tracing.c493
-rw-r--r--ext/objspace/objspace.c775
-rw-r--r--ext/objspace/objspace.h20
-rw-r--r--ext/objspace/objspace_dump.c431
-rw-r--r--ext/openssl/depend6
-rw-r--r--ext/openssl/deprecation.rb21
-rw-r--r--ext/openssl/extconf.rb160
-rw-r--r--ext/openssl/lib/openssl.rb24
-rw-r--r--ext/openssl/lib/openssl/bn.rb38
-rw-r--r--ext/openssl/lib/openssl/buffering.rb457
-rw-r--r--ext/openssl/lib/openssl/cipher.rb65
-rw-r--r--ext/openssl/lib/openssl/config.rb472
-rw-r--r--ext/openssl/lib/openssl/digest.rb88
-rw-r--r--ext/openssl/lib/openssl/ssl.rb253
-rw-r--r--ext/openssl/lib/openssl/x509.rb162
-rw-r--r--ext/openssl/openssl_missing.c356
-rw-r--r--ext/openssl/openssl_missing.h198
-rw-r--r--ext/openssl/ossl.c1168
-rw-r--r--ext/openssl/ossl.h247
-rw-r--r--ext/openssl/ossl_asn1.c1997
-rw-r--r--ext/openssl/ossl_asn1.h59
-rw-r--r--ext/openssl/ossl_bio.c87
-rw-r--r--ext/openssl/ossl_bio.h21
-rw-r--r--ext/openssl/ossl_bn.c896
-rw-r--r--ext/openssl/ossl_bn.h25
-rw-r--r--ext/openssl/ossl_cipher.c970
-rw-r--r--ext/openssl/ossl_cipher.h22
-rw-r--r--ext/openssl/ossl_config.c83
-rw-r--r--ext/openssl/ossl_config.h22
-rw-r--r--ext/openssl/ossl_digest.c438
-rw-r--r--ext/openssl/ossl_digest.h22
-rw-r--r--ext/openssl/ossl_engine.c584
-rw-r--r--ext/openssl/ossl_engine.h20
-rw-r--r--ext/openssl/ossl_hmac.c364
-rw-r--r--ext/openssl/ossl_hmac.h19
-rw-r--r--ext/openssl/ossl_ns_spki.c389
-rw-r--r--ext/openssl/ossl_ns_spki.h21
-rw-r--r--ext/openssl/ossl_ocsp.c1188
-rw-r--r--ext/openssl/ossl_ocsp.h24
-rw-r--r--ext/openssl/ossl_pkcs12.c212
-rw-r--r--ext/openssl/ossl_pkcs12.h15
-rw-r--r--ext/openssl/ossl_pkcs5.c189
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c1048
-rw-r--r--ext/openssl/ossl_pkcs7.h22
-rw-r--r--ext/openssl/ossl_pkey.c439
-rw-r--r--ext/openssl/ossl_pkey.h151
-rw-r--r--ext/openssl/ossl_pkey_dh.c666
-rw-r--r--ext/openssl/ossl_pkey_dsa.c623
-rw-r--r--ext/openssl/ossl_pkey_ec.c1683
-rw-r--r--ext/openssl/ossl_pkey_rsa.c701
-rw-r--r--ext/openssl/ossl_rand.c202
-rw-r--r--ext/openssl/ossl_rand.h20
-rw-r--r--ext/openssl/ossl_ssl.c2281
-rw-r--r--ext/openssl/ossl_ssl.h36
-rw-r--r--ext/openssl/ossl_ssl_session.c323
-rw-r--r--ext/openssl/ossl_version.h16
-rw-r--r--ext/openssl/ossl_x509.c104
-rw-r--r--ext/openssl/ossl_x509.h114
-rw-r--r--ext/openssl/ossl_x509attr.c275
-rw-r--r--ext/openssl/ossl_x509cert.c846
-rw-r--r--ext/openssl/ossl_x509crl.c537
-rw-r--r--ext/openssl/ossl_x509ext.c471
-rw-r--r--ext/openssl/ossl_x509name.c510
-rw-r--r--ext/openssl/ossl_x509req.c468
-rw-r--r--ext/openssl/ossl_x509revoked.c229
-rw-r--r--ext/openssl/ossl_x509store.c677
-rw-r--r--ext/openssl/ruby_missing.h28
-rw-r--r--ext/pathname/depend3
-rw-r--r--ext/pathname/extconf.rb3
-rw-r--r--ext/pathname/lib/pathname.rb579
-rw-r--r--ext/pathname/pathname.c1463
-rw-r--r--ext/psych/.gitignore11
-rw-r--r--ext/psych/depend3
-rw-r--r--ext/psych/extconf.rb38
-rw-r--r--ext/psych/lib/psych.rb498
-rw-r--r--ext/psych/lib/psych/class_loader.rb101
-rw-r--r--ext/psych/lib/psych/coder.rb94
-rw-r--r--ext/psych/lib/psych/core_ext.rb35
-rw-r--r--ext/psych/lib/psych/deprecated.rb85
-rw-r--r--ext/psych/lib/psych/exception.rb13
-rw-r--r--ext/psych/lib/psych/handler.rb249
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb22
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb39
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb19
-rw-r--r--ext/psych/lib/psych/json/stream.rb16
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb12
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb29
-rw-r--r--ext/psych/lib/psych/nodes.rb77
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb18
-rw-r--r--ext/psych/lib/psych/nodes/document.rb60
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb56
-rw-r--r--ext/psych/lib/psych/nodes/node.rb55
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb67
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb81
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb37
-rw-r--r--ext/psych/lib/psych/omap.rb4
-rw-r--r--ext/psych/lib/psych/parser.rb51
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb149
-rw-r--r--ext/psych/lib/psych/set.rb4
-rw-r--r--ext/psych/lib/psych/stream.rb37
-rw-r--r--ext/psych/lib/psych/streaming.rb27
-rw-r--r--ext/psych/lib/psych/syntax_error.rb21
-rw-r--r--ext/psych/lib/psych/tree_builder.rb96
-rw-r--r--ext/psych/lib/psych/visitors.rb6
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb26
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb51
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb24
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb374
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb19
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb551
-rw-r--r--ext/psych/lib/psych/y.rb9
-rw-r--r--ext/psych/psych.c34
-rw-r--r--ext/psych/psych.gemspec23
-rw-r--r--ext/psych/psych.h20
-rw-r--r--ext/psych/psych_emitter.c538
-rw-r--r--ext/psych/psych_emitter.h8
-rw-r--r--ext/psych/psych_parser.c579
-rw-r--r--ext/psych/psych_parser.h6
-rw-r--r--ext/psych/psych_to_ruby.c43
-rw-r--r--ext/psych/psych_to_ruby.h8
-rw-r--r--ext/psych/psych_yaml_tree.c24
-rw-r--r--ext/psych/psych_yaml_tree.h8
-rw-r--r--ext/psych/yaml/LICENSE19
-rw-r--r--ext/psych/yaml/api.c1415
-rw-r--r--ext/psych/yaml/config.h10
-rw-r--r--ext/psych/yaml/dumper.c394
-rw-r--r--ext/psych/yaml/emitter.c2329
-rw-r--r--ext/psych/yaml/loader.c459
-rw-r--r--ext/psych/yaml/parser.c1370
-rw-r--r--ext/psych/yaml/reader.c469
-rw-r--r--ext/psych/yaml/scanner.c3583
-rw-r--r--ext/psych/yaml/writer.c141
-rw-r--r--ext/psych/yaml/yaml.h1971
-rw-r--r--ext/psych/yaml/yaml_private.h664
-rw-r--r--ext/pty/depend6
-rw-r--r--ext/pty/extconf.rb19
-rw-r--r--ext/pty/lib/expect.rb71
-rw-r--r--ext/pty/pty.c759
-rw-r--r--ext/racc/cparse/README11
-rw-r--r--ext/racc/cparse/cparse.c831
-rw-r--r--ext/racc/cparse/extconf.rb5
-rw-r--r--ext/rbconfig/sizeof/depend3
-rw-r--r--ext/rbconfig/sizeof/extconf.rb3
-rw-r--r--ext/readline/MANIFEST4
-rw-r--r--ext/readline/README61
-rw-r--r--ext/readline/README.ja386
-rw-r--r--ext/readline/depend6
-rw-r--r--ext/readline/extconf.rb111
-rw-r--r--ext/readline/readline.c1940
-rw-r--r--ext/ripper/README30
-rw-r--r--ext/ripper/depend56
-rw-r--r--ext/ripper/eventids2.c293
-rw-r--r--ext/ripper/extconf.rb21
-rw-r--r--ext/ripper/lib/ripper.rb73
-rw-r--r--ext/ripper/lib/ripper/core.rb70
-rw-r--r--ext/ripper/lib/ripper/filter.rb77
-rw-r--r--ext/ripper/lib/ripper/lexer.rb186
-rw-r--r--ext/ripper/lib/ripper/sexp.rb114
-rwxr-xr-xext/ripper/tools/generate-param-macros.rb14
-rwxr-xr-xext/ripper/tools/generate.rb154
-rwxr-xr-xext/ripper/tools/preproc.rb91
-rwxr-xr-xext/ripper/tools/strip.rb12
-rw-r--r--ext/sdbm/_sdbm.c953
-rw-r--r--ext/sdbm/depend2
-rw-r--r--ext/sdbm/extconf.rb4
-rw-r--r--ext/sdbm/init.c1045
-rw-r--r--ext/sdbm/sdbm.h86
-rw-r--r--ext/socket/.document17
-rw-r--r--ext/socket/MANIFEST4
-rw-r--r--ext/socket/addrinfo.h189
-rw-r--r--ext/socket/ancdata.c1838
-rw-r--r--ext/socket/basicsocket.c776
-rw-r--r--ext/socket/constants.c145
-rw-r--r--ext/socket/depend30
-rw-r--r--ext/socket/extconf.rb707
-rw-r--r--ext/socket/getaddrinfo.c678
-rw-r--r--ext/socket/getnameinfo.c261
-rw-r--r--ext/socket/ifaddr.c459
-rw-r--r--ext/socket/init.c677
-rw-r--r--ext/socket/ipsocket.c334
-rw-r--r--ext/socket/lib/socket.rb871
-rw-r--r--ext/socket/mkconstants.rb804
-rw-r--r--ext/socket/option.c1471
-rw-r--r--ext/socket/raddrinfo.c2573
-rw-r--r--ext/socket/rubysocket.h415
-rw-r--r--ext/socket/socket.c3338
-rw-r--r--ext/socket/sockport.h116
-rw-r--r--ext/socket/sockssocket.c71
-rw-r--r--ext/socket/tcpserver.c178
-rw-r--r--ext/socket/tcpsocket.c82
-rw-r--r--ext/socket/udpsocket.c266
-rw-r--r--ext/socket/unixserver.c155
-rw-r--r--ext/socket/unixsocket.c532
-rw-r--r--ext/stringio/README18
-rw-r--r--ext/stringio/depend4
-rw-r--r--ext/stringio/extconf.rb2
-rw-r--r--ext/stringio/stringio.c1620
-rw-r--r--ext/strscan/depend7
-rw-r--r--ext/strscan/extconf.rb3
-rw-r--r--ext/strscan/strscan.c1400
-rw-r--r--ext/syslog/depend2
-rw-r--r--ext/syslog/extconf.rb10
-rw-r--r--ext/syslog/lib/syslog/logger.rb208
-rw-r--r--ext/syslog/syslog.c592
-rw-r--r--ext/syslog/syslog.txt124
-rw-r--r--ext/tcltklib/MANIFEST15
-rw-r--r--ext/tcltklib/MANUAL.euc124
-rw-r--r--ext/tcltklib/README.euc133
-rw-r--r--ext/tcltklib/depend1
-rw-r--r--ext/tcltklib/extconf.rb85
-rw-r--r--ext/tcltklib/lib/tcltk.rb367
-rw-r--r--ext/tcltklib/sample/sample0.rb39
-rw-r--r--ext/tcltklib/sample/sample1.rb634
-rw-r--r--ext/tcltklib/sample/sample2.rb449
-rw-r--r--ext/tcltklib/tcltklib.c441
-rw-r--r--ext/thread/extconf.rb3
-rw-r--r--ext/thread/thread.c653
-rw-r--r--ext/tk/ChangeLog.tkextlib949
-rw-r--r--ext/tk/MANIFEST25
-rw-r--r--ext/tk/MANUAL_tcltklib.eng473
-rw-r--r--ext/tk/MANUAL_tcltklib.ja584
-rw-r--r--ext/tk/README.1st19
-rw-r--r--ext/tk/README.ActiveTcl62
-rw-r--r--ext/tk/README.fork34
-rw-r--r--ext/tk/README.macosx-aqua67
-rw-r--r--ext/tk/README.tcltklib152
-rw-r--r--ext/tk/config_list.in41
-rw-r--r--ext/tk/depend3
-rw-r--r--ext/tk/extconf.rb2094
-rw-r--r--ext/tk/lib/README30
-rw-r--r--ext/tk/lib/multi-tk.rb3754
-rw-r--r--ext/tk/lib/remote-tk.rb530
-rw-r--r--ext/tk/lib/tcltk.rb367
-rw-r--r--ext/tk/lib/tk.rb6867
-rw-r--r--ext/tk/lib/tk/after.rb6
-rw-r--r--ext/tk/lib/tk/autoload.rb760
-rw-r--r--ext/tk/lib/tk/bgerror.rb29
-rw-r--r--ext/tk/lib/tk/bindtag.rb138
-rw-r--r--ext/tk/lib/tk/busy.rb118
-rw-r--r--ext/tk/lib/tk/button.rb31
-rw-r--r--ext/tk/lib/tk/canvas.rb846
-rw-r--r--ext/tk/lib/tk/canvastag.rb459
-rw-r--r--ext/tk/lib/tk/checkbutton.rb32
-rw-r--r--ext/tk/lib/tk/clipboard.rb75
-rw-r--r--ext/tk/lib/tk/clock.rb71
-rw-r--r--ext/tk/lib/tk/composite.rb484
-rw-r--r--ext/tk/lib/tk/console.rb52
-rw-r--r--ext/tk/lib/tk/dialog.rb326
-rw-r--r--ext/tk/lib/tk/encodedstr.rb187
-rw-r--r--ext/tk/lib/tk/entry.rb120
-rw-r--r--ext/tk/lib/tk/event.rb562
-rw-r--r--ext/tk/lib/tk/font.rb2351
-rw-r--r--ext/tk/lib/tk/fontchooser.rb176
-rw-r--r--ext/tk/lib/tk/frame.rb132
-rw-r--r--ext/tk/lib/tk/grid.rb279
-rw-r--r--ext/tk/lib/tk/image.rb395
-rw-r--r--ext/tk/lib/tk/itemconfig.rb1222
-rw-r--r--ext/tk/lib/tk/itemfont.rb327
-rw-r--r--ext/tk/lib/tk/kinput.rb71
-rw-r--r--ext/tk/lib/tk/label.rb22
-rw-r--r--ext/tk/lib/tk/labelframe.rb31
-rw-r--r--ext/tk/lib/tk/listbox.rb284
-rw-r--r--ext/tk/lib/tk/macpkg.rb80
-rw-r--r--ext/tk/lib/tk/menu.rb718
-rw-r--r--ext/tk/lib/tk/menubar.rb137
-rw-r--r--ext/tk/lib/tk/menuspec.rb456
-rw-r--r--ext/tk/lib/tk/message.rb24
-rw-r--r--ext/tk/lib/tk/mngfocus.rb33
-rw-r--r--ext/tk/lib/tk/msgcat.rb299
-rw-r--r--ext/tk/lib/tk/namespace.rb546
-rw-r--r--ext/tk/lib/tk/optiondb.rb377
-rw-r--r--ext/tk/lib/tk/optionobj.rb212
-rw-r--r--ext/tk/lib/tk/pack.rb107
-rw-r--r--ext/tk/lib/tk/package.rb143
-rw-r--r--ext/tk/lib/tk/palette.rb55
-rw-r--r--ext/tk/lib/tk/panedwindow.rb260
-rw-r--r--ext/tk/lib/tk/place.rb128
-rw-r--r--ext/tk/lib/tk/radiobutton.rb73
-rw-r--r--ext/tk/lib/tk/root.rb95
-rw-r--r--ext/tk/lib/tk/scale.rb112
-rw-r--r--ext/tk/lib/tk/scrollable.rb82
-rw-r--r--ext/tk/lib/tk/scrollbar.rb183
-rw-r--r--ext/tk/lib/tk/scrollbox.rb39
-rw-r--r--ext/tk/lib/tk/selection.rb86
-rw-r--r--ext/tk/lib/tk/spinbox.rb144
-rw-r--r--ext/tk/lib/tk/tagfont.rb43
-rw-r--r--ext/tk/lib/tk/text.rb1604
-rw-r--r--ext/tk/lib/tk/textimage.rb88
-rw-r--r--ext/tk/lib/tk/textmark.rb204
-rw-r--r--ext/tk/lib/tk/texttag.rb321
-rw-r--r--ext/tk/lib/tk/textwindow.rb154
-rw-r--r--ext/tk/lib/tk/timer.rb669
-rw-r--r--ext/tk/lib/tk/toplevel.rb264
-rw-r--r--ext/tk/lib/tk/ttk_selector.rb98
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb39
-rw-r--r--ext/tk/lib/tk/validation.rb397
-rw-r--r--ext/tk/lib/tk/variable.rb1799
-rw-r--r--ext/tk/lib/tk/virtevent.rb139
-rw-r--r--ext/tk/lib/tk/winfo.rb392
-rw-r--r--ext/tk/lib/tk/winpkg.rb156
-rw-r--r--ext/tk/lib/tk/wm.rb552
-rw-r--r--ext/tk/lib/tk/xim.rb122
-rw-r--r--ext/tk/lib/tkafter.rb296
-rw-r--r--ext/tk/lib/tkbgerror.rb17
-rw-r--r--ext/tk/lib/tkcanvas.rb831
-rw-r--r--ext/tk/lib/tkclass.rb15
-rw-r--r--ext/tk/lib/tkconsole.rb4
-rw-r--r--ext/tk/lib/tkdialog.rb141
-rw-r--r--ext/tk/lib/tkentry.rb75
-rw-r--r--ext/tk/lib/tkextlib/ICONS.rb13
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb129
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS193
-rw-r--r--ext/tk/lib/tkextlib/blt.rb189
-rw-r--r--ext/tk/lib/tkextlib/blt/barchart.rb79
-rw-r--r--ext/tk/lib/tkextlib/blt/bitmap.rb112
-rw-r--r--ext/tk/lib/tkextlib/blt/busy.rb83
-rw-r--r--ext/tk/lib/tkextlib/blt/component.rb2218
-rw-r--r--ext/tk/lib/tkextlib/blt/container.rb28
-rw-r--r--ext/tk/lib/tkextlib/blt/cutbuffer.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/dragdrop.rb269
-rw-r--r--ext/tk/lib/tkextlib/blt/eps.rb32
-rw-r--r--ext/tk/lib/tkextlib/blt/graph.rb67
-rw-r--r--ext/tk/lib/tkextlib/blt/htext.rb112
-rw-r--r--ext/tk/lib/tkextlib/blt/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/blt/spline.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/stripchart.rb74
-rw-r--r--ext/tk/lib/tkextlib/blt/table.rb412
-rw-r--r--ext/tk/lib/tkextlib/blt/tabnotebook.rb110
-rw-r--r--ext/tk/lib/tkextlib/blt/tabset.rb504
-rw-r--r--ext/tk/lib/tkextlib/blt/ted.rb68
-rw-r--r--ext/tk/lib/tkextlib/blt/tile.rb25
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/button.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/checkbutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/frame.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/label.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/radiobutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/scrollbar.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/toplevel.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tree.rb1058
-rw-r--r--ext/tk/lib/tkextlib/blt/treeview.rb1287
-rw-r--r--ext/tk/lib/tkextlib/blt/unix_dnd.rb141
-rw-r--r--ext/tk/lib/tkextlib/blt/vector.rb256
-rw-r--r--ext/tk/lib/tkextlib/blt/watch.rb175
-rw-r--r--ext/tk/lib/tkextlib/blt/win_printer.rb61
-rw-r--r--ext/tk/lib/tkextlib/blt/winop.rb107
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb153
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb90
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb194
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dragsite.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dropsite.rb39
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb63
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb43
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb41
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb80
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb52
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb361
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb132
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb192
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb166
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb42
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panelframe.rb67
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb44
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb58
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb40
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb48
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb25
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb91
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb98
-rw-r--r--ext/tk/lib/tkextlib/bwidget/statusbar.rb62
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb33
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb500
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb129
-rw-r--r--ext/tk/lib/tkextlib/itcl.rb13
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb178
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb446
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/iwidgets.rb94
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb125
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb53
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb130
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb104
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb185
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb40
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb42
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb365
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb39
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb45
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb67
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb212
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb93
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb175
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb134
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb131
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb121
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb353
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb59
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb207
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb568
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb102
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb169
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb181
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb145
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb25
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb112
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb56
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb184
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb105
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README135
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb158
-rw-r--r--ext/tk/lib/tkextlib/tcllib/calendar.rb55
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_sqmap.rb36
-rw-r--r--ext/tk/lib/tkextlib/tcllib/canvas_zoom.rb21
-rw-r--r--ext/tk/lib/tkextlib/tcllib/chatwidget.rb151
-rw-r--r--ext/tk/lib/tkextlib/tcllib/crosshair.rb117
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb160
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb97
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dateentry.rb62
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/diagrams.rb224
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dialog.rb84
-rw-r--r--ext/tk/lib/tkextlib/tcllib/getstring.rb134
-rw-r--r--ext/tk/lib/tkextlib/tcllib/history.rb73
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ico.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb75
-rw-r--r--ext/tk/lib/tkextlib/tcllib/khim.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/menuentry.rb47
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ntext.rb146
-rw-r--r--ext/tk/lib/tkextlib/tcllib/panelframe.rb78
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb1404
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ruler.rb65
-rw-r--r--ext/tk/lib/tkextlib/tcllib/screenruler.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrolledwindow.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrollwin.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib/statusbar.rb79
-rw-r--r--ext/tk/lib/tkextlib/tcllib/style.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/superframe.rb51
-rw-r--r--ext/tk/lib/tkextlib/tcllib/swaplist.rb150
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist.rb28
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_core.rb1072
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb43
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb314
-rw-r--r--ext/tk/lib/tkextlib/tcllib/toolbar.rb175
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tooltip.rb104
-rw-r--r--ext/tk/lib/tkextlib/tcllib/widget.rb82
-rw-r--r--ext/tk/lib/tkextlib/tclx.rb13
-rw-r--r--ext/tk/lib/tkextlib/tclx/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tclx/tclx.rb74
-rw-r--r--ext/tk/lib/tkextlib/tile.rb449
-rw-r--r--ext/tk/lib/tkextlib/tile/dialog.rb102
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tile/sizegrip.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb336
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tcombobox.rb55
-rw-r--r--ext/tk/lib/tkextlib/tile/tentry.rb49
-rw-r--r--ext/tk/lib/tkextlib/tile/tframe.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabelframe.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb147
-rw-r--r--ext/tk/lib/tkextlib/tile/tpaned.rb245
-rw-r--r--ext/tk/lib/tkextlib/tile/tprogressbar.rb57
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb38
-rw-r--r--ext/tk/lib/tkextlib/tile/treeview.rb1306
-rw-r--r--ext/tk/lib/tkextlib/tile/tscale.rb56
-rw-r--r--ext/tk/lib/tkextlib/tile/tscrollbar.rb63
-rw-r--r--ext/tk/lib/tkextlib/tile/tseparator.rb34
-rw-r--r--ext/tk/lib/tkextlib/tile/tspinbox.rb107
-rw-r--r--ext/tk/lib/tkextlib/tile/tsquare.rb30
-rw-r--r--ext/tk/lib/tkextlib/tkDND.rb18
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb125
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb182
-rw-r--r--ext/tk/lib/tkextlib/tkHTML.rb13
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb453
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg.rb36
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README26
-rw-r--r--ext/tk/lib/tkextlib/tkimg/bmp.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/gif.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ico.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/jpeg.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pcx.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pixmap.rb44
-rw-r--r--ext/tk/lib/tkextlib/tkimg/png.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ppm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ps.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sgi.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sun.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tga.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tiff.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/window.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xbm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xpm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tktable.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb966
-rw-r--r--ext/tk/lib/tkextlib/tktrans.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb64
-rw-r--r--ext/tk/lib/tkextlib/treectrl.rb13
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb2522
-rw-r--r--ext/tk/lib/tkextlib/trofs.rb13
-rw-r--r--ext/tk/lib/tkextlib/trofs/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/trofs/trofs.rb51
-rw-r--r--ext/tk/lib/tkextlib/version.rb6
-rw-r--r--ext/tk/lib/tkextlib/vu.rb48
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb61
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb53
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb102
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb286
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb22
-rw-r--r--ext/tk/lib/tkextlib/winico.rb14
-rw-r--r--ext/tk/lib/tkextlib/winico/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/winico/winico.rb224
-rw-r--r--ext/tk/lib/tkfont.rb944
-rw-r--r--ext/tk/lib/tkmacpkg.rb4
-rw-r--r--ext/tk/lib/tkmenubar.rb137
-rw-r--r--ext/tk/lib/tkmngfocus.rb27
-rw-r--r--ext/tk/lib/tkpalette.rb48
-rw-r--r--ext/tk/lib/tkscrollbox.rb31
-rw-r--r--ext/tk/lib/tktext.rb799
-rw-r--r--ext/tk/lib/tkvirtevent.rb66
-rw-r--r--ext/tk/lib/tkwinpkg.rb4
-rw-r--r--ext/tk/old-README.tcltklib.ja159
-rw-r--r--ext/tk/old-extconf.rb440
-rw-r--r--ext/tk/sample/24hr_clock.rb286
-rw-r--r--ext/tk/sample/binding_sample.rb87
-rw-r--r--ext/tk/sample/bindtag_sample.rb127
-rw-r--r--ext/tk/sample/binstr_usage.rb45
-rw-r--r--ext/tk/sample/btn_with_frame.rb20
-rw-r--r--ext/tk/sample/cd_timer.rb81
-rw-r--r--ext/tk/sample/cmd_res_test.rb17
-rw-r--r--ext/tk/sample/cmd_resource5
-rw-r--r--ext/tk/sample/demos-en/ChangeLog64
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev9
-rw-r--r--ext/tk/sample/demos-en/README138
-rw-r--r--ext/tk/sample/demos-en/README.1st18
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding29
-rw-r--r--ext/tk/sample/demos-en/anilabel.rb174
-rw-r--r--ext/tk/sample/demos-en/aniwave.rb118
-rw-r--r--ext/tk/sample/demos-en/arrow.rb249
-rw-r--r--ext/tk/sample/demos-en/bind.rb127
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb75
-rw-r--r--ext/tk/sample/demos-en/browse163
-rw-r--r--ext/tk/sample/demos-en/browse282
-rw-r--r--ext/tk/sample/demos-en/button.rb84
-rw-r--r--ext/tk/sample/demos-en/check.rb72
-rw-r--r--ext/tk/sample/demos-en/check2.rb109
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb87
-rw-r--r--ext/tk/sample/demos-en/colors.rb158
-rw-r--r--ext/tk/sample/demos-en/combo.rb96
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb136
-rw-r--r--ext/tk/sample/demos-en/ctext.rb207
-rw-r--r--ext/tk/sample/demos-en/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-en/dialog2.rb41
-rw-r--r--ext/tk/sample/demos-en/doc.org/README7
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-en/entry1.rb58
-rw-r--r--ext/tk/sample/demos-en/entry2.rb93
-rw-r--r--ext/tk/sample/demos-en/entry3.rb220
-rw-r--r--ext/tk/sample/demos-en/filebox.rb102
-rw-r--r--ext/tk/sample/demos-en/floor.rb1723
-rw-r--r--ext/tk/sample/demos-en/floor2.rb1722
-rw-r--r--ext/tk/sample/demos-en/form.rb64
-rw-r--r--ext/tk/sample/demos-en/goldberg.rb2006
-rw-r--r--ext/tk/sample/demos-en/hello14
-rw-r--r--ext/tk/sample/demos-en/hscale.rb75
-rw-r--r--ext/tk/sample/demos-en/icon.rb105
-rw-r--r--ext/tk/sample/demos-en/image1.rb65
-rw-r--r--ext/tk/sample/demos-en/image2.rb107
-rw-r--r--ext/tk/sample/demos-en/image3.rb125
-rw-r--r--ext/tk/sample/demos-en/items.rb381
-rw-r--r--ext/tk/sample/demos-en/ixset333
-rw-r--r--ext/tk/sample/demos-en/ixset2367
-rw-r--r--ext/tk/sample/demos-en/knightstour.rb271
-rw-r--r--ext/tk/sample/demos-en/label.rb72
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb95
-rw-r--r--ext/tk/sample/demos-en/mclist.rb117
-rw-r--r--ext/tk/sample/demos-en/menu.rb196
-rw-r--r--ext/tk/sample/demos-en/menu84.rb215
-rw-r--r--ext/tk/sample/demos-en/menubu.rb237
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb90
-rw-r--r--ext/tk/sample/demos-en/msgbox2.rb91
-rw-r--r--ext/tk/sample/demos-en/paned1.rb47
-rw-r--r--ext/tk/sample/demos-en/paned2.rb94
-rw-r--r--ext/tk/sample/demos-en/pendulum.rb240
-rw-r--r--ext/tk/sample/demos-en/plot.rb124
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb134
-rw-r--r--ext/tk/sample/demos-en/radio.rb86
-rw-r--r--ext/tk/sample/demos-en/radio2.rb109
-rw-r--r--ext/tk/sample/demos-en/radio3.rb117
-rw-r--r--ext/tk/sample/demos-en/rmt268
-rw-r--r--ext/tk/sample/demos-en/rolodex320
-rw-r--r--ext/tk/sample/demos-en/ruler.rb205
-rw-r--r--ext/tk/sample/demos-en/sayings.rb106
-rw-r--r--ext/tk/sample/demos-en/search.rb187
-rw-r--r--ext/tk/sample/demos-en/spin.rb65
-rw-r--r--ext/tk/sample/demos-en/square81
-rw-r--r--ext/tk/sample/demos-en/states.rb80
-rw-r--r--ext/tk/sample/demos-en/style.rb231
-rw-r--r--ext/tk/sample/demos-en/tcolor526
-rw-r--r--ext/tk/sample/demos-en/text.rb128
-rw-r--r--ext/tk/sample/demos-en/textpeer.rb76
-rw-r--r--ext/tk/sample/demos-en/timer136
-rw-r--r--ext/tk/sample/demos-en/tkencoding.rb42
-rw-r--r--ext/tk/sample/demos-en/toolbar.rb130
-rw-r--r--ext/tk/sample/demos-en/tree.rb119
-rw-r--r--ext/tk/sample/demos-en/ttkbut.rb139
-rw-r--r--ext/tk/sample/demos-en/ttkmenu.rb85
-rw-r--r--ext/tk/sample/demos-en/ttknote.rb89
-rw-r--r--ext/tk/sample/demos-en/ttkpane.rb213
-rw-r--r--ext/tk/sample/demos-en/ttkprogress.rb66
-rw-r--r--ext/tk/sample/demos-en/twind.rb291
-rw-r--r--ext/tk/sample/demos-en/twind2.rb384
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb114
-rw-r--r--ext/tk/sample/demos-en/vscale.rb79
-rw-r--r--ext/tk/sample/demos-en/widget1087
-rw-r--r--ext/tk/sample/demos-jp/README54
-rw-r--r--ext/tk/sample/demos-jp/README.1st20
-rw-r--r--ext/tk/sample/demos-jp/anilabel.rb177
-rw-r--r--ext/tk/sample/demos-jp/aniwave.rb120
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb247
-rw-r--r--ext/tk/sample/demos-jp/bind.rb125
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb74
-rw-r--r--ext/tk/sample/demos-jp/browse163
-rw-r--r--ext/tk/sample/demos-jp/browse282
-rw-r--r--ext/tk/sample/demos-jp/button.rb83
-rw-r--r--ext/tk/sample/demos-jp/check.rb70
-rw-r--r--ext/tk/sample/demos-jp/check2.rb110
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb84
-rw-r--r--ext/tk/sample/demos-jp/colors.rb155
-rw-r--r--ext/tk/sample/demos-jp/combo.rb98
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb134
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb204
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb39
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb43
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README7
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb60
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb91
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb225
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb102
-rw-r--r--ext/tk/sample/demos-jp/floor.rb1721
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb1719
-rw-r--r--ext/tk/sample/demos-jp/form.rb66
-rw-r--r--ext/tk/sample/demos-jp/goldberg.rb2011
-rw-r--r--ext/tk/sample/demos-jp/hello10
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb78
-rw-r--r--ext/tk/sample/demos-jp/icon.rb103
-rw-r--r--ext/tk/sample/demos-jp/image1.rb64
-rw-r--r--ext/tk/sample/demos-jp/image2.rb106
-rw-r--r--ext/tk/sample/demos-jp/image3.rb127
-rw-r--r--ext/tk/sample/demos-jp/items.rb379
-rw-r--r--ext/tk/sample/demos-jp/ixset333
-rw-r--r--ext/tk/sample/demos-jp/ixset2369
-rw-r--r--ext/tk/sample/demos-jp/knightstour.rb273
-rw-r--r--ext/tk/sample/demos-jp/label.rb69
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb102
-rw-r--r--ext/tk/sample/demos-jp/mclist.rb121
-rw-r--r--ext/tk/sample/demos-jp/menu.rb201
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb213
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb233
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb238
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb89
-rw-r--r--ext/tk/sample/demos-jp/msgbox2.rb90
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb52
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb100
-rw-r--r--ext/tk/sample/demos-jp/pendulum.rb242
-rw-r--r--ext/tk/sample/demos-jp/plot.rb126
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb131
-rw-r--r--ext/tk/sample/demos-jp/radio.rb84
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb112
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb119
-rw-r--r--ext/tk/sample/demos-jp/rmt268
-rw-r--r--ext/tk/sample/demos-jp/rolodex320
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j300
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb203
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb103
-rw-r--r--ext/tk/sample/demos-jp/search.rb184
-rw-r--r--ext/tk/sample/demos-jp/spin.rb71
-rw-r--r--ext/tk/sample/demos-jp/square81
-rw-r--r--ext/tk/sample/demos-jp/states.rb74
-rw-r--r--ext/tk/sample/demos-jp/style.rb270
-rw-r--r--ext/tk/sample/demos-jp/tcolor534
-rw-r--r--ext/tk/sample/demos-jp/text.rb120
-rw-r--r--ext/tk/sample/demos-jp/textpeer.rb82
-rw-r--r--ext/tk/sample/demos-jp/timer136
-rw-r--r--ext/tk/sample/demos-jp/toolbar.rb136
-rw-r--r--ext/tk/sample/demos-jp/tree.rb120
-rw-r--r--ext/tk/sample/demos-jp/ttkbut.rb145
-rw-r--r--ext/tk/sample/demos-jp/ttkmenu.rb91
-rw-r--r--ext/tk/sample/demos-jp/ttknote.rb97
-rw-r--r--ext/tk/sample/demos-jp/ttkpane.rb216
-rw-r--r--ext/tk/sample/demos-jp/ttkprogress.rb71
-rw-r--r--ext/tk/sample/demos-jp/twind.rb292
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb384
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb119
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb80
-rw-r--r--ext/tk/sample/demos-jp/widget1122
-rw-r--r--ext/tk/sample/editable_listbox.rb148
-rw-r--r--ext/tk/sample/encstr_usage.rb30
-rw-r--r--ext/tk/sample/figmemo_sample.rb456
-rw-r--r--ext/tk/sample/images/earth.gifbin0 -> 51712 bytes-rw-r--r--ext/tk/sample/images/earthris.gifbin0 -> 6343 bytes-rw-r--r--ext/tk/sample/images/face.xbm173
-rw-r--r--ext/tk/sample/images/flagdown.xbm27
-rw-r--r--ext/tk/sample/images/flagup.xbm27
-rw-r--r--ext/tk/sample/images/gray25.xbm6
-rw-r--r--ext/tk/sample/images/grey.256
-rw-r--r--ext/tk/sample/images/grey.56
-rw-r--r--ext/tk/sample/images/letters.xbm27
-rw-r--r--ext/tk/sample/images/noletter.xbm27
-rw-r--r--ext/tk/sample/images/pattern.xbm6
-rw-r--r--ext/tk/sample/images/tcllogo.gifbin0 -> 2341 bytes-rw-r--r--ext/tk/sample/images/teapot.ppm31
-rw-r--r--ext/tk/sample/irbtk.rb30
-rw-r--r--ext/tk/sample/irbtkw.rbw156
-rw-r--r--ext/tk/sample/iso2022-kr.txt2
-rw-r--r--ext/tk/sample/menubar1.rb51
-rw-r--r--ext/tk/sample/menubar2.rb56
-rw-r--r--ext/tk/sample/menubar3.rb72
-rw-r--r--ext/tk/sample/msgs_rb/README3
-rw-r--r--ext/tk/sample/msgs_rb/cs.msg84
-rw-r--r--ext/tk/sample/msgs_rb/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb/el.msg98
-rw-r--r--ext/tk/sample/msgs_rb/en.msg83
-rw-r--r--ext/tk/sample/msgs_rb/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_rb/eo.msg87
-rw-r--r--ext/tk/sample/msgs_rb/es.msg84
-rw-r--r--ext/tk/sample/msgs_rb/fr.msg84
-rw-r--r--ext/tk/sample/msgs_rb/it.msg84
-rw-r--r--ext/tk/sample/msgs_rb/ja.msg13
-rw-r--r--ext/tk/sample/msgs_rb/nl.msg123
-rw-r--r--ext/tk/sample/msgs_rb/pl.msg87
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg87
-rw-r--r--ext/tk/sample/msgs_rb2/README5
-rw-r--r--ext/tk/sample/msgs_rb2/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb2/ja.msg85
-rw-r--r--ext/tk/sample/msgs_tk/README4
-rw-r--r--ext/tk/sample/msgs_tk/cs.msg84
-rw-r--r--ext/tk/sample/msgs_tk/de.msg88
-rw-r--r--ext/tk/sample/msgs_tk/el.msg103
-rw-r--r--ext/tk/sample/msgs_tk/en.msg83
-rw-r--r--ext/tk/sample/msgs_tk/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_tk/eo.msg87
-rw-r--r--ext/tk/sample/msgs_tk/es.msg84
-rw-r--r--ext/tk/sample/msgs_tk/fr.msg84
-rw-r--r--ext/tk/sample/msgs_tk/it.msg84
-rw-r--r--ext/tk/sample/msgs_tk/ja.msg13
-rw-r--r--ext/tk/sample/msgs_tk/license.terms39
-rw-r--r--ext/tk/sample/msgs_tk/nl.msg123
-rw-r--r--ext/tk/sample/msgs_tk/pl.msg87
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg87
-rw-r--r--ext/tk/sample/multi-ip_sample.rb103
-rw-r--r--ext/tk/sample/multi-ip_sample2.rb29
-rw-r--r--ext/tk/sample/optobj_sample.rb67
-rw-r--r--ext/tk/sample/propagate.rb30
-rw-r--r--ext/tk/sample/remote-ip_sample.rb33
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb56
-rw-r--r--ext/tk/sample/resource.en13
-rw-r--r--ext/tk/sample/resource.ja13
-rw-r--r--ext/tk/sample/safe-tk.rb134
-rw-r--r--ext/tk/sample/scrollframe.rb249
-rw-r--r--ext/tk/sample/tcltklib/batsu.gif (renamed from ext/tcltklib/sample/batsu.gif)bin538 -> 538 bytes-rw-r--r--ext/tk/sample/tcltklib/lines0.tcl (renamed from ext/tcltklib/demo/lines0.tcl)0
-rw-r--r--ext/tk/sample/tcltklib/lines1.rb (renamed from ext/tcltklib/demo/lines2.rb)0
-rw-r--r--ext/tk/sample/tcltklib/lines2.rb (renamed from ext/tcltklib/demo/lines1.rb)0
-rw-r--r--ext/tk/sample/tcltklib/lines3.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines4.rb54
-rw-r--r--ext/tk/sample/tcltklib/maru.gif (renamed from ext/tcltklib/sample/maru.gif)bin481 -> 481 bytes-rw-r--r--ext/tk/sample/tcltklib/safeTk.rb22
-rw-r--r--ext/tk/sample/tcltklib/sample0.rb39
-rw-r--r--ext/tk/sample/tcltklib/sample1.rb634
-rw-r--r--ext/tk/sample/tcltklib/sample2.rb451
-rw-r--r--ext/tk/sample/tkalignbox.rb235
-rw-r--r--ext/tk/sample/tkballoonhelp.rb220
-rw-r--r--ext/tk/sample/tkbiff.rb42
-rw-r--r--ext/tk/sample/tkbrowse.rb12
-rw-r--r--ext/tk/sample/tkcombobox.rb497
-rw-r--r--ext/tk/sample/tkdialog.rb5
-rw-r--r--ext/tk/sample/tkextlib/ICONS/Orig_LICENSE.txt61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons-sample.kde658
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons.kde195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb329
-rw-r--r--ext/tk/sample/tkextlib/blt/barchart5.rb101
-rw-r--r--ext/tk/sample/tkextlib/blt/calendar.rb117
-rw-r--r--ext/tk/sample/tkextlib/blt/graph6.rb2222
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7a.rb63
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7b.rb41
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7c.rb45
-rw-r--r--ext/tk/sample/tkextlib/blt/images/buckskin.gifbin0 -> 7561 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/chalk.gifbin0 -> 4378 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/qv100.t.gifbin0 -> 2694 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/rain.gifbin0 -> 3785 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/sample.gifbin0 -> 186103 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/pareto.rb90
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1.rb9
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1b.rb10
-rw-r--r--ext/tk/sample/tkextlib/blt/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/blt/scripts/stipples.rb156
-rw-r--r--ext/tk/sample/tkextlib/blt/winop1.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/winop2.rb28
-rw-r--r--ext/tk/sample/tkextlib/bwidget/Orig_LICENSE.txt53
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb198
-rw-r--r--ext/tk/sample/tkextlib/bwidget/bwidget.xbm46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb243
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb150
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb82
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb221
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb289
-rw-r--r--ext/tk/sample/tkextlib/bwidget/x1.xbm2258
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/Orig_LICENSE.txt42
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/box.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/clear.gifbin0 -> 279 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/close.gifbin0 -> 249 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/copy.gifbin0 -> 269 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/cut.gifbin0 -> 179 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/exit.gifbin0 -> 396 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/find.gifbin0 -> 386 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/help.gifbin0 -> 591 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/line.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/mag.gifbin0 -> 183 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/new.gifbin0 -> 212 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/open.gifbin0 -> 258 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/oval.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/paste.gifbin0 -> 376 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/points.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/poly.gifbin0 -> 141 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/print.gifbin0 -> 263 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/ruler.gifbin0 -> 174 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/save.gifbin0 -> 270 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/select.gifbin0 -> 124 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/text.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/buttonbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintdialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/checkbox.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dateentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/datefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialog.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb39
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectiondialog.rb29
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/feedback.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectiondialog.rb28
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/finddialog.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb25
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hyperhelp.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledframe.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb64
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb124
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb9
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/radiobox.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledcanvas.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb18
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb11
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spindate.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb33
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spintime.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb26
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabset.rb34
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timeentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb152
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb18
-rw-r--r--ext/tk/sample/tkextlib/tcllib/Orig_LICENSE.txt46
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb29
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb158
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb71
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb83
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb17
-rw-r--r--ext/tk/sample/tkextlib/tile/Orig_LICENSE.txt30
-rw-r--r--ext/tk/sample/tkextlib/tile/demo.rb983
-rw-r--r--ext/tk/sample/tkextlib/tile/iconlib.tcl110
-rw-r--r--ext/tk/sample/tkextlib/tile/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/tile/repeater.tcl117
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue.tcl149
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-h.gifbin0 -> 315 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-p.gifbin0 -> 312 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown.gifbin0 -> 313 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-h.gifbin0 -> 329 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-p.gifbin0 -> 327 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft.gifbin0 -> 323 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-h.gifbin0 -> 330 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-p.gifbin0 -> 327 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright.gifbin0 -> 324 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-h.gifbin0 -> 309 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-p.gifbin0 -> 313 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup.gifbin0 -> 314 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-h.gifbin0 -> 696 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.gifbin0 -> 770 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.xcfbin0 -> 1942 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-p.gifbin0 -> 769 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hc.gifbin0 -> 254 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hu.gifbin0 -> 234 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nc.gifbin0 -> 249 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nu.gifbin0 -> 229 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hc.gifbin0 -> 1098 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hu.gifbin0 -> 626 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nc.gifbin0 -> 389 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nu.gifbin0 -> 401 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb-p.gifbin0 -> 343 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb.gifbin0 -> 316 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb-p.gifbin0 -> 333 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb.gifbin0 -> 308 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider-p.gifbin0 -> 182 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider.gifbin0 -> 182 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider-p.gifbin0 -> 183 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider.gifbin0 -> 283 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/pkgIndex.tcl6
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik.tcl194
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-n.gifbin0 -> 273 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-p.gifbin0 -> 258 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-n.gifbin0 -> 292 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-p.gifbin0 -> 272 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-n.gifbin0 -> 274 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-p.gifbin0 -> 258 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-n.gifbin0 -> 286 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-p.gifbin0 -> 271 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-d.gifbin0 -> 1266 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-h.gifbin0 -> 896 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-n.gifbin0 -> 881 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-p.gifbin0 -> 625 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-s.gifbin0 -> 859 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-c.gifbin0 -> 434 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-u.gifbin0 -> 423 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-n.gifbin0 -> 401 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-p.gifbin0 -> 395 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hslider-n.gifbin0 -> 592 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-a.gifbin0 -> 1116 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-arrow-n.gifbin0 -> 61 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-d.gifbin0 -> 1057 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-n.gifbin0 -> 1095 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-c.gifbin0 -> 695 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-u.gifbin0 -> 686 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-n.gifbin0 -> 383 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-p.gifbin0 -> 878 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-a.gifbin0 -> 907 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-n.gifbin0 -> 238 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-p.gifbin0 -> 927 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-n.gifbin0 -> 405 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-p.gifbin0 -> 399 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vslider-n.gifbin0 -> 587 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc.rb226
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc.tcl163
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-h.gifbin0 -> 522 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-n.gifbin0 -> 554 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-p.gifbin0 -> 548 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hc.gifbin0 -> 281 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hu.gifbin0 -> 273 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nc.gifbin0 -> 303 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nu.gifbin0 -> 294 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hc.gifbin0 -> 652 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hu.gifbin0 -> 644 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nc.gifbin0 -> 632 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nu.gifbin0 -> 621 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/pkgIndex.tcl16
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik.tcl125
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-n.gifbin0 -> 362 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-p.gifbin0 -> 250 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-n.gifbin0 -> 378 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-p.gifbin0 -> 267 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-n.gifbin0 -> 379 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-p.gifbin0 -> 266 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-n.gifbin0 -> 363 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-p.gifbin0 -> 251 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-h.gifbin0 -> 439 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-n.gifbin0 -> 443 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-p.gifbin0 -> 302 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hc.gifbin0 -> 169 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hu.gifbin0 -> 170 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nc.gifbin0 -> 235 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nu.gifbin0 -> 226 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-pc.gifbin0 -> 169 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hsb-n.gifbin0 -> 269 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hslider-n.gifbin0 -> 342 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hc.gifbin0 -> 178 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hu.gifbin0 -> 179 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nc.gifbin0 -> 236 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nu.gifbin0 -> 178 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-pc.gifbin0 -> 178 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vsb-n.gifbin0 -> 366 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vslider-n.gifbin0 -> 336 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/toolbutton.tcl152
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/Orig_COPYRIGHT.txt12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb313
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image1bin0 -> 8995 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image10bin0 -> 3095 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image11bin0 -> 1425 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image12bin0 -> 2468 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image13bin0 -> 4073 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image14bin0 -> 53 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image2bin0 -> 42 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image3bin0 -> 3473 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image4bin0 -> 1988 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image5bin0 -> 973 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image6bin0 -> 2184 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image7bin0 -> 2022 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image8bin0 -> 1186 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image9bin0 -> 139 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/index.html115
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image1bin0 -> 1966 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image10bin0 -> 255 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image11bin0 -> 590 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image12bin0 -> 254 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image13bin0 -> 493 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image14bin0 -> 195 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image15bin0 -> 68 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image16bin0 -> 157 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image17bin0 -> 81 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image18bin0 -> 545 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image19bin0 -> 53 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image2bin0 -> 49 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image20bin0 -> 533 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image21bin0 -> 564 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image22bin0 -> 81 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image23bin0 -> 539 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image24bin0 -> 151 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image25bin0 -> 453 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image26bin0 -> 520 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image27bin0 -> 565 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image28bin0 -> 416 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image29bin0 -> 121 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image3bin0 -> 10835 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image30bin0 -> 663 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image31bin0 -> 78 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image32bin0 -> 556 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image33bin0 -> 598 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image34bin0 -> 496 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image35bin0 -> 724 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image36bin0 -> 404 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image37bin0 -> 124 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image38bin0 -> 8330 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image39bin0 -> 369 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image4bin0 -> 268 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image5bin0 -> 492 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image6bin0 -> 246 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image7bin0 -> 551 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image8bin0 -> 497 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image9bin0 -> 492 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html433
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image1bin0 -> 113 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image10bin0 -> 5088 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image11bin0 -> 4485 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image12bin0 -> 3579 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image13bin0 -> 5119 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image14bin0 -> 3603 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image2bin0 -> 74 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image3bin0 -> 681 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image4bin0 -> 3056 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image5bin0 -> 2297 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image6bin0 -> 79 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image7bin0 -> 1613 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image8bin0 -> 864 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image9bin0 -> 2379 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html2787
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image1bin0 -> 42 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image2bin0 -> 14343 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image3bin0 -> 17750 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image4bin0 -> 61 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image5bin0 -> 201 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image6bin0 -> 214 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image7bin0 -> 149 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image8bin0 -> 203 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image9bin0 -> 1504 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/index.html768
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb436
-rw-r--r--ext/tk/sample/tkextlib/tkimg/demo.rb1478
-rw-r--r--ext/tk/sample/tkextlib/tkimg/license_terms_of_Img_extension41
-rw-r--r--ext/tk/sample/tkextlib/tkimg/readme.txt3
-rw-r--r--ext/tk/sample/tkextlib/tktable/Orig_LICENSE.txt52
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb60
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb76
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb89
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb101
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb99
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb67
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb137
-rw-r--r--ext/tk/sample/tkextlib/tktable/tcllogo.gifbin0 -> 2341 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb88
-rw-r--r--ext/tk/sample/tkextlib/treectrl/bitmaps.rb76
-rw-r--r--ext/tk/sample/tkextlib/treectrl/demo.rb1305
-rw-r--r--ext/tk/sample/tkextlib/treectrl/explorer.rb430
-rw-r--r--ext/tk/sample/tkextlib/treectrl/help.rb404
-rw-r--r--ext/tk/sample/tkextlib/treectrl/imovie.rb130
-rw-r--r--ext/tk/sample/tkextlib/treectrl/layout.rb159
-rw-r--r--ext/tk/sample/tkextlib/treectrl/mailwasher.rb269
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-folders.rb124
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-newgroup.rb448
-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-dll.gifbin0 -> 437 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-exe.gifbin0 -> 368 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-file.gifbin0 -> 466 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-folder.gifbin0 -> 459 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-txt.gifbin0 -> 392 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/checked.gifbin0 -> 78 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/file.gifbin0 -> 279 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-closed.gifbin0 -> 111 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-open.gifbin0 -> 120 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-closed.gifbin0 -> 115 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-open.gifbin0 -> 128 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-page.gifbin0 -> 132 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-01.gifbin0 -> 5406 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-02.gifbin0 -> 5912 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-03.gifbin0 -> 4696 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-04.gifbin0 -> 5783 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-05.gifbin0 -> 3238 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-06.gifbin0 -> 3509 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-07.gifbin0 -> 2091 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-off.gifbin0 -> 70 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-on.gifbin0 -> 76 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-print.gifbin0 -> 124 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-off.gifbin0 -> 68 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-on.gifbin0 -> 71 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-search.gifbin0 -> 114 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-security.gifbin0 -> 108 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-collapse.gifbin0 -> 275 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-expand.gifbin0 -> 277 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-arrow.gifbin0 -> 73 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-clip.gifbin0 -> 73 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-deleted.gifbin0 -> 138 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-draft.gifbin0 -> 134 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-folder.gifbin0 -> 133 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-group.gifbin0 -> 144 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-inbox.gifbin0 -> 133 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-local.gifbin0 -> 146 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-main.gifbin0 -> 174 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-outbox.gifbin0 -> 136 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read-2.gifbin0 -> 343 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read.gifbin0 -> 304 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-sent.gifbin0 -> 132 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-server.gifbin0 -> 163 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-unread.gifbin0 -> 303 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-watch.gifbin0 -> 98 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/sky.gifbin0 -> 6454 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-dll.gifbin0 -> 311 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-exe.gifbin0 -> 115 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-file.gifbin0 -> 338 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-folder.gifbin0 -> 307 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-txt.gifbin0 -> 302 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/unchecked.gifbin0 -> 72 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/random.rb508
-rw-r--r--ext/tk/sample/tkextlib/treectrl/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/treectrl/www-options.rb303
-rw-r--r--ext/tk/sample/tkextlib/vu/Orig_LICENSE.txt51
-rw-r--r--ext/tk/sample/tkextlib/vu/README.txt50
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb90
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb82
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb101
-rw-r--r--ext/tk/sample/tkextlib/vu/dial_demo.rb113
-rw-r--r--ext/tk/sample/tkextlib/vu/m128_000.xbm174
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb56
-rw-r--r--ext/tk/sample/tkextlib/vu/vu_demo.rb67
-rw-r--r--ext/tk/sample/tkfrom.rb32
-rw-r--r--ext/tk/sample/tkhello.rb10
-rw-r--r--ext/tk/sample/tkline.rb6
-rw-r--r--ext/tk/sample/tkmenubutton.rb135
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb118
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb743
-rw-r--r--ext/tk/sample/tkmultilistbox.rb654
-rw-r--r--ext/tk/sample/tkmultilistframe.rb940
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb73
-rw-r--r--ext/tk/sample/tkoptdb.rb106
-rw-r--r--ext/tk/sample/tkrttimer.rb77
-rw-r--r--ext/tk/sample/tksleep_sample.rb29
-rw-r--r--ext/tk/sample/tktextframe.rb281
-rw-r--r--ext/tk/sample/tktextio.rb1060
-rw-r--r--ext/tk/sample/tktimer.rb2
-rw-r--r--ext/tk/sample/tktimer2.rb47
-rw-r--r--ext/tk/sample/tktimer3.rb59
-rw-r--r--ext/tk/sample/tktree.rb103
-rw-r--r--ext/tk/sample/tktree.tcl305
-rw-r--r--ext/tk/sample/ttk_wrapper.rb154
-rw-r--r--ext/tk/stubs.c592
-rw-r--r--ext/tk/stubs.h33
-rw-r--r--ext/tk/tcltklib.c11058
-rw-r--r--ext/tk/tkutil.c45
-rw-r--r--ext/tk/tkutil/depend1
-rw-r--r--ext/tk/tkutil/extconf.rb11
-rw-r--r--ext/tk/tkutil/tkutil.c1870
-rw-r--r--ext/win32/extconf.rb3
-rw-r--r--ext/win32/lib/Win32API.rb31
-rw-r--r--ext/win32/lib/win32/importer.rb14
-rw-r--r--ext/win32/lib/win32/registry.rb898
-rw-r--r--ext/win32/lib/win32/resolv.rb378
-rw-r--r--ext/win32/lib/win32/sspi.rb330
-rw-r--r--ext/win32ole/depend12
-rw-r--r--ext/win32ole/extconf.rb44
-rw-r--r--ext/win32ole/lib/win32ole/property.rb16
-rw-r--r--ext/win32ole/sample/excel1.rb33
-rw-r--r--ext/win32ole/sample/excel2.rb27
-rw-r--r--ext/win32ole/sample/excel3.rb13
-rw-r--r--ext/win32ole/sample/ie.rb11
-rw-r--r--ext/win32ole/sample/ieconst.rb32
-rw-r--r--ext/win32ole/sample/ienavi.rb40
-rw-r--r--ext/win32ole/sample/ienavi2.rb40
-rw-r--r--ext/win32ole/sample/oledirs.rb23
-rw-r--r--ext/win32ole/sample/olegen.rb347
-rw-r--r--ext/win32ole/sample/xml.rb7306
-rw-r--r--ext/win32ole/win32ole.c4015
-rw-r--r--ext/win32ole/win32ole.h161
-rw-r--r--ext/win32ole/win32ole_error.c82
-rw-r--r--ext/win32ole/win32ole_error.h8
-rw-r--r--ext/win32ole/win32ole_event.c1258
-rw-r--r--ext/win32ole/win32ole_event.h6
-rw-r--r--ext/win32ole/win32ole_method.c928
-rw-r--r--ext/win32ole/win32ole_method.h15
-rw-r--r--ext/win32ole/win32ole_param.c418
-rw-r--r--ext/win32ole/win32ole_param.h8
-rw-r--r--ext/win32ole/win32ole_record.c577
-rw-r--r--ext/win32ole/win32ole_record.h10
-rw-r--r--ext/win32ole/win32ole_type.c901
-rw-r--r--ext/win32ole/win32ole_type.h8
-rw-r--r--ext/win32ole/win32ole_typelib.c832
-rw-r--r--ext/win32ole/win32ole_typelib.h11
-rw-r--r--ext/win32ole/win32ole_variable.c366
-rw-r--r--ext/win32ole/win32ole_variable.h8
-rw-r--r--ext/win32ole/win32ole_variant.c707
-rw-r--r--ext/win32ole/win32ole_variant.h13
-rw-r--r--ext/win32ole/win32ole_variant_m.c148
-rw-r--r--ext/win32ole/win32ole_variant_m.h7
-rw-r--r--ext/zlib/depend5
-rw-r--r--ext/zlib/extconf.rb64
-rw-r--r--ext/zlib/zlib.c4623
-rw-r--r--file.c5901
-rw-r--r--fnmatch.c243
-rw-r--r--fnmatch.h36
-rw-r--r--gc.c9076
-rw-r--r--gc.h107
-rw-r--r--gem_prelude.rb1
-rw-r--r--gems/bundled_gems3
-rw-r--r--glob.c591
-rw-r--r--golf_prelude.rb123
-rw-r--r--goruby.c60
-rw-r--r--hash.c4005
-rw-r--r--ia64.s42
-rw-r--r--include/ruby.h35
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h47
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h110
-rw-r--r--include/ruby/defines.h289
-rw-r--r--include/ruby/encoding.h352
-rw-r--r--include/ruby/intern.h940
-rw-r--r--include/ruby/io.h214
-rw-r--r--include/ruby/missing.h251
-rw-r--r--include/ruby/oniguruma.h841
-rw-r--r--include/ruby/re.h71
-rw-r--r--include/ruby/regex.h46
-rw-r--r--include/ruby/ruby.h1814
-rw-r--r--include/ruby/st.h157
-rw-r--r--include/ruby/subst.h19
-rw-r--r--include/ruby/thread.h45
-rw-r--r--include/ruby/thread_native.h56
-rw-r--r--include/ruby/util.h102
-rw-r--r--include/ruby/version.h74
-rw-r--r--include/ruby/vm.h64
-rw-r--r--include/ruby/win32.h841
-rw-r--r--inits.c121
-rw-r--r--insns.def2217
-rw-r--r--install-sh238
-rw-r--r--instruby.rb67
-rw-r--r--intern.h324
-rw-r--r--internal.h1094
-rw-r--r--io.c12741
-rw-r--r--iseq.c2328
-rw-r--r--iseq.h157
-rw-r--r--keywords42
-rw-r--r--lex.c119
-rw-r--r--lex.c.blt219
-rw-r--r--lib/English.rb163
-rw-r--r--lib/Env.rb31
-rw-r--r--lib/README61
-rw-r--r--lib/abbrev.rb131
-rw-r--r--lib/base64.rb110
-rw-r--r--lib/benchmark.rb557
-rw-r--r--lib/cgi-lib.rb147
-rw-r--r--lib/cgi.rb295
-rw-r--r--lib/cgi/cookie.rb170
-rw-r--r--lib/cgi/core.rb880
-rw-r--r--lib/cgi/html.rb1034
-rw-r--r--lib/cgi/session.rb531
-rw-r--r--lib/cgi/session/pstore.rb100
-rw-r--r--lib/cgi/util.rb194
-rw-r--r--lib/cmath.rb400
-rw-r--r--lib/complex.rb496
-rw-r--r--lib/csv.rb2333
-rw-r--r--lib/date.rb258
-rw-r--r--lib/date2.rb219
-rw-r--r--lib/debug.rb1289
-rw-r--r--lib/delegate.rb475
-rw-r--r--lib/drb.rb2
-rw-r--r--lib/drb/acl.rb232
-rw-r--r--lib/drb/drb.rb1829
-rw-r--r--lib/drb/eq.rb14
-rw-r--r--lib/drb/extserv.rb43
-rw-r--r--lib/drb/extservm.rb93
-rw-r--r--lib/drb/gw.rb160
-rw-r--r--lib/drb/invokemethod.rb34
-rw-r--r--lib/drb/observer.rb25
-rw-r--r--lib/drb/ssl.rb344
-rw-r--r--lib/drb/timeridconv.rb101
-rw-r--r--lib/drb/unix.rb115
-rw-r--r--lib/e2mmap.rb263
-rw-r--r--lib/erb.rb1009
-rw-r--r--lib/eregex.rb36
-rw-r--r--lib/fileutils.rb1761
-rw-r--r--lib/final.rb41
-rw-r--r--lib/finalize.rb201
-rw-r--r--lib/find.rb102
-rw-r--r--lib/forwardable.rb289
-rw-r--r--lib/ftools.rb166
-rw-r--r--lib/ftplib.rb574
-rw-r--r--lib/getoptlong.rb483
-rw-r--r--lib/getopts.rb141
-rw-r--r--lib/importenv.rb32
-rw-r--r--lib/ipaddr.rb658
-rw-r--r--lib/irb.rb703
-rw-r--r--lib/irb/cmd/chws.rb33
-rw-r--r--lib/irb/cmd/fork.rb38
-rw-r--r--lib/irb/cmd/help.rb41
-rw-r--r--lib/irb/cmd/load.rb66
-rw-r--r--lib/irb/cmd/nop.rb38
-rw-r--r--lib/irb/cmd/pushws.rb40
-rw-r--r--lib/irb/cmd/subirb.rb42
-rw-r--r--lib/irb/completion.rb227
-rw-r--r--lib/irb/context.rb419
-rw-r--r--lib/irb/ext/change-ws.rb45
-rw-r--r--lib/irb/ext/history.rb118
-rw-r--r--lib/irb/ext/loader.rb128
-rw-r--r--lib/irb/ext/math-mode.rb47
-rw-r--r--lib/irb/ext/multi-irb.rb265
-rw-r--r--lib/irb/ext/save-history.rb103
-rw-r--r--lib/irb/ext/tracer.rb71
-rw-r--r--lib/irb/ext/use-loader.rb73
-rw-r--r--lib/irb/ext/workspaces.rb66
-rw-r--r--lib/irb/extend-command.rb308
-rw-r--r--lib/irb/frame.rb80
-rw-r--r--lib/irb/help.rb36
-rw-r--r--lib/irb/init.rb304
-rw-r--r--lib/irb/input-method.rb191
-rw-r--r--lib/irb/inspector.rb131
-rw-r--r--lib/irb/lc/.document4
-rw-r--r--lib/irb/lc/error.rb31
-rw-r--r--lib/irb/lc/help-message50
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb10
-rw-r--r--lib/irb/lc/ja/error.rb30
-rw-r--r--lib/irb/lc/ja/help-message53
-rw-r--r--lib/irb/locale.rb181
-rw-r--r--lib/irb/magic-file.rb37
-rw-r--r--lib/irb/notifier.rb231
-rw-r--r--lib/irb/output-method.rb91
-rw-r--r--lib/irb/ruby-lex.rb1170
-rw-r--r--lib/irb/ruby-token.rb266
-rw-r--r--lib/irb/slex.rb281
-rw-r--r--lib/irb/src_encoding.rb4
-rw-r--r--lib/irb/version.rb15
-rw-r--r--lib/irb/workspace.rb114
-rw-r--r--lib/irb/ws-for-case-2.rb14
-rw-r--r--lib/irb/xmp.rb169
-rw-r--r--lib/jcode.rb208
-rw-r--r--lib/logger.rb737
-rw-r--r--lib/mailread.rb48
-rw-r--r--lib/mathn.rb384
-rw-r--r--lib/matrix.rb2308
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb882
-rw-r--r--lib/matrix/lup_decomposition.rb218
-rw-r--r--lib/mkmf.rb2866
-rw-r--r--lib/monitor.rb527
-rw-r--r--lib/mutex_m.rb266
-rw-r--r--lib/net/ftp.rb1126
-rw-r--r--lib/net/http.rb1555
-rw-r--r--lib/net/http/backward.rb25
-rw-r--r--lib/net/http/exceptions.rb25
-rw-r--r--lib/net/http/generic_request.rb332
-rw-r--r--lib/net/http/header.rb452
-rw-r--r--lib/net/http/proxy_delta.rb16
-rw-r--r--lib/net/http/request.rb20
-rw-r--r--lib/net/http/requests.rb122
-rw-r--r--lib/net/http/response.rb414
-rw-r--r--lib/net/http/responses.rb273
-rw-r--r--lib/net/https.rb22
-rw-r--r--lib/net/imap.rb3578
-rw-r--r--lib/net/pop.rb1021
-rw-r--r--lib/net/protocol.rb420
-rw-r--r--lib/net/smtp.rb1073
-rw-r--r--lib/net/telnet.rb763
-rw-r--r--lib/observer.rb199
-rw-r--r--lib/open-uri.rb788
-rw-r--r--lib/open3.rb694
-rw-r--r--lib/optionparser.rb1
-rw-r--r--lib/optparse.rb1997
-rw-r--r--lib/optparse/ac.rb50
-rw-r--r--lib/optparse/date.rb17
-rw-r--r--lib/optparse/shellwords.rb6
-rw-r--r--lib/optparse/time.rb10
-rw-r--r--lib/optparse/uri.rb6
-rw-r--r--lib/optparse/version.rb70
-rw-r--r--lib/ostruct.rb293
-rw-r--r--lib/parsearg.rb83
-rw-r--r--lib/parsedate.rb75
-rw-r--r--lib/ping.rb62
-rw-r--r--lib/pp.rb544
-rw-r--r--lib/prettyprint.rb554
-rw-r--r--lib/prime.rb489
-rw-r--r--lib/profile.rb63
-rw-r--r--lib/profiler.rb148
-rw-r--r--lib/pstore.rb488
-rw-r--r--lib/racc/parser.rb622
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc219
-rw-r--r--lib/rake.rb78
-rw-r--r--lib/rake/alt_system.rb110
-rw-r--r--lib/rake/application.rb783
-rw-r--r--lib/rake/backtrace.rb23
-rw-r--r--lib/rake/clean.rb76
-rw-r--r--lib/rake/cloneable.rb16
-rw-r--r--lib/rake/contrib/.document1
-rw-r--r--lib/rake/contrib/compositepublisher.rb21
-rw-r--r--lib/rake/contrib/ftptools.rb137
-rw-r--r--lib/rake/contrib/publisher.rb81
-rw-r--r--lib/rake/contrib/rubyforgepublisher.rb18
-rw-r--r--lib/rake/contrib/sshpublisher.rb61
-rw-r--r--lib/rake/contrib/sys.rb4
-rw-r--r--lib/rake/cpu_counter.rb110
-rw-r--r--lib/rake/default_loader.rb14
-rw-r--r--lib/rake/dsl_definition.rb199
-rw-r--r--lib/rake/early_time.rb21
-rw-r--r--lib/rake/ext/core.rb25
-rw-r--r--lib/rake/ext/module.rb2
-rw-r--r--lib/rake/ext/pathname.rb25
-rw-r--r--lib/rake/ext/string.rb173
-rw-r--r--lib/rake/ext/time.rb15
-rw-r--r--lib/rake/file_creation_task.rb24
-rw-r--r--lib/rake/file_list.rb428
-rw-r--r--lib/rake/file_task.rb46
-rw-r--r--lib/rake/file_utils.rb128
-rw-r--r--lib/rake/file_utils_ext.rb144
-rw-r--r--lib/rake/gempackagetask.rb4
-rw-r--r--lib/rake/invocation_chain.rb56
-rw-r--r--lib/rake/invocation_exception_mixin.rb16
-rw-r--r--lib/rake/linked_list.rb103
-rw-r--r--lib/rake/loaders/makefile.rb40
-rw-r--r--lib/rake/multi_task.rb13
-rw-r--r--lib/rake/name_space.rb38
-rw-r--r--lib/rake/packagetask.rb202
-rw-r--r--lib/rake/pathmap.rb3
-rw-r--r--lib/rake/phony.rb15
-rw-r--r--lib/rake/private_reader.rb20
-rw-r--r--lib/rake/promise.rb99
-rw-r--r--lib/rake/pseudo_status.rb29
-rw-r--r--lib/rake/rake_module.rb38
-rw-r--r--lib/rake/rake_test_loader.rb22
-rw-r--r--lib/rake/rdoctask.rb4
-rw-r--r--lib/rake/ruby182_test_unit_fix.rb29
-rw-r--r--lib/rake/rule_recursion_overflow_error.rb20
-rw-r--r--lib/rake/runtest.rb27
-rw-r--r--lib/rake/scope.rb42
-rw-r--r--lib/rake/task.rb383
-rw-r--r--lib/rake/task_argument_error.rb7
-rw-r--r--lib/rake/task_arguments.rb98
-rw-r--r--lib/rake/task_manager.rb310
-rw-r--r--lib/rake/tasklib.rb24
-rw-r--r--lib/rake/testtask.rb212
-rw-r--r--lib/rake/thread_history_display.rb48
-rw-r--r--lib/rake/thread_pool.rb164
-rw-r--r--lib/rake/trace_output.rb22
-rw-r--r--lib/rake/version.rb7
-rw-r--r--lib/rake/win32.rb56
-rw-r--r--lib/rational.rb366
-rw-r--r--lib/rbconfig/.document1
-rw-r--r--lib/rbconfig/datadir.rb13
-rw-r--r--lib/rdoc.rb185
-rw-r--r--lib/rdoc/alias.rb111
-rw-r--r--lib/rdoc/anon_class.rb10
-rw-r--r--lib/rdoc/any_method.rb316
-rw-r--r--lib/rdoc/attr.rb175
-rw-r--r--lib/rdoc/class_module.rb799
-rw-r--r--lib/rdoc/code_object.rb429
-rw-r--r--lib/rdoc/code_objects.rb5
-rw-r--r--lib/rdoc/comment.rb229
-rw-r--r--lib/rdoc/constant.rb186
-rw-r--r--lib/rdoc/context.rb1211
-rw-r--r--lib/rdoc/context/section.rb238
-rw-r--r--lib/rdoc/cross_reference.rb183
-rw-r--r--lib/rdoc/encoding.rb99
-rw-r--r--lib/rdoc/erb_partial.rb18
-rw-r--r--lib/rdoc/erbio.rb37
-rw-r--r--lib/rdoc/extend.rb9
-rw-r--r--lib/rdoc/generator.rb51
-rw-r--r--lib/rdoc/generator/darkfish.rb759
-rw-r--r--lib/rdoc/generator/json_index.rb248
-rw-r--r--lib/rdoc/generator/markup.rb169
-rw-r--r--lib/rdoc/generator/pot.rb97
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb67
-rw-r--r--lib/rdoc/generator/pot/po.rb83
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb140
-rw-r--r--lib/rdoc/generator/ri.rb30
-rw-r--r--lib/rdoc/generator/template/darkfish/.document0
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml5
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_navigation.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_search.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml174
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts.css167
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Light.ttfbin0 -> 94668 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-LightItalic.ttfbin0 -> 94196 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Regular.ttfbin0 -> 96184 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-RegularItalic.ttfbin0 -> 95316 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin0 -> 71200 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin0 -> 71692 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/add.pngbin0 -> 733 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/arrow_up.pngbin0 -> 372 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin0 -> 452 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin0 -> 764 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin0 -> 774 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin0 -> 211 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin0 -> 207 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin0 -> 209 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin0 -> 626 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/delete.pngbin0 -> 715 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin0 -> 659 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin0 -> 5886 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin0 -> 207 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin0 -> 853 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin0 -> 621 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin0 -> 342 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin0 -> 309 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin0 -> 591 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin0 -> 592 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_blue.pngbin0 -> 1880 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin0 -> 613 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/transparent.pngbin0 -> 97 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin0 -> 610 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin0 -> 584 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin0 -> 692 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml23
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js161
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js4
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js109
-rw-r--r--lib/rdoc/generator/template/darkfish/page.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/rdoc.css590
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_not_found.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml63
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml58
-rw-r--r--lib/rdoc/generator/template/json_index/.document1
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js142
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js228
-rw-r--r--lib/rdoc/ghost_method.rb6
-rw-r--r--lib/rdoc/i18n.rb9
-rw-r--r--lib/rdoc/i18n/locale.rb101
-rw-r--r--lib/rdoc/i18n/text.rb125
-rw-r--r--lib/rdoc/include.rb9
-rw-r--r--lib/rdoc/known_classes.rb73
-rw-r--r--lib/rdoc/markdown.rb15961
-rw-r--r--lib/rdoc/markdown/entities.rb2131
-rw-r--r--lib/rdoc/markdown/literals_1_9.rb420
-rw-r--r--lib/rdoc/markup.rb869
-rw-r--r--lib/rdoc/markup/attr_changer.rb22
-rw-r--r--lib/rdoc/markup/attr_span.rb29
-rw-r--r--lib/rdoc/markup/attribute_manager.rb343
-rw-r--r--lib/rdoc/markup/attributes.rb70
-rw-r--r--lib/rdoc/markup/blank_line.rb27
-rw-r--r--lib/rdoc/markup/block_quote.rb14
-rw-r--r--lib/rdoc/markup/document.rb164
-rw-r--r--lib/rdoc/markup/formatter.rb264
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb767
-rw-r--r--lib/rdoc/markup/hard_break.rb31
-rw-r--r--lib/rdoc/markup/heading.rb78
-rw-r--r--lib/rdoc/markup/include.rb42
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb47
-rw-r--r--lib/rdoc/markup/inline.rb1
-rw-r--r--lib/rdoc/markup/list.rb101
-rw-r--r--lib/rdoc/markup/list_item.rb99
-rw-r--r--lib/rdoc/markup/paragraph.rb28
-rw-r--r--lib/rdoc/markup/parser.rb558
-rw-r--r--lib/rdoc/markup/pre_process.rb293
-rw-r--r--lib/rdoc/markup/raw.rb69
-rw-r--r--lib/rdoc/markup/rule.rb20
-rw-r--r--lib/rdoc/markup/special.rb40
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb114
-rw-r--r--lib/rdoc/markup/to_ansi.rb93
-rw-r--r--lib/rdoc/markup/to_bs.rb78
-rw-r--r--lib/rdoc/markup/to_html.rb397
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb160
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb284
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb71
-rw-r--r--lib/rdoc/markup/to_label.rb74
-rw-r--r--lib/rdoc/markup/to_markdown.rb191
-rw-r--r--lib/rdoc/markup/to_rdoc.rb333
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb87
-rw-r--r--lib/rdoc/markup/to_test.rb69
-rw-r--r--lib/rdoc/markup/to_tt_only.rb120
-rw-r--r--lib/rdoc/markup/verbatim.rb83
-rw-r--r--lib/rdoc/meta_method.rb6
-rw-r--r--lib/rdoc/method_attr.rb418
-rw-r--r--lib/rdoc/mixin.rb120
-rw-r--r--lib/rdoc/normal_class.rb92
-rw-r--r--lib/rdoc/normal_module.rb73
-rw-r--r--lib/rdoc/options.rb1251
-rw-r--r--lib/rdoc/parser.rb310
-rw-r--r--lib/rdoc/parser/c.rb1229
-rw-r--r--lib/rdoc/parser/changelog.rb198
-rw-r--r--lib/rdoc/parser/markdown.rb23
-rw-r--r--lib/rdoc/parser/rd.rb22
-rw-r--r--lib/rdoc/parser/ruby.rb2160
-rw-r--r--lib/rdoc/parser/ruby_tools.rb167
-rw-r--r--lib/rdoc/parser/simple.rb61
-rw-r--r--lib/rdoc/parser/text.rb11
-rw-r--r--lib/rdoc/rd.rb99
-rw-r--r--lib/rdoc/rd/block_parser.rb1055
-rw-r--r--lib/rdoc/rd/inline.rb71
-rw-r--r--lib/rdoc/rd/inline_parser.rb1207
-rw-r--r--lib/rdoc/rdoc.rb570
-rw-r--r--lib/rdoc/require.rb51
-rw-r--r--lib/rdoc/ri.rb20
-rw-r--r--lib/rdoc/ri/driver.rb1497
-rw-r--r--lib/rdoc/ri/formatter.rb5
-rw-r--r--lib/rdoc/ri/paths.rb187
-rw-r--r--lib/rdoc/ri/store.rb6
-rw-r--r--lib/rdoc/ruby_lex.rb1377
-rw-r--r--lib/rdoc/ruby_token.rb460
-rw-r--r--lib/rdoc/rubygems_hook.rb253
-rw-r--r--lib/rdoc/servlet.rb441
-rw-r--r--lib/rdoc/single_class.rb21
-rw-r--r--lib/rdoc/stats.rb457
-rw-r--r--lib/rdoc/stats/normal.rb59
-rw-r--r--lib/rdoc/stats/quiet.rb59
-rw-r--r--lib/rdoc/stats/verbose.rb45
-rw-r--r--lib/rdoc/store.rb979
-rw-r--r--lib/rdoc/task.rb330
-rw-r--r--lib/rdoc/test_case.rb217
-rw-r--r--lib/rdoc/text.rb324
-rw-r--r--lib/rdoc/token_stream.rb95
-rw-r--r--lib/rdoc/tom_doc.rb257
-rw-r--r--lib/rdoc/top_level.rb282
-rw-r--r--lib/readbytes.rb36
-rw-r--r--lib/resolv-replace.rb74
-rw-r--r--lib/resolv.rb2831
-rw-r--r--lib/rexml/attlistdecl.rb62
-rw-r--r--lib/rexml/attribute.rb191
-rw-r--r--lib/rexml/cdata.rb67
-rw-r--r--lib/rexml/child.rb96
-rw-r--r--lib/rexml/comment.rb80
-rw-r--r--lib/rexml/doctype.rb269
-rw-r--r--lib/rexml/document.rb286
-rw-r--r--lib/rexml/dtd/attlistdecl.rb10
-rw-r--r--lib/rexml/dtd/dtd.rb46
-rw-r--r--lib/rexml/dtd/elementdecl.rb17
-rw-r--r--lib/rexml/dtd/entitydecl.rb56
-rw-r--r--lib/rexml/dtd/notationdecl.rb39
-rw-r--r--lib/rexml/element.rb1240
-rw-r--r--lib/rexml/encoding.rb50
-rw-r--r--lib/rexml/entity.rb166
-rw-r--r--lib/rexml/formatters/default.rb111
-rw-r--r--lib/rexml/formatters/pretty.rb141
-rw-r--r--lib/rexml/formatters/transitive.rb57
-rw-r--r--lib/rexml/functions.rb394
-rw-r--r--lib/rexml/instruction.rb70
-rw-r--r--lib/rexml/light/node.rb195
-rw-r--r--lib/rexml/namespace.rb47
-rw-r--r--lib/rexml/node.rb75
-rw-r--r--lib/rexml/output.rb29
-rw-r--r--lib/rexml/parent.rb167
-rw-r--r--lib/rexml/parseexception.rb51
-rw-r--r--lib/rexml/parsers/baseparser.rb532
-rw-r--r--lib/rexml/parsers/lightparser.rb58
-rw-r--r--lib/rexml/parsers/pullparser.rb196
-rw-r--r--lib/rexml/parsers/sax2parser.rb273
-rw-r--r--lib/rexml/parsers/streamparser.rb52
-rw-r--r--lib/rexml/parsers/treeparser.rb100
-rw-r--r--lib/rexml/parsers/ultralightparser.rb56
-rw-r--r--lib/rexml/parsers/xpathparser.rb697
-rw-r--r--lib/rexml/quickpath.rb265
-rw-r--r--lib/rexml/rexml.rb31
-rw-r--r--lib/rexml/sax2listener.rb97
-rw-r--r--lib/rexml/security.rb27
-rw-r--r--lib/rexml/source.rb296
-rw-r--r--lib/rexml/streamlistener.rb92
-rw-r--r--lib/rexml/syncenumerator.rb32
-rw-r--r--lib/rexml/text.rb425
-rw-r--r--lib/rexml/undefinednamespaceexception.rb8
-rw-r--r--lib/rexml/validation/relaxng.rb559
-rw-r--r--lib/rexml/validation/validation.rb155
-rw-r--r--lib/rexml/validation/validationexception.rb9
-rw-r--r--lib/rexml/xmldecl.rb115
-rw-r--r--lib/rexml/xmltokens.rb84
-rw-r--r--lib/rexml/xpath.rb80
-rw-r--r--lib/rexml/xpath_parser.rb803
-rw-r--r--lib/rinda/rinda.rb327
-rw-r--r--lib/rinda/ring.rb480
-rw-r--r--lib/rinda/tuplespace.rb642
-rw-r--r--lib/rss.rb91
-rw-r--r--lib/rss/0.9.rb461
-rw-r--r--lib/rss/1.0.rb484
-rw-r--r--lib/rss/2.0.rb142
-rw-r--r--lib/rss/atom.rb839
-rw-r--r--lib/rss/content.rb33
-rw-r--r--lib/rss/content/1.0.rb9
-rw-r--r--lib/rss/content/2.0.rb11
-rw-r--r--lib/rss/converter.rb170
-rw-r--r--lib/rss/dublincore.rb163
-rw-r--r--lib/rss/dublincore/1.0.rb12
-rw-r--r--lib/rss/dublincore/2.0.rb12
-rw-r--r--lib/rss/dublincore/atom.rb16
-rw-r--r--lib/rss/image.rb197
-rw-r--r--lib/rss/itunes.rb412
-rw-r--r--lib/rss/maker.rb78
-rw-r--r--lib/rss/maker/0.9.rb508
-rw-r--r--lib/rss/maker/1.0.rb435
-rw-r--r--lib/rss/maker/2.0.rb223
-rw-r--r--lib/rss/maker/atom.rb172
-rw-r--r--lib/rss/maker/base.rb944
-rw-r--r--lib/rss/maker/content.rb21
-rw-r--r--lib/rss/maker/dublincore.rb121
-rw-r--r--lib/rss/maker/entry.rb163
-rw-r--r--lib/rss/maker/feed.rb426
-rw-r--r--lib/rss/maker/image.rb111
-rw-r--r--lib/rss/maker/itunes.rb242
-rw-r--r--lib/rss/maker/slash.rb33
-rw-r--r--lib/rss/maker/syndication.rb18
-rw-r--r--lib/rss/maker/taxonomy.rb118
-rw-r--r--lib/rss/maker/trackback.rb61
-rw-r--r--lib/rss/parser.rb570
-rw-r--r--lib/rss/rexmlparser.rb49
-rw-r--r--lib/rss/rss.rb1352
-rw-r--r--lib/rss/slash.rb51
-rw-r--r--lib/rss/syndication.rb68
-rw-r--r--lib/rss/taxonomy.rb147
-rw-r--r--lib/rss/trackback.rb290
-rw-r--r--lib/rss/utils.rb199
-rw-r--r--lib/rss/xml-stylesheet.rb105
-rw-r--r--lib/rss/xml.rb71
-rw-r--r--lib/rss/xmlparser.rb94
-rw-r--r--lib/rss/xmlscanner.rb121
-rw-r--r--lib/rubygems.rb1239
-rw-r--r--lib/rubygems/LICENSE.txt54
-rw-r--r--lib/rubygems/available_set.rb164
-rw-r--r--lib/rubygems/basic_specification.rb260
-rw-r--r--lib/rubygems/command.rb582
-rw-r--r--lib/rubygems/command_manager.rb218
-rw-r--r--lib/rubygems/commands/build_command.rb60
-rw-r--r--lib/rubygems/commands/cert_command.rb276
-rw-r--r--lib/rubygems/commands/check_command.rb93
-rw-r--r--lib/rubygems/commands/cleanup_command.rb165
-rw-r--r--lib/rubygems/commands/contents_command.rb191
-rw-r--r--lib/rubygems/commands/dependency_command.rb207
-rw-r--r--lib/rubygems/commands/environment_command.rb158
-rw-r--r--lib/rubygems/commands/fetch_command.rb77
-rw-r--r--lib/rubygems/commands/generate_index_command.rb84
-rw-r--r--lib/rubygems/commands/help_command.rb384
-rw-r--r--lib/rubygems/commands/install_command.rb347
-rw-r--r--lib/rubygems/commands/list_command.rb40
-rw-r--r--lib/rubygems/commands/lock_command.rb110
-rw-r--r--lib/rubygems/commands/mirror_command.rb23
-rw-r--r--lib/rubygems/commands/open_command.rb74
-rw-r--r--lib/rubygems/commands/outdated_command.rb32
-rw-r--r--lib/rubygems/commands/owner_command.rb99
-rw-r--r--lib/rubygems/commands/pristine_command.rb151
-rw-r--r--lib/rubygems/commands/push_command.rb98
-rw-r--r--lib/rubygems/commands/query_command.rb343
-rw-r--r--lib/rubygems/commands/rdoc_command.rb96
-rw-r--r--lib/rubygems/commands/search_command.rb40
-rw-r--r--lib/rubygems/commands/server_command.rb86
-rw-r--r--lib/rubygems/commands/setup_command.rb483
-rw-r--r--lib/rubygems/commands/sources_command.rb210
-rw-r--r--lib/rubygems/commands/specification_command.rb145
-rw-r--r--lib/rubygems/commands/stale_command.rb38
-rw-r--r--lib/rubygems/commands/uninstall_command.rb164
-rw-r--r--lib/rubygems/commands/unpack_command.rb182
-rw-r--r--lib/rubygems/commands/update_command.rb276
-rw-r--r--lib/rubygems/commands/which_command.rb90
-rw-r--r--lib/rubygems/commands/yank_command.rb107
-rw-r--r--lib/rubygems/compatibility.rb60
-rw-r--r--lib/rubygems/config_file.rb483
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb66
-rwxr-xr-xlib/rubygems/core_ext/kernel_require.rb139
-rw-r--r--lib/rubygems/defaults.rb177
-rw-r--r--lib/rubygems/dependency.rb334
-rw-r--r--lib/rubygems/dependency_installer.rb480
-rw-r--r--lib/rubygems/dependency_list.rb244
-rw-r--r--lib/rubygems/deprecate.rb70
-rw-r--r--lib/rubygems/doctor.rb131
-rw-r--r--lib/rubygems/errors.rb137
-rw-r--r--lib/rubygems/exceptions.rb270
-rw-r--r--lib/rubygems/ext.rb18
-rw-r--r--lib/rubygems/ext/build_error.rb6
-rw-r--r--lib/rubygems/ext/builder.rb218
-rw-r--r--lib/rubygems/ext/cmake_builder.rb16
-rw-r--r--lib/rubygems/ext/configure_builder.rb23
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb78
-rw-r--r--lib/rubygems/ext/rake_builder.rb36
-rw-r--r--lib/rubygems/gem_runner.rb81
-rw-r--r--lib/rubygems/gemcutter_utilities.rb154
-rw-r--r--lib/rubygems/indexer.rb498
-rw-r--r--lib/rubygems/install_default_message.rb12
-rw-r--r--lib/rubygems/install_message.rb12
-rw-r--r--lib/rubygems/install_update_options.rb186
-rw-r--r--lib/rubygems/installer.rb819
-rw-r--r--lib/rubygems/installer_test_case.rb193
-rw-r--r--lib/rubygems/local_remote_options.rb148
-rw-r--r--lib/rubygems/mock_gem_ui.rb88
-rw-r--r--lib/rubygems/name_tuple.rb123
-rw-r--r--lib/rubygems/package.rb613
-rw-r--r--lib/rubygems/package/digest_io.rb64
-rw-r--r--lib/rubygems/package/file_source.rb33
-rw-r--r--lib/rubygems/package/io_source.rb45
-rw-r--r--lib/rubygems/package/old.rb178
-rw-r--r--lib/rubygems/package/source.rb3
-rw-r--r--lib/rubygems/package/tar_header.rb229
-rw-r--r--lib/rubygems/package/tar_reader.rb123
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb147
-rw-r--r--lib/rubygems/package/tar_test_case.rb137
-rw-r--r--lib/rubygems/package/tar_writer.rb320
-rw-r--r--lib/rubygems/package_task.rb128
-rw-r--r--lib/rubygems/path_support.rb87
-rw-r--r--lib/rubygems/platform.rb204
-rw-r--r--lib/rubygems/psych_additions.rb9
-rw-r--r--lib/rubygems/psych_tree.rb31
-rw-r--r--lib/rubygems/rdoc.rb335
-rw-r--r--lib/rubygems/remote_fetcher.rb394
-rw-r--r--lib/rubygems/request.rb244
-rw-r--r--lib/rubygems/request/connection_pools.rb79
-rw-r--r--lib/rubygems/request/http_pool.rb38
-rw-r--r--lib/rubygems/request/https_pool.rb10
-rw-r--r--lib/rubygems/request_set.rb374
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb792
-rw-r--r--lib/rubygems/request_set/lockfile.rb633
-rw-r--r--lib/rubygems/requirement.rb273
-rw-r--r--lib/rubygems/resolver.rb485
-rw-r--r--lib/rubygems/resolver/activation_request.rb172
-rw-r--r--lib/rubygems/resolver/api_set.rb125
-rw-r--r--lib/rubygems/resolver/api_specification.rb85
-rw-r--r--lib/rubygems/resolver/best_set.rb78
-rw-r--r--lib/rubygems/resolver/composed_set.rb66
-rw-r--r--lib/rubygems/resolver/conflict.rb160
-rw-r--r--lib/rubygems/resolver/current_set.rb13
-rw-r--r--lib/rubygems/resolver/dependency_request.rb116
-rw-r--r--lib/rubygems/resolver/git_set.rb122
-rw-r--r--lib/rubygems/resolver/git_specification.rb59
-rw-r--r--lib/rubygems/resolver/index_set.rb80
-rw-r--r--lib/rubygems/resolver/index_specification.rb69
-rw-r--r--lib/rubygems/resolver/installed_specification.rb58
-rw-r--r--lib/rubygems/resolver/installer_set.rb224
-rw-r--r--lib/rubygems/resolver/local_specification.rb41
-rw-r--r--lib/rubygems/resolver/lock_set.rb84
-rw-r--r--lib/rubygems/resolver/lock_specification.rb84
-rw-r--r--lib/rubygems/resolver/requirement_list.rb81
-rw-r--r--lib/rubygems/resolver/set.rb56
-rw-r--r--lib/rubygems/resolver/spec_specification.rb56
-rw-r--r--lib/rubygems/resolver/specification.rb110
-rw-r--r--lib/rubygems/resolver/stats.rb44
-rw-r--r--lib/rubygems/resolver/vendor_set.rb87
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb24
-rw-r--r--lib/rubygems/security.rb595
-rw-r--r--lib/rubygems/security/policies.rb115
-rw-r--r--lib/rubygems/security/policy.rb295
-rw-r--r--lib/rubygems/security/signer.rb154
-rw-r--r--lib/rubygems/security/trust_dir.rb118
-rw-r--r--lib/rubygems/server.rb868
-rw-r--r--lib/rubygems/source.rb230
-rw-r--r--lib/rubygems/source/git.rb232
-rw-r--r--lib/rubygems/source/installed.rb40
-rw-r--r--lib/rubygems/source/local.rb129
-rw-r--r--lib/rubygems/source/lock.rb48
-rw-r--r--lib/rubygems/source/specific_file.rb72
-rw-r--r--lib/rubygems/source/vendor.rb27
-rw-r--r--lib/rubygems/source_list.rb149
-rw-r--r--lib/rubygems/source_local.rb5
-rw-r--r--lib/rubygems/source_specific_file.rb4
-rw-r--r--lib/rubygems/spec_fetcher.rb269
-rw-r--r--lib/rubygems/specification.rb2792
-rw-r--r--lib/rubygems/ssl_certs/.document1
-rw-r--r--lib/rubygems/ssl_certs/Class3PublicPrimaryCertificationAuthority.pem14
-rw-r--r--lib/rubygems/ssl_certs/DigiCertHighAssuranceEVRootCA.pem23
-rw-r--r--lib/rubygems/ssl_certs/EntrustnetSecureServerCertificationAuthority.pem28
-rw-r--r--lib/rubygems/ssl_certs/GeoTrustGlobalCA.pem20
-rw-r--r--lib/rubygems/stub_specification.rb190
-rw-r--r--lib/rubygems/syck_hack.rb76
-rw-r--r--lib/rubygems/test_case.rb1399
-rw-r--r--lib/rubygems/test_utilities.rb383
-rw-r--r--lib/rubygems/text.rb75
-rw-r--r--lib/rubygems/uninstaller.rb345
-rw-r--r--lib/rubygems/uri_formatter.rb49
-rw-r--r--lib/rubygems/user_interaction.rb712
-rw-r--r--lib/rubygems/util.rb134
-rw-r--r--lib/rubygems/util/list.rb48
-rw-r--r--lib/rubygems/util/stringio.rb34
-rw-r--r--lib/rubygems/validator.rb165
-rw-r--r--lib/rubygems/version.rb356
-rw-r--r--lib/rubygems/version_option.rb71
-rw-r--r--lib/scanf.rb776
-rw-r--r--lib/securerandom.rb274
-rw-r--r--lib/set.rb787
-rw-r--r--lib/shell.rb458
-rw-r--r--lib/shell/builtin-command.rb146
-rw-r--r--lib/shell/command-processor.rb667
-rw-r--r--lib/shell/error.rb25
-rw-r--r--lib/shell/filter.rb137
-rw-r--r--lib/shell/process-controller.rb310
-rw-r--r--lib/shell/system-command.rb158
-rw-r--r--lib/shell/version.rb15
-rw-r--r--lib/shellwords.rb239
-rw-r--r--lib/singleton.rb195
-rw-r--r--lib/sync.rb527
-rw-r--r--lib/telnet.rb439
-rw-r--r--lib/tempfile.rb424
-rw-r--r--lib/thread.rb209
-rw-r--r--lib/thwait.rb169
-rw-r--r--lib/time.rb676
-rw-r--r--lib/timeout.rb148
-rw-r--r--lib/tmpdir.rb152
-rw-r--r--lib/tracer.rb290
-rw-r--r--lib/tsort.rb448
-rw-r--r--lib/ubygems.rb10
-rw-r--r--lib/un.rb375
-rw-r--r--lib/uri.rb111
-rw-r--r--lib/uri/common.rb720
-rw-r--r--lib/uri/ftp.rb266
-rw-r--r--lib/uri/generic.rb1563
-rw-r--r--lib/uri/http.rb106
-rw-r--r--lib/uri/https.rb22
-rw-r--r--lib/uri/ldap.rb260
-rw-r--r--lib/uri/ldaps.rb20
-rw-r--r--lib/uri/mailto.rb286
-rw-r--r--lib/uri/rfc2396_parser.rb543
-rw-r--r--lib/uri/rfc3986_parser.rb105
-rw-r--r--lib/weakref.rb141
-rw-r--r--lib/webrick.rb226
-rw-r--r--lib/webrick/accesslog.rb158
-rw-r--r--lib/webrick/cgi.rb308
-rw-r--r--lib/webrick/compat.rb35
-rw-r--r--lib/webrick/config.rb151
-rw-r--r--lib/webrick/cookie.rb171
-rw-r--r--lib/webrick/htmlutils.rb29
-rw-r--r--lib/webrick/httpauth.rb95
-rw-r--r--lib/webrick/httpauth/authenticator.rb116
-rw-r--r--lib/webrick/httpauth/basicauth.rb108
-rw-r--r--lib/webrick/httpauth/digestauth.rb408
-rw-r--r--lib/webrick/httpauth/htdigest.rb131
-rw-r--r--lib/webrick/httpauth/htgroup.rb93
-rw-r--r--lib/webrick/httpauth/htpasswd.rb124
-rw-r--r--lib/webrick/httpauth/userdb.rb52
-rw-r--r--lib/webrick/httpproxy.rb337
-rw-r--r--lib/webrick/httprequest.rb584
-rw-r--r--lib/webrick/httpresponse.rb466
-rw-r--r--lib/webrick/https.rb86
-rw-r--r--lib/webrick/httpserver.rb278
-rw-r--r--lib/webrick/httpservlet.rb22
-rw-r--r--lib/webrick/httpservlet/abstract.rb153
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb46
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb120
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb87
-rw-r--r--lib/webrick/httpservlet/filehandler.rb521
-rw-r--r--lib/webrick/httpservlet/prochandler.rb46
-rw-r--r--lib/webrick/httpstatus.rb194
-rw-r--r--lib/webrick/httputils.rb509
-rw-r--r--lib/webrick/httpversion.rb75
-rw-r--r--lib/webrick/log.rb155
-rw-r--r--lib/webrick/server.rb350
-rw-r--r--lib/webrick/ssl.rb195
-rw-r--r--lib/webrick/utils.rb230
-rw-r--r--lib/webrick/version.rb17
-rw-r--r--lib/xmlrpc.rb301
-rw-r--r--lib/xmlrpc/base64.rb62
-rw-r--r--lib/xmlrpc/client.rb614
-rw-r--r--lib/xmlrpc/config.rb42
-rw-r--r--lib/xmlrpc/create.rb286
-rw-r--r--lib/xmlrpc/datetime.rb129
-rw-r--r--lib/xmlrpc/marshal.rb66
-rw-r--r--lib/xmlrpc/parser.rb838
-rw-r--r--lib/xmlrpc/server.rb707
-rw-r--r--lib/xmlrpc/utils.rb171
-rw-r--r--lib/yaml.rb59
-rw-r--r--lib/yaml/dbm.rb279
-rw-r--r--lib/yaml/store.rb81
-rw-r--r--load.c1194
-rw-r--r--loadpath.c92
-rw-r--r--localeinit.c70
-rw-r--r--main.c45
-rw-r--r--man/erb.1157
-rw-r--r--man/goruby.139
-rw-r--r--man/irb.1173
-rw-r--r--man/rake.1198
-rw-r--r--man/ri.1181
-rw-r--r--man/ruby.1511
-rw-r--r--marshal.c2158
-rw-r--r--math.c964
-rw-r--r--method.h141
-rw-r--r--miniinit.c30
-rw-r--r--misc/README17
-rw-r--r--misc/inf-ruby.el230
-rw-r--r--misc/rb_optparse.bash20
-rwxr-xr-xmisc/rb_optparse.zsh38
-rw-r--r--misc/rdoc-mode.el166
-rw-r--r--misc/ruby-additional.el126
-rw-r--r--misc/ruby-electric.el475
-rw-r--r--misc/ruby-mode.el1887
-rw-r--r--misc/ruby-style.el79
-rw-r--r--misc/rubydb3x.el73
-rw-r--r--missing/acosh.c93
-rw-r--r--missing/alloca.c18
-rw-r--r--missing/cbrt.c11
-rw-r--r--missing/close.c72
-rw-r--r--missing/crt_externs.h8
-rw-r--r--missing/crypt.c1185
-rw-r--r--missing/dir.h63
-rw-r--r--missing/dup2.c68
-rw-r--r--missing/erf.c89
-rw-r--r--missing/ffs.c49
-rw-r--r--missing/file.h33
-rw-r--r--missing/fileblocks.c1
-rw-r--r--missing/finite.c9
-rw-r--r--missing/flock.c84
-rw-r--r--missing/hypot.c17
-rw-r--r--missing/isinf.c69
-rw-r--r--missing/isnan.c32
-rw-r--r--missing/langinfo.c148
-rw-r--r--missing/lgamma_r.c80
-rw-r--r--missing/memcmp.c15
-rw-r--r--missing/memmove.c38
-rw-r--r--missing/mkdir.c104
-rw-r--r--missing/nextafter.c77
-rw-r--r--missing/os2.c138
-rw-r--r--missing/setproctitle.c170
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/strcasecmp.c13
-rw-r--r--missing/strchr.c57
-rw-r--r--missing/strdup.c25
-rw-r--r--missing/strerror.c13
-rw-r--r--missing/strftime.c889
-rw-r--r--missing/strlcat.c74
-rw-r--r--missing/strlcpy.c70
-rw-r--r--missing/strstr.c82
-rw-r--r--missing/strtol.c87
-rw-r--r--missing/strtoul.c184
-rw-r--r--missing/tgamma.c92
-rw-r--r--missing/vsnprintf.c1122
-rw-r--r--missing/x68.c36
-rw-r--r--missing/x86_64-chkstk.s10
-rw-r--r--mkconfig.rb77
-rw-r--r--nacl/GNUmakefile.in87
-rw-r--r--nacl/README.nacl34
-rw-r--r--nacl/create_nmf.rb70
-rw-r--r--nacl/dirent.h15
-rw-r--r--nacl/example.html150
-rw-r--r--nacl/ioctl.h7
-rwxr-xr-xnacl/nacl-config.rb61
-rw-r--r--nacl/package.rb109
-rw-r--r--nacl/pepper_main.c870
-rw-r--r--nacl/resource.h8
-rw-r--r--nacl/select.h7
-rw-r--r--nacl/signal.h6
-rw-r--r--nacl/stat.h10
-rw-r--r--nacl/unistd.h9
-rw-r--r--nacl/utime.h11
-rw-r--r--node.c1085
-rw-r--r--node.h508
-rw-r--r--numeric.c4281
-rw-r--r--object.c3491
-rw-r--r--pack.c1947
-rw-r--r--parse.c7257
-rw-r--r--parse.y11822
-rw-r--r--prelude.rb15
-rw-r--r--probes.d234
-rw-r--r--probes_helper.h67
-rw-r--r--proc.c2862
-rw-r--r--process.c8052
-rw-r--r--random.c1419
-rw-r--r--range.c1372
-rw-r--r--rational.c2625
-rw-r--r--re.c3836
-rw-r--r--re.h39
-rw-r--r--regcomp.c6721
-rw-r--r--regenc.c957
-rw-r--r--regenc.h234
-rw-r--r--regerror.c408
-rw-r--r--regex.c4416
-rw-r--r--regex.h173
-rw-r--r--regexec.c4365
-rw-r--r--regint.h972
-rw-r--r--regparse.c6496
-rw-r--r--regparse.h363
-rw-r--r--regsyntax.c387
-rw-r--r--ruby.1285
-rw-r--r--ruby.c2215
-rw-r--r--ruby.h554
-rw-r--r--ruby_atomic.h170
-rw-r--r--rubyio.h60
-rw-r--r--rubysig.h54
-rw-r--r--rubytest.rb16
-rw-r--r--safe.c133
-rw-r--r--sample/README27
-rw-r--r--sample/benchmark.rb19
-rw-r--r--sample/biorhythm.rb154
-rw-r--r--sample/cal.rb262
-rw-r--r--sample/cbreak.rb4
-rw-r--r--sample/cgi-session-pstore.rb11
-rw-r--r--sample/clnt.rb12
-rw-r--r--sample/coverage.rb62
-rw-r--r--sample/dbmtest.rb14
-rw-r--r--sample/delegate.rb31
-rw-r--r--sample/dir.rb6
-rw-r--r--sample/drb/README.ja.rdoc59
-rw-r--r--sample/drb/README.rdoc56
-rw-r--r--sample/drb/acl.rb15
-rw-r--r--sample/drb/darray.rb12
-rw-r--r--sample/drb/darrayc.rb47
-rw-r--r--sample/drb/dbiff.rb51
-rw-r--r--sample/drb/dcdbiff.rb43
-rw-r--r--sample/drb/dchatc.rb41
-rw-r--r--sample/drb/dchats.rb70
-rw-r--r--sample/drb/dhasen.rb42
-rw-r--r--sample/drb/dhasenc.rb14
-rw-r--r--sample/drb/dlogc.rb16
-rw-r--r--sample/drb/dlogd.rb39
-rw-r--r--sample/drb/dqin.rb13
-rw-r--r--sample/drb/dqlib.rb14
-rw-r--r--sample/drb/dqout.rb14
-rw-r--r--sample/drb/dqueue.rb12
-rw-r--r--sample/drb/drbc.rb45
-rw-r--r--sample/drb/drbch.rb48
-rw-r--r--sample/drb/drbm.rb60
-rw-r--r--sample/drb/drbmc.rb22
-rw-r--r--sample/drb/drbs-acl.rb51
-rw-r--r--sample/drb/drbs.rb64
-rw-r--r--sample/drb/drbssl_c.rb19
-rw-r--r--sample/drb/drbssl_s.rb31
-rw-r--r--sample/drb/extserv_test.rb80
-rw-r--r--sample/drb/gw_ct.rb29
-rw-r--r--sample/drb/gw_cu.rb28
-rw-r--r--sample/drb/gw_s.rb10
-rw-r--r--sample/drb/holderc.rb22
-rw-r--r--sample/drb/holders.rb63
-rw-r--r--sample/drb/http0.rb77
-rw-r--r--sample/drb/http0serv.rb119
-rw-r--r--sample/drb/name.rb117
-rw-r--r--sample/drb/namec.rb36
-rw-r--r--sample/drb/old_tuplespace.rb214
-rw-r--r--sample/drb/rinda_ts.rb7
-rw-r--r--sample/drb/rindac.rb17
-rw-r--r--sample/drb/rindas.rb18
-rw-r--r--sample/drb/ring_echo.rb30
-rw-r--r--sample/drb/ring_inspect.rb30
-rw-r--r--sample/drb/ring_place.rb25
-rw-r--r--sample/drb/simpletuple.rb91
-rw-r--r--sample/drb/speedc.rb21
-rw-r--r--sample/drb/speeds.rb31
-rw-r--r--sample/dualstack-fetch.rb48
-rw-r--r--sample/dualstack-httpd.rb55
-rw-r--r--sample/eval.rb21
-rw-r--r--sample/exyacc.rb32
-rw-r--r--sample/fact.rb5
-rw-r--r--sample/fib.awk8
-rw-r--r--sample/fib.pl19
-rw-r--r--sample/fib.scm6
-rw-r--r--sample/freq.rb7
-rw-r--r--sample/from.rb160
-rw-r--r--sample/fullpath.rb16
-rw-r--r--sample/getopts.test36
-rw-r--r--sample/goodfriday.rb48
-rw-r--r--sample/list.rb17
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb2
-rw-r--r--sample/logger/app.rb46
-rw-r--r--sample/logger/log.rb27
-rw-r--r--sample/logger/shifting.rb26
-rwxr-xr-x[-rw-r--r--]sample/mine.rb47
-rw-r--r--sample/mkproto.rb30
-rw-r--r--sample/mpart.rb2
-rw-r--r--sample/mrshtest.rb14
-rw-r--r--sample/net-imap.rb167
-rw-r--r--sample/observ.rb8
-rw-r--r--sample/occur.pl8
-rw-r--r--sample/occur.rb6
-rw-r--r--sample/occur2.rb13
-rw-r--r--sample/open3.rb12
-rw-r--r--sample/openssl/c_rehash.rb174
-rw-r--r--sample/openssl/cert2text.rb23
-rw-r--r--sample/openssl/certstore.rb161
-rw-r--r--sample/openssl/cipher.rb54
-rw-r--r--sample/openssl/crlstore.rb122
-rw-r--r--sample/openssl/echo_cli.rb44
-rw-r--r--sample/openssl/echo_svr.rb65
-rw-r--r--sample/openssl/gen_csr.rb51
-rw-r--r--sample/openssl/smime_read.rb23
-rw-r--r--sample/openssl/smime_write.rb23
-rw-r--r--sample/openssl/wget.rb34
-rwxr-xr-xsample/optparse/opttest.rb125
-rwxr-xr-xsample/optparse/subcommand.rb19
-rw-r--r--sample/philos.rb6
-rw-r--r--sample/pi.rb2
-rw-r--r--sample/pstore.rb19
-rw-r--r--sample/pty/expect_sample.rb48
-rw-r--r--sample/pty/script.rb37
-rw-r--r--sample/pty/shl.rb92
-rw-r--r--sample/rbc.rb1015
-rw-r--r--sample/rcs.awk54
-rw-r--r--sample/rcs.rb30
-rw-r--r--sample/rdoc/markup/rdoc2latex.rb15
-rw-r--r--sample/rdoc/markup/sample.rb40
-rw-r--r--sample/regx.rb23
-rw-r--r--sample/rename.rb297
-rw-r--r--sample/rinda-ring.rb22
-rw-r--r--sample/ripper/ruby2html.rb112
-rw-r--r--sample/ripper/strip-comment.rb19
-rwxr-xr-xsample/rss/blend.rb79
-rwxr-xr-xsample/rss/convert.rb69
-rwxr-xr-xsample/rss/list_description.rb91
-rwxr-xr-xsample/rss/re_read.rb64
-rwxr-xr-xsample/rss/rss_recent.rb85
-rw-r--r--sample/sieve.rb21
-rw-r--r--sample/svr.rb14
-rw-r--r--sample/tempfile.rb8
-rwxr-xr-x[-rw-r--r--]sample/test.rb2216
-rw-r--r--sample/testunit/adder.rb13
-rw-r--r--sample/testunit/subtracter.rb12
-rw-r--r--sample/testunit/tc_adder.rb18
-rw-r--r--sample/testunit/tc_subtracter.rb18
-rw-r--r--sample/testunit/ts_examples.rb7
-rw-r--r--sample/time.rb16
-rw-r--r--sample/timeout.rb42
-rw-r--r--sample/trick2013/README.md13
-rw-r--r--sample/trick2013/kinaba/authors.markdown3
-rw-r--r--sample/trick2013/kinaba/entry.rb1
-rw-r--r--sample/trick2013/kinaba/remarks.markdown37
-rw-r--r--sample/trick2013/mame/authors.markdown3
-rw-r--r--sample/trick2013/mame/entry.rb97
-rw-r--r--sample/trick2013/mame/music-box.mp4bin0 -> 580724 bytes-rw-r--r--sample/trick2013/mame/remarks.markdown47
-rw-r--r--sample/trick2013/shinh/authors.markdown2
-rw-r--r--sample/trick2013/shinh/entry.rb10
-rw-r--r--sample/trick2013/shinh/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/authors.markdown3
-rw-r--r--sample/trick2013/yhara/entry.rb28
-rw-r--r--sample/trick2013/yhara/remarks.en.markdown23
-rw-r--r--sample/trick2013/yhara/remarks.markdown24
-rw-r--r--sample/trojan.rb7
-rw-r--r--sample/tsvr.rb17
-rw-r--r--sample/uumerge.rb16
-rw-r--r--sample/weakref.rb9
-rw-r--r--sample/webrick/demo-app.rb66
-rw-r--r--sample/webrick/demo-multipart.cgi12
-rw-r--r--sample/webrick/demo-servlet.rb6
-rw-r--r--sample/webrick/demo-urlencoded.cgi12
-rw-r--r--sample/webrick/hello.cgi11
-rw-r--r--sample/webrick/hello.rb8
-rw-r--r--sample/webrick/httpd.rb23
-rw-r--r--sample/webrick/httpproxy.rb25
-rw-r--r--sample/webrick/httpsd.rb33
-rw-r--r--signal.c1443
-rw-r--r--siphash.c484
-rw-r--r--siphash.h48
-rw-r--r--sparc.c40
-rw-r--r--spec/README31
-rw-r--r--spec/default.mspec21
-rw-r--r--sprintf.c1524
-rw-r--r--st.c1707
-rw-r--r--st.h46
-rw-r--r--strftime.c1163
-rw-r--r--string.c9225
-rw-r--r--struct.c1173
-rw-r--r--symbol.c1156
-rw-r--r--symbol.h54
-rw-r--r--template/Doxyfile.tmpl265
-rw-r--r--template/GNUmakefile.in6
-rw-r--r--template/encdb.h.tmpl91
-rw-r--r--template/fake.rb.in24
-rw-r--r--template/id.c.tmpl27
-rw-r--r--template/id.h.tmpl114
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/known_errors.inc.tmpl14
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/ruby.pc.in56
-rw-r--r--template/sizes.c.tmpl30
-rw-r--r--template/transdb.h.tmpl59
-rw-r--r--template/verconf.h.tmpl61
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yarvarch.en7
-rw-r--r--template/yarvarch.ja454
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/array/test_resize.rb29
-rw-r--r--test/-ext-/bignum/test_big2str.rb29
-rw-r--r--test/-ext-/bignum/test_bigzero.rb13
-rw-r--r--test/-ext-/bignum/test_div.rb28
-rw-r--r--test/-ext-/bignum/test_mul.rb137
-rw-r--r--test/-ext-/bignum/test_pack.rb398
-rw-r--r--test/-ext-/bignum/test_str2big.rb37
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb17
-rw-r--r--test/-ext-/class/test_class2name.rb18
-rw-r--r--test/-ext-/debug/test_debug.rb58
-rw-r--r--test/-ext-/debug/test_profile_frames.rb104
-rw-r--r--test/-ext-/exception/test_data_error.rb14
-rw-r--r--test/-ext-/exception/test_enc_raise.rb15
-rw-r--r--test/-ext-/exception/test_ensured.rb32
-rw-r--r--test/-ext-/file/test_stat.rb14
-rw-r--r--test/-ext-/float/test_nextafter.rb57
-rw-r--r--test/-ext-/funcall/test_passing_block.rb22
-rw-r--r--test/-ext-/iter/test_iter_break.rb15
-rw-r--r--test/-ext-/iter/test_yield_block.rb21
-rw-r--r--test/-ext-/load/test_dot_dot.rb10
-rw-r--r--test/-ext-/marshal/test_usrmarshal.rb33
-rw-r--r--test/-ext-/method/test_arity.rb37
-rw-r--r--test/-ext-/num2int/test_num2int.rb267
-rw-r--r--test/-ext-/path_to_class/test_path_to_class.rb12
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb28
-rw-r--r--test/-ext-/rational/test_rat.rb31
-rw-r--r--test/-ext-/st/test_numhash.rb49
-rw-r--r--test/-ext-/st/test_update.rb50
-rw-r--r--test/-ext-/string/test_coderange.rb59
-rw-r--r--test/-ext-/string/test_cstr.rb42
-rw-r--r--test/-ext-/string/test_ellipsize.rb46
-rw-r--r--test/-ext-/string/test_enc_associate.rb12
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb15
-rw-r--r--test/-ext-/string/test_modify_expand.rb15
-rw-r--r--test/-ext-/string/test_normalize.rb106
-rw-r--r--test/-ext-/string/test_qsort.rb19
-rw-r--r--test/-ext-/string/test_set_len.rb25
-rw-r--r--test/-ext-/struct/test_member.rb16
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb286
-rw-r--r--test/-ext-/symbol/test_type.rb124
-rw-r--r--test/-ext-/test_bug-3571.rb21
-rw-r--r--test/-ext-/test_bug-3662.rb10
-rw-r--r--test/-ext-/test_bug-5832.rb21
-rw-r--r--test/-ext-/test_printf.rb190
-rw-r--r--test/-ext-/test_recursion.rb36
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb80
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb16
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb45
-rw-r--r--test/-ext-/win32/test_console_attr.rb43
-rw-r--r--test/-ext-/win32/test_dln.rb35
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb100
-rw-r--r--test/benchmark/test_benchmark.rb161
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1550
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb50
-rw-r--r--test/bigdecimal/test_bigmath.rb81
-rw-r--r--test/bigdecimal/testbase.rb27
-rw-r--r--test/cgi/test_cgi_cookie.rb110
-rw-r--r--test/cgi/test_cgi_core.rb312
-rw-r--r--test/cgi/test_cgi_header.rb181
-rw-r--r--test/cgi/test_cgi_modruby.rb146
-rw-r--r--test/cgi/test_cgi_multipart.rb381
-rw-r--r--test/cgi/test_cgi_session.rb172
-rw-r--r--test/cgi/test_cgi_tag_helper.rb353
-rw-r--r--test/cgi/test_cgi_util.rb104
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin0 -> 156414 bytes-rw-r--r--test/cgi/testdata/small.pngbin0 -> 82 bytes-rw-r--r--test/coverage/test_coverage.rb64
-rw-r--r--test/csv/base.rb8
-rw-r--r--test/csv/line_endings.gzbin0 -> 59 bytes-rwxr-xr-xtest/csv/test_csv_parsing.rb221
-rwxr-xr-xtest/csv/test_csv_writing.rb97
-rwxr-xr-xtest/csv/test_data_converters.rb263
-rwxr-xr-xtest/csv/test_encodings.rb337
-rwxr-xr-xtest/csv/test_features.rb327
-rwxr-xr-xtest/csv/test_headers.rb297
-rwxr-xr-xtest/csv/test_interface.rb368
-rwxr-xr-xtest/csv/test_row.rb355
-rwxr-xr-xtest/csv/test_table.rb434
-rw-r--r--test/csv/ts_all.rb20
-rw-r--r--test/date/test_date.rb150
-rw-r--r--test/date/test_date_arith.rb264
-rw-r--r--test/date/test_date_attr.rb103
-rw-r--r--test/date/test_date_base.rb442
-rw-r--r--test/date/test_date_compat.rb21
-rw-r--r--test/date/test_date_conv.rb137
-rw-r--r--test/date/test_date_marshal.rb41
-rw-r--r--test/date/test_date_new.rb271
-rw-r--r--test/date/test_date_parse.rb1124
-rw-r--r--test/date/test_date_strftime.rb422
-rw-r--r--test/date/test_date_strptime.rb512
-rw-r--r--test/date/test_switch_hitter.rb664
-rw-r--r--test/dbm/test_dbm.rb631
-rwxr-xr-xtest/digest/test_digest.rb201
-rw-r--r--test/digest/test_digest_extend.rb158
-rw-r--r--test/dl/test_base.rb146
-rw-r--r--test/dl/test_c_struct_entry.rb55
-rw-r--r--test/dl/test_c_union_entity.rb31
-rw-r--r--test/dl/test_callback.rb72
-rw-r--r--test/dl/test_cfunc.rb80
-rw-r--r--test/dl/test_cparser.rb33
-rw-r--r--test/dl/test_cptr.rb226
-rw-r--r--test/dl/test_dl2.rb140
-rw-r--r--test/dl/test_func.rb190
-rw-r--r--test/dl/test_handle.rb191
-rw-r--r--test/dl/test_import.rb165
-rw-r--r--test/dl/test_win32.rb54
-rw-r--r--test/drb/drbtest.rb369
-rw-r--r--test/drb/ignore_test_drb.rb13
-rw-r--r--test/drb/test_acl.rb197
-rw-r--r--test/drb/test_drb.rb357
-rw-r--r--test/drb/test_drbssl.rb76
-rw-r--r--test/drb/test_drbunix.rb59
-rw-r--r--test/drb/ut_array.rb16
-rw-r--r--test/drb/ut_array_drbssl.rb40
-rw-r--r--test/drb/ut_array_drbunix.rb16
-rw-r--r--test/drb/ut_drb.rb167
-rw-r--r--test/drb/ut_drb_drbssl.rb41
-rw-r--r--test/drb/ut_drb_drbunix.rb17
-rw-r--r--test/drb/ut_eq.rb36
-rw-r--r--test/drb/ut_eval.rb36
-rw-r--r--test/drb/ut_large.rb43
-rw-r--r--test/drb/ut_port.rb15
-rw-r--r--test/drb/ut_safe1.rb16
-rw-r--r--test/drb/ut_timerholder.rb53
-rw-r--r--test/dtrace/dummy.rb1
-rw-r--r--test/dtrace/helper.rb51
-rw-r--r--test/dtrace/test_array_create.rb35
-rw-r--r--test/dtrace/test_cmethod.rb49
-rw-r--r--test/dtrace/test_function_entry.rb87
-rw-r--r--test/dtrace/test_gc.rb26
-rw-r--r--test/dtrace/test_hash_create.rb52
-rw-r--r--test/dtrace/test_load.rb52
-rw-r--r--test/dtrace/test_method_cache.rb28
-rw-r--r--test/dtrace/test_object_create_start.rb35
-rw-r--r--test/dtrace/test_raise.rb29
-rw-r--r--test/dtrace/test_require.rb34
-rw-r--r--test/dtrace/test_singleton_function.rb55
-rw-r--r--test/dtrace/test_string.rb27
-rw-r--r--test/erb/hello.erb4
-rw-r--r--test/erb/test_erb.rb485
-rw-r--r--test/erb/test_erb_m17n.rb123
-rw-r--r--test/etc/test_etc.rb162
-rw-r--r--test/fiddle/helper.rb125
-rw-r--r--test/fiddle/test_c_struct_entry.rb76
-rw-r--r--test/fiddle/test_c_union_entity.rb34
-rw-r--r--test/fiddle/test_closure.rb84
-rw-r--r--test/fiddle/test_cparser.rb35
-rw-r--r--test/fiddle/test_fiddle.rb16
-rw-r--r--test/fiddle/test_func.rb92
-rw-r--r--test/fiddle/test_function.rb83
-rw-r--r--test/fiddle/test_handle.rb196
-rw-r--r--test/fiddle/test_import.rb150
-rw-r--r--test/fiddle/test_pointer.rb238
-rw-r--r--test/fileutils/clobber.rb91
-rw-r--r--test/fileutils/fileasserts.rb111
-rw-r--r--test/fileutils/test_dryrun.rb17
-rw-r--r--test/fileutils/test_fileutils.rb1568
-rw-r--r--test/fileutils/test_nowrite.rb17
-rw-r--r--test/fileutils/test_verbose.rb17
-rw-r--r--test/fileutils/visibility_tests.rb41
-rw-r--r--test/gdbm/test_gdbm.rb716
-rw-r--r--test/inlinetest.rb55
-rw-r--r--test/io/console/test_io_console.rb306
-rw-r--r--test/io/nonblock/test_flush.rb52
-rw-r--r--test/io/wait/test_io_wait.rb112
-rw-r--r--test/irb/test_completion.rb22
-rw-r--r--test/irb/test_option.rb12
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb14
-rw-r--r--test/json/fixtures/fail1.json1
-rw-r--r--test/json/fixtures/fail10.json1
-rw-r--r--test/json/fixtures/fail11.json1
-rw-r--r--test/json/fixtures/fail12.json1
-rw-r--r--test/json/fixtures/fail13.json1
-rw-r--r--test/json/fixtures/fail14.json1
-rw-r--r--test/json/fixtures/fail18.json1
-rw-r--r--test/json/fixtures/fail19.json1
-rw-r--r--test/json/fixtures/fail2.json1
-rw-r--r--test/json/fixtures/fail20.json1
-rw-r--r--test/json/fixtures/fail21.json1
-rw-r--r--test/json/fixtures/fail22.json1
-rw-r--r--test/json/fixtures/fail23.json1
-rw-r--r--test/json/fixtures/fail24.json1
-rw-r--r--test/json/fixtures/fail25.json1
-rw-r--r--test/json/fixtures/fail27.json2
-rw-r--r--test/json/fixtures/fail28.json2
-rw-r--r--test/json/fixtures/fail3.json1
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail5.json1
-rw-r--r--test/json/fixtures/fail6.json1
-rw-r--r--test/json/fixtures/fail7.json1
-rw-r--r--test/json/fixtures/fail8.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/pass1.json56
-rw-r--r--test/json/fixtures/pass15.json1
-rw-r--r--test/json/fixtures/pass16.json1
-rw-r--r--test/json/fixtures/pass17.json1
-rw-r--r--test/json/fixtures/pass2.json1
-rw-r--r--test/json/fixtures/pass26.json1
-rw-r--r--test/json/fixtures/pass3.json6
-rw-r--r--test/json/setup_variant.rb11
-rwxr-xr-xtest/json/test_json.rb547
-rwxr-xr-xtest/json/test_json_addition.rb196
-rw-r--r--test/json/test_json_encoding.rb65
-rwxr-xr-xtest/json/test_json_fixtures.rb35
-rwxr-xr-xtest/json/test_json_generate.rb323
-rw-r--r--test/json/test_json_generic_object.rb75
-rw-r--r--test/json/test_json_string_matching.rb39
-rwxr-xr-xtest/json/test_json_unicode.rb72
-rw-r--r--test/lib/leakchecker.rb163
-rw-r--r--test/lib/minitest/README.txt457
-rw-r--r--test/lib/minitest/autorun.rb13
-rw-r--r--test/lib/minitest/benchmark.rb417
-rw-r--r--test/lib/minitest/mock.rb195
-rw-r--r--test/lib/minitest/unit.rb1417
-rw-r--r--test/lib/profile_test_all.rb90
-rw-r--r--test/lib/test/unit.rb894
-rw-r--r--test/lib/test/unit/assertions.rb465
-rw-r--r--test/lib/test/unit/parallel.rb190
-rw-r--r--test/lib/test/unit/testcase.rb34
-rw-r--r--test/lib/tracepointchecker.rb118
-rw-r--r--test/lib/with_different_ofs.rb17
-rw-r--r--test/logger/test_logdevice.rb420
-rw-r--r--test/logger/test_logger.rb244
-rw-r--r--test/logger/test_severity.rb15
-rw-r--r--test/matrix/test_matrix.rb488
-rw-r--r--test/matrix/test_vector.rb154
-rw-r--r--test/minitest/metametameta.rb69
-rw-r--r--test/minitest/test_minitest_benchmark.rb130
-rw-r--r--test/minitest/test_minitest_mock.rb403
-rw-r--r--test/minitest/test_minitest_unit.rb1803
-rw-r--r--test/misc/test_ruby_mode.rb182
-rw-r--r--test/mkmf/base.rb129
-rw-r--r--test/mkmf/test_config.rb17
-rw-r--r--test/mkmf/test_constant.rb37
-rw-r--r--test/mkmf/test_convertible.rb34
-rw-r--r--test/mkmf/test_find_executable.rb50
-rw-r--r--test/mkmf/test_flags.rb35
-rw-r--r--test/mkmf/test_framework.rb48
-rw-r--r--test/mkmf/test_have_func.rb14
-rw-r--r--test/mkmf/test_have_library.rb55
-rw-r--r--test/mkmf/test_have_macro.rb35
-rw-r--r--test/mkmf/test_libs.rb86
-rw-r--r--test/mkmf/test_signedness.rb29
-rw-r--r--test/mkmf/test_sizeof.rb47
-rw-r--r--test/monitor/test_monitor.rb197
-rw-r--r--test/net/ftp/test_buffered_socket.rb40
-rw-r--r--test/net/ftp/test_ftp.rb797
-rw-r--r--test/net/http/test_buffered_io.rb17
-rw-r--r--test/net/http/test_http.rb922
-rw-r--r--test/net/http/test_http_request.rb79
-rw-r--r--test/net/http/test_httpheader.rb334
-rw-r--r--test/net/http/test_httpresponse.rb254
-rw-r--r--test/net/http/test_httpresponses.rb24
-rw-r--r--test/net/http/test_https.rb154
-rw-r--r--test/net/http/test_https_proxy.rb43
-rw-r--r--test/net/http/utils.rb114
-rw-r--r--test/net/imap/Makefile15
-rw-r--r--test/net/imap/cacert.pem66
-rw-r--r--test/net/imap/server.crt48
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb547
-rw-r--r--test/net/imap/test_imap_response_parser.rb271
-rw-r--r--test/net/pop/test_pop.rb132
-rw-r--r--test/net/protocol/test_protocol.rb28
-rw-r--r--test/net/smtp/test_response.rb99
-rw-r--r--test/net/smtp/test_smtp.rb54
-rw-r--r--test/net/smtp/test_ssl_socket.rb91
-rw-r--r--test/nkf/test_kconv.rb81
-rw-r--r--test/nkf/test_nkf.rb22
-rw-r--r--test/objspace/test_objspace.rb279
-rw-r--r--test/open-uri/test_open-uri.rb737
-rw-r--r--test/open-uri/test_ssl.rb323
-rw-r--r--test/openssl/ssl_server.rb81
-rw-r--r--test/openssl/test_asn1.rb609
-rw-r--r--test/openssl/test_bn.rb52
-rw-r--r--test/openssl/test_buffering.rb87
-rw-r--r--test/openssl/test_cipher.rb255
-rw-r--r--test/openssl/test_config.rb297
-rw-r--r--test/openssl/test_digest.rb126
-rw-r--r--test/openssl/test_engine.rb75
-rw-r--r--test/openssl/test_fips.rb14
-rw-r--r--test/openssl/test_hmac.rb41
-rw-r--r--test/openssl/test_ns_spki.rb51
-rw-r--r--test/openssl/test_ocsp.rb47
-rw-r--r--test/openssl/test_pair.rb372
-rw-r--r--test/openssl/test_partial_record_read.rb36
-rw-r--r--test/openssl/test_pkcs12.rb209
-rw-r--r--test/openssl/test_pkcs5.rb97
-rw-r--r--test/openssl/test_pkcs7.rb297
-rw-r--r--test/openssl/test_pkey_dh.rb82
-rw-r--r--test/openssl/test_pkey_dsa.rb240
-rw-r--r--test/openssl/test_pkey_ec.rb211
-rw-r--r--test/openssl/test_pkey_rsa.rb313
-rw-r--r--test/openssl/test_ssl.rb753
-rw-r--r--test/openssl/test_ssl_session.rb369
-rw-r--r--test/openssl/test_x509cert.rb226
-rw-r--r--test/openssl/test_x509crl.rb220
-rw-r--r--test/openssl/test_x509ext.rb69
-rw-r--r--test/openssl/test_x509name.rb367
-rw-r--r--test/openssl/test_x509req.rb158
-rw-r--r--test/openssl/test_x509store.rb232
-rw-r--r--test/openssl/utils.rb336
-rw-r--r--test/optparse/test_acceptable.rb195
-rw-r--r--test/optparse/test_autoconf.rb63
-rw-r--r--test/optparse/test_bash_completion.rb42
-rw-r--r--test/optparse/test_getopts.rb34
-rw-r--r--test/optparse/test_noarg.rb57
-rw-r--r--test/optparse/test_optarg.rb46
-rw-r--r--test/optparse/test_optparse.rb66
-rw-r--r--test/optparse/test_placearg.rb56
-rw-r--r--test/optparse/test_reqarg.rb77
-rw-r--r--test/optparse/test_summary.rb46
-rw-r--r--test/optparse/test_zsh_completion.rb22
-rw-r--r--test/ostruct/test_ostruct.rb138
-rw-r--r--test/pathname/test_pathname.rb1390
-rw-r--r--test/psych/handlers/test_recorder.rb25
-rw-r--r--test/psych/helper.rb114
-rw-r--r--test/psych/json/test_stream.rb109
-rw-r--r--test/psych/nodes/test_enumerable.rb43
-rw-r--r--test/psych/test_alias_and_anchor.rb96
-rw-r--r--test/psych/test_array.rb57
-rw-r--r--test/psych/test_boolean.rb36
-rw-r--r--test/psych/test_class.rb36
-rw-r--r--test/psych/test_coder.rb184
-rw-r--r--test/psych/test_date_time.rb38
-rw-r--r--test/psych/test_deprecated.rb214
-rw-r--r--test/psych/test_document.rb46
-rw-r--r--test/psych/test_emitter.rb94
-rw-r--r--test/psych/test_encoding.rb259
-rw-r--r--test/psych/test_exception.rb157
-rw-r--r--test/psych/test_hash.rb49
-rw-r--r--test/psych/test_json_tree.rb65
-rw-r--r--test/psych/test_merge_keys.rb180
-rw-r--r--test/psych/test_nil.rb18
-rw-r--r--test/psych/test_null.rb19
-rw-r--r--test/psych/test_numeric.rb45
-rw-r--r--test/psych/test_object.rb44
-rw-r--r--test/psych/test_object_references.rb71
-rw-r--r--test/psych/test_omap.rb75
-rw-r--r--test/psych/test_parser.rb339
-rw-r--r--test/psych/test_psych.rb168
-rw-r--r--test/psych/test_safe_load.rb97
-rw-r--r--test/psych/test_scalar.rb11
-rw-r--r--test/psych/test_scalar_scanner.rb106
-rw-r--r--test/psych/test_serialize_subclasses.rb38
-rw-r--r--test/psych/test_set.rb49
-rw-r--r--test/psych/test_stream.rb93
-rw-r--r--test/psych/test_string.rb166
-rw-r--r--test/psych/test_struct.rb49
-rw-r--r--test/psych/test_symbol.rb25
-rw-r--r--test/psych/test_tainted.rb130
-rw-r--r--test/psych/test_to_yaml_properties.rb63
-rw-r--r--test/psych/test_tree_builder.rb79
-rw-r--r--test/psych/test_yaml.rb1288
-rw-r--r--test/psych/test_yamldbm.rb193
-rw-r--r--test/psych/test_yamlstore.rb85
-rw-r--r--test/psych/visitors/test_depth_first.rb49
-rw-r--r--test/psych/visitors/test_emitter.rb144
-rw-r--r--test/psych/visitors/test_to_ruby.rb326
-rw-r--r--test/psych/visitors/test_yaml_tree.rb173
-rw-r--r--test/rake/file_creation.rb34
-rw-r--r--test/rake/helper.rb130
-rw-r--r--test/rake/support/rakefile_definitions.rb478
-rw-r--r--test/rake/support/ruby_runner.rb34
-rw-r--r--test/rake/test_private_reader.rb42
-rw-r--r--test/rake/test_rake.rb40
-rw-r--r--test/rake/test_rake_application.rb643
-rw-r--r--test/rake/test_rake_application_options.rb466
-rw-r--r--test/rake/test_rake_backtrace.rb119
-rw-r--r--test/rake/test_rake_clean.rb61
-rw-r--r--test/rake/test_rake_cpu_counter.rb50
-rw-r--r--test/rake/test_rake_definitions.rb79
-rw-r--r--test/rake/test_rake_directory_task.rb76
-rw-r--r--test/rake/test_rake_dsl.rb40
-rw-r--r--test/rake/test_rake_early_time.rb31
-rw-r--r--test/rake/test_rake_extension.rb59
-rw-r--r--test/rake/test_rake_file_creation_task.rb56
-rw-r--r--test/rake/test_rake_file_list.rb655
-rw-r--r--test/rake/test_rake_file_list_path_map.rb8
-rw-r--r--test/rake/test_rake_file_task.rb201
-rw-r--r--test/rake/test_rake_file_utils.rb309
-rw-r--r--test/rake/test_rake_ftp_file.rb74
-rw-r--r--test/rake/test_rake_functional.rb482
-rw-r--r--test/rake/test_rake_invocation_chain.rb64
-rw-r--r--test/rake/test_rake_linked_list.rb84
-rw-r--r--test/rake/test_rake_makefile_loader.rb46
-rw-r--r--test/rake/test_rake_multi_task.rb64
-rw-r--r--test/rake/test_rake_name_space.rb57
-rw-r--r--test/rake/test_rake_package_task.rb79
-rw-r--r--test/rake/test_rake_path_map.rb168
-rw-r--r--test/rake/test_rake_path_map_explode.rb34
-rw-r--r--test/rake/test_rake_path_map_partial.rb18
-rw-r--r--test/rake/test_rake_pathname_extensions.rb15
-rw-r--r--test/rake/test_rake_pseudo_status.rb21
-rw-r--r--test/rake/test_rake_rake_test_loader.rb20
-rw-r--r--test/rake/test_rake_reduce_compat.rb26
-rw-r--r--test/rake/test_rake_require.rb40
-rw-r--r--test/rake/test_rake_rules.rb388
-rw-r--r--test/rake/test_rake_scope.rb44
-rw-r--r--test/rake/test_rake_task.rb393
-rw-r--r--test/rake/test_rake_task_argument_parsing.rb119
-rw-r--r--test/rake/test_rake_task_arguments.rb127
-rw-r--r--test/rake/test_rake_task_lib.rb9
-rw-r--r--test/rake/test_rake_task_manager.rb178
-rw-r--r--test/rake/test_rake_task_manager_argument_resolution.rb19
-rw-r--r--test/rake/test_rake_task_with_arguments.rb172
-rw-r--r--test/rake/test_rake_test_task.rb141
-rw-r--r--test/rake/test_rake_thread_pool.rb146
-rw-r--r--test/rake/test_rake_top_level_functions.rb71
-rw-r--r--test/rake/test_rake_win32.rb72
-rw-r--r--test/rake/test_thread_history_display.rb101
-rw-r--r--test/rake/test_trace_output.rb52
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Amps and angle encoding.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Auto links.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Backslash escapes.text120
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Blockquotes with code blocks.text11
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Blocks.text14
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Spans.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Hard-wrapped paragraphs with list-like lines.text8
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Horizontal rules.text67
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Advanced).text15
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Simple).text69
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML comments.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, inline style.text12
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, reference style.text71
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, shortcut references.text20
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Literal quotes in titles.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text306
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text888
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Nested blockquotes.text5
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Ordered and unordered lists.text131
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Strong and em together.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tabs.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tidyness.text5
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin0 -> 1024 bytes-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/test.ja.largedoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_rdoc_alias.rb13
-rw-r--r--test/rdoc/test_rdoc_any_method.rb460
-rw-r--r--test/rdoc/test_rdoc_attr.rb190
-rw-r--r--test/rdoc/test_rdoc_class_module.rb1492
-rw-r--r--test/rdoc/test_rdoc_code_object.rb450
-rw-r--r--test/rdoc/test_rdoc_comment.rb504
-rw-r--r--test/rdoc/test_rdoc_constant.rb181
-rw-r--r--test/rdoc/test_rdoc_context.rb901
-rw-r--r--test/rdoc/test_rdoc_context_section.rb130
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb192
-rw-r--r--test/rdoc/test_rdoc_encoding.rb227
-rw-r--r--test/rdoc/test_rdoc_extend.rb94
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb229
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb264
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb59
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb91
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb51
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb139
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb78
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb73
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb123
-rw-r--r--test/rdoc/test_rdoc_include.rb108
-rw-r--r--test/rdoc/test_rdoc_markdown.rb980
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb1884
-rw-r--r--test/rdoc/test_rdoc_markup.rb95
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb361
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb39
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb207
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb175
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb31
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb29
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb19
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb53
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1680
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb473
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb22
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb369
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb366
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb643
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb225
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb710
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb112
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb389
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb377
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb126
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb246
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb29
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb193
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb47
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb42
-rw-r--r--test/rdoc/test_rdoc_options.rb766
-rw-r--r--test/rdoc/test_rdoc_parser.rb327
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1896
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb315
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb61
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb55
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb3322
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb115
-rw-r--r--test/rdoc/test_rdoc_rd.rb30
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb535
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb63
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb177
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb455
-rw-r--r--test/rdoc/test_rdoc_require.rb25
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1436
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb155
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb421
-rw-r--r--test/rdoc/test_rdoc_ruby_token.rb19
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb251
-rw-r--r--test/rdoc/test_rdoc_servlet.rb535
-rw-r--r--test/rdoc/test_rdoc_single_class.rb12
-rw-r--r--test/rdoc/test_rdoc_stats.rb667
-rw-r--r--test/rdoc/test_rdoc_store.rb993
-rw-r--r--test/rdoc/test_rdoc_task.rb170
-rw-r--r--test/rdoc/test_rdoc_text.rb554
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb42
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb520
-rw-r--r--test/rdoc/test_rdoc_top_level.rb287
-rw-r--r--test/rdoc/xref_data.rb76
-rw-r--r--test/rdoc/xref_test_case.rb67
-rw-r--r--test/readline/test_readline.rb519
-rw-r--r--test/readline/test_readline_history.rb292
-rw-r--r--test/resolv/test_addr.rb29
-rw-r--r--test/resolv/test_dns.rb164
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin0 -> 50154 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin0 -> 161690 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_110_utf16.xmlbin0 -> 207464 bytes-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb50
-rw-r--r--test/rexml/parse/test_document_type_declaration.rb49
-rw-r--r--test/rexml/parse/test_notation_declaration.rb99
-rw-r--r--test/rexml/parser/test_sax2.rb202
-rw-r--r--test/rexml/parser/test_tree.rb42
-rw-r--r--test/rexml/parser/test_ultra_light.rb69
-rw-r--r--test/rexml/rexml_test_utils.rb6
-rw-r--r--test/rexml/test_attributes.rb222
-rw-r--r--test/rexml/test_attributes_mixin.rb31
-rw-r--r--test/rexml/test_changing_encoding.rb44
-rw-r--r--test/rexml/test_comment.rb25
-rw-r--r--test/rexml/test_contrib.rb584
-rw-r--r--test/rexml/test_core.rb1467
-rw-r--r--test/rexml/test_doctype.rb106
-rw-r--r--test/rexml/test_document.rb321
-rw-r--r--test/rexml/test_elements.rb118
-rw-r--r--test/rexml/test_encoding.rb98
-rw-r--r--test/rexml/test_entity.rb189
-rw-r--r--test/rexml/test_functions.rb224
-rw-r--r--test/rexml/test_functions_number.rb34
-rw-r--r--test/rexml/test_jaxen.rb129
-rw-r--r--test/rexml/test_light.rb106
-rw-r--r--test/rexml/test_lightparser.rb15
-rw-r--r--test/rexml/test_listener.rb130
-rw-r--r--test/rexml/test_martin_fowler.rb39
-rw-r--r--test/rexml/test_namespace.rb40
-rw-r--r--test/rexml/test_order.rb109
-rw-r--r--test/rexml/test_preceding_sibling.rb40
-rw-r--r--test/rexml/test_pullparser.rb102
-rw-r--r--test/rexml/test_rexml_issuezilla.rb18
-rw-r--r--test/rexml/test_sax.rb286
-rw-r--r--test/rexml/test_stream.rb129
-rw-r--r--test/rexml/test_text.rb21
-rw-r--r--test/rexml/test_ticket_80.rb58
-rw-r--r--test/rexml/test_validation_rng.rb792
-rw-r--r--test/rexml/test_xml_declaration.rb35
-rw-r--r--test/rexml/xpath/test_attribute.rb29
-rw-r--r--test/rexml/xpath/test_axis_preceding_sibling.rb39
-rw-r--r--test/rexml/xpath/test_base.rb1089
-rw-r--r--test/rexml/xpath/test_node.rb42
-rw-r--r--test/rexml/xpath/test_predicate.rb82
-rw-r--r--test/rexml/xpath/test_text.rb74
-rw-r--r--test/rinda/test_rinda.rb811
-rw-r--r--test/rinda/test_tuplebag.rb172
-rw-r--r--test/ripper/dummyparser.rb216
-rw-r--r--test/ripper/test_files.rb24
-rw-r--r--test/ripper/test_filter.rb83
-rw-r--r--test/ripper/test_parser_events.rb1209
-rw-r--r--test/ripper/test_ripper.rb53
-rw-r--r--test/ripper/test_scanner_events.rb896
-rw-r--r--test/rss/dot.pngbin0 -> 111 bytes-rw-r--r--test/rss/rss-assertions.rb2090
-rw-r--r--test/rss/rss-testcase.rb478
-rw-r--r--test/rss/test_1.0.rb307
-rw-r--r--test/rss/test_2.0.rb411
-rw-r--r--test/rss/test_accessor.rb103
-rw-r--r--test/rss/test_atom.rb683
-rw-r--r--test/rss/test_content.rb104
-rw-r--r--test/rss/test_dublincore.rb269
-rw-r--r--test/rss/test_image.rb214
-rw-r--r--test/rss/test_inherit.rb40
-rw-r--r--test/rss/test_itunes.rb347
-rw-r--r--test/rss/test_maker_0.9.rb474
-rw-r--r--test/rss/test_maker_1.0.rb516
-rw-r--r--test/rss/test_maker_2.0.rb757
-rw-r--r--test/rss/test_maker_atom_entry.rb393
-rw-r--r--test/rss/test_maker_atom_feed.rb454
-rw-r--r--test/rss/test_maker_content.rb47
-rw-r--r--test/rss/test_maker_dc.rb149
-rw-r--r--test/rss/test_maker_image.rb62
-rw-r--r--test/rss/test_maker_itunes.rb469
-rw-r--r--test/rss/test_maker_slash.rb37
-rw-r--r--test/rss/test_maker_sy.rb44
-rw-r--r--test/rss/test_maker_taxo.rb81
-rw-r--r--test/rss/test_maker_trackback.rb41
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb83
-rw-r--r--test/rss/test_parser.rb64
-rw-r--r--test/rss/test_parser_1.0.rb528
-rw-r--r--test/rss/test_parser_2.0.rb122
-rw-r--r--test/rss/test_parser_atom_entry.rb163
-rw-r--r--test/rss/test_parser_atom_feed.rb276
-rw-r--r--test/rss/test_setup_maker_0.9.rb246
-rw-r--r--test/rss/test_setup_maker_1.0.rb550
-rw-r--r--test/rss/test_setup_maker_2.0.rb308
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb409
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb445
-rw-r--r--test/rss/test_setup_maker_itunes.rb143
-rw-r--r--test/rss/test_setup_maker_slash.rb38
-rw-r--r--test/rss/test_slash.rb64
-rw-r--r--test/rss/test_syndication.rb125
-rw-r--r--test/rss/test_taxonomy.rb172
-rw-r--r--test/rss/test_to_s.rb670
-rw-r--r--test/rss/test_trackback.rb135
-rw-r--r--test/rss/test_version.rb9
-rw-r--r--test/rss/test_xml-stylesheet.rb108
-rw-r--r--test/ruby/allpairs.rb102
-rw-r--r--test/ruby/beginmainend.rb80
-rw-r--r--test/ruby/enc/test_big5.rb28
-rw-r--r--test/ruby/enc/test_cp949.rb28
-rw-r--r--test/ruby/enc/test_emoji.rb442
-rw-r--r--test/ruby/enc/test_euc_jp.rb24
-rw-r--r--test/ruby/enc/test_euc_kr.rb36
-rw-r--r--test/ruby/enc/test_euc_tw.rb28
-rw-r--r--test/ruby/enc/test_gb18030.rb126
-rw-r--r--test/ruby/enc/test_gbk.rb28
-rw-r--r--test/ruby/enc/test_iso_8859.rb163
-rw-r--r--test/ruby/enc/test_koi8.rb22
-rw-r--r--test/ruby/enc/test_shift_jis.rb27
-rw-r--r--test/ruby/enc/test_utf16.rb384
-rw-r--r--test/ruby/enc/test_utf32.rb93
-rw-r--r--test/ruby/enc/test_windows_1251.rb16
-rw-r--r--test/ruby/endblockwarn_rb12
-rw-r--r--test/ruby/envutil.rb522
-rw-r--r--test/ruby/find_executable.rb21
-rw-r--r--test/ruby/lbtest.rb49
-rw-r--r--test/ruby/marshaltestlib.rb436
-rw-r--r--test/ruby/memory_status.rb134
-rw-r--r--test/ruby/sentence.rb668
-rw-r--r--test/ruby/test_alias.rb197
-rw-r--r--test/ruby/test_argf.rb860
-rw-r--r--test/ruby/test_arity.rb69
-rw-r--r--test/ruby/test_array.rb2499
-rw-r--r--test/ruby/test_assignment.rb760
-rw-r--r--test/ruby/test_autoload.rb182
-rw-r--r--test/ruby/test_backtrace.rb246
-rw-r--r--test/ruby/test_basicinstructions.rb700
-rw-r--r--test/ruby/test_beginendblock.rb191
-rw-r--r--test/ruby/test_bignum.rb711
-rw-r--r--test/ruby/test_call.rb34
-rw-r--r--test/ruby/test_case.rb125
-rw-r--r--test/ruby/test_class.rb403
-rw-r--r--test/ruby/test_clone.rb28
-rw-r--r--test/ruby/test_comparable.rb95
-rw-r--r--test/ruby/test_complex.rb1014
-rw-r--r--test/ruby/test_complex2.rb735
-rw-r--r--test/ruby/test_complexrational.rb407
-rw-r--r--test/ruby/test_condition.rb16
-rw-r--r--test/ruby/test_const.rb66
-rw-r--r--test/ruby/test_continuation.rb135
-rw-r--r--test/ruby/test_defined.rb212
-rw-r--r--test/ruby/test_dir.rb307
-rw-r--r--test/ruby/test_dir_m17n.rb331
-rw-r--r--test/ruby/test_econv.rb927
-rw-r--r--test/ruby/test_encoding.rb124
-rw-r--r--test/ruby/test_enum.rb660
-rw-r--r--test/ruby/test_enumerator.rb629
-rw-r--r--test/ruby/test_env.rb553
-rw-r--r--test/ruby/test_eval.rb487
-rw-r--r--test/ruby/test_exception.rb631
-rw-r--r--test/ruby/test_fiber.rb348
-rw-r--r--test/ruby/test_file.rb416
-rw-r--r--test/ruby/test_file_exhaustive.rb1203
-rw-r--r--test/ruby/test_fixnum.rb315
-rw-r--r--test/ruby/test_flip.rb42
-rw-r--r--test/ruby/test_float.rb676
-rw-r--r--test/ruby/test_fnmatch.rb132
-rw-r--r--test/ruby/test_gc.rb355
-rw-r--r--test/ruby/test_hash.rb1284
-rw-r--r--test/ruby/test_ifunless.rb14
-rw-r--r--test/ruby/test_integer.rb280
-rw-r--r--test/ruby/test_integer_comb.rb631
-rw-r--r--test/ruby/test_io.rb3095
-rw-r--r--test/ruby/test_io_m17n.rb2551
-rw-r--r--test/ruby/test_iseq.rb127
-rw-r--r--test/ruby/test_iterator.rb497
-rw-r--r--test/ruby/test_keyword.rb494
-rw-r--r--test/ruby/test_lambda.rb147
-rw-r--r--test/ruby/test_lazy_enumerator.rb494
-rw-r--r--test/ruby/test_literal.rb437
-rw-r--r--test/ruby/test_m17n.rb1572
-rw-r--r--test/ruby/test_m17n_comb.rb1610
-rw-r--r--test/ruby/test_marshal.rb639
-rw-r--r--test/ruby/test_math.rb292
-rw-r--r--test/ruby/test_metaclass.rb167
-rw-r--r--test/ruby/test_method.rb859
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb25
-rw-r--r--test/ruby/test_module.rb1977
-rw-r--r--test/ruby/test_not.rb12
-rw-r--r--test/ruby/test_notimp.rb84
-rw-r--r--test/ruby/test_numeric.rb363
-rw-r--r--test/ruby/test_object.rb827
-rw-r--r--test/ruby/test_objectspace.rb106
-rw-r--r--test/ruby/test_optimization.rb208
-rw-r--r--test/ruby/test_pack.rb712
-rw-r--r--test/ruby/test_parse.rb874
-rw-r--r--test/ruby/test_path.rb259
-rw-r--r--test/ruby/test_pipe.rb29
-rw-r--r--test/ruby/test_primitive.rb423
-rw-r--r--test/ruby/test_proc.rb1314
-rw-r--r--test/ruby/test_process.rb1976
-rw-r--r--test/ruby/test_rand.rb528
-rw-r--r--test/ruby/test_range.rb576
-rw-r--r--test/ruby/test_rational.rb927
-rw-r--r--test/ruby/test_rational2.rb1386
-rw-r--r--test/ruby/test_readpartial.rb72
-rw-r--r--test/ruby/test_refinement.rb1174
-rw-r--r--test/ruby/test_regexp.rb1090
-rw-r--r--test/ruby/test_require.rb668
-rw-r--r--test/ruby/test_rubyoptions.rb692
-rw-r--r--test/ruby/test_rubyvm.rb17
-rw-r--r--test/ruby/test_settracefunc.rb1298
-rw-r--r--test/ruby/test_signal.rb292
-rw-r--r--test/ruby/test_sleep.rb16
-rw-r--r--test/ruby/test_sprintf.rb411
-rw-r--r--test/ruby/test_sprintf_comb.rb553
-rw-r--r--test/ruby/test_string.rb2281
-rw-r--r--test/ruby/test_stringchar.rb181
-rw-r--r--test/ruby/test_struct.rb333
-rw-r--r--test/ruby/test_super.rb496
-rw-r--r--test/ruby/test_symbol.rb225
-rw-r--r--test/ruby/test_syntax.rb483
-rw-r--r--test/ruby/test_system.rb163
-rw-r--r--test/ruby/test_thread.rb1024
-rw-r--r--test/ruby/test_threadgroup.rb58
-rw-r--r--test/ruby/test_time.rb1034
-rw-r--r--test/ruby/test_time_tz.rb361
-rw-r--r--test/ruby/test_trace.rb61
-rw-r--r--test/ruby/test_transcode.rb2094
-rw-r--r--test/ruby/test_undef.rb37
-rw-r--r--test/ruby/test_unicode_escape.rb271
-rw-r--r--test/ruby/test_variable.rb109
-rw-r--r--test/ruby/test_weakmap.rb134
-rw-r--r--test/ruby/test_whileuntil.rb83
-rw-r--r--test/ruby/test_yield.rb393
-rw-r--r--test/ruby/ut_eof.rb128
-rw-r--r--test/rubygems/alternate_cert.pem18
-rw-r--r--test/rubygems/alternate_cert_32.pem18
-rw-r--r--test/rubygems/alternate_key.pem27
-rw-r--r--test/rubygems/bad_rake.rb1
-rw-r--r--test/rubygems/bogussources.rb8
-rw-r--r--test/rubygems/ca_cert.pem68
-rw-r--r--test/rubygems/child_cert.pem18
-rw-r--r--test/rubygems/child_cert_32.pem18
-rw-r--r--test/rubygems/child_key.pem27
-rw-r--r--test/rubygems/client.pem49
-rw-r--r--test/rubygems/data/gem-private_key.pem27
-rw-r--r--test/rubygems/data/gem-public_cert.pem20
-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin0 -> 554 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem30
-rw-r--r--test/rubygems/expired_cert.pem18
-rw-r--r--test/rubygems/fake_certlib/openssl.rb7
-rw-r--r--test/rubygems/fix_openssl_warnings.rb12
-rw-r--r--test/rubygems/foo/discover.rb0
-rw-r--r--test/rubygems/future_cert.pem18
-rw-r--r--test/rubygems/future_cert_32.pem18
-rw-r--r--test/rubygems/good_rake.rb1
-rw-r--r--test/rubygems/grandchild_cert.pem18
-rw-r--r--test/rubygems/grandchild_cert_32.pem18
-rw-r--r--test/rubygems/grandchild_key.pem27
-rw-r--r--test/rubygems/invalid_client.pem49
-rw-r--r--test/rubygems/invalid_issuer_cert.pem18
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem18
-rw-r--r--test/rubygems/invalid_key.pem27
-rw-r--r--test/rubygems/invalid_signer_cert.pem18
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem18
-rw-r--r--test/rubygems/invalidchild_cert.pem18
-rw-r--r--test/rubygems/invalidchild_cert_32.pem18
-rw-r--r--test/rubygems/invalidchild_key.pem27
-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb2
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb2
-rw-r--r--test/rubygems/private_key.pem27
-rw-r--r--test/rubygems/public_cert.pem18
-rw-r--r--test/rubygems/public_cert_32.pem18
-rw-r--r--test/rubygems/public_key.pem9
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb5
-rw-r--r--test/rubygems/rubygems_plugin.rb21
-rw-r--r--test/rubygems/sff/discover.rb0
-rw-r--r--test/rubygems/simple_gem.rb66
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec9
-rw-r--r--test/rubygems/specifications/foo-0.0.1.gemspecbin0 -> 269 bytes-rw-r--r--test/rubygems/ssl_cert.pem19
-rw-r--r--test/rubygems/ssl_key.pem15
-rw-r--r--test/rubygems/test_bundled_ca.rb60
-rw-r--r--test/rubygems/test_config.rb14
-rw-r--r--test/rubygems/test_deprecate.rb76
-rw-r--r--test/rubygems/test_gem.rb1593
-rw-r--r--test/rubygems/test_gem_available_set.rb128
-rw-r--r--test/rubygems/test_gem_command.rb243
-rw-r--r--test/rubygems/test_gem_command_manager.rb263
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb110
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb670
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb68
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb167
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb239
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb221
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb153
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb126
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb50
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb74
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb997
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb68
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb32
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb46
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb204
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb370
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb262
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb668
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb17
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb59
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb138
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb248
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb250
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb40
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb281
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb210
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb530
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb85
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb97
-rw-r--r--test/rubygems/test_gem_config_file.rb467
-rw-r--r--test/rubygems/test_gem_dependency.rb357
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb1208
-rw-r--r--test/rubygems/test_gem_dependency_list.rb259
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb28
-rw-r--r--test/rubygems/test_gem_doctor.rb168
-rw-r--r--test/rubygems/test_gem_ext_builder.rb334
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb84
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb82
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb206
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb64
-rw-r--r--test/rubygems/test_gem_gem_runner.rb68
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb234
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb61
-rw-r--r--test/rubygems/test_gem_indexer.rb366
-rw-r--r--test/rubygems/test_gem_install_update_options.rb184
-rw-r--r--test/rubygems/test_gem_installer.rb1533
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb133
-rw-r--r--test/rubygems/test_gem_name_tuple.rb44
-rw-r--r--test/rubygems/test_gem_package.rb824
-rw-r--r--test/rubygems/test_gem_package_old.rb89
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb146
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb89
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb134
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb250
-rw-r--r--test/rubygems/test_gem_package_task.rb80
-rw-r--r--test/rubygems/test_gem_path_support.rb84
-rw-r--r--test/rubygems/test_gem_platform.rb296
-rw-r--r--test/rubygems/test_gem_rdoc.rb269
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb919
-rw-r--r--test/rubygems/test_gem_request.rb362
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb120
-rw-r--r--test/rubygems/test_gem_request_set.rb597
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb814
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb1238
-rw-r--r--test/rubygems/test_gem_requirement.rb376
-rw-r--r--test/rubygems/test_gem_resolver.rb733
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb73
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb208
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb144
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb137
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb45
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb87
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb84
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb189
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb112
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb89
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb89
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb49
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb247
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb45
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb63
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb98
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb20
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb64
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb83
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb83
-rw-r--r--test/rubygems/test_gem_security.rb306
-rw-r--r--test/rubygems/test_gem_security_policy.rb540
-rw-r--r--test/rubygems/test_gem_security_signer.rb208
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb98
-rw-r--r--test/rubygems/test_gem_server.rb404
-rw-r--r--test/rubygems/test_gem_silent_ui.rb116
-rw-r--r--test/rubygems/test_gem_source.rb227
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb19
-rw-r--r--test/rubygems/test_gem_source_git.rb297
-rw-r--r--test/rubygems/test_gem_source_installed.rb36
-rw-r--r--test/rubygems/test_gem_source_list.rb111
-rw-r--r--test/rubygems/test_gem_source_local.rb106
-rw-r--r--test/rubygems/test_gem_source_lock.rb114
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb75
-rw-r--r--test/rubygems/test_gem_source_vendor.rb31
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb310
-rw-r--r--test/rubygems/test_gem_specification.rb3089
-rw-r--r--test/rubygems/test_gem_stream_ui.rb238
-rw-r--r--test/rubygems/test_gem_stub_specification.rb191
-rw-r--r--test/rubygems/test_gem_text.rb58
-rw-r--r--test/rubygems/test_gem_uninstaller.rb483
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb32
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb28
-rw-r--r--test/rubygems/test_gem_util.rb31
-rw-r--r--test/rubygems/test_gem_validator.rb45
-rw-r--r--test/rubygems/test_gem_version.rb213
-rw-r--r--test/rubygems/test_gem_version_option.rb151
-rw-r--r--test/rubygems/test_kernel.rb61
-rw-r--r--test/rubygems/test_require.rb275
-rw-r--r--test/rubygems/wrong_key_cert.pem18
-rw-r--r--test/rubygems/wrong_key_cert_32.pem18
-rw-r--r--test/runner.rb46
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb303
-rw-r--r--test/scanf/test_scanfblocks.rb81
-rw-r--r--test/scanf/test_scanfio.rb20
-rw-r--r--test/sdbm/test_sdbm.rb542
-rw-r--r--test/shell/test_command_processor.rb69
-rw-r--r--test/socket/test_addrinfo.rb640
-rw-r--r--test/socket/test_ancdata.rb66
-rw-r--r--test/socket/test_basicsocket.rb88
-rw-r--r--test/socket/test_nonblock.rb297
-rw-r--r--test/socket/test_socket.rb654
-rw-r--r--test/socket/test_sockopt.rb65
-rw-r--r--test/socket/test_tcp.rb79
-rw-r--r--test/socket/test_udp.rb72
-rw-r--r--test/socket/test_unix.rb666
-rw-r--r--test/stringio/test_stringio.rb577
-rw-r--r--test/strscan/test_stringscanner.rb720
-rw-r--r--test/syslog/test_syslog_logger.rb572
-rw-r--r--test/test_abbrev.rb54
-rw-r--r--test/test_cmath.rb16
-rw-r--r--test/test_delegate.rb240
-rw-r--r--test/test_find.rb301
-rw-r--r--test/test_ipaddr.rb271
-rw-r--r--test/test_mathn.rb120
-rw-r--r--test/test_mutex_m.rb26
-rw-r--r--test/test_open3.rb262
-rw-r--r--test/test_pp.rb187
-rw-r--r--test/test_prettyprint.rb519
-rw-r--r--test/test_prime.rb174
-rw-r--r--test/test_pstore.rb145
-rw-r--r--test/test_pty.rb242
-rw-r--r--test/test_rbconfig.rb53
-rw-r--r--test/test_securerandom.rb185
-rw-r--r--test/test_set.rb697
-rw-r--r--test/test_shellwords.rb61
-rw-r--r--test/test_singleton.rb103
-rw-r--r--test/test_syslog.rb181
-rw-r--r--test/test_tempfile.rb343
-rw-r--r--test/test_time.rb481
-rw-r--r--test/test_timeout.rb83
-rw-r--r--test/test_tmpdir.rb33
-rw-r--r--test/test_tracer.rb61
-rw-r--r--test/test_tsort.rb100
-rw-r--r--test/test_weakref.rb64
-rw-r--r--test/testunit/test4test_hideskip.rb9
-rw-r--r--test/testunit/test4test_redefinition.rb13
-rw-r--r--test/testunit/test4test_sorting.rb17
-rw-r--r--test/testunit/test_assertion.rb8
-rw-r--r--test/testunit/test_hideskip.rb16
-rw-r--r--test/testunit/test_parallel.rb191
-rw-r--r--test/testunit/test_rake_integration.rb36
-rw-r--r--test/testunit/test_redefinition.rb15
-rw-r--r--test/testunit/test_sorting.rb17
-rw-r--r--test/testunit/tests_for_parallel/ptest_first.rb7
-rw-r--r--test/testunit/tests_for_parallel/ptest_forth.rb29
-rw-r--r--test/testunit/tests_for_parallel/ptest_second.rb11
-rw-r--r--test/testunit/tests_for_parallel/ptest_third.rb10
-rw-r--r--test/testunit/tests_for_parallel/runner.rb13
-rw-r--r--test/thread/test_cv.rb222
-rw-r--r--test/thread/test_queue.rb281
-rw-r--r--test/thread/test_sync.rb63
-rw-r--r--test/uri/test_common.rb175
-rw-r--r--test/uri/test_ftp.rb66
-rw-r--r--test/uri/test_generic.rb829
-rw-r--r--test/uri/test_http.rb64
-rw-r--r--test/uri/test_ldap.rb100
-rw-r--r--test/uri/test_mailto.rb136
-rw-r--r--test/uri/test_parser.rb41
-rw-r--r--test/webrick/.htaccess1
-rw-r--r--test/webrick/test_cgi.rb140
-rw-r--r--test/webrick/test_cookie.rb131
-rw-r--r--test/webrick/test_filehandler.rb290
-rw-r--r--test/webrick/test_htmlutils.rb20
-rw-r--r--test/webrick/test_httpauth.rb169
-rw-r--r--test/webrick/test_httpproxy.rb284
-rw-r--r--test/webrick/test_httprequest.rb411
-rw-r--r--test/webrick/test_httpresponse.rb143
-rw-r--r--test/webrick/test_httpserver.rb392
-rw-r--r--test/webrick/test_httputils.rb100
-rw-r--r--test/webrick/test_httpversion.rb40
-rw-r--r--test/webrick/test_server.rb92
-rw-r--r--test/webrick/test_utils.rb64
-rw-r--r--test/webrick/utils.rb63
-rw-r--r--test/webrick/webrick.cgi36
-rw-r--r--test/webrick/webrick_long_filename.cgi36
-rw-r--r--test/win32ole/err_in_callback.rb9
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb55
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb65
-rw-r--r--test/win32ole/test_nil2vtempty.rb36
-rw-r--r--test/win32ole/test_ole_methods.rb36
-rw-r--r--test/win32ole/test_propertyputref.rb30
-rw-r--r--test/win32ole/test_thread.rb33
-rw-r--r--test/win32ole/test_win32ole.rb564
-rw-r--r--test/win32ole/test_win32ole_event.rb347
-rw-r--r--test/win32ole/test_win32ole_method.rb146
-rw-r--r--test/win32ole/test_win32ole_param.rb106
-rw-r--r--test/win32ole/test_win32ole_record.rb313
-rw-r--r--test/win32ole/test_win32ole_type.rb249
-rw-r--r--test/win32ole/test_win32ole_typelib.rb116
-rw-r--r--test/win32ole/test_win32ole_variable.rb61
-rw-r--r--test/win32ole/test_win32ole_variant.rb712
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb35
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb68
-rw-r--r--test/win32ole/test_word.rb71
-rw-r--r--test/xmlrpc/data/blog.xml18
-rw-r--r--test/xmlrpc/data/bug_bool.expected3
-rw-r--r--test/xmlrpc/data/bug_bool.xml8
-rw-r--r--test/xmlrpc/data/bug_cdata.expected3
-rw-r--r--test/xmlrpc/data/bug_cdata.xml8
-rw-r--r--test/xmlrpc/data/bug_covert.expected10
-rw-r--r--test/xmlrpc/data/bug_covert.xml6
-rw-r--r--test/xmlrpc/data/datetime_iso8601.xml8
-rw-r--r--test/xmlrpc/data/fault.xml16
-rw-r--r--test/xmlrpc/data/value.expected7
-rw-r--r--test/xmlrpc/data/value.xml22
-rw-r--r--test/xmlrpc/data/xml1.expected243
-rw-r--r--test/xmlrpc/data/xml1.xml1
-rw-r--r--test/xmlrpc/htpasswd2
-rw-r--r--test/xmlrpc/test_client.rb317
-rw-r--r--test/xmlrpc/test_cookie.rb98
-rw-r--r--test/xmlrpc/test_datetime.rb161
-rw-r--r--test/xmlrpc/test_features.rb50
-rw-r--r--test/xmlrpc/test_marshal.rb110
-rw-r--r--test/xmlrpc/test_parser.rb93
-rw-r--r--test/xmlrpc/test_webrick_server.rb137
-rw-r--r--test/xmlrpc/webrick_testing.rb48
-rw-r--r--test/zlib/test_zlib.rb1094
-rw-r--r--thread.c5218
-rw-r--r--thread_pthread.c1640
-rw-r--r--thread_pthread.h54
-rw-r--r--thread_win32.c797
-rw-r--r--thread_win32.h36
-rw-r--r--time.c5139
-rw-r--r--timev.h42
-rw-r--r--tool/asm_parse.rb51
-rwxr-xr-xtool/bisect.sh42
-rwxr-xr-xtool/build-transcode16
-rwxr-xr-xtool/change_maker.rb34
-rw-r--r--tool/compile_prelude.rb199
-rw-r--r--tool/downloader.rb11
-rw-r--r--tool/enc-emoji-citrus-gen.rb131
-rw-r--r--tool/enc-emoji4unicode.rb133
-rwxr-xr-xtool/enc-unicode.rb371
-rw-r--r--tool/eval.rb159
-rwxr-xr-xtool/expand-config.rb7
-rw-r--r--tool/fake.rb30
-rwxr-xr-xtool/file2lastrev.rb68
-rwxr-xr-xtool/gen_dummy_probes.rb28
-rwxr-xr-xtool/gen_ruby_tapset.rb105
-rw-r--r--tool/generic_erb.rb42
-rwxr-xr-xtool/get-config_files13
-rwxr-xr-xtool/id2token.rb24
-rwxr-xr-xtool/ifchange61
-rwxr-xr-xtool/insns2vm.rb15
-rw-r--r--tool/install-sh17
-rwxr-xr-xtool/instruction.rb1343
-rw-r--r--tool/jisx0208.rb84
-rwxr-xr-xtool/make-snapshot360
-rwxr-xr-xtool/mdoc2man.rb465
-rwxr-xr-xtool/merger.rb259
-rwxr-xr-xtool/mkconfig.rb290
-rwxr-xr-xtool/mkrunnable.rb122
-rwxr-xr-xtool/node_name.rb6
-rw-r--r--tool/parse.rb13
-rw-r--r--tool/probes_to_wiki.rb16
-rwxr-xr-xtool/rbinstall.rb753
-rwxr-xr-xtool/rbuninstall.rb67
-rwxr-xr-xtool/redmine-backporter.rb411
-rwxr-xr-xtool/release.sh38
-rwxr-xr-xtool/rmdirs11
-rwxr-xr-xtool/rubytest.rb30
-rwxr-xr-xtool/runruby.rb99
-rwxr-xr-xtool/strip-rdoc.rb23
-rw-r--r--tool/test/test_jisx0208.rb40
-rw-r--r--tool/transcode-tblgen.rb1074
-rwxr-xr-xtool/update-deps157
-rw-r--r--tool/vcs.rb118
-rw-r--r--tool/vpath.rb82
-rw-r--r--tool/vtlh.rb15
-rwxr-xr-xtool/ytab.sed37
-rw-r--r--top.sed58
-rw-r--r--transcode.c4557
-rw-r--r--transcode_data.h123
-rw-r--r--util.c4439
-rw-r--r--util.h38
-rw-r--r--variable.c2690
-rw-r--r--version.c87
-rw-r--r--version.h55
-rw-r--r--vm.c3044
-rw-r--r--vm_backtrace.c1367
-rw-r--r--vm_core.h1120
-rw-r--r--vm_debug.h37
-rw-r--r--vm_dump.c1058
-rw-r--r--vm_eval.c2058
-rw-r--r--vm_exec.c170
-rw-r--r--vm_exec.h182
-rw-r--r--vm_insnhelper.c2437
-rw-r--r--vm_insnhelper.h233
-rw-r--r--vm_method.c1766
-rw-r--r--vm_opts.h56
-rw-r--r--vm_trace.c1578
-rw-r--r--vsnprintf.c1333
-rw-r--r--win32/Makefile230
-rw-r--r--win32/Makefile.sub1158
-rw-r--r--win32/README.win32141
-rw-r--r--win32/config.h48
-rwxr-xr-xwin32/configure.bat216
-rw-r--r--win32/dir.h45
-rw-r--r--win32/enc-setup.mak10
-rw-r--r--win32/file.c672
-rwxr-xr-xwin32/ifchange.bat95
-rwxr-xr-xwin32/makedirs.bat3
-rwxr-xr-xwin32/mkexports.rb172
-rwxr-xr-xwin32/ntsetup.bat10
-rwxr-xr-xwin32/resource.rb97
-rwxr-xr-xwin32/rm.bat18
-rwxr-xr-xwin32/rmdirs.bat29
-rw-r--r--win32/rtname.cmd18
-rw-r--r--win32/ruby.def442
-rw-r--r--win32/sdbm.c981
-rw-r--r--win32/sdbm.h84
-rw-r--r--win32/setup.mak221
-rw-r--r--win32/stub.c42
-rw-r--r--win32/win32.c7769
-rw-r--r--win32/win32.h347
-rw-r--r--win32/winmain.c10
-rw-r--r--x68/_dtos18.c250
-rw-r--r--x68/_round.c45
-rw-r--r--x68/fconvert.c81
-rw-r--r--x68/select.c167
4433 files changed, 1719997 insertions, 85437 deletions
diff --git a/.document b/.document
new file mode 100644
index 0000000000..9a5067bc52
--- /dev/null
+++ b/.document
@@ -0,0 +1,28 @@
+# This file determines which files in the
+# Ruby hierarchy will be processed by the RDoc
+# tool when it is given the top-level directory
+# as an argument
+
+# Process all the C source files
+*.c
+
+# prelude
+prelude.rb
+
+# the lib/ directory (which has its own .document file)
+lib
+
+# and some of the ext/ directory (which has its own .document file)
+ext
+
+# rdoc files
+ChangeLog
+
+NEWS
+
+README
+README.EXT
+README.EXT.ja
+README.ja
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..67abf4b978
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,16 @@
+root = true
+
+[*]
+end_of_line = lf
+insert_final_newline = true
+trim_trailing_whitespace = true
+tab_width = 8
+indent_style = tab
+indent_size = 4
+
+[**.bat]
+end_of_line = crlf
+
+[**.rb]
+indent_style = space
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..e2a34f3715
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,910 @@
+define hook-run
+ set $color_type = 0
+ set $color_highlite = 0
+ set $color_end = 0
+end
+
+define ruby_gdb_init
+ if !$color_type
+ set $color_type = "\033[31m"
+ end
+ if !$color_highlite
+ set $color_highlite = "\033[36m"
+ end
+ if !$color_end
+ set $color_end = "\033[m"
+ end
+ if ruby_dummy_gdb_enums.special_consts
+ end
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+ ruby_gdb_init
+ if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+ printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+ else
+ if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+ set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+ printf "%sSYMBOL%s: ", $color_type, $color_end
+ rp_id $id
+ else
+ if ($arg0) == RUBY_Qfalse
+ echo false\n
+ else
+ if ($arg0) == RUBY_Qtrue
+ echo true\n
+ else
+ if ($arg0) == RUBY_Qnil
+ echo nil\n
+ else
+ if ($arg0) == RUBY_Qundef
+ echo undef\n
+ else
+ if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+ if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+ printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+ else
+ echo immediate\n
+ end
+ else
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+ printf "[PROMOTED] "
+ end
+ if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+ printf "%sT_NONE%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+ printf "%sT_NIL%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+ printf "%sT_OBJECT%s: ", $color_type, $color_end
+ print (struct RObject *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+ printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+ rp_class $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+ printf "%sT_ICLASS%s: ", $color_type, $color_end
+ rp_class $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+ printf "%sT_MODULE%s: ", $color_type, $color_end
+ rp_class $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+ printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
+ print (struct RFloat *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ printf "%sT_STRING%s: ", $color_type, $color_end
+ rp_string $arg0 $flags
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+ set $regsrc = ((struct RRegexp*)($arg0))->src
+ set $rsflags = ((struct RBasic*)$regsrc)->flags
+ printf "%sT_REGEXP%s: ", $color_type, $color_end
+ set print address off
+ output (char *)(($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.ptr : \
+ ((struct RString*)$regsrc)->as.ary)
+ set print address on
+ printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.len : \
+ (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $flags & RUBY_FL_USER6
+ printf "(none) "
+ end
+ if $flags & RUBY_FL_USER5
+ printf "(literal) "
+ end
+ if $flags & RUBY_FL_USER4
+ printf "(fixed) "
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ print (struct RRegexp *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if ($flags & RUBY_FL_USER1)
+ set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+ printf "(embed) "
+ if ($len == 0)
+ printf "{(empty)} "
+ else
+ output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ printf " "
+ end
+ else
+ set $len = ((struct RArray*)($arg0))->as.heap.len
+ printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) shared="
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+ printf " "
+ else
+ printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+ end
+ if ($len == 0)
+ printf "{(empty)} "
+ else
+ output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ printf " "
+ end
+ end
+ print (struct RArray *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+ printf "%sT_FIXNUM%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+ printf "%sT_HASH%s: ", $color_type, $color_end,
+ if ((struct RHash *)($arg0))->ntbl
+ printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+ end
+ print (struct RHash *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+ printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
+ (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+ ((struct RStruct *)($arg0))->as.heap.len)
+ print (struct RStruct *)($arg0)
+ x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ((struct RStruct *)($arg0))->as.ary : \
+ ((struct RStruct *)($arg0))->as.heap.ptr)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+ printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+ (($flags & RUBY_FL_USER1) != 0), \
+ (($flags & RUBY_FL_USER2) ? \
+ ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+ ((struct RBignum*)($arg0))->as.heap.len)
+ if $flags & RUBY_FL_USER2
+ printf "(embed) "
+ end
+ print (struct RBignum *)($arg0)
+ x/xw (($flags & RUBY_FL_USER2) ? \
+ ((struct RBignum*)($arg0))->as.ary : \
+ ((struct RBignum*)($arg0))->as.heap.digits)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+ printf "%sT_RATIONAL%s: ", $color_type, $color_end
+ print (struct RRational *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+ printf "%sT_COMPLEX%s: ", $color_type, $color_end
+ print (struct RComplex *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+ printf "%sT_FILE%s: ", $color_type, $color_end
+ print (struct RFile *)($arg0)
+ output *((struct RFile *)($arg0))->fptr
+ printf "\n"
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+ printf "%sT_TRUE%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+ printf "%sT_FALSE%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+ if ((struct RTypedData *)($arg0))->typed_flag == 1
+ printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
+ print (struct RTypedData *)($arg0)
+ else
+ printf "%sT_DATA%s: ", $color_type, $color_end
+ print (struct RData *)($arg0)
+ end
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+ printf "%sT_MATCH%s: ", $color_type, $color_end
+ print (struct RMatch *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+ printf "%sT_SYMBOL%s: ", $color_type, $color_end
+ print (struct RSymbol *)($arg0)
+ set $id_type = ((struct RSymbol *)($arg0))->type
+ if $id_type == RUBY_ID_LOCAL
+ printf "l"
+ else
+ if $id_type == RUBY_ID_INSTANCE
+ printf "i"
+ else
+ if $id_type == RUBY_ID_GLOBAL
+ printf "G"
+ else
+ if $id_type == RUBY_ID_ATTRSET
+ printf "a"
+ else
+ if $id_type == RUBY_ID_CONST
+ printf "C"
+ else
+ if $id_type == RUBY_ID_CLASS
+ printf "c"
+ else
+ printf "j"
+ end
+ end
+ end
+ end
+ end
+ end
+ set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+ rp_string $id_fstr
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+ printf "%sT_UNDEF%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+ printf "%sT_NODE%s(", $color_type, $color_end
+ output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+ printf "): "
+ print *(NODE *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+ printf "%sT_ZOMBIE%s: ", $color_type, $color_end
+ print (struct RData *)($arg0)
+ else
+ printf "%sunknown%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp
+ Print a Ruby's VALUE.
+end
+
+define rp_id
+ set $id = (ID)$arg0
+ if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+ printf "(:%c)\n", $id
+ else
+ if $id == idDot2
+ printf "(:..)\n"
+ else
+ if $id == idDot3
+ printf "(:...)\n"
+ else
+ if $id == idUPlus
+ printf "(:+@)\n"
+ else
+ if $id == idUMinus
+ printf "(:-@)\n"
+ else
+ if $id == idPow
+ printf "(:**)\n"
+ else
+ if $id == idCmp
+ printf "(:<=>)\n"
+ else
+ if $id == idLTLT
+ printf "(:<<)\n"
+ else
+ if $id == idLE
+ printf "(:<=)\n"
+ else
+ if $id == idGE
+ printf "(:>=)\n"
+ else
+ if $id == idEq
+ printf "(:==)\n"
+ else
+ if $id == idEqq
+ printf "(:===)\n"
+ else
+ if $id == idNeq
+ printf "(:!=)\n"
+ else
+ if $id == idEqTilde
+ printf "(:=~)\n"
+ else
+ if $id == idNeqTilde
+ printf "(:!~)\n"
+ else
+ if $id == idAREF
+ printf "(:[])\n"
+ else
+ if $id == idASET
+ printf "(:[]=)\n"
+ else
+ if $id <= tLAST_OP_ID
+ printf "O"
+ else
+ set $id_type = $id & RUBY_ID_SCOPE_MASK
+ if $id_type == RUBY_ID_LOCAL
+ printf "l"
+ else
+ if $id_type == RUBY_ID_INSTANCE
+ printf "i"
+ else
+ if $id_type == RUBY_ID_GLOBAL
+ printf "G"
+ else
+ if $id_type == RUBY_ID_ATTRSET
+ printf "a"
+ else
+ if $id_type == RUBY_ID_CONST
+ printf "C"
+ else
+ if $id_type == RUBY_ID_CLASS
+ printf "c"
+ else
+ printf "j"
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ printf "(%ld): ", $id
+ rb_numtable_entry global_symbols.id_str $id
+ if $rb_numtable_rec
+ rp_string $rb_numtable_rec
+ else
+ echo undef\n
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp_id
+ Print an ID.
+end
+
+define rp_string
+ set $flags = ((struct RBasic*)($arg0))->flags
+ set print address off
+ output (char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary)
+ set print address on
+ printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if !($flags & RUBY_FL_USER1)
+ printf "(embed) "
+ else
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) "
+ end
+ if ($flags & RUBY_FL_USER3)
+ printf "(assoc) "
+ end
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+ printf "coderange:unknown "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+ printf "coderange:7bit "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+ printf "coderange:valid "
+ else
+ printf "coderange:broken "
+ end
+ end
+ end
+ print (struct RString *)($arg0)
+end
+document rp_string
+ Print the content of a String.
+end
+
+define rp_class
+ printf "(struct RClass *) %p", (void*)$arg0
+ if ((struct RClass *)($arg0))->ptr.origin != $arg0
+ printf " -> %p", ((struct RClass *)($arg0))->ptr.origin
+ end
+ printf "\n"
+ rb_classname $arg0
+ print *(struct RClass *)($arg0)
+ print *((struct RClass *)($arg0))->ptr
+end
+document rp_class
+ Print the content of a Class/Module.
+end
+
+define nd_type
+ print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+ Print a Ruby' node type.
+end
+
+define nd_file
+ print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+ Print the source file name of a node.
+end
+
+define nd_line
+ print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+ Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_alen
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+define nd_next
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_cond
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_body
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_else
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_orig
+ printf "%su3.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.value
+end
+
+
+define nd_resq
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_ensr
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_1st
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_2nd
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+
+define nd_stts
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+
+define nd_entry
+ printf "%su3.entry%s: ", $color_highlite, $color_end
+ p ($arg0).u3.entry
+end
+
+define nd_vid
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_cflag
+ printf "%su2.id%s: ", $color_highlite, $color_end
+ p ($arg0).u2.id
+end
+
+define nd_cval
+ printf "%su3.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.value
+end
+
+
+define nd_cnt
+ printf "%su3.cnt%s: ", $color_highlite, $color_end
+ p ($arg0).u3.cnt
+end
+
+define nd_tbl
+ printf "%su1.tbl%s: ", $color_highlite, $color_end
+ p ($arg0).u1.tbl
+end
+
+
+define nd_var
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_ibdy
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_iter
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_value
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_aid
+ printf "%su3.id%s: ", $color_highlite, $color_end
+ p ($arg0).u3.id
+end
+
+
+define nd_lit
+ printf "%su1.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.value
+end
+
+
+define nd_frml
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_rest
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+define nd_opt
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+
+define nd_recv
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_mid
+ printf "%su2.id%s: ", $color_highlite, $color_end
+ p ($arg0).u2.id
+end
+
+define nd_args
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_noex
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_defn
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_old
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_new
+ printf "%su2.id%s: ", $color_highlite, $color_end
+ p ($arg0).u2.id
+end
+
+
+define nd_cfnc
+ printf "%su1.cfunc%s: ", $color_highlite, $color_end
+ p ($arg0).u1.cfunc
+end
+
+define nd_argc
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+
+define nd_cname
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_super
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_modl
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_clss
+ printf "%su1.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.value
+end
+
+
+define nd_beg
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_end
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_state
+ printf "%su3.state%s: ", $color_highlite, $color_end
+ p ($arg0).u3.state
+end
+
+define nd_rval
+ printf "%su2.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.value
+end
+
+
+define nd_nth
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+
+define nd_tag
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_tval
+ printf "%su2.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.value
+end
+
+define rb_p
+ call rb_p($arg0)
+end
+
+define rb_numtable_entry
+ set $rb_numtable_tbl = $arg0
+ set $rb_numtable_id = (st_data_t)$arg1
+ set $rb_numtable_key = 0
+ set $rb_numtable_rec = 0
+ if $rb_numtable_tbl->entries_packed
+ set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+ while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+ if $rb_numtable_p.k == $rb_numtable_id
+ set $rb_numtable_key = $rb_numtable_p.k
+ set $rb_numtable_rec = $rb_numtable_p.v
+ set $rb_numtable_p = 0
+ else
+ set $rb_numtable_p = $rb_numtable_p + 1
+ end
+ end
+ else
+ set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
+ while $rb_numtable_p
+ if $rb_numtable_p->key == $rb_numtable_id
+ set $rb_numtable_key = $rb_numtable_p->key
+ set $rb_numtable_rec = $rb_numtable_p->record
+ set $rb_numtable_p = 0
+ else
+ set $rb_numtable_p = $rb_numtable_p->next
+ end
+ end
+ end
+end
+
+define rb_id2name
+ ruby_gdb_init
+ printf "%sID%s: ", $color_type, $color_end
+ rp_id $arg0
+end
+document rb_id2name
+ Print the name of id
+end
+
+define rb_method_entry
+ set $rb_method_entry_klass = (struct RClass *)$arg0
+ set $rb_method_entry_id = (ID)$arg1
+ set $rb_method_entry_me = (rb_method_entry_t *)0
+ while !$rb_method_entry_me && $rb_method_entry_klass
+ rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
+ set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+ if !$rb_method_entry_me
+ set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
+ end
+ end
+ if $rb_method_entry_me
+ print *$rb_method_entry_klass
+ print *$rb_method_entry_me
+ else
+ echo method not found\n
+ end
+end
+document rb_method_entry
+ Search method entry by class and id
+end
+
+define rb_classname
+ # up to 128bit int
+ set $rb_classname_permanent = "0123456789ABCDEF"
+ set $rb_classname = classname($arg0, $rb_classname_permanent)
+ if $rb_classname != RUBY_Qnil
+ rp $rb_classname
+ else
+ echo anonymous class/module\n
+ end
+end
+
+define rb_ancestors
+ set $rb_ancestors_module = $arg0
+ while $rb_ancestors_module
+ rp_class $rb_ancestors_module
+ set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+ end
+end
+document rb_ancestors
+ Print ancestors.
+end
+
+define rb_backtrace
+ call rb_backtrace()
+end
+
+define iseq
+ if ruby_dummy_gdb_enums.special_consts
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_NONE
+ echo [none]\n
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_LABEL
+ print *(LABEL*)($arg0)
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_INSN
+ print *(INSN*)($arg0)
+ if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+ set $i = 0
+ set $operand_size = ((INSN*)($arg0))->operand_size
+ set $operands = ((INSN*)($arg0))->operands
+ while $i < $operand_size
+ rp $operands[$i++]
+ end
+ end
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+ print *(ADJUST*)($arg0)
+ end
+end
+
+define rb_ps
+ rb_ps_vm ruby_current_vm
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+ print $ps_vm = (rb_vm_t*)$arg0
+ set $ps_threads = (st_table*)$ps_vm->living_threads
+ if $ps_threads->entries_packed
+ set $ps_threads_i = 0
+ while $ps_threads_i < $ps_threads->num_entries
+ set $ps_threads_key = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].key
+ set $ps_threads_val = (st_data_t)$ps_threads->as.packed.entries[$ps_threads_i].val
+ rb_ps_thread $ps_threads_key $ps_threads_val
+ set $ps_threads_i = $ps_threads_i + 1
+ end
+ else
+ set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
+ while $ps_threads_ptr
+ set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
+ set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
+ rb_ps_thread $ps_threads_key $ps_threads_val
+ set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+ end
+ end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define rb_ps_thread
+ set $ps_thread = (struct RTypedData*)$arg0
+ set $ps_thread_id = $arg1
+ print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define trace_machine_instructions
+ set logging on
+ set height 0
+ set width 0
+ display/i $pc
+ while !$exit_code
+ info line *$pc
+ si
+ end
+end
+
+define SDR
+ call rb_vmdebug_stack_dump_raw_current()
+end
+
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..9515852837
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,152 @@
+*-*-*.def
+*.a
+*.bak
+*.dSYM
+*.dmyh
+*.dylib
+*.elc
+*.inc
+*.log
+*.o
+*.orig
+*.rej
+*.sav
+*.swp
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+Makefile
+Makefile.old
+extconf.h
+y.output
+y.tab.c
+
+# /
+/*-fake.rb
+/*.pc
+/*_prelude.c
+/COPYING.LIB
+/ChangeLog-*
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
+/Doxyfile
+/GNUmakefile
+/GNUmakefile.old
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/beos
+/bmlog-*
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/coverage/simplecov
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
+/doc/capi
+/enc.mk
+/encdb.h
+/exts.mk
+/goruby
+/id.[ch]
+/largefile.h
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/probes.h
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-man.rd.gz
+/sizes.c
+/test.rb
+/tmp
+/transdb.h
+/uncommon.mk
+/verconf.h
+/web
+/yasmdata.rb
+
+# /benchmark/
+/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+# /enc/trans/
+/enc/trans/*.c
+
+# /ext/
+/ext/extinit.c
+
+# /ext/dl/callback/
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
+
+# /ext/etc/
+/ext/etc/constdefs.h
+
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /ext/tk/
+/ext/tk/config_list
+
+# /gems
+/gems/*.gem
+
+# /spec/
+/spec/mspec
+/spec/rubyspec
+
+# /tool/
+/tool/config.guess
+/tool/config.sub
+
+# /win32/
+/win32/*.ico
+/win32/.time
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..6a207a0554
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,21 @@
+-bap
+-nbbb
+-nbc
+-br
+-nbs
+-ncdb
+-ce
+-cli0.5
+-ndj
+-ei
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+
+-TID
+-TVALUE
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..d39c72b0f9
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,92 @@
+# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
+#
+# This file is a part of the programming language Ruby. Permission is hereby
+# granted, to either redistribute or modify this file, provided that the
+# conditions mentioned in the file COPYING are met. Consult the file for
+# details.
+
+# This is a Travis-CI build configuration file. The list of configurations
+# available is located in
+#
+# http://about.travis-ci.org/docs/user/build-configuration/
+#
+# and as Ruby itself is a project written in C language,
+#
+# http://about.travis-ci.org/docs/user/languages/c/
+#
+# is also a good place to look at.
+
+# Language specification.
+language: c
+
+# Compilers. Several compilers are provided in Travis, so we try them all.
+# The value set here is visible via $CC environment variable.
+compiler:
+ - gcc
+ - clang
+
+# Dependencies. Some header files are missing in a Travis' worker VM, so we
+# have to install them. The "1.9.1" here is OK. It is the most adopted
+# version string for Debian/Ubuntu, and no dependencies have been changed so
+# far since the 1.9.1 release.
+before_install:
+ - "sudo apt-get -qq update"
+ - "sudo apt-get -qq install $CC" # upgrade if any
+install: "sudo apt-get -qq build-dep ruby1.9.1 2>/dev/null"
+
+# Script is where the test runs. Note we just do "make test", not other tests
+# like test-all, test-rubyspec. This is because they take too much time,
+# enough for Travis to shut down the VM as being stalled.
+before_script:
+ - "uname -a"
+ - "uname -r"
+ - "rm -fr .ext autom4te.cache"
+ - "make -f common.mk BASERUBY=ruby srcdir=. update-config_files"
+ - "autoconf"
+ - "mkdir config_1st config_2nd"
+ - "./configure -C --with-gcc=$CC"
+ - "cp -pr config.status .ext/include config_1st"
+ - "make reconfig"
+ - "cp -pr config.status .ext/include config_2nd"
+ - "diff -ru config_1st config_2nd"
+ - "make -sj encs"
+ - "make -sj exts"
+script:
+ - "make test OPTS=-v"
+ - "make test-all TESTS='-qv -j2'"
+
+# Branch matrix. Not all branches are Travis-ready so we limit branches here.
+branches:
+ only:
+ - trunk
+ - ruby_1_9_3
+ - ruby_2_0_0
+ - ruby_2_1
+ - ruby_2_2
+
+# We want to be notified when something happens.
+notifications:
+ irc:
+ channels:
+ - "irc.freenode.org#ruby-core"
+ - "irc.freenode.org#ruby-ja"
+ on_success: change # [always|never|change] # default: always
+ on_failure: change # [always|never|change] # default: always
+ template:
+ - "%{message} by @%{author}: See %{build_url}"
+
+ # Update ruby-head installed on Travis CI so other projects can test against it.
+ webhooks:
+ urls:
+ - "https://rubies.travis-ci.org/rebuild/ruby-head"
+ on_success: always
+ on_failure: never
+
+# Local Variables:
+# mode: YAML
+# coding: utf-8-unix
+# indent-tabs-mode: nil
+# tab-width: 4
+# fill-column: 79
+# default-justification: full
+# End:
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..a009caefea
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..ffdf2dd4b8
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1,4 @@
+Please see the [official issue tracker] and wiki [HowToContribute].
+
+[official issue tracker]: https://bugs.ruby-lang.org
+[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index eeb586b392..a1f19ff99d 100644
--- a/COPYING
+++ b/COPYING
@@ -1,340 +1,56 @@
- GNU GENERAL PUBLIC LICENSE
- Version 2, June 1991
+Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
- 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
- Preamble
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
- The licenses for most software are designed to take away your
-freedom to share and change it. By contrast, the GNU General Public
-License is intended to guarantee your freedom to share and change free
-software--to make sure the software is free for all its users. This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it. (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.) You can apply it to
-your programs, too.
+ a) place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
- When we speak of free software, we are referring to freedom, not
-price. Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-this service if you wish), that you receive source code or can get it
-if you want it, that you can change the software or use pieces of it
-in new free programs; and that you know you can do these things.
+ b) use the modified software only within your corporation or
+ organization.
- To protect your rights, we need to make restrictions that forbid
-anyone to deny you these rights or to ask you to surrender the rights.
-These restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
+ c) give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must give the recipients all the rights that
-you have. You must make sure that they, too, receive or can get the
-source code. And you must show them these terms so they know their
-rights.
+ d) make other distribution arrangements with the author.
- We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
+ 3. You may distribute the software in object code or binary form,
+ provided that you do at least ONE of the following:
- Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software. If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
+ a) distribute the binaries and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
- Finally, any free program is threatened constantly by software
-patents. We wish to avoid the danger that redistributors of a free
-program will individually obtain patent licenses, in effect making the
-program proprietary. To prevent this, we have made it clear that any
-patent must be licensed for everyone's free use or not licensed at all.
+ b) accompany the distribution with the machine-readable source of
+ the software.
- The precise terms and conditions for copying, distribution and
-modification follow.
-
- GNU GENERAL PUBLIC LICENSE
- TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+ c) give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- 0. This License applies to any program or other work which contains
-a notice placed by the copyright holder saying it may be distributed
-under the terms of this General Public License. The "Program", below,
-refers to any such program or work, and a "work based on the Program"
-means either the Program or any derivative work under copyright law:
-that is to say, a work containing the Program or a portion of it,
-either verbatim or with modifications and/or translated into another
-language. (Hereinafter, translation is included without limitation in
-the term "modification".) Each licensee is addressed as "you".
+ d) make other distribution arrangements with the author.
-Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope. The act of
-running the Program is not restricted, and the output from the Program
-is covered only if its contents constitute a work based on the
-Program (independent of having been made by running the Program).
-Whether that is true depends on what the Program does.
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under these terms.
- 1. You may copy and distribute verbatim copies of the Program's
-source code as you receive it, in any medium, provided that you
-conspicuously and appropriately publish on each copy an appropriate
-copyright notice and disclaimer of warranty; keep intact all the
-notices that refer to this License and to the absence of any warranty;
-and give any other recipients of the Program a copy of this License
-along with the Program.
+ For the list of those files and their copying conditions, see the
+ file LEGAL.
-You may charge a fee for the physical act of transferring a copy, and
-you may at your option offer warranty protection in exchange for a fee.
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
- 2. You may modify your copy or copies of the Program or any portion
-of it, thus forming a work based on the Program, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
- a) You must cause the modified files to carry prominent notices
- stating that you changed the files and the date of any change.
-
- b) You must cause any work that you distribute or publish, that in
- whole or in part contains or is derived from the Program or any
- part thereof, to be licensed as a whole at no charge to all third
- parties under the terms of this License.
-
- c) If the modified program normally reads commands interactively
- when run, you must cause it, when started running for such
- interactive use in the most ordinary way, to print or display an
- announcement including an appropriate copyright notice and a
- notice that there is no warranty (or else, saying that you provide
- a warranty) and that users may redistribute the program under
- these conditions, and telling the user how to view a copy of this
- License. (Exception: if the Program itself is interactive but
- does not normally print such an announcement, your work based on
- the Program is not required to print an announcement.)
-
-These requirements apply to the modified work as a whole. If
-identifiable sections of that work are not derived from the Program,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works. But when you
-distribute the same sections as part of a whole which is a work based
-on the Program, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Program.
-
-In addition, mere aggregation of another work not based on the Program
-with the Program (or with a work based on the Program) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
- 3. You may copy and distribute the Program (or a work based on it,
-under Section 2) in object code or executable form under the terms of
-Sections 1 and 2 above provided that you also do one of the following:
-
- a) Accompany it with the complete corresponding machine-readable
- source code, which must be distributed under the terms of Sections
- 1 and 2 above on a medium customarily used for software interchange; or,
-
- b) Accompany it with a written offer, valid for at least three
- years, to give any third party, for a charge no more than your
- cost of physically performing source distribution, a complete
- machine-readable copy of the corresponding source code, to be
- distributed under the terms of Sections 1 and 2 above on a medium
- customarily used for software interchange; or,
-
- c) Accompany it with the information you received as to the offer
- to distribute corresponding source code. (This alternative is
- allowed only for noncommercial distribution and only if you
- received the program in object code or executable form with such
- an offer, in accord with Subsection b above.)
-
-The source code for a work means the preferred form of the work for
-making modifications to it. For an executable work, complete source
-code means all the source code for all modules it contains, plus any
-associated interface definition files, plus the scripts used to
-control compilation and installation of the executable. However, as a
-special exception, the source code distributed need not include
-anything that is normally distributed (in either source or binary
-form) with the major components (compiler, kernel, and so on) of the
-operating system on which the executable runs, unless that component
-itself accompanies the executable.
-
-If distribution of executable or object code is made by offering
-access to copy from a designated place, then offering equivalent
-access to copy the source code from the same place counts as
-distribution of the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
- 4. You may not copy, modify, sublicense, or distribute the Program
-except as expressly provided under this License. Any attempt
-otherwise to copy, modify, sublicense or distribute the Program is
-void, and will automatically terminate your rights under this License.
-However, parties who have received copies, or rights, from you under
-this License will not have their licenses terminated so long as such
-parties remain in full compliance.
-
- 5. You are not required to accept this License, since you have not
-signed it. However, nothing else grants you permission to modify or
-distribute the Program or its derivative works. These actions are
-prohibited by law if you do not accept this License. Therefore, by
-modifying or distributing the Program (or any work based on the
-Program), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Program or works based on it.
-
- 6. Each time you redistribute the Program (or any work based on the
-Program), the recipient automatically receives a license from the
-original licensor to copy, distribute or modify the Program subject to
-these terms and conditions. You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties to
-this License.
-
- 7. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Program at all. For example, if a patent
-license would not permit royalty-free redistribution of the Program by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Program.
-
-If any portion of this section is held invalid or unenforceable under
-any particular circumstance, the balance of the section is intended to
-apply and the section as a whole is intended to apply in other
-circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system, which is
-implemented by public license practices. Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
- 8. If the distribution and/or use of the Program is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Program under this License
-may add an explicit geographical distribution limitation excluding
-those countries, so that distribution is permitted only in or among
-countries not thus excluded. In such case, this License incorporates
-the limitation as if written in the body of this License.
-
- 9. The Free Software Foundation may publish revised and/or new versions
-of the General Public License from time to time. Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
-Each version is given a distinguishing version number. If the Program
-specifies a version number of this License which applies to it and "any
-later version", you have the option of following the terms and conditions
-either of that version or of any later version published by the Free
-Software Foundation. If the Program does not specify a version number of
-this License, you may choose any version ever published by the Free Software
-Foundation.
-
- 10. If you wish to incorporate parts of the Program into other free
-programs whose distribution conditions are different, write to the author
-to ask for permission. For software which is copyrighted by the Free
-Software Foundation, write to the Free Software Foundation; we sometimes
-make exceptions for this. Our decision will be guided by the two goals
-of preserving the free status of all derivatives of our free software and
-of promoting the sharing and reuse of software generally.
-
- NO WARRANTY
-
- 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
-FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
-OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
-PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
-OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
-MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS
-TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE
-PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
-REPAIR OR CORRECTION.
-
- 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
-REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
-INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
-OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
-TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
-YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
-PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGES.
-
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
-
- If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
-
- To do so, attach the following notices to the program. It is safest
-to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least
-the "copyright" line and a pointer to where the full notice is found.
-
- <one line to give the program's name and a brief idea of what it does.>
- Copyright (C) 19yy <name of author>
-
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
-
-
-Also add information on how to contact you by electronic and paper mail.
-
-If the program is interactive, make it output a short notice like this
-when it starts in an interactive mode:
-
- Gnomovision version 69, Copyright (C) 19yy name of author
- Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
- This is free software, and you are welcome to redistribute it
- under certain conditions; type `show c' for details.
-
-The hypothetical commands `show w' and `show c' should show the appropriate
-parts of the General Public License. Of course, the commands you use may
-be called something other than `show w' and `show c'; they could even be
-mouse-clicks or menu items--whatever suits your program.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the program, if
-necessary. Here is a sample; alter the names:
-
- Yoyodyne, Inc., hereby disclaims all copyright interest in the program
- `Gnomovision' (which makes passes at compilers) written by James Hacker.
-
- <signature of Ty Coon>, 1 April 1989
- Ty Coon, President of Vice
-
-This General Public License does not permit incorporating your program into
-proprietary programs. If your program is a subroutine library, you may
-consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Library General
-Public License instead of this License.
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
new file mode 100644
index 0000000000..e50d01c8d1
--- /dev/null
+++ b/COPYING.ja
@@ -0,0 +1,51 @@
+本プログラムã¯ãƒ•リーソフトウェアã§ã™ï¼Ž2-clause BSDL
+ã¾ãŸã¯ä»¥ä¸‹ã«ç¤ºã™æ¡ä»¶ã§æœ¬ãƒ—ログラムをå†é…布ã§ãã¾ã™
+2-clause BSDLã«ã¤ã„ã¦ã¯BSDLファイルをå‚ç…§ã—ã¦ä¸‹ã•ã„.
+
+ 1. 複製ã¯åˆ¶é™ãªã自由ã§ã™ï¼Ž
+
+ 2. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムã®ã‚½ãƒ¼ã‚¹ã‚’
+ 自由ã«å¤‰æ›´ã§ãã¾ã™ï¼Ž
+
+ (a) ãƒãƒƒãƒˆãƒ‹ãƒ¥ãƒ¼ã‚ºã«ãƒã‚¹ãƒˆã—ãŸã‚Šï¼Œä½œè€…ã«å¤‰æ›´ã‚’é€ä»˜ã™ã‚‹
+ ãªã©ã®æ–¹æ³•ã§ï¼Œå¤‰æ›´ã‚’公開ã™ã‚‹ï¼Ž
+
+ (b) 変更ã—ãŸæœ¬ãƒ—ãƒ­ã‚°ãƒ©ãƒ ã‚’è‡ªåˆ†ã®æ‰€å±žã™ã‚‹çµ„織内部ã ã‘ã§
+ 使ã†ï¼Ž
+
+ (c) 変更点を明示ã—ãŸã†ãˆï¼Œã‚½ãƒ•トウェアã®åå‰ã‚’変更ã™ã‚‹ï¼Ž
+ ãã®ã‚½ãƒ•トウェアをé…布ã™ã‚‹æ™‚ã«ã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラ
+ ãƒ ã‚‚åŒæ™‚ã«é…布ã™ã‚‹ï¼Žã¾ãŸã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラムã®ã‚½ãƒ¼
+ スã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
+
+ (d) ãã®ä»–ã®å¤‰æ›´æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
+
+ 3. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムをコンパイ
+ ルã—ãŸã‚ªãƒ–ジェクトコードや実行形å¼ã§ã‚‚é…布ã§ãã¾ã™ï¼Ž
+
+ (a) ãƒã‚¤ãƒŠãƒªã‚’å—ã‘å–ã£ãŸäººãŒã‚½ãƒ¼ã‚¹ã‚’入手ã§ãるよã†ã«ï¼Œ
+ ソースã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
+
+ (b) 機械å¯èª­ãªã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’添付ã™ã‚‹ï¼Ž
+
+ (c) 変更を行ã£ãŸãƒã‚¤ãƒŠãƒªã¯åå‰ã‚’変更ã—ãŸã†ãˆï¼Œã‚ªãƒªã‚¸ãƒŠ
+ ルã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
+
+ (d) ãã®ä»–ã®é…布æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
+
+ 4. ä»–ã®ãƒ—ログラムã¸ã®å¼•用ã¯ã„ã‹ãªã‚‹ç›®çš„ã§ã‚れ自由ã§ã™ï¼ŽãŸ
+ ã ã—,本プログラムã«å«ã¾ã‚Œã‚‹ä»–ã®ä½œè€…ã«ã‚ˆã‚‹ã‚³ãƒ¼ãƒ‰ã¯ï¼Œã
+ れãžã‚Œã®ä½œè€…ã®æ„å‘ã«ã‚ˆã‚‹åˆ¶é™ãŒåŠ ãˆã‚‰ã‚Œã‚‹å ´åˆãŒã‚りã¾ã™ï¼Ž
+
+ ãれらファイルã®ä¸€è¦§ã¨ãれãžã‚Œã®é…布æ¡ä»¶ãªã©ã«ä»˜ã„ã¦ã¯
+ LEGALファイルをå‚ç…§ã—ã¦ãã ã•ã„.
+
+ 5. 本プログラムã¸ã®å…¥åŠ›ã¨ãªã‚‹ã‚¹ã‚¯ãƒªãƒ—トãŠã‚ˆã³ï¼Œæœ¬ãƒ—ログラ
+ ムã‹ã‚‰ã®å‡ºåŠ›ã®æ¨©åˆ©ã¯æœ¬ãƒ—ログラムã®ä½œè€…ã§ã¯ãªã,ãれãž
+ れã®å…¥å‡ºåŠ›ã‚’ç”Ÿæˆã—ãŸäººã«å±žã—ã¾ã™ï¼Žã¾ãŸï¼Œæœ¬ãƒ—ログラムã«
+ 組ã¿è¾¼ã¾ã‚Œã‚‹ãŸã‚ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¤ã„ã¦ã‚‚åŒæ§˜ã§ã™ï¼Ž
+
+ 6. 本プログラムã¯ç„¡ä¿è¨¼ã§ã™ï¼Žä½œè€…ã¯æœ¬ãƒ—ログラムをサãƒãƒ¼ãƒˆ
+ ã™ã‚‹æ„å¿—ã¯ã‚りã¾ã™ãŒï¼Œãƒ—ログラム自身ã®ãƒã‚°ã‚ã‚‹ã„ã¯æœ¬ãƒ—
+ ログラムã®å®Ÿè¡Œãªã©ã‹ã‚‰ç™ºç”Ÿã™ã‚‹ã„ã‹ãªã‚‹æå®³ã«å¯¾ã—ã¦ã‚‚責
+ 任をæŒã¡ã¾ã›ã‚“.
diff --git a/ChangeLog b/ChangeLog
index 64a329f899..dc0c1aed39 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,3272 +1,8211 @@
-Mon Feb 1 10:01:17 1999 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+Wed Sep 17 23:12:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y (yylex): range check for the float literal.
+ * lib/uri/rfc3986_parser.rb: specify a regexp for :OPAQUE; generic.rb
+ assumes it is present, and will refuse all values otherwise.
+ by Matthew Draper <matthew@trebex.net>
+ https://github.com/ruby/ruby/pull/718 fix GH-718
-Sat Jan 30 18:34:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 17 16:22:58 2014 Eric Wong <e@80x24.org>
- * ruby.c (usage): -h option to show brief command description.
+ * ext/zlib/zlib.c (zlib_mem_alloc): check overflow
-Sat Jan 30 08:45:16 1999 IKARASHI Akira <ikarashi@itlb.te.noda.sut.ac.jp>
+Wed Sep 17 11:33:35 2014 Laurent Arnoud <laurent@spkdev.net>
- * lib/cgi-lib.rb: cookie support added.
+ * test/fiddle/test_import.rb (Fiddle::TestImport#test_sizeof):
+ added test for long long [fix GH-716]
-Sat Jan 30 13:38:24 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 17 11:09:21 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * regex.c (re_compile_pattern): mbchars should match with \w
- within character classs. Was matching with \W.
+ * tool/rbinstall.rb: fixed invalid options with latest rubygems.
+ https://github.com/rubygems/rubygems/issues/1013
- * regex.c (re_match): \w should match with multi byte characters,
- not its first byte.
+Tue Sep 16 19:19:00 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Jan 30 10:06:41 1999 Yoshida Masato <yoshidam@yoshidam.net>
+ * benchmark/bm_app_aobench.rb: update outdated links to the
+ original program. [ruby-dev:48550] [Feature #10247]
- * re.c (rb_reg_s_new): UTF-8 flag handle (/u, /U).
+Tue Sep 16 01:06:40 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * re.c (rb_kcode): $KCODE handle for UTF-8.
+ * reg*.c: Merge Onigmo 5.15.0 38a870960aa7370051a3544
-Sat Jan 30 01:51:16 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Sep 15 16:21:10 2014 Eric Wong <e@80x24.org>
- * array.c (rb_ary_delete_if): RTEST() missing.
+ * io.c (struct io_advise_struct): 32 => 24 bytes on 64-bit
+ * io.c (struct io_internal_writev_struct): 24 => 16 bytes on 64-bit
+ * process.c (struct waitpid_arg): ditto
- * hash.c (delete_if_i): ditto.
+Mon Sep 15 10:29:25 2014 Natalie Weizenbaum <nweiz@google.com>
- * enum.c (Init_Enumerable): select (=find_all), detect (=find)
- added as aliases.
+ * ext/pathname/lib/pathname.rb (SAME_PATHS):
+ Pathname#relative_path_from uses String#casecmp to compare strings
+ on case-insensitive filesystem platforms (e.g., Windows). This can
+ return nil for strings with different encodings, and the code
+ previously assumed that it always returned a Fixnum. [Fix GH-713]
-Fri Jan 29 21:32:19 1999 WATANABE Tetsuya <tetsu@jpn.hp.com>
+Mon Sep 15 09:43:18 2014 Sho Hashimoto <sho.hsmt@gmail.com>
- * hash.c (rb_f_setenv): SEGV caused by small typo.
+ * ext/fiddle/lib/fiddle/import.rb (Fiddle::Importer#sizeof): fix typo,
+ SIZEOF_LONG_LON. [Fix GH-714]
-Fri Jan 29 00:15:58 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Sep 15 08:13:40 2014 Matthew Draper <matthew@trebex.net>
- * lib/parsedate.rb (parsedate): support date format like
- 23-Feb-93, which is required by HTTP/1.1.
+ * sprintf.c (rb_str_format): rational 'f' format works for more
+ values. [fix GH-717]
- * variable.c (find_class_path): avoid calling rb_iv_set().
+Sun Sep 14 16:57:27 2014 Eric Wong <e@80x24.org>
- * eval.c (backtrace): do not need to modify $SAFE internally.
+ * template/vm.inc.tmpl: "insns.c" => "insns.def"
+ * tool/instruction.rb: typo fix
- * variable.c (classname): inline __classid__ access.
+Sun Sep 14 12:29:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (THREAD_ALLOC): needed to initialize wrapper.
+ * test/test_tracer.rb: fixed testcase for rubygems update.
- * lib/ftools.rb (makedirs): allows slash at the end of the path.
+Sun Sep 14 12:29:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * numeric.c (rb_fix_induced_from): ensure result to be Fixnum.
+ * lib/rubygems: Update to RubyGems 2.4.1 master(713ab65)
+ Complete history at:
+ https://github.com/rubygems/rubygems/blob/master/History.txt#L3-L216
-Thu Jan 28 17:31:43 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/rubygems: ditto.
- * numeric.c (flo_to_s): float format changed to "%16.10g".
+Sun Sep 14 11:03:24 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu Jan 28 02:13:11 1999 Yoshinori Toki <toki@freedom.ne.jp>
+ * ext/psych/lib/psych.rb: update version
+ * ext/psych/psych.gemspec: ditto
- * array.c (rb_ary_store): expand allocated buffer by 3/2.
+Sun Sep 14 08:43:37 2014 Eric Wong <e@80x24.org>
-Wed Jan 27 17:50:02 1999 Kazuhiro HIWADA <hiwada@kuee.kyoto-u.ac.jp>
+ * ccan/container_of/container_of.h (container_of_or_null): added
+ [ccan 7ec5b8e06b2fd5fa98b1fcde1158c286d2d429d8] (David Gibson)
- * bignum.c (dbl2big): raised error if double is too big to cast
- into long. check added.
+Sun Sep 14 08:41:44 2014 Eric Wong <e@80x24.org>
-Wed Jan 27 03:16:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ccan/list/list.h (list_del_init, list_node_init): new functions
+ for multiple list_del() calls
+ [ccan ec8654d94d3c5c47aa5f82698f7e8048c79765b1] (Rusty Russell)
- * variable.c (rb_mod_const_at): can't list constants of the
- untainted objects in safe mode.
+Sat Sep 13 22:19:26 2014 Bernard Potocki <bernard.potocki@imanel.org>
- * class.c (method_list): can't list methods of untainted objects
- in safe mode.
+ * hash.c (rb_hash_aset): fix misleading example which may suggest
+ that Hash.store will return self instead of value - Hash#store
+ is returning value and update itself, as well as Hash#[]=.
+ [Fix GH-715]
-Tue Jan 26 02:40:41 1999 GOTO Kentaro <gotoken@math.sci.hokudai.ac.jp>
+Sat Sep 13 15:16:31 2014 Eric Wong <e@80x24.org>
- * prec.c: Precision support for numbers.
+ * class.c: use ALLOC(rb_subclass_entry_t)
-Thu Jan 21 19:08:14 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 13 14:14:00 2014 Eric Wong <e@80x24.org>
- * eval.c (rb_f_raise): calls `exception' method, not `new'.
+ * process.c (free_exec_arg): remove
+ (memsize_exec_arg): ptr is never NULL
+ (exec_arg_data_type): use RUBY_TYPED_DEFAULT_FREE
- * error.c (exc_exception): renamed from `new'.
+ * variable.c (autoload_i_free): remove
+ (autoload_data_i_type): use RUBY_TYPED_DEFAULT_FREE
+ (autoload_memsize): ptr is never NULL
-Wed Jan 20 03:39:48 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_backtrace.c (location_free): remove
+ (location_mark): ptr is never NULL
+ (location_data_type): use RUBY_TYPED_DEFAULT_FREE
+ (backtrace_mark): ditto
+ (backtrace_free): ditto
- * parse.y (yycompile): rb_in_compile renamed to ruby_in_compile.
+Sat Sep 13 13:43:07 2014 Eric Wong <e@80x24.org>
- * ruby.c (load_file): define DATA iff __END__ appeared in script.
+ * doc/NEWS-2.0.0: fix typo for default RUBY_FIBER_MACHINE_STACK_SIZE
+ [ci skip]
-Tue Jan 19 14:57:51 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 13 11:16:58 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * parse.y (here_document): need to protect lex_lastline.
+ * ext/win32ole/win32ole_event.c(ev_advise, ole_event_free,
+ fev_s_allocate, fev_unadvise): avoid segmentation fault when COM
+ server freed before calling Unadvise from WIN32OLE_EVENT object.
+ * ext/win32ole/win32ole.c: ditto.
- * parse.y (yylex): disable %//, %'', %``.
+Sat Sep 13 09:47:44 2014 Eric Wong <e@80x24.org>
-Tue Jan 19 05:01:16 1999 Koji Arai <JCA02266@nifty.ne.jp>
+ * man/ruby.1: use https for *.ruby-lang.org links
- * array.c (beg_len): round range value too much.
+Sat Sep 13 06:31:23 2014 Eric Wong <e@80x24.org>
-Mon Jan 18 13:02:27 1999 Kuroda Jun <jkuro@dwe.co.j>
+ * vm.c (thread_alloc): remove needless volatile
- * hash.c (env_keys): strchr() may return NULL.
+Sat Sep 13 06:13:55 2014 Eric Wong <e@80x24.org>
-Mon Jan 18 17:51:47 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * proc.c (proc_free): remove, use RUBY_TYPED_DEFAULT_FREE
+ (proc_mark, proc_memsize): remove needless branching
- * instruby.rb (wdir): install libruby.a in archdir.
+ * vm.c (env_free): remove, use RUBY_TYPED_DEFAULT_FREE
+ (env_mark, env_memsize): remove needless branching
- * lib/ftools.rb (install): removes file before installing.
+Sat Sep 13 05:52:15 2014 Eric Wong <e@80x24.org>
-Mon Jan 18 16:55:31 1999 MAEDA shugo <shugo@aianet.ne.jp>
+ * proc.c (rb_proc_alloc): inline and move to vm.c
+ (rb_proc_wrap): new wrapper function used by rb_proc_alloc
+ (proc_dup): simplify alloc + copy + wrap operation
+ [ruby-core:64994]
- * eval.c (rb_callcc): experimental continuation support.
+ * vm.c (rb_proc_alloc): new inline function
+ (rb_vm_make_proc): call rb_proc_alloc
-Sun Jan 17 19:45:37 1999 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * vm_core.h: remove rb_proc_alloc, add rb_proc_wrap
- * pack.c (pack_pack): nil packing caused SEGV.
+ * benchmark/bm_vm2_newlambda.rb: short test to show difference
-Sat Jan 16 13:18:03 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 13 04:40:04 2014 Eric Wong <e@80x24.org>
- * string.c (rb_str_concat): character (fixnum) can be append to
- strings
+ * process.c (Init_process): subclass Thread as Process::Waiter
+ (rb_detach_process): use Process::Waiter instead of singleton class
+ Thanks to headius and nobu. [Bug #10231]
- * array.c (rb_ary_unshift): unshift returns array.
+ * test/ruby/test_process.rb (test_process_detach): new test
-Sat Jan 16 01:39:19 1999 Yoshida Masato <yoshidam@tau.bekkoame.ne.jp>
+ * inits.c (rb_call_inits): call Init_Thread before Init_process to
+ ensure Process::Waiter may be a subclass of Thread
- * string.c (rb_str_split_method): UTF-8 support.
+Fri Sep 12 18:14:28 2014 Eric Wong <e@80x24.org>
- * regex.c: UTF-8 support.
+ * vm.c (env_alloc): inline to avoid extra zeroing
+ tiny speedup [ruby-core:64980]
-Thu Jan 14 00:42:55 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 12 17:13:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (rb_str_gsub_bang): forget to add offset for null match.
+ * vm_method.c (rb_method_entry_make, remove_method): ditto.
- * eval.c (rb_thread_local_aset): can't modify in tainted mode.
+Fri Sep 12 14:39:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * hash.c (env_each_key): avoid generating temporary array.
+ * gems/bundled_gems: Upgraded to test-unit-3.0.1 and minitest-5.4.1
-Wed Jan 13 23:58:50 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 12 06:55:40 2014 Eric Wong <e@80x24.org>
- * hash.c (rb_f_setenv): name and value can be tainted.
+ * string.c (Init_frozen_strings): use st_init_table_with_size
-Wed Jan 6 02:42:08 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 12 06:15:37 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * bignum.c (Init_Bignum): forgot to define Bignum#===.
+ * string.c (sym_find): remove Symbol.find because we have Symbol GC now.
+ https://bugs.ruby-lang.org/projects/ruby/wiki/DevelopersMeeting20140904Japan
+ If you still want this, request again on Redmine. [Feature #7854]
+ https://bugs.ruby-lang.org/issues/7854
- * gc.c (gc_sweep): if add_heap() is called during GC, objects on
- allocated heap page(s) are not marked, should not be recycled.
+ * ext/-test-/symbol/init.c (sym_find): moved from string.c for tests.
- * gc.c (gc_sweep): should refer latest freelist.
+Fri Sep 12 04:24:03 2014 Eric Wong <e@80x24.org>
- * gc.c (id2ref): modified to support performance patch.
+ * insns.def (once): define and use fake RUNNING_THREAD_ONCE_DONE
+ pointer to indicate is->once.running_thread is done.
- * object.c (rb_obj_id): performance patch (no bignum for id).
+ * vm_core.h (iseq_inline_storage_entry): remove done field,
+ allowing the union to be reduced from 24=>16 bytes on 64-bit
+ [Feature #10187]
-Tue Jan 5 01:56:18 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Sep 11 20:10:00 2014 Koichi Sasada <ko1@atdot.net>
- * config.guess: merge up-to-date from autoconf 2.12.
+ * vm.c (rb_thread_mark): use rb_gc_mark_values() to mark VM stack.
- * array.c (rb_ary_join): avoid calling rb_protect_inspect() till
- it is really needed.
+Thu Sep 11 19:50:57 2014 Koichi Sasada <ko1@atdot.net>
- * object.c (rb_obj_inspect): show detailed information for the
- instance variables (infinite loop can avoid now).
+ * vm.c (rb_vm_register_special_exception): make new function to
+ make and register special exceptions.
- * struct.c (rb_struct_inspect): avoid infinite loop.
+ * vm.c (rb_vm_mark): do not need to mark special exceptions
+ because they are registered by rb_gc_register_mark_object().
-Sun Jan 3 01:37:58 1999 Takao KAWAMURA <kawamura@ike.tottori-u.ac.jp>
+ * eval.c (Init_eval): use rb_vm_register_special_exception().
- * misc/ruby-mode.el (ruby-end-of-defun): moved too much.
+ * gc.c (Init_GC): ditto.
- * misc/ruby-mode.el (ruby-mode-variables): set paragraph-separator
- for the mode.
+ * proc.c (Init_Proc): ditto.
- * misc/ruby-mode.el: proper font-lock for `def' and `nil' etc.
+ * thread.c (Init_Thread): ditto.
-Sat Jan 2 17:09:06 1999 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Sep 11 19:32:30 2014 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_jump_tag): new api to invoke JUMP_TAG. tag values
- can obtained from rb_eval_string_protect()/rb_load_protect().
+ * gc.c (rb_gc_mark_values): added.
+ This function is similar to rb_gc_mark_locations(), but not
+ conservative.
- * eval.c (rb_rescue): now catches all exceptions but SystemExit.
+ * internal.h: ditto.
- * eval.c (rb_eval_string_protect): eval string with protection.
+ * vm.c (env_mark): use rb_gc_mark_values() because env values should
+ be Ruby VALUEs.
- * eval.c (rb_load_protect): load file with protection.
+Thu Sep 11 19:16:39 2014 Koichi Sasada <ko1@atdot.net>
- * io.c (rb_io_puts): avoid infinite loop for cyclic arrays.
+ * gc.c (gc_mark_ptr): rename to gc_mark_set.
- * eval.c (rb_thread_local_aref): thread local hash tables.
+ * gc.c (gc_mark): add gc_mark_ptr() to skip is_markable_object()
+ check. gc_mark_maybe() can use gc_mark_ptr() directly because
+ passed pointer is checked by is_pointer_to_heap().
- * object.c (rb_equal): check exact equal before calling `=='.
+Thu Sep 11 18:40:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Thu Dec 31 22:28:53 1998 MAEDA shugo <shugo@aianet.ne.jp>
+ * .gitignore: ignored temporary files and coverage results.
- * eval.c (rb_f_require): feature names should be provided with
- DLEXT extension.
+Thu Sep 11 18:15:30 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * marshal.c (Init_marshal): need to provide `marshal.so'.
+ * .gitignore: ignored only simplecov.
+ * coverage/README: Added coverage docs.
-Wed Dec 30 02:29:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Sep 11 17:25:31 2014 Koichi Sasada <ko1@atdot.net>
- * variable.c (classname): do not call rb_ivar_set().
+ * include/ruby/ruby.h, gc.c: add new internal events
+ RUBY_INTERNAL_EVENT_GC_ENTER and
+ RUBY_INTERNAL_EVENT_GC_EXIT.
- * eval.c (ruby_run): finalizers were called too early.
+ When invoking GC process, GC_ENTER event is called.
+ When exiting from GC process, GC_EXIT event is called.
-Fri Dec 25 12:19:30 1998 Fukuda Masaki <fukuda@wni.co.jp>
+ Incremental GC (incremental marking and lazy sweep) can call
+ these events many times.
- * gc.c (rb_gc_mark): should not return on FL_EXIVAR.
+ For example (minor marking):
+ (1) GC_ENTER
+ - (2) GC_START (minor GC)
+ (minor marking)
+ - (3) GC_END_MARK
+ (start lazy sweep)
+ (4) GC_EXIT
+ (ruby process)
+ (5) GC_ENTER
+ (lazy sweep)
+ (6) GC_EXIT
+ (ruby process)
+ (... repeat (5), (6))
+ (7) GC_ENTER
+ (finish lazy sweep)
+ - (8) GC_END_SWEEP
+ (9) GC_EXIT
-Fri Dec 25 11:56:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ 2nd example (incremental major marking):
+ (1) GC_ENTER
+ - (2) GC_START (minor GC)
+ (start incremental marking)
+ (3) GC_EXIT
+ (ruby process)
+ (4) GC_ENTER
+ (incremental marking)
+ (5) GC_EXIT
+ (ruby process)
+ (... repeat (4), (5))
+ (6) GC_ENTER
+ (finish incremental marking)
+ - (7) GC_END_MARK
+ (start lazy sweep)
+ (8) GC_EXIT
+ (ruby process)
+ (9) GC_ENTER
+ (lazy sweep)
+ (10) GC_EXIT
+ (ruby process)
+ (... repeat (9), (10))
+ (11) GC_ENTER
+ (finish lazy marking)
+ - (12) GC_STOP_SWEEP
+ (13) GC_EXIT
- * gc.c (gc_mark): proper scanning for temporary region.
+ These internal events enable to measure GC pause time completely.
- * eval.c (TMP_ALLOC): protection for C_ALLOCA was broken.
+Thu Sep 11 17:04:54 2014 Eric Wong <e@80x24.org>
-Thu Dec 24 18:26:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/benchmark.rb: remove CLOCK_MONOTONIC_RAW support
+ Thanks to Vit Ondruch for reporting the issue on ARM.
+ [Bug #10202]
- * development version 1.3 released.
+Thu Sep 11 14:31:57 2014 Koichi Sasada <ko1@atdot.net>
-Thu Dec 24 00:17:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h: freeze nil/true/false.
+ [Feature #8923]
- * eval.c (rb_load): top self should be set properly.
+ * gc.c (should_be_finalizable): check frozen after checkin FL_ABLE.
- * variable.c (classname): check __classpath__ iff it is defined.
+ * object.c (rb_obj_taint): check
+ OBJ_TAINTABLE(obj).
- * variable.c (classname): invalid warning at -v with static linked
- ruby interpreter.
+ * object.c (rb_obj_freeze): remove immediate_frozen_tbl
+ because all of immediate values are frozen. YAY!
- * eval.c (is_defined): modified for expr::Const support.
+ * object.c (rb_obj_frozen_p): ditto.
- * eval.c (rb_eval): invoke method expr::Const if expr is not class
- nor module.
+ * test/ruby/test_eval.rb: skip instance_variable_set for
+ frozen objects.
- * parse.y (primary): enable expr::identifier as method
- invocation.
+ * test/ruby/test_weakmap.rb: check ArgumentError instead of
+ RuntimeError.
+
+Thu Sep 11 10:03:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Dec 23 03:04:36 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/rdoc.rb, lib/rdoc, test/rdoc: Update to RDoc 4.2.0.alpha(21b241a)
- * regex.c (re_match): avoid too many loop pops for (?:..).
+Wed Sep 10 17:52:25 2014 Koichi Sasada <ko1@atdot.net>
-Tue Dec 22 18:01:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * compile.c (rb_vm_addr2insn): rename to rb_vm_insn_addr2insn
+ to clear what address.
- * experimental version 1.1d1 released.
+Wed Sep 10 16:22:26 2014 Koichi Sasada <ko1@atdot.net>
-Mon Dec 21 01:33:03 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_gc.rb: fix condition.
- * eval.c (TMP_PROTECT): add volatile to ensure GC protection.
+Wed Sep 10 15:29:46 2014 Eric Wong <e@80x24.org>
- * string.c (rb_str_gsub_bang): calculate buffer size properly.
+ * vm_core.h (rb_call_info_t): ci->flag becomes 32-bit unsigned int
+ ci->index becomes a 32-bit signed int (from signed long).
+ Reorder for better packing on 64-bit, giving an 8 byte reduction
+ from 104 to 96 bytes for each ci.
+ [Feature #10187]
- * parse.y (lex_get_str): needed to return Qnil at EOS.
+ * compile.c (new_callinfo, setup_args, iseq_compile_each,
+ iseq_build_from_ary_body): adjust for type changes
- * eval.c (find_file): check policy modified, raise exception
- immediately for tainted load_path.
+ * vm_insnhelper.c (vm_getivar): ditto
- * hash.c (rb_f_setenv): do not depend on setenv() nor putenv().
+Wed Sep 10 15:07:35 2014 Eric Wong <e@80x24.org>
-Thu Dec 17 06:29:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * compile.c (rb_iseq_translate_threaded_code):
+ modify in-place w/o copy
+ (rb_vm_addr2insn): new function for debug
+ (rb_iseq_original_iseq): ditto
+ (iseq_set_sequence): assign iseq_encoded directly
+ [Feature #10185]
- * ext/tk/tkutil.c (tk_s_new): use rb_obj_instance_eval(), instead
- of rb_yield_0().
+ * vm_core (rb_iseq_t): move original ->iseq to bottom
- * eval.c (rb_f_require): forgot to call find_file in some cases.
+ * iseq.c (iseq_free, iseq_free): adjust for new layout
+ (rb_iseq_disasm): use original iseq for dump
+ (iseq_data_to_ary): ditto
+ (rb_iseq_line_trace_each): ditto
+ (rb_iseq_build_for_ruby2cext): use iseq_encoded directly
- * eval.c (rb_f_require): `require "feature.so"' to load dynamic
- libraries. old `require "feature.o"' is still OK.
+ * vm_dump.c (rb_vmdebug_debug_print_pre): use original iseq
- * eval.c (rb_eval): yield without value dumped core.
+Wed Sep 10 15:00:11 2014 Eric Wong <e@80x24.org>
-Wed Dec 16 16:28:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * time.c (time_mark): remove NULL check
+ (time_memsize): ditto
+ (time_free): remove, use RUBY_TYPED_DEFAULT_FREE instead
+ [Feature #10219]
- * experimental version 1.1d0 (pre1.2) released.
+Wed Sep 10 14:14:57 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Dec 16 10:43:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * common.mk (encs enc trans libencs libenc libtrans): force to run
+ enk.mk because common.mk does not know the dependency, but enk.mk
+ knows. [ruby-dev:48530] [Bug #10220]
- * regex.c (re_search): bound check before calling re_match().
+Wed Sep 10 11:59:10 2014 Koichi Sasada <ko1@atdot.net>
-Tue Dec 15 13:59:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (gc_stat): update rdoc.
- * error.c (exc_to_s): returns class name for unset mesg.
+Wed Sep 10 11:52:08 2014 Koichi Sasada <ko1@atdot.net>
- * error.c (exc_initialize): do not initialize @mesg by "".
+ * gc.c (gc_stat_internal): rename:
+ * malloc_increase -> malloc_increase_bytes
+ * malloc_limit -> malloc_increase_bytes_limit
+ * oldmalloc_increase -> oldmalloc_increase_bytes
+ * oldmalloc_limit -> oldmalloc_increase_bytes_limit
+ ref: [Feature #9924]
- * parse.y (nextc): __END__ should handle CR+LF newlines.
+Wed Sep 10 11:45:40 2014 Koichi Sasada <ko1@atdot.net>
-Wed Dec 9 13:37:12 1998 MAEDA shugo <shugo@aianet.ne.jp>
+ * gc.c (gc_stat_internal): rename `heap_used' to `heap_allocated_pages'.
+ ref: [Feature #9924]
- * pack.c (encodes): use buffering for B-encoding.
+ * test/ruby/test_gc.rb: add constraints test for gc stat information.
- * pack.c (pack_pack): Q-encoding by 'M'.
+Wed Sep 10 11:31:16 2014 Koichi Sasada <ko1@atdot.net>
-Tue Dec 8 14:10:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (gc_stat_internal): rename:
+ * remembered_shady_object -> remembered_wb_unprotected_objects
+ * remembered_shady_object_limit -> remembered_wb_unprotected_objects_limit
+ * old_object -> old_objects
+ * old_object_limit -> old_objects_limit
+ ref: [Feature #9924]
- * variable.c (generic_ivar_get): any object can have instance
- variables now. great improvement.
+Wed Sep 10 11:12:25 2014 Koichi Sasada <ko1@atdot.net>
- * variable.c (rb_name_class): do not set __classpath__ by default,
- use __classid__ instead.
+ * gc.c (gc_stat_internal): support:
+ * total_allocated_pages
+ * total_freed_pages
+ ref: [Feature #9924]
-Mon Dec 7 22:08:22 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 10 10:48:04 2014 Koichi Sasada <ko1@atdot.net>
- * ruby.h (struct RFile): IO objects can have instance variables now.
+ * test/ruby/test_gc.rb: catch up last fix.
- * parse.y (primary): allows `def obj::foo; .. end'.
+Wed Sep 10 10:36:08 2014 Koichi Sasada <ko1@atdot.net>
-Mon Dec 7 18:24:50 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
+ * gc.c (objspace_total_slot): rename objspace_available_slots.
- * ruby.c (set_arg0): $0 supprt for HP-UX.
+ * gc.c (objspace_live_slot, objspace_free_slot): rename
+ ..._slot() to ..._slots().
-Mon Dec 7 01:30:28 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * gc.c (objspace_free_slot): should subtract heap_pages_final_slots.
- * dln.c (dln_strerror): better error messages on win32.
+ * gc.c (gc_stat_internal):
+ * add `heap_available_slots' field
+ * rename heap_live_slot to heap_live_slots
+ * rename heap_free_slot to heap_free_slots
+ ref: [Feature #9924]
-Sat Dec 5 23:27:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 10 07:22:53 2014 Koichi Sasada <ko1@atdot.net>
- * parse.y (here_document): indentable here-doc delimiter by
- `<<-'. Proposed by Clemens <c.hintze@gmx.net>. Thanks.
+ * gc.c: refactoring for RGENGC_PROFILE > 0.
-Thu Dec 3 16:50:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * rename rb_objspace_t::profile::..._count
+ to rb_objspace_t::profile::total_..._count
+ * rename promote_infant_types to promote_types
- * ext/extmk.rb.in (realclean): trouble on install.
+ * gc.c (gc_remember_unprotected): count remembered shady objects here.
-Sun Nov 29 22:25:39 1998 Takaaki Tateishi <ttate@jaist.ac.jp>
+Wed Sep 10 03:12:12 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
- * process.c (f_exec): check number of argument.
+ * gc.c (init_mark_stack): MEMZERO() receive type as 2nd argument instead
+ of size.
+ Coverity Scan found this bug.
-Thu Nov 26 17:27:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 21:55:39 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * version 1.1c9 released.
+ * ext/win32ole/sample/excel2.rb: remove some commented-out code.
+ rotate graph more slowly to see graph clearly.
-Wed Nov 25 13:07:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 19:52:33 2014 Koichi Sasada <ko1@atdot.net>
- * string.c (rb_str_dup): do not copy additional data (STR_NO_ORIG).
+ * gc.c: rename rb_objspace_t::marked_objects to marked_slots.
- * parse.y (yycompile): reduce known memory leak (hard to remove).
+ * gc.c (gc_marks_start): should be clear first.
-Wed Nov 25 03:41:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (gc_marks_start): remembered shady objects are also marked.
- * st.c (st_init_table_with_size): round size up to prime number.
+ * gc.c (gc_stat_internal): add heap_marked_slots.
-Sat Nov 21 23:27:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 18:58:48 2014 Koichi Sasada <ko1@atdot.net>
- * hash.c (rb_hash_aset): reduce copying key strings.
+ * gc.c: rename
+ * total_allocated_object_num -> total_allocated_objects
+ * total_allocated_object_num_at_gc_start -> total_allocated_objects_at_gc_start
+ * total_freed_object_num -> total_freed_objects
- * gc.c (looks_pointerp): declare as inline function if possible.
+ * gc.c (gc_stat_internal):
+ * rename total_allocated_object -> total_allocated_objects
+ * rename total_freed_object -> total_freed_objects
- * st.c (PTR_NOT_EQUAL): compare hash values first before calling
- comparing function.
+Tue Sep 9 18:51:36 2014 Koichi Sasada <ko1@atdot.net>
- * st.c (ADD_DIRECT): save hash value in entries to reduce hash
- calculation.
+ * gc.c (gc_stat_internal): fix symbol names
+ * heap_final_slot -> heap_final_slots
+ * heap_swept_slot -> heap_swept_slots
- * string.c (rb_str_gsub_bang): avoid rb_scan_args() to speed-up.
+Tue Sep 9 18:18:07 2014 Koichi Sasada <ko1@atdot.net>
- * string.c (rb_str_sub_bang): ditto.
+ * gc.c (rb_objspace_t::heap_pages): rename field names:
+ * used -> allocated_pages
+ * increment -> allocatable_pages
+ * length -> sorted_length
+ And remove unused `limit' field.
-Sat Nov 21 18:44:06 1998 Masaki Fukushima <fukusima@goto.info.waseda.ac.jp>
+ * gc.c: rename macros:
+ * heap_pages_used -> heap_allocated_pages
+ * heap_pages_length -> heap_pages_sorted_length
+ * heap_pages_increment -> heap_allocatable_pages
- * time.c (time_s_now): had memory leak.
+ * gc.c (gc_stat_internal): fix symbol names
+ * heap_used -> heap_allocated_pages
+ * heap_eden_page_length -> heap_eden_pages
+ * heap_tomb_page_length -> heap_tomb_pages
+ * heap_increment -> heap_allocatable_pages
+ * heap_length -> heap_sorted_length
- * ext/md5/md5init.c (md5_new): had memory leak.
+ ref: [Feature #9924]
+ https://docs.google.com/spreadsheets/d/11Ua4uBr6o0k-nORrZLEIIUkHJ9JRzRR0NyZfrhEEnc8/edit?usp=sharing
+ Yellow color fields in this table are changed.
- * ext/md5/md5init.c (md5_clone): ditto.
+ * test/ruby/test_gc.rb: catch up this change.
-Fri Nov 20 23:23:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 14:56:03 2014 Koichi Sasada <ko1@atdot.net>
- * lib/delegate.rb: do not propagate hash and eql?.
+ * gc.c: continue layout changing.
-Thu Nov 19 01:40:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ newobj_of() also touch:
+ (4) increment total_allocated_object_num
+ (5) check hook_events
- * sample/ruby-mode.el (ruby-expr-beg): failed to find reserved
- word boundary.
+ And gather fields related to marking phase.
- * eval.c (rb_eval): avoid calling `concat' method. calls
- rb_ary_concat() directly for efficiency.
+Tue Sep 9 14:21:50 2014 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_eval): actual rest arguments extended arrays too much.
+ * gc.c: fix layout of rb_objspace_t to improve cache locality.
-Wed Nov 18 14:30:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ newobj_of() accesses:
+ (1) rb_objspace_t::flags
+ (2) rb_objspace_t::eden_heap::freelist
+ (3) and rb_objspace_t::eden_heap::free_pages if freelist is NULL.
- * class.c (rb_define_global_function): global functions now be
- module function of the Kernel.
+Tue Sep 9 14:09:36 2014 Koichi Sasada <ko1@atdot.net>
-Wed Nov 18 10:48:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c: move rb_objspace_t::flags::gc_stressful after during_gc
+ to make accessing both parameters easy.
- * io.c (read_all): SEGV on large files.
+ * gc.c (heap_get_freeobj): add LIKELY() hint.
-Tue Nov 17 18:11:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (heap_get_freeobj_from_next_freepage): ditto.
- * version 1.1c8 released.
+ * gc.c (newobj_of): check both parameters at once for exceptional
+ case.
-Tue Nov 17 16:58:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 13:51:32 2014 Koichi Sasada <ko1@atdot.net>
- * parse.y (arg): assignment to attribute name start with capital
- should be allowed.
+ * gc.c: add rb_objspace_t::flags::gc_stressful and
+ ruby_gc_stressful macro.
+ Rename objspace->gc_stress to objspace->gc_stress_mode.
- * eval.c (thread_alloc): needed to mark terminated threads too.
+ If objspace->gc_stress_mode is true (!nil and !false) then
+ ruby_gc_stressful becomes TRUE.
-Tue Nov 17 12:33:48 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
+ ruby_gc_stressful will speedup newobj_of() slightly.
- * ext/extmk.rb.in (create_makefile): Set `libdir' to `@libdir@',
- Set `pkglibdir' to `$libdir/$(RUBY_INSTALL_NAME)'.
+ * gc.c: initialize ruby_gc_stress(full|_mode) by gc_params.gc_stress
+ even if ENABLE_VM_OBJSPACE is false.
-Tue Nov 17 10:30:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 13:05:50 2014 Koichi Sasada <ko1@atdot.net>
- * sprintf.c (f_sprintf): %l%%c -> %%l%c
+ * gc.c: remove ruby_disable_gc_stress and add ruby_disable_gc
+ to speed-up newobj_of().
-Tue Nov 17 01:08:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (ready_to_gc): check ruby_disable_gc.
- * parse.y (ret_args): distinguish `a' and `*a' for the arguments
- of yield and return.
+ * signal.c: use ruby_disable_gc.
- * eval.c (rb_eval): flip3 should work like sed.
+Tue Sep 9 12:11:41 2014 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_eval): flip{2,3} now have independent state for each
- scope to work fine with thread.
+ * gc.c: rename gc_stat entries and check stat transition.
-Mon Nov 16 23:26:29 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 9 12:06:03 2014 Koichi Sasada <ko1@atdot.net>
- * parse.y (primary): exec else clause if no exception raised.
+ * gc.c (gc_sweep_rest): remove wrong modification of during_gc flag.
-Sun Nov 15 15:44:07 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+Tue Sep 9 11:39:41 2014 Koichi Sasada <ko1@atdot.net>
- * ext/extmk.rb.in (install): bug in target.
+ * gc.c: pack boolean values into rb_objspace_t::flags with bit fields
+ to improve cache locality.
-Sat Nov 14 11:02:05 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
+Tue Sep 9 11:11:05 2014 Koichi Sasada <ko1@atdot.net>
- * Makefile.in (install): Give the argument `$(DESTDIR)' to
- `instruby.rb'.
- * instruby.rb: Recognize ARG[0] as `destdir'.
- * instruby.rb: Give the argument `destdir' to `extmk.rb'.
- * ext/extmk.rb.in: Recognize ARG[1] as `$destdir'.
+ * test/ruby/test_object.rb: extend timeout.
- * instruby.rb: Create the installation directories (bindir, libdir,
- archdir, pkglibdir, archdir, and mandir) under `destdir', and
- install all files under there.
- * ext/extmk.rb.in: Likewise.
-
-Sat Nov 14 10:56:55 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
+Tue Sep 9 09:02:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * instruby.rb: Add the variable `pkglibdir'.
- * instruby.rb: Set the variable `libdir' to `$(libdir)', not
- `$(libdir)/$(ruby_install_name)'. `libruby.so' and `libruby.so.LIB'
- are installed at `libdir'.
- * instruby.rb: Set the variable `archdir' to `$(pkglibdir)/$(arch)'.
+ * lib/mkmf.rb (MakeMakefile#pkg_config): append --cflags to also
+ $CXXFLAGS, as they are often used by C++ compiler.
+ [ruby-core:54532] [Bug #8315]
-Fri Nov 13 19:43:29 1998 KIMURA Koichi <kbk@kt.rim.or.jp>
+Tue Sep 9 07:03:22 2014 Eric Wong <e@80x24.org>
- * missing/nt.c (SafeFree): wrong free offset.
+ * compile.c: remove needless SYM2ID <-> ID2SYM conversions
+ [misc #10207]
-Thu Nov 12 20:11:53 1998 Koji Arai <JCA02266@nifty.ne.jp>
+Tue Sep 9 05:48:42 2014 Eric Wong <e@80x24.org>
- * sample/ruby-mode.el: wrong highlight.
+ * symbol.c (rb_intern_cstr_without_pindown): check dsymbol on return
+ This is not a complete fix for bug 10206, but seems to reduce
+ that crash and also looks correct.
- * parse.y (parse_regx): newline in regexp was ignored.
+Tue Sep 9 04:36:24 2014 Eric Wong <e@80x24.org>
-Wed Nov 11 10:54:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_core.h (rb_env_t): use flexible array
+ This reduces allocations and speeds up the lambda calculus
+ fizzbuzz (bm_app_lc_fizzbuzz.rb) benchmark [ruby-core:64858]
+ * proc.c (get_local_variable_ptr): deconst to adjust for flex array
+ * vm.c (env_mark, env_free, env_memsize): remove check for env->env
+ * vm.c (env_alloc): single allocation for flex array
+ * vm.c (vm_make_env_each): adjust env_alloc call
- * parse.y (here_document): <<'FOO' should not escape anything.
+Mon Sep 8 16:08:22 2014 Koichi Sasada <ko1@atdot.net>
- * parse.y (here_document): bare << here-doc available, even though
- it's deprecated.
+ * benchmark/bm_app_lc_fizzbuzz.rb: should skip output on benchmark.
- * file.c (rb_file_s_readlink): return value should be tainted.
+Mon Sep 8 16:04:02 2014 Koichi Sasada <ko1@atdot.net>
- * ext/etc/etc.c (setup_passwd): information (eg. GCOS name) should
- be tainted (modified at Perl Conference).
+ * benchmark/bm_app_lc_fizzbuzz.rb: `answer.to_a' does not return
+ a string, but an array.
-Tue Nov 10 00:22:11 1998 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+Mon Sep 8 13:18:37 2014 Koichi Sasada <ko1@atdot.net>
- * configure.in: elf supprt for FreeBSD 3.x
+ * benchmark/bm_app_lc_fizzbuzz.rb: added.
-Tue Nov 10 00:05:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ This program is described closely in "Understanding Computation"
+ chapter 6 by Tom Stuart. <http://computationbook.com/>
- * parse.y (yylex): here document available in eval.
+ Japanese translation will be published soon.
+ <http://www.oreilly.co.jp/books/9784873116976/>
-Mon Nov 9 17:55:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Sep 8 12:01:39 2014 Koichi Sasada <ko1@atdot.net>
- * version 1.1c7 released.
+ * gc.c: add incremental GC algorithm. [Feature #10137]
-Fri Nov 6 19:25:27 1998 Takao KAWAMURA <kawamura@ike.tottori-u.ac.jp>
+ Please refer this ticket for details.
- * sample/ruby-mode.el: font-lock patch.
+ This change also introduces the following changes.
-Thu Nov 5 15:42:22 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * Remove RGENGC_AGE2_PROMOTION and introduce object age (0 to 3).
+ Age can be count with FL_PROMOTE0 and FL_PROMOTE1 flags in
+ RBasic::flags (2 bit). Age == 3 objects become old objects.
+ * WB_PROTECTED flag in RBasic to WB_UNPROTECTED bitmap.
+ * LONG_LIVED bitmap to represent living objects while minor GCs
+ It specifies (1) Old objects and (2) remembered shady objects.
+ * Introduce rb_objspace_t::marked_objects which counts marked
+ objects in current marking phase. marking count is needed to
+ introduce incremental marking.
+ * rename mark related function and sweep related function to
+ gc_(marks|sweep)_(start|finish|step|rest|continue).
+ * rename rgengc_report() to gc_report().
+ * Add obj_info() function to get cstr of object details.
+ * Add MEASURE_LINE() macro to measure execution time of specific line.
+ * and many small fixes.
- * sample/README, lib/README: simple description for each file.
+ * include/ruby/ruby.h: add flag USE_RINCGC.
+ Now USE_RINCGC can be set only with USE_RGENGC.
-Wed Nov 4 18:14:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h: introduce FL_PROMOTED0 and add FL_PROMOTED1
+ to count object age.
- * eval.c (assign): attribute assignment should be called as public.
+ * include/ruby/ruby.h: rewrite write barriers for incremental marking.
-Tue Nov 3 23:36:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * debug.c: catch up flag name changes.
- * string.c (rb_str_dump): dumps core for negative char value.
+ * internal.h: add rb_gc_writebarrier_remember() instead of
+ rb_gc_writebarrier_remember_promoted().
- * regex.c (re_compile_pattern): out of boundary access for empty
- regexp.
+ * array.c (ary_memcpy0): use rb_gc_writebarrier_remember().
-Mon Nov 2 22:54:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * array.c (rb_ary_modify): ditto.
- * string.c (rb_str_aset): `str[str]' replaces first match.
+ * hash.c (rb_hash_keys): ditto.
-Mon Nov 2 18:24:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * hash.c (rb_hash_values): ditto.
- * eval.c (thread_create): was accessing modified status.
+ * object.c (init_copy): use rb_copy_wb_protected_attribute() because
+ FL_WB_PROTECTED is moved from RBasic::flags.
-Sun Nov 1 01:18:52 1998 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+ * test/objspace/test_objspace.rb: catch up ObjectSpace.dump() changes.
- * gc.c (xrealloc): size 0 needs round up to 1.
+Sun Sep 7 12:47:06 2014 Tanaka Akira <akr@fsij.org>
-Sat Oct 31 23:18:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * process.c: PTHREAD_CANCEL_DISABLE is not defined on Android.
- * string.c (rb_str_split_method): negative LIMIT means number of
- splitted fields are unlimited, as in perl.
+Sat Sep 6 20:59:06 2014 Tanaka Akira <akr@fsij.org>
- * string.c (rb_str_split_method): if LIMIT is unspecified,
- trailing null fields are stripped.
+ * process.c (has_privilege): The gid zero is not a privilege.
-Sat Oct 31 04:16:14 1998 Inaba Hiroto <inaba@st.rim.or.jp>
+Sat Sep 6 20:19:16 2014 Tanaka Akira <akr@fsij.org>
- * string.c (str_aref): regexp index SEGVed.
+ * process.c (struct child_handler_disabler_state): cancelstate field
+ added.
+ (disable_child_handler_before_fork): Record cancelstate.
+ (disable_child_handler_fork_parent): Restore cancelstate.
-Fri Oct 30 14:33:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 6 19:27:10 2014 Tanaka Akira <akr@fsij.org>
- * re.c (reg_match): returns nil for unmatch.
+ * process.c (struct child_handler_disabler_state): Defined.
- * dir.c (dir_entries): new method.
+Sat Sep 6 18:31:32 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (block_pass): do not push block, substitute it.
+ * lib/rake.rb, lib/rake/*, test/rake/*: Update latest rake master(e47d023)
-Fri Oct 30 01:28:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 6 16:38:08 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * range.c (range_check): avoid <=> check for Fixnums.
+ * ext/win32ole/win32ole_variant.c (ole_val2variant_err,
+ ole_val2variantdata, Init_win32ole_variant): support VT_ERROR
+ variant with error code. add WIN32OLE_VARIANT::NoParam.
+ * test/win32ole/test_win32ole_variant.rb(test_c_noparam,
+ test_vt_error_noparam): ditto.
+ * ext/win32ole/win32ole.c: ditto.
- * array.c (rb_ary_aset): accept negative index.
+Sat Sep 6 11:08:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Oct 28 22:00:54 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * parse.y (arg_ambiguous_gen): fix warning message, "even" does
+ not mean the number of spaces here. state the place to put a
+ space and the operator. [ruby-core:64790] [Bug #10204]
- * regex.c (re_match): access out of boundary fixed.
+Sat Sep 6 08:44:40 2014 Zachary Scott <e@zzak.io>
-Wed Oct 28 11:37:42 1998 TAMITO <tommy@valley.ne.jp>
+ * lib/rdoc/generator/template/darkfish/js/jquery.js: Backport
+ rdoc/rdoc@74f60fcb04fee1778fe2694d1a0ea6513f8e67b7
- * io.c (f_select): fd number comparison bug.
+Sat Sep 6 08:10:44 2014 Eric Wong <e@80x24.org>
-Tue Oct 27 23:07:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_io.rb (test_readpartial_locktmp): use IO#nonblock=
+ Old fcntl invocation may drop necessary flags on some platforms.
- * sample/ruby-mode.el (ruby-parse-region): forgot to support %w()
- style array literal.
+Sat Sep 6 07:46:51 2014 Eric Wong <e@80x24.org>
- * eval.c (rb_eval): unused block raises warning.
+ * test/ruby/test_io.rb (test_readpartial_locktmp): avoid EBADF
+ [ruby-core:64773] [ruby-core:64775]
-Mon Oct 26 09:37:53 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 6 01:34:31 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (dvar_asgn_push): dvar pushed too many times if
- variable-in-block first appear in loops.
+ * process.c (rb_f_exec): Call before_exec_async_signal_safe and
+ after_exec_async_signal_safe around rb_exec_async_signal_safe.
+ (rb_exec_async_signal_safe): Don't call
+ before_exec_async_signal_safe and after_exec_async_signal_safe.
+ (rb_exec_without_timer_thread): Call before_exec and
+ after_exec.
+ (disable_child_handler_fork_child): Make SIGPIPE handler SIG_DFL.
-Sun Oct 25 22:59:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Sep 6 00:49:41 2014 Tanaka Akira <akr@fsij.org>
- * regex.c (set_list_bits): was using wrong offset.
+ * signal.c (ruby_signal): Don't set SA_SIGINFO for SIG_IGN and
+ SIG_DFL.
-Thu Oct 22 00:07:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 5 21:45:33 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_obj_method): method retrieved from tainted object
- should be tainted too.
+ * process.c (disable_child_handler_before_fork): New function.
+ (disable_child_handler_fork_parent): Ditto.
+ (disable_child_handler_fork_child): Ditto.
+ (retry_fork_async_signal_safe): Call above functions to disable
+ signal handlers in child process.
- * eval.c (method_call): safe_level should be restored during
- Method#call.
+Fri Sep 5 21:02:54 2014 Tanaka Akira <akr@fsij.org>
-Wed Oct 21 14:21:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * process.c (handle_fork_error): Make try_gc_p argument volatile to
+ suppress "clobbered" warning.
- * io.c (Init_IO): new constants IO::SEEK_{SET,CUR,END}.
+Fri Sep 5 20:48:06 2014 Tanaka Akira <akr@fsij.org>
- * io.c (rb_f_ungetc): ungetc pushes a char back into STDIN.
+ * process.c (handle_fork_error): Don't need state_p argument.
-Mon Oct 19 11:50:00 1998 Motoyuki Kasahara <m-kasahr@sra.co.jp>
+Fri Sep 5 20:35:52 2014 Tanaka Akira <akr@fsij.org>
- * ext/extmk.rb: Load '@top_srcdir@/lib/find.rb', not
- '../lib/find.rb'.
- * ext/extmk.rb: Distinguish between `top_srcdir' and `topdir'.
- * Makefile.in (CFLAGS): Add `-I.'.
- * Makefile.in (lex.c): Give `@srcdir@/keywords' to gperf, not
- `keywords'.
- * instruby.rb: Use `CONFIG["bindir"]', instead of `prefix + "/bin"'.
- * instruby.rb: Use `CONFIG["libdir"]', instead of `prefix + "/lib"'.
- * instruby.rb Use `CONFIG["mandir"]', instead of `prefix + "/man"'.
- * instruby.rb (wdir): Add the variable to preserve the current
- working directory.
- * instruby.rb: Chdir to wdir before install `config.h' and
- `rbconfig.rb'.
+ * process.c (has_privilege): Fix a return value.
-Mon Oct 19 10:07:01 1998 EGUCHI Osamu <eguchi@shizuokanet.ne.jp>
+Fri Sep 5 19:00:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (rb_eval): reduce recursive calls to rb_eval().
+ * lib/shellwords.rb: proofreading documentation.
+ [Bug #10155][ruby-core:64471]
-Fri Oct 16 15:31:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 5 18:34:33 2014 Laurent Arnoud <laurent@spkdev.net>
- * time.c (time_new_internal): timeval must be positive.
+ * test/csv/test_row.rb: Added some missing tests in CSV.
+ [fix GH-710]
+ * test/csv/test_table.rb: ditto.
-Thu Oct 15 13:54:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 5 12:57:52 2014 Tanaka Akira <akr@fsij.org>
- * parse.y (arg): local variabls can be accessed within right side
- expression in assignment, notably in blocks.
+ * process.c (has_privilege): Refine uid/gid check.
-Wed Oct 14 00:18:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 5 12:40:55 2014 Tanaka Akira <akr@fsij.org>
- * array.c (Init_Array): Array#=== is now for equal check, not
- inclusion check.
+ * configure.in: Check sys/id.h, getuidx and getgidx for AIX.
- * parse.y (when_args): `when a, *b' style new syntax for array
- expansion in `case'.
+ * process.c (getresuid): Defined for AIX.
+ (getresgid): Ditto
+ AIX don't have getresuid/getresgid but getuidx/getgidx.
-Tue Oct 13 14:30:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Sep 5 12:28:21 2014 Tanaka Akira <akr@fsij.org>
- * object.c (rb_obj_untaint): taint marks can be unset.
+ * process.c (has_privilege): Fix assignments.
- * eval.c (rb_eval): taint propagation for embedded strings.
+Fri Sep 5 11:10:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Mon Oct 12 13:27:15 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/rdoc/generator/pot/po.rb: fixed broken tests for trailing whitespace.
+ * test/rdoc/test_rdoc_generator_pot.rb: ditto.
+ * test/rdoc/test_rdoc_generator_pot_po.rb: ditto.
- * eval.c (rb_call0): check stack depth more frequently.
+Fri Sep 5 10:41:07 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Mon Oct 12 08:08:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/rdoc/test_rdoc_rdoc.rb (TestRDocRDoc#test_parse_file_encoding):
+ typofix.
- * io.c (rb_p): can print even in secure mode.
+Fri Sep 5 10:39:14 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Sun Oct 11 22:50:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/rdoc.rb, lib/rdoc, test/rdoc: Update to RDoc 4.2.0.alpha(313287)
- * variable.c (rb_const_set): taint check for modification.
+Fri Sep 5 06:04:22 2014 Eric Wong <e@80x24.org>
- * variable.c (rb_ivar_set): taint check for modification.
+ * vm.c: remove unused USE_THREAD_RECYCLE [misc #10198]
- * string.c (rb_str_modify): taint check for modification.
+Fri Sep 5 00:29:08 2014 Tanaka Akira <akr@fsij.org>
- * hash.c (rb_hash_modify): taint check for modification.
+ * configure.in (dirfd): Check function.
- * array.c (rb_ary_modify): taint check for modification.
+ * dir.c (dir_fileno): New method.
+ [ruby-dev:48265] [Feature #9880]
- * ruby.h (FL_TAINT): taint for all objects, not only strings.
+Thu Sep 4 23:39:52 2014 Tanaka Akira <akr@fsij.org>
-Fri Oct 9 17:01:14 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * process.c (has_privilege): New function.
+ (retry_fork_async_signal_safe): Don't use vfork() for privileged
+ process.
- * io.c (read_all): read() returns "" at immediate EOF.
+ * configure.in (getresuid): Check function.
+ (getresgid): Ditto.
- * io.c (io_read): read(nil) read all until EOF.
+Thu Sep 4 20:22:14 2014 Laurent Arnoud <laurent@spkdev.net>
-Thu Oct 8 13:32:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/pathname/test_pathname.rb: added testcase for Pathname#mountpoint?.
+ [fix GH-709]
- * time.c (time_dump): marshal can dump Time object now.
+Thu Sep 4 20:09:21 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * marshal.c (Init_marshal): rename marshal methods `_dump_to' to
- `_dump', `_load_from' to `_load'.
+ * symbian/*: removed Symbian support.
+ [Feature #10199][ruby-core:64725]
+ * dln.c: ditto.
+ * include/ruby/defines.h: ditto.
+ * thread_pthread.c: ditto.
+ * vm.c: ditto.
- * parse.y (rb_intern): "+=".intern generates proper symbol.
+Thu Sep 4 17:44:40 2014 Koichi Sasada <ko1@atdot.net>
-Mon Oct 5 18:31:53 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * dir.c (glob_helper): use #ifdef instead of #if.
+ gcc's -Wundef option shows warning for undefined macro.
- * version 1.1c6 released.
+ * numeric.c (flo_is_finite_p): ditto.
-Fri Oct 2 14:22:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_dump.c (rb_vmdebug_thread_dump_state): ditto.
- * regex.c (re_search): `/\s*(--)$/ =~ "- --"' did not match,
- because of wrong optimize condition.
+ * vm_core.h: define VM_DEBUG_VERIFY_METHOD_CACHE to 0.
-Mon Oct 1 01:55:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Sep 4 03:57:46 2014 Eric Wong <e@80x24.org>
- * parse.y (rb_intern): should not raise exceptions.
+ * man/ruby.1: spelling fix ("bellow" => "below") [ci-skip]
- * parse.y (yylex): symbol like `:foo?=' should not be allowed.
+Thu Sep 4 03:52:16 2014 Eric Wong <e@80x24.org>
- * ext/extmk.rb.in: makes *.a for static link modules.
+ * man/ruby.1: add trailing slash to URLs [ci-skip]
-Wed Sep 30 14:13:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 3 19:10:28 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_thread_start): supports making a subclass of the
- Thread class.
+ * process.c (before_fork_ruby): Renamed from before_fork.
+ (after_fork_ruby): Renamed from after_fork.
-Tue Sep 29 17:46:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 3 18:56:05 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (rb_thread_join): join is now an instance method.
+ * process.c (forked_child): Removed.
-Fri Sep 25 12:01:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Sep 3 16:56:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (yylex): `@foo!' should be an error.
+ * object.c (rb_obj_copy_ivar): allocate no memory for empty
+ instance variables. [ruby-core:64700] [Bug #10191]
-Thu Sep 24 14:55:06 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
+Wed Sep 3 12:05:17 2014 Tanaka Akira <akr@fsij.org>
- * ext/etc/etc.c (Init_etc): wrong field definition.
+ * process.c (retry_fork_async_signal_safe): Use vfork() if available.
+ vfork() is still faster than fork() especially when the parent
+ process uses big memory.
-Thu Sep 17 17:09:05 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ ruby -rbenchmark -e 'a = "a" * 1_000_000_000; puts Benchmark.measure { system("true") }'
+ fork: 0.000000 0.010000 0.010000 ( 0.014968)
+ vfork: 0.000000 0.000000 0.000000 ( 0.000912)
+ on Debian sid.
- * io.c (io_reopen): was creating FILE* for wrong fd.
+Wed Sep 3 11:33:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Sep 15 05:28:11 1998 Koji Arai <JCA02266@nifty.ne.jp>
+ * test/openssl/test_pkey_rsa.rb (OpenSSL#test_sign_verify_memory_leak):
+ added timeout into testcase for low performance environment.
+ [Bug #9984][ruby-core:63367]
- * regex.c (re_compile_pattern): forgot to fixup for the pattern
- like (?=(A)|(B)).
+Wed Sep 3 07:50:15 2014 Tanaka Akira <akr@fsij.org>
-Tue Sep 15 01:06:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * configure.in: Use AC_FUNC_FORK.
- * io.c (rb_io_gets_internal): do not set $_ by default, only
- gets/readline set the variable.
+ * io.c: Use HAVE_WORKING_FORK instead of HAVE_FORK.
- * eval.c (rb_f_load): load toplevel class is set to anonymous
- module if safe_level >= 5, to encapsulate modification.
+ * process.c: Ditto.
- * eval.c (rb_f_load): set frame properly.
+Wed Sep 3 00:12:44 2014 Tanaka Akira <akr@fsij.org>
- * string.c (rb_str_each_line): do not set $_.
+ * process.c (retry_fork_async_signal_safe): Don't return on in child
+ process.
-Mon Sep 14 14:42:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 2 23:47:35 2014 Tanaka Akira <akr@fsij.org>
- * regex.c (re_match): beginning and end of the string, do not
- automatically match `\b'.
+ * process.c (retry_fork_async_signal_safe): Specialized version of
+ retry_fork respect to rb_fork_async_signal_safe.
+ (retry_fork_ruby): Specialized version of retry_fork respect to
+ rb_fork_ruby.
+ (rb_fork_ruby): Removed.
- * string.c (scan_once): comsume at leaset on character.
+Tue Sep 2 23:26:26 2014 Tanaka Akira <akr@fsij.org>
- * regex.c (re_search): wrong behavior for negative range.
+ * process.c (send_child_error): Simplified.
+ (recv_child_error): Ditto.
-Sat Sep 12 21:21:26 1998 Koji Arai <JCA02266@nifty.ne.jp>
+Tue Sep 2 22:56:25 2014 Tanaka Akira <akr@fsij.org>
- * regex.c (re_search): range value should be maintained.
+ * process.c (rb_fork_async_signal_safe): Inline rb_fork_internal.
+ (rb_fork_ruby): Ditto.
+ (rb_fork_internal): Removed.
+ (chfunc_protect): Removed.
-Thu Sep 10 10:55:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 2 22:43:52 2014 Tanaka Akira <akr@fsij.org>
- * parse.y (backref_error): yyerror does not understand formats.
+ * test/ruby/test_io.rb (test_new_with_block): Set autoclose to avoid
+ EBADF.
-Tue Sep 8 18:05:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 2 22:01:51 2014 Kouhei Sutou <kou@cozmixng.org>
- * version 1.1c5 released.
+ * Makefile.in (update-coverage): Remove a never executed line.
-Tue Sep 8 10:03:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 2 19:48:26 2014 Tanaka Akira <akr@fsij.org>
- * string.c (str_each_line): wrong line splitting with newline at
- top of the string.
+ * process.c (handle_fork_error): Extracted from retry_fork.
- * string.c: non bang methods return copied string.
+Tue Sep 2 17:02:53 2014 Vit Ondruch <v.ondruch@tiscali.cz>
- * eval.c (f_END): needed to initialize frame->argc;
+ * tool/rbinstall.rb: fixed error of local installation.
+ [Bug #10192][ruby-core:64702]
-Fri Sep 4 11:27:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Sep 2 16:58:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * bignum.c (bigadd): proper sign combination.
+ * test/runner.rb: reporting test coverage for test-all with COVERAGE env.
+ [Feature #10189][ruby-core:64681][fix GH-708]
+ * Makefile.in: added task for coverage report.
+ * common.mk: added definition of forked simplecov url.
+ * .gitignore: ignored coverage directory.
- * regex.c (re_search): wrong return value for \A.
+Mon Sep 1 20:11:02 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
->>>>>>> 1.1.1.2.2.154
-Thu Sep 3 14:08:14 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c (rbtime2vtdate): try to convert millisecond
+ of Time object to millisecond of VT_DATE VARIANT.
+ * test/win32ole/test_win32ole_variant.rb
+ (test_conversion_time2date_with_msec): ditto.
- * version 1.1c4 released.
+Sun Aug 31 16:58:49 2014 Tanaka Akira <akr@fsij.org>
-Tue Sep 1 10:47:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/benchmark.rb: Fix a syntax error.
- * regex.c (slow_search): do not compare llen and blen. llen may
- be longer than blen, if little contains 0xff.
+Sun Aug 31 08:46:44 2014 Eric Wong <e@80x24.org>
- * regex.c (mbctab_euc): set 0x8e as multibyte character.
+ * ext/zlib/zlib.c (gzfile_reset): preserve ZSTREAM_FLAG_GZFILE
+ [Bug #10101]
- * string.c (str_inspect): mask character for octal output.
+ * test/zlib/test_zlib.rb (test_rewind): test each_byte
-Mon Aug 31 15:32:41 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Aug 30 19:22:47 2014 Eric Wong <e@80x24.org>
- * regex.c (re_search): use calculated offset if exactn is the
- first opcode in the compiled regexp.
+ * symbol.c (rb_sym2id): do not return garbage object
- * regex.c (bm_search): use Boyer-Moore search for simple search.
+Sat Aug 30 06:39:48 2014 Aaron Patterson <aaron@tenderlovemaking.com>
- * regex.c (must_instr): wrong length check if pattern includes
- byte escape by 0xff.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: fix NameError dumping and
+ loading. Fixes GH #85. Thanks @brentdax for the patch!
+ * test/psych/test_exception.rb: test for fix
- * regex.c (re_compile_pattern): need not to check current_mbctype.
+Sat Aug 30 06:23:40 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Aug 29 16:31:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/psych/lib/psych/scalar_scanner.rb: fix loading strings that
+ look like integers but have a newline. Fixes GH #189
+ * test/psych/test_string.rb: test for fix
- * eval.c (rb_check_safe_str): avoid calling rb_id2name() in normal
- cases to speed-up.
+Sat Aug 30 06:10:39 2014 Aaron Patterson <aaron@tenderlovemaking.com>
- * eval.c (thread_raise): do not save context of terminated thread.
+ * ext/psych/lib/psych/visitors/to_ruby.rb: merge keys with a hash
+ should merge the hash in to the parent.
+ * test/psych/test_merge_keys.rb: test for change. Fixes GH #202
- * regex.c (re_compile_pattern): mask \nnn over 256.
+Sat Aug 30 06:00:26 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-Sat Aug 29 02:09:46 1998 1998 Koji Arai <JCA02266@nifty.ne.jp>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: quoted "<<" strings
+ should not be treated as merge keys.
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: hashes with keys
+ containing "<<" should roundtrip.
+ * test/psych/test_merge_keys.rb: test for change. Fixes GH #203
- * sprintf.c (f_sprintf): wrong buffer size check.
+Fri Aug 29 17:56:44 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Aug 28 01:57:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/net/imap/test_imap_response_parser.rb: removed needless code.
- * regex.c (re_compile_pattern): accepts (?ix-ix) and (?ix-ix:...).
+Fri Aug 29 17:36:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Aug 28 12:25:33 1998 Hiroshi Igarashi <igarashi@ueda.info.waseda.ac.jp>
+ * test/rinda/test_rinda.rb: removed useless assignment variables.
+ * test/rss/rss-assertions.rb: ditto.
+ * test/rss/test_maker_itunes.rb: ditto.
- * ruby.c (ruby_require_modules): load modules in appearing order.
+Fri Aug 29 16:18:26 2014 Eric Wong <e@80x24.org>
-Fri Aug 28 01:57:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * string.c: revert part of r47311, add rb_vm_fstring_table(),
+ remove vm_core.h dependency. [ruby-core:64627]
- * regex.c (re_compile_pattern): accepts (?ix-ix) and (?ix-ix:...).
+Fri Aug 29 15:17:13 2014 Eric Wong <e@80x24.org>
-Thu Aug 27 12:54:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * string.c: remove static frozen_strings
+ * string.c (Init_frozen_strings): new function
+ * string.c (rb_fstring): remove check for frozen strings,
+ use per-VM table
+ * string.c (rb_str_free): use per-VM table
+ * string.c (Init_String): use per-VM table
+ * vm_core.h (rb_vm_t): add frozen_strings table
+ * internal.h (Init_frozen_strings): new function prototype
+ * eval.c (ruby_setup): call Init_frozen_strings
+ [Feature #10182]
- * version 1.1c3 released.
+Wed Aug 27 23:10:24 2014 Masaki Matsushita <glass.saga@gmail.com>
-Wed Aug 26 14:40:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/tempfile.rb: remove "require 'thread'". its features are no
+ longer used.
- * eval.c (rb_eval): check whether ruby_class is properly set,
- before accessing it.
+Wed Aug 27 21:19:40 2014 gogo tanaka <mail@tanakakazuki.com>
- * eval.c (rb_obj_instance_eval): ruby_class should be Qnil for
- special objects like Fixnums.
+ * lib/drb/acl.rb: Removed meaningless #to_s methods in interpolation.
+ [Feature #10174][ruby-core:64584]
+ * lib/erb.rb: ditto.
+ * lib/observer.rb: ditto.
+ * lib/rake/invocation_chain.rb: ditto.
+ * lib/rubygems/command_manager.rb: ditto.
+ * lib/rubygems/config_file.rb: ditto.
+ * lib/uri/common.rb: ditto.
- * ext/tkutil/tkutil.c (Init_tkutil): removes calls to
- rb_yield_0(). used instance_eval() instead in the tk.rb.
+Wed Aug 27 21:08:20 2014 gogo tanaka <mail@tanakakazuki.com>
-Wed Aug 26 11:47:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/drb/drb.rb: use attr_reader instead of Module#attr.
+ [Feature #10172][ruby-core:64582]
+ * lib/irb/ruby-token.rb: ditto.
+ * lib/net/telnet.rb: ditto.
+ * lib/rdoc/ruby_token.rb: ditto.
+ * lib/thwait.rb: ditto.
- * regex.c (re_match): pop non-greedy stack elements on success.
+Wed Aug 27 19:52:33 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Wed Aug 26 09:25:35 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * ext/win32ole/win32ole.c (vtdate2rbtime): try to convert millisecond
+ of VT_DATE VARIANT to nsec of Time object.
+ * test/win32ole/test_win32ole_variant.rb
+ (test_conversion_dbl2date_with_msec): ditto.
- * ruby.h: add #define environ for cygwin32.
+Wed Aug 27 09:57:29 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Aug 25 08:57:41 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_complex.rb: removed unreachable code.
+ * test/ruby/test_rational.rb: ditto.
- * array.c (rb_ary_sort_bang): temporarily freeze sorting array.
+Wed Aug 27 07:59:17 2014 Eric Wong <e@80x24.org>
-Mon Aug 24 18:46:44 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * compile.c (iseq_set_sequence): check for multiplication overflow
- * dln.c (dln_find_1): path check was too strict.
+Tue Aug 26 22:07:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Mon Aug 24 15:28:11 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * test/ruby/test_complex.rb: cherry-picked working assertions from r47251.
+ * test/ruby/test_rational.rb: cherry-picked working assertions from r47263.
- * parse.y (f_arglist): opt_nl added after f_args.
+Tue Aug 26 21:07:56 2014 gogo tanaka <mail@tanakakazuki.com>
-Fri Aug 21 01:06:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/mathn.rb (Fixnum#**, Bignum#**, Float#**, Rational#**):
+ remove as these are now built-in. [ruby-core:63973] [Bug #10086]
- * ext/socket/socket.c: grand renaming on socket.c.
+Tue Aug 26 20:46:55 2014 Tanaka Akira <akr@fsij.org>
- * ext/socket/socket.c (inet_aton): supply inet_aton for those
- systems that do not have it.
+ * time.c (rb_time_unmagnify_to_float): Avoid double rounding.
+ Reported by Tsuyoshi Sawada.
+ https://bugs.ruby-lang.org/issues/10135#note-1
- * ext/socket/socket.c (setipaddr): use inet_aton instead of
- inet_addr.
+Tue Aug 26 17:12:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c (tcp_s_gethostbyname): new method: works
- like Socket.gethostbyname but returning array contains ip-addrs
- as octet decimal string format like "127.0.0.1".
+ * io.c (io_close): ignore only "closed stream" IOError and
+ NoMethodError, do not swallow other exceptions at the end of
+ block. [ruby-core:64463] [Bug #10153]
- * ext/socket/socket.c (mkhostent): return format changed to
- [host, aliases, type, ipaddr..] as documented.
+Tue Aug 26 13:46:33 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-Wed Aug 19 00:31:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * template/fake.rb.in: fix failed to make install when @srcdir@ is
+ absolute path.
- * io.c (io_ctl): forgot to place TRAP_END at right position.
+Tue Aug 26 13:43:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Aug 14 11:01:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_range.rb: added workaround for VERBOSE message.
- * eval.c (call_trace_func): save __FILE__, __LINE__ before
- executing trace_func, since trace function should not corrupt
- line number information.
+Tue Aug 26 12:38:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Thu Aug 13 15:09:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/test_mathn.rb: added workaround for VERBOSE messages.
- * array.c (ary_s_new): was marking unallocated region on GC.
+Tue Aug 26 11:44:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Aug 11 11:57:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/shell/process-controller.rb: removed commented-out code.
- * version 1.1c2 released.
+Tue Aug 26 11:39:01 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Mon Aug 10 14:05:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/thwait.rb (ThreadsWait): removed needless constant.
- * process.c (f_system): removed fflush(stdin).
+Tue Aug 26 09:27:10 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Aug 7 17:44:44 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/mathn.rb: mathn library is deprecated on ruby 2.2.
+ [Feature #10169][ruby-core:64553]
- * error.c (err_snprintf): replace sprintf for fixed sized buffer,
- with snprintf to avoid buffer over-run. For systems which does
- dot provide snprintf, missing/snprintf.c added.
+Tue Aug 26 09:25:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Aug 5 00:47:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/mathn.rb: removed commented-out code.
- * re.c (rb_reg_search): recycle match object.
+Mon Aug 25 20:15:50 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Mon Aug 3 09:17:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c(fole_s_connect, fole_initialize): raise a
+ security error with the tainted string object.
+ * ext/win32ole/win32ole_event.c(ev_advise): ditto.
+ * test/win32ole/test_win32ole.rb(test_s_new_exc_svr_tainted,
+ test_s_new_exc_host_tainted): ditto.
+ * test/win32ole/test_win32ole_event.rb(test_s_new_exc_tainted): ditto.
- * string.c (rb_str_gsub_bang): do not allocate temporary string.
+Mon Aug 25 12:56:54 2014 Ivan Korunkov <ivankorunkov@ya.ru>
- * string.c (rb_str_sub_bang): use inline replace.
+ * lib/logger.rb (format_datetime): use "%6N" to show microsecond.
+ [Fix GH-704]
-Wed Jul 29 00:36:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Aug 25 11:02:07 2014 Eric Wong <e@80x24.org>
- * hash.c (hash_s_new): the default value can be specified.
+ * vm_core.h (rb_iseq_location_t): change first_lineno type to VALUE
+ * iseq.c (rb_iseq_build_for_ruby2cext): update based on argument
- * hash.c (hash_default): method to set the default value.
+Sun Aug 24 16:14:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * hash.c (hash_aref): now returns the default value.
+ * lib/e2mmap.rb: remove needless instance variables.
+ * lib/irb.rb: ditto.
+ * lib/irb/**/*.rb: ditto.
+ * lib/shell.rb: ditto.
-Tue Jul 28 13:03:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Aug 24 12:44:26 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * array.c (ary_s_new): argument to specify initial value is added.
+ * test/ruby/test_complex.rb: removed needless conditions.
+ * test/ruby/test_rational.rb: ditto.
- * array.c (ary_s_new): specifies size, not capacity.
+Sun Aug 24 11:47:39 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Mon Jul 27 12:39:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_rational.rb: fixed indent.
- * string.c (str_replace): zero fill for expansion gap.
+Sun Aug 24 11:44:11 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * regex.c (mbctab_euc): set flags on for 0xA1-0xFE. suggested by
- <inaba@st.rim.or.jp>.
+ * test/ruby/test_rational.rb: remove commented-out code.
- * string.c (str_inspect): consider current_mbctype.
+Sun Aug 24 11:09:29 2014 Eric Wong <e@80x24.org>
-Sun Jul 26 15:37:11 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * lib/benchmark.rb (measure): reduce allocations as in r47260
- * array.c (ary_s_new): Array.new(1<<30) dumps core.
+Sun Aug 24 10:35:54 2014 Pete Higgins <pete@peterhiggins.org>
-Fri Jul 24 13:40:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/benchmark.rb (module Benchmark): define BENCHMARK_CLOCK
+ (realtime): use Process.clock_gettime(BENCHMARK_CLOCK)
+ Reduces allocations to improve performance [Feature #10165]
- * version 1.1c1 released.
+ * test/benchmark/test_benchmark.rb (test_realtime_output): new test
-Fri Jul 24 02:10:22 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 22 20:23:54 2014 Koichi Sasada <ko1@atdot.net>
- * marshal.c (r_bytes2): allocated buffer size was too short.
+ * string.c (rb_fstring): fix condition (easy to cause infinite loop!).
- * marshal.c (w_object): saves all options, not only casefold flag.
+Fri Aug 22 20:07:43 2014 Koichi Sasada <ko1@atdot.net>
- * re.c (reg_clone): now copies options properly.
+ * string.c (rb_fstring, fstr_update_callback): simply delete garbage
+ key first.
- * re.c (reg_get_kcode): code number was wrong.
+ Garbage keys can be swept by lazy sweeping invoked by creating new
+ fstring. So that simply do:
+ (1) delete garbage key and return `fstr_update_callback' immediately
+ (2) try again `fstr_update_callback()' to create a new fstr.
-Thu Jul 23 13:11:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ This bug can be cause memory corruption, reported by
+ http://u64.rubyci.org/~chkbuild/ruby-trunk/log/20140821T220302Z.fail.html.gz
- * eval.c (rb_attr): argument should be symbol or string.
+Fri Aug 22 19:30:39 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Jul 22 11:59:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_complex.rb: removed commented-out code.
- * regex.c (calculate_must_string): wrong offset added.
+Fri Aug 22 19:25:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Jul 22 11:59:59 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_complex.rb: fixed broken tests. Math is not
+ compatible CMath now.
- * st.c (rehash): still had a GC problem. fixed.
+Fri Aug 22 15:36:09 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jul 21 13:19:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * common.mk (Doxyfile): revert r43888, not to require preinstalled
+ ruby. [ruby-core:64488] [Bug #10161]
- * eval.c (gc_mark_threads): crashed on GC before thread allocation.
+Fri Aug 22 12:32:15 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * st.c (rehash): GC during rehash caused SEGV.
+ * lib/shell.rb: removed commented-out code.
+ * lib/shell/builtin-command.rb: ditto.
+ * lib/shell/command-processor.rb: ditto.
-Tue Jul 21 01:25:10 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 22 12:21:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * sprintf.c (f_sprintf): integer formatter totally re-written.
+ * lib/complex.rb: removed deprecated library.
+ * lib/rational.rb: ditto.
- * sprintf.c (remove_sign_bits): support uppercase hexadecimal.
+Fri Aug 22 11:38:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Sat Jul 18 00:14:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/prettyprint.rb: removed PrettyPrint#first?
+ because it is obsoleted method since Ruby 1.8.2
- * sprintf.c (f_sprintf): proper sign position for %X and %O.
+Thu Aug 21 17:10:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 17 14:10:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * win32/win32.c (constat_attr): manage reverse video internally
+ since Windows console window does not manage it. based on the
+ patch by white leaf in [ruby-dev:48483]. [Bug #10158]
- * version 1.1c0 released.
+Thu Aug 21 14:45:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Jul 17 08:01:49 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * lib/e2mmap.rb: removed commented-out code.
- * process.c (f_exec): Check_SafeStr() added.
+Thu Aug 21 13:23:34 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * process.c (f_system): Check_SafeStr() moved before fork().
+ * lib/rinda/ring.rb: split executable code into sample directory.
+ * sample/rinda-ring.rb: ditto.
-Thu Jul 16 22:58:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Aug 21 13:21:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * string.c (scan_once): substrings to the block should not be
- tainted. use reg_nth_match(), not str_substr().
+ * lib/drb/acl.rb: split executable code into sample directory.
+ * sample/drb/acl.rb: ditto.
- * string.c (str_substr): needed to transfer taint.
+Thu Aug 21 12:55:35 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Thu Jul 16 16:15:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * .gitignore: ignored temporary file for Changelog.
+ http://mkosaki.blog46.fc2.com/blog-entry-1284.html
- * gc.c (xmalloc): object allocation count added to GC trigger.
+Thu Aug 21 12:40:22 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (thread_save_context): avoid marking uninitialized stack
- in thread_mark. GC may be triggered by REALLOC_N().
+ * lib/net/imap.rb: split executable code into sample directory.
+ * sample/net-imap.rb: ditto.
-Wed Jul 15 15:11:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Aug 21 12:23:56 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * experimental release 1.1b9_31.
+ * lib/net/imap.rb: removed commented-out code.
-Wed Jul 15 15:05:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Aug 20 17:27:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (thread_create): exit() and abort() in threads now
- forwarded to main_thread.
+ * configure.in (RUBY_TRY_CFLAGS, RUBY_TRY_LDFLAGS),
+ (RUBY_CHECK_BUILTIN_SETJMP, RUBY_SETJMP_TYPE),
+ (RUBY_STACK_GROW_DIRECTION): quote defun names, for some
+ versions of autoconf possibly. [ruby-core:64473] [Bug #10156]
-Tue Jul 14 14:03:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Aug 19 22:28:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * variable.c (obj_instance_variables): list names that is not
- instance variables.
+ * sprintf.c (rb_str_format): fix condition to round.
+ [ruby-core:64454] [Bug #10151]
- * gc.c (GC_MALLOC_LIMIT): choose smaller limit value.
+Tue Aug 19 22:22:45 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Jul 13 12:39:38 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * enc/trans/euckr-tbl.rb (EUCKR_TO_UCS_TBL): add missing euro and
+ registered signs. [ruby-core:64452] [Bug #10149]
- * object.c (str2cstr): should not return NULL.
+Tue Aug 19 13:59:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Jul 10 11:51:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * compar.c (rb_cmperr): preserve encodings of arguments in the
+ message.
- * parse.y (gettable): needed to add dyna_in_block() check.
+Tue Aug 19 10:13:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jul 9 17:38:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/thread/thread.c (get_array): check instance variables are
+ initialized properly. [ruby-core:63826][Bug #10062]
- * experimental release 1.1b9_30.
+Mon Aug 18 17:06:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Jul 9 16:01:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * sprintf.c (rb_str_format): support rational 'f' format.
+ [ruby-core:64382] [Bug #10136]
- * sprintf.c (fmt_setup): format specifier for long needed.
+Mon Aug 18 08:03:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * sprintf.c (f_sprintf): ditto.
+ * spec/default.mspec: use 2.2 definition.
- * numeric.c (fix2str): ditto.
+Sun Aug 17 19:41:40 2014 Kazuki Tsujimoto <kazuki@callcc.net>
- * eval.c (thread_create): no more ITIMER_REAL.
+ * gc.c (obj_memsize_of): don't calculate memsize of T_NODE
+ when called from check_gen_consistency. It fixes segmentation
+ fault on RGENGC_CHECK_MODE >= 1 introduced by r47188.
- * eval.c (thread_create): thread finalization needed before
- aborting thread if thread_abort is set.
+Sun Aug 17 17:08:12 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Wed Jul 8 18:17:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c (ole_invoke): use RHASH_SIZE instead of
+ calling Hash#length method.
- * bignum.c (big_pow): abandon power by bignum (too big).
+Sat Aug 16 19:32:06 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Tue Jul 7 13:58:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole_event.c (evs_length): use RARRAY_LEN instead
+ of calling Array#length method.
- * eval.c (rb_catch): add C level catch/throw feature.
+Sat Aug 16 10:20:17 2014 Eric Wong <e@80x24.org>
-Mon Jul 6 15:18:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * time.c (time_timespec): fix tv_nsec overflow
+ [Bug #10144]
- * parse.y (arg): proper return values for `||=' and `&&='.
+Fri Aug 15 20:34:17 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Fri Jul 3 16:05:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: separate WIN32OLE_EVENT src from
+ win32ole.c.
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_event.c: ditto.
+ * ext/win32ole/win32ole_event.h: ditto.
+ * ext/win32ole/depend: ditto.
- * experimental release 1.1b9_29.
+Fri Aug 15 19:38:00 2014 Koichi Sasada <ko1@atdot.net>
-Fri Jul 3 11:20:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * iseq.c (rb_iseq_clone): Should not insert write barrier from
+ non-RVALUE data (to non-RVALUE data, of course).
- * marshal.c (r_byte): byte should not extend sign bit.
+ Ruby 2.1 also has a same problem.
- * numeric.c (fix_mul): use FIX2LONG() instead of FIX2INT() for
- 64bit architectures.
+Fri Aug 15 19:34:33 2014 Koichi Sasada <ko1@atdot.net>
- * marshal.c (r_bytes): remove weird casting bwetween pointer and int.
+ * string.c (setup_fake_str): fake strings should not set class by
+ RBASIC_SET_CLASS() because it insert write barriers to fake
+ (non-RVALUE) structure.
- * process.c (proc_setsid): new method Process#setsid().
+ It can cause unexpected behaviour.
-Thu Jul 2 12:49:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ Ruby 2.1 also have a same problem (setup_fake_str() in parse.y).
- * marshal.c (w_object): remove `write_bignum' label for 64bit
- architectures.
+ * symbol.c (setup_fake_str): ditto.
- * marshal.c (r_bytes): needs int, not long.
+Fri Aug 15 19:27:25 2014 Koichi Sasada <ko1@atdot.net>
-Wed Jul 1 14:21:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * array.c (rb_ary_tmp_new_fill): added.
+ This function creates internal use only array (which is completely
+ hided by ObjectSpace.each_object) with filling nil.
- * numeric.c (flo_plus): should not allow addition with strings.
+ Otherwise, it can be includes strange VALUEs.
-Wed Jul 1 13:09:01 1998 Keiju ISHITSUKA <keiju@rational.com>
+ * internal.h: added.
- * numeric.c (num_uminus): wrong coerce direction.
+ * node.h: use rb_ary_tmp_new_fill() for MEMO.
-Tue Jun 30 10:13:44 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 15 10:13:37 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * io.c (f_p): accepts arbitrary number of arguments.
+ * lib/gserver.rb: removed unmaintained code.
+ [ruby-core:40313][Feature #5480]
+ * lib/xmlrpc/httpserver.rb: ditto.
- * eval.c (rb_yield_0): there's some case that iterator_p() returns
- true even if the_block was not set. check added.
+Fri Aug 15 09:22:12 2014 Eric Wong <e@80x24.org>
-Tue Jun 30 01:05:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_core.h (rb_thread_struct): reorder to pack
+ * cont.c (rb_context_struct, rb_fiber_struct): ditto
+ On x86-64, these changes reduces:
+ rb_thread_struct to 1000 bytes (from 1016)
+ rb_context_struct to 1288 bytes (from 1312)
+ rb_fiber_struct to 2272 bytes (from 2304)
- * eval.c (BEGIN_CALLARGS): adjust the_block before evaluating the
- receiver's value and the arguments.
+Fri Aug 15 09:06:31 2014 Eric Wong <e@80x24.org>
-Fri Jun 26 18:02:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * thread_pthread.h: define RB_NATIVETHREAD_LOCK_INIT and
+ RB_NATIVETHREAD_COND_INIT macros
- * experimental release 1.1b9_28.
+ * thread_pthread.c (native_mutex_lock, native_mutex_unlock,
+ native_mutex_trylock, native_mutex_initialize,
+ native_mutex_destroy, native_cond_wait):
+ use rb_nativethread_lock_t instead of pthread_mutex_t
+ [Feature #10134]
-Fri Jun 26 11:01:26 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * thread_pthread.c (native_mutex_debug): make argument type-agnostic
+ to avoid later cast.
- * string.c (str_aset_method): needed to convert to string.
+ * thread_pthread.c (register_cached_thread_and_wait):
+ replace PTHREAD_COND_INITIALIZER with RB_NATIVETHREAD_COND_INIT,
+ use native_mutex_{lock,unlock}
-Thu Jun 25 02:05:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * thread_pthread.c (use_cached_thread):
+ use native_mutex_{lock,unlock}
- * regex.c (re_search): optimize for `.*' at beginning of the
- pattern.
+ * thread_pthread.c (native_sleep):
+ use rb_nativethread_lock_t to match th->interrupt_lock,
+ use native_mutex_{lock,unlock}
- * regex.c (re_search): optimize for character class repeat at
- beginning of the pattern.
+ * thread_pthread.c (timer_thread_lock): use rb_nativethread_lock_t type
- * regex.c (re_compile_pattern): detect optimization potential for
- the compiled patterns.
+Fri Aug 15 08:10:29 2014 Eric Wong <e@80x24.org>
-Thu Jun 25 00:02:26 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * cont.c (cont_mark): fix typo in unused path [ci skip]
- * re.c (reg_s_new): flag value was wrong.
+Fri Aug 15 06:00:56 2014 Eric Wong <e@80x24.org>
-Wed Jun 24 23:45:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm.c (rb_thread_mark): update comment about marking `me'
+ [ruby-core:64340] [ruby-core:64341]
- * regex.c (re_search): wrong anchor handling for reverse search.
+Fri Aug 15 05:53:59 2014 Eric Wong <e@80x24.org>
-Wed Jun 24 02:18:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * README.EXT: preliminary documentation for RB_GC_GUARD
+ [Bug #10100] [ruby-core:60741]
- * parse.y (mlhs): `((a,b)),c = [[1,2]],3' assigns a=1,b=2,c=3.
+Thu Aug 14 00:26:19 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Tue Jun 23 11:46:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: separate WIN32OLE_RECORD src from
+ win32ole.c
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_record.c: ditto.
+ * ext/win32ole/win32ole_record.h: ditto.
+ * ext/win32ole/depend: ditto.
- * parse.y (yylex): `&&=' and `||=' added.
+Wed Aug 13 21:41:04 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Sat Jun 20 02:53:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: separate WIN32OLE_VARIANT src from
+ win32ole.c.
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_variant.c: ditto.
+ * ext/win32ole/win32ole_variant.c: ditto.
+ * ext/win32ole/depend: ditto.
- * parse.y (assignable): nesting local variables should have higher
- priority than normal local variables for assignment too.
+Wed Aug 13 20:09:37 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Fri Jun 19 18:28:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: remove unused variable.
- * experimental release 1.1b9_27.
+Wed Aug 13 19:31:27 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Fri Jun 19 14:34:49 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c (ole_search_handler_method, rescue_callback,
+ folerecord_inspect): use PRIsVALUE in rb_sprintf.
- * eval.c (assign): support hack for nested multiple assignment.
+ * ext/win32ole/win32ole_param.c (foleparam_inspect): ditto.
- * parse.y (mlhs): nested multiple assignment.
+ * ext/win32ole/win32ole_variable.c (folevariable_inspect): use
+ PRIsVALUE in rb_sprintf, use rb_inspect.
- * eval.c (rb_eval): in-block variables now honors static scope.
+Wed Aug 13 11:54:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * configure.in: RSHIFT check moved to configure.
+ * lib/irb/completion.rb: reverted r47163.
+ because another case can't be show completion target.
-Thu Jun 18 16:46:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Aug 13 11:17:00 2014 Shimpei Makimoto <github@makimoto.org>
- * experimental release 1.1b9_26.
+ * lib/irb.rb: Prevent irb from crashing when exception with
+ nil backtrace is raised.
+ [fix GH-434][ruby-core:58078][Bug #9063]
+ * test/irb/test_raise_no_backtrace_exception.rb: ditto.
-Thu Jun 18 13:37:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Aug 13 11:08:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * file.c (file_s_ftype): uses lstat(2) instead of stat(2).
+ * lib/irb/completion.rb: fixed broken completion list with
+ String including spaces. Contributed from @dunric. [fix GH-465]
- * dir.c (dir_s_glob): there can be buffer overrun, check added.
+Wed Aug 13 00:07:01 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * eval.c (f_binding): handles in-block variables declared after
- binding's generation.
+ * ext/win32ole/win32ole.c: separate WIN32OLE_PARAM src from win32ole.c
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_param.c: ditto.
+ * ext/win32ole/win32ole_param.h: ditto.
+ * ext/win32ole/depend: ditto.
- * numeric.c (flo_floor): floor, ceil, round added to Float.
+Tue Aug 12 23:17:47 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Wed Jun 17 11:20:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: refactoring. move some methods
+ into win32ole_type.c / win32ole_method.c
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_method.c: ditto.
+ * ext/win32ole/win32ole_method.h: ditto.
+ * ext/win32ole/win32ole_type.h: ditto.
+ * ext/win32ole/win32ole_type.h: ditto.
- * parse.y (gettable): nesting local variables should have higher
- priority than normal local variables.
+Tue Aug 12 22:59:48 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Tue Jun 16 12:30:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: refactoring. move
+ ole_typelib_from_itypeinfo into win32ole_typelib.c.
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_typelib.h: ditto.
+ * ext/win32ole/win32ole_typelib.h: ditto.
- * bignum.c (str2inum): handles `+ddd'.
+Tue Aug 12 21:49:40 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * struct.c (make_struct): name parameter can be nil for unnamed
- structures.
+ * ext/win32ole/win32ole.c (ole_create_dcom): use the converted
+ result if the argument can be converted to a string, to get rid
+ of invalid access. Thanks to nobu. [ruby-dev:48467] [Bug #10127]
-Mon Jun 15 16:30:10 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Aug 12 14:22:58 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * object.c (class_s_inherited): prohibiting to make subclass of
- class Class.
+ * configure.in: ignored working directory same as prefix value.
+ [ruby-core:54999] [Bug #8409]
- * object.c (module_s_new): support for making subclass of Module.
+Tue Aug 12 13:34:25 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * parse.y (yycompile): clear eval_tree before compiling.
+ * lib/fileutils.rb: enable to remove with non-owner directory.
+ [ruby-dev:45976] [Bug #6756]
+ * test/fileutils/test_fileutils.rb: add testcase for #6756.
-Fri Jun 12 17:58:18 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Aug 12 12:57:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (eval): write back the_dyna_var into the block.
+ * vm_exec.c: improve performance in ppc64 arch.
+ [ruby-core:63437] [Feature #9997]
-Thu Jun 11 18:19:18 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Aug 12 12:14:52 2014 Akira Matsuda <ronnie@dio.jp>
- * experimental release 1.1b9_25.
+ * lib/fileutils.rb: fix typo.
+ [ruby-dev:47831] [Bug #9180]
- * eval.c (dvar_add_compiling): register dyna_var at compile time.
+Tue Aug 12 10:10:42 2014 Eric Wong <e@80x24.org>
- * regex.c (re_compile_pattern): RE_DUP_MAX iteration is too big.
+ * vm_method.c (release_method_definition): use rb_free_method_entry
-Wed Jun 10 15:12:04 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Aug 12 06:16:09 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * io.c (io_eof): do not block other threads.
+ * ext/win32ole/win32ole.c: separate WIN32OLE_METHOD src from
+ win32ole.c.
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_method.c: ditto.
+ * ext/win32ole/win32ole_method.h: ditto.
+ * ext/win32ole/depend: ditto.
- * signal.c (trap): reserve SIGALRM for thread.
+Mon Aug 11 22:19:15 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * eval.c (thread_create): use ITIMER_REAL also to avoid system
- call blocking.
+ * ext/win32ole/win32ole_variable.c (folevariable_inspect): refactoring.
- * io.c (f_syscall): add TRAP_BEG, TRAP_END around system calls.
+Mon Aug 11 20:47:27 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * io.c (io_ctl): add TRAP_BEG, TRAP_END around system calls.
+ * ext/win32ole/win32ole.c: separate WIN32OLE_VARIABLE src from
+ win32ole.c
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_variable.c: ditto.
+ * ext/win32ole/win32ole_variable.h: ditto.
+ * ext/win32ole/depend: ditto.
- * enum.c (enum_collect): did not collect false values.
+Mon Aug 11 16:17:21 2014 Tony Miller <mcfiredrill@gmail.com>
- * array.c (ary_new2): forgot to initialize capa field.
+ * dir.c (rb_dir_exists_p): [DOC] Document that Dir.exists? is
+ deprecated. [ruby-core:64135] [Bug #10102]
-Tue Jun 9 18:36:15 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Mon Aug 11 11:26:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (str_split_method): split dumped core for "\xff".
+ * lib/tempfile.rb: start rdoc parsing inside singleton class
+ definition to include the document there.
+ [ruby-core:64157] [Bug #10105]
-Tue Jun 9 16:22:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Aug 10 12:22:43 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * experimental release 1.1b9_24.
+ * ext/win32ole/win32ole_type.c: refactoring.
-Tue Jun 9 16:04:07 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Sun Aug 10 10:34:00 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ext/kconv/kconv.c (kconv_guess): more precise decision for EUC,
- using jless algorithm (3 sequential EUC hiragana characters).
+ * lib/cgi/session/pstore.rb: separated sample code.
+ * lib/open3.rb: ditto.
-Tue Jun 9 15:12:44 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Aug 10 10:03:24 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ext/kconv/kconv.c (kconv_guess): wrong guess for EUC as SJIS in
- some cases (0xe0 - 0xef).
+ * lib/irb/ext/multi-irb.rb: removed commented-out code.
- * gc.c (xmalloc): insert size check for big (negative in signed)
- allocation size.
+Sat Aug 9 11:02:07 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Jun 9 02:54:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/irb.rb: removed commented-out code.
+ * lib/irb/**/*.rb: ditto.
- * lib/parsedate.rb: wday moved to the last in the return values.
+Sat Aug 9 10:35:30 2014 Laurent Arnoud <laurent@spkdev.net>
-Mon Jun 8 10:40:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/cmath.rb: fixed indent. [fix GH-696]
+ * lib/drb/ssl.rb: ditto.
+ * lib/irb/**/*.rb: ditto.
- * string.c (str_split_method): split dumped core for "\0".
+Sat Aug 9 10:28:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Sat Jun 6 22:50:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/minitest/test_minitest_unit.rb: removed obsoleted condition
+ for Ruby 1.8.
+ * test/ruby/test_time_tz.rb: ditto.
- * regex.c (calculate_must_string): wrong condition for
- {start,stop}_nowidth.
+Sat Aug 9 10:18:00 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * regex.c (re_match): various features imported from GNU regex.c
- 0.12, such as nested grouping, avoiding infinite loop with empty
- match, etc.
+ * test/cgi/test_cgi_core.rb: removed obsoleted condition for Ruby 1.8.
+ * test/cgi/test_cgi_header.rb: ditto.
+ * test/cgi/test_cgi_multipart.rb: ditto.
+ * test/cgi/test_cgi_tag_helper.rb: ditto.
- * regex.c (register_info_type): now use union.
+Sat Aug 9 00:34:37 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * regex.c (re_search): more precise anchor(^) check.
+ * ext/win32ole/win32ole.c: separate WIN32OLE_TYPE src from win32ole.c.
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_type.c: ditto.
+ * ext/win32ole/win32ole_type.h: ditto.
+ * ext/win32ole/depend: ditto.
-Wed Jun 3 18:07:54 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 8 01:53:37 2014 Masaki Matsushita <glass.saga@gmail.com>
- * re.c (reg_raise): check rb_in_compile, not rb_in_eval.
+ * lib/securerandom.rb: use OpenSSL::BN for performance improvement.
-Mon Jun 1 05:26:06 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
+ * benchmark/bm_securerandom.rb: benchmark script.
- * string.c (trnext): casting to signed char* needed.
+Fri Aug 8 17:19:57 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Jun 2 16:00:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/open-uri.rb: remove needless condition for old ruby version.
+ * test/open-uri/test_open-uri.rb: ditto.
- * ext/socket/socket.c (udp_addrsetup): error check enhanced.
+Fri Aug 8 16:40:59 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ext/socket/socket.c (sock_s_getservbyaname): use strtoul(), if
- possible.
+ * lib/irb/init.rb: removed unreachable code.
-Sat May 30 07:10:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 8 16:34:22 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * re.c (reg_prepare_re): no more needless regular expression
- recompile on casefold conditions.
+ * lib/drb/drb.rb: removed unreachable code.
-Thu May 28 18:02:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 8 14:33:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * object.c (nil_plus): no more `+' method for nil.
+ * lib/webrick/httpproxy.rb: remove needless condition
+ for old ruby version.
-Wed May 27 17:33:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 8 01:07:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * hash.c (hash_fetch): new method.
+ * parse.y (parser_yylex): fix invalid char in eval, should raise
+ an syntax error too, as well as directly coded.
+ [ruby-core:64243] [Bug #10117]
- * regex.c (re_search): check whether translate table is set.
+Thu Aug 7 23:25:29 2014 Masaki Matsushita <glass.saga@gmail.com>
-Tue May 26 11:39:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/open3.rb: avoid unnecessary write if stdin_data is empty.
- * experimental release 1.1b9_23.
+Thu Aug 7 21:42:49 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * parse.y (yylex): no UPLUS/UMINUS for 1st argument if
- parenthesises are omitted.
+ * ext/win32ole/win32ole_typelib.c (foletypelib_version): return
+ version string.
-Tue May 26 01:09:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/win32ole/test_win32ole_typelib.rb (test_version): ditto.
- * regex.c (re_compile_pattern): (?XI) for turns off the
- corresponding option.
+Thu Aug 7 15:13:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Mon May 25 12:38:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/cgi.rb: remove needless condition for old ruby version.
- * regex.c (re_compile_pattern): inline i option (?i).
+Thu Aug 7 06:04:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * regex.c (re_compile_pattern): inline x option (?x).
+ * parse.y (parser_yyerror): preserve source code encoding in
+ syntax error messages. [ruby-core:64228] [Bug #10114]
- * regex.c (re_compile_pattern): x option for regexp.
+Wed Aug 6 20:56:02 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * dir.c (dir_s_open): returns block's evaluated value.
+ * ext/win32ole/win32ole.c: separate src of WIN32OLE_TYPELIB from
+ win32ole.c
- * io.c (f_open): returns block's evaluated value.
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_typelib.c: ditto.
+ * ext/win32ole/win32ole_typelib.h: ditto.
+ * ext/win32ole/depend: ditto.
- * ext/curses/curses.c (curses_addstr): nil argument caused SEGV.
+Wed Aug 6 20:44:07 2014 Akinori MUSHA <knu@iDaemons.org>
-Fri May 22 11:52:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * enum.c (enum_one): [DOC] Move enum.one? documentation before the
+ relevant method. Submitted by @vipulnsward. [Fixes GH-687]
+ https://github.com/ruby/ruby/pull/687
- * regex.c (re_compile_pattern): push mark on (?:), so that
- laststart check for {a,b} can be done.
+Wed Aug 6 20:25:47 2014 Akinori MUSHA <knu@iDaemons.org>
-Thu May 21 17:31:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/set.rb (Set#replace): Check if an object given is enumerable
+ before clearing self. Reported by yui-knk. [GH-675]
+ https://github.com/ruby/ruby/pull/675
- * regex.c (re_match): wrong match (too non-greedy) for `{a,b}?'.
+Wed Aug 6 20:07:26 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * io.c (io_lineno): new method IO#lineno, IO#lineno=.
+ * ext/win32ole/win32ole.c (olerecord_ivar_set): remove rb_str_subseq.
-Wed May 20 06:04:43 1998 MAEDA shugo <shugo@aianet.ne.jp>
+Wed Aug 6 19:09:27 2014 Akinori MUSHA <knu@iDaemons.org>
- * BeOS patch.
+ * lib/set.rb (Set): Implement Set#clone by splitting
+ initialize_copy into initialize_dup and initialize_clone.
+ Submitted by yui-knk. [Fixes GH-661]
+ https://github.com/ruby/ruby/pull/661
-Wed May 20 16:32:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Aug 6 18:42:58 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * bignum.c (BIGDN): use RSHIFT(), instead of mere `>>'.
+ * ext/win32ole/win32ole.c: separate src of WIN32OLERuntimeError
+ from win32ole.c.
-Tue May 19 16:36:26 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.h: ditto
+ * ext/win32ole/depend: ditto.
+ * ext/win32ole/win32ole_error.c: ditto.
+ * ext/win32ole/win32ole_error.h: ditto.
- * experimental release 1.1b9_22.
+Wed Aug 6 04:33:58 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Tue May 19 16:31:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/net/http.rb (Net::HTTP.proxy_uri): use initializer instead
+ of parser to handle IPv6 address. [Bug #9129]
- * parse.y (assignable): specification changed for in-block
- variable definition.
+Wed Aug 6 04:16:05 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (dyna_var_asgn): error in in-block variables' compile
- time definition.
+ * lib/net/http/requests.rb (Net::HTTP::Options::RESPONSE_HAS_BODY):
+ OPTIONS requests may have response bodies. [Feature #8429]
+ http://tools.ietf.org/html/rfc7231#section-4.3.7
- * parse.y (str_extend): wrong nesting detection.
+Wed Aug 6 03:18:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Tue May 19 09:47:55 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * lib/net/http/generic_request.rb (Net::HTTP::GenericRequest#exec):
+ handle req['host'] in update_uri.
- * numeric.c (num2int): re-defined (extensions may use this).
+ * lib/net/http/generic_request.rb
+ (Net::HTTP::GenericRequest#update_uri):
+ use req['host'] if it is explicitly set. Even if URI is given,
+ it is already used for the initial value of req['host'].
+ Therefore overwritten value should be respected. [Bug #10054]
-Mon May 18 16:40:50 1998 MAEDA shugo <shugo@aianet.ne.jp>
+Wed Aug 6 03:17:34 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * error.c (get_syserr): BeOS support.
+ * lib/net/http/generic_request.rb
+ (Net::HTTP::GenericRequest#update_uri):
+ handle scheme, host, and port to reflect connection to @uri.
- * configure.in: modified for BeOS.
+ * lib/net/http.rb (Net::HTTP#begin_transport): move trivial handling
+ to Net::HTTP::GenericRequest#update_uri.
- * string.c (str_dump): do not call isascii().
- * sprintf.c (remove_sign_bits): forgot to initialize end pointer.
+Wed Aug 6 02:16:43 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * glob.c: #include <alloca.h> added.
+ * lib/net/http/generic_request.rb
+ (Net::HTTP::GenericRequest#initialize):
+ optimize object allocation.
-Mon May 18 14:52:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
-
- * experimental release 1.1b9_21.
+Wed Aug 6 01:16:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Mon May 18 03:27:57 1998 MAEDA shugo <shugo@aianet.ne.jp>
+ * lib/uri/generic.rb (URI::Generic#path_query): remove a private method.
- * file.c (file_s_expand_path): optional second argument
- `default_directory' added.
+Wed Aug 6 01:15:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Sat May 16 22:06:52 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * lib/uri/generic.rb (URI::Generic#normalize!): use String#empty?
- * error.c (RAISE_ERROR): wrong error message
+ * lib/uri/generic.rb (URI::Generic#path_query): optimized.
-Fri May 15 14:43:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/uri/generic.rb (URI::Generic#to_s): optimized.
- * experimental release 1.1b9_20.
+Wed Aug 6 00:15:10 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Thu May 14 14:44:21 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * lib/uri/http.rb (URI::HTTP#request_uri): optimized.
+ decrease object allocation, and ensure always create at least one new
+ object for return value.
- * sun4 cc patches for intern.h and regex.h.
+Wed Aug 6 03:41:21 2014 Aaron Patterson <aaron@tenderlovemaking.com>
-Thu May 14 14:03:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/psych/lib/psych/visitors/to_ruby.rb: backwards compatibility for
+ hashes emitted by Syck. Github #198
+ * test/psych/test_hash.rb: test for change.
- * random.c (RANDOM_MAX): guessing proper maximum value for random
- numbers.
+Tue Aug 5 19:27:59 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * random.c (f_rand): use drand48 if possible.
+ * ext/win32ole/win32ole.c (ole_invoke): skip VariantClear when
+ argument is VT_RECORD variant.
-Wed May 13 19:05:20 1998 1998 MAEDA shugo <shugo@aianet.ne.jp>
+Tue Aug 5 15:52:51 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * BeOS patches for io.c, error.c and config.guess.
+ * gems/bundled_gems: Upgrade to test-unit-3.0.0 and minitest-5.4.0.
-Wed May 13 14:56:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Aug 4 21:50:09 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * experimental release 1.1b9_19.
+ * test/win32ole/test_win32ole_record.rb: add for WIN32OLE_RECORD
+ test(need .NET Framework 3.5 to run test).
- * most of the Mac and BeOS patches merged, except path separators.
+Mon Aug 4 19:49:34 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * error.c (err_append): generated SyntaxError was String.
+ * ext/win32ole/win32ole.c (ole_invoke): call rb_hash_foreach instead
+ of rb_block_call.
- * ruby.h: xxx2INT, xxx2UINT checks values as int, not long.
+ * ext/win32ole/win32ole.c: add comment for rdoc of WIN32OLE_VARIANT
+ class.
- * ruby.h: remove typedef's. INT, UINT, UCHAR, USHORT.
+Mon Aug 4 09:12:47 2014 Eric Wong <e@80x24.org>
-Tue May 12 17:38:00 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * variable.c: cleanup to use rb_const_lookup
+ [Feature #10107]
- * experimental release 1.1b9_18.
+ * vm_insnhelper.c: ditto
-Tue May 12 11:38:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Aug 3 10:55:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * error.c (syserr_errno): returns errno of the SystemCallError.
+ * include/ruby/encoding.h (rb_check_symbol_cstr): ditto.
- * error.c (rb_sys_fail): saves errno in the Exception.
+Sun Aug 3 10:43:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * error.c (set_syserr): no need to protect syserr_list.
+ * vm_insnhelper.c (vm_call_method): unusable super class should cause
+ method missing when BasicObject is refined but not been using.
+ [ruby-core:64166] [Bug #10106]
- * error.c (rb_sys_fail): no more bufsize limit.
+Sat Aug 2 23:47:45 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * error.c (set_syserr): integer value of errno can be accessed by
- Errno::EXXX::Errno.
+ * ext/win32ole/win32ole.c: separate WIN32OLE::VARIANT src file
+ from win32ole.c
+ * ext/win32ole/win32ole.h: ditto.
+ * ext/win32ole/win32ole_variant_m.c: ditto.
+ * ext/win32ole/win32ole_variant_m.h: ditto.
+ * ext/win32ole/depend: ditto.
+ * ext/.document: ditto.
-Sun May 10 03:10:33 1998 WATANABE Tetsuya <tetsu@jpn.hp.com>
+Sat Aug 2 14:34:58 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * io.c (io_tell etc.): moved from File class to IO class.
+ * ext/win32ole/win32ole.c: add comments for rdoc.
-Fri May 8 12:26:37 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Aug 2 10:26:57 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * pack.c (pack_unpack): should be unsigned int (was signed int).
+ * object.c (rb_obj_itself): new method Object#itself. based on the
+ patch by Rafael Franca in [ruby-core:64156].
+ [EXPERIMENTAL] this method may be renamed due to compatibilities.
+ [ruby-core:44704] [Feature #6373]
-Thu May 7 16:34:10 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Aug 1 22:30:40 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * pack.c (pack_pack): `V', `N' uses newly created NUM2UINT().
+ * ext/win32ole/win32ole.c (folerecord_initialize): accept
+ only 2 arguments. The 2nd argument should be WIN32OLE object or
+ WIN32OLE_RECORD object.
- * ruby.h (NUM2UINT): new macro.
+Fri Aug 1 20:17:33 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * bignum.c (big2uint): try to convert bignum into UINT.
+ * ext/win32ole/win32ole.c (ole_variant2val): call
+ folerecord_s_allocate instead of WIN32OLE_RECORD.new.
- * re.c (reg_match): needed to return false for match with nil.
+Fri Aug 1 18:39:57 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * gc.c (obj_free): wrong condition to free string.
+ * test/date/test_date.rb: remove commented-out code.
+ * test/date/test_date_arith.rb: ditto.
+ * test/date/test_date_attr.rb: ditto.
+ * test/date/test_date_parse.rb: ditto.
-Wed May 6 21:08:08 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Fri Aug 1 16:35:32 2014 Evan Miller <evan@squareup.com>
- * ruby.c (ruby_process_options): modified for DJGPP.
+ * numeric.c (flodivmod): all results are NaN if divisor is NaN.
+ [fix GH-692]
-Wed May 6 15:48:03 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Aug 01 07:28:12 2014 Kenta Murata <mrkn@mrkn.jp>
- * experimental release 1.1b9_17.
+ * ext/bigdecimal/bigdecimal.c: [DOC] Add description of
+ `BigDecimal.new` exceptions. Patched by @joker1007 and
+ @prathamesh-sonpatki [Fixes GH-690]
+ https://github.com/ruby/ruby/pull/690
-Wed May 6 01:37:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Jul 31 22:20:12 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * eval.c: remove global variable `errat'.
+ * ext/win32ole/win32ole.c: add WIN32OLE_RECORD#inspect.
- * eval.c (rb_longjmp): embed error position information in the
- exception object.
+Thu Jul 31 20:35:32 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Sat May 2 12:20:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/win32ole/win32ole.c: add
+ WIN32OLE_RECORD#ole_instance_variable_set and
+ WIN32OLE_RECORD#ole_instance_variable_get
- * re.c (reg_search): supports reverse search.
+Wed Jul 30 23:28:10 2014 Kazuki Tsujimoto <kazuki@callcc.net>
- * string.c (str_index_method): does update $~ etc.
+ * sprintf.c (rb_str_format): like r47006, get rid of
+ function calls in RSTRING_PTR().
- * eval.c (f_load): needed to clear the_dyna_vars.
+Wed Jul 30 22:10:29 2014 Kazuki Tsujimoto <kazuki@callcc.net>
- * eval.c (dyna_var_asgn): do not push dyna_var, which is id == 0.
+ * process.c (rlimit_resource_type, rlimit_resource_value):
+ get rid of inadvertent dynamic symbol pin-down.
- * error.c (Init_Exception): NotImplementError is no longer
- StandardError, which is not handled by default rescue.
+ * re.c (match_backref_number): ditto.
-Fri May 1 00:35:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * signal.c (esignal_init, rb_f_kill, trap_signm): ditto.
- * ruby.c (proc_options): `-d' turns on verbose flag too.
+ * transcode.c (econv_opts): ditto.
- * error.c (exception): last argument may be the superclass of the
- defining exception(s).
+ * vm_trace.c (symbol2event_flag): ditto.
- * io.c (Init_IO): EOFError is now subclass of the IOError.
+Wed Jul 30 21:29:39 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * io.c (Init_IO): forgot to define IOError.
+ * ext/win32ole/win32ole.c (ole_invoke): pass WIN32OLE_RECORD variant
+ by reference when invoke OLE methods at first.
- * error.c (Init_Exception): old Exception class renamed to
- StandardError. Exception now replaces old GlobalExit.
+ * ext/win32ole/win32ole.c (olerecord_set_ivar): release
+ IRecordInfo interface before setting another IRecordInfo interface.
- * error.c (Init_Exception): Exception is now the root of the
- Global Exits. There's no longer GlobalExit class.
+Wed Jul 30 13:17:35 2014 Koichi Sasada <ko1@atdot.net>
- * util.c (ruby_mktemp): check TMP, TMPDIR first.
+ * gc.c: remove unused macros.
-Thu Apr 30 01:08:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Jul 29 22:21:37 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * lib/tk.rb: call 'unknown', if proc not defined.
+ * ext/win32ole/win32ole.c (hash2olerec): ignore WIN32OLE_RECORD
+ instance variable if the variable is nil.
- * eval.c (handle_rescue): default rescue handles `Exceptional' not
- only the instance of the `Exception's.
+Tue Jul 29 19:43:27 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * eval.c (f_raise): exception can be any object.
+ * ext/win32ole/win32ole.c (folerecord_method_missing): refactoring.
+ divide functionality of folerecord_method_missing into
+ olerecord_ivar_set and olerecord_ivar_get.
- * time.c (time_gm_or_local): call time_gmtime or time_localtime.
+Mon Jul 28 20:20:08 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * eval.c (f_raise): raises TypeError if the class which is not a
- subclass of String is specified (checked in exc_new()).
+ * ext/win32ole/win23ole.c (folerecord_method_missing): support
+ setter of member of WIN32OLE_RECORD object.
- * error.c (exc_new): need to check whether invalid class (not a
- subclass of String) is specified.
+Mon Jul 28 06:37:19 2014 Zachary Scott <e@zzak.io>
-Wed Apr 29 21:05:44 1998 WATANABE Hirofumi <eban@os.rim.or.jp>
+ * vm_eval.c: [DOC] Fix rdoc formatting of patch from [Bug #9551]
- * ruby.c (proc_options): option '-e' via tempfile.
+Mon Jul 28 06:34:43 2014 Zachary Scott <e@zzak.io>
-Tue Apr 28 15:27:58 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_eval.c: [DOC] [Bug #9551] Improve clarity of Kernel::catch
+ documentation, patch by Jesse Sielaff.
- * experimental release 1.1b9_16.
+Mon Jul 28 06:24:54 2014 Zachary Scott <e@zzak.io>
-Tue Apr 28 00:07:38 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/uri/common.rb: [DOC] [Bug #9563] Recommend using URI.escape
+ before parsing a uri to avoid invalid characters. Reported by
+ Evgeniy Serykh.
- * eval.c (obj_is_proc): type check predicate.
+Mon Jul 28 05:55:56 2014 Zachary Scott <e@zzak.io>
- * eval.c (obj_is_block): ditto.
+ * time.c: [DOC] Clarify %Y in strftime, which can accept any digits
+ and will output at least 4 digits as the year. Reported by Yury
+ Trofimenko [Bug #10049]
-Mon Apr 27 16:59:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/time.rb: ditto
- * ext/gtk/gtk.c (Init_gtk): use timeout, not idle to avoid
- comsuming CPU too much.
+Mon Jul 28 05:32:06 2014 Zachary Scott <e@zzak.io>
- * lib/tk.rb: use tcltklib#_invoke instead of `_eval'.
+ * lib/uri/common.rb: [DOC] [Bug #10075] Clarify how URI.join arguments
+ are handled by RFC3986, originally reported by John Feminella.
-Mon Apr 27 16:59:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Jul 28 05:21:41 2014 Zachary Scott <e@zzak.io>
- * array.c (ary_sort): use dup, not clone.
+ * file.c: [DOC] Clarify how File.file? handles symbolic links. Also
+ cleaned up the rdoc style for this method, more to follow.
+ Originally reported by Michael Renner [Bug #10067]
-Mon Apr 27 13:46:27 1998 Tadahiro Maebashi <maebashi@iij.ad.jp>
+Mon Jul 28 05:12:22 2014 Zachary Scott <e@zzak.io>
- * ext/tcltklib/tcltklib.c (ip_invoke): invoke tcl command
- directly. need not worry about escaping tcl characters.
+ * time.c: [DOC] Remove dead link and old bug report, which hasn't been
+ reproduced in a few years. Reported by Federico Builes [Bug #10071]
-Mon Apr 27 12:04:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Jul 28 04:39:58 2014 Zachary Scott <e@zzak.io>
- * random.c (f_rand): do not call srand() implicitly.
+ * ext/zlib/zlib.c: [DOC] Remove default value of Zlib constants, as
+ they may change in the implementation without notice. Patched by
+ @robin850 [Fixes GH-682] https://github.com/ruby/ruby/pull/682
-Fri Apr 24 14:35:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Jul 28 04:35:35 2014 Zachary Scott <e@zzak.io>
- * experimental release 1.1b9_15.
+ * ext/openssl/ossl_hmac.c: Fix NO_HMAC warning [Fixes GH-665]
+ Patched by @vipulnsward https://github.com/ruby/ruby/pull/665
- * parse.y (assignable): dyna_var_asgn actually defines nested
- local variables in outer context.
+Sun Jul 27 19:49:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * random.c (f_rand): call srand(), if it has not called yet.
+ * lib/cgi/core.rb: remove unused variables.
+ * lib/erb.rb: ditto.
+ * lib/mkmf.rb: ditto.
+ * lib/net/http/response.rb: ditto.
+ * lib/optparse/version.rb: ditto.
+ * lib/prime.rb: ditto.
+ * lib/racc/parser.rb: ditto.
+ * lib/rexml/document.rb: ditto.
+ * lib/rexml/dtd/dtd.rb: ditto.
+ * lib/rexml/element.rb: ditto.
+ * lib/rexml/functions.rb: ditto.
+ * lib/rexml/parsers/xpathparser.rb: ditto.
- * random.c (f_srand): use tv_usec as the default seed.
+Sun Jul 27 05:11:21 2014 Zachary Scott <e@zzak.io>
- * eval.c (rb_eval): values of nested local variables should be
- independent.
+ * lib/irb.rb: [DOC] PROMPT_I cannot be nil, patch by @hgillane
+ Fixes documenting-ruby/ruby#37
+ https://github.com/documenting-ruby/ruby/pull/37
- * eval.c (rb_yield_0): local variables wrong nested conditions.
+Sun Jul 27 02:41:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Apr 22 23:27:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/shell/command-processor.rb: remove unused variable.
+ * lib/shell/system-command.rb: ditto.
+ * lib/tmpdir.rb: ditto.
+ * lib/uri/generic.rb: ditto.
- * io.c (select_get_io): get IO object by `to_io'.
+Sun Jul 27 02:08:31 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * io.c (io_to_io): method to retrieve IO object, from delegating
- object for example.
+ * lib/weakref.rb: split executable code into sample directory.
+ * sample/weakref.rb: ditto.
-Wed Apr 22 16:52:37 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Jul 27 02:06:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * experimental release 1.1b9_14.
+ * lib/delegate.rb: split executable code into sample directory.
+ * sample/delegate.rb: ditto.
- * string.c (str_modify): check for embedded pointer reference.
+Sun Jul 27 01:46:34 2014 Zachary Scott <e@zzak.io>
- * gc.c (obj_free): ditto.
+ * proc.c (method_super_method): [DOC] Method#super_method
- * pack.c (pack_pack): p/P template to embed pointers.
+Sun Jul 27 01:22:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Apr 22 00:07:10 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * proc.c (method_super_method): new method Method#super_method,
+ which returns a method object of the method to be called by
+ `super` in the receiver method object.
+ [ruby-core:62202] [Feature #9781]
- * array.c (ary_rindex): embarrassing typo.
+Sat Jul 26 17:22:14 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-Tue Apr 21 12:31:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/objspace/objspace_dump.c (dump_append): avoid fflush.
- * experimental release 1.1b9_13.
+ because dump_append_string_value() iterates over each chars,
+ fflush()-ing here effectively issues system calls on every single
+ bytes exist in a ruby process.
- * configure.in (RUBY_LIB): supports --program-{prefix,suffix}.
+Sat Jul 26 16:55:18 2014 Eric Wong <e@80x24.org>
- * array.c (ary_rindex): new method.
+ * iseq.h (struct iseq_compile_data_storage): reduce overhead
+ to 16 bytes (from 32) on 64-bit
- * io.c (io_binmode): should return self.
+Sat Jul 26 16:28:06 2014 Eric Wong <e@80x24.org>
-Tue Apr 21 08:23:04 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * vm_core.h (struct rb_iseq_struct): reduce to 280 bytes
+ (from 288 bytes) on 64-bit
- * parse.y (here_document): calling parse_string with wrong
- arguments.
+Sat Jul 26 06:44:43 2014 Eric Wong <e@80x24.org>
+
+ * parse.y (struct parse_params): shrink to 320 to 304 bytes on 64-bit
+
+Sat Jul 26 05:58:35 2014 Eric Wong <e@80x24.org>
+
+ * include/ruby/ruby.h (ZALLOC, ZALLOC_N): implement
+ (Data_Make_Struct, TypedData_Make_Struct):
+ ZALLOC replaces ALLOC+memset
+ [ruby-core:63951][Feature #10082]
+ * compile.c (iseq_seq_sequence): ZALLOC_N replaces ALLOC_N+MEMZERO
+ * cont.c (fiber_t_alloc): ZALLOC replaces ALLOC+MEMZERO
+ * io.c (rb_io_reopen): ditto
+ * iseq.c (prepare_iseq_build): ditto
+ * parse.y (new_args_tail_gen, parser_new, ripper_s_allocate): ditto
+ * re.c (match_alloc): ditto
+ * variable.c (rb_const_set): ditto
+ * ext/socket/raddrinfo.c (get_addrinfo): ditto
+ * ext/strscan/strscan.c (strscan_s_allocate): ditto
+ * gc.c (rb_objspace_alloc): calloc replaces malloc+MEMZERO
+
+Sat Jul 26 05:54:54 2014 Eric Wong <e@80x24.org>
+
+ * symbol.c (dsymbol_check): remove unneeded semi-colon
+
+Fri Jul 25 14:07:27 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: change objspace::rgengc::parent_object_is_old (boolean)
+ to objspace::rgengc::parent_object (VALUE).
+ Use Qfalse or RVALUE pointer instead of FALSE and TRUE.
+
+ * gc.c (gc_marks_body): should clear parent_object just before
+ gc_mark_roots() because there are no parents objects
+ for root objects.
+
+Fri Jul 25 13:45:39 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (rb_gc_writebarrier_remember_promoted): should remember only
+ OLD objects on RGENGC_AGE2_PROMOTION.
+
+Fri Jul 25 13:42:02 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (gc_mark_stacked_objects): fix error message.
+
+Fri Jul 25 13:18:00 2014 Will Farrington <wfarrington@digitalocean.com>
+
+ * ext/socket/socket.c (sock_gethostname): Use NI_MAXHOST to support
+ hostnames longer than 64 characters if the system supports it.
+ [fixes GH-683]
+
+Fri Jul 25 12:21:11 2014 Santiago Pastorino <santiago@wyeworks.com>
+
+ * compile.c (defined_expr): make the condition if the receiver
+ is explicit or implicit cleaner. [fix GH-681]
+
+Fri Jul 25 03:53:52 2014 Eric Hodel <drbrain@segment7.net>
+
+ * doc/keywords.rdoc: [DOC] Describe each keyword.
+
+Thu Jul 24 22:40:24 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (Init_win32ole): add WIN32OLE_RECORD#initialize
+ method.
+
+ * ext/win32ole/win32ole.c (ole_val2variant): convert WIN32OLE_RECORD
+ object to VT_RECORD variant.
+
+Thu Jul 24 20:10:59 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: fix major GC flags.
+ * add GPR_FLAG_MAJOR_BY_FORCE, which indicates
+ major GC by METHOD, CAPI and so on (see GC_BY).
+ * remove GPR_FLAG_MAJOR_BY_RESCAN because not used.
+ * remove GPR_FLAG_MAJOR_BY_STRESS, use FORCE instead.
+
+ * test/ruby/test_gc.rb: catch up.
+
+Thu Jul 24 15:55:02 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * include/ruby/io.h (struct rb_io_buffer_t): PACKED_STRUCT should not
+ be used for platform-specific optimization. PACKED_STRUCT_UNALIGNED
+ should be used. [ruby-core:63988] [Bug #10088]
+
+Thu Jul 24 04:42:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/benchmark.rb: split executable code into sample directory.
+ * sample/benchmark.rb: ditto.
+
+Thu Jul 24 04:36:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/tempfile.rb: split executable code into sample directory.
+ * sample/tempfile.rb: ditto.
+
+Thu Jul 24 04:29:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/pstore.rb: split executable code into sample directory.
+ * sample/pstore.rb: ditto.
+
+Wed Jul 23 23:50:11 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * include/ruby/defines.h, siphash.c, st.c (UNALIGNED_WORD_ACCESS):
+ add PowerPC64 too, which is capable to access unaligned words.
+ patched by Gustavo Frederico Temple Pedrosa in [ruby-core:63937].
+ [Feature #10081]
+
+ * regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): ditto.
+
+Wed Jul 23 04:04:38 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/drb/extserv.rb: remove duplicate code with sample directory.
+ contributed from @vipulnsward. [fix GH-679]
+
+Tue Jul 22 12:56:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_count): fix wrong single-byte optimization.
+ 7bit ascii can be a trailing byte in Shift_JIS.
+ [ruby-dev:48442] [Bug #10078]
+
+Tue Jul 22 01:48:38 2014 Eric Wong <e@80x24.org>
+
+ * include/ruby/io.h (rb_io_buffer_t): fix packing on gcc
+ r46892 caused packing to be a no-op on gcc (4.7.2-5, Debian)
+ [Bug #10079][ruby-core:63912]
+
+Mon Jul 21 15:55:42 2014 fuji70 <fujifuji70@gmail.com>
+
+ * lib/optparse.rb (getopts): print default values and descriptions
+ in the help message. [fix GH-676]
+
+Sun Jul 20 14:26:27 2014 Eric Wong <e@80x24.org>
+
+ * vm_core.h (rb_proc_t): reduce to 64 bytes from 72 on 64-bit
+
+Sun Jul 20 13:50:34 2014 Eric Wong <e@80x24.org>
+
+ * transcode.c (rb_econv_t): reduce to 184 bytes from 200 on 64-bit
+
+Sun Jul 20 12:44:23 2014 Eric Wong <e@80x24.org>
+
+ * include/ruby/io.h (rb_io_buffer_t): pack structure
+ Reduces rb_io_t from 200 to 192 bytes, allowing rb_io_t to
+ occupy one less cache line.
+ [Feature #10050]
+
+Sun Jul 20 12:41:53 2014 Eric Wong <e@80x24.org>
+
+ * include/ruby/io.h (rb_io_t): shrink to 200 bytes from 216 on 64-bit
+ This puts us within 8 bytes of being three cache lines instead of
+ four lines on x86-64. This breaks the ABI.
+ [Feature #10050]
+
+Sun Jul 20 12:36:46 2014 Eric Wong <e@80x24.org>
+
+ * include/ruby/oniguruma.h (struct re_pattern_buffer): shrink to 448
+ bytes from 464 bytes on 64-bit. This breaks the ABI.
+ [Feature #10034]
+
+Sun Jul 20 01:06:06 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * ext/openssl/ossl.c: use encryptor instead of encrypter in doc.
+ contributed from @vipulnsward. [fix GH-663]
+
+Sun Jul 20 00:32:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_io_initialize): [DOC] fix rdoc of append mode. it does
+ not move the pointer at open. [ruby-core:63747] [Bug #10039]
+
+Sat Jul 19 12:40:50 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * compile.c (iseq_compile_each): allow to access private attribute
+ reader in op_assign. [ruby-core:63817] [Bug #10060]
+
+Sat Jul 19 11:56:36 2014 Grey Baker <greysteil@gmail.com>
+
+ * lib/time.rb (Time#apply_offset): Guards against a `nil` return
+ value from `Time.month_days` when offsetting date. Out of range
+ values are then caught when `Time.utc` is called (as usual).
+
+ Previously a `nil` return value from `Time.month_days` would
+ have the `<` operator called on it, and raise `NoMethodError`.
+ [fix GH-667]
+
+ * lib/rdoc/parser/changelog.rb (RDoc#parse_entries): fix dirty hack.
+
+Sat Jul 19 06:19:01 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c: refactoring.
+
+Fri Jul 18 22:34:41 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (folevariant_initialize): WIN32OLE_VARIANT
+ does not support VT_RECORD. VT_RECORD should be supported in
+ WIN32OLE_RECORD.
+
+ * test/win32ole/test_win32ole_variant.rb (test_s_new_vt_record_exc):
+ ditto.
+
+Fri Jul 18 19:54:03 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (folevariant_initialize): remove unnecessary
+ code.
+
+Fri Jul 18 19:11:03 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+
+ * lib/matrix/eigenvalue_decomposition: Style fix
+ Patch by Gogo Tanaka [#10058]
+
+Fri Jul 18 19:03:53 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+
+ * lib/matrix.rb: Avoid using `and`.
+ Patch by gogo tanaka [#10058]
+
+Fri Jul 18 17:41:54 2014 GoGo tanaka <qlli.illb@gmail.com>
+
+ * test/matrix/test_matrix.rb: Add tests for Matrix class.
+ [Feature #10057][ruby-core:63809]
+
+Fri Jul 18 10:14:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/fileutils.rb: added missing options of FileUtils.touch by @Domon.
+ [fix GH-669]
+
+Thu Jul 17 19:57:27 2014 Herwin <herwin@quarantainenet.nl>
+
+ * ext/thread/thread.c (rb_szqueue_push): add optional parameter,
+ non_block defaulted to false. [ruby-core:63794] [Feature #10052]
+
+Wed Jul 16 23:01:43 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (ole_variant2val): support array of
+ VT_RECORD variant.
+
+Wed Jul 16 20:21:49 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * vm_core.h (struct rb_iseq_struct): stack_max is changed to int
+ because all calculations related to stack_max in compile.c
+ (iseq_set_sequence) and vm_insnhelper.c (vm_push_frame) are
+ conducted by using int. This partly reverts r23945.
+ * vm_insnhelper.c (vm_push_frame): ditto. This reverts r42401.
+
+Wed Jul 16 19:55:32 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * vm_core.h (struct rb_iseq_struct): temporal workaround of [Bug 10037].
+ Add padding on big-endian 64-bit architecture (e.g. sparc64).
+
+Wed Jul 16 19:32:23 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (fole_record_method_missing): call
+ rb_hash_fetch instead of rb_hash_aref.
+
+Wed Jul 16 18:08:47 2014 Koichi Sasada <ko1@atdot.net>
+
+ * iseq.c (rb_iseq_defined_string): use rb_gc_mark_object() instead of
+ marking from vm_mark().
+
+ * vm.c (rb_vm_mark): ditto.
+
+Wed Jul 16 18:03:50 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (gc_mark_roots): call rb_vm_mark directly.
+
+ * vm.c: remove mark function for RubyVM object because
+ RubyVM object marked manually.
- * struct.c (struct_aset): problem member assignment with name.
+Wed Jul 16 12:25:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Mon Apr 20 14:47:49 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * regcomp.c: Merge Onigmo 5.14.1 25a8a69fc05ae3b56a09.
+ this includes Support for Unicode 7.0 [Bug #9092].
- * experimental release 1.1b9_12.
+Tue Jul 15 23:59:27 2014 Jared Jennings <jared.jennings.ctr@us.af.mil>
- * time.c (time_arg): args may be string (support for reduced
- implicit type conversion).
+ * ext/digest: make built-in digest function implementations
+ indicate success or failure of init and final functions.
+ [ruby-core:61614] [Bug #9659]
- * lib/base64.rb: changed to use pack/unpack with `m' template.
+ * ext/digest/digest.c: expect digest init and finish functions to
+ indicate success or failure; raise exception on failure.
+ [ruby-core:61614] [Bug #9659]
-Mon Apr 20 06:23:20 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Jul 15 20:31:40 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
- * variable.c (mod_remove_const): new method.
+ * ext/win32ole/win32ole.c: modify document for WIN32OLE_RECORD.
-Sat Apr 18 03:53:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Jul 15 12:42:23 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * hash.c (hash_each_with_index): removed. use Enumerable's
- each_with_index instead.
+ * defs/default_gems: change version definition file of rake.
- * class.c (rb_include_module): check for super modules, since
- module's included modules may be changed.
+Tue Jul 15 12:00:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Apr 17 21:50:47 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * lib/rake.rb, lib/rake/*.rb: Upgrade to rake-10.3.2
+ [fix GH-668]
+ * test/rake/*.rb: ditto.
- * marshal.c (r_long): r_byte() may return signed byte.
+Mon Jul 14 19:14:51 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-Fri Apr 17 11:58:30 1998 NAGAI Hidetoshi <nagai@dumbo.ai.kyutech.ac.jp>
+ * ext/win32ole/win32ole.c: modify WIN32OLE class document and
+ add comment for constants of WIN32OLE.
- * ext/tcltklib/tcltklib.c (lib_mainloop): thread and interrupt check.
+Mon Jul 14 16:38:45 2014 Eric Wong <e@80x24.org>
-Fri Apr 17 11:06:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_core.h (struct rb_iseq_struct): reduce to 288 bytes
+ on x86-64 (from 296 bytes)
- * eval.c (find_file): try to fopen() to check whether file exists.
+Mon Jul 14 16:07:25 2014 Eric Wong <e@80x24.org>
- * ruby.c (load_file): ditto.
+ * iseq.h (struct iseq_catch_table_entry): shrink to 32 bytes
+ on x86-64 (from 48 bytes)
- * struct.c (struct_aset): struct member can be set by member name.
+Mon Jul 14 16:04:41 2014 Eric Wong <e@80x24.org>
-Fri Apr 17 00:47:19 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * iseq.h (struct iseq_catch_table): new flexible array struct
+ (iseq_catch_table_bytes): allocated size function
+ * vm_core.h (struct rb_iseq_struct): update catch_table member
+ This reduces the struct from 304 to 296 bytes on x86-64.
+ * compile.c (iseq_set_exception_table): update for struct changes
+ * iseq.c (iseq_free): ditto
+ * iseq.c (iseq_memsize): ditto
+ * iseq.c (rb_iseq_disasm): ditto
+ * iseq.c (iseq_data_to_ary): ditto
+ * iseq.c (rb_iseq_build_for_ruby2cext): ditto (untested)
+ * vm.c (vm_exec): ditto
+ * vm_core.h (struct rb_iseq_struct): ditto
+ * vm_insnhelper.c (vm_throw): ditto
- * ext/extmk.rb.in: added m68k-human support
+Sun Jul 13 17:49:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * file.c (LOCK_SH): defines moved.
+ * ext/openssl/ossl_cipher.c: Fix call to ciphers class method and
+ spell out `encryption` by @vipulnsward [fix GH-664]
- * array.c (ary_flatten_bang): simplified loop.
+Sun Jul 13 17:31:51 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Thu Apr 16 16:52:01 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/gdbm/gdbm.c: fix wrong arguments in GetDBM2 macro.
+ * ext/sdbm/init.c: ditto.
- * experimental release 1.1b9_11.
+Sun Jul 13 17:25:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * lib/tk.rb: thread support (experimental - maybe slow).
+ * ext/dbm/dbm.c: fix wrong arguments in GetDBM2 macro by @v2e4lisp.
+ [fix GH-655]
- * eval.c (rb_longjmp): trace event on exception in raising
- context, just before raising exception.
+Sun Jul 13 16:44:56 2014 Eric Wong <e@80x24.org>
- * struct.c (struct_s_members): forgot to check singletons.
+ * vm_core.h (struct rb_call_info_struct): improve packing
+ This reduces the struct from 112 to 104 bytes on x86-64.
- * struct.c (struct_aref): members can be accessed by names too.
+Sun Jul 13 15:53:25 2014 Eric Wong <e@80x24.org>
- * array.c (ary_flatten): new method.
+ * vm_core.h (struct rb_iseq_struct): stack_max is uint32_t
+ This reduces the struct from 312 to 304 bytes on x86-64.
- * eval.c (rb_longjmp): prints exception information with `-d'.
+Sun Jul 13 10:56:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * object.c (any_to_s): remove class name restriction.
+ * configure.in (rb_cv_broken_backtrace): exit with failure
+ normally, no needs to abort. [ruby-core:63678] [Bug #10008]
-Thu Apr 16 01:38:02 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Jul 12 15:10:22 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (fole_record_method_missing): correct
+ fields Hash key.
+
+Sat Jul 12 04:17:40 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
+
+ * lib/net/smtp.rb (Net::SMTP#data): enable buffering while
+ 'data' send for optimizing Net::SMTP#send_message.
+ [ruby-dev:48329] [misc #9981]
+ patch by Masahiro Tomita.
+
+Sat Jul 12 01:13:45 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * test/ruby/envutil.rb (assert_no_memory_leak): On Solaris 9 or later,
+ if possible, execute child ruby with environment variables
+ LD_PRELOAD=libumem.so UMEM_OPTIONS="backend=mmap". With these
+ variables, freed memory is immediately returned to the OS.
+ [Bug #10020] [ruby-dev:48391]
+
+Fri Jul 11 20:49:10 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c: add WIN32OLE_RECORD class to support
+ VT_RECORD OLE variables.
+
+Fri Jul 11 17:15:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/abbrev.rb: remove executable.
+
+Fri Jul 11 16:45:39 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/fileutils.rb: handle ENOENT error with symlink targeted to
+ non-exists file. [ruby-dev:45933] [Bug #6716]
+
+Fri Jul 11 15:59:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * array.c: Clarify documentation for Array#insert.
+ [ruby-core:62934] [Bug #9901]
+
+Fri Jul 11 15:39:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * io.c: Improve Documentation by @dapplebeforedawn.
+ [fix GH-658] [ruby-core:63579] [Bug #10012]
+
+Fri Jul 11 14:19:14 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+
+ * lib/matrix.rb: Fix sign for cross_product [#9499]
+
+Fri Jul 11 11:11:50 2014 Koichi Sasada <ko1@atdot.net>
+
+ * benchmark/prepare_so_k_nucleotide.rb: use require_relative.
+
+ * benchmark/prepare_so_reverse_complement.rb: ditto.
+
+Fri Jul 11 10:09:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * pack.c (encodes): fix buffer overrun by tail_lf. Thanks to
+ Mamoru Tasaka and Tomas Hoger. [ruby-core:63604] [Bug #10019]
+
+Thu Jul 10 23:51:36 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * hash.c (ruby_setenv): Fix TestEnv#test_aset failure on Solaris 9.
+ When name contains '=', ruby_setenv raises Errno::EINVAL.
+ That is the same behavior as Solaris 10.
+ NULL check for malloc return value is also added.
+
+Thu Jul 10 15:02:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm_insnhelper.c (vm_callee_setup_keyword_arg): adjust VM stack
+ pointer to get rid of overwriting splat arguments by arguments
+ for `to_hash` conversion. [ruby-core:63593] [Bug #10016]
+
+Thu Jul 10 01:09:57 2014 Koichi Sasada <ko1@atdot.net>
+
+ * symbol.c: remove rb_gc_mark_symbols().
+
+ fstrings referred by static symbols and pinned dynamic symbols
+ are registered by rb_gc_register_mark_object().
+
+ fstrings referred by dynamic symbols (not pinned symbols)
+ are referred from global_symbols.dsymbol_fstr_hash (Hash object).
+
+ Note that fstrings referred from dynamic symbols must live logger
+ than symbol objects themselves because rb_gc_free_dsymbol() uses
+ fstrings to remove from symbol tables.
+ This is why we can not mark fstrings from dynamic symbols.
+
+ This technique reduces root objects for GC marking.
+
+ * gc.c (gc_mark_roots): ditto.
+
+ * internal.h: ditto.
+
+Thu Jul 10 00:24:18 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * common.mk (DTRACE_DEPENDENT_OBJS): fix build failure on Solaris
+ introduced in r46768. Object files containing dtrace probes should
+ be listed in DTRACE_DEPENDENT_OBJS.
+
+Wed Jul 9 17:07:28 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * symbol.c, symbol.h: Symbol class implementation and internals,
+ split from parse.y.
+
+Wed Jul 9 14:45:39 2014 Koichi Sasada <ko1@atdot.net>
+
+ * parse.y: change Symbol <-> ID relationship to avoid
+ exposing IDs from collectable symbols.
+ [Bug #10014]
+
+ Now, rb_check_id() returns 0 if corresponding symbol is
+ pinned dynamic symbol.
+
+ There is remaining intern_cstr_without_pindown(), it can return
+ IDs from collectable symbols. We must be careful to use it
+ (only used in parse.y). I think it should be removed if
+ it does not have impact for performance.
+
+ * parse.y:
+ add:
+ * STATIC_SYM2ID()
+ * STATIC_ID2SYM()
+ rename:
+ * rb_pin_dynamic_symbol() -> dsymbol_pindown()
+
+ * internal.h:
+ remove:
+ * rb_check_id_without_pindown()
+ * rb_sym2id_without_pindown()
+ add:
+ * rb_check_symbol()
+ * rb_check_symbol_cstr()
+
+ * load.c: use rb_check_id() or rb_check_id_cstr().
+
+ * object.c: ditto.
+
+ * struct.c: ditto.
+
+ * thread.c: ditto.
+
+ * vm_method.c: ditto.
+
+ * string.c (sym_find): use only rb_check_symbol().
+
+ * sprintf.c (rb_str_format): use rb_check_symbol_cstr().
+
+Wed Jul 9 12:21:55 2014 Koichi Sasada <ko1@atdot.net>
+
+ * parse.y (symbols_i): delete garbage symbols for Symbol.all_symbols.
+
+Wed Jul 9 05:49:08 2014 Eric Wong <e@80x24.org>
+
+ * thread_pthread.h (struct rb_global_vm_lock_struct):
+ do not expose pthread type for lock
+
+Wed Jul 9 05:41:40 2014 Eric Wong <e@80x24.org>
+
+ * thread_pthread.h: remove unneeded semaphore.h include
+
+Wed Jul 9 00:12:28 2014 Keiju Ishitsuka <keiju@ishitsuka.com>
+
+ * lib/irb/ruby-lex.rb: fix counting indent in identify_string_dvar.
+
+Tue Jul 8 16:58:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/ruby/memory_status.rb (Memory::PSCMD): use ps command which
+ outputs expected result. [ruby-dev:48370] [Bug #10010]
+
+Tue Jul 8 14:45:17 2014 Koichi Sasada <ko1@atdot.net>
+
+ * parse.y (dsymbol_alloc): set global_symbols.minor_marked to 0.
+
+ * parse.y (dsymbol_check): set RSYMBOL(sym)->fstr to 0
+ because we should not touch fstr after that.
+
+ * parse.y (rb_gc_free_dsymbol): skip deleting str and sym
+ from tables if fstr == 0.
+
+Mon Jul 7 14:31:52 2014 Koichi Sasada <ko1@atdot.net>
+
+ * parse.y: remove global_symbols::pinned_dsym
+ (and ::pinned_dsym_minor_marked).
+
+ Mark pinned dsymbols by rb_gc_register_mark_object() because
+ they are immortal.
+
+ * parse.y (rb_gc_free_dsymbol): rename parameter name `ptr' to `sym'.
+
+Mon Jul 7 12:45:51 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: revert miss-commit.
+
+Mon Jul 7 12:40:59 2014 Koichi Sasada <ko1@atdot.net>
+
+ * parse.y: need to use updated (re-created) symbols.
+
+Mon Jul 7 11:02:55 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * tool/mkconfig.rb: remove not to require rbconfig/obsolete.rb.
+
+ * lib/rbconfig/obsolete.rb: removed.
+
+Mon Jul 7 10:52:03 2014 Koichi Sasada <ko1@atdot.net>
+
+ * parse.y: do not use rb_gc_resurrect(), but create a new dynamic
+ symbol for garbage dynamic symbol.
+
+ * common.mk: use gc.h by parse.y.
+
+Mon Jul 7 02:18:42 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c (fstr_update_callback): do not use rb_gc_resurrect()
+ any more.
+
+ Make new frozen string and replace with garbage frozen string.
+
+ * common.mk: use gc.h from string.c.
+
+Mon Jul 7 00:36:13 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: rename is_dying_object() to is_garbage_object().
+
+ * gc.h: rb_objspace_garbage_object_p() as an exported function.
+
+Sun Jul 6 21:30:35 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (is_dying_object): fix missed condition.
+
+ * gc.c (is_live_object): move frequent path first.
+
+Sun Jul 6 21:00:11 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: rename is_dead_object() to is_dying_object().
+ This function is not opposite against is_live_object()
+ because is_dying_object() does *not* check object type.
+
+ * gc.c (is_dying_object): change condition.
+
+ * gc.c (is_live_object): use T_NONE instead of 0.
+
+ * gc.c (rb_objspace_dying_object_p): added.
+
+Sun Jul 6 13:37:27 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (rb_gc_register_mark_object): change data structure.
+ From single array, to array of arrays. Each array only has 1024
+ entries.
- * file.c (thread_flock): do not block other threads.
+ * vm.c (Init_vm_objects): change default capa from 1 to 128.
- * eval.c (thread_trap_eval): signals are now delivered to the
- current thread again. In case that the current thread is dead,
- signals are forwarded to the main thread.
+Sat Jul 5 05:05:53 2014 Vipul A M <vipulnsward@gmail.com>
- * string.c (str_new4): need not to duplicate frozen strings.
+ * lib/irb/locale.rb (IRB::Locale#modifier): fix wrong attr_reader
+ `modifieer` => `modifier` from irb locale. [fix GH-656]
-Wed Apr 15 08:33:47 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+Fri Jul 4 20:45:26 2014 Koichi Sasada <ko1@atdot.net>
- * struct.c (struct_inspect): remove restriction for struct names.
+ * parse.y: rename symbols::sym_id to symbols::str_id.
+ This table is not {Symbol => ID} table, but
+ {String => ID} table.
-Wed Apr 15 02:55:02 1998 Kazuya 'Sharl' Masuda <sharl@www.ufo.co.jp>
+ * parse.y (lookup_sym_id): also rename lookup_sym_id() to
+ lookup_str_id() because key is not Symbol, but String.
- * x68 patches to config.sub, ext/extmk.rb.in
+Fri Jul 4 18:42:04 2014 Koichi Sasada <ko1@atdot.net>
-Wed Apr 15 01:22:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * parse.y (must_be_dynamic_symbol): fix missed-condition.
- * string.c (str_dup_frozen): do not duplicate frozen strings.
+Fri Jul 4 18:38:11 2014 Koichi Sasada <ko1@atdot.net>
- * parse.y (yylex): allow nested parenthesises.
+ * parse.y (rb_pin_dynamic_symbol): should be `static' function.
- * io.c (obj_displayln): prints newline after `display'ing the
- receiver.
+Fri Jul 4 18:03:35 2014 Koichi Sasada <ko1@atdot.net>
- * io.c (io_puts): avoid generating "\n" each time. use RS_default
- instead.
+ * parse.y (must_be_dynamic_symbol): refactoring.
+ * add `inline'.
+ * use UNLIKELY().
+ * check only DYNAMIC_SYM_P(), otherwise it is a bug.
+ * lookup_id_str() is not needed in second condition.
- * io.c (f_p): ditto.
+Fri Jul 4 11:53:56 2014 Koichi Sasada <ko1@atdot.net>
-Tue Apr 14 22:18:17 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * parse.y: remove unused code
+ surrounded by `#if ENABLE_SELECTOR_NAMESPACE'
- * struct.c (struct_aref): should not subtract negative index.
+Fri Jul 4 10:08:24 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Apr 14 11:34:50 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/rubygems/test_gem_package.rb: avoid tempfile leaks using Tempfile#close!
+ * test/rubygems/test_gem_request_set.rb: ditto.
+ * test/rubygems/test_gem_request_set_gem_dependency_api.rb: ditto.
- * experimental release 1.1b9_10.
+Fri Jul 4 04:42:05 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * parse.y: token names prefixed by `t'.
+ * lib/net/http/response.rb (Net::Inflater#inflate_adapter):
+ prevent automatic encoding conversion.
- * struct.c (struct_s_def): supports subclassing of Struct.
+Fri Jul 4 04:39:52 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * io.c (io_s_new): supports subclassing of IO.
+ * lib/net/http/response.rb (Net::HTTPResponse.each_response_header):
+ raise first exception even if inflate_body_io.finish raises error.
+ when begin block raises error, finish usually raises error too.
-Mon Apr 13 11:07:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Jul 4 02:56:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (f_binding): need to restore method name.
+ * lib/uri/generic.rb (URI::Generic#query=): remove validation, just
+ escape. [Feature #2542]
- * eval.c (rb_call0): raises SystemStackError, not Fatal.
+ * lib/uri/generic.rb (URI::Generic#fragment=): ditto.
- * io.c (obj_display): same as `print self'.
+ * lib/uri/generic.rb (URI::Generic#check_query): removed.
- * io.c (f_p): can now be called in the method form.
+ * lib/uri/generic.rb (URI::Generic#set_query): ditto.
- * re.c (reg_regsub): needed to be mbchar aware.
+ * lib/uri/generic.rb (URI::Generic#check_fragment): ditto.
-Mon Apr 13 13:18:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/uri/generic.rb (URI::Generic#set_fragment): ditto.
- * eval.c (thread_trap_eval): all signals delivered to main_thread.
+Thu Jul 3 12:40:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Apr 13 12:47:03 1998 TAKAHASHI Masayoshi <maki@inac.co.jp>
+ * configure.in (--with-static-linked-ext): fix for extensions to
+ be linked statically.
- * re.c (kcode_set_option): did not set SJIS on SJIS condition.
+ * Makefile.in, common.mk: use ENCSTATIC for enc directory.
-Sun Apr 12 22:14:07 1998 Kazunori NISHI <kazunori@swlab.csce.kyushu-u.ac.jp>
+ * ext/extmk.rb: supply dependencies of statically linked extension
+ libraries.
- * array.c (ary_uniq_bang): should be `==', not `='. embarrassing.
+Wed Jul 2 15:45:49 2014 Koichi Sasada <ko1@atdot.net>
-Sat Apr 11 02:13:30 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (gc_heap_lazy_sweep): simplify logic.
- * array.c (ary_subseq): SEGVed for `[][1,1]'.
+ * gc.c (gc_page_sweep): return TRUE if empty slots are available.
-Fri Apr 10 21:29:06 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+Wed Jul 2 09:48:42 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * array.c (ary_subseq): add check for beg larger than array length.
+ * logger.rb: removed unmaintained code.
+ [Feature #9860][ruby-core:62724]
+ * test/logger/test_application.rb: ditto.
-Wed Apr 8 17:24:11 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+Wed Jul 2 03:20:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
- * dir.c (dir_s_open): can be called with block (like IO#open).
+ * node.c (dump_node): handle nd_value == (NODE *)-1 to mean this
+ keyword argument is required
- * dir.c (dir_s_chdir): print directory path on error.
+Wed Jul 2 02:57:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * dir.c (dir_s_chroot): ditto
+ * vm.c (rb_vm_env_local_variables): returns array of local
+ variable name symbols in the environment by envval.
- * dir.c (Init_Dir): needed to override `new'.
+ * proc.c (bind_local_variables): use rb_vm_env_local_variables.
-Thu Apr 9 18:24:58 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Jul 2 02:23:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * experimental release 1.1b9_09.
+ * proc.c (bind_receiver): new method to return the bound receiver
+ of the binding object. [ruby-dev:47613] [Feature #8779]
- * string.c (str_cmp): do not depend on sentinel at the end of the
- strings.
+Wed Jul 2 02:14:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (str_chomp_bang): forgot to set the sentinel.
+ * proc.c (bind_local_variables): update env from envval for each
+ iterations. [ruby-dev:48351] [Bug #10001]
-Wed Apr 8 00:59:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue Jul 1 23:46:34 2014 NAKAMURA Usaku <usa@ruby-lang.org>
- * bignum.c (big2int): converted int may be too big to fit in
- signed int.
+ * NEWS: [DOC] mention about Binding#local_variables, introduced at
+ r44392 (see [Feature #8773]).
- * parse.y (arg): `foo += 1' should not cause an error.
+Tue Jul 1 23:30:51 2014 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
- * variable.c (rb_const_defined): returned false even if the
- constant is defined at the top level.
+ * numeric.c (num_step_scan_args): table argument of rb_get_kwargs() is
+ array of IDs, not Symbols. [ruby-dev:48353] [Bug #9811]
- * eval.c (f_local_variables): dyna_var->id may be null. should
- have checked before calling str_new2().
+Tue Jul 1 16:18:22 2014 Akinori MUSHA <knu@iDaemons.org>
-Tue Apr 7 01:15:15 1998 Kaneko Naoshi <wbs01621@mail.wbs.or.jp>
+ * ext/digest/lib/digest/hmac.rb, test/digest/test_digest_hmac.rb:
+ Digest::HMAC is finally removed as previously noticed.
+ [fix GH-648]
- * re.c (reg_regsub): need to check string boundary.
+Tue Jul 1 11:13:43 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Tue Apr 7 19:19:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/date/lib/date/format.rb: removed empty file by @vipulnsward.
+ * ext/date/lib/date.rb: removed needless require.
+ [fix GH-647]
- * string.c (str_cmp): returns either 1, 0, -1.
+Mon Jun 30 16:42:52 2014 Koichi Sasada <ko1@atdot.net>
- * array.c (ary_cmp): should check array length, too
+ * gc.c (gc_stat_internal): return size_t value instead of VALUE
+ and remove `out' parameter.
-Tue Apr 7 18:50:16 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c: add braces for `if' statements.
- * experimental release 1.1b9_08.
+ * gc.c (gc_stat_internal): fix comment.
-Tue Apr 7 18:31:27 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Mon Jun 30 15:07:34 2014 Koichi Sasada <ko1@atdot.net>
- * instruby.rb (mandir): dll installation for cygwin32
+ * gc.c: support `USE_RGENGC == 0'.
-Tue Apr 7 01:16:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_gc.rb: ditto.
- * config.sub (maybe_os): TOWNS support?
+Mon Jun 30 11:36:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * config.guess: too strict check for libc versions on linuxes.
+ * file.c: [DOC] document File.join returns a string.
+ Contributed by @dapplebeforedawn. [fix GH-646]
- * experimental release 1.1b9_07.
+Sat Jun 28 22:57:01 2014 NAKAMURA Usaku <usa@ruby-lang.org>
- * array.c (ary_cmp): compare each element using `<=>'.
+ * ext/pathname/pathname.c (path_birthtime): Windows support.
+ see [Feature #9857] [ruby-dev:48339]
- * hash.c (hash_each_with_index): yields [value, key] pair.
+Sat Jun 28 22:44:16 2014 Tanaka Akira <akr@fsij.org>
- * class.c (class_protected_instance_methods): list protected
- method names.
+ * ext/pathname/pathname.c (path_birthtime): New method,
+ Pathname#birthtime.
+ Proposed by Kazuhiro NISHIYAMA. [ruby-dev:48232] [Feature #9857]
- * class.c (ins_methods_i): exclude protected methods.
+Sat Jun 28 20:29:03 2014 Simon Baird <simon.baird@gmail.com>
- * eval.c (PUSH_BLOCK): dynamic variables can be accessed from
- eval() with bindings.
+ * ext/bigdecimal/lib/bigdecimal/math.rb (BigMath#PI): change error
+ message about zero or negative precision for clarity and
+ consistency with other methods. [GH-644]
-Mon Apr 6 14:49:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Jun 28 15:32:57 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (thread_yield): must return evaluated value.
+ * lib/webrick/utils.rb (create_listeners): Close socket objects.
-Fri Apr 3 13:07:29 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Jun 28 13:58:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (thread_schedule): context switch bypassed on wrong
- conditions.
+ * eval.c (setup_exception): should not overwrite SystemStackError
+ backtrace if set already. [ruby-core:63377] [Feature #6216]
- * variable.c (rb_name_class): set classname by id before String
- class is initialized (1.0 behavior restored).
+ * eval.c (setup_exception): get rid of method calls before raising
+ stack overflow, not to cause stack overflow again.
-Fri Apr 3 11:25:45 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * defs/id.def: add IDs for backtraces.
- * numeric.c (num2int): no implicit conversion from string.
+Sat Jun 28 04:08:22 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * numeric.c (num2int): check whether `to_i' returns an Integer.
+ * lib/uri/mailto.rb: update to latest specs, RFC 6068 and HTML5.
- * numeric.c (num_zero_p): new method.
+ * lib/uri/mailto.rb (HEADER_PATTERN): removed.
- * numeric.c (num_nonzero_p): new method. returns the receiver if
- it's not zero.
+ * lib/uri/mailto.rb (HEADER_REGEXP): use RFC 6068 hfields.
- * eval.c (obj_instance_eval): the_class should be the object's
- singleton class.
+ * lib/uri/mailto.rb (EMAIL_REGEXP): use HTML5 email regexp.
- * error.c (exc_s_new): message is converted into a string.
+ * lib/uri/mailto.rb (URI::MailTo.build): support multiple to addresses.
-Thu Apr 2 18:31:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/uri/mailto.rb (URI::MailTo#initialize): Support multiple to
+ addresses. Don't check with regexp, only split.
- * eval.c (obj_call_init): every object call `initialize'.
+ * lib/uri/mailto.rb (URI::MailTo#check_to): verify by matching
+ URI path-rootless and HTML5 email regexp with unescaped one.
-Wed Apr 1 08:51:53 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * lib/uri/mailto.rb (URI::MailTo#check_headers): verify only by
+ HEADER_REGEXP.
- * parse.y (stmt): UNTIL_MOD should be for stmt, not only for expr.
+ * lib/uri/mailto.rb (URI::MailTo#set_headers): don't check by
+ HEADER_REGEXP, only split it.
-Wed Apr 1 01:20:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Jun 28 00:35:10 2014 Lauri Tirkkonen <lotheac@iki.fi>
- * object.c (true_and): boolean operators &, | and ^.
+ * tool/mkconfig.rb: fix empty RbConfig::CONFIG["prefix"] when
+ configured --with-rubyarchprefix, remove prefix from rubyarchdir
+ after expansion for the case it does not start with '$(prefix)'.
+ [fix GH-643]
-Tue Mar 31 13:23:58 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Jun 27 15:20:12 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * array.c (ary_compact_bang): returns nil, if it does not modify
- the array like String's bang methods.
+ * lib/rubygems/test_case.rb: rescue Gem::LoadError in Gem::TestCase.
+ because it's effected by removing minitest from stdlib.
- * array.c (ary_uniq_bang): new method to remove duplicate items.
+Fri Jun 27 12:29:37 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (bind_s_new): new method.
+ * lib/rubygems/specification.rb: fixed broken condition caused
+ by removing YAML::ENGINE.
+ * lib/rubygems/package/old.rb: ditto.
- * numeric.c (num2int): raise exception if Fixnums too big to
- convert into `int' in case that sizeof(int) < sizeof(INT).
+Fri Jun 27 05:33:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (str_center): SEGV on negative width.
+ * hash.c (env_shift): fix memory leak on Windows, free environment
+ strings block always. [ruby-dev:48332] [Bug #9983]
- * eval.c (eval): forgot to set sourcefile.
+Fri Jun 27 03:41:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Mar 30 11:12:29 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * sprintf.c (GETASTER): should not use the numbered argument to be
+ formatted, raise ArgumentError instead.
+ [ruby-dev:48330] [Bug #9982]
- * file.c (f_test): raises exception for unkown command.
+Thu Jun 26 18:18:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (Init_eval): `class_eval': alias to the module_eval.
+ * test/with_different_ofs.rb: move into test library directory.
+ * test/csv/base.rb: fix require path for with_different_ofs.rb.
+ * test/digest/test_digest_extend.rb: ditto.
-Mon Mar 30 18:50:42 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+Thu Jun 26 18:06:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * string.c (str_capitalize_bang): did not check string modification.
+ * test/profile_test_all.rb: move into test library directory.
+ * test/runner.rb: fix require path for profile_test_all.rb.
- * string.c (str_delete_bang): wrong conversion.
+Thu Jun 26 17:57:57 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * string.c (str_intern): typo in error message.
+ * lib/webrick/httpproxy.rb: remove useless assigned variables.
+ * lib/webrick/httpservlet/cgihandler.rb: ditto.
+ * lib/webrick/httpservlet/erbhandler.rb: ditto.
+ * lib/webrick/server.rb: ditto.
-Mon Mar 30 01:44:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Jun 26 08:28:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (obj_instance_eval): accepts block as evaluation body.
- No compilation needed each time.
+ * hash.c (env_select): fix memory leak and crash on Windows, make
+ keys array first instead of iterating on environ directly.
+ [ruby-dev:48325] [Bug #9978]
- * eval.c (mod_module_eval): ditto
+Thu Jun 26 02:45:04 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * file.c (file_s_umask): umask did not return old values, if no
- argument given.
+ * eval_error.c (error_print): put a newline after an anonymous
+ exception class name.
-Sun Mar 29 00:54:23 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Jun 25 22:31:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (f_throw): nil returned always.
+ * hash.c (ruby_setenv): fix memory leak on Windows, free
+ environment strings block after check for the size.
+ [ruby-dev:48323] [Bug #9977]
-Sat Mar 28 20:40:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Jun 25 15:44:12 2014 Eric Wong <e@80x24.org>
- * experimental release 1.1b9_06.
+ * ccan/container_of/container_of.h (container_off_var):
+ avoid warning with -Wcast-qual
+ [ccan ba5ad771af4aa9e085498de6c3c665c52694460f (Rusty Russell)]
-Sat Mar 28 16:07:11 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Wed Jun 25 10:19:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_closed): should not cause exception fot closed IO.
+ * hash.c (env_aset, env_has_key, env_assoc, env_has_value),
+ (env_rassoc, env_key): prohibit tainted strings if $SAFE is
+ non-zero. [Bug #9976]
- * string.c (str_tr): returned nil for success.
+Tue Jun 24 14:46:17 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Sat Mar 28 00:47:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/gserver.rb: remove redundant use of to_s in interpolation.
+ * lib/logger.rb: ditto.
+ * lib/optparse.rb: ditto.
+ * lib/rbconfig/obsolete.rb: ditto.
+ * lib/resolv.rb: ditto.
+ * lib/webrick/httpresponse.rb: ditto.
- * eval.c (f_local_variables): new method to return an array of
- local variable names.
+Tue Jun 24 10:50:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * variable.c (obj_instance_variables): now returns an array of
- variable names, as described in the reference.
+ * hash.c (env_path_str_new): make PATH environment variable
+ string, to be frozen.
- * eval.c (rb_attr): honors default method visibility of the
- current scope.
+Tue Jun 24 10:40:52 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Fri Mar 27 13:49:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * tool/make-snapshot: download bundle gems when package making.
+ [Feature #9852][ruby-core:62676]
+ * gems/bundled_gems: listed bundled gems for Ruby 2.2.
- * experimental release 1.1b9_05.
+Tue Jun 24 10:20:35 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ruby.c (ruby_prog_init): `site_ruby' added to load_path.
+ * tool/downloader.rb: make Downloader class to general download utility.
+ It can be used without config.guess and config.sub.
+ * tool/get-config_files: ditto.
+ * tool/make-snapshot: ditto.
- * ruby.c (ruby_prog_init): load-path order changed. Paths in
- the RUBYLIB environment variable comes first in non-tainted
- mode.
+Tue Jun 24 06:17:52 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Thu Mar 26 11:51:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * eval.c (setup_exception): "mesg == sysstack_error" and
+ sysstack_error_p(mesg) are duplicated.
+ r46502 seems to want to use latter.
- * eval.c (rb_call): new feature: `protected' methods.
+Tue Jun 24 06:15:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (str_dump): new method.
+ * ext/tk/tcltklib.c: fix format specifiers for VALUE and
+ Tcl_Interp*. [ruby-core:63283] [Bug #9972]
- * eval.c (block_pass): block argument can be nil, which means no
- block is supplied for the method.
+Tue Jun 24 05:40:41 2014 KOSAKI Motohiro <kosaki.motohiro@gmail.com>
-Wed Mar 25 21:20:13 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+ * nacl/nacl-config.rb: Use File.exist? instead of executable?
+ for irt_core. Recent nacl_sdk has non-executable irt_core.
+ Patch by Shinichiro Hamaji.
+ [Fixes GH-529] https://github.com/ruby/ruby/pull/529
- * string.c (str_reverse_bang): string copied to wrong place.
+Mon Jun 23 18:44:45 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Mar 25 08:12:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * tool/config_files.rb: rename class ConfigFiles to Downloader.
+ * tool/get-config_files: ditto.
+ * tool/make-snapshot: ditto.
- * numeric.c (flo_modulo): caused SEGV if left operand is not a
- float value.
+Mon Jun 23 18:03:13 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (f_eval): optional third and fourth argument to specify
- file-name and line-number.
+ * tool/rbinstall.rb: support to install bundle gems.
- * eval.c (eval): file-name and line-number set properly.
+Mon Jun 23 17:33:11 2014 Akinori MUSHA <knu@iDaemons.org>
- * parse.y (assign_in_cond): literal assignment is now warning, not
- compile error.
+ * lib/net/imap.rb (Net::IMAP#fetch): [DOC] Describe how a range in
+ +set+ is interpreted, and mention -1 which can be used for '*'.
- * error.c (Warn): Warn() always print message, OTOH Waring()
- prints when verbose flag is set.
+Mon Jun 23 16:22:50 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-Tue Mar 24 12:50:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h (struct RHash): no longer. [Feature #9889]
- * ruby.c (ruby_prog_init): `.' should come last in the load-path.
+ * include/ruby/ruby.h (RHASH): ditto.
- * eval.c (Init_eval): `__send__', alias for `send'.
+ * include/ruby/ruby.h (RHASH_ITER_LEV): deprecated. Will be deleted later.
-Mon Mar 23 12:44:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h (RHASH_IFNONE): ditto.
- * string.c (str_chomp_bang): now takes `rs' as an argument.
+ * internal.h (struct RHash): moved here.
- * eval.c (thread_free): main_thread should not be freed.
+ * internal.h (RHASH): ditto.
-Fri Mar 20 16:40:34 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * hash.c (rb_hash_iter_lev): do not use this.
- * string.c (str_chomp_bang): chomp! (and other ! methods) returns
- nil if it does not modify the string.
+ * hash.c (rb_hash_ifnone): ditto.
- * string.c (str_sub_iter_s): should check last pattern since it
- may be matched to null.
+Mon Jun 23 13:30:11 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
-Thu Mar 19 13:48:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h (struct RComplex): no longer. [Feature #9888]
- * experimental release 1.1b9_04.
+ * include/ruby/ruby.h (RCOMPLEX): ditto.
- * parse.y (yylex): `10e0.9' should cause syntax error.
+ * include/ruby/ruby.h (RCOMPLEX_SET_REAL): deprecated. Will be deleted later.
-Wed Mar 18 17:46:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h (RCOMPLEX_SET_IMAG): ditto.
- * ruby.c (load_file): new file object constant DATA. Only
- available for the script from the file.
+ * internal.h (struct RFloat): moved here.
- * regex.c (re_match): forwading failure point popped too much.
+ * internal.h (RCOMPLEX): ditto.
-Tue Mar 17 18:23:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * complex.c (rb_complex_set_real): do not use this.
- * math.c (math_frexp): newly added.
+ * complex.c (rb_complex_set_imag): ditto.
- * math.c (math_ldexp): ditto.
+Mon Jun 23 13:10:15 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
- * bignum.c (bigdivmod): calculates modulo.
+ * include/ruby/ruby.h (struct RFloat): no longer. [Feature #9863]
- * numeric.c (fix_remainder): returns reminder, formerly introduced
- as modulo.
+ * include/ruby/ruby.h (RFLOAT): ditto.
- * numeric.c (fix_modulo): calculates proper `modulo'.
+ * internal.h (struct RFloat): moved here.
- * bignum.c (bigdivmod): wrong sign for reminder.
+ * internal.h (RFLOAT): ditto.
-Mon Mar 16 17:07:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Jun 23 12:01:42 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * experimental release 1.1b9_03.
+ * lib/uri/generic.rb (check_port): allow strings for port= as
+ described in rdoc.
-Mon Mar 16 16:33:53 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * lib/uri/rfc3986_parser.rb (regexp): implementation detail of above.
- * io.c (pipe_finalize): needed to add pipe_finalize to pipes on
- cygwin32.
+Mon Jun 23 11:35:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Mar 16 14:11:06 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * eval.c (setup_exception): set backtrace in system stack error
+ other than the pre-allocated sysstack_error. [Feature #6216]
- * class.c (ins_methods_i): needed to consider NOEX_UNDEF.
+ * proc.c (Init_Proc): freeze the pre-allocated sysstack_error.
-Mon Mar 16 13:23:53 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * vm_insnhelper.c (vm_stackoverflow): raise new instance for each
+ times without calling any methods to keep the backtrace with no
+ further stack overflow.
- * io.c (io_check_closed): check for `fptr->f2 == NULL'.
+ * object.c (rb_obj_copy_ivar): extract function to copy instance
+ variables only for T_OBJECT from init_copy.
- * io.c (io_fptr_close): ditto.
+Mon Jun 23 11:11:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Mon Mar 16 11:49:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * signal.c (check_stack_overflow): drop the last tag too close to
+ the fault page, to get rid of stack overflow deadlock.
+ [Bug #9971]
- * io.c (pipe_atexit): free()ing referencing pipe_list.
+Sun Jun 22 09:11:15 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * range.c (range_length): returns zero, if the first is greater
- than the last.
+ * lib/uri/generic.rb: remove registry.
+ 'registry' is not used and RFC3986 doesn't use it.
- * signal.c (trap_restore_mask): restore signal mask before raising
- exceptions and throws.
+Sun Jun 22 09:10:09 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Fri Mar 13 13:49:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/uri/rfc3986_parser.rb: raise exception when given a URI string
+ has non ASCII in order to keep the regexp compiled for US-ASCII.
- * experimental release 1.1b9_02.
+Sun Jun 22 09:05:42 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * object.c (mod_clone): need to dups constants and instance
- variables.
+ * lib/uri/common.rb (URI::REGEXP): move to lib/uri/rfc2396_parser.rb.
- * eval.c (rb_eval): forgot to initialize body for NODE_DEFS.
+ * lib/uri/common.rb (URI::Parser): ditto.
- * eval.c (rb_eval): retrieve self from calling frame, since self
- changes sometimes.
+ * lib/uri/common.rb (URI.split): use RFC3986_Parser. [Feature #2542]
- * env.h (FRAME): need to save self in the calling frame.
+ * lib/uri/common.rb (URI.parse): ditto.
- * io.c (f_gets_method): rs should be initialized by RS.
+ * lib/uri/common.rb (URI.join): ditto.
-Thu Mar 12 15:33:57 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/uri/common.rb (URI.extract): deprecated.
- * experimental release 1.1b9_01.
+ * lib/uri/common.rb (URI.regexp): ditto.
- * range.c (range_s_new): check values by `first <= last'.
+ * lib/uri/rfc2396_parser.rb: added.
- * parse.y (lastline_set): fixed offset for $_ and $~ in the local
- variable space.
+ * lib/uri/rfc3986_parser.rb: added.
-Wed Mar 11 02:14:17 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Jun 22 09:04:50 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * io.c (io_gets): handle normal case specially for speed.
+ * lib/uri/mailto.rb (initialize): as previous commit, fix arg_check
- * eval.c (rb_disable_super): function to disable superclass's
- method explicitly.
+Sun Jun 22 09:01:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * eval.c (rb_eval): inherits previous method definition's
- NOEX_UNDEF-ness, if exists.
+ * lib/uri/ftp.rb (initialize): argument checking flag is arg_check,
+ but arg[-1] is fragment.
- * class.c (rb_define_method): disables superclass's overriding
- method by default.
+ * lib/uri/ftp.rb (initialize): explicitly specify arguments.
-Wed Mar 11 01:40:48 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+Sat Jun 21 12:50:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * numeric.c (flo_gt,etc.): do not depend on `<=>', to handle NaN.
+ * ext/fiddle/extconf.rb: supply 0 to fill RUBY_LIBFFI_MODVERSION
+ with 3-digit. libffi 3.1 returns just 2-digit.
+ [ruby-core:62920] [Bug #9897]
-Tue Mar 10 00:03:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Jun 21 07:06:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ruby.c (load_file): understands multiple options in #! line.
+ * encoding.c (enc_find): [DOC] never accepted a symbol.
+ [ruby-dev:48308] [Bug #9966]
- * regex.c (re_compile_pattern): support for [:alpha:] etc.
+Fri Jun 20 17:15:43 2014 Koichi Sasada <ko1@atdot.net>
-Mon Mar 9 16:53:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/tracepointchecker.rb: add to check TracePoint healthiness.
- * io.h (GetOpenFile): embed io_check_closed in GetOpenFile.
+ * test/runner.rb: use it.
- * sprintf.c (f_sprintf): zero padding failed for negative
- integers.
+Fri Jun 20 07:26:44 2014 Koichi Sasada <ko1@atdot.net>
- * sprintf.c (remove_sign_bits): failed to remove some bits.
+ * test/ruby/test_settracefunc.rb: rewrite tests with
+ assert_consistent_call_return().
-Sat Mar 7 21:51:46 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+ assert_consistent_call_return() is also modified to check
+ consistency.
- * class.c (ins_methods_i): body may be NULL for some case.
+Fri Jun 20 07:07:28 2014 Koichi Sasada <ko1@atdot.net>
-Fri Mar 6 17:23:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * compile.c (rb_iseq_compile_node): put start label of block after
+ trace (b_call).
+ [Bug #9964]
- * regex.c (mbcinit): table driven mbchar detection.
+ * test/ruby/test_settracefunc.rb: add a test.
- * object.c (obj_alloc): check for allocating instance for the
- primitive classes (mostly perfect).
+ added assert_consistent_call_return() method check call/return
+ consistency.
- * ext/curses/curses.c (curses_finalize): restore original state at
- interpreter temination.
+Fri Jun 20 05:26:27 2014 Koichi Sasada <ko1@atdot.net>
- * ext/curses/curses.c (curses_addstr): forgot to check argument
- type (caused SEGV). now uses STR2CSTR() macro.
+ * vm_eval.c (rb_catch_protect): fix same problem of [Bug #9961].
-Thu Mar 5 13:47:39 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_eval.c (rb_iterate): ditto.
- * eval.c (block_pass): accepts method object as block args.
+Thu Jun 19 21:41:30 2014 Koichi Sasada <ko1@atdot.net>
- * eval.c (f_missing): use any_to_s() for stringify.
+ * vm.c (rb_vm_rewind_cfp): add new function to rewind specified cfp
+ with invoking RUBY_EVENT_C_RETURN.
+ [Bug #9961]
-Wed Mar 4 01:39:52 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_core.h: ditto.
- * parse.y (block_arg): new syntax - block argument in the
- calling arglist.
+ * eval.c (rb_protect): use it.
- * eval.c (rb_call): no module search. simplified a lot.
+ * eval.c (rb_rescue2): ditto.
- * eval.c (rb_eval): block arg support.
+ * vm_eval.c (rb_iterate): ditto.
- * parse.y (f_block_arg): new syntax - block argument in the
- formal arglist.
+ * test/ruby/test_settracefunc.rb: add a test.
-Tue Mar 3 14:20:15 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_core.h (rb_vm_rewind_cfp): add the prototype declaration.
- * eval.c (obj_method): returns bound method object.
+Thu Jun 19 19:47:21 2014 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_call): argument check for empty methods.
+ * vm.c (invoke_block_from_c): move call/return event timing for
+ bmethod. It can invoke inconsistent call event if this call raises
+ argument error.
+ [Bug #9959]
- * ruby.h (NUM2CHR): new macro, originally from curses module.
+ * vm_insnhelper.c (vm_call_bmethod_body): ditto.
-Tue Mar 3 13:03:35 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+ * test/ruby/test_settracefunc.rb: add a test.
- * io.c (io_putc): new method.
+Thu Jun 19 18:14:47 2014 Koichi Sasada <ko1@atdot.net>
-Tue Mar 3 11:21:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_core.h: add VM_FRAME_MAGIC_RESCUE to recognize normal block or
+ rescue clause.
- * string.c (str_inspect): more strict charcode detection.
+ * vm.c (vm_exec): use VM_FRAME_MAGIC_RESCUE on at rescue/ensure.
- * eval.c (thread_stop): stopping only thread raises ThreadError
+ * test/ruby/test_settracefunc.rb: should not invoke b_return at rescue
+ clause.
+ [Bug #9957]
+
+ * vm_dump.c (control_frame_dump): check VM_FRAME_MAGIC_RESCUE.
+
+ * vm_dump.c (vm_stack_dump_each): ditto.
+
+Thu Jun 19 13:39:11 2014 Arne Brasseur <arne@arnebrasseur.net>
+
+ * proc.c (rb_method_curry): Implement Method#curry, which delegates
+ to to_proc.curry. [ruby-core:62212] [Feature #9783]
+
+Tue Jun 17 16:41:49 2014 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/ftp.rb (gets, readline): read lines without LF properly.
+ [ruby-core:63205] [Bug #9949]
+
+ * test/net/ftp/test_buffered_socket.rb: related test.
+
+Tue Jun 17 12:35:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (extract_raise_opts): pass unknown options to the
+ exception, so that exception class can receive a hash argument.
+ [ruby-core:63203] [Feature #8257]
+
+Tue Jun 17 12:24:57 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (obj_memsize_of): memsize_of(T_ZOMBIE) returns 0, not a rb_bug.
+ ObjectSpace.count_objects_size() uses memsize_of(T_ZOMBIE).
+
+ This bug introduced at r46348.
+
+Mon Jun 16 19:00:11 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/runner.rb: failure message should be passed as an argument.
+
+Mon Jun 16 18:42:57 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/runner.rb: capture TracePoint stat before setup and compare
+ it after teardown.
+
+Mon Jun 16 14:33:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * process.c (open): use UTF-8 version function to support
+ non-ascii path properly. [ruby-core:63185] [Bug #9946]
+
+Sat Jun 14 10:54:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * array.c (rcombinate0): remove recursion, by looping with indexes
+ stored in `p`.
+
+ * array.c (rpermute0): remove recursion, by looping with indexes
+ stored in `p`.
+
+ * array.c (permute0): remove recursion, by looping with indexes
+ stored in `p`. [ruby-core:63103] [Bug #9932]
+
+Sat Jun 14 10:52:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_resize): update capa only when buffer get
+ reallocated.
+ http://d.hatena.ne.jp/nagachika/20140613/ruby_trunk_changes_46413_46420#r46413
+
+Sat Jun 14 08:28:59 2014 Zachary Scott <e@zzak.io>
+
+ * man/rake.1: [DOC] Update links for Rake, patch by @hsbt [Bug #9904]
+ [Fixes GH-628] https://github.com/ruby/ruby/pull/628
+
+Fri Jun 13 17:58:58 2014 Koichi Sasada <ko1@atdot.net>
+
+ * vm_trace.c: add new method TracePoint.stat to debug
+ TracePoint mechanism.
+
+ Ruby users should not use this method. So I don't note this method
+ in the NEWS file.
+
+ * test/runner.rb: detect zombie active TracePoints with
+ TracePoint.stat.
+
+Fri Jun 13 17:46:31 2014 Koichi Sasada <ko1@atdot.net>
+
+ * vm_trace.c: clear and restore recursive checking thread local data
+ to avoid unexpected throw from TracePoint.
+ [Bug #9940]
+
+ * test/ruby/test_settracefunc.rb: add a test.
+
+ * thread.c: added
+ * rb_threadptr_reset_recursive_data(rb_thread_t *th);
+ * rb_threadptr_restore_recursive_data(rb_thread_t *th, VALUE old);
+
+ * vm_core.h: ditto.
+
+Fri Jun 13 17:33:14 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * array.c (rb_ary_combination): iterate on a shared copy, and use
+ array of indexes instead of array of chosen objects.
+ [ruby-core:63149] [Bug #9939]
+
+ * array.c (yield_indexed_values): extract from permute0(),
+ rpermute0(), and rcombinate0().
+
+Fri Jun 13 13:42:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * array.c (rb_ary_permutation): `p` is the array of size `r`, as
+ commented at permute0(). since `n >= r` here, buffer overflow
+ never happened, just reduce unnecessary allocation though.
+
+Thu Jun 12 20:32:28 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_resize): should consider the capacity instead
+ of the old length, as pointed out by nagachika.
+
+Thu Jun 12 18:31:01 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * lib/net/http/responses.rb: added Net::HTTPPermanentRedirect(308)
+ Contributed by @yorkie [fix GH-638]
+
+Thu Jun 12 13:27:38 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_freeze): shrink the buffer before freezing, as
+ pointed out by Eric Wong at [ruby-core:63119].
+
+Thu Jun 12 13:09:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * file.c (expand_path): shrink expanded path which no longer needs
+ rooms to append. [ruby-core:63114] [Bug #9934]
+
+Wed Jun 11 17:37:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (rb_cv_scalar_pthread_t): pthread_t is not required
+ to be a scalar type.
+
+ * thread.c (fill_thread_id_string, thread_id_str): dump pthread_t
+ in hexadecimal form if it is not a scalar type, assume it can be
+ represented in a pointer form otherwise. based on the patch by
+ Rei Odaira at [ruby-core:62867]. [ruby-core:62857] [Bug #9884]
+
+ * thread_pthread.c (Init_native_thread, thread_start_func_1),
+ (native_thread_create): set thread_id_str if needed.
+
+ * vm_core.h (rb_thread_t): add thread_id_string if needed.
+
+Wed Jun 11 01:53:22 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: invoke GC before memory allocation (xmalloc/xrealloc)
+ when GC.stress = true.
+ [Bug #9859]
+
+ * test/ruby/test_gc.rb: add a test.
+
+Tue Jun 10 13:20:14 2014 Takeyuki FUJIOKA <xibbar@ruby-lang.org>
+
+ * lib/cgi/core.rb: Provide a mechanism to specify the
+ max_multipart_length of multipart data.
+ [Feature #8370] patch by Leif Eriksen <leif.eriksen.au@gmail.com>
+
+Tue Jun 10 10:57:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/csv.rb (CSV#<<): honor explicitly given encoding. based on
+ the patch by DAISUKE TANIWAKI <daisuketaniwaki AT gmail.com> at
+ [ruby-core:62113]. [Bug #9766]
+
+Mon Jun 9 20:40:48 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: change full GC timing to keep lower memory usage.
+
+ Extend heap only at
+ (1) after major GC
+ or
+ (2) after several (two times, at current) minor GC
+
+ Details in https://bugs.ruby-lang.org/issues/9607#note-9
+ [Bug #9607]
+
+Mon Jun 9 16:01:41 2014 Masahiro Ide <imasahiro9@gmail.com>
+
+ * gc.c (gcdebug_sentinel): fix typo, "sentinel" not "sential".
+ [fix GH-634]
+
+Mon Jun 9 00:04:25 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (posix_fadvise): disable use of posix_fadvise
+ itself on 32-bit AIX. [ruby-core:62968] [Bug #9914]
+
+Sun Jun 8 23:28:00 2014 <kanemoto@ruby-lang.org>
+
+ * io.c (rb_io_advise): AIX currently does not support a 32-bit call to
+ posix_fadvise() if _LARGE_FILES is defined. Patch by Rei Odaira.
+ [ruby-core:62968] [Bug #9914]
+
+Sun Jun 8 04:52:40 2014 Jun Hiroe <Jun.Hiroe@gmail.com>
+
+ * string.c (rb_str_slice_bang): [DOC] update return value against
+ a fixnum, which has changed because of M17N. [fix GH-631]
+
+Sat Jun 7 22:13:42 2014 Benoit Daloze <eregontp@gmail.com>
+
+ * numeric.c (do_coerce): Add a warning when an exception is raised
+ or an invalid value is returned in #coerce called by
+ numeric comparison operators and the exception
+ thrown by the caller has no information on the failure.
+ In the next release such exception should not be rescued or
+ should be the cause of the caller exception. nil is accepted
+ as the "no possible coercion" return value. See #7688.
+
+ * test/ruby/test_numeric.rb: Add corresponding test.
+
+Sat Jun 7 18:15:33 2014 Benoit Daloze <eregontp@gmail.com>
+
+ * numeric.c (bit_coerce): remove constant parameter `err'
+ (always TRUE) of bit_coerce().
+
+Sat Jun 7 16:01:57 2014 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+
+ * cont.c (rb_fiber_struct): keep context.uc_stack.ss_sp and context.uc_stack.ss_size
+ for later use. Patch by Rei Odaira. [ruby-core:62945] [Bug #9905]
+
+Sat Jun 7 12:51:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (read_all): truncate the buffer before appending read data,
+ instead of truncating before reading.
+ [ruby-core:55951] [Bug #8625]
+
+Sat Jun 7 12:28:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/digest/digest.c (rb_digest_instance_equal): no need to call
+ `to_s` twice. [Bug #9913]
+
+Sat Jun 7 11:35:01 2014 Tanaka Akira <akr@fsij.org>
+
+ * object.c (rb_mod_initialize_clone): Override Kernel#initialize_clone
+ to avoid an exception on Class.new.freeze.clone.to_s.
+ Reported by Andrew Grimm. [ruby-core:41858] [Bug #5828]
+
+Sat Jun 7 06:03:11 2014 Benoit Daloze <eregontp@gmail.com>
+
+ * ext/digest/digest.c (rb_digest_instance_equal):
+ fix #== for non-string arguments. [ruby-core:62967] [Bug #9913]
+
+ * test/digest/test_digest.rb: add test for above.
+
+Fri Jun 6 22:19:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * compile.c (private_recv_p): check by node type, instead of a
+ magic number.
+
+ * node.h (NODE_PRIVATE_RECV), parse.y (attrset_gen): remove
+
+Fri Jun 6 17:07:08 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * compile.c (iseq_compile_each), parse.y (new_attr_op_assign_gen):
+ allow op assign to a private attribute.
+ [ruby-core:62949] [Bug #9907]
+
+Fri Jun 6 13:39:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (io_setstrbuf, io_read): should not shorten the given buffer until
+ read succeeds. [ruby-core:55951] [Bug #8625]
+
+Fri Jun 6 07:41:41 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: dump empty symbols with a
+ tag so that they can be parsed on input. [Bug #9873] [ruby-core:62825]
+ * test/psych/test_symbol.rb: test for change
+
+Thu Jun 5 16:08:39 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (gc_page_sweep): refactoring.
+
+ * gc.c (gc_page_sweep): should not set, but add final_slots into
+ sweep_page->final_slots.
+
+Thu Jun 5 14:36:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (jemalloc): check for the header regardless drop-in
+ libjemalloc is found, for `malloc_conf` declaration.
+
+ * version.c (ruby_show_version): show `malloc_conf` if set.
+ [Feature #9113]
+
+ * configure.in (with-jemalloc): also check for header, for ABIs
+ which JEMALLOC_MANGLE is needed, i.e., Mach-O and PE-COFF
+ platforms. [ruby-core:62939] [Feature #9113]
+
+ * include/ruby/missing.h: include alternative malloc header to
+ replace memory management functions.
+
+ * dln.c, io.c, parse.y, st.c: undef malloc family before
+ re-definition to suppress warnings.
+
+Thu Jun 5 12:52:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * man/ruby.1: remove rubyforge entry.
+
+Thu Jun 5 12:45:32 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * misc/README: use github link instead of rubyforge.
+
+Thu Jun 5 10:03:29 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (obj_free): check also FL_PROMOTED bit by RVALUE_OLD_P().
+
+Thu Jun 5 03:45:28 2014 Eric Wong <e@80x24.org>
+
+ * configure.in: add --with-jemalloc option
+ [ruby-core:62912]
+
+Wed Jun 4 22:28:14 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: introduce RZombie to manage zombie objects.
+ Rewrite finalizing logics with this type.
+
+ * gc.c (gc_verify_internal_consistency): verify zombie (finalizing)
+ objects count.
+
+Wed Jun 4 22:09:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * re.c (match_aref, rb_reg_regsub): consider encoding of captured
+ names, encoding-incompatible should not match.
+ [ruby-dev:48278] [Bug #9903]
+
+Wed Jun 4 21:23:52 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * re.c (match_aref): should not ignore name after NUL byte.
+ [ruby-dev:48275] [Bug #9902]
+
+Wed Jun 4 04:08:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm.c (core_hash_merge_kwd): should return the result hash, which
+ may be converted from and differ from the given argument.
+ [ruby-core:62921] [Bug #9898]
+
+Tue Jun 3 23:32:34 2014 Tanaka Akira <akr@fsij.org>
+
+ * ruby.c (load_file_internal2): Extracted from load_file_internal.
+ (load_file_internal): Invoke load_file_internal2 using rb_protect.
+ Close an opened FD if load_file_internal2 raises an exception.
+
+Tue Jun 3 19:11:45 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (rb_objspace_free): should not rest_sweep() here.
+ Some data structures are already freed.
+
+Tue Jun 3 18:43:51 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/test_gc.rb: allocate more objects to invoke GC by newobj.
+ GC allows extending pages depends on heap_increment.
+
+Tue Jun 3 18:01:27 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (rb_gc_call_finalizer_at_exit): add
+ gc_verify_internal_consistency() when RGENGC_CHECK_MODE >= 2.
+
+Tue Jun 3 17:54:21 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: change the counting method for young objects.
+ clear counter at the beginning of every GC and
+ count promoted (infant->young) objects.
+
+ Some promotions (infant->young) are transition of promoting to old
+ objects. We should not count such promotions.
+
+ With this technique, we don't need to check young objects
+ at obj_free().
+
+Tue Jun 3 16:38:19 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: add verifying counters code in gc_verify_internal_consistency().
+ gc_verify_internal_consistency() counts all
+ - live objects
+ - young objects (if age2 promotion)
+ - old objects
+ in all pages and compares with objspace managing counters.
+
+ * gc.c (gc_after_sweep): do gc_verify_internal_consistency()
+ when RGENGC_CHECK_MODE >= 2.
+
+Tue Jun 3 13:14:04 2014 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb (body_type_1part): Gmail IMAP reports a body
+ type as "MIXED" followed immediately by params
+ [ruby-core:62864] [Bug #9885]
+ Patch by @rayners (David Raynes). [Fixes GH-622]
+ https://github.com/ruby/ruby/pull/622
+
+Tue Jun 3 13:18:24 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (objspace_live_slot): live slot count should not include final
+ slot (contains T_ZOMBIE) count.
+
+Tue Jun 3 13:03:21 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (obj_free): fix spacing.
+
+Tue Jun 3 12:59:32 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (check_gen_consistency): fix error message.
+
+Tue Jun 3 12:40:23 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: count old/young objects more correctly.
+
+ * gc.c (RVALUE_DEMOTE_FROM_OLD): decrement old object count.
+
+ * gc.c (RVALUE_DEMOTE_FROM_YOUNG): decrement young object count.
+
+ * gc.c (rb_gc_resurrect): increment old object count.
+
+ * gc.c (gc_marks_body): should not add old object count.
+ This code is completely my misunderstanding.
+
+ * gc.c (rb_gc_force_recycle): decrement young or old object count
+ correctly.
+
+Tue Jun 3 12:26:47 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/memory_status.rb: add $LOAD_PATH to load test/unit
+ correctly for fiddle/import unavailable environments.
+
+Tue Jun 3 09:45:13 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/openssl/test_ssl.rb (OpenSSL::TestSSL#test_verify_result):
+ shouldn't use same server for respective tests, because the 1st
+ test sometimes kills the server main loop silently.
+ [Bug #9881] [ruby-dev:48266]
+
+Tue Jun 3 01:34:59 2014 Zachary Scott <e@zzak.io>
+
+ * README.EXT: [DOC] Add rb_call_super when subclassing from @robin850
+ [Fixes GH-623] https://github.com/ruby/ruby/pull/623
+
+Mon Jun 2 17:14:49 2014 Koichi Sasada <ko1@atdot.net>
+
+ * vm.c (ruby_vm_destruct): remove useless call of
+ rb_gc_force_recycle().
+
+ At this line, a VM object is already freed
+ (is changed to T_NONE) by rb_gc_call_finalizer_at_exit().
+
+Mon Jun 2 15:50:24 2014 Koichi Sasada <ko1@atdot.net>
+
+ * eval.c (rb_using_refinement): add write-barriers for
+ cref->nd_refinements.
+
+Mon Jun 2 12:26:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * CONTRIBUTING.md: added contributing guide for github. [fix GH-625]
+
+Mon Jun 2 07:30:33 2014 Tanaka Akira <akr@fsij.org>
+
+ * test/ruby/envutil.rb (default_warning): New method.
+
+ * test/ruby/test_autoload.rb: Use EnvUtil.default_warning.
+
+Mon Jun 2 07:05:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * include/ruby/encoding.h: constify `rb_encoding` arguments.
+
+ * include/ruby/oniguruma.h: constify `OnigEncoding` arguments.
+
+Sun Jun 1 12:05:10 2014 Tanaka Akira <akr@fsij.org>
+
+ * test/drb: Wrap tests definitions by DRbTests module. This makes
+ several tests (ACLEntryTest, TestBug4409, etc.) easier to understand
+ that they are tests for DRb.
+
+Sun Jun 1 11:36:25 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/rinda/ring.rb (RingFinger#make_socket): Close the socket on
exception.
-Tue Mar 3 08:04:56 1998 Tadayoshi Funaba <tadf@kt.rim.or.jp>
+Sun Jun 1 06:55:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * struct.c (struct_alloc): imcomplete struct initialization made
- GC to access unallocated addresses.
+ * parse.y (intern_str): dynamic attrset ID is registered by
+ `rb_id_attrset()` already, so no further registration is needed.
+ [ruby-core:62861]
-Mon Mar 2 16:28:27 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Jun 1 04:52:47 2014 Zachary Scott <e@zzak.io>
- * eval.c (thread_stop_method): remove Thread#stop.
+ * lib/English.rb: [DOC] $LOADED_FEATURES moved to load.c [Fixes GH-620]
+ Patch submitted by @leafac in https://github.com/ruby/ruby/pull/620
+ * doc/globals.rdoc: Added $LOADED_FEATURES to list
-Fri Feb 27 18:16:26 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 31 22:30:14 2014 Tanaka Akira <akr@fsij.org>
- * version 1.1b9 released.
+ * test/lib/leakchecker.rb: Leak checker extracted from
+ test/lib/minitest/unit.rb.
-Fri Feb 27 09:36:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 31 21:15:43 2014 URABE Shyouhei <shyouhei@ruby-lang.org>
- * hash.c (hash_delete_nil): needed to compare value to nil, since
- nil is the valid key for hashes.
+ * thread.c (rb_thread_atfork_internal): My compiler complains
+ about this variable being used before initialized. I looked at
+ the code and expanded the macro and turned out it was actually
+ USED for pointer arithmetic, not dereferenced. So this was
+ never a serious bug. But is annoying indeed to see warnings
+ every time. I added `=0` and all went healthy.
- * hash.c (hash_foreach_iter): rehashing causes IndexError.
+ * configure.in: Also, I found that the problematic macro expansion
+ only happens when we lack __typeof__ C extension, which shall
+ not be the case of my compiler. I added AC_C_TYPEOF to kick ass.
- * hash.c (hash_foreach_iter): rehash check by pointer comparison.
+Sat May 31 16:32:50 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Thu Feb 26 17:22:13 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/ipaddr.rb: extracted inline tests into test dir.
+ * test/test_ipaddr.rb: ditto.
- * parse.y (fname): convert reswords into symbols.
+Sat May 31 16:29:21 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * parse.y (reswords): reserved words are now embedded in the
- syntax (sigh).
+ * ext/digest/lib/digest/hmac.rb: extracted inline tests into test dir.
+ * test/digest/test_digest_hmac.rb: ditto.
- * parse.y: now reserved words can be method names safely.
+Sat May 31 16:02:03 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Wed Feb 25 15:50:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/test_syslog.rb: remove executable.
- * eval.c (mod_module_eval): clear the_scope's PRIVATE flag before
- calling eval().
+Sat May 31 08:58:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c (gc_call_finalizer_at_exit): run finalizers before any data
- object being freed.
+ * enc/unicode.c (init_case_fold_table): no longer need to
+ initialize tables at runtime.
- * eval.c (rb_eval): needed to keep prot_tag->retval before
- evaluating the ensure clause.
+ * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
+ lookup case unfolding table 3.
-Tue Feb 24 11:16:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
+ lookup case unfolding table 2.
- * parse.y (yylex): reserved words can be appear as method names at
- right after 'def' and `.'(dot), like foo.next.
+ * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
+ lookup case unfolding table 1.
- * eval.c (return_check): checks for return out of thread (formerly
- done in return_value).
+ * enc/unicode/case-folding.rb (lookup_hash): make perfect hash to
+ lookup case folding table.
- * eval.c (POP_TAG): copy retval to outer level.
+ * enc/unicode/case-folding.rb (print_table): merge non-locale and
+ locale tables, and reduce initializing loops.
- * eval.c (return_value): just set retval, no check, no unwinding.
+ * enc/unicode/case-folding.rb (CaseFolding): modularize, and add
+ --output-file option.
- * parse.y (nextc): line continuation by backslash at end of line.
+ * enc/unicode/case-folding.rb: script to convert CaseFolding.txt,
+ translated from CaseFolding.py.
- * regex.c (re_compile_pattern): forgot to clear pending_exact on
- closing parentheses.
+Sat May 31 08:31:41 2014 Tanaka Akira <akr@fsij.org>
- * parse.y (assignable): should not assign dyna_var to true, if it
- is already defined.
+ * test/lib/minitest/unit.rb: Check Tempfile leaks for each test method
+ again.
-Mon Feb 23 14:35:03 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 31 03:50:50 2014 Zachary Scott <e@zzak.io>
- * object.c (obj_is_kind_of): no longer accepts true/false/nil.
+ * lib/delegate.rb: [DOC] Document raise in Delegator class
+ Patch by @lucasmazza. [Fixes GH-621]
+ https://github.com/ruby/ruby/pull/621
- * object.c ({true,false,nil}_to_i): can be converted into integers.
+Fri May 30 21:23:26 2014 Tanaka Akira <akr@fsij.org>
-Mon Feb 23 12:11:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/webrick/server.rb: Use a pipe to detect server shutdown.
+ shutdown() or close() for listening socket is not a reliable.
+ Actually, both doesn't work (doesn't wake up select()) on
+ DragonFly BSD 3.6.2.
- * re.c (reg_s_quote): needed to be mbchar aware.
+ * test/webrick/utils.rb: :ShutdownSocketWithoutClose is not required
+ now to immediate server shutdown detection.
+ This fixes fd leaks.
- * eval.c (proc_s_new): wrong iter mark.
+ * test/net/http/utils.rb: Ditto.
-Sat Feb 21 22:59:30 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+Fri May 30 20:58:37 2014 Tanaka Akira <akr@fsij.org>
- * io.c (f_syscall): no argument check.
+ * test/lib/minitest/unit.rb (check_fd_leak): Sort the inspected
+ objects list for a FD.
-Fri Feb 20 10:17:51 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri May 30 18:06:55 2014 Tanaka Akira <akr@fsij.org>
- * version 1.1b8 released.
+ * test/lib/minitest/unit.rb (check_fd_leak): Try GC to delete leaked
+ FDs.
- * ext/kconv/kconv.c (kconv_kconv): default output code now be
- determined according to the value of $KCODE.
+Fri May 30 12:05:59 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * re.c (rb_get_kcode): can retrieve $KCODE from C code.
+ * test/lib/test/unit/parallel.rb (_run_suite): orig_stdout may be nil
+ though I don't know the reason.
- * parse.y (stmt): if/unless modifiers returns nil, if condition is
- not established.
+Fri May 30 11:33:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Feb 19 11:06:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * string.c (rb_str_substr): need to reset code range for shared
+ string too, not only copied string.
+ [ruby-core:62842] [Bug #9882]
- * ext/kconv/kconv.c (kconv_kconv): charcode can be specified by
- code name (JIS, SJIS, EUC like value of $KCODE).
+Fri May 30 10:22:21 2014 Mark Lorenz <mlorenz@covermymeds.com>
- * regex.c (re_compile_pattern): forgot to fixup_jump for (?:..).
+ * lib/erb.rb (result): [DOC] no longer accepts a Proc, as
+ Kernel.eval does not. [fix GH-619]
- * regex.c (re_compile_pattern): needed to clear pending_exact on
- non-registering grouping (?:...).
+Fri May 30 07:25:46 2014 Tanaka Akira <akr@fsij.org>
-Wed Feb 18 19:54:21 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/-test-/dir: Dir#fileno implemented.
- * parse.y (here_document): needed to set lex_state to EXPR_END.
+ * test/lib/minitest/unit.rb (find_fds): Don't return the fd used to
+ scan /proc/$$/fd.
-Wed Feb 18 18:45:10 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Fri May 30 04:48:00 2014 Eric Wong <e@80x24.org>
- * patches for cygwin32 applied.
+ * parse.y (rb_gc_mark_parser): remove, empty since r8758
+ * internal.h: ditto, not usable from extensions since 2.0.0
+ * gc.c (gc_mark_roots): remove checkpoint for parser
-Wed Feb 18 00:41:31 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu May 29 23:27:50 2014 Rei Odaira <Rei.Odaira@gmail.com>
- * string.c (str_sub_s): needed to be mbchar aware to increment one
- character.
+ * signal.c (ruby_signal): should return either `old.sa_sigaction`
+ or `old.sa_handler`, depending on whether `SA_SIGINFO` is set in
+ `old.sa_flags`, because they may not be a union.
+ [ruby-core:62836] [Bug #9878]
- * regex.c (re_match): \Z matches newline just before the end of
- the string.
+Thu May 29 23:11:20 2014 Tanaka Akira <akr@fsij.org>
-Tue Feb 17 00:04:32 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * io.c (pipe_open): Close pipes when rb_execarg_fixup() raises
+ an exception.
+ (rb_execarg_fixup_v): New function.
- * time.c (time_arg): Time.gm and Time.local now understands
- Time#to_a format.
+Thu May 29 22:18:57 2014 Tanaka Akira <akr@fsij.org>
- * string.c (str_sub_s): replace happened twice for null pattern.
+ * test/lib/minitest/unit.rb (capture_subprocess_io): Close fds.
- * regex.c (re_search): null pattern should not match after newline
- at the end of string.
+Thu May 29 19:47:08 2014 Tanaka Akira <akr@fsij.org>
- * time.c (time_isdst): now returns boolean value.
+ * io.c (rb_io_s_pipe): Close pipes if io_encoding_set() raises an
+ exception.
+ (io_encoding_set_v): New function.
- * error.c (rb_check_type): treat special constants in messages.
+Thu May 29 19:42:49 2014 Tanaka Akira <akr@fsij.org>
- * parse.y (yylex): new form `::Const' to see toplevel constants.
+ * lib/csv.rb (CSV.open): Close the opened file when an exception
+ occur.
- * parse.y (cond): SEGV on `if ()'.
+Thu May 29 19:31:10 2014 Tanaka Akira <akr@fsij.org>
- * gc.c (obj_free): some data needed explicit free().
+ * ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): Close a socket
+ if any exception occur.
-Mon Feb 16 23:55:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu May 29 05:05:29 2014 Eric Wong <e@80x24.org>
- * eval.c (blk_free): release duplicated block informations.
+ * include/ruby/ruby.h: Hide Symbol internals.
+ (struct RSymbol): moved to internal.h
+ (RSYMBOL): ditto
- * eval.c (blk_copy_prev): duplicate outer block information into
- the heap, when proc/binding created.
+Thu May 29 00:28:56 2014 Tanaka Akira <akr@fsij.org>
-Mon Feb 16 14:38:25 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/socket/unixsocket.c (rsock_init_unixsock): Open a socket
+ after path length check.
+ This fixes a fd leak by TestSocket_UNIXSocket#test_too_long_path.
- * time.c (time_mon): now 1 for January and so on.
+Wed May 28 23:04:35 2014 Tanaka Akira <akr@fsij.org>
- * time.c (time_year): year in 19xx (no + 1900 needed anymore).
+ * test/ruby/test_io.rb (test_flush_in_finalizer1): Use
+ ObjectSpace.each_object to close files.
+ GC.start is not reliable.
-Mon Feb 16 13:28:33 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed May 28 19:00:31 2014 Tanaka Akira <akr@fsij.org>
- * regex.c (re_compile_pattern): need to fetch mbchar's second byte
- without translation.
+ * lib/net/imap.rb (Net::IMAP#initialize): Close the opened socket when
+ any exception occur.
+ This fixes a fd leak by IMAPTest#test_imaps_post_connection_check
+ which start_tls_session() raises an exception.
-Mon Feb 16 12:29:27 1998 MAEDA shugo <shugo@po.aianet.ne.jp>
+Wed May 28 18:06:13 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (f_pass_block): pass iterator block to other method.
+ * ext/openssl/ossl_ssl.c (ossl_ssl_close): Fix sync_close to work
+ when SSL is not started.
+ This fix the fd leak by test_https_proxy_authentication in
+ test/net/http/test_https_proxy.rb.
-Fri Feb 13 08:16:11 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed May 28 10:29:28 2014 Eric Wong <e@80x24.org>
- * parse.y (parse_regx): handle \s before read_escape().
+ * vm.c (rb_vm_living_threads_foreach): remove function
+ [ruby-core:62745]
+ * thread.c (terminate_i): remove
+ * thread.c (terminate_all): implement (inlines old terminate_i)
+ * thread.c (rb_thread_terminate_all): use terminate_all
+ * thread.c (rb_thread_fd_close_i): remove
+ * thread.c (rb_thread_fd_close): iterate inline
+ * thread.c (thread_list_i): remove
+ * thread.c (rb_thread_list): iterate inline
+ * thread.c (rb_thread_atfork_internal): iterate inline
+ * thread.c (terminate_atfork_i): update types to remove casts
+ * thread.c (terminate_atfork_before_exec_i): ditto
+ * thread.c (struct thgroup_list_params): remove definition
+ * thread.c (thgroup_list_i): remove
+ * thread.c (thgroup_list): iterate inline
+ * thread.c (check_deadlock_i): remove
+ * thread.c (debug_deadlock_check): implement (inlines check_deadlock_i)
+ * thread.c (debug_i): remove
+ * thread.c (rb_check_deadlock): iterate inline
+ * vm.c (vm_mark_each_thread_func): remove
+ * vm.c (rb_vm_mark): iterate inline
+ * vm_core.h (rb_vm_living_threads_remove): remove
+ * vm_trace.c (clear_trace_func_i): remove
+ * vm_trace.c (rb_clear_trace_func): iterate inline
- * parse.y (read_escape): `\s' in strings as space.
+Wed May 28 09:30:51 2014 Eric Wong <e@80x24.org>
-Tue Feb 10 17:29:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * signal.c (signal_exec): ignore immediate cmd for SIG_IGN
+ * signal.c (trap_handler): set cmd to true for SIG_IGN
+ * signal.c (trap): handle nil and true values for oldcmd
+ [Bug #9835]
- * version 1.1b7 released.
+Wed May 28 01:02:54 2014 Tanaka Akira <akr@fsij.org>
- * string.c (str_aset): string insertion by `str[n] = str2'.
+ * lib/tempfile.rb (Tempfile#inspect): Show "(closed)" if the tempfile
+ is closed.
- * string.c (str_oct): does recognize `0x'.
+Wed May 28 00:38:09 2014 Tanaka Akira <akr@fsij.org>
- * sprintf.c (f_sprintf): use baes 10 for conversion from string to
- integer.
+ * test/lib/minitest/unit.rb: Use Tempfile#close! instead of
+ Tempfile#unlink to close file descriptors.
-Mon Feb 9 14:51:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/openssl/test_config.rb: Ditto.
- * numeric.c (do_coerce): proper error message.
+ * test/ruby/test_io.rb: Ditto.
- * string.c (str_sum): bug - masked by wrong value. (sigh..)
+Wed May 28 00:06:18 2014 Tanaka Akira <akr@fsij.org>
-Sat Feb 7 15:11:14 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/net/ftp.rb (transfercmd): Close TCP server socket even if an
+ exception occur.
- * string.c (str_empty): new method
+Tue May 27 23:50:07 2014 Tanaka Akira <akr@fsij.org>
-Fri Feb 6 01:42:15 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/cgi/core.rb: Use Tempfile#close! instead of Tempfile#unlink
+ to close file descriptors.
- * time.c (time_asctime): use asctime(3), not strftime(3).
+Tue May 27 23:06:46 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Feb 5 18:58:46 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * parse.y (parser_number_literal_suffix): refine error message for
+ extra dot and digits.
- * io.c (io_fptr_close): do not free path on close().
+Tue May 27 22:44:20 2014 Tanaka Akira <akr@fsij.org>
- * array.c (ary_filter): new method.
+ * test/rexml: Avoid fd leaks.
- * enum.c (enum_each_with_index): new method.
+Tue May 27 22:24:25 2014 Kouhei Sutou <kou@cozmixng.org>
-Thu Feb 5 14:10:35 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/rexml/test_document.rb: Indent.
- * parse.y (primary): singleton class def can be appeared inside
- method bodies.
+Tue May 27 22:15:29 2014 Kouhei Sutou <kou@cozmixng.org>
- * hash.c (hash_replace): replace content.
+ * test/rexml/test_document.rb: Wrap by REXMLTests module.
- * string.c (str_replace_method): replace content.
+Tue May 27 22:11:10 2014 Kouhei Sutou <kou@cozmixng.org>
- * array.c (ary_replace_method): replace elements.
+ * test/rexml/test_encoding_2.rb: Remove a needless file.
- * string.c (str_succ_bang): String#succ!
+Tue May 27 22:10:30 2014 Kouhei Sutou <kou@cozmixng.org>
-Thu Feb 5 18:20:30 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * test/rexml/test_contrib.rb: Indent.
- * string.c (str_upcase_bang): multi byte character support.
+Tue May 27 21:28:16 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Feb 4 13:55:26 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/socket/ifaddr.c (ifaddr_inspect_flags): support IFF_SIMPLEX.
- * array.c (ary_reverse): SEGV on empty array reverse.
+Tue May 27 21:03:03 2014 Kouhei Sutou <kou@cozmixng.org>
-Tue Feb 3 12:24:07 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/rexml/: Use REXMLTests as wrapping module for REXML tests.
+ I avoid using the same module for library in test because
+ it provides "include REXML" environment in test. Normally,
+ users don't use REXML on "include REXML" environment. So I
+ don't want to write tests on "include REXML" environment.
- * re.c (match_to_a): non matching element should be nil.
+Tue May 27 20:59:37 2014 Kouhei Sutou <kou@cozmixng.org>
- * ruby.c (ruby_load_script): load script after all initialization.
+ * test/rexml/test_comment.rb: Remove needless REXML module wrapping.
- * bignum.c (str2inum): need to interpret prefix `0' of `0x'.
+Tue May 27 20:56:49 2014 Kouhei Sutou <kou@cozmixng.org>
-Tue Feb 3 10:00:18 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * test/openssl/test_pkcs7.rb: Fix inverted expected and actual values.
- * numeric.c (fix_rshift): use `sizeof(INT)*8' instead of 32.
+Tue May 27 20:26:06 2014 NAKAMURA Usaku <usa@ruby-lang.org>
-Mon Feb 2 14:09:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_io.rb (test_flush_in_finalizer1): some opened fds are
+ remain before GC, so unlink the tempfile is failed.
- * ruby.c (set_arg0): grab environment region too.
+Tue May 27 19:07:26 2014 Tanaka Akira <akr@fsij.org>
-Thu Jan 29 18:36:25 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * io.c (rb_io_autoclose_p): Don't raise on frozen IO.
- * process.c (rb_proc_exec): check `sh' to be exist.
+ * test/lib/minitest/unit.rb: IO#autoclose? may raise IOError.
-Thu Jan 29 18:18:19 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue May 27 19:01:49 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * io.c (io_stdio_set): assignment to $stdin or $stdout does
- reopen() as well as $stderr.
+ * test/openssl/test_pair.rb: Modify TestSSL#test_read_and_write
+ to handle partial sysreads. [Bug #7398][ruby-core:49563]
+ * test/openssl/test_ssl.rb: ditto.
-Thu Jan 29 14:18:40 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue May 27 18:46:23 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * class.c (mod_ancestors): should not include singleton classes.
+ * test/openssl/test_pkcs7.rb: Add tests for PKCS7#type= and add_data.
+ [Feature #7399][ruby-core:49565]
- * object.c (obj_type): should not return internal class.
+Tue May 27 17:45:09 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * io.c (io_reopen): unwillingly closes stdio streams.
+ * test/openssl/test_hmac.rb (test_binary_update): Added Test for
+ HMAC signing with UTF-8 String. [Bug #7512][ruby-core:50559]
-Thu Jan 29 11:50:35 1998 Toshihiko SHIMOKAWA <toshi@csce.kyushu-u.ac.jp>
+Tue May 27 17:10:14 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ext/socket/socket.c (udp_addrsetup): forgot to use htons().
+ * test/runner.rb: fixed randomly test failure.
+ [Bug #6573][ruby-core:45563]
-Tue Jan 27 23:15:24 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue May 27 16:58:12 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * keywords: __FILE__, __LINE__ are available again.
+ * test/test_timeout.rb (test_timeout): inverted test condition.
+ [Bug #8523]
-Fri Jan 23 14:19:28 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue May 27 12:24:22 2014 Tanaka Akira <akr@fsij.org>
- * version 1.1b6 released.
+ * test/lib/minitest/unit.rb: Show leaked file descriptors.
- * object.c (mod_to_s): need to duplicate classpath.
+Tue May 27 11:12:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * error.c (exc_inspect): need to duplicate classpath.
+ * io.c (rb_io_fileno, rb_io_inspect): non-modification does not
+ error on frozen IO. [ruby-dev:48241] [Bug #9865]
-Thu Jan 22 00:37:47 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Tue May 27 00:00:21 2014 yui-knk <spiketeika@gmail.com>
- * ruby.h (STR2CSTR): new macro to retrieve char*.
+ * insns.def (defineclass): fix typo in the instruction comment.
+ [fix GH-618]
- * class.c (rb_define_method): `initialize' should always be
- private, even if it defined by C extensions.
+Mon May 26 16:33:15 2014 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (rb_eval): `initialize' should always be private.
+ * test/ruby/test_file.rb: skip the test of atime on Windows, because
+ Windows delays updating atime about 1 hour.
+ see more details:
+ http://msdn.microsoft.com/en-us/library/windows/desktop/ms724290%28v=vs.85%29.aspx
-Thu Jan 22 16:21:08 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon May 26 12:25:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (rb_eval): some singleton class def cause SEGV.
+ * lib/optionparser.rb, lib/optparse.rb (OptParse): aliases.
+ [ruby-core:62751] [Feature #9864]
- * eval.c (TMP_ALLOC): replace ALLOCA_N, where thread context
- switch may happen.
+Mon May 26 07:59:34 2014 Tanaka Akira <akr@fsij.org>
-Wed Jan 21 01:43:42 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/minitest/unit.rb: Show Finished threads line-by-line.
- * eval.c (PUSH_FRAME): do not use ALLOCA_N(). crash on some
- platforms that use missing/alloca.c.
+Mon May 26 01:39:02 2014 Zachary Scott <e@zzak.io>
- * regex.c (re_compile_pattern): too many pops for non register
- subexpr.
+ * lib/csv.rb: Reject nil as data source for CSV.new, patch by @Peeja.
+ [Fixes GH-580] https://github.com/ruby/ruby/pull/580
- * parse.y (yylex): open parentheses after identifiers are argument
- list, even if whitespaces have seen.
+Mon May 26 01:07:51 2014 Tanaka Akira <akr@fsij.org>
-Tue Jan 20 15:19:59 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/minitest/unit.rb: Show leaked threads and tempfiles
+ line-by-line.
- * parse.y (terms): quoted word list by %w(a b c).
+Sun May 25 23:02:06 2014 Tanaka Akira <akr@fsij.org>
- * ext/tcltklib/extconf.rb: more accurate check for tcl/tk libs.
+ * test/lib/minitest/unit.rb (MiniTest::Assertions#diff): Remove
+ tempfiles.
- * file.c (rb_stat): most of the FileTest methods (and function
- `test') accept File objects as the argument.
+Sun May 25 22:42:27 2014 Tanaka Akira <akr@fsij.org>
-Tue Jan 19 18:19:24 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * test/lib/minitest/unit.rb: Check tempfile leak for each test class.
- * ext/extmk.rb.in (install): there should be no newline after install:
+Sun May 25 20:31:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * re.c (MIN): renamed from min(). there's a local variable named
- min in the file, so that some cpp will raise an error.
+ * configure.in (ac_cv_func_{getcontext,setcontext}): do not
+ disable ucontext.h entirely, but disable use of functions only.
+ `ucontext_t` is necessary in the signal handler now.
-Mon Jan 19 16:30:05 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 25 20:00:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * version 1.1b5 released.
+ * signal.c (check_stack_overflow): revert part of r46100, the
+ previous condition was correct, and fix compilation error on
+ other architecture linux. [ruby-core:62746] [Bug #9862]
- * process.c (rb_syswait): no exception raised.
+Sun May 25 17:09:13 2014 Tanaka Akira <akr@fsij.org>
-Fri Jan 16 00:43:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/minitest/unit.rb: Less ObjectSpace.each_object(Tempfile)
+ invocation.
- * ruby.h (CLONESETUP): copies its singleton classes too.
+Sun May 25 16:54:06 2014 Tanaka Akira <akr@fsij.org>
- * class.c (singleton_class_attached): saves binded object in the
- singleton classes.
+ * test/lib/minitest/unit.rb: Use Thread.list instead of
+ ObjectSpace.each_object(Thread).
- * eval.c (rb_eval): calls singleton_method_added even in the
- singleton class clauses.
+Sun May 25 15:53:54 2014 Tanaka Akira <akr@fsij.org>
-Fri Jan 15 23:22:43 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * lib/rinda/ring.rb (Rinda::RingServer#shutdown): Join the killed
+ threads.
- * ruby.c (proc_options): -S does not recognize PATH.
+Sun May 25 15:26:17 2014 Tanaka Akira <akr@fsij.org>
-Thu Jan 15 02:03:12 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/webrick/utils.rb: Override the inspect method of the thread
+ used in WEBrick::Utils::TimeoutHandler.
- * eval.c (rb_clear_cache_by_id): clear only affected cache
- entries.
+Sun May 25 14:22:30 2014 Tanaka Akira <akr@fsij.org>
-Wed Jan 14 02:14:48 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/openssl: Join threads.
- * ext/socket/socket.c: new UDP/IP socket classes.
+Sun May 25 12:46:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Tue Jan 13 10:00:18 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * error.c (rb_bug_context): new function to report bug with
+ context.
- * string.c (str_cmp): ignorecase($=) works wrong.
+ * vm_dump.c (rb_vm_bugreport): accepts `ucontext_t` argument to
+ dump machine registers. based on [GH-584].
-Fri Jan 9 13:19:55 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * signal.c (sigbus, sigsegv): dump machine registers if available.
- * version 1.1b4 released.
+Sun May 25 12:32:42 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (f_missing): class name omitted from the error message.
+ * test/lib/minitest/unit.rb: Sort leaked threads and tempfiles.
- * error.c (exc_inspect): description changed.
+Sun May 25 12:15:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (Init_String): GlobalExit's superclass did not filled,
- since GlobalExit created earlier than String.
+ * signal.c (check_stack_overflow): fix condition to use ucontext
+ register, mcontext_t dereference, and its member names, on Mac
+ OS X.
-Thu Jan 8 12:10:09 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 25 11:58:26 2014 Zachary Scott <e@zzak.io>
- * parse.y (aryset): expr in the brackets can be null.
+ * enumerator.c: [DOC] Fix example to show Enumerator#peek behavior
+ Patch by Erik Hollembeak [Bug #9814]
-Wed Jan 7 21:13:56 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 25 11:56:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_reopen): keep stderr unclosed.
+ * vsnprintf.c (BSD_vfprintf): fix string width when precision is
+ given. as the result of `memchr` is NULL or its offset from the
+ start cannot exceed the size, the comparison was always false.
+ [ruby-core:62737] [Bug #9861]
- * io.c (io_errset): keep stderr unclosed.
+Sun May 25 11:32:42 2014 Zachary Scott <e@zzak.io>
-Tue Jan 6 00:27:43 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/yaml.rb: Remove Psych::EngineManager [Bug #8344]
+ * test/psych/*: ditto.
- * parse.y: syntax modified for `while expr do .. end' etc.
+Sun May 25 10:34:15 2014 Zachary Scott <e@zzak.io>
- * process.c (f_exec,f_system): can supply arbitrary name for the
- new process.
+ * doc/regexp.rdoc: [DOC] Clarify whitespace matching by @allolex
+ [Fixes GH-606] https://github.com/ruby/ruby/pull/606
-Mon Jan 5 16:59:13 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Sun May 25 10:19:34 2014 Zachary Scott <e@zzak.io>
- * file.c (file_s_basename): removes any extention by ".*".
+ * enum.c: [DOC] Use #find in example to clarify alias by @rachellogie
+ Patch submitted via documenting-ruby/ruby#34
-Sun Jan 4 19:36:22 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Sun May 25 10:16:43 2014 Zachary Scott <e@zzak.io>
- * parse.y (yylex): needed to update lex_p (reading point).
+ * cont.c: [DOC] Fix rdoc in example for Fiber#transfer by @majjoha
+ Patch submitted via documenting-ruby/ruby#33
-Sat Jan 3 19:14:14 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Sun May 25 10:01:11 2014 Zachary Scott <e@zzak.io>
- * class.c,object.c: duplicate defines mKernel and cFinxnum.
+ * lib/irb.rb: [DOC] Fixed syntax error in example by @jasdeepsingh.
+ Patch submitted via documenting-ruby/ruby#32
-Fri Jan 2 20:38:59 1998 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 25 09:58:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ext/curses/curses.c (NUM2CHAR): uses the first character for
- string arguments.
+ * test/fileutils/test_fileutils.rb (test_chown_R): Add tests for
+ chown_R. [Feature #9383][ruby-core:59641]
- * array.c (ary_fill): did not extend array for ranges.
+Sun May 25 09:57:09 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * array.c (beg_len): did not return end pos bigger than size.
+ * test/fileutils/test_fileutils.rb: Added recursively chown tests.
+ [Feature #9303][ruby-core:59325]
-Fri Jan 2 02:09:16 1998 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Sun May 25 09:41:56 2014 Zachary Scott <e@zzak.io>
- * dir.c (dir_s_chdir): bug in nil check.
+ * class.c: [DOC] Fixed grammar and examples of instance_methods.
+ By @alex-frost via documenting-ruby/ruby#31
- * array.c (ary_fill): bug in nil check.
+Sun May 25 09:40:44 2014 Tanaka Akira <akr@fsij.org>
-Tue Dec 30 11:46:23 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/minitest/unit.rb: Show leaked threads and tempfiles.
- * hash.c (env_path_tainted): checks directories in PATH
- environment variable are not world writable.
+Sun May 25 08:54:38 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ruby.c (load_file): invoke specified interpreter if the #! line
- does not contain the word `ruby'.
+ * test/openssl/test_partial_record_read.rb: Testing read_nonblock on
+ a partial TLS record results in IO::WaitReadable by @mohamedhafez.
+ [fix GH-547]
-Fri Dec 26 03:26:41 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 25 08:43:16 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * string.c (uscore_get): type information included in the error
- message.
+ * lib/logger.rb: refactored to include Logger::Period.
- * variable.c (f_untrace_var): does not free trace-data within
- trace procedure.
+Sun May 25 06:50:19 2014 Zachary Scott <e@zzak.io>
-Thu Dec 25 02:50:29 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_eval.c: [DOC] Improve instance_eval description when given a
+ block or String arguments. By @nathanl via documenting-ruby/ruby#28
- * version 1.1b3 released.
+Sun May 25 06:29:39 2014 Zachary Scott <e@zzak.io>
- * ruby.h: inlining some functions on gcc 2.x
+ * array.c: [DOC] Clarify default argument for Array.new.
+ By @Elffers [Fixes GH-610]
-Tue Dec 23 02:47:33 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 24 22:37:20 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * eval.c (rb_eval): public/private information kept in the current
- scope, to remove undesired state from the class/module.
+ * array.c: [DOC] Add more documents to shuffle! and shuffle.
+ Contributed by @JuanitoFatas [ci skip][fix GH-612]
- * time.c (time_strftime): remove hidden limit of 100 bytes of
- result string, using malloc'ed buffer.
+Sat May 24 22:28:55 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * hash.c (hash_update): merges the contents of another hash,
- overriding existing keys.
+ * test/lib/minitest/.document: removed unused configuration.
- * regex.c (must_instr): totally re-written.
+Sat May 24 19:08:47 2014 Tanaka Akira <akr@fsij.org>
- * io.c (read_all): try to allocate proper sized buffer using
- fstat(2) for speedup.
+ * test/lib/minitest/spec.rb: Unused file removed.
-Sat Dec 20 00:27:28 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/minitest/autorun.rb: Don't require minitest/spec.
- * regex.c (must_instr): need to skip 2 bytes for mbchars.
+ * test/lib/minitest/benchmark.rb: Ditto.
-Fri Dec 19 01:18:29 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 24 18:45:30 2014 Tanaka Akira <akr@fsij.org>
- * version 1.1b2 released.
+ * test/benchmark/test_benchmark.rb: Use test/unit.
- * eval.c (check_errat): check and convert (if necessary) traceback
- information before assigning to the variable $@.
+Sat May 24 16:20:59 2014 Eric Wong <e@80x24.org>
- * eval.c (f_raise): optional third argument to specify traceback
- information.
+ * process.c (proc_getgroups, proc_setgroups): use ALLOCV_N
+ [Bug #9856]
- * io.c (f_open): prevent infinite recursive call.
+Sat May 24 15:49:39 2014 Tanaka Akira <akr@fsij.org>
-Thu Dec 18 19:33:47 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/lib/minitest/unit.rb (parallelize_me!): Removed.
+ This fixes the line-by-line structure of the test result in verbose
+ mode. [ruby-core:54905]
- * string.c (str_rindex): now accepts regexp as index.
+ * test/lib/minitest/parallel_each.rb: Removed.
-Thu Dec 18 18:42:50 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * test/minitest/test_minitest_mock.rb: Don't call parallelize_me!.
- * ext/socket/extconf.rb: modified to detect win32 socket lib.
+ * test/minitest/test_minitest_spec.rb: Ditto.
-Thu Dec 18 00:25:03 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/minitest/test_minitest_unit.rb: Ditto.
+ Tests for parallel feature removed.
- * re.c (reg_equal): checks for source and casefold and kcode matching.
+Sat May 24 15:29:10 2014 Tanaka Akira <akr@fsij.org>
- * marshal.c: became built-in module.
+ * test/lib/minitest/hell.rb: Unused file removed.
- * ext/marshal/marshal.c (r_object): displays struct name for
- non-compatible struct.
+ * test/lib/minitest/pride.rb: Ditto.
- * string.c (str_index_method): now searches character (fixnum) in
- the string.
+Sat May 24 15:05:32 2014 yui-knk <spiketeika@gmail.com>
- * string.c (str_include): redefine `include?'.
+ * enumerator.c (yielder_yield_push): Insert a break after the
+ method return value. [fix GH-617]
- * regex.c (re_match): start_nowidth saves current stack position
- to stop_nowidth.
+Sat May 24 14:59:12 2014 Tanaka Akira <akr@fsij.org>
- * regex.c (re_compile_pattern): add space to stop_nowidth to save
- runtime stack position.
+ * test/lib/minitest: Remove comments not appropriate now.
-Tue Dec 16 14:57:43 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/minitest: Ditto.
- * string.c (scan_once): wrong exception for regexp that match with
- null string (use substr instead of subseq).
+Sat May 24 14:02:04 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Sat Dec 13 00:13:32 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * NEWS: added minitest changes.
- * parse.y (expr): remove bare assocs from expr rule.
+Sat May 24 13:42:46 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * rbconfig.rb: renamed from config.rb (it was too generic name).
+ * test/lib/test/unit/test-unit.gemspec: removed needless gemspec file.
-Fri Dec 12 00:50:25 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 24 09:39:06 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * parse.y (expr): warns if BEGIN or END appear in the method
- bodies.
+ * defs/default_gems: removed minitest entry.
- * string.c (str_match): calls y =~ x if y is neither String nor
- Regexp so that eregex.rb works.
+Sat May 24 06:17:33 2014 Ryan Davis <ryand-ruby@zenspider.com>
- * eval.c (f_at_exit): to register end proc.
+ * lib/minitest: minitest 4.7.5 removed. Need to support proper
+ gem packaging / installation before minitest 5 can be added.
- * class.c (rb_define_module_function): define 'function' method
- for the Module, not private method.
+Sat May 24 05:54:06 2014 Tanaka Akira <akr@fsij.org>
- * class.c (rb_define_function): function to define `function' method.
+ * ext/socket/mkconstants.rb: More constants
- * eval.c (rb_eval): inherit visibility from superclass's method
- except when it is set to `function'
+Sat May 24 00:25:34 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
- * eval.c (rb_eval): new visibility status `function'.
+ * NEWS: add information of incompatibility about Prime.prime?
+ * lib/prime.rb: fix docs.
- * parse.y (yycompile): do not clear eval_tree. thus enable multipe
- command line script by optn `-e'.
+Fri May 23 21:36:28 2014 Josh Goebel <dreamer3@gmail.com>
- * eval.c (rb_eval): END execute just once.
+ * net/protocol.rb (using_each_crlf_line): fix SMTP dot-stuffing
+ for messages not ending with a new-line.
+ [ruby-core:61441] [Bug #9627] [fix GH-616]
- * parse.y (expr): BEGIN/END built in the syntax.
+Fri May 23 03:48:08 2014 Eric Wong <e@80x24.org>
-Thu Dec 11 13:14:35 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (rb_free_m_tbl): mark function as static
- * object.c (mod_le): Module (or Class) comparison.
+ * method.h (rb_free_m_tbl): remove prototype
- * eval.c (rb_remove_method): raises NameError if named method does
- not exist.
+Thu May 22 22:58:27 2014 Tanaka Akira <akr@fsij.org>
- * ext/curses/curses.c: remove CHECK macro for BSD curses.
-
-Thu Dec 11 12:44:01 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * ext/socket/mkconstants.rb: More TCP option constants.
+ Describe Linux and glibc versions.
- * pack.c: sun4 cc patch
+Thu May 22 20:38:10 2014 NARUSE, Yui <naruse@ruby-lang.org>
-Wed Dec 10 15:21:36 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * file.c (stat_birthtime): add birthtime support [Feature #9647]
- * ext/marshal/marshal.c (marshal_load): can supply evolution proc
- object as optional second argument.
+ * file.c (rb_stat_birthtime): add File::Stat.birthtime
- * re.c (reg_source): get source string of the regular expression.
+ * file.c (rb_file_s_birthtime): add File.birthtime
-Tue Dec 9 10:05:17 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * file.c (rb_file_birthtime): add File#birthtime
- * version 1.1b1 released.
+ * configure.in: check struct stat.st_birthtimespec.
- * parse.y (tokadd): token buffer overrun.
+Thu May 22 19:38:14 2014 NARUSE, Yui <naruse@ruby-lang.org>
- * ruby.c (ruby_prog_init): forgot to protect rb_argv0 from gc.
+ * file.c: remove IO::Statfs because of reject. [Feature #9772]
- * eval.c (ruby_run): call finalizers at process termination.
+Thu May 22 14:02:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * gc.c (gc_call_finalizer_at_exit): call free proc for every Data
- Wrapper, and finalizer for specified objects at termination.
+ * enc/jis/props.kwd: constify character property tables of JIS
+ based encodings by perfect hash.
- * version.c (show_version): version format changed.
+ * enc/euc_jp.c, enc/shift_jis.c: use character property functions.
- * regex.c (re_match): wrong match with non-greedy if they appear
- more than once in regular expressions.
+Wed May 21 12:21:10 2014 Tanaka Akira <akr@fsij.org>
- * sample/ruby-mode.el (ruby-expr-beg): forgot to handle modifiers.
+ * ext/socket/option.c: Fix compilation error on Android.
+ Bionic doesn't define TCP state constants.
-Mon Dec 8 19:00:15 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed May 21 11:42:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (io_puts): just put a newline if no argument given.
+ * configure.in: workaround for Info.plist to get rid of `dsymutil`
+ crash by wrong files in parent directories.
+ [ruby-core:62594] [Bug #9840]
- * ext/tcltklib/tcltklib.c (lib_mainloop): thread-aware tk handle
- when $tk_thread_safe is set.
+Tue May 20 20:57:34 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
- * ext/tcltklib/tcltklib.c (lib_mainloop): use Tcl_DoOneEvent()
- instead of Tk_MainLoop().
+ * test/ruby/test_dir.rb (test_glob): added testcase of double
+ slash path.
-Mon Dec 6 07:11:16 1997 MAEDA shugo <shugo@po.aianet.ne.jp>
+Tue May 20 04:58:54 2014 Tanaka Akira <akr@fsij.org>
- * io.c (io_puts): core dumped without any argument.
+ * ext/socket/extconf.rb: Don't check fields of struct tcp_info if the
+ structure is not available.
-Fri Dec 5 18:17:17 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon May 19 23:13:33 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (mod_remove_method): remove (not undef) a method from the
- class/module.
+ * ext/socket/option.c (inspect_tcp_info): Permit longer data. (glibc
+ 2.7 adds tcpi_rcv_rtt, tcpi_rcv_space and tcpi_total_retrans to
+ struct tcp_info.)
- * variable.c (obj_remove_instance_variable): method to remove
- instance variables.
+Mon May 19 20:49:07 2014 Tanaka Akira <akr@fsij.org>
-Thu Dec 4 13:50:29 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/socket/option.c (inspect_tcp_info): New function to inspect
+ struct tcp_info.
+ (sockopt_inspect): Use inspect_tcp_info.
- * version 1.1b0 released.
+ * ext/socket/extconf.rb: Check tcp_info related things.
- * string.c (str_aref): called str_index for regexp.
+ * ext/socket/rubysocket.h: Include netinet/tcp_fsm.h if available.
-Mon Dec 1 15:24:41 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon May 19 19:36:39 2014 Tanaka Akira <akr@fsij.org>
- * compar.c (cmp_between): wrong comparison made.
+ * test/dbm/test_dbm.rb: Use Etc.uname.
-Wed Nov 26 18:18:05 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/gdbm/test_gdbm.rb: Ditto.
- * lib/mkmf.rb: generate Makefile for extention modules out of ruby
- source tree. use like `ruby -r mkmf extconf.rb'.
+Mon May 19 16:54:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * numeric.c (fix2str): enlarge buffer to prevent overflow on some
- machines.
+ * ext/etc/etc.c (etc_uname): add support for Windows using
+ GetVersionExW(), GetSystemInfo(), and GetComputerNameExW() with
+ `ComputerNameDnsHostname`. [Feature #9842]
- * parse.y (here_document): wrong line number generated after here-doc.
+Mon May 19 16:29:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Nov 21 13:17:12 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * string.c (rb_pat_search): advance by byte offset but not by char
+ offset. [ruby-core:62669] [Bug #9849]
- * parse.y (yylex): skip multibyte characters in comments.
+Mon May 19 14:06:18 2014 Shota Fukumori <her@sorah.jp>
-Wed Nov 19 17:19:20 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * bin/testrb: Removed. Forgot to remove in r45971.
+ [Feature #9711] [ruby-core:62620]
- * object.c (nil_to_a): nil.to_a => [].
+Sun May 18 16:42:08 2014 Tanaka Akira <akr@fsij.org>
- * parse.y (call_args): wrong node generation.
+ * test/ruby/test_m17n_comb.rb (test_str_crypt): Use Etc.confstr to
+ detect the glibc version.
+ libc.so is not an executable on Debian GNU/kFreeBSD 7.0 (wheezy).
-Tue Nov 18 10:13:08 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 18 12:15:54 2014 Jonathan Mukai-Heidt <johnnymukai@gmail.com>
- * array.c (Init_Array): Array#=== works as Array#include?
+ * io.c (argf_each_line, argf_inplace_mode_set): [DOC] Update ARGF
+ documentation examples. `ARGF.lines` has been deprecated in
+ favor of `ARGF.each_line`. [Fixes GH-615]
- * regex.c (re_compile_pattern): insert initialize code for jump_n,
- before entering loops.
+Sun May 18 11:59:25 2014 Tanaka Akira <akr@fsij.org>
- * re.c (reg_search): does not save registers unless $& etc appear
- in the script.
+ * missing/nextafter.c: Include ruby/missing.h.
-Mon Nov 17 13:01:43 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 18 11:09:28 2014 Tanaka Akira <akr@fsij.org>
- * eval.c (is_defined): add defined? check for receivers and
- arguments for calls.
+ * win32/Makefile.sub: Add nextafter.obj to MISSING.
- * re.c (reg_search): cache last match object.
+Sun May 18 10:46:04 2014 Tanaka Akira <akr@fsij.org>
- * re.c (match_aref): $[0] etc. are available.
+ * ext/etc/etc.c: Etc.sysconf, Etc.confstr and IO#pathconf implemented.
-Sat Nov 15 00:11:36 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * ext/etc/extconf.rb: Check sysconf(), confstr() and fpathconf().
- * io.c (io_s_popen): "rb" detection
+ * ext/etc/mkconstants.rb: New file.
-Fri Nov 14 18:28:40 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ [ruby-core:62600] [Feature #9842]
- * string.c (scan_once): returns whole match if the pattern does
- not contain any parentheses.
+Sun May 18 09:58:17 2014 Tanaka Akira <akr@fsij.org>
-Thu Nov 13 14:39:06 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/etc/etc.c: Etc.uname method implemented.
- * string.c (str_sub): returns copy of the receiver string, even if
- any substitution occurred.
+ * ext/etc/extconf.rb: Check uname() function.
- * regex.c (re_compile_pattern): no-width match by (?=..), (?!..).
+ [ruby-core:62139] [Feature #9770]
-Wed Nov 12 13:44:47 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun May 18 09:16:33 2014 Tanaka Akira <akr@fsij.org>
- * time.c: remove coerce from Time class.
+ * configure.in: Check nextafter() availability.
- * regex.c (re_match): non-greedy match by ??, *? +?, {n,m}?.
+ * include/ruby/missing.h (nextafter): New optional declaration.
-Mon Nov 10 11:24:51 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * missing/nextafter.c: New file.
- * regex.c (re_compile_pattern): non-resitering parens (?:..).
+ * numeric.c: Float#next_float and Float#prev_float implemented.
- * regex.c (re_compile_pattern): new meta character \< (wordbeg)
- and \> (wordend).
+ [ruby-core:62562] [Feature #9834]
- * regex.c (re_compile_pattern): embedded comment for regular
- expression by (?#...).
+Sun May 18 09:02:17 2014 Tanaka Akira <akr@fsij.org>
-Fri Nov 7 16:58:24 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * enum.c: Enumerable#slice_after implemented.
- * regex.c (re_compile_pattern): perl5 regxp \A and \Z available.
+ * enumerator.c: Enumerator::Lazy#slice_after implemented.
- * regex.c (re_compile_pattern): can expand compile stack dynamically.
+ Requested by Tsuyoshi Sawada. [ruby-core:58123] [Feature #9071]
- * regex.c (PUSH_FAILURE_POINT): wrong compare condition.
+Sun May 18 08:22:25 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Nov 2 16:00:00 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * io.c (io_setstrbuf): always check if the buffer is modifiable.
+ [ruby-core:62643] [Bug #9847]
- * string.c (str_sub_s): "".sub! "", "" => "\000"
+Sun May 18 01:21:23 2014 Tanaka Akira <akr@fsij.org>
-Fri Oct 31 15:52:10 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h: Hide Rational internal.
+ (RRational): Moved to internal.h
+ (RRATIONAL): Ditto.
+ (RRATIONAL_SET_NUM): Moved to rational.c.
+ (RRATIONAL_SET_DEN): Ditto.
- * parse.y (assoc): keyword assoc like {fg->"black"}.
+ * rational.c (rb_rational_num): New function.
+ (rb_rational_den): Ditto.
-Thu Oct 30 17:33:38 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/intern.h (rb_rational_num): Declared.
+ (rb_rational_den): Ditto.
- * io.c (io_println): print with newline, which is not affected by
- the values of $/ and $\.
+ * ext/bigdecimal/bigdecimal.c: Follow the above change.
-Thu Oct 30 16:54:01 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * ext/date/date_core.c: Ditto.
- * string.c (str_chop_bang): "".chop caused SEGV.
+ [ruby-core:60665] [Feature #9513]
- * string.c (str_chomp_bang): method to chop out last newline.
+Sat May 17 17:04:32 2014 Shota Fukumori <her@sorah.jp>
-Mon Oct 27 13:49:13 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * NEWS: Add news about removal of lib/test/**/*.rb.
- * ext/extmk.rb.in: library may have pathname contains `.'
+Sat May 17 16:57:33 2014 Shota Fukumori <her@sorah.jp>
- * eval.c (rb_rescue): should not protect SystemError.
+ * lib/test: Removed because ruby's test cases now independent to
+ lib/test by r45970. [Feature #9711] [ruby-core:62620]
-Fri Oct 24 10:58:53 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ I'm still considering about the future of lib/minitest, lib/test.
+ (bundling gems?)
- * io.c (io_s_with_open_stream): ensures to close stream.
+Sat May 17 15:06:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
-Thu Oct 23 11:17:44 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/runner.rb: remove dependency test-unit and minitest
+ from stdlib when running with test-all.
+ [Feature #9711][ruby-core:61890]
+ * test/testunit/*.rb: ditto.
+ * test/lib: ditto.
- * io.c (io_errset): value of $stderr can be changed (to any IO
- object).
+Sat May 17 11:02:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * io.c (next_argv): $< can be anything that responds to `write'.
+ * dir.c (glob_helper): try match PLAIN as well as ALPHA, which are
+ separated by previous commits. [ruby-core:61552] [Bug #9648]
- * file.c (file_s_with_open_file): ensures to close file.
+ * dir.c (glob_make_pattern): set PLAIN for non-magical path to
+ skip parts which not need to glob.
+ [ruby-core:61552] [Bug #9648]
- * error.c (exception): create error under the current class/module.
+ * dir.c (has_magic): return ALPHA at alphabetical name regardless
+ FNM_CASEFOLD flag.
- * range.c (range_eqq): fixnum check for last needed too.
+ * dir.c (glob_helper): fix conditions for ALPHA.
+ [ruby-core:61552] [Bug #9648]
-Wed Oct 22 12:52:30 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat May 17 01:49:27 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * ext/socket/socket.c: Socket::Constants added.
+ * dir.c (glob_helper): reduce matching at non-magical path on
+ Windows.
- * file.c: File::Constants added for inclusion.
+Sat May 17 01:49:23 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * array.c (ary_join): call ary_join() recursively for the 1st
- array element.
+ * dir.c (glob_pattern_type): separate names with alphabet but no
+ magical from plain.
-Mon Oct 20 12:18:29 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * dir.c (glob_helper): match plain names as-is to treat super-root
+ same as the root. [ruby-core:61552] [Bug #9648]
- * ruby.c (load_file): wrong condition for #! check with -x.
+Fri May 16 17:38:22 2014 Koichi Sasada <ko1@atdot.net>
- * file.c (file_s_dirname): did return "" for "/a".
+ * gc.c (gc_marks, gc_marks_body): increase the counter of young objects
+ at the major GC because AGE2Promotion changes all old objects into
+ young objects at major GC.
-Fri Oct 17 14:29:09 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri May 16 17:26:24 2014 Koichi Sasada <ko1@atdot.net>
- * ruby.c: now works on alpha-linux.
+ * gc.c (gc_before_sweep): heap_pages_swept_slots should contains
+ heap_pages_increment.
- * bignum.c (bigadd): some undefined side effect order assumed.
+ For example, GC by exceeding malloc_limit can remain
+ heap_pages_increment.
-Wed Oct 15 17:49:24 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu May 15 21:18:43 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * intern.h: function prototypes added.
+ * configure.in: enable SSE2 on mingw. target='i386-pc-mingw32'.
+ [ruby-core:62095] [Bug #8358]
-Mon Oct 13 16:54:18 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu May 15 21:04:06 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
- * class.c (rb_define_class_id): call superclass's `inherited'
- method when making subclasses.
+ * lib/test/unit/parallel.rb: fix test-all parallel failure if a test
+ is skipped after raise.
+ DL::TestFunc#test_sinf is skipped after raise on mingw ruby.
+ But it causes Marshal.load failure due to undefined class/module
+ DL::DLError when doing test-all parallel and test-all doesn't
+ complete. We create new MiniTest::Skip object to avoid Marshal.load
+ failure.
+ [ruby-core:62133] [Bug #9767]
- * parse.y (nextc): clear lex_lastline at the end of file.
+ * test/testunit/test_parallel.rb (TestParallel): add a test.
- * object.c (Init_Object): need to undef Class#append_features.
+ * test/testunit/tests_for_parallel/ptest_forth.rb: ditto.
- * eval.c (rb_eval): no warning on extending classes or modules.
+Thu May 15 18:57:23 2014 Koichi Sasada <ko1@atdot.net>
-Thu Oct 9 11:17:50 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (garbage_collect_body): move gc_heap_prepare_minimum_pages()
+ from gc_sweep().
- * eval.c (error_print): the exception name follows after the error
- message.
+Thu May 15 18:51:25 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (heap_extend_pages): calculate next growing heap size.
+
+ * gc.c (heap_set_increment): accept addition pages instead of
+ minimum pages.
+
+ * gc.c (gc_after_sweep): use heap_etend_pages().
+
+ * gc.c (gc_heap_prepare_minimum_pages): add only 1 page.
+
+ * gc.c (heap_ready_to_gc): add only 1 page.
+
+Thu May 15 18:42:49 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: introduce macros to remove magic number.
+
+ GC_HEAP_FREE_SLOTS_MIN_RATIO = 0.3: guarantee minimum empty slots
+ ratio after sweep.
+ GC_HEAP_FREE_SLOTS_MAX_RATIO = 0.8: allow to free pages 0.2 (= 1-0.8)
+ of current existing slots.
+
+Thu May 15 17:32:51 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+
+ * thread_win32.c (rb_w32_stack_overflow_handler): use Structured
+ Exception Handling by AddVectoredExceptionHandler() for machine
+ stack overflow on mingw.
+ This would be equivalent to the handling using __try and __except
+ on mswin introduced by r43748.
+
+Wed May 14 19:31:03 2014 Koichi Sasada <ko1@atdot.net>
+
+ * ext/openssl/depend: remove dependency from internal headers.
+ [Feature #9612]
+
+ * ext/openssl/ossl.c (ossl_fips_mode_set): ditto.
+
+ * ext/coverage/depend: ditto.
+
+ * include/ruby/thread_native.h: added.
+
+ This header file only provides wrapper functions to control
+ native threads. These wrapper functions are used by MRI
+ implementation.
+
+ * vm_core.h: use include/ruby/thread_native.h.
+
+ * thread.c: ditto.
+
+ * thread_pthread.h: ditto.
+
+ * thread_win32.h: ditto.
+
+ * thread_native.h: removed.
+
+Wed May 14 18:03:28 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: enable RGENGC_AGE2_PROMOTION.
+
+Wed May 14 18:02:30 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (rgengc_rememberset_mark): promote remembered object earlier.
+
+Mon May 12 23:57:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (rb_cv_atan2_inf_c99): check whether runtime atan2
+ handles Inf as C99. [ruby-core:62536] [Bug #9831]
+
+Mon May 12 20:33:01 2014 Tanaka Akira <akr@fsij.org>
+
+ * configure.in: Invoke AC_REPLACE_FUNCS for each function.
+
+Mon May 12 19:52:11 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: count young object correctly and show it in GC.stat
+ on RGENGC_AGE2_PROMOTION.
+
+ * gc.c (RVALUE_PROMOTE_YOUNG): decrement young object count on
+ YOUNG->OLD.
+
+ * gc.c (obj_free): decrement young object count when young object
+ freed.
+
+ * gc.c (gc_marks): should not clear young object count.
+
+ * gc.c (gc_stat_internal): GC.stat :young_object information.
+
+Mon May 12 01:30:59 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/ifaddr.c (IS_IFADDRS): Unused macro removed.
+
+ * ext/strscan/strscan.c (BUFSIZE): Ditto.
+
+ * ext/zlib/zlib.c (OBJ_IS_FREED): Ditto.
+
+Sun May 11 22:27:18 2014 Tanaka Akira <akr@fsij.org>
+
+ * compile.c (BUFSIZE): Unused macro removed.
+
+ * vm.c (BUFSIZE): Ditto.
+
+ * pack.c (INT64toNUM): Ditto.
+ (UINT64toNUM): Ditto.
+ (BYTEWIDTH): Ditto.
+
+ * time.c (lshift): Ditto.
+ (UINT64toNUM): Ditto.
+ (id_lshift): Unused variable removed.
+
+Sun May 11 21:23:27 2014 Tanaka Akira <akr@fsij.org>
+
+ * pack.c (swaps): Unused macro removed.
+ (swapi): Ditto.
+ (swapl): Ditto.
+ (swapll): Ditto.
+
+Sun May 11 08:02:49 2014 Eric Wong <e@80x24.org>
+
+ * vm_core.h (rb_vm_t): list_head and counter for living_threads
+ (rb_thread_t): vmlt_node for living_threads linkage
+ (rb_vm_living_threads_init): new function wrapper
+ (rb_vm_living_threads_insert): ditto
+ (rb_vm_living_threads_remove): ditto
+ * vm.c (rb_vm_living_threads_foreach): new function wrapper
+ * thread.c (terminate_i, thread_start_func_2, thread_create_core,
+ thread_fd_close_i, thread_fd_close): update to use new APIs
+ * vm.c (vm_mark_each_thread_func, rb_vm_mark, ruby_vm_destruct,
+ vm_memsize, vm_init2, Init_VM): ditto
+ * vm_trace.c (clear_trace_func_i, rb_clear_trace_func): ditto
+ * benchmark/bm_vm_thread_close.rb: added to show improvement
+ * ccan/build_assert/build_assert.h: added as a dependency of list.h
+ * ccan/check_type/check_type.h: ditto
+ * ccan/container_of/container_of.h: ditto
+ * ccan/licenses/BSD-MIT: ditto
+ * ccan/licenses/CC0: ditto
+ * ccan/str/str.h: ditto (stripped of unused macros)
+ * ccan/list/list.h: ditto
+ * common.mk: add CCAN_LIST_INCLUDES
+ [ruby-core:61871][Feature #9632 (part 1)]
+
+Sun May 11 01:10:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * signal.c (rb_f_kill): directly enqueue an ignored signal to self,
+ except for SIGSEGV and SIGBUS. [ruby-dev:48203] [Bug #9820]
+
+Sat May 10 22:37:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (push_glob): match in UTF-8 on Mac OS X.
+ [ruby-dev:48213] [Bug #9825]
+
+Sat May 10 13:32:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * thread.c (thread_start_func_2): stop if forked in a sub-thread,
+ the thread has become the main thread.
+ [ruby-core:62070] [Bug #9751]
+
+Sat May 10 09:32:19 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * man/ruby.1: remove deadlink. [ruby-core:62145][Bug #9773]
+
+Sat May 10 08:47:36 2014 Tanaka Akira <akr@fsij.org>
+
+ * signal.c (trap): Return "SYSTEM_DEFAULT" if SIG_DFL is set.
+
+Fri May 9 14:27:05 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (RUBY_SETJMP_TYPE): check for setjmp type after
+ CCDLFLAGS is appended to CFLAGS, since __builtin_setjmp can be
+ affected. [ruby-core:62469] [Bug #9818]
+
+Fri May 9 03:59:06 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+
+ * lib/delegate.rb: Fix example of using delegator.
+ patched from Andrey Koleshko. [Fixes GH-505]
+
+Fri May 9 03:42:43 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+
+ * lib/shell.rb: add documentation in lib/shell.rb
+ patched from reprah. [Fixes GH-516]
+
+Fri May 9 03:28:04 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+
+ * lib/fileutils.rb: show fileutils require at top.
+ patched from Richard Schneeman. [Fixes GH-604]
+
+Fri May 9 03:07:09 2014 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
+
+ * lib/prime.rb (Prime#prime?): negative numbers can't be primes
+ by definition. reported by Ivan Kataitsev. [Bug #7395]
+ * test/test_prime.rb: add test.
+
+Thu May 8 14:34:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * class.c (rb_mod_init_copy): always clear instance variable,
+ constant and method tables first, regardless the source tables.
+ [ruby-dev:48182] [Bug #9813]
+
+Thu May 8 10:53:14 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in: OpenBSD needs to include sys/param.h before include
+ sys/mount.h. [ruby-dev:48167]
+
+Thu May 8 10:17:04 2014 Karsten Sperling <karsten@sperling.co.nz>
+
+ * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): stop
+ handling requests on shutdown, even if the socket is readable
+ and IO.select() returns true. [Fixes GH-607]
+
+ * lib/webrick/server.rb (WEBrick::GenericServer#start): IO.select()
+ raises ENOTSOCK on shutdown on Windows.
+
+Wed May 7 21:45:00 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#accept):
+ Consider Socket#accept as well as TCPServer#accept.
+ Reported by Sam Stelfox. [ruby-core:62064] [Bug #9750]
+
+Wed May 7 17:24:07 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * numeric.c (num_step_scan_args): check keyword arguments and fail
+ if they conflict with positional arguments.
+ [ruby-dev:48177] [Bug #9811]
+
+Wed May 7 12:06:14 2014 Koichi Sasada <ko1@atdot.net>
+
+ * benchmark/driver.rb: remove debug output and output results into
+ specified file.
+
+Wed May 7 11:55:40 2014 Koichi Sasada <ko1@atdot.net>
+
+ * benchmark/driver.rb: add '--rawdata-output=[FILE] option to output
+ raw results into FILE.
+
+Wed May 7 11:25:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm_eval.c (rb_f_local_variables): exclude variables hidden by
+ shadowing. [ruby-core:60501] [Bug #9486]
+
+ * vm.c (collect_local_variables_in_iseq): ditto.
+
+Tue May 6 23:29:05 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (new_bv_gen): no duplicated names, if already added in
+ shadowing_lvar().
+
+ * parse.y (local_tbl_gen): remove local variables duplicated with
+ arguments.
+ [ruby-core:60501] [Bug #9486]
+
+Tue May 6 18:48:50 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.make_time): Adjust the time zone of "now".
+
+Tue May 6 18:33:12 2014 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * io.c (io_{read,write}_nonblock): use rb_get_kwargs instead of
+ rb_hash_aref.
+
+Tue May 6 18:03:05 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.make_time): Argument validation code moved from
+ Time.parse and Time.strptime.
+
+Tue May 6 17:27:06 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.parse): [DOC] Fix an example in the documentation
+ to use EST.
+ Reported by Marcus Stollsteimer.
+ [ruby-core:60778] [Bug #9521] and [ruby-core:61718] [Bug #9682]
+
+Tue May 6 04:31:48 2014 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * file.c (rb_f_test): removed meaningless "case 'a'".
+
+Tue May 6 01:28:14 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/open-uri.rb (OpenURI.open_uri): Call StringIO#close only if
+ the StringIO object is not closed yet.
+ Reported by Jordi Massaguer Pla. [ruby-core:42538] [Bug #6010]
+
+Tue May 6 01:08:01 2014 Koichi Sasada <ko1@atdot.net>
+
+ * benchmark/driver.rb: define File::NULL if not defined and /dev/null
+ is available to run benchmark driver on ruby 1.9.2.
+
+Mon May 5 23:53:24 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/mkconstants.rb: Add IP_TRANSPARENT.
+ IP_TRANSPARENT is provieded since glibc-2.12.
+ Reported by Eliezer Croitoru. [ruby-core:50372] [Bug #7476]
+
+Mon May 5 22:29:47 2014 Tanaka Akira <akr@fsij.org>
+
+ * process.c (check_exec_redirect): Open the file in write mode for
+ redirect from [:out, :err].
+ Proposed and implemented by Yusuke Endoh.
+ [ruby-dev:41430] [Feature #3348]
+
+Mon May 5 21:52:35 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/pathname/lib/pathname.rb (cleanpath_aggressive): make all
+ separators File::SEPARATOR from File::ALT_SEPARATOR.
+ Reported by Daniel Rikowski.
+ Fixed by Nobuyoshi Nakada. [Bug #9618]
+
+ * ext/pathname/lib/pathname.rb (cleanpath_conservative): ditto.
+
+Mon May 5 21:48:04 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/pathname/lib/pathname.rb (Pathname#/): Aliased to Pathname#+.
+ Suggested by Alexey Muranov. [ruby-core:61432] [Feature #9625]
+
+Mon May 5 17:26:09 2014 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * math.c (rb_math_sqrt): omitted exporting an unused function,
+ anyway.
+ * internal.h: follows the above change.
+
+Mon May 5 11:44:03 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.strptime): Raise ArgumentError if Date._strptime
+ doesn't extract date information.
+ Reported by tadayoshi funaba. [ruby-core:62349]
+
+Mon May 5 01:12:27 2014 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * ext/date/date_core.c (rt_rewrite_frags): a new feature (not a
+ bug fix) of strptime. applies offset even if the given date is
+ not local time (%s and %Q). This is an exceptional feature and
+ I do NOT recommend to use this at all. Thank you git community.
+
+Sun May 4 20:51:32 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.force_zone!): Use usual local time if it has
+ expected offset from UTC.
+
+Sun May 4 17:58:12 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.force_zone!): New private method.
+ (Time.make_time): Use Time.force_zone!.
+ (Time.strptime): Ditto.
+ (Time.rfc2822): Ditto.
+ (Time.xmlschema): Ditto.
+
+ * lib/rss/rss.rb (Time.w3cdtf): Use Time.force_zone!.
+
+Sun May 4 10:22:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * math.c (math_atan2): return values like as expected by C99 if
+ both two arguments are infinity. based on the patch by cremno
+ phobia <cremno AT mail.ru> in [ruby-core:62310]. [Feature #9799]
+
+Sun May 4 03:46:42 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.httpdate): Always return a UTC Time object.
+
+Sun May 4 03:26:39 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.make_time): Refactored.
+
+Sun May 4 02:53:17 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.rfc2822): Fix year completion.
+ Produce fixed-offset time object if appropriate.
+ (Time.xmlschema): Produce fixed-offset time object if appropriate.
+
+Sat May 3 23:52:20 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (make_time): Produce fixed-offset time object if
+ appropriate.
+ (Time.strptime): Use d[:zone] instead of d[:offset].
+
+ * lib/rss/rss.rb (Time.w3cdtf): Produce fixed-offset time object if
+ appropriate.
+
+Sat May 3 20:21:38 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/time.rb (Time.strptime): Use d[:offset] if d[:seconds] is not
+ given.
+ Reported by tadayoshi funaba. [ruby-core:62322]
+
+Sat May 3 04:04:16 2014 Eric Wong <e@80x24.org>
+
+ * complex.c (parse_comp): replace ALLOCA_N with ALLOCV_N/ALLOCV_END
+ [Bug #9608]
+ * rational.c (read_digits): ditto
+
+Sat May 3 00:06:30 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * file.c (HAVE_STRUCT_STATVFS_F_BASETYPE): File::Statfs#fstypename
+ is supported on AIX, HP-UX, and Solaris, by using the value of
+ struct statvfs.f_basetype.
+
+ * configure.in (HAVE_STRUCT_STATVFS_F_BASETYPE): check struct
+ statvfs.f_basetype which is available on AIX, HP-UX, and Solaris.
+
+Fri May 2 21:04:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (next_id): no reason to set ID_STATIC_SYM here, as ID
+ returned by rb_intern3 can be a dynamic symbol and the static
+ symbol flag is set otherwise. [Bug #9787]
+
+Fri May 2 11:32:51 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/ruby/test_io.rb (test_seek, test_seek_symwhence): defer
+ File::Statfs#type call which may not be implemented, to mitigate
+ errors on platforms where SEEK_DATA is available but f_type in
+ struct statfs is not. [ruby-dev:48154] [Bug #9789]
+
+Fri May 2 10:37:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (rb_id_attrset): turn dynamically interned Symbol into
+ an ID, since rb_str_dynamic_intern returns a Symbol but not an
+ ID. [ruby-core:62226] [Bug #9787]
+
+Thu May 1 22:19:34 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * file.c: Change AND condition to nested condition.
+
+Thu May 1 00:36:26 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * file.c (FSTATFS): check availability of struct statfs and
+ struct statvfs in addition to fstatfs(2) and fstatvfs(2).
+ This fixes error in Solaris. [Bug #9788] [ruby-dev:48145]
+
+Wed Apr 30 19:46:23 2014 Narihiro Nakamura <authornari@gmail.com>
+
+ * gc.c (gc_after_sweep): suppress unnecessary expanding heap.
+ Tomb heap pages are freed pages here, so expanding heap is
+ not required.
+
+Wed Apr 30 17:58:40 2014 Koichi Sasada <ko1@atdot.net>
+
+ * vm.c (invoke_block_from_c): add VM_FRAME_FLAG_BMETHOD to record
+ it is bmethod frame.
+
+ * vm.c (vm_exec): invoke RUBY_EVENT_RETURN event if rollbacked frame
+ is VM_FRAME_FLAG_BMETHOD.
+ [Bug #9759]
+
+ * test/ruby/test_settracefunc.rb: add a test for TracePoint/set_trace_func.
+
+ * vm_core.h: rename rb_thread_t::passed_me to
+ rb_thread_t::passed_bmethod_me to clarify the usage.
+
+ * vm_insnhelper.c (vm_call_bmethod_body): use renamed member.
+
+Wed Apr 30 17:06:49 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (rb_id_attrset): pin down dynamic symbol only. it is
+ possible that attrset ID can be registered as a static symbol
+ after the corresponding attrget ID has been registered as a
+ dynamic, and then the latter may be collected.
+ [ruby-core:62226] [Bug #9787]
+
+Tue Apr 29 14:17:57 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/tmpdir.rb: Rescue LoadError on etc.so for miniruby.
+ Revert r45707, r45711, r45717.
+
+Tue Apr 29 12:50:02 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/fileutils.rb: Don't need to define fu_get_gid and fu_get_gid in
+ rescue LoadError on 'etc'.
+
+Tue Apr 29 10:21:38 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * parse.y (symbols_i): like r45492, call rb_gc_resurrect().
+
+Tue Apr 29 04:29:05 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * file.c (HAVE_STRUCT_STATFS_T_F_FSTYPENAME): Add new macro for
+ statfs_t.
+ * file.c (HAVE_STRUCT_STATFS_T_F_TYPE): ditto.
+
+ * file.c (rb_io_statfs): check FSTATFS macro only instead of
+ HAVE_FSTATFS and HAVE_FSTATVFS.
+
+ * file.c (statfs_type): use new macro.
+ * file.c (statfs_fstypename): ditto.
+ * file.c (statfs_inspect): ditto.
+
+Tue Apr 29 00:20:26 2014 Rajarshi Das <rajarshid@cybage.com>
+
+ * bootstraptest/test_literal.rb: fix typo of "dynamic". [ci skip]
+
+ * regexp.rdoc: fix typo of "organized". [ci skip]
+
+ * lib/session.rb: fix typo of "recognized". [ci skip]
+
+Mon Apr 28 21:40:27 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in (HAVE_STRUCT_STATFS_F_TYPE): check struct statfs.f_type
+ to support OpenBSD.
+
+ * file.c (statfs_type): use above macro to switch.
+
+ * file.c (statfs_inspect): ditto.
+
+Mon Apr 28 18:06:08 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in: check struct statvfs and struct statvfs.f_fstypename.
+
+ * configure.in: on NetBSD fstatfs is obsoleted.
+
+ * file.c: support NetBSD for File::Statfs.
+
+Mon Apr 28 17:42:42 2014 Narihiro Nakamura <authornari@gmail.com>
+
+ * gc.c: This argument must be a pointer.
+
+Mon Apr 28 17:40:15 2014 Narihiro Nakamura <authornari@gmail.com>
+
+ * gc.c: Fix typos. These are undefined variables.
+
+Sun Apr 27 19:39:42 2014 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * ext/date/date_strptime.c (date__strptime_internal): do not
+ overwrite century.
+
+Sat Apr 26 11:50:08 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/ruby/test_enum.rb (test_flat_map): Added test for flat_map.
+ Contribute from @igaiga. [fix GH-598]
+
+Sat Apr 26 10:55:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * compile.c (compile_array_): make copy a first hash not to modify
+ the argument itself. keyword splat should be non-destructive.
+ [ruby-core:62161] [Bug #9776]
+
+Sat Apr 26 08:05:36 2014 Tanaka Akira <akr@fsij.org>
+
+ * test/ruby/test_process.rb (test_rlimit_nofile): Don't limit
+ RLIMIT_NOFILE too small.
+ This fix sporadic "[ASYNC BUG] thread_timer: select" on GNU/Linux.
+
+Fri Apr 25 22:54:34 2014 Naohisa Goto <ngotogenome@gmail.com>
+
+ * lib/fileutils.rb (rmdir): rescue Errno::EEXIST in addition to
+ ENOTEMPTY (and ENOENT), because SUSv3 describes that "If the
+ directory is not an empty directory, rmdir() shall fail and set
+ errno to [EEXIST] or [ENOTEMPTY]" and Solaris uses EEXIST.
+ [Bug #9571] [ruby-dev:48017]
+
+Fri Apr 25 19:16:30 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/webrick/utils.rb: Don't rescue LoadError for 'etc' extension.
+
+Fri Apr 25 14:55:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (rb_cv_func___builtin_unreachable): try with an
+ external variable not only by a warning, which might not be
+ shown due to the optimization. [ruby-core:61647] [Bug #9665]
+
+Fri Apr 25 13:11:49 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in: NetBSD's ksh, used by configure, needs escapes.
+
+Fri Apr 25 12:51:08 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in: correct pthread_setname_np's prototype on NetBSD.
+ [Bug #9586]
+
+Thu Apr 24 23:17:25 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/fileutils.rb (fu_get_uid, fu_get_gid): Etc.getpwnam/getgrnam may
+ returns nil.
+
+ * lib/webrick/utils.rb (su): ditto.
+
+Thu Apr 24 22:55:22 2014 Tanaka Akira <akr@fsij.org>
+
+ * bootstraptest/test_io.rb: Add etc.so to $" before require 'tmpdir'.
+
+Thu Apr 24 21:09:55 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * man/ruby.1: fix broken link.
+
+Thu Apr 24 20:53:02 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/tmpdir.rb: Don't need to rescue LoadError for etc.so.
+
+Thu Apr 24 17:39:53 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * file.c (statfs_inspect): suppress warnings.
+ assume those values won't be larger than LONG_LONG_MAX.
+
+Thu Apr 24 11:53:28 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/openssl/ossl_asn1.c (ossl_asn1_initialize): SYMID on a value
+ other than Symbol is an undefined behavior. fix up r31699.
+ [ruby-core:62142] [Bug #9771]
+
+Thu Apr 24 11:21:37 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (rb_sym2id, rb_sym2id_without_pindown): return 0 for
+ non-symbol values, for the time being.
+
+Thu Apr 24 05:50:13 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * parse.y (dsym_node_gen): like r45492, call rb_gc_resurrect().
+
+Wed Apr 23 20:36:22 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/etc/extconf.rb: Build ext/etc unconditionally.
+
+Wed Apr 23 14:10:50 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * file.c (statfs_fsid): remove statfs.f_fsid because it doesn't return
+ meaningful value portably. http://togetter.com/li/658517
+
+Wed Apr 23 11:03:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_write): use rb_str_append to
+ reuse coderange bits other than ASCII-8BIT, and keep
+ taintedness. [ruby-dev:48118] [Bug #9769]
+
+Wed Apr 23 00:43:00 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c, include/ruby/win32.h (ustatfs): implementation of
+ statfs(2) clone. [EXPERIMENTAL]
+
+ * file.c (rb_io_statfs): use above function.
+
+ * configure.in, win32/Makefile.sub (struct statfs): available.
+
+Tue Apr 22 23:56:24 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * file.c (rb_io_stafs): use statfs(2) if fstatfs(2) is unavailable.
+
+ * configure.in (fstatfs): check it.
+
+Tue Apr 22 22:15:51 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * file.c (rb_io_statfs): need to define even if the system doesn't have
+ fstatfs(2).
+
+ * test/ruby/test_file.rb (TestFile#test_statfs): skip if IO#stafs is not
+ implemented.
+
+Tue Apr 22 19:32:48 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * file.c: newly added a class File::Statfs. (experimental)
+
+Tue Apr 22 08:22:33 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (objspace_malloc_increase): don't cause GC by malloc_increase
+ when memop type is MEMOP_TYPE_REALLOC.
+
+ GC at realloc is not well maintained.
+ We need a time to make it safe.
+ [ruby-dev:48117]
+
+Tue Apr 22 06:54:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * gc.c (objspace_malloc_increase): run full mark if 0x04 bit is
+ set in ruby_gc_stress. [ruby-core:62103] [Feature #9761]
+
+ * gc.c (objspace_malloc_increase): run GC after realloc not only
+ malloc and calloc by GC.stress. [ruby-core:62103] [Feature #9761]
+
+Mon Apr 21 19:12:20 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c (rb_str_coderange_scan_restartable): coderange is always
+ ENC_CODERANGE_VALID if the string is ASCII-8BIT and already has a non
+ ASCII character.
+
+Mon Apr 21 19:02:44 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c (coderange_scan): remove useless condition `p < e` after
+ search_nonascii.
+
+ * string.c (rb_str_coderange_scan_restartable): ditto.
+
+Mon Apr 21 18:55:21 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * ext/-test-/string/coderange.c: add Bug::String.new#coderange_scan
+ to explicitly scan coderange.
+
+Mon Apr 21 18:19:35 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c (coderange_scan): remove unused logic.
+
+ * string.c (rb_str_coderange_scan_restartable): ditto.
+
+Mon Apr 21 14:11:48 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_putc): fix for non-ascii
+ encoding, like as IO#putc. [ruby-dev:48114] [Bug #9765]
+
+Sun Apr 20 12:57:15 2014 Masaya Tarui <tarui@ruby-lang.org>
+
+ * st.c (st_foreach_check): change start point of search at check
+ from top to current. [ruby-dev:48047] [Bug #9646]
+
+Sun Apr 20 08:41:33 2014 Andrew DeMaria <ademariad@gmail.com>
+
+ * lib/mkmf.rb (link_command, libpathflag, create_makefile): prefer
+ user specified `$LIBPATH` than `$DEFLIBPATH`. [ruby-core:62100]
+ [ruby-trunk - Bug #9760]
+
+Sun Apr 20 06:01:18 2014 Eric Wong <e@80x24.org>
+
+ * gc.c (rb_gc_writebarrier): drop special case for big hash/array
+ [Bug #9518]
+
+Sat Apr 19 15:38:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (primary): flush cmdarg flags inside left-paren in a
+ command argument, to allow parenthesed do-block as an argument
+ without arguments parentheses. [ruby-core:61950] [Bug #9726]
+
+Sat Apr 19 10:07:24 2014 Tanaka Akira <akr@fsij.org>
+
+ * internal.h (struct RBignum): Use size_t for len.
+
+ * include/ruby/intern.h (rb_big_new): Use size_t instead of long to
+ specify the size of bignum.
+ (rb_big_resize): Ditto.
+
+ * bignum.c: Follow above changes.
+
+ * rational.c: Follow above changes.
+
+ * marshal.c: Follow above changes.
+
+Sat Apr 19 00:32:07 2014 Tanaka Akira <akr@fsij.org>
+
+ * numeric.c (rb_num2long): Returns a long.
+ (rb_num2ulong): Returns a unsigned long.
+
+ * bignum.c (rb_big2long): Returns a long.
+ (rb_big2ulong): Returns a unsigned long.
+
+ * include/ruby/intern.h: Follow above changes.
+
+ * include/ruby/ruby.h: Follow above changes.
+ (rb_num2long_inline): No need to cast.
+ (rb_num2ulong_inline): Ditto.
+
+Sat Apr 19 00:17:20 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (SHARABLE_SUBSTRING_P): predicate if substring can be
+ shared with the original string. true if just at the end of the
+ original string, for the time being. all substring will be able to
+ be shared in the future.
+
+Fri Apr 18 21:48:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_new_frozen): consider the shared string at
+ middle.
+
+ * string.c (rb_str_subseq, rb_str_substr, str_byte_substr): share
+ middle of a string.
+
+Fri Apr 18 15:40:05 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c: use uintptr_t instead of VALUE because they are not ruby
+ object.
+
+Fri Apr 18 14:51:42 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c: check str_strlen's argument, and add comment or
+ use NULL if simply it uses str's enc.
+
+Fri Apr 18 14:32:40 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c (str_strlen): use enc_strlen if the coderange is known.
+
+Fri Apr 18 14:21:21 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c (enc_strlen): move UTF-8 optimization from str_strlen to
+ enc_strlen.
+
+Fri Apr 18 08:50:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (rb_cv_getcwd_malloc): check if getcwd allocates
+ buffer if NULL is given [ruby-core:62072] [Bug #9752]
+
+Thu Apr 17 16:28:10 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * prelude.rb: [DOC] Update Thread::exclusive docs by @stevenharman.
+
+Thu Apr 17 10:03:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/fileutils.rb (FileUtils#copy_entry): update rdoc about
+ preserve option and permissions, following r31123.
+ [ruby-core:62065] [Bug #9748]
+
+Wed Apr 16 23:47:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * enum.c (dont_recycle_block_arg): fix condition to recycle block
+ argument. lambda with rest can get internal array directly.
+ [ruby-core:62060] [Bug #9749]
+
+Wed Apr 16 09:51:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/openssl/ossl_pkey.c (ossl_pkey_verify): as EVP_VerifyFinal()
+ finalizes only a copy of the digest context, the context must be
+ cleaned up after initialization by EVP_MD_CTX_cleanup() or a
+ memory leak will occur. [ruby-core:62038] [Bug #9743]
+
+Tue Apr 15 19:36:42 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * include/ruby/win32.h (rb_w32_cmdvector): removed.
+
+ * win32/win32.c (rb_w32_sysinit): use WCHAR version of GetCommandLine()
+ internally.
+
+ * win32/win32.c (w32_cmdvector): renamed from rb_w32_cmdvector. use
+ WCHAR* instead of char* internally.
+
+ these changes are expected to not changing the behavior yet.
+
+Tue Apr 15 19:26:05 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/extmk.rb: Re-generate extmk.mk and dummy makefiles only if
+ really required.
+ This fixes a problem to run multiple test-all concurrently as:
+ make test-all & make test-all & make test-all & ...
+
+Tue Apr 15 12:49:53 2014 Sam Rawlins <sam.rawlins@gmail.com>
+
+ * enum.c (enum_each_slice, enum_each_cons): make more efficient by
+ allocating less and recycling block argument arrays if possible.
+ [Fixes GH-596]
+
+Mon Apr 14 18:44:45 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): get base addrs in fill_lines to use it
+ with dladdr_fbases introduced at r45563.
+ it didn't get before if the executable is not pie.
+
+Mon Apr 14 18:05:48 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (main_exe_path): support FreeBSD.
+ At least sh, csh, tcsh, bash, and zsh sets realpath of the main
+ executable for dladdr, but gdb doesn't.
+
+Mon Apr 14 17:20:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * proc.c (umethod_bind): use the ancestor iclass instead of new
+ iclass to get rid of infinite recursion, if the defined module
+ is already included. [ruby-core:62014] [Bug #9721]
+
+Sun Apr 13 12:46:58 2014 Tanaka Akira <akr@fsij.org>
+
+ * bignum.c (SIZEOF_BDIGIT): Renamed from SIZEOF_BDIGITS.
+
+ * internal.h: Ditto.
+
+ * marshal.c: Ditto.
+
+ * rational.c: Ditto.
+
+Sun Apr 13 10:18:09 2014 Tanaka Akira <akr@fsij.org>
+
+ * common.mk: Unused target, $(MKMAIN_CMD), removed.
+
+ * Makefile.in (MKMAIN_CMD): Unused macro removed.
+
+ * win32/Makefile.sub (MKMAIN_CMD): Ditto.
+
+Sat Apr 12 22:11:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (sym_to_proc), proc.c (rb_block_clear_env_self): clear
+ caller's self which is useless, so that it can get collected.
+ [Fixes GH-592]
+
+Sat Apr 12 09:26:48 2014 Eric Hodel <drbrain@segment7.net>
+
+ * ext/openssl/ossl_ocsp.c: [DOC] Document OpenSSL::OCSP.
+
+Fri Apr 11 18:52:38 2014 Koichi Sasada <ko1@atdot.net>
+
+ * array.c (ARY_SET): added.
+
+ ARY_SET() is same functionality of RARRAY_ASET(), but
+ it has an assertion (`ary' doesn't have shared array).
+
+Fri Apr 11 16:54:26 2014 Koichi Sasada <ko1@atdot.net>
+
+ * array.c: make shared arrays WB-protected objects.
+
+ Shared arrays were WB-unprotected object because
+ sharing array can modify shared array's buffer
+ if it occupied shared array.
+
+ [sharing array (ary)] -> [shared array (shared)] -> <buff>
+ | A
+ +---------------------------------------+
+ write `buff' with WB(ary, &buff[i], obj)
+ -> if `ary' and `shared' are old, then only `ary'
+ will be remembered.
+ -> traverse from `ary'. But `shared' is old, so
+ that written `obj' is not marked.
+
+ It cause WB miss so that shared arrays were WB-unprotected.
+ (WB-unprotected objects are marked everytime if it is living)
+
+ This patch insert WB() for `shared' if it is needed.
+
+Fri Apr 11 15:05:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * proc.c (rb_method_call_with_block, umethod_bind): call with
+ IClass including the module for a module instance method.
+ [ruby-core:61936] [Bug #9721]
+
+ * vm_insnhelper.c (vm_search_super_method): allow bound
+ UnboundMethod case.
+
+Fri Apr 11 12:02:30 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (rb_dump_backtrace_with_lines): set base address
+ which is retrieved from dladdr to dladdr_fbases, to skip already
+ parsed objects.
+
+Fri Apr 11 12:44:50 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * array.c (ary_reject): may be turned into a shared array during
+ the given block. [ruby-dev:48101] [Bug #9727]
+
+Thu Apr 10 23:41:21 2014 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/net/ftp.rb (Net::FTP#login): [DOC] The default password for
+ anonymous login was changed to "anonymous@" in r25313.
+
+Thu Apr 10 19:22:58 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/test_array.rb: remove useless `assert'.
+
+Thu Apr 10 19:11:11 2014 Koichi Sasada <ko1@atdot.net>
+
+ * array.c (rb_ary_modify): remember shared array owner if a shared
+ array owner is promoted and a shared array is not promoted.
+
+ Now, shared array is WB-unprotected so that shared arrays are not
+ promoted. All objects referred from shared array should be marked
+ correctly.
+
+ [ruby-core:61919] [ruby-trunk - Bug #9718]
+
+ * test/ruby/test_array.rb: add a test for above.
+
+Thu Apr 10 18:57:12 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (gc_verify_internal_consistency): move lines and enable
+ allrefs_dump() on RGENGC_CHECK_MODE >= 4.
+
+Thu Apr 10 15:01:06 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (append_obj): clear allocated memory.
+
+ * addr2line.c (rb_dump_backtrace_with_lines): free `base_addrs'.
+
+Thu Apr 10 14:40:18 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (rb_gc_writebarrier_unprotect_promoted): disable to dump debug
+ message when RGENGC_CHECK_MODE == 0.
+
+Thu Apr 10 08:13:47 2014 Tanaka Akira <akr@fsij.org>
+
+ * signal.c (check_stack_overflow): Don't use ucontext_t if ucontext.h
+ is not available.
+ Fixes build on Android (x86).
+
+Wed Apr 9 23:22:44 2014 Tanaka Akira <akr@fsij.org>
+
+ * gc.c (mark_current_machine_context): Call SET_STACK_END.
+ This reverts a hunk of r40703 by ko1.
+ This fixes [ruby-dev:48098] [Bug #9717].
+
+Wed Apr 9 21:02:04 2014 Tanaka Akira <akr@fsij.org>
+
+ * process.c (OBJ2UID1): Defined even if getpwnam_r is not usable.
+ (OBJ2GID1): Defined even if getgrnam_r is not usable.
+ This fixes compilation error on Android.
+
+Wed Apr 9 15:16:59 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * encoding.c (rb_enc_default_internal): fix rdoc. `__FILE__` is
+ in filesystem encoding but not `default_internal`.
+ [ruby-core:61894] [Bug #9713]
+
+Wed Apr 9 14:43:00 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/test_gc.rb: more long timeout.
+ This test failed under RGENGC_CHECK_MODE >= 2.
+
+Wed Apr 9 13:07:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in: get rid of __builtin_setjmp/__builtin_longjmp on
+ x64-mingw, which causes SEGV with callcc.
+ [ruby-core:61887] [Bug #9710]
+
+Wed Apr 9 12:44:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (str_buf_cat): should round up the capacity by 4KiB,
+ but not number of rooms. [ruby-core:61886] [Bug #9709]
+
+Tue Apr 8 22:55:32 2014 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/mkmf.rb (MakeMakefile#dir_config): [DOC] Improve
+ documentation.
+
+Tue Apr 8 22:31:44 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: rename `RGENGC_THREEGEN' to `RGENGC_AGE2_PROMOTION'.
+
+ * gc.c (rgengc_rememberset_mark): don't promote, but remain in
+ remember set for infant objects.
+
+ * gc.c (RVALUE_PROMOTE_INFANT, RVALUE_PROMOTE_YOUNG): count numbers
+ in these functions.
+
+Mon Apr 7 21:11:49 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/socket.c (sock_s_getnameinfo): Save errno for EAI_SYSTEM.
+ Reported by Saravana kumar. [ruby-core:61820] [Bug #9697]
+ Fixed by Heesob Park. [ruby-core:61868]
+
+Mon Apr 7 07:20:23 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * lib/xmlrpc/client.rb (do_rpc): don't check body length.
+ If HTTP content-encoding is used, the length may be different.
+ [Bug #8182] [ruby-core:53811]
+
+Mon Apr 7 02:39:48 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+
+ * lib/matrix.rb: Add Matrix#cofactor [fix GH-568]
+ Add first_minor [fix GH-568]
+ Handle empty diagonal matrix case [fix GH-576]
+ Patches by gogotanaka
+
+Sun Apr 6 08:52:50 2014 Bugra Barin <bugrabarin@hotmail.com>
+
+ * dln.c (dln_load): use wchar version to load a library in
+ non-ascii path on Windows. based on the patch by Bugra Barin
+ <bugrabarin AT hotmail.com> in [ruby-core:61845]. [Bug #9699]
+
+Sat Apr 5 19:36:33 2014 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * ext/date/date_core.c (d_lite_cmp): should compare with #<.
+
+Sat Apr 5 00:31:21 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/readline/extconf.rb (rl_hook_func_t): check pointer type.
+ [ruby-dev:48089] [Bug #9702]
+
+Fri Apr 4 07:13:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (ac_cv_func___builtin_setjmp): should not skip
+ flags restoration in RUBY_WERROR_FLAG by `break`.
+ [ruby-dev:48086] [Bug #9698]
+
+Wed Apr 2 21:50:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (ac_cv_func___builtin_setjmp): __builtin_longjmp()
+ in Apple LLVM 5.1 (LLVM 3.4svn) uses `void**`, not `jmp_buf`.
+ [Bug #9692]
+
+Wed Apr 2 20:57:15 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c, gc.h (rb_objspace_each_objects_without_setup):
+ Add a new (hidden) C-API to iterate objspace snapshot.
+
+ This API is not safe to call any C-APIs in a given callback
+ function. Be careful to use this C-API.
+
+Wed Apr 2 17:43:17 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (ac_cv_func___builtin_setjmp): gcc 4.9 disallows a
+ variable as the second argument of __builtin_longjmp().
+ [ruby-core:61800] [Bug #9692]
+
+Wed Apr 2 15:12:18 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * common.mk: Use redmine-2.x url for DeveloperHowto wiki.
+ [ruby-core:60657] [Bug #9511]
+
+Wed Apr 2 11:46:29 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * ext/pathname/lib/pathname.rb (Pathname#join): Fix error with
+ empty args. Reported by ko1 via IRC.
+
+ * test/pathname/test_pathname.rb (TestPathname#test_join): Add the
+ test for above case.
+
+Tue Apr 1 11:39:57 2014 James Edward Gray II <james@graysoftinc.com>
+
+ * lib/csv.rb: Symbol HeaderConverter: strip leading/trailing space.
+ Reported by Skye Shaw
+ [Fixes GH-575]
+
+Tue Apr 1 11:34:04 2014 James Edward Gray II <james@graysoftinc.com>
+
+ * lib/csv.rb: Don't attempt to convert nil headers.
+ Reported by Skye Shaw
+
+Tue Apr 1 17:29:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * tool/config_files.rb (ConfigFiles.download): show failed URI.
+ [ruby-core:61792] [Bug #9690]
+
+Tue Apr 1 12:06:49 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (rb_dump_backtrace_with_lines): don't depend hard coded
+ symbol '_start'.
+
+ * addr2line.c (fill_lines): instead of above, get a dynamic symbol
+ in the main executable and use it to know the base address.
+
+ * addr2line.c (follow_debuglink0): use obj_info_t instead of
+ line_info_t to handle object related data.
+
+ * addr2line.c (main_exe_path): defined for Linux.
+
+Tue Apr 1 08:58:39 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * parse.y (rb_str_dynamic_intern): set mark bit if dynamic symbol
+ is before sweeping.
+
+Tue Apr 1 07:37:00 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): use dynsym, which is used for dynamic
+ linking and always exists, if there's no symtab.
+
+Tue Apr 1 07:27:15 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * vm_dump.c (rb_print_backtrace): current implementation
+ uses dladdr to get the path of objects.
+
+Mon Mar 31 23:57:45 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/readline/extconf.rb: fix typo, `$defs` not `$DEFS`.
+ [ruby-core:61756] [Bug #9578]
+
+Mon Mar 31 17:23:50 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/ruby/memory_status.rb: require envutil before accessing EnvUtil
+ module. reported by ko1 via twitter.
+
+Mon Mar 31 10:28:01 2014 Eric Wong <e@80x24.org>
+
+ * st.c (st_init_table_with_size): update comment
+ [Feature #9425]
+
+Sun Mar 30 23:39:26 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (rb_w32_accept, open_ifs_socket, socketpair_internal):
+ reset inherit flag of socket to avoid unintentional inheritance of
+ socket. note that the return value of SetHandleInformation() is not
+ verified intentionally because old Windows may return an error.
+ [Bug #9688] [ruby-core:61754]
+
+Sat Mar 29 13:04:22 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (gc_before_sweep): cap `malloc_limit' to
+ gc_params.malloc_limit_max. It can grow and grow with such case:
+ `loop{"a" * (1024 ** 2)}'
+ [Bug #9687]
+
+ This issue is pointed by Tim Robertson.
+ http://www.omniref.com/blog/blog/2014/03/27/ruby-garbage-collection-still-not-ready-for-production/
+
+Fri Mar 28 19:32:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * struct.c (not_a_member): extract name error and use same error
+ messages. based on the patch by Marcus Stollsteimer <sto.mar AT
+ web.de> at [ruby-core:61721]. [Bug #9684]
+
+Fri Mar 28 09:21:54 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * ext/psych/psych.gemspec: update gemspec for psych-2.0.5
+
+Fri Mar 28 09:11:06 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * ext/psych/lib/psych.rb: Merge psych-2.0.5. bump version to
+ libyaml-0.1.6 for CVE-2014-2525.
+ * ext/psych/yaml/config.h: ditto.
+ * ext/psych/yaml/scanner.c: ditto.
+ * ext/psych/yaml/yaml_private.h: ditto.
+
+Thu Mar 27 18:58:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * re.c (match_regexp): set regexp for MatchData from string.
+
+ * re.c (rb_backref_set_string): create MatchData from string and
+ set backref.
+
+ * string.c (rb_pat_search, rb_str_sub, rb_str_sub_bang, str_gsub),
+ (scan_once, rb_str_scan, rb_str_partition): use rb_str_index
+ instead of rb_reg_search() when pattern is a String. based on
+ the patch by Sam Rawlins <sam.rawlins@gmail.com> [Fixes GH-579]
+
+Thu Mar 27 11:58:55 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): check shdr[i].sh_type because even if
+ .symtab section exists, the section's type can be SHT_NOBITS and
+ actual data doesn't exist in the file.
+ revert r45441.
+
+Wed Mar 26 14:57:35 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * parse.y: inline must be static (for mswin).
+ fixed build error introduced at r45426.
+
+Wed Mar 26 14:33:00 2014 Narihiro Nakamura <authornari@gmail.com>
+
+ * internal.h (USE_SYMBOL_GC): enable Symbol GC by default (USE_SYMBOL_GC == 1).
+
+Tue Mar 25 22:57:11 2014 Narihiro Nakamura <authornari@gmail.com>
+
+ * parse.y: support Symbol GC. [ruby-trunk Feature #9634]
+ See this ticket about Symbol GC.
+
+ * include/ruby/ruby.h:
+ Declare few functions.
+ * rb_sym2id: almost same as old SYM2ID but support dynamic symbols.
+ * rb_id2sym: almost same as old ID2SYM but support dynamic symbols.
+ * rb_sym2str: almost same as `rb_id2str(SYM2ID(sym))` but not
+ pin down a dynamic symbol.
+ Declare a new struct.
+ * struct RSymbol: represents a dynamic symbol as object in
+ Ruby's heaps.
+ Add few macros.
+ * STATIC_SYM_P: check a static symbol.
+ * DYNAMIC_SYM_P: check a dynamic symbol.
+ * RSYMBOL: cast to RSymbol
+
+ * gc.c: declare RSymbol. support T_SYMBOL.
+
+ * internal.h: Declare few functions.
+ * rb_gc_free_dsymbol: free up a dynamic symbol. GC call this
+ function at a sweep phase.
+ * rb_str_dynamic_intern: convert a string to a dynamic symbol.
+ * rb_check_id_without_pindown: not pinning function.
+ * rb_sym2id_without_pindown: ditto.
+ * rb_check_id_cstr_without_pindown: ditto.
+
+ * string.c (Init_String): String#intern and String#to_sym use
+ rb_str_dynamic_intern.
+
+ * template/id.h.tmpl: use LSB of ID as a flag for determining a
+ static symbol, so we shift left other ruby_id_types.
+
+ * string.c: use rb_sym2str instead `rb_id2str(SYM2ID(sym))` to
+ avoid pinning.
+
+ * load.c: use xx_without_pindown function at creating temporary ID
+ to avoid pinning.
+
+ * object.c: ditto.
+
+ * sprintf.c: ditto.
+
+ * struct.c: ditto.
+
+ * thread.c: ditto.
+
+ * variable.c: ditto.
+
+ * vm_method.c: ditto.
+
+Wed Mar 26 13:25:54 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): loop reverse order not to overwrite
+ the basis of base addresses comparison.
+
+ * addr2line.c: use uintptr_t instead of intptr_t for pointers.
+
+ * addr2line.c (rb_dump_backtrace_with_lines): don't use syms.
+
+ * vm_dump.c (rb_print_backtrace): ditto.
+
+ * addr2line.h: ditto.
+
+Wed Mar 26 11:20:50 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (w_object): internal objects are not dumpable.
+ [ruby-core:61677] [Bug #9674]
+
+ * ext/thread/thread.c (undumpable): ConditionVariable and Queue
+ are not dumpable. [ruby-core:61677] [Bug #9674]
+
+Wed Mar 26 10:36:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (follow_debuglink): show message if it closes opened
+ (and maybe used) elf binary.
+
+Wed Mar 26 10:34:25 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_line): pass and use offset instead of
+ curobj_baseaddr.
+
+Wed Mar 26 09:07:48 2014 Yutaka Kanemoto <kanemoto@ruby-lang.org>
+
+ * configure.in: add --disable-pie. [Feature #9673]
+
+Wed Mar 26 08:47:04 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): don't run fill_lines multiple times.
+
+Wed Mar 26 08:45:00 2014 Sam Rawlins <sam.rawlins@gmail.com>
+
+ * internal.h: add prototype for rb_reg_search0
+
+ * re.c: rename rb_reg_search to rb_reg_search0, add set_backref_str
+ argument to allow callers to indicate that they don't require the
+ backref string to be allocated.
+
+ * string.c: don't allocate backref str if replacement string is provided
+
+ [GH-578] [Bug #9676] [ruby-core:61682]
+
+Wed Mar 26 08:29:43 2014 mo khan <mo@mokhan.ca>
+
+ * lib/rubygems.rb: fix spelling of Jim Weirich. [Fixes GH-577]
+
+Wed Mar 26 01:55:45 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (rb_dump_backtrace_with_lines): a function to get must
+ be a function in the main executable, whose absolute path is not
+ available by dladdr, and ruby get it by /proc/self/exe on Linux.
+
+Wed Mar 26 01:34:50 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): skip if path is NULL.
+
+Tue Mar 25 23:57:17 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (parser_yylex): only a newline after label should be
+ significant. [ruby-core:61658] [Bug #9669]
+
+Tue Mar 25 23:32:25 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * ext/pathname/lib/pathname.rb (Pathname#join): remove unnecessary
+ unshift.
+
+ * test/pathname/test_pathname.rb (TestPathname#test_join): add tests.
+
+Tue Mar 25 16:47:36 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (lex_state_e, parser_params, f_arglist, parser_yylex):
+ separate EXPR_LABELARG from EXPR_BEG and let newline significant,
+ so that required keyword argument can place at the end of
+ argument list without parentheses. [ruby-core:61658] [Bug #9669]
+
+Mon Mar 24 22:19:56 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (ripper_initialize): filename can not be modified.
+
+Mon Mar 24 15:19:47 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (rb_dump_backtrace_with_lines): fetch path of the
+ executable from /proc/self/exe on Linux.
+
+Mon Mar 24 14:14:37 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * gc.c: Fix up default GC params by @csfrancis [fix GH-556]
+
+Mon Mar 24 13:13:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (parse_debug_line_cu): explicitly specify signed char
+ because DWARF's line_Base is signed char and char maybe unsigned.
+ patched by Rei Odaira. [ruby-dev:48068] [Bug #9654]
+
+Sun Mar 23 11:03:50 2014 Kohei Suzuki <eagletmt@gmail.com>
+
+ * vm_method.c (rb_method_entry_get_without_cache): me->klass is 0
+ for a method aliased in a module. [ruby-core:61636] [Bug #9663]
+
+Sun Mar 23 08:12:27 2014 Eric Wong <e@80x24.org>
+
+ * st.c (hash_pos): use bitwise AND to avoid slow modulo op
+ (new_size): power-of-two sizes for hash_pos change
+ (st_numhash): adjust for common keys due to lack of prime modulo
+ [Feature #9425]
+ * hash.c (rb_any_hash): right shift for symbols
+ * benchmark/bm_hash_aref_miss.rb: added to show improvement
+ * benchmark/bm_hash_aref_sym_long.rb: ditto
+ * benchmark/bm_hash_aref_str.rb: ditto
+ * benchmark/bm_hash_aref_sym.rb: ditto
+ * benchmark/bm_hash_ident_num.rb: added to prevent regression
+ * benchmark/bm_hash_ident_obj.rb: ditto
+ * benchmark/bm_hash_ident_str.rb: ditto
+ * benchmark/bm_hash_ident_sym.rb: ditto
+
+Sat Mar 22 22:56:45 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): compare the file names of object in which
+ symbols exist. [Bug #9654] [ruby-dev:48058]
+
+Sat Mar 22 06:46:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/cgi/util.rb (escape_html, unescape_html): make synonyms
+ aliases instead of wrapper methods.
+
+ * lib/cgi/util.rb (escape_element, unescape_element): ditto.
+ [Fixes GH-573]
+
+Fri Mar 21 21:57:34 2014 Akinori MUSHA <knu@iDaemons.org>
+
+ * configure.in: Fix a build problem with clang and --with-opt-dir.
+ If ruby is configured with --with-opt-dir=dir when using clang
+ as compiler, a warning `clang: warning: argument unused during
+ compilation: '-I dir'` is emitted almost every time clang
+ compiles a file. Unfortunately, RUBY_CHECK_PRINTF_PREFIX takes
+ any output from the compiler as fatal error, and the check thus
+ fails due to the warning. This is an attempt to fix the problem
+ by adding a flag -Qunused-arguments to CFLAGS locally in the
+ function to suppress the warning. [ruby-dev:48062] [Bug #9658]
+ [Fixes GH-571] https://github.com/ruby/ruby/pull/571
+
+Fri Mar 21 16:31:56 2014 Zachary Scott <e@zzak.io>
+
+ * gc.c: [DOC] Fix call-seq for GC.start by @jasonrclark [Fixes GH-572]
+ https://github.com/ruby/ruby/pull/572
+
+Thu Mar 20 11:37:28 2014 James Edward Gray II <james@graysoftinc.com>
+
+ * lib/csv.rb: Fixed a broken regular expression that was causing
+ CSV to miss escaping some special meaning characters when used
+ in parsing.
+ Reported by David Unric
+ [ruby-core:54986] [Bug #8405]
+
+Thu Mar 20 16:53:07 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (objspace_malloc_increase): should not invoke
+ garbage_collect_with_gvl() here on non-ruby threads.
+
+ Should just ignore the malloc_increase.
+
+ This issue is pointed by Eric Wong [ruby-core:61519].
+
+Thu Mar 20 13:05:16 2014 Koichi Sasada <ko1@atdot.net>
+
+ * struct.c (rb_struct_alloc): use RARRAY_CONST_PTR() instead of
+ RARRAY_PTR().
+
+Thu Mar 20 12:59:39 2014 Koichi Sasada <ko1@atdot.net>
+
+ * include/ruby/intern.h (rb_obj_call_init, rb_class_new_instance):
+ constify a parameter (VALUE *).
+ I believe this incompatibility doesn't break any code.
+ However, if you have trouble, please tell us.
+
+ * eval.c, object.c: ditto.
+
+Thu Mar 20 12:31:26 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm_method.c (rb_method_entry_get_without_cache): get rid of
+ infinite recursion at aliases in a subclass and a superclass.
+ return actually defined class for other than singleton class.
+ [ruby-core:60431] [Bug #9475]
+
+Wed Mar 19 17:13:06 2014 Eric Wong <e@80x24.org>
+
+ * time.c (time_mload): freeze and preserve marshal-loaded time zone
+ * test/ruby/test_time.rb: add test for GC on loaded object
+ [Bug #9652]
+
+Tue Mar 18 23:20:12 2014 Shota Fukumori <her@sorah.jp>
+
+ * vm_eval.c (eval_string_with_cref): Unify to use NIL_P.
+
+Tue Mar 18 22:03:41 2014 Shota Fukumori <her@sorah.jp>
+
+ * vm_eval.c (eval_string_with_cref): Use file path even if scope is
+ given. Related to [ruby-core:56099] [Bug #8662] and r42103.
+
+Mon Mar 17 13:17:47 2014 Koichi Sasada <ko1@atdot.net>
+
+ * enumerator.c (enumerator_block_call): use RARRAY_CONST_PTR()
+ instead of RARRAY_PTR().
+
+ * io.c (rb_io_s_popen): ditto.
+
+ * numeric.c (num_step_size): ditto.
+
+ * vm_eval.c (rb_apply): ditto.
+
+ * vm_eval.c (rb_eval_cmd): ditto.
+
+Mon Mar 17 10:11:59 2014 Eric Wong <e@80x24.org>
+
+ * variable.c (rb_const_set): delete existing entry on redefinition
+ [Bug #9645]
+ * test/ruby/test_const.rb (test_redefinition): test for leak
+
+Sun Mar 16 21:33:01 2014 Zachary Scott <e@zzak.io>
+
+ * lib/time.rb: [DOC] Fix timezone in example of Time.parse [Bug #9521]
+ Based on patch by @stomar
+
+Sun Mar 16 13:21:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (DLDFLAGS): insert a space between option and its
+ argument for non-GCC compilers. [ruby-core:61429] [Bug #9624]
+
+Sun Mar 16 08:05:06 2014 Eric Wong <e@80x24.org>
+
+ * gc.c (objspace_xcalloc): fix GC accounting
+
+Sun Mar 16 06:33:35 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): return address is just after calling
+ address. Therefore noreturn function with tail call's return
+ address may be in another function.
+
+Sun Mar 16 05:51:55 2014 Zachary Scott <e@zzak.io>
+
+ * lib/gserver.rb: [DOC] Fixed typo in example by @stomar [Bug #9543]
+
+Sat Mar 15 18:54:03 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * ext/.document: remove refinement from documentable directories.
+
+Sat Mar 15 11:02:58 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (DLDFLAGS): check for each options to control
+ symbol resolution. [ruby-core:61429] [Bug #9624]
+
+Sat Mar 15 07:02:35 2014 Eric Wong <e@80x24.org>
+
+ * st.c (st_update): remove unnecessary assignment
+
+Fri Mar 14 14:58:38 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * addr2line.c (fill_lines): fetch symbol names from ELF binary's
+ symbol table if it is built with cc -g and not stripped.
+ Now ruby can show static symbols on Linux though glibc's
+ backtrace_symbols(3) don't show them.
+
+ * addr2line.c (rb_dump_backtrace_with_lines): use dladdr(3) to
+ detect what object file declares the symbol because
+ dl_iterate_phdr can't detect the main executable file
+ and codes on the stack.
+ NOTE: signal trampolines sometimes on the user stack. (FreeBSD)
+
+ * addr2line.c (rb_dump_backtrace_with_lines): stop showing
+ backtrace if the function's name is main.
+ NOTE: FreeBSD's backtrace (libexecinfo) shows _start and
+ an additional address. Why it doesn't remove them on dladdr phase
+ is, dladdr may fail to detect the main function but detect
+ as _start function. Therefore it must be after scanning
+ the symbol table and getting correct name.
+
+
+Fri Mar 14 12:07:46 2014 Zachary Scott <e@zzak.io>
+
+ * doc/syntax/literals.rdoc: [DOC] Single quote strings allows escape
+ of backslash as well, patch by @idupree [Fixes GH-553]
+ https://github.com/ruby/ruby/pull/553
+
+Fri Mar 14 01:18:24 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm.c (invoke_block_from_c): add splattable argument.
+
+ * vm.c (vm_invoke_proc): disallow to splat when directly invoked.
+
+ * vm_insnhelper.c (vm_callee_setup_arg_complex, vm_callee_setup_arg):
+ relax arity check of yielded lambda. [ruby-core:61340] [Bug #9605]
+
+ * test/ruby/test_yield.rb (TestRubyYieldGen#emu_bind_params): no
+ longer raise ArgumentError when splatting to lambda.
+
+Thu Mar 13 23:51:02 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/-test-/win32/dln/libdlntest.c (dlntest_ordinal): no need to
+ specify export in the source file because .def file do it.
+ get rid of warning on linking.
+
+Wed Mar 12 11:19:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm_insnhelper.c (vm_callee_setup_arg): disable fastpath if splat
+ argument, since argc may differ for each calls.
+ [ruby-core:61422] [Bug #9622]
+
+ * vm_insnhelper.c (vm_callee_setup_arg): turn a macro into an
+ inline function.
+
+Wed Mar 12 07:26:05 2014 Eric Wong <e@80x24.org>
+
+ * insns.def (opt_regexpmatch2): respect redefined match op
+ Thanks to Sam Rawlins for the fix.
+ * test/ruby/test_string.rb: test based on Tsuyoshi Sawada's report
+ [Bug #9581]
+
+Tue Mar 11 22:31:25 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * ext/.document: add objspace/objspace_dump.c to document file.
+
+Tue Mar 11 22:22:38 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * test/objspace/test_objspace.rb (TestObjSpace#test_dump_uninitialized_file):
+ remove dependency on json library.
+
+Tue Mar 11 10:55:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * README.EXT{,.ja} (Appendix B): update contents of `ruby_options`
+ and replace `ruby_run` with `ruby_run_node`. based on the patch
+ by Kaneko Yuichiro at [ruby-dev:48030] [Bug #9619].
+
+Tue Mar 11 06:54:00 2014 Scott Francis <scott.francis@shopify.com>
+
+ * ext/objspace/objspace_dump.c: Check fptr before trying to dump RFILE
+ object fd. [GH-562]
+
+ * test/objspace/test_objspace.rb: add test
+
+Tue Mar 11 02:04:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * vm_dump.c (rb_vm_bugreport): show vm maps on FreeBSD.
+
+ * vm_dump.c (procstat_vm): copied from FreeBSD.
+ http://svnweb.freebsd.org/base/head/usr.bin/procstat/procstat_vm.c?revision=261780
+
+Mon Mar 10 12:14:26 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in: always check dladdr(1).
+
+ * addr2line.c (fill_lines): show the line number in C backtrace if
+ ruby is built without --enable-shared (PIE) on Linux.
+ patch is originally by Shinichiro Hamaji
+ https://twitter.com/shinh/status/441957774264504321
+ NOTE: ld doesn't insert __executable_start for PIE.
+ dladdr(3)'s argument must be a function pointer.
+
+Mon Mar 10 10:51:17 2014 ksss <co000ri@gmail.com>
+
+ * test/ruby/test_enumerator.rb (test_iterators): fix test for hash
+ iterators. [Fixes GH-558]
+
+Sun Mar 9 14:14:49 2014 Eric Wong <e@80x24.org>
+
+ * class.c (rb_class_subclass_add): use xmalloc
+ * class.c (rb_module_add_to_subclasses_list): ditto
+ * class.c (rb_class_remove_from_super_subclasses): use xfree
+ * class.c (rb_class_remove_from_module_subclasses): ditto
+ [Bug #9616]
+
+Sun Mar 9 13:51:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/fiddle/function.c (function_call): fix memory leak when an
+ exception occurs at argument conversion or the function call.
+
+Sun Mar 9 06:42:40 2014 Eric Wong <e@80x24.org>
+
+ * variable.c (struct global_variable): shrink by 8 bytes on 64-bit
+
+Sat Mar 8 17:42:51 2014 Eric Wong <e@80x24.org>
+
+ * vm.c (add_opt_method): cleanup to use rb_method_entry_at
+
+Sat Mar 8 13:46:40 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/dl/cptr.c (dlptr_free), ext/dl/handle.c (dlhandle_free),
+ ext/fiddle/handle.c (fiddle_handle_free),
+ ext/fiddle/pointer.c (fiddle_ptr_free): fix memory leak.
+ based on the patch Heesob Park at [ruby-dev:48021] [Bug #9599].
+
+Sat Mar 8 13:30:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * process.c (obj2uid, obj2gid): now getpwnam_r() and getgrnam_r()
+ may need larger buffers than sysconf values, so retry with
+ expanding the buffer when ERANGE is returned.
+ [ruby-core:61325] [Bug #9600]
+
+Fri Mar 7 19:29:13 2014 Eric Wong <e@80x24.org>
+
+ * vm_eval.c (vm_call0_body): use RARRAY_CONST_PTR
+ (check_funcall_exec): ditto
+ [ruby-core:61360]
+
+Fri Mar 7 19:14:11 2014 Eric Wong <e@80x24.org>
+
+ * vm_eval.c (vm_call0_body): fix RB_GC_GUARD location
+ (check_funcall_exec): ditto
+ [Bug #9609]
+
+Fri Mar 7 14:48:17 2014 Narihiro Nakamura <authornari@gmail.com>
+
+ * parse.y (ENC_SINGLE): Unused macro removed.
+
+Fri Mar 7 12:06:19 2014 Martin Bosslet <Martin.Bosslet@gmail.com>
+
+ * test/openssl/test_ssl.rb: Reuse TLS default options from
+ OpenSSL::SSL::SSLContext::DEFAULT_PARAMS.
+
+Thu Mar 6 15:15:24 2014 Zachary Scott <e@zzak.io>
+
+ * doc/syntax/assignment.rdoc: [DOC] Fix assignment directions
+ By @idupree [Fixes GH-555] https://github.com/ruby/ruby/pull/555
+
+Thu Mar 6 15:07:18 2014 Zachary Scott <e@zzak.io>
+
+ * doc/syntax/methods.rdoc: [DOC] Fix example for block arguments
+ By @idupree [Fixes GH-554] https://github.com/ruby/ruby/pull/554
+
+Thu Mar 6 10:33:31 2014 Martin Bosslet <Martin.Bosslet@gmail.com>
+
+ * lib/openssl/ssl.rb: Explicitly whitelist the default
+ SSL/TLS ciphers. Forbid SSLv2 and SSLv3, disable
+ compression by default.
+ Reported by Jeff Hodges.
+ [ruby-core:59829] [Bug #9424]
+
+Wed Mar 5 15:56:18 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (f_arg_asgn): define optional arguments as argument
+ variables in the rhs default expressions.
+ [ruby-core:61299] [Bug #9593]
+
+Wed Mar 5 11:58:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/openssl/ossl.c (ossl_make_error): check NULL for unknown
+ error reasons with old OpenSSL, and insert a colon iff formatted
+ message is not empty.
+
+Wed Mar 5 00:42:00 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * ext/pathname/lib/pathname.rb (Pathname#find): add "ignore_error"
+ keyword argument defaulted to true as well as Find#find.
+
+Tue Mar 4 23:00:18 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/ruby/test_eval.rb (TestEval#make_test_binding): renamed.
+ it's not test method.
+
+Tue Mar 4 20:50:59 2014 Masaya Tarui <tarui@ruby-lang.org>
+
+ * st.c (st_foreach): fix type of hash. not st_data_t but st_index_t.
+
+Tue Mar 4 19:41:40 2014 Tanaka Akira <akr@fsij.org>
+
+ * Makefile.in: ".DEFAULT" target removed because it is not for
+ specifying default target.
+
+Tue Mar 4 00:25:35 2014 Kazuki Tsujimoto <kazuki@callcc.net>
+
+ * lib/find.rb (Find#find): should pass ignore_error option to enumerators.
+
+Mon Mar 3 13:27:35 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/test_find.rb (TestFind#test_unsearchable_dir): ruby cannot make
+ directory unreachable by owner on Windows.
+
+Mon Mar 3 08:10:04 2014 Eric Wong <e@80x24.org>
+
+ * vm_method.c (rb_method_entry_get_without_cache): disable GMC
+ writing if GMC is disabled.
+ [ruby-core:61218]
+
+Mon Mar 3 07:47:17 2014 Eric Wong <e@80x24.org>
+
+ * README.EXT: wrap GetDBM with do/while(0)
+ * README.EXT.ja: ditto
+ * ext/dbm/dbm.c: ditto, likewise for GetDBM2
+ * ext/gdbm/gdbm.c: ditto
+ * ext/sdbm/init.c: ditto
+ [ruby-core:61217]
+
+Mon Mar 3 07:17:31 2014 Zachary Scott <e@zzak.io>
+
+ * NEWS: [DOC] Update doc regarding filesystem load when flushing IO
+
+Mon Mar 3 04:37:50 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * io.c (rb_io_fsync): need to fsync even if on Windows. fixed mistake
+ of r45254 and r45256.
+
+Mon Mar 3 04:21:34 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/win32ole: get rid of warnings (unused variable).
+
+Mon Mar 3 02:53:53 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * io.c (rb_io_flush_raw): [EXPERIMENTAL] remove force syncing for Win32
+ to speed up IO. this may break some tests, and they'll be fixed
+ later.
+ [ruby-core:58570] [Bug #9153]
+
+Mon Mar 3 00:17:43 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/ruby/test_backtrace.rb: get rid of warnings. unused variable,
+ shadowing.
+
+Sun Mar 2 11:15:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/find.rb (Find#find): add "ignore_error" keyword argument
+ defaulted to true. [ruby-core:51025] [Feature #7596]
+
+Sun Mar 2 11:13:30 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/readline/extconf.rb (rl_hook_func_t): define as Function for
+ very old readline versions. [ruby-core:61209] [Bug #9578]
+
+Sun Mar 2 10:47:58 2014 Eric Wong <e@80x24.org>
+
+ * load.c (ruby_init_ext): make idempotent to suppress warnings
+
+Sat Mar 1 19:51:42 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/open3.rb (Open3.capture3): Ignore Errno::EPIPE for writing
+ stdin_data.
+ (Open3.capture2): Ditto.
+ (Open3.capture2e): Ditto.
+
+Sat Mar 1 19:06:47 2014 Eric Wong <e@80x24.org>
+
+ * gc.c (ruby_gc_set_params): simplify condition
+
+Sat Mar 1 16:18:40 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/readline/readline.c (Init_readline): Use rl_hook_func_t instead
+ of Function to support readline-6.3. (rl_hook_func_t is available
+ since readline-4.2.)
+ Reported by Dmitry Medvinsky. [ruby-core:61141] [Bug #9578]
+
+Sat Mar 1 16:05:58 2014 Eric Wong <e@80x24.org>
+
+ * gc.c (ruby_gc_set_params): fix building without RGenGC
+
+Sat Mar 1 11:08:00 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: support dumping Encoding
+ objects.
+
+ * ext/psych/lib/psych/visitors/to_ruby.rb: support loading Encoding
+ objects.
+
+ * test/psych/test_encoding.rb: add test
+
+ * ext/psych/lib/psych.rb: add version
+
+Sat Mar 1 10:52:34 2014 Zachary Scott <e@zzak.io>
+
+ * README.EXT.ja: [DOC] Fix typo "macro macro" @utenmiki [Fixes GH-551]
+ https://github.com/ruby/ruby/pull/551
+
+Fri Feb 28 11:16:55 2014 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
+
+ * numeric.c: Fix Numeric#step with 0 unit [Bug #9575]
+
+Thu Feb 27 17:59:01 2014 Zachary Scott <e@zzak.io>
+
+ * lib/optparse.rb: [DOC] Add example of generating help with optparse.
+ Patch by @joelmccracken documenting-ruby/ruby#19
+ https://github.com/documenting-ruby/ruby/pull/19
+
+Thu Feb 27 12:10:09 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * numeric.c (ruby_num_interval_step_size): check signs and get rid
+ of implementation dependent behavior of negative division.
+ [ruby-core:61106] [Bug #9570]
+
+Thu Feb 27 03:55:45 2014 Zachary Scott <e@zzak.io>
+
+ * thread.c: [DOC] Typo in comment for _FORTIFY_SOURCE [Fixes GH-548]
+ Patch by @qnet-herwin https://github.com/ruby/ruby/pull/548
+
+Wed Feb 26 18:43:43 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (heap_pages_free_unused_pages): check tomb page availability
+ at first.
+ And return immediately if we don't touch sorted list any more.
+
+Wed Feb 26 14:10:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (setup_exception): preserve exception class name encoding
+ in debug mode messages.
+
+ * eval.c (setup_exception): preserve errinfo across calling #to_s
+ method on the exception. [ruby-core:61091] [Bug #9568]
+
+Wed Feb 26 01:29:27 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * string.c (sym_find): Add Symbol.find(str), which returns whether given
+ string is defined as symbol or not. [Feature #7854]
+
+Tue Feb 25 22:52:02 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * ext/dl/dl.c (rb_dl_realloc): use NUM2SIZET instead of NUM2INT.
+
+ * ext/fiddle/fiddle.c (rb_fiddle_realloc): ditto.
+
+Tue Feb 25 22:49:30 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * ext/dl/dl.c (rb_dl_malloc): use NUM2SIZET instead of NUM2INT.
+ Coverity Scan found this bug.
+
+ * ext/fiddle/fiddle.c (rb_fiddle_malloc): ditto.
+
+Tue Feb 25 12:06:13 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * win32/Makefile.sub: define PACKED_STRUCT.
+
+Mon Feb 24 21:41:56 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * README.md, README.ja.md: removed (wrong) mode setting for emacs.
+
+Mon Feb 24 20:05:41 2014 Eric Wong <e@80x24.org>
+
+ * configure.in: define PACKED_STRUCT_UNALIGNED for x86*
+ * timev.h (struct vtm): use PACKED_STRUCT_UNALIGNED
+ * time.c (struct time_object): ditto
+ [Bug #9558] non-x86 cannot safely access unaligned addresses
+
+Mon Feb 24 18:10:02 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/fiddle/test_function.rb: remove unused variables.
+ * test/fileutils/test_fileutils.rb: ditto.
+ * test/io/console/test_io_console.rb: ditto.
+
+Mon Feb 24 12:37:51 2014 Eric Wong <e@80x24.org>
+
+ * configure.in: use -Wno-packed-bitfield-compat for GCC 4.4+
+ use __attribute__((packed)) if available
+ * timev.h: shrink and pack struct vtm
+ * time.c: pack struct time_object and adjust/introduce helpers
+ [ruby-core:60794]
+
+Sun Feb 23 17:55:50 2014 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rexml/xmltokens.rb: Add missing non ASCII valid characters
+ to element name characters. Now, REXML name tokens exactly
+ match "[5] Name" in the XML spec and "[4] NCName" in the
+ Namespaces in XML spec. See comment about the details.
+ [Bug #9539] [ruby-core:60901]
+ Reported by Mario Barcala. Thanks!!!
+
+ * test/rexml/xpath/test_node.rb: Add tests for the above case.
+
+Sun Feb 23 12:18:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/socket/raddrinfo.c (inet_pton): use rb_w32_inet_pton, instead of
+ inet_pton directly, which is unavailable on older version Windows.
+
+ * include/ruby/win32.h, win32/win32.c (rb_w32_inet_pton): add a
+ wrapper function for inet_pton minimum supported client is
+ Vista, as well as inet_ntop.
+
+Sun Feb 23 11:33:25 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/net/imap/test_imap.rb: remove unused variables.
+ * test/net/imap/test_imap_response_parser.rb: ditto.
+ * test/net/pop/test_pop.rb: ditto.
+
+Sun Feb 23 02:19:51 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/resolv.rb (bind_random_port): Rescue EPERM for FreeBSD which
+ security.mac.portacl.port_high is changed.
+ See mac_portacl(4) for details.
+ Reported by Jakub Szafranski. [ruby-core:60917] [Bug #9544]
+
+Sat Feb 22 23:17:01 2014 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rexml/xpath_parser.rb: Fix indent.
+
+Sat Feb 22 23:15:35 2014 Kouhei Sutou <kou@cozmixng.org>
+
+ * test/rexml/xpath/test_attribute.rb: Simplify.
+
+Sat Feb 22 20:28:47 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * tool/redmine-backporter.rb: more friendly.
+
+Sat Feb 22 20:24:43 2014 Kouhei Sutou <kou@cozmixng.org>
+
+ * test/rexml/test_xpath*.rb: Move to ...
+ * test/rexml/xpath/*.rb: ... here.
+
+Sat Feb 22 20:04:41 2014 Kouhei Sutou <kou@cozmixng.org>
+
+ * test/rexml/listener.rb: Untabify.
+
+Sat Feb 22 19:07:31 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/io/console/console.c (console_dev): need read access for conout$
+ because some functions need it. [Bug#9554]
+
+Sat Feb 22 18:40:58 2014 Eric Wong <e@80x24.org>
+
+ * .gitignore: ignore benchmark files
+
+Sat Feb 22 01:22:24 2014 Yusuke Endoh <mame@tsg.ne.jp>
+
+ * bignum.c (bary_mul_precheck): fix a copy-paste error.
+ Coverity Scan found this bug.
+
+Sat Feb 22 00:58:51 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * ext/socket/raddrinfo.c (rb_getaddrinfo): second argument of
+ MEMZERO is type. Coverity Scan found this bug.
+
+Fri Feb 21 23:47:24 2014 Shugo Maeda <shugo@ruby-lang.org>
+
+ * ext/socket/init.c (wait_connectable): break if the socket is
+ writable to avoid infinite loops on FreeBSD and other platforms
+ which conforms to SUSv3. This problem cannot be reproduced with
+ loopback interfaces, so it's hard to write test code.
+ rsock_connect() and wait_connectable() are overly complicated, so
+ they should be refactored, but I commit this fix as a workaround
+ for the release of Ruby 1.9.3 scheduled on Feb 24.
+ [ruby-core:60940] [Bug #9547]
+
+Fri Feb 21 23:03:39 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * tool/redmine-backporter.rb: added to handle redmine tickets.
+
+Fri Feb 21 20:42:01 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * class.c (rb_mod_init_copy): do nothing if copying self.
+ [ruby-dev:47989] [Bug #9535]
+
+ * hash.c (rb_hash_initialize_copy): ditto.
+
+Fri Feb 21 16:45:54 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/logger.rb (next_rotate_time, previous_period_end): consider
+ DST change.
+
+ * lib/logger.rb (Logger::LogDevice#check_shift_log): compare the
+ current time with the time for the next rotation to fix rotation
+ miss when date changed between the comparison and log writing.
+ based on the patch by megayu <yuhg2310 AT gmail.com>.
+ [Fixes GH-539]
+
+Fri Feb 21 10:39:33 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/monitor/test_monitor.rb: remove unused variables.
+ * test/resolv/test_dns.rb: ditto.
+ * test/rexml/test_functions.rb: ditto.
+ * test/rss/test_setup_maker_itunes.rb: ditto.
+
+Fri Feb 21 09:48:56 2014 Eric Wong <e@80x24.org>
+
+ * ext/socket/ancdata.c (bsock_sendmsg_internal): only retry on error
+ (bsock_recvmsg_internal): ditto
+ * test/socket/test_unix.rb: test above for infinite loop
+
+Fri Feb 21 08:27:19 2014 Eric Wong <e@80x24.org>
+
+ * include/ruby/ruby.h (RB_GC_GUARD):
+ use rb_gc_guarded_ptr_val on non-GCC/MSC
+ * gc.c (rb_gc_guarded_ptr_val): rename and adjust argument.
+ RB_GC_GUARD should be robust enough for any compiler.
+ [ruby-core:60816] [Bug #7805]
+
+Thu Feb 20 22:21:26 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/raddrinfo.c (numeric_getaddrinfo): Use xcalloc.
+ Suggested by Eric Wong.
+ https://bugs.ruby-lang.org/issues/9525#note-14
+
+Thu Feb 20 11:21:13 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * hash.c (rb_hash_flatten): fix behavior of flatten(-1).
+ [ruby-dev:47988] [Bug #9533]
+
+ * test/ruby/test_array.rb: test for above.
+
+Wed Feb 19 18:57:02 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket: Bypass getaddrinfo() if node and serv are numeric.
+ Reporeted by Naotoshi Seo. [ruby-core:60801] [Bug #9525]
+
+ * ext/socket/extconf.rb: Detect struct sockaddr_in6.sin6_len.
+
+ * ext/socket/sockport.h (SET_SIN6_LEN): New macro.
+ (INIT_SOCKADDR_IN6): Ditto.
+
+ * ext/socket/rubysocket.h (struct rb_addrinfo): Add
+ allocated_by_malloc field.
+
+ * ext/socket/raddrinfo.c (numeric_getaddrinfo): New function.
+ (rb_getaddrinfo): Call numeric_getaddrinfo at first.
+ (rb_freeaddrinfo): Free struct addrinfo properly when it is
+ allocated by numeric_getaddrinfo.
+
+Wed Feb 19 18:31:48 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket: Wrap struct addrinfo by struct rb_addrinfo.
+
+Wed Feb 19 17:47:01 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/ipsocket.c (ip_s_getaddress): Don't access freed memory.
+
+Wed Feb 19 11:39:41 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in: it must see rb_cv_broken_memmem not rb_cv_func_memmem.
+
+Tue Feb 18 23:18:41 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/socket/test_socket.rb: unix socket is required by test case.
+
+Tue Feb 18 20:48:38 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/socket/test_addrinfo.rb: remove unused variables.
+ * test/socket/test_nonblock.rb: ditto.
+ * test/socket/test_socket.rb: ditto.
+ * test/socket/test_unix.rb: ditto.
+ * test/testunit/test_parallel.rb: ditto.
+ * test/webrick/test_filehandler.rb: ditto.
+ * test/xmlrpc/test_features.rb: ditto.
+ * test/zlib/test_zlib.rb: ditto.
+
+Tue Feb 18 14:27:18 2014 Shota Fukumori <her@sorah.jp>
+
+ * lib/test/unit.rb: Requires minitest < 5.0.0 if Gem is available.
+
+Tue Feb 18 14:24:07 2014 Shota Fukumori <her@sorah.jp>
+
+ * lib/test/unit/test-unit.gemspec: Add minitest < 5.0.0 dependency
+
+ * tool/rbinstall.rb: Add empty implementations for `add_dependency`,
+ `add_runtime_dependency`, `add_development_dependency` for
+ Gem::Specification.
+
+Tue Feb 18 12:06:39 2014 Tanaka Akira <akr@fsij.org>
+
+ * configure.in (FILE_COUNT): Removed. (win32.c defines it in itself.)
+ (FILE_READPTR): Ditto.
+
+Tue Feb 18 09:35:44 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/test/psych/test_string.rb: remove unused variables.
+ * test/test/psych/test_yaml.rb: ditto.
+
+Mon Feb 17 21:31:31 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/test_gc.rb: ignore warning messages for running with -w
+ option such as chkbuild.
+
+Mon Feb 17 20:00:27 2014 Tanaka Akira <akr@fsij.org>
+
+ * internal.h: Move BDIGIT and related definitions from
+ include/ruby/defines.h.
+
+Mon Feb 17 17:41:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (marshal_dump, marshal_load): do not recycle wrapper
+ objects, to prevent from segfault with continuation.
+ [ruby-dev:47970] [Bug #9523]
+
+Mon Feb 17 15:43:59 2014 Zachary Scott <e@zzak.io>
+
+ * doc/keywords.rdoc: [DOC] Add keywords doc by documenting-ruby/ruby#29
+ https://github.com/documenting-ruby/ruby/pull/29
+
+Mon Feb 17 12:31:31 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (get_envparam_double): fix a warning message.
+
+Mon Feb 17 12:09:52 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c: introduce new environment variable
+ "RUBY_GC_HEAP_OLDOBJECT_LIMIT_FACTOR" to control major/minor GC
+ frequency.
+
+ Do full GC when the number of old objects is more than R * N
+ where R is this factor and
+ N is the number of old objects just after last full GC.
+
+ * test/ruby/test_gc.rb: add a test.
+
+Mon Feb 17 11:28:40 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/test_pty.rb: ignore warnings to unused variables.
+
+Mon Feb 17 11:27:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/test_find.rb: remove unused variables.
+
+Sun Feb 17 02:12:00 2014 Kenta Murata <mrkn@mrkn.jp>
+
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_initialize): Insert GC guard.
+
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_global_new): ditto.
+
+Sun Feb 16 15:53:36 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/test_securerandom.rb: File.exists? is deprecated. use File.exist?
+
+Sun Feb 16 15:05:00 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/pathname/test_pathname.rb: File.exists? is deprecated. use File.exist?
+
+Sun Feb 16 15:00:28 2014 SHIBATA Hiroshi <shibata.hiroshi@gmail.com>
+
+ * test/net/ftp/test_ftp.rb: remove unused variables.
+ * test/logger/test_logger.rb: ditto.
+
+Sun Feb 16 14:52:46 2014 Eric Wong <e@80x24.org>
+
+ * dir.c (dir_s_glob): RB_GC_GUARD instead of volatile
+
+Sun Feb 16 14:33:52 2014 Tanaka Akira <akr@fsij.org>
+
+ * include/ruby/ruby.h (RBIGNUM_SIGN): Defined for compatibility.
+ (RBIGNUM_POSITIVE_P): Ditto.
+ (RBIGNUM_NEGATIVE_P): Ditto.
+
+Sun Feb 16 12:46:47 2014 Eric Wong <e@80x24.org>
+
+ * io.c (rb_f_backquote): trade volatile for manual recycle
+ rb_gc_force_recycle ensures object is visible until recycle
+
+Sun Feb 16 11:55:14 2014 Eric Wong <e@80x24.org>
+
+ * marshal.c (marshal_dump): use rb_gc_force_recycle for GC-safety
+ (marshal_load): ditto
+ [ruby-core:60730] [Bug #7805]
+
+Sun Feb 16 08:11:23 2014 Zachary Scott <e@zzak.io>
+
+ * README.EXT.ja: [DOC] Fix typo by @utenmiki [Fixes GH-534]
+ https://github.com/ruby/ruby/pull/534
+
+Sun Feb 16 07:48:20 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/bigdecimal/bigdecimal.c (BIGNUM_ZERO_P): Unused macro removed.
+
+Sun Feb 16 06:12:23 2014 Tanaka Akira <akr@fsij.org>
+
+ * internal.h: Rename macro names: RBIGNUM_FOO to BIGNUM_FOO.
+ (BIGNUM_EMBED_LEN_NUMBITS): Renamed from RBIGNUM_EMBED_LEN_NUMBITS.
+ (BIGNUM_EMBED_LEN_MAX): Renamed from RBIGNUM_EMBED_LEN_MAX.
+ (BIGNUM_SIGN_BIT): Renamed from RBIGNUM_SIGN_BIT.
+ (BIGNUM_SIGN): Renamed from RBIGNUM_SIGN.
+ (BIGNUM_SET_SIGN): Renamed from RBIGNUM_SET_SIGN.
+ (BIGNUM_POSITIVE_P): Renamed from RBIGNUM_POSITIVE_P.
+ (BIGNUM_NEGATIVE_P): Renamed from RBIGNUM_NEGATIVE_P.
+ (BIGNUM_EMBED_FLAG): Renamed from RBIGNUM_EMBED_FLAG.
+ (BIGNUM_EMBED_LEN_MASK): Renamed from RBIGNUM_EMBED_LEN_MASK.
+ (BIGNUM_EMBED_LEN_SHIFT): Renamed from RBIGNUM_EMBED_LEN_SHIFT.
+ (BIGNUM_LEN): Renamed from RBIGNUM_LEN.
+ (RBIGNUM_DIGITS): Renamed from RBIGNUM_DIGITS.
+ (BIGNUM_LENINT): Renamed from RBIGNUM_LENINT.
+
+ * bignum.c: Follow the above change.
+
+ * gc.c: Ditto.
+
+ * marshal.c: Ditto.
+
+ * math.c: Ditto.
+
+ * numeric.c: Ditto.
+
+ * random.c: Ditto.
+
+ * rational.c: Ditto.
+
+ * sprintf.c: Ditto.
+
+ * ext/-test-/bignum/bigzero.c: Ditto.
+
+ * ext/-test-/bignum/intpack.c: Ditto.
+
+ * ext/bigdecimal/bigdecimal.c: Ditto.
+
+Sat Feb 15 20:48:49 2014 Tanaka Akira <akr@fsij.org>
+
+ * configure.in (FILE_READEND): Don't detect it because it is not used.
+
+Sat Feb 15 13:22:28 2014 Eric Wong <e@80x24.org>
+
+ * probes_helper.h (RUBY_DTRACE_HOOK): correct type for _id
+
+Sat Feb 15 11:47:47 2014 Tanaka Akira <akr@fsij.org>
+
+ * bignum.c (rb_big_cmp): Avoid bignum allocation for comparison
+ between bignum and fixnum.
+
+Sat Feb 15 10:55:12 2014 Hiroshi Shirosaki <h.shirosaki@gmail.com>
+
+ * ext/-test-/win32/fd_setsize/depend: fix wrong dependencies.
+ [ruby-dev:47253]
+
+Sat Feb 15 00:38:54 2014 Tanaka Akira <akr@fsij.org>
+
+ * enum.c: Enumerable#{min,min_by,max,max_by} extended to take an
+ optional argument.
+ (nmin_cmp): New function.
+ (nmin_block_cmp): Ditto
+ (nmin_filter): Ditto.
+ (nmin_i): Ditto.
+ (nmin_run): Ditto.
+ (enum_min): Call nmin_run if the optional argument is given.
+ (nmin_max): Ditto.
+ (nmin_min_by): Ditto.
+ (nmin_max_by): Ditto.
+
+ * range.c: Range#{min,max} extended to take an optional argument.
+ (range_min): Call range_first if the optional argument is given.
+ (range_max): Call rb_call_super if the optional argument is given.
+
+ [ruby-core:57111] [Feature #8887]
+
+Sat Feb 15 00:27:46 2014 Tanaka Akira <akr@fsij.org>
+
+ * include/ruby/ruby.h,
+ internal.h,
+ ext/-test-/bignum/bigzero.c: Hide a Bignum definition.
+ [ruby-core:42891] [Feature #6083]
+
+Sat Feb 15 00:13:14 2014 Tanaka Akira <akr@fsij.org>
+
+ * include/ruby/intern.h,
+ include/ruby/io.h,
+ include/ruby/ruby.h,
+ include/ruby/win32.h,
+ include/ruby/backward/rubysig.h,
+ bignum.c,
+ gc.c,
+ io.c,
+ process.c,
+ safe.c,
+ struct.c,
+ thread.c,
+ ext/socket/rubysocket.h,
+ ext/-test-/old_thread_select: Remove deprecated definitions
+ [ruby-core:60581] [Feature #9502]
+
+Fri Feb 14 18:38:46 2014 Eric Wong <e@80x24.org>
+
+ * string.c (rb_str_format_m): trade volatile for RB_GC_GUARD
+ RB_GC_GUARD meaning is clear and has better code generation.
+ [ruby-core:60688]
+
+Thu Feb 13 23:30:30 2014 Shugo Maeda <shugo@ruby-lang.org>
+
+ * vm_insnhelper.c (vm_call_method): should check ci->me->flag of
+ a refining method in case the method is private.
+ [ruby-core:60111] [Bug #9452]
+
+ * vm_method.c (make_method_entry_refined): set me->flag of a refined
+ method entry to NOEX_PUBLIC in case the original method is private
+ and it is refined as a public method. The original flag is stored
+ in me->def->body.orig_me, so it's OK to make a refined method
+ entry public. [ruby-core:60111] [Bug #9452]
+
+ * test/ruby/test_refinement.rb: related tests.
+
+Thu Feb 13 18:38:15 2014 Eric Wong <e@80x24.org>
+
+ * re.c (rb_reg_raise): remove volatile
+ Unnecessary since r41597
+
+Thu Feb 13 18:28:51 2014 Eric Wong <e@80x24.org>
+
+ * re.c (rb_reg_regcomp): remove volatile
+ Unnecessary since r13261
+
+Thu Feb 13 16:54:32 2014 Zachary Scott <e@zzak.io>
+
+ * test/ruby/test_array.rb: Ensure flatten! is used for test_flatten
+ Patch by @ksss [Fixes GH-530] https://github.com/ruby/ruby/pull/530
+
+Thu Feb 13 15:43:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (IDSET_ATTRSET_FOR_INTERN): fix off-by-one bug.
+
+ * parse.y (rb_enc_symname_type): junk ID succeeded by '=' is also
+ attrset ID. [ruby-core:60668] [Bug #8756]
+
+Thu Feb 13 11:06:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in: check if pthread_setname_np is available.
+
+ * thread_pthread.c: pthread_setname_np is not available on old
+ Darwins. [ruby-core:60524] [Bug #9492]
+
+Thu Feb 13 00:56:59 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * configure.in: revert r44922. I should have used AC_CHECK_FUNCS()
+ to just define a symbol if the function is available.
+
+Thu Feb 13 00:20:58 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * configure.in: use AC_CHECK_FUNC instead of AC_CHECK_FUNCS
+ if available.
+
+Thu Feb 13 00:15:10 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * configure.in: fix to undefine HAVE_MEMMEM correctly if it is broken.
+
+Tue Feb 11 23:54:40 2014 Tanaka Akira <akr@fsij.org>
+
+ * bignum.c (rb_big_cmp): Specialize a comparison to zero.
+
+ * ext/bigdecimal/bigdecimal.c (is_negative): Use rb_big_cmp instead of
+ RBIGNUM_NEGATIVE_P.
+ (BigMath_s_log): Ditto.
+
+Tue Feb 11 22:59:10 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/openssl/ossl_bn.c (ossl_bn_initialize): Use rb_integer_pack.
+ Fix SEGV by OpenSSL::BN.new(1 << (2**34)).
+
+Tue Feb 11 17:00:38 2014 Zachary Scott <e@zzak.io>
+
+ * ext/tk/README.tcltklib: [DOC] Fix typo by @xta [Fixes GH-532]
+
+Sun Feb 9 13:59:29 2014 Tanaka Akira <akr@fsij.org>
+
+ * configure.in: Fix compilation error.
+ https://bugs.ruby-lang.org/issues/8358#note-16
+
+Sun Feb 9 05:20:24 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * configure.in (rb_cv_gnu_qsort_r): use compile error "conflicting
+ types for 'qsort_r'" instead of AC_RUN_IFELSE.
+
+Sun Feb 9 04:07:34 2014 Zachary Scott <e@zzak.io>
+
+ * lib/yaml.rb: [DOC] Add links to syck and psych on github [Bug #9501]
+ Based on a patch by Giorgos Tsiftsis
+
+Sun Feb 9 02:13:53 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * include/ruby/ruby.h (OBJ_TAINTABLE, OBJ_TAINT, OBJ_INFECT),
+ marshal.c (r_entry0): all Numerics never be tainted now.
+ [ruby-core:57346] [Bug #8945]
+
+Sat Feb 8 23:40:35 2014 Vit Ondruch <vondruch@redhat.com>
+
+ * configure.in: add quoting brackets and append wildcard for the
+ rest after target_cpu, to properly detect platform for SSE2
+ instructions. [ruby-core:60576] [Bug #8358]
+
+Sat Feb 8 21:44:07 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * configure.in: check qsort_r(3) and whether it is GNU version.
+ BSD version has different prototype.
+
+ * util.h: use qsort_r() as ruby_qsort() if it is GNU version.
+
+ * util.c: define ruby_qsort() if needed.
+
+Sat Feb 8 16:34:36 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/resolv.rb (Resolv::DNS::Message::MessageDecoder#get_labels):
+ Make it iterative.
+
+Sat Feb 8 15:54:12 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c, gc.h (rb_objspace_marked_object_p): added.
+ This function *ONLY* works just after marking phase,
+ before any sweeping.
+ This function is highly depending current GC implementation
+ and can be removed future version.
+
+Sat Feb 8 15:41:37 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/resolv.rb: Don't set CLOEXEC flag explicitly. (Ruby set it by
+ default.)
+
+Sat Feb 8 15:27:02 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/resolv.rb (Resolv::DNS::Message::MessageDecoder): Raise
+ DecodeError if no data before the limit.
+ Reported by Will Bryant. [ruby-core:60557] [Bug #9498]
+
+Sat Feb 8 15:11:21 2014 Tanaka Akira <akr@fsij.org>
+
+ * io.c (SMALLBUF): Unused macro removed.
+
+Fri Feb 7 23:37:49 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/resolv.rb: Ignore name servers which cause EAFNOSUPPORT on
+ socket creation.
+ Reported by Bjoern Rennhak. [ruby-core:60442] [Bug #9477]
+
+Fri Feb 7 21:58:48 2014 Zachary Scott <e@zzak.io>
+
+ * lib/open-uri.rb: [DOC] use lower case version of core classes, same
+ as commit r44878, based on patch by Jonathan Jackson [Bug #9483]
+
+Fri Feb 7 21:54:53 2014 Zachary Scott <e@zzak.io>
+
+ * ext/ripper/lib/ripper/lexer.rb: [DOC] use lower case version of core
+ classes when referring to return value, since we aren't directly
+ talking about the class. Patch by Jonathan Jackson [Bug #9483]
+
+Fri Feb 7 05:28:38 2014 Eric Wong <e@80x24.org>
+
+ * constant.h: reduce rb_const_entry_t size on 64-bit
+ Patch by Adam Avilla [ruby-core:60542] [Feature #9496]
+
+Thu Feb 6 15:27:46 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (get_envparam_int): correct warning messages.
+
+ * gc.c (get_envparam_double): ditto.
+
+Thu Feb 6 15:17:30 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (get_envparam_int): don't accept a value equals to lowerbound
+ (changed by last commit) because "" or "foo" (not a number) strings
+ are parsed as 0. They should be rejected.
+
+ * gc.c (get_envparam_double): ditto.
+
+Thu Feb 6 09:00:35 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (ruby_gc_set_params): if RUBY_GC_OLDMALLOC_LIMIT is provided,
+ then set objspace->rgengc.oldmalloc_increase_limit.
+ Without this fix, the env variable RUBY_GC_OLDMALLOC_LIMIT
+ does not work.
+
+ * gc.c (get_envparam_int): accept a value equals to lowerbound.
+
+ * gc.c (get_envparam_double): ditto.
+
+Thu Feb 6 08:23:28 2014 Eric Wong <e@80x24.org>
+
+ * ext/thread/thread.c (rb_szqueue_max_set): use correct queue and
+ limit wakeups. [Bug #9343][ruby-core:60517]
+ * test/thread/test_queue.rb (test_sized_queue_assign_max):
+ test for bug
+
+Thu Feb 6 07:18:01 2014 Eric Hodel <drbrain@segment7.net>
+
+ * lib/rubygems: Update to RubyGems 2.2.2. Complete history at:
+
+ http://rubygems.rubyforge.org/rubygems-update/History_txt.html#label-2.2.2+%2F+2014-02-05
+
+ * test/rubygems: ditto.
+
+Wed Feb 5 20:56:32 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (to_be_skipped_id): ignore anonymous attributes.
+
+ * pack.c (Init_pack): use anonymous ID so that associated objects
+ do not appear in the packed result.
+
+ * parse.y (rb_make_internal_id): return an anonymous ID for
+ internal use.
+
+Wed Feb 5 14:41:56 2014 Koichi Sasada <ko1@atdot.net>
+
+ * vsnprintf.c: remove duplicated def of `UNINITIALIZED_VAR()'.
+
+Wed Feb 5 14:40:16 2014 Koichi Sasada <ko1@atdot.net>
+
+ * ext/objspace/objspace_dump.c (dump_object): use STR_SHARED_P()
+ instead of removed STR_NOCAPA_P() macro.
+
+Wed Feb 5 13:51:33 2014 Koichi Sasada <ko1@atdot.net>
+
+ * internal.h, vm_core.h: move LIKELY/UNLIKELY/UNINITIALIZED_VAR()
+ macros from vm_core.h to internal.h.
+
+ * string.c: remove dependency to "vm_core.h".
+
+ * common.mk: ditto.
+
+Wed Feb 5 13:29:01 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c (rb_str_free): use FL_TEST(str, STR_SHARED) directly
+ because str is not embed.
+
+ * string.c (str_replace): remove `FL_SET(str, STR_SHARED)' line
+ because STR_SET_SHARED() set STR_SHARED.
+
+Wed Feb 5 13:18:08 2014 Koichi Sasada <ko1@atdot.net>
+
+ * internal.h: remove macros STR_NOCAPA and STR_NOCAPA_P().
+
+ * string.c (rb_str_resize): remove `STR_SET_NOEMBED(str)' because
+ str_make_independent_expand() set NOEMBED flag.
+
+ * string.c (rb_str_resize): remove `STR_NOCAPA_P(str)' check because
+ `str' is independent (not shared).
+
+Wed Feb 5 12:54:25 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c: refactoring, especially about string flags.
+
+ * string.c (STR_UNSET_NOCAPA): removed.
+ Use FL_UNSET() with STR_SHARED.
+
+ * string.c (rb_str_capacity): check STR_SHARED directly
+ because it is not a embed string.
+
+ * string.c (rb_str_modify_expand): ditto.
+
+ * string.c (rb_str_shared_replace): use STR_SET_SHARED().
+
+ * string.c (str_make_independent_expand): remove STR_UNSET_NOCAPA()
+ because `str' is not shared string.
+
+Wed Feb 5 12:11:04 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c (RESIZE_CAPA): should not resize shared string.
+
+Wed Feb 5 11:46:42 2014 Koichi Sasada <ko1@atdot.net>
+
+ * gc.c (gc_mark_children): STR_ASSOC is no longer available.
+ Reported by @nagachika.
+ http://d.hatena.ne.jp/nagachika/20140204
+
+Wed Feb 5 11:27:22 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c (rb_str_new_frozen): refactoring code.
+ * Move code from str_new_frozen_with_klass() (and remove it)
+ * `aux.shared' should not be 0 for STR_SHARED strings.
+
+Wed Feb 5 04:23:41 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/psych/lib/psych.rb: New release of psych.
+ * ext/psych/psych.gemspec: ditto
+
+Wed Feb 5 04:16:41 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/psych/yaml/emitter.c: merge libyaml 0.1.5
+ * ext/psych/yaml/loader.c: ditto
+ * ext/psych/yaml/parser.c: ditto
+ * ext/psych/yaml/reader.c: ditto
+ * ext/psych/yaml/scanner.c: ditto
+ * ext/psych/yaml/writer.c: ditto
+ * ext/psych/yaml/yaml_private.h: ditto
+
+Tue Feb 4 19:10:29 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c: use long allocator names instead of numbered
+ allocator names.
+ * rb_str_new2 -> rb_str_new_cstr
+ * rb_str_new4 -> rb_str_new_frozen
+ * rb_str_new5 -> rb_str_new_with_class
+ * str_new3 -> str_new_shared
+ * str_new4 -> str_new_frozen_with_klass
+
+Tue Feb 4 17:20:03 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (glob_helper): return the filename with actual cases on
+ the filesystem if it is case-insensitive. [ruby-core:42469]
+ [Feature #5994]
+
+Tue Feb 4 16:16:58 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c: use STR_SHARED instead of ELTS_SHARED.
+ (same value, but more clear meaning)
+
+Tue Feb 4 16:09:14 2014 Koichi Sasada <ko1@atdot.net>
+
+ * string.c: remove STR_ASSOC related code.
+ By r44804, string objects can not have STR_ASSOC flag.
+
+ * internal.h: ditto.
+
+ * ext/objspace/objspace_dump.c (dump_object): ditto.
+
+Tue Feb 4 14:07:20 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * pack.c (str_associate, str_associated): keep associated objects
+ in an instance variables, instead of in the internal structure.
+
+ * string.c (rb_str_associate, rb_str_associated): deprecate.
+
+Tue Feb 4 12:55:31 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_modify_expand): enable capacity and disable
+ association with packed objects when setting capa, so that
+ pack("p") string fails to unpack properly after modified.
+
+Tue Feb 4 12:45:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (glob_make_pattern): all alphabets are magic characters on
+ case-insensitive filesystems. [ruby-core:42469] [Feature #5994]
+
+Tue Feb 4 09:47:57 2014 Eric Hodel <drbrain@segment7.net>
+
+ * lib/rubygems: Update to RubyGems 2.2.2 prerelease to check fixes to
+ CI.
+ * test/rubygems: ditto.
+
+Mon Feb 3 12:04:47 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * error.c: [DOC] Exception#cause may return nil. [ci skip]
+
+Sun Feb 2 05:48:42 2014 Eric Wong <e@80x24.org>
+
+ * io.c (rb_io_syswrite): add RB_GC_GUARD
+ [Bug #9472][ruby-core:60407]
+
+Sat Feb 1 15:09:16 2014 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (ole_typedesc2val): add VT_RECORD case.
+
+Sat Feb 1 06:38:51 2014 Zachary Scott <e@zzak.io>
+
+ * lib/drb/drb.rb: [DOC] Add note about start_service for each process
+ Based on a patch by @rosenfeld [Fixes GH-514] [ci skip]
+ https://github.com/ruby/ruby/pull/514
+
+Sat Feb 1 06:30:20 2014 Zachary Scott <e@zzak.io>
+
+ * error.c: [DOC] Document Exception#cause by @jasonrclark [ci skip]
+ [Fixes GH-519] https://github.com/ruby/ruby/pull/519
+
+Sat Feb 1 06:10:49 2014 Zachary Scott <e@zzak.io>
+
+ * lib/securerandom.rb: [DOC] Add note on require for examples
+ Based on a patch by @schneems [Fixes GH-518] [ci skip]
+ https://github.com/ruby/ruby/pull/518
+
+Sat Feb 1 06:04:56 2014 Zachary Scott <e@zzak.io>
+
+ * numeric.c: [DOC] Fix typo in example for #step [ci skip]
+ Patch by @ksss [Fixes GH-522] https://github.com/ruby/ruby/pull/522
+
+Fri Jan 31 17:01:47 2014 Eric Wong <e@80x24.org>
+
+ * ext/socket/init.c (rsock_socket0): split out SOCK_CLOEXEC version
+ * ext/socket/socket.c (rsock_socketpair0): ditto
+ [ruby-core:60377]
+
+Fri Jan 31 03:48:40 2014 Eric Wong <e@80x24.org>
+
+ * benchmark/driver: avoid large alloc in driver process
+ [ruby-core:59869] [Bug #9430]
+
+Thu Jan 30 14:45:49 2014 Shugo Maeda <shugo@ruby-lang.org>
+
+ * configure.in: use $@ instead of $(.TARGET) because .TARGET is not
+ supported by GNU make.
+
+Thu Jan 30 08:26:21 2014 Yusuke Endoh <mame@tsg.ne.jp>
+
+ * ext/fiddle/closure.c: use sizeof(*pcl) for correct sizeof value.
+ [ruby-core:57599] [Bug #8978].
+
+Wed Jan 29 20:08:15 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (nogvl_copy_stream_sendfile): check socket on other than
+ linux, as sendfile(2) on non-socket fd works only on linux.
+ [Feature #9427]
+
+Wed Jan 29 18:09:48 2014 Eric Wong <e@80x24.org>
+
+ * io.c (nogvl_copy_stream_sendfile): remove socket check
+ [ruby-core:59856][Feature #9427]
+
+Wed Jan 29 04:29:54 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/openssl/ossl_ssl.c: pass read_nonblock options to underlying IO
+ when SSL session has not been started.
+
+ * test/openssl/test_ssl.rb: test for change.
+
+Wed Jan 29 03:49:36 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/fiddle/closure.c: use sizeof(*pcl) for correct sizeof value.
+ [ruby-core:57599] [Bug #8978]. Thanks mame!
+
+Wed Jan 29 03:36:42 2014 Eric Wong <e@80x24.org>
+
+ * doc/contributing.rdoc: allow/encourage other git hosts
+ [ruby-core:59807][misc #9421]
+
+Tue Jan 28 23:36:01 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket: Avoid redundant fcntl/fstat syscalls for cloexec
+ sockets.
+ Patch by Eric Wong. [ruby-core:59429] [Feature #9330]
+
+Tue Jan 28 20:51:07 2014 Tanaka Akira <akr@fsij.org>
+
+ * process.c (READ_FROM_CHILD): Apply the last hunk of
+ 0001-process.c-avoid-EINTR-from-Process.spawn.patch written by
+ Eric Wong in [Bug #8770].
+
+Tue Jan 28 16:31:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * thread_pthread.c (ruby_init_stack, ruby_stack_overflowed_p):
+ place get_stack above others to get stack boundary information.
+ [ruby-core:60113] [Bug #9454]
+
+Tue Jan 28 15:27:36 2014 NARUSE, Yui <naruse@ruby-lang.org>
+
+ * thread_pthread.c: rlimit is only available on Linux.
+ At least r44712 breaks FreeBSD.
+ [ruby-core:60113] [Bug #9454]
+
+Tue Jan 28 15:17:59 2014 Zachary Scott <e@zzak.io>
+
+ * lib/set.rb: [DOC] Add examples for Set#intersect? and Set#disjoint?
+ Patch by xavier nayrac [Bug #9331] [ci skip]
+
+Tue Jan 28 15:12:22 2014 Zachary Scott <e@zzak.io>
+
+ * ext/zlib/zlib.c (rb_zlib_adler32): [DOC] Add example for adler32
+ Patch by Vajrasky Kok [Bug #9307] [ci skip]
+
+Tue Jan 28 08:56:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
+
+ * compile.c (iseq_build_from_ary_body): Use :blockptr instead of :block
+ as hash key when loading serialized instruction sequences from arrays.
+ [Bug #9455] [ruby-core:60146]
+
+Mon Jan 27 21:52:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * thread_pthread.c: get current main thread stack size, which may
+ be expanded than allocated size at initialization, by rlimit().
+ [ruby-core:60113] [Bug #9454]
+
+Sat Jan 25 22:17:02 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * README.ja.md, README.md: update the controller address of
+ mailing lists.
+
+Sat Jan 25 14:50:42 2014 Eric Wong <normalperson@yhbt.net>
+
+ * process.c (send_child_error): retry write on EINTR to fix
+ occasional Errno::EINTR from Process.spawn.
+
+ * process.c (recv_child_error): retry read on EINTR to fix
+ occasional Errno::EINTR from Process.spawn.
+
+Sat Jan 25 14:21:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * compile.c (iseq_compile_each): result of assignment should be
+ its rhs instead of returned value from a method.
+ [ruby-core:60071] [Bug #9448]
+
+Sat Jan 25 11:16:19 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * class.c (rb_extract_keywords): treat nil keyword_hash same as 0,
+ for the case rb_scan_args returns nil if no keyword hash.
+
+Fri Jan 24 15:13:20 2014 Zachary Scott <e@zzak.io>
+
+ * lib/racc/rdoc/grammar.en.rdoc: [DOC] Correct grammar and typos
+ Patch by Giorgos Tsiftsis [Bug #9429] [ci skip]
+
+Thu Jan 23 20:20:17 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/envutil.rb: try to wait a bit (0.1sec) when ruby process
+ exits by signals because some SEGV tests fail because of not enough
+ error output.
+
+Thu Jan 23 20:06:27 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/test_settracefunc.rb: check the target thread.
+
+Thu Jan 23 19:59:16 2014 Koichi Sasada <ko1@atdot.net>
+
+ * test/ruby/test_settracefunc.rb: check the target thread.
+
+Thu Jan 23 14:26:44 2014 Zachary Scott <e@zzak.io>
+
+ * lib/fileutils.rb: [DOC] Fix typo in options_of() example [Bug #9392]
+ Patch by Giorgos Tsiftsis
+
+Thu Jan 23 13:56:16 2014 Zachary Scott <e@zzak.io>
+
+ * README -> README.md: [DOC] Format README with Markdown [Bug #9255]
+ * README.ja -> README.ja.md: ditto
+
+Wed Jan 22 15:59:39 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/thread/thread.c (Init_thread): ConditionVariable and Queue
+ are not able to copy. [ruby-core:59961] [Bug #9440]
+
+Tue Jan 21 20:14:55 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * thread_pthread.c (rb_thread_create_timer_thread): fix for platforms
+ where PTHREAD_STACK_MIN is a dynamic value and not a compile-time
+ constant. [ruby-dev:47911] [Bug #9436]
+
+Tue Jan 21 17:55:09 2014 Zachary Scott <e@zzak.io>
+
+ * lib/uri/common.rb: [DOC] Use static w3.org uri [ci skip]
+ Patch by @ykzts [Fix GH-484] https://github.com/ruby/ruby/pull/484
+
+Tue Jan 21 16:43:22 2014 Zachary Scott <e@zzak.io>
+
+ * enum.c: [DOC] Add simple example of Enumerable#zip [ci skip]
+ Patch by @nruth on documenting-ruby/ruby#22
+ https://github.com/documenting-ruby/ruby/pull/22
+
+Tue Jan 21 16:26:44 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * thread_pthread.c (rb_thread_create_timer_thread): expand timer
+ thread stack size to get rid of segfault on FreeBSD/powerpc64.
+ based on the patch by Steve Wills at [ruby-core:59923].
+ [ruby-core:56590] [Bug #8783]
+
+Tue Jan 21 04:31:23 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/option.c: Use "int" for IP_MULTICAST_LOOP and
+ IP_MULTICAST_TTL on Mac OS X and Windows.
+
+Tue Jan 21 00:39:15 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/option.c: Use "byte" as default argument for
+ IP_MULTICAST_LOOP and IP_MULTICAST_TTL socket option to follow
+ the original multicast implementation.
+
+Mon Jan 20 20:20:27 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/option.c: Use preprocessor macros to avoid repeated
+ conditionals.
+
+Mon Jan 20 13:55:03 2014 Zachary Scott <e@zzak.io>
+
+ * lib/rubygems/version.rb: [DOC] Use gender-neutral pronouns [ci skip]
+ * lib/rubygems/security.rb: ditto
+
+Sun Jan 19 06:38:48 2014 Benoit Daloze <eregontp@gmail.com>
+
+ * compar.c (cmp_equal): warn for this release and still rescue
+ standard exceptions for a nicer transition. See #7688.
+ Partly reverts r44502.
+
+ * test/ruby/test_comparable.rb: adapt assertion to match new behavior.
+
+Sun Jan 19 06:27:18 2014 Benoit Daloze <eregontp@gmail.com>
+
+ * test/ruby/test_comparable.rb: specify behavior for the different
+ kind of exceptions rescued (or not) by Comparable#==.
+
+Sat Jan 18 23:12:19 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket: Avoid unnecessary ppoll/select on Linux.
+ Patch by Eric Wong. [ruby-core:57950] [Bug #9039]
+
+Sat Jan 18 22:57:44 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/resolv.rb (Resolv::DNS::Resource::TXT#data): Return concatenated
+ string.
+ Patch by Ryan Brunner. [ruby-core:58220] [Bug #9093]
+
+Sat Jan 18 22:35:15 2014 Tanaka Akira <akr@fsij.org>
+
+ * io.c (rb_update_max_fd): Return immediately if the given fd is small
+ enough.
+
+Sat Jan 18 22:25:53 2014 Tanaka Akira <akr@fsij.org>
+
+ * io.c: Test O_CLOEXEC only once.
+ Patch by Eric Wong. [ruby-core:59419] [Feature #9328]
+
+Sat Jan 18 21:24:49 2014 Tanaka Akira <akr@fsij.org>
+
+ * ext/socket/option.c: IP_MULTICAST_LOOP and IP_MULTICAST_TTL socket
+ option takes a byte on OpenBSD.
+ Fixed by Jeremy Evans. [ruby-core:59496] [Bug #9350]
+
+Sat Jan 18 21:19:04 2014 Tanaka Akira <akr@fsij.org>
+
+ * lib/open-uri.rb: Make proxy disabling working again.
+ Fixed by Christophe Philemotte. [ruby-core:59650] [Bug #9385]
+
+Fri Jan 17 20:05:02 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/delegate.rb (Delegator): keep source information methods
+ which start and end with '__'. [ruby-core:59718] [Bug #9403]
+
+Fri Jan 17 17:58:04 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_mod_s_constants): return its own constants for other
+ than Module itself. [ruby-core:59763] [Bug #9413]
+
+Tue Jan 16 00:17:00 2014 Kenta Murata <mrkn@mrkn.jp>
+
+ * ext/bigdecimal/bigdecimal.gemspec: bigdecimal version 1.2.5.
+
+Wed Jan 15 20:30:31 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * io.c (io_binwrite): use writev(2) to avoid double write if available.
+
+ * configure.in: check writev(2)
+
+Wed Jan 15 14:04:33 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (get_encoding): respect BOM on pseudo encodings.
+ [ruby-dev:47895] [Bug #9415]
+
+Wed Jan 15 14:03:47 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (get_actual_encoding): get actual encoding according to
+ the BOM if exists.
+
+ * string.c (rb_str_inspect): use according encoding, instead of
+ pseudo encodings, UTF-{16,32}. [ruby-core:59757] [Bug #8940]
+
+Tue Jan 14 21:07:22 2014 Masaki Matsushita <glass.saga@gmail.com>
+
+ * ext/thread/thread.c (rb_szqueue_clear): notify SZQUEUE_WAITERS
+ on SizedQueue#clear. [ruby-core:59462] [Bug #9342]
+
+ * test/thread/test_queue.rb: add test. the patch is from
+ Justin Collins.
+
+Tue Jan 14 15:58:43 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c (CLASS_NAME): macro to wrap
+ depending on PRIsVALUE for 1.9. [Backport #9406]
+
+ * ext/bigdecimal/bigdecimal.c (DECIMAL_SIZE_OF_BITS): fallback
+ definition for 2.1 or older. [ruby-core:59750] [Backport #9406]
+
+Tue Jan 14 11:28:44 2014 Yuki Yugui Sonoda <yugui@google.com>
+
+ * vm_exec.c (cfp): Fixes a SEGV issue in r44554.
+ r11 can be broken by subroutine and sometimes causes SEGV at
+ runtime. Use r13 instead.
+
+Tue Jan 14 02:20:00 2014 Kenta Murata <mrkn@mrkn.jp>
+
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_divide): Add an additional
+ digit for the quotient to be compatible with bigdecimal 1.2.1 and
+ the former. [ruby-core:59365] [#9316] [#9305]
+
+ * test/bigdecimal/test_bigdecimal.rb: tests for the above change.
+
+ * ext/bigdecimal/bigdecimal.gemspec: bigdecimal version 1.2.4.
+
+Mon Jan 13 14:55:31 2014 Zachary Scott <e@zzak.io>
+
+ * lib/xmlrpc/client.rb: [DOC] Remove note about SSL package on RAA
+ Since RAA has been deprecated, and the SSL package has been replaced
+ with net/https this statement is entirely false and should be
+ deleted. [Bug #9152]
+
+Mon Jan 13 14:47:07 2014 Zachary Scott <e@zzak.io>
+
+ * lib/net/smtp.rb: [DOC] Remove dead link to RAA by Giorgos Tsiftsis
+ Fixes the following bugs: [Bug #9152] [Bug #9268] [Bug #9394]
+ * lib/open-uri.rb: ditto
+
+Mon Jan 13 14:25:55 2014 Zachary Scott <e@zzak.io>
+
+ * ext/openssl/ossl_pkey_dh.c: Fixed typo by Sandor Szuecs [Bug #9243]
+
+Mon Jan 13 12:03:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
+
+ * ext/thread/thread.c (rb_szqueue_push): check GET_SZQUEUE_WAITERS
+ instead of GET_QUEUE_WAITERS to prevent deadlock. Patch by Eric Wong.
+ [Bug #9302] [ruby-core:59324]
+
+ * test/thread/test_queue.rb: add test
+
+Sun Jan 12 16:41:10 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * iseq.c (iseq_load): keep type_map to get rid of memory leak.
+ based on a patch by Eric Wong at [ruby-core:59699]. [Bug #9399]
+
+Sun Jan 12 09:21:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * include/ruby/util.h (DECIMAL_SIZE_OF_BITS): a preprocessor
+ constant macro to approximate decimal representation size of n-bits
+ integer.
+
+ * iseq.c (register_label): use DECIMAL_SIZE_OF_BITS for better
+ approximation.
+
+ * ext/bigdecimal/bigdecimal.c (BigMath_s_log): ditto.
+
+ * common.mk (iseq.o), ext/bigdecimal/depend (bigdecimal.o): add
+ dependency to ruby/util.h for DECIMAL_SIZE_OF_BITS.
+
+Fri Jan 10 16:27:20 2014 Yuki Yugui Sonoda <yugui@google.com>
+
+ * vm_exec.c (cfp): Avoid generating invalid binary for
+ NativeClient.
+ r15 on x86_64 is reserved by NativeClient. So r15 to cfp used to
+ generate invalid binary under some combinations of compiler
+ optimization flags.
+
+Fri Jan 10 18:01:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm_insnhelper.c (vm_search_super_method): allow bound method from a
+ module, yet another method transplanting.
+
+Fri Jan 10 13:34:04 2014 Aman Gupta <ruby@tmm1.net>
+
+ * insns.def (opt_aref_with): new instruction to optimize Hash#[],
+ removing any allocation overhead when used with a string literal
+ key. Patch by normalperson (Eric Wong). [ruby-core:59640] [Bug #9382]
+ * insns.def (opt_aset_with): new instruction to optimize Hash#[]=
+ * compile.c (iseq_compile_each): compiler shortcuts for new
+ instructions
+ * hash.c (static VALUE rb_hash_compare_by_id_p): fix documentation for
+ Hash#compare_by_identity to reflect frozen string sharing
+ * test/ruby/test_hash.rb (class TestHash): test for new behavior
+
+Fri Jan 10 06:23:21 2014 Benoit Daloze <eregontp@gmail.com>
+
+ * range.c (Range#size): [DOC] improve description and add examples.
+ Patch by @skade. [Fixes GH-501]
+
+Fri Jan 10 00:47:52 2014 Josef Stribny <strzibny@gmail.com>
+
+ * ext/tk/extconf.rb: fix to pass arrays instead of strings to
+ libpathflag. patch at [ruby-core:59665]. [Bug #9386]
+
+Thu Jan 9 20:49:22 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in: -mstackrealign is necessary for -msse2 working.
+ [ruby-core:54716] [Bug #8349]
+
+ * configure.in: use SSE2 instructions to drop unexpected precisions on
+ other than mingw. [ruby-core:59472] [Bug #8358]
+
+Thu Jan 9 20:31:10 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * hash.c (rb_objid_hash): should return `long'. brushup r44534.
+
+ * object.c (rb_obj_hash): follow above change.
+
+Thu Jan 9 19:12:37 2014 Koichi Sasada <ko1@atdot.net>
+
+ * vm.c (rb_vm_pop_cfunc_frame): added. It cares c_return event.
+ The patch base by drkaes (Stefan Kaes).
+ [Bug #9321]
+
+ * variable.c (rb_mod_const_missing): use rb_vm_pop_cfunc_frame()
+ instead of rb_frame_pop().
+
+ * vm_eval.c (raise_method_missing): ditto.
+
+ * vm_eval.c (rb_iterate): ditto.
+
+ * internal.h (rb_vm_pop_cfunc_frame): add decl.
+
+ * test/ruby/test_settracefunc.rb: add tests.
+ provided by drkaes (Stefan Kaes).
+
+ * vm.c, eval.c, include/ruby/intern.h (rb_frame_pop):
+ move definition of rb_frame_pop() and deprecate it.
+ It doesn't care about `return' events.
+
+Thu Jan 9 17:40:28 2014 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * hash.c (rb_any_hash): should treat the return value of rb_objid_hash()
+ as `long', because ruby assumes the hash value of the object id of
+ an object is `long'.
+ this fixes test failures on mswin64 introduced at r44525.
+
+Thu Jan 9 09:55:20 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/psych/lib/psych/visitors/yaml_tree.rb: dumping strings with
+ quotes should not have changed. [ruby-core:59316] [Bug #9300]
+
+ * ext/psych/lib/psych.rb: fixed missing require.
+
+ * test/psych/test_string.rb: test
+
+Thu Jan 9 09:51:00 2014 Aaron Patterson <aaron@tenderlovemaking.com>
+
+ * ext/psych/lib/psych/visitors/to_ruby.rb: anonymous structs
+ should be able to roundtrip. Thanks @splattael!
+
+ * test/psych/test_object_references.rb: test for change
+
+Wed Jan 8 22:53:16 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * vm_insnhelper.c (vm_search_super_method): when super called in a
+ bound UnboundMethod generated from a module, no superclass is
+ found since the current defined class is the module, then call
+ method_missing in that case. [ruby-core:59619] [Bug #9377]
+
+Wed Jan 8 15:55:21 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * hash.c (rb_objid_hash): return hash value from object ID with a
+ salt, extract from rb_any_hash().
+
+ * object.c (rb_obj_hash): return same value as rb_any_hash().
+ fix r44125. [ruby-core:59638] [Bug #9381]
+
+Wed Jan 8 13:12:41 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/timeout.rb (Timeout::ExitException.catch): pass arguments
+ for new instance.
+
+ * lib/timeout.rb (Timeout::ExitException#exception): fallback to
+ Timeout::Error if couldn't throw. [ruby-dev:47872] [Bug #9380]
+
+ * lib/timeout.rb (Timeout#timeout): initialize ExitException with
+ message for the fallback case.
+
+Tue Jan 7 12:43:06 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/timeout.rb (Timeout#timeout): should not rescue ordinarily
+ raised ExitException, which should not be thrown.
+
+ * lib/timeout.rb (Timeout::ExitException.catch): set @thread only if
+ it ought to be caught.
+
+ * lib/timeout.rb (Timeout#timeout): when a custom exception is given,
+ no instance is needed to be caught, so defer creating new instance
+ until it is raised. [ruby-core:59511] [Bug #9354]
+
+Tue Jan 7 10:16:02 2014 Eric Hodel <drbrain@segment7.net>
+
+ * lib/rubygems: Update to RubyGems master 21e409d / RubyGems 2.2.1.
+
+ See http://rubygems.rubyforge.org/rubygems-update/History_txt.html
+ for a list of bug fixes.
- * eval.c (compile_error): error message slightly changed.
+ * test/rubygems: ditto.
- * parse.y (nextc): script parsing will be terminated by __END__ at
- beginning of line.
+Tue Jan 7 10:10:46 2014 Eric Wong <e@80x24.org>
- * eval.c (compile_error): `__END__' is no longer a keyword.
+ * ext/json/generator/depend: add build dependencies for json extension
+ [Bug #9374] [ruby-core:59609]
+ * ext/json/parser/depend: ditto
- * parse.y (nextc): protect lastline read from script stream.
+Tue Jan 7 04:35:46 2014 Aman Gupta <ruby@tmm1.net>
-Tue Oct 7 14:06:06 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * array.c (ary_add_hash): Fix consistency issue between Array#uniq and
+ Array#uniq! [Bug #9340] [ruby-core:59457]
+ * test/ruby/test_array.rb (class TestArray): regression test for above.
- * version 1.1 alpha9 released.
+Mon Jan 6 21:28:48 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * eval.c (mod_append_features): renamed from extend_class.
+ * .gitignore: ignore *-fake.rb generated even when CROSS_COMPILING = no
+ since r42862.
- * eval.c (rb_eval): defining method calls `method_added'.
+Sun Jan 5 20:14:14 2014 Benoit Daloze <eregontp@gmail.com>
- * eval.c (ruby_options): exception while processing options must
- terminate the interpreter.
+ * compar.c (cmp_equal): remove error hiding in Comparable#==.
+ Comparable#== no longer rescues exceptions silently.
+ This was the cause of quite a couple bugs. See #7688. [EXPERIMENTAL]
- * error.c (Init_Exception): wrong method configuration. `new'
- should have been a singleton method.
+ * test/ruby/test_comparable.rb: adapt assertion to match new behavior.
-Mon Oct 6 18:55:38 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * lib/rdoc/method_attr.rb: fix bugs discovered by this change.
- * ext/kconv/kconv.c (kconv_guess): code to guess character code
- from string.
+ * test/rdoc/test_rdoc_normal_class.rb: fix bugs in tests.
-Mon Oct 6 18:38:17 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+Sat Jan 4 22:44:00 2014 Charlie Somerville <charliesome@ruby-lang.org>
- * pack.c: now encode/decode base64 by `m' template.
+ * struct.c (rb_struct_set): return assigned value from setter method
+ rather than struct object. [Bug #9353] [ruby-core:59509]
-Fri Oct 3 10:51:10 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_struct.rb (test_setter_method_returns_value): add test
- * MANIFEST: needed to include lex.c in the distribution.
+Sat Jan 4 21:44:31 2014 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
- * eval.c (ruby_options): f_require() called too early.
+ * test/ruby/test_gc.rb (TestGc#test_latest_gc_info): use
+ GC.stat(:key) instead of GC.stat.
- * eval.c (rb_provide): module extentions should always be `.o'.
+Sat Jan 4 19:15:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Oct 2 11:38:31 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/socket/socket.c (rsock_syserr_fail_host_port): use format flags,
+ '+' to inspect, ' ' to quote unprintables.
- * version 1.1 alpha8 released.
+ * ext/socket/socket.c (rsock_syserr_fail_path): ditto.
- * ext/marshal/marshal.c (r_object): remove temporal regist for
- structs. (caused problem if structs form cycles.)
+ * ext/socket/socket.c (rsock_syserr_fail_raddrinfo): ditto.
- * parse.y (match_gen): static binding for match(=~) calls
- with regexp literals.
+ * ext/socket/socket.c (rsock_syserr_fail_host_port): add errno
+ argument version and use rb_syserr_fail_str() instead of
+ rb_sys_fail_str() with restoring errno.
-Wed Oct 1 15:26:55 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/socket/socket.c (rsock_syserr_fail_path): ditto, and
+ rb_syserr_fail().
- * eval.c: protect retval in struct tag from GC for C_ALLOCA.
+ * ext/socket/socket.c (rsock_sys_fail_sockaddr): ditto, use
+ rsock_syserr_fail_raddrinfo().
- * eval.c: no more pointer value from setjmp/longjmp.
+ * ext/socket/socket.c (rsock_sys_fail_raddrinfo): ditto.
-Wed Oct 1 14:01:49 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * ext/socket/socket.c (setup_domain_and_type): ditto.
- * ext/marshal/marshal.c (w_byte): argument must be char.
+Sat Jan 4 17:18:58 2014 Kazuki Tsujimoto <kazuki@callcc.net>
-Wed Oct 1 10:30:22 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm.c (RubyVM::OPTS): get rid of a garbage character.
- * variable.c (mod_const_at): global constants now belongs to the
- class Object.
+Sat Jan 4 10:17:54 2014 Eric Hodel <drbrain@segment7.net>
- * object.c (Init_Object): new global constant NIL.
+ * lib/rinda/ring.rb (Rinda::RingFinger#make_socket): Use
+ ipv4_multicast_ttl option for portability.
- * ext/marshal/marshal.c (marshal_dump): try to set binmode.
+Sat Jan 4 10:15:47 2014 Eric Hodel <drbrain@segment7.net>
- * ext/marshal/marshal.c (r_object): forgot to re-regist structs in
- the object table.
+ * lib/rinda/ring.rb (Rinda::RingFinger#make_socket): Use
+ ipv4_multicast_loop option for portability. Patch by Jeremy Evans.
+ [ruby-trunk - Bug #9351]
- * eval.c (ruby_options): call Init_ext() before any require()
- calls by `-r'.
+Fri Jan 3 19:09:00 2014 Eric Wong <normalperson@yhbt.net>
-Fri Sep 30 14:29:22 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * ext/socket/socket.c (rsock_sys_fail_host_port): save and restore errno
+ before calling rb_sys_fail_str to prevent [BUG] errno == 0.
+ Patch by Eric Wong. [ruby-core:59498] [Bug #9352]
- * ext/marshal/marshal.c (w_object): marshal dumped core.
+ * ext/socket/socket.c (rsock_sys_fail_path): ditto
+ * ext/socket/socket.c (rsock_sys_fail_sockaddr): ditto
+ * ext/socket/socket.c (rsock_sys_fail_raddrinfo): ditto
+ * ext/socket/socket.c (rsock_sys_fail_raddrinfo_or_sockaddr): ditto
-Tue Sep 30 10:27:39 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Jan 3 10:43:57 2014 Aman Gupta <ruby@tmm1.net>
- * sample/test.rb: bignum test suits added.
+ * test/net/imap/cacert.pem: generate new CA cert, since the last one
+ expired. [Bug #9341] [ruby-core:59459]
+ * test/net/imap/server.crt: new server cert signed with updated CA.
+ * test/net/imap/Makefile: add `make regen_certs` to automate this
+ process.
- * eval.c (rb_eval): new pseudo variable `true' and `false'.
+Fri Jan 3 00:09:54 2014 Benoit Daloze <eregontp@gmail.com>
- * parse.y: new keywords `true' and `false' added.
+ * ext/bigdecimal: update class method call style from :: to .
+ in documentation and usage.
-Mon Sep 29 13:37:58 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * ext/bigdecimal/lib/bigdecimal/math.rb: [DOC] fix examples values.
+ Computations were made using ruby 2.0.0p247 to ensure
+ no effect of the recent BigDecimal bug.
- * ruby.c (forbid_setid): forbid some options in suid mode.
+ * ext/bigdecimal/sample/nlsolve.rb: fix indent.
- * ruby.h (NUM2DBL): new macro to convert into doubles.
+Thu Jan 2 16:07:21 2014 Masaki Matsushita <glass.saga@gmail.com>
-Mon Sep 27 09:53:48 1997 EGUCHI Osamu <eguchi@shizuokanet.or.jp>
+ * io.c (io_fwrite): freeze converted str.
- * bignum.c: modified for speeding.
+Thu Jan 2 04:15:13 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Sep 26 18:27:59 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * eval.c (rb_longjmp): remove an extra modifier from the forward
+ declaration to match the actual definition. [ruby-core:59451]
+ [Bug #9338]
- * sample/from.rb: some extensions.
+Thu Jan 2 01:23:30 2014 Masaki Matsushita <glass.saga@gmail.com>
-Mon Sep 29 13:15:56 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm_eval.c (method_missing): use ALLOCV_N() instead of
+ ALLOCA_N() and rb_ary_tmp_new().
- * parse.y (lhs): no more syntax error on `obj.CONSTANT = value'.
+Thu Jan 2 00:53:16 2014 Masaki Matsushita <glass.saga@gmail.com>
-Fri Sep 26 14:41:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * array.c (rb_ary_zip): use ALLOCV_N() instead of ALLOCA_N().
- * eval.c (ruby_run): deferred calling Init_ext() just before eval_node.
+Thu Jan 2 00:04:29 2014 Masaki Matsushita <glass.saga@gmail.com>
-Fri Sep 26 13:27:24 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * hash.c (rb_hash_keys): make rb_hash_keys() static.
+ it is no longer used from array.c since r43969.
+ the patch is from normalperson (Eric Wong).
+ [ruby-core:59449] [Feature #9336]
- * io.c (io_isatty): forgot to return TRUE value.
+ * internal.h: remove definition of rb_hash_keys().
-Fri Sep 25 11:10:58 1997 EGUCHI Osamu <eguchi@shizuokanet.or.jp>
+Wed Jan 1 18:19:35 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c: use _setjmp/_longjmp instead of setjmp/longjmp on some
- platforms.
+ * configure.in: reset LDFLAGS and DLDFLAGS for opt-dir again after
+ LIBPATHFLAG and RPATHFLAG are set. [ruby-dev:47868] [Bug #9317]
-Wed Sep 24 17:43:13 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Jan 1 11:12:29 2014 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * string.c (Init_String): String#taint and String#taint? added.
+ * configure.in: use SSE2 instructions for drop unexpected
+ precisions. [ruby-core:54738] [Bug #8358]
- * class.c (mod_ancestors): ancestors include the class itself.
+Tue Dec 31 23:49:07 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Sep 24 00:57:00 1997 Katsuyuki Okabe <HGC02147@niftyserve.or.jp>
+ * eval.c (rb_f_raise): add cause: optional keyword argument.
+ [ruby-core:58610] [Feature #8257] [EXPERIMENTAL]
- * X68000 patch.
+Tue Dec 31 21:44:17 2013 Akio Tajima <artonx@yahoo.co.jp>
-Tue Sep 23 20:42:30 1997 EGUCHI Osamu <eguchi@shizuokanet.or.jp>
+ * win32/Makefile.sub: remove HAVE_FSEEKO because fseeko removed from win32/win32.c
+ Fixed [Bug #9333].
- * parse.y (node_newnode): SEGV on null node setup.
+Tue Dec 31 21:02:27 2013 Masaki Matsushita <glass.saga@gmail.com>
-Mon Sep 22 11:22:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * io.c (io_fwrite): allocate frozen str only when str is not converted.
- * ruby.c (ruby_prog_init): wrong safe condition check.
+Tue Dec 31 15:44:48 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sun Sep 21 14:46:02 1997 MAEDA shugo <shugo@po.aianet.ne.jp>
+ * lib/mkmf.rb (RbConfig): expand RUBY_SO_NAME for extensions
+ backward compatibility. [ruby-core:59426] [Bug #9329]
- * error.c (exc_inspect): garbage added to classpath.
+Mon Dec 30 23:33:07 2013 Ayumu AIZAWA <ayumu.aizawa@gmail.com>
-Fri Sep 19 11:49:23 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * variable.c: [DOC] adding extra example in docs.
+ patched by Steve Klabnik. [Bug #9210]
- * parse.y (newtok): forgot to adjust buffer size when shrinking
- the token buffer.
+Mon Dec 30 18:34:18 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * enum.c (enum_find): rb_eval_cmd() does not return value.
+ * encoding.c (must_encindex, rb_enc_from_index, rb_obj_encoding): mask
+ encoding index and ignore dummy flags. [ruby-core:59354] [Bug #9314]
- * io.c (pipe_open): close fds on pipe exec. fcntl(fd, F_SETFD, 1)
- no longer used.
+Mon Dec 30 16:11:52 2013 WATANABE Hirofumi <eban@ruby-lang.org>
-Tue Sep 16 17:54:25 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * tool/make-snapshot: needs CXXFLAGS. [ruby-core:59393][Bug #9320]
- * file.c (f_test): problem if wrong command specified.
+Sun Dec 29 18:36:54 2013 Shota Fukumori <her@sorah.jp>
- * ruby.c (ruby_prog_init): close stdaux and stdprn for MSDOS.
+ * lib/mkmf.rb (configuration): Make CXXFLAGS customizable.
+ Patch by Kohei Suzuki (eagletmt). [Fixes GH-492]
- * ruby.c (ruby_prog_init): should not add path from environment
- variable, if ruby is running under seuid.
+Sun Dec 29 12:11:11 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * process.c (init_ids): check suid check for setuid/seteuid etc.
+ * proc.c (mnew_from_me): keep iclass as-is, to make inheritance
+ chain consistent. [ruby-core:59358] [Bug #9315]
-Mon Sep 15 00:42:04 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * proc.c (method_owner): return the original defined_class from
+ prepended iclass, instead.
- * regex.c (re_compile_pattern): \w{3} and \W{3} did not work.
+Sun Dec 29 08:47:24 2013 Lucas Allan Amorim <lucas.allan@gmail.com>
-Thu Sep 11 10:31:48 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/ruby/test_sprintf.rb (test_hash): Added tests for sprintf
+ with a hash as parameter. [Fixes GH-491]
- * version 1.1 alpha7 released.
+Sun Dec 29 07:27:51 2013 Benoit Daloze <eregontp@gmail.com>
- * ext/socket/socket.c (sock_new): no setbuf() for NT.
+ * compar.c (cmp_eq_recursive): Fix the return value, the value for
+ failed #<=> should be nil. It was raising a NoMethodError for
+ the test case TestComparable#test_no_cmp (undefined method `>'
+ for false:FalseClass). Yet one more reason for #7688.
- * io.c (rb_fopen,rb_fdopen): set close-on-exec for every fd.
+Sat Dec 28 22:21:59 2013 Benoit Daloze <eregontp@gmail.com>
-Wed Sep 10 15:55:31 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * object.c (Kernel#<=>) surround Comparable operators with <code> tags.
+ The #== method was hidden in ri/rdoc's output and was highlighting
+ the line instead.
- * ext/marshal/marshal.c (r_bytes0): extra big length check.
+Sat Dec 28 17:24:00 2013 DV Suresh <e@dvsuresh.me>
-Tue Sep 9 16:27:14 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * benchmark/bm_so_meteor_contest.rb: [DOC] Fix a few typos
+ * ext/fiddle/lib/fiddle/import.rb: ditto
+ * ext/psych/lib/psych.rb: ditto
+ * ext/psych/lib/psych/nodes/sequence.rb: ditto
+ * ext/tk/lib/multi-tk.rb: ditto
+ * ext/tk/lib/tcltk.rb: ditto
- * io.c (pipe_fptr_atexit): clean up popen()'ed fptr.
+Sat Dec 28 00:42:37 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * error.c (set_syserr): some system has error code that is bigger
- than sys_nerr. grrr.
+ * parse.y (local_push_gen, local_pop_gen): save cmdarg_stack to
+ isolate command argument state from outer scope.
+ [ruby-core:59342] [Bug #9308]
-Mon Sep 8 18:33:33 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Fri Dec 27 13:25:03 2013 NAKAMURA Usaku <usa@ruby-lang.org>
- * io.c (io_s_new): dereferenced nil for optional mode.
+ * win32/{setup.mak,Makefile.sub}: update fake.rb like
+ template/fake.rb.in.
-Fri Sep 5 10:26:03 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Dec 26 16:10:41 2013 NAKAMURA Usaku <usa@ruby-lang.org>
- * class.c (class_instance_methods): do not include methods which
- are changed to private in subclasses.
+ * win32/Makefile.sub (fake.rb): should depend on version.h because
+ if RUBY_VERSION is updated, fake.rb need to say the new version
+ to avoid install error in rbconfig.rb.
-Thu Sep 4 12:38:53 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Dec 26 14:25:03 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * variable.c (f_global_variables): list name of the global
- variables.
+ * hash.c (HASH_REJECT_COPY_EXTRA_STATES): turn off the old
+ behavior, copying extra states by accident.
- * object.c (obj_id): returns unique integer.
+Thu Dec 26 10:49:14 2013 Yukihiro Matsumoto <matz@ruby-lang.org>
-Wed Sep 3 14:05:16 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * version.h (RUBY_VERSION): 2.2.0 development has started.
- * version 1.1 alpha6 released.
+Thu Dec 26 10:27:53 2013 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (mod_s_constants): context sensitive constant list.
+ * tool/merger.rb (tag): support 2.1.1 semi-automatic tagging and 2.2.0
+ explicit tagging.
- * variable.c (mod_constants): no more `all' option.
+Thu Dec 26 06:35:25 2013 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * variable.c (mod_const_of): the values for autoload classes are
- their name strings.
+ * proc.c: Having any mandatory keyword argument increases min arity
+ [#9299]
- * class.c (class_instance_methods): no special treatment for
- singleton classes.
+Thu Dec 26 06:27:08 2013 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * object.c (obj_singleton_methods): returns list of singleton
- method names.
+ * proc.c: Having optional keyword arguments makes maximum arity +1,
+ not unlimited [#8072]
- * parse.y (yylex): no here document after `class' keyword.
+Thu Dec 26 01:09:57 2013 NAKAMURA Usaku <usa@ruby-lang.org>
- * eval.c (f_load): expand path if fname begins with `~'.
+ * tool/release.sh: make symbolic links.
-Tue Sep 2 13:19:48 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Thu Dec 26 00:45:33 2013 NAKAMURA Usaku <usa@ruby-lang.org>
- * class.c (ins_methods_i): do not list undef'ed methods.
+ * tool/make-snapshot: support new version scheme.
-Mon Sep 1 13:42:48 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Wed Dec 25 22:44:14 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * version 1.1 alpha5 released.
+ * compile.c (iseq_set_arguments): set arg_keyword_check from
+ nd_cflag, which is set by parser. internal ID is used for
+ unnamed keyword rest argument, which should be separated from no
+ keyword check.
- * object.c (mod_attr_reader): create methods to define attribute
- reader/write/accessor.
+ * iseq.c (rb_iseq_parameters): if no keyword check, keyword rest is
+ present.
- * class.c (rb_define_attr): always defines accessors.
+ * parse.y (new_args_tail_gen): set keywords check to nd_cflag, which
+ equals to that keyword rest is not present.
- * eval.c (rb_call): alias occured in the module body caused SEGV.
+Wed Dec 25 22:32:19 2013 Zachary Scott <e@zzak.io>
- * parse.y: did not generate here document strings properly.
+ * lib/abbrev.rb: [DOC] rdoc format patch by Giorgos Tsiftsis [Bug #9146]
-Mon Sep 1 11:43:57 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
-
- * parse.y (yylex): heredoc dropped an extra character.
+Wed Dec 25 20:30:10 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Fri Aug 29 11:10:21 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * iseq.c (rb_iseq_parameters): push argument type symbol only for
+ unnamed rest keywords argument.
- * class.c (class_instance_methods): same method names should not
- appear more than twice.
+Wed Dec 25 20:28:48 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * parse.y (yylex): spaces can follow =begin/=end.
+ * proc.c (rb_iseq_min_max_arity): maximum argument is unlimited if
+ having rest keywords argument. [ruby-core:53298] [Bug #8072]
- * variable.c (find_class_path): look for class_tbl also for
- unnamed fundamental classes, such as Object, String, etc.
+Wed Dec 25 18:29:22 2013 Koichi Sasada <ko1@atdot.net>
- * variable.c (rb_name_class): can't name class before String class
- is initilialized.
+ * vm_insnhelper.c (argument_error): insert dummy frame to make
+ a backtrace object intead of modify backtrace string array.
+ [Bug #9295]
- * inits.c (rb_call_inits): unrecognized dependency from GC to
- Array.
+ * test/ruby/test_backtrace.rb: add a test for this patch.
+ fix test to compare a result of Exception#backtrace with
+ a result of Exception#backtrace_locations.
- * variable.c (find_class_path): could not find class if Object's
- iv_tbl is NULL.
+Wed Dec 25 13:00:54 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Thu Aug 28 13:12:05 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * configure.in: let mingw do something black-magic, and check if
+ _gmtime64_s() is available actually.
- * version 1.1 alpha4 released.
+ * win32/win32.c (gmtime_s, localtime_s): use _gmtime64_s() and
+ _localtime64_s() if available, not depending on very confusing
+ mingw variants macros. based on the patch by phasis68 (Heesob
+ Park) at [ruby-core:58764]. [ruby-core:58391] [Bug #9119]
- * variable.c (mod_constants): wrong condition for singleton
- class.
+Wed Dec 25 12:33:41 2013 Yusuke Endoh <mame@tsg.ne.jp>
- * parse.y (yylex): revised `=begin' skip code.
+ * sample/trick2013/: added the award-winning entries of TRICK 2013.
+ See https://github.com/tric/trick2013 for the contest outline.
+ (Matz has approved the attachment.)
- * parse.y (here_document): forgot to free(eos).
+Wed Dec 25 10:42:02 2013 Yamashita Yuu <yamashita@geishatokyo.com>
- * parse.y (yylex): spaces after `<<' prohibited for here
- documents to avoid confusing with operator `<<'.
+ * ext/openssl/ossl_ssl.c (Init_ossl_ssl): Declare a constant
+ `OP_MSIE_SSLV2_RSA_PADDING` only if the macro is defined. The
+ `SSL_OP_MSIE_SSLV2_RSA_PADDING` has been removed from latest
+ snapshot of OpenSSL 1.0.1. [Fixes GH-488]
- * eval.c (is_defined): separated from rb_eval().
+Wed Dec 25 01:03:00 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Wed Aug 27 11:32:42 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * proc.c (bind_local_variables): allowing binding to list its
+ local variables. patch by Jack Danger Canty <jackdanger AT
+ squareup.com> at [ruby-core:56543]. [Feature #8773]
- * version 1.1 alpha3 released.
+Tue Dec 24 23:20:38 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * variable.c (mod_name): returns name of the class/module.
+ * test/fileutils/fileasserts.rb (assert_ownership_user): new
+ assertion for user ownership.
- * parse.y (here_document): finally here document available now.
+ * test/fileutils/test_fileutils.rb (test_chown_error),
+ (test_chown_without_permission, test_chown_with_root):
+ based on the patch by vajrasky (Vajrasky Kok) at
+ [ruby-core:59298]. [Feature #9292]
- * variable.c (fc_i): some classes/modules does not have iv_tbl.
+Tue Dec 24 16:28:05 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * variable.c (find_class_path): avoid inifinite loop.
+ * proc.c (rb_mod_define_method): consider visibility only if self
+ in the caller is same as the receiver, otherwise make public as
+ well as old behavior. [ruby-core:57747] [Bug #9005]
+ [ruby-core:58497] [Bug #9141]
-Tue Aug 26 13:43:47 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * vm.c (rb_vm_cref_in_context): return ruby level cref if self is
+ same.
- * eval.c (rb_eval): undef'ing non-existing method will raise
- NameError exception.
+Tue Dec 24 14:13:14 2013 Koichi Sasada <ko1@atdot.net>
- * object.c (class_s_new): needed to create metaclass too.
+ * README.EXT: add a refer to URL.
- * eval.c (error_print): no class name print for anonymous class.
+Tue Dec 24 13:48:45 2013 Koichi Sasada <ko1@atdot.net>
- * eval.c (rb_longjmp): proper exception raised if raise() called
- without arguments, with $! or $@ set.
+ * README.EXT: add a document about RGenGC.
+ Reviewed by havenwood.
+ [misc #8962]
- * object.c (Init_Object): superclass()'s method argument setting
- was wrong again.
+ * README.EXT.ja: ditto.
- * class.c (mod_anscestors): list superclasses and included modules
- in priority order.
+Tue Dec 24 12:11:43 2013 Koichi Sasada <ko1@atdot.net>
-Mon Aug 25 11:53:11 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * include/ruby/ruby.h (RARRAY_ASET): try to avoid compiler warning.
+ [Bug #9287]
- * version 1.1 alpha2 released.
+Tue Dec 24 05:04:56 2013 NAKAMURA Usaku <usa@ruby-lang.org>
- * sample/ruby-mode.el (ruby-parse-region): auto-indent now
- supports "\\" in the strings.
+ * test/fileutils/test_fileutils.rb (setup): should not call
+ Process.groups for Windows. get rid of many errors introduced by
+ r44364.
- * struct.c (struct_getmember): new API to get member value from C
- language side.
+Mon Dec 23 18:37:16 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
-Sat Aug 23 21:39:05 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * test/fileutils/fileasserts.rb (assert_ownership_group): new
+ assertion for group ownership.
- * parse.y (asignable): remove unnecessary local variable
- initialize by nil.
+ * test/fileutils/test_fileutils.rb (test_chown{,_verbose,_noop}):
+ based on the patch by vajrasky (Vajrasky Kok) at
+ [ruby-core:59281]. [Feature #9286]
-Fri Aug 22 14:26:40 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Dec 23 15:53:45 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (error_print): modified exception print format.
+ * hash.c (HAS_EXTRA_STATES): warn extra states only when something
+ differ. [ruby-core:59254] [Bug #9275]
-Thu Aug 21 16:10:58 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Mon Dec 23 12:42:13 2013 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
- * sample/ruby-mode.el (ruby-calculate-indent): wrong indent level
- calculated with keyword operators.
+ * array.c: Have to_h raise on elements that are not key-value pairs
+ [#9239]
-Thu Aug 21 11:36:58 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * enum.c: ditto
- * parse.y (arg): ary[0] += 1 cause SEGV
+Mon Dec 23 05:01:55 2013 Zachary Scott <e@zzak.io>
-Wed Aug 20 17:28:50 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * doc/syntax/methods.rdoc: [DOC] Added example for underscore
+ conventions in method names. Also added doc to clarify encoding
+ character set support for Ruby programs and elaborated on defining
+ predicate and bang methods. Based on a patch by @gaurish
+ [Fixes GH-477] https://github.com/ruby/ruby/pull/477
- * ruby.c (ruby_process_options): require() all modules after
- processing all options
+Mon Dec 23 03:18:09 2013 Zachary Scott <e@zzak.io>
- * process.c (rb_proc_exec): more security checks added.
+ * doc/ChangeLog-1.9.3: [DOC] Fix typos by @dvsuresh
+ [Fixes GH-485] https://github.com/ruby/ruby/pull/485
+ * ext/openssl/ossl_config.c: ditto
+ * lib/rss/utils.rb, lib/time.rb: ditto
+ * test/ruby/envutil.rb: ditto
- * process.c (rb_proc_exec): insecure path on exec.
+Sun Dec 22 23:56:56 2013 Zachary Scott <e@zzak.io>
- * hash.c (f_getenv): PATH modification security check.
+ * lib/{rake,rdoc,rss}/*, test/rexml/test_listener.rb: [DOC] Fix typos
+ by @dvsuresh [Fixes GH-486] https://github.com/ruby/ruby/pull/486
-Tue Aug 19 00:15:38 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Dec 22 11:08:47 2013 Eric Hodel <drbrain@segment7.net>
- * version 1.1 alpha1 released.
+ * test/rubygems/test_gem_ext_builder.rb: Fix warning due to ambiguous
+ expression.
- * eval.c (mod_eval): work as normal eval() if second binding
- argument given.
+Sun Dec 22 11:05:53 2013 Eric Hodel <drbrain@segment7.net>
- * eval.c (rb_call): did not raise ArgumentError if too many
- arguments more than optional arguments (without rest arg).
+ * lib/rubygems/commands/install_command.rb: Restore gem install
+ --ignore-dependencies for remote gems
+ * test/rubygems/test_gem_commands_install_command.rb: Test for the
+ above.
- * eval.c (rb_eval): did not work well for op_asgn2 (attribute
- self assignment).
+Sun Dec 22 10:23:40 2013 Eric Hodel <drbrain@segment7.net>
- * eval.c (Init_Thread): returns main thread.
+ * lib/rdoc.rb: Set RDoc to release version.
-Mon Aug 18 09:25:56 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sun Dec 22 10:19:07 2013 Eric Hodel <drbrain@segment7.net>
- * object.c (inspect_i): did not display T_DATA instance variables.
+ * lib/rubygems.rb: Set RubyGems to release version.
- * parse.y: provides more accurate line number information.
+Sun Dec 22 10:16:08 2013 Eric Hodel <drbrain@segment7.net>
- * eval.c (thread_value): include value's backtrace information in
- the variable `$@'.
+ * lib/rubygems.rb (module Gem): Fix comment for
+ Gem::load_path_insert_index.
- * eval.c (f_abort): print backtrace and exit.
+Sun Dec 22 04:07:55 2013 Koichi Sasada <ko1@atdot.net>
-Sat Aug 16 00:17:44 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * gc.c (ruby_gc_set_params): don't show obsolete warnings for
+ RUBY_FREE_MIN/RUBY_HEAP_MIN_SLOTS if
+ RUBY_GC_HEAP_FREE_SLOTS/RUBY_GC_HEAP_INIT_SLOTS are given.
+ [Bug #9276]
- * eval.c (class_new_instance): do not make instance from virtual
- classes.
+Sat Dec 21 13:00:20 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * object.c (class_s_new): do not make subclass of singleton class.
+ * file.c: remove unnecessary the source path from EEXIST error
+ messages and show the destination path only. [ruby-core:59202]
+ [Feature #9263]
-Fri Aug 15 15:49:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+Sat Dec 21 12:37:19 2013 Nobuyoshi Nakada <nobu@ruby-lang.org>
- * eval.c (call_trace_func): block context switch in the trace
- function.
+ * lib/resolv.rb (Resolv::Hosts#lazy_initialize): should not
+ consider encodings in hosts file. [ruby-core:59239] [Bug #9273]
- * eval.c (rb_eval): clear method cache at class extention.
+ * lib/resolv.rb (Resolv::Config.parse_resolv_conf): ditto.
- * object.c (obj_type): returns object's class even if it defines
- singleton methods.
+Sat Dec 21 05:43:27 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-Fri Aug 15 19:40:43 1997 WATANABE Hirofumi <watanabe@ase.ptg.sony.co.jp>
+ * tool/make-snapshot: replace RUBY_PATCHLEVEL_STR in version.h to
+ show users that this ruby is a preview/rc version.
- * ext/socket/socket.c (Init_socket): small typo caused SEGV.
+Sat Dec 21 05:03:49 2013 NAKAMURA Usaku <usa@ruby-lang.org>
-Wed Aug 13 17:51:46 1997 Yukihiro Matsumoto <matz@netlab.co.jp>
+ * win32/Makefile.sub (fake.rb): fixed wrong RUBY_PLATFORM, to correctly
+ install win32.h.
+ [ruby-core:58801][Bug #9199] reported by arton.
- * version 1.1 alpha0 released.
+For the changes before 2.1.0, see doc/ChangeLog-2.1.0
+For the changes before 2.0.0, see doc/ChangeLog-2.0.0
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
+For the changes before 1.8.0, see doc/ChangeLog-1.8.0
+Local variables:
+coding: us-ascii
+add-log-time-format: (lambda ()
+ (let* ((time (current-time))
+ (system-time-locale "C")
+ (diff (+ (cadr time) 32400))
+ (lo (% diff 65536))
+ (hi (+ (car time) (/ diff 65536))))
+ (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
+indent-tabs-mode: t
+tab-width: 8
+change-log-indent-text: 2
+end:
+vim: tabstop=8 shiftwidth=2
diff --git a/GPL b/GPL
new file mode 100644
index 0000000000..d159169d10
--- /dev/null
+++ b/GPL
@@ -0,0 +1,339 @@
+ GNU GENERAL PUBLIC LICENSE
+ Version 2, June 1991
+
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+ Preamble
+
+ The licenses for most software are designed to take away your
+freedom to share and change it. By contrast, the GNU General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users. This
+General Public License applies to most of the Free Software
+Foundation's software and to any other program whose authors commit to
+using it. (Some other Free Software Foundation software is covered by
+the GNU Lesser General Public License instead.) You can apply it to
+your programs, too.
+
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+this service if you wish), that you receive source code or can get it
+if you want it, that you can change the software or use pieces of it
+in new free programs; and that you know you can do these things.
+
+ To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
+
+ For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have. You must make sure that they, too, receive or can get the
+source code. And you must show them these terms so they know their
+rights.
+
+ We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
+
+ Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software. If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
+
+ Finally, any free program is threatened constantly by software
+patents. We wish to avoid the danger that redistributors of a free
+program will individually obtain patent licenses, in effect making the
+program proprietary. To prevent this, we have made it clear that any
+patent must be licensed for everyone's free use or not licensed at all.
+
+ The precise terms and conditions for copying, distribution and
+modification follow.
+
+ GNU GENERAL PUBLIC LICENSE
+ TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+ 0. This License applies to any program or other work which contains
+a notice placed by the copyright holder saying it may be distributed
+under the terms of this General Public License. The "Program", below,
+refers to any such program or work, and a "work based on the Program"
+means either the Program or any derivative work under copyright law:
+that is to say, a work containing the Program or a portion of it,
+either verbatim or with modifications and/or translated into another
+language. (Hereinafter, translation is included without limitation in
+the term "modification".) Each licensee is addressed as "you".
+
+Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope. The act of
+running the Program is not restricted, and the output from the Program
+is covered only if its contents constitute a work based on the
+Program (independent of having been made by running the Program).
+Whether that is true depends on what the Program does.
+
+ 1. You may copy and distribute verbatim copies of the Program's
+source code as you receive it, in any medium, provided that you
+conspicuously and appropriately publish on each copy an appropriate
+copyright notice and disclaimer of warranty; keep intact all the
+notices that refer to this License and to the absence of any warranty;
+and give any other recipients of the Program a copy of this License
+along with the Program.
+
+You may charge a fee for the physical act of transferring a copy, and
+you may at your option offer warranty protection in exchange for a fee.
+
+ 2. You may modify your copy or copies of the Program or any portion
+of it, thus forming a work based on the Program, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+ a) You must cause the modified files to carry prominent notices
+ stating that you changed the files and the date of any change.
+
+ b) You must cause any work that you distribute or publish, that in
+ whole or in part contains or is derived from the Program or any
+ part thereof, to be licensed as a whole at no charge to all third
+ parties under the terms of this License.
+
+ c) If the modified program normally reads commands interactively
+ when run, you must cause it, when started running for such
+ interactive use in the most ordinary way, to print or display an
+ announcement including an appropriate copyright notice and a
+ notice that there is no warranty (or else, saying that you provide
+ a warranty) and that users may redistribute the program under
+ these conditions, and telling the user how to view a copy of this
+ License. (Exception: if the Program itself is interactive but
+ does not normally print such an announcement, your work based on
+ the Program is not required to print an announcement.)
+
+These requirements apply to the modified work as a whole. If
+identifiable sections of that work are not derived from the Program,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works. But when you
+distribute the same sections as part of a whole which is a work based
+on the Program, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Program.
+
+In addition, mere aggregation of another work not based on the Program
+with the Program (or with a work based on the Program) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+ 3. You may copy and distribute the Program (or a work based on it,
+under Section 2) in object code or executable form under the terms of
+Sections 1 and 2 above provided that you also do one of the following:
+
+ a) Accompany it with the complete corresponding machine-readable
+ source code, which must be distributed under the terms of Sections
+ 1 and 2 above on a medium customarily used for software interchange; or,
+
+ b) Accompany it with a written offer, valid for at least three
+ years, to give any third party, for a charge no more than your
+ cost of physically performing source distribution, a complete
+ machine-readable copy of the corresponding source code, to be
+ distributed under the terms of Sections 1 and 2 above on a medium
+ customarily used for software interchange; or,
+
+ c) Accompany it with the information you received as to the offer
+ to distribute corresponding source code. (This alternative is
+ allowed only for noncommercial distribution and only if you
+ received the program in object code or executable form with such
+ an offer, in accord with Subsection b above.)
+
+The source code for a work means the preferred form of the work for
+making modifications to it. For an executable work, complete source
+code means all the source code for all modules it contains, plus any
+associated interface definition files, plus the scripts used to
+control compilation and installation of the executable. However, as a
+special exception, the source code distributed need not include
+anything that is normally distributed (in either source or binary
+form) with the major components (compiler, kernel, and so on) of the
+operating system on which the executable runs, unless that component
+itself accompanies the executable.
+
+If distribution of executable or object code is made by offering
+access to copy from a designated place, then offering equivalent
+access to copy the source code from the same place counts as
+distribution of the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+ 4. You may not copy, modify, sublicense, or distribute the Program
+except as expressly provided under this License. Any attempt
+otherwise to copy, modify, sublicense or distribute the Program is
+void, and will automatically terminate your rights under this License.
+However, parties who have received copies, or rights, from you under
+this License will not have their licenses terminated so long as such
+parties remain in full compliance.
+
+ 5. You are not required to accept this License, since you have not
+signed it. However, nothing else grants you permission to modify or
+distribute the Program or its derivative works. These actions are
+prohibited by law if you do not accept this License. Therefore, by
+modifying or distributing the Program (or any work based on the
+Program), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Program or works based on it.
+
+ 6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the
+original licensor to copy, distribute or modify the Program subject to
+these terms and conditions. You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties to
+this License.
+
+ 7. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Program at all. For example, if a patent
+license would not permit royalty-free redistribution of the Program by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Program.
+
+If any portion of this section is held invalid or unenforceable under
+any particular circumstance, the balance of the section is intended to
+apply and the section as a whole is intended to apply in other
+circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system, which is
+implemented by public license practices. Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+ 8. If the distribution and/or use of the Program is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Program under this License
+may add an explicit geographical distribution limitation excluding
+those countries, so that distribution is permitted only in or among
+countries not thus excluded. In such case, this License incorporates
+the limitation as if written in the body of this License.
+
+ 9. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time. Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number. If the Program
+specifies a version number of this License which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation. If the Program does not specify a version number of
+this License, you may choose any version ever published by the Free Software
+Foundation.
+
+ 10. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission. For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this. Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+ NO WARRANTY
+
+ 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+ 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
+
+ If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+ To do so, attach the following notices to the program. It is safest
+to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+ <one line to give the program's name and a brief idea of what it does.>
+ Copyright (C) <year> <name of author>
+
+ This program is free software; you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation; either version 2 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License along
+ with this program; if not, write to the Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+ Gnomovision version 69, Copyright (C) year name of author
+ Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+ This is free software, and you are welcome to redistribute it
+ under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License. Of course, the commands you use may
+be called something other than `show w' and `show c'; they could even be
+mouse-clicks or menu items--whatever suits your program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary. Here is a sample; alter the names:
+
+ Yoyodyne, Inc., hereby disclaims all copyright interest in the program
+ `Gnomovision' (which makes passes at compilers) written by James Hacker.
+
+ <signature of Ty Coon>, 1 April 1989
+ Ty Coon, President of Vice
+
+This General Public License does not permit incorporating your program into
+proprietary programs. If your program is a subroutine library, you may
+consider it more useful to permit linking proprietary applications with the
+library. If this is what you want to do, use the GNU Lesser General
+Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..b97a08d928
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,5 @@
+#
+# This test file concludes tests which point out known bugs.
+# So all tests will cause failure.
+#
+
diff --git a/LEGAL b/LEGAL
new file mode 100644
index 0000000000..24e36e6231
--- /dev/null
+++ b/LEGAL
@@ -0,0 +1,592 @@
+LEGAL NOTICE INFORMATION
+------------------------
+
+All the files in this distribution are covered under either the Ruby's
+license (see the file COPYING) or public-domain except some files
+mentioned below.
+
+ccan/build_assert/build_assert.h
+ccan/check_type/check_type.h
+ccan/container_of/container_of.h
+ccan/str/str.h
+
+ These files are licensed under the CC0.
+
+ http://creativecommons.org/choose/zero/
+
+ccan/list/list.h
+
+ This file is licensed under the MIT License.
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy
+ of this software and associated documentation files (the "Software"), to deal
+ in the Software without restriction, including without limitation the rights
+ to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the Software is
+ furnished to do so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in
+ all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+ THE SOFTWARE.
+
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+ When this software is partly used or it is distributed with Ruby,
+ this of Ruby follows the license of Ruby.
+
+configure:
+
+ This file is free software.
+
+ Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+
+ This configure script is free software; the Free Software Foundation
+ gives unlimited permission to copy, distribute and modify it.
+
+tool/config.guess:
+tool/config.sub:
+
+ As long as you distribute these files with the file configure, they
+ are covered under the Ruby's license.
+
+ Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
+ Free Software Foundation, Inc.
+
+ This file is free software; you can redistribute it and/or modify it
+ under the terms of the GNU General Public License as published by
+ the Free Software Foundation; either version 2 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful, but
+ WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program; if not, write to the Free Software
+ Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+
+ As a special exception to the GNU General Public License, if you
+ distribute this file as part of a program that contains a
+ configuration script generated by Autoconf, you may include it under
+ the same distribution terms that you use for the rest of that program.
+
+parse.c:
+
+ This file is licensed under the GPL, but is incorporated into Ruby and
+ redistributed under the terms of the Ruby license, as permitted by the
+ exception to the GPL below.
+
+ Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+ Free Software Foundation, Inc.
+
+ This program is free software; you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation; either version 2, or (at your option)
+ any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program; if not, write to the Free Software
+ Foundation, Inc., 51 Franklin Street, Fifth Floor,
+ Boston, MA 02110-1301, USA. */
+
+ /* As a special exception, you may create a larger work that contains
+ part or all of the Bison parser skeleton and distribute that work
+ under terms of your choice, so long as that work isn't itself a
+ parser generator using the skeleton or a modified version thereof
+ as a parser skeleton. Alternatively, if you modify or redistribute
+ the parser skeleton itself, you may (at your option) remove this
+ special exception, which will cause the skeleton and the resulting
+ Bison output files to be licensed under the GNU General Public
+ License without this special exception.
+
+ This special exception was added by the Free Software Foundation in
+ version 2.2 of Bison. */
+
+util.c (partly):
+
+ Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+ Permission to use, copy, modify, and distribute this software for any
+ purpose without fee is hereby granted, provided that this entire notice
+ is included in all copies of any software which is or includes a copy
+ or modification of this software and in all copies of the supporting
+ documentation for such software.
+
+ THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+ WARRANTY. IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+ REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+ OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
+win32/win32.[ch]:
+
+ You can apply the Artistic License to these files. (or GPL,
+ alternatively)
+
+ Copyright (c) 1993, Intergraph Corporation
+
+ You may distribute under the terms of either the GNU General Public
+ License or the Artistic License, as specified in the perl README file.
+
+util.c (partly):
+
+ Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+random.c
+
+ This file is under the new-style BSD license.
+
+ A C-program for MT19937, with initialization improved 2002/2/10.
+ Coded by Takuji Nishimura and Makoto Matsumoto.
+ This is a faster version by taking Shawn Cokus's optimization,
+ Matthe Bellew's simplification, Isaku Wada's real version.
+
+ Before using, initialize the state by using init_genrand(seed)
+ or init_by_array(init_key, key_length).
+
+ Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ 3. The names of its contributors may not be used to endorse or promote
+ products derived from this software without specific prior written
+ permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
+ "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+ LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+ A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR
+ CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+ PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF
+ LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
+ NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
+ SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+
+ Any feedback is very welcome.
+ http://www.math.keio.ac.jp/matumoto/emt.html
+ email: matumoto@math.keio.ac.jp
+
+vm_dump.c:procstat_vm
+
+ * Copyright (c) 2007 Robert N. M. Watson
+ * All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ * notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ * notice, this list of conditions and the following disclaimer in the
+ * documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ * $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+vsnprintf.c:
+
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
+
+ Copyright (c) 1990, 1993
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Chris Torek.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ IMPORTANT NOTE:
+ --------------
+ From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+ paragraph 3 above is now null and void.
+
+st.[ch]:
+missing/alloca.c:
+missing/dup2.c:
+missing/erf.c:
+missing/finite.c:
+missing/hypot.c:
+missing/isinf.c:
+missing/isnan.c:
+missing/lgamma_r.c:
+missing/memcmp.c:
+missing/memmove.c:
+missing/strchr.c:
+missing/strstr.c:
+missing/strtol.c:
+missing/tgamma.c:
+ext/digest/sha1/sha1.[ch]:
+
+ These files are all under public domain.
+
+missing/crypt.c:
+
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
+
+ Copyright (c) 1989, 1993
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Tom Truscott.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+missing/setproctitle.c
+
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
+
+ Copyright 2003 Damien Miller
+ Copyright (c) 1983, 1995-1997 Eric P. Allman
+ Copyright (c) 1988, 1993
+ The Regents of the University of California. All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+missing/strlcat.c
+missing/strlcpy.c
+
+ These files are under the new-style BSD license.
+
+ Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. The name of the author may not be used to endorse or promote products
+ derived from this software without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+ INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+ AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL
+ THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+ OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+ WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+ OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+ ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+missing/langinfo.c
+
+ This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+ Ruby uses a modified version. The file contains the following
+ author/copyright notice:
+
+ Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+ Permission to use, copy, modify, and distribute this software
+ for any purpose and without fee is hereby granted. The author
+ disclaims all warranties with regard to this software.
+
+ext/digest/md5/md5.[ch]:
+
+ These files are under the following license. Ruby uses modified
+ versions of them.
+
+ Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
+
+ This software is provided 'as-is', without any express or implied
+ warranty. In no event will the authors be held liable for any damages
+ arising from the use of this software.
+
+ Permission is granted to anyone to use this software for any purpose,
+ including commercial applications, and to alter it and redistribute it
+ freely, subject to the following restrictions:
+
+ 1. The origin of this software must not be misrepresented; you must not
+ claim that you wrote the original software. If you use this software
+ in a product, an acknowledgment in the product documentation would be
+ appreciated but is not required.
+ 2. Altered source versions must be plainly marked as such, and must not be
+ misrepresented as being the original software.
+ 3. This notice may not be removed or altered from any source distribution.
+
+ L. Peter Deutsch
+ ghost@aladdin.com
+
+ext/digest/rmd160/rmd160.[ch]:
+
+ These files have the following copyright information, and by the
+ author we are allowed to use it under the new-style BSD license.
+
+ AUTHOR: Antoon Bosselaers, ESAT-COSIC
+ (Arranged for libc by Todd C. Miller)
+ DATE: 1 March 1996
+
+ Copyright (c) Katholieke Universiteit Leuven
+ 1996, All Rights Reserved
+
+ext/digest/sha2/sha2.[ch]:
+
+ These files are under the new-style BSD license.
+
+ Copyright 2000 Aaron D. Gifford. All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the copyright holder nor the names of contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR(S) AND CONTRIBUTOR(S) ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR(S) OR CONTRIBUTOR(S) BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ext/nkf/nkf-utf8/config.h:
+ext/nkf/nkf-utf8/nkf.c:
+ext/nkf/nkf-utf8/utf8tbl.c:
+
+ These files are under the following license. So to speak, it is
+ copyrighted semi-public-domain software.
+
+ Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
+ Everyone is permitted to do anything on this program
+ including copying, modifying, improving,
+ as long as you don't try to pretend that you wrote it.
+ i.e., the above copyright notice has to appear in all copies.
+ Binary distribution requires original version messages.
+ You don't have to ask before copying, redistribution or publishing.
+ THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+ext/socket/addrinfo.h:
+ext/socket/getaddrinfo.c:
+ext/socket/getnameinfo.c:
+
+ These files are under the new-style BSD license.
+
+ Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the project nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ext/win32ole/win32ole.c:
+
+ You can apply the Artistic License to this file. (or GPL,
+ alternatively)
+
+ (c) 1995 Microsoft Corporation. All rights reserved.
+ Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
+
+ Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+ <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
+
+ You may distribute under the terms of either the GNU General Public
+ License or the Artistic License, as specified in the README file
+ of the Perl distribution.
diff --git a/MANIFEST b/MANIFEST
deleted file mode 100644
index 8f8976bb98..0000000000
--- a/MANIFEST
+++ /dev/null
@@ -1,219 +0,0 @@
-COPYING
-ChangeLog
-MANIFEST
-Makefile.in
-README
-README.jp
-README.EXT
-README.EXT.jp
-ToDo
-array.c
-bignum.c
-class.c
-compar.c
-configure
-configure.bat
-configure.in
-config_h.dj
-config_s.dj
-config.guess
-config.sub
-defines.h
-dir.c
-dln.c
-dln.h
-dmyext.c
-enum.c
-env.h
-error.c
-eval.c
-file.c
-fnmatch.c
-fnmatch.h
-gc.c
-glob.c
-hash.c
-inits.c
-install-sh
-instruby.rb
-intern.h
-io.c
-keywords
-lex.c
-main.c
-marshal.c
-math.c
-mkconfig.rb
-node.h
-numeric.c
-object.c
-pack.c
-parse.c
-parse.y
-prec.c
-process.c
-random.c
-range.c
-re.c
-re.h
-regex.c
-regex.h
-ruby.1
-ruby.c
-ruby.h
-rubyio.h
-rubysig.h
-rubytest.rb
-signal.c
-sprintf.c
-st.c
-st.h
-string.c
-struct.c
-time.c
-top.sed
-util.h
-util.c
-variable.c
-version.c
-version.h
-beos/ruby.def.in
-ext/Setup
-ext/Setup.dj
-ext/Setup.nt
-ext/Setup.x68
-ext/aix_ld.rb
-ext/cygwin32_ld.rb
-ext/extmk.rb.in
-ext/extmk.rb.nt
-lib/English.rb
-lib/Env.rb
-lib/README
-lib/base64.rb
-lib/cgi-lib.rb
-lib/complex.rb
-lib/date.rb
-lib/date2.rb
-lib/debug.rb
-lib/delegate.rb
-lib/e2mmap.rb
-lib/eregex.rb
-lib/find.rb
-lib/final.rb
-lib/finalize.rb
-lib/ftplib.rb
-lib/ftools.rb
-lib/getopts.rb
-lib/getoptlong.rb
-lib/importenv.rb
-lib/jcode.rb
-lib/mailread.rb
-lib/mathn.rb
-lib/matrix.rb
-lib/mkmf.rb
-lib/monitor.rb
-lib/mutex_m.rb
-lib/observer.rb
-lib/open3.rb
-lib/ostruct.rb
-lib/parsearg.rb
-lib/parsedate.rb
-lib/ping.rb
-lib/profile.rb
-lib/pstore.rb
-lib/rational.rb
-lib/readbytes.rb
-lib/shellwords.rb
-lib/singleton.rb
-lib/sync.rb
-lib/telnet.rb
-lib/tempfile.rb
-lib/thread.rb
-lib/thwait.rb
-lib/timeout.rb
-lib/tracer.rb
-lib/weakref.rb
-misc/README
-misc/inf-ruby.el
-misc/ruby-mode.el
-misc/rubydb2x.el
-misc/rubydb3x.el
-missing/alloca.c
-missing/crypt.c
-missing/dir.h
-missing/dup2.c
-missing/file.h
-missing/flock.c
-missing/memcmp.c
-missing/memmove.c
-missing/mkdir.c
-missing/strcasecmp.c
-missing/strchr.c
-missing/strdup.c
-missing/strerror.c
-missing/strftime.c
-missing/strstr.c
-missing/strtol.c
-missing/strtoul.c
-missing/vsnprintf.c
-missing/x68.c
-sample/README
-sample/biorhythm.rb
-sample/cal.rb
-sample/cbreak.rb
-sample/clnt.rb
-sample/dbmtest.rb
-sample/dir.rb
-sample/eval.rb
-sample/export.rb
-sample/exyacc.rb
-sample/fact.rb
-sample/fib.awk
-sample/fib.pl
-sample/fib.py
-sample/fib.rb
-sample/fib.scm
-sample/freq.rb
-sample/from.rb
-sample/fullpath.rb
-sample/getopts.test
-sample/goodfriday.rb
-sample/less.rb
-sample/list.rb
-sample/list2.rb
-sample/list3.rb
-sample/mine.rb
-sample/mkproto.rb
-sample/mpart.rb
-sample/mrshtest.rb
-sample/observ.rb
-sample/occur.pl
-sample/occur.rb
-sample/occur2.rb
-sample/philos.rb
-sample/pi.rb
-sample/rename.rb
-sample/rbc.rb
-sample/rcs.awk
-sample/rcs.dat
-sample/rcs.rb
-sample/regx.rb
-sample/sieve.rb
-sample/svr.rb
-sample/test.rb
-sample/time.rb
-sample/trojan.rb
-sample/tsvr.rb
-sample/uumerge.rb
-win32/Makefile
-win32/config.h
-win32/ntsetup.bat
-win32/ruby.def
-win32/sdbm.c
-win32/sdbm.h
-win32/win32.c
-win32/win32.h
-x68/fconvert.c
-x68/select.c
-x68/_dtos18.c
-x68/_round.c
diff --git a/Makefile.in b/Makefile.in
index 4019945b3d..39fe0bb37f 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,244 +1,492 @@
SHELL = /bin/sh
+NULLCMD = @NULLCMD@
+n=$(NULLCMD)
+ECHO1 = $(V:1=@$n)
+RUNCMD = $(SHELL)
+CDPATH = .
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
+PATH_SEPARATOR = @PATH_SEPARATOR@
#### Start of system configuration section. ####
-MAJOR= @MAJOR@
-MINOR= @MINOR@
-TEENY= @TEENY@
-
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-
srcdir = @srcdir@
-VPATH = @srcdir@:@srcdir@/missing
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
CC = @CC@
-YACC = @YACC@
+CPP = @CPP@
+LD = @LD@
+YACC = bison
PURIFY =
AUTOCONF = autoconf
@SET_MAKE@
+MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+CROSS_COMPILING = @CROSS_COMPILING@
+DOXYGEN = @DOXYGEN@
prefix = @prefix@
-CFLAGS = @CFLAGS@ -I. -I@srcdir@ -I@includedir@
+exec_prefix = @exec_prefix@
+bindir = @bindir@
+sbindir = @sbindir@
+libdir = @libdir@
+libexecdir = @libexecdir@
+datarootdir = @datarootdir@
+datadir = @datadir@
+arch = @arch@
+sitearch = @sitearch@
+sitedir = @sitedir@
+archlibdir = @archlibdir@
+ruby_version = @ruby_version@
+
+TESTUI = console
+TESTS =
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+
+EXTOUT = @EXTOUT@
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
+
+empty =
+CC_VERSION = @CC_VERSION@
+OUTFLAG = @OUTFLAG@$(empty)
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS_NO_ARCH = @CFLAGS@
+CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@ @strict_warnflags@
+cppflags = @cppflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLIBS =
+EXTLDFLAGS = @EXTLDFLAGS@
+XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
+EXTLIBS =
LIBS = @LIBS@ $(EXTLIBS)
MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LDSHARED@
-DLDFLAGS = @DLDFLAGS@
+LDSHARED = @LIBRUBY_LDSHARED@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
SOLIBS = @SOLIBS@
-
-binsuffix = @binsuffix@
+MAINLIBS = @MAINLIBS@
+ARCHMINIOBJS = @MINIOBJS@
+DLNOBJ = @DLNOBJ@
+ENCOBJS = @ENCOBJS@
+EXTOBJS = @EXTOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+POSTLINK = @POSTLINK@
+
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
+RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
+RUBY_SO_NAME=@RUBY_SO_NAME@
+EXEEXT = @EXEEXT@
+LIBEXT = @LIBEXT@
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+RUBY = $(RUBY_INSTALL_NAME)
+MINIRUBY = @MINIRUBY@\
+ $(MINIRUBYOPT)
+# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
+RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
+# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
+RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
+# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
+RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
+XRUBY = @XRUBY@
+BTESTRUBY = @BTESTRUBY@\
+ $(MINIRUBYOPT)
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
#### End of system configuration section. ####
+MAJOR= @MAJOR@
+MINOR= @MINOR@
+TEENY= @TEENY@
+
LIBRUBY_A = @LIBRUBY_A@
LIBRUBY_SO = @LIBRUBY_SO@
LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
LIBRUBY = @LIBRUBY@
LIBRUBYARG = @LIBRUBYARG@
-
-EXTOBJS =
-
-MAINOBJ = main.o
-
-OBJS = array.o \
- bignum.o \
- class.o \
- compar.o \
- dir.o \
- dln.o \
- enum.o \
- error.o \
- eval.o \
- file.o \
- fnmatch.o \
- gc.o \
- glob.o \
- hash.o \
- inits.o \
- io.o \
- marshal.o \
- prec.o \
- math.o \
- numeric.o \
- object.o \
- pack.o \
- parse.o \
- process.o \
- random.o \
- range.o \
- re.o \
- regex.o \
- ruby.o \
- signal.o \
- sprintf.o \
- st.o \
- string.o \
- struct.o \
- time.o \
- util.o \
- variable.o \
- version.o \
- $(MISSING)
-
-all: miniruby$(binsuffix) rbconfig.rb
- @./miniruby$(binsuffix) -Xext extmk.rb @EXTSTATIC@
-
-miniruby$(binsuffix): $(LIBRUBY_A) $(MAINOBJ) dmyext.o
- @rm -f $@
- $(PURIFY) $(CC) $(LDFLAGS) $(MAINOBJ) dmyext.o $(LIBRUBY_A) $(LIBS) -o $@
-
-ruby$(binsuffix): $(LIBRUBY) $(MAINOBJ) $(EXTOBJS)
- @rm -f $@
- $(PURIFY) $(CC) $(LDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) -o $@
-
-$(LIBRUBY_A): $(OBJS) dmyext.o
- @AR@ rcu $@ $(OBJS) dmyext.o
- @-@RANLIB@ $@ 2> /dev/null || true
-
-$(LIBRUBY_SO): $(OBJS) dmyext.o
- $(LDSHARED) $(DLDFLAGS) $(SOLIBS) $(OBJS) dmyext.o -o $@
- @for alias in $(LIBRUBY_ALIASES); do \
- rm -f $$alias \
- && @LN_S@ $(LIBRUBY_SO) $$alias \
- && echo ln @LN_S@ $(LIBRUBY_SO) $$alias; \
- done
-
-install: rbconfig.rb
- ./miniruby$(binsuffix) $(srcdir)/instruby.rb $(DESTDIR)
-
-clean:; @rm -f $(OBJS) $(LIBRUBY_A) $(LIBRUBY_SO) $(LIBRUBY_ALIASES) $(MAINOBJ) rbconfig.rb
- @rm -f ext/extinit.c ext/extinit.o dmyext.o
- @if test -f ./miniruby$(binsuffix); then \
- ./miniruby$(binsuffix) -Xext extmk.rb clean; \
- fi
-
-distclean: clean
- @rm -f Makefile ext/extmk.rb config.h
- @rm -f ext/config.cache config.cache config.log config.status
- @rm -f parse.c *~ core *.core gmon.out y.tab.c y.output
- @rm -f ruby$(binsuffix) miniruby$(binsuffix)
-
-realclean: distclean
- @rm -f lex.c
-
-test: miniruby$(binsuffix)
- @./miniruby$(binsuffix) $(srcdir)/rubytest.rb
-
-rbconfig.rb: config.status miniruby$(binsuffix)
- @./miniruby$(binsuffix) $(srcdir)/mkconfig.rb rbconfig.rb
-
-config.status: $(srcdir)/configure
- $(SHELL) ./config.status --recheck
-
-$(srcdir)/configure: $(srcdir)/configure.in
- cd $(srcdir) && $(AUTOCONF)
-
-.c.o:
- $(CC) $(CFLAGS) $(CPPFLAGS) -c $<
-
-lex.c: keywords
- gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ @srcdir@/keywords > lex.c
-
-parse.c: parse.y
- $(YACC) $<
- mv -f y.tab.c parse.c
-
-alloca.o: @srcdir@/missing/alloca.c
- $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/alloca.c
-
-crypt.o: @srcdir@/missing/crypt.c
- $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/crypt.c
-
-dup2.o: @srcdir@/missing/dup2.c
- $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/dup2.c
-
-flock.o: @srcdir@/missing/flock.c
- $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/flock.c
-
-memcmp.o: @srcdir@/missing/memcmp.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/memcmp.c
-
-memmove.o: @srcdir@/missing/memmove.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/memmove.c
-
-mkdir.o: @srcdir@/missing/mkdir.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/mkdir.c
-
-vsnprintf.o: @srcdir@/missing/vsnprintf.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/vsnprintf.c
-
-strcasecmp.o: @srcdir@/missing/strcasecmp.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strcasecmp.c
-
-strchr.o: @srcdir@/missing/strchr.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strchr.c
-
-strdup.o: @srcdir@/missing/strdup.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strdup.c
-
-strerror.o: @srcdir@/missing/strerror.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strerror.c
-
-strftime.o: @srcdir@/missing/strftime.c
- $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strftime.c
-
-strstr.o: @srcdir@/missing/strstr.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strstr.c
-
-strtol.o: @srcdir@/missing/strtol.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtol.c
-
-strtoul.o: @srcdir@/missing/strtoul.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtoul.c
-
-nt.o: @srcdir@/missing/nt.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/nt.c
-
-x68.o: @srcdir@/missing/x68.c
- $(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/x68.c
+LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
+LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
+LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
+
+THREAD_MODEL = @THREAD_MODEL@
+
+PREP = @PREP@
+ARCHFILE = @ARCHFILE@
+SETUP =
+EXTSTATIC = @EXTSTATIC@
+ENCSTATIC = @ENCSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
+
+MAKEDIRS = @MKDIR_P@
+CP = cp
+MV = mv
+RM = rm -f
+RMDIR = @RMDIR@
+RMDIRS = @RMDIRS@
+RMALL = @RMALL@
+NM = @NM@
+AR = @AR@
+ARFLAGS = rcu
+RANLIB = @RANLIB@
+AS = @AS@
+ASFLAGS = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP = @OBJDUMP@
+OBJCOPY = @OBJCOPY@
+VCS = @VCS@
+VCSUP = @VCSUP@
+DTRACE = @DTRACE@
+DTRACE_EXT = @DTRACE_EXT@
+DTRACE_OBJ = @DTRACE_OBJ@
+DTRACE_GLOMMED_OBJ = @DTRACE_GLOMMED_OBJ@
+
+OBJEXT = @OBJEXT@
+ASMEXT = S
+DLEXT = @DLEXT@
+MANTYPE = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
+
+INSTALLED_LIST= .installed.list
+
+NEWLINE_C = newline.c
+MINIPRELUDE_C = miniprelude.c
+RBCONFIG = .rbconfig.time
+
+SRC_FILE = $<
+OS_SRC_FILE = $<
+DEST_FILE = $@
+OS_DEST_FILE = $@
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+ECHO_BEGIN = @sep=''; for word in
+ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
+
+DESTDIR = @DESTDIR@
+
+configure_args = @configure_args@
+#### End of variables
+
+.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
+
+all:
# Prevent GNU make v3 from overflowing arg limit on SysV.
.NOEXPORT:
-###
-parse.o: parse.y ruby.h config.h defines.h intern.h env.h node.h st.h regex.h util.h lex.c
-###
-array.o: array.c ruby.h config.h defines.h intern.h
-bignum.o: bignum.c ruby.h config.h defines.h intern.h
-class.o: class.c ruby.h config.h defines.h intern.h node.h st.h
-compar.o: compar.c ruby.h config.h defines.h intern.h
-dir.o: dir.c ruby.h config.h defines.h intern.h
-dln.o: dln.c config.h defines.h dln.h
-dmyext.o: dmyext.c
-enum.o: enum.c ruby.h config.h defines.h intern.h
-error.o: error.c ruby.h config.h defines.h intern.h env.h
-eval.o: eval.c ruby.h config.h defines.h intern.h node.h env.h rubysig.h st.h dln.h
-file.o: file.c ruby.h config.h defines.h intern.h rubyio.h rubysig.h
-fnmatch.o: fnmatch.c config.h fnmatch.h
-gc.o: gc.c ruby.h config.h defines.h intern.h rubysig.h st.h node.h env.h re.h regex.h
-glob.o: config.h glob.c fnmatch.h
-hash.o: hash.c ruby.h config.h defines.h intern.h st.h rubysig.h
-inits.o: inits.c ruby.h config.h defines.h intern.h
-io.o: io.c ruby.h config.h defines.h intern.h rubyio.h rubysig.h
-main.o: main.c ruby.h config.h defines.h intern.h
-marshal.o: marshal.c ruby.h config.h defines.h intern.h rubyio.h st.h
-prec.o: prec.c ruby.h config.h defines.h intern.h
-math.o: math.c ruby.h config.h defines.h intern.h
-numeric.o: numeric.c ruby.h config.h defines.h intern.h
-object.o: object.c ruby.h config.h defines.h intern.h st.h
-pack.o: pack.c ruby.h config.h defines.h intern.h
-process.o: process.c ruby.h config.h defines.h intern.h rubysig.h st.h
-random.o: random.c ruby.h config.h defines.h intern.h
-range.o: range.c ruby.h config.h defines.h intern.h
-re.o: re.c ruby.h config.h defines.h intern.h re.h regex.h
-regex.o: regex.c config.h regex.h util.h
-ruby.o: ruby.c ruby.h config.h defines.h intern.h dln.h util.h
-signal.o: signal.c ruby.h config.h defines.h intern.h rubysig.h
-sprintf.o: sprintf.c ruby.h config.h defines.h intern.h
-st.o: st.c config.h st.h
-string.o: string.c ruby.h config.h defines.h intern.h re.h regex.h
-struct.o: struct.c ruby.h config.h defines.h intern.h
-time.o: time.c ruby.h config.h defines.h intern.h
-util.o: util.c ruby.h config.h defines.h intern.h util.h
-variable.o: variable.c ruby.h config.h defines.h intern.h env.h node.h st.h
-version.o: version.c ruby.h config.h defines.h intern.h version.h
+
+miniruby$(EXEEXT):
+ @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+ $(ECHO) linking $@
+ $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(DMYEXT) $(DTRACE_OBJ) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+
+$(PROGRAM):
+ @$(RM) $@
+ $(ECHO) linking $@
+ $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
+ $(Q) $(POSTLINK)
+
+# We must `rm' the library each time this rule is invoked because "updating" a
+# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
+# supported.
+$(LIBRUBY_A):
+ @$(RM) $@
+ $(ECHO) linking static-library $@
+ $(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(DMYEXT)
+ @-$(RANLIB) $@ 2> /dev/null || true
+ $(ECHO) verifying static-library $@
+ @$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
+ @$(RM) conftest$(EXEEXT) conftest.c
+
+$(LIBRUBY_SO):
+ @-$(PRE_LIBRUBY_UPDATE)
+ $(ECHO) linking shared-library $@
+ $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(DTRACE_OBJ) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
+ -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
+ $(Q) $(POSTLINK)
+ @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
+ File.symlink "$(LIBRUBY_SO)", link}' \
+ $(LIBRUBY_ALIASES) || true
+$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
+ @./config.status --file=$@:$(srcdir)/template/fake.rb.in
+ @chmod +x $@
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+ @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+ $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+ $(ECHO) installing cross-compiling stuff
+ $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+ $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+ $(Q) $(BASERUBY) -p \
+ -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+ -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+ rbconfig.rb > fake-rbconfig.rb
+ $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+ $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+ @$(RM) fake.rb fake-rbconfig.rb
+ $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+ $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+ $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+ $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/version.h
+ @[ -f $@ ] && mv $@ $@.old
+ MAKE=$(MAKE) $(SHELL) ./config.status $@
+ @cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
+ { \
+ echo "all:; -@rm -f conftest.mk"; \
+ echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
+ echo ".force:"; \
+ } > conftest.mk || exit 1; \
+ $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
+ { echo "$@ updated, restart."; exit 1; }
+
+uncommon.mk: $(srcdir)/common.mk
+ sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+
+.PHONY: reconfig
+reconfig-args = $(srcdir)/configure $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
+reconfig-exec-1 = set -x; "$$@"
+
+reconfig config.status: $(srcdir)/configure $(srcdir)/enc/Makefile.in \
+ $(srcdir)/include/ruby/version.h
+ @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+ set $(SHELL) $($@-args); $(reconfig-exec-$(V))
+
+$(srcdir)/configure: $(srcdir)/configure.in
+ $(CHDIR) $(srcdir) && exec $(AUTOCONF)
+
+incs: id.h
+all-incs: probes.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+ @\
+ if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+ [ $(Q) ] && echo copying $@ || set -x; \
+ $(CP) $(srcdir)/lex.c.blt $@; \
+ else \
+ [ $(Q) ] && echo generating $@ || set -x; \
+ gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
+ $(MV) $@.tmp $@ && \
+ $(CP) $? $(srcdir)/defs/lex.c.src && \
+ $(CP) $@ $(srcdir)/lex.c.blt; \
+ fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+ $(MAKEDIRS) $(@D)
+ @set +e; \
+ if cmp -s $(?:.kwd=.src) $?; then \
+ set -x; \
+ $(CP) $(?:.kwd=.h.blt) $@; \
+ else \
+ trap '$(RM) $@-1.h $@-2.h' 0 && \
+ set -x; \
+ sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+ sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
+ diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+ $(MV) $@.tmp $@ && \
+ $(CP) $? $(?:.kwd=.src) && \
+ $(CP) $@ $(?:.kwd=.h.blt); \
+ fi
+
+JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
+
+enc/jis/props.h: enc/jis/props.kwd
+ $(MAKEDIRS) $(@D)
+ @set +e; \
+ if cmp -s $(?:.kwd=.src) $?; then \
+ set -x; \
+ $(CP) $(?:.kwd=.h.blt) $@; \
+ else \
+ set -x; \
+ gperf $(JIS_PROPS_OPTIONS) $? | \
+ sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
+ $(CP) $? $(?:.kwd=.src) && \
+ $(CP) $@ $(?:.kwd=.h.blt); \
+ fi
+
+.c.@OBJEXT@:
+ @$(ECHO) compiling $<
+ $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+
+.s.@OBJEXT@:
+ @$(ECHO) assembling $<
+ $(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+ @$(ECHO) translating $<
+ $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+ @$(ECHO) preprocessing $<
+ $(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+
+.d.h:
+ @$(ECHO) translating probes $<
+ $(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
+ $(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/PROBES_H/g' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
+ $(Q) $(RM) $@.tmp
+
+.dmyh.h:
+ @$(ECHO) copying dummy $(DEST_FILE)
+ $(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
+
+probes.@OBJEXT@: $(srcdir)/probes.d
+ @$(ECHO) processing probes in object files
+ $(Q) stamp="$*.stamp"; \
+ if test -f "$$stamp" -o -f "$@"; then \
+ $(RM) $(DTRACE_DEPENDENT_OBJS) "$$stamp"; \
+ for o in $(DTRACE_DEPENDENT_OBJS); do \
+ echo "rebuilding $$o which was modified by \"dtrace -G\""; \
+ $(MAKE) "$$o"; \
+ done; \
+ fi; \
+ touch "$$stamp"
+ $(RM) $@
+ $(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_DEPENDENT_OBJS)
+
+# DTrace static library hacks described here:
+# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
+ruby-glommed.$(OBJEXT):
+ @$(ECHO) generating a glommed object with DTrace probes for static library
+ $(Q) $(LD) -r -o $@ $(OBJS) $(DTRACE_OBJ)
+
+clean-local::
+ $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
+ enc/encinit.c enc/encinit.$(OBJEXT)
+ -$(Q)$(RM) $(pkgconfig_DATA)
+
+distclean-local::
+ $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+ -$(Q)$(RM) run.gdb
+ -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
+ -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+ @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+ test "$$#" = 0 && set .; \
+ set dummy `\
+ find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
+ `; shift; \
+ cd ..; \
+ for dir do \
+ echo $(@:-ext=)ing "$$dir"; \
+ (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+ case "$@" in \
+ *distclean-ext*|*realclean-ext*) \
+ $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+ esac; \
+ done
+ -$(Q)$(RM) ext/extinit.$(OBJEXT)
+
+distclean-ext realclean-ext::
+ -$(Q)$(RM) ext/extinit.c
+ -$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+
+clean-enc distclean-enc realclean-enc:
+ @test -f "$(ENC_MK)" || exit 0; \
+ echo $(@:-enc=ing) encodings; \
+ exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
+
+ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
+ $(ECHO) compiling $@
+ $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
+
+up::
+ @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+up::
+ -$(Q)$(MAKE) $(MFLAGS) after-update
+
+after-update:: update-config_files
+
+update-mspec:
+ @$(CHDIR) $(srcdir); \
+ if [ -d spec/mspec ]; then \
+ cd spec/mspec; \
+ echo updating mspec ...; \
+ exec git pull; \
+ else \
+ echo retrieving mspec ...; \
+ exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+ fi
+
+update-rubyspec: update-mspec
+ @$(CHDIR) $(srcdir); \
+ if [ -d spec/rubyspec ]; then \
+ cd spec/rubyspec; \
+ echo updating rubyspec ...; \
+ exec git pull; \
+ else \
+ echo retrieving rubyspec ...; \
+ exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+ fi
+
+test-rubyspec-precheck:
+ @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
+
+update-coverage:
+ @$(CHDIR) $(srcdir); \
+ if [ -d coverage/simplecov ]; then \
+ cd coverage/simplecov; \
+ echo updating simplecov ...; \
+ exec git pull; \
+ else \
+ echo retrieving simplecov ...; \
+ exec git clone $(SIMPLECOV_GIT_URL) coverage/simplecov; \
+ fi
+
+INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+ vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+ $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+ $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+ $(ECHO) generating $@
+ $(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
+
+loadpath: verconf.h
+ @$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
+ sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
+ -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..6abfa3fc50
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,255 @@
+# -*- rdoc -*-
+
+= NEWS for Ruby 2.2.0
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or
+reference information is supplied with. For a full list of changes
+with all sufficient information, see the ChangeLog file.
+
+== Changes since the 2.1.0 release
+
+=== Language changes
+
+* nil/true/false
+ * nil/true/false objects are frozen. [Feature #8923]
+
+=== Core classes updates (outstanding ones only)
+
+* Binding
+ * New methods:
+ * Binding#local_variables
+ * Binding#receiver
+
+* Dir
+ * New methods:
+ * Dir#fileno
+
+* Enumerable
+ * New methods:
+ * Enumerable#slice_after
+ * Extended methods:
+ * min, min_by, max and max_by supports optional argument to return
+ multiple elements.
+
+* Float
+ * New methods:
+ * Float#next_float
+ * Float#prev_float
+
+* File
+ * New methods:
+ * File.birthtime
+ * File#birthtime
+
+* File::Stat
+ * New methods:
+ * File::Stat#birthtime
+
+* GC
+ * Improvements
+ * Introduce incremental marking for major GC. [Feature #10137]
+
+* Kernel
+ * New methods:
+ * Kernel#itself
+
+* Process
+ * Extended method:
+ * Process execution methods such as Process.spawn opens the file in write
+ mode for redirect from [:out, :err].
+ * Process creation methods, such as spawn(), uses vfork() system call.
+ vfork() is faster than fork() when the parent process uses huge memory.
+
+* Symbol
+ * Improvements
+ * Most symbols which are returned by String#to_sym and
+ String#intern are GC-able.
+
+* Matrix
+ * New methods:
+ * Matrix#first_minor(row, column) returns the submatrix obtained
+ by deleting the specified row and column.
+ * Matrix#cofactor(row, column) returns the (row, column) cofactor
+ which is obtained by multiplying the first minor by (-1)**(row + column).
+
+* Method
+ * New methods:
+ * Method#curry([arity]) returns a curried Proc.
+ * Method#super_method returns a Method of superclass, which would be called
+ when super is used.
+
+=== Core classes compatibility issues (excluding feature bug fixes)
+
+* GC
+ * incompatible changes:
+ * Rename GC.stat entries. [Feature #9924]
+ See https://docs.google.com/spreadsheets/d/11Ua4uBr6o0k-nORrZLEIIUkHJ9JRzRR0NyZfrhEEnc8/edit?usp=sharing
+
+* IO
+ * incompatible changes:
+ * When flushing file IO, you cannot assume that the metadata of the file
+ is updated immediately. On some platforms (especially Windows), it is
+ delayed until the filesystem load is decreased.
+
+* Math
+ * incompatible changes:
+ * Math.log now raises Math::DomainError instead of returning NaN if the
+ base is less than 0, and returns NaN instead of -infinity if both of
+ two arguments are 0.
+ * Math.atan2 now returns values like as expected by C99 if both two
+ arguments are infinity.
+
+* Proc
+ * incompatible changes:
+ * ArgumentError is no longer raised when lambda Proc is passed as a
+ block, and the number of yielded arguments does not match the formal
+ arguments of the lambda, if just an array is yielded and its length
+ matches.
+
+* Process
+ * Process execution methods such as Process.spawn opens the file in write
+ mode for redirect from [:out, :err].
+ Before Ruby 2.2, it was opened in read mode.
+
+=== Stdlib updates (outstanding ones only)
+
+* Digest
+ * Digest::HMAC has been removed just as previously noticed.
+
+* Etc
+ * New methods:
+ * Etc.uname
+ * Etc.sysconf
+ * Etc.confstr
+ * IO#pathconf
+
+* Find, Pathname
+ * Extended methods:
+ * find method accepts "ignore_error" keyword argument.
+
+* Pathname
+ * Pathname#/ is aliased to Pathname#+.
+ * New methods:
+ * Pathname#birthtime
+
+=== Stdlib compatibility issues (excluding feature bug fixes)
+
+* lib/mathn.rb
+ * Show deprecated warning [Feature #10169]
+
+* ext/date/lib/date/format.rb
+ * Removed because it's empty file.
+
+* Digest
+ * Digest::HMAC has finally ceased to exist. Use OpenSSL::HMAC or an external gem instead.
+
+* time.rb
+ * Time.parse, Time.strptime, Time.rfc2822, Time.xmlschema may produce
+ fixed-offset Time objects.
+ It is happen when usual localtime doesn't preserve the offset from UTC.
+ * Time.httpdate produces always UTC Time object.
+ * Time.strptime raises ArgumentError when no date information.
+
+* lib/rational.rb
+ * Removed because it is deprecated from 2009.
+
+* lib/complex.rb
+ * Removed because it is deprecated from 2009.
+
+* lib/prettyprint.rb
+ * Removed PrettyPrint#first?
+
+* lib/minitest/*.rb
+ * Removed because it conflicts to minitest 5. [Feature #9711]
+
+* lib/test/**/*.rb
+ * Removed because it conflicts to minitest 5, and it was just an wrapper
+ of minitest 4. [Feature #9711]
+
+* lib/uri
+ * support RFC 3986. [Feature #2542]
+
+* GServer
+ * GServer is extracted to gserver gem. It's unmaintain code.
+
+* Logger
+ * Logger::Application is extracted to logger-application gem. It's unmaintain code.
+
+* Prime
+ * incompatible changes:
+ * Prime.prime? now returns false for negative numbers. This method
+ should not be used to know the number is composite or not. [Bug #7395]
+
+* Psych
+ * Removed Psych::EngineManager [Bug #8344]
+
+=== Built-in global variables compatibility issues
+
+=== C API updates
+
+* Deprecated APIs removed. [Feature #9502]
+
+ Check_SafeStr -> SafeStringValue
+ rb_check_safe_str -> SafeStringValue
+ rb_quad_pack -> rb_integer_pack
+ rb_quad_unpack -> rb_integer_unpack
+ rb_read_check : access struct FILE internal. no replacement.
+ rb_struct_iv_get : internal function. no replacement.
+ struct rb_blocking_region_buffer : internal type. no replacement.
+ rb_thread_blocking_region_begin -> rb_thread_call_without_gvl family
+ rb_thread_blocking_region_end -> rb_thread_call_without_gvl family
+ TRAP_BEG -> rb_thread_call_without_gvl family
+ TRAP_END -> rb_thread_call_without_gvl family
+ rb_thread_select -> rb_thread_fd_select
+ struct rb_exec_arg : internal type. no replacement.
+ rb_exec : internal function. no replacement.
+ rb_exec_arg_addopt : internal function. no replacement.
+ rb_exec_arg_fixup : internal function. no replacement.
+ rb_exec_arg_init : internal function. no replacement.
+ rb_exec_err : internal function. no replacement.
+ rb_fork : internal function. no replacement.
+ rb_fork_err : internal function. no replacement.
+ rb_proc_exec_n : internal function. no replacement.
+ rb_run_exec_options : internal function. no replacement.
+ rb_run_exec_options_err : internal function. no replacement.
+ rb_thread_blocking_region -> rb_thread_call_without_gvl family
+ rb_thread_polling -> rb_thread_wait_for
+ rb_big2str0 : internal function. no replacement.
+ rb_big2ulong_pack -> rb_integer_pack
+ rb_gc_set_params : internal function. no replacement.
+
+* struct RBignum is hidden. [Feature #6083]
+ Use rb_integer_pack and rb_integer_unpack instead.
+
+* struct RRational is hidden. [Feature #9513]
+ Use rb_rational_num and rb_rational_den instead.
+
+* rb_big_new and rb_big_resize takes a size_t instead of long.
+
+* rb_num2long returns a long instead of SIGNED_VALUE.
+
+* rb_num2ulong returns an unsigned long instead of VALUE.
+
+* st hash table uses power-of-two sizes for speed [Feature #9425].
+ Lookups are 10-25% faster if using appropriate hash functions.
+ However, weaknesses in hash distribution can no longer be masked
+ by prime number-sized tables, so extensions may need to tweak
+ hash functions to ensure good distribution.
+
+* rb_sym2str() added. This is almost same as `rb_id2str(SYM2ID(sym))`
+ but not pinning a dynamic symbol.
+
+* rb_str_cat_cstr() added. This is same as `rb_str_cat2()`.
+
+* `rb_str_substr()` and `rb_str_subseq()` now share middle of a string,
+ but not only the end of a string. Therefore, result strings may not
+ be NUL-terminated, `StringValueCStr()` is needed calling to obtain a
+ NUL-terminated C string.
+
+* rb_tracepoint_new() supports new internal events accessible only from C:
+ * RUBY_INTERNAL_EVENT_GC_ENTER
+ * RUBY_INTERNAL_EVENT_GC_EXIT
+ r47528
diff --git a/README b/README
deleted file mode 100644
index dd93c592be..0000000000
--- a/README
+++ /dev/null
@@ -1,133 +0,0 @@
-* What's Ruby
-
-Ruby is the interpreted scripting language for quick and
-easy object-oriented programming. It has many features to
-process text files and to do system management tasks (as in
-Perl). It is simple, straight-forward, and extensible.
-
-* Features of Ruby
-
- + Simple Syntax
- + *Normal* Object-Oriented features(ex. class, method calls)
- + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
- + Operator Overloading
- + Exception Handling
- + Iterators and Closures
- + Garbage Collection
- + Dynamic Loading of Object files(on some architecture)
- + Highly Portable(works on many UNIX machines, and on DOS,
- Windows, Mac, BeOS etc.)
-
-* How to get Ruby
-
-The Ruby distribution can be found on
-
- ftp://ftp.netlab.co.jp/pub/lang/ruby/
-
-* How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
- 1. Run ./configure, which will generate config.h and Makefile.
-
- 2. Edit defines.h if you need. Probably this step will not need.
-
- 3. Remove comment mark(#) before the module names from ext/Setup (or
- add module names if not present), if you want to link modules
- statically.
-
- If you don't want to compile non static extension modules
- (probably on architectures which does not allow dynamic loading),
- remove comment mark from the line "#option nodynamic" in
- ext/Setup.
-
- 4. Run make.
-
- 5. Optionally, run 'make test' to check whether the compiled Ruby
- interpreter works well. If you see the message "test succeeded",
- your ruby works as it should (hopefully).
-
- 6. Run 'make install'
-
- You may have to be a super user to install ruby.
-
-If you fail to compile ruby, please send the detailed error report with
-the error log and machine/OS type, to help others.
-
-* Copying
-
-Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.co.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-(see COPYING file), or the conditions below:
-
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
-
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
-
- a) place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
-
- b) use the modified software only within your corporation or
- organization.
-
- c) rename any non-standard executables so the names do not conflict
- with standard executables, which must also be provided.
-
- d) make other distribution arrangements with the author.
-
- 3. You may distribute the software in object code or executable
- form, provided that you do at least ONE of the following:
-
- a) distribute the executables and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
-
- b) accompany the distribution with the machine-readable source of
- the software.
-
- c) give non-standard executables non-standard names, with
- instructions on where to get the original software distribution.
-
- d) make other distribution arrangements with the author.
-
- 4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under this terms.
- They are gc.c(partly), utils.c(partly), regex.[ch], fnmatch.[ch],
- glob.c, st.[ch] and some files under the ./missing directory. See
- each file for the copying condition.
-
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
-
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
-
-* Ruby home-page
-
-The URL of the Ruby home-page is:
-
- http://www.netlab.co.jp/ruby/
-
-* The Author
-
-Feel free to send comments and bug reports to the author. Here is the
-author's latest mail address:
-
- matz@netlab.co.jp
-
--------------------------------------------------------
-created at: Thu Aug 3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.EXT b/README.EXT
index 297b31b468..f7ee0022df 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1,59 +1,62 @@
-.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
+# README.EXT - -*- RDoc -*- created at: Mon Aug 7 16:45:54 JST 1995
-This document explains how to make extention modules for Ruby.
+This document explains how to make extension libraries for Ruby.
-1¡¥Basic knowledge
+= Basic Knowledge
In C, variables have types and data do not have types. In contrast,
-Ruby variables do not have static type and data themselves have
-types. So, data need to be converted across the languages.
-
-Data in Ruby represented C type `VALUE'. Each VALUE data have its
-data-type.
-
-To retrieve an C data from the VALUE, you need to:
-
- (1) Identify VALUE's data type
- (2) Convert VALUE into C data
-
-Converting to wrong data type may cause serious promblems.
-
-
-1.1 Data-types
-
-Ruby interpreter has data-types as below:
-
- T_NIL nil
- T_OBJECT ordinaly object
- T_CLASS class
- T_MODULE module
- T_FLOAT floating point number
- T_STRING string
- T_REGEXP regular expression
- T_ARRAY array
- T_FIXNUM Fixnum(31bit integer)
- T_HASH assosiative array
- T_STRUCT (Ruby) structure
- T_BIGNUM multi precision integer
- T_TRUE true
- T_FALSE false
- T_DATA data
-
-Otherwise, there are several other types used internally:
-
- T_ICLASS
- T_MATCH
- T_VARMAP
- T_SCOPE
- T_NODE
+Ruby variables do not have a static type, and data themselves have
+types, so data will need to be converted between the languages.
+
+Data in Ruby are represented by the C type `VALUE'. Each VALUE data
+has its data-type.
+
+To retrieve C data from a VALUE, you need to:
+
+1. Identify the VALUE's data type
+2. Convert the VALUE into C data
+
+Converting to the wrong data type may cause serious problems.
+
+== Data-Types
+
+The Ruby interpreter has the following data types:
+
+T_NIL :: nil
+T_OBJECT :: ordinary object
+T_CLASS :: class
+T_MODULE :: module
+T_FLOAT :: floating point number
+T_STRING :: string
+T_REGEXP :: regular expression
+T_ARRAY :: array
+T_HASH :: associative array
+T_STRUCT :: (Ruby) structure
+T_BIGNUM :: multi precision integer
+T_FIXNUM :: Fixnum(31bit or 63bit integer)
+T_COMPLEX :: complex number
+T_RATIONAL :: rational number
+T_FILE :: IO
+T_TRUE :: true
+T_FALSE :: false
+T_DATA :: data
+T_SYMBOL :: symbol
+
+In addition, there are several other types used internally:
+
+T_ICLASS :: included module
+T_MATCH :: MatchData object
+T_UNDEF :: undefined
+T_NODE :: syntax tree node
+T_ZOMBIE :: object awaiting finalization
Most of the types are represented by C structures.
-1.2 Check Data Type of the VALUE
+== Check Data Type of the VALUE
-The macro TYPE() defined in ruby.h shows data-type of the VALUE.
+The macro TYPE() defined in ruby.h shows the data type of the VALUE.
TYPE() returns the constant number T_XXXX described above. To handle
-data-types, the code will be like:
+data types, your code will look something like this:
switch (TYPE(obj)) {
case T_FIXNUM:
@@ -67,175 +70,289 @@ data-types, the code will be like:
break;
default:
/* raise exception */
- Fail("not valid value");
+ rb_raise(rb_eTypeError, "not valid value");
break;
}
-There is the data-type check function.
+There is the data-type check function
void Check_Type(VALUE value, int type)
-It raises an exception, if the VALUE does not have the type specified.
+which raises an exception if the VALUE does not have the type
+specified.
-There are faster check-macros for fixnums and nil.
+There are also faster check macros for fixnums and nil.
FIXNUM_P(obj)
NIL_P(obj)
-1.3 Convert VALUE into C data
+== Convert VALUE into C Data
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
respectively. They are singletons for the data type.
-
-The T_FIXNUM data is the 31bit length fixed integer (63bit length on
-some machines), which can be conver to the C integer by using
-FIX2INT() macro. There also be NUM2INT() which converts any Ruby
-numbers into C integer. The NUM2INT() macro includes type check, so
-the exception will be raised if conversion failed.
+The equivalent C constants are: Qnil, Qfalse, Qtrue.
+Note that Qfalse is false in C also (i.e. 0), but not Qnil.
+
+The T_FIXNUM data is a 31bit or 63bit length fixed integer.
+This size is depend on the size of long: if long is 32bit then
+T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
+T_FIXNUM can be converted to a C integer by using the
+FIX2INT() macro or FIX2LONG(). Though you have to check that the
+data is really FIXNUM before using them, they are faster. FIX2LONG()
+never raises exceptions, but FIX2INT() raises RangeError if the
+result is bigger or smaller than the size of int.
+There are also NUM2INT() and NUM2LONG() which converts any Ruby
+numbers into C integers. These macros includes a type check,
+so an exception will be raised if the conversion failed. NUM2DBL()
+can be used to retrieve the double float value in the same way.
+
+You can use the macros
+StringValue() and StringValuePtr() to get a char* from a VALUE.
+StringValue(var) replaces var's value with the result of "var.to_str()".
+StringValuePtr(var) does same replacement and returns char*
+representation of var. These macros will skip the replacement if var
+is a String. Notice that the macros take only the lvalue as their
+argument, to change the value of var in place.
+
+You can also use the macro named StringValueCStr(). This is just
+like StringValuePtr(), but always add nul character at the end of
+the result. If the result contains nul character, this macro causes
+the ArgumentError exception.
+StringValuePtr() doesn't guarantee the existence of a nul at the end
+of the result, and the result may contain nul.
Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. VALUE of the type which has corresponding structure
-can be cast to retrieve the pointer to the struct. The casting macro
-RXXXX for each data type like RARRAY(obj). see "ruby.h".
-
-For example, `RSTRING(size)->len' is the way to get the size of the
-Ruby String object. The allocated region can be accessed by
-`RSTRING(str)->ptr'. For arrays, `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
+for T_ARRAY etc. The VALUE of the type which has the corresponding
+structure can be cast to retrieve the pointer to the struct. The
+casting macro will be of the form RXXXX for each data type; for
+instance, RARRAY(obj). See "ruby.h". However, we do not recommend
+to access RXXXX data directly because these data structure is complex.
+Use corresponding rb_xxx() functions to access internal struct.
+For example, to access an entry of array, use rb_ary_entry(ary, offset)
+and rb_ary_store(ary, offset, obj).
+
+There are some accessing macros for structure members, for example
+`RSTRING_LEN(str)' to get the size of the Ruby String object. The
+allocated region can be accessed by `RSTRING_PTR(str)'.
Notice: Do not change the value of the structure directly, unless you
-are responsible about the result. It will be the cause of interesting
-bugs.
+are responsible for the result. This ends up being the cause of
+interesting bugs.
+
+== Convert C Data into VALUE
+
+To convert C data to Ruby values:
+
+FIXNUM ::
+
+ left shift 1 bit, and turn on LSB.
+
+Other pointer values::
+
+ cast to VALUE.
+
+You can determine whether a VALUE is pointer or not by checking its LSB.
+
+Notice Ruby does not allow arbitrary pointer values to be a VALUE. They
+should be pointers to the structures which Ruby knows about. The known
+structures are defined in <ruby.h>.
+
+To convert C numbers to Ruby values, use these macros.
+
+INT2FIX() :: for integers within 31bits.
+INT2NUM() :: for arbitrary sized integer.
+
+INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
+range, but is a bit slower.
+
+== Manipulating Ruby Data
+
+As I already mentioned, it is not recommended to modify an object's
+internal structure. To manipulate objects, use the functions supplied
+by the Ruby interpreter. Some (not all) of the useful functions are
+listed below:
+
+=== String Functions
+
+rb_str_new(const char *ptr, long len) ::
+
+ Creates a new Ruby string.
+
+rb_str_new2(const char *ptr) ::
+rb_str_new_cstr(const char *ptr) ::
+
+ Creates a new Ruby string from a C string. This is equivalent to
+ rb_str_new(ptr, strlen(ptr)).
+
+rb_tainted_str_new(const char *ptr, long len) ::
+
+ Creates a new tainted Ruby string. Strings from external data
+ sources should be tainted.
+
+rb_tainted_str_new2(const char *ptr) ::
+rb_tainted_str_new_cstr(const char *ptr) ::
-1.4 Convert C data into VALUE
+ Creates a new tainted Ruby string from a C string.
-VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
+rb_sprintf(const char *format, ...) ::
+rb_vsprintf(const char *format, va_list ap) ::
- * FIXNUM¤Î¾ì¹ç
+ Creates a new Ruby string with printf(3) format.
- 1bit±¦¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
+ Note: In the format string, %i is used for Object#to_s (or Object#inspect if
+ '+' flag is set) output (and related argument must be a VALUE). For integers
+ in format strings, use %d.
- * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
+rb_str_cat(VALUE str, const char *ptr, long len) ::
- ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
+ Appends len bytes of data from ptr to the Ruby string.
-¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
-¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
-¤¤¤ë)¡¥
+rb_str_cat2(VALUE str, const char* ptr) ::
+rb_str_cat_cstr(VALUE str, const char* ptr) ::
-¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
-¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
-ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
-¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
-¤Î¤â¤Î)¤À¤±¤Ë¤·¤Æ¤ª¤¤¤Æ¤¯¤À¤µ¤¤¡¥
+ Appends C string ptr to Ruby string str. This function is
+ equivalent to rb_str_cat(str, ptr, strlen(ptr)).
-To convert C numbers to Ruby value, use these macros.
+rb_str_catf(VALUE str, const char* format, ...) ::
+rb_str_vcatf(VALUE str, const char* format, va_list ap) ::
- INT2FIX() for intergers within 31bits.
- INT2NUM() for arbitrary sized integer.
+ Appends C string format and successive arguments to Ruby string
+ str according to a printf-like format. These functions are
+ equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
+ rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
-INT2NUM() converts integers into Bignums, if it is out of FIXNUM
-range, but bit slower.
+rb_enc_str_new(const char *ptr, long len, rb_encoding *enc) ::
+rb_enc_str_new_cstr(const char *ptr, rb_encoding *enc) ::
-1.5 Manipulate Ruby data
+ Creates a new Ruby string with the specified encoding.
-As I already told, it is not recommended to modify object's internal
-structure. To manipulate objects, use functions supplied by Ruby
-interpreter. Useful functions are listed below (not all):
+rb_usascii_str_new(const char *ptr, long len) ::
+rb_usascii_str_new_cstr(const char *ptr) ::
- String funtions
+ Creates a new Ruby string with encoding US-ASCII.
- rb_str_new(char *ptr, int len)
+rb_str_resize(VALUE str, long len) ::
- Creates a new Ruby string.
+ Resizes Ruby string to len bytes. If str is not modifiable, this
+ function raises an exception. The length of str must be set in
+ advance. If len is less than the old length the content beyond
+ len bytes is discarded, else if len is greater than the old length
+ the content beyond the old length bytes will not be preserved but
+ will be garbage. Note that RSTRING_PTR(str) may change by calling
+ this function.
- rb_str_new2(char *ptr)
+rb_str_set_len(VALUE str, long len) ::
- Creates a new Ruby string from C string. This is equivalent to
- rb_str_new(ptr, strlen(ptr)).
+ Sets the length of Ruby string. If str is not modifiable, this
+ function raises an exception. This function preserves the content
+ upto len bytes, regardless RSTRING_LEN(str). len must not exceed
+ the capacity of str.
- rb_str_cat(VALUE str, char *ptr, int len)
+=== Array Functions
- Appends len bytes data from ptr to the Ruby string.
+rb_ary_new() ::
- Array functions
+ Creates an array with no elements.
- rb_ary_new()
+rb_ary_new2(long len) ::
+rb_ary_new_capa(long len) ::
- Creates an array with no element.
+ Creates an array with no elements, allocating internal buffer
+ for len elements.
- rb_ary_new2(int len)
+rb_ary_new3(long n, ...) ::
+rb_ary_new_from_args(long n, ...) ::
- Creates an array with no element, with allocating internal buffer
- for len elements.
+ Creates an n-element array from the arguments.
- rb_ary_new3(int n, ...)
+rb_ary_new4(long n, VALUE *elts) ::
+rb_ary_new_from_values(long n, VALUE *elts) ::
- Creates an n-elements array from arguments.
+ Creates an n-element array from a C array.
- rb_ary_new4(int n, VALUE *elts)
+rb_ary_to_ary(VALUE obj) ::
- Creates an n-elements array from C array.
+ Converts the object into an array.
+ Equivalent to Object#to_ary.
- rb_ary_push(VALUE ary, VALUE val)
- rb_ary_pop(VALUE ary)
- rb_ary_shift(VALUE ary)
- rb_ary_unshift(VALUE ary, VALUE val)
- rb_ary_entry(VALUE ary, int idx)
+There are many functions to operate an array. They may dump core if other
+types are given.
- Array operations. The first argument to each functions must be an
- array. They may dump core if other types given.
+rb_ary_aref(argc, VALUE *argv, VALUE ary) ::
-2. Extend Ruby with C
+ Equivalent to Array#[].
-¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
-½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
-¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
-²ð¤·¤Þ¤¹¡¥
+rb_ary_entry(VALUE ary, long offset) ::
-2.1 Add new features to Ruby
+ ary[offset]
+
+rb_ary_store(VALUE ary, long offset, VALUE obj) ::
+
+ ary[offset] = obj
+
+rb_ary_subseq(VALUE ary, long beg, long len) ::
+
+ ary[beg, len]
+
+rb_ary_push(VALUE ary, VALUE val) ::
+rb_ary_pop(VALUE ary) ::
+rb_ary_shift(VALUE ary) ::
+rb_ary_unshift(VALUE ary, VALUE val) ::
+
+rb_ary_cat(VALUE ary, const VALUE *ptr, long len) ::
+
+ Appends len elements of objects from ptr to the array.
+
+= Extending Ruby with C
+
+== Adding New Features to Ruby
You can add new features (classes, methods, etc.) to the Ruby
-interpreter. Ruby provides the API to define things below:
+interpreter. Ruby provides APIs for defining the following things:
+
+* Classes, Modules
+* Methods, Singleton Methods
+* Constants
- * Classes, Modules
- * Methods, Singleton Methods
- * Constants
+=== Class and Module Definition
-2.1.1 Class/module definition
+To define a class or module, use the functions below:
-To define class or module, use functions below:
+ VALUE rb_define_class(const char *name, VALUE super)
+ VALUE rb_define_module(const char *name)
- VALUE rb_define_class(char *name, VALUE super)
- VALUE rb_define_module(char *name)
+These functions return the newly created class or module. You may
+want to save this reference into a variable to use later.
-These functions return the newly created class ot module. You may
-want to save this reference into the variable to use later.
+To define nested classes or modules, use the functions below:
-2.1.2 Method/singleton method definition
+ VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE outer, const char *name)
-To define methods or singleton methods, use functions below:
+=== Method and Singleton Method Definition
- void rb_define_method(VALUE class, char *name,
+To define methods or singleton methods, use these functions:
+
+ void rb_define_method(VALUE klass, const char *name,
VALUE (*func)(), int argc)
- void rb_define_singleton_method(VALUE object, char *name,
+ void rb_define_singleton_method(VALUE object, const char *name,
VALUE (*func)(), int argc)
The `argc' represents the number of the arguments to the C function,
-which must be less than 17. But I believe you don't need that much. :-)
+which must be less than 17. But I doubt you'll need that many.
-If `argc' is negative, it specifies calling sequence, not number of
-the arguments.
+If `argc' is negative, it specifies the calling sequence, not number of
+the arguments.
-If argc is -1, the function will be called like:
+If argc is -1, the function will be called as:
VALUE func(int argc, VALUE *argv, VALUE obj)
where argc is the actual number of arguments, argv is the C array of
the arguments, and obj is the receiver.
-if argc is -2, the arguments are passed in Ruby array. The function
+If argc is -2, the arguments are passed in a Ruby array. The function
will be called like:
VALUE func(VALUE obj, VALUE args)
@@ -243,15 +360,23 @@ will be called like:
where obj is the receiver, and args is the Ruby array containing
actual arguments.
-There're two more functions to define method. One is to define
-private method:
+There are some more functions to define methods. One takes an ID
+as the name of method to be defined. See also ID or Symbol below.
+
+ void rb_define_method_id(VALUE klass, ID name,
+ VALUE (*func)(ANYARGS), int argc)
- void rb_define_private_method(VALUE class, char *name,
+There are two functions to define private/protected methods:
+
+ void rb_define_private_method(VALUE klass, const char *name,
VALUE (*func)(), int argc)
+ void rb_define_protected_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
-The other is to define module function, which is private AND singleton
-method of the module. For example, sqrt is the module function
-defined in Math module. It can be call in the form like:
+At last, rb_define_module_function defines a module functions,
+which are private AND singleton methods of the module.
+For example, sqrt is the module function defined in Math module.
+It can be called in the following way:
Math.sqrt(4)
@@ -260,71 +385,135 @@ or
include Math
sqrt(4)
-To define module function
+To define module functions, use:
- void rb_define_module_function(VALUE module, char *name,
+ void rb_define_module_function(VALUE module, const char *name,
VALUE (*func)(), int argc)
-Oh, in addition, function-like method, which is private method defined
-in Kernel module, can be defined using:
+In addition, function-like methods, which are private methods defined
+in the Kernel module, can be defined using:
+
+ void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+To define an alias for the method,
- void rb_define_global_function(char *name, VALUE (*func)(), int argc)
+ void rb_define_alias(VALUE module, const char* new, const char* old);
+To define a reader/writer for an attribute,
-2.1.3 Constant definition
+ void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
+To define and undefine the `allocate' class method,
+
+ void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
+ void rb_undef_alloc_func(VALUE klass);
+
+func has to take the klass as the argument and return a newly
+allocated instance. This instance should be as empty as possible,
+without any expensive (including external) resources.
+
+If you are overriding an existing method of any ancestor of your class,
+you may rely on:
+
+ VALUE rb_call_super(int argc, const VALUE *argv)
+
+=== Constant Definition
We have 2 functions to define constants:
- void rb_define_const(VALUE class, char *name, VALUE val)
- void rb_define_global_const(char *name, VALUE val)
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
-The former is to define constant under specified class/module. The
-latter is to define global constant.
+The former is to define a constant under specified class/module. The
+latter is to define a global constant.
-2.2 Use Ruby features from C
+== Use Ruby Features from C
There are several ways to invoke Ruby's features from C code.
-2.2.1 Evaluate Ruby Program in String
+=== Evaluate Ruby Programs in a String
-Easiest way to call Ruby's function from C program is to evaluate the
-string as Ruby program. This function will do the job.
+The easiest way to use Ruby's functionality from a C program is to
+evaluate the string as Ruby program. This function will do the job:
- VALUE rb_eval_string(char *str)
+ VALUE rb_eval_string(const char *str)
-Evaluation is done under current context, thus current local variables
+Evaluation is done under the current context, thus current local variables
of the innermost method (which is defined by Ruby) can be accessed.
-2.2.2 ID or Symbol
+Note that the evaluation can raise an exception. There is a safer
+function:
+
+ VALUE rb_eval_string_protect(const char *str, int *state)
+
+It returns nil when an error occur. Moreover, *state is zero if str was
+successfully evaluated, or nonzero otherwise.
+
+=== ID or Symbol
You can invoke methods directly, without parsing the string. First I
-need to explain about symbols (which data type is ID). ID is the
-integer number to represent Ruby's identifiers such as variable names.
-It can be accessed from Ruby in the form like:
+need to explain about ID. ID is the integer number to represent
+Ruby's identifiers such as variable names. The Ruby data type
+corresponding to ID is Symbol. It can be accessed from Ruby in the
+form:
+
+ :Identifier
+
+or
+
+ :"any kind of string"
+
+You can get the ID value from a string within C code by using
+
+ rb_intern(const char *name)
+ rb_intern_str(VALUE name)
+
+You can retrieve ID from Ruby object (Symbol or String) given as an
+argument by using
- :Identifier
+ rb_to_id(VALUE symbol)
+ rb_check_id(volatile VALUE *name)
+ rb_check_id_cstr(const char *name, long len, rb_encoding *enc)
-You can get the symbol value from string within C code, by using
+These functions try to convert the argument to a String if it was not
+a Symbol nor a String. The second function stores the converted
+result into *name, and returns 0 if the string is not a known symbol.
+After this function returned a non-zero value, *name is always a
+Symbol or a String, otherwise it is a String if the result is 0.
+The third function takes NUL-terminated C string, not Ruby VALUE.
- rb_intern(char *name)
+You can retrieve Symbol from Ruby object (Symbol or String) given as
+an argument by using
-In addition, the symbols for one character operators (e.g +) is the
-code for that character.
+ rb_to_symbol(VALUE name)
+ rb_check_symbol(volatile VALUE *namep)
+ rb_check_symbol_cstr(const char *ptr, long len, rb_encoding *enc)
-2.2.3 Invoke Ruby method from C
+These functions are similar to above functions except that these
+return a Symbol instead of an ID.
+
+You can convert C ID to Ruby Symbol by using
+
+ VALUE ID2SYM(ID id)
+
+and to convert Ruby Symbol object to ID, use
+
+ ID SYM2ID(VALUE symbol)
+
+=== Invoke Ruby Method from C
To invoke methods directly, you can use the function below
VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-This function invokes the method of the recv, which name is specified
-by the symbol mid.
+This function invokes a method on the recv, with the method name
+specified by the symbol mid.
-2.2.4 Accessing the variables and constants
+=== Accessing the Variables and Constants
-You can access class variables, and instance variables using access
-functions. Also, global variables can be shared between both worlds.
-There's no way to access Ruby's local variables.
+You can access class variables and instance variables using access
+functions. Also, global variables can be shared between both
+environments. There's no way to access Ruby's local variables.
The functions to access/modify instance variables are below:
@@ -337,678 +526,1151 @@ To access the constants of the class/module:
VALUE rb_const_get(VALUE obj, ID id)
-See 2.1.3 for defining new constant.
+See also Constant Definition above.
-3. Informatin sharing between Ruby and C
+= Information Sharing Between Ruby and C
-3.1 Ruby constant that C can be accessed from C
+=== Ruby Constants That C Can Be Accessed From C
-Following Ruby constants can be referred from C.
+As stated in section 1.3,
+the following Ruby constants can be referred from C.
Qtrue
Qfalse
-Boolean values. Qfalse is false in the C also (i.e. 0).
+Boolean values. Qfalse is false in C also (i.e. 0).
Qnil
Ruby nil in C scope.
-3.2 Global variables shared between C and Ruby
+== Global Variables Shared Between C and Ruby
-C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
-ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
-¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
+Information can be shared between the two environments using shared global
+variables. To define them, you can use functions listed below:
- void rb_define_variable(char *name, VALUE *var)
+ void rb_define_variable(const char *name, VALUE *var)
-This function defines the variable which is shared by the both world.
-The value of the global variable pointerd by `var', can be accessed
+This function defines the variable which is shared by both environments.
+The value of the global variable pointed to by `var' can be accessed
through Ruby's global variable named `name'.
-You can define read-only (from Ruby, of course) variable by the
+You can define read-only (from Ruby, of course) variables using the
function below.
- void rb_define_readonly_variable(char *name, VALUE *var)
+ void rb_define_readonly_variable(const char *name, VALUE *var)
-¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
-¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
-Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
+You can defined hooked variables. The accessor functions (getter and
+setter) are called on access to the hooked variables.
- void rb_define_hooked_variable(char *name, VALUE *var,
- VALUE (*getter)(), VALUE (*setter)())
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
-¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
-¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
-¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
-setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
+If you need to supply either setter or getter, just supply 0 for the
+hook you don't need. If both hooks are 0, rb_define_hooked_variable()
+works just like rb_define_variable().
-# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
+The prototypes of the getter and setter functions are as follows:
-¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+ VALUE (*getter)(ID id, VALUE *var);
+ void (*setter)(VALUE val, ID id, VALUE *var);
- void rb_define_virtual_variable(char *name,
- VALUE (*getter)(), VALUE (*setter)())
-¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
-getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
+Also you can define a Ruby global variable without a corresponding C
+variable. The value of the variable will be set/get only by hooks.
-The prototypes of the getter and setter functions are as following:
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
- (*getter)(ID id, void *data, struct global_entry* entry);
- (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+The prototypes of the getter and setter functions are as follows:
-3.3 Encapsulate C data into Ruby object
+ VALUE (*getter)(ID id);
+ void (*setter)(VALUE val, ID id);
-C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
-¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
-To wrapping and objectify the C pointer, use Data_Wrap_Struct().
+== Encapsulate C Data into a Ruby Object
- Data_Wrap_Struct(class,mark,free,ptr)
+To wrap and objectify a C pointer as a Ruby object (so called
+DATA), use Data_Wrap_Struct().
-Data_Wrap_Struct() returns a created Data object.
+ Data_Wrap_Struct(klass, mark, free, sval)
-class¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
-¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
-»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
+Data_Wrap_Struct() returns a created DATA object. The klass argument
+is the class for the DATA object. The mark argument is the function
+to mark Ruby objects pointed by this data. The free argument is the
+function to free the pointer allocation. If this is -1, the pointer
+will be just freed. The functions mark and free will be called from
+garbage collector.
-# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
+These mark / free functions are invoked during GC execution. No
+object allocations are allowed during it, so do not allocate ruby
+objects inside them.
-free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
-´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥
+You can allocate and wrap the structure in one step.
-C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
-¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- Data_Make_Struct(class, type, mark, free, sval)
+ Data_Make_Struct(klass, type, mark, free, sval)
This macro returns an allocated Data object, wrapping the pointer to
-the structure, which is also allocated.
+the structure, which is also allocated. This macro works like:
+
+ (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-Arguments, class, mark, free, works like thier counterpart of
-Data_Wrap_Struct(). The pointer to allocated structure will be
-assigned to sval, which should be the pointer to the type specified.
+Arguments klass, mark, and free work like their counterparts in
+Data_Wrap_Struct(). A pointer to the allocated structure will be
+assigned to sval, which should be a pointer of the type specified.
To retrieve the C pointer from the Data object, use the macro
Data_Get_Struct().
Data_Get_Struct(obj, type, sval)
-The pointer to the structure will be assigned to the variable sval.
+A pointer to the structure will be assigned to the variable sval.
-See example below for detail.
+See the example below for details.
-4¡¥Example - Create dbm module
+= Example - Creating dbm Extension
-¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
-Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥â¥¸¥å¡¼¥ë¤òÎã¤Ë
-¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
+OK, here's the example of making an extension library. This is the
+extension to access DBMs. The full source is included in the ext/
+directory in the Ruby's source tree.
-(1) make the directory
+== Make the Directory
% mkdir ext/dbm
Make a directory for the extension library under ext directory.
-(2) create MANIFEST file
+== Design the Library
- % cd ext/dbm
- % touch MANIFEST
+You need to design the library features, before making it.
-There should be MANIFEST file in the directory for the extension
-library. Make empty file now.
+== Write the C Code
-(3) design the library
+You need to write C code for your extension library. If your library
+has only one source file, choosing ``LIBRARY.c'' as a file name is
+preferred. On the other hand, in case your library has multiple source
+files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
+with an intermediate file ``LIBRARY.o'' on some platforms.
+Note that some functions in mkmf library described below generate
+a file ``conftest.c'' for checking with compilation. You shouldn't
+choose ``conftest.c'' as a name of a source file.
+
+Ruby will execute the initializing function named ``Init_LIBRARY'' in
+the library. For example, ``Init_dbm()'' will be executed when loading
+the library.
+
+Here's the example of an initializing function.
+
+ void
+ Init_dbm(void)
+ {
+ /* define DBM class */
+ cDBM = rb_define_class("DBM", rb_cObject);
+ /* DBM includes Enumerable module */
+ rb_include_module(cDBM, rb_mEnumerable);
+
+ /* DBM has class method open(): arguments are received as C array */
+ rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+ /* DBM instance method close(): no args */
+ rb_define_method(cDBM, "close", fdbm_close, 0);
+ /* DBM instance method []: 1 argument */
+ rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+
+ /* ... */
+
+ /* ID for a instance variable to store DBM data */
+ id_dbm = rb_intern("dbm");
+ }
+
+The dbm extension wraps the dbm struct in the C environment using
+Data_Make_Struct.
+
+ struct dbmdata {
+ int di_size;
+ DBM *di_dbm;
+ };
+
+ obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+
+This code wraps the dbmdata structure into a Ruby object. We avoid
+wrapping DBM* directly, because we want to cache size information.
+
+To retrieve the dbmdata structure from a Ruby object, we define the
+following macro:
+
+ #define GetDBM(obj, dbmp) do {\
+ Data_Get_Struct(obj, struct dbmdata, dbmp);\
+ if (dbmp->di_dbm == 0) closed_dbm();\
+ } while (0)
+
+This sort of complicated macro does the retrieving and close checking for
+the DBM.
+
+There are three kinds of way to receive method arguments. First,
+methods with a fixed number of arguments receive arguments like this:
+
+ static VALUE
+ fdbm_delete(VALUE obj, VALUE keystr)
+ {
+ /* ... */
+ }
+
+The first argument of the C function is the self, the rest are the
+arguments to the method.
+
+Second, methods with an arbitrary number of arguments receive
+arguments like this:
+
+ static VALUE
+ fdbm_s_open(int argc, VALUE *argv, VALUE klass)
+ {
+ /* ... */
+ if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+ mode = 0666; /* default value */
+ }
+ /* ... */
+ }
+
+The first argument is the number of method arguments, the second
+argument is the C array of the method arguments, and the third
+argument is the receiver of the method.
+
+You can use the function rb_scan_args() to check and retrieve the
+arguments. The third argument is a string that specifies how to
+capture method arguments and assign them to the following VALUE
+references.
-You need to design the library features, before making it.
-(4) write C code.
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥êËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
-¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
-¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤È¤¤¤¦¥Õ¥¡
-¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
-¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥â¥¸¥å¡¼¥ë̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
-
-Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥â¥¸¥å¡¼¥ë̾¡×¤È
-¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤Î¾ì¹ç¡ÖInit_dbm¡×
-¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
-ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
-
---
-Init_dbm()
-{
- /* define DBM class */
- cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM includes Enumerate module */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM has class method open(): arguments are received as C array */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM instance method close(): no args */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM instance method []: 1 argument */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
- :
-
-}
---
-
-DBM¥â¥¸¥å¡¼¥ë¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
-¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-
-dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-struct dbmdata {
- int di_size;
- DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(class,struct dbmdata,0,free_dbm,dbmp);
---
-
-¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
-¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
-¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
-¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-#define GetDBM(obj, dbmp) {\
- Data_Get_Struct(obj, struct dbmdata, dbmp);\
- if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
-¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
-¤ë¤À¤±¤Ç¤¹¡¥
-
-DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
-°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
-¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
-fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_delete(obj, keystr)
- VALUE obj, keystr;
-{
- :
-}
---
-
-°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
-¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
-
-°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
-¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
-¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
-¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_s_open(argc, argv, class)
- int argc;
- VALUE *argv;
- VALUE class;
-{
- :
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- :
-}
---
-
-¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
-¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
-¤¨¤é¤ì¤Þ¤¹¡¥
-
-¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
-½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
-¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
-¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
-¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
-¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
-¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
-ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
-¤¦¤Ç¤¹¡¥
-
---
-static VALUE
-fdbm_indexes(obj, args)
- VALUE obj, args;
-{
- :
-}
---
+The following is an example of a method that takes arguments by Ruby's
+array:
+
+ static VALUE
+ thread_initialize(VALUE thread, VALUE args)
+ {
+ /* ... */
+ }
The first argument is the receiver, the second one is the Ruby array
which contains the arguments to the method.
-** Notice
-
-GC should know about global variables which refers Ruby's objects, but
-not exported to the Ruby world. You need to protect them by
+*Notice*: GC should know about global variables which refer to Ruby's objects,
+but are not exported to the Ruby world. You need to protect them by
void rb_global_variable(VALUE *var)
-(5) prepare extconf.rb
+== Prepare extconf.rb
+
+If the file named extconf.rb exists, it will be executed to generate
+Makefile.
-If there exists the file named extconf.rb, it will be executed to
-generate Makefile. If not, compilation scheme try to generate
-Makefile anyway.
+extconf.rb is the file for checking compilation conditions etc. You
+need to put
-extconf.rb¤Ï¥â¥¸¥å¡¼¥ë¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã¥¯¤Ê¤É
-¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø¿ô¤ò»È¤¦
-¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
+ require 'mkmf'
- have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
- have_func(func): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
- have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
- create_makefile(target): Makefile¤ÎÀ¸À®
+at the top of the file. You can use the functions below to check
+various conditions.
-°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
+ have_macro(macro[, headers[, opt]]): check whether macro is defined
+ have_library(lib[, func[, headers[, opt]]]): check whether library containing function exists
+ find_library(lib[, func, *paths]): find library from paths
+ have_func(func[, headers[, opt]): check whether function exists
+ have_var(var[, headers[, opt]]): check whether variable exists
+ have_header(header[, preheaders[, opt]]): check whether header file exists
+ find_header(header, *paths): find header from paths
+ have_framework(fw): check whether framework exists (for MacOS X)
+ have_struct_member(type, member[, headers[, opt]]): check whether struct has member
+ have_type(type[, headers[, opt]]): check whether type exists
+ find_type(type, opt, *headers): check whether type exists in headers
+ have_const(const[, headers[, opt]]): check whether constant is defined
+ check_sizeof(type[, headers[, opts]]): check size of type
+ check_signedness(type[, headers[, opts]]): check signedness of type
+ convertible_int(type[, headers[, opts]]): find convertible integer type
+ find_executable(bin[, path]): find executable file path
+ create_header(header): generate configured header
+ create_makefile(target[, target_prefix]): generate Makefile
- $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤Ê¤É)
- $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
+See MakeMakefile for full documentation of these functions.
-¥â¥¸¥å¡¼¥ë¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤Ê¤º¡¤¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³
-¥ó¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤Ï
-À¸À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
+The value of the variables below will affect the Makefile.
-(6) prepare depend (optional)
+ $CFLAGS: included in CFLAGS make variable (such as -O)
+ $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
+ $LDFLAGS: included in LDFLAGS make variable (such as -L)
+ $objs: list of object file names
+
+Normally, the object files list is automatically generated by searching
+source files, but you must define them explicitly if any sources will
+be generated while building.
+
+If a compilation condition is not fulfilled, you should not call
+``create_makefile''. The Makefile will not be generated, compilation will
+not be done.
+
+== Prepare Depend (Optional)
If the file named depend exists, Makefile will include that file to
-check dependency. You can make this file by invoking
+check dependencies. You can make this file by invoking
+
+ % gcc -MM *.c > depend
- % gcc -MM *.c > depend
+It's harmless. Prepare it.
-It's no harm. Prepare it.
+== Generate Makefile
-(7) MANIFEST¥Õ¥¡¥¤¥ë¤Ë¥Õ¥¡¥¤¥ë̾¤òÆþ¤ì¤ë
+Try generating the Makefile by:
- % find * -type f -print > MANIFEST
- % vi MANIFEST
+ ruby extconf.rb
-Append file names into MANIFEST. The compilation scheme requires
-MANIFEST only to be exist. But, you'd better take this step to
-distinguish required files.
+If the library should be installed under vendor_ruby directory
+instead of site_ruby directory, use --vendor option as follows.
-(8) make
+ ruby extconf.rb --vendor
-Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤
-ɬÍפˤè¤Ã¤Æ¤Ï¤½¤Î¥â¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô
-¤·¤Æ¤¯¤ì¤Þ¤¹¡¥extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®
-¤¬É¬Íפʻþ¤Ï¤Þ¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
+You don't need this step if you put the extension library under the ext
+directory of the ruby source tree. In that case, compilation of the
+interpreter will do this step for you.
-(9) debug
+== Run make
-You may need to rb_debug the module. The modules can be linked
-statically by adding directory name in the ext/Setup file,
-so that you can inspect the module by the debugger.
+Type
-(10) done, now you have the extension library
+ make
+
+to compile your extension. You don't need this step either if you have
+put the extension library under the ext directory of the ruby source tree.
+
+== Debug
+
+You may need to rb_debug the extension. Extensions can be linked
+statically by adding the directory name in the ext/Setup file so that
+you can inspect the extension with the debugger.
+
+== Done! Now You Have the Extension Library
You can do anything you want with your library. The author of Ruby
-will not claim any restriction about your code depending Ruby API.
+will not claim any restrictions on your code depending on the Ruby API.
Feel free to use, modify, distribute or sell your program.
-Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
+= Appendix A. Ruby Source Files Overview
-Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
-¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
-¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
-»×¤¤¤Þ¤¹¡¥
+== Ruby Language Core
-ruby language core
+class.c :: classes and modules
+error.c :: exception classes and exception mechanism
+gc.c :: memory management
+load.c :: library loading
+object.c :: objects
+variable.c :: variables and constants
- class.c
- error.c
- eval.c
- gc.c
- object.c
- parse.y
- variable.c
+== Ruby Syntax Parser
+
+parse.y :: grammar definition
+parse.c :: automatically generated from parse.y
+keywords :: reserved keywords
+lex.c :: automatically generated from keywords
-utility functions
+== Ruby Evaluator (a.k.a. YARV)
+
+ compile.c
+ eval.c
+ eval_error.c
+ eval_jump.c
+ eval_safe.c
+ insns.def : definition of VM instructions
+ iseq.c : implementation of VM::ISeq
+ thread.c : thread management and context switching
+ thread_win32.c : thread implementation
+ thread_pthread.c : ditto
+ vm.c
+ vm_dump.c
+ vm_eval.c
+ vm_exec.c
+ vm_insnhelper.c
+ vm_method.c
+
+ opt_insns_unif.def : instruction unification
+ opt_operand.def : definitions for optimization
+
+ -> insn*.inc : automatically generated
+ -> opt*.inc : automatically generated
+ -> vm.inc : automatically generated
+
+== Regular Expression Engine (Oniguruma)
- dln.c
- fnmatch.c
- glob.c
regex.c
- st.c
- util.c
+ regcomp.c
+ regenc.c
+ regerror.c
+ regexec.c
+ regparse.c
+ regsyntax.c
-ruby interpreter implementation
+== Utility Functions
+
+debug.c :: debug symbols for C debugger
+dln.c :: dynamic loading
+st.c :: general purpose hash table
+strftime.c :: formatting times
+util.c :: misc utilities
+
+== Ruby Interpreter Implementation
dmyext.c
+ dmydln.c
+ dmyencoding.c
+ id.c
inits.c
main.c
ruby.c
version.c
-class library
+ gem_prelude.rb
+ prelude.rb
+
+== Class Library
+
+array.c :: Array
+bignum.c :: Bignum
+compar.c :: Comparable
+complex.c :: Complex
+cont.c :: Fiber, Continuation
+dir.c :: Dir
+enum.c :: Enumerable
+enumerator.c :: Enumerator
+file.c :: File
+hash.c :: Hash
+io.c :: IO
+marshal.c :: Marshal
+math.c :: Math
+numeric.c :: Numeric, Integer, Fixnum, Float
+pack.c :: Array#pack, String#unpack
+proc.c :: Binding, Proc
+process.c :: Process
+random.c :: random number
+range.c :: Range
+rational.c :: Rational
+re.c :: Regexp, MatchData
+signal.c :: Signal
+sprintf.c :: String#sprintf
+string.c :: String
+struct.c :: Struct
+time.c :: Time
+
+defs/known_errors.def :: Errno::* exception classes
+-> known_errors.inc :: automatically generated
+
+== Multilingualization
+
+encoding.c :: Encoding
+transcode.c :: Encoding::Converter
+enc/*.c :: encoding classes
+enc/trans/* :: codepoint mapping tables
+
+== goruby Interpreter Implementation
+
+ goruby.c
+ golf_prelude.rb : goruby specific libraries.
+ -> golf_prelude.c : automatically generated
+
+
+= Appendix B. Ruby Extension API Reference
+
+== Types
+
+VALUE ::
+
+ The type for the Ruby object. Actual structures are defined in ruby.h,
+ such as struct RString, etc. To refer the values in structures, use
+ casting macros like RSTRING(obj).
+
+== Variables and Constants
+
+Qnil::
+ nil object
+
+Qtrue::
+ true object (default true value)
+
+Qfalse::
+ false object
+
+== C Pointer Wrapping
+
+Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval) ::
+
+ Wrap a C pointer into a Ruby object. If object has references to other
+ Ruby objects, they should be marked by using the mark function during
+ the GC process. Otherwise, mark should be 0. When this object is no
+ longer referred by anywhere, the pointer will be discarded by free
+ function.
+
+Data_Make_Struct(klass, type, mark, free, sval) ::
+
+ This macro allocates memory using malloc(), assigns it to the variable
+ sval, and returns the DATA encapsulating the pointer to memory region.
+
+Data_Get_Struct(data, type, sval) ::
+
+ This macro retrieves the pointer value from DATA, and assigns it to
+ the variable sval.
+
+== Checking Data Types
+
+TYPE(value) ::
+
+ Internal type (T_NIL, T_FIXNUM, etc.)
+
+FIXNUM_P(value) ::
+
+ Is +value+ a Fixnum?
+
+NIL_P(value) ::
+
+ Is +value+ nil?
+
+void Check_Type(VALUE value, int type) ::
+
+ Ensures +value+ is of the given internal +type+ or raises a TypeError
+
+SaveStringValue(value) ::
+
+ Checks that +value+ is a String and is not tainted
+
+== Data Type Conversion
+
+FIX2INT(value), INT2FIX(i) ::
+
+ Fixnum <-> integer
+
+FIX2LONG(value), LONG2FIX(l) ::
+
+ Fixnum <-> long
+
+NUM2INT(value), INT2NUM(i) ::
+
+ Numeric <-> integer
+
+NUM2UINT(value), UINT2NUM(ui) ::
+
+ Numeric <-> unsigned integer
+
+NUM2LONG(value), LONG2NUM(l) ::
+
+ Numeric <-> long
+
+NUM2ULONG(value), ULONG2NUM(ul) ::
+
+ Numeric <-> unsigned long
+
+NUM2LL(value), LL2NUM(ll) ::
+
+ Numeric <-> long long
+
+NUM2ULL(value), ULL2NUM(ull) ::
+
+ Numeric <-> unsigned long long
+
+NUM2OFFT(value), OFFT2NUM(off) ::
+
+ Numeric <-> off_t
+
+NUM2SIZET(value), SIZET2NUM(size) ::
+
+ Numeric <-> size_t
+
+NUM2SSIZET(value), SSIZET2NUM(ssize) ::
+
+ Numeric <-> ssize_t
+
+rb_integer_pack(value, words, numwords, wordsize, nails, flags), rb_integer_unpack(words, numwords, wordsize, nails, flags) ::
+
+ Numeric <-> Arbitrary size integer buffer
+
+NUM2DBL(value) ::
+
+ Numeric -> double
+
+rb_float_new(f) ::
+
+ double -> Float
+
+RSTRING_LEN(str) ::
+
+ String -> length of String data in bytes
+
+RSTRING_PTR(str) ::
+
+ String -> pointer to String data
+ Note that the result pointer may not be NUL-terminated
+
+StringValue(value) ::
+
+ Object with #to_str -> String
+
+StringValuePtr(value) ::
+
+ Object with #to_str -> pointer to String data
+
+StringValueCStr(value) ::
+
+ Object with #to_str -> pointer to String data without NUL bytes
+ It is guaranteed that the result data is NUL-terminated
+
+rb_str_new2(s) ::
+
+ char * -> String
+
+== Defining Class and Module
+
+VALUE rb_define_class(const char *name, VALUE super) ::
+
+ Defines a new Ruby class as a subclass of super.
+
+VALUE rb_define_class_under(VALUE module, const char *name, VALUE super) ::
+
+ Creates a new Ruby class as a subclass of super, under the module's
+ namespace.
+
+VALUE rb_define_module(const char *name) ::
+
+ Defines a new Ruby module.
+
+VALUE rb_define_module_under(VALUE module, const char *name) ::
+
+ Defines a new Ruby module under the module's namespace.
+
+void rb_include_module(VALUE klass, VALUE module) ::
+
+ Includes module into class. If class already includes it, just ignored.
+
+void rb_extend_object(VALUE object, VALUE module) ::
+
+ Extend the object with the module's attributes.
+
+== Defining Global Variables
+
+void rb_define_variable(const char *name, VALUE *var) ::
+
+ Defines a global variable which is shared between C and Ruby. If name
+ contains a character which is not allowed to be part of the symbol,
+ it can't be seen from Ruby programs.
+
+void rb_define_readonly_variable(const char *name, VALUE *var) ::
+
+ Defines a read-only global variable. Works just like
+ rb_define_variable(), except the defined variable is read-only.
+
+void rb_define_virtual_variable(const char *name, VALUE (*getter)(), VALUE (*setter)()) ::
+
+ Defines a virtual variable, whose behavior is defined by a pair of C
+ functions. The getter function is called when the variable is
+ referenced. The setter function is called when the variable is set to a
+ value. The prototype for getter/setter functions are:
+
+ VALUE getter(ID id)
+ void setter(VALUE val, ID id)
+
+ The getter function must return the value for the access.
+
+void rb_define_hooked_variable(const char *name, VALUE *var, VALUE (*getter)(), VALUE (*setter)()) ::
+
+ Defines hooked variable. It's a virtual variable with a C variable.
+ The getter is called as
+
+ VALUE getter(ID id, VALUE *var)
+
+ returning a new value. The setter is called as
+
+ void setter(VALUE val, ID id, VALUE *var)
+
+ GC requires C global variables which hold Ruby values to be marked.
+
+void rb_global_variable(VALUE *var)
+
+ Tells GC to protect these variables.
+
+== Constant Definition
+
+void rb_define_const(VALUE klass, const char *name, VALUE val) ::
+
+ Defines a new constant under the class/module.
+
+void rb_define_global_const(const char *name, VALUE val) ::
+
+ Defines a global constant. This is just the same as
+
+ rb_define_const(cKernal, name, val)
+
+== Method Definition
+
+rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
+
+ Defines a method for the class. func is the function pointer. argc
+ is the number of arguments. if argc is -1, the function will receive
+ 3 arguments: argc, argv, and self. if argc is -2, the function will
+ receive 2 arguments, self and args, where args is a Ruby array of
+ the method arguments.
+
+rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
+
+ Defines a private method for the class. Arguments are same as
+ rb_define_method().
+
+rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
+
+ Defines a singleton method. Arguments are same as rb_define_method().
+
+rb_scan_args(int argc, VALUE *argv, const char *fmt, ...) ::
+
+ Retrieve argument from argc and argv to given VALUE references
+ according to the format string. The format can be described in ABNF
+ as follows:
+
+ scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+ param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec /
+ pre-opt-post-arg-spec
+ pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
+ post-arg-spec := sym-for-variable-length-args
+ [num-of-trailing-mandatory-args]
+ pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args
+ num-of-trailing-mandatory-args
+ option-hash-arg-spec := sym-for-option-hash-arg
+ block-arg-spec := sym-for-block-arg
+
+ num-of-leading-mandatory-args := DIGIT ; The number of leading
+ ; mandatory arguments
+ num-of-optional-args := DIGIT ; The number of optional
+ ; arguments
+ sym-for-variable-length-args := "*" ; Indicates that variable
+ ; length arguments are
+ ; captured as a ruby array
+ num-of-trailing-mandatory-args := DIGIT ; The number of trailing
+ ; mandatory arguments
+ sym-for-option-hash-arg := ":" ; Indicates that an option
+ ; hash is captured if the last
+ ; argument is a hash or can be
+ ; converted to a hash with
+ ; #to_hash. When the last
+ ; argument is nil, it is
+ ; captured if it is not
+ ; ambiguous to take it as
+ ; empty option hash; i.e. '*'
+ ; is not specified and
+ ; arguments are given more
+ ; than sufficient.
+ sym-for-block-arg := "&" ; Indicates that an iterator
+ ; block should be captured if
+ ; given
+
+ For example, "12" means that the method requires at least one
+ argument, and at most receives three (1+2) arguments. So, the format
+ string must be followed by three variable references, which are to be
+ assigned to captured arguments. For omitted arguments, variables are
+ set to Qnil. NULL can be put in place of a variable reference, which
+ means the corresponding captured argument(s) should be just dropped.
+
+ The number of given arguments, excluding an option hash or iterator
+ block, is returned.
+
+== Invoking Ruby method
+
+VALUE rb_funcall(VALUE recv, ID mid, int narg, ...) ::
+
+ Invokes a method. To retrieve mid from a method name, use rb_intern().
+ Able to call even private/protected methods.
+
+VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv) ::
+VALUE rb_funcallv(VALUE recv, ID mid, int argc, VALUE *argv) ::
+
+ Invokes a method, passing arguments as an array of values.
+ Able to call even private/protected methods.
+
+VALUE rb_funcallv_public(VALUE recv, ID mid, int argc, VALUE *argv) ::
+
+ Invokes a method, passing arguments as an array of values.
+ Able to call only public methods.
+
+VALUE rb_eval_string(const char *str) ::
+
+ Compiles and executes the string as a Ruby program.
+
+ID rb_intern(const char *name) ::
+
+ Returns ID corresponding to the name.
+
+char *rb_id2name(ID id) ::
+
+ Returns the name corresponding ID.
+
+char *rb_class2name(VALUE klass) ::
+
+ Returns the name of the class.
+
+int rb_respond_to(VALUE object, ID id) ::
+
+ Returns true if the object responds to the message specified by id.
+
+== Instance Variables
+
+VALUE rb_iv_get(VALUE obj, const char *name) ::
- array.c
- bignum.c
- compar.c
- dir.c
- enum.c
- file.c
- hash.c
- io.c
- math.c
- numeric.c
- pack.c
- process.c
- random.c
- range.c
- re.c
- signal.c
- sprintf.c
- string.c
- struct.c
- time.c
+ Retrieve the value of the instance variable. If the name is not
+ prefixed by `@', that variable shall be inaccessible from Ruby.
-Appendix B. Ruby extension API reference
+VALUE rb_iv_set(VALUE obj, const char *name, VALUE val) ::
-C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+ Sets the value of the instance variable.
-** ·¿
+== Control Structure
- VALUE
+VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv, VALUE (*func) (ANYARGS), VALUE data2) ::
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
-ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
-ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
-̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤ë¡¥
+ Calls a method on the recv, with the method name specified by the
+ symbol mid, with argc arguments in argv, supplying func as the
+ block. When func is called as the block, it will receive the value
+ from yield as the first argument, and data2 as the second argument.
+ When yielded with multiple values (in C, rb_yield_values(),
+ rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
+ whereas yielded values can be gotten via argc/argv of the third/fourth
+ arguments.
-** Variables and constants
+[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2) ::
- Qnil
+ Calls the function func1, supplying func2 as the block. func1 will be
+ called with the argument arg1. func2 receives the value from yield as
+ the first argument, arg2 as the second argument.
-const: nil object
+ When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
+ This function is obsolete since 1.9; use rb_block_call instead.
- Qtrue
+VALUE rb_yield(VALUE val) ::
-const: Qtrue object(default true value)
+ Evaluates the block with value val.
- Qfalse
+VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
-const: Qfalse object
+ Calls the function func1, with arg1 as the argument. If an exception
+ occurs during func1, it calls func2 with arg2 as the argument. The
+ return value of rb_rescue() is the return value from func1 if no
+ exception occurs, from func2 otherwise.
-** C pointer wrapping
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
- Data_Wrap_Struct(VALUE class, void (*mark)(), void (*free)(), void *sval)
+ Calls the function func1 with arg1 as the argument, then calls func2
+ with arg2 if execution terminated. The return value from
+ rb_ensure() is that of func1 when no exception occurred.
-C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
-¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
-´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
-¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
-¤¬¤¢¤ë¡¥
+VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state) ::
- Data_Make_Struct(class, type, mark, free, sval)
+ Calls the function func with arg as the argument. If no exception
+ occurred during func, it returns the result of func and *state is zero.
+ Otherwise, it returns Qnil and sets *state to nonzero. If state is
+ NULL, it is not set in both cases.
+ You have to clear the error info with rb_set_errinfo(Qnil) when
+ ignoring the caught exception.
-type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
-¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
+void rb_jump_tag(int state) ::
- Data_Get_Struct(data, type, sval)
+ Continues the exception caught by rb_protect() and rb_eval_string_protect().
+ state must be the returned value from those functions. This function
+ never return to the caller.
-data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
+void rb_iter_break() ::
-** defining class/module
+ Exits from the current innermost block. This function never return to
+ the caller.
- VALUE rb_define_class(char *name, VALUE super)
+void rb_iter_break_value(VALUE value) ::
-Defines new Ruby class as subclass of super.
+ Exits from the current innermost block with the value. The block will
+ return the given argument value. This function never return to the
+ caller.
- VALUE rb_define_class_under(VALUE module, char *name, VALUE super)
+== Exceptions and Errors
-Creates new Ruby class as subclass of super, under the module's
-namespace.
+void rb_warn(const char *fmt, ...) ::
- VALUE rb_define_module(char *name)
+ Prints a warning message according to a printf-like format.
-Defines new Ruby module.
+void rb_warning(const char *fmt, ...) ::
- VALUE rb_define_module_under(VALUE module, char *name, VALUE super)
+ Prints a warning message according to a printf-like format, if
+ $VERBOSE is true.
-Defines new Ruby module, under the modules's namespace.
+void rb_raise(rb_eRuntimeError, const char *fmt, ...) ::
- void rb_include_module(VALUE class, VALUE module)
+ Raises RuntimeError. The fmt is a format string just like printf().
-Includes module into class. If class already includes it, just
-ignore.
+void rb_raise(VALUE exception, const char *fmt, ...) ::
- void rb_extend_object(VALUE object, VALUE module)
+ Raises a class exception. The fmt is a format string just like printf().
-Extend the object with module's attribute.
+void rb_fatal(const char *fmt, ...) ::
-** Defining Global Variables
+ Raises a fatal error, terminates the interpreter. No exception handling
+ will be done for fatal errors, but ensure blocks will be executed.
- void rb_define_variable(char *name, VALUE *var)
+void rb_bug(const char *fmt, ...) ::
-Defines a global variable which is shared between C and Ruby. If name
-contains the character which is not allowed to be part of the symbol,
-it can't be seen from Ruby programs.
+ Terminates the interpreter immediately. This function should be
+ called under the situation caused by the bug in the interpreter. No
+ exception handling nor ensure execution will be done.
- void rb_define_readonly_variable(char *name, VALUE *var)
+Note: In the format string, %i is used for Object#to_s (or Object#inspect if
+'+' flag is set) output (and related argument must be a VALUE). For integers
+in format strings, use %d.
-Defines a read-only global variable. Works just like
-rb_define_variable(), except defined variable is read-only.
+== Initialize and Start the Interpreter
- void rb_define_virtual_variable(char *name,
- VALUE (*getter)(), VALUE (*setter)())
+The embedding API functions are below (not needed for extension libraries):
-Defines a virtual variable, whose behavior is defined by pair of C
-functions. The getter function is called when the variable is
-referred. The setter function is called when the value is set to the
-variable. The prototype for getter/setter functions are:
+void ruby_init() ::
- VALUE getter(ID id)
- void setter(VALUE val, ID id)
+ Initializes the interpreter.
-The getter function must return the value for the access.
+void *ruby_options(int argc, char **argv) ::
- void rb_define_hooked_variable(char *name, VALUE *var,
- VALUE (*getter)(), VALUE (*setter)())
+ Process command line arguments for the interpreter.
+ And compiles the Ruby source to execute.
+ It returns an opaque pointer to the compiled source
+ or an internal special value.
-Defines hooked variable. It's virtual variable with C variable. The
-getter is called as
+int ruby_run_node(void *n) ::
- VALUE getter(ID id, VALUE *var)
+ Runs the given compiled source and exits this process.
+ It returns EXIT_SUCCESS if successfully runs the source.
+ Otherwise, it returns other value.
-returning new value. The setter is called as
+void ruby_script(char *name) ::
- void setter(VALUE val, ID id, VALUE *var)
+ Specifies the name of the script ($0).
-GC requires to mark the C global variables which hold Ruby values.
+== Hooks for the Interpreter Events
- void rb_global_variable(VALUE *var)
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events,
+ VALUE data)
-Tells GC to protect these variables.
+Adds a hook function for the specified interpreter events.
+events should be OR'ed value of:
-** Constant Definition
+ RUBY_EVENT_LINE
+ RUBY_EVENT_CLASS
+ RUBY_EVENT_END
+ RUBY_EVENT_CALL
+ RUBY_EVENT_RETURN
+ RUBY_EVENT_C_CALL
+ RUBY_EVENT_C_RETURN
+ RUBY_EVENT_RAISE
+ RUBY_EVENT_ALL
- void rb_define_const(VALUE klass, char *name, VALUE val)
+The definition of rb_event_hook_func_t is below:
-Defines a new constant under the class/module.
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ VALUE self, ID id, VALUE klass)
- void rb_define_global_const(char *name, VALUE val)
+The third argument `data' to rb_add_event_hook() is passed to the hook
+function as the second argument, which was the pointer to the current
+NODE in 1.8. See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
-Defines global contant. This is just work as
+ int rb_remove_event_hook(rb_event_hook_func_t func)
- rb_define_const(cKernal, name, val)
+Removes the specified hook function.
-** Method Definition
+== Macros for Compatibility
- rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
+Some macros to check API compatibilities are available by default.
-Defines a method for the class. func is the function pointer. argc
-is the number of arguments. if argc is -1, the function will receive
-3 arguments argc, argv, and self. if argc is -2, the function will
-receive 2 arguments, self and args, where args is the Ruby array of
-the method arguments.
+NORETURN_STYLE_NEW ::
- rb_define_private_method(VALUE class, char *name, VALUE (*func)(), int argc)
+ Means that NORETURN macro is functional style instead of prefix.
-Defines a private method for the class. Arguments are same as
-rb_define_method().
+HAVE_RB_DEFINE_ALLOC_FUNC ::
- rb_define_singleton_method(VALUE class, char *name, VALUE (*func)(), int argc)
+ Means that function rb_define_alloc_func() is provided, that means the
+ allocation framework is used. This is same as the result of
+ have_func("rb_define_alloc_func", "ruby.h").
-Defines a singleton method. Arguments are same as rb_define_method().
+HAVE_RB_REG_NEW_STR ::
- rb_scan_args(int atgc, VALUE *argv, char *fmt, ...)
+ Means that function rb_reg_new_str() is provided, that creates Regexp
+ object from String object. This is same as the result of
+ have_func("rb_reg_new_str", "ruby.h").
-argc,argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô,
-Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú¿ô
-»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Äǽ¤Ç
-¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê¹ß¤ÏÊÑ
-¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥Éղðú
-¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬ÂåÆþ¤µ¤ì
-¤ë¡¥
+HAVE_RB_IO_T ::
-** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
+ Means that type rb_io_t is provided.
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+USE_SYMBOL_AS_METHOD_NAME ::
-Invokes the method. To retrieve mid from method name, use rb_intern().
+ Means that Symbols will be returned as method names, e.g.,
+ Module#methods, #singleton_methods and so on.
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+HAVE_RUBY_*_H ::
-Invokes method, passing arguments by array of values.
+ Defined in ruby.h and means corresponding header is available. For
+ instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
+ mere st.h.
- VALUE rb_eval_string(char *str)
+RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ::
-Compiles and executes the string as Ruby program.
+ Means that rb_add_event_hook() takes the third argument `data', to be
+ passed to the given event hook function.
- ID rb_intern(char *name)
+= Appendix C. Functions available for use in extconf.rb
-Returns ID corresponding the name.
+See documentation for {mkmf}[rdoc-ref:MakeMakefile].
- char *rb_id2name(ID id)
+= Appendix D. Generational GC
-Returns the name corresponding ID.
+Ruby 2.1 introduced a generational garbage collector (called RGenGC).
+RGenGC (mostly) keeps compatibility.
- char *rb_class2name(VALUE class)
+Generally, the use of the technique called write barriers is required in
+extension libraries for generational GC
+(http://en.wikipedia.org/wiki/Garbage_collection_%28computer_science%29).
+RGenGC works fine without write barriers in extension libraries.
-Returns the name of the class.
+If your library adheres to the following tips, performance can
+be further improved. Especially, the "Don't touch pointers directly" section is
+important.
-** Instance Variables
+== Incompatibility
- VALUE rb_iv_get(VALUE obj, char *name)
+You can't write RBASIC(obj)->klass field directly because it is const
+value now.
-Retrieve the value of the instance variable. If the name is not
-prefixed by `@', that variable shall be inaccessible from Ruby.
+Basically you should not write this field because MRI expects it to be
+an immutable field, but if you want to do it in your extension you can
+use the following functions:
- VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
+VALUE rb_obj_hide(VALUE obj) ::
-Sets the value of the instance variable.
+ Clear RBasic::klass field. The object will be an internal object.
+ ObjectSpace::each_object can't find this object.
-** Control Structure
+VALUE rb_obj_reveal(VALUE obj, VALUE klass) ::
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ Reset RBasic::klass to be klass.
+ We expect the `klass' is hidden class by rb_obj_hide().
-func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
-func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
-¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
-
- VALUE rb_yield(VALUE val)
+== Write barriers
-val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
+RGenGC doesn't require write barriers to support generational GC.
+However, caring about write barrier can improve the performance of
+RGenGC. Please check the following tips.
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+=== Don't touch pointers directly
-´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸¤·
-¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸¤·¤Ê
-¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá¤êÃͤÇ
-¤¢¤ë¡¥
+In MRI (include/ruby/ruby.h), some macros to acquire pointers to the
+internal data structures are supported such as RARRAY_PTR(),
+RSTRUCT_PTR() and so on.
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+DO NOT USE THESE MACROS and instead use the corresponding C-APIs such as
+rb_ary_aref(), rb_ary_store() and so on.
-´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬È¯
-À¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1¤ÎÌá
-¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
+=== Consider whether to insert write barriers
-** Îã³°¡¦¥¨¥é¡¼
+You don't need to care about write barriers if you only use built-in
+types.
- void rb_warning(char *fmt, ...)
+If you support T_DATA objects, you may consider using write barriers.
-rb_verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+Inserting write barriers into T_DATA objects only works with the
+following type objects: (a) long-lived objects, (b) when a huge number
+of objects are generated and (c) container-type objects that have
+references to other objects. If your extension provides such a type of
+T_DATA objects, consider inserting write barriers.
- void rb_raise(rb_eRuntimeError, char *fmt, ...)
+(a): short-lived objects don't become old generation objects.
+(b): only a few oldgen objects don't have performance impact.
+(c): only a few references don't have performance impact.
-Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+Inserting write barriers is a very difficult hack, it is easy to
+introduce critical bugs. And inserting write barriers has several areas
+of overhead. Basically we don't recommend you insert write barriers.
+Please carefully consider the risks.
- void rb_fatal(char *fmt, ...)
+=== Combine with built-in types
-Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
-¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë¼Â
-¹Ô¤µ¤ì¤ë)¡¥
+Please consider utilizing built-in types. Most built-in types support
+write barrier, so you can use them to avoid manually inserting write
+barriers.
- void rb_bug(char *fmt, ...)
+For example, if your T_DATA has references to other objects, then you
+can move these references to Array. A T_DATA object only has a reference
+to an array object. Or you can also use a Struct object to gather a
+T_DATA object (without any references) and an that Array contains
+references.
-¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤¾õ
-¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥Îã³°
-½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
+With use of such techniques, you don't need to insert write barriers
+anymore.
-** Initialize and Starts the Interpreter
+=== Insert write barriers
-The embedding API are below (not needed for extension libraries):
+[AGAIN] Inserting write barriers is a very difficult hack, and it is
+easy to introduce critical bugs. And inserting write barriers has
+several areas of overhead. Basically we don't recommend you insert write
+barriers. Please carefully consider the risks.
- void ruby_init(int argc, char **argv, char **envp)
+Before inserting write barriers, you need to know about RGenGC algorithm
+(gc.c will help you). Macros and functions to insert write barriers are
+available in in include/ruby/ruby.h. An example is available in iseq.c.
-Initializes the interpreter.
+For a complete guide for RGenGC and write barriers, please refer to
+<https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/RGenGC>.
- void ruby_run()
+= Appendix E. RB_GC_GUARD to protect from premature GC
-Starts execution of the interpreter.
+C Ruby currently uses conservative garbage collection, thus VALUE
+variables must remain visible on the stack or registers to ensure any
+associated data remains usable. Optimizing C compilers are not designed
+with conservative garbage collection in mind, so they may optimize away
+the original VALUE even if the code depends on data associated with that
+VALUE.
- void ruby_script(char *name)
+The following example illustrates the use of RB_GC_GUARD to ensure
+the contents of sptr remain valid while the second invocation of
+rb_str_new_cstr is running.
-Specifies the name of the script ($0).
+ VALUE s, w;
+ const char *sptr;
-Appendix B. Functions Available in extconf.rb
+ s = rb_str_new_cstr("hello world!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!");
+ sptr = RSTRING_PTR(s);
+ w = rb_str_new_cstr(sptr + 6); /* Possible GC invocation */
-extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
-²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+ RB_GC_GUARD(s); /* ensure s (and thus sptr) do not get GC-ed */
- have_library(lib, func)
+In the above example, RB_GC_GUARD must be placed _after_ the last use of
+sptr. Placing RB_GC_GUARD before dereferencing sptr would be of no use.
+RB_GC_GUARD is only effective on the VALUE data type, not converted C
+data types.
-Checks whether library which contains specified function exists.
-Returns true if the library exists.
+RB_GC_GUARD would not be necessary at all in the above example if
+non-inlined function calls are made on the `s' VALUE after sptr is
+dereferenced. Thus, in the above example, calling any un-inlined
+function on `s' such as:
- have_func(func)
+ rb_str_modify(s);
-Checks whether func exists. Returns true if the function exists. To
-check functions in the additional library, you need to check that
-library first using have_library().
+Will ensure `s' stays on the stack or register to prevent a
+GC invocation from prematurely freeing it.
- have_header(header)
+Using the RB_GC_GUARD macro is preferable to using the "volatile"
+keyword in C. RB_GC_GUARD has the following advantages:
-Checks for the header files. Returns true if the header file exists.
+1) the intent of the macro use is clear
- create_makefile(target)
+2) RB_GC_GUARD only affects its call site, "volatile" generates some
+ extra code every time the variable is used, hurting optimization.
-Generates the Makefile for the extension library. If you don't invoke
-this method, the compilation will not be done.
+3) "volatile" implementations may be buggy/inconsistent in some
+ compilers and architectures. RB_GC_GUARD is customizable for broken
+ systems/compilers without those without negatively affecting other
+ systems.
/*
* Local variables:
diff --git a/README.EXT.ja b/README.EXT.ja
new file mode 100644
index 0000000000..0ab61abcbe
--- /dev/null
+++ b/README.EXT.ja
@@ -0,0 +1,1666 @@
+# README.EXT.ja - -*- RDoc -*- created at: Mon Aug 7 16:45:54 JST 1995
+
+Rubyã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã®ä½œã‚Šæ–¹ã‚’説明ã—ã¾ã™ï¼Ž
+
+= 基礎知識
+
+Cã®å¤‰æ•°ã«ã¯åž‹ãŒã‚り,データã«ã¯åž‹ãŒã‚りã¾ã›ã‚“.ã§ã™ã‹ã‚‰ï¼ŒãŸ
+ã¨ãˆã°ãƒã‚¤ãƒ³ã‚¿ã‚’intã®å¤‰æ•°ã«ä»£å…¥ã™ã‚‹ã¨ï¼Œãã®å€¤ã¯æ•´æ•°ã¨ã—ã¦å–
+り扱ã‚れã¾ã™ï¼Žé€†ã«Rubyã®å¤‰æ•°ã«ã¯åž‹ãŒãªã,データã«åž‹ãŒã‚りã¾
+ã™ï¼Žã“ã®é•ã„ã®ãŸã‚,Cã¨Rubyã¯ç›¸äº’ã«å¤‰æ›ã—ãªã‘れã°ï¼ŒãŠäº’ã„ã®
+データをアクセスã§ãã¾ã›ã‚“.
+
+Rubyã®ãƒ‡ãƒ¼ã‚¿ã¯VALUEã¨ã„ã†Cã®åž‹ã§è¡¨ç¾ã•れã¾ã™ï¼ŽVALUEåž‹ã®ãƒ‡ãƒ¼
+ã‚¿ã¯ãã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—を自分ã§çŸ¥ã£ã¦ã„ã¾ã™ï¼Žã“ã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã¨
+ã„ã†ã®ã¯ãƒ‡ãƒ¼ã‚¿(オブジェクト)ã®å®Ÿéš›ã®æ§‹é€ ã‚’æ„味ã—ã¦ã„ã¦ï¼ŒRuby
+ã®ã‚¯ãƒ©ã‚¹ã¨ã¯ã¾ãŸé•ã£ãŸã‚‚ã®ã§ã™ï¼Ž
+
+VALUEã‹ã‚‰Cã«ã¨ã£ã¦æ„味ã®ã‚るデータをå–り出ã™ãŸã‚ã«ã¯
+
+1. VALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—を知る
+2. VALUEã‚’Cã®ãƒ‡ãƒ¼ã‚¿ã«å¤‰æ›ã™ã‚‹
+
+ã®ä¸¡æ–¹ãŒå¿…è¦ã§ã™ï¼Ž(1)を忘れるã¨é–“é•ã£ãŸãƒ‡ãƒ¼ã‚¿ã®å¤‰æ›ãŒè¡Œã‚れ
+ã¦ï¼Œæœ€æ‚ªãƒ—ログラムãŒcore dumpã—ã¾ã™ï¼Ž
+
+== データタイプ
+
+Rubyã«ã¯ãƒ¦ãƒ¼ã‚¶ãŒä½¿ã†å¯èƒ½æ€§ã®ã‚る以下ã®ã‚¿ã‚¤ãƒ—ãŒã‚りã¾ã™ï¼Ž
+
+T_NIL :: nil
+T_OBJECT :: 通常ã®ã‚ªãƒ–ジェクト
+T_CLASS :: クラス
+T_MODULE :: モジュール
+T_FLOAT :: æµ®å‹•å°æ•°ç‚¹æ•°
+T_STRING :: 文字列
+T_REGEXP :: æ­£è¦è¡¨ç¾
+T_ARRAY :: é…列
+T_HASH :: 連想é…列
+T_STRUCT :: (Rubyã®)構造体
+T_BIGNUM :: 多å€é•·æ•´æ•°
+T_FIXNUM :: Fixnum(31bitã¾ãŸã¯63bité•·æ•´æ•°)
+T_COMPLEX :: 複素数
+T_RATIONAL :: æœ‰ç†æ•°
+T_FILE :: 入出力
+T_TRUE :: 真
+T_FALSE :: å½
+T_DATA :: データ
+T_SYMBOL :: シンボル
+
+ãã®ä»–ã«å†…部ã§åˆ©ç”¨ã•れã¦ã„る以下ã®ã‚¿ã‚¤ãƒ—ãŒã‚りã¾ã™ï¼Ž
+
+ T_ICLASS
+ T_MATCH
+ T_UNDEF
+ T_NODE
+ T_ZOMBIE
+
+ã»ã¨ã‚“ã©ã®ã‚¿ã‚¤ãƒ—ã¯Cã®æ§‹é€ ä½“ã§å®Ÿè£…ã•れã¦ã„ã¾ã™ï¼Ž
+
+== VALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹
+
+ruby.hã§ã¯TYPE()ã¨ã„ã†ãƒžã‚¯ãƒ­ãŒå®šç¾©ã•れã¦ã„ã¦ï¼ŒVALUEã®ãƒ‡ãƒ¼ã‚¿
+タイプを知るã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼ŽTYPE()マクロã¯ä¸Šã§ç´¹ä»‹ã—ãŸT_XXXX
+ã®å½¢å¼ã®å®šæ•°ã‚’è¿”ã—ã¾ã™ï¼ŽVALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã«å¿œã˜ã¦å‡¦ç†ã™ã‚‹
+å ´åˆã«ã¯ï¼ŒTYPE()ã®å€¤ã§åˆ†å²ã™ã‚‹ã“ã¨ã«ãªã‚Šã¾ã™ï¼Ž
+
+ switch (TYPE(obj)) {
+ case T_FIXNUM:
+ /* FIXNUMã®å‡¦ç† */
+ break;
+ case T_STRING:
+ /* 文字列ã®å‡¦ç† */
+ break;
+ case T_ARRAY:
+ /* é…列ã®å‡¦ç† */
+ break;
+ default:
+ /* 例外を発生ã•ã›ã‚‹ */
+ rb_raise(rb_eTypeError, "not valid value");
+ break;
+ }
+
+ãれã¨ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã‚’ãƒã‚§ãƒƒã‚¯ã—ã¦ï¼Œæ­£ã—ããªã‘れã°ä¾‹å¤–を発生ã™
+る関数ãŒç”¨æ„ã•れã¦ã„ã¾ã™ï¼Ž
+
+ void Check_Type(VALUE value, int type)
+
+ã“ã®é–¢æ•°ã¯valueãŒtypeã§ç„¡ã‘れã°ï¼Œä¾‹å¤–を発生ã•ã›ã¾ã™ï¼Žå¼•æ•°ã¨
+ã—ã¦ä¸Žãˆã‚‰ã‚ŒãŸVALUEã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ãŒæ­£ã—ã„ã‹ã©ã†ã‹ãƒã‚§ãƒƒã‚¯ã™
+ã‚‹ãŸã‚ã«ã¯ï¼Œã“ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+FIXNUMã¨NILã«é–¢ã—ã¦ã¯ã‚ˆã‚Šé«˜é€Ÿãªåˆ¤åˆ¥ãƒžã‚¯ãƒ­ãŒç”¨æ„ã•れã¦ã„ã¾ã™ï¼Ž
+
+ FIXNUM_P(obj)
+ NIL_P(obj)
+
+== VALUEã‚’Cã®ãƒ‡ãƒ¼ã‚¿ã«å¤‰æ›ã™ã‚‹
+
+データタイプãŒT_NIL,T_FALSE,T_TRUEã§ã‚る時,データã¯ãれãž
+れnil,false,trueã§ã™ï¼Žã“ã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã®ã‚ªãƒ–ジェクトã¯ã²ã¨
+ã¤ãšã¤ã—ã‹å­˜åœ¨ã—ã¾ã›ã‚“.
+
+データタイプãŒT_FIXNUMã®æ™‚,ã“れã¯31bitã¾ãŸã¯63bitã®ã‚µã‚¤ã‚ºã‚’
+æŒã¤æ•´æ•°ã§ã™ï¼Žlongã®ã‚µã‚¤ã‚ºãŒ32bitã®ãƒ—ラットフォームã§ã‚れã°
+31bitã«ï¼Œlongã®ã‚µã‚¤ã‚ºãŒ64bitã®ãƒ—ラットフォームã§ã‚れã°63bit
+ã«ãªã‚Šã¾ã™. FIXNUM ã‚’ C ã®æ•´æ•°ã«å¤‰æ›ã™ã‚‹ãŸã‚ã«ã¯ãƒžã‚¯ãƒ­
+「FIX2INT()ã€ã¾ãŸã¯ã€ŒFIX2LONG()ã€ã‚’使ã„ã¾ã™ï¼Žã“れらã®ãƒžã‚¯ãƒ­
+を使用ã™ã‚‹éš›ã«ã¯äº‹å‰ã«ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ãŒFIXNUMã§ã‚ã‚‹ã“ã¨ã‚’確èªã™
+ã‚‹å¿…è¦ãŒã‚りã¾ã™ãŒï¼Œæ¯”較的高速ã«å¤‰æ›ã‚’行ã†ã“ã¨ãŒã§ãã¾ã™ï¼Žã¾
+ãŸï¼Œã€ŒFIX2LONG()ã€ã¯ä¾‹å¤–を発生ã—ã¾ã›ã‚“ãŒï¼Œã€ŒFIX2INT()ã€ã¯å¤‰
+æ›çµæžœãŒintã®ã‚µã‚¤ã‚ºã«åŽã¾ã‚‰ãªã„å ´åˆã«ã¯ä¾‹å¤–を発生ã—ã¾ã™ï¼Ž
+ãれã‹ã‚‰ï¼ŒFIXNUMã«é™ã‚‰ãšRubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ•´æ•°ã«å¤‰æ›ã™ã‚‹
+「NUM2INT()ã€ãŠã‚ˆã³ã€ŒNUM2LONG()ã€ã¨ã„ã†ãƒžã‚¯ãƒ­ãŒã‚りã¾ã™ï¼Žã“
+れらã®ãƒžã‚¯ãƒ­ã¯ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã®ãƒã‚§ãƒƒã‚¯ç„¡ã—ã§ä½¿ãˆã¾ã™
+(æ•´æ•°ã«å¤‰æ›ã§ããªã„å ´åˆã«ã¯ä¾‹å¤–ãŒç™ºç”Ÿã™ã‚‹)ï¼ŽåŒæ§˜ã«ãƒã‚§ãƒƒã‚¯ç„¡ã—
+ã§ä½¿ãˆã‚‹å¤‰æ›ãƒžã‚¯ãƒ­ã¯doubleã‚’å–り出ã™ã€ŒNUM2DBL()ã€ãŒã‚りã¾ã™ï¼Ž
+
+char* ã‚’å–り出ã™å ´åˆï¼Œ StringValue() 㨠StringValuePtr()
+を使ã„ã¾ã™ï¼Ž
+StringValue(var) 㯠var ㌠String
+ã§ã‚れã°ä½•ã‚‚ã›ãšï¼Œãã†ã§ãªã‘れ㰠var ã‚’ var.to_str() ã®çµæžœ
+ã«ç½®ãæ›ãˆã‚‹ãƒžã‚¯ãƒ­ï¼ŒStringValuePtr(var) ã¯åŒæ§˜ã« var ã‚’
+String ã«ç½®ãæ›ãˆã¦ã‹ã‚‰ var ã®ãƒã‚¤ãƒˆåˆ—表ç¾ã«å¯¾ã™ã‚‹ char* ã‚’
+è¿”ã™ãƒžã‚¯ãƒ­ã§ã™ï¼Žvar ã®å†…å®¹ã‚’ç›´æŽ¥ç½®ãæ›ãˆã‚‹å‡¦ç†ãŒå…¥ã‚‹ã®ã§ï¼Œ
+var 㯠lvalue ã§ã‚ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+ã¾ãŸï¼ŒStringValuePtr() ã«é¡žä¼¼ã—㟠StringValueCStr() ã¨ã„ã†ãƒž
+クロもã‚りã¾ã™ï¼ŽStringValueCStr(var) 㯠var ã‚’ String ã«ç½®ã
+æ›ãˆã¦ã‹ã‚‰ var ã®æ–‡å­—列表ç¾ã«å¯¾ã™ã‚‹ char* ã‚’è¿”ã—ã¾ã™ï¼Žè¿”ã•れ
+ã‚‹æ–‡å­—åˆ—ã®æœ«å°¾ã«ã¯ nul 文字ãŒä»˜åŠ ã•れã¾ã™ï¼ŽãªãŠï¼Œé€”中㫠nul
+文字ãŒå«ã¾ã‚Œã‚‹å ´åˆã¯ ArgumentError ãŒç™ºç”Ÿã—ã¾ã™ï¼Ž
+一方,StringValuePtr() ã§ã¯ï¼Œæœ«å°¾ã« nul 文字ãŒã‚ã‚‹ä¿è¨¼ã¯ãªã,
+途中㫠nul 文字ãŒå«ã¾ã‚Œã¦ã„ã‚‹å¯èƒ½æ€§ã‚‚ã‚りã¾ã™ï¼Ž
+
+ãれ以外ã®ãƒ‡ãƒ¼ã‚¿ã‚¿ã‚¤ãƒ—ã¯å¯¾å¿œã™ã‚‹Cã®æ§‹é€ ä½“ãŒã‚りã¾ã™ï¼Žå¯¾å¿œã™
+る構造体ã®ã‚ã‚‹VALUEã¯ãã®ã¾ã¾ã‚­ãƒ£ã‚¹ãƒˆ(型変æ›)ã™ã‚Œã°æ§‹é€ ä½“ã®
+ãƒã‚¤ãƒ³ã‚¿ã«å¤‰æ›ã§ãã¾ã™ï¼Ž
+
+構造体ã¯ã€Œstruct RXxxxxã€ã¨ã„ã†åå‰ã§ruby.hã§å®šç¾©ã•れã¦ã„ã¾
+ã™ï¼Žä¾‹ãˆã°æ–‡å­—列ã¯ã€Œstruct RStringã€ã§ã™ï¼Žå®Ÿéš›ã«ä½¿ã†å¯èƒ½æ€§ãŒ
+ã‚ã‚‹ã®ã¯æ–‡å­—列ã¨é…列ãらã„ã ã¨æ€ã„ã¾ã™ï¼Ž
+
+ruby.hã§ã¯æ§‹é€ ä½“ã¸ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ãƒžã‚¯ãƒ­ã‚‚「RXXXXX()ã€(全部大文
+å­—ã«ã—ãŸã‚‚ã®)ã¨ã„ã†åå‰ã§æä¾›ã•れã¦ã„ã¾ã™(例: RSTRING()).ãŸ
+ã ã—ã€æ§‹é€ ä½“ã¸ã®ç›´æŽ¥ã®ã‚¢ã‚¯ã‚»ã‚¹ã¯ã§ãã‚‹ã ã‘é¿ã‘,対応ã™ã‚‹
+rb_xxxx() ã¨ã„ã£ãŸé–¢æ•°ã‚’使ã†ã‚ˆã†ã«ã—ã¦ä¸‹ã•ã„.例ãˆã°ï¼Œé…列ã®
+è¦ç´ ã¸ã‚¢ã‚¯ã‚»ã‚¹ã™ã‚‹å ´åˆã¯ï¼Œrb_ary_entry(ary, offset),
+rb_ary_store(ary, offset, obj) を利用ã™ã‚‹ã‚ˆã†ã«ã—ã¦ä¸‹ã•ã„.
+
+構造体ã‹ã‚‰ãƒ‡ãƒ¼ã‚¿ã‚’å–り出ã™ãƒžã‚¯ãƒ­ãŒæä¾›ã•れã¦ã„ã¾ã™ï¼Žæ–‡å­—列
+strã®é•·ã•ã‚’å¾—ã‚‹ãŸã‚ã«ã¯ã€ŒRSTRING_LEN(str)ã€ã¨ã—,文字列strã‚’
+char*ã¨ã—ã¦å¾—ã‚‹ãŸã‚ã«ã¯ã€ŒRSTRING_PTR(str)ã€ã¨ã—ã¾ã™ï¼Ž
+
+Rubyã®æ§‹é€ ä½“を直接アクセスã™ã‚‹æ™‚ã«æ°—ã‚’ã¤ã‘ãªã‘れã°ãªã‚‰ãªã„ã“
+ã¨ã¯ï¼Œé…åˆ—ã‚„æ–‡å­—åˆ—ã®æ§‹é€ ä½“ã®ä¸­èº«ã¯å‚ç…§ã™ã‚‹ã ã‘ã§ï¼Œç›´æŽ¥å¤‰æ›´ã—
+ãªã„ã“ã¨ã§ã™ï¼Žç›´æŽ¥å¤‰æ›´ã—ãŸå ´åˆï¼Œã‚ªãƒ–ジェクトã®å†…å®¹ã®æ•´åˆæ€§ãŒ
+ã¨ã‚Œãªããªã£ã¦ï¼Œæ€ã‚ã¬ãƒã‚°ã®åŽŸå› ã«ãªã‚Šã¾ã™ï¼Ž
+
+== Cã®ãƒ‡ãƒ¼ã‚¿ã‚’VALUEã«å¤‰æ›ã™ã‚‹
+
+VALUEã®å®Ÿéš›ã®æ§‹é€ ã¯
+
+FIXNUMã®å ´åˆ ::
+
+ 1bit左シフトã—ã¦ï¼ŒLSBã‚’ç«‹ã¦ã‚‹ï¼Ž
+
+ãã®ä»–ã®ãƒã‚¤ãƒ³ã‚¿ã®å ´åˆ ::
+
+ ãã®ã¾ã¾VALUEã«ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ï¼Ž
+
+ã¨ãªã£ã¦ã„ã¾ã™ï¼Žã‚ˆã£ã¦ï¼ŒLSBã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚Œã°VALUEãŒFIXNUMã‹ã©
+ã†ã‹ã‚ã‹ã‚‹ã‚ã‘ã§ã™(ãƒã‚¤ãƒ³ã‚¿ã®LSBãŒç«‹ã£ã¦ã„ãªã„ã“ã¨ã‚’仮定ã—ã¦
+ã„ã‚‹).
+
+ã§ã™ã‹ã‚‰ï¼ŒFIXNUM以外ã®Rubyã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆã®æ§‹é€ ä½“ã¯å˜ã«VALUE
+ã«ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ã ã‘ã§VALUEã«å¤‰æ›å‡ºæ¥ã¾ã™ï¼ŽãŸã ã—,任æ„ã®æ§‹é€ 
+体ãŒVALUEã«ã‚­ãƒ£ã‚¹ãƒˆå‡ºæ¥ã‚‹ã‚ã‘ã§ã¯ã‚りã¾ã›ã‚“.キャストã™ã‚‹ã®
+ã¯Rubyã®çŸ¥ã£ã¦ã„る構造体(ruby.hã§å®šç¾©ã•れã¦ã„ã‚‹struct RXxxx
+ã®ã‚‚ã®)ã ã‘ã§ã™ï¼Ž
+
+FIXNUMã«é–¢ã—ã¦ã¯å¤‰æ›ãƒžã‚¯ãƒ­ã‚’経由ã™ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼ŽCã®æ•´æ•°
+ã‹ã‚‰VALUEã«å¤‰æ›ã™ã‚‹ãƒžã‚¯ãƒ­ã¯ä»¥ä¸‹ã®ã‚‚ã®ãŒã‚りã¾ã™ï¼Žå¿…è¦ã«å¿œã˜
+ã¦ä½¿ã„分ã‘ã¦ãã ã•ã„.
+
+INT2FIX() :: ã‚‚ã¨ã®æ•´æ•°ãŒ31bitã¾ãŸã¯63bit以内ã«åŽã¾ã‚‹è‡ªä¿¡
+ ãŒã‚る時
+INT2NUM() :: ä»»æ„ã®æ•´æ•°ã‹ã‚‰VALUEã¸
+
+INT2NUM()ã¯æ•´æ•°ãŒFIXNUMã®ç¯„囲ã«åŽã¾ã‚‰ãªã„å ´åˆï¼ŒBignumã«å¤‰æ›
+ã—ã¦ãれã¾ã™(ãŒï¼Œå°‘ã—é…ã„).
+
+== Rubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ“作ã™ã‚‹
+
+先程も述ã¹ãŸé€šã‚Šï¼ŒRubyã®æ§‹é€ ä½“をアクセスã™ã‚‹æ™‚ã«å†…å®¹ã®æ›´æ–°ã‚’
+行ã†ã“ã¨ã¯å‹§ã‚られã¾ã›ã‚“.ã§ï¼ŒRubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ“作ã™ã‚‹æ™‚ã«ã¯
+RubyãŒç”¨æ„ã—ã¦ã„る関数を用ã„ã¦ãã ã•ã„.
+
+ã“ã“ã§ã¯ã‚‚ã£ã¨ã‚‚使ã‚れるã§ã‚ã‚ã†æ–‡å­—列ã¨é…列ã®ç”Ÿæˆ/æ“作を行
+ã†é–¢æ•°ã‚’ã‚ã’ã¾ã™(全部ã§ã¯ãªã„ã§ã™).
+
+=== 文字列ã«å¯¾ã™ã‚‹é–¢æ•°
+
+rb_str_new(const char *ptr, long len) ::
+
+ æ–°ã—ã„Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
+
+rb_str_new2(const char *ptr)
+rb_str_new_cstr(const char *ptr)
+
+ Cã®æ–‡å­—列ã‹ã‚‰Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Žã“ã®é–¢æ•°ã®æ©Ÿèƒ½ã¯
+ rb_str_new(ptr, strlen(ptr))ã¨åŒç­‰ã§ã‚る.
+
+rb_tainted_str_new(const char *ptr, long len)
+
+ 汚染マークãŒä»˜åŠ ã•ã‚ŒãŸæ–°ã—ã„Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Žå¤–部
+ ã‹ã‚‰ã®ãƒ‡ãƒ¼ã‚¿ã«åŸºã¥ã文字列ã«ã¯æ±šæŸ“マークãŒä»˜åŠ ã•れるã¹ã
+ ã§ã‚る.
+
+rb_tainted_str_new2(const char *ptr)
+rb_tainted_str_new_cstr(const char *ptr)
+
+ Cã®æ–‡å­—列ã‹ã‚‰æ±šæŸ“マークãŒä»˜åŠ ã•れãŸRubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
+
+rb_sprintf(const char *format, ...)
+rb_vsprintf(const char *format, va_list ap)
+
+ Cã®æ–‡å­—列formatã¨ç¶šã引数をprintf(3)ã®ãƒ•ォーマットã«ã—ãŸãŒã£ã¦
+ æ•´å½¢ã—,Rubyã®æ–‡å­—列を生æˆã™ã‚‹ï¼Ž
+
+ 注æ„: %iã¯Object#to_s('+'ãƒ•ãƒ©ã‚°ãŒæŒ‡å®šã•れã¦ã„ã‚‹ã¨ãã¯Object#inspect)ã‚’
+ 使ã£ãŸVALUEã®å‡ºåŠ›ã«ä½¿ç”¨ã•れã¦ã„ã‚‹ãŸã‚,整数ã«ã¯%dを使用ã™ã‚‹ã“ã¨ï¼Ž
+
+rb_str_cat(VALUE str, const char *ptr, long len)
+
+ Rubyã®æ–‡å­—列strã«lenãƒã‚¤ãƒˆã®æ–‡å­—列ptrを追加ã™ã‚‹ï¼Ž
+
+rb_str_cat2(VALUE str, const char* ptr)
+rb_str_cat_cstr(VALUE str, const char* ptr)
+
+ Rubyã®æ–‡å­—列strã«Cã®æ–‡å­—列ptrを追加ã™ã‚‹ï¼Žã“ã®é–¢æ•°ã®æ©Ÿèƒ½ã¯
+ rb_str_cat(str, ptr, strlen(ptr))ã¨åŒç­‰ã§ã‚る.
+
+rb_str_catf(VALUE str, const char* format, ...)
+rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+ Cã®æ–‡å­—列formatã¨ç¶šã引数をprintf(3)ã®ãƒ•ォーマットã«ã—ãŸãŒã£ã¦
+ æ•´å½¢ã—,Rubyã®æ–‡å­—列strã«è¿½åŠ ã™ã‚‹ï¼Žã“ã®é–¢æ•°ã®æ©Ÿèƒ½ã¯ï¼Œãれãžã‚Œ
+ rb_str_cat2(str, rb_sprintf(format, ...)) ã‚„
+ rb_str_cat2(str, rb_vsprintf(format, ap)) ã¨åŒç­‰ã§ã‚る.
+
+rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+rb_enc_str_new_cstr(const char *ptr, rb_encoding *enc)
+
+ 指定ã•れãŸã‚¨ãƒ³ã‚³ãƒ¼ãƒ‡ã‚£ãƒ³ã‚°ã§Rubyã®æ–‡å­—列を生æˆã™ã‚‹.
+
+rb_usascii_str_new(const char *ptr, long len)
+rb_usascii_str_new_cstr(const char *ptr)
+
+ エンコーディングãŒUS-ASCIIã®Rubyã®æ–‡å­—列を生æˆã™ã‚‹.
+
+rb_str_resize(VALUE str, long len)
+
+ Rubyã®æ–‡å­—列ã®ã‚µã‚¤ã‚ºã‚’lenãƒã‚¤ãƒˆã«å¤‰æ›´ã™ã‚‹ï¼Žstrã®é•·ã•ã¯å‰
+ 以ã¦ã‚»ãƒƒãƒˆã•れã¦ã„ãªã‘れã°ãªã‚‰ãªã„.lenãŒå…ƒã®é•·ã•よりも短
+ ã„æ™‚ã¯ï¼Œlenãƒã‚¤ãƒˆã‚’è¶ŠãˆãŸéƒ¨åˆ†ã®å†…å®¹ã¯æ¨ã¦ã‚‰ã‚Œã‚‹ï¼ŽlenãŒå…ƒ
+ ã®é•·ã•ã‚ˆã‚Šã‚‚é•·ã„æ™‚ã¯ï¼Œå…ƒã®é•·ã•ã‚’è¶ŠãˆãŸéƒ¨åˆ†ã®å†…容ã¯ä¿å­˜ã•
+ れãªã„ã§ã‚´ãƒŸã«ãªã‚‹ã ã‚ã†ï¼Žã“ã®é–¢æ•°ã®å‘¼ã³å‡ºã—ã«ã‚ˆã£ã¦
+ RSTRING_PTR(str)ãŒå¤‰æ›´ã•れるã‹ã‚‚ã—れãªã„ã“ã¨ã«æ³¨æ„.
+
+rb_str_set_len(VALUE str, long len)
+
+ Rubyã®æ–‡å­—列ã®ã‚µã‚¤ã‚ºã‚’lenãƒã‚¤ãƒˆã«ã‚»ãƒƒãƒˆã™ã‚‹ï¼ŽstrãŒå¤‰æ›´å¯
+ 能ã§ãªã‘れã°ä¾‹å¤–ãŒç™ºç”Ÿã™ã‚‹ï¼ŽRSTRING_LEN(str)ã¨ã¯ç„¡é–¢ä¿‚ã«ï¼Œ
+ lenãƒã‚¤ãƒˆã¾ã§ã®å†…容ã¯ä¿å­˜ã•れる.lenã¯strã®å®¹é‡ã‚’è¶Šãˆã¦ã„
+ ã¦ã¯ãªã‚‰ãªã„.
+
+
+== é…列ã«å¯¾ã™ã‚‹é–¢æ•°
+
+rb_ary_new()
+
+ è¦ç´ ãŒ0ã®é…列を生æˆã™ã‚‹ï¼Ž
+
+rb_ary_new2(long len)
+rb_ary_new_capa(long len)
+
+ è¦ç´ ãŒ0ã®é…列を生æˆã™ã‚‹ï¼Žlenè¦ç´ åˆ†ã®é ˜åŸŸã‚’ã‚らã‹ã˜ã‚割り
+ 当ã¦ã¦ãŠã.
+
+rb_ary_new3(long n, ...)
+rb_ary_new_from_args(long n, ...)
+
+ å¼•æ•°ã§æŒ‡å®šã—ãŸnè¦ç´ ã‚’å«ã‚€é…列を生æˆã™ã‚‹ï¼Ž
+
+rb_ary_new4(long n, VALUE *elts)
+rb_ary_new_from_values(long n, VALUE *elts)
+
+ é…列ã§ä¸ŽãˆãŸnè¦ç´ ã®é…列を生æˆã™ã‚‹ï¼Ž
+
+rb_ary_to_ary(VALUE obj)
+
+ オブジェクトをé…列ã«å¤‰æ›ã™ã‚‹.
+ Object#to_aryã¨åŒç­‰ã§ã‚ã‚‹.
+
+ä»–ã«ã‚‚é…列をæ“作ã™ã‚‹é–¢æ•°ãŒå¤šæ•°ã‚ã‚‹. ã“れらã¯
+引数aryã«é…列を渡ã•ãªã‘れã°ãªã‚‰ãªã„. ã•ã‚‚ãªã„ã¨
+コアをåã.
+
+rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+ Array#[]ã¨åŒç­‰.
+
+rb_ary_entry(VALUE ary, long offset)
+
+ ary[offset]
+
+rb_ary_store(VALUE ary, long offset, VALUE obj) ::
+
+ ary[offset] = obj
+
+rb_ary_subseq(VALUE ary, long beg, long len)
+
+ ary[beg, len]
+
+rb_ary_push(VALUE ary, VALUE val)
+rb_ary_pop(VALUE ary)
+rb_ary_shift(VALUE ary)
+rb_ary_unshift(VALUE ary, VALUE val)
+
+rb_ary_cat(VALUE ary, const VALUE *ptr, long len)
+
+ é…列aryã«ptrã‹ã‚‰len個ã®ã‚ªãƒ–ジェクトを追加ã™ã‚‹ï¼Ž
+
+= Rubyã®æ©Ÿèƒ½ã‚’使ã†
+
+原ç†çš„ã«Rubyã§æ›¸ã‘ã‚‹ã“ã¨ã¯Cã§ã‚‚書ã‘ã¾ã™ï¼ŽRubyãã®ã‚‚ã®ãŒCã§è¨˜
+è¿°ã•れã¦ã„ã‚‹ã‚“ã§ã™ã‹ã‚‰ï¼Œå½“ç„¶ã¨ã„ãˆã°å½“ç„¶ãªã‚“ã§ã™ã‘ã©ï¼Žã“ã“ã§
+ã¯Rubyã®æ‹¡å¼µã«ä½¿ã†ã“ã¨ãŒå¤šã„ã ã‚ã†ã¨äºˆæ¸¬ã•れる機能を中心ã«ç´¹
+介ã—ã¾ã™ï¼Ž
+
+== Rubyã«æ©Ÿèƒ½ã‚’追加ã™ã‚‹
+
+Rubyã§æä¾›ã•れã¦ã„る関数を使ãˆã°Rubyã‚¤ãƒ³ã‚¿ãƒ—ãƒªã‚¿ã«æ–°ã—ã„æ©Ÿèƒ½
+を追加ã™ã‚‹ã“ã¨ãŒã§ãã¾ã™ï¼ŽRubyã§ã¯ä»¥ä¸‹ã®æ©Ÿèƒ½ã‚’追加ã™ã‚‹é–¢æ•°ãŒ
+æä¾›ã•れã¦ã„ã¾ã™ï¼Ž
+
+* クラス,モジュール
+* メソッド,特異メソッドãªã©
+* 定数
+
+ã§ã¯é †ã«ç´¹ä»‹ã—ã¾ã™ï¼Ž
+
+=== クラス/モジュール定義
+
+クラスやモジュールを定義ã™ã‚‹ãŸã‚ã«ã¯ï¼Œä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+ VALUE rb_define_class(const char *name, VALUE super)
+ VALUE rb_define_module(const char *name)
+
+ã“れらã®é–¢æ•°ã¯æ–°ã—ã定義ã•れãŸã‚¯ãƒ©ã‚¹ã‚„モジュールを返ã—ã¾ã™ï¼Ž
+メソッドや定数ã®å®šç¾©ã«ã“れらã®å€¤ãŒå¿…è¦ãªã®ã§ï¼Œã»ã¨ã‚“ã©ã®å ´åˆ
+ã¯æˆ»ã‚Šå€¤ã‚’å¤‰æ•°ã«æ ¼ç´ã—ã¦ãŠãå¿…è¦ãŒã‚ã‚‹ã§ã—ょã†ï¼Ž
+
+クラスやモジュールを他ã®ã‚¯ãƒ©ã‚¹ã®å†…部ã«ãƒã‚¹ãƒˆã—ã¦å®šç¾©ã™ã‚‹æ™‚ã«
+ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+ VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE outer, const char *name)
+
+=== メソッド/特異メソッド定義
+
+メソッドや特異メソッドを定義ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+ void rb_define_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+ void rb_define_singleton_method(VALUE object, const char *name,
+ VALUE (*func)(), int argc)
+
+
+念ã®ãŸã‚説明ã™ã‚‹ã¨ã€Œç‰¹ç•°ãƒ¡ã‚½ãƒƒãƒ‰ã€ã¨ã¯ï¼Œãã®ç‰¹å®šã®ã‚ªãƒ–ジェク
+トã«å¯¾ã—ã¦ã ã‘有効ãªãƒ¡ã‚½ãƒƒãƒ‰ã§ã™ï¼ŽRubyã§ã¯ã‚ˆãSmalltalkã«ãŠ
+ã‘るクラスメソッドã¨ã—ã¦ï¼Œã‚¯ãƒ©ã‚¹ã«å¯¾ã™ã‚‹ç‰¹ç•°ãƒ¡ã‚½ãƒƒãƒ‰ãŒä½¿ã‚れ
+ã¾ã™ï¼Ž
+
+ã“れらã®é–¢æ•°ã® argcã¨ã„ã†å¼•æ•°ã¯Cã®é–¢æ•°ã¸æ¸¡ã•ã‚Œã‚‹å¼•æ•°ã®æ•°(ã¨
+å½¢å¼)を決ã‚ã¾ã™ï¼ŽargcãŒ0ä»¥ä¸Šã®æ™‚ã¯é–¢æ•°ã«å¼•ãæ¸¡ã™å¼•æ•°ã®æ•°ã‚’æ„
+味ã—ã¾ã™ï¼Ž16個以上ã®å¼•æ•°ã¯ä½¿ãˆã¾ã›ã‚“(ãŒï¼Œè¦ã‚Šã¾ã›ã‚“よã­ï¼Œã
+ã‚“ãªã«).実際ã®é–¢æ•°ã«ã¯å…ˆé ­ã®å¼•æ•°ã¨ã—ã¦selfãŒä¸Žãˆã‚‰ã‚Œã¾ã™ã®
+ã§ï¼ŒæŒ‡å®šã—ãŸæ•°ã‚ˆã‚Š1多ã„引数をæŒã¤ã“ã¨ã«ãªã‚Šã¾ã™ï¼Ž
+
+argcãŒè² ã®æ™‚ã¯å¼•æ•°ã®æ•°ã§ã¯ãªã,形å¼ã‚’指定ã—ãŸã“ã¨ã«ãªã‚Šã¾ã™ï¼Ž
+argcãŒ-1ã®æ™‚ã¯å¼•æ•°ã‚’é…列ã«å…¥ã‚Œã¦æ¸¡ã•れã¾ã™ï¼ŽargcãŒ-2ã®æ™‚ã¯å¼•
+æ•°ã¯Rubyã®é…列ã¨ã—ã¦æ¸¡ã•れã¾ã™ï¼Ž
+
+メソッドを定義ã™ã‚‹é–¢æ•°ã¯ã¾ã ã„ãã¤ã‹ã‚りã¾ã™. ã²ã¨ã¤ã¯ãƒ¡ã‚½ãƒƒãƒ‰
+åã¨ã—ã¦IDã‚’å–りã¾ã™. IDã«ã¤ã„ã¦ã¯2.2.2ã‚’å‚ç…§.
+
+ void rb_define_method_id(VALUE klass, ID name,
+ VALUE (*func)(ANYARGS), int argc)
+
+private/protectedãªãƒ¡ã‚½ãƒƒãƒ‰ã‚’定義ã™ã‚‹ãµãŸã¤ã®é–¢æ•°ãŒã‚りã¾ã™.
+
+ void rb_define_private_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+ void rb_define_protected_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+privateメソッドã¨ã¯é–¢æ•°å½¢å¼ã§ã—ã‹å‘¼ã³å‡ºã™ã“ã¨ã®å‡ºæ¥ãªã„メソッ
+ドã§ã™ï¼Ž
+
+最後ã«ï¼Œ rb_define_module関数ã¯ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«é–¢æ•°ã‚’定義ã—ã¾ã™ï¼Ž
+モジュール関数ã¨ã¯ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã®ç‰¹ç•°ãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚ã‚Šï¼ŒåŒæ™‚ã«
+privateメソッドã§ã‚‚ã‚ã‚‹ã‚‚ã®ã§ã™ï¼Žä¾‹ã‚’ã‚ã’ã‚‹ã¨Mathモジュール
+ã®sqrt()ãªã©ãŒã‚ã’られã¾ã™ï¼Žã“ã®ãƒ¡ã‚½ãƒƒãƒ‰ã¯
+
+ Math.sqrt(4)
+
+ã¨ã„ã†å½¢å¼ã§ã‚‚
+
+ include Math
+ sqrt(4)
+
+ã¨ã„ã†å½¢å¼ã§ã‚‚使ãˆã¾ã™ï¼Žãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«é–¢æ•°ã‚’定義ã™ã‚‹é–¢æ•°ã¯ä»¥ä¸‹ã®
+通りã§ã™ï¼Ž
+
+ void rb_define_module_function(VALUE module, const char *name,
+ VALUE (*func)(), int argc)
+
+関数的メソッド(Kernelモジュールã®private method)を定義ã™ã‚‹ãŸ
+ã‚ã®é–¢æ•°ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
+
+ void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+
+メソッドã®åˆ¥åを定義ã™ã‚‹ãŸã‚ã®é–¢æ•°ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
+
+ void rb_define_alias(VALUE module, const char* new, const char* old);
+
+属性ã®å–得・設定メソッドを定義ã™ã‚‹ã«ã¯
+
+ void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
+クラスメソッドallocateを定義ã—ãŸã‚Šå‰Šé™¤ã—ãŸã‚Šã™ã‚‹ãŸã‚ã®é–¢æ•°ã¯
+以下ã®é€šã‚Šã§ã™ï¼Ž
+
+ void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
+ void rb_undef_alloc_func(VALUE klass);
+
+funcã¯ã‚¯ãƒ©ã‚¹ã‚’引数ã¨ã—ã¦å—ã‘å–ã£ã¦ï¼Œæ–°ã—ã割り当ã¦ã‚‰ã‚ŒãŸã‚¤ãƒ³
+スタンスを返ã•ãªãã¦ã¯ãªã‚Šã¾ã›ã‚“.ã“ã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹ã¯ï¼Œå¤–部リ
+ソースãªã©ã‚’å«ã¾ãªã„,ã§ãã‚‹ã ã‘「空ã€ã®ã¾ã¾ã«ã—ã¦ãŠã„ãŸã»ã†
+ãŒã‚ˆã„ã§ã—ょã†ï¼Ž
+
+=== 定数定義
+
+拡張ライブラリãŒå¿…è¦ãªå®šæ•°ã¯ã‚らã‹ã˜ã‚定義ã—ã¦ãŠã„ãŸæ–¹ãŒè‰¯ã„
+ã§ã—ょã†ï¼Žå®šæ•°ã‚’定義ã™ã‚‹é–¢æ•°ã¯äºŒã¤ã‚りã¾ã™ï¼Ž
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
+
+å‰è€…ã¯ç‰¹å®šã®ã‚¯ãƒ©ã‚¹/モジュールã«å±žã™ã‚‹å®šæ•°ã‚’定義ã™ã‚‹ã‚‚ã®ï¼Œå¾Œ
+者ã¯ã‚°ãƒ­ãƒ¼ãƒãƒ«ãªå®šæ•°ã‚’定義ã™ã‚‹ã‚‚ã®ã§ã™ï¼Ž
+
+== Rubyã®æ©Ÿèƒ½ã‚’Cã‹ã‚‰å‘¼ã³å‡ºã™
+
+æ—¢ã«ã€Ž1.5 Rubyã®ãƒ‡ãƒ¼ã‚¿ã‚’æ“作ã™ã‚‹ã€ã§ä¸€éƒ¨ç´¹ä»‹ã—ãŸã‚ˆã†ãªé–¢æ•°ã‚’
+使ãˆã°ï¼ŒRubyã®æ©Ÿèƒ½ã‚’実ç¾ã—ã¦ã„る関数を直接呼ã³å‡ºã™ã“ã¨ãŒå‡ºæ¥
+ã¾ã™ï¼Ž
+
+# ã“ã®ã‚ˆã†ãªé–¢æ•°ã®ä¸€è¦§è¡¨ã¯ã„ã¾ã®ã¨ã“ã‚ã‚りã¾ã›ã‚“.ソースを見
+# ã‚‹ã—ã‹ãªã„ã§ã™ã­ï¼Ž
+
+ãれ以外ã«ã‚‚Rubyã®æ©Ÿèƒ½ã‚’呼ã³å‡ºã™æ–¹æ³•ã¯ã„ãã¤ã‹ã‚りã¾ã™ï¼Ž
+
+=== Rubyã®ãƒ—ログラムをevalã™ã‚‹
+
+Cã‹ã‚‰Rubyã®æ©Ÿèƒ½ã‚’呼ã³å‡ºã™ã‚‚ã£ã¨ã‚‚ç°¡å˜ãªæ–¹æ³•ã¨ã—ã¦ï¼Œæ–‡å­—列ã§
+与ãˆã‚‰ã‚ŒãŸRubyã®ãƒ—ログラムを評価ã™ã‚‹ä»¥ä¸‹ã®é–¢æ•°ãŒã‚りã¾ã™ï¼Ž
+
+ VALUE rb_eval_string(const char *str)
+
+ã“ã®è©•価ã¯ç¾åœ¨ã®ç’°å¢ƒã§è¡Œã‚れã¾ã™ï¼Žã¤ã¾ã‚Šï¼Œç¾åœ¨ã®ãƒ­ãƒ¼ã‚«ãƒ«å¤‰æ•°
+ãªã©ã‚’å—ã‘ç¶™ãŽã¾ã™ï¼Ž
+
+評価ã¯ä¾‹å¤–を発生ã™ã‚‹ã‹ã‚‚ã—れãªã„ã“ã¨ã«æ³¨æ„ã—ã¾ã—ょã†. より安全
+ãªé–¢æ•°ã‚‚ã‚りã¾ã™.
+
+ VALUE rb_eval_string_protect(const char *str, int *state)
+
+ã“ã®é–¢æ•°ã¯ã‚¨ãƒ©ãƒ¼ãŒç™ºç”Ÿã™ã‚‹ã¨nilã‚’è¿”ã—ã¾ã™ï¼Žãã—ã¦ï¼ŒæˆåŠŸæ™‚ã«ã¯
+*stateã¯ã‚¼ãƒ­ã«ï¼Œã•ã‚‚ãªãã°éžã‚¼ãƒ­ã«ãªã‚Šã¾ã™ï¼Ž
+
+=== IDã¾ãŸã¯ã‚·ãƒ³ãƒœãƒ«
+
+Cã‹ã‚‰æ–‡å­—列を経由ã›ãšã«Rubyã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™ã“ã¨ã‚‚ã§ãã¾
+ã™ï¼Žãã®å‰ã«ï¼ŒRubyインタプリタ内ã§ãƒ¡ã‚½ãƒƒãƒ‰ã‚„変数åを指定ã™ã‚‹
+時ã«ä½¿ã‚れã¦ã„ã‚‹IDã«ã¤ã„ã¦èª¬æ˜Žã—ã¦ãŠãã¾ã—ょã†ï¼Ž
+
+IDã¨ã¯å¤‰æ•°å,メソッドåã‚’è¡¨ã™æ•´æ•°ã§ã™ï¼ŽRubyã®ä¸­ã§ã¯
+
+ :識別å­
+
+ã¾ãŸã¯
+
+ :"ä»»æ„ã®æ–‡å­—列"
+
+ã§ã‚¢ã‚¯ã‚»ã‚¹ã§ãã¾ã™ï¼ŽCã‹ã‚‰ã“ã®æ•´æ•°ã‚’å¾—ã‚‹ãŸã‚ã«ã¯é–¢æ•°
+
+ rb_intern(const char *name)
+ rb_intern_str(VALUE name)
+
+を使ã„ã¾ã™ï¼ŽRubyã‹ã‚‰å¼•æ•°ã¨ã—ã¦ä¸Žãˆã‚‰ã‚ŒãŸã‚·ãƒ³ãƒœãƒ«(ã¾ãŸã¯æ–‡å­—
+列)ã‚’IDã«å¤‰æ›ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+ rb_to_id(VALUE symbol)
+ rb_check_id(volatile VALUE *name)
+ rb_check_id_cstr(const char *name, long len, rb_encoding *enc)
+
+ã‚‚ã—引数ãŒã‚·ãƒ³ãƒœãƒ«ã§ã‚‚文字列ã§ã‚‚ãªã‘れã°ï¼Œto_strãƒ¡ã‚½ãƒƒãƒ‰ã§æ–‡
+字列ã«å¤‰æ›ã—よã†ã¨ã—ã¾ã™ï¼Žç¬¬äºŒã®é–¢æ•°ã¯ãã®å¤‰æ›çµæžœã‚’*nameã«ä¿
+å­˜ã—,ãã®åå‰ãŒæ—¢çŸ¥ã®ã‚·ãƒ³ãƒœãƒ«ã§ãªã„å ´åˆã¯0ã‚’è¿”ã—ã¾ã™ï¼Žã“ã®é–¢
+æ•°ãŒ0以外を返ã—ãŸå ´åˆã¯*nameã¯å¸¸ã«ã‚·ãƒ³ãƒœãƒ«ã‹æ–‡å­—列ã§ã‚り,0ã‚’
+è¿”ã—ãŸå ´åˆã¯å¸¸ã«æ–‡å­—列ã§ã™ï¼Žç¬¬ä¸‰ã®é–¢æ•°ã¯Rubyã®æ–‡å­—列ã§ã¯ãªã
+NUL終端ã•れãŸCã®æ–‡å­—列を使ã„ã¾ã™ï¼Ž
+
+Rubyã‹ã‚‰å¼•æ•°ã¨ã—ã¦ä¸Žãˆã‚‰ã‚ŒãŸã‚·ãƒ³ãƒœãƒ«(ã¾ãŸã¯æ–‡å­—列)をシンボル
+ã«å¤‰æ›ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+ rb_to_symbol(VALUE name)
+ rb_check_symbol(volatile VALUE *namep)
+ rb_check_symbol_cstr(const char *ptr, long len, rb_encoding *enc)
+
+ã“れらã®é–¢æ•°ã¯ï¼ŒIDã®ä»£ã‚りã«ã‚·ãƒ³ãƒœãƒ«ã‚’è¿”ã™ã“ã¨ã‚’除ã‘ã°ä¸Šè¨˜ã®
+関数ã¨åŒã˜ã§ã™ï¼Ž
+
+=== Cã‹ã‚‰Rubyã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™
+
+Cã‹ã‚‰æ–‡å­—列を経由ã›ãšã«Rubyã®ãƒ¡ã‚½ãƒƒãƒ‰ã‚’呼ã³å‡ºã™ãŸã‚ã«ã¯ä»¥ä¸‹
+ã®é–¢æ•°ã‚’使ã„ã¾ã™ï¼Ž
+
+ VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+ã“ã®é–¢æ•°ã¯ã‚ªãƒ–ジェクトrecvã®midã§æŒ‡å®šã•れるメソッドを呼ã³å‡º
+ã—ã¾ã™ï¼Žãã®ä»–ã«å¼•æ•°ã®æŒ‡å®šã®ä»•æ–¹ãŒé•ã†ä»¥ä¸‹ã®é–¢æ•°ã‚‚ã‚りã¾ã™ï¼Ž
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+ VALUE rb_funcallv(VALUE recv, ID mid, int argc, VALUE *argv)
+ VALUE rb_apply(VALUE recv, ID mid, VALUE args)
+
+applyã«ã¯å¼•æ•°ã¨ã—ã¦Rubyã®é…列を与ãˆã¾ã™ï¼Ž
+
+=== 変数/定数をå‚ç…§/æ›´æ–°ã™ã‚‹
+
+Cã‹ã‚‰é–¢æ•°ã‚’使ã£ã¦å‚照・更新ã§ãã‚‹ã®ã¯ï¼Œå®šæ•°ï¼Œã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰
+æ•°ã§ã™ï¼Žå¤§åŸŸå¤‰æ•°ã¯ä¸€éƒ¨ã®ã‚‚ã®ã¯Cã®å¤§åŸŸå¤‰æ•°ã¨ã—ã¦ã‚¢ã‚¯ã‚»ã‚¹ã§ã
+ã¾ã™ï¼Žãƒ­ãƒ¼ã‚«ãƒ«å¤‰æ•°ã‚’å‚ç…§ã™ã‚‹æ–¹æ³•ã¯å…¬é–‹ã—ã¦ã„ã¾ã›ã‚“.
+
+オブジェクトã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã‚’å‚照・更新ã™ã‚‹é–¢æ•°ã¯ä»¥ä¸‹ã®é€š
+りã§ã™ï¼Ž
+
+ VALUE rb_ivar_get(VALUE obj, ID id)
+ VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+idã¯rb_intern()ã§å¾—られるもã®ã‚’使ã£ã¦ãã ã•ã„.
+
+定数をå‚ç…§ã™ã‚‹ã«ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã£ã¦ãã ã•ã„.
+
+ VALUE rb_const_get(VALUE obj, ID id)
+
+定数を新ã—ã定義ã™ã‚‹ãŸã‚ã«ã¯ã€Ž2.1.3 定数定義ã€ã§ç´¹ä»‹ã•
+れã¦ã„る関数を使ã£ã¦ãã ã•ã„.
+
+= Rubyã¨Cã¨ã®æƒ…報共有
+
+C言語ã¨Rubyã®é–“ã§æƒ…報を共有ã™ã‚‹æ–¹æ³•ã«ã¤ã„ã¦è§£èª¬ã—ã¾ã™ï¼Ž
+
+== Cã‹ã‚‰å‚ç…§ã§ãã‚‹Rubyã®å®šæ•°
+
+以下ã®Rubyã®å®šæ•°ã¯Cã®ãƒ¬ãƒ™ãƒ«ã‹ã‚‰å‚ç…§ã§ãã¾ã™ï¼Ž
+
+ Qtrue
+ Qfalse
+
+真å½å€¤ï¼ŽQfalseã¯C言語ã§ã‚‚å½ã¨ã¿ãªã•れã¾ã™(ã¤ã¾ã‚Š0).
+
+ Qnil
+
+C言語ã‹ã‚‰è¦‹ãŸã€Œnilã€ï¼Ž
+
+== Cã¨Rubyã§å…±æœ‰ã•れる大域変数
+
+Cã¨Rubyã§å¤§åŸŸå¤‰æ•°ã‚’使ã£ã¦æƒ…報を共有ã§ãã¾ã™ï¼Žå…±æœ‰ã§ãる大域
+変数ã«ã¯ã„ãã¤ã‹ã®ç¨®é¡žãŒã‚りã¾ã™ï¼Žãã®ãªã‹ã§ã‚‚ã£ã¨ã‚‚良ã使ã‚
+ã‚Œã‚‹ã¨æ€ã‚れるã®ã¯rb_define_variable()ã§ã™ï¼Ž
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+ã“ã®é–¢æ•°ã¯Rubyã¨Cã¨ã§å…±æœ‰ã™ã‚‹å¤§åŸŸå¤‰æ•°ã‚’定義ã—ã¾ã™ï¼Žå¤‰æ•°åãŒ
+`$'ã§å§‹ã¾ã‚‰ãªã„時ã«ã¯è‡ªå‹•çš„ã«è¿½åŠ ã•れã¾ã™ï¼Žã“ã®å¤‰æ•°ã®å€¤ã‚’変
+æ›´ã™ã‚‹ã¨è‡ªå‹•çš„ã«Rubyã®å¯¾å¿œã™ã‚‹å¤‰æ•°ã®å€¤ã‚‚変ã‚りã¾ã™ï¼Ž
+
+ã¾ãŸRubyå´ã‹ã‚‰ã¯æ›´æ–°ã§ããªã„変数もã‚りã¾ã™ï¼Žã“ã®read onlyã®
+変数ã¯ä»¥ä¸‹ã®é–¢æ•°ã§å®šç¾©ã—ã¾ã™ï¼Ž
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+ã“れら変数ã®ä»–ã«hookã‚’ã¤ã‘ãŸå¤§åŸŸå¤‰æ•°ã‚’定義ã§ãã¾ã™ï¼Žhook付ã
+ã®å¤§åŸŸå¤‰æ•°ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’用ã„ã¦å®šç¾©ã—ã¾ã™ï¼Žhook付ã大域変数ã®
+値ã®å‚照や設定ã¯hookã§è¡Œã†å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+ã“ã®é–¢æ•°ã¯Cã®é–¢æ•°ã«ã‚ˆã£ã¦hookã®ã¤ã‘られãŸå¤§åŸŸå¤‰æ•°ã‚’定義ã—ã¾
+ã™ï¼Žå¤‰æ•°ãŒå‚ç…§ã•ã‚ŒãŸæ™‚ã«ã¯é–¢æ•°getterãŒï¼Œå¤‰æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•れ
+ãŸæ™‚ã«ã¯é–¢æ•°setterãŒå‘¼ã°ã‚Œã‚‹ï¼Žhookを指定ã—ãªã„å ´åˆã¯getterã‚„
+setterã«0を指定ã—ã¾ã™ï¼Ž
+# getterã‚‚setterã‚‚0ãªã‚‰ã°rb_define_variable()ã¨åŒã˜ã«ãªã‚‹ï¼Ž
+
+getterã¨setterã®ä»•æ§˜ã¯æ¬¡ã®é€šã‚Šã§ã™ï¼Ž
+
+ VALUE (*getter)(ID id, VALUE *var);
+ void (*setter)(VALUE val, ID id, VALUE *var);
+
+
+ãれã‹ã‚‰ï¼Œå¯¾å¿œã™ã‚‹Cã®å¤‰æ•°ã‚’æŒãŸãªã„Rubyã®å¤§åŸŸå¤‰æ•°ã‚’定義ã™ã‚‹
+ã“ã¨ã‚‚ã§ãã¾ã™. ãã®å¤‰æ•°ã®å€¤ã¯ãƒ•ック関数ã®ã¿ã«ã‚ˆã£ã¦å–得・設定
+ã•れã¾ã™.
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+ã“ã®é–¢æ•°ã«ã‚ˆã£ã¦å®šç¾©ã•れãŸRubyã®å¤§åŸŸå¤‰æ•°ãŒå‚ç…§ã•ã‚ŒãŸæ™‚ã«ã¯
+getterãŒï¼Œå¤‰æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•ã‚ŒãŸæ™‚ã«ã¯setterãŒå‘¼ã°ã‚Œã¾ã™ï¼Ž
+
+getterã¨setterã®ä»•様ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
+
+ (*getter)(ID id);
+ (*setter)(VALUE val, ID id);
+
+== Cã®ãƒ‡ãƒ¼ã‚¿ã‚’Rubyオブジェクトã«ã™ã‚‹
+
+Cã®ä¸–界ã§å®šç¾©ã•れãŸãƒ‡ãƒ¼ã‚¿(構造体)ã‚’Rubyã®ã‚ªãƒ–ジェクトã¨ã—ã¦
+å–り扱ã„ãŸã„å ´åˆãŒã‚りãˆã¾ã™ï¼Žã“ã®ã‚ˆã†ãªå ´åˆã«ã¯ï¼ŒDataã¨ã„ã†
+Rubyオブジェクトã«Cã®æ§‹é€ ä½“(ã¸ã®ãƒã‚¤ãƒ³ã‚¿)ã‚’ãã‚‹ã‚€ã“ã¨ã§Ruby
+オブジェクトã¨ã—ã¦å–り扱ãˆã‚‹ã‚ˆã†ã«ãªã‚Šã¾ã™ï¼Ž
+
+Dataオブジェクトを生æˆã—ã¦æ§‹é€ ä½“ã‚’Rubyオブジェクトã«ã‚«ãƒ—セル
+化ã™ã‚‹ãŸã‚ã«ã¯ï¼Œä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ã‚’使ã„ã¾ã™ï¼Ž
+
+ Data_Wrap_Struct(klass, mark, free, sval)
+
+ã“ã®ãƒžã‚¯ãƒ­ã®æˆ»ã‚Šå€¤ã¯ç”Ÿæˆã•れãŸDataオブジェクトã§ã™ï¼Ž
+
+klassã¯ã“ã®Dataオブジェクトã®ã‚¯ãƒ©ã‚¹ã§ã™ï¼Žmarkã¯ã“ã®æ§‹é€ ä½“ãŒ
+Rubyã®ã‚ªãƒ–ジェクトã¸ã®å‚ç…§ãŒã‚る時ã«ä½¿ã†é–¢æ•°ã§ã™ï¼Žãã®ã‚ˆã†ãª
+å‚ç…§ã‚’å«ã¾ãªã„時ã«ã¯0を指定ã—ã¾ã™ï¼Ž
+
+# ãã®ã‚ˆã†ãªå‚ç…§ã¯å‹§ã‚られã¾ã›ã‚“.
+
+freeã¯ã“ã®æ§‹é€ ä½“ãŒã‚‚ã†ä¸è¦ã«ãªã£ãŸæ™‚ã«å‘¼ã°ã‚Œã‚‹é–¢æ•°ã§ã™ï¼Žã“ã®
+関数ãŒã‚¬ãƒ¼ãƒ™ãƒ¼ã‚¸ã‚³ãƒ¬ã‚¯ã‚¿ã‹ã‚‰å‘¼ã°ã‚Œã¾ã™ï¼Žã“れãŒ-1ã®å ´åˆã¯ï¼Œå˜
+ç´”ã«é–‹æ”¾ã•れã¾ã™ï¼Ž
+
+markãŠã‚ˆã³free関数ã¯GC実行中ã«å‘¼ã³å‡ºã•れã¾ã™.
+ãªãŠ, GC実行中ã¯Rubyオブジェクトã®ã‚¢ãƒ­ã‚±ãƒ¼ã‚·ãƒ§ãƒ³ã¯ç¦æ­¢ã•れã¾
+ã™. よã£ã¦, markãŠã‚ˆã³free関数ã§Rubyオブジェクトã®ã‚¢ãƒ­ã‚±ãƒ¼ã‚·
+ョンã¯è¡Œã‚ãªã„ã§ãã ã•ã„.
+
+Cã®æ§‹é€ ä½“ã®å‰²å½“ã¨Dataオブジェクトã®ç”Ÿæˆã‚’åŒæ™‚ã«è¡Œã†ãƒžã‚¯ãƒ­ã¨
+ã—ã¦ä»¥ä¸‹ã®ã‚‚ã®ãŒæä¾›ã•れã¦ã„ã¾ã™ï¼Ž
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+ã“ã®ãƒžã‚¯ãƒ­ã®æˆ»ã‚Šå€¤ã¯ç”Ÿæˆã•れãŸDataオブジェクトã§ã™ï¼Žã“ã®ãƒžã‚¯
+ロã¯ä»¥ä¸‹ã®å¼ã®ã‚ˆã†ã«åƒãã¾ã™:
+
+ (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
+
+klass, mark, freeã¯Data_Wrap_Structã¨åŒã˜åƒãã‚’ã—ã¾ã™ï¼Žtype
+ã¯å‰²ã‚Šå½“ã¦ã‚‹C構造体ã®åž‹ã§ã™ï¼Žå‰²ã‚Šå½“ã¦ã‚‰ã‚ŒãŸæ§‹é€ ä½“ã¯å¤‰æ•°sval
+ã«ä»£å…¥ã•れã¾ã™ï¼Žã“ã®å¤‰æ•°ã®åž‹ã¯ (type*) ã§ã‚ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+
+Dataオブジェクトã‹ã‚‰ãƒã‚¤ãƒ³ã‚¿ã‚’å–り出ã™ã®ã¯ä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ã‚’用ã„
+ã¾ã™ï¼Ž
+
+ Data_Get_Struct(obj, type, sval)
+
+Cã®æ§‹é€ ä½“ã¸ã®ãƒã‚¤ãƒ³ã‚¿ã¯å¤‰æ•°svalã«ä»£å…¥ã•れã¾ã™ï¼Ž
+
+ã“れらã®Dataã®ä½¿ã„æ–¹ã¯ã¡ã‚‡ã£ã¨åˆ†ã‹ã‚Šã«ãã„ã®ã§ï¼Œå¾Œã§èª¬æ˜Žã™ã‚‹
+例題をå‚ç…§ã—ã¦ãã ã•ã„.
+
+= 例題 - dbmパッケージを作る
+
+ã“ã“ã¾ã§ã®èª¬æ˜Žã§ã¨ã‚Šã‚ãˆãšæ‹¡å¼µãƒ©ã‚¤ãƒ–ãƒ©ãƒªã¯ä½œã‚Œã‚‹ã¯ãšã§ã™ï¼Ž
+Rubyã®extディレクトリã«ã™ã§ã«å«ã¾ã‚Œã¦ã„ã‚‹dbmライブラリを例ã«
+ã—ã¦æ®µéšŽçš„ã«èª¬æ˜Žã—ã¾ã™ï¼Ž
+
+== ディレクトリを作る
+
+ % mkdir ext/dbm
+
+Ruby 1.1ã‹ã‚‰ã¯ä»»æ„ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã§ãƒ€ã‚¤ãƒŠãƒŸãƒƒã‚¯ãƒ©ã‚¤ãƒ–ラリを作
+ã‚‹ã“ã¨ãŒã§ãるよã†ã«ãªã‚Šã¾ã—ãŸï¼ŽRubyã«é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹å ´åˆã«
+ã¯Rubyを展開ã—ãŸãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã®ä¸‹ï¼Œextディレクトリã®ä¸­ã«æ‹¡å¼µ
+ライブラリ用ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’作る必è¦ãŒã‚りã¾ã™ï¼Žåå‰ã¯é©å½“ã«
+é¸ã‚“ã§æ§‹ã„ã¾ã›ã‚“.
+
+== 設計ã™ã‚‹
+
+ã¾ã‚,当然ãªã‚“ã§ã™ã‘ã©ï¼Œã©ã†ã„ã†æ©Ÿèƒ½ã‚’実ç¾ã™ã‚‹ã‹ã©ã†ã‹ã¾ãšè¨­
+計ã™ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Žã©ã‚“ãªã‚¯ãƒ©ã‚¹ã‚’ã¤ãã‚‹ã‹ï¼Œãã®ã‚¯ãƒ©ã‚¹ã«ã¯
+ã©ã‚“ãªãƒ¡ã‚½ãƒƒãƒ‰ãŒã‚ã‚‹ã‹ï¼Œã‚¯ãƒ©ã‚¹ãŒæä¾›ã™ã‚‹å®šæ•°ãªã©ã«ã¤ã„ã¦è¨­è¨ˆ
+ã—ã¾ã™ï¼Ž
+
+== Cコードを書ã
+
+拡張ライブラリ本体ã¨ãªã‚‹C言語ã®ã‚½ãƒ¼ã‚¹ã‚’書ãã¾ã™ï¼ŽC言語ã®ã‚½ãƒ¼
+スãŒã²ã¨ã¤ã®æ™‚ã«ã¯ã€Œãƒ©ã‚¤ãƒ–ラリå.cã€ã‚’é¸ã¶ã¨è‰¯ã„ã§ã—ょã†ï¼ŽC
+言語ã®ã‚½ãƒ¼ã‚¹ãŒè¤‡æ•°ã®å ´åˆã«ã¯é€†ã«ã€Œãƒ©ã‚¤ãƒ–ラリå.cã€ã¨ã„ã†ãƒ•ã‚¡
+イルåã¯é¿ã‘ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Žã‚ªãƒ–ジェクトファイルã¨ãƒ¢ã‚¸ãƒ¥ãƒ¼
+ãƒ«ç”Ÿæˆæ™‚ã«ä¸­é–“çš„ã«ç”Ÿæˆã•れる「ライブラリå.oã€ã¨ã„ã†ãƒ•ァイル
+ã¨ãŒè¡çªã™ã‚‹ã‹ã‚‰ã§ã™ï¼Žã¾ãŸï¼Œå¾Œè¿°ã™ã‚‹ mkmf ライブラリã®ã„ãã¤
+ã‹ã®é–¢æ•°ãŒã‚³ãƒ³ãƒ‘イルをè¦ã™ã‚‹ãƒ†ã‚¹ãƒˆã®ãŸã‚ã«ã€Œconftest.cã€ã¨ã„
+ã†ãƒ•ァイルåを使用ã™ã‚‹ã“ã¨ã«æ³¨æ„ã—ã¦ãã ã•ã„.ソースファイル
+åã¨ã—ã¦ã€Œconftest.cã€ã‚’使用ã—ã¦ã¯ãªã‚Šã¾ã›ã‚“.
+
+Rubyã¯æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリをロードã™ã‚‹æ™‚ã«ã€ŒInit_ライブラリåã€ã¨
+ã„ã†é–¢æ•°ã‚’自動的ã«å®Ÿè¡Œã—ã¾ã™ï¼Ždbmライブラリã®å ´åˆã€ŒInit_dbmã€
+ã§ã™ï¼Žã“ã®é–¢æ•°ã®ä¸­ã§ã‚¯ãƒ©ã‚¹ï¼Œãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ï¼Œãƒ¡ã‚½ãƒƒãƒ‰ï¼Œå®šæ•°ãªã©ã®
+定義を行ã„ã¾ã™ï¼Ždbm.cã‹ã‚‰ä¸€éƒ¨å¼•用ã—ã¾ã™ï¼Ž
+
+ void
+ Init_dbm(void)
+ {
+ /* DBMクラスを定義ã™ã‚‹ */
+ cDBM = rb_define_class("DBM", rb_cObject);
+ /* DBMã¯Enumerableモジュールをインクルードã™ã‚‹ */
+ rb_include_module(cDBM, rb_mEnumerable);
+
+ /* DBMクラスã®ã‚¯ãƒ©ã‚¹ãƒ¡ã‚½ãƒƒãƒ‰open(): 引数ã¯Cã®é…列ã§å—ã‘ã‚‹ */
+ rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+ /* DBMクラスã®ãƒ¡ã‚½ãƒƒãƒ‰close(): 引数ã¯ãªã— */
+ rb_define_method(cDBM, "close", fdbm_close, 0);
+ /* DBMクラスã®ãƒ¡ã‚½ãƒƒãƒ‰[]: 引数ã¯1個 */
+ rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+
+ /* ... */
+
+ /* DBMデータを格ç´ã™ã‚‹ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°åã®ãŸã‚ã®ID */
+ id_dbm = rb_intern("dbm");
+ }
+
+DBMライブラリã¯dbmã®ãƒ‡ãƒ¼ã‚¿ã¨å¯¾å¿œã™ã‚‹ã‚ªãƒ–ジェクトã«ãªã‚‹ã¯ãšã§
+ã™ã‹ã‚‰ï¼ŒCã®ä¸–界ã®dbmã‚’Rubyã®ä¸–界ã«å–り込む必è¦ãŒã‚りã¾ã™ï¼Ž
+
+dbm.cã§ã¯Data_Make_Structを以下ã®ã‚ˆã†ã«ä½¿ã£ã¦ã„ã¾ã™ï¼Ž
+
+ struct dbmdata {
+ int di_size;
+ DBM *di_dbm;
+ };
+
+
+ obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+
+ã“ã“ã§ã¯dbmstruct構造体ã¸ã®ãƒã‚¤ãƒ³ã‚¿ã‚’Dataã«ã‚«ãƒ—セル化ã—ã¦ã„
+ã¾ã™ï¼ŽDBM*を直接カプセル化ã—ãªã„ã®ã¯close()ã—ãŸæ™‚ã®å‡¦ç†ã‚’考
+ãˆã¦ã®ã“ã¨ã§ã™ï¼Ž
+
+Dataオブジェクトã‹ã‚‰dbmstruct構造体ã®ãƒã‚¤ãƒ³ã‚¿ã‚’å–り出ã™ãŸã‚
+ã«ä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ã‚’使ã£ã¦ã„ã¾ã™ï¼Ž
+
+ #define GetDBM(obj, dbmp) do {\
+ Data_Get_Struct(obj, struct dbmdata, dbmp);\
+ if (dbmp->di_dbm == 0) closed_dbm();\
+ } while (0)
+
+ã¡ã‚‡ã£ã¨è¤‡é›‘ãªãƒžã‚¯ãƒ­ã§ã™ãŒï¼Œè¦ã™ã‚‹ã«dbmdata構造体ã®ãƒã‚¤ãƒ³ã‚¿
+ã®å–り出ã—ã¨ï¼Œcloseã•れã¦ã„ã‚‹ã‹ã©ã†ã‹ã®ãƒã‚§ãƒƒã‚¯ã‚’ã¾ã¨ã‚ã¦ã„
+ã‚‹ã ã‘ã§ã™ï¼Ž
+
+DBMクラスã«ã¯ãŸãã•んメソッドãŒã‚りã¾ã™ãŒï¼Œåˆ†é¡žã™ã‚‹ã¨3種類ã®
+引数ã®å—ã‘æ–¹ãŒã‚りã¾ã™ï¼Žã²ã¨ã¤ã¯å¼•æ•°ã®æ•°ãŒå›ºå®šã®ã‚‚ã®ã§ï¼Œä¾‹ã¨
+ã—ã¦ã¯deleteメソッドãŒã‚りã¾ã™ï¼Ždeleteメソッドを実装ã—ã¦ã„ã‚‹
+fdbm_delete()ã¯ã“ã®ã‚ˆã†ã«ãªã£ã¦ã„ã¾ã™ï¼Ž
+
+ static VALUE
+ fdbm_delete(VALUE obj, VALUE keystr)
+ {
+ /* ... */
+ }
+
+å¼•æ•°ã®æ•°ãŒå›ºå®šã®ã‚¿ã‚¤ãƒ—ã¯ç¬¬1引数ãŒself,第2引数以é™ãŒãƒ¡ã‚½ãƒƒãƒ‰
+ã®å¼•æ•°ã¨ãªã‚Šã¾ã™ï¼Ž
+
+å¼•æ•°ã®æ•°ãŒä¸å®šã®ã‚‚ã®ã¯Cã®é…列ã§å—ã‘ã‚‹ã‚‚ã®ã¨Rubyã®é…列ã§å—ã‘
+ã‚‹ã‚‚ã®ã¨ãŒã‚りã¾ã™ï¼Ždbmライブラリã®ä¸­ã§ï¼ŒCã®é…列ã§å—ã‘ã‚‹ã‚‚ã®
+ã¯DBMã®ã‚¯ãƒ©ã‚¹ãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚ã‚‹open()ã§ã™ï¼Žã“れを実装ã—ã¦ã„ã‚‹é–¢
+æ•°fdbm_s_open()ã¯ã“ã†ãªã£ã¦ã„ã¾ã™ï¼Ž
+
+ static VALUE
+ fdbm_s_open(int argc, VALUE *argv, VALUE klass)
+ {
+ /* ... */
+
+ if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+ mode = 0666; /* default value */
+ }
+
+ /* ... */
+ }
+
+ã“ã®ã‚¿ã‚¤ãƒ—ã®é–¢æ•°ã¯ç¬¬1引数ãŒä¸Žãˆã‚‰ã‚ŒãŸå¼•æ•°ã®æ•°ï¼Œç¬¬2引数ãŒä¸Žãˆ
+られãŸå¼•æ•°ã®å…¥ã£ã¦ã„ã‚‹é…列ã«ãªã‚Šã¾ã™ï¼Žselfã¯ç¬¬3引数ã¨ã—ã¦ä¸Ž
+ãˆã‚‰ã‚Œã¾ã™ï¼Ž
+
+ã“ã®é…列ã§ä¸Žãˆã‚‰ã‚ŒãŸå¼•æ•°ã‚’è§£æžã™ã‚‹ãŸã‚ã®é–¢æ•°ãŒopen()ã§ã‚‚使ã‚
+れã¦ã„ã‚‹rb_scan_args()ã§ã™ï¼Žç¬¬3å¼•æ•°ã«æŒ‡å®šã—ãŸãƒ•ォーマットã«å¾“
+ã„,第4変数以é™ã«æŒ‡å®šã—ãŸVALUEã¸ã®å‚ç…§ã«å€¤ã‚’代入ã—ã¦ãれã¾
+ã™ï¼Ž
+
+
+引数をRubyã®é…列ã¨ã—ã¦å—ã‘å–るメソッドã®ä¾‹ã«ã¯
+Thread#initializeãŒã‚りã¾ã™ï¼Žå®Ÿè£…ã¯ã“ã†ã§ã™ï¼Ž
+
+ static VALUE
+ thread_initialize(VALUE thread, VALUE args)
+ {
+ /* ... */
+ }
+
+第1引数ã¯self,第2引数ã¯Rubyã®é…列ã§ã™ï¼Ž
+
+*注æ„事項*
+
+Rubyã¨å…±æœ‰ã¯ã—ãªã„ãŒRubyã®ã‚ªãƒ–ジェクトを格ç´ã™ã‚‹å¯èƒ½æ€§ã®ã‚ã‚‹
+Cã®å¤§åŸŸå¤‰æ•°ã¯ä»¥ä¸‹ã®é–¢æ•°ã‚’使ã£ã¦Rubyインタプリタã«å¤‰æ•°ã®å­˜åœ¨
+ã‚’æ•™ãˆã¦ã‚ã’ã¦ãã ã•ã„.ã§ãªã„ã¨GCã§ãƒˆãƒ©ãƒ–ルを起ã“ã—ã¾ã™ï¼Ž
+
+ void rb_global_variable(VALUE *var)
+
+== extconf.rbを用æ„ã™ã‚‹
+
+Makefileを作る場åˆã®é››åž‹ã«ãªã‚‹extconf.rbã¨ã„ã†ãƒ•ァイルを作り
+ã¾ã™ï¼Žextconf.rbã¯ãƒ©ã‚¤ãƒ–ラリã®ã‚³ãƒ³ãƒ‘イルã«å¿…è¦ãªæ¡ä»¶ã®ãƒã‚§ãƒƒ
+クãªã©ã‚’行ã†ã“ã¨ãŒç›®çš„ã§ã™ï¼Žã¾ãšï¼Œ
+
+ require 'mkmf'
+
+ã‚’extconf.rbã®å…ˆé ­ã«ç½®ãã¾ã™ï¼Žextconf.rbã®ä¸­ã§ã¯ä»¥ä¸‹ã®Rubyé–¢
+数を使ã†ã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼Ž
+
+ have_library(lib, func): ライブラリã®å­˜åœ¨ãƒã‚§ãƒƒã‚¯
+ have_func(func, header): 関数ã®å­˜åœ¨ãƒã‚§ãƒƒã‚¯
+ have_header(header): ヘッダファイルã®å­˜åœ¨ãƒã‚§ãƒƒã‚¯
+ create_makefile(target[, target_prefix]): Makefileã®ç”Ÿæˆ
+
+以下ã®å¤‰æ•°ã‚’使ã†ã“ã¨ãŒã§ãã¾ã™ï¼Ž
+
+ $CFLAGS: コンパイル時ã«è¿½åŠ çš„ã«æŒ‡å®šã™ã‚‹ãƒ•ラグ(-Oãªã©)
+ $CPPFLAGS: プリプロセッサã«è¿½åŠ çš„ã«æŒ‡å®šã™ã‚‹ãƒ•ラグ(-Iã‚„-Dãªã©)
+ $LDFLAGS: リンク時ã«è¿½åŠ çš„ã«æŒ‡å®šã™ã‚‹ãƒ•ラグ(-Lãªã©)
+ $objs: リンクã•れるオブジェクトファイルåã®ãƒªã‚¹ãƒˆ
+
+オブジェクトファイルã®ãƒªã‚¹ãƒˆã¯ï¼Œé€šå¸¸ã¯ã‚½ãƒ¼ã‚¹ãƒ•ァイルを検索ã—
+ã¦è‡ªå‹•çš„ã«ç”Ÿæˆã•れã¾ã™ãŒï¼Œmakeã®é€”中ã§ã‚½ãƒ¼ã‚¹ã‚’生æˆã™ã‚‹ã‚ˆã†ãª
+å ´åˆã¯æ˜Žç¤ºçš„ã«æŒ‡å®šã™ã‚‹å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+
+ライブラリをコンパイルã™ã‚‹æ¡ä»¶ãŒæƒã‚ãšï¼Œãã®ãƒ©ã‚¤ãƒ–ラリをコン
+パイルã—ãªã„時ã«ã¯create_makefileを呼ã°ãªã‘れã°Makefileã¯ç”Ÿ
+æˆã•れãšï¼Œã‚³ãƒ³ãƒ‘イルも行ã‚れã¾ã›ã‚“.
+
+== dependを用æ„ã™ã‚‹
+
+ã‚‚ã—,ディレクトリã«dependã¨ã„ã†ãƒ•ァイルãŒå­˜åœ¨ã™ã‚Œã°ï¼Œ
+MakefileãŒä¾å­˜é–¢ä¿‚ã‚’ãƒã‚§ãƒƒã‚¯ã—ã¦ãれã¾ã™ï¼Ž
+
+ % gcc -MM *.c > depend
+
+ãªã©ã§ä½œã‚‹ã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼Žã‚ã£ã¦æã¯ç„¡ã„ã§ã—ょã†ï¼Ž
+
+== Makefileを生æˆã™ã‚‹
+
+Makefileを実際ã«ç”Ÿæˆã™ã‚‹ãŸã‚ã«ã¯
+
+ ruby extconf.rb
+
+ã¨ã—ã¾ã™ï¼Žextconf.rbã« require 'mkmf' ã®è¡ŒãŒãªã„å ´åˆã«ã¯ã‚¨ãƒ©ãƒ¼
+ã«ãªã‚Šã¾ã™ã®ã§ï¼Œå¼•数を追加ã—ã¦
+
+ ruby -r mkmf extconf.rb
+
+ã¨ã—ã¦ãã ã•ã„.
+
+site_ruby ディレクトリã§ãªã,
+vendor_ruby ディレクトリã«ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«ã™ã‚‹å ´åˆã«ã¯
+以下ã®ã‚ˆã†ã« --vendor オプションを加ãˆã¦ãã ã•ã„.
+
+ ruby extconf.rb --vendor
+
+ディレクトリをext以下ã«ç”¨æ„ã—ãŸå ´åˆã«ã¯Ruby全体ã®makeã®æ™‚ã«
+自動的ã«MakefileãŒç”Ÿæˆã•れã¾ã™ã®ã§ï¼Œã“ã®ã‚¹ãƒ†ãƒƒãƒ—ã¯ä¸è¦ã§ã™ï¼Ž
+
+== makeã™ã‚‹
+
+動的リンクライブラリを生æˆã™ã‚‹å ´åˆã«ã¯ãã®å ´ã§makeã—ã¦ãã ã•
+ã„.必è¦ã§ã‚れ㰠make install ã§ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«ã•れã¾ã™ï¼Ž
+
+ext以下ã«ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’用æ„ã—ãŸå ´åˆã¯ï¼ŒRubyã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã§
+makeを実行ã™ã‚‹ã¨Makefileを生æˆã‹ã‚‰make,必è¦ã«ã‚ˆã£ã¦ã¯ãã®ãƒ¢
+ジュールã®Rubyã¸ã®ãƒªãƒ³ã‚¯ã¾ã§è‡ªå‹•çš„ã«å®Ÿè¡Œã—ã¦ãれã¾ã™ï¼Ž
+extconf.rbã‚’æ›¸ãæ›ãˆã‚‹ãªã©ã—ã¦Makefileã®å†ç”ŸæˆãŒå¿…è¦ãªæ™‚ã¯ã¾
+ãŸRubyディレクトリã§makeã—ã¦ãã ã•ã„.
+
+拡張ライブラリã¯make installã§Rubyライブラリã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã®
+下ã«ã‚³ãƒ”ーã•れã¾ã™ï¼Žã‚‚ã—æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã¨å”調ã—ã¦ä½¿ã†Rubyã§è¨˜
+è¿°ã•れãŸãƒ—ログラムãŒã‚り,Rubyライブラリã«ç½®ããŸã„å ´åˆã«ã¯ï¼Œ
+拡張ライブラリ用ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã®ä¸‹ã« lib ã¨ã„ã†ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒª
+を作り,ãã“ã« æ‹¡å¼µå­ .rb ã®ãƒ•ァイルを置ã„ã¦ãŠã‘ã°åŒæ™‚ã«ã‚¤ãƒ³
+ストールã•れã¾ã™ï¼Ž
+
+== デãƒãƒƒã‚°
+
+ã¾ã‚,デãƒãƒƒã‚°ã—ãªã„ã¨å‹•ã‹ãªã„ã§ã—ょã†ã­ï¼Žext/Setupã«ãƒ‡ã‚£ãƒ¬
+クトリåを書ãã¨é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹ã®ã§ãƒ‡ãƒãƒƒã‚¬ãŒä½¿ãˆã‚‹ã‚ˆã†ã«ãª
+りã¾ã™ï¼Žãã®åˆ†ã‚³ãƒ³ãƒ‘イルãŒé…ããªã‚Šã¾ã™ã‘ã©ï¼Ž
+
+== ã§ãã‚ãŒã‚Š
+
+後ã¯ã“ã£ãり使ã†ãªã‚Šï¼Œåºƒã公開ã™ã‚‹ãªã‚Šï¼Œå£²ã‚‹ãªã‚Šï¼Œã”自由ã«ãŠ
+使ã„ãã ã•ã„.Rubyã®ä½œè€…ã¯æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«é–¢ã—ã¦ä¸€åˆ‡ã®æ¨©åˆ©ã‚’
+主張ã—ã¾ã›ã‚“.
+
+= Appendix A. Rubyã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®åˆ†é¡ž
+
+Rubyã®ã‚½ãƒ¼ã‚¹ã¯ã„ãã¤ã‹ã«åˆ†é¡žã™ã‚‹ã“ã¨ãŒå‡ºæ¥ã¾ã™ï¼Žã“ã®ã†ã¡ã‚¯ãƒ©
+スライブラリã®éƒ¨åˆ†ã¯åŸºæœ¬çš„ã«æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã¨åŒã˜ä½œã‚Šæ–¹ã«ãªã£
+ã¦ã„ã¾ã™ï¼Žã“れらã®ã‚½ãƒ¼ã‚¹ã¯ä»Šã¾ã§ã®èª¬æ˜Žã§ã»ã¨ã‚“ã©ç†è§£ã§ãã‚‹ã¨
+æ€ã„ã¾ã™ï¼Ž
+
+== Ruby言語ã®ã‚³ã‚¢
+
+class.c :: クラスã¨ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«
+error.c :: 例外クラスã¨ä¾‹å¤–機構
+gc.c :: 記憶領域管ç†
+load.c :: ライブラリã®ãƒ­ãƒ¼ãƒ‰
+object.c :: オブジェクト
+variable.c :: 変数ã¨å®šæ•°
+
+== Rubyã®æ§‹æ–‡è§£æžå™¨
+
+ parse.y : å­—å¥è§£æžå™¨ã¨æ§‹æ–‡å®šç¾©
+ -> parse.c : 自動生æˆ
+ keywords : 予約語
+ -> lex.c : 自動生æˆ
+
+== Rubyã®è©•価器 (通称YARV)
+ compile.c
+ eval.c
+ eval_error.c
+ eval_jump.c
+ eval_safe.c
+ insns.def : 仮想機械語ã®å®šç¾©
+ iseq.c : VM::ISeqã®å®Ÿè£…
+ thread.c : スレッド管ç†ã¨ã‚³ãƒ³ãƒ†ã‚­ã‚¹ãƒˆåˆ‡ã‚Šæ›¿ãˆ
+ thread_win32.c : スレッド実装
+ thread_pthread.c : åŒä¸Š
+ vm.c
+ vm_dump.c
+ vm_eval.c
+ vm_exec.c
+ vm_insnhelper.c
+ vm_method.c
+
+ opt_insns_unif.def : 命令èžåˆ
+ opt_operand.def : 最é©åŒ–ã®ãŸã‚ã®å®šç¾©
+
+ -> insn*.inc : 自動生æˆ
+ -> opt*.inc : 自動生æˆ
+ -> vm.inc : 自動生æˆ
+
+== æ­£è¦è¡¨ç¾ã‚¨ãƒ³ã‚¸ãƒ³ (鬼車)
+
+ regex.c
+ regcomp.c
+ regenc.c
+ regerror.c
+ regexec.c
+ regparse.c
+ regsyntax.c
+
+== ユーティリティ関数
+
+debug.c :: Cデãƒãƒƒã‚¬ç”¨ã®ãƒ‡ãƒãƒƒã‚°ã‚·ãƒ³ãƒœãƒ«
+dln.c :: 動的ローディング
+st.c :: 汎用ãƒãƒƒã‚·ãƒ¥è¡¨
+strftime.c :: 時刻整形
+util.c :: ãã®ä»–ã®ãƒ¦ãƒ¼ãƒ†ã‚£ãƒªãƒ†ã‚£
+
+== Rubyコマンドã®å®Ÿè£…
+
+ dmyext.c
+ dmydln.c
+ dmyencoding.c
+ id.c
+ inits.c
+ main.c
+ ruby.c
+ version.c
+
+ gem_prelude.rb
+ prelude.rb
+
+== クラスライブラリ
+
+array.c :: Array
+bignum.c :: Bignum
+compar.c :: Comparable
+complex.c :: Complex
+cont.c :: Fiber, Continuation
+dir.c :: Dir
+enum.c :: Enumerable
+enumerator.c :: Enumerator
+file.c :: File
+hash.c :: Hash
+io.c :: IO
+marshal.c :: Marshal
+math.c :: Math
+numeric.c :: Numeric, Integer, Fixnum, Float
+pack.c :: Array#pack, String#unpack
+proc.c :: Binding, Proc
+process.c :: Process
+random.c :: 乱数
+range.c :: Range
+rational.c :: Rational
+re.c :: Regexp, MatchData
+signal.c :: Signal
+sprintf.c :: String#sprintf
+string.c :: String
+struct.c :: Struct
+time.c :: Time
+defs/known_errors.def :: 例外クラス Errno::*
+-> known_errors.inc :: 自動生æˆ
+
+== 多言語化
+
+encoding.c :: Encoding
+transcode.c :: Encoding::Converter
+enc/*.c :: エンコーディングクラス群
+enc/trans/* :: コードãƒã‚¤ãƒ³ãƒˆå¯¾å¿œè¡¨
+
+== gorubyコマンドã®å®Ÿè£…
+
+ goruby.c
+ golf_prelude.rb : goruby固有ã®ãƒ©ã‚¤ãƒ–ラリ
+ -> golf_prelude.c : 自動生æˆ
+
+= Appendix B. 拡張用関数リファレンス
+
+C言語ã‹ã‚‰Rubyã®æ©Ÿèƒ½ã‚’利用ã™ã‚‹APIã¯ä»¥ä¸‹ã®é€šã‚Šã§ã‚る.
+
+== åž‹
+
+VALUE ::
+
+ Rubyオブジェクトを表ç¾ã™ã‚‹åž‹ï¼Žå¿…è¦ã«å¿œã˜ã¦ã‚­ãƒ£ã‚¹ãƒˆã—ã¦ç”¨ã„る.
+ 組ã¿è¾¼ã¿åž‹ã‚’表ç¾ã™ã‚‹Cã®åž‹ã¯ruby.hã«è¨˜è¿°ã—ã¦ã‚ã‚‹Rã§å§‹ã¾ã‚‹æ§‹é€ 
+ 体ã§ã‚る.VALUE型をã“れらã«ã‚­ãƒ£ã‚¹ãƒˆã™ã‚‹ãŸã‚ã«Rã§å§‹ã¾ã‚‹æ§‹é€ ä½“
+ åã‚’å…¨ã¦å¤§æ–‡å­—ã«ã—ãŸåå‰ã®ãƒžã‚¯ãƒ­ãŒç”¨æ„ã•れã¦ã„る.
+
+== 変数・定数
+
+Qnil ::
+
+ 定数: nilオブジェクト
+
+Qtrue ::
+
+ 定数: trueオブジェクト(真ã®ãƒ‡ãƒ•ォルト値)
+
+Qfalse ::
+
+ 定数: falseオブジェクト
+
+== Cデータã®ã‚«ãƒ—セル化
+
+Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval) ::
+
+ Cã®ä»»æ„ã®ãƒã‚¤ãƒ³ã‚¿ã‚’カプセル化ã—ãŸRubyオブジェクトを返ã™ï¼Žã“
+ ã®ãƒã‚¤ãƒ³ã‚¿ãŒRubyã‹ã‚‰ã‚¢ã‚¯ã‚»ã‚¹ã•れãªããªã£ãŸæ™‚,freeã§æŒ‡å®šã—ãŸ
+ 関数ãŒå‘¼ã°ã‚Œã‚‹ï¼Žã¾ãŸï¼Œã“ã®ãƒã‚¤ãƒ³ã‚¿ã®æŒ‡ã™ãƒ‡ãƒ¼ã‚¿ãŒä»–ã®Rubyオブ
+ ジェクトを指ã—ã¦ã„ã‚‹å ´åˆï¼Œmarkã«æŒ‡å®šã™ã‚‹é–¢æ•°ã§ãƒžãƒ¼ã‚¯ã™ã‚‹å¿…è¦
+ ãŒã‚る.
+
+Data_Make_Struct(klass, type, mark, free, sval) ::
+
+ typeåž‹ã®ãƒ¡ãƒ¢ãƒªã‚’mallocã—,変数svalã«ä»£å…¥ã—ãŸå¾Œï¼Œãれをカプセ
+ ル化ã—ãŸãƒ‡ãƒ¼ã‚¿ã‚’è¿”ã™ãƒžã‚¯ãƒ­ï¼Ž
+
+Data_Get_Struct(data, type, sval) ::
+
+ dataã‹ã‚‰typeåž‹ã®ãƒã‚¤ãƒ³ã‚¿ã‚’å–り出ã—変数svalã«ä»£å…¥ã™ã‚‹ãƒžã‚¯ãƒ­ï¼Ž
+
+== åž‹ãƒã‚§ãƒƒã‚¯
+
+ TYPE(value)
+ FIXNUM_P(value)
+ NIL_P(value)
+ void Check_Type(VALUE value, int type)
+ SafeStringValue(value)
+
+== 型変æ›
+
+ FIX2INT(value), INT2FIX(i)
+ FIX2LONG(value), LONG2FIX(l)
+ NUM2INT(value), INT2NUM(i)
+ NUM2UINT(value), UINT2NUM(ui)
+ NUM2LONG(value), LONG2NUM(l)
+ NUM2ULONG(value), ULONG2NUM(ul)
+ NUM2LL(value), LL2NUM(ll)
+ NUM2ULL(value), ULL2NUM(ull)
+ NUM2OFFT(value), OFFT2NUM(off)
+ NUM2SIZET(value), SIZET2NUM(size)
+ NUM2SSIZET(value), SSIZET2NUM(ssize)
+ rb_integer_pack(value, words, numwords, wordsize, nails, flags), rb_integer_unpack(words, numwords, wordsize, nails, flags)
+ NUM2DBL(value)
+ rb_float_new(f)
+ RSTRING_LEN(str)
+ RSTRING_PTR(str)
+ StringValue(value)
+ StringValuePtr(value)
+ StringValueCStr(value)
+ rb_str_new2(s)
+
+== クラス/モジュール定義
+
+VALUE rb_define_class(const char *name, VALUE super) ::
+
+ superã®ã‚µãƒ–クラスã¨ã—ã¦æ–°ã—ã„Rubyクラスを定義ã™ã‚‹ï¼Ž
+
+VALUE rb_define_class_under(VALUE module, const char *name, VALUE super) ::
+
+ superã®ã‚µãƒ–クラスã¨ã—ã¦æ–°ã—ã„Rubyクラスを定義ã—,moduleã®
+ 定数ã¨ã—ã¦å®šç¾©ã™ã‚‹ï¼Ž
+
+VALUE rb_define_module(const char *name) ::
+
+ æ–°ã—ã„Rubyモジュールを定義ã™ã‚‹ï¼Ž
+
+VALUE rb_define_module_under(VALUE module, const char *name) ::
+
+ æ–°ã—ã„Rubyモジュールを定義ã—,moduleã®å®šæ•°ã¨ã—ã¦å®šç¾©ã™ã‚‹ï¼Ž
+
+void rb_include_module(VALUE klass, VALUE module) ::
+
+ モジュールをインクルードã™ã‚‹ï¼ŽclassãŒã™ã§ã«moduleをインク
+ ルードã—ã¦ã„る時ã«ã¯ä½•ã‚‚ã—ãªã„(多é‡ã‚¤ãƒ³ã‚¯ãƒ«ãƒ¼ãƒ‰ã®ç¦æ­¢).
+
+void rb_extend_object(VALUE object, VALUE module) ::
+
+ オブジェクトをモジュール(ã§å®šç¾©ã•れã¦ã„るメソッド)ã§æ‹¡å¼µã™ã‚‹ï¼Ž
+
+== 大域変数定義
+
+void rb_define_variable(const char *name, VALUE *var) ::
+
+ Rubyã¨Cã¨ã§å…±æœ‰ã™ã‚‹ã‚°ãƒ­ãƒ¼ãƒãƒ«å¤‰æ•°ã‚’定義ã™ã‚‹ï¼Žå¤‰æ•°åãŒ`$'ã§
+ å§‹ã¾ã‚‰ãªã„時ã«ã¯è‡ªå‹•çš„ã«è¿½åŠ ã•れる.nameã¨ã—ã¦Rubyã®è­˜åˆ¥å­
+ ã¨ã—ã¦è¨±ã•れãªã„文字(例ãˆã°` ')ã‚’å«ã‚€å ´åˆã«ã¯Rubyプログラ
+ ムã‹ã‚‰ã¯è¦‹ãˆãªããªã‚‹ï¼Ž
+
+void rb_define_readonly_variable(const char *name, VALUE *var) ::
+
+ Rubyã¨Cã¨ã§å…±æœ‰ã™ã‚‹read onlyã®ã‚°ãƒ­ãƒ¼ãƒãƒ«å¤‰æ•°ã‚’定義ã™ã‚‹ï¼Ž
+ read onlyã§ã‚ã‚‹ã“ã¨ä»¥å¤–ã¯rb_define_variable()ã¨åŒã˜ï¼Ž
+
+void rb_define_virtual_variable(const char *name, VALUE (*getter)(), void (*setter)()) ::
+
+ 関数ã«ã‚ˆã£ã¦å®Ÿç¾ã•れるRuby変数を定義ã™ã‚‹ï¼Žå¤‰æ•°ãŒå‚ç…§ã•れãŸ
+ 時ã«ã¯getterãŒï¼Œå¤‰æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•ã‚ŒãŸæ™‚ã«ã¯setterãŒå‘¼ã°ã‚Œ
+ る.
+
+void rb_define_hooked_variable(const char *name, VALUE *var, VALUE (*getter)(), void (*setter)()) ::
+
+ 関数ã«ã‚ˆã£ã¦hookã®ã¤ã‘られãŸã‚°ãƒ­ãƒ¼ãƒãƒ«å¤‰æ•°ã‚’定義ã™ã‚‹ï¼Žå¤‰æ•°
+ ãŒå‚ç…§ã•ã‚ŒãŸæ™‚ã«ã¯getterãŒï¼Œé–¢æ•°ã«å€¤ãŒã‚»ãƒƒãƒˆã•ã‚ŒãŸæ™‚ã«ã¯
+ setterãŒå‘¼ã°ã‚Œã‚‹ï¼Žgetterã‚„setterã«0を指定ã—ãŸæ™‚ã«ã¯hookã‚’
+ 指定ã—ãªã„ã®ã¨åŒã˜äº‹ã«ãªã‚‹ï¼Ž
+
+void rb_global_variable(VALUE *var)
+
+ GCã®ãŸã‚,Rubyプログラムã‹ã‚‰ã¯ã‚¢ã‚¯ã‚»ã‚¹ã•れãªã„ãŒ, Rubyオブ
+ ジェクトをå«ã‚€å¤§åŸŸå¤‰æ•°ã‚’マークã™ã‚‹ï¼Ž
+
+== 定数
+
+void rb_define_const(VALUE klass, const char *name, VALUE val) ::
+
+ 定数を定義ã™ã‚‹ï¼Ž
+
+void rb_define_global_const(const char *name, VALUE val) ::
+
+ 大域定数を定義ã™ã‚‹ï¼Ž
+
+ rb_define_const(rb_cObject, name, val)
+
+ ã¨åŒã˜æ„味.
+
+== メソッド定義
+
+rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
+
+ メソッドを定義ã™ã‚‹ï¼Žargcã¯selfを除ãå¼•æ•°ã®æ•°ï¼ŽargcãŒ-1ã®æ™‚,
+ 関数ã«ã¯å¼•æ•°ã®æ•°(selfã‚’å«ã¾ãªã„)を第1引数, 引数ã®é…列を第2
+ 引数ã¨ã™ã‚‹å½¢å¼ã§ä¸Žãˆã‚‰ã‚Œã‚‹(第3引数ã¯self).argcãŒ-2ã®æ™‚,
+ 第1引数ãŒself, 第2引数ãŒargs(argsã¯å¼•æ•°ã‚’å«ã‚€Rubyã®é…列)ã¨
+ ã„ã†å½¢å¼ã§ä¸Žãˆã‚‰ã‚Œã‚‹ï¼Ž
+
+rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
+
+ privateメソッドを定義ã™ã‚‹ï¼Žå¼•æ•°ã¯rb_define_method()ã¨åŒã˜ï¼Ž
+
+rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc) ::
+
+ 特異メソッドを定義ã™ã‚‹ï¼Žå¼•æ•°ã¯rb_define_method()ã¨åŒã˜ï¼Ž
+
+rb_scan_args(int argc, VALUE *argv, const char *fmt, ...) ::
+
+ argc, argvå½¢å¼ã§ä¸Žãˆã‚‰ã‚ŒãŸæŒ‡å®šã•れãŸãƒ•ォーマットã«å¾“ã£ã¦å¼•
+ 数を分解ã—,続ãVALUEã¸ã®å‚ç…§ã«ã‚»ãƒƒãƒˆã—ã¾ã™ï¼Žã“ã®ãƒ•ォーマッ
+ トã¯ï¼ŒABNFã§è¨˜è¿°ã™ã‚‹ã¨ä»¥ä¸‹ã®é€šã‚Šã§ã™ï¼Ž
+
+ scan-arg-spec := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+ param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec /
+ pre-opt-post-arg-spec
+ pre-arg-spec := num-of-leading-mandatory-args [num-of-optional-args]
+ post-arg-spec := sym-for-variable-length-args
+ [num-of-trailing-mandatory-args]
+ pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args
+ num-of-trailing-mandatory-args
+ option-hash-arg-spec := sym-for-option-hash-arg
+ block-arg-spec := sym-for-block-arg
+
+ num-of-leading-mandatory-args := DIGIT ; 先頭ã«ç½®ã‹ã‚Œã‚‹çœç•¥ä¸èƒ½ãªå¼•æ•°ã®æ•°
+ num-of-optional-args := DIGIT ; ç¶šã„ã¦ç½®ã‹ã‚Œã‚‹çœç•¥å¯èƒ½ãªå¼•æ•°ã®æ•°
+ sym-for-variable-length-args := "*" ; ç¶šã„ã¦ç½®ã‹ã‚Œã‚‹å¯å¤‰é•·å¼•æ•°ã‚’
+ ; Rubyã®é…列ã§å–å¾—ã™ã‚‹ãŸã‚ã®æŒ‡å®š
+ num-of-trailing-mandatory-args := DIGIT ; 終端ã«ç½®ã‹ã‚Œã‚‹çœç•¥ä¸èƒ½ãªå¼•æ•°ã®æ•°
+ sym-for-option-hash-arg := ":" ; オプションãƒãƒƒã‚·ãƒ¥ã‚’å–å¾—ã™ã‚‹
+ ; ãŸã‚ã®æŒ‡å®š; çœç•¥ä¸èƒ½ãªå¼•æ•°ã®
+ ; 数よりも多ãã®å¼•æ•°ãŒæŒ‡å®šã•れ,
+ ; 最後ã®å¼•æ•°ãŒãƒãƒƒã‚·ãƒ¥ï¼ˆã¾ãŸã¯
+ ; #to_hashã§å¤‰æ›å¯èƒ½ï¼‰ã®å ´åˆã«
+ ; å–å¾—ã•れる.最後ã®å¼•æ•°ãŒnilã®
+ ; å ´åˆï¼Œå¯å¤‰é•·å¼•数指定ãŒãªã,
+ ; çœç•¥ä¸èƒ½å¼•æ•°ã®æ•°ã‚ˆã‚Šã‚‚多ãã®
+ ; å¼•æ•°ãŒæŒ‡å®šã•れãŸå ´åˆã«å–å¾—ã•れる
+ sym-for-block-arg := "&" ; イテレータブロックをå–å¾—ã™ã‚‹ãŸã‚ã®
+ ; 指定
+
+ フォーマットãŒ"12"ã®å ´åˆï¼Œå¼•æ•°ã¯æœ€ä½Ž1ã¤ã§ï¼Œ3ã¤(1+2)ã¾ã§è¨±ã•
+ れるã¨ã„ã†æ„味ã«ãªã‚Šã¾ã™ï¼Žå¾“ã£ã¦ï¼Œãƒ•ォーマット文字列ã«ç¶šã„
+ ã¦3ã¤ã®VALUEã¸ã®å‚ç…§ã‚’ç½®ãå¿…è¦ãŒã‚りã¾ã™ï¼Žãれらã«ã¯å–å¾—ã—ãŸ
+ 変数ãŒã‚»ãƒƒãƒˆã•れã¾ã™ï¼Žå¤‰æ•°ã¸ã®å‚ç…§ã®ä»£ã‚りã«NULLを指定ã™ã‚‹
+ ã“ã¨ã‚‚ã§ã,ãã®å ´åˆã¯å–å¾—ã—ãŸå¼•æ•°ã®å€¤ã¯æ¨ã¦ã‚‰ã‚Œã¾ã™ï¼ŽãªãŠï¼Œ
+ çœç•¥å¯èƒ½å¼•æ•°ãŒçœç•¥ã•ã‚ŒãŸæ™‚ã®å¤‰æ•°ã®å€¤ã¯nil(C言語ã®ãƒ¬ãƒ™ãƒ«ã§ã¯
+ Qnil)ã«ãªã‚Šã¾ã™ï¼Ž
+
+ 返り値ã¯ä¸Žãˆã‚‰ã‚ŒãŸå¼•æ•°ã®æ•°ã§ã™ï¼Žã‚ªãƒ—ションãƒãƒƒã‚·ãƒ¥ãŠã‚ˆã³ã‚¤
+ ãƒ†ãƒ¬ãƒ¼ã‚¿ãƒ–ãƒ­ãƒƒã‚¯ã¯æ•°ãˆã¾ã›ã‚“.
+
+== Rubyメソッド呼ã³å‡ºã—
+
+VALUE rb_funcall(VALUE recv, ID mid, int narg, ...) ::
+
+ メソッド呼ã³å‡ºã—.文字列ã‹ã‚‰midã‚’å¾—ã‚‹ãŸã‚ã«ã¯rb_intern()ã‚’
+ 使ã†ï¼Ž
+ private/protectedãªãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚‚呼ã³å‡ºã›ã‚‹ï¼Ž
+
+VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv) ::
+VALUE rb_funcallv(VALUE recv, ID mid, int argc, VALUE *argv) ::
+
+ メソッド呼ã³å‡ºã—.引数をargc, argvå½¢å¼ã§æ¸¡ã™ï¼Ž
+ private/protectedãªãƒ¡ã‚½ãƒƒãƒ‰ã§ã‚‚呼ã³å‡ºã›ã‚‹ï¼Ž
+
+VALUE rb_funcallv_public(VALUE recv, ID mid, int argc, VALUE *argv) ::
+
+ メソッド呼ã³å‡ºã—.
+ publicãªãƒ¡ã‚½ãƒƒãƒ‰ã—ã‹å‘¼ã¹ãªã„.
+
+VALUE rb_eval_string(const char *str)
+
+ 文字列をRubyスクリプトã¨ã—ã¦ã‚³ãƒ³ãƒ‘イル・実行ã™ã‚‹ï¼Ž
+
+ID rb_intern(const char *name) ::
+
+ 文字列ã«å¯¾å¿œã™ã‚‹IDã‚’è¿”ã™ï¼Ž
+
+char *rb_id2name(ID id) ::
+
+ IDã«å¯¾å¿œã™ã‚‹æ–‡å­—列を返ã™(デãƒãƒƒã‚°ç”¨).
+
+char *rb_class2name(VALUE klass) ::
+
+ クラスã®åå‰ã‚’è¿”ã™(デãƒãƒƒã‚°ç”¨).クラスãŒåå‰ã‚’æŒãŸãªã„時ã«
+ ã¯, 祖先をé¡ã£ã¦åå‰ã‚’æŒã¤ã‚¯ãƒ©ã‚¹ã®åå‰ã‚’è¿”ã™ï¼Ž
+
+int rb_respond_to(VALUE obj, ID id) ::
+
+ objãŒidã§ç¤ºã•れるメソッドをæŒã¤ã‹ã©ã†ã‹ã‚’è¿”ã™ï¼Ž
+
+== インスタンス変数
+
+VALUE rb_iv_get(VALUE obj, const char *name) ::
+
+ objã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã®å€¤ã‚’得る.`@'ã§å§‹ã¾ã‚‰ãªã„インスタン
+ ス変数㯠Rubyプログラムã‹ã‚‰ã‚¢ã‚¯ã‚»ã‚¹ã§ããªã„「隠れãŸã€ã‚¤ãƒ³
+ スタンス変数ã«ãªã‚‹ï¼Žå®šæ•°ã¯å¤§æ–‡å­—ã®åå‰ã‚’æŒã¤ã‚¯ãƒ©ã‚¹(ã¾ãŸã¯
+ モジュール)ã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã¨ã—ã¦å®Ÿè£…ã•れã¦ã„る.
+
+VALUE rb_iv_set(VALUE obj, const char *name, VALUE val) ::
+
+ objã®ã‚¤ãƒ³ã‚¹ã‚¿ãƒ³ã‚¹å¤‰æ•°ã‚’valã«ã‚»ãƒƒãƒˆã™ã‚‹ï¼Ž
+
+== 制御構造
+
+VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv, VALUE (*func) (ANYARGS), VALUE data2) ::
+
+ funcをブロックã¨ã—ã¦è¨­å®šã—,objをレシーãƒï¼Œargcã¨argvを引数
+ ã¨ã—ã¦midメソッドを呼ã³å‡ºã™ï¼Žfuncã¯ç¬¬ä¸€å¼•æ•°ã«yieldã•れãŸå€¤ï¼Œ
+ 第二引数ã«data2ã‚’å—ã‘å–る.複数ã®å€¤ãŒyieldã•れãŸå ´åˆ(Cã§ã¯
+ rb_yield_values()ã¨rb_yield_values2(), rb_yield_splat()),
+ data2ã¯Arrayã¨ã—ã¦ãƒ‘ックã•れã¦ã„る.第三, 第四引数ã®argcã¨
+ argvã«ã‚ˆã£ã¦yieldã•れãŸå€¤ã‚’å–り出ã™ã“ã¨ãŒã§ãる.
+
+[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
+
+ func2をブロックã¨ã—ã¦è¨­å®šã—, func1をイテレータã¨ã—ã¦å‘¼ã¶ï¼Ž
+ func1ã«ã¯ arg1ãŒå¼•æ•°ã¨ã—ã¦æ¸¡ã•れ, func2ã«ã¯ç¬¬1引数ã«ã‚¤ãƒ†ãƒ¬ãƒ¼
+ ã‚¿ã‹ã‚‰ä¸Žãˆã‚‰ã‚ŒãŸå€¤, 第2引数ã«arg2ãŒæ¸¡ã•れる.
+
+ 1.9ã§rb_iterateを使ã†å ´åˆã¯, func1ã®ä¸­ã§Rubyレベルã®ãƒ¡ã‚½ãƒƒãƒ‰
+ を呼ã³å‡ºã•ãªã‘れã°ãªã‚‰ãªã„.
+ 1.9ã§obsoleteã¨ãªã£ãŸ. 代ã‚りã«rb_block_callãŒç”¨æ„ã•れãŸ.
+
+VALUE rb_yield(VALUE val) ::
+
+ valを値ã¨ã—ã¦ã‚¤ãƒ†ãƒ¬ãƒ¼ã‚¿ãƒ–ロックを呼ã³å‡ºã™ï¼Ž
+
+VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
+
+ 関数func1ã‚’arg1を引数ã«å‘¼ã³å‡ºã™ï¼Žfunc1ã®å®Ÿè¡Œä¸­ã«ä¾‹å¤–ãŒç™ºç”Ÿ
+ ã—ãŸæ™‚ã«ã¯ func2ã‚’arg2を引数ã¨ã—ã¦å‘¼ã¶ï¼Žæˆ»ã‚Šå€¤ã¯ä¾‹å¤–ãŒç™ºç”Ÿ
+ ã—ãªã‹ã£ãŸæ™‚ã¯func1ã®æˆ»ã‚Šå€¤, 例外ãŒç™ºç”Ÿã—ãŸæ™‚ã«ã¯func2ã®æˆ»
+ り値ã§ã‚る.
+
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2) ::
+
+ 関数func1ã‚’arg1を引数ã¨ã—ã¦å®Ÿè¡Œã—, 実行終了後(ãŸã¨ãˆä¾‹å¤–ãŒ
+ 発生ã—ã¦ã‚‚) func2ã‚’arg2を引数ã¨ã—ã¦å®Ÿè¡Œã™ã‚‹ï¼Žæˆ»ã‚Šå€¤ã¯func1
+ ã®æˆ»ã‚Šå€¤ã§ã‚ã‚‹(例外ãŒç™ºç”Ÿã—ãŸæ™‚ã¯æˆ»ã‚‰ãªã„).
+
+VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state) ::
+
+ 関数funcã‚’argを引数ã¨ã—ã¦å®Ÿè¡Œã—, 例外ãŒç™ºç”Ÿã—ãªã‘れã°ãã®æˆ»
+ り値を返ã™ï¼Žä¾‹å¤–ãŒç™ºç”Ÿã—ãŸå ´åˆã¯, *stateã«éž0をセットã—ã¦
+ Qnilã‚’è¿”ã™ï¼Ž
+ rb_jump_tag()を呼ã°ãšã«æ•æ‰ã—ãŸä¾‹å¤–を無視ã™ã‚‹å ´åˆã«ã¯ï¼Œ
+ rb_set_errinfo(Qnil)ã§ã‚¨ãƒ©ãƒ¼æƒ…報をクリアã—ãªã‘れã°ãªã‚‰ãªã„.
+
+void rb_jump_tag(int state) ::
+
+ rb_protect()ã‚„rb_eval_string_protect()ã§æ•æ‰ã•れãŸä¾‹å¤–ã‚’å†
+ é€ã™ã‚‹ï¼Žstateã¯ãれらã®é–¢æ•°ã‹ã‚‰è¿”ã•れãŸå€¤ã§ãªã‘れã°ãªã‚‰ãªã„.
+ ã“ã®é–¢æ•°ã¯ç›´æŽ¥ã®å‘¼ã³å‡ºã—å…ƒã«æˆ»ã‚‰ãªã„.
+
+void rb_iter_break() ::
+
+ ç¾åœ¨ã®æœ€ã‚‚内å´ã®ãƒ–ロックを終了ã™ã‚‹ï¼Žã“ã®é–¢æ•°ã¯ç›´æŽ¥ã®å‘¼ã³å‡º
+ ã—å…ƒã«æˆ»ã‚‰ãªã„.
+
+void rb_iter_break_value(VALUE value) ::
+
+ ç¾åœ¨ã®æœ€ã‚‚内å´ã®ãƒ–ロックをvalueã§çµ‚了ã™ã‚‹ï¼Žãƒ–ロックã¯å¼•æ•°ã§
+ 与ãˆã‚‰ã‚ŒãŸvalueã‚’è¿”ã™ï¼Žã“ã®é–¢æ•°ã¯ç›´æŽ¥ã®å‘¼ã³å‡ºã—å…ƒã«æˆ»ã‚‰ãªã„.
+
+== 例外・エラー
+
+void rb_warning(const char *fmt, ...) ::
+
+ rb_verboseæ™‚ã«æ¨™æº–エラー出力ã«è­¦å‘Šæƒ…報を表示ã™ã‚‹ï¼Žå¼•æ•°ã¯
+ printf()ã¨åŒã˜ï¼Ž
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...) ::
+
+ RuntimeError例外を発生ã•ã›ã‚‹ï¼Žå¼•æ•°ã¯printf()ã¨åŒã˜ï¼Ž
+
+void rb_raise(VALUE exception, const char *fmt, ...) ::
+
+ exceptionã§æŒ‡å®šã—ãŸä¾‹å¤–を発生ã•ã›ã‚‹ï¼Žfmt以下ã®å¼•æ•°ã¯
+ printf()ã¨åŒã˜ï¼Ž
+
+void rb_fatal(const char *fmt, ...) ::
+
+ 致命的例外を発生ã•ã›ã‚‹ï¼Žé€šå¸¸ã®ä¾‹å¤–処ç†ã¯è¡Œãªã‚れãš, インター
+ プリタãŒçµ‚了ã™ã‚‹(ãŸã ã—ensureã§æŒ‡å®šã•れãŸã‚³ãƒ¼ãƒ‰ã¯çµ‚了å‰ã«
+ 実行ã•れる).
+
+void rb_bug(const char *fmt, ...) ::
+
+ インタープリタãªã©ãƒ—ログラムã®ãƒã‚°ã§ã—ã‹ç™ºç”Ÿã™ã‚‹ã¯ãšã®ãªã„
+ 状æ³ã®æ™‚呼ã¶ï¼Žã‚¤ãƒ³ã‚¿ãƒ¼ãƒ—リタã¯ã‚³ã‚¢ãƒ€ãƒ³ãƒ—ã—ç›´ã¡ã«çµ‚了ã™ã‚‹ï¼Ž
+ 例外処ç†ã¯ä¸€åˆ‡è¡Œãªã‚れãªã„.
+
+注æ„: %iã¯Object#to_s('+'ãƒ•ãƒ©ã‚°ãŒæŒ‡å®šã•れã¦ã„ã‚‹ã¨ãã¯Object#inspect)ã‚’
+使ã£ãŸVALUEã®å‡ºåŠ›ã«ä½¿ç”¨ã•れã¦ã„ã‚‹ãŸã‚,整数ã«ã¯%dを使用ã™ã‚‹ã“ã¨ï¼Ž
+
+== Rubyã®åˆæœŸåŒ–・実行
+
+Rubyをアプリケーションã«åŸ‹ã‚込む場åˆã«ã¯ä»¥ä¸‹ã®ã‚¤ãƒ³ã‚¿ãƒ•ェース
+を使ã†ï¼Žé€šå¸¸ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¯å¿…è¦ãªã„.
+
+void ruby_init() ::
+
+ Rubyインタプリタã®åˆæœŸåŒ–を行ãªã†ï¼Ž
+
+void *ruby_options(int argc, char **argv) ::
+
+ Rubyインタプリタã®ã‚³ãƒžãƒ³ãƒ‰ãƒ©ã‚¤ãƒ³å¼•æ•°ã®å‡¦ç†ã‚’行ãªã„,
+ Rubyã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’コンパイルã™ã‚‹ï¼Ž
+ コンパイルã•れãŸã‚½ãƒ¼ã‚¹ã¸ã®ãƒã‚¤ãƒ³ã‚¿ï¼Œã‚‚ã—ãã¯ç‰¹æ®Šå€¤ã‚’è¿”ã™.
+
+int ruby_run_node(void *n) ::
+
+ コンパイルã•れãŸã‚³ãƒ¼ãƒ‰ã‚’実行ã™ã‚‹ï¼Ž
+ å®Ÿè¡Œã«æˆåŠŸã—ãŸå ´åˆã¯EXIT_SUCCESSを,エラーãŒèµ·ã“ã£ãŸã¨ãã¯ãれ以外を返ã™ï¼Ž
+
+void ruby_script(char *name) ::
+
+ Rubyã®ã‚¹ã‚¯ãƒªãƒ—トå($0)を設定ã™ã‚‹ï¼Ž
+
+== インタプリタã®ã‚¤ãƒ™ãƒ³ãƒˆã®ãƒ•ック
+
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events,
+ VALUE data)
+
+指定ã•れãŸã‚¤ãƒ³ã‚¿ãƒ—リタã®ã‚¤ãƒ™ãƒ³ãƒˆã«å¯¾ã™ã‚‹ãƒ•ック関数を追加ã—ã¾ã™ï¼Ž
+eventsã¯ä»¥ä¸‹ã®å€¤ã®orã§ãªã‘れã°ãªã‚Šã¾ã›ã‚“:
+
+ RUBY_EVENT_LINE
+ RUBY_EVENT_CLASS
+ RUBY_EVENT_END
+ RUBY_EVENT_CALL
+ RUBY_EVENT_RETURN
+ RUBY_EVENT_C_CALL
+ RUBY_EVENT_C_RETURN
+ RUBY_EVENT_RAISE
+ RUBY_EVENT_ALL
+
+rb_event_hook_func_tã®å®šç¾©ã¯ä»¥ä¸‹ã®é€šã‚Šã§ã™:
+
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ VALUE self, ID id, VALUE klass)
+
+rb_add_event_hook() ã®ç¬¬3引数 data ã¯ï¼Œãƒ•ック関数ã®ç¬¬2引数ã¨
+ã—ã¦æ¸¡ã•れã¾ã™ï¼Žã“れã¯1.8ã§ã¯ç¾åœ¨ã®NODEã¸ã®ãƒã‚¤ãƒ³ã‚¿ã§ã—ãŸï¼Žä»¥
+下㮠RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ã‚‚å‚ç…§ã—ã¦ãã ã•ã„.
+
+ int rb_remove_event_hook(rb_event_hook_func_t func)
+
+指定ã•れãŸãƒ•ック関数を削除ã—ã¾ã™ï¼Ž
+
+== äº’æ›æ€§ã®ãŸã‚ã®ãƒžã‚¯ãƒ­
+
+APIã®äº’æ›æ€§ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ãŸã‚ã«ä»¥ä¸‹ã®ãƒžã‚¯ãƒ­ãŒãƒ‡ãƒ•ォルトã§å®šç¾©ã•れã¦ã„ã¾ã™ï¼Ž
+
+NORETURN_STYLE_NEW ::
+
+ NORETURN マクロãŒé–¢æ•°åž‹ãƒžã‚¯ãƒ­ã¨ã—ã¦å®šç¾©ã•れã¦ã„ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
+
+HAVE_RB_DEFINE_ALLOC_FUNC ::
+
+ rb_define_alloc_func() é–¢æ•°ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨ï¼Œã¤ã¾ã‚Š
+ allocation framework ãŒä½¿ã‚れるã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
+ have_func("rb_define_alloc_func", "ruby.h")
+ ã®çµæžœã¨åŒã˜ï¼Ž
+
+HAVE_RB_REG_NEW_STR ::
+
+ Stringオブジェクトã‹ã‚‰Regexpオブジェクトを作る
+ rb_reg_new_str() é–¢æ•°ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
+ have_func("rb_reg_new_str", "ruby.h").
+ ã®çµæžœã¨åŒã˜ï¼Ž
+
+HAVE_RB_IO_T ::
+
+ rb_io_t åž‹ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
+
+USE_SYMBOL_AS_METHOD_NAME ::
+
+ メソッドåã‚’è¿”ã™ãƒ¡ã‚½ãƒƒãƒ‰ï¼ŒModule#methods, #singleton_methods
+ ãªã©ãŒSymbolã‚’è¿”ã™ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
+
+HAVE_RUBY_*_H ::
+
+ ruby.h ã§å®šç¾©ã•れã¦ã„る.対応ã™ã‚‹ãƒ˜ãƒƒãƒ€ãŒæä¾›ã•れã¦ã„ã‚‹ã“ã¨
+ ã‚’æ„味ã™ã‚‹ï¼ŽãŸã¨ãˆã°ï¼ŒHAVE_RUBY_ST_H ãŒå®šç¾©ã•れã¦ã„ã‚‹å ´åˆã¯
+ å˜ãªã‚‹ st.h ã§ã¯ãªã ruby/st.h を使用ã™ã‚‹ï¼Ž
+
+RB_EVENT_HOOKS_HAVE_CALLBACK_DATA ::
+
+ rb_add_event_hook() ãŒãƒ•ãƒƒã‚¯é–¢æ•°ã«æ¸¡ã™ data を第3引数ã¨ã—ã¦
+ å—ã‘å–ã‚‹ã“ã¨ã‚’æ„味ã™ã‚‹ï¼Ž
+
+= Appendix C. extconf.rbã§ä½¿ãˆã‚‹é–¢æ•°ãŸã¡
+
+extconf.rbã®ä¸­ã§ã¯åˆ©ç”¨å¯èƒ½ãªã‚³ãƒ³ãƒ‘イルæ¡ä»¶ãƒã‚§ãƒƒã‚¯ã®é–¢æ•°ã¯ä»¥
+下ã®é€šã‚Šã§ã‚る.
+
+have_macro(macro, headers) ::
+
+ ヘッダファイルheaderをインクルードã—ã¦ãƒžã‚¯ãƒ­macroãŒå®šç¾©ã•
+ れã¦ã„ã‚‹ã‹ã©ã†ã‹ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒžã‚¯ãƒ­ãŒå®šç¾©ã•れã¦ã„る時true
+ ã‚’è¿”ã™ï¼Ž
+
+have_library(lib, func) ::
+
+ 関数funcを定義ã—ã¦ã„るライブラリlibã®å­˜åœ¨ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Ž
+ ãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œ-llibã‚’$libsã«è¿½åŠ ã—,trueã‚’è¿”ã™ï¼Ž
+
+find_library(lib, func, path...) ::
+
+ 関数funcを定義ã—ã¦ã„るライブラリlibã®å­˜åœ¨ã‚’ -Lpath を追加
+ ã—ãªãŒã‚‰ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œ-llibã‚’$libsã«
+ 追加ã—,trueã‚’è¿”ã™ï¼Ž
+
+have_func(func, header) ::
+
+ ヘッダファイルheaderをインクルードã—ã¦é–¢æ•°funcã®å­˜åœ¨ã‚’ãƒã‚§
+ ックã™ã‚‹ï¼ŽfuncãŒæ¨™æº–ã§ã¯ãƒªãƒ³ã‚¯ã•れãªã„ライブラリ内ã®ã‚‚ã®ã§
+ ã‚る時ã«ã¯å…ˆã«have_libraryã§ãã®ãƒ©ã‚¤ãƒ–ラリをãƒã‚§ãƒƒã‚¯ã—ã¦ãŠ
+ ã事.ãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
+ `HAVE_{FUNC}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
+
+have_var(var, header) ::
+
+ ヘッダファイルheaderをインクルードã—ã¦å¤‰æ•°varã®å­˜åœ¨ã‚’ãƒã‚§ãƒƒ
+ クã™ã‚‹ï¼ŽvarãŒæ¨™æº–ã§ã¯ãƒªãƒ³ã‚¯ã•れãªã„ライブラリ内ã®ã‚‚ã®ã§ã‚
+ る時ã«ã¯å…ˆã«have_libraryã§ãã®ãƒ©ã‚¤ãƒ–ラリをãƒã‚§ãƒƒã‚¯ã—ã¦ãŠã
+ 事.ãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
+ `HAVE_{VAR}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
+
+have_header(header) ::
+
+ ヘッダファイルã®å­˜åœ¨ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œ
+ プリプロセッサマクロ `HAVE_{HEADER_H}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
+ (スラッシュやドットã¯ã‚¢ãƒ³ãƒ€ãƒ¼ã‚¹ã‚³ã‚¢ã«ç½®æ›ã•れる)
+
+find_header(header, path...) ::
+
+ ヘッダファイルheaderã®å­˜åœ¨ã‚’ -Ipath を追加ã—ãªãŒã‚‰ãƒã‚§ãƒƒã‚¯
+ ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
+ `HAVE_{HEADER_H}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
+ (スラッシュやドットã¯ã‚¢ãƒ³ãƒ€ãƒ¼ã‚¹ã‚³ã‚¢ã«ç½®æ›ã•れる)
+
+have_struct_member(type, member[, header[, opt]]) ::
+
+ ヘッダファイルheaderをインクルードã—ã¦åž‹typeãŒå®šç¾©ã•れ,
+ ãªãŠã‹ã¤ãƒ¡ãƒ³ãƒmemberãŒå­˜åœ¨ã™ã‚‹ã‹ã‚’ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«
+ æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ `HAVE_{TYPE}_{MEMBER}` ã‚’
+ 定義ã—,trueã‚’è¿”ã™ï¼Ž
+
+have_type(type, header, opt) ::
+
+ ヘッダファイルheaderをインクルードã—ã¦åž‹typeãŒå­˜åœ¨ã™ã‚‹ã‹ã‚’
+ ãƒã‚§ãƒƒã‚¯ã™ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
+ `HAVE_TYPE_{TYPE}` を定義ã—,trueã‚’è¿”ã™ï¼Ž
+
+check_sizeof(type, header) ::
+
+ ヘッダファイルheaderをインクルードã—ã¦åž‹typeã®charå˜ä½ã‚µã‚¤
+ ズを調ã¹ã‚‹ï¼Žãƒã‚§ãƒƒã‚¯ã«æˆåŠŸã™ã‚‹ã¨ï¼Œãƒ—リプロセッサマクロ
+ `SIZEOF_{TYPE}` を定義ã—,ãã®ã‚µã‚¤ã‚ºã‚’è¿”ã™ï¼Žå®šç¾©ã•れã¦ã„ãª
+ ã„ã¨ãã¯nilã‚’è¿”ã™ï¼Ž
+
+create_makefile(target[, target_prefix]) ::
+
+ 拡張ライブラリ用ã®Makefileを生æˆã™ã‚‹ï¼Žã“ã®é–¢æ•°ã‚’呼ã°ãªã‘れ
+ ã°ãã®ãƒ©ã‚¤ãƒ–ラリã¯ã‚³ãƒ³ãƒ‘イルã•れãªã„.targetã¯ãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«å
+ を表ã™ï¼Ž
+
+find_executable(command, path) ::
+
+ コマンドcommandã‚’File::PATH_SEPARATORã§åŒºåˆ‡ã‚‰ã‚ŒãŸãƒ‘スåã®
+ リストpathã‹ã‚‰æŽ¢ã™ï¼ŽpathãŒnilã¾ãŸã¯çœç•¥ã•れãŸå ´åˆã¯ï¼Œç’°å¢ƒ
+ 変数PATHã®å€¤ã‚’使用ã™ã‚‹ï¼Žå®Ÿè¡Œå¯èƒ½ãªã‚³ãƒžãƒ³ãƒ‰ãŒè¦‹ã¤ã‹ã£ãŸå ´åˆ
+ ã¯ãƒ‘スをå«ã‚€ãƒ•ァイルå,見ã¤ã‹ã‚‰ãªã‹ã£ãŸå ´åˆã¯nilã‚’è¿”ã™ï¼Ž
+
+with_config(withval[, default=nil]) ::
+
+ コマンドライン上ã®--with-<withval>ã§æŒ‡å®šã•れãŸã‚ªãƒ—ション値
+ を得る.
+
+enable_config(config, *defaults) ::
+disable_config(config, *defaults) ::
+
+ コマンドライン上ã®--enable-<config>ã¾ãŸã¯
+ --disable-<config>ã§æŒ‡å®šã•れãŸçœŸå½å€¤ã‚’得る.
+ --enable-<config>ãŒæŒ‡å®šã•れã¦ã„ãŸå ´åˆã¯true,
+ --disable-<config>ãŒæŒ‡å®šã•れã¦ã„ãŸå ´åˆã¯falseã‚’è¿”ã™ï¼Ž
+ ã©ã¡ã‚‰ã‚‚指定ã•れã¦ã„ãªã„å ´åˆã¯ï¼Œãƒ–ロックã¤ãã§å‘¼ã³å‡ºã•れã¦
+ ã„ã‚‹å ´åˆã¯*defaultsã‚’yieldã—ãŸçµæžœï¼Œãƒ–ロックãªã—ãªã‚‰
+ *defaultsã‚’è¿”ã™ï¼Ž
+
+dir_config(target[, default_dir]) ::
+dir_config(target[, default_include, default_lib]) ::
+
+ コマンドライン上ã®--with-<target>-dir, --with-<target>-include,
+ --with-<target>-libã®ã„ãšã‚Œã‹ã§æŒ‡å®šã•れるディレクトリを
+ $CFLAGS ã‚„ $LDFLAGS ã«è¿½åŠ ã™ã‚‹ï¼Ž--with-<target>-dir=/pathã¯
+ --with-<target>-include=/path/include --with-<target>-lib=/path/lib
+ ã¨ç­‰ä¾¡ã§ã‚る.追加ã•れ㟠include ディレクトリ㨠lib ディレ
+ クトリã®é…列を返ã™ï¼Ž ([include_dir, lib_dir])
+
+pkg_config(pkg, option=nil) ::
+
+ pkg-configコマンドã‹ã‚‰ãƒ‘ッケージpkgã®æƒ…報を [cflags, ldflags, libs]
+ ã®é…列ã¨ã—ã¦å¾—る.$CFLAGS, $LDFLAGS, $libs ã«ã¯ãれãžã‚Œã®å€¤ãŒ
+ 追加ã•れる.
+
+ pkg-configã®å®Ÿéš›ã®ã‚³ãƒžãƒ³ãƒ‰ã¯ï¼Œä»¥ä¸‹ã®é †ã§è©¦ã•れる.
+
+ 1. コマンドラインã§--with-{pkg}-config={command}オプションãŒ
+ 指定ã•れãŸå ´åˆ: {command} {option}
+ 2. {pkg}-config {option}
+ 3. pkg-config {option} {pkg}
+
+ optionãŒæŒ‡å®šã•れãŸå ´åˆã¯ï¼Œä¸Šè¨˜ã®é…列ã®ä»£ã‚りã«ãã®ã‚ªãƒ—ションを
+ 指定ã—ã¦å¾—られãŸå‡ºåŠ›ã‚’stripã—ãŸã‚‚ã®ã‚’è¿”ã™ï¼Ž
+
+= Appendix D. 世代別GC
+
+Ruby 2.1ã‹ã‚‰ä¸–代別GCã«å¯¾å¿œã—ã¾ã—ãŸï¼Žæˆ‘々ã¯ã“れをRGenGCã¨å‘¼ã‚“ã§ã„ã¾ã™ï¼Ž
+RGenGCã¯ï¼ŒéŽåŽ»ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ï¼ˆã»ã¼ï¼‰äº’æ›æ€§ã‚’ä¿ã¤ã‚ˆã†ã«é–‹ç™ºã•れã¦ã„ã‚‹
+ãŸã‚,拡張ライブラリå´ã®å¯¾å¿œã¯ã»ã¼ä¸è¦ã§ã™ï¼Ž
+
+ãŸã ã—,対応をã™ã‚‹ã“ã¨ã§æ€§èƒ½ã‚’å‘上ã™ã‚‹ã“ã¨ãŒã§ãã‚‹å¯èƒ½æ€§ãŒã‚りã¾ã™ï¼Žã‚‚ã—
+拡張ライブラリã«é«˜ã„性能ãŒå¿…è¦ã§ã‚ã‚‹å ´åˆã¯å¯¾å¿œã‚’検討ã—ã¦ä¸‹ã•ã„.
+
+ã¨ãã«RARRAY_PTR()/RHASH_TBL()ã®ã‚ˆã†ãªãƒžã‚¯ãƒ­ã‚’用ã„ã¦ãƒã‚¤ãƒ³ã‚¿ã«ç›´æŽ¥ã‚¢ã‚¯ã‚»
+スã™ã‚‹ã‚ˆã†ãªã‚³ãƒ¼ãƒ‰ã¯æ›¸ã‹ãªã„よã†ã«ã—ã¦ä¸‹ã•ã„.代ã‚りã«ï¼Œrb_ary_aref(),
+rb_ary_store() ãªã©ã®ï¼Œé©åˆ‡ãª API 関数を利用ã™ã‚‹ã‚ˆã†ã«ã—ã¦ä¸‹ã•ã„.
+
+ãã®ã»ã‹ï¼Œå¯¾å¿œã«ã¤ã„ã¦ã®è©³ç´°ã¯ README.EXT ã®ã€ŒAppendix D. Generational
+GCã€ã‚’å‚ç…§ã—ã¦ä¸‹ã•ã„.
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.EXT.jp b/README.EXT.jp
deleted file mode 100644
index 6adeab3f0b..0000000000
--- a/README.EXT.jp
+++ /dev/null
@@ -1,1144 +0,0 @@
-.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-Ruby¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Îºî¤êÊý¤òÀâÌÀ¤·¤Þ¤¹¡¥
-
-1¡¥´ðÁÃÃμ±
-
-C¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤¢¤ê¡¤¥Ç¡¼¥¿¤Ë¤Ï·¿¤¬¤¢¤ê¤Þ¤»¤ó¡¥¤Ç¤¹¤«¤é¡¤¤¿
-¤È¤¨¤Ð¥Ý¥¤¥ó¥¿¤òint¤ÎÊÑ¿ô¤ËÂåÆþ¤¹¤ë¤È¡¤¤½¤ÎÃͤÏÀ°¿ô¤È¤·¤Æ¼è
-¤ê°·¤ï¤ì¤Þ¤¹¡¥µÕ¤ËRuby¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤Ê¤¯¡¤¥Ç¡¼¥¿¤Ë·¿¤¬¤¢¤ê¤Þ
-¤¹¡¥¤³¤Î°ã¤¤¤Î¤¿¤á¡¤C¤ÈRuby¤ÏÁê¸ß¤ËÊÑ´¹¤·¤Ê¤±¤ì¤Ð¡¤¤ª¸ß¤¤¤Î
-¥Ç¡¼¥¿¤ò¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤»¤ó¡¥
-
-Ruby¤Î¥Ç¡¼¥¿¤ÏVALUE¤È¤¤¤¦C¤Î·¿¤Çɽ¸½¤µ¤ì¤Þ¤¹¡¥VALUE·¿¤Î¥Ç¡¼
-¥¿¤Ï¤½¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¼«Ê¬¤ÇÃΤäƤ¤¤Þ¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤È
-¤¤¤¦¤Î¤Ï¥Ç¡¼¥¿(¥ª¥Ö¥¸¥§¥¯¥È)¤Î¼ÂºÝ¤Î¹½Â¤¤ò°ÕÌ£¤·¤Æ¤¤¤Æ¡¤Ruby
-¤Î¥¯¥é¥¹¤È¤Ï¤Þ¤¿°ã¤Ã¤¿¤â¤Î¤Ç¤¹¡¥
-
-VALUE¤«¤éC¤Ë¤È¤Ã¤Æ°ÕÌ£¤Î¤¢¤ë¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á¤Ë¤Ï
-
- (1) VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤òÃΤë
- (2) VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¤ÎξÊý¤¬É¬ÍפǤ¹¡¥(1)¤ò˺¤ì¤ë¤È´Ö°ã¤Ã¤¿¥Ç¡¼¥¿¤ÎÊÑ´¹¤¬¹Ô¤ï¤ì
-¤Æ¡¤ºÇ°­¥×¥í¥°¥é¥à¤¬core dump¤·¤Þ¤¹¡¥
-
-1.1 ¥Ç¡¼¥¿¥¿¥¤¥×
-
-Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
- T_NIL nil
- T_OBJECT Ä̾ï¤Î¥ª¥Ö¥¸¥§¥¯¥È
- T_CLASS ¥¯¥é¥¹
- T_MODULE ¥â¥¸¥å¡¼¥ë
- T_FLOAT ÉâÆ°¾®¿ôÅÀ¿ô
- T_STRING ʸ»úÎó
- T_REGEXP Àµµ¬É½¸½
- T_ARRAY ÇÛÎó
- T_FIXNUM Fixnum(31bitĹÀ°¿ô)
- T_HASH Ï¢ÁÛÇÛÎó
- T_STRUCT (Ruby¤Î)¹½Â¤ÂÎ
- T_BIGNUM ¿ÇÜĹÀ°¿ô
- T_FILE Æþ½ÐÎÏ
- T_TRUE ¿¿
- T_FALSE µ¶
- T_DATA ¥Ç¡¼¥¿
-
-¤½¤Î¾¤ËÆâÉô¤ÇÍøÍѤµ¤ì¤Æ¤¤¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
- T_ICLASS
- T_MATCH
- T_VARMAP
- T_SCOPE
- T_NODE
-
-¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-1.2 VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤¹¤ë
-
-ruby.h¤Ç¤ÏTYPE()¤È¤¤¤¦¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤VALUE¤Î¥Ç¡¼¥¿
-¥¿¥¤¥×¤òÃΤ뤳¤È¤¬½ÐÍè¤Þ¤¹¡¥TYPE()¥Þ¥¯¥í¤Ï¾å¤Ç¾Ò²ð¤·¤¿T_XXXX
-¤Î·Á¼°¤ÎÄê¿ô¤òÊÖ¤·¤Þ¤¹¡¥VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Ë±þ¤¸¤Æ½èÍý¤¹¤ë
-¾ì¹ç¤Ë¤Ï¡¤TYPE()¤ÎÃͤÇʬ´ô¤¹¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* FIXNUM¤Î½èÍý */
- break;
- case T_STRING:
- /* ʸ»úÎó¤Î½èÍý */
- break;
- case T_ARRAY:
- /* ÇÛÎó¤Î½èÍý */
- break;
- default:
- /* Îã³°¤òȯÀ¸¤µ¤»¤ë */
- TypeError("not valid value");
- break;
- }
-
-¤½¤ì¤È¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤·¤Æ¡¤Àµ¤·¤¯¤Ê¤±¤ì¤ÐÎã³°¤òȯÀ¸¤¹
-¤ë´Ø¿ô¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- void Check_Type(VALUE value, int type)
-
-¤³¤Î´Ø¿ô¤Ïvalue¤¬type¤Ç̵¤±¤ì¤Ð¡¤Îã³°¤òȯÀ¸¤µ¤»¤Þ¤¹¡¥°ú¿ô¤È
-¤·¤ÆÍ¿¤¨¤é¤ì¤¿VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤¬Àµ¤·¤¤¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹
-¤ë¤¿¤á¤Ë¤Ï¡¤¤³¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
-¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
-¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
-¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
-¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
-¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
-¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
-ȯÀ¸¤¹¤ë)¡¥
-
-ƱÍͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò¼è¤ê½Ð¤¹
-¡ÖNUM2DBL()¡×¤Èchar*¤ò¼è¤ê½Ð¤¹¡ÖSTR2CSTR()¡×¤¬¤¢¤ê¤Þ¤¹¡¥
-
-¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
-¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
-¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
-
-¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
-¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
-¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
-
-ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
-»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
-
-Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
-¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
-¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(ary)->len¡×¡¤
-¡ÖRARRAY(ary)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
-¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
-¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍÆ¤ÎÀ°¹çÀ­¤¬
-¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-1.4 C¤Î¥Ç¡¼¥¿¤òVALUE¤ËÊÑ´¹¤¹¤ë
-
-VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
-
- * FIXNUM¤Î¾ì¹ç
-
- 1bit±¦¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
-
- * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
-
- ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
-
-¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
-¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
-¤¤¤ë)¡¥
-
-¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
-¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
-ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
-¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
-¤Î¤â¤Î)¤À¤±¤Ç¤¹¡¥
-
-FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
-¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
-¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
-
- INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
- INT2NUM() Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
-
-INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
-¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
-
-1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë
-
-ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍÆ¤Î¹¹¿·¤ò
-¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
-Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
-
-¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
-¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
-
- ʸ»úÎó¤ËÂФ¹¤ë´Ø¿ô
-
- rb_str_new(char *ptr, int len)
-
- ¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_str_new2(char *ptr)
-
- C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
- rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_str_cat(VALUE str, char *ptr, int len)
-
- Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
-
- ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
-
- rb_ary_new()
-
- Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_new2(int len)
-
- Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥lenÍ×ÁÇʬ¤ÎÎΰè¤ò¤¢¤é¤«¤¸¤á³ä¤ê
- Åö¤Æ¤Æ¤ª¤¯¡¥
-
- rb_ary_new3(int n, ...)
-
- °ú¿ô¤Ç»ØÄꤷ¤¿nÍ×ÁǤò´Þ¤àÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_new4(int n, VALUE *elts)
-
- ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_push(VALUE ary, VALUE val)
- rb_ary_pop(VALUE ary)
- rb_ary_shift(VALUE ary)
- rb_ary_unshift(VALUE ary, VALUE val)
- rb_ary_entry(VALUE ary, int idx)
-
- Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
- ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
-
-2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
-
-¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
-½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
-¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
-²ð¤·¤Þ¤¹¡¥
-
-2.1 Ruby¤Ëµ¡Ç½¤òÄɲ乤ë
-
-Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
-¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲä¹¤ë´Ø¿ô¤¬
-Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
- * ¥á¥½¥Ã¥É¡¤ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É
- * Äê¿ô
-
-¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
-
-2.1.1 ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_define_class(char *name, VALUE super)
- VALUE rb_define_module(char *name)
-
-¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
-¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
-¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤ò¾¤Î¥¯¥é¥¹¤ÎÆâÉô¤Ë¥Í¥¹¥È¤·¤ÆÄêµÁ¤¹¤ë»þ¤Ë
-¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_define_class(VALUE outer, char *name, VALUE super)
- VALUE rb_define_module(VALUE outer, char *name)
-
-2.1.2 ¥á¥½¥Ã¥É/ÆÃ°Û¥á¥½¥Ã¥ÉÄêµÁ
-
-¥á¥½¥Ã¥É¤äÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- void rb_define_method(VALUE class, char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, char *name,
- VALUE (*func)(), int argc)
-
-
-ǰ¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆÃ°Û¥á¥½¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
-¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
-¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆÃ°Û¥á¥½¥Ã¥É¤¬»È¤ï¤ì
-¤Þ¤¹¡¥
-
-¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
-·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬Àµ¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°ÕÌ£
-¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½¤ó
-¤Ê¤Ë)¡¥¼ÂºÝ¤Î´Ø¿ô¤Ë¤ÏÀèÆ¬¤Î°ú¿ô¤È¤·¤Æself¤¬Í¿¤¨¤é¤ì¤Þ¤¹¤Î¤Ç¡¤
-»ØÄꤷ¤¿¿ô¤è¤ê1¿¤¤°ú¿ô¤ò»ý¤Ä¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
-¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
-
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
-¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
-
- void rb_define_private_method(VALUE class, char *name,
- VALUE (*func)(), int argc)
-
-private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
-¥É¤Ç¤¹¡¥
-
-¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
-¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
-¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
-¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
-
- Math.sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â
-
- include Math
- sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
-Ä̤ê¤Ç¤¹¡¥
-
- void rb_define_module_function(VALUE module, char *name,
- VALUE (*func)(), int argc)
-
-´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivate method)¤òÄêµÁ¤¹¤ë¤¿
-¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- void rb_define_global_function(char *name, VALUE (*func)(), int argc)
-
-
-2.1.3 Äê¿ôÄêµÁ
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
-¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_const(VALUE class, char *name, VALUE val)
- void rb_define_global_const(char *name, VALUE val)
-
-Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
-¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
-
-2.2 Ruby¤Îµ¡Ç½¤òC¤«¤é¸Æ¤Ó½Ð¤¹
-
-´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
-»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
-¤Þ¤¹¡¥
-
-# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
-# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
-
-¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
-
-2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
-
-C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
-Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
- VALUE rb_eval_string(char *str)
-
-¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
-¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
-
-2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
-¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
-»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
-
-ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
-
- :¼±ÊÌ»Ò
-
-¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
-
- rb_intern(char *name)
-
-¤ò»È¤¤¤Þ¤¹¡¥¤Þ¤¿°ìʸ»ú¤Î±é»»»Ò¤Ï¤½¤Îʸ»ú¥³¡¼¥É¤¬¤½¤Î¤Þ¤Þ¥·¥ó
-¥Ü¥ë¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥Ruby¤«¤é°ú¿ô¤È¤·¤ÆÍ¿¤¨¤é¤ì¤¿¥·¥ó¥Ü¥ë(¤Þ
-¤¿¤Ïʸ»úÎó)¤òID¤ËÊÑ´¹¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- rb_to_id(VALUE symbol)
-
-2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
-¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
-¤·¤Þ¤¹¡¥¤½¤Î¾¤Ë°ú¿ô¤Î»ØÄê¤Î»ÅÊý¤¬°ã¤¦°Ê²¼¤Î´Ø¿ô¤â¤¢¤ê¤Þ¤¹¡¥
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
- VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-apply¤Ë¤Ï°ú¿ô¤È¤·¤ÆRuby¤ÎÇÛÎó¤òÍ¿¤¨¤Þ¤¹¡¥
-
-2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
-
-C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤Äê¿ô¡¤¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ
-¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»¥¹¤Ç¤­
-¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
-
-¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
-¤ê¤Ç¤¹¡¥
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
-¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-3¡¥Ruby¤ÈC¤È¤Î¾ðÊó¶¦Í­
-
-C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
-
-3.1 C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
-
-°Ê²¼¤ÎRuby¤ÎÄê¿ô¤ÏC¤Î¥ì¥Ù¥ë¤«¤é»²¾È¤Ç¤­¤ë¡¥
-
- Qtrue
- Qfalse
-
-¿¿µ¶ÃÍ¡¥Qfalse¤ÏC¸À¸ì¤Ç¤âµ¶¤È¤ß¤Ê¤µ¤ì¤ë(¤Ä¤Þ¤ê0)¡¥
-
- Qnil
-
-C¸À¸ì¤«¤é¸«¤¿¡Önil¡×¡¥
-
-3.2 C¤ÈRuby¤Ç¶¦Í­¤µ¤ì¤ëÂç°èÊÑ¿ô
-
-C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
-ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
-¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
-
- void rb_define_variable(char *name, VALUE *var)
-
-¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
-`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
-¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
-
-¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
-ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
-
- void rb_define_readonly_variable(char *name, VALUE *var)
-
-¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
-¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
-Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_hooked_variable(char *name, VALUE *var,
- VALUE (*getter)(), VALUE (*setter)())
-
-¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
-¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
-¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
-setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-
-¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_virtual_variable(char *name,
- VALUE (*getter)(), VALUE (*setter)())
-
-¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
-getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
-
-getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- (*getter)(ID id, void *data, struct global_entry* entry);
- (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
-
-C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
-¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
-²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- Data_Wrap_Struct(class,mark,free,ptr)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-class¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
-¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
-»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
-
-free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
-´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥
-
-C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
-¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- Data_Make_Struct(class, type, mark, free, sval)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-class, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
-¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
-¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
-¤Þ¤¹¡¥
-
- Data_Get_Struct(obj, type, sval)
-
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
-
-¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
-ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-4¡¥ÎãÂê - dbm¥Ñ¥Ã¥±¡¼¥¸¤òºî¤ë
-
-¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
-Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥â¥¸¥å¡¼¥ë¤òÎã¤Ë
-¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
-
-(1) ¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë
-
- % mkdir ext/dbm
-
-Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
-¤ë¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤·¤¿¡¥Ruby¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¾ì¹ç¤Ë
-¤ÏRuby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥
-¥â¥¸¥å¡¼¥ëÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤Ë
-Áª¤ó¤Ç¹½¤¤¤Þ¤»¤ó¡¥
-
-(2) MANIFEST¥Õ¥¡¥¤¥ë¤òºî¤ë
-
- % cd ext/dbm
- % touch MANIFEST
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¤Ë¤ÏMANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬
-ɬÍפʤΤǡ¤¤È¤ê¤¢¤¨¤º¶õ¤Î¥Õ¥¡¥¤¥ë¤òºî¤Ã¤Æ¤ª¤­¤Þ¤¹¡¥¸å¤Ç¤³¤Î
-¥Õ¥¡¥¤¥ë¤Ë¤ÏɬÍפʥե¡¥¤¥ë°ìÍ÷¤¬Æþ¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-MANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤Ï¡¤ÀÅŪ¥ê¥ó¥¯¤Îmake¤Î»þ¤Ë¥Ç¥£¥ì¥¯¥È¥ê
-¤¬³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò´Þ¤ó¤Ç¤¤¤ë¤«¤É¤¦¤«È½Äꤹ¤ë¤¿¤á¤Ë»È¤ï¤ì¤ì¤Æ
-¤¤¤Þ¤¹¡¥¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî¤ë¾ì¹ç¤Ë¤Ïɬ¤º¤·¤âɬÍפǤÏ
-¤¢¤ê¤Þ¤»¤ó¡¥
-
-(3) À߷פ¹¤ë
-
-¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
-·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
-¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
-¤·¤Þ¤¹¡¥dbm¥¯¥é¥¹¤Ë¤Ä¤¤¤Æ¤Ïext/dbm.doc¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-(4) C¥³¡¼¥É¤ò½ñ¤¯
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥êËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
-¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
-¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤È¤¤¤¦¥Õ¥¡
-¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
-¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥â¥¸¥å¡¼¥ë̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
-
-Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥â¥¸¥å¡¼¥ë̾¡×¤È
-¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤Î¾ì¹ç¡ÖInit_dbm¡×
-¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
-ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
-
---
-Init_dbm()
-{
- /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
- cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
- :
-
- /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
- id_dbm = rb_intern("dbm");
-}
---
-
-DBM¥â¥¸¥å¡¼¥ë¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
-¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-
-dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-struct dbmdata {
- int di_size;
- DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(class,struct dbmdata,0,free_dbm,dbmp);
---
-
-¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
-¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
-¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
-¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-#define GetDBM(obj, dbmp) {\
- Data_Get_Struct(obj, struct dbmdata, dbmp);\
- if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
-¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
-¤ë¤À¤±¤Ç¤¹¡¥
-
-DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
-°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
-¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
-fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_delete(obj, keystr)
- VALUE obj, keystr;
-{
- :
-}
---
-
-°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
-¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
-
-°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
-¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
-¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
-¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_s_open(argc, argv, class)
- int argc;
- VALUE *argv;
- VALUE class;
-{
- :
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- :
-}
---
-
-¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
-¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
-¤¨¤é¤ì¤Þ¤¹¡¥
-
-¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
-½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
-¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
-¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
-¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
-¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
-¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
-ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
-¤¦¤Ç¤¹¡¥
-
---
-static VALUE
-fdbm_indexes(obj, args)
- VALUE obj, args;
-{
- :
-}
---
-
-Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥
-
-** Ãí°Õ»ö¹à
-
-Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
-C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
-¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
-
- void rb_global_variable(VALUE *var)
-
-(5) extconf.rb¤òÍѰդ¹¤ë
-
-Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
-¤Þ¤¹¡¥extconf.rb¤Ï¥â¥¸¥å¡¼¥ë¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã
-¥¯¤Ê¤É¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø¿ô
-¤ò»È¤¦¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
-
- have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
- have_func(func): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
- have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
- create_makefile(target): Makefile¤ÎÀ¸À®
-
-°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
-
- $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤Ê¤É)
- $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
-
-¥â¥¸¥å¡¼¥ë¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤Ê¤º¡¤¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³
-¥ó¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤Ï
-À¸À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
-
-¥â¥¸¥å¡¼¥ë¤¬Ruby 1.1ÀìÍѤǤ¢¤ë¾ì¹ç¤Ë¤Ï
-
- require 'mkmf'
-
-¤òextconf.rb¤ÎÀèÆ¬¤ËÃÖ¤¯¤ÈÊØÍø¤Ç¤·¤ç¤¦¡¥
-
-(6) depend¤òÍѰդ¹¤ë
-
-¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
-Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-
- % gcc -MM *.c > depend
-
-¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤ÆÂ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
-
-(7) MANIFEST¥Õ¥¡¥¤¥ë¤Ë¥Õ¥¡¥¤¥ë̾¤òÆþ¤ì¤ë
-
- % find * -type f -print > MANIFEST
- % vi MANIFEST
-
-*.o, *~¤Ê¤ÉÉÔɬÍפʥե¡¥¤¥ë°Ê³°¤ÏMANIFEST¤ËÄɲ䷤Ƥª¤­¤Þ¤¹¡¥
-make»þ¤Ë¤ÏMANIFEST¤ÎÆâÍÆ¤Ï»²¾È¤·¤Þ¤»¤ó¤Î¤Ç¡¤¶õ¤Î¤Þ¤Þ¤Ç¤âÌäÂê
-¤Ïµ¯¤­¤Þ¤»¤ó¤¬¡¤¥Ñ¥Ã¥±¡¼¥¸¥ó¥°¤Î»þ¤Ë»²¾È¤¹¤ë¤³¤È¤¬¤¢¤ë¤Î¤È¡¤
-ɬÍפʥե¡¥¤¥ë¤ò¶èÊ̤Ǥ­¤ë¤Î¤Ç¡¤ÍѰդ·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤¤Ç¤·¤ç
-¤¦¡¥
-
-(8) Makefile¤òÀ¸À®¤¹¤ë
-
-Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
-
- ruby extconf.rb
-
-¤È¤·¤Þ¤¹¡¥extconf.rb¤Ë require 'mkmf' ¤Î¹Ô¤¬¤Ê¤¤¾ì¹ç¤Ë¤Ï¥¨¥é¡¼
-¤Ë¤Ê¤ê¤Þ¤¹¤Î¤Ç¡¤°ú¿ô¤òÄɲä·¤Æ
-
- ruby -r mkmf extconf.rb
-
-¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍѰդ·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
-¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
-
-(9) make¤¹¤ë
-
-ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤òÀ¸À®¤¹¤ë¾ì¹ç¤Ë¤Ï¤½¤Î¾ì¤Çmake¤·¤Æ¤¯¤À¤µ
-¤¤¡¥É¬ÍפǤ¢¤ì¤Ð make install ¤Ç¥¤¥ó¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-ext°Ê²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òÍѰդ·¤¿¾ì¹ç¤Ï¡¤Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç
-make¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤É¬Íפˤè¤Ã¤Æ¤Ï¤½¤Î¥â
-¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®¤¬É¬Íפʻþ¤Ï¤Þ
-¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤Ïmake install¤ÇRuby¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯
-¥È¥ê¤Î²¼¤Ë¥³¥Ô¡¼¤µ¤ì¤Þ¤¹¡¥¤â¤·¥â¥¸¥å¡¼¥ë¤È¶¨Ä´¤·¤Æ»È¤¦Ruby¤Ç
-µ­½Ò¤µ¤ì¤¿¥×¥í¥°¥é¥à¤¬¤¢¤ê¡¤Ruby¥é¥¤¥Ö¥é¥ê¤ËÃÖ¤­¤¿¤¤¾ì¹ç¤Ë¤Ï¡¤
-³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤Î²¼¤Ë lib ¤È¤¤¤¦¥Ç¥£¥ì¥¯¥È¥ê
-¤òºî¤ê¡¤¤½¤³¤Ë ³ÈÄ¥»Ò .rb ¤Î¥Õ¥¡¥¤¥ë¤òÃÖ¤¤¤Æ¤ª¤±¤ÐƱ»þ¤Ë¥¤¥ó
-¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-(10) ¥Ç¥Ð¥Ã¥°
-
-¤Þ¤¢¡¤¥Ç¥Ð¥Ã¥°¤·¤Ê¤¤¤Èư¤«¤Ê¤¤¤Ç¤·¤ç¤¦¤Í¡¥ext/Setup¤Ë¥Ç¥£¥ì
-¥¯¥È¥ê̾¤ò½ñ¤¯¤ÈÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¤Î¤Ç¥Ç¥Ð¥Ã¥¬¤¬»È¤¨¤ë¤è¤¦¤Ë¤Ê
-¤ê¤Þ¤¹¡¥¤½¤Îʬ¥³¥ó¥Ñ¥¤¥ë¤¬ÃÙ¤¯¤Ê¤ê¤Þ¤¹¤±¤É¡¥
-
-(11) ¤Ç¤­¤¢¤¬¤ê
-
-¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
-»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
-¼çÄ¥¤·¤Þ¤»¤ó¡¥
-
-Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
-
-Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
-¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
-¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
-»×¤¤¤Þ¤¹¡¥
-
-Ruby¸À¸ì¤Î¥³¥¢
-
- class.c
- error.c
- eval.c
- gc.c
- object.c
- parse.y
- variable.c
-
-¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
-
- dln.c
- fnmatch.c
- glob.c
- regex.c
- st.c
- util.c
-
-Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
-
- dmyext.c
- inits.c
- main.c
- ruby.c
- version.c
-
-¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
-
- array.c
- bignum.c
- compar.c
- dir.c
- enum.c
- file.c
- hash.c
- io.c
- marshal.c
- math.c
- numeric.c
- pack.c
- process.c
- random.c
- range.c
- re.c
- signal.c
- sprintf.c
- string.c
- struct.c
- time.c
-
-Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
-
-C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-** ·¿
-
- VALUE
-
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
-ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
-ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
-̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤ë¡¥
-
-** ÊÑ¿ô¡¦Äê¿ô
-
- Qnil
-
-Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
-
- Qtrue
-
-Äê¿ô: true¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
-
- Qfalse
-
-Äê¿ô: false¥ª¥Ö¥¸¥§¥¯¥È
-
-** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
-
- Data_Wrap_Struct(VALUE class, void (*mark)(), void (*free)(), void *sval)
-
-C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
-¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
-´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
-¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
-¤¬¤¢¤ë¡¥
-
- Data_Make_Struct(class, type, mark, free, sval)
-
-type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
-¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
-
- Data_Get_Struct(data, type, sval)
-
-data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
-
-** ·¿¥Á¥§¥Ã¥¯
-
- TYPE(value)
- FIXNUM_P(value)
- NIL_P(value)
- void Check_Type(VALUE value, int type)
- void Check_SafeStr(VALUE value)
-
-** ·¿ÊÑ´¹
-
- FIX2INT(value)
- INT2FIX(i)
- NUM2INT(value)
- INT2NUM(i)
- NUM2DBL(value)
- rb_float_new(f)
- STR2CSTR(value)
- rb_str_new2(s)
-
-** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
- VALUE rb_define_class(char *name, VALUE super)
-
-super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
-
- VALUE rb_define_class_under(VALUE module, char *name, VALUE super)
-
-super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤ÎÄê
-¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
- VALUE rb_define_module(char *name)
-
-¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
-
- VALUE rb_define_module_under(VALUE module, char *name, VALUE super)
-
-¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
- void rb_include_module(VALUE class, VALUE module)
-
-¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯¥ë¡¼
-¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
-
- void rb_extend_object(VALUE object, VALUE module)
-
-¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
-
-** Âç°èÊÑ¿ôÄêµÁ
-
- void rb_define_variable(char *name, VALUE *var)
-
-Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç»Ï
-¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±Ê̻ҤȤ·
-¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é¥à¤«¤é
-¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
-
- void rb_define_readonly_variable(char *name, VALUE *var)
-
-Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥read
-only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
-
- void rb_define_virtual_variable(char *name,
- VALUE (*getter)(), VALUE (*setter)())
-
-´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ
-¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤ë¡¥
-
- void rb_define_hooked_variable(char *name, VALUE *var,
- VALUE (*getter)(), VALUE (*setter)())
-
-´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬
-»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter
-¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò»ØÄꤷ¤Ê
-¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
-
- void rb_global_variable(VALUE *var)
-
-GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö¥¸¥§
-¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
-
-** Äê¿ô
-
- void rb_define_const(VALUE klass, char *name, VALUE val)
-
-Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
- void rb_define_global_const(char *name, VALUE val)
-
-Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
- rb_define_const(cKernal, name, val)
-
-¤ÈƱ¤¸°ÕÌ£¡¥
-
-** ¥á¥½¥Ã¥ÉÄêµÁ
-
- rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ,
-´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2°ú
-¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ, Âè1°ú
-¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È¤¤¤¦·Á
-¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
-
- rb_define_private_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
- rb_define_singleton_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-ÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
- rb_scan_args(int atgc, VALUE *argv, char *fmt, ...)
-
-argc,argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô,
-Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú¿ô
-»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Äǽ¤Ç
-¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê¹ß¤ÏÊÑ
-¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥Éղðú
-¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬ÂåÆþ¤µ¤ì
-¤ë¡¥
-
-** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò»È¤¦¡¥
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc,argv·Á¼°¤ÇÅϤ¹¡¥
-
- VALUE rb_eval_string(char *str)
-
-ʸ»úÎó¤òRuby¤È¥¹¥¯¥ê¥×¥È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
-
- ID rb_intern(char *name)
-
-ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
-
- char *rb_id2name(ID id)
-
-ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
-
- char *rb_class2name(VALUE class)
-
-class¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥class¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï,
-ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
-
-** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
-
- VALUE rb_iv_get(VALUE obj, char *name)
-
-obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó¥¹
-ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó¥¹¥¿
-¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥Äê¿ô¤ÏÂçʸ»ú¤Î̾Á°¤ò»ý¤Ä¥¯¥é¥¹(¤Þ¤¿¤Ï¥â¥¸¥å¡¼
-¥ë)¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤È¤·¤Æ¼ÂÁõ¤µ¤ì¤Æ¤¤¤ë¡¥
-
- VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
-
-obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
-
-** À©¸æ¹½Â¤
-
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
-func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
-¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
-
- VALUE rb_yield(VALUE val)
-
-val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
-
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸¤·
-¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸¤·¤Ê
-¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá¤êÃͤÇ
-¤¢¤ë¡¥
-
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
-
-´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬È¯
-À¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1¤ÎÌá
-¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
-
-** Îã³°¡¦¥¨¥é¡¼
-
- void rb_warning(char *fmt, ...)
-
-rb_verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
-
- void rb_raise(rb_eRuntimeError, char *fmt, ...)
-
-RuntimeErrorÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
-
- void rb_raise(VALUE exception, char *fmt, ...)
-
-exception¤Ç»ØÄꤷ¤¿Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥fmt°Ê²¼¤Î°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
-
- void rb_fatal(char *fmt, ...)
-
-Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
-¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë¼Â
-¹Ô¤µ¤ì¤ë)¡¥
-
- void rb_bug(char *fmt, ...)
-
-¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤¾õ
-¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥Îã³°
-½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
-
-** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
-
-Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
-¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë¤ÏɬÍפʤ¤¡¥
-
- void ruby_init(int argc, char **argv, char **envp)
-
-Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
-
- void ruby_run()
-
-Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
-
- void ruby_script(char *name)
-
-Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
-
-
-Appendix B. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
-
-extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
-²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
- have_library(lib, func)
-
-´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é
-¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤true¤òÊÖ¤¹¡¥
-
- have_func(func)
-
-´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é
-¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê
-¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯»ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þTRUE¤òÊÖ¤¹¡¥
-
- have_header(header)
-
-¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ë
-»þtrue¤òÊÖ¤¹¡¥
-
- create_makefile(target)
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì¤Ð
-¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾¤òɽ
-¤¹¡¥
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..1e9bae7e0c
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,163 @@
+# Rubyã¨ã¯
+
+Rubyã¯ã‚·ãƒ³ãƒ—ルã‹ã¤å¼·åŠ›ãªã‚ªãƒ–ジェクト指å‘スクリプト言語ã§ã™ï¼Ž Rubyã¯ç´”粋ãªã‚ªãƒ–ジェクト指å‘言語ã¨ã—ã¦è¨­è¨ˆã•れã¦ã„ã‚‹ã®ã§ï¼Œ
+オブジェクト指å‘プログラミングを手軽ã«è¡Œã†äº‹ãŒå‡ºæ¥ã¾ã™ï¼Žã‚‚ã¡ã‚ã‚“æ™®é€šã®æ‰‹ç¶šãåž‹ã®ãƒ—ログラミングもå¯èƒ½ã§ã™ï¼Ž
+
+Rubyã¯ãƒ†ã‚­ã‚¹ãƒˆå‡¦ç†é–¢ä¿‚ã®èƒ½åŠ›ãªã©ã«å„ªã‚Œï¼ŒPerlã¨åŒã˜ãらã„強力ã§ã™ï¼Žã•らã«ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•ã¨ï¼Œ
+例外処ç†ã‚„イテレータãªã©ã®æ©Ÿæ§‹ã«ã‚ˆã£ã¦ï¼Œã‚ˆã‚Šåˆ†ã‹ã‚Šã‚„ã™ã„プログラミングãŒå‡ºæ¥ã¾ã™ï¼Ž
+
+## Rubyã®ç‰¹é•·
+
+* ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•
+* 普通ã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(クラス,メソッドコールãªã©)
+* 特殊ãªã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(Mixin, 特異メソッドãªã©)
+* 演算å­ã‚ªãƒ¼ãƒãƒ¼ãƒ­ãƒ¼ãƒ‰
+* ä¾‹å¤–å‡¦ç†æ©Ÿèƒ½
+* イテレータã¨ã‚¯ãƒ­ãƒ¼ã‚¸ãƒ£
+* ガーベージコレクタ
+* ダイナミックローディング (アーキテクãƒãƒ£ã«ã‚ˆã‚‹)
+* ç§»æ¤æ€§ãŒé«˜ã„.多ãã®Unix-like/POSIX互æ›ãƒ—ラットフォーム上ã§å‹•ãã ã‘ã§ãªã,Windows, Mac OS
+ X,BeOSãªã©ã®ä¸Šã§ã‚‚å‹•ã cf.
+ http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+
+
+## 入手法
+
+### FTPã§
+
+以下ã®å ´æ‰€ã«ãŠã„ã¦ã‚りã¾ã™ï¼Ž
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+### Subversionã§
+
+開発先端ã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§å–å¾—ã§ãã¾ã™ï¼Ž
+
+ $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+ä»–ã«é–‹ç™ºä¸­ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+
+ $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+### Gitã§
+
+Subversionã®ãƒŸãƒ©ãƒ¼ã‚’GitHubã«å…¬é–‹ã—ã¦ã„ã¾ã™ï¼Ž 以下ã®ã‚³ãƒžãƒ³ãƒ‰ã§ãƒªãƒã‚¸ãƒˆãƒªã‚’å–å¾—ã§ãã¾ã™ï¼Ž
+
+ $ git clone git://github.com/ruby/ruby.git
+
+## ホームページ
+
+Rubyã®ãƒ›ãƒ¼ãƒ ãƒšãƒ¼ã‚¸ã®URLã¯
+
+http://www.ruby-lang.org/
+
+ã§ã™ï¼Ž
+
+## メーリングリスト
+
+Rubyã®ãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆãŒã‚りã¾ã™ã€‚å‚åŠ å¸Œæœ›ã®æ–¹ã¯
+
+mailto:ruby-list-request@ruby-lang.org
+
+ã¾ã§æœ¬æ–‡ã«
+
+ subscribe
+
+ã¨æ›¸ã„ã¦é€ã£ã¦ä¸‹ã•ã„。
+
+Ruby開発者å‘ã‘メーリングリストもã‚りã¾ã™ã€‚ã“ã¡ã‚‰ã§ã¯rubyã®ãƒã‚°ã€å°†æ¥ã®ä»•様拡張ãªã©å®Ÿè£…上ã®å•題ã«ã¤ã„ã¦è­°è«–ã•れã¦ã„ã¾ã™ã€‚ å‚åŠ å¸Œæœ›ã®æ–¹ã¯
+
+mailto:ruby-dev-request@ruby-lang.org
+
+ã¾ã§ruby-listã¨åŒæ§˜ã®æ–¹æ³•ã§ãƒ¡ãƒ¼ãƒ«ã—ã¦ãã ã•ã„。
+
+Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆã¨æ•°å­¦é–¢ä¿‚ã®è©±é¡Œã«ã¤ã„ã¦è©±ã—åˆã†ruby-mathメーリングリストã¨
+英語ã§rubyã«ã¤ã„ã¦è©±ã—åˆã†ruby-talkメーリングリストもã‚りã¾ã™ã€‚å‚加方法ã¯ã©ã‚Œã‚‚åŒã˜ã§ã™ã€‚
+
+## コンパイル・インストール
+
+ä»¥ä¸‹ã®æ‰‹é †ã§è¡Œã£ã¦ãã ã•ã„.
+
+1. ã‚‚ã— `configure` ファイルãŒè¦‹ã¤ã‹ã‚‰ãªã„ã€ã‚‚ã—ã㯠`configure.in` よりå¤ã„よã†ãªã‚‰ã€ `autoconf` を実行ã—ã¦
+ æ–°ã—ã `configure` を生æˆã™ã‚‹
+
+2. `configure` を実行ã—㦠`Makefile` ãªã©ã‚’生æˆã™ã‚‹
+
+ 環境ã«ã‚ˆã£ã¦ã¯ãƒ‡ãƒ•ォルトã®Cコンパイラ用オプションãŒä»˜ãã¾ã™ï¼Ž `configure` オプション㧠`optflags=..`
+ `warnflags=..` ç­‰ã§ä¸Šæ›¸ãã§ãã¾ã™ï¼Ž
+
+3. (å¿…è¦ãªã‚‰ã°)`defines.h` を編集ã™ã‚‹
+
+ 多分,必è¦ç„¡ã„ã¨æ€ã„ã¾ã™ï¼Ž
+
+4. (å¿…è¦ãªã‚‰ã°)`ext/Setup` ã«é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’指定ã™ã‚‹
+
+ `ext/Setup` ã«è¨˜è¿°ã—ãŸãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã¯é™çš„ã«ãƒªãƒ³ã‚¯ã•れã¾ã™ï¼Ž
+
+ ダイナミックローディングをサãƒãƒ¼ãƒˆã—ã¦ã„ãªã„アーキテクãƒãƒ£ã§ã¯ `Setup` ã®1行目ã®ã€Œ`option nodynamic`ã€ã¨ã„ã†è¡Œã®ã‚³
+ メントを外ã™å¿…è¦ãŒã‚りã¾ã™ï¼Žã¾ãŸï¼Œã“ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ã§æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’利用ã™ã‚‹ãŸã‚ã«ã¯ï¼Œã‚らã‹ã˜ã‚é™çš„ã«ãƒªãƒ³ã‚¯ã‚’ã—ã¦ãŠãå¿…è¦ãŒã‚りã¾ã™ï¼Ž
+
+5. `make` を実行ã—ã¦ã‚³ãƒ³ãƒ‘イルã™ã‚‹
+
+6. `make check`ã§ãƒ†ã‚¹ãƒˆã‚’行ã†ï¼Ž
+
+ 「`check succeeded`ã€ã¨è¡¨ç¤ºã•ã‚Œã‚Œã°æˆåŠŸã§ã™ï¼ŽãŸã ã—ãƒ†ã‚¹ãƒˆã«æˆåŠŸã—ã¦ã‚‚完璧ã ã¨ä¿è¨¼ã•れã¦ã„る訳ã§ã¯ã‚りã¾ã›ã‚“.
+
+7. `make install`
+
+ 以下ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’作ã£ã¦ï¼Œãã“ã«ãƒ•ァイルをインストー ルã—ã¾ã™ï¼Ž
+
+ * `${DESTDIR}${prefix}/bin`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFOR
+ M}`
+ * `${DESTDIR}${prefix}/lib`
+ * `${DESTDIR}${prefix}/lib/ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${P
+ LATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/$
+ {PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/share/man/man1`
+ * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+ Rubyã®APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ãŒ'*x.y.z*'ã§ã‚れã°ï¼Œ`${MAJOR}`ã¯
+ '*x*'ã§ï¼Œ`${MINOR}`ã¯'*y*',`${TEENY}`ã¯'*z*'ã§ã™ï¼Ž
+
+ **注æ„**: APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ã® `teeny` ã¯ï¼ŒRubyプログラムã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã¨ã¯ç•°ãªã‚‹ã“ã¨ãŒã‚りã¾ã™ï¼Ž
+
+ `root` ã§ä½œæ¥­ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
+
+
+ã‚‚ã—,コンパイル時ã«ã‚¨ãƒ©ãƒ¼ãŒç™ºç”Ÿã—ãŸå ´åˆã«ã¯ã‚¨ãƒ©ãƒ¼ã®ãƒ­ã‚°ã¨ãƒžã‚·ãƒ³ï¼ŒOSã®ç¨®é¡žã‚’å«ã‚€ã§ãã‚‹ã ã‘詳ã—ã„レãƒãƒ¼ãƒˆã‚’作者ã«é€ã£ã¦ä¸‹ã•ã‚‹ã¨ä»–ã®æ–¹ã®ãŸã‚ã«ã‚‚ãªã‚Šã¾ã™ï¼Ž
+
+## ç§»æ¤
+
+UNIXã§ã‚れ㰠`configure` ãŒã»ã¨ã‚“ã©ã®å·®ç•°ã‚’å¸åŽã—ã¦ãれるã¯ãšã§ã™ãŒï¼Œæ€ã‚ã¬è¦‹è½ã¨ã—ãŒã‚ã£ãŸå ´åˆ(ã‚る事ãŒå¤šã„),作者ã«ãã®
+ã“ã¨ã‚’報告ã™ã‚Œã°ï¼Œè§£æ±ºã§ãã‚‹å¯èƒ½æ€§ãŒã‚りã¾ã™ï¼Ž
+
+アーキテクãƒãƒ£ã«ã‚‚ã£ã¨ã‚‚ä¾å­˜ã™ã‚‹ã®ã¯GC部ã§ã™ï¼ŽRubyã®GCã¯å¯¾è±¡
+ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ãŒ`setjmp()`ã¾ãŸã¯`getcontext()`ã«ã‚ˆã£ã¦å…¨ã¦ã®ãƒ¬ã‚¸ã‚¹ã‚¿ã‚’ `jmp_buf` ã‚„ `ucontext_t`
+ã«æ ¼ç´ã™ã‚‹ã“ã¨ã¨ï¼Œ `jmp_buf` ã‚„ `ucontext_t` ã¨ã‚¹ã‚¿ãƒƒã‚¯ãŒ32bitアラインメントã•れã¦ã„ã‚‹ã“ã¨ã‚’仮定
+ã—ã¦ã„ã¾ã™ï¼Žç‰¹ã«å‰è€…ãŒæˆç«‹ã—ãªã„å ´åˆã®å¯¾å¿œã¯éžå¸¸ã«å›°é›£ã§ã—ょã†ï¼Ž 後者ã®è§£æ±ºã¯æ¯”較的簡å˜ã§ï¼Œ `gc.c` ã§ã‚¹ã‚¿ãƒƒã‚¯ã‚’マークã—ã¦ã„ã‚‹
+部分ã«ã‚¢ãƒ©ã‚¤ãƒ³ãƒ¡ãƒ³ãƒˆã®ãƒã‚¤ãƒˆæ•°ã ã‘ãšã‚‰ã—ã¦ãƒžãƒ¼ã‚¯ã™ã‚‹ã‚³ãƒ¼ãƒ‰ã‚’追加ã™ã‚‹ã ã‘ã§æ¸ˆã¿ã¾ã™ï¼Ž`defined(_\*mc68000*\_)`ã§æ‹¬ã‚‰ã‚Œã¦ã„
+る部分をå‚考ã«ã—ã¦ãã ã•ã„.
+
+レジスタウィンドウをæŒã¤CPUã§ã¯ï¼Œãƒ¬ã‚¸ã‚¹ã‚¿ã‚¦ã‚£ãƒ³ãƒ‰ã‚¦ã‚’スタックã«ãƒ•ラッシュã™ã‚‹ã‚¢ã‚»ãƒ³ãƒ–ラコードを追加ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
+
+## é…布æ¡ä»¶
+
+`COPYING.ja` ファイルをå‚ç…§ã—ã¦ãã ã•ã„。
+
+## 著者
+
+コメント,ãƒã‚°ãƒ¬ãƒãƒ¼ãƒˆãã®ä»–㯠mailto:matz@ruby-lang.org ã¾ã§ï¼Ž
+---
+created at: Thu Aug 3 11:57:36 JST 1995
diff --git a/README.jp b/README.jp
deleted file mode 100644
index d137a435d8..0000000000
--- a/README.jp
+++ /dev/null
@@ -1,175 +0,0 @@
-* Ruby¤È¤Ï
-
-Ruby¤Ï¥·¥ó¥×¥ë¤«¤Ä¶¯ÎϤʥª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¹¡¥
-Ruby¤ÏºÇ½é¤«¤é½ã¿è¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤È¤·¤ÆÀ߷פµ¤ì¤Æ¤¤¤Þ
-¤¹¤«¤é¡¤¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥×¥í¥°¥é¥ß¥ó¥°¤ò¼ê·Ú¤Ë¹Ô¤¦»ö¤¬½ÐÍè¤Þ
-¤¹¡¥¤â¤Á¤í¤óÄ̾ï¤Î¼ê³¤­·¿¤Î¥×¥í¥°¥é¥ß¥ó¥°¤â²Äǽ¤Ç¤¹¡¥
-
-Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
-¤Ç¤¹¡¥¤µ¤é¤Ë¥·¥ó¥×¥ë¤Êʸˡ¤È¡¤Îã³°½èÍý¤ä¥¤¥Æ¥ì¡¼¥¿¤Ê¤É¤Îµ¡¹½
-¤Ë¤è¤Ã¤Æ¡¤¤è¤êʬ¤«¤ê¤ä¤¹¤¤¥×¥í¥°¥é¥ß¥ó¥°¤¬½ÐÍè¤Þ¤¹¡¥
-
-
-* Ruby¤ÎÆÃĹ¡¥
-
- + ¥·¥ó¥×¥ë¤Êʸˡ
- + ÉáÄ̤Υª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(¥¯¥é¥¹¡¤¥á¥½¥Ã¥É¥³¡¼¥ë¤Ê¤É)
- + ÆÃ¼ì¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(Mixin, ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É)
- + ±é»»»Ò¥ª¡¼¥Ð¡¼¥í¡¼¥É
- + Îã³°½èÍýµ¡Ç½
- + ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
- + ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
- + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
- + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤Çư¤¯¤À¤±¤Ç¤Ê¤¯¡¤DOS¤äWindows¡¤
- Mac¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
-
-
-* Æþ¼êË¡
-
-** ftp¤Ç
-
-°Ê²¼¤Î¾ì½ê¤Ë¤ª¤¤¤Æ¤¢¤ê¤Þ¤¹¡¥
-
- ftp://ftp.netlab.co.jp/pub/lang/ruby/
-
-
-* ¥Û¡¼¥à¥Ú¡¼¥¸
-
- Ruby¤Î¥Û¡¼¥à¥Ú¡¼¥¸¤ÎURL¤Ï
-
- http://www.netlab.co.jp/ruby/jp/
-
- ¤Ç¤¹¡¥
-
-
-* ¥á¡¼¥ê¥ó¥°¥ê¥¹¥È
-
- Ruby¤Ë´Ø¤ï¤ëÏÃÂê¤Î¤¿¤á¤Î¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤ò³«Àߤ·¤Þ¤·¤¿¡¥¥¢
- ¥É¥ì¥¹¤Ï
-
- ruby-list@netlab.co.jp
-
- ¤Ç¤¹¡¥¤³¤Î¥¢¥É¥ì¥¹¤Ë¥á¡¼¥ë¤òÁ÷¤ì¤Ð¡¤¼«Æ°Åª¤ËÅÐÏ¿¤µ¤ì¤Þ¤¹¡¥
-
-
-* ¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
-
-°Ê²¼¤Î¼ê½ç¤Ç¹Ô¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
- 1. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
-
- 2. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
-
- ¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
-
- 3. (ɬÍפʤé¤Ð)ext/Setup¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò
- »ØÄꤹ¤ë
-
- ext/Setup¤Ëµ­½Ò¤·¤¿¥â¥¸¥å¡¼¥ë¤ÏÀÅŪ¤Ë¥ê¥ó¥¯¤µ¤ì¤Þ¤¹¡¥
-
- ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥°¤ò¥µ¥Ý¡¼¥È¤·¤Æ¤¤¤Ê¤¤¥¢¡¼¥­¥Æ¥¯
- ¥Á¥ã¤Ç¤ÏSetup¤Î1¹ÔÌܤΡÖoption nodynamic¡×¤È¤¤¤¦¹Ô¤Î¥³
- ¥á¥ó¥È¤ò³°¤¹É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤Þ¤¿¡¤¤³¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ç
- ³ÈÄ¥¥â¥¸¥å¡¼¥ë¤òÍøÍѤ¹¤ë¤¿¤á¤Ë¤Ï¡¤¤¢¤é¤«¤¸¤áÀÅŪ¤Ë¥ê¥ó
- ¥¯¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
- 4. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
-
- 5. make test¤Ç¥Æ¥¹¥È¤ò¹Ô¤¦¡¥
-
- ¡Ötest succeeded¡×¤Èɽ¼¨¤µ¤ì¤ì¤ÐÀ®¸ù¤Ç¤¹¡¥¤¿¤À¤·¥Æ¥¹¥È
- ¤ËÀ®¸ù¤·¤Æ¤â´°àú¤À¤ÈÊݾڤµ¤ì¤Æ¤¤¤ëÌõ¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥
-
- 6. make install
-
- root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
-
-¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
-¥·¥ó¡¤OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¯
-¤À¤µ¤ë¤È¾¤ÎÊý¤Î¤¿¤á¤Ë¤â¤Ê¤ê¤Þ¤¹¡¥
-
-
-* °Ü¿¢
-
-UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
-¤¹¤¬¡¤»×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤)¡¤ºî¼Ô¤Ë¤½¤Î
-¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
-
-¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
-¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
-³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
-¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
-¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
-¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
-¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
-³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
-
-# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
-
-¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
-¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
-¤ì¤Þ¤»¤ó¡¥
-
-
-* ÇÛÉÛ¾ò·ï
-
-RUby¤Ï¥Õ¥ê¡¼¥½¥Õ¥È¥¦¥§¥¢¤Ç¤¹¡¥GPL(the GNU General Public
-Licence)¤Þ¤¿¤Ï°Ê²¼¤Ë¼¨¤¹¾ò·ï¤ÇRuby¤òºÆÇÛÉۤǤ­¤Þ¤¹¡¥GPL¤Ë¤Ä
-¤¤¤Æ¤ÏCOPYING¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ²¼¤µ¤¤¡¥
-
- 1. Ê£À½¤ÏÀ©¸Â¤Ê¤¯¼«Í³¤Ç¤¹¡¥
-
- 2. °Ê²¼¤Î¾ò·ï¤Î¤¤¤º¤ì¤«¤òËþ¤¿¤¹»þ¤Ë¼ê¸µ¤ÎRuby¤Î¥½¡¼¥¹¤ò¼«
- ͳ¤ËÊѹ¹¤Ç¤­¤Þ¤¹¡¥
-
- (a) ¥Í¥Ã¥È¥Ë¥å¡¼¥º¤Ë¥Ý¥¹¥È¤·¤¿¤ê¡¤ºî¼Ô¤ËÊѹ¹¤òÁ÷ÉÕ¤¹¤ë
- ¤Ê¤É¤ÎÊýË¡¤Ç¡¤Êѹ¹¤ò¸ø³«¤¹¤ë¡¥
-
- (b) Êѹ¹¤·¤¿Ruby¤ò¼«Ê¬¤Î½ê°¤¹¤ëÁÈ¿¥ÆâÉô¤À¤±¤Ç»È¤¦¡¥
-
- (c) Êѹ¹ÅÀ¤òÌÀ¼¨¤·¤¿¤¦¤¨¡¤¥½¥Õ¥È¥¦¥§¥¢¤Î̾Á°¤òÊѹ¹¤¹¤ë¡¥
- ¤½¤Î¥½¥Õ¥È¥¦¥§¥¢¤òÇÛÉÛ¤¹¤ë»þ¤Ë¤ÏÊѹ¹Á°¤ÎRuby¤âƱ»þ
- ¤ËÇÛÉÛ¤¹¤ë¡¥¤Þ¤¿¤ÏÊѹ¹Á°¤ÎRuby¤Î¥½¡¼¥¹¤ÎÆþ¼êË¡¤òÌÀ
- ¼¨¤¹¤ë¡¥
-
- (d) ¤½¤Î¾¤ÎÊѹ¹¾ò·ï¤òºî¼Ô¤È¹ç°Õ¤¹¤ë¡¥
-
- 3. °Ê²¼¤Î¾ò·ï¤Î¤¤¤º¤ì¤«¤òËþ¤¿¤¹»þ¤ËRuby¤ò¥ª¥Ö¥¸¥§¥¯¥È¥³¡¼
- ¥É¤ä¼Â¹Ô·Á¼°¤Ç¤âÇÛÉۤǤ­¤Þ¤¹¡¥
-
- (a) ¥Ð¥¤¥Ê¥ê¤ò¼õ¤±¼è¤Ã¤¿¿Í¤¬¥½¡¼¥¹¤òÆþ¼ê¤Ç¤­¤ë¤è¤¦¤Ë¡¤
- ¥½¡¼¥¹¤ÎÆþ¼êË¡¤òÌÀ¼¨¤¹¤ë¡¥
-
- (b) µ¡³£²ÄÆÉ¤Ê¥½¡¼¥¹¥³¡¼¥É¤òźÉÕ¤¹¤ë¡¥
-
- (c) Êѹ¹¤ò¹Ô¤Ã¤¿¥Ð¥¤¥Ê¥ê¤Ï̾Á°¤òÊѹ¹¤·¤¿¤¦¤¨¡¤¥½¡¼¥¹¤Î
- Æþ¼êË¡¤òÌÀ¼¨¤¹¤ë¡¥
-
- (d) ¤½¤Î¾¤ÎÇÛÉÛ¾ò·ï¤òºî¼Ô¤È¹ç°Õ¤¹¤ë¡¥
-
- 4. ¾¤Î¥×¥í¥°¥é¥à¤Ø¤Î°úÍѤϤ¤¤«¤Ê¤ëÌÜŪ¤Ç¤¢¤ì¼«Í³¤Ç¤¹¡¥¤¿
- ¤À¤·¡¤Ruby¤Ë´Þ¤Þ¤ì¤ë¾¤Îºî¼Ô¤Ë¤è¤ë¥³¡¼¥É¤Ï¡¤¤½¤ì¤¾¤ì¤Î
- ºî¼Ô¤Î°Õ¸þ¤Ë¤è¤ëÀ©¸Â¤¬²Ã¤¨¤é¤ì¤Þ¤¹¡¥¶ñÂÎŪ¤Ë¤Ïgc.c(°ìÉô)¡¤
- util.c(°ìÉô)¡¤st.[ch]¡¤regex.[ch], fnmatch.[ch], glob.c
- ¤ª¤è¤Ó./missing¥Ç¥£¥ì¥¯¥È¥ê²¼¤Î¥Õ¥¡¥¤¥ë·²¤¬³ºÅö¤·¤Þ¤¹¡¥
- ¤½¤ì¤¾¤ì¤ÎÇÛÉÛ¾ò·ï¤Ê¤É¤ËÉÕ¤¤¤Æ¤Ï³Æ¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ¤¯
- ¤À¤µ¤¤¡¥
-
- 5. Ruby¤Ø¤ÎÆþÎϤȤʤ륹¥¯¥ê¥×¥È¤ª¤è¤Ó¡¤Ruby¤«¤é¤Î½ÐÎϤθ¢
- Íø¤ÏRuby¤Îºî¼Ô¤Ç¤Ï¤Ê¤¯¡¤¤½¤ì¤¾¤ì¤ÎÆþ½ÐÎϤòÀ¸À®¤·¤¿¿Í¤Ë
- °¤·¤Þ¤¹¡¥¤Þ¤¿¡¤Ruby¤ËÁȤ߹þ¤à¤¿¤á¤Î³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä
- ¤¤¤Æ¤âƱÍͤǤ¹¡¥
-
- 6. Ruby¤Ï̵ÊݾڤǤ¹¡¥ºî¼Ô¤ÏRuby¤ò¥µ¥Ý¡¼¥È¤¹¤ë°Õ»Ö¤Ï¤¢¤ê¤Þ
- ¤¹¤¬¡¤Ruby¼«¿È¤Î¥Ð¥°¤¢¤ë¤¤¤ÏRuby¥¹¥¯¥ê¥×¥È¤Î¥Ð¥°¤Ê¤É¤«
- ¤éȯÀ¸¤¹¤ë¤¤¤«¤Ê¤ë»³²¤ËÂФ·¤Æ¤âÀÕǤ¤ò»ý¤Á¤Þ¤»¤ó¡¥
-
-
-* Ãø¼Ô
-
-¥³¥á¥ó¥È¡¤¥Ð¥°¥ì¥Ý¡¼¥È¤½¤Î¾¤Ï matz@netlab.co.jp ¤Þ¤Ç¡¥
--------------------------------------------------------
-created at: Thu Aug 3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..c6498a8cca
--- /dev/null
+++ b/README.md
@@ -0,0 +1,161 @@
+# What's Ruby
+
+Ruby is the interpreted scripting language for quick and easy object-oriented
+programming. It has many features to process text files and to do system
+management tasks (as in Perl). It is simple, straight-forward, and
+extensible.
+
+## Features of Ruby
+
+* Simple Syntax
+* **Normal** Object-Oriented features(ex. class, method calls)
+* **Advanced** Object-Oriented features(ex. Mix-in, Singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object files(on some architecture)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+ well as Windows, Mac OS X, BeOS etc.) cf.
+ http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+
+
+## How to get Ruby
+
+For a complete list of ways to install Ruby, including using third party tools
+like rvm, see:
+
+http://www.ruby-lang.org/en/downloads/
+
+The Ruby distribution files can be found in the following FTP site:
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+The trunk of the Ruby source tree can be checked out with the following
+command:
+
+ $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+Or if you are using git then use the following command:
+
+ $ git clone git://github.com/ruby/ruby.git
+
+There are some other branches under development. Try the following command
+and see the list of branches:
+
+ $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+Or if you are using git then use the following command:
+
+ $ git ls-remote git://github.com/ruby/ruby.git
+
+## Ruby home-page
+
+The URL of the Ruby home-page is:
+
+http://www.ruby-lang.org/
+
+## Mailing list
+
+There is a mailing list to talk about Ruby. To subscribe this list, please
+send the following phrase
+
+ subscribe
+
+in the mail body (not subject) to the address
+<mailto:ruby-talk-request@ruby-lang.org>.
+
+## How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+1. If you want to use Microsoft Visual C++ to compile ruby, read
+ win32/README.win32 instead of this document.
+
+2. If `./configure` does not exist or is older than configure.in, run
+ autoconf to (re)generate configure.
+
+3. Run `./configure`, which will generate config.h and Makefile.
+
+ Some C compiler flags may be added by default depending on your
+ environment. Specify `optflags=..` and `warnflags=..` as necessary to
+ override them.
+
+4. Edit `defines.h` if you need. Usually this step will not be needed.
+
+5. Remove comment mark(`#`) before the module names from `ext/Setup` (or add
+ module names if not present), if you want to link modules statically.
+
+ If you don't want to compile non static extension modules (probably on
+ architectures which do not allow dynamic loading), remove comment mark
+ from the line "`#option nodynamic`" in `ext/Setup`.
+
+ Usually this step will not be needed.
+
+6. Run `make`.
+
+7. Optionally, run '`make check`' to check whether the compiled Ruby
+ interpreter works well. If you see the message "`check succeeded`", your
+ ruby works as it should (hopefully).
+
+8. Run '`make install`'
+
+ This command will create following directories and install files onto
+ them.
+
+ * `${DESTDIR}${prefix}/bin`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFOR
+ M}`
+ * `${DESTDIR}${prefix}/lib`
+ * `${DESTDIR}${prefix}/lib/ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${P
+ LATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/$
+ {PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/share/man/man1`
+ * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+ If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
+ `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
+
+ **NOTE**: teeny of the API version may be different from one of Ruby's
+ program version
+
+ You may have to be a super user to install ruby.
+
+
+If you fail to compile ruby, please send the detailed error report with the
+error log and machine/OS type, to help others.
+
+Some extension libraries may not get compiled because of lack of necessary
+external libraries and/or headers, then you will need to run '`make
+distclean-ext`' to remove old configuration after installing them in such
+case.
+
+## Copying
+
+See the file `COPYING`.
+
+## Feedback
+
+Questions about the Ruby language can be asked on the Ruby-Talk mailing list
+(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(http://stackoverflow.com).
+
+Bug reports should be filed at http://bugs.ruby-lang.org
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
+1995.
+
+<mailto:matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index 7f20c28ed3..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,38 +0,0 @@
-Language Spec.
-
-* package or access control for global variables
-* named arguments like foo(nation:="german" or nation: "german").
-* method to retrieve argument information (need new C API)
-* multiple return values, yield values. maybe imcompatible
-* cascading method invocation.
-
-Hacking Interpreter
-
-* non-blocking open (e.g. named pipe) for thread
-* avoid blocking with gethostbyname/gethostbyaddr
-* objectify interpreters
-* remove rb_eval() recursions
-* syntax tree -> bytecode ???
-* scrambled script, or script filter
-
-Extension Libraries
-
-* mod_ruby, FastCGI ruby
-* InterBase module
-* ptk.rb pTk wrapper that is compatible to tk.rb
-
-Ruby Libraries
-
-* CGI.rb
-* httplib.rb, urllib.rb, nttplib.rb, etc.
-* format like perl's
-
-Tools
-
-* extension library maker like XS or SWIG
-* freeze or undump to bundle everything
-
-Misc
-
-* translate README.EXT fully into English
-* publish Ruby books
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..c8faf48d62
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,1208 @@
+/**********************************************************************
+
+ addr2line.c -
+
+ $Author$
+
+ Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#include "ruby/config.h"
+#include "ruby/missing.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef USE_ELF
+
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdint.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+
+/* Make alloca work the best possible way. */
+#ifdef __GNUC__
+# ifndef atarist
+# ifndef alloca
+# define alloca __builtin_alloca
+# endif
+# endif /* atarist */
+#else
+# ifdef HAVE_ALLOCA_H
+# include <alloca.h>
+# else
+# ifdef _AIX
+#pragma alloca
+# else
+# ifndef alloca /* predefined by HP cc +Olibcalls */
+void *alloca();
+# endif
+# endif /* AIX */
+# endif /* HAVE_ALLOCA_H */
+#endif /* __GNUC__ */
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#define DW_LNS_copy 0x01
+#define DW_LNS_advance_pc 0x02
+#define DW_LNS_advance_line 0x03
+#define DW_LNS_set_file 0x04
+#define DW_LNS_set_column 0x05
+#define DW_LNS_negate_stmt 0x06
+#define DW_LNS_set_basic_block 0x07
+#define DW_LNS_const_add_pc 0x08
+#define DW_LNS_fixed_advance_pc 0x09
+#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
+#define DW_LNS_set_isa 0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence 0x01
+#define DW_LNE_set_address 0x02
+#define DW_LNE_define_file 0x03
+#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+# define ElfW(x) Elf64##_##x
+# else
+# define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+# define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+# define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#ifndef PATH_MAX
+#define PATH_MAX 4096
+#endif
+
+int kprintf(const char *fmt, ...);
+
+typedef struct {
+ const char *dirname;
+ const char *filename;
+ const char *path; /* object path */
+ int line;
+
+ uintptr_t base_addr;
+ uintptr_t saddr;
+ const char *sname; /* function name */
+} line_info_t;
+typedef struct obj_info obj_info_t;
+struct obj_info {
+ const char *path; /* object path */
+ int fd;
+ void *mapped;
+ size_t mapped_size;
+ uintptr_t base_addr;
+ obj_info_t *next;
+};
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX];
+
+static unsigned long
+uleb128(char **p)
+{
+ unsigned long r = 0;
+ int s = 0;
+ for (;;) {
+ unsigned char b = *(unsigned char *)(*p)++;
+ if (b < 0x80) {
+ r += (unsigned long)b << s;
+ break;
+ }
+ r += (b & 0x7f) << s;
+ s += 7;
+ }
+ return r;
+}
+
+static long
+sleb128(char **p)
+{
+ long r = 0;
+ int s = 0;
+ for (;;) {
+ unsigned char b = *(unsigned char *)(*p)++;
+ if (b < 0x80) {
+ if (b & 0x40) {
+ r -= (0x80 - b) << s;
+ }
+ else {
+ r += (b & 0x3f) << s;
+ }
+ break;
+ }
+ r += (b & 0x7f) << s;
+ s += 7;
+ }
+ return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+ if (!dir--) {
+ return "";
+ }
+ while (dir--) {
+ while (*p) p++;
+ p++;
+ if (!*p) {
+ kprintf("Unexpected directory number %lu in %s\n",
+ dir, binary_filename);
+ return "";
+ }
+ }
+ return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames,
+ line_info_t *line)
+{
+ int i;
+ char *p = filenames;
+ char *filename;
+ unsigned long dir;
+ for (i = 1; i <= file; i++) {
+ filename = p;
+ if (!*p) {
+ /* Need to output binary file name? */
+ kprintf("Unexpected file number %d in %s\n",
+ file, binary_filename);
+ return;
+ }
+ while (*p) p++;
+ p++;
+ dir = uleb128(&p);
+ /* last modified. */
+ uleb128(&p);
+ /* size of the file. */
+ uleb128(&p);
+
+ if (i == file) {
+ line->filename = filename;
+ line->dirname = get_nth_dirname(dir, include_directories);
+ }
+ }
+}
+
+static void
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+ char *include_directories, char *filenames,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ int i;
+ addr += obj->base_addr;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t a = (uintptr_t)traces[i];
+ /* We assume one line code doesn't result >100 bytes of native code.
+ We may want more reliable way eventually... */
+ if (addr < a && a < addr + 100) {
+ fill_filename(file, include_directories, filenames, &lines[i]);
+ lines[i].line = line;
+ }
+ }
+}
+
+static void
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ char *p, *cu_end, *cu_start, *include_directories, *filenames;
+ unsigned long unit_length;
+ int default_is_stmt, line_base;
+ unsigned int header_length, minimum_instruction_length, line_range,
+ opcode_base;
+ /* unsigned char *standard_opcode_lengths; */
+
+ /* The registers. */
+ unsigned long addr = 0;
+ unsigned int file = 1;
+ unsigned int line = 1;
+ /* unsigned int column = 0; */
+ int is_stmt;
+ /* int basic_block = 0; */
+ /* int end_sequence = 0; */
+ /* int prologue_end = 0; */
+ /* int epilogue_begin = 0; */
+ /* unsigned int isa = 0; */
+
+ p = *debug_line;
+
+ unit_length = *(unsigned int *)p;
+ p += sizeof(unsigned int);
+ if (unit_length == 0xffffffff) {
+ unit_length = *(unsigned long *)p;
+ p += sizeof(unsigned long);
+ }
+
+ cu_end = p + unit_length;
+
+ /*dwarf_version = *(unsigned short *)p;*/
+ p += 2;
+
+ header_length = *(unsigned int *)p;
+ p += sizeof(unsigned int);
+
+ cu_start = p + header_length;
+
+ minimum_instruction_length = *(unsigned char *)p;
+ p++;
+
+ is_stmt = default_is_stmt = *(unsigned char *)p;
+ p++;
+
+ line_base = *(signed char *)p;
+ p++;
+
+ line_range = *(unsigned char *)p;
+ p++;
+
+ opcode_base = *(unsigned char *)p;
+ p++;
+
+ /* standard_opcode_lengths = (unsigned char *)p - 1; */
+ p += opcode_base - 1;
+
+ include_directories = p;
+
+ /* skip include directories */
+ while (*p) {
+ while (*p) p++;
+ p++;
+ }
+ p++;
+
+ filenames = p;
+
+ p = cu_start;
+
+#define FILL_LINE() \
+ do { \
+ fill_line(num_traces, traces, addr, file, line, \
+ include_directories, filenames, \
+ obj, lines, offset); \
+ /*basic_block = prologue_end = epilogue_begin = 0;*/ \
+ } while (0)
+
+ while (p < cu_end) {
+ unsigned long a;
+ unsigned char op = *p++;
+ switch (op) {
+ case DW_LNS_copy:
+ FILL_LINE();
+ break;
+ case DW_LNS_advance_pc:
+ a = uleb128(&p);
+ addr += a;
+ break;
+ case DW_LNS_advance_line: {
+ long a = sleb128(&p);
+ line += a;
+ break;
+ }
+ case DW_LNS_set_file:
+ file = (unsigned int)uleb128(&p);
+ break;
+ case DW_LNS_set_column:
+ /*column = (unsigned int)*/(void)uleb128(&p);
+ break;
+ case DW_LNS_negate_stmt:
+ is_stmt = !is_stmt;
+ break;
+ case DW_LNS_set_basic_block:
+ /*basic_block = 1; */
+ break;
+ case DW_LNS_const_add_pc:
+ a = ((255 - opcode_base) / line_range) *
+ minimum_instruction_length;
+ addr += a;
+ break;
+ case DW_LNS_fixed_advance_pc:
+ a = *(unsigned char *)p++;
+ addr += a;
+ break;
+ case DW_LNS_set_prologue_end:
+ /* prologue_end = 1; */
+ break;
+ case DW_LNS_set_epilogue_begin:
+ /* epilogue_begin = 1; */
+ break;
+ case DW_LNS_set_isa:
+ /* isa = (unsigned int)*/(void)uleb128(&p);
+ break;
+ case 0:
+ a = *(unsigned char *)p++;
+ op = *p++;
+ switch (op) {
+ case DW_LNE_end_sequence:
+ /* end_sequence = 1; */
+ FILL_LINE();
+ addr = 0;
+ file = 1;
+ line = 1;
+ /* column = 0; */
+ is_stmt = default_is_stmt;
+ /* end_sequence = 0; */
+ /* isa = 0; */
+ break;
+ case DW_LNE_set_address:
+ addr = *(unsigned long *)p;
+ p += sizeof(unsigned long);
+ break;
+ case DW_LNE_define_file:
+ kprintf("Unsupported operation in %s\n",
+ binary_filename);
+ break;
+ case DW_LNE_set_discriminator:
+ /* TODO:currently ignore */
+ uleb128(&p);
+ break;
+ default:
+ kprintf("Unknown extended opcode: %d in %s\n",
+ op, binary_filename);
+ }
+ break;
+ default: {
+ unsigned long addr_incr;
+ unsigned long line_incr;
+ a = op - opcode_base;
+ addr_incr = (a / line_range) * minimum_instruction_length;
+ line_incr = line_base + (a % line_range);
+ addr += (unsigned int)addr_incr;
+ line += (unsigned int)line_incr;
+ FILL_LINE();
+ }
+ }
+ }
+ *debug_line = p;
+}
+
+static void
+parse_debug_line(int num_traces, void **traces,
+ char *debug_line, unsigned long size,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ char *debug_line_end = debug_line + size;
+ while (debug_line < debug_line_end) {
+ parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+ }
+ if (debug_line != debug_line_end) {
+ kprintf("Unexpected size of .debug_line in %s\n",
+ binary_filename);
+ }
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset);
+
+static void
+append_obj(obj_info_t **objp) {
+ obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+ if (*objp) (*objp)->next = newobj;
+ *objp = newobj;
+}
+
+static void
+follow_debuglink(char *debuglink, int num_traces, void **traces,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ /* Ideally we should check 4 paths to follow gnu_debuglink,
+ but we handle only one case for now as this format is used
+ by some linux distributions. See GDB's info for detail. */
+ static const char global_debug_dir[] = "/usr/lib/debug";
+ char *p, *subdir;
+ obj_info_t *o1 = *objp, *o2;
+
+ p = strrchr(binary_filename, '/');
+ if (!p) {
+ return;
+ }
+ p[1] = '\0';
+
+ subdir = (char *)alloca(strlen(binary_filename) + 1);
+ strcpy(subdir, binary_filename);
+ strcpy(binary_filename, global_debug_dir);
+ strlcat(binary_filename, subdir, PATH_MAX);
+ strlcat(binary_filename, debuglink, PATH_MAX);
+
+ append_obj(objp);
+ o2 = *objp;
+ o2->base_addr = o1->base_addr;
+ o2->path = o1->path;
+ fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ int i, j;
+ char *shstr;
+ char *section_name;
+ ElfW(Ehdr) *ehdr;
+ ElfW(Shdr) *shdr, *shstr_shdr;
+ ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+ int fd;
+ off_t filesize;
+ char *file;
+ ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+ ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+ obj_info_t *obj = *objp;
+ uintptr_t dladdr_fbase = 0;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ goto fail;
+ }
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
+ }
+
+ ehdr = (ElfW(Ehdr) *)file;
+ if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+ /*
+ * Huh? Maybe filename was overridden by setproctitle() and
+ * it match non-elf file.
+ */
+ close(fd);
+ goto fail;
+ }
+
+ obj->fd = fd;
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
+
+ shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+ shstr_shdr = shdr + ehdr->e_shstrndx;
+ shstr = file + shstr_shdr->sh_offset;
+
+ for (i = 0; i < ehdr->e_shnum; i++) {
+ section_name = shstr + shdr[i].sh_name;
+ switch (shdr[i].sh_type) {
+ case SHT_STRTAB:
+ if (!strcmp(section_name, ".strtab")) {
+ strtab_shdr = shdr + i;
+ }
+ else if (!strcmp(section_name, ".dynstr")) {
+ dynstr_shdr = shdr + i;
+ }
+ break;
+ case SHT_SYMTAB:
+ /* if (!strcmp(section_name, ".symtab")) */
+ symtab_shdr = shdr + i;
+ break;
+ case SHT_DYNSYM:
+ /* if (!strcmp(section_name, ".dynsym")) */
+ dynsym_shdr = shdr + i;
+ break;
+ case SHT_PROGBITS:
+ if (!strcmp(section_name, ".debug_line")) {
+ debug_line_shdr = shdr + i;
+ }
+ else if (!strcmp(section_name, ".gnu_debuglink")) {
+ gnu_debuglink_shdr = shdr + i;
+ }
+ break;
+ }
+ }
+
+ if (offset == -1) {
+ /* main executable */
+ offset = 0;
+ if (dynsym_shdr && dynstr_shdr) {
+ char *strtab = file + dynstr_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+ int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ Dl_info info;
+ void *h, *s;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+ h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+ if (!h) continue;
+ s = dlsym(h, strtab + sym->st_name);
+ if (!s) continue;
+ if (dladdr(s, &info)) {
+ dladdr_fbase = (uintptr_t)info.dli_fbase;
+ break;
+ }
+ }
+ if (ehdr->e_type == ET_EXEC) {
+ obj->base_addr = 0;
+ }
+ else {
+ /* PIE (position-independent executable) */
+ obj->base_addr = dladdr_fbase;
+ }
+ }
+ }
+
+ if (!symtab_shdr) {
+ symtab_shdr = dynsym_shdr;
+ strtab_shdr = dynstr_shdr;
+ }
+
+ if (symtab_shdr && strtab_shdr) {
+ char *strtab = file + strtab_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+ int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t d = (uintptr_t)traces[i] - saddr;
+ if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ lines[i].sname = strtab + sym->st_name;
+ lines[i].saddr = saddr;
+ lines[i].path = obj->path;
+ lines[i].base_addr = obj->base_addr;
+ }
+ }
+ }
+
+ if (!debug_line_shdr) {
+ /* This file doesn't have .debug_line section,
+ let's check .gnu_debuglink section instead. */
+ if (gnu_debuglink_shdr && check_debuglink) {
+ follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+ num_traces, traces,
+ objp, lines, offset);
+ }
+ goto finish;
+ }
+
+ parse_debug_line(num_traces, traces,
+ file + debug_line_shdr->sh_offset,
+ debug_line_shdr->sh_size,
+ obj, lines, offset);
+finish:
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
+}
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(void)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__)
+ssize_t
+main_exe_path(void)
+{
+# define PROC_SELF_EXE "/proc/self/exe"
+ ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+ binary_filename[len] = 0;
+ return len;
+}
+#elif defined(__FreeBSD__)
+ssize_t
+main_exe_path(void)
+{
+ int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+ size_t len = PATH_MAX;
+ int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+ if (err) {
+ kprintf("Can't get the path of ruby");
+ return -1;
+ }
+ len--; /* sysctl sets strlen+1 */
+ return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
+{
+ int i;
+ /* async-signal unsafe */
+ line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+ obj_info_t *obj = NULL;
+ /* 2 is NULL + main executable */
+ void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+#ifdef HAVE_MAIN_EXE_PATH
+ char *main_path = NULL; /* used on printing backtrace */
+ ssize_t len;
+ if ((len = main_exe_path()) > 0) {
+ main_path = (char *)alloca(len + 1);
+ if (main_path) {
+ uintptr_t addr;
+ memcpy(main_path, binary_filename, len+1);
+ append_obj(&obj);
+ obj->path = main_path;
+ addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+ if (addr != (uintptr_t)-1) {
+ dladdr_fbases[0] = (void *)addr;
+ }
+ }
+ }
+#endif
+
+ /* fill source lines by reading dwarf */
+ for (i = 0; i < num_traces; i++) {
+ Dl_info info;
+ if (lines[i].line) continue;
+ if (dladdr(traces[i], &info)) {
+ const char *path;
+ void **p;
+
+ /* skip symbols which is in already checked objects */
+ /* if the binary is strip-ed, this may effect */
+ for (p=dladdr_fbases; *p; p++) {
+ if (*p == info.dli_fbase) {
+ lines[i].path = info.dli_fname;
+ lines[i].sname = info.dli_sname;
+ goto next_line;
+ }
+ }
+ *p = info.dli_fbase;
+
+ append_obj(&obj);
+ obj->base_addr = (uintptr_t)info.dli_fbase;
+ path = info.dli_fname;
+ obj->path = path;
+ lines[i].path = path;
+ strcpy(binary_filename, path);
+ fill_lines(num_traces, traces, 1, &obj, lines, i);
+ }
+next_line:
+ continue;
+ }
+
+ /* output */
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = &lines[i];
+ uintptr_t addr = (uintptr_t)traces[i];
+ uintptr_t d = addr - line->saddr;
+ if (!line->path) {
+ kprintf("[0x%lx]\n", addr);
+ }
+ else if (!line->saddr || !line->sname) {
+ kprintf("%s [0x%lx]\n", line->path, addr);
+ }
+ else if (line->line <= 0) {
+ kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
+ d, addr);
+ }
+ else if (!line->filename) {
+ kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
+ d, addr, line->line);
+ }
+ else if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
+ d, addr, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
+ d, addr, line->filename, line->line);
+ }
+ /* FreeBSD's backtrace may show _start and so on */
+ if (line->sname && strcmp("main", line->sname) == 0)
+ break;
+ }
+
+ /* free */
+ while (obj) {
+ obj_info_t *o = obj;
+ obj = o->next;
+ if (o->fd) {
+ munmap(o->mapped, o->mapped_size);
+ close(o->fd);
+ }
+ free(o);
+ }
+ free(lines);
+ free(dladdr_fbases);
+}
+
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ * The Regents of the University of California. All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ * notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ * notice, this list of conditions and the following disclaimer in the
+ * documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ * may be used to endorse or promote products derived from this software
+ * without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ * @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+extern int rb_toupper(int c);
+#define toupper(c) rb_toupper(c)
+#define hex2ascii(hex) (hex2ascii_data[hex])
+char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+ char s[1];
+ ssize_t ret;
+
+ s[0] = (char)c;
+ ret = write(2, s, 1);
+ (void)ret;
+}
+
+int
+kprintf(const char *fmt, ...)
+{
+ va_list ap;
+ int retval;
+
+ va_start(ap, fmt);
+ retval = kvprintf(fmt, putce, NULL, 10, ap);
+ va_end(ap);
+ return retval;
+}
+
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+ char *p, c;
+
+ p = nbuf;
+ *p = '\0';
+ do {
+ c = hex2ascii(num % base);
+ *++p = upper ? toupper(c) : c;
+ } while (num /= base);
+ if (lenp)
+ *lenp = (int)(p - nbuf);
+ return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ * printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex. Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register. Thus:
+ *
+ * kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ * reg=3<BITTWO,BITONE>
+ *
+ * XXX: %D -- Hexdump, takes pointer and separator string:
+ * ("%6D", ptr, ":") -> XX:XX:XX:XX:XX:XX
+ * ("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+ char nbuf[MAXNBUF];
+ char *d;
+ const char *p, *percent, *q;
+ unsigned char *up;
+ int ch, n;
+ uintmax_t num;
+ int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+ int cflag, hflag, jflag, tflag, zflag;
+ int dwidth, upper;
+ char padc;
+ int stop = 0, retval = 0;
+
+ num = 0;
+ if (!func)
+ d = (char *) arg;
+ else
+ d = NULL;
+
+ if (fmt == NULL)
+ fmt = "(fmt null)\n";
+
+ if (radix < 2 || radix > 36)
+ radix = 10;
+
+ for (;;) {
+ padc = ' ';
+ width = 0;
+ while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+ if (ch == '\0')
+ return (retval);
+ PCHAR(ch);
+ }
+ percent = fmt - 1;
+ qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+ sign = 0; dot = 0; dwidth = 0; upper = 0;
+ cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch: switch (ch = (unsigned char)*fmt++) {
+ case '.':
+ dot = 1;
+ goto reswitch;
+ case '#':
+ sharpflag = 1;
+ goto reswitch;
+ case '+':
+ sign = 1;
+ goto reswitch;
+ case '-':
+ ladjust = 1;
+ goto reswitch;
+ case '%':
+ PCHAR(ch);
+ break;
+ case '*':
+ if (!dot) {
+ width = va_arg(ap, int);
+ if (width < 0) {
+ ladjust = !ladjust;
+ width = -width;
+ }
+ } else {
+ dwidth = va_arg(ap, int);
+ }
+ goto reswitch;
+ case '0':
+ if (!dot) {
+ padc = '0';
+ goto reswitch;
+ }
+ case '1': case '2': case '3': case '4':
+ case '5': case '6': case '7': case '8': case '9':
+ for (n = 0;; ++fmt) {
+ n = n * 10 + ch - '0';
+ ch = *fmt;
+ if (ch < '0' || ch > '9')
+ break;
+ }
+ if (dot)
+ dwidth = n;
+ else
+ width = n;
+ goto reswitch;
+ case 'b':
+ num = (unsigned int)va_arg(ap, int);
+ p = va_arg(ap, char *);
+ for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+ PCHAR(*q--);
+
+ if (num == 0)
+ break;
+
+ for (tmp = 0; *p;) {
+ n = *p++;
+ if (num & (1 << (n - 1))) {
+ PCHAR(tmp ? ',' : '<');
+ for (; (n = *p) > ' '; ++p)
+ PCHAR(n);
+ tmp = 1;
+ } else
+ for (; *p > ' '; ++p)
+ continue;
+ }
+ if (tmp)
+ PCHAR('>');
+ break;
+ case 'c':
+ PCHAR(va_arg(ap, int));
+ break;
+ case 'D':
+ up = va_arg(ap, unsigned char *);
+ p = va_arg(ap, char *);
+ if (!width)
+ width = 16;
+ while(width--) {
+ PCHAR(hex2ascii(*up >> 4));
+ PCHAR(hex2ascii(*up & 0x0f));
+ up++;
+ if (width)
+ for (q=p;*q;q++)
+ PCHAR(*q);
+ }
+ break;
+ case 'd':
+ case 'i':
+ base = 10;
+ sign = 1;
+ goto handle_sign;
+ case 'h':
+ if (hflag) {
+ hflag = 0;
+ cflag = 1;
+ } else
+ hflag = 1;
+ goto reswitch;
+ case 'j':
+ jflag = 1;
+ goto reswitch;
+ case 'l':
+ if (lflag) {
+ lflag = 0;
+ qflag = 1;
+ } else
+ lflag = 1;
+ goto reswitch;
+ case 'n':
+ if (jflag)
+ *(va_arg(ap, intmax_t *)) = retval;
+ else if (qflag)
+ *(va_arg(ap, int64_t *)) = retval;
+ else if (lflag)
+ *(va_arg(ap, long *)) = retval;
+ else if (zflag)
+ *(va_arg(ap, size_t *)) = retval;
+ else if (hflag)
+ *(va_arg(ap, short *)) = retval;
+ else if (cflag)
+ *(va_arg(ap, char *)) = retval;
+ else
+ *(va_arg(ap, int *)) = retval;
+ break;
+ case 'o':
+ base = 8;
+ goto handle_nosign;
+ case 'p':
+ base = 16;
+ sharpflag = (width == 0);
+ sign = 0;
+ num = (uintptr_t)va_arg(ap, void *);
+ goto number;
+ case 'q':
+ qflag = 1;
+ goto reswitch;
+ case 'r':
+ base = radix;
+ if (sign)
+ goto handle_sign;
+ goto handle_nosign;
+ case 's':
+ p = va_arg(ap, char *);
+ if (p == NULL)
+ p = "(null)";
+ if (!dot)
+ n = (int)strlen (p);
+ else
+ for (n = 0; n < dwidth && p[n]; n++)
+ continue;
+
+ width -= n;
+
+ if (!ladjust && width > 0)
+ while (width--)
+ PCHAR(padc);
+ while (n--)
+ PCHAR(*p++);
+ if (ladjust && width > 0)
+ while (width--)
+ PCHAR(padc);
+ break;
+ case 't':
+ tflag = 1;
+ goto reswitch;
+ case 'u':
+ base = 10;
+ goto handle_nosign;
+ case 'X':
+ upper = 1;
+ case 'x':
+ base = 16;
+ goto handle_nosign;
+ case 'y':
+ base = 16;
+ sign = 1;
+ goto handle_sign;
+ case 'z':
+ zflag = 1;
+ goto reswitch;
+handle_nosign:
+ sign = 0;
+ if (jflag)
+ num = va_arg(ap, uintmax_t);
+ else if (qflag)
+ num = va_arg(ap, uint64_t);
+ else if (tflag)
+ num = va_arg(ap, ptrdiff_t);
+ else if (lflag)
+ num = va_arg(ap, unsigned long);
+ else if (zflag)
+ num = va_arg(ap, size_t);
+ else if (hflag)
+ num = (unsigned short)va_arg(ap, int);
+ else if (cflag)
+ num = (unsigned char)va_arg(ap, int);
+ else
+ num = va_arg(ap, unsigned int);
+ goto number;
+handle_sign:
+ if (jflag)
+ num = va_arg(ap, intmax_t);
+ else if (qflag)
+ num = va_arg(ap, int64_t);
+ else if (tflag)
+ num = va_arg(ap, ptrdiff_t);
+ else if (lflag)
+ num = va_arg(ap, long);
+ else if (zflag)
+ num = va_arg(ap, ssize_t);
+ else if (hflag)
+ num = (short)va_arg(ap, int);
+ else if (cflag)
+ num = (char)va_arg(ap, int);
+ else
+ num = va_arg(ap, int);
+number:
+ if (sign && (intmax_t)num < 0) {
+ neg = 1;
+ num = -(intmax_t)num;
+ }
+ p = ksprintn(nbuf, num, base, &n, upper);
+ tmp = 0;
+ if (sharpflag && num != 0) {
+ if (base == 8)
+ tmp++;
+ else if (base == 16)
+ tmp += 2;
+ }
+ if (neg)
+ tmp++;
+
+ if (!ladjust && padc == '0')
+ dwidth = width - tmp;
+ width -= tmp + imax(dwidth, n);
+ dwidth -= n;
+ if (!ladjust)
+ while (width-- > 0)
+ PCHAR(' ');
+ if (neg)
+ PCHAR('-');
+ if (sharpflag && num != 0) {
+ if (base == 8) {
+ PCHAR('0');
+ } else if (base == 16) {
+ PCHAR('0');
+ PCHAR('x');
+ }
+ }
+ while (dwidth-- > 0)
+ PCHAR('0');
+
+ while (*p)
+ PCHAR(*p--);
+
+ if (ladjust)
+ while (width-- > 0)
+ PCHAR(' ');
+
+ break;
+ default:
+ while (percent < fmt)
+ PCHAR(*percent++);
+ /*
+ * Since we ignore an formatting argument it is no
+ * longer safe to obey the remaining formatting
+ * arguments as the arguments will no longer match
+ * the format specs.
+ */
+ stop = 1;
+ break;
+ }
+ }
+#undef PCHAR
+}
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..d99f010934
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+ addr2line.h -
+
+ $Author$
+
+ Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#ifdef USE_ELF
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 25ea483778..6b551dbe24 100644
--- a/array.c
+++ b/array.c
@@ -1,26 +1,140 @@
-/************************************************
+/**********************************************************************
array.c -
$Author$
- $Date$
created at: Fri Aug 6 09:46:12 JST 1993
- Copyright (C) 1993-1999 Yukihiro Matsumoto
+ Copyright (C) 1993-2007 Yukihiro Matsumoto
+ Copyright (C) 2000 Network Applied Communication Laboratory, Inc.
+ Copyright (C) 2000 Information-technology Promotion Agency, Japan
-************************************************/
+**********************************************************************/
-#include "ruby.h"
-#include "util.h"
+#include "ruby/ruby.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "ruby/encoding.h"
+#include "internal.h"
+#include "probes.h"
+#include "id.h"
+
+#ifndef ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include <assert.h>
VALUE rb_cArray;
+static ID id_cmp, id_div, id_power;
+
#define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+
+# define ARY_SHARED_P(ary) \
+ (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+ FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+ (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+ FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+ (assert(ARY_EMBED_P(a)), \
+ (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+ (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+#define FL_SET_EMBED(a) do { \
+ assert(!ARY_SHARED_P(a)); \
+ FL_SET((a), RARRAY_EMBED_FLAG); \
+} while (0)
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+ long tmp_n = (n); \
+ assert(ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+ RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+ if (ARY_EMBED_P(ary)) { \
+ ARY_SET_EMBED_LEN((ary), (n)); \
+ } \
+ else { \
+ ARY_SET_HEAP_LEN((ary), (n)); \
+ } \
+ assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do { \
+ assert(!OBJ_FROZEN(ary)); \
+ if (ARY_EMBED_P(ary)) { \
+ ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+ } \
+ else { \
+ RARRAY(ary)->as.heap.len += (n); \
+ } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+ ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_CAPA(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!ARY_SHARED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+ const VALUE _ary_ = (ary); \
+ const VALUE _value_ = (value); \
+ assert(!ARY_EMBED_P(_ary_)); \
+ assert(ARY_SHARED_P(_ary_)); \
+ assert(ARY_SHARED_ROOT_P(_value_)); \
+ RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+ (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+ assert(ARY_SHARED_ROOT_P(ary)); \
+ RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
void
-rb_mem_clear(mem, size)
- register VALUE *mem;
- register size_t size;
+rb_mem_clear(register VALUE *mem, register long size)
{
while (size--) {
*mem++ = Qnil;
@@ -28,1494 +142,5613 @@ rb_mem_clear(mem, size)
}
static void
-memfill(mem, size, val)
- register VALUE *mem;
- register size_t size;
- register VALUE val;
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+ RARRAY_PTR_USE(ary, ptr, {
+ rb_mem_clear(ptr + beg, size);
+ });
+}
+
+static inline void
+memfill(register VALUE *mem, register long size, register VALUE val)
{
while (size--) {
*mem++ = val;
}
}
-#define ARY_FREEZE FL_USER1
-#define ARY_TMPLOCK FL_USER2
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+ RARRAY_PTR_USE(ary, ptr, {
+ memfill(ptr + beg, size, val);
+ RB_OBJ_WRITTEN(ary, Qundef, val);
+ });
+}
static void
-rb_ary_modify(ary)
- VALUE ary;
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
{
- if (FL_TEST(ary, ARY_FREEZE))
- rb_raise(rb_eTypeError, "can't modify frozen array");
- if (FL_TEST(ary, ARY_TMPLOCK))
- rb_raise(rb_eTypeError, "can't modify array during sort");
- if (!FL_TEST(ary, FL_TAINT) && rb_safe_level() >= 4)
- rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+#if 1
+ assert(!ARY_SHARED_P(buff_owner_ary));
+
+ if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+ rb_gc_writebarrier_remember(buff_owner_ary);
+ RARRAY_PTR_USE(ary, ptr, {
+ MEMCPY(ptr+beg, argv, VALUE, argc);
+ });
+ }
+ else {
+ int i;
+ RARRAY_PTR_USE(ary, ptr, {
+ for (i=0; i<argc; i++) {
+ RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+ }
+ });
+ }
+#else
+ /* giveup write barrier (traditional way) */
+ RARRAY_PTR(buff_owner_ary);
+ MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
+#endif
}
-VALUE
-rb_ary_freeze(ary)
- VALUE ary;
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+ ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+ assert(RARRAY_LEN(ary) <= capacity);
+ assert(!OBJ_FROZEN(ary));
+ assert(!ARY_SHARED_P(ary));
+ if (capacity > RARRAY_EMBED_LEN_MAX) {
+ if (ARY_EMBED_P(ary)) {
+ long len = ARY_EMBED_LEN(ary);
+ VALUE *ptr = ALLOC_N(VALUE, (capacity));
+ MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_HEAP_LEN(ary, len);
+ }
+ else {
+ SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+ }
+ ARY_SET_CAPA(ary, (capacity));
+ }
+ else {
+ if (!ARY_EMBED_P(ary)) {
+ long len = RARRAY_LEN(ary);
+ const VALUE *ptr = RARRAY_CONST_PTR(ary);
+
+ if (len > capacity) len = capacity;
+ MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+ FL_SET_EMBED(ary);
+ ARY_SET_LEN(ary, len);
+ ruby_xfree((VALUE *)ptr);
+ }
+ }
+}
+
+static inline void
+ary_shrink_capa(VALUE ary)
+{
+ long capacity = ARY_HEAP_LEN(ary);
+ long old_capa = RARRAY(ary)->as.heap.aux.capa;
+ assert(!ARY_SHARED_P(ary));
+ assert(old_capa >= capacity);
+ if (old_capa > capacity)
+ REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+ long new_capa = ARY_CAPA(ary) / 2;
+
+ if (new_capa < ARY_DEFAULT_SIZE) {
+ new_capa = ARY_DEFAULT_SIZE;
+ }
+ if (new_capa >= ARY_MAX_SIZE - min) {
+ new_capa = (ARY_MAX_SIZE - min) / 2;
+ }
+ new_capa += min;
+ ary_resize_capa(ary, new_capa);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared)
{
- FL_SET(ary, ARY_FREEZE);
+ if (shared) {
+ long num = ARY_SHARED_NUM(shared) - 1;
+ if (num == 0) {
+ rb_ary_free(shared);
+ rb_gc_force_recycle(shared);
+ }
+ else if (num > 0) {
+ ARY_SET_SHARED_NUM(shared, num);
+ }
+ }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+ VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+ rb_ary_decrement_share(shared);
+ FL_UNSET_SHARED(ary);
+}
+
+static inline void
+rb_ary_unshare_safe(VALUE ary)
+{
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared)
+{
+ long num = ARY_SHARED_NUM(shared);
+ if (num >= 0) {
+ ARY_SET_SHARED_NUM(shared, num + 1);
+ }
+ return shared;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared)
+{
+ rb_ary_increment_share(shared);
+ FL_SET_SHARED(ary);
+ ARY_SET_SHARED(ary, shared);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+ rb_check_frozen(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_P(ary)) {
+ long shared_len, len = RARRAY_LEN(ary);
+ VALUE shared = ARY_SHARED(ary);
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ FL_UNSET_SHARED(ary);
+ FL_SET_EMBED(ary);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+ rb_ary_decrement_share(shared);
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
+ long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
+ FL_UNSET_SHARED(ary);
+ ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
+ ARY_SET_CAPA(ary, shared_len);
+ RARRAY_PTR_USE(ary, ptr, {
+ MEMMOVE(ptr, ptr+shift, VALUE, len);
+ });
+ FL_SET_EMBED(shared);
+ rb_ary_decrement_share(shared);
+ }
+ else {
+ VALUE *ptr = ALLOC_N(VALUE, len);
+ MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+ rb_ary_unshare(ary);
+ ARY_SET_CAPA(ary, len);
+ ARY_SET_PTR(ary, ptr);
+ }
+
+ rb_gc_writebarrier_remember(ary);
+ }
+}
+
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
+{
+ long new_len = RARRAY_LEN(ary) + add_len;
+ long capa;
+
+ if (ARY_SHARED_P(ary)) {
+ if (new_len > RARRAY_EMBED_LEN_MAX) {
+ VALUE shared = ARY_SHARED(ary);
+ if (ARY_SHARED_OCCUPIED(shared)) {
+ if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
+ rb_ary_modify_check(ary);
+ return shared;
+ }
+ else {
+ /* if array is shared, then it is likely it participate in push/shift pattern */
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (new_len > capa - (capa >> 6)) {
+ ary_double_capa(ary, new_len);
+ }
+ return ary;
+ }
+ }
+ }
+ }
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (new_len > capa) {
+ ary_double_capa(ary, new_len);
+ }
+
return ary;
}
+/*
+ * call-seq:
+ * ary.freeze -> ary
+ *
+ * Calls Object#freeze on +ary+ to prevent any further
+ * modification. A RuntimeError will be raised if a modification
+ * attempt is made.
+ *
+ */
+
+VALUE
+rb_ary_freeze(VALUE ary)
+{
+ return rb_obj_freeze(ary);
+}
+
+/*
+ * call-seq:
+ * ary.frozen? -> true or false
+ *
+ * Return +true+ if this array is frozen (or temporarily frozen
+ * while being sorted). See also Object#frozen?
+ */
+
static VALUE
-rb_ary_frozen_p(ary)
- VALUE ary;
+rb_ary_frozen_p(VALUE ary)
{
- if (FL_TEST(ary, ARY_FREEZE|ARY_TMPLOCK))
- return Qtrue;
+ if (OBJ_FROZEN(ary)) return Qtrue;
return Qfalse;
}
+/* This can be used to take a snapshot of an array (with
+ e.g. rb_ary_replace) and check later whether the array has been
+ modified from the snapshot. The snapshot is cheap, though if
+ something does modify the array it will pay the cost of copying
+ it. If Array#pop or Array#shift has been called, the array will
+ be still shared with the snapshot, but the array length will
+ differ. */
VALUE
-rb_ary_new2(len)
- int len;
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
+{
+ if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+ !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+ RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
+ RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+ return Qtrue;
+ }
+ return Qfalse;
+}
+
+static VALUE
+ary_alloc(VALUE klass)
{
- NEWOBJ(ary, struct RArray);
- OBJSETUP(ary, rb_cArray, T_ARRAY);
+ NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+ /* Created array is:
+ * FL_SET_EMBED((VALUE)ary);
+ * ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ */
+ return (VALUE)ary;
+}
- if (len < 0) {
+static VALUE
+empty_ary_alloc(VALUE klass)
+{
+ if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
+ RUBY_DTRACE_ARRAY_CREATE(0, rb_sourcefile(), rb_sourceline());
+ }
+
+ return ary_alloc(klass);
+}
+
+static VALUE
+ary_new(VALUE klass, long capa)
+{
+ VALUE ary,*ptr;
+
+ if (capa < 0) {
rb_raise(rb_eArgError, "negative array size (or size too big)");
}
- if (len > 0 && len*sizeof(VALUE) <= 0) {
+ if (capa > ARY_MAX_SIZE) {
rb_raise(rb_eArgError, "array size too big");
}
- ary->len = 0;
- ary->capa = len;
- ary->ptr = 0;
- ary->ptr = ALLOC_N(VALUE, len);
- return (VALUE)ary;
+ if (RUBY_DTRACE_ARRAY_CREATE_ENABLED()) {
+ RUBY_DTRACE_ARRAY_CREATE(capa, rb_sourcefile(), rb_sourceline());
+ }
+
+ if (capa > RARRAY_EMBED_LEN_MAX) {
+ ptr = ALLOC_N(VALUE, capa);
+ ary = ary_alloc(klass);
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_CAPA(ary, capa);
+ ARY_SET_HEAP_LEN(ary, 0);
+ }
+ else {
+ ary = ary_alloc(klass);
+ }
+
+ return ary;
}
VALUE
-rb_ary_new()
+rb_ary_new_capa(long capa)
{
- return rb_ary_new2(ARY_DEFAULT_SIZE);
+ return ary_new(rb_cArray, capa);
}
-#ifdef HAVE_STDARG_PROTOTYPES
-#include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
+VALUE
+rb_ary_new(void)
+{
+ return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+}
VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
-rb_ary_new3(int n, ...)
-#else
-rb_ary_new3(n, va_alist)
- int n;
- va_dcl
-#endif
+rb_ary_new_from_args(long n, ...)
{
va_list ar;
VALUE ary;
- int i;
+ long i;
- if (n < 0) {
- rb_raise(rb_eIndexError, "negative number of items(%d)", n);
- }
- ary = rb_ary_new2(n<ARY_DEFAULT_SIZE?ARY_DEFAULT_SIZE:n);
+ ary = rb_ary_new2(n);
- va_init_list(ar, n);
+ va_start(ar, n);
for (i=0; i<n; i++) {
- RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+ ARY_SET(ary, i, va_arg(ar, VALUE));
}
va_end(ar);
- RARRAY(ary)->len = n;
+ ARY_SET_LEN(ary, n);
return ary;
}
VALUE
-rb_ary_new4(n, elts)
- int n;
- VALUE *elts;
+rb_ary_new_from_values(long n, const VALUE *elts)
{
VALUE ary;
ary = rb_ary_new2(n);
- if (elts) {
- MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+ if (n > 0 && elts) {
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
}
- RARRAY(ary)->len = n;
return ary;
}
VALUE
-rb_assoc_new(car, cdr)
- VALUE car, cdr;
+rb_ary_tmp_new(long capa)
{
- VALUE ary;
-
- ary = rb_ary_new2(2);
- RARRAY(ary)->ptr[0] = car;
- RARRAY(ary)->ptr[1] = cdr;
- RARRAY(ary)->len = 2;
+ return ary_new(0, capa);
+}
+VALUE
+rb_ary_tmp_new_fill(long capa)
+{
+ VALUE ary = ary_new(0, capa);
+ ary_memfill(ary, 0, capa, Qnil);
+ ARY_SET_LEN(ary, capa);
return ary;
}
-static VALUE
-rb_ary_s_new(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
+void
+rb_ary_free(VALUE ary)
{
- int len = 0;
- VALUE size, val;
- NEWOBJ(ary, struct RArray);
- OBJSETUP(ary, klass, T_ARRAY);
+ if (ARY_OWNS_HEAP_P(ary)) {
+ ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+}
- ary->len = 0;
- ary->ptr = 0;
- if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
- ary->capa = ARY_DEFAULT_SIZE;
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+ if (ARY_OWNS_HEAP_P(ary)) {
+ return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
}
else {
- int capa = NUM2INT(size);
+ return 0;
+ }
+}
- if (capa < 0) {
- rb_raise(rb_eArgError, "negative array size");
- }
- if (capa > 0 && capa*sizeof(VALUE) <= 0) {
- rb_raise(rb_eArgError, "array size too big");
- }
- ary->capa = capa;
- len = capa;
+static inline void
+ary_discard(VALUE ary)
+{
+ rb_ary_free(ary);
+ RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+ RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
+}
+
+static VALUE
+ary_make_shared(VALUE ary)
+{
+ assert(!ARY_EMBED_P(ary));
+ if (ARY_SHARED_P(ary)) {
+ return ARY_SHARED(ary);
+ }
+ else if (ARY_SHARED_ROOT_P(ary)) {
+ return ary;
+ }
+ else if (OBJ_FROZEN(ary)) {
+ ary_shrink_capa(ary);
+ FL_SET_SHARED_ROOT(ary);
+ ARY_SET_SHARED_NUM(ary, 1);
+ return ary;
+ }
+ else {
+ long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+ NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+ FL_UNSET_EMBED(shared);
+
+ ARY_SET_LEN((VALUE)shared, capa);
+ ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
+ ary_mem_clear((VALUE)shared, len, capa - len);
+ FL_SET_SHARED_ROOT(shared);
+ ARY_SET_SHARED_NUM((VALUE)shared, 1);
+ FL_SET_SHARED(ary);
+ ARY_SET_SHARED(ary, (VALUE)shared);
+ OBJ_FREEZE(shared);
+ return (VALUE)shared;
}
- ary->ptr = ALLOC_N(VALUE, ary->capa);
- memfill(ary->ptr, len, val);
- ary->len = len;
- rb_obj_call_init((VALUE)ary);
+}
- return (VALUE)ary;
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+ long len = RARRAY_LEN(ary);
+
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE subst = rb_ary_new2(len);
+ ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+ ARY_SET_EMBED_LEN(subst, len);
+ return subst;
+ }
+ else {
+ return rb_ary_increment_share(ary_make_shared(ary));
+ }
+}
+
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+ return rb_ary_new3(2, car, cdr);
}
static VALUE
-rb_ary_s_create(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
+to_ary(VALUE ary)
+{
+ return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+}
+
+VALUE
+rb_check_array_type(VALUE ary)
+{
+ return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+}
+
+/*
+ * call-seq:
+ * Array.try_convert(obj) -> array or nil
+ *
+ * Tries to convert +obj+ into an array, using +to_ary+ method. Returns the
+ * converted array or +nil+ if +obj+ cannot be converted for any reason.
+ * This method can be used to check if an argument is an array.
+ *
+ * Array.try_convert([1]) #=> [1]
+ * Array.try_convert("1") #=> nil
+ *
+ * if tmp = Array.try_convert(arg)
+ * # the argument is an array
+ * elsif tmp = String.try_convert(arg)
+ * # the argument is a string
+ * end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+ return rb_check_array_type(ary);
+}
+
+/*
+ * call-seq:
+ * Array.new(size=0, default=nil)
+ * Array.new(array)
+ * Array.new(size) {|index| block }
+ *
+ * Returns a new array.
+ *
+ * In the first form, if no arguments are sent, the new array will be empty.
+ * When a +size+ and an optional +default+ are sent, an array is created with
+ * +size+ copies of +default+. Take notice that all elements will reference the
+ * same object +default+.
+ *
+ * The second form creates a copy of the array passed as a parameter (the
+ * array is generated by calling to_ary on the parameter).
+ *
+ * first_array = ["Matz", "Guido"]
+ *
+ * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ * first_array.equal? second_array #=> false
+ *
+ * In the last form, an array of the given size is created. Each element in
+ * this array is created by passing the element's index to the given block
+ * and storing the return value.
+ *
+ * Array.new(3){ |index| index ** 2 }
+ * # => [0, 1, 4]
+ *
+ * == Common gotchas
+ *
+ * When sending the second parameter, the same object will be used as the
+ * value for all the array elements:
+ *
+ * a = Array.new(2, Hash.new)
+ * # => [{}, {}]
+ *
+ * a[0]['cat'] = 'feline'
+ * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
+ * a[1]['cat'] = 'Felix'
+ * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ * Since all the Array elements store the same hash, changes to one of them
+ * will affect them all.
+ *
+ * If multiple copies are what you want, you should use the block
+ * version which uses the result of that block each time an element
+ * of the array needs to be initialized:
+ *
+ * a = Array.new(2) { Hash.new }
+ * a[0]['cat'] = 'feline'
+ * a # => [{"cat"=>"feline"}, {}]
+ *
+ */
+
+static VALUE
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
{
- NEWOBJ(ary, struct RArray);
- OBJSETUP(ary, klass, T_ARRAY);
+ long len;
+ VALUE size, val;
- ary->len = argc;
- ary->capa = argc;
+ rb_ary_modify(ary);
if (argc == 0) {
- ary->ptr = 0;
+ if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
+ ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+ rb_ary_unshare_safe(ary);
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
+ if (rb_block_given_p()) {
+ rb_warning("given block not used");
+ }
+ return ary;
+ }
+ rb_scan_args(argc, argv, "02", &size, &val);
+ if (argc == 1 && !FIXNUM_P(size)) {
+ val = rb_check_array_type(size);
+ if (!NIL_P(val)) {
+ rb_ary_replace(ary, val);
+ return ary;
+ }
+ }
+
+ len = NUM2LONG(size);
+ /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
+ if (len < 0) {
+ rb_raise(rb_eArgError, "negative array size");
+ }
+ if (len > ARY_MAX_SIZE) {
+ rb_raise(rb_eArgError, "array size too big");
+ }
+ /* recheck after argument conversion */
+ rb_ary_modify(ary);
+ ary_resize_capa(ary, len);
+ if (rb_block_given_p()) {
+ long i;
+
+ if (argc == 2) {
+ rb_warn("block supersedes default value argument");
+ }
+ for (i=0; i<len; i++) {
+ rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+ ARY_SET_LEN(ary, i + 1);
+ }
}
else {
- ary->ptr = ALLOC_N(VALUE, argc);
- MEMCPY(ary->ptr, argv, VALUE, argc);
+ ary_memfill(ary, 0, len, val);
+ ARY_SET_LEN(ary, len);
}
+ return ary;
+}
- return (VALUE)ary;
+/*
+ * Returns a new array populated with the given objects.
+ *
+ * Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ * Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
+ * [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
+ */
+
+static VALUE
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+{
+ VALUE ary = ary_new(klass, argc);
+ if (argc > 0 && argv) {
+ ary_memcpy(ary, 0, argc, argv);
+ ARY_SET_LEN(ary, argc);
+ }
+
+ return ary;
}
void
-rb_ary_store(ary, idx, val)
- VALUE ary;
- int idx;
- VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
{
- rb_ary_modify(ary);
+ long len = RARRAY_LEN(ary);
+
if (idx < 0) {
- idx = RARRAY(ary)->len + idx;
+ idx += len;
if (idx < 0) {
- rb_raise(rb_eIndexError, "negative index of array");
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ idx - len, -len);
}
}
+ else if (idx >= ARY_MAX_SIZE) {
+ rb_raise(rb_eIndexError, "index %ld too big", idx);
+ }
- if (idx >= RARRAY(ary)->capa) {
- int capa_inc = RARRAY(ary)->capa / 2;
- if (capa_inc < ARY_DEFAULT_SIZE) {
- capa_inc = ARY_DEFAULT_SIZE;
- }
- RARRAY(ary)->capa = idx + capa_inc;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ rb_ary_modify(ary);
+ if (idx >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, idx);
}
- if (idx > RARRAY(ary)->len) {
- rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len,
- idx-RARRAY(ary)->len+1);
+ if (idx > len) {
+ ary_mem_clear(ary, len, idx - len + 1);
}
- if (idx >= RARRAY(ary)->len) {
- RARRAY(ary)->len = idx + 1;
+ if (idx >= len) {
+ ARY_SET_LEN(ary, idx + 1);
}
- RARRAY(ary)->ptr[idx] = val;
+ ARY_SET(ary, idx, val);
}
-VALUE
-rb_ary_push(ary, item)
- VALUE ary;
- VALUE item;
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
{
- rb_ary_store(ary, RARRAY(ary)->len, item);
- return ary;
+ assert(offset >= 0);
+ assert(len >= 0);
+ assert(offset+len <= RARRAY_LEN(ary));
+
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE result = ary_alloc(klass);
+ ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+ ARY_SET_EMBED_LEN(result, len);
+ return result;
+ }
+ else {
+ VALUE shared, result = ary_alloc(klass);
+ FL_UNSET_EMBED(result);
+
+ shared = ary_make_shared(ary);
+ ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+ ARY_SET_LEN(result, RARRAY_LEN(ary));
+ rb_ary_set_shared(result, shared);
+
+ ARY_INCREASE_PTR(result, offset);
+ ARY_SET_LEN(result, len);
+ return result;
+ }
}
static VALUE
-rb_ary_push_method(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+ary_make_shared_copy(VALUE ary)
+{
+ return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+}
+
+enum ary_take_pos_flags
+{
+ ARY_TAKE_FIRST = 0,
+ ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
{
- while (argc--) {
- rb_ary_store(ary, RARRAY(ary)->len, *argv++);
+ VALUE nv;
+ long n;
+ long len;
+ long offset = 0;
+
+ rb_scan_args(argc, argv, "1", &nv);
+ n = NUM2LONG(nv);
+ len = RARRAY_LEN(ary);
+ if (n > len) {
+ n = len;
+ }
+ else if (n < 0) {
+ rb_raise(rb_eArgError, "negative array size");
+ }
+ if (last) {
+ offset = len - n;
}
+ return ary_make_partial(ary, rb_cArray, offset, n);
+}
+
+/*
+ * call-seq:
+ * ary << obj -> ary
+ *
+ * Append---Pushes the given object on to the end of this array. This
+ * expression returns the array itself, so several appends
+ * may be chained together.
+ *
+ * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
+ * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *
+ */
+
+VALUE
+rb_ary_push(VALUE ary, VALUE item)
+{
+ long idx = RARRAY_LEN(ary);
+ VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+ RARRAY_PTR_USE(ary, ptr, {
+ RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+ });
+ ARY_SET_LEN(ary, idx + 1);
return ary;
}
VALUE
-rb_ary_pop(ary)
- VALUE ary;
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
{
- if (RARRAY(ary)->len == 0) return Qnil;
- if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
- RARRAY(ary)->capa = RARRAY(ary)->len * 2;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ long oldlen = RARRAY_LEN(ary);
+ VALUE target_ary = ary_ensure_room_for_push(ary, len);
+ ary_memcpy0(ary, oldlen, len, argv, target_ary);
+ ARY_SET_LEN(ary, oldlen + len);
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.push(obj, ... ) -> ary
+ *
+ * Append --- Pushes the given object(s) on to the end of this array. This
+ * expression returns the array itself, so several appends
+ * may be chained together. See also Array#pop for the opposite
+ * effect.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.push("d", "e", "f")
+ * #=> ["a", "b", "c", "d", "e", "f"]
+ * [1, 2, 3,].push(4).push(5)
+ * #=> [1, 2, 3, 4, 5]
+ */
+
+static VALUE
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
+{
+ return rb_ary_cat(ary, argv, argc);
+}
+
+VALUE
+rb_ary_pop(VALUE ary)
+{
+ long n;
+ rb_ary_modify_check(ary);
+ n = RARRAY_LEN(ary);
+ if (n == 0) return Qnil;
+ if (ARY_OWNS_HEAP_P(ary) &&
+ n * 3 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+ {
+ ary_resize_capa(ary, n * 2);
+ }
+ --n;
+ ARY_SET_LEN(ary, n);
+ return RARRAY_AREF(ary, n);
+}
+
+/*
+ * call-seq:
+ * ary.pop -> obj or nil
+ * ary.pop(n) -> new_ary
+ *
+ * Removes the last element from +self+ and returns it, or
+ * +nil+ if the array is empty.
+ *
+ * If a number +n+ is given, returns an array of the last +n+ elements
+ * (or less) just like <code>array.slice!(-n, n)</code> does. See also
+ * Array#push for the opposite effect.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.pop #=> "d"
+ * a.pop(2) #=> ["b", "c"]
+ * a #=> ["a"]
+ */
+
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result;
+
+ if (argc == 0) {
+ return rb_ary_pop(ary);
}
- return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+ rb_ary_modify_check(ary);
+ result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+ return result;
}
VALUE
-rb_ary_shift(ary)
- VALUE ary;
+rb_ary_shift(VALUE ary)
{
VALUE top;
+ long len = RARRAY_LEN(ary);
+
+ rb_ary_modify_check(ary);
+ if (len == 0) return Qnil;
+ top = RARRAY_AREF(ary, 0);
+ if (!ARY_SHARED_P(ary)) {
+ if (len < ARY_DEFAULT_SIZE) {
+ RARRAY_PTR_USE(ary, ptr, {
+ MEMMOVE(ptr, ptr+1, VALUE, len-1);
+ }); /* WB: no new reference */
+ ARY_INCREASE_LEN(ary, -1);
+ return top;
+ }
+ assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+ ARY_SET(ary, 0, Qnil);
+ ary_make_shared(ary);
+ }
+ else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+ RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+ }
+ ARY_INCREASE_PTR(ary, 1); /* shift ptr */
+ ARY_INCREASE_LEN(ary, -1);
- if (RARRAY(ary)->len == 0) return Qnil;
+ return top;
+}
- top = RARRAY(ary)->ptr[0];
- RARRAY(ary)->len--;
+/*
+ * call-seq:
+ * ary.shift -> obj or nil
+ * ary.shift(n) -> new_ary
+ *
+ * Removes the first element of +self+ and returns it (shifting all
+ * other elements down by one). Returns +nil+ if the array
+ * is empty.
+ *
+ * If a number +n+ is given, returns an array of the first +n+ elements
+ * (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
+ * containing only the remainder elements, not including what was shifted to
+ * +new_ary+. See also Array#unshift for the opposite effect.
+ *
+ * args = [ "-m", "-q", "filename" ]
+ * args.shift #=> "-m"
+ * args #=> ["-q", "filename"]
+ *
+ * args = [ "-m", "-q", "filename" ]
+ * args.shift(2) #=> ["-m", "-q"]
+ * args #=> ["filename"]
+ */
+
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result;
+ long n;
- /* sliding items */
- MEMMOVE(RARRAY(ary)->ptr, RARRAY(ary)->ptr+1, VALUE, RARRAY(ary)->len);
- if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
- RARRAY(ary)->capa = RARRAY(ary)->len * 2;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ if (argc == 0) {
+ return rb_ary_shift(ary);
}
- return top;
+ rb_ary_modify_check(ary);
+ result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ n = RARRAY_LEN(result);
+ if (ARY_SHARED_P(ary)) {
+ if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+ ary_mem_clear(ary, 0, n);
+ }
+ ARY_INCREASE_PTR(ary, n);
+ }
+ else {
+ RARRAY_PTR_USE(ary, ptr, {
+ MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary)-n);
+ }); /* WB: no new reference */
+ }
+ ARY_INCREASE_LEN(ary, -n);
+
+ return result;
}
-VALUE
-rb_ary_unshift(ary, item)
- VALUE ary, item;
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
{
+ long len = RARRAY_LEN(ary);
+ long new_len = len + argc;
+ long capa;
+ const VALUE *head, *sharedp;
+
+ if (ARY_SHARED_P(ary)) {
+ VALUE shared = ARY_SHARED(ary);
+ capa = RARRAY_LEN(shared);
+ if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
+ head = RARRAY_CONST_PTR(ary);
+ sharedp = RARRAY_CONST_PTR(shared);
+ goto makeroom_if_need;
+ }
+ }
+
rb_ary_modify(ary);
- if (RARRAY(ary)->len >= RARRAY(ary)->capa) {
- int capa_inc = RARRAY(ary)->capa / 2;
- if (capa_inc < ARY_DEFAULT_SIZE) {
- capa_inc = ARY_DEFAULT_SIZE;
+ capa = ARY_CAPA(ary);
+ if (capa - (capa >> 6) <= new_len) {
+ ary_double_capa(ary, new_len);
+ }
+
+ /* use shared array for big "queues" */
+ if (new_len > ARY_DEFAULT_SIZE * 4) {
+ /* make a room for unshifted items */
+ capa = ARY_CAPA(ary);
+ ary_make_shared(ary);
+
+ head = sharedp = RARRAY_CONST_PTR(ary);
+ goto makeroom;
+ makeroom_if_need:
+ if (head - sharedp < argc) {
+ long room;
+ makeroom:
+ room = capa - new_len;
+ room -= room >> 4;
+ MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+ head = sharedp + argc + room;
}
- RARRAY(ary)->capa+=capa_inc;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ ARY_SET_PTR(ary, head - argc);
+ assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
+ return ARY_SHARED(ary);
}
+ else {
+ /* sliding items */
+ RARRAY_PTR_USE(ary, ptr, {
+ MEMMOVE(ptr + argc, ptr, VALUE, len);
+ });
+
+ return ary;
+ }
+}
- /* sliding items */
- MEMMOVE(RARRAY(ary)->ptr+1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+/*
+ * call-seq:
+ * ary.unshift(obj, ...) -> ary
+ *
+ * Prepends objects to the front of +self+, moving other elements upwards.
+ * See also Array#shift for the opposite effect.
+ *
+ * a = [ "b", "c", "d" ]
+ * a.unshift("a") #=> ["a", "b", "c", "d"]
+ * a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
+ */
- RARRAY(ary)->len++;
- RARRAY(ary)->ptr[0] = item;
+static VALUE
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
+{
+ long len = RARRAY_LEN(ary);
+ VALUE target_ary;
+
+ if (argc == 0) {
+ rb_ary_modify_check(ary);
+ return ary;
+ }
+ target_ary = ary_ensure_room_for_unshift(ary, argc);
+ ary_memcpy0(ary, 0, argc, argv, target_ary);
+ ARY_SET_LEN(ary, len + argc);
return ary;
}
VALUE
-rb_ary_entry(ary, offset)
- VALUE ary;
- int offset;
+rb_ary_unshift(VALUE ary, VALUE item)
{
- if (RARRAY(ary)->len == 0) return Qnil;
+ return rb_ary_unshift_m(1,&item,ary);
+}
+
+/* faster version - use this if you don't need to treat negative offset */
+static inline VALUE
+rb_ary_elt(VALUE ary, long offset)
+{
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ if (offset < 0 || len <= offset) {
+ return Qnil;
+ }
+ return RARRAY_AREF(ary, offset);
+}
+VALUE
+rb_ary_entry(VALUE ary, long offset)
+{
if (offset < 0) {
- offset = RARRAY(ary)->len + offset;
+ offset += RARRAY_LEN(ary);
}
- if (offset < 0 || RARRAY(ary)->len <= offset) {
- return Qnil;
+ return rb_ary_elt(ary, offset);
+}
+
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+ VALUE klass;
+ long alen = RARRAY_LEN(ary);
+
+ if (beg > alen) return Qnil;
+ if (beg < 0 || len < 0) return Qnil;
+
+ if (alen < len || alen < beg + len) {
+ len = alen - beg;
}
+ klass = rb_obj_class(ary);
+ if (len == 0) return ary_new(klass, 0);
- return RARRAY(ary)->ptr[offset];
+ return ary_make_partial(ary, klass, beg, len);
}
-static VALUE
-rb_ary_subseq(ary, beg, len)
- VALUE ary;
- int beg, len;
+/*
+ * call-seq:
+ * ary[index] -> obj or nil
+ * ary[start, length] -> new_ary or nil
+ * ary[range] -> new_ary or nil
+ * ary.slice(index) -> obj or nil
+ * ary.slice(start, length) -> new_ary or nil
+ * ary.slice(range) -> new_ary or nil
+ *
+ * Element Reference --- Returns the element at +index+, or returns a
+ * subarray starting at the +start+ index and continuing for +length+
+ * elements, or returns a subarray specified by +range+ of indices.
+ *
+ * Negative indices count backward from the end of the array (-1 is the last
+ * element). For +start+ and +range+ cases the starting index is just before
+ * an element. Additionally, an empty array is returned when the starting
+ * index for an element range is at the end of the array.
+ *
+ * Returns +nil+ if the index (or starting index) are out of range.
+ *
+ * a = [ "a", "b", "c", "d", "e" ]
+ * a[2] + a[0] + a[1] #=> "cab"
+ * a[6] #=> nil
+ * a[1, 2] #=> [ "b", "c" ]
+ * a[1..3] #=> [ "b", "c", "d" ]
+ * a[4..7] #=> [ "e" ]
+ * a[6..10] #=> nil
+ * a[-3, 3] #=> [ "c", "d", "e" ]
+ * # special cases
+ * a[5] #=> nil
+ * a[6, 1] #=> nil
+ * a[5, 1] #=> []
+ * a[5..10] #=> []
+ *
+ */
+
+VALUE
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
{
- VALUE ary2;
+ VALUE arg;
+ long beg, len;
- if (len <= 0) {
- return rb_ary_new2(0);
+ if (argc == 2) {
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ if (beg < 0) {
+ beg += RARRAY_LEN(ary);
+ }
+ return rb_ary_subseq(ary, beg, len);
}
- if (beg < 0) {
- len += beg;
- beg = 0;
+ if (argc != 1) {
+ rb_scan_args(argc, argv, "11", NULL, NULL);
}
- if (beg + len > RARRAY(ary)->len) {
- len = RARRAY(ary)->len - beg;
+ arg = argv[0];
+ /* special case - speeding up */
+ if (FIXNUM_P(arg)) {
+ return rb_ary_entry(ary, FIX2LONG(arg));
}
- if (len < 0) {
- len = 0;
+ /* check if idx is Range */
+ switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+ case Qfalse:
+ break;
+ case Qnil:
+ return Qnil;
+ default:
+ return rb_ary_subseq(ary, beg, len);
}
-
- ary2 = rb_ary_new2(len);
- MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr+beg, VALUE, len);
- RARRAY(ary2)->len = len;
-
- return ary2;
+ return rb_ary_entry(ary, NUM2LONG(arg));
}
+/*
+ * call-seq:
+ * ary.at(index) -> obj or nil
+ *
+ * Returns the element at +index+. A negative index counts from the end of
+ * +self+. Returns +nil+ if the index is out of range. See also
+ * Array#[].
+ *
+ * a = [ "a", "b", "c", "d", "e" ]
+ * a.at(0) #=> "a"
+ * a.at(-1) #=> "e"
+ */
+
static VALUE
-beg_len(range, begp, lenp, len)
- VALUE range;
- int *begp, *lenp, len;
+rb_ary_at(VALUE ary, VALUE pos)
{
- int beg, end;
- int b, e;
+ return rb_ary_entry(ary, NUM2LONG(pos));
+}
- if (!rb_range_beg_end(range, &beg, &end)) return Qfalse;
- b = beg; e = end;
+/*
+ * call-seq:
+ * ary.first -> obj or nil
+ * ary.first(n) -> new_ary
+ *
+ * Returns the first element, or the first +n+ elements, of the array.
+ * If the array is empty, the first form returns +nil+, and the
+ * second form returns an empty array. See also Array#last for
+ * the opposite effect.
+ *
+ * a = [ "q", "r", "s", "t" ]
+ * a.first #=> "q"
+ * a.first(2) #=> ["q", "r"]
+ */
- if (beg < 0) {
- beg = len + beg;
- }
- if (end < 0) {
- end = len + end;
+static VALUE
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
+{
+ if (argc == 0) {
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ return RARRAY_AREF(ary, 0);
}
- if (beg > end) {
- rb_raise(rb_eIndexError, "end smaller than beg [%d..%d]", b, e);
+ else {
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
}
+}
- *begp = beg;
- if (beg > len) {
- *lenp = 0;
+/*
+ * call-seq:
+ * ary.last -> obj or nil
+ * ary.last(n) -> new_ary
+ *
+ * Returns the last element(s) of +self+. If the array is empty,
+ * the first form returns +nil+.
+ *
+ * See also Array#first for the opposite effect.
+ *
+ * a = [ "w", "x", "y", "z" ]
+ * a.last #=> "z"
+ * a.last(2) #=> ["y", "z"]
+ */
+
+VALUE
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+{
+ if (argc == 0) {
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ return RARRAY_AREF(ary, len-1);
}
else {
- len = end - beg +1;
- *lenp = len;
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
}
- return Qtrue;
}
-VALUE
-rb_ary_aref(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
-{
- VALUE arg1, arg2;
- int beg, len;
+/*
+ * call-seq:
+ * ary.fetch(index) -> obj
+ * ary.fetch(index, default) -> obj
+ * ary.fetch(index) { |index| block } -> obj
+ *
+ * Tries to return the element at position +index+, but throws an IndexError
+ * exception if the referenced +index+ lies outside of the array bounds. This
+ * error can be prevented by supplying a second argument, which will act as a
+ * +default+ value.
+ *
+ * Alternatively, if a block is given it will only be executed when an
+ * invalid +index+ is referenced. Negative values of +index+ count from the
+ * end of the array.
+ *
+ * a = [ 11, 22, 33, 44 ]
+ * a.fetch(1) #=> 22
+ * a.fetch(-1) #=> 44
+ * a.fetch(4, 'cat') #=> "cat"
+ * a.fetch(100) { |i| puts "#{i} is out of bounds" }
+ * #=> "100 is out of bounds"
+ */
- if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
- beg = NUM2INT(arg1);
- len = NUM2INT(arg2);
- if (beg < 0) {
- beg = RARRAY(ary)->len + beg;
- }
- return rb_ary_subseq(ary, beg, len);
+static VALUE
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE pos, ifnone;
+ long block_given;
+ long idx;
+
+ rb_scan_args(argc, argv, "11", &pos, &ifnone);
+ block_given = rb_block_given_p();
+ if (block_given && argc == 2) {
+ rb_warn("block supersedes default value argument");
}
+ idx = NUM2LONG(pos);
- /* special case - speeding up */
- if (FIXNUM_P(arg1)) {
- return rb_ary_entry(ary, FIX2INT(arg1));
- }
- else if (TYPE(arg1) == T_BIGNUM) {
- rb_raise(rb_eIndexError, "index too big");
+ if (idx < 0) {
+ idx += RARRAY_LEN(ary);
}
- else if (beg_len(arg1, &beg, &len, RARRAY(ary)->len)) {
- /* check if idx is Range */
- return rb_ary_subseq(ary, beg, len);
+ if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+ if (block_given) return rb_yield(pos);
+ if (argc == 1) {
+ rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+ idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+ }
+ return ifnone;
}
- return rb_ary_entry(ary, NUM2INT(arg1));
+ return RARRAY_AREF(ary, idx);
}
+/*
+ * call-seq:
+ * ary.find_index(obj) -> int or nil
+ * ary.find_index { |item| block } -> int or nil
+ * ary.find_index -> Enumerator
+ * ary.index(obj) -> int or nil
+ * ary.index { |item| block } -> int or nil
+ * ary.index -> Enumerator
+ *
+ * Returns the _index_ of the first object in +ary+ such that the object is
+ * <code>==</code> to +obj+.
+ *
+ * If a block is given instead of an argument, returns the _index_ of the
+ * first object for which the block returns +true+. Returns +nil+ if no
+ * match is found.
+ *
+ * See also Array#rindex.
+ *
+ * An Enumerator is returned if neither a block nor argument is given.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.index("b") #=> 1
+ * a.index("z") #=> nil
+ * a.index { |x| x == "b" } #=> 1
+ */
+
static VALUE
-rb_ary_index(ary, val)
- VALUE ary;
- VALUE val;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
{
- int i;
+ const VALUE *ptr;
+ VALUE val;
+ long i, len;
- for (i=0; i<RARRAY(ary)->len; i++) {
- if (rb_equal(RARRAY(ary)->ptr[i], val))
- return INT2FIX(i);
+ if (argc == 0) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ return LONG2NUM(i);
+ }
+ }
+ return Qnil;
+ }
+ rb_check_arity(argc, 0, 1);
+ val = argv[0];
+ if (rb_block_given_p())
+ rb_warn("given block not used");
+ len = RARRAY_LEN(ary);
+ ptr = RARRAY_CONST_PTR(ary);
+ for (i=0; i<len; i++) {
+ VALUE e = ptr[i];
+ switch (rb_equal_opt(e, val)) {
+ case Qundef:
+ if (!rb_equal(e, val)) break;
+ case Qtrue:
+ return LONG2NUM(i);
+ case Qfalse:
+ continue;
+ }
+ len = RARRAY_LEN(ary);
+ ptr = RARRAY_CONST_PTR(ary);
}
return Qnil;
}
+/*
+ * call-seq:
+ * ary.rindex(obj) -> int or nil
+ * ary.rindex { |item| block } -> int or nil
+ * ary.rindex -> Enumerator
+ *
+ * Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *
+ * If a block is given instead of an argument, returns the _index_ of the
+ * first object for which the block returns +true+, starting from the last
+ * object.
+ *
+ * Returns +nil+ if no match is found.
+ *
+ * See also Array#index.
+ *
+ * If neither block nor argument is given, an Enumerator is returned instead.
+ *
+ * a = [ "a", "b", "b", "b", "c" ]
+ * a.rindex("b") #=> 3
+ * a.rindex("z") #=> nil
+ * a.rindex { |x| x == "b" } #=> 3
+ */
+
static VALUE
-rb_ary_rindex(ary, val)
- VALUE ary;
- VALUE val;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
{
- int i = RARRAY(ary)->len;
+ const VALUE *ptr;
+ VALUE val;
+ long i = RARRAY_LEN(ary), len;
+ if (argc == 0) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (i--) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+ return LONG2NUM(i);
+ if (i > (len = RARRAY_LEN(ary))) {
+ i = len;
+ }
+ }
+ return Qnil;
+ }
+ rb_check_arity(argc, 0, 1);
+ val = argv[0];
+ if (rb_block_given_p())
+ rb_warn("given block not used");
+ ptr = RARRAY_CONST_PTR(ary);
while (i--) {
- if (rb_equal(RARRAY(ary)->ptr[i], val))
- return INT2FIX(i);
+ VALUE e = ptr[i];
+ switch (rb_equal_opt(e, val)) {
+ case Qundef:
+ if (!rb_equal(e, val)) break;
+ case Qtrue:
+ return LONG2NUM(i);
+ case Qfalse:
+ continue;
+ }
+ if (i > (len = RARRAY_LEN(ary))) {
+ i = len;
+ }
+ ptr = RARRAY_CONST_PTR(ary);
}
return Qnil;
}
-static VALUE
-rb_ary_indexes(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+VALUE
+rb_ary_to_ary(VALUE obj)
{
- VALUE new_ary;
- int i;
-
- new_ary = rb_ary_new2(argc);
- for (i=0; i<argc; i++) {
- rb_ary_store(new_ary, i, rb_ary_entry(ary, NUM2INT(argv[i])));
- }
+ VALUE tmp = rb_check_array_type(obj);
- return new_ary;
+ if (!NIL_P(tmp)) return tmp;
+ return rb_ary_new3(1, obj);
}
static void
-rb_ary_replace(ary, beg, len, rpl)
- VALUE ary, rpl;
- int beg, len;
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
{
- if (len < 0) {
- rb_raise(rb_eIndexError, "negative length %d", len);
- }
+ long rlen;
+ long olen;
- if (TYPE(rpl) != T_ARRAY) {
- rpl = rb_Array(rpl);
+ if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+ olen = RARRAY_LEN(ary);
+ if (beg < 0) {
+ beg += olen;
+ if (beg < 0) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ beg - olen, -olen);
+ }
+ }
+ if (olen < len || olen < beg + len) {
+ len = olen - beg;
}
- if (beg + len < 0 || (beg < 0 && beg <= -len)) {
- rb_raise(rb_eIndexError, "index %d out of range", beg);
+ if (rpl == Qundef) {
+ rlen = 0;
}
- if (beg < 0) {
- len += beg;
- beg = 0;
+ else {
+ rpl = rb_ary_to_ary(rpl);
+ rlen = RARRAY_LEN(rpl);
+ olen = RARRAY_LEN(ary); /* ary may be resized in rpl.to_ary too */
}
-
- rb_ary_modify(ary);
- if (beg >= RARRAY(ary)->len) {
- len = beg + RARRAY(rpl)->len;
- if (len >= RARRAY(ary)->capa) {
- RARRAY(ary)->capa=len;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ if (beg >= olen) {
+ VALUE target_ary;
+ if (beg > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", beg);
+ }
+ target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+ len = beg + rlen;
+ ary_mem_clear(ary, olen, beg - olen);
+ if (rlen > 0) {
+ ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
}
- rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len, beg-RARRAY(ary)->len);
- MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, RARRAY(rpl)->len);
- RARRAY(ary)->len = len;
+ ARY_SET_LEN(ary, len);
}
else {
- int alen;
+ long alen;
- if (beg + len > RARRAY(ary)->len) {
- len = RARRAY(ary)->len - beg;
+ rb_ary_modify(ary);
+ alen = olen + rlen - len;
+ if (alen >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, alen);
}
- alen = RARRAY(ary)->len + RARRAY(rpl)->len - len;
- if (alen >= RARRAY(ary)->capa) {
- RARRAY(ary)->capa=alen;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ if (len != rlen) {
+ RARRAY_PTR_USE(ary, ptr,
+ MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+ VALUE, olen - (beg + len)));
+ ARY_SET_LEN(ary, alen);
}
-
- if (len != RARRAY(rpl)->len) {
- MEMMOVE(RARRAY(ary)->ptr+beg+RARRAY(rpl)->len, RARRAY(ary)->ptr+beg+len,
- VALUE, RARRAY(ary)->len-(beg+len));
- RARRAY(ary)->len = alen;
+ if (rlen > 0) {
+ MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
}
- MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, RARRAY(rpl)->len);
}
}
-static VALUE
-rb_ary_aset(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+void
+rb_ary_set_len(VALUE ary, long len)
{
- VALUE arg1, arg2, arg3;
- int offset, beg, len;
+ long capa;
- if (rb_scan_args(argc, argv, "21", &arg1, &arg2, &arg3) == 3) {
- beg = NUM2INT(arg1);
- len = NUM2INT(arg2);
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_P(ary)) {
+ rb_raise(rb_eRuntimeError, "can't set length of shared ");
+ }
+ if (len > (capa = (long)ARY_CAPA(ary))) {
+ rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+ }
+ ARY_SET_LEN(ary, len);
+}
- if (beg < 0) {
- beg = RARRAY(ary)->len + beg;
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary an array
+ * \param len new size
+ * \return \a ary
+ * \post the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+ long olen;
+
+ rb_ary_modify(ary);
+ olen = RARRAY_LEN(ary);
+ if (len == olen) return ary;
+ if (len > ARY_MAX_SIZE) {
+ rb_raise(rb_eIndexError, "index %ld too big", len);
+ }
+ if (len > olen) {
+ if (len >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, len);
}
- rb_ary_replace(ary, beg, len, arg3);
- return arg3;
+ ary_mem_clear(ary, olen, len - olen);
+ ARY_SET_LEN(ary, len);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE tmp[RARRAY_EMBED_LEN_MAX];
+ MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+ ary_discard(ary);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else {
+ if (olen > len + ARY_DEFAULT_SIZE) {
+ SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
+ ARY_SET_CAPA(ary, len);
+ }
+ ARY_SET_HEAP_LEN(ary, len);
+ }
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary[index] = obj -> obj
+ * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
+ * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
+ *
+ * Element Assignment --- Sets the element at +index+, or replaces a subarray
+ * from the +start+ index for +length+ elements, or replaces a subarray
+ * specified by the +range+ of indices.
+ *
+ * If indices are greater than the current capacity of the array, the array
+ * grows automatically. Elements are inserted into the array at +start+ if
+ * +length+ is zero.
+ *
+ * Negative indices will count backward from the end of the array. For
+ * +start+ and +range+ cases the starting index is just before an element.
+ *
+ * An IndexError is raised if a negative index points past the beginning of
+ * the array.
+ *
+ * See also Array#push, and Array#unshift.
+ *
+ * a = Array.new
+ * a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
+ * a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
+ * a[1..2] = [ 1, 2 ] #=> ["a", 1, 2, nil, "4"]
+ * a[0, 2] = "?" #=> ["?", 2, nil, "4"]
+ * a[0..2] = "A" #=> ["A", "4"]
+ * a[-1] = "Z" #=> ["A", "Z"]
+ * a[1..-1] = nil #=> ["A", nil]
+ * a[1..-1] = [] #=> ["A"]
+ * a[0, 0] = [ 1, 2 ] #=> [1, 2, "A"]
+ * a[3, 0] = "B" #=> [1, 2, "A", "B"]
+ */
+
+static VALUE
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+{
+ long offset, beg, len;
+
+ if (argc == 3) {
+ rb_ary_modify_check(ary);
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ rb_ary_splice(ary, beg, len, argv[2]);
+ return argv[2];
}
- else if (FIXNUM_P(arg1)) {
- offset = FIX2INT(arg1);
+ rb_check_arity(argc, 2, 2);
+ rb_ary_modify_check(ary);
+ if (FIXNUM_P(argv[0])) {
+ offset = FIX2LONG(argv[0]);
goto fixnum;
}
- else if (beg_len(arg1, &beg, &len, RARRAY(ary)->len)) {
+ if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
/* check if idx is Range */
- rb_ary_replace(ary, beg, len, arg2);
- return arg2;
+ rb_ary_splice(ary, beg, len, argv[1]);
+ return argv[1];
+ }
+
+ offset = NUM2LONG(argv[0]);
+fixnum:
+ rb_ary_store(ary, offset, argv[1]);
+ return argv[1];
+}
+
+/*
+ * call-seq:
+ * ary.insert(index, obj...) -> ary
+ *
+ * Inserts the given values before the element with the given +index+.
+ *
+ * Negative indices count backwards from the end of the array, where +-1+ is
+ * the last element. If a negative index is used, the given values will be
+ * inserted after that element, so using an index of +-1+ will insert the
+ * values at the end of the array.
+ *
+ * a = %w{ a b c d }
+ * a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
+ * a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ */
+
+static VALUE
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
+{
+ long pos;
+
+ rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+ rb_ary_modify_check(ary);
+ if (argc == 1) return ary;
+ pos = NUM2LONG(argv[0]);
+ if (pos == -1) {
+ pos = RARRAY_LEN(ary);
}
- if (TYPE(arg1) == T_BIGNUM) {
- rb_raise(rb_eIndexError, "index too big");
+ if (pos < 0) {
+ pos++;
}
+ rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+ return ary;
+}
- offset = NUM2INT(arg1);
- fixnum:
- rb_ary_store(ary, offset, arg2);
- return arg2;
+static VALUE
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
+{
+ return rb_ary_length(ary);
}
+/*
+ * call-seq:
+ * ary.each { |item| block } -> ary
+ * ary.each -> Enumerator
+ *
+ * Calls the given block once for each element in +self+, passing that element
+ * as a parameter.
+ *
+ * An Enumerator is returned if no block is given.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.each {|x| print x, " -- " }
+ *
+ * produces:
+ *
+ * a -- b -- c --
+ */
+
VALUE
-rb_ary_each(ary)
- VALUE ary;
+rb_ary_each(VALUE array)
{
- int i;
+ long i;
+ volatile VALUE ary = array;
- for (i=0; i<RARRAY(ary)->len; i++) {
- rb_yield(RARRAY(ary)->ptr[i]);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(RARRAY_AREF(ary, i));
}
- return Qnil;
+ return ary;
}
+/*
+ * call-seq:
+ * ary.each_index { |index| block } -> ary
+ * ary.each_index -> Enumerator
+ *
+ * Same as Array#each, but passes the +index+ of the element instead of the
+ * element itself.
+ *
+ * An Enumerator is returned if no block is given.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.each_index {|x| print x, " -- " }
+ *
+ * produces:
+ *
+ * 0 -- 1 -- 2 --
+ */
+
static VALUE
-rb_ary_each_index(ary)
- VALUE ary;
+rb_ary_each_index(VALUE ary)
{
- int i;
+ long i;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- for (i=0; i<RARRAY(ary)->len; i++) {
- rb_yield(INT2FIX(i));
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(LONG2NUM(i));
}
- return Qnil;
+ return ary;
}
+/*
+ * call-seq:
+ * ary.reverse_each { |item| block } -> ary
+ * ary.reverse_each -> Enumerator
+ *
+ * Same as Array#each, but traverses +self+ in reverse order.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.reverse_each {|x| print x, " " }
+ *
+ * produces:
+ *
+ * c b a
+ */
+
static VALUE
-rb_ary_reverse_each(ary)
- VALUE ary;
+rb_ary_reverse_each(VALUE ary)
{
- int len = RARRAY(ary)->len;
+ long len;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ len = RARRAY_LEN(ary);
while (len--) {
- rb_yield(RARRAY(ary)->ptr[len]);
+ long nlen;
+ rb_yield(RARRAY_AREF(ary, len));
+ nlen = RARRAY_LEN(ary);
+ if (nlen < len) {
+ len = nlen;
+ }
}
- return Qnil;
+ return ary;
}
+/*
+ * call-seq:
+ * ary.length -> int
+ *
+ * Returns the number of elements in +self+. May be zero.
+ *
+ * [ 1, 2, 3, 4, 5 ].length #=> 5
+ * [].length #=> 0
+ */
+
static VALUE
-rb_ary_length(ary)
- VALUE ary;
+rb_ary_length(VALUE ary)
{
- return INT2FIX(RARRAY(ary)->len);
+ long len = RARRAY_LEN(ary);
+ return LONG2NUM(len);
}
+/*
+ * call-seq:
+ * ary.empty? -> true or false
+ *
+ * Returns +true+ if +self+ contains no elements.
+ *
+ * [].empty? #=> true
+ */
+
static VALUE
-rb_ary_empty_p(ary)
- VALUE ary;
+rb_ary_empty_p(VALUE ary)
{
- if (RARRAY(ary)->len == 0)
+ if (RARRAY_LEN(ary) == 0)
return Qtrue;
return Qfalse;
}
-static VALUE
-rb_ary_clone(ary)
- VALUE ary;
+VALUE
+rb_ary_dup(VALUE ary)
{
- VALUE ary2 = rb_ary_new2(RARRAY(ary)->len);
-
- CLONESETUP(ary2, ary);
- MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- RARRAY(ary2)->len = RARRAY(ary)->len;
- return ary2;
+ long len = RARRAY_LEN(ary);
+ VALUE dup = rb_ary_new2(len);
+ ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+ ARY_SET_LEN(dup, len);
+ return dup;
}
-static VALUE
-rb_ary_dup(ary)
- VALUE ary;
+VALUE
+rb_ary_resurrect(VALUE ary)
{
- return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
+ return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
}
+extern VALUE rb_output_fs;
+
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
static VALUE
-to_ary(ary)
- VALUE ary;
+recursive_join(VALUE obj, VALUE argp, int recur)
{
- return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ VALUE *arg = (VALUE *)argp;
+ VALUE ary = arg[0];
+ VALUE sep = arg[1];
+ VALUE result = arg[2];
+ int *first = (int *)arg[3];
+
+ if (recur) {
+ rb_raise(rb_eArgError, "recursive array join");
+ }
+ else {
+ ary_join_1(obj, ary, sep, 0, result, first);
+ }
+ return Qnil;
}
-extern VALUE rb_output_fs;
-
-static VALUE
-inspect_join(ary, arg)
- VALUE ary;
- VALUE *arg;
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
{
- return rb_ary_join(arg[0], arg[1]);
+ long i;
+ VALUE val;
+
+ if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
+ for (i=0; i<max; i++) {
+ val = RARRAY_AREF(ary, i);
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, val);
+ if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+ }
}
-VALUE
-rb_ary_join(ary, sep)
- VALUE ary, sep;
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
{
- int i;
- VALUE result, tmp;
- if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+ VALUE val, tmp;
- tmp = RARRAY(ary)->ptr[0];
- switch (TYPE(tmp)) {
- case T_STRING:
- result = rb_str_dup(tmp);
- break;
- case T_ARRAY:
- if (rb_inspecting_p(tmp)) {
- result = rb_str_new2("[...]");
- }
- else {
- VALUE args[2];
+ for (; i<RARRAY_LEN(ary); i++) {
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
- args[0] = tmp;
- args[1] = sep;
- result = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+ val = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(val, T_STRING)) {
+ str_join:
+ rb_str_buf_append(result, val);
+ *first = FALSE;
}
- break;
- default:
- result = rb_obj_as_string(tmp);
- break;
- }
-
- for (i=1; i<RARRAY(ary)->len; i++) {
- tmp = RARRAY(ary)->ptr[i];
- switch (TYPE(tmp)) {
- case T_STRING:
- break;
- case T_ARRAY:
- if (rb_inspecting_p(tmp)) {
- tmp = rb_str_new2("[...]");
+ else if (RB_TYPE_P(val, T_ARRAY)) {
+ obj = val;
+ ary_join:
+ if (val == ary) {
+ rb_raise(rb_eArgError, "recursive array join");
}
else {
- VALUE args[2];
+ VALUE args[4];
- args[0] = tmp;
+ args[0] = val;
args[1] = sep;
- tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+ args[2] = result;
+ args[3] = (VALUE)first;
+ rb_exec_recursive(recursive_join, obj, (VALUE)args);
}
- break;
- default:
- tmp = rb_obj_as_string(tmp);
}
- if (!NIL_P(sep)) rb_str_concat(result, sep);
- rb_str_cat(result, RSTRING(tmp)->ptr, RSTRING(tmp)->len);
- if (OBJ_TAINTED(tmp)) OBJ_TAINT(result);
+ else {
+ tmp = rb_check_string_type(val);
+ if (!NIL_P(tmp)) {
+ val = tmp;
+ goto str_join;
+ }
+ tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+ if (!NIL_P(tmp)) {
+ obj = val;
+ val = tmp;
+ goto ary_join;
+ }
+ val = rb_obj_as_string(val);
+ if (*first) {
+ rb_enc_copy(result, val);
+ *first = FALSE;
+ }
+ goto str_join;
+ }
+ }
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+ long len = 1, i;
+ int taint = FALSE;
+ VALUE val, tmp, result;
+
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+ if (OBJ_TAINTED(ary)) taint = TRUE;
+
+ if (!NIL_P(sep)) {
+ StringValue(sep);
+ len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+ }
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ val = RARRAY_AREF(ary, i);
+ tmp = rb_check_string_type(val);
+
+ if (NIL_P(tmp) || tmp != val) {
+ int first;
+ result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+ rb_enc_associate(result, rb_usascii_encoding());
+ if (taint) OBJ_TAINT(result);
+ ary_join_0(ary, sep, i, result);
+ first = i == 0;
+ ary_join_1(ary, ary, sep, i, result, &first);
+ return result;
+ }
+
+ len += RSTRING_LEN(tmp);
}
+ result = rb_str_buf_new(len);
+ if (taint) OBJ_TAINT(result);
+ ary_join_0(ary, sep, RARRAY_LEN(ary), result);
+
return result;
}
+/*
+ * call-seq:
+ * ary.join(separator=$,) -> str
+ *
+ * Returns a string created by converting each element of the array to
+ * a string, separated by the given +separator+.
+ * If the +separator+ is +nil+, it uses current $,.
+ * If both the +separator+ and $, are nil, it uses empty string.
+ *
+ * [ "a", "b", "c" ].join #=> "abc"
+ * [ "a", "b", "c" ].join("-") #=> "a-b-c"
+ */
+
static VALUE
-rb_ary_join_method(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
{
VALUE sep;
rb_scan_args(argc, argv, "01", &sep);
if (NIL_P(sep)) sep = rb_output_fs;
+
return rb_ary_join(ary, sep);
}
-VALUE
-rb_ary_to_s(ary)
- VALUE ary;
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
{
- VALUE str;
+ int tainted = OBJ_TAINTED(ary);
+ long i;
+ VALUE s, str;
- if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
- str = rb_ary_join(ary, rb_output_fs);
- if (NIL_P(str)) return rb_str_new(0, 0);
+ if (recur) return rb_usascii_str_new_cstr("[...]");
+ str = rb_str_buf_new2("[");
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ s = rb_inspect(RARRAY_AREF(ary, i));
+ if (OBJ_TAINTED(s)) tainted = TRUE;
+ if (i > 0) rb_str_buf_cat2(str, ", ");
+ else rb_enc_copy(str, s);
+ rb_str_buf_append(str, s);
+ }
+ rb_str_buf_cat2(str, "]");
+ if (tainted) OBJ_TAINT(str);
return str;
}
-#ifdef USE_THREAD
-static ID inspect_key;
-#else
-static VALUE inspect_tbl;
-#endif
+/*
+ * call-seq:
+ * ary.inspect -> string
+ * ary.to_s -> string
+ *
+ * Creates a string representation of +self+.
+ *
+ * [ "a", "b", "c" ].to_s #=> "[\"a\", \"b\", \"c\"]"
+ */
-struct inspect_arg {
- VALUE (*func)();
- VALUE arg1, arg2;
-};
+static VALUE
+rb_ary_inspect(VALUE ary)
+{
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+ return rb_exec_recursive(inspect_ary, ary, 0);
+}
VALUE
-inspect_call(arg)
- struct inspect_arg *arg;
+rb_ary_to_s(VALUE ary)
{
- return (*arg->func)(arg->arg1, arg->arg2);
+ return rb_ary_inspect(ary);
}
+/*
+ * call-seq:
+ * ary.to_a -> ary
+ *
+ * Returns +self+.
+ *
+ * If called on a subclass of Array, converts the receiver to an Array object.
+ */
+
static VALUE
-inspect_ensure(obj)
- VALUE obj;
+rb_ary_to_a(VALUE ary)
{
-#ifdef USE_THREAD
- VALUE inspect_tbl;
-
- inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-#endif
- rb_ary_pop(inspect_tbl);
- return 0;
+ if (rb_obj_class(ary) != rb_cArray) {
+ VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+ rb_ary_replace(dup, ary);
+ return dup;
+ }
+ return ary;
}
-VALUE
-rb_protect_inspect(func, obj, arg)
- VALUE (*func)();
- VALUE obj, arg;
+/*
+ * call-seq:
+ * ary.to_h -> hash
+ *
+ * Returns the result of interpreting <i>ary</i> as an array of
+ * <tt>[key, value]</tt> pairs.
+ *
+ * [[:foo, :bar], [1, 2]].to_h
+ * # => {:foo => :bar, 1 => 2}
+ */
+
+static VALUE
+rb_ary_to_h(VALUE ary)
{
- struct inspect_arg iarg;
+ long i;
+ VALUE hash = rb_hash_new();
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE key_value_pair = rb_check_array_type(rb_ary_elt(ary, i));
+ if (NIL_P(key_value_pair)) {
+ rb_raise(rb_eTypeError, "wrong element type %s at %ld (expected array)",
+ rb_builtin_class_name(rb_ary_elt(ary, i)), i);
+ }
+ if (RARRAY_LEN(key_value_pair) != 2) {
+ rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+ i, RARRAY_LEN(key_value_pair));
+ }
+ rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+ }
+ return hash;
+}
-#ifdef USE_THREAD
- VALUE inspect_tbl;
+/*
+ * call-seq:
+ * ary.to_ary -> ary
+ *
+ * Returns +self+.
+ */
- if (!inspect_key) {
- inspect_key = rb_intern("__inspect_key__");
- }
- inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
- if (NIL_P(inspect_tbl)) {
- inspect_tbl = rb_ary_new();
- rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
- }
-#else
- if (!inspect_tbl) {
- inspect_tbl = rb_ary_new();
- rb_global_variable(&inspect_tbl);
+static VALUE
+rb_ary_to_ary_m(VALUE ary)
+{
+ return ary;
+}
+
+static void
+ary_reverse(VALUE *p1, VALUE *p2)
+{
+ while (p1 < p2) {
+ VALUE tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
}
-#endif
- rb_ary_push(inspect_tbl, obj);
- iarg.func = func;
- iarg.arg1 = obj;
- iarg.arg2 = arg;
- return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
}
VALUE
-rb_inspecting_p(obj)
- VALUE obj;
+rb_ary_reverse(VALUE ary)
{
-#ifdef USE_THREAD
- VALUE inspect_tbl;
+ VALUE *p2;
+ long len = RARRAY_LEN(ary);
- if (!inspect_key) return Qfalse;
- inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
- if (NIL_P(inspect_tbl)) return Qfalse;
-#else
- if (!inspect_tbl) return Qnil;
-#endif
- return rb_ary_includes(inspect_tbl, obj);
+ rb_ary_modify(ary);
+ if (len > 1) {
+ RARRAY_PTR_USE(ary, p1, {
+ p2 = p1 + len - 1; /* points last item */
+ ary_reverse(p1, p2);
+ }); /* WB: no new reference */
+ }
+ return ary;
}
+/*
+ * call-seq:
+ * ary.reverse! -> ary
+ *
+ * Reverses +self+ in place.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.reverse! #=> ["c", "b", "a"]
+ * a #=> ["c", "b", "a"]
+ */
+
static VALUE
-inspect_ary(ary)
- VALUE ary;
+rb_ary_reverse_bang(VALUE ary)
{
- int i = 0;
- VALUE s, str;
+ return rb_ary_reverse(ary);
+}
- str = rb_str_new2("[");
+/*
+ * call-seq:
+ * ary.reverse -> new_ary
+ *
+ * Returns a new array containing +self+'s elements in reverse order.
+ *
+ * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
+ * [ 1 ].reverse #=> [1]
+ */
- for (i=0; i<RARRAY(ary)->len; i++) {
- s = rb_inspect(RARRAY(ary)->ptr[i]);
- if (i > 0) rb_str_cat(str, ", ", 2);
- rb_str_cat(str, RSTRING(s)->ptr, RSTRING(s)->len);
+static VALUE
+rb_ary_reverse_m(VALUE ary)
+{
+ long len = RARRAY_LEN(ary);
+ VALUE dup = rb_ary_new2(len);
+
+ if (len > 0) {
+ const VALUE *p1 = RARRAY_CONST_PTR(ary);
+ VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+ do *p2-- = *p1++; while (--len > 0);
}
- rb_str_cat(str, "]", 1);
+ ARY_SET_LEN(dup, RARRAY_LEN(ary));
+ return dup;
+}
- return str;
+static inline long
+rotate_count(long cnt, long len)
+{
+ return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
}
-static VALUE
-rb_ary_inspect(ary)
- VALUE ary;
+VALUE
+rb_ary_rotate(VALUE ary, long cnt)
{
- if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
- if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
- return rb_protect_inspect(inspect_ary, ary, 0);
+ rb_ary_modify(ary);
+
+ if (cnt != 0) {
+ VALUE *ptr = RARRAY_PTR(ary);
+ long len = RARRAY_LEN(ary);
+
+ if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+ --len;
+ if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+ if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+ if (len > 0) ary_reverse(ptr, ptr + len);
+ return ary;
+ }
+ }
+
+ return Qnil;
}
+/*
+ * call-seq:
+ * ary.rotate!(count=1) -> ary
+ *
+ * Rotates +self+ in place so that the element at +count+ comes first, and
+ * returns +self+.
+ *
+ * If +count+ is negative then it rotates in the opposite direction, starting
+ * from the end of the array where +-1+ is the last element.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.rotate! #=> ["b", "c", "d", "a"]
+ * a #=> ["b", "c", "d", "a"]
+ * a.rotate!(2) #=> ["d", "a", "b", "c"]
+ * a.rotate!(-3) #=> ["a", "b", "c", "d"]
+ */
+
static VALUE
-rb_ary_to_a(ary)
- VALUE ary;
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
{
+ long n = 1;
+
+ switch (argc) {
+ case 1: n = NUM2LONG(argv[0]);
+ case 0: break;
+ default: rb_scan_args(argc, argv, "01", NULL);
+ }
+ rb_ary_rotate(ary, n);
return ary;
}
-VALUE
-rb_ary_reverse(ary)
- VALUE ary;
+/*
+ * call-seq:
+ * ary.rotate(count=1) -> new_ary
+ *
+ * Returns a new array by rotating +self+ so that the element at +count+ is
+ * the first element of the new array.
+ *
+ * If +count+ is negative then it rotates in the opposite direction, starting
+ * from the end of +self+ where +-1+ is the last element.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.rotate #=> ["b", "c", "d", "a"]
+ * a #=> ["a", "b", "c", "d"]
+ * a.rotate(2) #=> ["c", "d", "a", "b"]
+ * a.rotate(-3) #=> ["b", "c", "d", "a"]
+ */
+
+static VALUE
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
{
- VALUE *p1, *p2;
- VALUE tmp;
+ VALUE rotated;
+ const VALUE *ptr;
+ long len, cnt = 1;
+
+ switch (argc) {
+ case 1: cnt = NUM2LONG(argv[0]);
+ case 0: break;
+ default: rb_scan_args(argc, argv, "01", NULL);
+ }
- if (RARRAY(ary)->len == 0) return ary;
+ len = RARRAY_LEN(ary);
+ rotated = rb_ary_new2(len);
+ if (len > 0) {
+ cnt = rotate_count(cnt, len);
+ ptr = RARRAY_CONST_PTR(ary);
+ len -= cnt;
+ ary_memcpy(rotated, 0, len, ptr + cnt);
+ ary_memcpy(rotated, len, cnt, ptr);
+ }
+ ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+ return rotated;
+}
- p1 = RARRAY(ary)->ptr;
- p2 = p1 + RARRAY(ary)->len - 1; /* points last item */
+struct ary_sort_data {
+ VALUE ary;
+ int opt_methods;
+ int opt_inited;
+};
- while (p1 < p2) {
- tmp = *p1;
- *p1 = *p2;
- *p2 = tmp;
- p1++; p2--;
- }
+enum {
+ sort_opt_Fixnum,
+ sort_opt_String,
+ sort_optimizable_count
+};
- return ary;
-}
+#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+ (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+ ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+ (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+ rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+ ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
static VALUE
-rb_ary_reverse_method(ary)
- VALUE ary;
+sort_reentered(VALUE ary)
{
- return rb_ary_reverse(rb_ary_dup(ary));
+ if (RBASIC(ary)->klass) {
+ rb_raise(rb_eRuntimeError, "sort reentered");
+ }
+ return Qnil;
}
-static ID cmp;
-
static int
-sort_1(a, b)
- VALUE *a, *b;
+sort_1(const void *ap, const void *bp, void *dummy)
{
- VALUE retval = rb_yield(rb_assoc_new(*a, *b));
- return NUM2INT(retval);
+ struct ary_sort_data *data = dummy;
+ VALUE retval = sort_reentered(data->ary);
+ VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ int n;
+
+ retval = rb_yield_values(2, a, b);
+ n = rb_cmpint(retval, a, b);
+ sort_reentered(data->ary);
+ return n;
}
static int
-sort_2(a, b)
- VALUE *a, *b;
+sort_2(const void *ap, const void *bp, void *dummy)
{
- VALUE retval;
+ struct ary_sort_data *data = dummy;
+ VALUE retval = sort_reentered(data->ary);
+ VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ int n;
- if (FIXNUM_P(*a)) {
- if (FIXNUM_P(*b)) return *a - *b;
+ if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
+ if ((long)a > (long)b) return 1;
+ if ((long)a < (long)b) return -1;
+ return 0;
}
- else if (TYPE(*a) == T_STRING && TYPE(*b) == T_STRING) {
- return rb_str_cmp(*a, *b);
+ if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+ return rb_str_cmp(a, b);
}
- retval = rb_funcall(*a, cmp, 1, *b);
- return NUM2INT(retval);
+ retval = rb_funcallv(a, id_cmp, 1, &b);
+ n = rb_cmpint(retval, a, b);
+ sort_reentered(data->ary);
+
+ return n;
}
+/*
+ * call-seq:
+ * ary.sort! -> ary
+ * ary.sort! { |a, b| block } -> ary
+ *
+ * Sorts +self+ in place.
+ *
+ * Comparisons for the sort will be done using the <code><=></code> operator
+ * or using an optional code block.
+ *
+ * The block must implement a comparison between +a+ and +b+, and return
+ * +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
+ * if +b+ follows +a+.
+ *
+ * See also Enumerable#sort_by.
+ *
+ * a = [ "d", "a", "e", "c", "b" ]
+ * a.sort! #=> ["a", "b", "c", "d", "e"]
+ * a.sort! { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ */
+
+VALUE
+rb_ary_sort_bang(VALUE ary)
+{
+ rb_ary_modify(ary);
+ assert(!ARY_SHARED_P(ary));
+ if (RARRAY_LEN(ary) > 1) {
+ VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+ struct ary_sort_data data;
+ long len = RARRAY_LEN(ary);
+
+ RBASIC_CLEAR_CLASS(tmp);
+ data.ary = tmp;
+ data.opt_methods = 0;
+ data.opt_inited = 0;
+ RARRAY_PTR_USE(tmp, ptr, {
+ ruby_qsort(ptr, len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
+ }); /* WB: no new reference */
+ rb_ary_modify(ary);
+ if (ARY_EMBED_P(tmp)) {
+ if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+ rb_ary_unshare(ary);
+ }
+ FL_SET_EMBED(ary);
+ ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+ ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+ }
+ else {
+ if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+ FL_UNSET_SHARED(ary);
+ ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+ }
+ else {
+ assert(!ARY_SHARED_P(tmp));
+ if (ARY_EMBED_P(ary)) {
+ FL_UNSET_EMBED(ary);
+ }
+ else if (ARY_SHARED_P(ary)) {
+ /* ary might be destructively operated in the given block */
+ rb_ary_unshare(ary);
+ }
+ else {
+ ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+ ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+ ARY_SET_HEAP_LEN(ary, len);
+ ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+ }
+ /* tmp was lost ownership for the ptr */
+ FL_UNSET(tmp, FL_FREEZE);
+ FL_SET_EMBED(tmp);
+ ARY_SET_EMBED_LEN(tmp, 0);
+ FL_SET(tmp, FL_FREEZE);
+ }
+ /* tmp will be GC'ed. */
+ RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
+ }
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.sort -> new_ary
+ * ary.sort { |a, b| block } -> new_ary
+ *
+ * Returns a new array created by sorting +self+.
+ *
+ * Comparisons for the sort will be done using the <code><=></code> operator
+ * or using an optional code block.
+ *
+ * The block must implement a comparison between +a+ and +b+, and return
+ * +-1+, when +a+ follows +b+, +0+ when +a+ and +b+ are equivalent, or ++1+
+ * if +b+ follows +a+.
+ *
+ *
+ * See also Enumerable#sort_by.
+ *
+ * a = [ "d", "a", "e", "c", "b" ]
+ * a.sort #=> ["a", "b", "c", "d", "e"]
+ * a.sort { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ */
+
+VALUE
+rb_ary_sort(VALUE ary)
+{
+ ary = rb_ary_dup(ary);
+ rb_ary_sort_bang(ary);
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.bsearch {|x| block } -> elem
+ *
+ * By using binary search, finds a value from this array which meets
+ * the given condition in O(log n) where n is the size of the array.
+ *
+ * You can use this method in two use cases: a find-minimum mode and
+ * a find-any mode. In either case, the elements of the array must be
+ * monotone (or sorted) with respect to the block.
+ *
+ * In find-minimum mode (this is a good choice for typical use case),
+ * the block must return true or false, and there must be an index i
+ * (0 <= i <= ary.size) so that:
+ *
+ * - the block returns false for any element whose index is less than
+ * i, and
+ * - the block returns true for any element whose index is greater
+ * than or equal to i.
+ *
+ * This method returns the i-th element. If i is equal to ary.size,
+ * it returns nil.
+ *
+ * ary = [0, 4, 7, 10, 12]
+ * ary.bsearch {|x| x >= 4 } #=> 4
+ * ary.bsearch {|x| x >= 6 } #=> 7
+ * ary.bsearch {|x| x >= -1 } #=> 0
+ * ary.bsearch {|x| x >= 100 } #=> nil
+ *
+ * In find-any mode (this behaves like libc's bsearch(3)), the block
+ * must return a number, and there must be two indices i and j
+ * (0 <= i <= j <= ary.size) so that:
+ *
+ * - the block returns a positive number for ary[k] if 0 <= k < i,
+ * - the block returns zero for ary[k] if i <= k < j, and
+ * - the block returns a negative number for ary[k] if
+ * j <= k < ary.size.
+ *
+ * Under this condition, this method returns any element whose index
+ * is within i...j. If i is equal to j (i.e., there is no element
+ * that satisfies the block), this method returns nil.
+ *
+ * ary = [0, 4, 7, 10, 12]
+ * # try to find v such that 4 <= v < 8
+ * ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
+ * # try to find v such that 8 <= v < 10
+ * ary.bsearch {|x| 4 - x / 2 } #=> nil
+ *
+ * You must not mix the two modes at a time; the block must always
+ * return either true/false, or always return a number. It is
+ * undefined which value is actually picked up at each iteration.
+ */
+
static VALUE
-sort_internal(ary)
- VALUE ary;
+rb_ary_bsearch(VALUE ary)
{
- qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
- rb_iterator_p()?sort_1:sort_2);
+ long low = 0, high = RARRAY_LEN(ary), mid;
+ int smaller = 0, satisfied = 0;
+ VALUE v, val;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (low < high) {
+ mid = low + ((high - low) / 2);
+ val = rb_ary_entry(ary, mid);
+ v = rb_yield(val);
+ if (FIXNUM_P(v)) {
+ if (FIX2INT(v) == 0) return val;
+ smaller = FIX2INT(v) < 0;
+ }
+ else if (v == Qtrue) {
+ satisfied = 1;
+ smaller = 1;
+ }
+ else if (v == Qfalse || v == Qnil) {
+ smaller = 0;
+ }
+ else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+ const VALUE zero = INT2FIX(0);
+ switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, INT2FIX(0))) {
+ case 0: return val;
+ case 1: smaller = 1; break;
+ case -1: smaller = 0;
+ }
+ }
+ else {
+ rb_raise(rb_eTypeError, "wrong argument type %s"
+ " (must be numeric, true, false or nil)",
+ rb_obj_classname(v));
+ }
+ if (smaller) {
+ high = mid;
+ }
+ else {
+ low = mid + 1;
+ }
+ }
+ if (low == RARRAY_LEN(ary)) return Qnil;
+ if (!satisfied) return Qnil;
+ return rb_ary_entry(ary, low);
+}
+
+
+static VALUE
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+{
+ return rb_yield(i);
+}
+
+/*
+ * call-seq:
+ * ary.sort_by! { |obj| block } -> ary
+ * ary.sort_by! -> Enumerator
+ *
+ * Sorts +self+ in place using a set of keys generated by mapping the
+ * values in +self+ through the given block.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+ VALUE sorted;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
+ sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+ rb_ary_replace(ary, sorted);
return ary;
}
+
+/*
+ * call-seq:
+ * ary.collect { |item| block } -> new_ary
+ * ary.map { |item| block } -> new_ary
+ * ary.collect -> Enumerator
+ * ary.map -> Enumerator
+ *
+ * Invokes the given block once for each element of +self+.
+ *
+ * Creates a new array containing the values returned by the block.
+ *
+ * See also Enumerable#collect.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.collect { |x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
+ * a.map.with_index{ |x, i| x * i } #=> ["", "b", "cc", "ddd"]
+ * a #=> ["a", "b", "c", "d"]
+ */
+
static VALUE
-sort_unlock(ary)
- VALUE ary;
+rb_ary_collect(VALUE ary)
+{
+ long i;
+ VALUE collect;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ collect = rb_ary_new2(RARRAY_LEN(ary));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+ }
+ return collect;
+}
+
+
+/*
+ * call-seq:
+ * ary.collect! {|item| block } -> ary
+ * ary.map! {|item| block } -> ary
+ * ary.collect! -> Enumerator
+ * ary.map! -> Enumerator
+ *
+ * Invokes the given block once for each element of +self+, replacing the
+ * element with the value returned by the block.
+ *
+ * See also Enumerable#collect.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.map! {|x| x + "!" }
+ * a #=> [ "a!", "b!", "c!", "d!" ]
+ * a.collect!.with_index {|x, i| x[0...i] }
+ * a #=> ["", "b", "c!", "d!"]
+ */
+
+static VALUE
+rb_ary_collect_bang(VALUE ary)
{
- FL_UNSET(ary, ARY_TMPLOCK);
+ long i;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+ }
return ary;
}
VALUE
-rb_ary_sort_bang(ary)
- VALUE ary;
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
+{
+ VALUE result = rb_ary_new2(argc);
+ long beg, len, i, j;
+
+ for (i=0; i<argc; i++) {
+ if (FIXNUM_P(argv[i])) {
+ rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+ continue;
+ }
+ /* check if idx is Range */
+ if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+ long end = olen < beg+len ? olen : beg+len;
+ for (j = beg; j < end; j++) {
+ rb_ary_push(result, (*func)(obj, j));
+ }
+ if (beg + len > j)
+ rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+ continue;
+ }
+ rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.values_at(selector, ...) -> new_ary
+ *
+ * Returns an array containing the elements in +self+ corresponding to the
+ * given +selector+(s).
+ *
+ * The selectors may be either integer indices or ranges.
+ *
+ * See also Array#select.
+ *
+ * a = %w{ a b c d e f }
+ * a.values_at(1, 3, 5) # => ["b", "d", "f"]
+ * a.values_at(1, 3, 5, 7) # => ["b", "d", "f", nil]
+ * a.values_at(-1, -2, -2, -7) # => ["f", "e", "e", nil]
+ * a.values_at(4..6, 3...6) # => ["e", "f", nil, "d", "e", "f"]
+ */
+
+static VALUE
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+{
+ return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+}
+
+
+/*
+ * call-seq:
+ * ary.select { |item| block } -> new_ary
+ * ary.select -> Enumerator
+ *
+ * Returns a new array containing all elements of +ary+
+ * for which the given +block+ returns a true value.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * [1,2,3,4,5].select { |num| num.even? } #=> [2, 4]
+ *
+ * a = %w{ a b c d e f }
+ * a.select { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
+ *
+ * See also Enumerable#select.
+ */
+
+static VALUE
+rb_ary_select(VALUE ary)
+{
+ VALUE result;
+ long i;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ result = rb_ary_new2(RARRAY_LEN(ary));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ rb_ary_push(result, rb_ary_elt(ary, i));
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.select! {|item| block } -> ary or nil
+ * ary.select! -> Enumerator
+ *
+ * Invokes the given block passing in successive elements from +self+,
+ * deleting elements for which the block returns a +false+ value.
+ *
+ * If changes were made, it will return +self+, otherwise it returns +nil+.
+ *
+ * See also Array#keep_if
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
{
- if (RARRAY(ary)->len <= 1) return ary;
+ long i1, i2;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
- FL_SET(ary, ARY_TMPLOCK); /* prohibit modification during sort */
- rb_ensure(sort_internal, ary, sort_unlock, ary);
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (!RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ i2++;
+ }
+
+ if (i1 == i2) return Qnil;
+ if (i2 < i1)
+ ARY_SET_LEN(ary, i2);
return ary;
}
-VALUE
-rb_ary_sort(ary)
- VALUE ary;
+/*
+ * call-seq:
+ * ary.keep_if { |item| block } -> ary
+ * ary.keep_if -> Enumerator
+ *
+ * Deletes every element of +self+ for which the given block evaluates to
+ * +false+.
+ *
+ * See also Array#select!
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * a = %w{ a b c d e f }
+ * a.keep_if { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_select_bang(ary);
+ return ary;
+}
+
+static void
+ary_resize_smaller(VALUE ary, long len)
{
- if (RARRAY(ary)->len == 0) return ary;
- return rb_ary_sort_bang(rb_ary_dup(ary));
+ rb_ary_modify(ary);
+ if (RARRAY_LEN(ary) > len) {
+ ARY_SET_LEN(ary, len);
+ if (len * 2 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+ ary_resize_capa(ary, len * 2);
+ }
+ }
}
+/*
+ * call-seq:
+ * ary.delete(obj) -> item or nil
+ * ary.delete(obj) { block } -> item or result of block
+ *
+ * Deletes all items from +self+ that are equal to +obj+.
+ *
+ * Returns the last deleted item, or +nil+ if no matching item is found.
+ *
+ * If the optional code block is given, the result of the block is returned if
+ * the item is not found. (To remove +nil+ elements and get an informative
+ * return value, use Array#compact!)
+ *
+ * a = [ "a", "b", "b", "b", "c" ]
+ * a.delete("b") #=> "b"
+ * a #=> ["a", "c"]
+ * a.delete("z") #=> nil
+ * a.delete("z") { "not found" } #=> "not found"
+ */
+
VALUE
-rb_ary_delete(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
{
- int i1, i2;
+ VALUE v = item;
+ long i1, i2;
- rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- if (rb_equal(RARRAY(ary)->ptr[i1], item)) continue;
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE e = RARRAY_AREF(ary, i1);
+
+ if (rb_equal(e, item)) {
+ v = e;
+ continue;
+ }
if (i1 != i2) {
- RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
+ rb_ary_store(ary, i2, e);
}
i2++;
}
- if (RARRAY(ary)->len == i2) {
- if (rb_iterator_p()) {
+ if (RARRAY_LEN(ary) == i2) {
+ if (rb_block_given_p()) {
return rb_yield(item);
}
return Qnil;
}
- else {
- RARRAY(ary)->len = i2;
- }
- return item;
+ ary_resize_smaller(ary, i2);
+
+ return v;
}
-VALUE
-rb_ary_delete_at(ary, at)
- VALUE ary;
- VALUE at;
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
{
- int i1, i2, pos;
- VALUE del = Qnil;
+ long i1, i2;
- rb_ary_modify(ary);
- pos = NUM2INT(at);
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- if (i1 == pos) {
- del = RARRAY(ary)->ptr[i1];
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE e = RARRAY_AREF(ary, i1);
+
+ if (e == item) {
continue;
}
if (i1 != i2) {
- RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
+ rb_ary_store(ary, i2, e);
}
i2++;
}
- RARRAY(ary)->len = i2;
+ if (RARRAY_LEN(ary) == i2) {
+ return;
+ }
+
+ ary_resize_smaller(ary, i2);
+}
+
+VALUE
+rb_ary_delete_at(VALUE ary, long pos)
+{
+ long len = RARRAY_LEN(ary);
+ VALUE del;
+
+ if (pos >= len) return Qnil;
+ if (pos < 0) {
+ pos += len;
+ if (pos < 0) return Qnil;
+ }
+
+ rb_ary_modify(ary);
+ del = RARRAY_AREF(ary, pos);
+ RARRAY_PTR_USE(ary, ptr, {
+ MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+ });
+ ARY_INCREASE_LEN(ary, -1);
return del;
}
+/*
+ * call-seq:
+ * ary.delete_at(index) -> obj or nil
+ *
+ * Deletes the element at the specified +index+, returning that element, or
+ * +nil+ if the +index+ is out of range.
+ *
+ * See also Array#slice!
+ *
+ * a = ["ant", "bat", "cat", "dog"]
+ * a.delete_at(2) #=> "cat"
+ * a #=> ["ant", "bat", "dog"]
+ * a.delete_at(99) #=> nil
+ */
+
static VALUE
-rb_ary_delete_if(ary)
- VALUE ary;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
{
- int i1, i2;
+ return rb_ary_delete_at(ary, NUM2LONG(pos));
+}
- rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- if (RTEST(rb_yield(RARRAY(ary)->ptr[i1]))) continue;
- if (i1 != i2) {
- RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
+/*
+ * call-seq:
+ * ary.slice!(index) -> obj or nil
+ * ary.slice!(start, length) -> new_ary or nil
+ * ary.slice!(range) -> new_ary or nil
+ *
+ * Deletes the element(s) given by an +index+ (optionally up to +length+
+ * elements) or by a +range+.
+ *
+ * Returns the deleted object (or objects), or +nil+ if the +index+ is out of
+ * range.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.slice!(1) #=> "b"
+ * a #=> ["a", "c"]
+ * a.slice!(-1) #=> "c"
+ * a #=> ["a"]
+ * a.slice!(100) #=> nil
+ * a #=> ["a"]
+ */
+
+static VALUE
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE arg1, arg2;
+ long pos, len, orig_len;
+
+ rb_ary_modify_check(ary);
+ if (argc == 2) {
+ pos = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ delete_pos_len:
+ if (len < 0) return Qnil;
+ orig_len = RARRAY_LEN(ary);
+ if (pos < 0) {
+ pos += orig_len;
+ if (pos < 0) return Qnil;
}
- i2++;
+ else if (orig_len < pos) return Qnil;
+ if (orig_len < pos + len) {
+ len = orig_len - pos;
+ }
+ if (len == 0) return rb_ary_new2(0);
+ arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+ RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
+ rb_ary_splice(ary, pos, len, Qundef);
+ return arg2;
}
- RARRAY(ary)->len = i2;
- return ary;
+ if (argc != 1) {
+ /* error report */
+ rb_scan_args(argc, argv, "11", NULL, NULL);
+ }
+ arg1 = argv[0];
+
+ if (!FIXNUM_P(arg1)) {
+ switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+ case Qtrue:
+ /* valid range */
+ goto delete_pos_len;
+ case Qnil:
+ /* invalid range */
+ return Qnil;
+ default:
+ /* not a range */
+ break;
+ }
+ }
+
+ return rb_ary_delete_at(ary, NUM2LONG(arg1));
}
static VALUE
-rb_ary_filter(ary)
- VALUE ary;
+ary_reject(VALUE orig, VALUE result)
{
- int i;
+ long i;
- rb_ary_modify(ary);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- RARRAY(ary)->ptr[i] = rb_yield(RARRAY(ary)->ptr[i]);
+ for (i = 0; i < RARRAY_LEN(orig); i++) {
+ VALUE v = RARRAY_AREF(orig, i);
+ if (!RTEST(rb_yield(v))) {
+ rb_ary_push(result, v);
+ }
}
- return ary;
+ return result;
}
static VALUE
-rb_ary_replace_method(ary, ary2)
- VALUE ary, ary2;
+ary_reject_bang(VALUE ary)
{
- ary2 = to_ary(ary2);
- rb_ary_replace(ary, 0, RARRAY(ary2)->len, ary2);
+ long i;
+ VALUE result = Qnil;
+
+ rb_ary_modify_check(ary);
+ for (i = 0; i < RARRAY_LEN(ary); ) {
+ VALUE v = RARRAY_AREF(ary, i);
+ if (RTEST(rb_yield(v))) {
+ rb_ary_delete_at(ary, i);
+ result = ary;
+ }
+ else {
+ i++;
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.reject! { |item| block } -> ary or nil
+ * ary.reject! -> Enumerator
+ *
+ * Equivalent to Array#delete_if, deleting elements from +self+ for which the
+ * block evaluates to +true+, but returns +nil+ if no changes were made.
+ *
+ * The array is changed instantly every time the block is called, not after
+ * the iteration is over.
+ *
+ * See also Enumerable#reject and Array#delete_if.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ */
+
+static VALUE
+rb_ary_reject_bang(VALUE ary)
+{
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ return ary_reject_bang(ary);
+}
+
+/*
+ * call-seq:
+ * ary.reject {|item| block } -> new_ary
+ * ary.reject -> Enumerator
+ *
+ * Returns a new array containing the items in +self+ for which the given
+ * block is not +true+.
+ *
+ * See also Array#delete_if
+ *
+ * If no block is given, an Enumerator is returned instead.
+ */
+
+static VALUE
+rb_ary_reject(VALUE ary)
+{
+ VALUE rejected_ary;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rejected_ary = rb_ary_new();
+ ary_reject(ary, rejected_ary);
+ return rejected_ary;
+}
+
+/*
+ * call-seq:
+ * ary.delete_if { |item| block } -> ary
+ * ary.delete_if -> Enumerator
+ *
+ * Deletes every element of +self+ for which block evaluates to +true+.
+ *
+ * The array is changed instantly every time the block is called, not after
+ * the iteration is over.
+ *
+ * See also Array#reject!
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * scores = [ 97, 42, 75 ]
+ * scores.delete_if {|score| score < 80 } #=> [97]
+ */
+
+static VALUE
+rb_ary_delete_if(VALUE ary)
+{
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ ary_reject_bang(ary);
return ary;
}
static VALUE
-rb_ary_clear(ary)
- VALUE ary;
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
+{
+ VALUE *args = (VALUE *)cbarg;
+ if (args[1]-- == 0) rb_iter_break();
+ if (argc > 1) val = rb_ary_new4(argc, argv);
+ rb_ary_push(args[0], val);
+ return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+ VALUE result = rb_check_array_type(obj);
+ VALUE args[2];
+
+ if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+ result = rb_ary_new2(n);
+ args[0] = result; args[1] = (VALUE)n;
+ if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+ rb_obj_class(obj));
+ return result;
+}
+
+
+/*
+ * call-seq:
+ * ary.zip(arg, ...) -> new_ary
+ * ary.zip(arg, ...) { |arr| block } -> nil
+ *
+ * Converts any arguments to arrays, then merges elements of +self+ with
+ * corresponding elements from each argument.
+ *
+ * This generates a sequence of <code>ary.size</code> _n_-element arrays,
+ * where _n_ is one more than the count of arguments.
+ *
+ * If the size of any argument is less than the size of the initial array,
+ * +nil+ values are supplied.
+ *
+ * If a block is given, it is invoked for each output +array+, otherwise an
+ * array of arrays is returned.
+ *
+ * a = [ 4, 5, 6 ]
+ * b = [ 7, 8, 9 ]
+ * [1, 2, 3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ * [1, 2].zip(a, b) #=> [[1, 4, 7], [2, 5, 8]]
+ * a.zip([1, 2], [8]) #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ */
+
+static VALUE
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
{
- RARRAY(ary)->len = 0;
- if (ARY_DEFAULT_SIZE*3 < RARRAY(ary)->capa) {
- RARRAY(ary)->capa = ARY_DEFAULT_SIZE * 2;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+ int i, j;
+ long len = RARRAY_LEN(ary);
+ VALUE result = Qnil;
+
+ for (i=0; i<argc; i++) {
+ argv[i] = take_items(argv[i], len);
+ }
+
+ if (rb_block_given_p()) {
+ int arity = rb_block_arity();
+
+ if (arity > 1) {
+ VALUE work, *tmp;
+
+ tmp = ALLOCV_N(VALUE, work, argc+1);
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ tmp[0] = RARRAY_AREF(ary, i);
+ for (j=0; j<argc; j++) {
+ tmp[j+1] = rb_ary_elt(argv[j], i);
+ }
+ rb_yield_values2(argc+1, tmp);
+ }
+
+ if (work) ALLOCV_END(work);
+ }
+ else {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_yield(tmp);
+ }
+ }
+ }
+ else {
+ result = rb_ary_new_capa(len);
+
+ for (i=0; i<len; i++) {
+ VALUE tmp = rb_ary_new_capa(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_ary_push(result, tmp);
+ }
+ }
+
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.transpose -> new_ary
+ *
+ * Assumes that +self+ is an array of arrays and transposes the rows and
+ * columns.
+ *
+ * a = [[1,2], [3,4], [5,6]]
+ * a.transpose #=> [[1, 3, 5], [2, 4, 6]]
+ *
+ * If the length of the subarrays don't match, an IndexError is raised.
+ */
+
+static VALUE
+rb_ary_transpose(VALUE ary)
+{
+ long elen = -1, alen, i, j;
+ VALUE tmp, result = 0;
+
+ alen = RARRAY_LEN(ary);
+ if (alen == 0) return rb_ary_dup(ary);
+ for (i=0; i<alen; i++) {
+ tmp = to_ary(rb_ary_elt(ary, i));
+ if (elen < 0) { /* first element */
+ elen = RARRAY_LEN(tmp);
+ result = rb_ary_new2(elen);
+ for (j=0; j<elen; j++) {
+ rb_ary_store(result, j, rb_ary_new2(alen));
+ }
+ }
+ else if (elen != RARRAY_LEN(tmp)) {
+ rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+ RARRAY_LEN(tmp), elen);
+ }
+ for (j=0; j<elen; j++) {
+ rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.replace(other_ary) -> ary
+ * ary.initialize_copy(other_ary) -> ary
+ *
+ * Replaces the contents of +self+ with the contents of +other_ary+,
+ * truncating or expanding if necessary.
+ *
+ * a = [ "a", "b", "c", "d", "e" ]
+ * a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
+ * a #=> ["x", "y", "z"]
+ */
+
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
+{
+ rb_ary_modify_check(copy);
+ orig = to_ary(orig);
+ if (copy == orig) return copy;
+
+ if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+ VALUE shared = 0;
+
+ if (ARY_OWNS_HEAP_P(copy)) {
+ RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+ }
+ else if (ARY_SHARED_P(copy)) {
+ shared = ARY_SHARED(copy);
+ FL_UNSET_SHARED(copy);
+ }
+ FL_SET_EMBED(copy);
+ ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+ if (shared) {
+ rb_ary_decrement_share(shared);
+ }
+ ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ }
+ else {
+ VALUE shared = ary_make_shared(orig);
+ if (ARY_OWNS_HEAP_P(copy)) {
+ RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+ }
+ else {
+ rb_ary_unshare_safe(copy);
+ }
+ FL_UNSET_EMBED(copy);
+ ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
+ ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ rb_ary_set_shared(copy, shared);
+ }
+ return copy;
+}
+
+/*
+ * call-seq:
+ * ary.clear -> ary
+ *
+ * Removes all elements from +self+.
+ *
+ * a = [ "a", "b", "c", "d", "e" ]
+ * a.clear #=> [ ]
+ */
+
+VALUE
+rb_ary_clear(VALUE ary)
+{
+ rb_ary_modify_check(ary);
+ ARY_SET_LEN(ary, 0);
+ if (ARY_SHARED_P(ary)) {
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ }
+ }
+ else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
}
return ary;
}
+/*
+ * call-seq:
+ * ary.fill(obj) -> ary
+ * ary.fill(obj, start [, length]) -> ary
+ * ary.fill(obj, range ) -> ary
+ * ary.fill { |index| block } -> ary
+ * ary.fill(start [, length] ) { |index| block } -> ary
+ * ary.fill(range) { |index| block } -> ary
+ *
+ * The first three forms set the selected elements of +self+ (which
+ * may be the entire array) to +obj+.
+ *
+ * A +start+ of +nil+ is equivalent to zero.
+ *
+ * A +length+ of +nil+ is equivalent to the length of the array.
+ *
+ * The last three forms fill the array with the value of the given block,
+ * which is passed the absolute index of each element to be filled.
+ *
+ * Negative values of +start+ count from the end of the array, where +-1+ is
+ * the last element.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.fill("x") #=> ["x", "x", "x", "x"]
+ * a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
+ * a.fill("y", 0..1) #=> ["y", "y", "z", "z"]
+ * a.fill { |i| i*i } #=> [0, 1, 4, 9]
+ * a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
+ */
+
static VALUE
-rb_ary_fill(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
{
VALUE item, arg1, arg2;
- int beg, end, len;
- VALUE *p, *pend;
+ long beg = 0, end = 0, len = 0;
+ int block_p = FALSE;
- if (rb_scan_args(argc, argv, "12", &item, &arg1, &arg2) == 2 &&
- beg_len(arg1, &beg, &len, RARRAY(ary)->len)) {
- /* beg and len set already */
+ if (rb_block_given_p()) {
+ block_p = TRUE;
+ rb_scan_args(argc, argv, "02", &arg1, &arg2);
+ argc += 1; /* hackish */
}
else {
- beg = NIL_P(arg1)?0:NUM2INT(arg1);
+ rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+ }
+ switch (argc) {
+ case 1:
+ beg = 0;
+ len = RARRAY_LEN(ary);
+ break;
+ case 2:
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+ break;
+ }
+ /* fall through */
+ case 3:
+ beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
if (beg < 0) {
- beg = RARRAY(ary)->len + beg;
+ beg = RARRAY_LEN(ary) + beg;
if (beg < 0) beg = 0;
}
- len = NIL_P(arg2)?RARRAY(ary)->len - beg:NUM2INT(arg2);
+ len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+ break;
}
rb_ary_modify(ary);
+ if (len < 0) {
+ return ary;
+ }
+ if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+ rb_raise(rb_eArgError, "argument too big");
+ }
end = beg + len;
- if (end > RARRAY(ary)->len) {
- if (end >= RARRAY(ary)->capa) {
- RARRAY(ary)->capa=end;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
- }
- if (beg > RARRAY(ary)->len) {
- rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len,end-RARRAY(ary)->len);
+ if (RARRAY_LEN(ary) < end) {
+ if (end >= ARY_CAPA(ary)) {
+ ary_resize_capa(ary, end);
}
- RARRAY(ary)->len = end;
+ ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+ ARY_SET_LEN(ary, end);
}
- p = RARRAY(ary)->ptr + beg; pend = p + len;
- while (p < pend) {
- *p++ = item;
+ if (block_p) {
+ VALUE v;
+ long i;
+
+ for (i=beg; i<end; i++) {
+ v = rb_yield(LONG2NUM(i));
+ if (i>=RARRAY_LEN(ary)) break;
+ ARY_SET(ary, i, v);
+ }
+ }
+ else {
+ ary_memfill(ary, beg, len, item);
}
return ary;
}
+/*
+ * call-seq:
+ * ary + other_ary -> new_ary
+ *
+ * Concatenation --- Returns a new array built by concatenating the
+ * two arrays together to produce a third array.
+ *
+ * [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
+ * a = [ "a", "b", "c" ]
+ * c = a + [ "d", "e", "f" ]
+ * c #=> [ "a", "b", "c", "d", "e", "f" ]
+ * a #=> [ "a", "b", "c" ]
+ *
+ * See also Array#concat.
+ */
+
VALUE
-rb_ary_plus(x, y)
- VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
{
VALUE z;
+ long len, xlen, ylen;
- if (TYPE(y) != T_ARRAY) {
- return rb_ary_plus(x, rb_Array(y));
- }
+ y = to_ary(y);
+ xlen = RARRAY_LEN(x);
+ ylen = RARRAY_LEN(y);
+ len = xlen + ylen;
+ z = rb_ary_new2(len);
- z = rb_ary_new2(RARRAY(x)->len + RARRAY(y)->len);
- MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
- MEMCPY(RARRAY(z)->ptr+RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
- RARRAY(z)->len = RARRAY(x)->len + RARRAY(y)->len;
+ ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
+ ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+ ARY_SET_LEN(z, len);
return z;
}
+/*
+ * call-seq:
+ * ary.concat(other_ary) -> ary
+ *
+ * Appends the elements of +other_ary+ to +self+.
+ *
+ * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ * a = [ 1, 2, 3 ]
+ * a.concat( [ 4, 5 ] )
+ * a #=> [ 1, 2, 3, 4, 5 ]
+ *
+ * See also Array#+.
+ */
+
VALUE
-rb_ary_concat(x, y)
- VALUE x, y;
+rb_ary_concat(VALUE x, VALUE y)
{
- VALUE *p, *pend;
-
- if (TYPE(y) != T_ARRAY) {
- return rb_ary_concat(x, rb_Array(y));
- }
-
- p = RARRAY(y)->ptr;
- pend = p + RARRAY(y)->len;
- while (p < pend) {
- rb_ary_store(x, RARRAY(x)->len, *p);
- p++;
+ rb_ary_modify_check(x);
+ y = to_ary(y);
+ if (RARRAY_LEN(y) > 0) {
+ rb_ary_splice(x, RARRAY_LEN(x), 0, y);
}
return x;
}
+
+/*
+ * call-seq:
+ * ary * int -> new_ary
+ * ary * str -> new_string
+ *
+ * Repetition --- With a String argument, equivalent to
+ * <code>ary.join(str)</code>.
+ *
+ * Otherwise, returns a new array built by concatenating the +int+ copies of
+ * +self+.
+ *
+ *
+ * [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
+ * [ 1, 2, 3 ] * "," #=> "1,2,3"
+ *
+ */
+
static VALUE
-rb_ary_times(ary, times)
- VALUE ary;
- VALUE times;
+rb_ary_times(VALUE ary, VALUE times)
{
- VALUE ary2;
- int i, len;
+ VALUE ary2, tmp;
+ const VALUE *ptr;
+ long t, len;
- if (TYPE(times) == T_STRING) {
- return rb_ary_join(ary, times);
+ tmp = rb_check_string_type(times);
+ if (!NIL_P(tmp)) {
+ return rb_ary_join(ary, tmp);
}
- len = NUM2INT(times);
+ len = NUM2LONG(times);
+ if (len == 0) {
+ ary2 = ary_new(rb_obj_class(ary), 0);
+ goto out;
+ }
if (len < 0) {
rb_raise(rb_eArgError, "negative argument");
}
- len *= RARRAY(ary)->len;
-
- ary2 = rb_ary_new2(len);
- RARRAY(ary2)->len = len;
-
- for (i=0; i<len; i+=RARRAY(ary)->len) {
- MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+ rb_raise(rb_eArgError, "argument too big");
}
+ len *= RARRAY_LEN(ary);
+
+ ary2 = ary_new(rb_obj_class(ary), len);
+ ARY_SET_LEN(ary2, len);
+
+ ptr = RARRAY_CONST_PTR(ary);
+ t = RARRAY_LEN(ary);
+ if (0 < t) {
+ ary_memcpy(ary2, 0, t, ptr);
+ while (t <= len/2) {
+ ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+ t *= 2;
+ }
+ if (t < len) {
+ ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+ }
+ }
+ out:
+ OBJ_INFECT(ary2, ary);
return ary2;
}
+/*
+ * call-seq:
+ * ary.assoc(obj) -> new_ary or nil
+ *
+ * Searches through an array whose elements are also arrays comparing +obj+
+ * with the first element of each contained array using <code>obj.==</code>.
+ *
+ * Returns the first contained array that matches (that is, the first
+ * associated array), or +nil+ if no match is found.
+ *
+ * See also Array#rassoc
+ *
+ * s1 = [ "colors", "red", "blue", "green" ]
+ * s2 = [ "letters", "a", "b", "c" ]
+ * s3 = "foo"
+ * a = [ s1, s2, s3 ]
+ * a.assoc("letters") #=> [ "letters", "a", "b", "c" ]
+ * a.assoc("foo") #=> nil
+ */
+
VALUE
-rb_ary_assoc(ary, key)
- VALUE ary;
- VALUE key;
+rb_ary_assoc(VALUE ary, VALUE key)
{
- VALUE *p, *pend;
+ long i;
+ VALUE v;
- p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
- while (p < pend) {
- if (TYPE(*p) == T_ARRAY
- && RARRAY(*p)->len > 1
- && rb_equal(RARRAY(*p)->ptr[0], key))
- return *p;
- p++;
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ v = rb_check_array_type(RARRAY_AREF(ary, i));
+ if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+ rb_equal(RARRAY_AREF(v, 0), key))
+ return v;
}
return Qnil;
}
+/*
+ * call-seq:
+ * ary.rassoc(obj) -> new_ary or nil
+ *
+ * Searches through the array whose elements are also arrays.
+ *
+ * Compares +obj+ with the second element of each contained array using
+ * <code>obj.==</code>.
+ *
+ * Returns the first contained array that matches +obj+.
+ *
+ * See also Array#assoc.
+ *
+ * a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
+ * a.rassoc("two") #=> [2, "two"]
+ * a.rassoc("four") #=> nil
+ */
+
VALUE
-rb_ary_rassoc(ary, value)
- VALUE ary;
- VALUE value;
+rb_ary_rassoc(VALUE ary, VALUE value)
{
- VALUE *p, *pend;
+ long i;
+ VALUE v;
- p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
- while (p < pend) {
- if (TYPE(*p) == T_ARRAY
- && RARRAY(*p)->len > 1
- && rb_equal(RARRAY(*p)->ptr[1], value))
- return *p;
- p++;
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(v, T_ARRAY) &&
+ RARRAY_LEN(v) > 1 &&
+ rb_equal(RARRAY_AREF(v, 1), value))
+ return v;
}
return Qnil;
}
static VALUE
-rb_ary_equal(ary1, ary2)
- VALUE ary1, ary2;
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
{
- int i;
+ long i, len1;
+ const VALUE *p1, *p2;
+
+ if (recur) return Qtrue; /* Subtle! */
+
+ p1 = RARRAY_CONST_PTR(ary1);
+ p2 = RARRAY_CONST_PTR(ary2);
+ len1 = RARRAY_LEN(ary1);
+
+ for (i = 0; i < len1; i++) {
+ if (*p1 != *p2) {
+ if (rb_equal(*p1, *p2)) {
+ len1 = RARRAY_LEN(ary1);
+ if (len1 != RARRAY_LEN(ary2))
+ return Qfalse;
+ if (len1 < i)
+ return Qtrue;
+ p1 = RARRAY_CONST_PTR(ary1) + i;
+ p2 = RARRAY_CONST_PTR(ary2) + i;
+ }
+ else {
+ return Qfalse;
+ }
+ }
+ p1++;
+ p2++;
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * ary == other_ary -> bool
+ *
+ * Equality --- Two arrays are equal if they contain the same number of
+ * elements and if each element is equal to (according to Object#==) the
+ * corresponding element in +other_ary+.
+ *
+ * [ "a", "c" ] == [ "a", "c", 7 ] #=> false
+ * [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
+ * [ "a", "c", 7 ] == [ "a", "d", "f" ] #=> false
+ *
+ */
- if (TYPE(ary2) != T_ARRAY) return Qfalse;
- if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_equal(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+static VALUE
+rb_ary_equal(VALUE ary1, VALUE ary2)
+{
+ if (ary1 == ary2) return Qtrue;
+ if (!RB_TYPE_P(ary2, T_ARRAY)) {
+ if (!rb_respond_to(ary2, idTo_ary)) {
return Qfalse;
+ }
+ return rb_equal(ary2, ary1);
}
- return Qtrue;
+ if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+ return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
}
static VALUE
-rb_ary_eql(ary1, ary2)
- VALUE ary1, ary2;
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
{
- int i;
+ long i;
- if (TYPE(ary2) != T_ARRAY) return Qfalse;
- if (RARRAY(ary1)->len != RARRAY(ary2)->len)
- return Qfalse;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_eql(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+ if (recur) return Qtrue; /* Subtle! */
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
return Qfalse;
}
return Qtrue;
}
+/*
+ * call-seq:
+ * ary.eql?(other) -> true or false
+ *
+ * Returns +true+ if +self+ and +other+ are the same object,
+ * or are both arrays with the same content (according to Object#eql?).
+ */
+
static VALUE
-rb_ary_hash(ary)
- VALUE ary;
+rb_ary_eql(VALUE ary1, VALUE ary2)
{
- int i, h;
+ if (ary1 == ary2) return Qtrue;
+ if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
+ if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+ return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+}
+
+/*
+ * call-seq:
+ * ary.hash -> fixnum
+ *
+ * Compute a hash-code for this array.
+ *
+ * Two arrays with the same content will have the same hash code (and will
+ * compare using #eql?).
+ *
+ * See also Object#hash.
+ */
- h = RARRAY(ary)->len;
- for (i=0; i<RARRAY(ary)->len; i++) {
- int n = rb_hash(RARRAY(ary)->ptr[i]);
- h ^= NUM2LONG(n);
+static VALUE
+rb_ary_hash(VALUE ary)
+{
+ long i;
+ st_index_t h;
+ VALUE n;
+
+ h = rb_hash_start(RARRAY_LEN(ary));
+ h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ n = rb_hash(RARRAY_AREF(ary, i));
+ h = rb_hash_uint(h, NUM2LONG(n));
}
- return INT2FIX(h);
+ h = rb_hash_end(h);
+ return LONG2FIX(h);
}
+/*
+ * call-seq:
+ * ary.include?(object) -> true or false
+ *
+ * Returns +true+ if the given +object+ is present in +self+ (that is, if any
+ * element <code>==</code> +object+), otherwise returns +false+.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.include?("b") #=> true
+ * a.include?("z") #=> false
+ */
+
VALUE
-rb_ary_includes(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
{
- int i;
- for (i=0; i<RARRAY(ary)->len; i++) {
- if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+ long i;
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_AREF(ary, i), item)) {
return Qtrue;
}
}
return Qfalse;
}
+
static VALUE
-rb_ary_cmp(ary, ary2)
- VALUE ary;
- VALUE ary2;
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
{
- int i, len;
+ long i, len;
- ary2 = to_ary(ary2);
- len = RARRAY(ary)->len;
- if (len > RARRAY(ary2)->len) {
- len = RARRAY(ary2)->len;
+ if (recur) return Qundef; /* Subtle! */
+ len = RARRAY_LEN(ary1);
+ if (len > RARRAY_LEN(ary2)) {
+ len = RARRAY_LEN(ary2);
}
for (i=0; i<len; i++) {
- VALUE v = rb_funcall(RARRAY(ary)->ptr[i],cmp,1,RARRAY(ary2)->ptr[i]);
+ VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+ VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
if (v != INT2FIX(0)) {
return v;
}
}
- len = RARRAY(ary)->len - RARRAY(ary2)->len;
+ return Qundef;
+}
+
+/*
+ * call-seq:
+ * ary <=> other_ary -> -1, 0, +1 or nil
+ *
+ * Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
+ * array is less than, equal to, or greater than +other_ary+.
+ *
+ * Each object in each array is compared (using the <=> operator).
+ *
+ * Arrays are compared in an "element-wise" manner; the first element of +ary+
+ * is compared with the first one of +other_ary+ using the <=> operator, then
+ * each of the second elements, etc...
+ * As soon as the result of any such comparison is non zero (i.e. the two
+ * corresponding elements are not equal), that result is returned for the
+ * whole array comparison.
+ *
+ * If all the elements are equal, then the result is based on a comparison of
+ * the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
+ * and only if, they have the same length and the value of each element is
+ * equal to the value of the corresponding element in the other array.
+ *
+ * +nil+ is returned if the +other_ary+ is not an array or if the comparison
+ * of two elements returned +nil+.
+ *
+ * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
+ * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
+ * [ 1, 2 ] <=> [ 1, :two ] #=> nil
+ *
+ */
+
+VALUE
+rb_ary_cmp(VALUE ary1, VALUE ary2)
+{
+ long len;
+ VALUE v;
+
+ ary2 = rb_check_array_type(ary2);
+ if (NIL_P(ary2)) return Qnil;
+ if (ary1 == ary2) return INT2FIX(0);
+ v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+ if (v != Qundef) return v;
+ len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
return INT2FIX(-1);
}
static VALUE
-rb_ary_diff(ary1, ary2)
- VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
{
- VALUE ary3;
- int i;
+ long i;
- ary2 = to_ary(ary2);
- ary3 = rb_ary_new();
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (rb_ary_includes(ary2, RARRAY(ary1)->ptr[i])) continue;
- if (rb_ary_includes(ary3, RARRAY(ary1)->ptr[i])) continue;
- rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE elt = RARRAY_AREF(ary, i);
+ if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
+ rb_hash_aset(hash, elt, elt);
+ }
}
- return ary3;
+ return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(void)
+{
+ VALUE hash = rb_hash_new();
+
+ RBASIC_CLEAR_CLASS(hash);
+ return hash;
}
static VALUE
-rb_ary_and(ary1, ary2)
- VALUE ary1, ary2;
+ary_make_hash(VALUE ary)
{
- VALUE ary3;
- int i;
+ VALUE hash = ary_tmp_hash_new();
+ return ary_add_hash(hash, ary);
+}
- ary2 = to_ary(ary2);
- ary3 = rb_ary_new();
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (rb_ary_includes(ary2, RARRAY(ary1)->ptr[i])
- && !rb_ary_includes(ary3, RARRAY(ary1)->ptr[i])) {
- rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+ long i;
+
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+ if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+ rb_hash_aset(hash, k, v);
}
}
- return ary3;
+ return hash;
}
static VALUE
-rb_ary_or(ary1, ary2)
- VALUE ary1, ary2;
+ary_make_hash_by(VALUE ary)
{
- VALUE ary3;
- int i;
+ VALUE hash = ary_tmp_hash_new();
+ return ary_add_hash_by(hash, ary);
+}
- if (TYPE(ary2) != T_ARRAY) {
- if (rb_ary_includes(ary1, ary2)) return ary1;
- else return rb_ary_plus(ary1, ary2);
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+ if (RHASH(hash)->ntbl) {
+ st_table *tbl = RHASH(hash)->ntbl;
+ RHASH(hash)->ntbl = 0;
+ st_free_table(tbl);
}
+}
+
+/*
+ * call-seq:
+ * ary - other_ary -> new_ary
+ *
+ * Array Difference
+ *
+ * Returns a new array that is a copy of the original array, removing any
+ * items that also appear in +other_ary+. The order is preserved from the
+ * original array.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
+ *
+ * If you need set-like behavior, see the library class Set.
+ */
+static VALUE
+rb_ary_diff(VALUE ary1, VALUE ary2)
+{
+ VALUE ary3;
+ volatile VALUE hash;
+ long i;
+
+ hash = ary_make_hash(to_ary(ary2));
ary3 = rb_ary_new();
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_ary_includes(ary3, RARRAY(ary1)->ptr[i]))
- rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
+
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
+ rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
- for (i=0; i<RARRAY(ary2)->len; i++) {
- if (!rb_ary_includes(ary3, RARRAY(ary2)->ptr[i]))
- rb_ary_push(ary3, RARRAY(ary2)->ptr[i]);
+ ary_recycle_hash(hash);
+ return ary3;
+}
+
+/*
+ * call-seq:
+ * ary & other_ary -> new_ary
+ *
+ * Set Intersection --- Returns a new array containing elements common to the
+ * two arrays, excluding any duplicates. The order is preserved from the
+ * original array.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ 1, 1, 3, 5 ] & [ 1, 2, 3 ] #=> [ 1, 3 ]
+ * [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ] #=> [ 'a', 'b' ]
+ *
+ * See also Array#uniq.
+ */
+
+
+static VALUE
+rb_ary_and(VALUE ary1, VALUE ary2)
+{
+ VALUE hash, ary3, v;
+ st_table *table;
+ st_data_t vv;
+ long i;
+
+ ary2 = to_ary(ary2);
+ ary3 = rb_ary_new();
+ if (RARRAY_LEN(ary2) == 0) return ary3;
+ hash = ary_make_hash(ary2);
+ table = rb_hash_tbl_raw(hash);
+
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ vv = (st_data_t)v;
+ if (st_delete(table, &vv, 0)) {
+ rb_ary_push(ary3, v);
+ }
}
+ ary_recycle_hash(hash);
+
return ary3;
}
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+ if (existing) return ST_STOP;
+ *key = *value = (VALUE)arg;
+ return ST_CONTINUE;
+}
+
+/*
+ * call-seq:
+ * ary | other_ary -> new_ary
+ *
+ * Set Union --- Returns a new array by joining +ary+ with +other_ary+,
+ * excluding any duplicates and preserving the order from the original array.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ "a", "b", "c" ] | [ "c", "d", "a" ] #=> [ "a", "b", "c", "d" ]
+ *
+ * See also Array#uniq.
+ */
+
static VALUE
-rb_ary_uniq_bang(ary)
- VALUE ary;
+rb_ary_or(VALUE ary1, VALUE ary2)
{
- VALUE *p, *q, *t, *end;
- VALUE v;
+ VALUE hash, ary3;
+ long i;
- rb_ary_modify(ary);
- p = RARRAY(ary)->ptr;
- end = p + RARRAY(ary)->len;
+ ary2 = to_ary(ary2);
+ hash = ary_make_hash(ary1);
- while (p < end) {
- v = *p++;
- q = t = p;
- while (q < end) {
- if (rb_equal(*q, v)) q++;
- else *t++ = *q++;
+ for (i=0; i<RARRAY_LEN(ary2); i++) {
+ VALUE elt = RARRAY_AREF(ary2, i);
+ if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+ RB_OBJ_WRITTEN(hash, Qundef, elt);
}
- end = t;
}
- if (RARRAY(ary)->len == (end - RARRAY(ary)->ptr)) {
+ ary3 = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary3;
+}
+
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+ rb_ary_push((VALUE)ary, (VALUE)val);
+ return ST_CONTINUE;
+}
+
+/*
+ * call-seq:
+ * ary.uniq! -> ary or nil
+ * ary.uniq! { |item| ... } -> ary or nil
+ *
+ * Removes duplicate elements from +self+.
+ *
+ * If a block is given, it will use the return value of the block for
+ * comparison.
+ *
+ * It compares values using their #hash and #eql? methods for efficiency.
+ *
+ * Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *
+ * a = [ "a", "a", "b", "b", "c" ]
+ * a.uniq! # => ["a", "b", "c"]
+ *
+ * b = [ "a", "b", "c" ]
+ * b.uniq! # => nil
+ *
+ * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ * c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
+ */
+
+static VALUE
+rb_ary_uniq_bang(VALUE ary)
+{
+ VALUE hash;
+ long hash_size;
+
+ rb_ary_modify_check(ary);
+ if (RARRAY_LEN(ary) <= 1)
+ return Qnil;
+ if (rb_block_given_p())
+ hash = ary_make_hash_by(ary);
+ else
+ hash = ary_make_hash(ary);
+
+ hash_size = RHASH_SIZE(hash);
+ if (RARRAY_LEN(ary) == hash_size) {
return Qnil;
}
-
- RARRAY(ary)->len = (end - RARRAY(ary)->ptr);
+ rb_ary_modify_check(ary);
+ ARY_SET_LEN(ary, 0);
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ }
+ ary_resize_capa(ary, hash_size);
+ st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+ ary_recycle_hash(hash);
return ary;
}
+/*
+ * call-seq:
+ * ary.uniq -> new_ary
+ * ary.uniq { |item| ... } -> new_ary
+ *
+ * Returns a new array by removing duplicate values in +self+.
+ *
+ * If a block is given, it will use the return value of the block for comparison.
+ *
+ * It compares values using their #hash and #eql? methods for efficiency.
+ *
+ * a = [ "a", "a", "b", "b", "c" ]
+ * a.uniq # => ["a", "b", "c"]
+ *
+ * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ * b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
+ */
+
static VALUE
-rb_ary_uniq(ary)
- VALUE ary;
+rb_ary_uniq(VALUE ary)
{
- VALUE v = rb_ary_uniq_bang(rb_ary_dup(ary));
+ VALUE hash, uniq;
- if (NIL_P(v)) return ary;
- return v;
+ if (RARRAY_LEN(ary) <= 1)
+ return rb_ary_dup(ary);
+ if (rb_block_given_p()) {
+ hash = ary_make_hash_by(ary);
+ uniq = rb_hash_values(hash);
+ }
+ else {
+ hash = ary_make_hash(ary);
+ uniq = rb_hash_values(hash);
+ }
+ RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
+ ary_recycle_hash(hash);
+
+ return uniq;
}
+/*
+ * call-seq:
+ * ary.compact! -> ary or nil
+ *
+ * Removes +nil+ elements from the array.
+ *
+ * Returns +nil+ if no changes were made, otherwise returns the array.
+ *
+ * [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
+ * [ "a", "b", "c" ].compact! #=> nil
+ */
+
static VALUE
-rb_ary_compact_bang(ary)
- VALUE ary;
+rb_ary_compact_bang(VALUE ary)
{
VALUE *p, *t, *end;
+ long n;
rb_ary_modify(ary);
- p = t = RARRAY(ary)->ptr;
- end = p + RARRAY(ary)->len;
+ p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+ end = p + RARRAY_LEN(ary);
+
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+ n = p - RARRAY_CONST_PTR(ary);
+ if (RARRAY_LEN(ary) == n) {
return Qnil;
}
- RARRAY(ary)->len = RARRAY(ary)->capa = (p - RARRAY(ary)->ptr);
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ ary_resize_smaller(ary, n);
return ary;
}
+/*
+ * call-seq:
+ * ary.compact -> new_ary
+ *
+ * Returns a copy of +self+ with all +nil+ elements removed.
+ *
+ * [ "a", nil, "b", nil, "c", nil ].compact
+ * #=> [ "a", "b", "c" ]
+ */
+
static VALUE
-rb_ary_compact(ary)
- VALUE ary;
+rb_ary_compact(VALUE ary)
{
- VALUE v = rb_ary_compact_bang(rb_ary_dup(ary));
+ ary = rb_ary_dup(ary);
+ rb_ary_compact_bang(ary);
+ return ary;
+}
- if (NIL_P(v)) return ary;
- return v;
+/*
+ * call-seq:
+ * ary.count -> int
+ * ary.count(obj) -> int
+ * ary.count { |item| block } -> int
+ *
+ * Returns the number of elements.
+ *
+ * If an argument is given, counts the number of elements which equal +obj+
+ * using <code>==</code>.
+ *
+ * If a block is given, counts the number of elements for which the block
+ * returns a true value.
+ *
+ * ary = [1, 2, 4, 2]
+ * ary.count #=> 4
+ * ary.count(2) #=> 2
+ * ary.count { |x| x%2 == 0 } #=> 3
+ *
+ */
+
+static VALUE
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
+{
+ long i, n = 0;
+
+ if (argc == 0) {
+ VALUE v;
+
+ if (!rb_block_given_p())
+ return LONG2NUM(RARRAY_LEN(ary));
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (RTEST(rb_yield(v))) n++;
+ }
+ }
+ else {
+ VALUE obj;
+
+ rb_scan_args(argc, argv, "1", &obj);
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+ }
+ }
+
+ return LONG2NUM(n);
}
static VALUE
-rb_ary_nitems(ary)
- VALUE ary;
+flatten(VALUE ary, int level, int *modified)
+{
+ long i = 0;
+ VALUE stack, result, tmp, elt;
+ st_table *memo;
+ st_data_t id;
+
+ stack = ary_new(0, ARY_DEFAULT_SIZE);
+ result = ary_new(0, RARRAY_LEN(ary));
+ memo = st_init_numtable();
+ st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+ *modified = 0;
+
+ while (1) {
+ while (i < RARRAY_LEN(ary)) {
+ elt = RARRAY_AREF(ary, i++);
+ tmp = rb_check_array_type(elt);
+ if (RBASIC(result)->klass) {
+ rb_raise(rb_eRuntimeError, "flatten reentered");
+ }
+ if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
+ rb_ary_push(result, elt);
+ }
+ else {
+ *modified = 1;
+ id = (st_data_t)tmp;
+ if (st_lookup(memo, id, 0)) {
+ st_free_table(memo);
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ st_insert(memo, id, (st_data_t)Qtrue);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i));
+ ary = tmp;
+ i = 0;
+ }
+ }
+ if (RARRAY_LEN(stack) == 0) {
+ break;
+ }
+ id = (st_data_t)ary;
+ st_delete(memo, &id, 0);
+ tmp = rb_ary_pop(stack);
+ i = NUM2LONG(tmp);
+ ary = rb_ary_pop(stack);
+ }
+
+ st_free_table(memo);
+
+ RBASIC_SET_CLASS(result, rb_class_of(ary));
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.flatten! -> ary or nil
+ * ary.flatten!(level) -> ary or nil
+ *
+ * Flattens +self+ in place.
+ *
+ * Returns +nil+ if no modifications were made (i.e., the array contains no
+ * subarrays.)
+ *
+ * The optional +level+ argument determines the level of recursion to flatten.
+ *
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten! #=> [1, 2, 3, 4, 5]
+ * a.flatten! #=> nil
+ * a #=> [1, 2, 3, 4, 5]
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ */
+
+static VALUE
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
{
- int n = 0;
- VALUE *p, *pend;
+ int mod = 0, level = -1;
+ VALUE result, lv;
+
+ rb_scan_args(argc, argv, "01", &lv);
+ rb_ary_modify_check(ary);
+ if (!NIL_P(lv)) level = NUM2INT(lv);
+ if (level == 0) return Qnil;
- p = RARRAY(ary)->ptr;
- pend = p + RARRAY(ary)->len;
- while (p < pend) {
- if (!NIL_P(*p)) n++;
- p++;
+ result = flatten(ary, level, &mod);
+ if (mod == 0) {
+ ary_discard(result);
+ return Qnil;
}
- return INT2FIX(n);
+ if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+ rb_ary_replace(ary, result);
+ if (mod) ARY_SET_EMBED_LEN(result, 0);
+
+ return ary;
}
+/*
+ * call-seq:
+ * ary.flatten -> new_ary
+ * ary.flatten(level) -> new_ary
+ *
+ * Returns a new array that is a one-dimensional flattening of +self+
+ * (recursively).
+ *
+ * That is, for every element that is an array, extract its elements into
+ * the new array.
+ *
+ * The optional +level+ argument determines the level of recursion to
+ * flatten.
+ *
+ * s = [ 1, 2, 3 ] #=> [1, 2, 3]
+ * t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
+ * a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
+ * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten(1) #=> [1, 2, 3, [4, 5]]
+ */
+
static VALUE
-rb_ary_flatten_bang(ary)
- VALUE ary;
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+ int mod = 0, level = -1;
+ VALUE result, lv;
+
+ rb_scan_args(argc, argv, "01", &lv);
+ if (!NIL_P(lv)) level = NUM2INT(lv);
+ if (level == 0) return ary_make_shared_copy(ary);
+
+ result = flatten(ary, level, &mod);
+ OBJ_INFECT(result, ary);
+
+ return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+ (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static ID id_random;
+
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
+
+/*
+ * call-seq:
+ * ary.shuffle! -> ary
+ * ary.shuffle!(random: rng) -> ary
+ *
+ * Shuffles elements in +self+ in place.
+ *
+ * a = [ 1, 2, 3 ] #=> [1, 2, 3]
+ * a.shuffle! #=> [2, 3, 1]
+ * a #=> [2, 3, 1]
+ *
+ * The optional +rng+ argument will be used as the random number generator.
+ *
+ * a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
{
- int i;
- int mod = 0;
+ VALUE opts, randgen = rb_cRandom;
+ long i, len;
+
+ if (OPTHASH_GIVEN_P(opts)) {
+ VALUE rnd;
+ ID keyword_ids[1];
+ keyword_ids[0] = id_random;
+ rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+ if (rnd != Qundef) {
+ randgen = rnd;
+ }
+ }
+ rb_check_arity(argc, 0, 0);
rb_ary_modify(ary);
- for (i=0; i<RARRAY(ary)->len; i++) {
- VALUE ary2 = RARRAY(ary)->ptr[i];
- if (TYPE(ary2) == T_ARRAY) {
- rb_ary_replace(ary, i--, 1, ary2);
- mod = 1;
+ i = len = RARRAY_LEN(ary);
+ RARRAY_PTR_USE(ary, ptr, {
+ while (i) {
+ long j = RAND_UPTO(i);
+ VALUE tmp;
+ if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+ rb_raise(rb_eRuntimeError, "modified during shuffle");
+ }
+ tmp = ptr[--i];
+ ptr[i] = ptr[j];
+ ptr[j] = tmp;
+ }
+ }); /* WB: no new reference */
+ return ary;
+}
+
+
+/*
+ * call-seq:
+ * ary.shuffle -> new_ary
+ * ary.shuffle(random: rng) -> new_ary
+ *
+ * Returns a new array with elements of +self+ shuffled.
+ *
+ * a = [ 1, 2, 3 ] #=> [1, 2, 3]
+ * a.shuffle #=> [2, 3, 1]
+ * a #=> [1, 2, 3]
+ *
+ * The optional +rng+ argument will be used as the random number generator.
+ *
+ * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+{
+ ary = rb_ary_dup(ary);
+ rb_ary_shuffle_bang(argc, argv, ary);
+ return ary;
+}
+
+
+/*
+ * call-seq:
+ * ary.sample -> obj
+ * ary.sample(random: rng) -> obj
+ * ary.sample(n) -> new_ary
+ * ary.sample(n, random: rng) -> new_ary
+ *
+ * Choose a random element or +n+ random elements from the array.
+ *
+ * The elements are chosen by using random and unique indices into the array
+ * in order to ensure that an element doesn't repeat itself unless the array
+ * already contained duplicate elements.
+ *
+ * If the array is empty the first form returns +nil+ and the second form
+ * returns an empty array.
+ *
+ * The optional +rng+ argument will be used as the random number generator.
+ *
+ * a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+ * a.sample #=> 7
+ * a.sample(4) #=> [6, 4, 2, 5]
+ */
+
+
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE nv, result;
+ VALUE opts, randgen = rb_cRandom;
+ long n, len, i, j, k, idx[10];
+ long rnds[numberof(idx)];
+
+ if (OPTHASH_GIVEN_P(opts)) {
+ VALUE rnd;
+ ID keyword_ids[1];
+
+ keyword_ids[0] = id_random;
+ rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+ if (rnd != Qundef) {
+ randgen = rnd;
+ }
+ }
+ len = RARRAY_LEN(ary);
+ if (argc == 0) {
+ if (len < 2)
+ i = 0;
+ else
+ i = RAND_UPTO(len);
+
+ return rb_ary_elt(ary, i);
+ }
+ rb_scan_args(argc, argv, "1", &nv);
+ n = NUM2LONG(nv);
+ if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+ if (n > len) n = len;
+ if (n <= numberof(idx)) {
+ for (i = 0; i < n; ++i) {
+ rnds[i] = RAND_UPTO(len - i);
+ }
+ }
+ k = len;
+ len = RARRAY_LEN(ary);
+ if (len < k && n <= numberof(idx)) {
+ for (i = 0; i < n; ++i) {
+ if (rnds[i] >= len) return rb_ary_new_capa(0);
+ }
+ }
+ if (n > len) n = len;
+ switch (n) {
+ case 0:
+ return rb_ary_new_capa(0);
+ case 1:
+ i = rnds[0];
+ return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+ case 2:
+ i = rnds[0];
+ j = rnds[1];
+ if (j >= i) j++;
+ return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+ case 3:
+ i = rnds[0];
+ j = rnds[1];
+ k = rnds[2];
+ {
+ long l = j, g = i;
+ if (j >= i) l = i, g = ++j;
+ if (k >= l && (++k >= g)) ++k;
+ }
+ return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+ }
+ if (n <= numberof(idx)) {
+ long sorted[numberof(idx)];
+ sorted[0] = idx[0] = rnds[0];
+ for (i=1; i<n; i++) {
+ k = rnds[i];
+ for (j = 0; j < i; ++j) {
+ if (k < sorted[j]) break;
+ ++k;
+ }
+ memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+ sorted[j] = idx[i] = k;
+ }
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+ }
+ });
+ }
+ else {
+ result = rb_ary_dup(ary);
+ RBASIC_CLEAR_CLASS(result);
+ RB_GC_GUARD(ary);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ j = RAND_UPTO(len-i) + i;
+ nv = ptr_result[j];
+ ptr_result[j] = ptr_result[i];
+ ptr_result[i] = nv;
+ }
+ });
+ RBASIC_SET_CLASS_RAW(result, rb_cArray);
+ }
+ ARY_SET_LEN(result, n);
+
+ return result;
+}
+
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+ long mul;
+ VALUE n = Qnil;
+ if (args && (RARRAY_LEN(args) > 0)) {
+ n = RARRAY_AREF(args, 0);
+ }
+ if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+ if (n == Qnil) return DBL2NUM(INFINITY);
+ mul = NUM2LONG(n);
+ if (mul <= 0) return INT2FIX(0);
+ n = LONG2FIX(mul);
+ return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+}
+
+/*
+ * call-seq:
+ * ary.cycle(n=nil) { |obj| block } -> nil
+ * ary.cycle(n=nil) -> Enumerator
+ *
+ * Calls the given block for each element +n+ times or forever if +nil+ is
+ * given.
+ *
+ * Does nothing if a non-positive number is given or the array is empty.
+ *
+ * Returns +nil+ if the loop has finished without getting interrupted.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * a = ["a", "b", "c"]
+ * a.cycle { |x| puts x } # print, a, b, c, a, b, c,.. forever.
+ * a.cycle(2) { |x| puts x } # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+ long n, i;
+ VALUE nv = Qnil;
+
+ rb_scan_args(argc, argv, "01", &nv);
+
+ RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+ if (NIL_P(nv)) {
+ n = -1;
+ }
+ else {
+ n = NUM2LONG(nv);
+ if (n <= 0) return Qnil;
+ }
+
+ while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(RARRAY_AREF(ary, i));
+ }
+ }
+ return Qnil;
+}
+
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
+
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
+{
+ const VALUE result = rb_ary_new2(r);
+ VALUE *const result_array = RARRAY_PTR(result);
+ const VALUE *const values_array = RARRAY_CONST_PTR(values);
+ long i;
+
+ for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+ ARY_SET_LEN(result, r);
+ rb_yield(result);
+ return !RBASIC(values)->klass;
+}
+
+/*
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ for (;;) {
+ const char *const unused = memchr(&used[i], 0, n-i);
+ if (!unused) {
+ if (!index) break;
+ i = p[--index]; /* pop index */
+ used[i++] = 0; /* index unused */
+ }
+ else {
+ i = unused - used;
+ p[index] = i;
+ used[i] = 1; /* mark index used */
+ ++index;
+ if (index < r-1) { /* if not done yet */
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ if (used[i]) continue;
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "permute reentered");
+ }
+ }
+ i = p[--index]; /* pop index */
+ used[i] = 0; /* index unused */
+ p[index] = ++i;
+ }
+ }
+}
+
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
+static VALUE
+descending_factorial(long from, long how_many)
+{
+ VALUE cnt = LONG2FIX(how_many >= 0);
+ while (how_many-- > 0) {
+ VALUE v = LONG2FIX(from--);
+ cnt = rb_funcallv(cnt, '*', 1, &v);
+ }
+ return cnt;
+}
+
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+ VALUE r, v;
+ if (comb > size-comb) {
+ comb = size-comb;
+ }
+ if (comb < 0) {
+ return LONG2FIX(0);
+ }
+ r = descending_factorial(size, comb);
+ v = descending_factorial(comb, comb);
+ return rb_funcallv(r, id_div, 1, &v);
+}
+
+static VALUE
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+
+ return descending_factorial(n, k);
+}
+
+/*
+ * call-seq:
+ * ary.permutation { |p| block } -> ary
+ * ary.permutation -> Enumerator
+ * ary.permutation(n) { |p| block } -> ary
+ * ary.permutation(n) -> Enumerator
+ *
+ * When invoked with a block, yield all permutations of length +n+ of the
+ * elements of the array, then return the array itself.
+ *
+ * If +n+ is not specified, yield all permutations of all elements.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3]
+ * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ * a.permutation(1).to_a #=> [[1],[2],[3]]
+ * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ * a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ * a.permutation(4).to_a #=> [] # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE num;
+ long r, n, i;
+
+ n = RARRAY_LEN(ary); /* Array length */
+ RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
+ rb_scan_args(argc, argv, "01", &num);
+ r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
+
+ if (r < 0 || n < r) {
+ /* no permutations: yield nothing */
+ }
+ else if (r == 0) { /* exactly one permutation: the zero-length array */
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (r == 1) { /* this is a special, easy case */
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
}
}
- if (mod == 0) return Qnil;
+ else { /* this is the general case */
+ volatile VALUE t0;
+ long *p = (long*)ALLOCV(t0, r*sizeof(long)+n*sizeof(char));
+ char *used = (char*)(p + r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
+
+ MEMZERO(used, char, n); /* initialize array */
+
+ permute0(n, r, p, used, ary0); /* compute and yield permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
return ary;
}
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+ long lev = 0;
+
+ MEMZERO(stack+1, long, n);
+ stack[0] = -1;
+ for (;;) {
+ for (lev++; lev < n; lev++) {
+ stack[lev+1] = stack[lev]+1;
+ }
+ if (!yield_indexed_values(values, n, stack+1)) {
+ rb_raise(rb_eRuntimeError, "combination reentered");
+ }
+ do {
+ if (lev == 0) return;
+ stack[lev--]++;
+ } while (stack[lev+1]+n == len+lev+1);
+ }
+}
+
static VALUE
-rb_ary_flatten(ary)
- VALUE ary;
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
{
- VALUE v = rb_ary_flatten_bang(rb_ary_dup(ary));
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
- if (NIL_P(v)) return ary;
- return v;
+ return binomial_coefficient(k, n);
+}
+
+/*
+ * call-seq:
+ * ary.combination(n) { |c| block } -> ary
+ * ary.combination(n) -> Enumerator
+ *
+ * When invoked with a block, yields all combinations of length +n+ of elements
+ * from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3, 4]
+ * a.combination(1).to_a #=> [[1],[2],[3],[4]]
+ * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ * a.combination(4).to_a #=> [[1,2,3,4]]
+ * a.combination(0).to_a #=> [[]] # one combination of length 0
+ * a.combination(5).to_a #=> [] # no combinations of length 5
+ *
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+ long i, n, len;
+
+ n = NUM2LONG(num);
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
+ len = RARRAY_LEN(ary);
+ if (n < 0 || len < n) {
+ /* yield nothing */
+ }
+ else if (n == 0) {
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (n == 1) {
+ for (i = 0; i < len; i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else {
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ volatile VALUE t0;
+ long *stack = ALLOCV_N(long, t0, n+1);
+
+ RBASIC_CLEAR_CLASS(ary0);
+ combinate0(len, n, stack, ary0);
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
+}
+
+/*
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ p[index] = i;
+ for (;;) {
+ if (++index < r-1) {
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated permute reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
+ }
+}
+
+static VALUE
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+ VALUE v;
+
+ if (k < 0) {
+ return LONG2FIX(0);
+ }
+
+ v = LONG2NUM(k);
+ return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+}
+
+/*
+ * call-seq:
+ * ary.repeated_permutation(n) { |p| block } -> ary
+ * ary.repeated_permutation(n) -> Enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length +n+ of
+ * the elements of the array, then return the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2]
+ * a.repeated_permutation(1).to_a #=> [[1], [2]]
+ * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
+ * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
+ */
+
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+ long r, n, i;
+
+ n = RARRAY_LEN(ary); /* Array length */
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size); /* Return Enumerator if no block */
+ r = NUM2LONG(num); /* Permutation size from argument */
+
+ if (r < 0) {
+ /* no permutations: yield nothing */
+ }
+ else if (r == 0) { /* exactly one permutation: the zero-length array */
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (r == 1) { /* this is a special, easy case */
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else { /* this is the general case */
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r * sizeof(long));
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
+
+ rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
}
+static void
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ p[index] = i;
+ for (;;) {
+ if (++index < r-1) {
+ p[index] = i;
+ continue;
+ }
+ for (; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated combination reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
+ }
+}
+
+static VALUE
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+ if (k == 0) {
+ return LONG2FIX(1);
+ }
+ return binomial_coefficient(k, n + k - 1);
+}
+
+/*
+ * call-seq:
+ * ary.repeated_combination(n) { |c| block } -> ary
+ * ary.repeated_combination(n) -> Enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of length +n+ of
+ * elements from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3]
+ * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
+ * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
+ *
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+ long n, i, len;
+
+ n = NUM2LONG(num); /* Combination size from argument */
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size); /* Return enumerator if no block */
+ len = RARRAY_LEN(ary);
+ if (n < 0) {
+ /* yield nothing */
+ }
+ else if (n == 0) {
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (n == 1) {
+ for (i = 0; i < len; i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else if (len == 0) {
+ /* yield nothing */
+ }
+ else {
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, n);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
+
+ rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.product(other_ary, ...) -> new_ary
+ * ary.product(other_ary, ...) { |p| block } -> ary
+ *
+ * Returns an array of all combinations of elements from all arrays.
+ *
+ * The length of the returned array is the product of the length of +self+ and
+ * the argument arrays.
+ *
+ * If given a block, #product will yield all combinations and return +self+
+ * instead.
+ *
+ * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
+ * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ * [1,2].product() #=> [[1],[2]]
+ * [1,2].product([]) #=> []
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+ int n = argc+1; /* How many arrays we're operating on */
+ volatile VALUE t0 = tmpary(n);
+ volatile VALUE t1 = tmpbuf(n, sizeof(int));
+ VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+ int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+ VALUE result = Qnil; /* The array we'll be returning, when no block given */
+ long i,j;
+ long resultlen = 1;
+
+ RBASIC_CLEAR_CLASS(t0);
+ RBASIC_CLEAR_CLASS(t1);
+
+ /* initialize the arrays of arrays */
+ ARY_SET_LEN(t0, n);
+ arrays[0] = ary;
+ for (i = 1; i < n; i++) arrays[i] = Qnil;
+ for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+ /* initialize the counters for the arrays */
+ for (i = 0; i < n; i++) counters[i] = 0;
+
+ /* Otherwise, allocate and fill in an array of results */
+ if (rb_block_given_p()) {
+ /* Make defensive copies of arrays; exit if any is empty */
+ for (i = 0; i < n; i++) {
+ if (RARRAY_LEN(arrays[i]) == 0) goto done;
+ arrays[i] = ary_make_shared_copy(arrays[i]);
+ }
+ }
+ else {
+ /* Compute the length of the result array; return [] if any is empty */
+ for (i = 0; i < n; i++) {
+ long k = RARRAY_LEN(arrays[i]);
+ if (k == 0) {
+ result = rb_ary_new2(0);
+ goto done;
+ }
+ if (MUL_OVERFLOW_LONG_P(resultlen, k))
+ rb_raise(rb_eRangeError, "too big to product");
+ resultlen *= k;
+ }
+ result = rb_ary_new2(resultlen);
+ }
+ for (;;) {
+ int m;
+ /* fill in one subarray */
+ VALUE subarray = rb_ary_new2(n);
+ for (j = 0; j < n; j++) {
+ rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+ }
+
+ /* put it on the result array */
+ if (NIL_P(result)) {
+ FL_SET(t0, FL_USER5);
+ rb_yield(subarray);
+ if (! FL_TEST(t0, FL_USER5)) {
+ rb_raise(rb_eRuntimeError, "product reentered");
+ }
+ else {
+ FL_UNSET(t0, FL_USER5);
+ }
+ }
+ else {
+ rb_ary_push(result, subarray);
+ }
+
+ /*
+ * Increment the last counter. If it overflows, reset to 0
+ * and increment the one before it.
+ */
+ m = n-1;
+ counters[m]++;
+ while (counters[m] == RARRAY_LEN(arrays[m])) {
+ counters[m] = 0;
+ /* If the first counter overflows, we are done */
+ if (--m < 0) goto done;
+ counters[m]++;
+ }
+ }
+done:
+ tmpary_discard(t0);
+ tmpbuf_discard(t1);
+
+ return NIL_P(result) ? ary : result;
+}
+
+/*
+ * call-seq:
+ * ary.take(n) -> new_ary
+ *
+ * Returns first +n+ elements from the array.
+ *
+ * If a negative number is given, raises an ArgumentError.
+ *
+ * See also Array#drop
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.take(3) #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+ long len = NUM2LONG(n);
+ if (len < 0) {
+ rb_raise(rb_eArgError, "attempt to take negative size");
+ }
+ return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ * call-seq:
+ * ary.take_while { |arr| block } -> new_ary
+ * ary.take_while -> Enumerator
+ *
+ * Passes elements to the block until the block returns +nil+ or +false+, then
+ * stops iterating and returns an array of all prior elements.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * See also Array#drop_while
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.take_while { |i| i < 3 } #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+ long i;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+ }
+ return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ * call-seq:
+ * ary.drop(n) -> new_ary
+ *
+ * Drops first +n+ elements from +ary+ and returns the rest of the elements in
+ * an array.
+ *
+ * If a negative number is given, raises an ArgumentError.
+ *
+ * See also Array#take
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.drop(3) #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+ VALUE result;
+ long pos = NUM2LONG(n);
+ if (pos < 0) {
+ rb_raise(rb_eArgError, "attempt to drop negative size");
+ }
+
+ result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+ if (result == Qnil) result = rb_ary_new();
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.drop_while { |arr| block } -> new_ary
+ * ary.drop_while -> Enumerator
+ *
+ * Drops elements up to, but not including, the first element for which the
+ * block returns +nil+ or +false+ and returns an array containing the
+ * remaining elements.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * See also Array#take_while
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+ long i;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+ }
+ return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+/*
+ * call-seq:
+ * ary.any? [{ |obj| block }] -> true or false
+ *
+ * See also Enumerable#any?
+ */
+
+static VALUE
+rb_ary_any_p(VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+ const VALUE *ptr = RARRAY_CONST_PTR(ary);
+
+ if (!len) return Qfalse;
+ if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ return Qfalse;
+}
+
+/*
+ * Arrays are ordered, integer-indexed collections of any object.
+ *
+ * Array indexing starts at 0, as in C or Java. A negative index is assumed
+ * to be relative to the end of the array---that is, an index of -1 indicates
+ * the last element of the array, -2 is the next to last element in the
+ * array, and so on.
+ *
+ * == Creating Arrays
+ *
+ * A new array can be created by using the literal constructor
+ * <code>[]</code>. Arrays can contain different types of objects. For
+ * example, the array below contains an Integer, a String and a Float:
+ *
+ * ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *
+ * An array can also be created by explicitly calling Array.new with zero, one
+ * (the initial size of the Array) or two arguments (the initial size and a
+ * default object).
+ *
+ * ary = Array.new #=> []
+ * Array.new(3) #=> [nil, nil, nil]
+ * Array.new(3, true) #=> [true, true, true]
+ *
+ * Note that the second argument populates the array with references to the
+ * same object. Therefore, it is only recommended in cases when you need to
+ * instantiate arrays with natively immutable objects such as Symbols,
+ * numbers, true or false.
+ *
+ * To create an array with separate objects a block can be passed instead.
+ * This method is safe to use with mutable objects such as hashes, strings or
+ * other arrays:
+ *
+ * Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
+ *
+ * This is also a quick way to build up multi-dimensional arrays:
+ *
+ * empty_table = Array.new(3) { Array.new(3) }
+ * #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ * An array can also be created by using the Array() method, provided by
+ * Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *
+ * Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *
+ * == Example Usage
+ *
+ * In addition to the methods it mixes in through the Enumerable module, the
+ * Array class has proprietary methods for accessing, searching and otherwise
+ * manipulating arrays.
+ *
+ * Some of the more common ones are illustrated below.
+ *
+ * == Accessing Elements
+ *
+ * Elements in an array can be retrieved using the Array#[] method. It can
+ * take a single integer argument (a numeric index), a pair of arguments
+ * (start and length) or a range. Negative indices start counting from the end,
+ * with -1 being the last element.
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr[2] #=> 3
+ * arr[100] #=> nil
+ * arr[-3] #=> 4
+ * arr[2, 3] #=> [3, 4, 5]
+ * arr[1..4] #=> [2, 3, 4, 5]
+ * arr[1..-3] #=> [2, 3, 4]
+ *
+ * Another way to access a particular array element is by using the #at method
+ *
+ * arr.at(0) #=> 1
+ *
+ * The #slice method works in an identical manner to Array#[].
+ *
+ * To raise an error for indices outside of the array bounds or else to
+ * provide a default value when that happens, you can use #fetch.
+ *
+ * arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ * arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ * arr.fetch(100, "oops") #=> "oops"
+ *
+ * The special methods #first and #last will return the first and last
+ * elements of an array, respectively.
+ *
+ * arr.first #=> 1
+ * arr.last #=> 6
+ *
+ * To return the first +n+ elements of an array, use #take
+ *
+ * arr.take(3) #=> [1, 2, 3]
+ *
+ * #drop does the opposite of #take, by returning the elements after +n+
+ * elements have been dropped:
+ *
+ * arr.drop(3) #=> [4, 5, 6]
+ *
+ * == Obtaining Information about an Array
+ *
+ * Arrays keep track of their own length at all times. To query an array
+ * about the number of elements it contains, use #length, #count or #size.
+ *
+ * browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ * browsers.length #=> 5
+ * browsers.count #=> 5
+ *
+ * To check whether an array contains any elements at all
+ *
+ * browsers.empty? #=> false
+ *
+ * To check whether a particular item is included in the array
+ *
+ * browsers.include?('Konqueror') #=> false
+ *
+ * == Adding Items to Arrays
+ *
+ * Items can be added to the end of an array by using either #push or #<<
+ *
+ * arr = [1, 2, 3, 4]
+ * arr.push(5) #=> [1, 2, 3, 4, 5]
+ * arr << 6 #=> [1, 2, 3, 4, 5, 6]
+ *
+ * #unshift will add a new item to the beginning of an array.
+ *
+ * arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ * With #insert you can add a new element to an array at any position.
+ *
+ * arr.insert(3, 'apple') #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ * Using the #insert method, you can also insert multiple values at once:
+ *
+ * arr.insert(3, 'orange', 'pear', 'grapefruit')
+ * #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ * == Removing Items from an Array
+ *
+ * The method #pop removes the last element in an array and returns it:
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.pop #=> 6
+ * arr #=> [1, 2, 3, 4, 5]
+ *
+ * To retrieve and at the same time remove the first item, use #shift:
+ *
+ * arr.shift #=> 1
+ * arr #=> [2, 3, 4, 5]
+ *
+ * To delete an element at a particular index:
+ *
+ * arr.delete_at(2) #=> 4
+ * arr #=> [2, 3, 5]
+ *
+ * To delete a particular element anywhere in an array, use #delete:
+ *
+ * arr = [1, 2, 2, 3]
+ * arr.delete(2) #=> 2
+ * arr #=> [1,3]
+ *
+ * A useful method if you need to remove +nil+ values from an array is
+ * #compact:
+ *
+ * arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ * arr.compact #=> ['foo', 0, 'bar', 7, 'baz']
+ * arr #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ * arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ * arr #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ * Another common need is to remove duplicate elements from an array.
+ *
+ * It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ * arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ * arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ * == Iterating over Arrays
+ *
+ * Like all classes that include the Enumerable module, Array has an each
+ * method, which defines what elements should be iterated over and how. In
+ * case of Array's #each, all elements in the Array instance are yielded to
+ * the supplied block in sequence.
+ *
+ * Note that this operation leaves the array unchanged.
+ *
+ * arr = [1, 2, 3, 4, 5]
+ * arr.each { |a| print a -= 10, " " }
+ * # prints: -9 -8 -7 -6 -5
+ * #=> [1, 2, 3, 4, 5]
+ *
+ * Another sometimes useful iterator is #reverse_each which will iterate over
+ * the elements in the array in reverse order.
+ *
+ * words = %w[first second third fourth fifth sixth]
+ * str = ""
+ * words.reverse_each { |word| str += "#{word} " }
+ * p str #=> "sixth fifth fourth third second first "
+ *
+ * The #map method can be used to create a new array based on the original
+ * array, but with the values modified by the supplied block:
+ *
+ * arr.map { |a| 2*a } #=> [2, 4, 6, 8, 10]
+ * arr #=> [1, 2, 3, 4, 5]
+ * arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ * arr #=> [1, 4, 9, 16, 25]
+ *
+ * == Selecting Items from an Array
+ *
+ * Elements can be selected from an array according to criteria defined in a
+ * block. The selection can happen in a destructive or a non-destructive
+ * manner. While the destructive operations will modify the array they were
+ * called on, the non-destructive methods usually return a new array with the
+ * selected elements, but leave the original array unchanged.
+ *
+ * === Non-destructive Selection
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.select { |a| a > 3 } #=> [4, 5, 6]
+ * arr.reject { |a| a < 3 } #=> [3, 4, 5, 6]
+ * arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ * arr #=> [1, 2, 3, 4, 5, 6]
+ *
+ * === Destructive Selection
+ *
+ * #select! and #reject! are the corresponding destructive methods to #select
+ * and #reject
+ *
+ * Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ * opposite result when supplied with the same block:
+ *
+ * arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ * arr #=> [4, 5, 6]
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ * arr #=> [1, 2, 3]
+ *
+ */
+
void
-Init_Array()
+Init_Array(void)
{
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
- rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
+ rb_define_alloc_func(rb_cArray, empty_ary_alloc);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
- rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
+ rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
+ rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
+ rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
+
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+ rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
- rb_define_method(rb_cArray, "to_ary", rb_ary_to_a, 0);
-
- rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
+ rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
+ rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
rb_define_method(rb_cArray, "hash", rb_ary_hash, 0);
- rb_define_method(rb_cArray, "===", rb_ary_equal, 1);
rb_define_method(rb_cArray, "[]", rb_ary_aref, -1);
rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
+ rb_define_method(rb_cArray, "at", rb_ary_at, 1);
+ rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
+ rb_define_method(rb_cArray, "first", rb_ary_first, -1);
+ rb_define_method(rb_cArray, "last", rb_ary_last, -1);
rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
- rb_define_method(rb_cArray, "push", rb_ary_push_method, -1);
- rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
- rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
- rb_define_method(rb_cArray, "unshift", rb_ary_unshift, 1);
+ rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+ rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+ rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+ rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+ rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
rb_define_alias(rb_cArray, "size", "length");
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
- rb_define_method(rb_cArray, "index", rb_ary_index, 1);
- rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
- rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
- rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
- rb_define_method(rb_cArray, "clone", rb_ary_clone, 0);
- rb_define_method(rb_cArray, "dup", rb_ary_dup, 0);
- rb_define_method(rb_cArray, "join", rb_ary_join_method, -1);
- rb_define_method(rb_cArray, "reverse", rb_ary_reverse_method, 0);
- rb_define_method(rb_cArray, "reverse!", rb_ary_reverse, 0);
+ rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+ rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+ rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+ rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
+ rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
+ rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+ rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+ rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+ rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
+ rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
+ rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
+ rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
+ rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
+ rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
+ rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
- rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at, 1);
+ rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
rb_define_method(rb_cArray, "delete_if", rb_ary_delete_if, 0);
- rb_define_method(rb_cArray, "filter", rb_ary_filter, 0);
- rb_define_method(rb_cArray, "replace", rb_ary_replace_method, 1);
+ rb_define_method(rb_cArray, "reject", rb_ary_reject, 0);
+ rb_define_method(rb_cArray, "reject!", rb_ary_reject_bang, 0);
+ rb_define_method(rb_cArray, "zip", rb_ary_zip, -1);
+ rb_define_method(rb_cArray, "transpose", rb_ary_transpose, 0);
+ rb_define_method(rb_cArray, "replace", rb_ary_replace, 1);
rb_define_method(rb_cArray, "clear", rb_ary_clear, 0);
rb_define_method(rb_cArray, "fill", rb_ary_fill, -1);
rb_define_method(rb_cArray, "include?", rb_ary_includes, 1);
rb_define_method(rb_cArray, "<=>", rb_ary_cmp, 1);
+ rb_define_method(rb_cArray, "slice", rb_ary_aref, -1);
+ rb_define_method(rb_cArray, "slice!", rb_ary_slice_bang, -1);
+
rb_define_method(rb_cArray, "assoc", rb_ary_assoc, 1);
rb_define_method(rb_cArray, "rassoc", rb_ary_rassoc, 1);
@@ -1530,9 +5763,28 @@ Init_Array()
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
- rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
- rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
- rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
-
- cmp = rb_intern("<=>");
+ rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+ rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+ rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+ rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+ rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+ rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+ rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+ rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+ rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+ rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+ rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+ rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+ rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+ rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+ rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+ rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+ rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+ rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+
+ id_cmp = rb_intern("<=>");
+ id_random = rb_intern("random");
+ id_div = rb_intern("div");
+ id_power = rb_intern("**");
}
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+def the_answer_to_life_the_universe_and_everything
+ (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
new file mode 100644
index 0000000000..ffab116fcd
--- /dev/null
+++ b/benchmark/bm_app_aobench.rb
@@ -0,0 +1,291 @@
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsmpling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+ ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+ if(n > 1)
+ n * fact(n-1)
+ else
+ 1
+ end
+end
+
+100.times {
+ fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/bm_app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+# "Understanding Computation" by Tom Stuart
+# http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST = -> l { LEFT[RIGHT[l]] }
+IF = -> b { b }
+LEFT = -> p { p[-> x { -> y { x } } ] }
+RIGHT = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY = LEFT
+REST = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+ proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+ IF[proc][true][false]
+end
+
+def to_array(proc)
+ array = []
+
+ until to_boolean(IS_EMPTY[proc])
+ array.push(FIRST[proc])
+ proc = REST[proc]
+ end
+
+ array
+end
+
+def to_char(c)
+ '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+ to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+ to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+ i = 0
+ while i<100
+ i += 1
+ z = z * z
+ return false if z.abs > 2
+ end
+ true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+ (0..1000).each{|dy|
+ x = dx / 50.0
+ y = dy / 50.0
+ c = Complex(x, y)
+ ary << c if mandelbrot?(c)
+ }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+ for x in nb
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ for d in [-ROW, -1, 1, ROW]
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ end
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ end
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ for i in 0...ROW*COL
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ end
+end
+
+def pboard
+ print "No. #$no\n"
+ for i in 0...COL
+ print "|"
+ for j in 0...ROW-NP
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ end
+ print "\n"
+ end
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ for s in x do
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ end
+ if f == 0 then
+ for s in x do
+ $b[pos+s] = i
+ end
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ for s in x do
+ $b[pos+s] = -1
+ end
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+ i += 1
+ begin
+ raise
+ rescue
+ end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+ "#{1+1} #{1+1} #{1+1}"
+ i += 1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+ if x <= y
+ then y
+ else tarai(tarai(x-1, y, z),
+ tarai(y-1, z, x),
+ tarai(z-1, x, y))
+ end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+ uri = URI.parse('http://www.ruby-lang.org')
+ uri.scheme
+ uri.host
+ uri.port
+}
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/bm_hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/bm_hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
new file mode 100644
index 0000000000..54298ffc9e
--- /dev/null
+++ b/benchmark/bm_hash_aref_sym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
new file mode 100644
index 0000000000..a9be4059e6
--- /dev/null
+++ b/benchmark/bm_hash_aref_sym_long.rb
@@ -0,0 +1,8 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+].map!(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/bm_hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+1000.times do
+ h.flatten
+end
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/bm_hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/bm_hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/bm_hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/bm_hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/bm_hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.keys
+end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/bm_hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+50000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/bm_hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.values
+end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+ f = open(file, 'w')
+ f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+ f.seek 0
+ f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+ f.seek 0
+ f.write str
+}
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+ IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+ ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+ IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+ r, w = IO.pipe
+ r.close
+ ios.push w
+end
+
+nr.times do
+ IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+ #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+ gen = (1..max).each
+ loop do
+ gen.next
+ end
+else
+ require 'generator'
+ gen = Generator.new((0..max))
+ while gen.next?
+ gen.next
+ end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+ i += 1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+ i += 1
+end
diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/bm_securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+ SecureRandom.random_number(100)
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+ # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+ tree[1]
+ else
+ tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+ item_item = 2 * item
+ depth -= 1
+ [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+ [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+ temp_tree = bottom_up_tree(i, depth)
+ check += item_check(temp_tree)
+
+ temp_tree = bottom_up_tree(-i, depth)
+ check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..873214de7c
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+ i += 1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..deb003a594
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i += 1
+ some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+ maxFlips, m, r, check = 0, n-1, n, 0
+ count = (1..n).to_a
+ perm = (1..n).to_a
+
+ while true
+ if check < 30
+ puts "#{perm}"
+ check += 1
+ end
+
+ while r != 1
+ count[r-1] = r
+ r -= 1
+ end
+
+ if perm[0] != 1 and perm[m] != n
+ perml = perm.clone #.dup
+ flips = 0
+ while (k = perml.first ) != 1
+ perml = perml.slice!(0, k).reverse + perml
+ flips += 1
+ end
+ maxFlips = flips if flips > maxFlips
+ end
+ while true
+ if r==n then return maxFlips end
+ perm.insert r,perm.shift
+ break if (count[r] -= 1) > 0
+ r += 1
+ end
+ end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+end
+
+def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+ # create a list of integers (Li1) from 1 to SIZE
+ li1 = (1..SIZE).to_a
+ # copy the list to li2 (not by individual items)
+ li2 = li1.dup
+ # remove each individual item from left side of li2 and
+ # append to right side of li3 (preserving order)
+ li3 = Array.new
+ while (not li2.empty?)
+ li3.push(li2.shift)
+ end
+ # li2 must now be empty
+ # remove each individual item from right side of li3 and
+ # append to right side of li2 (reversing list)
+ while (not li3.empty?)
+ li2.push(li3.pop)
+ end
+ # li3 must now be empty
+ # reverse li1 in place
+ li1.reverse!
+ # check that first item is now SIZE
+ if li1[0] != SIZE then
+ p "not SIZE"
+ 0
+ else
+ # compare li1 and li2 for equality
+ if li1 != li2 then
+ return(0)
+ else
+ # return the length of the list
+ li1.length
+ end
+ end
+end
+
+i = 0
+while i<NUM
+ i += 1
+ result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+# The Computer Language Benchmarks Game
+# http://shootout.alioth.debian.org/
+#
+# contributed by Karl von Laudermann
+# modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49 # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1 # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+ for x in 0..count_size
+ zr = 0.0
+ zi = 0.0
+ cr = (2.0*x/size)-1.5
+ ci = (2.0*y/size)-1.0
+ escape = false
+
+ # To make use of the for..in code, we use a dummy variable,
+ # like one would in C
+ for dummy in 0..ITER
+ tr = zr*zr - zi*zi + cr
+ ti = 2*zr*zi + ci
+ zr, zi = tr, ti
+
+ if (zr*zr+zi*zi) > LIMIT_SQUARED
+ escape = true
+ break
+ end
+ end
+
+ byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+ bit_num += 1
+
+ # Code is very similar for these cases, but using separate blocks
+ # ensures we skip the shifting when it's unnecessary, which is most cases.
+ if (bit_num == 8)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ elsif (x == count_size)
+ byte_acc <<= (8 - bit_num)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ end
+ end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..b8e93bd150
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values ( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop across the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the current row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # following reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is acheived via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticeable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+ e = 0.0
+ nbodies = bodies.size
+
+ for i in 0 ... nbodies
+ b = bodies[i]
+ e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+ for j in (i + 1) ... nbodies
+ b2 = bodies[j]
+ dx = b.x - b2.x
+ dy = b.y - b2.y
+ dz = b.z - b2.z
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ e -= (b.mass * b2.mass) / distance
+ end
+ end
+ e
+end
+
+def offset_momentum(bodies)
+ px, py, pz = 0.0, 0.0, 0.0
+
+ for b in bodies
+ m = b.mass
+ px += b.vx * m
+ py += b.vy * m
+ pz += b.vz * m
+ end
+
+ b = bodies[0]
+ b.vx = - px / SOLAR_MASS
+ b.vy = - py / SOLAR_MASS
+ b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+ # sun
+ Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+ # jupiter
+ Planet.new(
+ 4.84143144246472090e+00,
+ -1.16032004402742839e+00,
+ -1.03622044471123109e-01,
+ 1.66007664274403694e-03,
+ 7.69901118419740425e-03,
+ -6.90460016972063023e-05,
+ 9.54791938424326609e-04),
+
+ # saturn
+ Planet.new(
+ 8.34336671824457987e+00,
+ 4.12479856412430479e+00,
+ -4.03523417114321381e-01,
+ -2.76742510726862411e-03,
+ 4.99852801234917238e-03,
+ 2.30417297573763929e-05,
+ 2.85885980666130812e-04),
+
+ # uranus
+ Planet.new(
+ 1.28943695621391310e+01,
+ -1.51111514016986312e+01,
+ -2.23307578892655734e-01,
+ 2.96460137564761618e-03,
+ 2.37847173959480950e-03,
+ -2.96589568540237556e-05,
+ 4.36624404335156298e-05),
+
+ # neptune
+ Planet.new(
+ 1.53796971148509165e+01,
+ -2.59193146099879641e+01,
+ 1.79258772950371181e-01,
+ 2.68067772490389322e-03,
+ 1.62824170038242295e-03,
+ -9.51592254519715870e-05,
+ 5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+ i = 0
+ while i < nbodies
+ b = BODIES[i]
+ b.move_from_i(BODIES, nbodies, dt, i + 1)
+ i += 1
+ end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ x += 1
+ end
+ end
+ end
+ end
+ end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/bm_so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+ flags = Flags.dup[0,m]
+ count = 0
+ pmax = m - 1
+ p = 2
+ while p <= pmax
+ unless flags[p].zero?
+ count += 1
+ mult = p
+ while mult <= pmax
+ flags[mult] = 0
+ mult += p
+ end
+ end
+ p += 1
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+ break if exponent < 0
+ m = (1 << exponent) * 10_000
+ # m = (2 ** exponent) * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/bm_so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+ items = "\xFF" * ((m / BitsPerChar) + 1)
+ masks = ""
+ BitsPerChar.times do |b|
+ masks << (1 << b).chr
+ end
+
+ count = 0
+ pmax = m - 1
+ 2.step(pmax, 1) do |p|
+ if items[p >> CharExponent][p & LowMask] == 1
+ count += 1
+ p.step(pmax, p) do |mult|
+ a = mult >> CharExponent
+ b = mult & LowMask
+ items[a] -= masks[b] if items[a][b] != 0
+ end
+ end
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+ break if exponent < 0
+ m = 2 ** exponent * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+ def initialize(start_state)
+ @bool = start_state
+ end
+
+ def value
+ @bool
+ end
+
+ def activate
+ @bool = !@bool
+ self
+ end
+end
+
+class NthToggle < Toggle
+ def initialize(start_state, max_counter)
+ super start_state
+ @count_max = max_counter
+ @counter = 0
+ end
+
+ def activate
+ @counter += 1
+ if @counter >= @count_max
+ @bool = !@bool
+ @counter = 0
+ end
+ self
+ end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+ toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+ ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/bm_so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+ d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+ s0 += (2.0 / 3.0) ** (d - 1.0)
+ s1 += 1.0 / Math.sqrt(d)
+ s2 += 1.0 / (d * (d + 1.0))
+ s3 += 1.0 / (d3 * ds * ds)
+ s4 += 1.0 / (d3 * dc * dc)
+ s5 += 1.0 / d
+ s6 += 1.0 / d2
+ s7 += alt / d
+ s8 += alt / (2.0 * d - 1.0)
+
+ alt = -alt
+end
+
+if false
+ printf("%.9f\t(2/3)^k\n", s0)
+ printf("%.9f\tk^-0.5\n", s1)
+ printf("%.9f\t1/k(k+1)\n", s2)
+ printf("%.9f\tFlint Hills\n", s3)
+ printf("%.9f\tCookson Hills\n", s4)
+ printf("%.9f\tHarmonic\n", s5)
+ printf("%.9f\tRiemann Zeta\n", s6)
+ printf("%.9f\tAlternating Harmonic\n", s7)
+ printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
new file mode 100644
index 0000000000..c7d6fbfb4d
--- /dev/null
+++ b/benchmark/bm_so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+ def initialize()
+ @z = Transformation.new 1,0,0,1
+ @x = Transformation.new 0,0,0,0
+ @inverse = Transformation.new 0,0,0,0
+ end
+
+ def next!
+ @y = @z.extract(3)
+ if safe? @y
+ @z = produce(@y)
+ @y
+ else
+ @z = consume @x.next!()
+ next!()
+ end
+ end
+
+ def safe?(digit)
+ digit == @z.extract(4)
+ end
+
+ def produce(i)
+ @inverse.qrst(10,-10*i,0,1).compose(@z)
+ end
+
+ def consume(a)
+ @z.compose(a)
+ end
+end
+
+
+class Transformation
+ attr_reader :q, :r, :s, :t
+ def initialize (q, r, s, t)
+ @q,@r,@s,@t,@k = q,r,s,t,0
+ end
+
+ def next!()
+ @q = @k = @k + 1
+ @r = 4 * @k + 2
+ @s = 0
+ @t = 2 * @k + 1
+ self
+ end
+
+ def extract(j)
+ (@q * j + @r) / (@s * j + @t)
+ end
+
+ def compose(a)
+ self.class.new( @q * a.q,
+ @q * a.r + r * a.t,
+ @s * a.q + t * a.s,
+ @s * a.r + t * a.t
+ )
+ end
+
+ def qrst *args
+ initialize *args
+ self
+ end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+ if n >= WIDTH
+ WIDTH.times {print digits.next!}
+ j += WIDTH
+ else
+ n.times {print digits.next!}
+ (WIDTH-n).times {print " "}
+ j += n
+ end
+ puts "\t:"+j.to_s
+ n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/bm_so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+ (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+ i +=1
+ gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+ seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+ stringlen=seq.length
+ 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+ if $_ =~ />/
+ if seq.length != 0
+ revcomp(seq.join)
+ seq=Array.new
+ end
+ puts $_
+ else
+ $_.sub(/\n/,'')
+ seq.push $_
+ end
+end
+revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/bm_so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+ k += 1
+ count = 0
+ flags = flags0.dup
+ i = 2
+ while i<8192
+ i += 1
+ if flags[i]
+ # remove all multiples of prime: i
+ j = i*i
+ while j < 8192
+ j += i
+ flags[j] = nil
+ end
+ count += 1
+ end
+ end
+end
+count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/bm_so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+ return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+ v, i = nil, nil
+ (0..u.length-1).collect { |i|
+ v = 0
+ for j in 0..u.length-1
+ v += eval_A(i,j)*u[j]
+ end
+ v
+ }
+end
+
+def eval_At_times_u(u)
+ v, i = nil, nil
+ (0..u.length-1).collect{|i|
+ v = 0
+ for j in 0..u.length-1
+ v += eval_A(j,i)*u[j]
+ end
+ v
+ }
+end
+
+def eval_AtA_times_u(u)
+ return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+ v=eval_AtA_times_u(u)
+ u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+ vBv += u[i]*v[i]
+ vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
new file mode 100644
index 0000000000..16906f3605
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar.rb
@@ -0,0 +1,14 @@
+class C
+ attr_reader :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ j = obj.a
+ k = obj.b
+end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
new file mode 100644
index 0000000000..7e7a6b48c0
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar_set.rb
@@ -0,0 +1,14 @@
+class C
+ attr_accessor :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ obj.a = 1
+ obj.b = 2
+end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..a9f56b15ea
--- /dev/null
+++ b/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+ yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ m{
+ }
+end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..ac59ebccf1
--- /dev/null
+++ b/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ j = Const
+ k = Const
+end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..a1596145f2
--- /dev/null
+++ b/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+ i += 1
+ begin
+ begin
+ ensure
+ end
+ ensure
+ end
+end
+
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
new file mode 100644
index 0000000000..d4581439ff
--- /dev/null
+++ b/benchmark/bm_vm1_float_simple.rb
@@ -0,0 +1,7 @@
+i = 0.0; f = 0.0
+while i<30_000_000
+ i += 1
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
new file mode 100644
index 0000000000..e78bca5668
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_lived.rb
@@ -0,0 +1,10 @@
+i = 0
+while i<30_000_000 # while loop 1
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+ i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
new file mode 100644
index 0000000000..b66052dee0
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_complex_long.rb
@@ -0,0 +1,27 @@
+def nested_hash h, n
+ if n == 0
+ ''
+ else
+ 10.times{
+ h[Object.new] = nested_hash(h, n-1)
+ }
+ end
+end
+
+long_lived = Hash.new
+nested_hash long_lived, 6
+
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+ i+=1
+end
+
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
new file mode 100644
index 0000000000..298dbc845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_long.rb
@@ -0,0 +1,13 @@
+long_lived = Array.new(1_000_000){|i| "#{i}"}
+GC.start
+GC.start
+i = 0
+while i<30_000_000 # while loop 1
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+ i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
new file mode 100644
index 0000000000..6b15c1b7bf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_symbol.rb
@@ -0,0 +1,15 @@
+# make many symbols
+50_000.times{|i| sym = "sym#{i}".to_sym}
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+ i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
new file mode 100644
index 0000000000..ecfab51dbf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary.rb
@@ -0,0 +1,10 @@
+long_lived = []
+GC.start
+GC.start
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+ long_lived[0] = short_lived # write barrier
+ i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
new file mode 100644
index 0000000000..017eff4f94
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj.rb
@@ -0,0 +1,13 @@
+class C
+ attr_accessor :foo
+end
+long_lived = C.new
+GC.start
+GC.start
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+ long_lived.foo = short_lived # write barrier
+ i+=1
+end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..68a73cf92f
--- /dev/null
+++ b/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ j = @a
+ k = @a
+end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..bd81b06c34
--- /dev/null
+++ b/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ @a = 1
+ @b = 2
+end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..353de3ab0e
--- /dev/null
+++ b/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ a.length
+ b.length
+end
+
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
new file mode 100644
index 0000000000..36f2068811
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_init.rb
@@ -0,0 +1,18 @@
+def m v
+ unless v
+ # unreachable code
+ v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+ v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+ v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+ v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+ v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+ end
+end
+
+i = 0
+
+while i<30_000_000 # while loop 1
+ i += 1
+ m i
+end
+
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
new file mode 100644
index 0000000000..222e864134
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..bbb4ae07a4
--- /dev/null
+++ b/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+ i += 1
+ obj1 != obj2
+end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..b09ecdcc21
--- /dev/null
+++ b/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+ i += 1
+ !obj
+end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..b0d3e2bdfa
--- /dev/null
+++ b/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ begin
+ rescue
+ end
+end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..63f9f21675
--- /dev/null
+++ b/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+ return 1
+end
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ m
+end
+
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..918f8b2112
--- /dev/null
+++ b/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i = 0
+while i<30_000_000 # while loop 1
+ i += 1
+ a, b = b, a
+end
+
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
new file mode 100644
index 0000000000..775597cea6
--- /dev/null
+++ b/benchmark/bm_vm1_yield.rb
@@ -0,0 +1,10 @@
+def m
+ i = 0
+ while i<30_000_000 # while loop 1
+ i += 1
+ yield
+ end
+end
+
+m{}
+
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..df9037c83c
--- /dev/null
+++ b/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
new file mode 100644
index 0000000000..b02509d6a2
--- /dev/null
+++ b/benchmark/bm_vm2_bigarray.rb
@@ -0,0 +1,106 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ a = [
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ ]
+end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
new file mode 100644
index 0000000000..5e3f437bb8
--- /dev/null
+++ b/benchmark/bm_vm2_bighash.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<60_000 # benchmark loop 2
+ i += 1
+ a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..adc6e4df0a
--- /dev/null
+++ b/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i = 0
+while i<6_000_000 # while loop 2
+ case :foo
+ when :bar
+ raise
+ when :baz
+ raise
+ when :boo
+ raise
+ when :foo
+ i += 1
+ end
+end
+
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..053ed6c912
--- /dev/null
+++ b/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+ define_method(:m){}
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
new file mode 100644
index 0000000000..58c0f7bbc3
--- /dev/null
+++ b/benchmark/bm_vm2_dstr.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = 'z'
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..307cfc28ef
--- /dev/null
+++ b/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ eval("1")
+end
+
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..a8ccff7138
--- /dev/null
+++ b/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+ nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
new file mode 100644
index 0000000000..2badc73101
--- /dev/null
+++ b/benchmark/bm_vm2_method_missing.rb
@@ -0,0 +1,12 @@
+class C
+ def method_missing mid
+ end
+end
+
+obj = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
new file mode 100644
index 0000000000..b4efb4f520
--- /dev/null
+++ b/benchmark/bm_vm2_method_with_block.rb
@@ -0,0 +1,9 @@
+def m
+ nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..7362f738c5
--- /dev/null
+++ b/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ m.synchronize{}
+end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
new file mode 100644
index 0000000000..6422c9b0d0
--- /dev/null
+++ b/benchmark/bm_vm2_newlambda.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ lambda {}
+end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..c82c0e4bce
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+ def m
+ 1
+ end
+end
+class C2
+ def m
+ 2
+ end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ o = (i % 2 == 0) ? o1 : o2
+ o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..aa5fd1dd38
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+ def m
+ 1
+ end
+end
+class C2
+ def m
+ 2
+ end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ o = (i % 2 == 0) ? o1 : o2
+# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..65e5217371
--- /dev/null
+++ b/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+ b
+end
+
+pr = m{
+ a = 1
+}
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ pr.call
+end
+
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
new file mode 100644
index 0000000000..aa5387987f
--- /dev/null
+++ b/benchmark/bm_vm2_raise1.rb
@@ -0,0 +1,18 @@
+def rec n
+ if n > 0
+ rec n-1
+ else
+ raise
+ end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+
+ begin
+ rec 1
+ rescue
+ # ignore
+ end
+end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
new file mode 100644
index 0000000000..1f61c63157
--- /dev/null
+++ b/benchmark/bm_vm2_raise2.rb
@@ -0,0 +1,18 @@
+def rec n
+ if n > 0
+ rec n-1
+ else
+ raise
+ end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+
+ begin
+ rec 10
+ rescue
+ # ignore
+ end
+end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..55f9e957a3
--- /dev/null
+++ b/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i = 0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+ /hoge/ =~ str
+ i += 1
+end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..6a3ab6fdab
--- /dev/null
+++ b/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+ def m
+ end
+end
+
+o = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ o.__send__ :m
+end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..afd8579e7b
--- /dev/null
+++ b/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+ def m
+ 1
+ end
+end
+
+class CC < C
+ def m
+ super()
+ end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+ obj.m
+ i += 1
+end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..1774625942
--- /dev/null
+++ b/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ m 100, 200
+end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..2a43e62217
--- /dev/null
+++ b/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+ def m a
+ 1
+ end
+end
+
+class CC < C
+ def m a
+ super
+ end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+ obj.m 10
+ i += 1
+end
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
new file mode 100644
index 0000000000..0fbf73e1ca
--- /dev/null
+++ b/benchmark/bm_vm3_backtrace.rb
@@ -0,0 +1,22 @@
+# get last backtrace
+
+begin
+ caller(0, 0)
+rescue ArgumentError
+ alias caller_orig caller
+ def caller lev, n
+ caller_orig(lev)[0..n]
+ end
+end
+
+def rec n
+ if n < 0
+ 100_000.times{
+ caller(0, 1)
+ }
+ else
+ rec(n-1)
+ end
+end
+
+rec 50
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
new file mode 100644
index 0000000000..9661323cd2
--- /dev/null
+++ b/benchmark/bm_vm3_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<200_000
+ i += 1
+
+ Class.new{
+ def m; end
+ }
+end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
new file mode 100755
index 0000000000..7db9829d44
--- /dev/null
+++ b/benchmark/bm_vm3_gc.rb
@@ -0,0 +1,7 @@
+#! /usr/bin/ruby
+5000.times do
+ 100.times do
+ {"xxxx"=>"yyyy"}
+ end
+ GC.start
+end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+ t = Thread.new{}
+ while t.alive?
+ Thread.pass
+ end
+}
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
new file mode 100644
index 0000000000..3e9a265ce8
--- /dev/null
+++ b/benchmark/bm_vm_thread_close.rb
@@ -0,0 +1,6 @@
+1000.times { Thread.new { sleep } }
+i = 0
+while i<100_000 # benchmark loop 3
+ i += 1
+ IO.pipe.each(&:close)
+end
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
new file mode 100644
index 0000000000..393cd45df9
--- /dev/null
+++ b/benchmark/bm_vm_thread_create_join.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<100_000 # benchmark loop 3
+ i += 1
+ Thread.new{
+ }.join
+end
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
new file mode 100644
index 0000000000..5c9f85dfb7
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+ Thread.new{
+ i = 0
+ while i<lmax
+ i += 1
+ m.synchronize{
+ r += 1
+ }
+ end
+ }
+}.each{|e|
+ e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
new file mode 100644
index 0000000000..10de59054f
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+ Thread.new{
+ i = 0
+ while i<lmax
+ i += 1
+ m.synchronize{
+ r += 1
+ }
+ end
+ }
+}.each{|e|
+ e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
new file mode 100644
index 0000000000..7f9a44b39d
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+ Thread.new{
+ i = 0
+ while i<max
+ i += 1
+ m.synchronize{
+ r += 1
+ }
+ end
+ }
+}.each{|e|
+ e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+ Thread.new{
+ lmax.times{
+ Thread.pass
+ }
+ }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..27157d1a6f
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,8 @@
+1000.times{
+ Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10000
+ i += 1
+end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
new file mode 100644
index 0000000000..272d231eba
--- /dev/null
+++ b/benchmark/bm_vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Mesure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+ lmax.times{
+ w.write('a')
+ }
+ p "w:exit"
+}, Thread.new{
+ lmax.times{
+ r.read(1)
+ }
+ p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
new file mode 100644
index 0000000000..37381ae62b
--- /dev/null
+++ b/benchmark/bm_vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 1_000_000
+q = Queue.new
+consumer = Thread.new{
+ while q.pop
+ # consuming
+ end
+}
+
+producer = Thread.new{
+ n.times{
+ q.push true
+ }
+ q.push nil
+}
+
+consumer.join
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
new file mode 100644
index 0000000000..3904e25503
--- /dev/null
+++ b/benchmark/driver.rb
@@ -0,0 +1,321 @@
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+ require 'optparse'
+rescue LoadError
+ if first
+ first = false
+ $:.unshift File.join(File.dirname(__FILE__), '../lib')
+ retry
+ else
+ raise
+ end
+end
+
+require 'benchmark'
+require 'pp'
+
+class BenchmarkDriver
+ def self.benchmark(opt)
+ driver = self.new(opt[:execs], opt[:dir], opt)
+ begin
+ driver.run
+ ensure
+ driver.show_results
+ end
+ end
+
+ def output *args
+ puts(*args)
+ @output and @output.puts(*args)
+ end
+
+ def message *args
+ output(*args) if @verbose
+ end
+
+ def message_print *args
+ if @verbose
+ print(*args)
+ STDOUT.flush
+ @output and @output.print(*args)
+ end
+ end
+
+ def progress_message *args
+ unless STDOUT.tty?
+ STDERR.print(*args)
+ STDERR.flush
+ end
+ end
+
+ def initialize execs, dir, opt = {}
+ @execs = execs.map{|e|
+ e.strip!
+ next if e.empty?
+
+ if /(.+)::(.+)/ =~ e
+ # ex) ruby-a::/path/to/ruby-a
+ label = $1.strip
+ path = $2
+ version = `#{path} -v`.chomp
+ else
+ path = e
+ version = label = `#{path} -v`.chomp
+ end
+ [path, label, version]
+ }.compact
+
+ @dir = dir
+ @repeat = opt[:repeat] || 1
+ @repeat = 1 if @repeat < 1
+ @pattern = opt[:pattern] || nil
+ @exclude = opt[:exclude] || nil
+ @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+ @output = opt[:output] ? open(opt[:output], 'w') : nil
+ @rawdata_output = opt[:rawdata_output] ? open(opt[:rawdata_output], 'w') : nil
+ @loop_wl1 = @loop_wl2 = nil
+ @ruby_arg = opt[:ruby_arg] || nil
+ @opt = opt
+
+ # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+ @results = []
+
+ if @verbose
+ @start_time = Time.now
+ message @start_time
+ @execs.each_with_index{|(path, label, version), i|
+ message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
+ }
+ end
+ end
+
+ def adjusted_results name, results
+ s = nil
+ results.each_with_index{|e, i|
+ r = e.min
+ case name
+ when /^vm1_/
+ if @loop_wl1
+ r -= @loop_wl1[i]
+ r = 0 if r < 0
+ s = '*'
+ end
+ when /^vm2_/
+ if @loop_wl2
+ r -= @loop_wl2[i]
+ r = 0 if r < 0
+ s = '*'
+ end
+ end
+ yield r
+ }
+ s
+ end
+
+ def show_results
+ output
+
+ if @verbose
+ message '-----------------------------------------------------------'
+ message 'raw data:'
+ message
+ message PP.pp(@results, "", 79)
+ message
+ message "Elapsed time: #{Time.now - @start_time} (sec)"
+ end
+
+ if @rawdata_output
+ h = {}
+ h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
+ h[:executables] = @execs
+ h[:results] = @results
+ @rawdata_output.puts h.inspect
+ end
+
+ output '-----------------------------------------------------------'
+ output 'benchmark results:'
+
+ if @verbose and @repeat > 1
+ output "minimum results in each #{@repeat} measurements."
+ end
+
+ output "Execution time (sec)"
+ output "name\t#{@execs.map{|(_, v)| v}.join("\t")}"
+ @results.each{|v, result|
+ rets = []
+ s = adjusted_results(v, result){|r|
+ rets << sprintf("%.3f", r)
+ }
+ output "#{v}#{s}\t#{rets.join("\t")}"
+ }
+
+ if @execs.size > 1
+ output
+ output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
+ output "name\t#{@execs[1..-1].map{|(_, v)| v}.join("\t")}"
+ @results.each{|v, result|
+ rets = []
+ first_value = nil
+ s = adjusted_results(v, result){|r|
+ if first_value
+ if r == 0
+ rets << "Error"
+ else
+ rets << sprintf("%.3f", first_value/r)
+ end
+ else
+ first_value = r
+ end
+ }
+ output "#{v}#{s}\t#{rets.join("\t")}"
+ }
+ end
+
+ if @opt[:output]
+ output
+ output "Log file: #{@opt[:output]}"
+ end
+ end
+
+ def files
+ flag = {}
+ @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+ next if @pattern && /#{@pattern}/ !~ File.basename(file)
+ next if @exclude && /#{@exclude}/ =~ File.basename(file)
+ case file
+ when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+ flag[$1] = true
+ end
+ file
+ }.compact
+
+ if flag['vm1'] && !flag['whileloop']
+ @files << File.join(@dir, 'bm_loop_whileloop.rb')
+ elsif flag['vm2'] && !flag['whileloop2']
+ @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+ end
+
+ @files.sort!
+ progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+ @files
+ end
+
+ def run
+ files.each_with_index{|file, i|
+ @i = i
+ r = measure_file(file)
+
+ if /bm_loop_whileloop.rb/ =~ file
+ @loop_wl1 = r[1].map{|e| e.min}
+ elsif /bm_loop_whileloop2.rb/ =~ file
+ @loop_wl2 = r[1].map{|e| e.min}
+ end
+ }
+ end
+
+ def measure_file file
+ name = File.basename(file, '.rb').sub(/^bm_/, '')
+ prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+ load prepare_file if FileTest.exist?(prepare_file)
+
+ if @verbose
+ output
+ output '-----------------------------------------------------------'
+ output name
+ output
+ output File.read(file)
+ output
+ end
+
+ result = [name]
+ result << @execs.map{|(e, v)|
+ (0...@repeat).map{
+ message_print "#{v}\t"
+ progress_message '.'
+
+ m = measure(e, file)
+ message "#{m}"
+ m
+ }
+ }
+ @results << result
+ result
+ end
+
+ unless defined?(File::NULL)
+ if File.exist?('/dev/null')
+ File::NULL = '/dev/null'
+ end
+ end
+
+ def measure executable, file
+ cmd = "#{executable} #{@ruby_arg} #{file}"
+
+ m = Benchmark.measure{
+ system(cmd, out: File::NULL)
+ }
+
+ if $? != 0
+ output "\`#{cmd}\' exited with abnormal status (#{$?})"
+ 0
+ else
+ m.real
+ end
+ end
+end
+
+if __FILE__ == $0
+ opt = {
+ :execs => [],
+ :dir => File.dirname(__FILE__),
+ :repeat => 1,
+ :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}",
+ :raw_output => nil
+ }
+
+ parser = OptionParser.new{|o|
+ o.on('-e', '--executables [EXECS]',
+ "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
+ e.split(/;/).each{|path|
+ opt[:execs] << path
+ }
+ }
+ o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+ opt[:dir] = d
+ }
+ o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+ opt[:pattern] = p
+ }
+ o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
+ opt[:exclude] = e
+ }
+ o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+ opt[:repeat] = n.to_i
+ }
+ o.on('-o', '--output-file [FILE]', "Output file"){|f|
+ opt[:output] = f
+ }
+ o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
+ opt[:ruby_arg] = a
+ }
+ o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
+ opt[:rawdata_output] = r
+ }
+ o.on('-v', '--verbose'){|v|
+ opt[:verbose] = v
+ }
+ o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+ opt[:quiet] = q
+ opt[:verbose] = false
+ }
+ }
+
+ parser.parse!(ARGV)
+ BenchmarkDriver.benchmark(opt)
+end
+
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..2eed7abc83
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..af8ea722aa
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..09a404466a
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,56 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = true
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+ GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+ load script
+}
+
+gc_time = 0
+
+if $gcprof
+ gc_time = GC::Profiler.total_time
+ GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+ GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+ puts
+ puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts " (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+ h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+ ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+ h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..94ba74be89
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+ dir = File.join(d, 'rdocbench')
+ args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+ args << '--op' << dir
+
+ r = RDoc::RDoc.new
+ r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+ class Node
+ attr_accessor :color
+ attr_accessor :key
+ attr_accessor :left
+ attr_accessor :right
+ attr_accessor :parent
+
+ RED = :red
+ BLACK = :black
+ COLORS = [RED, BLACK].freeze
+
+ def initialize(key, color = RED)
+ raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+ @color = color
+ @key = key
+ @left = @right = @parent = NilNode.instance
+ end
+
+ def black?
+ return color == BLACK
+ end
+
+ def red?
+ return color == RED
+ end
+ end
+
+ class NilNode < Node
+ class << self
+ private :new
+
+ # it's not thread safe
+ def instance
+ @instance ||= begin
+ def instance
+ return @instance
+ end
+
+ new
+ end
+ end
+ end
+
+ def initialize
+ self.color = BLACK
+ self.key = 0
+ self.left = nil
+ self.right = nil
+ self.parent = nil
+ end
+
+ def nil?
+ return true
+ end
+ end
+
+ include Enumerable
+
+ attr_accessor :root
+ attr_accessor :size
+
+ def initialize
+ self.root = NilNode.instance
+ self.size = 0
+ end
+
+ def add(key)
+ insert(Node.new(key))
+ end
+
+ def insert(x)
+ insert_helper(x)
+
+ x.color = Node::RED
+ while x != root && x.parent.color == Node::RED
+ if x.parent == x.parent.parent.left
+ y = x.parent.parent.right
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.right
+ x = x.parent
+ left_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ right_rotate(x.parent.parent)
+ end
+ else
+ y = x.parent.parent.left
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.left
+ x = x.parent
+ right_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ left_rotate(x.parent.parent)
+ end
+ end
+ end
+ root.color = Node::BLACK
+ end
+
+ alias << insert
+
+ def delete(z)
+ y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+ x = y.left.nil? ? y.right : y.left
+ x.parent = y.parent
+
+ if y.parent.nil?
+ self.root = x
+ else
+ if y == y.parent.left
+ y.parent.left = x
+ else
+ y.parent.right = x
+ end
+ end
+
+ z.key = y.key if y != z
+
+ if y.color == Node::BLACK
+ delete_fixup(x)
+ end
+
+ self.size -= 1
+ return y
+ end
+
+ def minimum(x = root)
+ while !x.left.nil?
+ x = x.left
+ end
+ return x
+ end
+
+ def maximum(x = root)
+ while !x.right.nil?
+ x = x.right
+ end
+ return x
+ end
+
+ def successor(x)
+ if !x.right.nil?
+ return minimum(x.right)
+ end
+ y = x.parent
+ while !y.nil? && x == y.right
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def predecessor(x)
+ if !x.left.nil?
+ return maximum(x.left)
+ end
+ y = x.parent
+ while !y.nil? && x == y.left
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def inorder_walk(x = root)
+ x = self.minimum
+ while !x.nil?
+ yield x.key
+ x = successor(x)
+ end
+ end
+
+ alias each inorder_walk
+
+ def reverse_inorder_walk(x = root)
+ x = self.maximum
+ while !x.nil?
+ yield x.key
+ x = predecessor(x)
+ end
+ end
+
+ alias reverse_each reverse_inorder_walk
+
+ def search(key, x = root)
+ while !x.nil? && x.key != key
+ key < x.key ? x = x.left : x = x.right
+ end
+ return x
+ end
+
+ def empty?
+ return self.root.nil?
+ end
+
+ def black_height(x = root)
+ height = 0
+ while !x.nil?
+ x = x.left
+ height +=1 if x.nil? || x.black?
+ end
+ return height
+ end
+
+private
+
+ def left_rotate(x)
+ raise "x.right is nil!" if x.right.nil?
+ y = x.right
+ x.right = y.left
+ y.left.parent = x if !y.left.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.left = x
+ x.parent = y
+ end
+
+ def right_rotate(x)
+ raise "x.left is nil!" if x.left.nil?
+ y = x.left
+ x.left = y.right
+ y.right.parent = x if !y.right.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.right = x
+ x.parent = y
+ end
+
+ def insert_helper(z)
+ y = NilNode.instance
+ x = root
+ while !x.nil?
+ y = x
+ z.key < x.key ? x = x.left : x = x.right
+ end
+ z.parent = y
+ if y.nil?
+ self.root = z
+ else
+ z.key < y.key ? y.left = z : y.right = z
+ end
+ self.size += 1
+ end
+
+ def delete_fixup(x)
+ while x != root && x.color == Node::BLACK
+ if x == x.parent.left
+ w = x.parent.right
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ left_rotate(x.parent)
+ w = x.parent.right
+ end
+ if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.right.color == Node::BLACK
+ w.left.color = Node::BLACK
+ w.color = Node::RED
+ right_rotate(w)
+ w = x.parent.right
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.right.color = Node::BLACK
+ left_rotate(x.parent)
+ x = root
+ end
+ else
+ w = x.parent.left
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ right_rotate(x.parent)
+ w = x.parent.left
+ end
+ if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.left.color == Node::BLACK
+ w.right.color = Node::BLACK
+ w.color = Node::RED
+ left_rotate(w)
+ w = x.parent.left
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.left.color = Node::BLACK
+ right_rotate(x.parent)
+ x = root
+ end
+ end
+ end
+ x.color = Node::BLACK
+ end
+end
+
+def rbt_bm
+ n = 100_000
+ a1 = []; n.times { a1 << rand(999_999) }
+ a2 = []; n.times { a2 << rand(999_999) }
+
+ start = Time.now
+
+ tree = RedBlackTree.new
+
+ n.times {|i| tree.add(i) }
+ n.times { tree.delete(tree.root) }
+
+ tree = RedBlackTree.new
+ a1.each {|e| tree.add(e) }
+ a2.each {|e| tree.search(e) }
+ tree.inorder_walk {|key| key + 1 }
+ tree.reverse_inorder_walk {|key| key + 1 }
+ n.times { tree.minimum }
+ n.times { tree.maximum }
+
+ return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+ # puts rbt_bm.to_f
+ rbt_bm.to_f
+ # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+ attr_reader :next_ring
+ def initialize n = nil
+ @next_ring = n
+ end
+
+
+ def size
+ s = 1
+ ring = self
+ while ring.next_ring
+ s += 1
+ ring = ring.next_ring
+ end
+ s
+ end
+end
+
+ring = Ring.new
+
+max.times{
+ ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+end
+
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+ return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+ : Ack($_[0]-1, 1))
+ : $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+ if (not M):
+ return( N + 1 )
+ if (not N):
+ return( Ack(M-1, 1) )
+ return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+ NUM = 9
+ sys.setrecursionlimit(10000)
+ Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+ (cond ((zero? m) (+ n 1))
+ ((zero? n) (ack (- m 1) 1))
+ (else (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+ loop
+ ack
+ fib
+ tak
+ fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+ ruby-cyg
+ ../../../test6/miniruby
+ perl
+ python
+ gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+ .rb
+ .rb
+ .pl
+ .py
+ .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+ m = Benchmark.measure{
+ #p cmd
+ system(cmd)
+ }
+ [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+ r = []
+ Lang.each_with_index{|l, idx|
+ cmd = "#{l} #{b}#{Ext[idx]}"
+ r << bench(cmd)
+ }
+ Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+ print b, "\t"
+ puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+ print b, "\t"
+ puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+ my $n = @_[0];
+ if($n < 2){
+ return 1;
+ }
+ else{
+ return $n * fact($n-1);
+ }
+}
+
+for($i=0; $i<10000; $i++){
+ &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..01593965d9
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+ r = 1
+ for x in range(2, n):
+ r *= x
+ return r
+
+def factR(n):
+ if n < 2:
+ return 1
+ else:
+ return n * factR(n-1)
+
+for i in range(10000):
+ factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..6cedc752cd
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+ if n < 2
+ 1
+ else
+ n * fact(n-1)
+ end
+end
+
+i = 0
+while i<10000
+ i += 1
+ fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+ (if (< n 2)
+ 1
+ (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+ (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+ my $n = $_[0];
+ if($n < 3){
+ return 1;
+ }
+ else{
+ return fib($n-1) + fib($n-2);
+ }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+ if n < 3:
+ return 1
+ else:
+ return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+ (if (< n 3)
+ 1
+ (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+ pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..b367b9dbf3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30000000
+ i += 1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+ local($x, $y, $z) = @_;
+ if (!($y < $x)) {
+ return $z;
+ } else {
+ return &tak(&tak($x - 1, $y, $z),
+ &tak($y - 1, $z, $x),
+ &tak($z - 1, $x, $y));
+ }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+ if not(y<x):
+ return z
+ else:
+ return tak(tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+ (if (not (< y x))
+ z
+ (tak (tak (- x 1) y z)
+ (tak (- y 1) z x)
+ (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
new file mode 100644
index 0000000000..ee2138cdb2
--- /dev/null
+++ b/benchmark/prepare_so_count_words.rb
@@ -0,0 +1,15 @@
+# prepare 'wc.input'
+
+def prepare_wc_input
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ wcbase = File.join(File.dirname($0), 'wc.input.base')
+ unless FileTest.exist?(wcinput)
+ data = File.read(wcbase)
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+end
+
+prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..d83aeb7a7e
--- /dev/null
+++ b/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..da3ec2df14
--- /dev/null
+++ b/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(2_500_000)
diff --git a/benchmark/report.rb b/benchmark/report.rb
new file mode 100644
index 0000000000..d2dc56b1e1
--- /dev/null
+++ b/benchmark/report.rb
@@ -0,0 +1,79 @@
+#
+# YARV benchmark driver
+#
+
+require 'yarvutil'
+require 'benchmark'
+require 'rbconfig'
+
+def exec_command type, file, w
+ <<-EOP
+ $DRIVER_PATH = '#{File.dirname($0)}'
+ $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
+ require 'benchmark'
+ require 'yarvutil'
+# print '#{type}'
+ begin
+ puts Benchmark.measure{
+ #{w}('#{file}')
+ }.utime
+ rescue Exception => exec_command_error_variable
+ puts "\t" + exec_command_error_variable.message
+ end
+ EOP
+end
+
+def benchmark cmd
+ rubybin = ENV['RUBY'] || RbConfig.ruby
+
+ IO.popen(rubybin, 'r+'){|io|
+ io.write cmd
+ io.close_write
+ return io.gets
+ }
+end
+
+def ruby_exec file
+ prog = exec_command 'ruby', file, 'load'
+ benchmark prog
+end
+
+def yarv_exec file
+ prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
+ benchmark prog
+end
+
+$wr = $wy = nil
+
+def measure bench
+ file = File.dirname($0) + "/bm_#{bench}.rb"
+ r = ruby_exec(file).to_f
+ y = yarv_exec(file).to_f
+ puts "#{bench}\t#{r}\t#{y}"
+end
+
+def measure2
+ r = ruby_exec.to_f
+ y = yarv_exec.to_f
+ puts r/y
+end
+
+if $0 == __FILE__
+ %w{
+ whileloop
+ whileloop2
+ times
+ const
+ method
+ poly_method
+ block
+ rescue
+ rescue2
+ }.each{|bench|
+ measure bench
+ }
+end
+
+
+
+
diff --git a/benchmark/run.rb b/benchmark/run.rb
new file mode 100644
index 0000000000..0cd2363849
--- /dev/null
+++ b/benchmark/run.rb
@@ -0,0 +1,127 @@
+#
+# Ruby benchmark driver
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$matzrubyonly = false
+$rubyonly = false
+
+$results = []
+
+# prepare 'wc.input'
+def prepare_wc_input
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ wcbase = File.join(File.dirname($0), 'wc.input.base')
+ unless FileTest.exist?(wcinput)
+ data = File.read(wcbase)
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+end
+
+prepare_wc_input
+
+def bm file
+ prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
+ return if prog.empty?
+
+ /[a-z]+_(.+)\.rb/ =~ file
+ bm_name = $1
+ puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
+ puts "#{bm_name}: "
+
+
+puts <<EOS unless $matzrubyonly || $rubyonly
+#{prog}
+--
+EOS
+ begin
+ result = [bm_name]
+ result << matzruby_exec(file) unless $rubyonly
+ result << ruby_exec(file) unless $matzrubyonly
+ $results << result
+
+ rescue Exception => e
+ puts
+ puts "** benchmark failure: #{e}"
+ puts e.backtrace
+ end
+end
+
+def benchmark file, bin
+ m = Benchmark.measure{
+ `#{bin} #{$opts} #{file}`
+ }
+ sec = '%.3f' % m.real
+ puts " #{sec}"
+ sec
+end
+
+def ruby_exec file
+ print 'ruby'
+ benchmark file, $ruby_program
+end
+
+def matzruby_exec file
+ print 'matz'
+ rubylib = ENV['RUBYLIB']
+ ENV['RUBYLIB'] = ''
+ r = benchmark file, $matzruby_program
+ ENV['RUBYLIB'] = rubylib
+ r
+end
+
+if $0 == __FILE__
+ ARGV.each{|arg|
+ case arg
+ when /\A--ruby=(.+)/
+ $ruby_program = $1
+ when /\A--matzruby=(.+)/
+ $matzruby_program = $1
+ when /\A--opts=(.+)/
+ $opts = $1
+ when /\A(-r|--only-ruby)\z/
+ $rubyonly = true
+ when /\A(-m|--only-matzruby)\z/
+ $matzrubyonly = true
+ end
+ }
+ ARGV.delete_if{|arg|
+ /\A-/ =~ arg
+ }
+
+ puts "MatzRuby:"
+ system("#{$matzruby_program} -v")
+ puts "Ruby:"
+ system("#{$ruby_program} -v")
+ puts
+
+ if ARGV.empty?
+ Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
+ bm file
+ }
+ else
+ ARGV.each{|file|
+ Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
+ # file = "#{File.dirname(__FILE__)}/#{file}.rb"
+ bm ef
+ }
+ }
+ end
+
+ puts
+ puts "-- benchmark summary ---------------------------"
+ $results.each{|res|
+ print res.shift, "\t"
+ (res||[]).each{|result|
+ /([\d\.]+)/ =~ result
+ print $1 + "\t" if $1
+ }
+ puts
+ }
+end
+
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
new file mode 100644
index 0000000000..97c5cef045
--- /dev/null
+++ b/benchmark/runc.rb
@@ -0,0 +1,27 @@
+#
+#
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$rubybin = ENV['RUBY'] || RbConfig.ruby
+
+def runfile file
+ puts file
+ file = File.join(File.dirname($0), 'contrib', file)
+ Benchmark.bm{|x|
+ x.report('ruby'){
+ system("#{$rubybin} #{file}")
+ }
+ x.report('yarv'){
+ system("#{$rubybin} -rite -I.. #{file}")
+ }
+ }
+end
+
+ARGV.each{|file|
+ runfile file
+}
+
+
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
new file mode 100644
index 0000000000..41143fbac0
--- /dev/null
+++ b/benchmark/wc.input.base
@@ -0,0 +1,25 @@
+Subject: Re: Who was Izchak Miller?
+From: "Jane D. Anonymous" <nobody@yale.edu>
+Date: 1996/04/28
+Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
+References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+To: 75176.2330@compuserve.com
+Content-Type: text/plain; charset=us-ascii
+Organization: Yale University
+X-Url: news:4lk6vl$gde@ns.oar.net
+Mime-Version: 1.0
+Newsgroups: rec.games.roguelike.nethack
+X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+Hello there, Izchak Miller was my father. When I was younger I spent
+many a night, hunched over the keyboard with a cup of tea, playing
+nethack with him and my brother. my dad was a philosopher with a strong
+weakness for fantasy/sci fi. I remember when he started to get involved
+with the Nethack team- my brother's Dungeons and Dragons monster book
+found a regular place beside my dad's desk. it's nice to see him living
+on in the game he loved so much :-).
+ Tamar Miller
+
+The following is a really long word of 5000 characters:
+
+wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index 3671dae8d9..08b4337262 100644
--- a/bignum.c
+++ b/bignum.c
@@ -1,402 +1,5081 @@
-/************************************************
+/**********************************************************************
bignum.c -
$Author$
- $Date$
created at: Fri Jun 10 00:48:55 JST 1994
-************************************************/
+ Copyright (C) 1993-2007 Yukihiro Matsumoto
-#include "ruby.h"
+**********************************************************************/
+
+#include "ruby/ruby.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "internal.h"
+
+#ifdef HAVE_STRINGS_H
+#include <strings.h>
+#endif
#include <math.h>
+#include <float.h>
#include <ctype.h>
+#ifdef HAVE_IEEEFP_H
+#include <ieeefp.h>
+#endif
+#include <assert.h>
+
+#if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
+#define USE_GMP
+#include <gmp.h>
+#endif
+
+#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
VALUE rb_cBignum;
-typedef unsigned short USHORT;
+const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+
+#ifndef SIZEOF_BDIGIT_DBL
+# if SIZEOF_INT*2 <= SIZEOF_LONG_LONG
+# define SIZEOF_BDIGIT_DBL SIZEOF_LONG_LONG
+# else
+# define SIZEOF_BDIGIT_DBL SIZEOF_LONG
+# endif
+#endif
-#define BDIGITS(x) RBIGNUM(x)->digits
-#define BITSPERDIG (sizeof(short)*CHAR_BIT)
-#define BIGRAD (1L << BITSPERDIG)
-#define DIGSPERINT ((unsigned int)(sizeof(long)/sizeof(short)))
-#define BIGUP(x) ((unsigned long)(x) << BITSPERDIG)
-#define BIGDN(x) (((x)<0) ? ~((~(x))>>BITSPERDIG) : (x)>>BITSPERDIG)
-#define BIGLO(x) ((USHORT)((x) & (BIGRAD-1)))
+STATIC_ASSERT(sizeof_bdigit_dbl, sizeof(BDIGIT_DBL) == SIZEOF_BDIGIT_DBL);
+STATIC_ASSERT(sizeof_bdigit_dbl_signed, sizeof(BDIGIT_DBL_SIGNED) == SIZEOF_BDIGIT_DBL);
+STATIC_ASSERT(sizeof_bdigit, SIZEOF_BDIGIT <= sizeof(BDIGIT));
+STATIC_ASSERT(sizeof_bdigit_and_dbl, SIZEOF_BDIGIT*2 <= SIZEOF_BDIGIT_DBL);
+STATIC_ASSERT(bdigit_signedness, 0 < (BDIGIT)-1);
+STATIC_ASSERT(bdigit_dbl_signedness, 0 < (BDIGIT_DBL)-1);
+STATIC_ASSERT(bdigit_dbl_signed_signedness, 0 > (BDIGIT_DBL_SIGNED)-1);
+STATIC_ASSERT(rbignum_embed_len_max, BIGNUM_EMBED_LEN_MAX <= (BIGNUM_EMBED_LEN_MASK >> BIGNUM_EMBED_LEN_SHIFT));
+
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_LONG % SIZEOF_BDIGIT == 0);
+#else
+STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
+#endif
-static VALUE
-bignew_1(klass, len, sign)
- VALUE klass;
- int len;
- char sign;
+#ifdef WORDS_BIGENDIAN
+# define HOST_BIGENDIAN_P 1
+#else
+# define HOST_BIGENDIAN_P 0
+#endif
+#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
+/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio. */
+#define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
+#define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
+#define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
+#define FILL_LOWBITS(d, numbits) ((d) | (LSHIFTX(((d)*0+1), (numbits))-1))
+#define POW2_P(x) (((x)&((x)-1))==0)
+
+#define BDIGITS(x) (BIGNUM_DIGITS(x))
+#define BITSPERDIG (SIZEOF_BDIGIT*CHAR_BIT)
+#define BIGRAD ((BDIGIT_DBL)1 << BITSPERDIG)
+#define BIGRAD_HALF ((BDIGIT)(BIGRAD >> 1))
+#define BDIGIT_MSB(d) (((d) & BIGRAD_HALF) != 0)
+#define BIGUP(x) LSHIFTX(((x) + (BDIGIT_DBL)0), BITSPERDIG)
+#define BIGDN(x) RSHIFT((x),BITSPERDIG)
+#define BIGLO(x) ((BDIGIT)((x) & BDIGMAX))
+#define BDIGMAX ((BDIGIT)(BIGRAD-1))
+#define BDIGIT_DBL_MAX (~(BDIGIT_DBL)0)
+
+#if SIZEOF_BDIGIT == 2
+# define swap_bdigit(x) swap16(x)
+#elif SIZEOF_BDIGIT == 4
+# define swap_bdigit(x) swap32(x)
+#elif SIZEOF_BDIGIT == 8
+# define swap_bdigit(x) swap64(x)
+#endif
+
+#define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
+ (BDIGITS(x)[0] == 0 && \
+ (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
+#define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
+ BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
+ (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
+ rb_absint_size(x, NULL))
+
+#define BIGDIVREM_EXTRA_WORDS 1
+#define roomof(n, m) ((long)(((n)+(m)-1) / (m)))
+#define bdigit_roomof(n) roomof(n, SIZEOF_BDIGIT)
+#define BARY_ARGS(ary) ary, numberof(ary)
+
+#define BARY_ADD(z, x, y) bary_add(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_SUB(z, x, y) bary_sub(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_SHORT_MUL(z, x, y) bary_short_mul(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_DIVMOD(q, r, x, y) bary_divmod(BARY_ARGS(q), BARY_ARGS(r), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_ZERO_P(x) bary_zero_p(BARY_ARGS(x))
+
+#define BIGNUM_SET_NEGATIVE_SIGN(b) BIGNUM_SET_SIGN(b, 0)
+#define BIGNUM_SET_POSITIVE_SIGN(b) BIGNUM_SET_SIGN(b, 1)
+
+#define bignew(len,sign) bignew_1(rb_cBignum,(len),(sign))
+
+#define BDIGITS_ZERO(ptr, n) do { \
+ BDIGIT *bdigitz_zero_ptr = (ptr); \
+ size_t bdigitz_zero_n = (n); \
+ while (bdigitz_zero_n) { \
+ *bdigitz_zero_ptr++ = 0; \
+ bdigitz_zero_n--; \
+ } \
+} while (0)
+
+#define BARY_TRUNC(ds, n) do { \
+ while (0 < (n) && (ds)[(n)-1] == 0) \
+ (n)--; \
+ } while (0)
+
+#define KARATSUBA_BALANCED(xn, yn) ((yn)/2 < (xn))
+#define TOOM3_BALANCED(xn, yn) (((yn)+2)/3 * 2 < (xn))
+
+#define GMP_MUL_DIGITS 20
+#define KARATSUBA_MUL_DIGITS 70
+#define TOOM3_MUL_DIGITS 150
+
+#define GMP_DIV_DIGITS 20
+#define GMP_BIG2STR_DIGITS 20
+#define GMP_STR2BIG_DIGITS 20
+
+typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
+
+static mulfunc_t bary_mul_toom3_start;
+static mulfunc_t bary_mul_karatsuba_start;
+static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
+static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
+
+static VALUE bigmul0(VALUE x, VALUE y);
+static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
+static VALUE bignew_1(VALUE klass, size_t len, int sign);
+static inline VALUE bigtrunc(VALUE x);
+
+static VALUE bigsq(VALUE x);
+static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
+static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
+
+#if SIZEOF_BDIGIT <= SIZEOF_INT
+static int nlz(BDIGIT x) { return nlz_int((unsigned int)x) - (SIZEOF_INT-SIZEOF_BDIGIT) * CHAR_BIT; }
+#elif SIZEOF_BDIGIT <= SIZEOF_LONG
+static int nlz(BDIGIT x) { return nlz_long((unsigned long)x) - (SIZEOF_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
+#elif SIZEOF_BDIGIT <= SIZEOF_LONG_LONG
+static int nlz(BDIGIT x) { return nlz_long_long((unsigned LONG_LONG)x) - (SIZEOF_LONG_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
+#elif SIZEOF_BDIGIT <= SIZEOF_INT128_T
+static int nlz(BDIGIT x) { return nlz_int128((uint128_t)x) - (SIZEOF_INT128_T-SIZEOF_BDIGIT) * CHAR_BIT; }
+#endif
+
+#define U16(a) ((uint16_t)(a))
+#define U32(a) ((uint32_t)(a))
+#ifdef HAVE_UINT64_T
+#define U64(a,b) (((uint64_t)(a) << 32) | (b))
+#endif
+#ifdef HAVE_UINT128_T
+#define U128(a,b,c,d) (((uint128_t)U64(a,b) << 64) | U64(c,d))
+#endif
+
+/* The following scirpt, maxpow.rb, generates the tables follows.
+
+def big(n, bits)
+ ns = []
+ ((bits+31)/32).times {
+ ns << sprintf("0x%08x", n & 0xffff_ffff)
+ n >>= 32
+ }
+ "U#{bits}(" + ns.reverse.join(",") + ")"
+end
+def values(ary, width, indent)
+ lines = [""]
+ ary.each {|e|
+ lines << "" if !ary.last.empty? && width < (lines.last + e + ", ").length
+ lines.last << e + ", "
+ }
+ lines.map {|line| " " * indent + line.chomp(" ") + "\n" }.join
+end
+[16,32,64,128].each {|bits|
+ max = 2**bits-1
+ exps = []
+ nums = []
+ 2.upto(36) {|base|
+ exp = 0
+ n = 1
+ while n * base <= max
+ exp += 1
+ n *= base
+ end
+ exps << exp.to_s
+ nums << big(n, bits)
+ }
+ puts "#ifdef HAVE_UINT#{bits}_T"
+ puts "static const int maxpow#{bits}_exp[35] = {"
+ print values(exps, 70, 4)
+ puts "};"
+ puts "static const uint#{bits}_t maxpow#{bits}_num[35] = {"
+ print values(nums, 70, 4)
+ puts "};"
+ puts "#endif"
+}
+
+ */
+
+#if SIZEOF_BDIGIT_DBL == 2
+static const int maxpow16_exp[35] = {
+ 15, 10, 7, 6, 6, 5, 5, 5, 4, 4, 4, 4, 4, 4, 3, 3, 3, 3, 3, 3, 3, 3,
+ 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,
+};
+static const uint16_t maxpow16_num[35] = {
+ U16(0x00008000), U16(0x0000e6a9), U16(0x00004000), U16(0x00003d09),
+ U16(0x0000b640), U16(0x000041a7), U16(0x00008000), U16(0x0000e6a9),
+ U16(0x00002710), U16(0x00003931), U16(0x00005100), U16(0x00006f91),
+ U16(0x00009610), U16(0x0000c5c1), U16(0x00001000), U16(0x00001331),
+ U16(0x000016c8), U16(0x00001acb), U16(0x00001f40), U16(0x0000242d),
+ U16(0x00002998), U16(0x00002f87), U16(0x00003600), U16(0x00003d09),
+ U16(0x000044a8), U16(0x00004ce3), U16(0x000055c0), U16(0x00005f45),
+ U16(0x00006978), U16(0x0000745f), U16(0x00008000), U16(0x00008c61),
+ U16(0x00009988), U16(0x0000a77b), U16(0x0000b640),
+};
+#elif SIZEOF_BDIGIT_DBL == 4
+static const int maxpow32_exp[35] = {
+ 31, 20, 15, 13, 12, 11, 10, 10, 9, 9, 8, 8, 8, 8, 7, 7, 7, 7, 7, 7,
+ 7, 7, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6,
+};
+static const uint32_t maxpow32_num[35] = {
+ U32(0x80000000), U32(0xcfd41b91), U32(0x40000000), U32(0x48c27395),
+ U32(0x81bf1000), U32(0x75db9c97), U32(0x40000000), U32(0xcfd41b91),
+ U32(0x3b9aca00), U32(0x8c8b6d2b), U32(0x19a10000), U32(0x309f1021),
+ U32(0x57f6c100), U32(0x98c29b81), U32(0x10000000), U32(0x18754571),
+ U32(0x247dbc80), U32(0x3547667b), U32(0x4c4b4000), U32(0x6b5a6e1d),
+ U32(0x94ace180), U32(0xcaf18367), U32(0x0b640000), U32(0x0e8d4a51),
+ U32(0x1269ae40), U32(0x17179149), U32(0x1cb91000), U32(0x23744899),
+ U32(0x2b73a840), U32(0x34e63b41), U32(0x40000000), U32(0x4cfa3cc1),
+ U32(0x5c13d840), U32(0x6d91b519), U32(0x81bf1000),
+};
+#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
+static const int maxpow64_exp[35] = {
+ 63, 40, 31, 27, 24, 22, 21, 20, 19, 18, 17, 17, 16, 16, 15, 15, 15,
+ 15, 14, 14, 14, 14, 13, 13, 13, 13, 13, 13, 13, 12, 12, 12, 12, 12,
+ 12,
+};
+static const uint64_t maxpow64_num[35] = {
+ U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
+ U64(0x40000000,0x00000000), U64(0x6765c793,0xfa10079d),
+ U64(0x41c21cb8,0xe1000000), U64(0x36427987,0x50226111),
+ U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
+ U64(0x8ac72304,0x89e80000), U64(0x4d28cb56,0xc33fa539),
+ U64(0x1eca170c,0x00000000), U64(0x780c7372,0x621bd74d),
+ U64(0x1e39a505,0x7d810000), U64(0x5b27ac99,0x3df97701),
+ U64(0x10000000,0x00000000), U64(0x27b95e99,0x7e21d9f1),
+ U64(0x5da0e1e5,0x3c5c8000), U64(0xd2ae3299,0xc1c4aedb),
+ U64(0x16bcc41e,0x90000000), U64(0x2d04b7fd,0xd9c0ef49),
+ U64(0x5658597b,0xcaa24000), U64(0xa0e20737,0x37609371),
+ U64(0x0c29e980,0x00000000), U64(0x14adf4b7,0x320334b9),
+ U64(0x226ed364,0x78bfa000), U64(0x383d9170,0xb85ff80b),
+ U64(0x5a3c23e3,0x9c000000), U64(0x8e651373,0x88122bcd),
+ U64(0xdd41bb36,0xd259e000), U64(0x0aee5720,0xee830681),
+ U64(0x10000000,0x00000000), U64(0x172588ad,0x4f5f0981),
+ U64(0x211e44f7,0xd02c1000), U64(0x2ee56725,0xf06e5c71),
+ U64(0x41c21cb8,0xe1000000),
+};
+#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
+static const int maxpow128_exp[35] = {
+ 127, 80, 63, 55, 49, 45, 42, 40, 38, 37, 35, 34, 33, 32, 31, 31, 30,
+ 30, 29, 29, 28, 28, 27, 27, 27, 26, 26, 26, 26, 25, 25, 25, 25, 24,
+ 24,
+};
+static const uint128_t maxpow128_num[35] = {
+ U128(0x80000000,0x00000000,0x00000000,0x00000000),
+ U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
+ U128(0x40000000,0x00000000,0x00000000,0x00000000),
+ U128(0xd0cf4b50,0xcfe20765,0xfff4b4e3,0xf741cf6d),
+ U128(0x6558e2a0,0x921fe069,0x42860000,0x00000000),
+ U128(0x5080c7b7,0xd0e31ba7,0x5911a67d,0xdd3d35e7),
+ U128(0x40000000,0x00000000,0x00000000,0x00000000),
+ U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
+ U128(0x4b3b4ca8,0x5a86c47a,0x098a2240,0x00000000),
+ U128(0xffd1390a,0x0adc2fb8,0xdabbb817,0x4d95c99b),
+ U128(0x2c6fdb36,0x4c25e6c0,0x00000000,0x00000000),
+ U128(0x384bacd6,0x42c343b4,0xe90c4272,0x13506d29),
+ U128(0x31f5db32,0xa34aced6,0x0bf13a0e,0x00000000),
+ U128(0x20753ada,0xfd1e839f,0x53686d01,0x3143ee01),
+ U128(0x10000000,0x00000000,0x00000000,0x00000000),
+ U128(0x68ca11d6,0xb4f6d1d1,0xfaa82667,0x8073c2f1),
+ U128(0x223e493b,0xb3bb69ff,0xa4b87d6c,0x40000000),
+ U128(0xad62418d,0x14ea8247,0x01c4b488,0x6cc66f59),
+ U128(0x2863c1f5,0xcdae42f9,0x54000000,0x00000000),
+ U128(0xa63fd833,0xb9386b07,0x36039e82,0xbe651b25),
+ U128(0x1d1f7a9c,0xd087a14d,0x28cdf3d5,0x10000000),
+ U128(0x651b5095,0xc2ea8fc1,0xb30e2c57,0x77aaf7e1),
+ U128(0x0ddef20e,0xff760000,0x00000000,0x00000000),
+ U128(0x29c30f10,0x29939b14,0x6664242d,0x97d9f649),
+ U128(0x786a435a,0xe9558b0e,0x6aaf6d63,0xa8000000),
+ U128(0x0c5afe6f,0xf302bcbf,0x94fd9829,0xd87f5079),
+ U128(0x1fce575c,0xe1692706,0x07100000,0x00000000),
+ U128(0x4f34497c,0x8597e144,0x36e91802,0x00528229),
+ U128(0xbf3a8e1d,0x41ef2170,0x7802130d,0x84000000),
+ U128(0x0e7819e1,0x7f1eb0fb,0x6ee4fb89,0x01d9531f),
+ U128(0x20000000,0x00000000,0x00000000,0x00000000),
+ U128(0x4510460d,0xd9e879c0,0x14a82375,0x2f22b321),
+ U128(0x91abce3c,0x4b4117ad,0xe76d35db,0x22000000),
+ U128(0x08973ea3,0x55d75bc2,0x2e42c391,0x727d69e1),
+ U128(0x10e425c5,0x6daffabc,0x35c10000,0x00000000),
+};
+#endif
+
+static BDIGIT_DBL
+maxpow_in_bdigit_dbl(int base, int *exp_ret)
{
- NEWOBJ(big, struct RBignum);
- OBJSETUP(big, klass, T_BIGNUM);
- big->sign = sign;
- big->len = len;
- BDIGITS(big) = ALLOC_N(USHORT, len);
+ BDIGIT_DBL maxpow;
+ int exponent;
+
+ assert(2 <= base && base <= 36);
+
+ {
+#if SIZEOF_BDIGIT_DBL == 2
+ maxpow = maxpow16_num[base-2];
+ exponent = maxpow16_exp[base-2];
+#elif SIZEOF_BDIGIT_DBL == 4
+ maxpow = maxpow32_num[base-2];
+ exponent = maxpow32_exp[base-2];
+#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
+ maxpow = maxpow64_num[base-2];
+ exponent = maxpow64_exp[base-2];
+#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
+ maxpow = maxpow128_num[base-2];
+ exponent = maxpow128_exp[base-2];
+#else
+ maxpow = base;
+ exponent = 1;
+ while (maxpow <= BDIGIT_DBL_MAX / base) {
+ maxpow *= base;
+ exponent++;
+ }
+#endif
+ }
- return (VALUE)big;
+ *exp_ret = exponent;
+ return maxpow;
+}
+
+static inline BDIGIT_DBL
+bary2bdigitdbl(const BDIGIT *ds, size_t n)
+{
+ assert(n <= 2);
+
+ if (n == 2)
+ return ds[0] | BIGUP(ds[1]);
+ if (n == 1)
+ return ds[0];
+ return 0;
+}
+
+static inline void
+bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
+{
+ assert(n == 2);
+
+ ds[0] = BIGLO(num);
+ ds[1] = (BDIGIT)BIGDN(num);
+}
+
+static int
+bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ BARY_TRUNC(xds, xn);
+ BARY_TRUNC(yds, yn);
+
+ if (xn < yn)
+ return -1;
+ if (xn > yn)
+ return 1;
+
+ while (xn-- && xds[xn] == yds[xn])
+ ;
+ if (xn == (size_t)-1)
+ return 0;
+ return xds[xn] < yds[xn] ? -1 : 1;
+}
+
+static BDIGIT
+bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
+{
+ size_t i;
+ BDIGIT_DBL num = 0;
+ assert(0 <= shift && shift < BITSPERDIG);
+
+ for (i=0; i<n; i++) {
+ num = num | (BDIGIT_DBL)*xds++ << shift;
+ *zds++ = BIGLO(num);
+ num = BIGDN(num);
+ }
+ return BIGLO(num);
+}
+
+static void
+bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
+{
+ BDIGIT_DBL num = 0;
+ BDIGIT x;
+
+ assert(0 <= shift && shift < BITSPERDIG);
+
+ num = BIGUP(higher_bdigit);
+ while (n--) {
+ num = (num | xds[n]) >> shift;
+ x = xds[n];
+ zds[n] = BIGLO(num);
+ num = BIGUP(x);
+ }
+}
+
+static int
+bary_zero_p(BDIGIT *xds, size_t xn)
+{
+ if (xn == 0)
+ return 1;
+ do {
+ if (xds[--xn]) return 0;
+ } while (xn);
+ return 1;
+}
+
+static void
+bary_neg(BDIGIT *ds, size_t n)
+{
+ while (n--)
+ ds[n] = BIGLO(~ds[n]);
+}
+
+static int
+bary_2comp(BDIGIT *ds, size_t n)
+{
+ size_t i;
+ i = 0;
+ for (i = 0; i < n; i++) {
+ if (ds[i] != 0) {
+ goto non_zero;
+ }
+ }
+ return 1;
+
+ non_zero:
+ ds[i] = BIGLO(~ds[i] + 1);
+ i++;
+ for (; i < n; i++) {
+ ds[i] = BIGLO(~ds[i]);
+ }
+ return 0;
+}
+
+static void
+bary_swap(BDIGIT *ds, size_t num_bdigits)
+{
+ BDIGIT *p1 = ds;
+ BDIGIT *p2 = ds + num_bdigits - 1;
+ for (; p1 < p2; p1++, p2--) {
+ BDIGIT tmp = *p1;
+ *p1 = *p2;
+ *p2 = tmp;
+ }
+}
+
+#define INTEGER_PACK_WORDORDER_MASK \
+ (INTEGER_PACK_MSWORD_FIRST | \
+ INTEGER_PACK_LSWORD_FIRST)
+#define INTEGER_PACK_BYTEORDER_MASK \
+ (INTEGER_PACK_MSBYTE_FIRST | \
+ INTEGER_PACK_LSBYTE_FIRST | \
+ INTEGER_PACK_NATIVE_BYTE_ORDER)
+
+static void
+validate_integer_pack_format(size_t numwords, size_t wordsize, size_t nails, int flags, int supported_flags)
+{
+ int wordorder_bits = flags & INTEGER_PACK_WORDORDER_MASK;
+ int byteorder_bits = flags & INTEGER_PACK_BYTEORDER_MASK;
+
+ if (flags & ~supported_flags) {
+ rb_raise(rb_eArgError, "unsupported flags specified");
+ }
+ if (wordorder_bits == 0) {
+ if (1 < numwords)
+ rb_raise(rb_eArgError, "word order not specified");
+ }
+ else if (wordorder_bits != INTEGER_PACK_MSWORD_FIRST &&
+ wordorder_bits != INTEGER_PACK_LSWORD_FIRST)
+ rb_raise(rb_eArgError, "unexpected word order");
+ if (byteorder_bits == 0) {
+ rb_raise(rb_eArgError, "byte order not specified");
+ }
+ else if (byteorder_bits != INTEGER_PACK_MSBYTE_FIRST &&
+ byteorder_bits != INTEGER_PACK_LSBYTE_FIRST &&
+ byteorder_bits != INTEGER_PACK_NATIVE_BYTE_ORDER)
+ rb_raise(rb_eArgError, "unexpected byte order");
+ if (wordsize == 0)
+ rb_raise(rb_eArgError, "invalid wordsize: %"PRI_SIZE_PREFIX"u", wordsize);
+ if (SSIZE_MAX < wordsize)
+ rb_raise(rb_eArgError, "too big wordsize: %"PRI_SIZE_PREFIX"u", wordsize);
+ if (wordsize <= nails / CHAR_BIT)
+ rb_raise(rb_eArgError, "too big nails: %"PRI_SIZE_PREFIX"u", nails);
+ if (SIZE_MAX / wordsize < numwords)
+ rb_raise(rb_eArgError, "too big numwords * wordsize: %"PRI_SIZE_PREFIX"u * %"PRI_SIZE_PREFIX"u", numwords, wordsize);
+}
+
+static void
+integer_pack_loop_setup(
+ size_t numwords, size_t wordsize, size_t nails, int flags,
+ size_t *word_num_fullbytes_ret,
+ int *word_num_partialbits_ret,
+ size_t *word_start_ret,
+ ssize_t *word_step_ret,
+ size_t *word_last_ret,
+ size_t *byte_start_ret,
+ int *byte_step_ret)
+{
+ int wordorder_bits = flags & INTEGER_PACK_WORDORDER_MASK;
+ int byteorder_bits = flags & INTEGER_PACK_BYTEORDER_MASK;
+ size_t word_num_fullbytes;
+ int word_num_partialbits;
+ size_t word_start;
+ ssize_t word_step;
+ size_t word_last;
+ size_t byte_start;
+ int byte_step;
+
+ word_num_partialbits = CHAR_BIT - (int)(nails % CHAR_BIT);
+ if (word_num_partialbits == CHAR_BIT)
+ word_num_partialbits = 0;
+ word_num_fullbytes = wordsize - (nails / CHAR_BIT);
+ if (word_num_partialbits != 0) {
+ word_num_fullbytes--;
+ }
+
+ if (wordorder_bits == INTEGER_PACK_MSWORD_FIRST) {
+ word_start = wordsize*(numwords-1);
+ word_step = -(ssize_t)wordsize;
+ word_last = 0;
+ }
+ else {
+ word_start = 0;
+ word_step = wordsize;
+ word_last = wordsize*(numwords-1);
+ }
+
+ if (byteorder_bits == INTEGER_PACK_NATIVE_BYTE_ORDER) {
+#ifdef WORDS_BIGENDIAN
+ byteorder_bits = INTEGER_PACK_MSBYTE_FIRST;
+#else
+ byteorder_bits = INTEGER_PACK_LSBYTE_FIRST;
+#endif
+ }
+ if (byteorder_bits == INTEGER_PACK_MSBYTE_FIRST) {
+ byte_start = wordsize-1;
+ byte_step = -1;
+ }
+ else {
+ byte_start = 0;
+ byte_step = 1;
+ }
+
+ *word_num_partialbits_ret = word_num_partialbits;
+ *word_num_fullbytes_ret = word_num_fullbytes;
+ *word_start_ret = word_start;
+ *word_step_ret = word_step;
+ *word_last_ret = word_last;
+ *byte_start_ret = byte_start;
+ *byte_step_ret = byte_step;
+}
+
+static inline void
+integer_pack_fill_dd(BDIGIT **dpp, BDIGIT **dep, BDIGIT_DBL *ddp, int *numbits_in_dd_p)
+{
+ if (*dpp < *dep && BITSPERDIG <= (int)sizeof(*ddp) * CHAR_BIT - *numbits_in_dd_p) {
+ *ddp |= (BDIGIT_DBL)(*(*dpp)++) << *numbits_in_dd_p;
+ *numbits_in_dd_p += BITSPERDIG;
+ }
+ else if (*dpp == *dep) {
+ /* higher bits are infinity zeros */
+ *numbits_in_dd_p = (int)sizeof(*ddp) * CHAR_BIT;
+ }
+}
+
+static inline BDIGIT_DBL
+integer_pack_take_lowbits(int n, BDIGIT_DBL *ddp, int *numbits_in_dd_p)
+{
+ BDIGIT_DBL ret;
+ ret = (*ddp) & (((BDIGIT_DBL)1 << n) - 1);
+ *ddp >>= n;
+ *numbits_in_dd_p -= n;
+ return ret;
+}
+
+#if !defined(WORDS_BIGENDIAN)
+static int
+bytes_2comp(unsigned char *buf, size_t len)
+{
+ size_t i;
+ for (i = 0; i < len; i++)
+ buf[i] = ~buf[i];
+ for (i = 0; i < len; i++) {
+ buf[i]++;
+ if (buf[i] != 0)
+ return 0;
+ }
+ return 1;
+}
+#endif
+
+static int
+bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+ BDIGIT *dp, *de;
+ unsigned char *buf, *bufend;
+
+ dp = ds;
+ de = ds + num_bdigits;
+
+ validate_integer_pack_format(numwords, wordsize, nails, flags,
+ INTEGER_PACK_MSWORD_FIRST|
+ INTEGER_PACK_LSWORD_FIRST|
+ INTEGER_PACK_MSBYTE_FIRST|
+ INTEGER_PACK_LSBYTE_FIRST|
+ INTEGER_PACK_NATIVE_BYTE_ORDER|
+ INTEGER_PACK_2COMP|
+ INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
+
+ while (dp < de && de[-1] == 0)
+ de--;
+ if (dp == de) {
+ sign = 0;
+ }
+
+ if (!(flags & INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION)) {
+ if (sign == 0) {
+ MEMZERO(words, unsigned char, numwords * wordsize);
+ return 0;
+ }
+ if (nails == 0 && numwords == 1) {
+ int need_swap = wordsize != 1 &&
+ (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_NATIVE_BYTE_ORDER &&
+ ((flags & INTEGER_PACK_MSBYTE_FIRST) ? !HOST_BIGENDIAN_P : HOST_BIGENDIAN_P);
+ if (0 < sign || !(flags & INTEGER_PACK_2COMP)) {
+ BDIGIT d;
+ if (wordsize == 1) {
+ *((unsigned char *)words) = (unsigned char)(d = dp[0]);
+ return ((1 < de - dp || CLEAR_LOWBITS(d, 8) != 0) ? 2 : 1) * sign;
+ }
+#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
+ if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+ uint16_t u = (uint16_t)(d = dp[0]);
+ if (need_swap) u = swap16(u);
+ *((uint16_t *)words) = u;
+ return ((1 < de - dp || CLEAR_LOWBITS(d, 16) != 0) ? 2 : 1) * sign;
+ }
+#endif
+#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
+ if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+ uint32_t u = (uint32_t)(d = dp[0]);
+ if (need_swap) u = swap32(u);
+ *((uint32_t *)words) = u;
+ return ((1 < de - dp || CLEAR_LOWBITS(d, 32) != 0) ? 2 : 1) * sign;
+ }
+#endif
+#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
+ if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+ uint64_t u = (uint64_t)(d = dp[0]);
+ if (need_swap) u = swap64(u);
+ *((uint64_t *)words) = u;
+ return ((1 < de - dp || CLEAR_LOWBITS(d, 64) != 0) ? 2 : 1) * sign;
+ }
+#endif
+ }
+ else { /* sign < 0 && (flags & INTEGER_PACK_2COMP) */
+ BDIGIT_DBL_SIGNED d;
+ if (wordsize == 1) {
+ *((unsigned char *)words) = (unsigned char)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+ return (1 < de - dp || FILL_LOWBITS(d, 8) != -1) ? -2 : -1;
+ }
+#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
+ if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+ uint16_t u = (uint16_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+ if (need_swap) u = swap16(u);
+ *((uint16_t *)words) = u;
+ return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
+ (1 < de - dp || FILL_LOWBITS(d, 16) != -1) ? -2 : -1;
+ }
+#endif
+#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
+ if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+ uint32_t u = (uint32_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+ if (need_swap) u = swap32(u);
+ *((uint32_t *)words) = u;
+ return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
+ (1 < de - dp || FILL_LOWBITS(d, 32) != -1) ? -2 : -1;
+ }
+#endif
+#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
+ if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+ uint64_t u = (uint64_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+ if (need_swap) u = swap64(u);
+ *((uint64_t *)words) = u;
+ return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
+ (1 < de - dp || FILL_LOWBITS(d, 64) != -1) ? -2 : -1;
+ }
+#endif
+ }
+ }
+#if !defined(WORDS_BIGENDIAN)
+ if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+ (flags & INTEGER_PACK_WORDORDER_MASK) == INTEGER_PACK_LSWORD_FIRST &&
+ (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_MSBYTE_FIRST) {
+ size_t src_size = (de - dp) * SIZEOF_BDIGIT;
+ size_t dst_size = numwords * wordsize;
+ int overflow = 0;
+ while (0 < src_size && ((unsigned char *)ds)[src_size-1] == 0)
+ src_size--;
+ if (src_size <= dst_size) {
+ MEMCPY(words, dp, char, src_size);
+ MEMZERO((char*)words + src_size, char, dst_size - src_size);
+ }
+ else {
+ MEMCPY(words, dp, char, dst_size);
+ overflow = 1;
+ }
+ if (sign < 0 && (flags & INTEGER_PACK_2COMP)) {
+ int zero_p = bytes_2comp(words, dst_size);
+ if (zero_p && overflow) {
+ unsigned char *p = (unsigned char *)dp;
+ if (dst_size == src_size-1 &&
+ p[dst_size] == 1) {
+ overflow = 0;
+ }
+ }
+ }
+ if (overflow)
+ sign *= 2;
+ return sign;
+ }
+#endif
+ if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+ wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % ALIGNOF(BDIGIT) == 0) {
+ size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
+ size_t src_num_bdigits = de - dp;
+ size_t dst_num_bdigits = numwords * bdigits_per_word;
+ int overflow = 0;
+ int mswordfirst_p = (flags & INTEGER_PACK_MSWORD_FIRST) != 0;
+ int msbytefirst_p = (flags & INTEGER_PACK_NATIVE_BYTE_ORDER) ? HOST_BIGENDIAN_P :
+ (flags & INTEGER_PACK_MSBYTE_FIRST) != 0;
+ if (src_num_bdigits <= dst_num_bdigits) {
+ MEMCPY(words, dp, BDIGIT, src_num_bdigits);
+ BDIGITS_ZERO((BDIGIT*)words + src_num_bdigits, dst_num_bdigits - src_num_bdigits);
+ }
+ else {
+ MEMCPY(words, dp, BDIGIT, dst_num_bdigits);
+ overflow = 1;
+ }
+ if (sign < 0 && (flags & INTEGER_PACK_2COMP)) {
+ int zero_p = bary_2comp(words, dst_num_bdigits);
+ if (zero_p && overflow &&
+ dst_num_bdigits == src_num_bdigits-1 &&
+ dp[dst_num_bdigits] == 1)
+ overflow = 0;
+ }
+ if (msbytefirst_p != HOST_BIGENDIAN_P) {
+ size_t i;
+ for (i = 0; i < dst_num_bdigits; i++) {
+ BDIGIT d = ((BDIGIT*)words)[i];
+ ((BDIGIT*)words)[i] = swap_bdigit(d);
+ }
+ }
+ if (mswordfirst_p ? !msbytefirst_p : msbytefirst_p) {
+ size_t i;
+ BDIGIT *p = words;
+ for (i = 0; i < numwords; i++) {
+ bary_swap(p, bdigits_per_word);
+ p += bdigits_per_word;
+ }
+ }
+ if (mswordfirst_p) {
+ bary_swap(words, dst_num_bdigits);
+ }
+ if (overflow)
+ sign *= 2;
+ return sign;
+ }
+ }
+
+ buf = words;
+ bufend = buf + numwords * wordsize;
+
+ if (buf == bufend) {
+ /* overflow if non-zero*/
+ if (!(flags & INTEGER_PACK_2COMP) || 0 <= sign)
+ sign *= 2;
+ else {
+ if (de - dp == 1 && dp[0] == 1)
+ sign = -1; /* val == -1 == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+ else
+ sign = -2; /* val < -1 == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+ }
+ }
+ else if (dp == de) {
+ memset(buf, '\0', bufend - buf);
+ }
+ else if (dp < de && buf < bufend) {
+ int word_num_partialbits;
+ size_t word_num_fullbytes;
+
+ ssize_t word_step;
+ size_t byte_start;
+ int byte_step;
+
+ size_t word_start, word_last;
+ unsigned char *wordp, *last_wordp;
+ BDIGIT_DBL dd;
+ int numbits_in_dd;
+
+ integer_pack_loop_setup(numwords, wordsize, nails, flags,
+ &word_num_fullbytes, &word_num_partialbits,
+ &word_start, &word_step, &word_last, &byte_start, &byte_step);
+
+ wordp = buf + word_start;
+ last_wordp = buf + word_last;
+
+ dd = 0;
+ numbits_in_dd = 0;
+
+#define FILL_DD \
+ integer_pack_fill_dd(&dp, &de, &dd, &numbits_in_dd)
+#define TAKE_LOWBITS(n) \
+ integer_pack_take_lowbits(n, &dd, &numbits_in_dd)
+
+ while (1) {
+ size_t index_in_word = 0;
+ unsigned char *bytep = wordp + byte_start;
+ while (index_in_word < word_num_fullbytes) {
+ FILL_DD;
+ *bytep = TAKE_LOWBITS(CHAR_BIT);
+ bytep += byte_step;
+ index_in_word++;
+ }
+ if (word_num_partialbits) {
+ FILL_DD;
+ *bytep = TAKE_LOWBITS(word_num_partialbits);
+ bytep += byte_step;
+ index_in_word++;
+ }
+ while (index_in_word < wordsize) {
+ *bytep = 0;
+ bytep += byte_step;
+ index_in_word++;
+ }
+
+ if (wordp == last_wordp)
+ break;
+
+ wordp += word_step;
+ }
+ FILL_DD;
+ /* overflow tests */
+ if (dp != de || 1 < dd) {
+ /* 2**(numwords*(wordsize*CHAR_BIT-nails)+1) <= abs(val) */
+ sign *= 2;
+ }
+ else if (dd == 1) {
+ /* 2**(numwords*(wordsize*CHAR_BIT-nails)) <= abs(val) < 2**(numwords*(wordsize*CHAR_BIT-nails)+1) */
+ if (!(flags & INTEGER_PACK_2COMP) || 0 <= sign)
+ sign *= 2;
+ else { /* overflow_2comp && sign == -1 */
+ /* test lower bits are all zero. */
+ dp = ds;
+ while (dp < de && *dp == 0)
+ dp++;
+ if (de - dp == 1 && /* only one non-zero word. */
+ POW2_P(*dp)) /* *dp contains only one bit set. */
+ sign = -1; /* val == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+ else
+ sign = -2; /* val < -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+ }
+ }
+ }
+
+ if ((flags & INTEGER_PACK_2COMP) && (sign < 0 && numwords != 0)) {
+ unsigned char *buf;
+
+ int word_num_partialbits;
+ size_t word_num_fullbytes;
+
+ ssize_t word_step;
+ size_t byte_start;
+ int byte_step;
+
+ size_t word_start, word_last;
+ unsigned char *wordp, *last_wordp;
+
+ unsigned int partialbits_mask;
+ int carry;
+
+ integer_pack_loop_setup(numwords, wordsize, nails, flags,
+ &word_num_fullbytes, &word_num_partialbits,
+ &word_start, &word_step, &word_last, &byte_start, &byte_step);
+
+ partialbits_mask = (1 << word_num_partialbits) - 1;
+
+ buf = words;
+ wordp = buf + word_start;
+ last_wordp = buf + word_last;
+
+ carry = 1;
+ while (1) {
+ size_t index_in_word = 0;
+ unsigned char *bytep = wordp + byte_start;
+ while (index_in_word < word_num_fullbytes) {
+ carry += (unsigned char)~*bytep;
+ *bytep = (unsigned char)carry;
+ carry >>= CHAR_BIT;
+ bytep += byte_step;
+ index_in_word++;
+ }
+ if (word_num_partialbits) {
+ carry += (*bytep & partialbits_mask) ^ partialbits_mask;
+ *bytep = carry & partialbits_mask;
+ carry >>= word_num_partialbits;
+ bytep += byte_step;
+ index_in_word++;
+ }
+
+ if (wordp == last_wordp)
+ break;
+
+ wordp += word_step;
+ }
+ }
+
+ return sign;
+#undef FILL_DD
+#undef TAKE_LOWBITS
+}
+
+static size_t
+integer_unpack_num_bdigits_small(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
+{
+ /* nlp_bits stands for number of leading padding bits */
+ size_t num_bits = (wordsize * CHAR_BIT - nails) * numwords;
+ size_t num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG;
+ *nlp_bits_ret = (int)(num_bdigits * BITSPERDIG - num_bits);
+ return num_bdigits;
+}
+
+static size_t
+integer_unpack_num_bdigits_generic(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
+{
+ /* BITSPERDIG = SIZEOF_BDIGIT * CHAR_BIT */
+ /* num_bits = (wordsize * CHAR_BIT - nails) * numwords */
+ /* num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG */
+
+ /* num_bits = CHAR_BIT * (wordsize * numwords) - nails * numwords = CHAR_BIT * num_bytes1 - nails * numwords */
+ size_t num_bytes1 = wordsize * numwords;
+
+ /* q1 * CHAR_BIT + r1 = numwords */
+ size_t q1 = numwords / CHAR_BIT;
+ size_t r1 = numwords % CHAR_BIT;
+
+ /* num_bits = CHAR_BIT * num_bytes1 - nails * (q1 * CHAR_BIT + r1) = CHAR_BIT * num_bytes2 - nails * r1 */
+ size_t num_bytes2 = num_bytes1 - nails * q1;
+
+ /* q2 * CHAR_BIT + r2 = nails */
+ size_t q2 = nails / CHAR_BIT;
+ size_t r2 = nails % CHAR_BIT;
+
+ /* num_bits = CHAR_BIT * num_bytes2 - (q2 * CHAR_BIT + r2) * r1 = CHAR_BIT * num_bytes3 - r1 * r2 */
+ size_t num_bytes3 = num_bytes2 - q2 * r1;
+
+ /* q3 * BITSPERDIG + r3 = num_bytes3 */
+ size_t q3 = num_bytes3 / BITSPERDIG;
+ size_t r3 = num_bytes3 % BITSPERDIG;
+
+ /* num_bits = CHAR_BIT * (q3 * BITSPERDIG + r3) - r1 * r2 = BITSPERDIG * num_digits1 + CHAR_BIT * r3 - r1 * r2 */
+ size_t num_digits1 = CHAR_BIT * q3;
+
+ /*
+ * if CHAR_BIT * r3 >= r1 * r2
+ * CHAR_BIT * r3 - r1 * r2 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2))
+ * q4 * BITSPERDIG + r4 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2)
+ * num_bits = BITSPERDIG * num_digits1 + CHAR_BIT * BITSPERDIG - (q4 * BITSPERDIG + r4) = BITSPERDIG * num_digits2 - r4
+ * else
+ * q4 * BITSPERDIG + r4 = -(CHAR_BIT * r3 - r1 * r2)
+ * num_bits = BITSPERDIG * num_digits1 - (q4 * BITSPERDIG + r4) = BITSPERDIG * num_digits2 - r4
+ * end
+ */
+
+ if (CHAR_BIT * r3 >= r1 * r2) {
+ size_t tmp1 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2);
+ size_t q4 = tmp1 / BITSPERDIG;
+ int r4 = (int)(tmp1 % BITSPERDIG);
+ size_t num_digits2 = num_digits1 + CHAR_BIT - q4;
+ *nlp_bits_ret = r4;
+ return num_digits2;
+ }
+ else {
+ size_t tmp1 = r1 * r2 - CHAR_BIT * r3;
+ size_t q4 = tmp1 / BITSPERDIG;
+ int r4 = (int)(tmp1 % BITSPERDIG);
+ size_t num_digits2 = num_digits1 - q4;
+ *nlp_bits_ret = r4;
+ return num_digits2;
+ }
+}
+
+static size_t
+integer_unpack_num_bdigits(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
+{
+ size_t num_bdigits;
+
+ if (numwords <= (SIZE_MAX - (BITSPERDIG-1)) / CHAR_BIT / wordsize) {
+ num_bdigits = integer_unpack_num_bdigits_small(numwords, wordsize, nails, nlp_bits_ret);
+#ifdef DEBUG_INTEGER_PACK
+ {
+ int nlp_bits1;
+ size_t num_bdigits1 = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, &nlp_bits1);
+ assert(num_bdigits == num_bdigits1);
+ assert(*nlp_bits_ret == nlp_bits1);
+ }
+#endif
+ }
+ else {
+ num_bdigits = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, nlp_bits_ret);
+ }
+ return num_bdigits;
+}
+
+static inline void
+integer_unpack_push_bits(int data, int numbits, BDIGIT_DBL *ddp, int *numbits_in_dd_p, BDIGIT **dpp)
+{
+ (*ddp) |= ((BDIGIT_DBL)data) << (*numbits_in_dd_p);
+ *numbits_in_dd_p += numbits;
+ while (BITSPERDIG <= *numbits_in_dd_p) {
+ *(*dpp)++ = BIGLO(*ddp);
+ *ddp = BIGDN(*ddp);
+ *numbits_in_dd_p -= BITSPERDIG;
+ }
+}
+
+static int
+integer_unpack_single_bdigit(BDIGIT u, size_t size, int flags, BDIGIT *dp)
+{
+ int sign;
+ if (flags & INTEGER_PACK_2COMP) {
+ sign = (flags & INTEGER_PACK_NEGATIVE) ?
+ ((size == SIZEOF_BDIGIT && u == 0) ? -2 : -1) :
+ ((u >> (size * CHAR_BIT - 1)) ? -1 : 1);
+ if (sign < 0) {
+ u |= LSHIFTX(BDIGMAX, size * CHAR_BIT);
+ u = BIGLO(1 + ~u);
+ }
+ }
+ else
+ sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+ *dp = u;
+ return sign;
+}
+
+static int
+bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags, int nlp_bits)
+{
+ int sign;
+ const unsigned char *buf = words;
+ BDIGIT *dp;
+ BDIGIT *de;
+
+ dp = bdigits;
+ de = dp + num_bdigits;
+
+ if (!(flags & INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION)) {
+ if (nails == 0 && numwords == 1) {
+ int need_swap = wordsize != 1 &&
+ (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_NATIVE_BYTE_ORDER &&
+ ((flags & INTEGER_PACK_MSBYTE_FIRST) ? !HOST_BIGENDIAN_P : HOST_BIGENDIAN_P);
+ if (wordsize == 1) {
+ return integer_unpack_single_bdigit(*(uint8_t *)buf, sizeof(uint8_t), flags, dp);
+ }
+#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
+ if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+ uint16_t u = *(uint16_t *)buf;
+ return integer_unpack_single_bdigit(need_swap ? swap16(u) : u, sizeof(uint16_t), flags, dp);
+ }
+#endif
+#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
+ if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+ uint32_t u = *(uint32_t *)buf;
+ return integer_unpack_single_bdigit(need_swap ? swap32(u) : u, sizeof(uint32_t), flags, dp);
+ }
+#endif
+#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
+ if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+ uint64_t u = *(uint64_t *)buf;
+ return integer_unpack_single_bdigit(need_swap ? swap64(u) : u, sizeof(uint64_t), flags, dp);
+ }
+#endif
+ }
+#if !defined(WORDS_BIGENDIAN)
+ if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+ (flags & INTEGER_PACK_WORDORDER_MASK) == INTEGER_PACK_LSWORD_FIRST &&
+ (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_MSBYTE_FIRST) {
+ size_t src_size = numwords * wordsize;
+ size_t dst_size = num_bdigits * SIZEOF_BDIGIT;
+ MEMCPY(dp, words, char, src_size);
+ if (flags & INTEGER_PACK_2COMP) {
+ if (flags & INTEGER_PACK_NEGATIVE) {
+ int zero_p;
+ memset((char*)dp + src_size, 0xff, dst_size - src_size);
+ zero_p = bary_2comp(dp, num_bdigits);
+ sign = zero_p ? -2 : -1;
+ }
+ else if (buf[src_size-1] >> (CHAR_BIT-1)) {
+ memset((char*)dp + src_size, 0xff, dst_size - src_size);
+ bary_2comp(dp, num_bdigits);
+ sign = -1;
+ }
+ else {
+ MEMZERO((char*)dp + src_size, char, dst_size - src_size);
+ sign = 1;
+ }
+ }
+ else {
+ MEMZERO((char*)dp + src_size, char, dst_size - src_size);
+ sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+ }
+ return sign;
+ }
+#endif
+ if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+ wordsize % SIZEOF_BDIGIT == 0) {
+ size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
+ int mswordfirst_p = (flags & INTEGER_PACK_MSWORD_FIRST) != 0;
+ int msbytefirst_p = (flags & INTEGER_PACK_NATIVE_BYTE_ORDER) ? HOST_BIGENDIAN_P :
+ (flags & INTEGER_PACK_MSBYTE_FIRST) != 0;
+ MEMCPY(dp, words, BDIGIT, numwords*bdigits_per_word);
+ if (mswordfirst_p) {
+ bary_swap(dp, num_bdigits);
+ }
+ if (mswordfirst_p ? !msbytefirst_p : msbytefirst_p) {
+ size_t i;
+ BDIGIT *p = dp;
+ for (i = 0; i < numwords; i++) {
+ bary_swap(p, bdigits_per_word);
+ p += bdigits_per_word;
+ }
+ }
+ if (msbytefirst_p != HOST_BIGENDIAN_P) {
+ BDIGIT *p;
+ for (p = dp; p < de; p++) {
+ BDIGIT d = *p;
+ *p = swap_bdigit(d);
+ }
+ }
+ if (flags & INTEGER_PACK_2COMP) {
+ if (flags & INTEGER_PACK_NEGATIVE) {
+ int zero_p = bary_2comp(dp, num_bdigits);
+ sign = zero_p ? -2 : -1;
+ }
+ else if (BDIGIT_MSB(de[-1])) {
+ bary_2comp(dp, num_bdigits);
+ sign = -1;
+ }
+ else {
+ sign = 1;
+ }
+ }
+ else {
+ sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+ }
+ return sign;
+ }
+ }
+
+ if (num_bdigits != 0) {
+ int word_num_partialbits;
+ size_t word_num_fullbytes;
+
+ ssize_t word_step;
+ size_t byte_start;
+ int byte_step;
+
+ size_t word_start, word_last;
+ const unsigned char *wordp, *last_wordp;
+ BDIGIT_DBL dd;
+ int numbits_in_dd;
+
+ integer_pack_loop_setup(numwords, wordsize, nails, flags,
+ &word_num_fullbytes, &word_num_partialbits,
+ &word_start, &word_step, &word_last, &byte_start, &byte_step);
+
+ wordp = buf + word_start;
+ last_wordp = buf + word_last;
+
+ dd = 0;
+ numbits_in_dd = 0;
+
+#define PUSH_BITS(data, numbits) \
+ integer_unpack_push_bits(data, numbits, &dd, &numbits_in_dd, &dp)
+
+ while (1) {
+ size_t index_in_word = 0;
+ const unsigned char *bytep = wordp + byte_start;
+ while (index_in_word < word_num_fullbytes) {
+ PUSH_BITS(*bytep, CHAR_BIT);
+ bytep += byte_step;
+ index_in_word++;
+ }
+ if (word_num_partialbits) {
+ PUSH_BITS(*bytep & ((1 << word_num_partialbits) - 1), word_num_partialbits);
+ bytep += byte_step;
+ index_in_word++;
+ }
+
+ if (wordp == last_wordp)
+ break;
+
+ wordp += word_step;
+ }
+ if (dd)
+ *dp++ = (BDIGIT)dd;
+ assert(dp <= de);
+ while (dp < de)
+ *dp++ = 0;
+#undef PUSH_BITS
+ }
+
+ if (!(flags & INTEGER_PACK_2COMP)) {
+ sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+ }
+ else {
+ if (nlp_bits) {
+ if ((flags & INTEGER_PACK_NEGATIVE) ||
+ (bdigits[num_bdigits-1] >> (BITSPERDIG - nlp_bits - 1))) {
+ bdigits[num_bdigits-1] |= BIGLO(BDIGMAX << (BITSPERDIG - nlp_bits));
+ sign = -1;
+ }
+ else {
+ sign = 1;
+ }
+ }
+ else {
+ if (flags & INTEGER_PACK_NEGATIVE) {
+ sign = bary_zero_p(bdigits, num_bdigits) ? -2 : -1;
+ }
+ else {
+ if (num_bdigits != 0 && BDIGIT_MSB(bdigits[num_bdigits-1]))
+ sign = -1;
+ else
+ sign = 1;
+ }
+ }
+ if (sign == -1 && num_bdigits != 0) {
+ bary_2comp(bdigits, num_bdigits);
+ }
+ }
+
+ return sign;
}
-#define bignew(len,sign) bignew_1(rb_cBignum,len,sign)
+static void
+bary_unpack(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+ size_t num_bdigits0;
+ int nlp_bits;
+ int sign;
+
+ validate_integer_pack_format(numwords, wordsize, nails, flags,
+ INTEGER_PACK_MSWORD_FIRST|
+ INTEGER_PACK_LSWORD_FIRST|
+ INTEGER_PACK_MSBYTE_FIRST|
+ INTEGER_PACK_LSBYTE_FIRST|
+ INTEGER_PACK_NATIVE_BYTE_ORDER|
+ INTEGER_PACK_2COMP|
+ INTEGER_PACK_FORCE_BIGNUM|
+ INTEGER_PACK_NEGATIVE|
+ INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
+
+ num_bdigits0 = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
+
+ assert(num_bdigits0 <= num_bdigits);
+
+ sign = bary_unpack_internal(bdigits, num_bdigits0, words, numwords, wordsize, nails, flags, nlp_bits);
+
+ if (num_bdigits0 < num_bdigits) {
+ BDIGITS_ZERO(bdigits + num_bdigits0, num_bdigits - num_bdigits0);
+ if (sign == -2) {
+ bdigits[num_bdigits0] = 1;
+ }
+ }
+}
+
+static int
+bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, int borrow)
+{
+ BDIGIT_DBL_SIGNED num;
+ size_t i;
+ size_t sn;
+
+ assert(xn <= zn);
+ assert(yn <= zn);
+
+ sn = xn < yn ? xn : yn;
+
+ num = borrow ? -1 : 0;
+ for (i = 0; i < sn; i++) {
+ num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ if (yn <= xn) {
+ for (; i < xn; i++) {
+ if (num == 0) goto num_is_zero;
+ num += xds[i];
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ }
+ else {
+ for (; i < yn; i++) {
+ num -= yds[i];
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ }
+ if (num == 0) goto num_is_zero;
+ for (; i < zn; i++) {
+ zds[i] = BDIGMAX;
+ }
+ return 1;
+
+ num_is_zero:
+ if (xds == zds && xn == zn)
+ return 0;
+ for (; i < xn; i++) {
+ zds[i] = xds[i];
+ }
+ for (; i < zn; i++) {
+ zds[i] = 0;
+ }
+ return 0;
+}
+
+static int
+bary_sub(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ return bary_subb(zds, zn, xds, xn, yds, yn, 0);
+}
+
+static int
+bary_sub_one(BDIGIT *zds, size_t zn)
+{
+ return bary_subb(zds, zn, zds, zn, NULL, 0, 1);
+}
+
+static int
+bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, int carry)
+{
+ BDIGIT_DBL num;
+ size_t i;
+
+ assert(xn <= zn);
+ assert(yn <= zn);
+
+ if (xn > yn) {
+ const BDIGIT *tds;
+ tds = xds; xds = yds; yds = tds;
+ i = xn; xn = yn; yn = i;
+ }
+
+ num = carry ? 1 : 0;
+ for (i = 0; i < xn; i++) {
+ num += (BDIGIT_DBL)xds[i] + yds[i];
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ for (; i < yn; i++) {
+ if (num == 0) goto num_is_zero;
+ num += yds[i];
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ for (; i < zn; i++) {
+ if (num == 0) goto num_is_zero;
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ return num != 0;
+
+ num_is_zero:
+ if (yds == zds && yn == zn)
+ return 0;
+ for (; i < yn; i++) {
+ zds[i] = yds[i];
+ }
+ for (; i < zn; i++) {
+ zds[i] = 0;
+ }
+ return 0;
+}
+
+static int
+bary_add(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ return bary_addc(zds, zn, xds, xn, yds, yn, 0);
+}
+
+static int
+bary_add_one(BDIGIT *ds, size_t n)
+{
+ size_t i;
+ for (i = 0; i < n; i++) {
+ ds[i] = BIGLO(ds[i]+1);
+ if (ds[i] != 0)
+ return 0;
+ }
+ return 1;
+}
+
+static void
+bary_mul_single(BDIGIT *zds, size_t zn, BDIGIT x, BDIGIT y)
+{
+ BDIGIT_DBL n;
+
+ assert(2 <= zn);
+
+ n = (BDIGIT_DBL)x * y;
+ bdigitdbl2bary(zds, 2, n);
+ BDIGITS_ZERO(zds + 2, zn - 2);
+}
+
+static int
+bary_muladd_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
+{
+ BDIGIT_DBL n;
+ BDIGIT_DBL dd;
+ size_t j;
+
+ assert(zn > yn);
+
+ if (x == 0)
+ return 0;
+ dd = x;
+ n = 0;
+ for (j = 0; j < yn; j++) {
+ BDIGIT_DBL ee = n + dd * yds[j];
+ if (ee) {
+ n = zds[j] + ee;
+ zds[j] = BIGLO(n);
+ n = BIGDN(n);
+ }
+ else {
+ n = 0;
+ }
+
+ }
+ for (; j < zn; j++) {
+ if (n == 0)
+ break;
+ n += zds[j];
+ zds[j] = BIGLO(n);
+ n = BIGDN(n);
+ }
+ return n != 0;
+}
+
+static BDIGIT_DBL_SIGNED
+bigdivrem_mulsub(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
+{
+ size_t i;
+ BDIGIT_DBL t2;
+ BDIGIT_DBL_SIGNED num;
+
+ assert(zn == yn + 1);
+
+ num = 0;
+ t2 = 0;
+ i = 0;
+
+ do {
+ BDIGIT_DBL ee;
+ t2 += (BDIGIT_DBL)yds[i] * x;
+ ee = num - BIGLO(t2);
+ num = (BDIGIT_DBL)zds[i] + ee;
+ if (ee) zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ t2 = BIGDN(t2);
+ } while (++i < yn);
+ num += zds[i] - t2; /* borrow from high digit; don't update */
+ return num;
+}
+
+static int
+bary_mulsub_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
+{
+ BDIGIT_DBL_SIGNED num;
+
+ assert(zn == yn + 1);
+
+ num = bigdivrem_mulsub(zds, zn, x, yds, yn);
+ zds[yn] = BIGLO(num);
+ if (BIGDN(num))
+ return 1;
+ return 0;
+}
+
+static void
+bary_mul_normal(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ size_t i;
+
+ assert(xn + yn <= zn);
+
+ BDIGITS_ZERO(zds, zn);
+ for (i = 0; i < xn; i++) {
+ bary_muladd_1xN(zds+i, zn-i, xds[i], yds, yn);
+ }
+}
+
+VALUE
+rb_big_mul_normal(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+ VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ bary_mul_normal(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+ return z;
+}
+
+/* efficient squaring (2 times faster than normal multiplication)
+ * ref: Handbook of Applied Cryptography, Algorithm 14.16
+ * http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
+ */
+static void
+bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
+{
+ size_t i, j;
+ BDIGIT_DBL c, v, w;
+ BDIGIT vl;
+ int vh;
+
+ assert(xn * 2 <= zn);
+
+ BDIGITS_ZERO(zds, zn);
+
+ if (xn == 0)
+ return;
+
+ for (i = 0; i < xn-1; i++) {
+ v = (BDIGIT_DBL)xds[i];
+ if (!v)
+ continue;
+ c = (BDIGIT_DBL)zds[i + i] + v * v;
+ zds[i + i] = BIGLO(c);
+ c = BIGDN(c);
+ v *= 2;
+ vl = BIGLO(v);
+ vh = (int)BIGDN(v);
+ for (j = i + 1; j < xn; j++) {
+ w = (BDIGIT_DBL)xds[j];
+ c += (BDIGIT_DBL)zds[i + j] + vl * w;
+ zds[i + j] = BIGLO(c);
+ c = BIGDN(c);
+ if (vh)
+ c += w;
+ }
+ if (c) {
+ c += (BDIGIT_DBL)zds[i + xn];
+ zds[i + xn] = BIGLO(c);
+ c = BIGDN(c);
+ if (c)
+ zds[i + xn + 1] += (BDIGIT)c;
+ }
+ }
+
+ /* i == xn-1 */
+ v = (BDIGIT_DBL)xds[i];
+ if (!v)
+ return;
+ c = (BDIGIT_DBL)zds[i + i] + v * v;
+ zds[i + i] = BIGLO(c);
+ c = BIGDN(c);
+ if (c) {
+ zds[i + xn] += BIGLO(c);
+ }
+}
VALUE
-rb_big_clone(x)
- VALUE x;
+rb_big_sq_fast(VALUE x)
+{
+ size_t xn = BIGNUM_LEN(x), zn = 2 * xn;
+ VALUE z = bignew(zn, 1);
+ bary_sq_fast(BDIGITS(z), zn, BDIGITS(x), xn);
+ RB_GC_GUARD(x);
+ return z;
+}
+
+/* balancing multiplication by slicing larger argument */
+static void
+bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn, mulfunc_t *mulfunc)
{
- VALUE z = bignew_1(CLASS_OF(x), RBIGNUM(x)->len, RBIGNUM(x)->sign);
+ VALUE work = 0;
+ size_t yn0 = yn;
+ size_t r, n;
+
+ assert(xn + yn <= zn);
+ assert(xn <= yn);
+ assert(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
+
+ BDIGITS_ZERO(zds, xn);
+
+ n = 0;
+ while (yn > 0) {
+ BDIGIT *tds;
+ size_t tn;
+ r = xn > yn ? yn : xn;
+ tn = xn + r;
+ if (2 * (xn + r) <= zn - n) {
+ tds = zds + n + xn + r;
+ mulfunc(tds, tn, xds, xn, yds + n, r, wds, wn);
+ BDIGITS_ZERO(zds + n + xn, r);
+ bary_add(zds + n, tn,
+ zds + n, tn,
+ tds, tn);
+ }
+ else {
+ if (wn < xn) {
+ wn = xn;
+ wds = ALLOCV_N(BDIGIT, work, wn);
+ }
+ tds = zds + n;
+ MEMCPY(wds, zds + n, BDIGIT, xn);
+ mulfunc(tds, tn, xds, xn, yds + n, r, wds-xn, wn-xn);
+ bary_add(zds + n, tn,
+ zds + n, tn,
+ wds, xn);
+ }
+ yn -= r;
+ n += r;
+ }
+ BDIGITS_ZERO(zds+xn+yn0, zn - (xn+yn0));
+
+ if (work)
+ ALLOCV_END(work);
+}
- MEMCPY(BDIGITS(z), BDIGITS(x), USHORT, RBIGNUM(x)->len);
+VALUE
+rb_big_mul_balance(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+ VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ bary_mul_balance_with_mulfunc(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0, bary_mul_toom3_start);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
return z;
}
-void
-rb_big_2comp(x) /* get 2's complement */
- VALUE x;
+/* multiplication by karatsuba method */
+static void
+bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+ VALUE work = 0;
+
+ size_t n;
+ int sub_p, borrow, carry1, carry2, carry3;
+
+ int odd_y = 0;
+ int odd_xy = 0;
+ int sq;
+
+ const BDIGIT *xds0, *xds1, *yds0, *yds1;
+ BDIGIT *zds0, *zds1, *zds2, *zds3;
+
+ assert(xn + yn <= zn);
+ assert(xn <= yn);
+ assert(yn < 2 * xn);
+
+ sq = xds == yds && xn == yn;
+
+ if (yn & 1) {
+ odd_y = 1;
+ yn--;
+ if (yn < xn) {
+ odd_xy = 1;
+ xn--;
+ }
+ }
+
+ n = yn / 2;
+
+ assert(n < xn);
+
+ if (wn < n) {
+ /* This function itself needs only n BDIGITs for work area.
+ * However this function calls bary_mul_karatsuba and
+ * bary_mul_balance recursively.
+ * 2n BDIGITs are enough to avoid allocations in
+ * the recursively called functions.
+ */
+ wn = 2*n;
+ wds = ALLOCV_N(BDIGIT, work, wn);
+ }
+
+ /* Karatsuba algorithm:
+ *
+ * x = x0 + r*x1
+ * y = y0 + r*y1
+ * z = x*y
+ * = (x0 + r*x1) * (y0 + r*y1)
+ * = x0*y0 + r*(x1*y0 + x0*y1) + r*r*x1*y1
+ * = x0*y0 + r*(x0*y0 + x1*y1 - (x1-x0)*(y1-y0)) + r*r*x1*y1
+ * = x0*y0 + r*(x0*y0 + x1*y1 - (x0-x1)*(y0-y1)) + r*r*x1*y1
+ */
+
+ xds0 = xds;
+ xds1 = xds + n;
+ yds0 = yds;
+ yds1 = yds + n;
+ zds0 = zds;
+ zds1 = zds + n;
+ zds2 = zds + 2*n;
+ zds3 = zds + 3*n;
+
+ sub_p = 1;
+
+ /* zds0:? zds1:? zds2:? zds3:? wds:? */
+
+ if (bary_sub(zds0, n, xds, n, xds+n, xn-n)) {
+ bary_2comp(zds0, n);
+ sub_p = !sub_p;
+ }
+
+ /* zds0:|x1-x0| zds1:? zds2:? zds3:? wds:? */
+
+ if (sq) {
+ sub_p = 1;
+ bary_mul_karatsuba_start(zds1, 2*n, zds0, n, zds0, n, wds, wn);
+ }
+ else {
+ if (bary_sub(wds, n, yds, n, yds+n, n)) {
+ bary_2comp(wds, n);
+ sub_p = !sub_p;
+ }
+
+ /* zds0:|x1-x0| zds1:? zds2:? zds3:? wds:|y1-y0| */
+
+ bary_mul_karatsuba_start(zds1, 2*n, zds0, n, wds, n, wds+n, wn-n);
+ }
+
+ /* zds0:|x1-x0| zds1,zds2:|x1-x0|*|y1-y0| zds3:? wds:|y1-y0| */
+
+ borrow = 0;
+ if (sub_p) {
+ borrow = !bary_2comp(zds1, 2*n);
+ }
+ /* zds0:|x1-x0| zds1,zds2:-?|x1-x0|*|y1-y0| zds3:? wds:|y1-y0| */
+
+ MEMCPY(wds, zds1, BDIGIT, n);
+
+ /* zds0:|x1-x0| zds1,zds2:-?|x1-x0|*|y1-y0| zds3:? wds:lo(-?|x1-x0|*|y1-y0|) */
+
+ bary_mul_karatsuba_start(zds0, 2*n, xds0, n, yds0, n, wds+n, wn-n);
+
+ /* zds0,zds1:x0*y0 zds2:hi(-?|x1-x0|*|y1-y0|) zds3:? wds:lo(-?|x1-x0|*|y1-y0|) */
+
+ carry1 = bary_add(wds, n, wds, n, zds0, n);
+ carry1 = bary_addc(zds2, n, zds2, n, zds1, n, carry1);
+
+ /* zds0,zds1:x0*y0 zds2:hi(x0*y0-?|x1-x0|*|y1-y0|) zds3:? wds:lo(x0*y0-?|x1-x0|*|y1-y0|) */
+
+ carry2 = bary_add(zds1, n, zds1, n, wds, n);
+
+ /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2:hi(x0*y0-?|x1-x0|*|y1-y0|) zds3:? wds:lo(x0*y0-?|x1-x0|*|y1-y0|) */
+
+ MEMCPY(wds, zds2, BDIGIT, n);
+
+ /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2:_ zds3:? wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+ bary_mul_karatsuba_start(zds2, zn-2*n, xds1, xn-n, yds1, n, wds+n, wn-n);
+
+ /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2,zds3:x1*y1 wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+ carry3 = bary_add(zds1, n, zds1, n, zds2, n);
+
+ /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1 wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+ carry3 = bary_addc(zds2, n, zds2, n, zds3, (4*n < zn ? n : zn-3*n), carry3);
+
+ /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1+hi(x1*y1) wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+ bary_add(zds2, zn-2*n, zds2, zn-2*n, wds, n);
+
+ /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1+hi(x1*y1)+hi(x0*y0-?|x1-x0|*|y1-y0|) wds:_ */
+
+ if (carry2)
+ bary_add_one(zds2, zn-2*n);
+
+ if (carry1 + carry3 - borrow < 0)
+ bary_sub_one(zds3, zn-3*n);
+ else if (carry1 + carry3 - borrow > 0) {
+ BDIGIT c = carry1 + carry3 - borrow;
+ bary_add(zds3, zn-3*n, zds3, zn-3*n, &c, 1);
+ }
+
+ /*
+ if (SIZEOF_BDIGIT * zn <= 16) {
+ uint128_t z, x, y;
+ ssize_t i;
+ for (x = 0, i = xn-1; 0 <= i; i--) { x <<= SIZEOF_BDIGIT*CHAR_BIT; x |= xds[i]; }
+ for (y = 0, i = yn-1; 0 <= i; i--) { y <<= SIZEOF_BDIGIT*CHAR_BIT; y |= yds[i]; }
+ for (z = 0, i = zn-1; 0 <= i; i--) { z <<= SIZEOF_BDIGIT*CHAR_BIT; z |= zds[i]; }
+ assert(z == x * y);
+ }
+ */
+
+ if (odd_xy) {
+ bary_muladd_1xN(zds+yn, zn-yn, yds[yn], xds, xn);
+ bary_muladd_1xN(zds+xn, zn-xn, xds[xn], yds, yn+1);
+ }
+ else if (odd_y) {
+ bary_muladd_1xN(zds+yn, zn-yn, yds[yn], xds, xn);
+ }
+
+ if (work)
+ ALLOCV_END(work);
+}
+
+VALUE
+rb_big_mul_karatsuba(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+ VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ if (!((xn <= yn && yn < 2) || KARATSUBA_BALANCED(xn, yn)))
+ rb_raise(rb_eArgError, "unexpected bignum length for karatsuba");
+ bary_mul_karatsuba(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+ return z;
+}
+
+static void
+bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+ size_t n;
+ size_t wnc;
+ VALUE work = 0;
+
+ /* "p" stands for "positive". Actually it means "non-negative", though. */
+ size_t x0n; const BDIGIT *x0ds;
+ size_t x1n; const BDIGIT *x1ds;
+ size_t x2n; const BDIGIT *x2ds;
+ size_t y0n; const BDIGIT *y0ds;
+ size_t y1n; const BDIGIT *y1ds;
+ size_t y2n; const BDIGIT *y2ds;
+
+ size_t u1n; BDIGIT *u1ds; int u1p;
+ size_t u2n; BDIGIT *u2ds; int u2p;
+ size_t u3n; BDIGIT *u3ds; int u3p;
+
+ size_t v1n; BDIGIT *v1ds; int v1p;
+ size_t v2n; BDIGIT *v2ds; int v2p;
+ size_t v3n; BDIGIT *v3ds; int v3p;
+
+ size_t t0n; BDIGIT *t0ds; int t0p;
+ size_t t1n; BDIGIT *t1ds; int t1p;
+ size_t t2n; BDIGIT *t2ds; int t2p;
+ size_t t3n; BDIGIT *t3ds; int t3p;
+ size_t t4n; BDIGIT *t4ds; int t4p;
+
+ size_t z0n; BDIGIT *z0ds;
+ size_t z1n; BDIGIT *z1ds; int z1p;
+ size_t z2n; BDIGIT *z2ds; int z2p;
+ size_t z3n; BDIGIT *z3ds; int z3p;
+ size_t z4n; BDIGIT *z4ds;
+
+ size_t zzn; BDIGIT *zzds;
+
+ int sq = xds == yds && xn == yn;
+
+ assert(xn <= yn); /* assume y >= x */
+ assert(xn + yn <= zn);
+
+ n = (yn + 2) / 3;
+ assert(2*n < xn);
+
+ wnc = 0;
+
+ wnc += (u1n = n+1); /* BITSPERDIG*n+2 bits */
+ wnc += (u2n = n+1); /* BITSPERDIG*n+1 bits */
+ wnc += (u3n = n+1); /* BITSPERDIG*n+3 bits */
+ wnc += (v1n = n+1); /* BITSPERDIG*n+2 bits */
+ wnc += (v2n = n+1); /* BITSPERDIG*n+1 bits */
+ wnc += (v3n = n+1); /* BITSPERDIG*n+3 bits */
+
+ wnc += (t0n = 2*n); /* BITSPERDIG*2*n bits */
+ wnc += (t1n = 2*n+2); /* BITSPERDIG*2*n+4 bits but bary_mul needs u1n+v1n */
+ wnc += (t2n = 2*n+2); /* BITSPERDIG*2*n+2 bits but bary_mul needs u2n+v2n */
+ wnc += (t3n = 2*n+2); /* BITSPERDIG*2*n+6 bits but bary_mul needs u3n+v3n */
+ wnc += (t4n = 2*n); /* BITSPERDIG*2*n bits */
+
+ wnc += (z1n = 2*n+1); /* BITSPERDIG*2*n+5 bits */
+ wnc += (z2n = 2*n+1); /* BITSPERDIG*2*n+6 bits */
+ wnc += (z3n = 2*n+1); /* BITSPERDIG*2*n+8 bits */
+
+ if (wn < wnc) {
+ wn = wnc * 3 / 2; /* Allocate working memory for whole recursion at once. */
+ wds = ALLOCV_N(BDIGIT, work, wn);
+ }
+
+ u1ds = wds; wds += u1n;
+ u2ds = wds; wds += u2n;
+ u3ds = wds; wds += u3n;
+
+ v1ds = wds; wds += v1n;
+ v2ds = wds; wds += v2n;
+ v3ds = wds; wds += v3n;
+
+ t0ds = wds; wds += t0n;
+ t1ds = wds; wds += t1n;
+ t2ds = wds; wds += t2n;
+ t3ds = wds; wds += t3n;
+ t4ds = wds; wds += t4n;
+
+ z1ds = wds; wds += z1n;
+ z2ds = wds; wds += z2n;
+ z3ds = wds; wds += z3n;
+
+ wn -= wnc;
+
+ zzds = u1ds;
+ zzn = 6*n+1;
+
+ x0n = n;
+ x1n = n;
+ x2n = xn - 2*n;
+ x0ds = xds;
+ x1ds = xds + n;
+ x2ds = xds + 2*n;
+
+ if (sq) {
+ y0n = x0n;
+ y1n = x1n;
+ y2n = x2n;
+ y0ds = x0ds;
+ y1ds = x1ds;
+ y2ds = x2ds;
+ }
+ else {
+ y0n = n;
+ y1n = n;
+ y2n = yn - 2*n;
+ y0ds = yds;
+ y1ds = yds + n;
+ y2ds = yds + 2*n;
+ }
+
+ /*
+ * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
+ *
+ * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
+ * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
+ *
+ * z(b) = x(b) * y(b)
+ * z(b) = z0 * b^0 + z1 * b^1 + z2 * b^2 + z3 * b^3 + z4 * b^4
+ * where:
+ * z0 = x0 * y0
+ * z1 = x0 * y1 + x1 * y0
+ * z2 = x0 * y2 + x1 * y1 + x2 * y0
+ * z3 = x1 * y2 + x2 * y1
+ * z4 = x2 * y2
+ *
+ * Toom3 method (a.k.a. Toom-Cook method):
+ * (Step1) calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4),
+ * where:
+ * b0 = 0, b1 = 1, b2 = -1, b3 = -2, b4 = inf,
+ * z(0) = x(0) * y(0) = x0 * y0
+ * z(1) = x(1) * y(1) = (x0 + x1 + x2) * (y0 + y1 + y2)
+ * z(-1) = x(-1) * y(-1) = (x0 - x1 + x2) * (y0 - y1 + y2)
+ * z(-2) = x(-2) * y(-2) = (x0 - 2 * (x1 - 2 * x2)) * (y0 - 2 * (y1 - 2 * y2))
+ * z(inf) = x(inf) * y(inf) = x2 * y2
+ *
+ * (Step2) interpolating z0, z1, z2, z3 and z4.
+ *
+ * (Step3) Substituting base value into b of the polynomial z(b),
+ */
+
+ /*
+ * [Step1] calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4)
+ */
+
+ /* u1 <- x0 + x2 */
+ bary_add(u1ds, u1n, x0ds, x0n, x2ds, x2n);
+ u1p = 1;
+
+ /* x(-1) : u2 <- u1 - x1 = x0 - x1 + x2 */
+ if (bary_sub(u2ds, u2n, u1ds, u1n, x1ds, x1n)) {
+ bary_2comp(u2ds, u2n);
+ u2p = 0;
+ }
+ else {
+ u2p = 1;
+ }
+
+ /* x(1) : u1 <- u1 + x1 = x0 + x1 + x2 */
+ bary_add(u1ds, u1n, u1ds, u1n, x1ds, x1n);
+
+ /* x(-2) : u3 <- 2 * (u2 + x2) - x0 = x0 - 2 * (x1 - 2 * x2) */
+ u3p = 1;
+ if (u2p) {
+ bary_add(u3ds, u3n, u2ds, u2n, x2ds, x2n);
+ }
+ else if (bary_sub(u3ds, u3n, x2ds, x2n, u2ds, u2n)) {
+ bary_2comp(u3ds, u3n);
+ u3p = 0;
+ }
+ bary_small_lshift(u3ds, u3ds, u3n, 1);
+ if (!u3p) {
+ bary_add(u3ds, u3n, u3ds, u3n, x0ds, x0n);
+ }
+ else if (bary_sub(u3ds, u3n, u3ds, u3n, x0ds, x0n)) {
+ bary_2comp(u3ds, u3n);
+ u3p = 0;
+ }
+
+ if (sq) {
+ v1n = u1n; v1ds = u1ds; v1p = u1p;
+ v2n = u2n; v2ds = u2ds; v2p = u2p;
+ v3n = u3n; v3ds = u3ds; v3p = u3p;
+ }
+ else {
+ /* v1 <- y0 + y2 */
+ bary_add(v1ds, v1n, y0ds, y0n, y2ds, y2n);
+ v1p = 1;
+
+ /* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
+ v2p = 1;
+ if (bary_sub(v2ds, v2n, v1ds, v1n, y1ds, y1n)) {
+ bary_2comp(v2ds, v2n);
+ v2p = 0;
+ }
+
+ /* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
+ bary_add(v1ds, v1n, v1ds, v1n, y1ds, y1n);
+
+ /* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
+ v3p = 1;
+ if (v2p) {
+ bary_add(v3ds, v3n, v2ds, v2n, y2ds, y2n);
+ }
+ else if (bary_sub(v3ds, v3n, y2ds, y2n, v2ds, v2n)) {
+ bary_2comp(v3ds, v3n);
+ v3p = 0;
+ }
+ bary_small_lshift(v3ds, v3ds, v3n, 1);
+ if (!v3p) {
+ bary_add(v3ds, v3n, v3ds, v3n, y0ds, y0n);
+ }
+ else if (bary_sub(v3ds, v3n, v3ds, v3n, y0ds, y0n)) {
+ bary_2comp(v3ds, v3n);
+ v3p = 0;
+ }
+ }
+
+ /* z(0) : t0 <- x0 * y0 */
+ bary_mul_toom3_start(t0ds, t0n, x0ds, x0n, y0ds, y0n, wds, wn);
+ t0p = 1;
+
+ /* z(1) : t1 <- u1 * v1 */
+ bary_mul_toom3_start(t1ds, t1n, u1ds, u1n, v1ds, v1n, wds, wn);
+ t1p = u1p == v1p;
+ assert(t1ds[t1n-1] == 0);
+ t1n--;
+
+ /* z(-1) : t2 <- u2 * v2 */
+ bary_mul_toom3_start(t2ds, t2n, u2ds, u2n, v2ds, v2n, wds, wn);
+ t2p = u2p == v2p;
+ assert(t2ds[t2n-1] == 0);
+ t2n--;
+
+ /* z(-2) : t3 <- u3 * v3 */
+ bary_mul_toom3_start(t3ds, t3n, u3ds, u3n, v3ds, v3n, wds, wn);
+ t3p = u3p == v3p;
+ assert(t3ds[t3n-1] == 0);
+ t3n--;
+
+ /* z(inf) : t4 <- x2 * y2 */
+ bary_mul_toom3_start(t4ds, t4n, x2ds, x2n, y2ds, y2n, wds, wn);
+ t4p = 1;
+
+ /*
+ * [Step2] interpolating z0, z1, z2, z3 and z4.
+ */
+
+ /* z0 <- z(0) == t0 */
+ z0n = t0n; z0ds = t0ds;
+
+ /* z4 <- z(inf) == t4 */
+ z4n = t4n; z4ds = t4ds;
+
+ /* z3 <- (z(-2) - z(1)) / 3 == (t3 - t1) / 3 */
+ if (t3p == t1p) {
+ z3p = t3p;
+ if (bary_sub(z3ds, z3n, t3ds, t3n, t1ds, t1n)) {
+ bary_2comp(z3ds, z3n);
+ z3p = !z3p;
+ }
+ }
+ else {
+ z3p = t3p;
+ bary_add(z3ds, z3n, t3ds, t3n, t1ds, t1n);
+ }
+ bigdivrem_single(z3ds, z3ds, z3n, 3);
+
+ /* z1 <- (z(1) - z(-1)) / 2 == (t1 - t2) / 2 */
+ if (t1p == t2p) {
+ z1p = t1p;
+ if (bary_sub(z1ds, z1n, t1ds, t1n, t2ds, t2n)) {
+ bary_2comp(z1ds, z1n);
+ z1p = !z1p;
+ }
+ }
+ else {
+ z1p = t1p;
+ bary_add(z1ds, z1n, t1ds, t1n, t2ds, t2n);
+ }
+ bary_small_rshift(z1ds, z1ds, z1n, 1, 0);
+
+ /* z2 <- z(-1) - z(0) == t2 - t0 */
+ if (t2p == t0p) {
+ z2p = t2p;
+ if (bary_sub(z2ds, z2n, t2ds, t2n, t0ds, t0n)) {
+ bary_2comp(z2ds, z2n);
+ z2p = !z2p;
+ }
+ }
+ else {
+ z2p = t2p;
+ bary_add(z2ds, z2n, t2ds, t2n, t0ds, t0n);
+ }
+
+ /* z3 <- (z2 - z3) / 2 + 2 * z(inf) == (z2 - z3) / 2 + 2 * t4 */
+ if (z2p == z3p) {
+ z3p = z2p;
+ if (bary_sub(z3ds, z3n, z2ds, z2n, z3ds, z3n)) {
+ bary_2comp(z3ds, z3n);
+ z3p = !z3p;
+ }
+ }
+ else {
+ z3p = z2p;
+ bary_add(z3ds, z3n, z2ds, z2n, z3ds, z3n);
+ }
+ bary_small_rshift(z3ds, z3ds, z3n, 1, 0);
+ if (z3p == t4p) {
+ bary_muladd_1xN(z3ds, z3n, 2, t4ds, t4n);
+ }
+ else {
+ if (bary_mulsub_1xN(z3ds, z3n, 2, t4ds, t4n)) {
+ bary_2comp(z3ds, z3n);
+ z3p = !z3p;
+ }
+ }
+
+ /* z2 <- z2 + z1 - z(inf) == z2 + z1 - t4 */
+ if (z2p == z1p) {
+ bary_add(z2ds, z2n, z2ds, z2n, z1ds, z1n);
+ }
+ else {
+ if (bary_sub(z2ds, z2n, z2ds, z2n, z1ds, z1n)) {
+ bary_2comp(z2ds, z2n);
+ z2p = !z2p;
+ }
+ }
+
+ if (z2p == t4p) {
+ if (bary_sub(z2ds, z2n, z2ds, z2n, t4ds, t4n)) {
+ bary_2comp(z2ds, z2n);
+ z2p = !z2p;
+ }
+ }
+ else {
+ bary_add(z2ds, z2n, z2ds, z2n, t4ds, t4n);
+ }
+
+ /* z1 <- z1 - z3 */
+ if (z1p == z3p) {
+ if (bary_sub(z1ds, z1n, z1ds, z1n, z3ds, z3n)) {
+ bary_2comp(z1ds, z1n);
+ z1p = !z1p;
+ }
+ }
+ else {
+ bary_add(z1ds, z1n, z1ds, z1n, z3ds, z3n);
+ }
+
+ /*
+ * [Step3] Substituting base value into b of the polynomial z(b),
+ */
+
+ MEMCPY(zzds, z0ds, BDIGIT, z0n);
+ BDIGITS_ZERO(zzds + z0n, 4*n - z0n);
+ MEMCPY(zzds + 4*n, z4ds, BDIGIT, z4n);
+ BDIGITS_ZERO(zzds + 4*n + z4n, zzn - (4*n + z4n));
+ if (z1p)
+ bary_add(zzds + n, zzn - n, zzds + n, zzn - n, z1ds, z1n);
+ else
+ bary_sub(zzds + n, zzn - n, zzds + n, zzn - n, z1ds, z1n);
+ if (z2p)
+ bary_add(zzds + 2*n, zzn - 2*n, zzds + 2*n, zzn - 2*n, z2ds, z2n);
+ else
+ bary_sub(zzds + 2*n, zzn - 2*n, zzds + 2*n, zzn - 2*n, z2ds, z2n);
+ if (z3p)
+ bary_add(zzds + 3*n, zzn - 3*n, zzds + 3*n, zzn - 3*n, z3ds, z3n);
+ else
+ bary_sub(zzds + 3*n, zzn - 3*n, zzds + 3*n, zzn - 3*n, z3ds, z3n);
+
+ BARY_TRUNC(zzds, zzn);
+ MEMCPY(zds, zzds, BDIGIT, zzn);
+ BDIGITS_ZERO(zds + zzn, zn - zzn);
+
+ if (work)
+ ALLOCV_END(work);
+}
+
+VALUE
+rb_big_mul_toom3(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+ VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ if (xn > yn || yn < 3 || !TOOM3_BALANCED(xn,yn))
+ rb_raise(rb_eArgError, "unexpected bignum length for toom3");
+ bary_mul_toom3(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+ return z;
+}
+
+#ifdef USE_GMP
+static void
+bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+ mpz_t x, y, z;
+ size_t count;
+
+ assert(xn + yn <= zn);
+
+ mpz_init(x);
+ mpz_init(y);
+ mpz_init(z);
+ mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+ if (xds == yds && xn == yn) {
+ mpz_mul(z, x, x);
+ }
+ else {
+ mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+ mpz_mul(z, x, y);
+ }
+ mpz_export(zds, &count, -1, sizeof(BDIGIT), 0, nails, z);
+ BDIGITS_ZERO(zds+count, zn-count);
+ mpz_clear(x);
+ mpz_clear(y);
+ mpz_clear(z);
+}
+
+VALUE
+rb_big_mul_gmp(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+ VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ bary_mul_gmp(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+ return z;
+}
+#endif
+
+static void
+bary_short_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ assert(xn + yn <= zn);
+
+ if (xn == 1 && yn == 1) {
+ bary_mul_single(zds, zn, xds[0], yds[0]);
+ }
+ else {
+ bary_mul_normal(zds, zn, xds, xn, yds, yn);
+ rb_thread_check_ints();
+ }
+}
+
+/* determine whether a bignum is sparse or not by random sampling */
+static inline int
+bary_sparse_p(const BDIGIT *ds, size_t n)
+{
+ long c = 0;
+
+ if ( ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+ if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+ if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+
+ return (c <= 1) ? 1 : 0;
+}
+
+static int
+bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp, const BDIGIT **ydsp, size_t *ynp)
+{
+ size_t nlsz; /* number of least significant zero BDIGITs */
+
+ BDIGIT *zds = *zdsp;
+ size_t zn = *znp;
+ const BDIGIT *xds = *xdsp;
+ size_t xn = *xnp;
+ const BDIGIT *yds = *ydsp;
+ size_t yn = *ynp;
+
+ assert(xn + yn <= zn);
+
+ nlsz = 0;
+
+ while (0 < xn) {
+ if (xds[xn-1] == 0) {
+ xn--;
+ }
+ else {
+ do {
+ if (xds[0] != 0)
+ break;
+ xds++;
+ xn--;
+ nlsz++;
+ } while (0 < xn);
+ break;
+ }
+ }
+
+ while (0 < yn) {
+ if (yds[yn-1] == 0) {
+ yn--;
+ }
+ else {
+ do {
+ if (yds[0] != 0)
+ break;
+ yds++;
+ yn--;
+ nlsz++;
+ } while (0 < yn);
+ break;
+ }
+ }
+
+ if (nlsz) {
+ BDIGITS_ZERO(zds, nlsz);
+ zds += nlsz;
+ zn -= nlsz;
+ }
+
+ /* make sure that y is longer than x */
+ if (xn > yn) {
+ const BDIGIT *tds;
+ size_t tn;
+ tds = xds; xds = yds; yds = tds;
+ tn = xn; xn = yn; yn = tn;
+ }
+ assert(xn <= yn);
+
+ if (xn <= 1) {
+ if (xn == 0) {
+ BDIGITS_ZERO(zds, zn);
+ return 1;
+ }
+
+ if (xds[0] == 1) {
+ MEMCPY(zds, yds, BDIGIT, yn);
+ BDIGITS_ZERO(zds+yn, zn-yn);
+ return 1;
+ }
+ if (POW2_P(xds[0])) {
+ zds[yn] = bary_small_lshift(zds, yds, yn, bit_length(xds[0])-1);
+ BDIGITS_ZERO(zds+yn+1, zn-yn-1);
+ return 1;
+ }
+ if (yn == 1 && yds[0] == 1) {
+ zds[0] = xds[0];
+ BDIGITS_ZERO(zds+1, zn-1);
+ return 1;
+ }
+ bary_mul_normal(zds, zn, xds, xn, yds, yn);
+ return 1;
+ }
+
+ *zdsp = zds;
+ *znp = zn;
+ *xdsp = xds;
+ *xnp = xn;
+ *ydsp = yds;
+ *ynp = yn;
+
+ return 0;
+}
+
+static void
+bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+ /* normal multiplication when x is small */
+ if (xn < KARATSUBA_MUL_DIGITS) {
+ normal:
+ if (xds == yds && xn == yn)
+ bary_sq_fast(zds, zn, xds, xn);
+ else
+ bary_short_mul(zds, zn, xds, xn, yds, yn);
+ return;
+ }
+
+ /* normal multiplication when x or y is a sparse bignum */
+ if (bary_sparse_p(xds, xn)) goto normal;
+ if (bary_sparse_p(yds, yn)) {
+ bary_short_mul(zds, zn, yds, yn, xds, xn);
+ return;
+ }
+
+ /* balance multiplication by slicing y when x is much smaller than y */
+ if (!KARATSUBA_BALANCED(xn, yn)) {
+ bary_mul_balance_with_mulfunc(zds, zn, xds, xn, yds, yn, wds, wn, bary_mul_karatsuba_start);
+ return;
+ }
+
+ /* multiplication by karatsuba method */
+ bary_mul_karatsuba(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul_karatsuba_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+ if (bary_mul_precheck(&zds, &zn, &xds, &xn, &yds, &yn))
+ return;
+
+ bary_mul_karatsuba_branch(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul_toom3_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+ if (xn < TOOM3_MUL_DIGITS) {
+ bary_mul_karatsuba_branch(zds, zn, xds, xn, yds, yn, wds, wn);
+ return;
+ }
+
+ if (!TOOM3_BALANCED(xn, yn)) {
+ bary_mul_balance_with_mulfunc(zds, zn, xds, xn, yds, yn, wds, wn, bary_mul_toom3_start);
+ return;
+ }
+
+ bary_mul_toom3(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul_toom3_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+ if (bary_mul_precheck(&zds, &zn, &xds, &xn, &yds, &yn))
+ return;
+
+ bary_mul_toom3_branch(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+#ifdef USE_GMP
+ const size_t naive_threshold = GMP_MUL_DIGITS;
+#else
+ const size_t naive_threshold = KARATSUBA_MUL_DIGITS;
+#endif
+ if (xn <= yn) {
+ if (xn < naive_threshold) {
+ if (xds == yds && xn == yn)
+ bary_sq_fast(zds, zn, xds, xn);
+ else
+ bary_short_mul(zds, zn, xds, xn, yds, yn);
+ return;
+ }
+ }
+ else {
+ if (yn < naive_threshold) {
+ bary_short_mul(zds, zn, yds, yn, xds, xn);
+ return;
+ }
+ }
+
+#ifdef USE_GMP
+ bary_mul_gmp(zds, zn, xds, xn, yds, yn);
+#else
+ bary_mul_toom3_start(zds, zn, xds, xn, yds, yn, NULL, 0);
+#endif
+}
+
+struct big_div_struct {
+ size_t yn, zn;
+ BDIGIT *yds, *zds;
+ volatile VALUE stop;
+};
+
+static void *
+bigdivrem1(void *ptr)
{
- int i = RBIGNUM(x)->len;
- USHORT *ds = BDIGITS(x);
- long num;
+ struct big_div_struct *bds = (struct big_div_struct*)ptr;
+ size_t yn = bds->yn;
+ size_t zn = bds->zn;
+ BDIGIT *yds = bds->yds, *zds = bds->zds;
+ BDIGIT_DBL_SIGNED num;
+ BDIGIT q;
- while (i--) ds[i] = ~ds[i];
- i = 0; num = 1;
do {
- num += ds[i];
- ds[i++] = BIGLO(num);
- num = BIGDN(num);
- } while (i < RBIGNUM(x)->len);
- if (ds[0] == 1 || ds[0] == 0) {
- for (i=1; i<RBIGNUM(x)->len; i++) {
- if (ds[i] != 0) return;
+ if (bds->stop) {
+ bds->zn = zn;
+ return 0;
+ }
+ if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
+ else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
+ if (q) {
+ num = bigdivrem_mulsub(zds+zn-(yn+1), yn+1,
+ q,
+ yds, yn);
+ while (num) { /* "add back" required */
+ q--;
+ num = bary_add(zds+zn-(yn+1), yn,
+ zds+zn-(yn+1), yn,
+ yds, yn);
+ num--;
+ }
}
- REALLOC_N(BDIGITS(x), USHORT, RBIGNUM(x)->len++);
- ds = BDIGITS(x);
- ds[RBIGNUM(x)->len-1] = 1;
+ zn--;
+ zds[zn] = q;
+ } while (zn > yn);
+ return 0;
+}
+
+static void
+rb_big_stop(void *ptr)
+{
+ struct big_div_struct *bds = ptr;
+ bds->stop = Qtrue;
+}
+
+static BDIGIT
+bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdigit, BDIGIT y)
+{
+ assert(0 < xn);
+ assert(x_higher_bdigit < y);
+ if (POW2_P(y)) {
+ BDIGIT r;
+ r = xds[0] & (y-1);
+ bary_small_rshift(qds, xds, xn, bit_length(y)-1, x_higher_bdigit);
+ return r;
+ }
+ else {
+ size_t i;
+ BDIGIT_DBL t2;
+ t2 = x_higher_bdigit;
+ i = xn;
+ while (i--) {
+ t2 = BIGUP(t2) + xds[i];
+ qds[i] = (BDIGIT)(t2 / y);
+ t2 %= y;
+ }
+ return (BDIGIT)t2;
+ }
+}
+
+static BDIGIT
+bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y)
+{
+ return bigdivrem_single1(qds, xds, xn, 0, y);
+}
+
+static void
+bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
+{
+ struct big_div_struct bds;
+ size_t ynzero;
+
+ assert(yn < zn);
+ assert(BDIGIT_MSB(yds[yn-1]));
+ assert(zds[zn-1] < yds[yn-1]);
+
+ for (ynzero = 0; !yds[ynzero]; ynzero++);
+
+ if (ynzero+1 == yn) {
+ BDIGIT r;
+ r = bigdivrem_single1(zds+yn, zds+ynzero, zn-yn, zds[zn-1], yds[ynzero]);
+ zds[ynzero] = r;
+ return;
+ }
+
+ bds.yn = yn - ynzero;
+ bds.zds = zds + ynzero;
+ bds.yds = yds + ynzero;
+ bds.stop = Qfalse;
+ bds.zn = zn - ynzero;
+ if (bds.zn > 10000 || bds.yn > 10000) {
+ retry:
+ bds.stop = Qfalse;
+ rb_thread_call_without_gvl(bigdivrem1, &bds, rb_big_stop, &bds);
+
+ if (bds.stop == Qtrue) {
+ /* execute trap handler, but exception was not raised. */
+ goto retry;
+ }
+ }
+ else {
+ bigdivrem1(&bds);
+ }
+}
+
+static void
+bary_divmod_normal(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ int shift;
+ BDIGIT *zds, *yyds;
+ size_t zn;
+ VALUE tmpyz = 0;
+
+ assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+ assert(qds ? (xn - yn + 1) <= qn : 1);
+ assert(rds ? yn <= rn : 1);
+
+ zn = xn + BIGDIVREM_EXTRA_WORDS;
+
+ shift = nlz(yds[yn-1]);
+ if (shift) {
+ int alloc_y = !rds;
+ int alloc_z = !qds || qn < zn;
+ if (alloc_y && alloc_z) {
+ yyds = ALLOCV_N(BDIGIT, tmpyz, yn+zn);
+ zds = yyds + yn;
+ }
+ else {
+ yyds = alloc_y ? ALLOCV_N(BDIGIT, tmpyz, yn) : rds;
+ zds = alloc_z ? ALLOCV_N(BDIGIT, tmpyz, zn) : qds;
+ }
+ zds[xn] = bary_small_lshift(zds, xds, xn, shift);
+ bary_small_lshift(yyds, yds, yn, shift);
+ }
+ else {
+ if (qds && zn <= qn)
+ zds = qds;
+ else
+ zds = ALLOCV_N(BDIGIT, tmpyz, zn);
+ MEMCPY(zds, xds, BDIGIT, xn);
+ zds[xn] = 0;
+ /* bigdivrem_restoring will not modify y.
+ * So use yds directly. */
+ yyds = (BDIGIT *)yds;
+ }
+
+ bigdivrem_restoring(zds, zn, yyds, yn);
+
+ if (rds) {
+ if (shift)
+ bary_small_rshift(rds, zds, yn, shift, 0);
+ else
+ MEMCPY(rds, zds, BDIGIT, yn);
+ BDIGITS_ZERO(rds+yn, rn-yn);
+ }
+
+ if (qds) {
+ size_t j = zn - yn;
+ MEMMOVE(qds, zds+yn, BDIGIT, j);
+ BDIGITS_ZERO(qds+j, qn-j);
+ }
+
+ if (tmpyz)
+ ALLOCV_END(tmpyz);
+}
+
+VALUE
+rb_big_divrem_normal(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), qn, rn;
+ BDIGIT *xds = BDIGITS(x), *yds = BDIGITS(y), *qds, *rds;
+ VALUE q, r;
+
+ BARY_TRUNC(yds, yn);
+ if (yn == 0)
+ rb_num_zerodiv();
+ BARY_TRUNC(xds, xn);
+
+ if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1]))
+ return rb_assoc_new(LONG2FIX(0), x);
+
+ qn = xn + BIGDIVREM_EXTRA_WORDS;
+ q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ qds = BDIGITS(q);
+
+ rn = yn;
+ r = bignew(rn, BIGNUM_SIGN(x));
+ rds = BDIGITS(r);
+
+ bary_divmod_normal(qds, qn, rds, rn, xds, xn, yds, yn);
+
+ bigtrunc(q);
+ bigtrunc(r);
+
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+
+ return rb_assoc_new(q, r);
+}
+
+#ifdef USE_GMP
+static void
+bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+ mpz_t x, y, q, r;
+ size_t count;
+
+ assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+ assert(qds ? (xn - yn + 1) <= qn : 1);
+ assert(rds ? yn <= rn : 1);
+ assert(qds || rds);
+
+ mpz_init(x);
+ mpz_init(y);
+ if (qds) mpz_init(q);
+ if (rds) mpz_init(r);
+
+ mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+ mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+
+ if (!rds) {
+ mpz_fdiv_q(q, x, y);
+ }
+ else if (!qds) {
+ mpz_fdiv_r(r, x, y);
+ }
+ else {
+ mpz_fdiv_qr(q, r, x, y);
+ }
+
+ mpz_clear(x);
+ mpz_clear(y);
+
+ if (qds) {
+ mpz_export(qds, &count, -1, sizeof(BDIGIT), 0, nails, q);
+ BDIGITS_ZERO(qds+count, qn-count);
+ mpz_clear(q);
+ }
+
+ if (rds) {
+ mpz_export(rds, &count, -1, sizeof(BDIGIT), 0, nails, r);
+ BDIGITS_ZERO(rds+count, rn-count);
+ mpz_clear(r);
+ }
+}
+
+VALUE
+rb_big_divrem_gmp(VALUE x, VALUE y)
+{
+ size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), qn, rn;
+ BDIGIT *xds = BDIGITS(x), *yds = BDIGITS(y), *qds, *rds;
+ VALUE q, r;
+
+ BARY_TRUNC(yds, yn);
+ if (yn == 0)
+ rb_num_zerodiv();
+ BARY_TRUNC(xds, xn);
+
+ if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1]))
+ return rb_assoc_new(LONG2FIX(0), x);
+
+ qn = xn - yn + 1;
+ q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ qds = BDIGITS(q);
+
+ rn = yn;
+ r = bignew(rn, BIGNUM_SIGN(x));
+ rds = BDIGITS(r);
+
+ bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
+
+ bigtrunc(q);
+ bigtrunc(r);
+
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+
+ return rb_assoc_new(q, r);
+}
+#endif
+
+static void
+bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+#ifdef USE_GMP
+ if (GMP_DIV_DIGITS < xn) {
+ bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
+ return;
+ }
+#endif
+ bary_divmod_normal(qds, qn, rds, rn, xds, xn, yds, yn);
+}
+
+static void
+bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+ assert(xn <= qn);
+ assert(yn <= rn);
+
+ BARY_TRUNC(yds, yn);
+ if (yn == 0)
+ rb_num_zerodiv();
+
+ BARY_TRUNC(xds, xn);
+ if (xn == 0) {
+ BDIGITS_ZERO(qds, qn);
+ BDIGITS_ZERO(rds, rn);
+ return;
+ }
+
+ if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
+ MEMCPY(rds, xds, BDIGIT, xn);
+ BDIGITS_ZERO(rds+xn, rn-xn);
+ BDIGITS_ZERO(qds, qn);
+ }
+ else if (yn == 1) {
+ MEMCPY(qds, xds, BDIGIT, xn);
+ BDIGITS_ZERO(qds+xn, qn-xn);
+ rds[0] = bigdivrem_single(qds, xds, xn, yds[0]);
+ BDIGITS_ZERO(rds+1, rn-1);
+ }
+ else if (xn == 2 && yn == 2) {
+ BDIGIT_DBL x = bary2bdigitdbl(xds, 2);
+ BDIGIT_DBL y = bary2bdigitdbl(yds, 2);
+ BDIGIT_DBL q = x / y;
+ BDIGIT_DBL r = x % y;
+ qds[0] = BIGLO(q);
+ qds[1] = BIGLO(BIGDN(q));
+ BDIGITS_ZERO(qds+2, qn-2);
+ rds[0] = BIGLO(r);
+ rds[1] = BIGLO(BIGDN(r));
+ BDIGITS_ZERO(rds+2, rn-2);
+ }
+ else {
+ bary_divmod_branch(qds, qn, rds, rn, xds, xn, yds, yn);
+ }
+}
+
+
+#define BIGNUM_DEBUG 0
+#if BIGNUM_DEBUG
+#define ON_DEBUG(x) do { x; } while (0)
+static void
+dump_bignum(VALUE x)
+{
+ long i;
+ printf("%c0x0", BIGNUM_SIGN(x) ? '+' : '-');
+ for (i = BIGNUM_LEN(x); i--; ) {
+ printf("_%0*"PRIxBDIGIT, SIZEOF_BDIGIT*2, BDIGITS(x)[i]);
}
+ printf(", len=%"PRIuSIZE, BIGNUM_LEN(x));
+ puts("");
}
static VALUE
-bignorm(x)
- VALUE x;
+rb_big_dump(VALUE x)
+{
+ dump_bignum(x);
+ return x;
+}
+#else
+#define ON_DEBUG(x)
+#endif
+
+static int
+bigzero_p(VALUE x)
{
- int len = RBIGNUM(x)->len;
- USHORT *ds = BDIGITS(x);
+ return bary_zero_p(BDIGITS(x), BIGNUM_LEN(x));
+}
- while (len-- && !ds[len]) ;
- RBIGNUM(x)->len = ++len;
+int
+rb_bigzero_p(VALUE x)
+{
+ return BIGZEROP(x);
+}
- if (len*sizeof(USHORT) <= sizeof(VALUE)) {
- long num = 0;
- while (len--) {
- num = BIGUP(num) + ds[len];
+int
+rb_cmpint(VALUE val, VALUE a, VALUE b)
+{
+ if (NIL_P(val)) {
+ rb_cmperr(a, b);
+ }
+ if (FIXNUM_P(val)) {
+ long l = FIX2LONG(val);
+ if (l > 0) return 1;
+ if (l < 0) return -1;
+ return 0;
+ }
+ if (RB_BIGNUM_TYPE_P(val)) {
+ if (BIGZEROP(val)) return 0;
+ if (BIGNUM_SIGN(val)) return 1;
+ return -1;
+ }
+ if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
+ if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
+ return 0;
+}
+
+#define BIGNUM_SET_LEN(b,l) \
+ ((RBASIC(b)->flags & BIGNUM_EMBED_FLAG) ? \
+ (void)(RBASIC(b)->flags = \
+ (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
+ ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
+ (void)(RBIGNUM(b)->as.heap.len = (l)))
+
+static void
+rb_big_realloc(VALUE big, size_t len)
+{
+ BDIGIT *ds;
+ if (RBASIC(big)->flags & BIGNUM_EMBED_FLAG) {
+ if (BIGNUM_EMBED_LEN_MAX < len) {
+ ds = ALLOC_N(BDIGIT, len);
+ MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, BIGNUM_EMBED_LEN_MAX);
+ RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
+ RBIGNUM(big)->as.heap.digits = ds;
+ RBASIC(big)->flags &= ~BIGNUM_EMBED_FLAG;
}
- if (num >= 0) {
- if (RBIGNUM(x)->sign) {
- if (POSFIXABLE(num)) return INT2FIX(num);
+ }
+ else {
+ if (len <= BIGNUM_EMBED_LEN_MAX) {
+ ds = RBIGNUM(big)->as.heap.digits;
+ RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
+ BIGNUM_SET_LEN(big, len);
+ (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
+ if (ds) {
+ MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
+ xfree(ds);
+ }
+ }
+ else {
+ if (BIGNUM_LEN(big) == 0) {
+ RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+ }
+ else {
+ REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
}
- else if (NEGFIXABLE(-(long)num)) return INT2FIX(-(long)num);
}
}
+}
+
+void
+rb_big_resize(VALUE big, size_t len)
+{
+ rb_big_realloc(big, len);
+ BIGNUM_SET_LEN(big, len);
+}
+
+static VALUE
+bignew_1(VALUE klass, size_t len, int sign)
+{
+ NEWOBJ_OF(big, struct RBignum, klass, T_BIGNUM | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0));
+ BIGNUM_SET_SIGN(big, sign?1:0);
+ if (len <= BIGNUM_EMBED_LEN_MAX) {
+ RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
+ BIGNUM_SET_LEN(big, len);
+ (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
+ }
+ else {
+ RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+ RBIGNUM(big)->as.heap.len = len;
+ }
+ OBJ_FREEZE(big);
+ return (VALUE)big;
+}
+
+VALUE
+rb_big_new(size_t len, int sign)
+{
+ return bignew(len, sign != 0);
+}
+
+VALUE
+rb_big_clone(VALUE x)
+{
+ size_t len = BIGNUM_LEN(x);
+ VALUE z = bignew_1(CLASS_OF(x), len, BIGNUM_SIGN(x));
+
+ MEMCPY(BDIGITS(z), BDIGITS(x), BDIGIT, len);
+ return z;
+}
+
+static void
+big_extend_carry(VALUE x)
+{
+ rb_big_resize(x, BIGNUM_LEN(x)+1);
+ BDIGITS(x)[BIGNUM_LEN(x)-1] = 1;
+}
+
+/* modify a bignum by 2's complement */
+static void
+get2comp(VALUE x)
+{
+ long i = BIGNUM_LEN(x);
+ BDIGIT *ds = BDIGITS(x);
+
+ if (bary_2comp(ds, i)) {
+ big_extend_carry(x);
+ }
+}
+
+void
+rb_big_2comp(VALUE x) /* get 2's complement */
+{
+ get2comp(x);
+}
+
+static BDIGIT
+abs2twocomp(VALUE *xp, long *n_ret)
+{
+ VALUE x = *xp;
+ long n = BIGNUM_LEN(x);
+ BDIGIT *ds = BDIGITS(x);
+ BDIGIT hibits = 0;
+
+ BARY_TRUNC(ds, n);
+
+ if (n != 0 && BIGNUM_NEGATIVE_P(x)) {
+ VALUE z = bignew_1(CLASS_OF(x), n, 0);
+ MEMCPY(BDIGITS(z), ds, BDIGIT, n);
+ bary_2comp(BDIGITS(z), n);
+ hibits = BDIGMAX;
+ *xp = z;
+ }
+ *n_ret = n;
+ return hibits;
+}
+
+static void
+twocomp2abs_bang(VALUE x, int hibits)
+{
+ BIGNUM_SET_SIGN(x, !hibits);
+ if (hibits) {
+ get2comp(x);
+ }
+}
+
+static inline VALUE
+bigtrunc(VALUE x)
+{
+ size_t len = BIGNUM_LEN(x);
+ BDIGIT *ds = BDIGITS(x);
+
+ if (len == 0) return x;
+ while (--len && !ds[len]);
+ if (BIGNUM_LEN(x) > len+1) {
+ rb_big_resize(x, len+1);
+ }
+ return x;
+}
+
+static inline VALUE
+bigfixize(VALUE x)
+{
+ size_t n = BIGNUM_LEN(x);
+ BDIGIT *ds = BDIGITS(x);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ unsigned long u;
+#else
+ BDIGIT u;
+#endif
+
+ BARY_TRUNC(ds, n);
+
+ if (n == 0) return INT2FIX(0);
+
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ if (sizeof(long)/SIZEOF_BDIGIT < n)
+ goto return_big;
+ else {
+ int i = (int)n;
+ u = 0;
+ while (i--) {
+ u = (unsigned long)(BIGUP(u) + ds[i]);
+ }
+ }
+#else /* SIZEOF_BDIGIT >= SIZEOF_LONG */
+ if (1 < n)
+ goto return_big;
+ else
+ u = ds[0];
+#endif
+
+ if (BIGNUM_POSITIVE_P(x)) {
+ if (POSFIXABLE(u)) return LONG2FIX((long)u);
+ }
+ else {
+ if (u <= -FIXNUM_MIN) return LONG2FIX(-(long)u);
+ }
+
+ return_big:
+ rb_big_resize(x, n);
+ return x;
+}
+
+static VALUE
+bignorm(VALUE x)
+{
+ if (RB_BIGNUM_TYPE_P(x)) {
+ x = bigfixize(x);
+ }
return x;
}
VALUE
-rb_big_norm(x)
- VALUE x;
+rb_big_norm(VALUE x)
{
return bignorm(x);
}
VALUE
-rb_uint2big(n)
- unsigned long n;
+rb_uint2big(VALUE n)
{
- unsigned int i = 0;
- USHORT *digits;
- VALUE big;
+ long i;
+ VALUE big = bignew(bdigit_roomof(SIZEOF_VALUE), 1);
+ BDIGIT *digits = BDIGITS(big);
- i = 0;
- big = bignew(DIGSPERINT, 1);
- digits = BDIGITS(big);
- while (i < DIGSPERINT) {
- digits[i++] = BIGLO(n);
+#if SIZEOF_BDIGIT >= SIZEOF_VALUE
+ digits[0] = n;
+#else
+ for (i = 0; i < bdigit_roomof(SIZEOF_VALUE); i++) {
+ digits[i] = BIGLO(n);
n = BIGDN(n);
}
+#endif
- i = DIGSPERINT;
- while (i-- && !digits[i]) ;
- RBIGNUM(big)->len = i+1;
+ i = bdigit_roomof(SIZEOF_VALUE);
+ while (--i && !digits[i]) ;
+ BIGNUM_SET_LEN(big, i+1);
return big;
}
VALUE
-rb_int2big(n)
- long n;
+rb_int2big(SIGNED_VALUE n)
{
long neg = 0;
+ VALUE u;
VALUE big;
if (n < 0) {
- n = -n;
+ u = 1 + (VALUE)(-(n + 1)); /* u = -n avoiding overflow */
neg = 1;
}
- big = rb_uint2big(n);
+ else {
+ u = n;
+ }
+ big = rb_uint2big(u);
if (neg) {
- RBIGNUM(big)->sign = 0;
+ BIGNUM_SET_SIGN(big, 0);
}
return big;
}
VALUE
-rb_uint2inum(n)
- unsigned long n;
+rb_uint2inum(VALUE n)
{
- if (POSFIXABLE(n)) return INT2FIX(n);
+ if (POSFIXABLE(n)) return LONG2FIX(n);
return rb_uint2big(n);
}
VALUE
-rb_int2inum(n)
- long n;
+rb_int2inum(SIGNED_VALUE n)
{
- if (FIXABLE(n)) return INT2FIX(n);
+ if (FIXABLE(n)) return LONG2FIX(n);
return rb_int2big(n);
}
+void
+rb_big_pack(VALUE val, unsigned long *buf, long num_longs)
+{
+ rb_integer_pack(val, buf, num_longs, sizeof(long), 0,
+ INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER|
+ INTEGER_PACK_2COMP);
+}
+
VALUE
-rb_str2inum(str, base)
- char *str;
- int base;
+rb_big_unpack(unsigned long *buf, long num_longs)
{
- char sign = 1, c;
- unsigned long num;
- int len, blen = 1;
- int i;
+ return rb_integer_unpack(buf, num_longs, sizeof(long), 0,
+ INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER|
+ INTEGER_PACK_2COMP);
+}
+
+/*
+ * Calculate the number of bytes to be required to represent
+ * the absolute value of the integer given as _val_.
+ *
+ * [val] an integer.
+ * [nlz_bits_ret] number of leading zero bits in the most significant byte is returned if not NULL.
+ *
+ * This function returns ((val_numbits * CHAR_BIT + CHAR_BIT - 1) / CHAR_BIT)
+ * where val_numbits is the number of bits of abs(val).
+ * This function should not overflow.
+ *
+ * If nlz_bits_ret is not NULL,
+ * (return_value * CHAR_BIT - val_numbits) is stored in *nlz_bits_ret.
+ * In this case, 0 <= *nlz_bits_ret < CHAR_BIT.
+ *
+ */
+size_t
+rb_absint_size(VALUE val, int *nlz_bits_ret)
+{
+ BDIGIT *dp;
+ BDIGIT *de;
+ BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
+
+ int num_leading_zeros;
+
+ val = rb_to_int(val);
+
+ if (FIXNUM_P(val)) {
+ long v = FIX2LONG(val);
+ if (v < 0) {
+ v = -v;
+ }
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ fixbuf[0] = v;
+#else
+ {
+ int i;
+ for (i = 0; i < numberof(fixbuf); i++) {
+ fixbuf[i] = BIGLO(v);
+ v = BIGDN(v);
+ }
+ }
+#endif
+ dp = fixbuf;
+ de = fixbuf + numberof(fixbuf);
+ }
+ else {
+ dp = BDIGITS(val);
+ de = dp + BIGNUM_LEN(val);
+ }
+ while (dp < de && de[-1] == 0)
+ de--;
+ if (dp == de) {
+ if (nlz_bits_ret)
+ *nlz_bits_ret = 0;
+ return 0;
+ }
+ num_leading_zeros = nlz(de[-1]);
+ if (nlz_bits_ret)
+ *nlz_bits_ret = num_leading_zeros % CHAR_BIT;
+ return (de - dp) * SIZEOF_BDIGIT - num_leading_zeros / CHAR_BIT;
+}
+
+static size_t
+absint_numwords_small(size_t numbytes, int nlz_bits_in_msbyte, size_t word_numbits, size_t *nlz_bits_ret)
+{
+ size_t val_numbits = numbytes * CHAR_BIT - nlz_bits_in_msbyte;
+ size_t div = val_numbits / word_numbits;
+ size_t mod = val_numbits % word_numbits;
+ size_t numwords;
+ size_t nlz_bits;
+ numwords = mod == 0 ? div : div + 1;
+ nlz_bits = mod == 0 ? 0 : word_numbits - mod;
+ *nlz_bits_ret = nlz_bits;
+ return numwords;
+}
+
+static size_t
+absint_numwords_generic(size_t numbytes, int nlz_bits_in_msbyte, size_t word_numbits, size_t *nlz_bits_ret)
+{
+ static const BDIGIT char_bit[1] = { CHAR_BIT };
+ BDIGIT numbytes_bary[bdigit_roomof(sizeof(numbytes))];
+ BDIGIT val_numbits_bary[bdigit_roomof(sizeof(numbytes) + 1)];
+ BDIGIT nlz_bits_in_msbyte_bary[1] = { nlz_bits_in_msbyte };
+ BDIGIT word_numbits_bary[bdigit_roomof(sizeof(word_numbits))];
+ BDIGIT div_bary[numberof(val_numbits_bary) + BIGDIVREM_EXTRA_WORDS];
+ BDIGIT mod_bary[numberof(word_numbits_bary)];
+ BDIGIT one[1] = { 1 };
+ size_t nlz_bits;
+ size_t mod;
+ int sign;
+ size_t numwords;
+
+ /*
+ * val_numbits = numbytes * CHAR_BIT - nlz_bits_in_msbyte
+ * div, mod = val_numbits.divmod(word_numbits)
+ * numwords = mod == 0 ? div : div + 1
+ * nlz_bits = mod == 0 ? 0 : word_numbits - mod
+ */
+
+ bary_unpack(BARY_ARGS(numbytes_bary), &numbytes, 1, sizeof(numbytes), 0,
+ INTEGER_PACK_NATIVE_BYTE_ORDER);
+ BARY_SHORT_MUL(val_numbits_bary, numbytes_bary, char_bit);
+ if (nlz_bits_in_msbyte)
+ BARY_SUB(val_numbits_bary, val_numbits_bary, nlz_bits_in_msbyte_bary);
+ bary_unpack(BARY_ARGS(word_numbits_bary), &word_numbits, 1, sizeof(word_numbits), 0,
+ INTEGER_PACK_NATIVE_BYTE_ORDER);
+ BARY_DIVMOD(div_bary, mod_bary, val_numbits_bary, word_numbits_bary);
+ if (BARY_ZERO_P(mod_bary)) {
+ nlz_bits = 0;
+ }
+ else {
+ BARY_ADD(div_bary, div_bary, one);
+ bary_pack(+1, BARY_ARGS(mod_bary), &mod, 1, sizeof(mod), 0,
+ INTEGER_PACK_NATIVE_BYTE_ORDER);
+ nlz_bits = word_numbits - mod;
+ }
+ sign = bary_pack(+1, BARY_ARGS(div_bary), &numwords, 1, sizeof(numwords), 0,
+ INTEGER_PACK_NATIVE_BYTE_ORDER);
+
+ if (sign == 2) {
+#if defined __GNUC__ && (__GNUC__ == 4 && __GNUC_MINOR__ == 4)
+ *nlz_bits_ret = 0;
+#endif
+ return (size_t)-1;
+ }
+ *nlz_bits_ret = nlz_bits;
+ return numwords;
+}
+
+/*
+ * Calculate the number of words to be required to represent
+ * the absolute value of the integer given as _val_.
+ *
+ * [val] an integer.
+ * [word_numbits] number of bits in a word.
+ * [nlz_bits_ret] number of leading zero bits in the most significant word is returned if not NULL.
+ *
+ * This function returns ((val_numbits * CHAR_BIT + word_numbits - 1) / word_numbits)
+ * where val_numbits is the number of bits of abs(val).
+ *
+ * This function can overflow.
+ * When overflow occur, (size_t)-1 is returned.
+ *
+ * If nlz_bits_ret is not NULL and overflow is not occur,
+ * (return_value * word_numbits - val_numbits) is stored in *nlz_bits_ret.
+ * In this case, 0 <= *nlz_bits_ret < word_numbits.
+ *
+ */
+size_t
+rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
+{
+ size_t numbytes;
+ int nlz_bits_in_msbyte;
+ size_t numwords;
+ size_t nlz_bits;
+
+ if (word_numbits == 0)
+ return (size_t)-1;
+
+ numbytes = rb_absint_size(val, &nlz_bits_in_msbyte);
+
+ if (numbytes <= SIZE_MAX / CHAR_BIT) {
+ numwords = absint_numwords_small(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
+#ifdef DEBUG_INTEGER_PACK
+ {
+ size_t numwords0, nlz_bits0;
+ numwords0 = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits0);
+ assert(numwords0 == numwords);
+ assert(nlz_bits0 == nlz_bits);
+ }
+#endif
+ }
+ else {
+ numwords = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
+ }
+ if (numwords == (size_t)-1)
+ return numwords;
+
+ if (nlz_bits_ret)
+ *nlz_bits_ret = nlz_bits;
+
+ return numwords;
+}
+
+/* Test abs(val) consists only a bit or not.
+ *
+ * Returns 1 if abs(val) == 1 << n for some n >= 0.
+ * Returns 0 otherwise.
+ *
+ * rb_absint_singlebit_p can be used to determine required buffer size
+ * for rb_integer_pack used with INTEGER_PACK_2COMP (two's complement).
+ *
+ * Following example calculates number of bits required to
+ * represent val in two's complement number, without sign bit.
+ *
+ * size_t size;
+ * int neg = FIXNUM_P(val) ? FIX2LONG(val) < 0 : BIGNUM_NEGATIVE_P(val);
+ * size = rb_absint_numwords(val, 1, NULL)
+ * if (size == (size_t)-1) ...overflow...
+ * if (neg && rb_absint_singlebit_p(val))
+ * size--;
+ *
+ * Following example calculates number of bytes required to
+ * represent val in two's complement number, with sign bit.
+ *
+ * size_t size;
+ * int neg = FIXNUM_P(val) ? FIX2LONG(val) < 0 : BIGNUM_NEGATIVE_P(val);
+ * int nlz_bits;
+ * size = rb_absint_size(val, &nlz_bits);
+ * if (nlz_bits == 0 && !(neg && rb_absint_singlebit_p(val)))
+ * size++;
+ */
+int
+rb_absint_singlebit_p(VALUE val)
+{
+ BDIGIT *dp;
+ BDIGIT *de;
+ BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
+ BDIGIT d;
+
+ val = rb_to_int(val);
+
+ if (FIXNUM_P(val)) {
+ long v = FIX2LONG(val);
+ if (v < 0) {
+ v = -v;
+ }
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ fixbuf[0] = v;
+#else
+ {
+ int i;
+ for (i = 0; i < numberof(fixbuf); i++) {
+ fixbuf[i] = BIGLO(v);
+ v = BIGDN(v);
+ }
+ }
+#endif
+ dp = fixbuf;
+ de = fixbuf + numberof(fixbuf);
+ }
+ else {
+ dp = BDIGITS(val);
+ de = dp + BIGNUM_LEN(val);
+ }
+ while (dp < de && de[-1] == 0)
+ de--;
+ while (dp < de && dp[0] == 0)
+ dp++;
+ if (dp == de) /* no bit set. */
+ return 0;
+ if (dp != de-1) /* two non-zero words. two bits set, at least. */
+ return 0;
+ d = *dp;
+ return POW2_P(d);
+}
+
+
+/*
+ * Export an integer into a buffer.
+ *
+ * This function fills the buffer specified by _words_ and _numwords_ as
+ * val in the format specified by _wordsize_, _nails_ and _flags_.
+ *
+ * [val] Fixnum, Bignum or another integer like object which has to_int method.
+ * [words] buffer to export abs(val).
+ * [numwords] the size of given buffer as number of words.
+ * [wordsize] the size of word as number of bytes.
+ * [nails] number of padding bits in a word.
+ * Most significant nails bits of each word are filled by zero.
+ * [flags] bitwise or of constants which name starts "INTEGER_PACK_".
+ *
+ * flags:
+ * [INTEGER_PACK_MSWORD_FIRST] Store the most significant word as the first word.
+ * [INTEGER_PACK_LSWORD_FIRST] Store the least significant word as the first word.
+ * [INTEGER_PACK_MSBYTE_FIRST] Store the most significant byte in a word as the first byte in the word.
+ * [INTEGER_PACK_LSBYTE_FIRST] Store the least significant byte in a word as the first byte in the word.
+ * [INTEGER_PACK_NATIVE_BYTE_ORDER] INTEGER_PACK_MSBYTE_FIRST or INTEGER_PACK_LSBYTE_FIRST corresponding to the host's endian.
+ * [INTEGER_PACK_2COMP] Use 2's complement representation.
+ * [INTEGER_PACK_LITTLE_ENDIAN] Same as INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_LSBYTE_FIRST
+ * [INTEGER_PACK_BIG_ENDIAN] Same as INTEGER_PACK_MSWORD_FIRST|INTEGER_PACK_MSBYTE_FIRST
+ * [INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION] Use generic implementation (for test and debug).
+ *
+ * This function fills the buffer specified by _words_
+ * as abs(val) if INTEGER_PACK_2COMP is not specified in _flags_.
+ * If INTEGER_PACK_2COMP is specified, 2's complement representation of val is
+ * filled in the buffer.
+ *
+ * This function returns the signedness and overflow condition.
+ * The overflow condition depends on INTEGER_PACK_2COMP.
+ *
+ * INTEGER_PACK_2COMP is not specified:
+ * -2 : negative overflow. val <= -2**(numwords*(wordsize*CHAR_BIT-nails))
+ * -1 : negative without overflow. -2**(numwords*(wordsize*CHAR_BIT-nails)) < val < 0
+ * 0 : zero. val == 0
+ * 1 : positive without overflow. 0 < val < 2**(numwords*(wordsize*CHAR_BIT-nails))
+ * 2 : positive overflow. 2**(numwords*(wordsize*CHAR_BIT-nails)) <= val
+ *
+ * INTEGER_PACK_2COMP is specified:
+ * -2 : negative overflow. val < -2**(numwords*(wordsize*CHAR_BIT-nails))
+ * -1 : negative without overflow. -2**(numwords*(wordsize*CHAR_BIT-nails)) <= val < 0
+ * 0 : zero. val == 0
+ * 1 : positive without overflow. 0 < val < 2**(numwords*(wordsize*CHAR_BIT-nails))
+ * 2 : positive overflow. 2**(numwords*(wordsize*CHAR_BIT-nails)) <= val
+ *
+ * The value, -2**(numwords*(wordsize*CHAR_BIT-nails)), is representable
+ * in 2's complement representation but not representable in absolute value.
+ * So -1 is returned for the value if INTEGER_PACK_2COMP is specified
+ * but returns -2 if INTEGER_PACK_2COMP is not specified.
+ *
+ * The least significant words are filled in the buffer when overflow occur.
+ */
+
+int
+rb_integer_pack(VALUE val, void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+ int sign;
+ BDIGIT *ds;
+ size_t num_bdigits;
+ BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
+
+ RB_GC_GUARD(val) = rb_to_int(val);
+
+ if (FIXNUM_P(val)) {
+ long v = FIX2LONG(val);
+ if (v < 0) {
+ sign = -1;
+ v = -v;
+ }
+ else {
+ sign = 1;
+ }
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ fixbuf[0] = v;
+#else
+ {
+ int i;
+ for (i = 0; i < numberof(fixbuf); i++) {
+ fixbuf[i] = BIGLO(v);
+ v = BIGDN(v);
+ }
+ }
+#endif
+ ds = fixbuf;
+ num_bdigits = numberof(fixbuf);
+ }
+ else {
+ sign = BIGNUM_POSITIVE_P(val) ? 1 : -1;
+ ds = BDIGITS(val);
+ num_bdigits = BIGNUM_LEN(val);
+ }
+
+ return bary_pack(sign, ds, num_bdigits, words, numwords, wordsize, nails, flags);
+}
+
+/*
+ * Import an integer into a buffer.
+ *
+ * [words] buffer to import.
+ * [numwords] the size of given buffer as number of words.
+ * [wordsize] the size of word as number of bytes.
+ * [nails] number of padding bits in a word.
+ * Most significant nails bits of each word are ignored.
+ * [flags] bitwise or of constants which name starts "INTEGER_PACK_".
+ *
+ * flags:
+ * [INTEGER_PACK_MSWORD_FIRST] Interpret the first word as the most significant word.
+ * [INTEGER_PACK_LSWORD_FIRST] Interpret the first word as the least significant word.
+ * [INTEGER_PACK_MSBYTE_FIRST] Interpret the first byte in a word as the most significant byte in the word.
+ * [INTEGER_PACK_LSBYTE_FIRST] Interpret the first byte in a word as the least significant byte in the word.
+ * [INTEGER_PACK_NATIVE_BYTE_ORDER] INTEGER_PACK_MSBYTE_FIRST or INTEGER_PACK_LSBYTE_FIRST corresponding to the host's endian.
+ * [INTEGER_PACK_2COMP] Use 2's complement representation.
+ * [INTEGER_PACK_LITTLE_ENDIAN] Same as INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_LSBYTE_FIRST
+ * [INTEGER_PACK_BIG_ENDIAN] Same as INTEGER_PACK_MSWORD_FIRST|INTEGER_PACK_MSBYTE_FIRST
+ * [INTEGER_PACK_FORCE_BIGNUM] the result will be a Bignum
+ * even if it is representable as a Fixnum.
+ * [INTEGER_PACK_NEGATIVE] Returns non-positive value.
+ * (Returns non-negative value if not specified.)
+ * [INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION] Use generic implementation (for test and debug).
+ *
+ * This function returns the imported integer as Fixnum or Bignum.
+ *
+ * The range of the result value depends on INTEGER_PACK_2COMP and INTEGER_PACK_NEGATIVE.
+ *
+ * INTEGER_PACK_2COMP is not set:
+ * 0 <= val < 2**(numwords*(wordsize*CHAR_BIT-nails)) if !INTEGER_PACK_NEGATIVE
+ * -2**(numwords*(wordsize*CHAR_BIT-nails)) < val <= 0 if INTEGER_PACK_NEGATIVE
+ *
+ * INTEGER_PACK_2COMP is set:
+ * -2**(numwords*(wordsize*CHAR_BIT-nails)-1) <= val <= 2**(numwords*(wordsize*CHAR_BIT-nails)-1)-1 if !INTEGER_PACK_NEGATIVE
+ * -2**(numwords*(wordsize*CHAR_BIT-nails)) <= val <= -1 if INTEGER_PACK_NEGATIVE
+ *
+ * INTEGER_PACK_2COMP without INTEGER_PACK_NEGATIVE means sign extension.
+ * INTEGER_PACK_2COMP with INTEGER_PACK_NEGATIVE mean assuming the higher bits are 1.
+ *
+ * Note that this function returns 0 when numwords is zero and
+ * INTEGER_PACK_2COMP is set but INTEGER_PACK_NEGATIVE is not set.
+ */
+
+VALUE
+rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+ VALUE val;
+ size_t num_bdigits;
+ int sign;
+ int nlp_bits;
+ BDIGIT *ds;
+ BDIGIT fixbuf[2] = { 0, 0 };
+
+ validate_integer_pack_format(numwords, wordsize, nails, flags,
+ INTEGER_PACK_MSWORD_FIRST|
+ INTEGER_PACK_LSWORD_FIRST|
+ INTEGER_PACK_MSBYTE_FIRST|
+ INTEGER_PACK_LSBYTE_FIRST|
+ INTEGER_PACK_NATIVE_BYTE_ORDER|
+ INTEGER_PACK_2COMP|
+ INTEGER_PACK_FORCE_BIGNUM|
+ INTEGER_PACK_NEGATIVE|
+ INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
+
+ num_bdigits = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
+
+ if (LONG_MAX-1 < num_bdigits)
+ rb_raise(rb_eArgError, "too big to unpack as an integer");
+ if (num_bdigits <= numberof(fixbuf) && !(flags & INTEGER_PACK_FORCE_BIGNUM)) {
+ val = Qfalse;
+ ds = fixbuf;
+ }
+ else {
+ val = bignew((long)num_bdigits, 0);
+ ds = BDIGITS(val);
+ }
+ sign = bary_unpack_internal(ds, num_bdigits, words, numwords, wordsize, nails, flags, nlp_bits);
+
+ if (sign == -2) {
+ if (val) {
+ big_extend_carry(val);
+ }
+ else if (num_bdigits == numberof(fixbuf)) {
+ val = bignew((long)num_bdigits+1, 0);
+ MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
+ BDIGITS(val)[num_bdigits++] = 1;
+ }
+ else {
+ ds[num_bdigits++] = 1;
+ }
+ }
+
+ if (!val) {
+ BDIGIT_DBL u = fixbuf[0] + BIGUP(fixbuf[1]);
+ if (u == 0)
+ return LONG2FIX(0);
+ if (0 < sign && POSFIXABLE(u))
+ return LONG2FIX(u);
+ if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
+ NEGFIXABLE(-(BDIGIT_DBL_SIGNED)u))
+ return LONG2FIX(-(BDIGIT_DBL_SIGNED)u);
+ val = bignew((long)num_bdigits, 0 <= sign);
+ MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
+ }
+
+ if ((flags & INTEGER_PACK_FORCE_BIGNUM) && sign != 0 &&
+ bary_zero_p(BDIGITS(val), BIGNUM_LEN(val)))
+ sign = 0;
+ BIGNUM_SET_SIGN(val, 0 <= sign);
+
+ if (flags & INTEGER_PACK_FORCE_BIGNUM)
+ return bigtrunc(val);
+ return bignorm(val);
+}
+
+#define conv_digit(c) (ruby_digit36_to_number_table[(unsigned char)(c)])
+
+static void
+str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, size_t *len_p)
+{
+ char nondigit = 0;
+ size_t num_digits = 0;
+ const char *digits_start = str;
+ const char *digits_end = str;
+
+ int c;
+
+ if (badcheck && *str == '_') goto bad;
+
+ while ((c = *str++) != 0) {
+ if (c == '_') {
+ if (nondigit) {
+ if (badcheck) goto bad;
+ break;
+ }
+ nondigit = (char) c;
+ continue;
+ }
+ else if ((c = conv_digit(c)) < 0) {
+ break;
+ }
+ if (c >= base) break;
+ nondigit = 0;
+ num_digits++;
+ digits_end = str;
+ }
+ if (badcheck) {
+ str--;
+ if (s+1 < str && str[-1] == '_') goto bad;
+ while (*str && ISSPACE(*str)) str++;
+ if (*str) {
+ bad:
+ rb_invalid_str(s, "Integer()");
+ }
+ }
+ *num_digits_p = num_digits;
+ *len_p = digits_end - digits_start;
+}
+
+static VALUE
+str2big_poweroftwo(
+ int sign,
+ const char *digits_start,
+ const char *digits_end,
+ size_t num_digits,
+ int bits_per_digit)
+{
+ BDIGIT *dp;
+ BDIGIT_DBL dd;
+ int numbits;
+
+ size_t num_bdigits;
+ const char *p;
+ int c;
VALUE z;
- USHORT *zds;
+ num_bdigits = (num_digits / BITSPERDIG) * bits_per_digit + roomof((num_digits % BITSPERDIG) * bits_per_digit, BITSPERDIG);
+ z = bignew(num_bdigits, sign);
+ dp = BDIGITS(z);
+ dd = 0;
+ numbits = 0;
+ for (p = digits_end; digits_start < p; p--) {
+ if ((c = conv_digit(p[-1])) < 0)
+ continue;
+ dd |= (BDIGIT_DBL)c << numbits;
+ numbits += bits_per_digit;
+ if (BITSPERDIG <= numbits) {
+ *dp++ = BIGLO(dd);
+ dd = BIGDN(dd);
+ numbits -= BITSPERDIG;
+ }
+ }
+ if (numbits) {
+ *dp++ = BIGLO(dd);
+ }
+ assert((size_t)(dp - BDIGITS(z)) == num_bdigits);
+
+ return z;
+}
+
+static VALUE
+str2big_normal(
+ int sign,
+ const char *digits_start,
+ const char *digits_end,
+ size_t num_bdigits,
+ int base)
+{
+ size_t blen = 1;
+ BDIGIT *zds;
+ BDIGIT_DBL num;
+
+ size_t i;
+ const char *p;
+ int c;
+ VALUE z;
+
+ z = bignew(num_bdigits, sign);
+ zds = BDIGITS(z);
+ BDIGITS_ZERO(zds, num_bdigits);
+
+ for (p = digits_start; p < digits_end; p++) {
+ if ((c = conv_digit(*p)) < 0)
+ continue;
+ num = c;
+ i = 0;
+ for (;;) {
+ while (i<blen) {
+ num += (BDIGIT_DBL)zds[i]*base;
+ zds[i++] = BIGLO(num);
+ num = BIGDN(num);
+ }
+ if (num) {
+ blen++;
+ continue;
+ }
+ break;
+ }
+ assert(blen <= num_bdigits);
+ }
+
+ return z;
+}
+
+static VALUE
+str2big_karatsuba(
+ int sign,
+ const char *digits_start,
+ const char *digits_end,
+ size_t num_digits,
+ size_t num_bdigits,
+ int digits_per_bdigits_dbl,
+ int base)
+{
+ VALUE powerv;
+ size_t unit;
+ VALUE tmpuv = 0;
+ BDIGIT *uds, *vds, *tds;
+ BDIGIT_DBL dd;
+ BDIGIT_DBL current_base;
+ int m;
+ int power_level = 0;
+
+ size_t i;
+ const char *p;
+ int c;
+ VALUE z;
+
+ uds = ALLOCV_N(BDIGIT, tmpuv, 2*num_bdigits);
+ vds = uds + num_bdigits;
+
+ powerv = power_cache_get_power(base, power_level, NULL);
+
+ i = 0;
+ dd = 0;
+ current_base = 1;
+ m = digits_per_bdigits_dbl;
+ if (num_digits < (size_t)m)
+ m = (int)num_digits;
+ for (p = digits_end; digits_start < p; p--) {
+ if ((c = conv_digit(p[-1])) < 0)
+ continue;
+ dd = dd + c * current_base;
+ current_base *= base;
+ num_digits--;
+ m--;
+ if (m == 0) {
+ uds[i++] = BIGLO(dd);
+ uds[i++] = (BDIGIT)BIGDN(dd);
+ dd = 0;
+ m = digits_per_bdigits_dbl;
+ if (num_digits < (size_t)m)
+ m = (int)num_digits;
+ current_base = 1;
+ }
+ }
+ assert(i == num_bdigits);
+ for (unit = 2; unit < num_bdigits; unit *= 2) {
+ for (i = 0; i < num_bdigits; i += unit*2) {
+ if (2*unit <= num_bdigits - i) {
+ bary_mul(vds+i, unit*2, BDIGITS(powerv), BIGNUM_LEN(powerv), uds+i+unit, unit);
+ bary_add(vds+i, unit*2, vds+i, unit*2, uds+i, unit);
+ }
+ else if (unit <= num_bdigits - i) {
+ bary_mul(vds+i, num_bdigits-i, BDIGITS(powerv), BIGNUM_LEN(powerv), uds+i+unit, num_bdigits-(i+unit));
+ bary_add(vds+i, num_bdigits-i, vds+i, num_bdigits-i, uds+i, unit);
+ }
+ else {
+ MEMCPY(vds+i, uds+i, BDIGIT, num_bdigits-i);
+ }
+ }
+ power_level++;
+ powerv = power_cache_get_power(base, power_level, NULL);
+ tds = vds;
+ vds = uds;
+ uds = tds;
+ }
+ BARY_TRUNC(uds, num_bdigits);
+ z = bignew(num_bdigits, sign);
+ MEMCPY(BDIGITS(z), uds, BDIGIT, num_bdigits);
+
+ if (tmpuv)
+ ALLOCV_END(tmpuv);
+
+ return z;
+}
+
+#ifdef USE_GMP
+static VALUE
+str2big_gmp(
+ int sign,
+ const char *digits_start,
+ const char *digits_end,
+ size_t num_digits,
+ size_t num_bdigits,
+ int base)
+{
+ const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+ char *buf, *p;
+ const char *q;
+ VALUE tmps;
+ mpz_t mz;
+ VALUE z;
+ BDIGIT *zds;
+ size_t zn, count;
+
+ buf = ALLOCV_N(char, tmps, num_digits+1);
+ p = buf;
+ for (q = digits_start; q < digits_end; q++) {
+ if (conv_digit(*q) < 0)
+ continue;
+ *p++ = *q;
+ }
+ *p = '\0';
+
+ mpz_init(mz);
+ mpz_set_str(mz, buf, base);
+ zn = num_bdigits;
+ z = bignew(zn, sign);
+ zds = BDIGITS(z);
+ mpz_export(BDIGITS(z), &count, -1, sizeof(BDIGIT), 0, nails, mz);
+ BDIGITS_ZERO(zds+count, zn-count);
+ mpz_clear(mz);
+
+ if (tmps)
+ ALLOCV_END(tmps);
+
+ return z;
+}
+#endif
+
+VALUE
+rb_cstr_to_inum(const char *str, int base, int badcheck)
+{
+ const char *s = str;
+ char sign = 1;
+ int c;
+ VALUE z;
+
+ int bits_per_digit;
+
+ const char *digits_start, *digits_end;
+ size_t num_digits;
+ size_t num_bdigits;
+ size_t len;
+
+ if (!str) {
+ if (badcheck) {
+ bad:
+ rb_invalid_str(s, "Integer()");
+ }
+ return INT2FIX(0);
+ }
while (ISSPACE(*str)) str++;
- if (*str == '+') {
+ if (str[0] == '+') {
str++;
}
- else if (*str == '-') {
+ else if (str[0] == '-') {
str++;
sign = 0;
}
- if (base == 0) {
- if (*str == '0') {
- str++;
- if (*str == 'x' || *str == 'X') {
- str++;
+ if (str[0] == '+' || str[0] == '-') {
+ if (badcheck) goto bad;
+ return INT2FIX(0);
+ }
+ if (base <= 0) {
+ if (str[0] == '0') {
+ switch (str[1]) {
+ case 'x': case 'X':
base = 16;
- }
- else {
+ str += 2;
+ break;
+ case 'b': case 'B':
+ base = 2;
+ str += 2;
+ break;
+ case 'o': case 'O':
+ base = 8;
+ str += 2;
+ break;
+ case 'd': case 'D':
+ base = 10;
+ str += 2;
+ break;
+ default:
base = 8;
}
- if (*str == '\0') return INT2FIX(0);
+ }
+ else if (base < -1) {
+ base = -base;
}
else {
base = 10;
}
}
- if (base == 8) {
- while (str[0] == '0') str++;
- len = 3*strlen(str)*sizeof(char);
+ else if (base == 2) {
+ if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
+ str += 2;
+ }
+ }
+ else if (base == 8) {
+ if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
+ str += 2;
+ }
+ }
+ else if (base == 10) {
+ if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
+ str += 2;
+ }
}
- else { /* base == 10 or 16 */
- if (base == 16 && str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
+ else if (base == 16) {
+ if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
str += 2;
}
- while (str[0] == '0') str++;
- len = 4*strlen(str)*sizeof(char);
+ }
+ if (base < 2 || 36 < base) {
+ rb_raise(rb_eArgError, "invalid radix %d", base);
+ }
+ if (*str == '0') { /* squeeze preceding 0s */
+ int us = 0;
+ while ((c = *++str) == '0' || c == '_') {
+ if (c == '_') {
+ if (++us >= 2)
+ break;
+ }
+ else {
+ us = 0;
+ }
+ }
+ if (!(c = *str) || ISSPACE(c)) --str;
+ }
+ c = *str;
+ c = conv_digit(c);
+ if (c < 0 || c >= base) {
+ if (badcheck) goto bad;
+ return INT2FIX(0);
}
- if (len <= (sizeof(VALUE)*CHAR_BIT)) {
- unsigned int val = strtoul((char*)str, 0, base);
+ bits_per_digit = bit_length(base-1);
+ if (bits_per_digit * strlen(str) <= sizeof(long) * CHAR_BIT) {
+ char *end;
+ unsigned long val = STRTOUL(str, &end, base);
+
+ if (str < end && *end == '_') goto bigparse;
+ if (badcheck) {
+ if (end == str) goto bad; /* no number */
+ while (*end && ISSPACE(*end)) end++;
+ if (*end) goto bad; /* trailing garbage */
+ }
if (POSFIXABLE(val)) {
- if (sign) return INT2FIX(val);
+ if (sign) return LONG2FIX(val);
else {
long result = -(long)val;
- return INT2FIX(result);
+ return LONG2FIX(result);
}
}
else {
VALUE big = rb_uint2big(val);
- RBIGNUM(big)->sign = sign;
- return big;
+ BIGNUM_SET_SIGN(big, sign);
+ return bignorm(big);
}
}
- len = (len/BITSPERDIG)+1;
- z = bignew(len, sign);
- zds = BDIGITS(z);
- for (i=len;i--;) zds[i]=0;
- while (c = *str++) {
- switch (c) {
- case '0': case '1': case '2': case '3': case '4':
- case '5': case '6': case '7': case '8': case '9':
- c = c - '0';
- break;
- case 'a': case 'b': case 'c':
- case 'd': case 'e': case 'f':
- c = c - 'a' + 10;
- break;
- case 'A': case 'B': case 'C':
- case 'D': case 'E': case 'F':
- c = c - 'A' + 10;
- break;
- default:
- c = base;
- break;
- }
- if (c >= base) break;
- i = 0;
- num = c;
- for (;;) {
- while (i<blen) {
- num += zds[i]*base;
- zds[i++] = BIGLO(num);
- num = BIGDN(num);
- }
- if (num) {
- blen++;
- continue;
- }
- break;
+ bigparse:
+ digits_start = str;
+ str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+ digits_end = digits_start + len;
+
+ if (POW2_P(base)) {
+ z = str2big_poweroftwo(sign, digits_start, digits_end, num_digits,
+ bits_per_digit);
+ }
+ else {
+ int digits_per_bdigits_dbl;
+ maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+ num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+#ifdef USE_GMP
+ if (GMP_STR2BIG_DIGITS < num_bdigits) {
+ z = str2big_gmp(sign, digits_start, digits_end, num_digits,
+ num_bdigits, base);
+ }
+ else
+#endif
+ if (num_bdigits < KARATSUBA_MUL_DIGITS) {
+ z = str2big_normal(sign, digits_start, digits_end,
+ num_bdigits, base);
+ }
+ else {
+ z = str2big_karatsuba(sign, digits_start, digits_end, num_digits,
+ num_bdigits, digits_per_bdigits_dbl, base);
+ }
+ }
+
+ return bignorm(z);
+}
+
+VALUE
+rb_str_to_inum(VALUE str, int base, int badcheck)
+{
+ char *s;
+ long len;
+ VALUE v = 0;
+ VALUE ret;
+
+ StringValue(str);
+ rb_must_asciicompat(str);
+ if (badcheck) {
+ s = StringValueCStr(str);
+ }
+ else {
+ s = RSTRING_PTR(str);
+ }
+ if (s) {
+ len = RSTRING_LEN(str);
+ if (s[len]) { /* no sentinel somehow */
+ char *p = ALLOCV(v, len+1);
+
+ MEMCPY(p, s, char, len);
+ p[len] = '\0';
+ s = p;
}
}
+ ret = rb_cstr_to_inum(s, base, badcheck);
+ if (v)
+ ALLOCV_END(v);
+ return ret;
+}
+
+VALUE
+rb_str2big_poweroftwo(VALUE arg, int base, int badcheck)
+{
+ int positive_p = 1;
+ const char *s, *str;
+ const char *digits_start, *digits_end;
+ size_t num_digits;
+ size_t len;
+ VALUE z;
+
+ if (base < 2 || 36 < base || !POW2_P(base)) {
+ rb_raise(rb_eArgError, "invalid radix %d", base);
+ }
+
+ rb_must_asciicompat(arg);
+ s = str = StringValueCStr(arg);
+ if (*str == '-') {
+ str++;
+ positive_p = 0;
+ }
+
+ digits_start = str;
+ str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+ digits_end = digits_start + len;
+
+ z = str2big_poweroftwo(positive_p, digits_start, digits_end, num_digits,
+ bit_length(base-1));
+
+ RB_GC_GUARD(arg);
+
+ return bignorm(z);
+}
+
+VALUE
+rb_str2big_normal(VALUE arg, int base, int badcheck)
+{
+ int positive_p = 1;
+ const char *s, *str;
+ const char *digits_start, *digits_end;
+ size_t num_digits;
+ size_t len;
+ VALUE z;
+
+ int digits_per_bdigits_dbl;
+ size_t num_bdigits;
+
+ if (base < 2 || 36 < base) {
+ rb_raise(rb_eArgError, "invalid radix %d", base);
+ }
+
+ rb_must_asciicompat(arg);
+ s = str = StringValueCStr(arg);
+ if (*str == '-') {
+ str++;
+ positive_p = 0;
+ }
+
+ digits_start = str;
+ str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+ digits_end = digits_start + len;
+
+ maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+ num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+ z = str2big_normal(positive_p, digits_start, digits_end,
+ num_bdigits, base);
+
+ RB_GC_GUARD(arg);
+
return bignorm(z);
}
-static char hexmap[] = "0123456789abcdef";
VALUE
-rb_big2str(x, base)
- VALUE x;
- int base;
+rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
{
- VALUE t;
- USHORT *ds;
- unsigned int i, j, hbase;
- VALUE ss;
- char *s, c;
+ int positive_p = 1;
+ const char *s, *str;
+ const char *digits_start, *digits_end;
+ size_t num_digits;
+ size_t len;
+ VALUE z;
- if (FIXNUM_P(x)) {
- return rb_fix2str(x, base);
+ int digits_per_bdigits_dbl;
+ size_t num_bdigits;
+
+ if (base < 2 || 36 < base) {
+ rb_raise(rb_eArgError, "invalid radix %d", base);
}
- i = RBIGNUM(x)->len;
- if (i == 0) return rb_str_new2("0");
- if (base == 10) {
- j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i*241L)/800+2;
- hbase = 10000;
+
+ rb_must_asciicompat(arg);
+ s = str = StringValueCStr(arg);
+ if (*str == '-') {
+ str++;
+ positive_p = 0;
}
- else if (base == 16) {
- j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i)/4+2;
- hbase = 0x10000;
+
+ digits_start = str;
+ str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+ digits_end = digits_start + len;
+
+ maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+ num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+ z = str2big_karatsuba(positive_p, digits_start, digits_end, num_digits,
+ num_bdigits, digits_per_bdigits_dbl, base);
+
+ RB_GC_GUARD(arg);
+
+ return bignorm(z);
+}
+
+#ifdef USE_GMP
+VALUE
+rb_str2big_gmp(VALUE arg, int base, int badcheck)
+{
+ int positive_p = 1;
+ const char *s, *str;
+ const char *digits_start, *digits_end;
+ size_t num_digits;
+ size_t len;
+ VALUE z;
+
+ int digits_per_bdigits_dbl;
+ size_t num_bdigits;
+
+ if (base < 2 || 36 < base) {
+ rb_raise(rb_eArgError, "invalid radix %d", base);
}
- else if (base == 8) {
- j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i)+2;
- hbase = 010000;
+
+ rb_must_asciicompat(arg);
+ s = str = StringValueCStr(arg);
+ if (*str == '-') {
+ str++;
+ positive_p = 0;
}
- else if (base == 2) {
- j = (sizeof(USHORT)*CHAR_BIT*i)+2;
- hbase = 020;
+
+ digits_start = str;
+ str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+ digits_end = digits_start + len;
+
+ maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+ num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+ z = str2big_gmp(positive_p, digits_start, digits_end, num_digits, num_bdigits, base);
+
+ RB_GC_GUARD(arg);
+
+ return bignorm(z);
+}
+#endif
+
+#if HAVE_LONG_LONG
+
+static VALUE
+rb_ull2big(unsigned LONG_LONG n)
+{
+ long i;
+ VALUE big = bignew(bdigit_roomof(SIZEOF_LONG_LONG), 1);
+ BDIGIT *digits = BDIGITS(big);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG_LONG
+ digits[0] = n;
+#else
+ for (i = 0; i < bdigit_roomof(SIZEOF_LONG_LONG); i++) {
+ digits[i] = BIGLO(n);
+ n = BIGDN(n);
+ }
+#endif
+
+ i = bdigit_roomof(SIZEOF_LONG_LONG);
+ while (i-- && !digits[i]) ;
+ BIGNUM_SET_LEN(big, i+1);
+ return big;
+}
+
+static VALUE
+rb_ll2big(LONG_LONG n)
+{
+ long neg = 0;
+ unsigned LONG_LONG u;
+ VALUE big;
+
+ if (n < 0) {
+ u = 1 + (unsigned LONG_LONG)(-(n + 1)); /* u = -n avoiding overflow */
+ neg = 1;
+ }
+ else {
+ u = n;
+ }
+ big = rb_ull2big(u);
+ if (neg) {
+ BIGNUM_SET_SIGN(big, 0);
+ }
+ return big;
+}
+
+VALUE
+rb_ull2inum(unsigned LONG_LONG n)
+{
+ if (POSFIXABLE(n)) return LONG2FIX(n);
+ return rb_ull2big(n);
+}
+
+VALUE
+rb_ll2inum(LONG_LONG n)
+{
+ if (FIXABLE(n)) return LONG2FIX(n);
+ return rb_ll2big(n);
+}
+
+#endif /* HAVE_LONG_LONG */
+
+VALUE
+rb_cstr2inum(const char *str, int base)
+{
+ return rb_cstr_to_inum(str, base, base==0);
+}
+
+VALUE
+rb_str2inum(VALUE str, int base)
+{
+ return rb_str_to_inum(str, base, base==0);
+}
+
+static VALUE
+big_shift3(VALUE x, int lshift_p, size_t shift_numdigits, int shift_numbits)
+{
+ BDIGIT *xds, *zds;
+ long s1;
+ int s2;
+ VALUE z;
+ long xn;
+
+ if (lshift_p) {
+ if (LONG_MAX < shift_numdigits) {
+ rb_raise(rb_eArgError, "too big number");
+ }
+ s1 = shift_numdigits;
+ s2 = shift_numbits;
+ xn = BIGNUM_LEN(x);
+ z = bignew(xn+s1+1, BIGNUM_SIGN(x));
+ zds = BDIGITS(z);
+ BDIGITS_ZERO(zds, s1);
+ xds = BDIGITS(x);
+ zds[xn+s1] = bary_small_lshift(zds+s1, xds, xn, s2);
+ }
+ else {
+ long zn;
+ BDIGIT hibitsx;
+ if (LONG_MAX < shift_numdigits || (size_t)BIGNUM_LEN(x) <= shift_numdigits) {
+ if (BIGNUM_POSITIVE_P(x) ||
+ bary_zero_p(BDIGITS(x), BIGNUM_LEN(x)))
+ return INT2FIX(0);
+ else
+ return INT2FIX(-1);
+ }
+ s1 = shift_numdigits;
+ s2 = shift_numbits;
+ hibitsx = abs2twocomp(&x, &xn);
+ xds = BDIGITS(x);
+ if (xn <= s1) {
+ return hibitsx ? INT2FIX(-1) : INT2FIX(0);
+ }
+ zn = xn - s1;
+ z = bignew(zn, 0);
+ zds = BDIGITS(z);
+ bary_small_rshift(zds, xds+s1, zn, s2, hibitsx != 0 ? BDIGMAX : 0);
+ twocomp2abs_bang(z, hibitsx != 0);
+ }
+ RB_GC_GUARD(x);
+ return z;
+}
+
+static VALUE
+big_shift2(VALUE x, int lshift_p, VALUE y)
+{
+ int sign;
+ size_t lens[2];
+ size_t shift_numdigits;
+ int shift_numbits;
+
+ assert(POW2_P(CHAR_BIT));
+ assert(POW2_P(BITSPERDIG));
+
+ if (BIGZEROP(x))
+ return INT2FIX(0);
+ sign = rb_integer_pack(y, lens, numberof(lens), sizeof(size_t), 0,
+ INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
+ if (sign < 0) {
+ lshift_p = !lshift_p;
+ sign = -sign;
+ }
+ if (lshift_p) {
+ if (1 < sign || CHAR_BIT <= lens[1])
+ rb_raise(rb_eRangeError, "shift width too big");
}
else {
- j = 0;
- hbase = 0;
- rb_raise(rb_eArgError, "bignum cannot treat base %d", base);
+ if (1 < sign || CHAR_BIT <= lens[1])
+ return BIGNUM_POSITIVE_P(x) ? INT2FIX(0) : INT2FIX(-1);
}
+ shift_numbits = (int)(lens[0] & (BITSPERDIG-1));
+ shift_numdigits = (lens[0] >> bit_length(BITSPERDIG-1)) |
+ (lens[1] << (CHAR_BIT*SIZEOF_SIZE_T - bit_length(BITSPERDIG-1)));
+ return big_shift3(x, lshift_p, shift_numdigits, shift_numbits);
+}
+
+static VALUE
+big_lshift(VALUE x, unsigned long shift)
+{
+ long s1 = shift/BITSPERDIG;
+ int s2 = (int)(shift%BITSPERDIG);
+ return big_shift3(x, 1, s1, s2);
+}
- t = rb_big_clone(x);
- ds = BDIGITS(t);
- ss = rb_str_new(0, j);
- s = RSTRING(ss)->ptr;
+static VALUE
+big_rshift(VALUE x, unsigned long shift)
+{
+ long s1 = shift/BITSPERDIG;
+ int s2 = (int)(shift%BITSPERDIG);
+ return big_shift3(x, 0, s1, s2);
+}
+
+#define MAX_BASE36_POWER_TABLE_ENTRIES (SIZEOF_SIZE_T * CHAR_BIT + 1)
- s[0] = RBIGNUM(x)->sign ? '+' : '-';
- while (i && j) {
- int k = i;
- unsigned long num = 0;
- while (k--) {
- num = BIGUP(num) + ds[k];
- ds[k] = (USHORT)(num / hbase);
- num %= hbase;
+static VALUE base36_power_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
+static size_t base36_numdigits_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
+
+static void
+power_cache_init(void)
+{
+ int i, j;
+ for (i = 0; i < 35; ++i) {
+ for (j = 0; j < MAX_BASE36_POWER_TABLE_ENTRIES; ++j) {
+ base36_power_cache[i][j] = Qnil;
}
- if (ds[i-1] == 0) i--;
- k = 4;
- while (k--) {
- c = (char)(num % base);
- s[--j] = hexmap[(int)c];
- num /= base;
- if (i == 0 && num == 0) break;
+ }
+}
+
+static inline VALUE
+power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
+{
+ /*
+ * MAX_BASE36_POWER_TABLE_ENTRIES is big enough to that
+ * base36_power_cache[base][MAX_BASE36_POWER_TABLE_ENTRIES-1] fills whole memory.
+ * So MAX_BASE36_POWER_TABLE_ENTRIES <= power_level is not possible to calculate.
+ *
+ * number-of-bytes =
+ * log256(base36_power_cache[base][MAX_BASE36_POWER_TABLE_ENTRIES-1]) =
+ * log256(maxpow_in_bdigit_dbl(base)**(2**(MAX_BASE36_POWER_TABLE_ENTRIES-1))) =
+ * log256(maxpow_in_bdigit_dbl(base)**(2**(SIZEOF_SIZE_T*CHAR_BIT))) =
+ * (2**(SIZEOF_SIZE_T*CHAR_BIT))*log256(maxpow_in_bdigit_dbl(base)) =
+ * (256**SIZEOF_SIZE_T)*log256(maxpow_in_bdigit_dbl(base)) >
+ * (256**SIZEOF_SIZE_T)*(sizeof(BDIGIT_DBL)-1) >
+ * 256**SIZEOF_SIZE_T
+ */
+ if (MAX_BASE36_POWER_TABLE_ENTRIES <= power_level)
+ rb_bug("too big power number requested: maxpow_in_bdigit_dbl(%d)**(2**%d)", base, power_level);
+
+ if (NIL_P(base36_power_cache[base - 2][power_level])) {
+ VALUE power;
+ size_t numdigits;
+ if (power_level == 0) {
+ int numdigits0;
+ BDIGIT_DBL dd = maxpow_in_bdigit_dbl(base, &numdigits0);
+ power = bignew(2, 1);
+ bdigitdbl2bary(BDIGITS(power), 2, dd);
+ numdigits = numdigits0;
+ }
+ else {
+ power = bigtrunc(bigsq(power_cache_get_power(base, power_level - 1, &numdigits)));
+ numdigits *= 2;
+ }
+ rb_obj_hide(power);
+ base36_power_cache[base - 2][power_level] = power;
+ base36_numdigits_cache[base - 2][power_level] = numdigits;
+ rb_gc_register_mark_object(power);
+ }
+ if (numdigits_ret)
+ *numdigits_ret = base36_numdigits_cache[base - 2][power_level];
+ return base36_power_cache[base - 2][power_level];
+}
+
+struct big2str_struct {
+ int negative;
+ int base;
+ BDIGIT_DBL hbase2;
+ int hbase2_numdigits;
+ VALUE result;
+ char *ptr;
+};
+
+static void
+big2str_alloc(struct big2str_struct *b2s, size_t len)
+{
+ if (LONG_MAX-1 < len)
+ rb_raise(rb_eArgError, "too big number");
+ b2s->result = rb_usascii_str_new(0, (long)(len + 1)); /* plus one for sign */
+ b2s->ptr = RSTRING_PTR(b2s->result);
+ if (b2s->negative)
+ *b2s->ptr++ = '-';
+}
+
+static void
+big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t taillen)
+{
+ size_t j;
+ BDIGIT_DBL num;
+ char buf[SIZEOF_BDIGIT_DBL*CHAR_BIT], *p;
+ int beginning = !b2s->ptr;
+ size_t len = 0;
+
+ assert(xn <= 2);
+ num = bary2bdigitdbl(xds, xn);
+
+ if (beginning) {
+ if (num == 0)
+ return;
+ p = buf;
+ j = sizeof(buf);
+ do {
+ p[--j] = ruby_digitmap[num % b2s->base];
+ num /= b2s->base;
+ } while (num);
+ len = sizeof(buf) - j;
+ big2str_alloc(b2s, len + taillen);
+ MEMCPY(b2s->ptr, buf + j, char, len);
+ }
+ else {
+ p = b2s->ptr;
+ j = b2s->hbase2_numdigits;
+ do {
+ p[--j] = ruby_digitmap[num % b2s->base];
+ num /= b2s->base;
+ } while (j);
+ len = b2s->hbase2_numdigits;
+ }
+ b2s->ptr += len;
+}
+
+static void
+big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
+ int power_level, size_t taillen)
+{
+ VALUE b;
+ size_t half_numdigits, lower_numdigits;
+ int lower_power_level;
+ size_t bn;
+ const BDIGIT *bds;
+ size_t len;
+
+ /*
+ * Precondition:
+ * abs(x) < maxpow**(2**power_level)
+ * where
+ * maxpow = maxpow_in_bdigit_dbl(base, &numdigits)
+ *
+ * This function generates sequence of zeros, and then stringized abs(x) into b2s->ptr.
+ *
+ * b2s->ptr can be NULL.
+ * It is allocated when the first character is generated via big2str_alloc.
+ *
+ * The prefix zeros should be generated if and only if b2s->ptr is not NULL.
+ * When the zeros are generated, the zeros and abs(x) consists
+ * numdigits*(2**power_level) characters at total.
+ *
+ * Note:
+ * power_cache_get_power(base, power_level, &len) may not be cached yet. It should not be called.
+ * power_cache_get_power(base, power_level-1, &len) should be cached already if 0 <= power_level-1.
+ */
+
+ if (xn == 0 || bary_zero_p(xds, xn)) {
+ if (b2s->ptr) {
+ /* When x is zero, power_cache_get_power(base, power_level) should be cached already. */
+ power_cache_get_power(b2s->base, power_level, &len);
+ memset(b2s->ptr, '0', len);
+ b2s->ptr += len;
}
+ return;
+ }
+
+ if (power_level == 0) {
+ big2str_2bdigits(b2s, xds, xn, taillen);
+ return;
+ }
+
+ lower_power_level = power_level-1;
+ b = power_cache_get_power(b2s->base, lower_power_level, &lower_numdigits);
+ bn = BIGNUM_LEN(b);
+ bds = BDIGITS(b);
+
+ half_numdigits = lower_numdigits;
+
+ while (0 < lower_power_level &&
+ (xn < bn ||
+ (xn == bn && bary_cmp(xds, xn, bds, bn) < 0))) {
+ lower_power_level--;
+ b = power_cache_get_power(b2s->base, lower_power_level, &lower_numdigits);
+ bn = BIGNUM_LEN(b);
+ bds = BDIGITS(b);
}
- while (s[j] == '0') j++;
- RSTRING(ss)->len -= RBIGNUM(x)->sign?j:j-1;
- memmove(RBIGNUM(x)->sign?s:s+1, s+j, RSTRING(ss)->len);
- s[RSTRING(ss)->len] = '\0';
- return ss;
+ if (lower_power_level == 0 &&
+ (xn < bn ||
+ (xn == bn && bary_cmp(xds, xn, bds, bn) < 0))) {
+ if (b2s->ptr) {
+ len = half_numdigits * 2 - lower_numdigits;
+ memset(b2s->ptr, '0', len);
+ b2s->ptr += len;
+ }
+ big2str_2bdigits(b2s, xds, xn, taillen);
+ }
+ else {
+ BDIGIT *qds, *rds;
+ size_t qn, rn;
+ BDIGIT *tds;
+ int shift;
+
+ if (lower_power_level != power_level-1 && b2s->ptr) {
+ len = (half_numdigits - lower_numdigits) * 2;
+ memset(b2s->ptr, '0', len);
+ b2s->ptr += len;
+ }
+
+ shift = nlz(bds[bn-1]);
+
+ qn = xn + BIGDIVREM_EXTRA_WORDS;
+
+ if (shift == 0) {
+ /* bigdivrem_restoring will not modify y.
+ * So use bds directly. */
+ tds = (BDIGIT *)bds;
+ xds[xn] = 0;
+ }
+ else {
+ /* bigdivrem_restoring will modify y.
+ * So use temporary buffer. */
+ tds = xds + qn;
+ assert(qn + bn <= xn + wn);
+ bary_small_lshift(tds, bds, bn, shift);
+ xds[xn] = bary_small_lshift(xds, xds, xn, shift);
+ }
+
+ bigdivrem_restoring(xds, qn, tds, bn);
+
+ rds = xds;
+ rn = bn;
+
+ qds = xds + bn;
+ qn = qn - bn;
+
+ if (shift) {
+ bary_small_rshift(rds, rds, rn, shift, 0);
+ }
+
+ BARY_TRUNC(qds, qn);
+ assert(qn <= bn);
+ big2str_karatsuba(b2s, qds, qn, xn+wn - (rn+qn), lower_power_level, lower_numdigits+taillen);
+ BARY_TRUNC(rds, rn);
+ big2str_karatsuba(b2s, rds, rn, xn+wn - rn, lower_power_level, taillen);
+ }
}
static VALUE
-rb_big_to_s(x)
- VALUE x;
+big2str_base_poweroftwo(VALUE x, int base)
{
- return rb_big2str(x, 10);
+ int word_numbits = ffs(base) - 1;
+ size_t numwords;
+ VALUE result;
+ char *ptr;
+ numwords = rb_absint_numwords(x, word_numbits, NULL);
+ if (BIGNUM_NEGATIVE_P(x)) {
+ if (LONG_MAX-1 < numwords)
+ rb_raise(rb_eArgError, "too big number");
+ result = rb_usascii_str_new(0, 1+numwords);
+ ptr = RSTRING_PTR(result);
+ *ptr++ = BIGNUM_POSITIVE_P(x) ? '+' : '-';
+ }
+ else {
+ if (LONG_MAX < numwords)
+ rb_raise(rb_eArgError, "too big number");
+ result = rb_usascii_str_new(0, numwords);
+ ptr = RSTRING_PTR(result);
+ }
+ rb_integer_pack(x, ptr, numwords, 1, CHAR_BIT-word_numbits,
+ INTEGER_PACK_BIG_ENDIAN);
+ while (0 < numwords) {
+ *ptr = ruby_digitmap[*(unsigned char *)ptr];
+ ptr++;
+ numwords--;
+ }
+ return result;
}
-unsigned long
-rb_big2ulong(x)
- VALUE x;
+VALUE
+rb_big2str_poweroftwo(VALUE x, int base)
{
+ return big2str_base_poweroftwo(x, base);
+}
+
+static VALUE
+big2str_generic(VALUE x, int base)
+{
+ BDIGIT *xds;
+ size_t xn;
+ struct big2str_struct b2s_data;
+ int power_level;
+ VALUE power;
+
+ xds = BDIGITS(x);
+ xn = BIGNUM_LEN(x);
+ BARY_TRUNC(xds, xn);
+
+ if (xn == 0) {
+ return rb_usascii_str_new2("0");
+ }
+
+ if (base < 2 || 36 < base)
+ rb_raise(rb_eArgError, "invalid radix %d", base);
+
+ if (xn >= LONG_MAX/BITSPERDIG) {
+ rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
+ }
+
+ power_level = 0;
+ power = power_cache_get_power(base, power_level, NULL);
+ while (power_level < MAX_BASE36_POWER_TABLE_ENTRIES &&
+ (size_t)BIGNUM_LEN(power) <= (xn+1)/2) {
+ power_level++;
+ power = power_cache_get_power(base, power_level, NULL);
+ }
+ assert(power_level != MAX_BASE36_POWER_TABLE_ENTRIES);
+
+ if ((size_t)BIGNUM_LEN(power) <= xn) {
+ /*
+ * This increment guarantees x < power_cache_get_power(base, power_level)
+ * without invoking it actually.
+ * (power_cache_get_power(base, power_level) can be slow and not used
+ * in big2str_karatsuba.)
+ *
+ * Although it is possible that x < power_cache_get_power(base, power_level-1),
+ * it is no problem because big2str_karatsuba checks it and
+ * doesn't affect the result when b2s_data.ptr is NULL.
+ */
+ power_level++;
+ }
+
+ b2s_data.negative = BIGNUM_NEGATIVE_P(x);
+ b2s_data.base = base;
+ b2s_data.hbase2 = maxpow_in_bdigit_dbl(base, &b2s_data.hbase2_numdigits);
+
+ b2s_data.result = Qnil;
+ b2s_data.ptr = NULL;
+
+ if (power_level == 0) {
+ big2str_2bdigits(&b2s_data, xds, xn, 0);
+ }
+ else {
+ VALUE tmpw = 0;
+ BDIGIT *wds;
+ size_t wn;
+ wn = power_level * BIGDIVREM_EXTRA_WORDS + BIGNUM_LEN(power);
+ wds = ALLOCV_N(BDIGIT, tmpw, xn + wn);
+ MEMCPY(wds, xds, BDIGIT, xn);
+ big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
+ if (tmpw)
+ ALLOCV_END(tmpw);
+ }
+ RB_GC_GUARD(x);
+
+ *b2s_data.ptr = '\0';
+ rb_str_resize(b2s_data.result, (long)(b2s_data.ptr - RSTRING_PTR(b2s_data.result)));
+
+ RB_GC_GUARD(x);
+ return b2s_data.result;
+}
+
+VALUE
+rb_big2str_generic(VALUE x, int base)
+{
+ return big2str_generic(x, base);
+}
+
+#ifdef USE_GMP
+VALUE
+big2str_gmp(VALUE x, int base)
+{
+ const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+ mpz_t mx;
+ size_t size;
+ VALUE str;
+ BDIGIT *xds = BDIGITS(x);
+ size_t xn = BIGNUM_LEN(x);
+
+ mpz_init(mx);
+ mpz_import(mx, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+
+ size = mpz_sizeinbase(mx, base);
+
+ if (BIGNUM_NEGATIVE_P(x)) {
+ mpz_neg(mx, mx);
+ str = rb_usascii_str_new(0, size+1);
+ }
+ else {
+ str = rb_usascii_str_new(0, size);
+ }
+ mpz_get_str(RSTRING_PTR(str), base, mx);
+ mpz_clear(mx);
+
+ if (RSTRING_PTR(str)[RSTRING_LEN(str)-1] == '\0') {
+ rb_str_set_len(str, RSTRING_LEN(str)-1);
+ }
+
+ RB_GC_GUARD(x);
+ return str;
+}
+
+VALUE
+rb_big2str_gmp(VALUE x, int base)
+{
+ return big2str_gmp(x, base);
+}
+#endif
+
+static VALUE
+rb_big2str1(VALUE x, int base)
+{
+ BDIGIT *xds;
+ size_t xn;
+
+ if (FIXNUM_P(x)) {
+ return rb_fix2str(x, base);
+ }
+
+ bigtrunc(x);
+ xds = BDIGITS(x);
+ xn = BIGNUM_LEN(x);
+ BARY_TRUNC(xds, xn);
+
+ if (xn == 0) {
+ return rb_usascii_str_new2("0");
+ }
+
+ if (base < 2 || 36 < base)
+ rb_raise(rb_eArgError, "invalid radix %d", base);
+
+ if (xn >= LONG_MAX/BITSPERDIG) {
+ rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
+ }
+
+ if (POW2_P(base)) {
+ /* base == 2 || base == 4 || base == 8 || base == 16 || base == 32 */
+ return big2str_base_poweroftwo(x, base);
+ }
+
+#ifdef USE_GMP
+ if (GMP_BIG2STR_DIGITS < xn) {
+ return big2str_gmp(x, base);
+ }
+#endif
+
+ return big2str_generic(x, base);
+}
+
+VALUE
+rb_big2str(VALUE x, int base)
+{
+ return rb_big2str1(x, base);
+}
+
+/*
+ * call-seq:
+ * big.to_s(base=10) -> string
+ *
+ * Returns a string containing the representation of <i>big</i> radix
+ * <i>base</i> (2 through 36).
+ *
+ * 12345654321.to_s #=> "12345654321"
+ * 12345654321.to_s(2) #=> "1011011111110110111011110000110001"
+ * 12345654321.to_s(8) #=> "133766736061"
+ * 12345654321.to_s(16) #=> "2dfdbbc31"
+ * 78546939656932.to_s(36) #=> "rubyrules"
+ */
+
+static VALUE
+rb_big_to_s(int argc, VALUE *argv, VALUE x)
+{
+ int base;
+
+ if (argc == 0) base = 10;
+ else {
+ VALUE b;
+
+ rb_scan_args(argc, argv, "01", &b);
+ base = NUM2INT(b);
+ }
+ return rb_big2str(x, base);
+}
+
+static unsigned long
+big2ulong(VALUE x, const char *type)
+{
+ size_t len = BIGNUM_LEN(x);
unsigned long num;
- int len = RBIGNUM(x)->len;
- USHORT *ds;
+ BDIGIT *ds;
- if (len > sizeof(long)/sizeof(USHORT))
- rb_raise(rb_eArgError, "bignum too big to convert into `uint'");
+ if (len == 0)
+ return 0;
+ if (BIGSIZE(x) > sizeof(long)) {
+ rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+ }
ds = BDIGITS(x);
+#if SIZEOF_LONG <= SIZEOF_BDIGIT
+ num = (unsigned long)ds[0];
+#else
num = 0;
while (len--) {
- num = BIGUP(num);
- num += ds[len];
+ num <<= BITSPERDIG;
+ num += (unsigned long)ds[len]; /* overflow is already checked */
}
+#endif
return num;
}
+unsigned long
+rb_big2ulong(VALUE x)
+{
+ unsigned long num = big2ulong(x, "unsigned long");
+
+ if (BIGNUM_POSITIVE_P(x)) {
+ return num;
+ }
+ else {
+ if (num <= LONG_MAX)
+ return -(long)num;
+ if (num == 1+(unsigned long)(-(LONG_MIN+1)))
+ return LONG_MIN;
+ }
+ rb_raise(rb_eRangeError, "bignum out of range of unsigned long");
+}
+
long
-rb_big2long(x)
- VALUE x;
+rb_big2long(VALUE x)
{
- unsigned long num = rb_big2ulong(x);
+ unsigned long num = big2ulong(x, "long");
+
+ if (BIGNUM_POSITIVE_P(x)) {
+ if (num <= LONG_MAX)
+ return num;
+ }
+ else {
+ if (num <= LONG_MAX)
+ return -(long)num;
+ if (num == 1+(unsigned long)(-(LONG_MIN+1)))
+ return LONG_MIN;
+ }
+ rb_raise(rb_eRangeError, "bignum too big to convert into `long'");
+}
+
+#if HAVE_LONG_LONG
- if ((long)num < 0) {
- rb_raise(rb_eArgError, "bignum too big to convert into `int'");
+static unsigned LONG_LONG
+big2ull(VALUE x, const char *type)
+{
+ size_t len = BIGNUM_LEN(x);
+ unsigned LONG_LONG num;
+ BDIGIT *ds = BDIGITS(x);
+
+ if (len == 0)
+ return 0;
+ if (BIGSIZE(x) > SIZEOF_LONG_LONG)
+ rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+#if SIZEOF_LONG_LONG <= SIZEOF_BDIGIT
+ num = (unsigned LONG_LONG)ds[0];
+#else
+ num = 0;
+ while (len--) {
+ num = BIGUP(num);
+ num += ds[len];
}
- if (!RBIGNUM(x)->sign) return -(long)num;
+#endif
return num;
}
-static VALUE
-rb_big_to_i(x)
- VALUE x;
+unsigned LONG_LONG
+rb_big2ull(VALUE x)
{
- return bignorm(x);
+ unsigned LONG_LONG num = big2ull(x, "unsigned long long");
+
+ if (BIGNUM_POSITIVE_P(x)) {
+ return num;
+ }
+ else {
+ if (num <= LLONG_MAX)
+ return -(LONG_LONG)num;
+ if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+ return LLONG_MIN;
+ }
+ rb_raise(rb_eRangeError, "bignum out of range of unsigned long long");
}
-VALUE
-rb_dbl2big(d)
- double d;
+LONG_LONG
+rb_big2ll(VALUE x)
{
- unsigned int i = 0;
- long c;
- USHORT *digits;
+ unsigned LONG_LONG num = big2ull(x, "long long");
+
+ if (BIGNUM_POSITIVE_P(x)) {
+ if (num <= LLONG_MAX)
+ return num;
+ }
+ else {
+ if (num <= LLONG_MAX)
+ return -(LONG_LONG)num;
+ if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+ return LLONG_MIN;
+ }
+ rb_raise(rb_eRangeError, "bignum too big to convert into `long long'");
+}
+
+#endif /* HAVE_LONG_LONG */
+
+static VALUE
+dbl2big(double d)
+{
+ long i = 0;
+ BDIGIT c;
+ BDIGIT *digits;
VALUE z;
double u = (d < 0)?-d:d;
- while (!POSFIXABLE(u) || 0 != (long)u) {
+ if (isinf(d)) {
+ rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
+ }
+ if (isnan(d)) {
+ rb_raise(rb_eFloatDomainError, "NaN");
+ }
+
+ while (1.0 <= u) {
u /= (double)(BIGRAD);
i++;
}
@@ -404,891 +5083,1933 @@ rb_dbl2big(d)
digits = BDIGITS(z);
while (i--) {
u *= BIGRAD;
- c = (long)u;
+ c = (BDIGIT)u;
u -= c;
- digits[i] = (USHORT)c;
+ digits[i] = c;
}
- return bignorm(z);
+ return z;
}
-double
-rb_big2dbl(x)
- VALUE x;
+VALUE
+rb_dbl2big(double d)
+{
+ return bignorm(dbl2big(d));
+}
+
+static double
+big2dbl(VALUE x)
{
double d = 0.0;
- int i = RBIGNUM(x)->len;
- USHORT *ds = BDIGITS(x);
+ long i = (bigtrunc(x), BIGNUM_LEN(x)), lo = 0, bits;
+ BDIGIT *ds = BDIGITS(x), dl;
- while (i--) {
- d = ds[i] + BIGRAD*d;
+ if (i) {
+ bits = i * BITSPERDIG - nlz(ds[i-1]);
+ if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
+ d = HUGE_VAL;
+ }
+ else {
+ if (bits > DBL_MANT_DIG+1)
+ lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
+ else
+ bits = 0;
+ while (--i > lo) {
+ d = ds[i] + BIGRAD*d;
+ }
+ dl = ds[i];
+ if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
+ int carry = (dl & ~(BDIGMAX << bits)) != 0;
+ if (!carry) {
+ while (i-- > 0) {
+ carry = ds[i] != 0;
+ if (carry) break;
+ }
+ }
+ if (carry) {
+ dl &= BDIGMAX << bits;
+ dl = BIGLO(dl + ((BDIGIT)1 << bits));
+ if (!dl) d += 1;
+ }
+ }
+ d = dl + BIGRAD*d;
+ if (lo) {
+ if (lo > INT_MAX / BITSPERDIG)
+ d = HUGE_VAL;
+ else if (lo < INT_MIN / BITSPERDIG)
+ d = 0.0;
+ else
+ d = ldexp(d, (int)(lo * BITSPERDIG));
+ }
+ }
+ }
+ if (!BIGNUM_SIGN(x)) d = -d;
+ return d;
+}
+
+double
+rb_big2dbl(VALUE x)
+{
+ double d = big2dbl(x);
+
+ if (isinf(d)) {
+ rb_warning("Bignum out of Float range");
+ if (d < 0.0)
+ d = -HUGE_VAL;
+ else
+ d = HUGE_VAL;
}
- if (!RBIGNUM(x)->sign) d = -d;
return d;
}
+/*
+ * call-seq:
+ * big.to_f -> float
+ *
+ * Converts <i>big</i> to a <code>Float</code>. If <i>big</i> doesn't
+ * fit in a <code>Float</code>, the result is infinity.
+ *
+ */
+
static VALUE
-rb_big_to_f(x)
- VALUE x;
+rb_big_to_f(VALUE x)
{
- return rb_float_new(rb_big2dbl(x));
+ return DBL2NUM(rb_big2dbl(x));
}
+VALUE
+rb_integer_float_cmp(VALUE x, VALUE y)
+{
+ double yd = RFLOAT_VALUE(y);
+ double yi, yf;
+ VALUE rel;
+
+ if (isnan(yd))
+ return Qnil;
+ if (isinf(yd)) {
+ if (yd > 0.0) return INT2FIX(-1);
+ else return INT2FIX(1);
+ }
+ yf = modf(yd, &yi);
+ if (FIXNUM_P(x)) {
+#if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
+ double xd = (double)FIX2LONG(x);
+ if (xd < yd)
+ return INT2FIX(-1);
+ if (xd > yd)
+ return INT2FIX(1);
+ return INT2FIX(0);
+#else
+ long xn, yn;
+ if (yi < FIXNUM_MIN)
+ return INT2FIX(1);
+ if (FIXNUM_MAX+1 <= yi)
+ return INT2FIX(-1);
+ xn = FIX2LONG(x);
+ yn = (long)yi;
+ if (xn < yn)
+ return INT2FIX(-1);
+ if (xn > yn)
+ return INT2FIX(1);
+ if (yf < 0.0)
+ return INT2FIX(1);
+ if (0.0 < yf)
+ return INT2FIX(-1);
+ return INT2FIX(0);
+#endif
+ }
+ y = rb_dbl2big(yi);
+ rel = rb_big_cmp(x, y);
+ if (yf == 0.0 || rel != INT2FIX(0))
+ return rel;
+ if (yf < 0.0)
+ return INT2FIX(1);
+ return INT2FIX(-1);
+}
+
+VALUE
+rb_integer_float_eq(VALUE x, VALUE y)
+{
+ double yd = RFLOAT_VALUE(y);
+ double yi, yf;
+
+ if (isnan(yd) || isinf(yd))
+ return Qfalse;
+ yf = modf(yd, &yi);
+ if (yf != 0)
+ return Qfalse;
+ if (FIXNUM_P(x)) {
+#if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
+ double xd = (double)FIX2LONG(x);
+ if (xd != yd)
+ return Qfalse;
+ return Qtrue;
+#else
+ long xn, yn;
+ if (yi < LONG_MIN || LONG_MAX < yi)
+ return Qfalse;
+ xn = FIX2LONG(x);
+ yn = (long)yi;
+ if (xn != yn)
+ return Qfalse;
+ return Qtrue;
+#endif
+ }
+ y = rb_dbl2big(yi);
+ return rb_big_eq(x, y);
+}
+
+/*
+ * call-seq:
+ * big <=> numeric -> -1, 0, +1 or nil
+ *
+ * Comparison---Returns -1, 0, or +1 depending on whether +big+ is
+ * less than, equal to, or greater than +numeric+. This is the
+ * basis for the tests in Comparable.
+ *
+ * +nil+ is returned if the two values are incomparable.
+ *
+ */
+
+VALUE
+rb_big_cmp(VALUE x, VALUE y)
+{
+ int cmp;
+
+ if (FIXNUM_P(y)) {
+ x = bignorm(x);
+ if (FIXNUM_P(x)) {
+ if (FIX2LONG(x) > FIX2LONG(y)) return INT2FIX(1);
+ if (FIX2LONG(x) < FIX2LONG(y)) return INT2FIX(-1);
+ return INT2FIX(0);
+ }
+ else {
+ if (BIGNUM_NEGATIVE_P(x)) return INT2FIX(-1);
+ return INT2FIX(1);
+ }
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ return rb_integer_float_cmp(x, y);
+ }
+ else {
+ return rb_num_coerce_cmp(x, y, rb_intern("<=>"));
+ }
+
+ if (BIGNUM_SIGN(x) > BIGNUM_SIGN(y)) return INT2FIX(1);
+ if (BIGNUM_SIGN(x) < BIGNUM_SIGN(y)) return INT2FIX(-1);
+
+ cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
+ if (BIGNUM_SIGN(x))
+ return INT2FIX(cmp);
+ else
+ return INT2FIX(-cmp);
+}
+
+enum big_op_t {
+ big_op_gt,
+ big_op_ge,
+ big_op_lt,
+ big_op_le
+};
+
static VALUE
-rb_big_cmp(x, y)
- VALUE x, y;
+big_op(VALUE x, VALUE y, enum big_op_t op)
{
- int xlen = RBIGNUM(x)->len;
+ VALUE rel;
+ int n;
- switch (TYPE(y)) {
- case T_FIXNUM:
- y = rb_int2big(FIX2LONG(y));
- break;
+ if (FIXNUM_P(y) || RB_BIGNUM_TYPE_P(y)) {
+ rel = rb_big_cmp(x, y);
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ rel = rb_integer_float_cmp(x, y);
+ }
+ else {
+ ID id = 0;
+ switch (op) {
+ case big_op_gt: id = '>'; break;
+ case big_op_ge: id = rb_intern(">="); break;
+ case big_op_lt: id = '<'; break;
+ case big_op_le: id = rb_intern("<="); break;
+ }
+ return rb_num_coerce_relop(x, y, id);
+ }
- case T_BIGNUM:
- break;
+ if (NIL_P(rel)) return Qfalse;
+ n = FIX2INT(rel);
- default:
- return rb_num_coerce_bin(x, y);
+ switch (op) {
+ case big_op_gt: return n > 0 ? Qtrue : Qfalse;
+ case big_op_ge: return n >= 0 ? Qtrue : Qfalse;
+ case big_op_lt: return n < 0 ? Qtrue : Qfalse;
+ case big_op_le: return n <= 0 ? Qtrue : Qfalse;
}
+ return Qundef;
+}
- if (RBIGNUM(x)->sign > RBIGNUM(y)->sign) return INT2FIX(1);
- if (RBIGNUM(x)->sign < RBIGNUM(y)->sign) return INT2FIX(-1);
- if (xlen < RBIGNUM(y)->len)
- return (RBIGNUM(x)->sign) ? INT2FIX(-1) : INT2FIX(1);
- if (xlen > RBIGNUM(y)->len)
- return (RBIGNUM(x)->sign) ? INT2FIX(1) : INT2FIX(-1);
+/*
+ * call-seq:
+ * big > real -> true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * greater than that of <code>real</code>.
+ */
- while(xlen-- && (BDIGITS(x)[xlen]==BDIGITS(y)[xlen]));
- if (-1 == xlen) return INT2FIX(0);
- return (BDIGITS(x)[xlen] > BDIGITS(y)[xlen]) ?
- (RBIGNUM(x)->sign ? INT2FIX(1) : INT2FIX(-1)) :
- (RBIGNUM(x)->sign ? INT2FIX(-1) : INT2FIX(1));
+static VALUE
+big_gt(VALUE x, VALUE y)
+{
+ return big_op(x, y, big_op_gt);
}
+/*
+ * call-seq:
+ * big >= real -> true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * greater than or equal to that of <code>real</code>.
+ */
+
static VALUE
-rb_big_eq(x, y)
- VALUE x, y;
+big_ge(VALUE x, VALUE y)
{
- if (rb_big_cmp(x, y) == INT2FIX(0)) return Qtrue;
- return Qfalse;
+ return big_op(x, y, big_op_ge);
+}
+
+/*
+ * call-seq:
+ * big < real -> true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * less than that of <code>real</code>.
+ */
+
+static VALUE
+big_lt(VALUE x, VALUE y)
+{
+ return big_op(x, y, big_op_lt);
}
+/*
+ * call-seq:
+ * big <= real -> true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * less than or equal to that of <code>real</code>.
+ */
+
static VALUE
-rb_big_uminus(x)
- VALUE x;
+big_le(VALUE x, VALUE y)
+{
+ return big_op(x, y, big_op_le);
+}
+
+/*
+ * call-seq:
+ * big == obj -> true or false
+ *
+ * Returns <code>true</code> only if <i>obj</i> has the same value
+ * as <i>big</i>. Contrast this with <code>Bignum#eql?</code>, which
+ * requires <i>obj</i> to be a <code>Bignum</code>.
+ *
+ * 68719476736 == 68719476736.0 #=> true
+ */
+
+VALUE
+rb_big_eq(VALUE x, VALUE y)
+{
+ if (FIXNUM_P(y)) {
+ if (bignorm(x) == y) return Qtrue;
+ y = rb_int2big(FIX2LONG(y));
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ return rb_integer_float_eq(x, y);
+ }
+ else {
+ return rb_equal(y, x);
+ }
+ if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
+ if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
+ if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * big.eql?(obj) -> true or false
+ *
+ * Returns <code>true</code> only if <i>obj</i> is a
+ * <code>Bignum</code> with the same value as <i>big</i>. Contrast this
+ * with <code>Bignum#==</code>, which performs type conversions.
+ *
+ * 68719476736.eql?(68719476736.0) #=> false
+ */
+
+VALUE
+rb_big_eql(VALUE x, VALUE y)
+{
+ if (!RB_BIGNUM_TYPE_P(y)) return Qfalse;
+ if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
+ if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
+ if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * -big -> integer
+ *
+ * Unary minus (returns an integer whose value is 0-big)
+ */
+
+VALUE
+rb_big_uminus(VALUE x)
{
VALUE z = rb_big_clone(x);
- RBIGNUM(z)->sign = !RBIGNUM(x)->sign;
+ BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
return bignorm(z);
}
+/*
+ * call-seq:
+ * ~big -> integer
+ *
+ * Inverts the bits in big. As Bignums are conceptually infinite
+ * length, the result acts as if it had an infinite number of one
+ * bits to the left. In hex representations, this is displayed
+ * as two periods to the left of the digits.
+ *
+ * sprintf("%X", ~0x1122334455) #=> "..FEEDDCCBBAA"
+ */
+
static VALUE
-rb_big_neg(x)
- VALUE x;
+rb_big_neg(VALUE x)
{
VALUE z = rb_big_clone(x);
- int i = RBIGNUM(x)->len;
- USHORT *ds = BDIGITS(z);
+ BDIGIT *ds = BDIGITS(z);
+ long n = BIGNUM_LEN(z);
- if (!RBIGNUM(x)->sign) rb_big_2comp(z);
- while (i--) ds[i] = ~ds[i];
- if (RBIGNUM(x)->sign) rb_big_2comp(z);
- RBIGNUM(z)->sign = !RBIGNUM(z)->sign;
+ if (!n) return INT2FIX(-1);
+
+ if (BIGNUM_POSITIVE_P(z)) {
+ if (bary_add_one(ds, n)) {
+ big_extend_carry(z);
+ }
+ BIGNUM_SET_NEGATIVE_SIGN(z);
+ }
+ else {
+ bary_neg(ds, n);
+ if (bary_add_one(ds, n))
+ return INT2FIX(-1);
+ bary_neg(ds, n);
+ BIGNUM_SET_POSITIVE_SIGN(z);
+ }
return bignorm(z);
}
static VALUE
-bigsub(x, y)
- VALUE x, y;
+bigsub(VALUE x, VALUE y)
{
- VALUE z = 0;
- USHORT *zds;
- long num;
- int i;
+ VALUE z;
+ BDIGIT *xds, *yds, *zds;
+ long xn, yn, zn;
- i = RBIGNUM(x)->len;
- /* if x is larger than y, swap */
- if (RBIGNUM(x)->len < RBIGNUM(y)->len) {
- z = x; x = y; y = z; /* swap x y */
- }
- else if (RBIGNUM(x)->len == RBIGNUM(y)->len) {
- while (i > 0) {
- i--;
- if (BDIGITS(x)[i] > BDIGITS(y)[i]) {
- break;
- }
- if (BDIGITS(x)[i] < BDIGITS(y)[i]) {
- z = x; x = y; y = z; /* swap x y */
- break;
- }
- }
+ xn = BIGNUM_LEN(x);
+ yn = BIGNUM_LEN(y);
+ zn = xn < yn ? yn : xn;
+
+ z = bignew(zn, 1);
+
+ xds = BDIGITS(x);
+ yds = BDIGITS(y);
+ zds = BDIGITS(z);
+
+ if (bary_sub(zds, zn, xds, xn, yds, yn)) {
+ bary_2comp(zds, zn);
+ BIGNUM_SET_NEGATIVE_SIGN(z);
}
- z = bignew(RBIGNUM(x)->len, (z == 0)?1:0);
+ return z;
+}
+
+static VALUE bigadd_int(VALUE x, long y);
+
+static VALUE
+bigsub_int(VALUE x, long y0)
+{
+ VALUE z;
+ BDIGIT *xds, *zds;
+ long xn, zn;
+ BDIGIT_DBL_SIGNED num;
+ long i, y;
+
+ y = y0;
+ xds = BDIGITS(x);
+ xn = BIGNUM_LEN(x);
+
+ if (xn == 0)
+ return LONG2NUM(-y0);
+
+ zn = xn;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ if (zn < bdigit_roomof(SIZEOF_LONG))
+ zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+ z = bignew(zn, BIGNUM_SIGN(x));
zds = BDIGITS(z);
- for (i = 0, num = 0; i < RBIGNUM(y)->len; i++) {
- num += (long)BDIGITS(x)[i] - BDIGITS(y)[i];
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ assert(xn == zn);
+ num = (BDIGIT_DBL_SIGNED)xds[0] - y;
+ if (xn == 1 && num < 0) {
+ BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+ zds[0] = (BDIGIT)-num;
+ RB_GC_GUARD(x);
+ return bignorm(z);
+ }
+ zds[0] = BIGLO(num);
+ num = BIGDN(num);
+ i = 1;
+ if (i < xn)
+ goto y_is_zero_x;
+ goto finish;
+#else
+ num = 0;
+ for (i=0; i < xn; i++) {
+ if (y == 0) goto y_is_zero_x;
+ num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
zds[i] = BIGLO(num);
num = BIGDN(num);
- }
- while (num && i < RBIGNUM(x)->len) {
- num += BDIGITS(x)[i];
- zds[i++] = BIGLO(num);
+ y = BIGDN(y);
+ }
+ for (; i < zn; i++) {
+ if (y == 0) goto y_is_zero_z;
+ num -= BIGLO(y);
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ y = BIGDN(y);
+ }
+ goto finish;
+#endif
+
+ for (; i < xn; i++) {
+ y_is_zero_x:
+ if (num == 0) goto num_is_zero_x;
+ num += xds[i];
+ zds[i] = BIGLO(num);
num = BIGDN(num);
}
- while (i < RBIGNUM(x)->len) {
- zds[i] = BDIGITS(x)[i];
- i++;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ for (; i < zn; i++) {
+ y_is_zero_z:
+ if (num == 0) goto num_is_zero_z;
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ }
+#endif
+ goto finish;
+
+ for (; i < xn; i++) {
+ num_is_zero_x:
+ zds[i] = xds[i];
}
-
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ for (; i < zn; i++) {
+ num_is_zero_z:
+ zds[i] = 0;
+ }
+#endif
+ goto finish;
+
+ finish:
+ assert(num == 0 || num == -1);
+ if (num < 0) {
+ get2comp(z);
+ BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+ }
+ RB_GC_GUARD(x);
return bignorm(z);
}
static VALUE
-bigadd(x, y, sign)
- VALUE x, y;
- char sign;
+bigadd_int(VALUE x, long y)
{
VALUE z;
- long num;
- int i, len;
+ BDIGIT *xds, *zds;
+ long xn, zn;
+ BDIGIT_DBL num;
+ long i;
- sign = (sign == RBIGNUM(y)->sign);
- if (RBIGNUM(x)->sign != sign) {
- if (sign) return bigsub(y, x);
- return bigsub(x, y);
- }
+ xds = BDIGITS(x);
+ xn = BIGNUM_LEN(x);
+
+ if (xn == 0)
+ return LONG2NUM(y);
- if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
- len = RBIGNUM(x)->len + 1;
- z = x; x = y; y = z;
+ zn = xn;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ if (zn < bdigit_roomof(SIZEOF_LONG))
+ zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+ zn++;
+
+ z = bignew(zn, BIGNUM_SIGN(x));
+ zds = BDIGITS(z);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ num = (BDIGIT_DBL)xds[0] + y;
+ zds[0] = BIGLO(num);
+ num = BIGDN(num);
+ i = 1;
+ if (i < xn)
+ goto y_is_zero_x;
+ goto y_is_zero_z;
+#else
+ num = 0;
+ for (i=0; i < xn; i++) {
+ if (y == 0) goto y_is_zero_x;
+ num += (BDIGIT_DBL)xds[i] + BIGLO(y);
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ y = BIGDN(y);
}
- else {
- len = RBIGNUM(y)->len + 1;
+ for (; i < zn; i++) {
+ if (y == 0) goto y_is_zero_z;
+ num += BIGLO(y);
+ zds[i] = BIGLO(num);
+ num = BIGDN(num);
+ y = BIGDN(y);
}
- z = bignew(len, sign);
+ goto finish;
+
+#endif
- len = RBIGNUM(x)->len;
- for (i = 0, num = 0; i < len; i++) {
- num += BDIGITS(x)[i] + BDIGITS(y)[i];
- BDIGITS(z)[i] = BIGLO(num);
+ for (;i < xn; i++) {
+ y_is_zero_x:
+ if (num == 0) goto num_is_zero_x;
+ num += (BDIGIT_DBL)xds[i];
+ zds[i] = BIGLO(num);
num = BIGDN(num);
}
- len = RBIGNUM(y)->len;
- while (num && i < len) {
- num += BDIGITS(y)[i];
- BDIGITS(z)[i++] = BIGLO(num);
+ for (; i < zn; i++) {
+ y_is_zero_z:
+ if (num == 0) goto num_is_zero_z;
+ zds[i] = BIGLO(num);
num = BIGDN(num);
}
- while (i < len) {
- BDIGITS(z)[i] = BDIGITS(y)[i];
- i++;
+ goto finish;
+
+ for (;i < xn; i++) {
+ num_is_zero_x:
+ zds[i] = xds[i];
}
- BDIGITS(z)[i] = (USHORT)num;
+ for (; i < zn; i++) {
+ num_is_zero_z:
+ zds[i] = 0;
+ }
+ goto finish;
+ finish:
+ RB_GC_GUARD(x);
return bignorm(z);
}
-VALUE
-rb_big_plus(x, y)
- VALUE x, y;
+static VALUE
+bigadd(VALUE x, VALUE y, int sign)
{
- switch (TYPE(y)) {
- case T_FIXNUM:
- y = rb_int2big(FIX2LONG(y));
- /* fall through */
- case T_BIGNUM:
- return bigadd(x, y, 1);
+ VALUE z;
+ size_t len;
- case T_FLOAT:
- return rb_float_new(rb_big2dbl(x) + RFLOAT(y)->value);
+ sign = (sign == BIGNUM_SIGN(y));
+ if (BIGNUM_SIGN(x) != sign) {
+ if (sign) return bigsub(y, x);
+ return bigsub(x, y);
+ }
- default:
- return rb_num_coerce_bin(x, y);
+ if (BIGNUM_LEN(x) > BIGNUM_LEN(y)) {
+ len = BIGNUM_LEN(x) + 1;
}
+ else {
+ len = BIGNUM_LEN(y) + 1;
+ }
+ z = bignew(len, sign);
+
+ bary_add(BDIGITS(z), BIGNUM_LEN(z),
+ BDIGITS(x), BIGNUM_LEN(x),
+ BDIGITS(y), BIGNUM_LEN(y));
+
+ return z;
}
+/*
+ * call-seq:
+ * big + other -> Numeric
+ *
+ * Adds big and other, returning the result.
+ */
+
VALUE
-rb_big_minus(x, y)
- VALUE x, y;
+rb_big_plus(VALUE x, VALUE y)
{
- switch (TYPE(y)) {
- case T_FIXNUM:
- y = rb_int2big(FIX2LONG(y));
- /* fall through */
- case T_BIGNUM:
- return bigadd(x, y, 0);
-
- case T_FLOAT:
- return rb_float_new(rb_big2dbl(x) - RFLOAT(y)->value);
+ long n;
- default:
- return rb_num_coerce_bin(x, y);
+ if (FIXNUM_P(y)) {
+ n = FIX2LONG(y);
+ if ((n > 0) != BIGNUM_SIGN(x)) {
+ if (n < 0) {
+ n = -n;
+ }
+ return bigsub_int(x, n);
+ }
+ if (n < 0) {
+ n = -n;
+ }
+ return bigadd_int(x, n);
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ return bignorm(bigadd(x, y, 1));
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
+ }
+ else {
+ return rb_num_coerce_bin(x, y, '+');
}
}
+/*
+ * call-seq:
+ * big - other -> Numeric
+ *
+ * Subtracts other from big, returning the result.
+ */
+
VALUE
-rb_big_mul(x, y)
- VALUE x, y;
+rb_big_minus(VALUE x, VALUE y)
{
- int i, j;
- unsigned long n = 0;
+ long n;
+
+ if (FIXNUM_P(y)) {
+ n = FIX2LONG(y);
+ if ((n > 0) != BIGNUM_SIGN(x)) {
+ if (n < 0) {
+ n = -n;
+ }
+ return bigadd_int(x, n);
+ }
+ if (n < 0) {
+ n = -n;
+ }
+ return bigsub_int(x, n);
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ return bignorm(bigadd(x, y, 0));
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
+ }
+ else {
+ return rb_num_coerce_bin(x, y, '-');
+ }
+}
+
+static VALUE
+bigsq(VALUE x)
+{
+ long xn, zn;
VALUE z;
- USHORT *zds;
+ BDIGIT *xds, *zds;
- if (FIXNUM_P(x)) x = rb_int2big(FIX2LONG(x));
- switch (TYPE(y)) {
- case T_FIXNUM:
- y = rb_int2big(FIX2LONG(y));
- break;
+ xn = BIGNUM_LEN(x);
+ zn = 2 * xn;
- case T_BIGNUM:
- break;
+ z = bignew(zn, 1);
- case T_FLOAT:
- return rb_float_new(rb_big2dbl(x) * RFLOAT(y)->value);
+ xds = BDIGITS(x);
+ zds = BDIGITS(z);
- default:
- return rb_num_coerce_bin(x, y);
- }
+#ifdef USE_GMP
+ if (xn < GMP_MUL_DIGITS)
+ bary_sq_fast(zds, zn, xds, xn);
+ else
+ bary_mul(zds, zn, xds, xn, xds, xn);
+#else
+ if (xn < KARATSUBA_MUL_DIGITS)
+ bary_sq_fast(zds, zn, xds, xn);
+ else
+ bary_mul(zds, zn, xds, xn, xds, xn);
+#endif
- j = RBIGNUM(x)->len + RBIGNUM(y)->len + 1;
- z = bignew(j, RBIGNUM(x)->sign==RBIGNUM(y)->sign);
+ RB_GC_GUARD(x);
+ return z;
+}
+
+static VALUE
+bigmul0(VALUE x, VALUE y)
+{
+ long xn, yn, zn;
+ VALUE z;
+ BDIGIT *xds, *yds, *zds;
+
+ if (x == y)
+ return bigsq(x);
+
+ xn = BIGNUM_LEN(x);
+ yn = BIGNUM_LEN(y);
+ zn = xn + yn;
+
+ z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+
+ xds = BDIGITS(x);
+ yds = BDIGITS(y);
zds = BDIGITS(z);
- while (j--) zds[j] = 0;
- for (i = 0; i < RBIGNUM(x)->len; i++) {
- unsigned long dd = BDIGITS(x)[i];
- if (dd == 0) continue;
- n = 0;
- for (j = 0; j < RBIGNUM(y)->len; j++) {
- int ee = n + dd * BDIGITS(y)[j];
- n = zds[i + j] + ee;
- if (ee) zds[i + j] = BIGLO(n);
- n = BIGDN(n);
- }
- if (n) {
- zds[i + j] = n;
- }
+
+ bary_mul(zds, zn, xds, xn, yds, yn);
+
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
+ return z;
+}
+
+/*
+ * call-seq:
+ * big * other -> Numeric
+ *
+ * Multiplies big and other, returning the result.
+ */
+
+VALUE
+rb_big_mul(VALUE x, VALUE y)
+{
+ if (FIXNUM_P(y)) {
+ y = rb_int2big(FIX2LONG(y));
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
+ }
+ else {
+ return rb_num_coerce_bin(x, y, '*');
}
- return bignorm(z);
+ return bignorm(bigmul0(x, y));
}
-static void
-bigdivmod(x, y, div, mod, modulo)
- VALUE x, y;
- VALUE *div, *mod;
- int modulo;
+static VALUE
+bigdivrem(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
{
- int nx = RBIGNUM(x)->len, ny = RBIGNUM(y)->len;
- int i, j;
- VALUE yy, z;
- USHORT *xds, *yds, *zds, *tds;
- unsigned long t2;
- long num;
- USHORT dd, q;
+ long xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y);
+ VALUE z;
+ BDIGIT *xds, *yds, *zds;
+ BDIGIT dd;
+
+ VALUE q = Qnil, r = Qnil;
+ BDIGIT *qds, *rds;
+ long qn, rn;
yds = BDIGITS(y);
- if (ny == 0 && yds[0] == 0) rb_num_zerodiv();
- if (nx < ny || nx == ny && BDIGITS(x)[nx - 1] < BDIGITS(y)[ny - 1]) {
- if (div) *div = INT2FIX(0);
- if (mod) *mod = bignorm(x);
- return;
- }
+ BARY_TRUNC(yds, yn);
+ if (yn == 0)
+ rb_num_zerodiv();
+
xds = BDIGITS(x);
- if (ny == 1) {
+ BARY_TRUNC(xds, xn);
+
+ if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
+ if (divp) *divp = rb_int2big(0);
+ if (modp) *modp = x;
+ return Qnil;
+ }
+ if (yn == 1) {
dd = yds[0];
- z = rb_big_clone(x);
+ z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
zds = BDIGITS(z);
- t2 = 0; i = nx;
- while (i--) {
- t2 = BIGUP(t2) + zds[i];
- zds[i] = (USHORT)(t2 / dd);
- t2 %= dd;
+ dd = bigdivrem_single(zds, xds, xn, dd);
+ if (modp) {
+ *modp = rb_uint2big((VALUE)dd);
+ BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
}
- if (div) *div = bignorm(z);
- if (mod) {
- if (!RBIGNUM(y)->sign) t2 = -(long)t2;
- *mod = INT2NUM(t2);
- }
- return;
+ if (divp) *divp = z;
+ return Qnil;
}
- z = bignew(nx==ny?nx+2:nx+1, RBIGNUM(x)->sign==RBIGNUM(y)->sign);
- zds = BDIGITS(z);
- if (nx==ny) zds[nx+1] = 0;
- while (!yds[ny-1]) ny--;
- if ((dd = BIGRAD/(int)(yds[ny-1]+1)) != 1) {
- yy = rb_big_clone(y);
- tds = BDIGITS(yy);
- j = 0;
- num = 0;
- while (j<ny) {
- num += (long)yds[j]*dd;
- tds[j++] = BIGLO(num);
- num = BIGDN(num);
- }
- yds = tds;
- j = 0;
- num = 0;
- while (j<nx) {
- num += (long)xds[j]*dd;
- zds[j++] = BIGLO(num);
- num = BIGDN(num);
- }
- zds[j] = (USHORT)num;
+ if (xn == 2 && yn == 2) {
+ BDIGIT_DBL x0 = bary2bdigitdbl(xds, 2);
+ BDIGIT_DBL y0 = bary2bdigitdbl(yds, 2);
+ BDIGIT_DBL q0 = x0 / y0;
+ BDIGIT_DBL r0 = x0 % y0;
+ if (divp) {
+ z = bignew(bdigit_roomof(sizeof(BDIGIT_DBL)), BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ zds = BDIGITS(z);
+ zds[0] = BIGLO(q0);
+ zds[1] = BIGLO(BIGDN(q0));
+ *divp = z;
+ }
+ if (modp) {
+ z = bignew(bdigit_roomof(sizeof(BDIGIT_DBL)), BIGNUM_SIGN(x));
+ zds = BDIGITS(z);
+ zds[0] = BIGLO(r0);
+ zds[1] = BIGLO(BIGDN(r0));
+ *modp = z;
+ }
+ return Qnil;
+ }
+
+ if (divp) {
+ qn = xn + BIGDIVREM_EXTRA_WORDS;
+ q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+ qds = BDIGITS(q);
}
else {
- zds[nx] = 0;
- j = nx;
- while (j--) zds[j] = xds[j];
+ qn = 0;
+ qds = NULL;
}
- j = nx==ny?nx+1:nx;
- do {
- if (zds[j] == yds[ny-1]) q = BIGRAD-1;
- else q = (USHORT)((BIGUP(zds[j]) + zds[j-1])/yds[ny-1]);
- if (q) {
- i = 0; num = 0; t2 = 0;
- do { /* multiply and subtract */
- int ee;
- t2 += (long)yds[i] * q;
- ee = num - BIGLO(t2);
- num = zds[j - ny + i] + ee;
- if (ee) zds[j - ny + i] = BIGLO(num);
- num = BIGDN(num);
- t2 = BIGDN(t2);
- } while (++i < ny);
- num += zds[j - ny + i] - t2; /* borrow from high digit; don't update */
- while (num) { /* "add back" required */
- i = 0; num = 0; q--;
- do {
- int ee = num + yds[i];
- num = (long) zds[j - ny + i] + ee;
- if (ee) zds[j - ny + i] = BIGLO(num);
- num = BIGDN(num);
- } while (++i < ny);
- num--;
- }
- }
- zds[j] = q;
- } while (--j >= ny);
- if (div) { /* move quotient down in z */
- *div = rb_big_clone(z);
- zds = BDIGITS(*div);
- j = (nx==ny ? nx+2 : nx+1) - ny;
- for (i = 0;i < j;i++) zds[i] = zds[i+ny];
- RBIGNUM(*div)->len = i;
- *div = bignorm(*div);
- }
- if (mod) { /* just normalize remainder */
- *mod = rb_big_clone(z);
- if (dd) {
- zds = BDIGITS(*mod);
- t2 = 0; i = ny;
- while(i--) {
- t2 = BIGUP(t2) + zds[i];
- zds[i] = (USHORT)(t2 / dd);
- t2 %= dd;
- }
- }
- RBIGNUM(*mod)->len = ny;
- RBIGNUM(*mod)->sign = RBIGNUM(x)->sign;
- if (modulo && RBIGNUM(x)->sign != RBIGNUM(y)->sign) {
- int len = ny;
- zds = BDIGITS(*mod);
- while (len-- && !zds[len]);
- if (len > 0) {
- *mod = bigadd(*mod, y, 1);
- return;
- }
- }
- *mod = bignorm(*mod);
+
+ if (modp) {
+ rn = yn;
+ r = bignew(rn, BIGNUM_SIGN(x));
+ rds = BDIGITS(r);
+ }
+ else {
+ rn = 0;
+ rds = NULL;
+ }
+
+ bary_divmod_branch(qds, qn, rds, rn, xds, xn, yds, yn);
+
+ if (divp) {
+ bigtrunc(q);
+ *divp = q;
+ }
+ if (modp) {
+ bigtrunc(r);
+ *modp = r;
+ }
+
+ return Qnil;
+}
+
+static void
+bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
+{
+ VALUE mod;
+
+ bigdivrem(x, y, divp, &mod);
+ if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y) && !BIGZEROP(mod)) {
+ if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
+ if (modp) *modp = bigadd(mod, y, 1);
+ }
+ else if (modp) {
+ *modp = mod;
}
}
+
static VALUE
-rb_big_div(x, y)
- VALUE x, y;
+rb_big_divide(VALUE x, VALUE y, ID op)
{
VALUE z;
- switch (TYPE(y)) {
- case T_FIXNUM:
+ if (FIXNUM_P(y)) {
y = rb_int2big(FIX2LONG(y));
- break;
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ if (op == '/') {
+ return DBL2NUM(rb_big2dbl(x) / RFLOAT_VALUE(y));
+ }
+ else {
+ double dy = RFLOAT_VALUE(y);
+ if (dy == 0.0) rb_num_zerodiv();
+ return rb_dbl2big(rb_big2dbl(x) / dy);
+ }
+ }
+ else {
+ return rb_num_coerce_bin(x, y, op);
+ }
+ bigdivmod(x, y, &z, 0);
+
+ return bignorm(z);
+}
- case T_BIGNUM:
- break;
+/*
+ * call-seq:
+ * big / other -> Numeric
+ *
+ * Performs division: the class of the resulting object depends on
+ * the class of <code>numeric</code> and on the magnitude of the
+ * result.
+ */
- case T_FLOAT:
- return rb_float_new(rb_big2dbl(x) / RFLOAT(y)->value);
+VALUE
+rb_big_div(VALUE x, VALUE y)
+{
+ return rb_big_divide(x, y, '/');
+}
- default:
- return rb_num_coerce_bin(x, y);
- }
- bigdivmod(x, y, &z, 0, 0);
+/*
+ * call-seq:
+ * big.div(other) -> integer
+ *
+ * Performs integer division: returns integer value.
+ */
- return z;
+VALUE
+rb_big_idiv(VALUE x, VALUE y)
+{
+ return rb_big_divide(x, y, rb_intern("div"));
}
+/*
+ * call-seq:
+ * big % other -> Numeric
+ * big.modulo(other) -> Numeric
+ *
+ * Returns big modulo other. See Numeric.divmod for more
+ * information.
+ */
+VALUE
+rb_big_modulo(VALUE x, VALUE y)
+{
+ VALUE z;
+
+ if (FIXNUM_P(y)) {
+ y = rb_int2big(FIX2LONG(y));
+ }
+ else if (!RB_BIGNUM_TYPE_P(y)) {
+ return rb_num_coerce_bin(x, y, '%');
+ }
+ bigdivmod(x, y, 0, &z);
+
+ return bignorm(z);
+}
+
+/*
+ * call-seq:
+ * big.remainder(numeric) -> number
+ *
+ * Returns the remainder after dividing <i>big</i> by <i>numeric</i>.
+ *
+ * -1234567890987654321.remainder(13731) #=> -6966
+ * -1234567890987654321.remainder(13731.24) #=> -9906.22531493148
+ */
static VALUE
-rb_big_modulo(x, y, modulo)
- VALUE x, y;
- int modulo;
+rb_big_remainder(VALUE x, VALUE y)
{
VALUE z;
- switch (TYPE(y)) {
- case T_FIXNUM:
+ if (FIXNUM_P(y)) {
y = rb_int2big(FIX2LONG(y));
- break;
+ }
+ else if (!RB_BIGNUM_TYPE_P(y)) {
+ return rb_num_coerce_bin(x, y, rb_intern("remainder"));
+ }
+ bigdivrem(x, y, 0, &z);
- case T_BIGNUM:
- break;
+ return bignorm(z);
+}
- case T_FLOAT:
- y = rb_dbl2big(RFLOAT(y)->value);
- break;
+/*
+ * call-seq:
+ * big.divmod(numeric) -> array
+ *
+ * See <code>Numeric#divmod</code>.
+ *
+ */
+VALUE
+rb_big_divmod(VALUE x, VALUE y)
+{
+ VALUE div, mod;
- default:
- return rb_num_coerce_bin(x, y);
+ if (FIXNUM_P(y)) {
+ y = rb_int2big(FIX2LONG(y));
+ }
+ else if (!RB_BIGNUM_TYPE_P(y)) {
+ return rb_num_coerce_bin(x, y, rb_intern("divmod"));
}
- bigdivmod(x, y, 0, &z, modulo);
+ bigdivmod(x, y, &div, &mod);
- return z;
+ return rb_assoc_new(bignorm(div), bignorm(mod));
}
static VALUE
-rb_big_mod(x, y)
- VALUE x, y;
+big_shift(VALUE x, long n)
{
- return rb_big_modulo(x, y, 1);
+ if (n < 0)
+ return big_lshift(x, 1+(unsigned long)(-(n+1)));
+ else if (n > 0)
+ return big_rshift(x, (unsigned long)n);
+ return x;
}
static VALUE
-rb_big_remainder(x, y)
- VALUE x, y;
+big_fdiv(VALUE x, VALUE y, long ey)
{
- return rb_big_modulo(x, y, 0);
+#define DBL_BIGDIG ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)
+ VALUE z;
+ long l, ex;
+
+ bigtrunc(x);
+ l = BIGNUM_LEN(x);
+ ex = l * BITSPERDIG - nlz(BDIGITS(x)[l-1]);
+ ex -= 2 * DBL_BIGDIG * BITSPERDIG;
+ if (ex) x = big_shift(x, ex);
+
+ bigdivrem(x, y, &z, 0);
+ l = ex - ey;
+#if SIZEOF_LONG > SIZEOF_INT
+ {
+ /* Visual C++ can't be here */
+ if (l > INT_MAX) return DBL2NUM(INFINITY);
+ if (l < INT_MIN) return DBL2NUM(0.0);
+ }
+#endif
+ return DBL2NUM(ldexp(big2dbl(z), (int)l));
}
static VALUE
-rb_big_divmod(x, y)
- VALUE x, y;
+big_fdiv_int(VALUE x, VALUE y)
{
- VALUE div, mod;
+ long l, ey;
+ bigtrunc(y);
+ l = BIGNUM_LEN(y);
+ ey = l * BITSPERDIG - nlz(BDIGITS(y)[l-1]);
+ ey -= DBL_BIGDIG * BITSPERDIG;
+ if (ey) y = big_shift(y, ey);
+ return big_fdiv(x, y, ey);
+}
- switch (TYPE(y)) {
- case T_FIXNUM:
- y = rb_int2big(FIX2LONG(y));
- break;
+static VALUE
+big_fdiv_float(VALUE x, VALUE y)
+{
+ int i;
+ y = dbl2big(ldexp(frexp(RFLOAT_VALUE(y), &i), DBL_MANT_DIG));
+ return big_fdiv(x, y, i - DBL_MANT_DIG);
+}
- case T_FLOAT:
- y = rb_dbl2big(RFLOAT(y)->value);
- break;
+/*
+ * call-seq:
+ * big.fdiv(numeric) -> float
+ *
+ * Returns the floating point result of dividing <i>big</i> by
+ * <i>numeric</i>.
+ *
+ * -1234567890987654321.fdiv(13731) #=> -89910996357705.5
+ * -1234567890987654321.fdiv(13731.24) #=> -89909424858035.7
+ *
+ */
- case T_BIGNUM:
- break;
- default:
- return rb_num_coerce_bin(x, y);
- }
- bigdivmod(x, y, &div, &mod, 1);
+VALUE
+rb_big_fdiv(VALUE x, VALUE y)
+{
+ double dx, dy;
- return rb_assoc_new(div, mod);;
+ dx = big2dbl(x);
+ if (FIXNUM_P(y)) {
+ dy = (double)FIX2LONG(y);
+ if (isinf(dx))
+ return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ dy = rb_big2dbl(y);
+ if (isinf(dx) || isinf(dy))
+ return big_fdiv_int(x, y);
+ }
+ else if (RB_FLOAT_TYPE_P(y)) {
+ dy = RFLOAT_VALUE(y);
+ if (isnan(dy))
+ return y;
+ if (isinf(dx))
+ return big_fdiv_float(x, y);
+ }
+ else {
+ return rb_num_coerce_bin(x, y, rb_intern("fdiv"));
+ }
+ return DBL2NUM(dx / dy);
}
+/*
+ * call-seq:
+ * big ** exponent -> numeric
+ *
+ * Raises _big_ to the _exponent_ power (which may be an integer, float,
+ * or anything that will coerce to a number). The result may be
+ * a Fixnum, Bignum, or Float
+ *
+ * 123456789 ** 2 #=> 15241578750190521
+ * 123456789 ** 1.2 #=> 5126464716.09932
+ * 123456789 ** -2 #=> 6.5610001194102e-17
+ */
+
VALUE
-rb_big_pow(x, y)
- VALUE x, y;
+rb_big_pow(VALUE x, VALUE y)
{
double d;
- long yy;
-
- if (y == INT2FIX(0)) return INT2FIX(1);
- switch (TYPE(y)) {
- case T_FLOAT:
- d = RFLOAT(y)->value;
- break;
+ SIGNED_VALUE yy;
- case T_BIGNUM:
+ again:
+ if (y == INT2FIX(0)) return INT2FIX(1);
+ if (RB_FLOAT_TYPE_P(y)) {
+ d = RFLOAT_VALUE(y);
+ if ((!BIGNUM_SIGN(x) && !BIGZEROP(x)) && d != round(d))
+ return rb_funcall(rb_complex_raw1(x), rb_intern("**"), 1, y);
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ y = bignorm(y);
+ if (FIXNUM_P(y))
+ goto again;
rb_warn("in a**b, b may be too big");
d = rb_big2dbl(y);
- break;
-
- case T_FIXNUM:
- yy = NUM2LONG(y);
- if (yy > 0) {
- VALUE z;
-
- z = x;
- for (;;) {
- yy = yy - 1;
- if (yy == 0) break;
- while (yy % 2 == 0) {
- yy = yy / 2;
- x = rb_big_mul(x, x);
+ }
+ else if (FIXNUM_P(y)) {
+ yy = FIX2LONG(y);
+
+ if (yy < 0)
+ return rb_funcall(rb_rational_raw1(x), rb_intern("**"), 1, y);
+ else {
+ VALUE z = 0;
+ SIGNED_VALUE mask;
+ const size_t xbits = rb_absint_numwords(x, 1, NULL);
+ const size_t BIGLEN_LIMIT = 32*1024*1024;
+
+ if (xbits == (size_t)-1 ||
+ (xbits > BIGLEN_LIMIT) ||
+ (xbits * yy > BIGLEN_LIMIT)) {
+ rb_warn("in a**b, b may be too big");
+ d = (double)yy;
+ }
+ else {
+ for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
+ if (z) z = bigsq(z);
+ if (yy & mask) {
+ z = z ? bigtrunc(bigmul0(z, x)) : x;
+ }
}
- z = rb_big_mul(z, x);
+ return bignorm(z);
}
- return z;
}
- d = (double)yy;
- break;
-
- default:
- return rb_num_coerce_bin(x, y);
}
- return rb_float_new(pow(rb_big2dbl(x), d));
+ else {
+ return rb_num_coerce_bin(x, y, rb_intern("**"));
+ }
+ return DBL2NUM(pow(rb_big2dbl(x), d));
}
-VALUE
-rb_big_and(x, y)
- VALUE x, y;
+static VALUE
+bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
{
VALUE z;
- USHORT *ds1, *ds2, *zds;
- int i, l1, l2;
- char sign;
+ BDIGIT *xds, *zds;
+ long zn;
+ long i;
+ BDIGIT hibitsy;
+
+ if (y == 0) return INT2FIX(0);
+ if (xn == 0) return hibitsx ? LONG2NUM(y) : 0;
+ hibitsy = 0 <= y ? 0 : BDIGMAX;
+ xds = BDIGITS(x);
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ if (!hibitsy) {
+ y &= xds[0];
+ return LONG2NUM(y);
+ }
+#endif
- if (FIXNUM_P(y)) {
- y = rb_int2big(FIX2LONG(y));
+ zn = xn;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ if (hibitsx && zn < bdigit_roomof(SIZEOF_LONG))
+ zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+
+ z = bignew(zn, 0);
+ zds = BDIGITS(z);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ i = 1;
+ zds[0] = xds[0] & BIGLO(y);
+#else
+ for (i=0; i < xn; i++) {
+ if (y == 0 || y == -1) break;
+ zds[i] = xds[i] & BIGLO(y);
+ y = BIGDN(y);
}
- else {
- Check_Type(y, T_BIGNUM);
+ for (; i < zn; i++) {
+ if (y == 0 || y == -1) break;
+ zds[i] = hibitsx & BIGLO(y);
+ y = BIGDN(y);
}
-
- if (!RBIGNUM(y)->sign) {
- y = rb_big_clone(y);
- rb_big_2comp(y);
+#endif
+ for (;i < xn; i++) {
+ zds[i] = xds[i] & hibitsy;
}
- if (!RBIGNUM(x)->sign) {
- x = rb_big_clone(x);
- rb_big_2comp(x);
+ for (;i < zn; i++) {
+ zds[i] = hibitsx & hibitsy;
}
- if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
- l1 = RBIGNUM(y)->len;
- l2 = RBIGNUM(x)->len;
- ds1 = BDIGITS(y);
- ds2 = BDIGITS(x);
- sign = RBIGNUM(y)->sign;
+ twocomp2abs_bang(z, hibitsx && hibitsy);
+ RB_GC_GUARD(x);
+ return bignorm(z);
+}
+
+/*
+ * call-seq:
+ * big & numeric -> integer
+ *
+ * Performs bitwise +and+ between _big_ and _numeric_.
+ */
+
+VALUE
+rb_big_and(VALUE x, VALUE y)
+{
+ VALUE z;
+ BDIGIT *ds1, *ds2, *zds;
+ long i, xn, yn, n1, n2;
+ BDIGIT hibitsx, hibitsy;
+ BDIGIT hibits1, hibits2;
+ VALUE tmpv;
+ BDIGIT tmph;
+ long tmpn;
+
+ if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
+ return rb_num_coerce_bit(x, y, '&');
}
- else {
- l1 = RBIGNUM(x)->len;
- l2 = RBIGNUM(y)->len;
- ds1 = BDIGITS(x);
- ds2 = BDIGITS(y);
- sign = RBIGNUM(x)->sign;
+
+ hibitsx = abs2twocomp(&x, &xn);
+ if (FIXNUM_P(y)) {
+ return bigand_int(x, xn, hibitsx, FIX2LONG(y));
}
- z = bignew(l2, RBIGNUM(x)->sign && RBIGNUM(y)->sign);
+ hibitsy = abs2twocomp(&y, &yn);
+ if (xn > yn) {
+ tmpv = x; x = y; y = tmpv;
+ tmpn = xn; xn = yn; yn = tmpn;
+ tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+ }
+ n1 = xn;
+ n2 = yn;
+ ds1 = BDIGITS(x);
+ ds2 = BDIGITS(y);
+ hibits1 = hibitsx;
+ hibits2 = hibitsy;
+
+ if (!hibits1)
+ n2 = n1;
+
+ z = bignew(n2, 0);
zds = BDIGITS(z);
- for (i=0; i<l1; i++) {
+ for (i=0; i<n1; i++) {
zds[i] = ds1[i] & ds2[i];
}
- for (; i<l2; i++) {
- zds[i] = sign?0:ds2[i];
+ for (; i<n2; i++) {
+ zds[i] = hibits1 & ds2[i];
}
- if (!RBIGNUM(z)->sign) rb_big_2comp(z);
+ twocomp2abs_bang(z, hibits1 && hibits2);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
return bignorm(z);
}
-VALUE
-rb_big_or(x, y)
- VALUE x, y;
+static VALUE
+bigor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
{
VALUE z;
- USHORT *ds1, *ds2, *zds;
- unsigned int i, l1, l2;
- char sign;
+ BDIGIT *xds, *zds;
+ long zn;
+ long i;
+ BDIGIT hibitsy;
+
+ if (y == -1) return INT2FIX(-1);
+ if (xn == 0) return hibitsx ? INT2FIX(-1) : LONG2FIX(y);
+ hibitsy = 0 <= y ? 0 : BDIGMAX;
+ xds = BDIGITS(x);
- if (FIXNUM_P(y)) {
- y = rb_int2big(FIX2LONG(y));
- }
- else {
- Check_Type(y, T_BIGNUM);
- }
+ zn = BIGNUM_LEN(x);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ if (zn < bdigit_roomof(SIZEOF_LONG))
+ zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+ z = bignew(zn, 0);
+ zds = BDIGITS(z);
- if (!RBIGNUM(y)->sign) {
- y = rb_big_clone(y);
- rb_big_2comp(y);
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ i = 1;
+ zds[0] = xds[0] | BIGLO(y);
+ if (i < zn)
+ goto y_is_fixed_point;
+ goto finish;
+#else
+ for (i=0; i < xn; i++) {
+ if (y == 0 || y == -1) goto y_is_fixed_point;
+ zds[i] = xds[i] | BIGLO(y);
+ y = BIGDN(y);
}
- if (!RBIGNUM(x)->sign) {
- x = rb_big_clone(x);
- rb_big_2comp(x);
+ if (hibitsx)
+ goto fill_hibits;
+ for (; i < zn; i++) {
+ if (y == 0 || y == -1) goto y_is_fixed_point;
+ zds[i] = BIGLO(y);
+ y = BIGDN(y);
}
- if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
- l1 = RBIGNUM(y)->len;
- l2 = RBIGNUM(x)->len;
- ds1 = BDIGITS(y);
- ds2 = BDIGITS(x);
- sign = RBIGNUM(y)->sign;
+ goto finish;
+#endif
+
+ y_is_fixed_point:
+ if (hibitsy)
+ goto fill_hibits;
+ for (; i < xn; i++) {
+ zds[i] = xds[i];
}
- else {
- l1 = RBIGNUM(x)->len;
- l2 = RBIGNUM(y)->len;
- ds1 = BDIGITS(x);
- ds2 = BDIGITS(y);
- sign = RBIGNUM(x)->sign;
+ if (hibitsx)
+ goto fill_hibits;
+ for (; i < zn; i++) {
+ zds[i] = 0;
}
- z = bignew(l2, RBIGNUM(x)->sign || RBIGNUM(y)->sign);
- zds = BDIGITS(z);
+ goto finish;
- for (i=0; i<l1; i++) {
- zds[i] = ds1[i] | ds2[i];
+ fill_hibits:
+ for (; i < zn; i++) {
+ zds[i] = BDIGMAX;
}
- for (; i<l2; i++) {
- zds[i] = sign?ds2[i]:(BIGRAD-1);
- }
- if (!RBIGNUM(z)->sign) rb_big_2comp(z);
+ finish:
+ twocomp2abs_bang(z, hibitsx || hibitsy);
+ RB_GC_GUARD(x);
return bignorm(z);
}
+/*
+ * call-seq:
+ * big | numeric -> integer
+ *
+ * Performs bitwise +or+ between _big_ and _numeric_.
+ */
+
VALUE
-rb_big_xor(x, y)
- VALUE x, y;
+rb_big_or(VALUE x, VALUE y)
{
VALUE z;
- USHORT *ds1, *ds2, *zds;
- unsigned int i, l1, l2;
- char sign;
+ BDIGIT *ds1, *ds2, *zds;
+ long i, xn, yn, n1, n2;
+ BDIGIT hibitsx, hibitsy;
+ BDIGIT hibits1, hibits2;
+ VALUE tmpv;
+ BDIGIT tmph;
+ long tmpn;
+
+ if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
+ return rb_num_coerce_bit(x, y, '|');
+ }
+ hibitsx = abs2twocomp(&x, &xn);
if (FIXNUM_P(y)) {
- y = rb_int2big(FIX2LONG(y));
+ return bigor_int(x, xn, hibitsx, FIX2LONG(y));
}
- else {
- Check_Type(y, T_BIGNUM);
+ hibitsy = abs2twocomp(&y, &yn);
+ if (xn > yn) {
+ tmpv = x; x = y; y = tmpv;
+ tmpn = xn; xn = yn; yn = tmpn;
+ tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
}
+ n1 = xn;
+ n2 = yn;
+ ds1 = BDIGITS(x);
+ ds2 = BDIGITS(y);
+ hibits1 = hibitsx;
+ hibits2 = hibitsy;
- if (!RBIGNUM(y)->sign) {
- y = rb_big_clone(y);
- rb_big_2comp(y);
- }
- if (!RBIGNUM(x)->sign) {
- x = rb_big_clone(x);
- rb_big_2comp(x);
- }
- if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
- l1 = RBIGNUM(y)->len;
- l2 = RBIGNUM(x)->len;
- ds1 = BDIGITS(y);
- ds2 = BDIGITS(x);
- sign = RBIGNUM(y)->sign;
- }
- else {
- l1 = RBIGNUM(x)->len;
- l2 = RBIGNUM(y)->len;
- ds1 = BDIGITS(x);
- ds2 = BDIGITS(y);
- sign = RBIGNUM(x)->sign;
- }
- RBIGNUM(x)->sign = RBIGNUM(x)->sign?1:0;
- RBIGNUM(y)->sign = RBIGNUM(y)->sign?1:0;
- z = bignew(l2, !(RBIGNUM(x)->sign ^ RBIGNUM(y)->sign));
+ if (hibits1)
+ n2 = n1;
+
+ z = bignew(n2, 0);
zds = BDIGITS(z);
- for (i=0; i<l1; i++) {
- zds[i] = ds1[i] ^ ds2[i];
+ for (i=0; i<n1; i++) {
+ zds[i] = ds1[i] | ds2[i];
}
- for (; i<l2; i++) {
- zds[i] = sign?ds2[i]:~ds2[i];
+ for (; i<n2; i++) {
+ zds[i] = hibits1 | ds2[i];
}
- if (!RBIGNUM(z)->sign) rb_big_2comp(z);
-
+ twocomp2abs_bang(z, hibits1 || hibits2);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
return bignorm(z);
}
-static VALUE rb_big_rshift _((VALUE,VALUE));
-
-VALUE
-rb_big_lshift(x, y)
- VALUE x, y;
+static VALUE
+bigxor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
{
- USHORT *xds, *zds;
- int shift = NUM2INT(y);
- int s1 = shift/BITSPERDIG;
- int s2 = shift%BITSPERDIG;
VALUE z;
- unsigned long num = 0;
- int len, i;
+ BDIGIT *xds, *zds;
+ long zn;
+ long i;
+ BDIGIT hibitsy;
- if (shift < 0) return rb_big_rshift(x, INT2FIX(-shift));
+ hibitsy = 0 <= y ? 0 : BDIGMAX;
xds = BDIGITS(x);
- len = RBIGNUM(x)->len;
- z = bignew(len+s1+1, RBIGNUM(x)->sign);
+ zn = BIGNUM_LEN(x);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+ if (zn < bdigit_roomof(SIZEOF_LONG))
+ zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+ z = bignew(zn, 0);
zds = BDIGITS(z);
- for (i=0; i<s1; i++) {
- *zds++ = 0;
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+ i = 1;
+ zds[0] = xds[0] ^ BIGLO(y);
+#else
+ for (i = 0; i < xn; i++) {
+ zds[i] = xds[i] ^ BIGLO(y);
+ y = BIGDN(y);
}
- for (i=0; i<len; i++) {
- num = num | *xds++<<s2;
- *zds++ = BIGLO(num);
- num = BIGDN(num);
+ for (; i < zn; i++) {
+ zds[i] = hibitsx ^ BIGLO(y);
+ y = BIGDN(y);
}
- *zds = BIGLO(num);
+#endif
+ for (; i < xn; i++) {
+ zds[i] = xds[i] ^ hibitsy;
+ }
+ for (; i < zn; i++) {
+ zds[i] = hibitsx ^ hibitsy;
+ }
+ twocomp2abs_bang(z, (hibitsx ^ hibitsy) != 0);
+ RB_GC_GUARD(x);
return bignorm(z);
}
+/*
+ * call-seq:
+ * big ^ numeric -> integer
+ *
+ * Performs bitwise +exclusive or+ between _big_ and _numeric_.
+ */
-static VALUE
-rb_big_rshift(x, y)
- VALUE x, y;
+VALUE
+rb_big_xor(VALUE x, VALUE y)
{
- USHORT *xds, *zds;
- int shift = NUM2INT(y);
- int s1 = shift/BITSPERDIG;
- int s2 = shift%BITSPERDIG;
VALUE z;
- unsigned long num = 0;
- int i = RBIGNUM(x)->len;
- int j;
+ BDIGIT *ds1, *ds2, *zds;
+ long i, xn, yn, n1, n2;
+ BDIGIT hibitsx, hibitsy;
+ BDIGIT hibits1, hibits2;
+ VALUE tmpv;
+ BDIGIT tmph;
+ long tmpn;
+
+ if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
+ return rb_num_coerce_bit(x, y, '^');
+ }
- if (shift < 0) return rb_big_lshift(x, INT2FIX(-shift));
- if (s1 > RBIGNUM(x)->len) {
- if (RBIGNUM(x)->sign)
- return INT2FIX(0);
- else
- return INT2FIX(-1);
+ hibitsx = abs2twocomp(&x, &xn);
+ if (FIXNUM_P(y)) {
+ return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
}
- xds = BDIGITS(x);
- i = RBIGNUM(x)->len; j = i - s1;
- z = bignew(j, RBIGNUM(x)->sign);
+ hibitsy = abs2twocomp(&y, &yn);
+ if (xn > yn) {
+ tmpv = x; x = y; y = tmpv;
+ tmpn = xn; xn = yn; yn = tmpn;
+ tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+ }
+ n1 = xn;
+ n2 = yn;
+ ds1 = BDIGITS(x);
+ ds2 = BDIGITS(y);
+ hibits1 = hibitsx;
+ hibits2 = hibitsy;
+
+ z = bignew(n2, 0);
zds = BDIGITS(z);
- while (i--, j--) {
- num = (num | xds[i]) >> s2;
- zds[j] = BIGLO(num);
- num = BIGUP(xds[i]);
+
+ for (i=0; i<n1; i++) {
+ zds[i] = ds1[i] ^ ds2[i];
}
+ for (; i<n2; i++) {
+ zds[i] = hibitsx ^ ds2[i];
+ }
+ twocomp2abs_bang(z, (hibits1 ^ hibits2) != 0);
+ RB_GC_GUARD(x);
+ RB_GC_GUARD(y);
return bignorm(z);
}
-static VALUE
-rb_big_aref(x, y)
- VALUE x, y;
+/*
+ * call-seq:
+ * big << numeric -> integer
+ *
+ * Shifts big left _numeric_ positions (right if _numeric_ is negative).
+ */
+
+VALUE
+rb_big_lshift(VALUE x, VALUE y)
{
- USHORT *xds;
- int shift = NUM2INT(y);
- int s1, s2;
+ int lshift_p;
+ size_t shift_numdigits;
+ int shift_numbits;
+
+ for (;;) {
+ if (FIXNUM_P(y)) {
+ long l = FIX2LONG(y);
+ unsigned long shift;
+ if (0 <= l) {
+ lshift_p = 1;
+ shift = l;
+ }
+ else {
+ lshift_p = 0;
+ shift = 1+(unsigned long)(-(l+1));
+ }
+ shift_numbits = (int)(shift & (BITSPERDIG-1));
+ shift_numdigits = shift >> bit_length(BITSPERDIG-1);
+ return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ return bignorm(big_shift2(x, 1, y));
+ }
+ y = rb_to_int(y);
+ }
+}
- if (shift < 0) return INT2FIX(0);
- s1 = shift/BITSPERDIG;
- s2 = shift%BITSPERDIG;
- if (!RBIGNUM(x)->sign) {
- if (s1 >= RBIGNUM(x)->len) return INT2FIX(1);
- x = rb_big_clone(x);
- rb_big_2comp(x);
+/*
+ * call-seq:
+ * big >> numeric -> integer
+ *
+ * Shifts big right _numeric_ positions (left if _numeric_ is negative).
+ */
+
+VALUE
+rb_big_rshift(VALUE x, VALUE y)
+{
+ int lshift_p;
+ size_t shift_numdigits;
+ int shift_numbits;
+
+ for (;;) {
+ if (FIXNUM_P(y)) {
+ long l = FIX2LONG(y);
+ unsigned long shift;
+ if (0 <= l) {
+ lshift_p = 0;
+ shift = l;
+ }
+ else {
+ lshift_p = 1;
+ shift = 1+(unsigned long)(-(l+1));
+ }
+ shift_numbits = (int)(shift & (BITSPERDIG-1));
+ shift_numdigits = shift >> bit_length(BITSPERDIG-1);
+ return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
+ }
+ else if (RB_BIGNUM_TYPE_P(y)) {
+ return bignorm(big_shift2(x, 0, y));
+ }
+ y = rb_to_int(y);
+ }
+}
+
+/*
+ * call-seq:
+ * big[n] -> 0, 1
+ *
+ * Bit Reference---Returns the <em>n</em>th bit in the (assumed) binary
+ * representation of <i>big</i>, where <i>big</i>[0] is the least
+ * significant bit.
+ *
+ * a = 9**15
+ * 50.downto(0) do |n|
+ * print a[n]
+ * end
+ *
+ * <em>produces:</em>
+ *
+ * 000101110110100000111000011110010100111100010111001
+ *
+ */
+
+static VALUE
+rb_big_aref(VALUE x, VALUE y)
+{
+ BDIGIT *xds;
+ size_t shift;
+ size_t i, s1, s2;
+ long l;
+ BDIGIT bit;
+
+ if (RB_BIGNUM_TYPE_P(y)) {
+ if (!BIGNUM_SIGN(y))
+ return INT2FIX(0);
+ bigtrunc(y);
+ if (BIGSIZE(y) > sizeof(size_t)) {
+ out_of_range:
+ return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
+ }
+#if SIZEOF_SIZE_T <= SIZEOF_LONG
+ shift = big2ulong(y, "long");
+#else
+ shift = big2ull(y, "long long");
+#endif
}
else {
- if (s1 >= RBIGNUM(x)->len) return INT2FIX(0);
+ l = NUM2LONG(y);
+ if (l < 0) return INT2FIX(0);
+ shift = (size_t)l;
}
+ s1 = shift/BITSPERDIG;
+ s2 = shift%BITSPERDIG;
+ bit = (BDIGIT)1 << s2;
+
+ if (s1 >= BIGNUM_LEN(x)) goto out_of_range;
+
xds = BDIGITS(x);
- if (xds[s1] & (1<<s2))
- return INT2FIX(1);
- return INT2FIX(0);
+ if (BIGNUM_POSITIVE_P(x))
+ return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
+ if (xds[s1] & (bit-1))
+ return (xds[s1] & bit) ? INT2FIX(0) : INT2FIX(1);
+ for (i = 0; i < s1; i++)
+ if (xds[i])
+ return (xds[s1] & bit) ? INT2FIX(0) : INT2FIX(1);
+ return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
}
+/*
+ * call-seq:
+ * big.hash -> fixnum
+ *
+ * Compute a hash based on the value of _big_.
+ *
+ * See also Object#hash.
+ */
+
static VALUE
-rb_big_hash(x)
- VALUE x;
+rb_big_hash(VALUE x)
{
- int i, len;
- int key;
- USHORT *digits;
+ st_index_t hash;
- key = 0; digits = BDIGITS(x);
- for (i=0,len=RBIGNUM(x)->len; i<RBIGNUM(x)->len; i++) {
- key ^= *digits++;
- }
- return INT2FIX(key);
+ hash = rb_memhash(BDIGITS(x), sizeof(BDIGIT)*BIGNUM_LEN(x)) ^ BIGNUM_SIGN(x);
+ return INT2FIX(hash);
}
+/*
+ * call-seq:
+ * big.coerce(numeric) -> array
+ *
+ * Returns an array with both a +numeric+ and a +big+ represented as Bignum
+ * objects.
+ *
+ * This is achieved by converting +numeric+ to a Bignum.
+ *
+ * A TypeError is raised if the +numeric+ is not a Fixnum or Bignum type.
+ *
+ * (0x3FFFFFFFFFFFFFFF+1).coerce(42) #=> [42, 4611686018427387904]
+ */
+
static VALUE
-rb_big_coerce(x, y)
- VALUE x, y;
+rb_big_coerce(VALUE x, VALUE y)
{
if (FIXNUM_P(y)) {
- return rb_assoc_new(rb_int2big(FIX2LONG(y)), x);
+ y = rb_int2big(FIX2LONG(y));
}
- else {
+ else if (!RB_BIGNUM_TYPE_P(y)) {
rb_raise(rb_eTypeError, "can't coerce %s to Bignum",
- rb_class2name(CLASS_OF(y)));
+ rb_obj_classname(y));
}
- /* not reached */
- return Qnil;
+ return rb_assoc_new(y, x);
}
+/*
+ * call-seq:
+ * big.abs -> aBignum
+ * big.magnitude -> aBignum
+ *
+ * Returns the absolute value of <i>big</i>.
+ *
+ * -1234567890987654321.abs #=> 1234567890987654321
+ */
+
static VALUE
-rb_big_abs(x)
- VALUE x;
+rb_big_abs(VALUE x)
{
- if (!RBIGNUM(x)->sign) {
+ if (!BIGNUM_SIGN(x)) {
x = rb_big_clone(x);
- RBIGNUM(x)->sign = 1;
+ BIGNUM_SET_SIGN(x, 1);
}
return x;
}
-/* !!!warnig!!!!
- this is not really a random number!!
-*/
+/*
+ * call-seq:
+ * big.size -> integer
+ *
+ * Returns the number of bytes in the machine representation of
+ * <i>big</i>.
+ *
+ * (256**10 - 1).size #=> 12
+ * (256**20 - 1).size #=> 20
+ * (256**40 - 1).size #=> 40
+ */
-VALUE
-rb_big_rand(max)
- VALUE max;
+static VALUE
+rb_big_size(VALUE big)
{
- struct RBignum *v;
- int len;
+ return SIZET2NUM(BIGSIZE(big));
+}
- len = RBIGNUM(max)->len;
- v = RBIGNUM(bignew(len,1));
- while (len--) {
-#ifdef HAVE_RANDOM
- BDIGITS(v)[len] = random();
-#else
- BDIGITS(v)[len] = rand();
-#endif
+/*
+ * call-seq:
+ * int.bit_length -> integer
+ *
+ * Returns the number of bits of the value of <i>int</i>.
+ *
+ * "the number of bits" means that
+ * the bit position of the highest bit which is different to the sign bit.
+ * (The bit position of the bit 2**n is n+1.)
+ * If there is no such bit (zero or minus one), zero is returned.
+ *
+ * I.e. This method returns ceil(log2(int < 0 ? -int : int+1)).
+ *
+ * (-2**10000-1).bit_length #=> 10001
+ * (-2**10000).bit_length #=> 10000
+ * (-2**10000+1).bit_length #=> 10000
+ *
+ * (-2**1000-1).bit_length #=> 1001
+ * (-2**1000).bit_length #=> 1000
+ * (-2**1000+1).bit_length #=> 1000
+ *
+ * (2**1000-1).bit_length #=> 1000
+ * (2**1000).bit_length #=> 1001
+ * (2**1000+1).bit_length #=> 1001
+ *
+ * (2**10000-1).bit_length #=> 10000
+ * (2**10000).bit_length #=> 10001
+ * (2**10000+1).bit_length #=> 10001
+ *
+ * This method can be used to detect overflow in Array#pack as follows.
+ *
+ * if n.bit_length < 32
+ * [n].pack("l") # no overflow
+ * else
+ * raise "overflow"
+ * end
+ */
+
+static VALUE
+rb_big_bit_length(VALUE big)
+{
+ int nlz_bits;
+ size_t numbytes;
+
+ static const BDIGIT char_bit[1] = { CHAR_BIT };
+ BDIGIT numbytes_bary[bdigit_roomof(sizeof(size_t))];
+ BDIGIT nlz_bary[1];
+ BDIGIT result_bary[bdigit_roomof(sizeof(size_t)+1)];
+
+ numbytes = rb_absint_size(big, &nlz_bits);
+
+ if (numbytes == 0)
+ return LONG2FIX(0);
+
+ if (BIGNUM_NEGATIVE_P(big) && rb_absint_singlebit_p(big)) {
+ if (nlz_bits != CHAR_BIT-1) {
+ nlz_bits++;
+ }
+ else {
+ nlz_bits = 0;
+ numbytes--;
+ }
+ }
+
+ if (numbytes <= SIZE_MAX / CHAR_BIT) {
+ return SIZET2NUM(numbytes * CHAR_BIT - nlz_bits);
}
- return rb_big_mod((VALUE)v, max);
+ nlz_bary[0] = nlz_bits;
+
+ bary_unpack(BARY_ARGS(numbytes_bary), &numbytes, 1, sizeof(numbytes), 0,
+ INTEGER_PACK_NATIVE_BYTE_ORDER);
+ BARY_SHORT_MUL(result_bary, numbytes_bary, char_bit);
+ BARY_SUB(result_bary, result_bary, nlz_bary);
+
+ return rb_integer_unpack(result_bary, numberof(result_bary), sizeof(BDIGIT), 0,
+ INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
}
+/*
+ * call-seq:
+ * big.odd? -> true or false
+ *
+ * Returns <code>true</code> if <i>big</i> is an odd number.
+ */
+
static VALUE
-rb_big_size(big)
- VALUE big;
+rb_big_odd_p(VALUE num)
{
- return INT2FIX(RBIGNUM(big)->len*sizeof(USHORT));
+ if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
+ return Qtrue;
+ }
+ return Qfalse;
}
+/*
+ * call-seq:
+ * big.even? -> true or false
+ *
+ * Returns <code>true</code> if <i>big</i> is an even number.
+ */
+
static VALUE
-rb_big_zero_p(big)
- VALUE big;
+rb_big_even_p(VALUE num)
{
- return Qfalse;
+ if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
+ return Qfalse;
+ }
+ return Qtrue;
}
+/*
+ * Bignum objects hold integers outside the range of
+ * Fixnum. Bignum objects are created
+ * automatically when integer calculations would otherwise overflow a
+ * Fixnum. When a calculation involving
+ * Bignum objects returns a result that will fit in a
+ * Fixnum, the result is automatically converted.
+ *
+ * For the purposes of the bitwise operations and <code>[]</code>, a
+ * Bignum is treated as if it were an infinite-length
+ * bitstring with 2's complement representation.
+ *
+ * While Fixnum values are immediate, Bignum
+ * objects are not---assignment and parameter passing work with
+ * references to objects, not the objects themselves.
+ *
+ */
+
void
-Init_Bignum()
+Init_Bignum(void)
{
rb_cBignum = rb_define_class("Bignum", rb_cInteger);
- rb_undef_method(CLASS_OF(rb_cBignum), "new");
-
- rb_define_method(rb_cBignum, "to_s", rb_big_to_s, 0);
+ rb_define_method(rb_cBignum, "to_s", rb_big_to_s, -1);
+ rb_define_alias(rb_cBignum, "inspect", "to_s");
rb_define_method(rb_cBignum, "coerce", rb_big_coerce, 1);
rb_define_method(rb_cBignum, "-@", rb_big_uminus, 0);
rb_define_method(rb_cBignum, "+", rb_big_plus, 1);
rb_define_method(rb_cBignum, "-", rb_big_minus, 1);
rb_define_method(rb_cBignum, "*", rb_big_mul, 1);
rb_define_method(rb_cBignum, "/", rb_big_div, 1);
- rb_define_method(rb_cBignum, "%", rb_big_mod, 1);
+ rb_define_method(rb_cBignum, "%", rb_big_modulo, 1);
+ rb_define_method(rb_cBignum, "div", rb_big_idiv, 1);
rb_define_method(rb_cBignum, "divmod", rb_big_divmod, 1);
+ rb_define_method(rb_cBignum, "modulo", rb_big_modulo, 1);
rb_define_method(rb_cBignum, "remainder", rb_big_remainder, 1);
+ rb_define_method(rb_cBignum, "fdiv", rb_big_fdiv, 1);
rb_define_method(rb_cBignum, "**", rb_big_pow, 1);
rb_define_method(rb_cBignum, "&", rb_big_and, 1);
rb_define_method(rb_cBignum, "|", rb_big_or, 1);
@@ -1300,12 +7021,25 @@ Init_Bignum()
rb_define_method(rb_cBignum, "<=>", rb_big_cmp, 1);
rb_define_method(rb_cBignum, "==", rb_big_eq, 1);
+ rb_define_method(rb_cBignum, ">", big_gt, 1);
+ rb_define_method(rb_cBignum, ">=", big_ge, 1);
+ rb_define_method(rb_cBignum, "<", big_lt, 1);
+ rb_define_method(rb_cBignum, "<=", big_le, 1);
rb_define_method(rb_cBignum, "===", rb_big_eq, 1);
- rb_define_method(rb_cBignum, "eql?", rb_big_eq, 1);
+ rb_define_method(rb_cBignum, "eql?", rb_big_eql, 1);
rb_define_method(rb_cBignum, "hash", rb_big_hash, 0);
- rb_define_method(rb_cBignum, "to_i", rb_big_to_i, 0);
rb_define_method(rb_cBignum, "to_f", rb_big_to_f, 0);
rb_define_method(rb_cBignum, "abs", rb_big_abs, 0);
+ rb_define_method(rb_cBignum, "magnitude", rb_big_abs, 0);
rb_define_method(rb_cBignum, "size", rb_big_size, 0);
- rb_define_method(rb_cBignum, "zero?", rb_big_zero_p, 0);
+ rb_define_method(rb_cBignum, "bit_length", rb_big_bit_length, 0);
+ rb_define_method(rb_cBignum, "odd?", rb_big_odd_p, 0);
+ rb_define_method(rb_cBignum, "even?", rb_big_even_p, 0);
+
+#ifdef USE_GMP
+ /* The version of loaded GMP. */
+ rb_define_const(rb_cBignum, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
+#endif
+
+ power_cache_init();
}
diff --git a/bin/erb b/bin/erb
new file mode 100755
index 0000000000..6a7ea7d593
--- /dev/null
+++ b/bin/erb
@@ -0,0 +1,155 @@
+#!/usr/bin/env ruby
+# Tiny eRuby --- ERB2
+# Copyright (c) 1999-2000,2002 Masatoshi SEKI
+# You can redistribute it and/or modify it under the same terms as Ruby.
+
+require 'erb'
+
+class ERB
+ module Main
+ def ARGV.switch
+ return nil if self.empty?
+ arg = self.shift
+ return nil if arg == '--'
+ if arg =~ /^-(.)(.*)/
+ if $1 == '-'
+ arg, @maybe_arg = arg.split(/=/, 2)
+ return arg
+ end
+ raise 'unknown switch "-"' if $2[0] == ?- and $1 != 'T'
+ if $2.size > 0
+ self.unshift "-#{$2}"
+ @maybe_arg = $2
+ else
+ @maybe_arg = nil
+ end
+ "-#{$1}"
+ else
+ self.unshift arg
+ nil
+ end
+ end
+
+ def ARGV.req_arg
+ (@maybe_arg || self.shift || raise('missing argument')).tap {
+ @maybe_arg = nil
+ }
+ end
+
+ def trim_mode_opt(trim_mode, disable_percent)
+ return trim_mode if disable_percent
+ case trim_mode
+ when 0
+ return '%'
+ when 1
+ return '%>'
+ when 2
+ return '%<>'
+ when '-'
+ return '%-'
+ end
+ end
+ module_function :trim_mode_opt
+
+ def run(factory=ERB)
+ trim_mode = 0
+ disable_percent = false
+ begin
+ while switch = ARGV.switch
+ case switch
+ when '-x' # ruby source
+ output = true
+ when '-n' # line number
+ number = true
+ when '-v' # verbose
+ $VERBOSE = true
+ when '--version' # version
+ STDERR.puts factory.version
+ exit
+ when '-d', '--debug' # debug
+ $DEBUG = true
+ when '-r' # require
+ require ARGV.req_arg
+ when '-S' # security level
+ arg = ARGV.req_arg
+ raise "invalid safe_level #{arg.dump}" unless arg =~ /^[0-3]$/
+ safe_level = arg.to_i
+ when '-T' # trim mode
+ arg = ARGV.req_arg
+ if arg == '-'
+ trim_mode = arg
+ next
+ end
+ raise "invalid trim mode #{arg.dump}" unless arg =~ /^[0-2]$/
+ trim_mode = arg.to_i
+ when '-E', '--encoding'
+ arg = ARGV.req_arg
+ set_encoding(*arg.split(/:/, 2))
+ when '-U'
+ set_encoding(Encoding::UTF_8, Encoding::UTF_8)
+ when '-P'
+ disable_percent = true
+ when '--help'
+ raise "print this help"
+ else
+ raise "unknown switch #{switch.dump}"
+ end
+ end
+ rescue # usage
+ STDERR.puts $!.to_s
+ STDERR.puts File.basename($0) +
+ " [switches] [inputfile]"
+ STDERR.puts <<EOU
+ -x print ruby script
+ -n print ruby script with line number
+ -v enable verbose mode
+ -d set $DEBUG to true
+ -r library load a library
+ -S safe_level set $SAFE (0..3)
+ -E ex[:in] set default external/internal encodings
+ -U set default encoding to UTF-8.
+ -T trim_mode specify trim_mode (0..2, -)
+ -P ignore lines which start with "%"
+EOU
+ exit 1
+ end
+
+ $<.set_encoding(Encoding::ASCII_8BIT, nil)
+ src = $<.read
+ filename = $FILENAME
+ exit 2 unless src
+ trim = trim_mode_opt(trim_mode, disable_percent)
+ erb = factory.new(src.untaint, safe_level, trim)
+ erb.filename = filename
+ if output
+ if number
+ erb.src.each_line.with_index do |line, l|
+ puts "%3d %s"%[l+1, line]
+ end
+ else
+ puts erb.src
+ end
+ else
+ erb.run(TOPLEVEL_BINDING.taint)
+ end
+ end
+ module_function :run
+
+ def set_encoding(extern, intern = nil)
+ verbose, $VERBOSE = $VERBOSE, nil
+ Encoding.default_external = extern unless extern.nil? || extern.empty?
+ Encoding.default_internal = intern unless intern.nil? || intern.empty?
+ [$stdin, $stdout, $stderr].each do |io|
+ io.set_encoding(extern, intern)
+ end
+ ensure
+ $VERBOSE = verbose
+ end
+ module_function :set_encoding
+ class << self; private :set_encoding; end
+ end
+end
+
+if __FILE__ == $0
+ ERB::Main.run
+end
diff --git a/bin/gem b/bin/gem
new file mode 100755
index 0000000000..a4ec754abb
--- /dev/null
+++ b/bin/gem
@@ -0,0 +1,25 @@
+#!/usr/bin/env ruby
+#--
+# Copyright 2006 by Chad Fowler, Rich Kilmer, Jim Weirich and others.
+# All rights reserved.
+# See LICENSE.txt for permissions.
+#++
+
+require 'rubygems'
+require 'rubygems/gem_runner'
+require 'rubygems/exceptions'
+
+required_version = Gem::Requirement.new ">= 1.8.7"
+
+unless required_version.satisfied_by? Gem.ruby_version then
+ abort "Expected Ruby Version #{required_version}, is #{Gem.ruby_version}"
+end
+
+args = ARGV.clone
+
+begin
+ Gem::GemRunner.new.run args
+rescue Gem::SystemExitException => e
+ exit e.exit_code
+end
+
diff --git a/bin/irb b/bin/irb
new file mode 100755
index 0000000000..c64ee85fbd
--- /dev/null
+++ b/bin/irb
@@ -0,0 +1,11 @@
+#!/usr/bin/env ruby
+#
+# irb.rb - interactive ruby
+# $Release Version: 0.9.6 $
+# $Revision$
+# by Keiju ISHITSUKA(keiju@ruby-lang.org)
+#
+
+require "irb"
+
+IRB.start(__FILE__)
diff --git a/bin/rake b/bin/rake
new file mode 100755
index 0000000000..4e0bbb7b7a
--- /dev/null
+++ b/bin/rake
@@ -0,0 +1,33 @@
+#!/usr/bin/env ruby
+
+#--
+# Copyright (c) 2003, 2004, 2005, 2006, 2007 Jim Weirich
+#
+# Permission is hereby granted, free of charge, to any person obtaining a copy
+# of this software and associated documentation files (the "Software"), to
+# deal in the Software without restriction, including without limitation the
+# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
+# sell copies of the Software, and to permit persons to whom the Software is
+# furnished to do so, subject to the following conditions:
+#
+# The above copyright notice and this permission notice shall be included in
+# all copies or substantial portions of the Software.
+#
+# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+# FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS
+# IN THE SOFTWARE.
+#++
+
+begin
+ require 'rubygems'
+ gem 'rake'
+rescue LoadError
+end
+
+require 'rake'
+
+Rake.application.run
diff --git a/bin/rdoc b/bin/rdoc
new file mode 100755
index 0000000000..aaa23292df
--- /dev/null
+++ b/bin/rdoc
@@ -0,0 +1,44 @@
+#!/usr/bin/env ruby
+#
+# RDoc: Documentation tool for source code
+# (see lib/rdoc/rdoc.rb for more information)
+#
+# Copyright (c) 2003 Dave Thomas
+# Released under the same terms as Ruby
+
+begin
+ gem 'rdoc'
+rescue NameError => e # --disable-gems
+ raise unless e.name == :gem
+rescue Gem::LoadError
+end
+
+require 'rdoc/rdoc'
+
+begin
+ r = RDoc::RDoc.new
+ r.document ARGV
+rescue Errno::ENOSPC
+ $stderr.puts 'Ran out of space creating documentation'
+ $stderr.puts
+ $stderr.puts 'Please free up some space and try again'
+rescue SystemExit
+ raise
+rescue Exception => e
+ if $DEBUG_RDOC then
+ $stderr.puts e.message
+ $stderr.puts "#{e.backtrace.join "\n\t"}"
+ $stderr.puts
+ elsif Interrupt === e then
+ $stderr.puts
+ $stderr.puts 'Interrupted'
+ else
+ $stderr.puts "uh-oh! RDoc had a problem:"
+ $stderr.puts e.message
+ $stderr.puts
+ $stderr.puts "run with --debug for full backtrace"
+ end
+
+ exit 1
+end
+
diff --git a/bin/ri b/bin/ri
new file mode 100755
index 0000000000..7fbed0c099
--- /dev/null
+++ b/bin/ri
@@ -0,0 +1,12 @@
+#!/usr/bin/env ruby
+
+begin
+ gem 'rdoc'
+rescue NameError => e # --disable-gems
+ raise unless e.name == :gem
+rescue Gem::LoadError
+end
+
+require 'rdoc/ri/driver'
+
+RDoc::RI::Driver.run ARGV
diff --git a/bootstraptest/pending.rb b/bootstraptest/pending.rb
new file mode 100644
index 0000000000..744c0adac1
--- /dev/null
+++ b/bootstraptest/pending.rb
@@ -0,0 +1,39 @@
+assert_equal 'A', %q{
+ class A
+ @@a = 'A'
+ def a=(x)
+ @@a = x
+ end
+ def a
+ @@a
+ end
+ end
+
+ B = A.dup
+ B.new.a = 'B'
+ A.new.a
+}, '[ruby-core:17019]'
+
+assert_equal 'ok', %q{
+ def m
+ lambda{
+ proc{
+ return :ng1
+ }
+ }.call.call
+ :ng2
+ end
+
+ begin
+ m()
+ rescue LocalJumpError
+ :ok
+ end
+}
+
+assert_normal_exit %q{
+ r = Range.allocate
+ def r.<=>(o) true end
+ r.instance_eval { initialize r, r }
+ r.inspect
+}
diff --git a/bootstraptest/runner.rb b/bootstraptest/runner.rb
new file mode 100755
index 0000000000..d58b824386
--- /dev/null
+++ b/bootstraptest/runner.rb
@@ -0,0 +1,505 @@
+"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- mode: ruby; coding: utf-8 -*-
+#!./ruby
+# $Id$
+
+# NOTE:
+# Never use optparse in this file.
+# Never use test/unit in this file.
+# Never use Ruby extensions in this file.
+
+begin
+ require 'fileutils'
+ require 'tmpdir'
+rescue LoadError
+ $:.unshift File.join(File.dirname(__FILE__), '../lib')
+ retry
+end
+
+if !Dir.respond_to?(:mktmpdir)
+ # copied from lib/tmpdir.rb
+ def Dir.mktmpdir(prefix_suffix=nil, tmpdir=nil)
+ case prefix_suffix
+ when nil
+ prefix = "d"
+ suffix = ""
+ when String
+ prefix = prefix_suffix
+ suffix = ""
+ when Array
+ prefix = prefix_suffix[0]
+ suffix = prefix_suffix[1]
+ else
+ raise ArgumentError, "unexpected prefix_suffix: #{prefix_suffix.inspect}"
+ end
+ tmpdir ||= Dir.tmpdir
+ t = Time.now.strftime("%Y%m%d")
+ n = nil
+ begin
+ path = "#{tmpdir}/#{prefix}#{t}-#{$$}-#{rand(0x100000000).to_s(36)}"
+ path << "-#{n}" if n
+ path << suffix
+ Dir.mkdir(path, 0700)
+ rescue Errno::EEXIST
+ n ||= 0
+ n += 1
+ retry
+ end
+
+ if block_given?
+ begin
+ yield path
+ ensure
+ FileUtils.remove_entry_secure path
+ end
+ else
+ path
+ end
+ end
+end
+
+def main
+ @ruby = File.expand_path('miniruby')
+ @verbose = false
+ $stress = false
+ @color = nil
+ @tty = nil
+ @quiet = false
+ dir = nil
+ quiet = false
+ tests = nil
+ ARGV.delete_if {|arg|
+ case arg
+ when /\A--ruby=(.*)/
+ @ruby = $1
+ @ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
+ @ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
+ @ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+ true
+ when /\A--sets=(.*)/
+ tests = Dir.glob("#{File.dirname($0)}/test_{#{$1}}*.rb").sort
+ puts tests.map {|path| File.basename(path) }.inspect
+ true
+ when /\A--dir=(.*)/
+ dir = $1
+ true
+ when /\A(--stress|-s)/
+ $stress = true
+ when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+ warn "unknown --color argument: #$3" if $3
+ @color = $1 ? nil : !$2
+ true
+ when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+ warn "unknown --tty argument: #$3" if $3
+ @tty = !$1 || !$2
+ true
+ when /\A(-q|--q(uiet))\z/
+ quiet = true
+ @quiet = true
+ true
+ when /\A(-v|--v(erbose))\z/
+ @verbose = true
+ when /\A(-h|--h(elp)?)\z/
+ puts(<<-End)
+Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
+ --sets=NAME,NAME,... Name of test sets.
+ --dir=DIRECTORY Working directory.
+ default: /tmp/bootstraptestXXXXX.tmpwd
+ --color[=WHEN] Colorize the output. WHEN defaults to 'always'
+ or can be 'never' or 'auto'.
+ -s, --stress stress test.
+ -v, --verbose Output test name before exec.
+ -q, --quiet Don\'t print header message.
+ -h, --help Print this message and quit.
+End
+ exit true
+ when /\A-j/
+ true
+ else
+ false
+ end
+ }
+ if tests and not ARGV.empty?
+ $stderr.puts "--tests and arguments are exclusive"
+ exit false
+ end
+ tests ||= ARGV
+ tests = Dir.glob("#{File.dirname($0)}/test_*.rb").sort if tests.empty?
+ pathes = tests.map {|path| File.expand_path(path) }
+
+ @progress = %w[- \\ | /]
+ @progress_bs = "\b" * @progress[0].size
+ @tty = $stderr.tty? if @tty.nil?
+ case @color
+ when nil
+ @color = @tty && /dumb/ !~ ENV["TERM"]
+ end
+ @tty &&= !@verbose
+ if @color
+ # dircolors-like style
+ colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:]*)/)] : {}
+ @passed = "\e[#{colors["pass"] || "32"}m"
+ @failed = "\e[#{colors["fail"] || "31"}m"
+ @reset = "\e[m"
+ else
+ @passed = @failed = @reset = ""
+ end
+ unless quiet
+ puts Time.now
+ if defined?(RUBY_DESCRIPTION)
+ puts "Driver is #{RUBY_DESCRIPTION}"
+ elsif defined?(RUBY_PATCHLEVEL)
+ puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}#{RUBY_PLATFORM}) [#{RUBY_PLATFORM}]"
+ else
+ puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}) [#{RUBY_PLATFORM}]"
+ end
+ puts "Target is #{`#{@ruby} -v`.chomp}"
+ puts
+ $stdout.flush
+ end
+
+ in_temporary_working_directory(dir) {
+ exec_test pathes
+ }
+end
+
+def erase(e = true)
+ if e and @columns > 0 and !@verbose
+ "\r#{" "*@columns}\r"
+ else
+ ""
+ end
+end
+
+def exec_test(pathes)
+ @count = 0
+ @error = 0
+ @errbuf = []
+ @location = nil
+ @columns = 0
+ @width = pathes.map {|path| File.basename(path).size}.max + 2
+ pathes.each do |path|
+ @basename = File.basename(path)
+ $stderr.printf("%s%-*s ", erase(@quiet), @width, @basename)
+ $stderr.flush
+ @columns = @width + 1
+ $stderr.puts if @verbose
+ count = @count
+ error = @error
+ load File.expand_path(path)
+ if @tty
+ if @error == error
+ msg = "PASS #{@count-count}"
+ @columns += msg.size - 1
+ $stderr.print "#{@progress_bs}#{@passed}#{msg}#{@reset}"
+ else
+ msg = "FAIL #{@error-error}/#{@count-count}"
+ $stderr.print "#{@progress_bs}#{@failed}#{msg}#{@reset}"
+ @columns = 0
+ end
+ end
+ $stderr.puts unless @quiet and @tty and @error == error
+ end
+ $stderr.print(erase) if @quiet
+ if @error == 0
+ if @count == 0
+ $stderr.puts "No tests, no problem"
+ else
+ $stderr.puts "#{@passed}PASS#{@reset} all #{@count} tests"
+ end
+ exit true
+ else
+ @errbuf.each do |msg|
+ $stderr.puts msg
+ end
+ $stderr.puts "#{@failed}FAIL#{@reset} #{@error}/#{@count} tests failed"
+ exit false
+ end
+end
+
+def show_progress(message = '')
+ if @verbose
+ $stderr.print "\##{@count} #{@location} "
+ elsif @tty
+ $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
+ end
+ t = Time.now if @verbose
+ faildesc, errout = with_stderr {yield}
+ t = Time.now - t if @verbose
+ if !faildesc
+ if @tty
+ $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
+ elsif @verbose
+ $stderr.printf(". %.3f\n", t)
+ else
+ $stderr.print '.'
+ end
+ else
+ $stderr.print "#{@failed}F"
+ $stderr.printf(" %.3f", t) if @verbose
+ $stderr.print "#{@reset}"
+ $stderr.puts if @verbose
+ error faildesc, message
+ unless errout.empty?
+ $stderr.print "#{@failed}stderr output is not empty#{@reset}\n", adjust_indent(errout)
+ end
+ if @tty and !@verbose
+ $stderr.printf("%-*s%s", @width, @basename, @progress[@count % @progress.size])
+ end
+ end
+rescue Interrupt
+ raise Interrupt
+rescue Exception => err
+ $stderr.print 'E'
+ $stderr.puts if @verbose
+ error err.message, message
+end
+
+# NativeClient is special. The binary is cross-compiled. But runs on the build environment.
+# So RUBY_PLATFORM in this process is not useful to detect it.
+def nacl?
+ @ruby and File.basename(@ruby.split(/\s/).first)['sel_ldr']
+end
+
+def assert_check(testsrc, message = '', opt = '')
+ show_progress(message) {
+ result = get_result_string(testsrc, opt)
+ check_coredump
+ yield(result)
+ }
+end
+
+def assert_equal(expected, testsrc, message = '')
+ newtest
+ assert_check(testsrc, message) {|result|
+ if expected == result
+ nil
+ else
+ desc = "#{result.inspect} (expected #{expected.inspect})"
+ pretty(testsrc, desc, result)
+ end
+ }
+end
+
+def assert_match(expected_pattern, testsrc, message = '')
+ newtest
+ assert_check(testsrc, message) {|result|
+ if expected_pattern =~ result
+ nil
+ else
+ desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
+ pretty(testsrc, desc, result)
+ end
+ }
+end
+
+def assert_not_match(unexpected_pattern, testsrc, message = '')
+ newtest
+ assert_check(testsrc, message) {|result|
+ if unexpected_pattern !~ result
+ nil
+ else
+ desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
+ pretty(testsrc, desc, result)
+ end
+ }
+end
+
+def assert_valid_syntax(testsrc, message = '')
+ newtest
+ assert_check(testsrc, message, '-c') {|result|
+ result if /Syntax OK/ !~ result
+ }
+end
+
+def assert_normal_exit(testsrc, *rest)
+ newtest
+ opt = {}
+ opt = rest.pop if Hash === rest.last
+ message, ignore_signals = rest
+ message ||= ''
+ timeout = opt[:timeout]
+ show_progress(message) {
+ faildesc = nil
+ filename = make_srcfile(testsrc)
+ old_stderr = $stderr.dup
+ timeout_signaled = false
+ begin
+ $stderr.reopen("assert_normal_exit.log", "w")
+ io = IO.popen("#{@ruby} -W0 #{filename}")
+ pid = io.pid
+ th = Thread.new {
+ io.read
+ io.close
+ $?
+ }
+ if !th.join(timeout)
+ Process.kill :KILL, pid
+ timeout_signaled = true
+ end
+ status = th.value
+ ensure
+ $stderr.reopen(old_stderr)
+ old_stderr.close
+ end
+ if status && status.signaled?
+ signo = status.termsig
+ signame = Signal.list.invert[signo]
+ unless ignore_signals and ignore_signals.include?(signame)
+ sigdesc = "signal #{signo}"
+ if signame
+ sigdesc = "SIG#{signame} (#{sigdesc})"
+ end
+ if timeout_signaled
+ sigdesc << " (timeout)"
+ end
+ faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
+ stderr_log = File.read("assert_normal_exit.log")
+ if !stderr_log.empty?
+ faildesc << "\n" if /\n\z/ !~ faildesc
+ stderr_log << "\n" if /\n\z/ !~ stderr_log
+ stderr_log.gsub!(/^.*\n/) { '| ' + $& }
+ faildesc << stderr_log
+ end
+ end
+ end
+ faildesc
+ }
+end
+
+def assert_finish(timeout_seconds, testsrc, message = '')
+ newtest
+ show_progress(message) {
+ faildesc = nil
+ filename = make_srcfile(testsrc)
+ io = IO.popen("#{@ruby} -W0 #{filename}")
+ pid = io.pid
+ waited = false
+ tlimit = Time.now + timeout_seconds
+ while Time.now < tlimit
+ if Process.waitpid pid, Process::WNOHANG
+ waited = true
+ break
+ end
+ sleep 0.1
+ end
+ if !waited
+ Process.kill(:KILL, pid)
+ Process.waitpid pid
+ faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
+ end
+ io.close
+ faildesc
+ }
+end
+
+def flunk(message = '')
+ newtest
+ show_progress('') { message }
+end
+
+def pretty(src, desc, result)
+ src = src.sub(/\A.*\n/, '')
+ (/\n/ =~ src ? "\n#{adjust_indent(src)}" : src) + " #=> #{desc}"
+end
+
+INDENT = 27
+
+def adjust_indent(src)
+ untabify(src).gsub(/^ {#{INDENT}}/o, '').gsub(/^/, ' ').sub(/\s*\z/, "\n")
+end
+
+def untabify(str)
+ str.gsub(/^\t+/) {' ' * (8 * $&.size) }
+end
+
+def make_srcfile(src)
+ filename = 'bootstraptest.tmp.rb'
+ File.open(filename, 'w') {|f|
+ f.puts "GC.stress = true" if $stress
+ f.puts "print(begin; #{src}; end)"
+ }
+ filename
+end
+
+def get_result_string(src, opt = '')
+ if @ruby
+ filename = make_srcfile(src)
+ begin
+ `#{@ruby} -W0 #{opt} #{filename}`
+ ensure
+ raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
+ raise CoreDumpError, "core dumped" if $? and $?.coredump?
+ end
+ else
+ eval(src).to_s
+ end
+end
+
+def with_stderr
+ out = err = nil
+ begin
+ r, w = IO.pipe
+ stderr = $stderr.dup
+ $stderr.reopen(w)
+ w.close
+ reader = Thread.start {r.read}
+ begin
+ out = yield
+ ensure
+ $stderr.reopen(stderr)
+ err = reader.value
+ end
+ ensure
+ w.close rescue nil
+ r.close rescue nil
+ end
+ return out, err
+end
+
+def newtest
+ @location = File.basename(caller(2).first)
+ @count += 1
+ cleanup_coredump
+end
+
+def error(msg, additional_message)
+ msg = "#{@failed}\##{@count} #{@location}#{@reset}: #{msg} #{additional_message}"
+ if @tty
+ $stderr.puts "#{erase}#{msg}"
+ else
+ @errbuf.push msg
+ end
+ @error += 1
+end
+
+def in_temporary_working_directory(dir)
+ if dir
+ Dir.mkdir dir
+ Dir.chdir(dir) {
+ yield
+ }
+ else
+ Dir.mktmpdir(["bootstraptest", ".tmpwd"]) {|d|
+ Dir.chdir(d) {
+ yield
+ }
+ }
+ end
+end
+
+def cleanup_coredump
+ FileUtils.rm_f 'core'
+ FileUtils.rm_f Dir.glob('core.*')
+ FileUtils.rm_f @ruby+'.stackdump' if @ruby
+end
+
+class CoreDumpError < StandardError; end
+
+def check_coredump
+ if File.file?('core') or not Dir.glob('core.*').empty? or
+ (@ruby and File.exist?(@ruby+'.stackdump'))
+ raise CoreDumpError, "core dumped"
+ end
+end
+
+main
diff --git a/bootstraptest/test_attr.rb b/bootstraptest/test_attr.rb
new file mode 100644
index 0000000000..721a847145
--- /dev/null
+++ b/bootstraptest/test_attr.rb
@@ -0,0 +1,36 @@
+assert_equal 'ok', %q{
+ module M
+ class A
+ class << self
+ attr_accessor :at
+ def workflow_rule
+ yield self
+ end
+
+ def eval_str(str)
+ eval(str)
+ end
+ end
+ end
+ end
+ begin
+ M::A.eval_str(<<-END)
+ workflow_rule do |r|
+ r.at 1
+ end
+ END
+ rescue ArgumentError => e
+ print "ok"
+ end
+}, '[ruby-core:14641]'
+
+assert_equal %{ok}, %{
+ class A
+ attr :m
+ end
+ begin
+ A.new.m(3)
+ rescue ArgumentError => e
+ print "ok"
+ end
+}, '[ruby-core:15120]'
diff --git a/bootstraptest/test_autoload.rb b/bootstraptest/test_autoload.rb
new file mode 100644
index 0000000000..a9f8e6dacd
--- /dev/null
+++ b/bootstraptest/test_autoload.rb
@@ -0,0 +1,70 @@
+assert_equal 'ok', %q{
+ File.unlink('zzz.rb') if File.file?('zzz.rb')
+ instance_eval do
+ autoload :ZZZ, './zzz.rb'
+ begin
+ ZZZ
+ rescue LoadError
+ :ok
+ end
+ end
+}, '[ruby-dev:43816]'
+
+assert_equal 'ok', %q{
+ open('zzz.rb', 'w') {|f| f.puts '' }
+ instance_eval do
+ autoload :ZZZ, './zzz.rb'
+ begin
+ ZZZ
+ rescue NameError
+ :ok
+ end
+ end
+}, '[ruby-dev:43816]'
+
+assert_equal 'ok', %q{
+ open('zzz.rb', 'w') {|f| f.puts 'class ZZZ; def self.ok;:ok;end;end'}
+ instance_eval do
+ autoload :ZZZ, './zzz.rb'
+ ZZZ.ok
+ end
+}, '[ruby-dev:43816]'
+
+assert_equal 'ok', %q{
+ open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+ autoload :ZZZ, "./zzz.rb"
+ ZZZ.ok
+}
+
+assert_equal 'ok', %q{
+ open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+ autoload :ZZZ, "./zzz.rb"
+ require "./zzz.rb"
+ ZZZ.ok
+}
+
+assert_equal 'okok', %q{
+ open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+ autoload :ZZZ, "./zzz.rb"
+ t1 = Thread.new {ZZZ.ok}
+ t2 = Thread.new {ZZZ.ok}
+ [t1.value, t2.value].join
+}
+
+assert_finish 5, %q{
+ autoload :ZZZ, File.expand_path(__FILE__)
+ begin
+ ZZZ
+ rescue NameError
+ end
+}, '[ruby-core:21696]'
+
+assert_equal 'A::C', %q{
+ open("zzz.rb", "w") {}
+ class A
+ autoload :C, "./zzz"
+ class C
+ end
+ C
+ end
+}
diff --git a/bootstraptest/test_block.rb b/bootstraptest/test_block.rb
new file mode 100644
index 0000000000..6a2ccfc6da
--- /dev/null
+++ b/bootstraptest/test_block.rb
@@ -0,0 +1,599 @@
+assert_equal %q{1}, %q{
+ 1.times{
+ begin
+ a = 1
+ ensure
+ foo = nil
+ end
+ }
+}
+assert_equal %q{2}, %q{
+ [1,2,3].find{|x| x == 2}
+}
+assert_equal %q{2}, %q{
+ class E
+ include Enumerable
+ def each(&block)
+ [1, 2, 3].each(&block)
+ end
+ end
+ E.new.find {|x| x == 2 }
+}
+assert_equal %q{6}, %q{
+ sum = 0
+ for x in [1, 2, 3]
+ sum += x
+ end
+ sum
+}
+assert_equal %q{15}, %q{
+ sum = 0
+ for x in (1..5)
+ sum += x
+ end
+ sum
+}
+assert_equal %q{0}, %q{
+ sum = 0
+ for x in []
+ sum += x
+ end
+ sum
+}
+assert_equal %q{1}, %q{
+ ans = []
+ 1.times{
+ for n in 1..3
+ a = n
+ ans << a
+ end
+ }
+}
+assert_equal %q{1..3}, %q{
+ ans = []
+ for m in 1..3
+ for n in 1..3
+ a = [m, n]
+ ans << a
+ end
+ end
+}
+assert_equal %q{[1, 2, 3]}, %q{
+ (1..3).to_a
+}
+assert_equal %q{[4, 8, 12]}, %q{
+ (1..3).map{|e|
+ e * 4
+ }
+}
+assert_equal %q{[1, 2, 3]}, %q{
+ class C
+ include Enumerable
+ def each
+ [1,2,3].each{|e|
+ yield e
+ }
+ end
+ end
+
+ C.new.to_a
+}
+assert_equal %q{[4, 5, 6]}, %q{
+ class C
+ include Enumerable
+ def each
+ [1,2,3].each{|e|
+ yield e
+ }
+ end
+ end
+
+ C.new.map{|e|
+ e + 3
+ }
+}
+assert_equal %q{100}, %q{
+ def m
+ yield
+ end
+ def n
+ yield
+ end
+
+ m{
+ n{
+ 100
+ }
+ }
+}
+assert_equal %q{20}, %q{
+ def m
+ yield 1
+ end
+
+ m{|ib|
+ m{|jb|
+ i = 20
+ }
+ }
+}
+assert_equal %q{2}, %q{
+ def m
+ yield 1
+ end
+
+ m{|ib|
+ m{|jb|
+ ib = 20
+ kb = 2
+ }
+ }
+}
+assert_equal %q{3}, %q{
+ def iter1
+ iter2{
+ yield
+ }
+ end
+
+ def iter2
+ yield
+ end
+
+ iter1{
+ jb = 2
+ iter1{
+ jb = 3
+ }
+ jb
+ }
+}
+assert_equal %q{2}, %q{
+ def iter1
+ iter2{
+ yield
+ }
+ end
+
+ def iter2
+ yield
+ end
+
+ iter1{
+ jb = 2
+ iter1{
+ jb
+ }
+ jb
+ }
+}
+assert_equal %q{2}, %q{
+ def m
+ yield 1
+ end
+ m{|ib|
+ ib*2
+ }
+}
+assert_equal %q{92580}, %q{
+ def m
+ yield 12345, 67890
+ end
+ m{|ib,jb|
+ ib*2+jb
+ }
+}
+assert_equal %q{[10, nil]}, %q{
+ def iter
+ yield 10
+ end
+
+ a = nil
+ [iter{|a|
+ a
+ }, a]
+}
+assert_equal %q{21}, %q{
+ def iter
+ yield 10
+ end
+
+ iter{|a|
+ iter{|a|
+ a + 1
+ } + a
+ }
+}
+assert_equal %q{[10, 20, 30, 40, nil, nil, nil, nil]}, %q{
+ def iter
+ yield 10, 20, 30, 40
+ end
+
+ a = b = c = d = nil
+ iter{|a, b, c, d|
+ [a, b, c, d]
+ } + [a, b, c, d]
+}
+assert_equal %q{[10, 20, 30, 40, nil, nil]}, %q{
+ def iter
+ yield 10, 20, 30, 40
+ end
+
+ a = b = nil
+ iter{|a, b, c, d|
+ [a, b, c, d]
+ } + [a, b]
+}
+assert_equal %q{[1]}, %q{
+ $a = []
+
+ def iter
+ yield 1
+ end
+
+ def m
+ x = iter{|x|
+ $a << x
+ y = 0
+ }
+ end
+ m
+ $a
+}
+assert_equal %q{[1, [2]]}, %q{
+ def iter
+ yield 1, 2
+ end
+
+ iter{|a, *b|
+ [a, b]
+ }
+}
+assert_equal %q{[[1, 2]]}, %q{
+ def iter
+ yield 1, 2
+ end
+
+ iter{|*a|
+ [a]
+ }
+}
+assert_equal %q{[1, 2, []]}, %q{
+ def iter
+ yield 1, 2
+ end
+
+ iter{|a, b, *c|
+ [a, b, c]
+ }
+}
+assert_equal %q{[1, 2, nil, []]}, %q{
+ def iter
+ yield 1, 2
+ end
+
+ iter{|a, b, c, *d|
+ [a, b, c, d]
+ }
+}
+assert_equal %q{1}, %q{
+ def m
+ yield
+ end
+ m{
+ 1
+ }
+}
+assert_equal %q{15129}, %q{
+ def m
+ yield 123
+ end
+ m{|ib|
+ m{|jb|
+ ib*jb
+ }
+ }
+}
+assert_equal %q{2}, %q{
+ def m a
+ yield a
+ end
+ m(1){|ib|
+ m(2){|jb|
+ ib*jb
+ }
+ }
+}
+assert_equal %q{9}, %q{
+ sum = 0
+ 3.times{|ib|
+ 2.times{|jb|
+ sum += ib + jb
+ }}
+ sum
+}
+assert_equal %q{10}, %q{
+ 3.times{|bl|
+ break 10
+ }
+}
+assert_equal %q{[1, 2]}, %q{
+ def iter
+ yield 1,2,3
+ end
+
+ iter{|i, j|
+ [i, j]
+ }
+}
+assert_equal %q{[1, nil]}, %q{
+ def iter
+ yield 1
+ end
+
+ iter{|i, j|
+ [i, j]
+ }
+}
+
+assert_equal '0', %q{
+def m()
+end
+m {|(v0,*,(*)),|}
+m {|(*v0,(*)),|}
+m {|(v0,*v1,(*)),|}
+m {|((v0,*v1,v2)),|}
+m {|(v0,*v1,v2),|}
+m {|(v0,*v1,(v2)),|}
+m {|((*),*v0,v1),|}
+m {|((v0),*v1,v2),|}
+m {|(v0,v1,*v2,v3),|}
+m {|v0,(v1,*v2,v3),|}
+m {|(v0,*v1,v2),v3,|}
+m {|(v0,*v1,v2)|}
+m {|(v0,*v1,v2),&v3|}
+m {|(v0,*v1,v2),*|}
+m {|(v0,*v1,v2),*,&v3|}
+m {|*,(v0,*v1,v2)|}
+m {|*,(v0,*v1,v2),&v3|}
+m {|v0,*,(v1,*v2,v3)|}
+m {|v0,*,(v1,*v2,v3),&v4|}
+m {|(v0,*v1,v2),*,v3|}
+m {|(v0,*v1,v2),*,v3,&v4|}
+m {|(v0, *v1, v2)|}
+m {|(*,v)|}
+0
+}, "block parameter (shouldn't SEGV: [ruby-dev:31143])"
+
+assert_equal 'nil', %q{
+ def m
+ yield
+ end
+ m{|&b| b}.inspect
+}, '[ruby-dev:31147]'
+
+assert_equal 'nil', %q{
+ def m()
+ yield
+ end
+ m {|(v,(*))|}.inspect
+}, '[ruby-dev:31160]'
+
+assert_equal 'nil', %q{
+ def m()
+ yield
+ end
+ m {|(*,a,b)|}.inspect
+}, '[ruby-dev:31153]'
+
+assert_equal 'nil', %q{
+ def m()
+ yield
+ end
+ m {|((*))|}.inspect
+}
+
+assert_equal %q{[1, 1, [1, nil], [1, nil], [1, nil], [1, nil], [1, 1], 1, [1, nil], [1, nil], [1, nil], [1, nil], [[1, 1], [1, 1]], [1, 1], [1, 1], [1, 1], [1, nil], [1, nil], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[1, 1], [1, 1]], [[1, 1], [1, 1]], [[1, 1], [1, 1]], [1, 1], [1, 1], [[[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[1, 1], [1, 1]], [[1, 1], [1, 1]]]}, %q{
+def m(ary = [])
+ yield(ary)
+end
+
+$ans = []
+o = 1
+5.times{
+ v,(*) = o; $ans << o
+ m(o){|(v,(*))| $ans << v}
+ ((x, y)) = o; $ans << [x, y]
+ m(o){|((x, y))| $ans << [x, y]}
+ (((x, y))) = o; $ans << [x, y]
+ m(o){|(((x, y)))| $ans << [x, y]}
+ o = [o, o]
+}; $ans
+}
+
+assert_equal '0', %q{
+ def m()
+ yield [0]
+ end
+ m {|*,v| v}.inspect
+}, '[ruby-dev:31437]'
+assert_equal '[0]', %q{
+ def m
+ yield [0]
+ end
+ m{|v, &b| v}.inspect
+}, '[ruby-dev:31440]'
+assert_equal 'ok', %q{
+ begin
+ lambda{|a|}.call(1, 2)
+ rescue ArgumentError
+ :ok
+ else
+ :ng
+ end
+}, '[ruby-dev:31464]'
+assert_equal 'ok', %q{
+ begin
+ lambda{|&b|}.call(3)
+ rescue ArgumentError
+ :ok
+ else
+ :ng
+ end
+}, '[ruby-dev:31472]'
+assert_equal 'ok', %q{
+ class C
+ def each
+ yield [1,2]
+ yield 1,2
+ end
+ end
+ vs1 = []
+ C.new.each {|*v| vs1 << v }
+ vs2 = []
+ C.new.to_enum.each {|*v| vs2 << v }
+ vs1 == vs2 ? :ok : :ng
+}, '[ruby-dev:32329]'
+
+assert_normal_exit %q{
+ e = [1,2,3].each
+ 10000.times {
+ e = [e].each
+ }
+ Thread.new { GC.start }.join
+}, '[ruby-dev:32604]'
+
+
+assert_equal '[nil, []]', %q{
+ def m() yield nil,[] end
+ l = lambda {|*v| v}
+ GC.stress=true
+ r = m(&l)
+ GC.stress=false
+ r.inspect
+}, '[ruby-dev:32567]'
+
+assert_equal NilClass.to_s, %q{
+ r = false; 1.times{|&b| r = b}; r.class
+}
+
+assert_equal 'ok', %q{
+ class C
+ define_method(:foo) do |arg, &block|
+ if block then block.call else arg end
+ end
+ end
+ C.new.foo("ng") {"ok"}
+}, '[ruby-talk:266422]'
+
+assert_equal 'ok', %q{
+ class C
+ define_method(:xyz) do |o, k, &block|
+ block.call(o, k)
+ end
+ end
+ C.new.xyz("o","k") {|o, k| o+k}
+}, '[ruby-core:20544]'
+
+assert_equal 'ok', %q{
+ class C
+ define_method(:xyz) do |*args, &block|
+ block.call(*args)
+ end
+ end
+ C.new.xyz("o","k") {|*args| args.join("")}
+}, '[ruby-core:20544]'
+
+assert_equal 'ok', %q{
+ STDERR.reopen(STDOUT)
+ class C
+ define_method(:foo) do |&block|
+ block.call if block
+ end
+ result = "ng"
+ new.foo() {result = "ok"}
+ result
+ end
+}
+
+assert_equal "ok", %q{
+ class Bar
+ def bar; :ok; end
+ end
+ def foo
+ yield(Bar.new) if block_given?
+ end
+ foo(&:bar)
+}, '[ruby-core:14279]'
+
+assert_normal_exit %q{
+ class Controller
+ def respond_to(&block)
+ responder = Responder.new
+ block.call(responder)
+ responder.respond
+ end
+ def test_for_bug
+ respond_to{|format|
+ format.js{
+ puts "in test"
+ render{|obj|
+ puts obj
+ }
+ }
+ }
+ end
+ def render(&block)
+ puts "in render"
+ end
+ end
+
+ class Responder
+ def method_missing(symbol, &block)
+ puts "enter method_missing"
+ @response = Proc.new{
+ puts 'in method missing'
+ block.call
+ }
+ puts "leave method_missing"
+ end
+ def respond
+ @response.call
+ end
+ end
+ t = Controller.new
+ t.test_for_bug
+}, '[ruby-core:14395]'
+
+assert_equal 'true', %q{
+ class C0
+ def foo
+ block_given?
+ end
+ end
+
+ class C1 < C0
+ def foo
+ super
+ end
+ end
+
+ C1.new.foo{}
+}
+
+assert_equal 'true', %q{
+ class C0
+ def foo
+ block_given?
+ end
+ end
+
+ class C1 < C0
+ def foo
+ super()
+ end
+ end
+
+ C1.new.foo{}
+}
+
diff --git a/bootstraptest/test_class.rb b/bootstraptest/test_class.rb
new file mode 100644
index 0000000000..b7fe0a1acd
--- /dev/null
+++ b/bootstraptest/test_class.rb
@@ -0,0 +1,169 @@
+# class
+assert_equal 'true', %q( class C; end
+ Object.const_defined?(:C) )
+assert_equal 'Class', %q( class C; end
+ C.class )
+assert_equal 'C', %q( class C; end
+ C.name )
+assert_equal 'C', %q( class C; end
+ C.new.class )
+assert_equal 'C', %q( class C; end
+ C.new.class.name )
+assert_equal 'Class', %q( class C; end
+ C.new.class.class )
+assert_equal 'true', %q( Object.__send__(:remove_const, :TrueClass)
+ GC.start
+ true.inspect)
+assert_equal 'false', %q( Object.__send__(:remove_const, :FalseClass)
+ GC.start
+ false.inspect)
+assert_equal 'nil', %q( Object.__send__(:remove_const, :NilClass)
+ GC.start
+ nil.inspect)
+
+
+# inherited class
+assert_equal 'true', %q( class A; end
+ class C < A; end
+ Object.const_defined?(:C) )
+assert_equal 'Class', %q( class A; end
+ class C < A; end
+ C.class )
+assert_equal 'C', %q( class A; end
+ class C < A; end
+ C.name )
+assert_equal 'C', %q( class A; end
+ class C < A; end
+ C.new.class )
+assert_equal 'C', %q( class A; end
+ class C < A; end
+ C.new.class.name )
+assert_equal 'Class', %q( class A; end
+ class C < A; end
+ C.new.class.class )
+
+# module
+assert_equal 'true', %q( module M; end
+ Object.const_defined?(:M) )
+assert_equal 'Module', %q( module M; end
+ M.class )
+assert_equal 'M', %q( module M; end
+ M.name )
+assert_equal 'C', %q( module M; end
+ class C; include M; end
+ C.new.class )
+
+# nested class
+assert_equal 'A::B', %q( class A; end
+ class A::B; end
+ A::B )
+assert_equal 'A::B', %q( class A; end
+ class A::B; end
+ A::B.name )
+assert_equal 'A::B', %q( class A; end
+ class A::B; end
+ A::B.new.class )
+assert_equal 'Class', %q( class A; end
+ class A::B; end
+ A::B.new.class.class )
+assert_equal 'A::B::C', %q( class A; end
+ class A::B; end
+ class A::B::C; end
+ A::B::C )
+assert_equal 'A::B::C', %q( class A; end
+ class A::B; end
+ class A::B::C; end
+ A::B::C.name )
+assert_equal 'Class', %q( class A; end
+ class A::B; end
+ class A::B::C; end
+ A::B::C.class )
+assert_equal 'A::B::C', %q( class A; end
+ class A::B; end
+ class A::B::C; end
+ A::B::C.new.class )
+assert_equal 'Class', %q( class A; end
+ class A::B; end
+ class A::B::C; end
+ A::B::C.new.class.class )
+assert_equal 'A::B2', %q( class A; end
+ class A::B; end
+ class A::B2 < A::B; end
+ A::B2 )
+assert_equal 'Class', %q( class A; end
+ class A::B; end
+ class A::B2 < A::B; end
+ A::B2.class )
+
+# reopen
+assert_equal 'true', %q( class C; end; c1 = ::C
+ class C; end; c2 = ::C
+ c1.equal?(c2) )
+assert_equal '1', %q( class C; end
+ class A; end
+ begin class C < A; end; rescue TypeError; 1 end )
+assert_equal '1', %q( class C; end
+ begin module C; end; rescue TypeError; 1 end )
+assert_equal '1', %q( C = 1 # [yarv-dev:782]
+ begin class C; end; rescue TypeError; 1 end )
+assert_equal '1', %q( C = 1 # [yarv-dev:800]
+ begin module C; end; rescue TypeError; 1 end )
+
+# colon2, colon3
+assert_equal '1', %q( class A; end; A::C = 1; A::C )
+assert_equal '1', %q( A = 7; begin A::C = 7; rescue TypeError; 1 end )
+assert_equal '1', %q( begin 7::C = 7; rescue TypeError; 1 end )
+assert_equal 'C', %q( class A; class ::C; end end; C )
+assert_equal 'Class', %q( class A; class ::C; end end; C.class )
+assert_equal 'OK', %q( class A; ::C = "OK"; end; C )
+assert_equal 'String', %q( class A; ::C = "OK"; end; C.class )
+
+# class/module dup
+assert_equal 'Class', %q( class C; end; C.dup.class )
+assert_equal 'Module', %q( module M; end; M.dup.class )
+
+
+assert_equal "ok", %q{
+ module Foo
+ end
+
+ begin
+ def foo(&b)
+ Foo.module_eval &b
+ end
+ foo{
+ def bar
+ end
+ }
+ bar()
+ rescue NameError
+ :ok
+ end
+}, '[ruby-core:14378]'
+
+assert_equal '3', %q{
+ $i = 0
+ class C
+ def self.const_missing *args
+ $i+=1
+ end
+ end
+
+ 3.times{
+ C::FOO
+ }
+ $i
+}
+
+assert_match /::C\z/, %q{
+ c = nil
+ Module.new{|m| c = class m::C; name; end}
+ c
+}, '[ruby-dev:38456]'
+
+assert_normal_exit %q{
+ s = Symbol.dup
+ class << s
+ end
+ s.allocate.to_s
+}, '[ruby-core:30843]'
diff --git a/bootstraptest/test_eval.rb b/bootstraptest/test_eval.rb
new file mode 100644
index 0000000000..bf7478006d
--- /dev/null
+++ b/bootstraptest/test_eval.rb
@@ -0,0 +1,324 @@
+assert_equal %q{ok}, %q{
+ def m
+ a = :ok
+ $b = binding
+ end
+ m
+ eval('a', $b)
+}
+assert_equal %q{[:ok, :ok2]}, %q{
+ def m
+ a = :ok
+ $b = binding
+ end
+ m
+ eval('b = :ok2', $b)
+ eval('[a, b]', $b)
+}
+assert_equal %q{[nil, 1]}, %q{
+ $ans = []
+ def m
+ $b = binding
+ end
+ m
+ $ans << eval(%q{
+ $ans << eval(%q{
+ a
+ }, $b)
+ a = 1
+ }, $b)
+ $ans
+}
+assert_equal %q{C}, %q{
+ Const = :top
+ class C
+ Const = :C
+ def m
+ binding
+ end
+ end
+ eval('Const', C.new.m)
+}
+assert_equal %q{top}, %q{
+ Const = :top
+ a = 1
+ class C
+ Const = :C
+ def m
+ eval('Const', TOPLEVEL_BINDING)
+ end
+ end
+ C.new.m
+}
+assert_equal %q{:ok
+ok}, %q{
+ class C
+ $b = binding
+ end
+ eval %q{
+ def m
+ :ok
+ end
+ }, $b
+ p C.new.m
+}
+assert_equal %q{ok}, %q{
+ b = proc{
+ a = :ok
+ binding
+ }.call
+ a = :ng
+ eval("a", b)
+}
+assert_equal %q{C}, %q{
+ class C
+ def foo
+ binding
+ end
+ end
+ C.new.foo.eval("self.class.to_s")
+}
+assert_equal %q{1}, %q{
+ eval('1')
+}
+assert_equal %q{1}, %q{
+ eval('a=1; a')
+}
+assert_equal %q{1}, %q{
+ a = 1
+ eval('a')
+}
+assert_equal %q{ok}, %q{
+ __send__ :eval, %{
+ :ok
+ }
+}
+assert_equal %q{ok}, %q{
+ 1.__send__ :instance_eval, %{
+ :ok
+ }
+}
+assert_equal %q{1}, %q{
+ 1.instance_eval{
+ self
+ }
+}
+assert_equal %q{foo}, %q{
+ 'foo'.instance_eval{
+ self
+ }
+}
+assert_equal %q{1}, %q{
+ class Fixnum
+ Const = 1
+ end
+ 1.instance_eval %{
+ Const
+ }
+}
+assert_equal %q{top}, %q{
+ Const = :top
+ class C
+ Const = :C
+ end
+ C.module_eval{
+ Const
+ }
+}
+assert_equal %q{C}, %q{
+ Const = :top
+ class C
+ Const = :C
+ end
+ C.class_eval %{
+ def m
+ Const
+ end
+ }
+ C.new.m
+}
+assert_equal %q{top}, %q{
+ Const = :top
+ class C
+ Const = :C
+ end
+ C.class_eval{
+ def m
+ Const
+ end
+ }
+ C.new.m
+}
+assert_equal %q{[:top, :C, :top, :C]}, %q{
+ Const = :top
+ class C
+ Const = :C
+ end
+ $nest = false
+ $ans = []
+ def m
+ $ans << Const
+ C.module_eval %{
+ $ans << Const
+ Boo = false unless defined? Boo
+ unless $nest
+ $nest = true
+ m
+ end
+ }
+ end
+ m
+ $ans
+}
+assert_equal %q{[10, main]}, %q{
+ $nested = false
+ $ans = []
+ $pr = proc{
+ $ans << self
+ unless $nested
+ $nested = true
+ $pr.call
+ end
+ }
+ class C
+ def initialize &b
+ 10.instance_eval(&b)
+ end
+ end
+ C.new(&$pr)
+ $ans
+}
+
+%w[break next redo].each do |keyword|
+ assert_match %r"Can't escape from eval with #{keyword}\z", %{
+ begin
+ eval "0 rescue #{keyword}"
+ rescue SyntaxError => e
+ e.message
+ end
+ }, '[ruby-dev:31372]'
+end
+
+assert_normal_exit %q{
+ STDERR.reopen(STDOUT)
+ class Foo
+ def self.add_method
+ class_eval("def some-bad-name; puts 'hello' unless @some_variable.some_function(''); end")
+ end
+ end
+ Foo.add_method
+}, '[ruby-core:14556] reported by Frederick Cheung'
+
+assert_equal 'ok', %q{
+ class Module
+ def my_module_eval(&block)
+ module_eval(&block)
+ end
+ end
+ class String
+ Integer.my_module_eval do
+ def hoge; end
+ end
+ end
+ if Integer.instance_methods(false).map{|m|m.to_sym}.include?(:hoge) &&
+ !String.instance_methods(false).map{|m|m.to_sym}.include?(:hoge)
+ :ok
+ else
+ :ng
+ end
+}, "[ruby-dev:34236]"
+
+assert_equal 'ok', %q{
+ begin
+ eval("class nil::Foo; end")
+ :ng
+ rescue Exception
+ :ok
+ end
+}
+
+assert_equal 'ok', %q{
+ begin
+ 0.instance_eval { def m() :m end }
+ 1.m
+ :ng
+ rescue Exception
+ :ok
+ end
+}, '[ruby-dev:34579]'
+
+assert_equal 'ok', %q{
+ begin
+ 12.instance_eval { @@a }
+ rescue NameError
+ :ok
+ end
+}, '[ruby-core:16794]'
+
+assert_equal 'ok', %q{
+ begin
+ 12.instance_exec { @@a }
+ rescue NameError
+ :ok
+ end
+}, '[ruby-core:16794]'
+
+assert_equal 'ok', %q{
+ nil.instance_eval {
+ def defd_using_instance_eval() :ok end
+ }
+ nil.defd_using_instance_eval
+}, '[ruby-core:28324]'
+
+assert_equal 'ok', %q{
+ nil.instance_exec {
+ def defd_using_instance_exec() :ok end
+ }
+ nil.defd_using_instance_exec
+}, '[ruby-core:28324]'
+
+assert_normal_exit %q{
+ eval("", method(:proc).call {}.binding)
+}
+
+assert_equal "", %q{
+ b = binding
+ 10.times{
+ eval('', b)
+ }
+ begin
+ eval('1.times{raise}', b)
+ rescue => e
+ e.message
+ end
+}, '[ruby-dev:35392]'
+
+assert_equal "[:x]", %q{
+ def kaboom!
+ yield.eval("local_variables")
+ end
+
+ for x in enum_for(:kaboom!)
+ binding
+ end
+}, '[ruby-core:25125]'
+
+assert_normal_exit %q{
+ hash = {}
+ ("aaaa".."matz").each_with_index do |s, i|
+ hash[s] = i
+ end
+ begin
+ eval "class C; @@h = #{hash.inspect}; end"
+ end
+}, '[ruby-core:25714]'
+
+assert_normal_exit %q{
+ begin
+ eval("# encoding:utf-16le\nfoo")
+ rescue Exception => e
+ p e
+ RubyVM::InstructionSequence.compile("p:hello")
+ end
+}, 'check escaping the internal value th->base_block'
+
diff --git a/bootstraptest/test_exception.rb b/bootstraptest/test_exception.rb
new file mode 100644
index 0000000000..35c8d25e37
--- /dev/null
+++ b/bootstraptest/test_exception.rb
@@ -0,0 +1,432 @@
+assert_equal %q{2}, %q{
+ begin
+ 1+1
+ ensure
+ 2+2
+ end
+}
+assert_equal %q{4}, %q{
+ begin
+ 1+1
+ begin
+ 2+2
+ ensure
+ 3+3
+ end
+ ensure
+ 4+4
+ end
+}
+assert_equal %q{4}, %q{
+ begin
+ 1+1
+ begin
+ 2+2
+ ensure
+ 3+3
+ end
+ ensure
+ 4+4
+ begin
+ 5+5
+ ensure
+ 6+6
+ end
+ end
+}
+assert_equal %q{NilClass}, %q{
+ a = nil
+ 1.times{|e|
+ begin
+ rescue => err
+ end
+ a = err.class
+ }
+ a
+}
+assert_equal %q{RuntimeError}, %q{
+ a = nil
+ 1.times{|e|
+ begin
+ raise
+ rescue => err
+ end
+ a = err.class
+ }
+ a
+}
+assert_equal %q{}, %q{
+ $!
+}
+assert_equal %q{FOO}, %q{
+ begin
+ raise "FOO"
+ rescue
+ $!
+ end
+}
+assert_equal %q{FOO}, %q{
+ def m
+ $!
+ end
+ begin
+ raise "FOO"
+ rescue
+ m()
+ end
+}
+assert_equal %q{[#<RuntimeError: BAR>, #<RuntimeError: FOO>]}, %q{
+ $ans = []
+ def m
+ $!
+ end
+ begin
+ raise "FOO"
+ rescue
+ begin
+ raise "BAR"
+ rescue
+ $ans << m()
+ end
+ $ans << m()
+ end
+ $ans
+}
+assert_equal %q{[#<RuntimeError: FOO>, #<RuntimeError: FOO>]}, %q{
+ $ans = []
+ def m
+ $!
+ end
+
+ begin
+ begin
+ raise "FOO"
+ ensure
+ $ans << m()
+ end
+ rescue
+ $ans << m()
+ end
+}
+assert_equal %q{[nil]}, %q{
+ $ans = []
+ def m
+ $!
+ end
+ def m2
+ 1.times{
+ begin
+ return
+ ensure
+ $ans << m
+ end
+ }
+ end
+ m2
+ $ans
+}
+assert_equal %q{ok}, %q{
+ begin
+ raise
+ rescue
+ :ok
+ end
+}
+assert_equal %q{ok}, %q{
+ begin
+ raise
+ rescue
+ :ok
+ ensure
+ :ng
+ end
+}
+assert_equal %q{RuntimeError}, %q{
+ begin
+ raise
+ rescue => e
+ e.class
+ end
+}
+assert_equal %q{ng}, %q{
+ begin
+ raise
+ rescue StandardError
+ :ng
+ rescue Exception
+ :ok
+ end
+}
+assert_equal %q{c}, %q{
+ begin
+ begin
+ raise "a"
+ rescue
+ raise "b"
+ ensure
+ raise "c"
+ end
+ rescue => e
+ e.message
+ end
+}
+assert_equal %q{33}, %q{
+ def m a, b
+ a + b
+ end
+ m(1, begin
+ raise
+ rescue
+ 2
+ end) +
+ m(10, begin
+ raise
+ rescue
+ 20
+ ensure
+ 30
+ end)
+}
+assert_equal %q{3}, %q{
+ def m a, b
+ a + b
+ end
+ m(begin
+ raise
+ rescue
+ 1
+ end,
+ begin
+ raise
+ rescue
+ 2
+ end)
+}
+assert_equal %q{ok3}, %q{
+ class E1 < Exception
+ end
+
+ def m
+ yield
+ end
+
+ begin
+ begin
+ begin
+ m{
+ raise
+ }
+ rescue E1
+ :ok2
+ ensure
+ end
+ rescue
+ :ok3
+ ensure
+ end
+ rescue E1
+ :ok
+ ensure
+ end
+}
+assert_equal %q{7}, %q{
+ $i = 0
+ def m
+ iter{
+ begin
+ $i += 1
+ begin
+ $i += 2
+ break
+ ensure
+
+ end
+ ensure
+ $i += 4
+ end
+ $i = 0
+ }
+ end
+
+ def iter
+ yield
+ end
+ m
+ $i
+}
+assert_equal %q{10}, %q{
+ $i = 0
+ def m
+ begin
+ $i += 1
+ begin
+ $i += 2
+ return
+ ensure
+ $i += 3
+ end
+ ensure
+ $i += 4
+ end
+ p :end
+ end
+ m
+ $i
+}
+assert_equal %q{1}, %q{
+ begin
+ 1
+ rescue
+ 2
+ end
+}
+assert_equal %q{4}, %q{
+ begin
+ 1
+ begin
+ 2
+ rescue
+ 3
+ end
+ 4
+ rescue
+ 5
+ end
+}
+assert_equal %q{3}, %q{
+ begin
+ 1
+ rescue
+ 2
+ else
+ 3
+ end
+}
+assert_equal %q{2}, %q{
+ begin
+ 1+1
+ rescue
+ 2+2
+ ensure
+ 3+3
+ end
+ }
+assert_equal %q{2}, %q{
+ begin
+ 1+1
+ rescue
+ 2+2
+ ensure
+ 3+3
+ end
+ }
+assert_equal %q{6}, %q{
+ begin
+ 1+1
+ rescue
+ 2+2
+ else
+ 3+3
+ ensure
+ 4+4
+ end
+ }
+assert_equal %q{12}, %q{
+ begin
+ 1+1
+ begin
+ 2+2
+ rescue
+ 3+3
+ else
+ 4+4
+ end
+ rescue
+ 5+5
+ else
+ 6+6
+ ensure
+ 7+7
+ end
+ }
+assert_equal %q{ok}, %q{ #
+ proc{
+ begin
+ raise
+ break
+ rescue
+ :ok
+ end
+ }.call
+}
+assert_equal %q{}, %q{
+ proc do
+ begin
+ raise StandardError
+ redo
+ rescue StandardError
+ end
+ end.call
+}
+
+##
+assert_match /undefined method `foo\'/, %q{#`
+ STDERR.reopen(STDOUT)
+ class C
+ def inspect
+ bar {}
+ end
+
+ def bar
+ raise
+ ensure
+ end
+ end
+ C.new.foo
+}, "[ruby-dev:31407]"
+
+assert_equal 'nil', %q{
+ doit = false
+ exc = nil
+ t = Thread.new {
+ begin
+ doit = true
+ sleep 10
+ ensure
+ exc = $!
+ end
+ }
+ Thread.pass until doit
+ t.kill
+ t.join
+ exc.inspect
+}, '[ruby-dev:32608]'
+
+assert_equal 'exception class/object expected', %q{
+ class ZeroDivisionError
+ def self.new(message)
+ 42
+ end
+ end
+ begin
+ 1/0
+ rescue Exception => e
+ e.message
+ end
+}, '[ruby-core:24767]'
+
+assert_equal 'ok', %q{
+ class C
+ def ===(o)
+ true
+ end
+ end
+ begin
+ begin
+ raise
+ rescue C.new
+ end
+ rescue TypeError
+ :ok
+ end
+}
diff --git a/bootstraptest/test_finalizer.rb b/bootstraptest/test_finalizer.rb
new file mode 100644
index 0000000000..22a16b1220
--- /dev/null
+++ b/bootstraptest/test_finalizer.rb
@@ -0,0 +1,8 @@
+assert_normal_exit %q{
+a1,a2,b1,b2=Array.new(4){""}
+ObjectSpace.define_finalizer(b2,proc{})
+ObjectSpace.define_finalizer(b1,proc{b1.inspect})
+
+ObjectSpace.define_finalizer(a2,proc{a1.inspect})
+ObjectSpace.define_finalizer(a1,proc{})
+}, '[ruby-dev:35778]'
diff --git a/bootstraptest/test_flip.rb b/bootstraptest/test_flip.rb
new file mode 100644
index 0000000000..ff194868b2
--- /dev/null
+++ b/bootstraptest/test_flip.rb
@@ -0,0 +1 @@
+assert_equal %q{E}, %q{$_ = "E"; eval("nil if true..~/^E/",nil,"-e"); $_}
diff --git a/bootstraptest/test_flow.rb b/bootstraptest/test_flow.rb
new file mode 100644
index 0000000000..0390062a24
--- /dev/null
+++ b/bootstraptest/test_flow.rb
@@ -0,0 +1,591 @@
+assert_equal %q{[1, 2, 4, 5, 6, 7, 8]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each{; $a << 2
+ break; $a << 3
+ }; $a << 4
+ begin; $a << 5
+ ensure; $a << 6
+ end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 6, 7, 8]}, %q{$a = []; begin; ; $a << 1
+ begin; $a << 2
+ [1,2].each do; $a << 3
+ break; $a << 4
+ end; $a << 5
+ ensure; $a << 6
+ end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{ok}, %q{
+ ["a"].inject("ng"){|x,y|
+ break :ok
+ }
+}
+assert_equal %q{ok}, %q{
+ unless ''.respond_to? :lines
+ class String
+ def lines
+ self
+ end
+ end
+ end
+
+ ('a').lines.map{|e|
+ break :ok
+ }
+}
+assert_equal %q{[1, 2, 4, 5]}, %q{$a = []; begin; ; $a << 1
+ ["a"].inject("ng"){|x,y|; $a << 2
+ break :ok; $a << 3
+ }; $a << 4
+; $a << 5
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 4, 5]}, %q{$a = []; begin; ; $a << 1
+ ('a'..'b').map{|e|; $a << 2
+ break :ok; $a << 3
+ }; $a << 4
+; $a << 5
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 7, 8]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each do; $a << 2
+ begin; $a << 3
+ break; $a << 4
+ ensure; $a << 5
+ end; $a << 6
+ end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 9, 10]}, %q{$a = []; begin; ; $a << 1
+ i=0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ begin; $a << 5
+ ensure; $a << 6
+ break; $a << 7
+ end; $a << 8
+ end; $a << 9
+; $a << 10
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 7, 10, 11]}, %q{$a = []; begin; ; $a << 1
+ i=0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ begin; $a << 5
+ raise; $a << 6
+ ensure; $a << 7
+ break; $a << 8
+ end; $a << 9
+ end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 7, 10, 11]}, %q{$a = []; begin; ; $a << 1
+ i=0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ begin; $a << 5
+ raise; $a << 6
+ rescue; $a << 7
+ break; $a << 8
+ end; $a << 9
+ end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each do; $a << 2
+ begin; $a << 3
+ raise StandardError; $a << 4
+ ensure; $a << 5
+ break; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each do; $a << 2
+ begin; $a << 3
+ raise StandardError; $a << 4
+ rescue; $a << 5
+ break; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 6, 8, 10, 11]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each do; $a << 2
+ begin; $a << 3
+ begin; $a << 4
+ break; $a << 5
+ ensure; $a << 6
+ end; $a << 7
+ ensure; $a << 8
+ end; $a << 9
+ end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 14, 15]}, %q{$a = []; begin; ; $a << 1
+ i = 0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ j = 0; $a << 5
+ while j<3; $a << 6
+ j+=1; $a << 7
+ begin; $a << 8
+ raise; $a << 9
+ rescue; $a << 10
+ break; $a << 11
+ end; $a << 12
+ end; $a << 13
+ end; $a << 14
+; $a << 15
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 16, 17]}, %q{$a = []; begin; ; $a << 1
+ i = 0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ j = 0; $a << 5
+ while j<3; $a << 6
+ j+=1; $a << 7
+ 1.times{; $a << 8
+ begin; $a << 9
+ raise; $a << 10
+ rescue; $a << 11
+ break; $a << 12
+ end; $a << 13
+ }; $a << 14
+ end; $a << 15
+ end; $a << 16
+; $a << 17
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 14, 15]}, %q{$a = []; begin; ; $a << 1
+ i = 0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ j = 0; $a << 5
+ while j<3; $a << 6
+ j+=1; $a << 7
+ begin; $a << 8
+ raise; $a << 9
+ ensure; $a << 10
+ break; $a << 11
+ end; $a << 12
+ end; $a << 13
+ end; $a << 14
+; $a << 15
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 16, 17]}, %q{$a = []; begin; ; $a << 1
+ i = 0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ j = 0; $a << 5
+ while j<3; $a << 6
+ j+=1; $a << 7
+ 1.times{; $a << 8
+ begin; $a << 9
+ raise; $a << 10
+ ensure; $a << 11
+ break; $a << 12
+ end; $a << 13
+ }; $a << 14
+ end; $a << 15
+ end; $a << 16
+; $a << 17
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ while true; $a << 2
+ begin; $a << 3
+ break; $a << 4
+ ensure; $a << 5
+ break; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 99]}, %q{
+$a = [];
+begin; ; $a << 1
+ while true; $a << 2
+ begin; $a << 3
+ break; $a << 4
+ ensure; $a << 5
+ raise; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 6, 8, 9, 10, 11]}, %q{$a = []; begin; ; $a << 1
+ begin; $a << 2
+ [1,2].each do; $a << 3
+ begin; $a << 4
+ break; $a << 5
+ ensure; $a << 6
+ end; $a << 7
+ end; $a << 8
+ ensure; $a << 9
+ end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 4, 99]}, %q{$a = []; begin; ; $a << 1
+ begin; $a << 2
+ raise StandardError; $a << 3
+ ensure; $a << 4
+ end; $a << 5
+; $a << 6
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4]}, %q{$a = []; begin; ; $a << 1
+ begin; $a << 2
+ ensure; $a << 3
+ end ; $a << 4
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 99]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each do; $a << 2
+ begin; $a << 3
+ break; $a << 4
+ ensure; $a << 5
+ raise StandardError; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{3}, %q{
+ def m a, b
+ a + b
+ end
+ m(1,
+ while true
+ break 2
+ end
+ )
+}
+assert_equal %q{4}, %q{
+ def m a, b
+ a + b
+ end
+ m(1,
+ (i=0; while i<2
+ i+=1
+ class C
+ next 2
+ end
+ end; 3)
+ )
+}
+assert_equal %q{34}, %q{
+ def m a, b
+ a+b
+ end
+ m(1, 1.times{break 3}) +
+ m(10, (1.times{next 3}; 20))
+}
+assert_equal %q{[1, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
+ 3.times{; $a << 2
+ class C; $a << 3
+ break; $a << 4
+ end; $a << 5
+ }; $a << 6
+; $a << 7
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ 3.times{; $a << 2
+ class A; $a << 3
+ class B; $a << 4
+ break; $a << 5
+ end; $a << 6
+ end; $a << 7
+ }; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 2, 3, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
+ 3.times{; $a << 2
+ class C; $a << 3
+ next; $a << 4
+ end; $a << 5
+ }; $a << 6
+; $a << 7
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 2, 3, 4, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ 3.times{; $a << 2
+ class C; $a << 3
+ class D; $a << 4
+ next; $a << 5
+ end; $a << 6
+ end; $a << 7
+ }; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
+ while true; $a << 2
+ class C; $a << 3
+ break; $a << 4
+ end; $a << 5
+ end; $a << 6
+; $a << 7
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ while true; $a << 2
+ class C; $a << 3
+ class D; $a << 4
+ break; $a << 5
+ end; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 3, 4, 5, 3, 4, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ i=0; $a << 2
+ while i<3; $a << 3
+ i+=1; $a << 4
+ class C; $a << 5
+ next 10; $a << 6
+ end; $a << 7
+ end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{1}, %q{
+ 1.times{
+ while true
+ class C
+ begin
+ break
+ ensure
+ break
+ end
+ end
+ end
+ }
+}
+assert_equal %q{[1, 2, 3, 5, 2, 3, 5, 7, 8]}, %q{$a = []; begin; ; $a << 1
+ [1,2].each do; $a << 2
+ begin; $a << 3
+ next; $a << 4
+ ensure; $a << 5
+ end; $a << 6
+ end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 6, 3, 5, 7, 8]}, %q{$a = []; begin; ; $a << 1
+ o = "test"; $a << 2
+ def o.test(a); $a << 3
+ return a; $a << 4
+ ensure; $a << 5
+ end; $a << 6
+ o.test(123); $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 4, 7, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+ def m1 *args; $a << 2
+ ; $a << 3
+ end; $a << 4
+ def m2; $a << 5
+ m1(:a, :b, (return 1; :c)); $a << 6
+ end; $a << 7
+ m2; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 8, 2, 3, 4, 5, 9, 10]}, %q{$a = []; begin; ; $a << 1
+ def m(); $a << 2
+ begin; $a << 3
+ 2; $a << 4
+ ensure; $a << 5
+ return 3; $a << 6
+ end; $a << 7
+ end; $a << 8
+ m; $a << 9
+; $a << 10
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 3, 11, 4, 5, 6, 7, 12, 13]}, %q{$a = []; begin; ; $a << 1
+ def m2; $a << 2
+ end; $a << 3
+ def m(); $a << 4
+ m2(begin; $a << 5
+ 2; $a << 6
+ ensure; $a << 7
+ return 3; $a << 8
+ end); $a << 9
+ 4; $a << 10
+ end; $a << 11
+ m(); $a << 12
+; $a << 13
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 16, 2, 3, 4, 5, 6, 7, 10, 11, 17, 18]}, %q{$a = []; begin; ; $a << 1
+ def m; $a << 2
+ 1; $a << 3
+ 1.times{; $a << 4
+ 2; $a << 5
+ begin; $a << 6
+ 3; $a << 7
+ return; $a << 8
+ 4; $a << 9
+ ensure; $a << 10
+ 5; $a << 11
+ end; $a << 12
+ 6; $a << 13
+ }; $a << 14
+ 7; $a << 15
+ end; $a << 16
+ m(); $a << 17
+; $a << 18
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[:ok, :ok2, :last]}, %q{
+ a = []
+ i = 0
+ begin
+ while i < 1
+ i+=1
+ begin
+ begin
+ next
+ ensure
+ a << :ok
+ end
+ ensure
+ a << :ok2
+ end
+ end
+ ensure
+ a << :last
+ end
+ a
+}
+assert_equal %q{[:ok, :ok2, :last]}, %q{
+ a = []
+ i = 0
+ begin
+ while i < 1
+ i+=1
+ begin
+ begin
+ break
+ ensure
+ a << :ok
+ end
+ ensure
+ a << :ok2
+ end
+ end
+ ensure
+ a << :last
+ end
+ a
+}
+assert_equal %q{[:ok, :ok2, :last]}, %q{
+ a = []
+ i = 0
+ begin
+ while i < 1
+ if i>0
+ break
+ end
+ i+=1
+ begin
+ begin
+ redo
+ ensure
+ a << :ok
+ end
+ ensure
+ a << :ok2
+ end
+ end
+ ensure
+ a << :last
+ end
+ a
+}
+assert_equal %Q{ENSURE\n}, %q{
+ def test
+ while true
+ return
+ end
+ ensure
+ puts("ENSURE")
+ end
+ test
+}, '[ruby-dev:37967]'
+
+[['[ruby-core:28129]', %q{
+ class Bug2728
+ include Enumerable
+ define_method(:dynamic_method) do
+ "dynamically defined method"
+ end
+ def each
+ begin
+ yield :foo
+ ensure
+ dynamic_method
+ end
+ end
+ end
+ e = Bug2728.new
+}],
+ ['[ruby-core:28132]', %q{
+ class Bug2729
+ include Enumerable
+ def each
+ begin
+ yield :foo
+ ensure
+ proc {}.call
+ end
+ end
+ end
+ e = Bug2729.new
+}],
+ ['[ruby-core:39125]', %q{
+ class Bug5234
+ include Enumerable
+ def each
+ begin
+ yield :foo
+ ensure
+ proc
+ end
+ end
+ end
+ e = Bug5234.new
+}],
+ ['[ruby-dev:45656]', %q{
+ class Bug6460
+ include Enumerable
+ def each
+ begin
+ yield :foo
+ ensure
+ 1.times { Proc.new }
+ end
+ end
+ end
+ e = Bug6460.new
+}]].each do |bug, src|
+ assert_equal "foo", src + %q{e.detect {true}}, bug
+ assert_equal "true", src + %q{e.any? {true}}, bug
+ assert_equal "false", src + %q{e.all? {false}}, bug
+ assert_equal "true", src + %q{e.include?(:foo)}, bug
+end
+
+assert_equal "foo", %q{
+ class Bug6460
+ def m1
+ m2 {|e|
+ return e
+ }
+ end
+
+ def m2
+ begin
+ yield :foo
+ ensure
+ begin
+ begin
+ yield :foo
+ ensure
+ Proc.new
+ raise ''
+ end
+ rescue
+ end
+ end
+ end
+ end
+ Bug6460.new.m1
+}, '[ruby-dev:46372]'
diff --git a/bootstraptest/test_fork.rb b/bootstraptest/test_fork.rb
new file mode 100644
index 0000000000..5de6ee1b12
--- /dev/null
+++ b/bootstraptest/test_fork.rb
@@ -0,0 +1,75 @@
+assert_equal '0', %q{
+ begin
+ GC.stress = true
+ pid = fork {}
+ Process.wait pid
+ $?.to_i
+ rescue NotImplementedError
+ 0
+ end
+}, '[ruby-dev:32404]'
+
+assert_finish 10, %q{
+ begin
+ children = (1..10).map{
+ Thread.start{fork{}}.value
+ }
+ while !children.empty? and pid = Process.wait
+ children.delete(pid)
+ end
+ rescue NotImplementedError
+ end
+}, '[ruby-core:22158]'
+
+assert_normal_exit(<<'End', '[ruby-dev:37934]')
+ main = Thread.current
+ Thread.new { sleep 0.01 until main.stop?; Thread.kill main }
+ Process.setrlimit(:NPROC, 1)
+ fork {}
+End
+
+assert_equal 'ok', %q{
+ begin
+ r, w = IO.pipe
+ if pid1 = fork
+ w.close
+ r.read(1)
+ Process.kill("USR1", pid1)
+ _, s = Process.wait2(pid1)
+ s.success? ? :ok : :ng
+ else
+ r.close
+ if pid2 = fork
+ trap("USR1") { Time.now.to_s; Process.kill("USR2", pid2) }
+ w.close
+ Process.wait2(pid2)
+ else
+ w.close
+ sleep 0.2
+ end
+ exit true
+ end
+ rescue NotImplementedError
+ :ok
+ end
+}, '[ruby-core:28924]'
+
+assert_equal '[1, 2]', %q{
+ a = []
+ main = Thread.current
+ trap(:INT) { a.push(1).size == 2 and main.wakeup }
+ trap(:TERM) { a.push(2).size == 2 and main.wakeup }
+ pid = $$
+ begin
+ pid = fork do
+ Process.kill(:INT, pid)
+ Process.kill(:TERM, pid)
+ end
+ Process.wait(pid)
+ 100.times {break if a.size > 1; sleep 0.001}
+ a.sort
+ rescue NotImplementedError
+ [1, 2]
+ end
+}, '[ruby-dev:44005] [Ruby 1.9 - Bug #4950]'
+
diff --git a/bootstraptest/test_gc.rb b/bootstraptest/test_gc.rb
new file mode 100644
index 0000000000..eb68c9845e
--- /dev/null
+++ b/bootstraptest/test_gc.rb
@@ -0,0 +1,34 @@
+assert_normal_exit %q{
+a = []
+ms = "a".."k"
+("A".."Z").each do |mod|
+ mod = eval("module #{mod}; self; end")
+ ms.each do |meth|
+ iseq = RubyVM::InstructionSequence.compile("module #{mod}; def #{meth}; end; end")
+ GC.stress = true
+ iseq.eval
+ GC.stress = false
+ end
+ o = Object.new.extend(mod)
+ ms.each do |meth|
+ o.send(meth)
+ end
+end
+}, '[ruby-dev:39453]'
+
+assert_normal_exit %q{
+a = []
+ms = "a".."k"
+("A".."Z").each do |mod|
+ mod = eval("module #{mod}; self; end")
+ ms.each do |meth|
+ GC.stress = true
+ mod.module_eval {define_method(meth) {}}
+ GC.stress = false
+ end
+ o = Object.new.extend(mod)
+ ms.each do |meth|
+ o.send(meth)
+ end
+end
+}, '[ruby-dev:39453]'
diff --git a/bootstraptest/test_io.rb b/bootstraptest/test_io.rb
new file mode 100644
index 0000000000..cee8cb399e
--- /dev/null
+++ b/bootstraptest/test_io.rb
@@ -0,0 +1,112 @@
+assert_finish 5, %q{
+ r, w = IO.pipe
+ t1 = Thread.new { r.sysread(1) }
+ t2 = Thread.new { r.sysread(1) }
+ sleep 0.01 until t1.stop? and t2.stop?
+ w.write "a"
+ w.write "a"
+}, '[ruby-dev:31866]'
+
+assert_finish 10, %q{
+ begin
+ require "io/nonblock"
+ require "timeout"
+ timeout(3) do
+ r, w = IO.pipe
+ w.nonblock?
+ w.nonblock = true
+ w.write_nonblock("a" * 100000)
+ w.nonblock = false
+ t1 = Thread.new { w.write("b" * 4096) }
+ t2 = Thread.new { w.write("c" * 4096) }
+ sleep 0.5
+ r.sysread(4096).length
+ sleep 0.5
+ r.sysread(4096).length
+ t1.join
+ t2.join
+ end
+ rescue LoadError, TimeoutError, NotImplementedError
+ end
+}, '[ruby-dev:32566]'
+
+assert_finish 1, %q{
+ r, w = IO.pipe
+ Thread.new {
+ w << "ab"
+ sleep 0.01
+ w << "ab"
+ }
+ r.gets("abab")
+}
+
+assert_equal 'ok', %q{
+ require 'tmpdir'
+ begin
+ tmpname = "#{Dir.tmpdir}/ruby-btest-#{$$}-#{rand(0x100000000).to_s(36)}"
+ rw = File.open(tmpname, File::RDWR|File::CREAT|File::EXCL)
+ rescue Errno::EEXIST
+ retry
+ end
+ save = STDIN.dup
+ STDIN.reopen(rw)
+ STDIN.reopen(save)
+ rw.close
+ File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
+ :ok
+}
+
+assert_equal 'ok', %q{
+ require 'tmpdir'
+ begin
+ tmpname = "#{Dir.tmpdir}/ruby-btest-#{$$}-#{rand(0x100000000).to_s(36)}"
+ rw = File.open(tmpname, File::RDWR|File::CREAT|File::EXCL)
+ rescue Errno::EEXIST
+ retry
+ end
+ save = STDIN.dup
+ STDIN.reopen(rw)
+ STDIN.print "a"
+ STDIN.reopen(save)
+ rw.close
+ File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
+ :ok
+}
+
+assert_equal 'ok', %q{
+ dup = STDIN.dup
+ dupfd = dup.fileno
+ dupfd == STDIN.dup.fileno ? :ng : :ok
+}, '[ruby-dev:46834]'
+
+assert_normal_exit %q{
+ ARGF.set_encoding "foo"
+}
+
+10.times do
+ assert_normal_exit %q{
+ at_exit { p :foo }
+
+ megacontent = "abc" * 12345678
+ #File.open("megasrc", "w") {|f| f << megacontent }
+
+ t0 = Thread.main
+ Thread.new { sleep 0.001 until t0.stop?; Process.kill(:INT, $$) }
+
+ r1, w1 = IO.pipe
+ r2, w2 = IO.pipe
+ t1 = Thread.new { w1 << megacontent; w1.close }
+ t2 = Thread.new { r2.read; r2.close }
+ IO.copy_stream(r1, w2) rescue nil
+ w2.close
+ r1.close
+ t1.join
+ t2.join
+ }, 'megacontent-copy_stream', ["INT"], :timeout => 10 or break
+end
+
+assert_normal_exit %q{
+ r, w = IO.pipe
+ STDOUT.reopen(w)
+ STDOUT.reopen(__FILE__, "r")
+}, '[ruby-dev:38131]'
diff --git a/bootstraptest/test_jump.rb b/bootstraptest/test_jump.rb
new file mode 100644
index 0000000000..595aaa7c4b
--- /dev/null
+++ b/bootstraptest/test_jump.rb
@@ -0,0 +1,308 @@
+assert_equal %q{ok}, %q{
+ def m
+ :ng1
+ mm{
+ yield
+ }
+ :ng2
+ end
+
+ def mm
+ :ng3
+ yield
+ :ng4
+ end
+
+ m{
+ break :ok
+ }
+}
+assert_equal %q{ok}, %q{
+ 3.times{
+ break :ok
+ }
+}
+assert_equal %q{}, %q{
+ catch(:foo){
+ throw :foo
+ }
+}
+assert_equal %q{false}, %q{
+ catch(:foo){
+ throw :foo, false
+ }
+}
+assert_equal %q{}, %q{
+ catch(:foo){
+ throw :foo, nil
+ }
+}
+assert_equal %q{ok}, %q{
+ catch(:foo){
+ throw :foo, :ok
+ }
+}
+assert_equal %q{}, %q{
+ catch(:foo){
+ 1.times{
+ throw :foo
+ }
+ }
+}
+assert_equal %q{ok}, %q{
+ catch(:foo){
+ 1.times{
+ throw :foo, :ok
+ }
+ }
+}
+assert_equal %q{ok}, %q{
+ catch(:foo){
+ catch(:bar){
+ throw :foo, :ok
+ }
+ :ng
+ }
+}
+assert_equal %q{ok}, %q{
+ catch(:foo){
+ catch(:bar){
+ 1.times{
+ throw :foo, :ok
+ }
+ }
+ :ng
+ }
+}
+assert_equal %q{2}, %q{
+ module Enumerable
+ def all_?
+ self.each{|e|
+ unless yield(e)
+ return false
+ end
+ }
+ true
+ end
+ end
+
+ xxx = 0
+ [1,2].each{|bi|
+ [3,4].each{|bj|
+ [true, nil, true].all_?{|be| be}
+ break
+ }
+ xxx += 1
+ }
+ xxx
+}
+assert_equal %q{ok}, %q{
+ def m
+ yield
+ end
+
+ m{
+ begin
+ ensure
+ break :ok
+ end
+ }
+}
+assert_equal %q{ok}, %q{
+ def m
+ yield
+ :ok
+ end
+ i=0
+ m{
+ if i>10
+ i*i
+ else
+ i+=1
+ next
+ end
+ }
+}
+assert_equal %q{ok}, %q{
+ def m
+ yield
+ end
+
+ m{
+ next :ok
+ }
+}
+assert_equal %q{131}, %q{
+ def m
+ yield + 10
+ end
+ i=0
+ m{
+ if i>10
+ i*i
+ else
+ i+=1
+ redo
+ end
+ }
+}
+assert_equal %q{ok}, %q{
+begin
+ eval %q{
+ 1.times{
+ retry
+ }
+ }
+rescue SyntaxError
+ :ok
+end
+}
+assert_equal %q{3}, %q{
+ def m
+ return 3
+ end
+ m
+}
+assert_equal %q{ok}, %q{
+ def m
+ :ng1
+ mm{
+ return :ok
+ }
+ :ng2
+ end
+
+ def mm
+ :ng3
+ yield
+ :ng4
+ end
+ m
+}
+assert_equal %q{100}, %q{
+ $i = 0
+ def m
+ begin
+ iter{
+ return
+ }
+ ensure
+ $i = 100
+ end
+ end
+
+ def iter
+ yield
+ end
+ m
+ $i
+}
+assert_equal %q{ok}, %q{
+ def m
+ begin
+ raise
+ rescue
+ return :ok
+ end
+ :ng
+ end
+ m
+}
+assert_equal %q{1}, %q{
+ def m
+ begin
+ raise
+ rescue
+ return 1
+ end
+ end
+
+ m
+}
+assert_equal %q{1}, %q{
+ def m
+ begin
+ #
+ ensure
+ return 1
+ end
+ end
+
+ m
+}
+assert_equal 'ok', %q{
+ begin
+ catch {|t| throw t, :ok }
+ rescue ArgumentError
+ :ng
+ end
+}, '[ruby-dev:31609]'
+
+assert_equal "1", %q{
+ catch do |t|
+ begin
+ throw t, 1
+ 2
+ ensure
+ 3
+ end
+ end
+}, "[ruby-dev:31698]"
+
+assert_normal_exit %q{
+ f = 0
+ 1.times do
+ begin
+ f += 1
+ ensure
+ redo unless f > 2
+ end
+ end
+}
+
+assert_normal_exit %q{
+ -> do
+ 1.times do
+ begin
+ raise
+ rescue
+ return
+ end
+ end
+ end.call
+}
+
+assert_normal_exit %q{
+ while true
+ begin
+ raise
+ next
+ rescue
+ end
+ break
+ end
+}, '[ruby-core:28172]'
+
+assert_equal "true", %q{
+ class Object
+ def return_eigenclass
+ class << self
+ return self
+ end
+ end
+ end
+ s = "foo"
+ s.return_eigenclass == class << s; self; end
+}, '[ruby-core:21379]'
+
+assert_equal "true", %q{
+ class Object
+ def yield_eigenclass
+ class << self
+ yield self
+ end
+ end
+ end
+ s = "foo"
+ s.yield_eigenclass {|c| c == class << s; self; end }
+}, '[ruby-dev:40975]'
diff --git a/bootstraptest/test_literal.rb b/bootstraptest/test_literal.rb
new file mode 100644
index 0000000000..aa65bddae1
--- /dev/null
+++ b/bootstraptest/test_literal.rb
@@ -0,0 +1,231 @@
+# empty program
+assert_equal '', ''
+assert_equal '', ' '
+assert_equal '', "\n"
+
+# special const
+assert_equal 'true', 'true'
+assert_equal 'TrueClass', 'true.class'
+assert_equal 'false', 'false'
+assert_equal 'FalseClass', 'false.class'
+assert_equal '', 'nil'
+assert_equal 'nil', 'nil.inspect'
+assert_equal 'NilClass', 'nil.class'
+assert_equal 'sym', ':sym'
+assert_equal ':sym', ':sym.inspect'
+assert_equal 'Symbol', ':sym.class'
+assert_equal '1234', '1234'
+assert_equal 'Fixnum', '1234.class'
+assert_equal '1234', '1_2_3_4'
+assert_equal 'Fixnum', '1_2_3_4.class'
+assert_equal '18', '0x12'
+assert_equal 'Fixnum', '0x12.class'
+assert_equal '15', '0o17'
+assert_equal 'Fixnum', '0o17.class'
+assert_equal '5', '0b101'
+assert_equal 'Fixnum', '0b101.class'
+assert_equal '123456789012345678901234567890', '123456789012345678901234567890'
+assert_equal 'Bignum', '123456789012345678901234567890.class'
+assert_equal '2.0', '2.0'
+assert_equal 'Float', '1.3.class'
+
+# self
+assert_equal 'main', 'self'
+assert_equal 'Object', 'self.class'
+
+# string literal
+assert_equal 'a', '?a'
+assert_equal 'String', '?a.class'
+assert_equal 'A', '?A'
+assert_equal 'String', '?A.class'
+assert_equal "\n", '?\n'
+assert_equal 'String', '?\n.class'
+assert_equal ' ', '?\ '
+assert_equal 'String', '?\ .class'
+assert_equal 'string', "'string'"
+assert_equal 'string', '"string"'
+assert_equal 'string', '%(string)'
+assert_equal 'string', '%q(string)'
+assert_equal 'string', '%Q(string)'
+assert_equal 'string string', '"string string"'
+assert_equal ' ', '" "'
+assert_equal "\0", '"\0"'
+assert_equal "\1", '"\1"'
+assert_equal "3", '"\x33"'
+assert_equal "\n", '"\n"'
+
+# dynamic string literal
+assert_equal '2', '"#{1 + 1}"'
+assert_equal '16', '"#{2 ** 4}"'
+assert_equal 'string', 's = "string"; "#{s}"'
+
+# dynamic symbol literal
+assert_equal 'a3c', ':"a#{1+2}c"'
+assert_equal ':a3c', ':"a#{1+2}c".inspect'
+assert_equal 'Symbol', ':"a#{1+2}c".class'
+
+# xstring
+unless nacl?
+ assert_equal "foo\n", %q(`echo foo`)
+ assert_equal "foo\n", %q(s = "foo"; `echo #{s}`)
+end
+
+# regexp
+assert_equal '', '//.source'
+assert_equal 'Regexp', '//.class'
+assert_equal '0', '// =~ "a"'
+assert_equal '0', '// =~ ""'
+assert_equal 'a', '/a/.source'
+assert_equal 'Regexp', '/a/.class'
+assert_equal '0', '/a/ =~ "a"'
+assert_equal '0', '/test/ =~ "test"'
+assert_equal '', '/test/ =~ "tes"'
+assert_equal '0', 're = /test/; re =~ "test"'
+assert_equal '0', 'str = "test"; /test/ =~ str'
+assert_equal '0', 're = /test/; str = "test"; re =~ str'
+
+# dynamic regexp
+assert_equal 'regexp', %q(/re#{'ge'}xp/.source)
+assert_equal 'Regexp', %q(/re#{'ge'}xp/.class)
+
+# array
+assert_equal 'Array', '[].class'
+assert_equal '0', '[].size'
+assert_equal '0', '[].length'
+assert_equal '[]', '[].inspect'
+assert_equal 'Array', '[0].class'
+assert_equal '1', '[3].size'
+assert_equal '[3]', '[3].inspect'
+assert_equal '3', 'a = [3]; a[0]'
+assert_equal 'Array', '[1,2].class'
+assert_equal '2', '[1,2].size'
+assert_equal '[1, 2]', '[1,2].inspect'
+assert_equal 'Array', '[1,2,3,4,5].class'
+assert_equal '5', '[1,2,3,4,5].size'
+assert_equal '[1, 2, 3, 4, 5]', '[1,2,3,4,5].inspect'
+assert_equal '1', 'a = [1,2]; a[0]'
+assert_equal '2', 'a = [1,2]; a[1]'
+assert_equal 'Array', 'a = [1 + 2, 3 + 4, 5 + 6]; a.class'
+assert_equal '[3, 7, 11]', 'a = [1 + 2, 3 + 4, 5 + 6]; a.inspect'
+assert_equal '7', 'a = [1 + 2, 3 + 4, 5 + 6]; a[1]'
+assert_equal '1', '([0][0] += 1)'
+assert_equal '1', '([2][0] -= 1)'
+assert_equal 'Array', 'a = [obj = Object.new]; a.class'
+assert_equal '1', 'a = [obj = Object.new]; a.size'
+assert_equal 'true', 'a = [obj = Object.new]; a[0] == obj'
+assert_equal '5', 'a = [1,2,3]; a[1] = 5; a[1]'
+assert_equal 'bar', '[*:foo];:bar'
+assert_equal '[1, 2]', 'def nil.to_a; [2]; end; [1, *nil]'
+assert_equal '[1, 2]', 'def nil.to_a; [1, 2]; end; [*nil]'
+assert_equal '[0, 1, {2=>3}]', '[0, *[1], 2=>3]', "[ruby-dev:31592]"
+
+
+# hash
+assert_equal 'Hash', '{}.class'
+assert_equal '{}', '{}.inspect'
+assert_equal 'Hash', '{1=>2}.class'
+assert_equal '{1=>2}', '{1=>2}.inspect'
+assert_equal '2', 'h = {1 => 2}; h[1]'
+assert_equal '0', 'h = {1 => 2}; h.delete(1); h.size'
+assert_equal '', 'h = {1 => 2}; h.delete(1); h[1]'
+assert_equal '2', 'h = {"string" => "literal", "goto" => "hell"}; h.size'
+assert_equal 'literal', 'h = {"string"=>"literal", "goto"=>"hell"}; h["string"]'
+assert_equal 'hell', 'h = {"string"=>"literal", "goto"=>"hell"}; h["goto"]'
+
+# range
+assert_equal 'Range', '(1..2).class'
+assert_equal '1..2', '(1..2).inspect'
+assert_equal '1', '(1..2).begin'
+assert_equal '2', '(1..2).end'
+assert_equal 'false', '(1..2).exclude_end?'
+assert_equal 'Range', 'r = 1..2; r.class'
+assert_equal '1..2', 'r = 1..2; r.inspect'
+assert_equal '1', 'r = 1..2; r.begin'
+assert_equal '2', 'r = 1..2; r.end'
+assert_equal 'false', 'r = 1..2; r.exclude_end?'
+assert_equal 'Range', '(1...3).class'
+assert_equal '1...3', '(1...3).inspect'
+assert_equal '1', '(1...3).begin'
+assert_equal '3', '(1...3).end'
+assert_equal 'true', '(1...3).exclude_end?'
+assert_equal 'Range', 'r = (1...3); r.class'
+assert_equal '1...3', 'r = (1...3); r.inspect'
+assert_equal '1', 'r = (1...3); r.begin'
+assert_equal '3', 'r = (1...3); r.end'
+assert_equal 'true', 'r = (1...3); r.exclude_end?'
+assert_equal 'Range', 'r = (1+2 .. 3+4); r.class'
+assert_equal '3..7', 'r = (1+2 .. 3+4); r.inspect'
+assert_equal '3', 'r = (1+2 .. 3+4); r.begin'
+assert_equal '7', 'r = (1+2 .. 3+4); r.end'
+assert_equal 'false', 'r = (1+2 .. 3+4); r.exclude_end?'
+assert_equal 'Range', 'r = (1+2 ... 3+4); r.class'
+assert_equal '3...7', 'r = (1+2 ... 3+4); r.inspect'
+assert_equal '3', 'r = (1+2 ... 3+4); r.begin'
+assert_equal '7', 'r = (1+2 ... 3+4); r.end'
+assert_equal 'true', 'r = (1+2 ... 3+4); r.exclude_end?'
+assert_equal 'Range', 'r = ("a".."c"); r.class'
+assert_equal '"a".."c"', 'r = ("a".."c"); r.inspect'
+assert_equal 'a', 'r = ("a".."c"); r.begin'
+assert_equal 'c', 'r = ("a".."c"); r.end'
+
+assert_equal 'String', '__FILE__.class'
+assert_equal 'Fixnum', '__LINE__.class'
+
+###
+
+assert_equal 'ok', %q{
+ # this cause "called on terminated object".
+ ObjectSpace.each_object(Module) {|m| m.name.inspect }
+ :ok
+}
+
+assert_normal_exit %q{
+ begin
+ r = 0**-1
+ r + r
+ rescue
+ end
+}, '[ruby-dev:34524]'
+
+assert_normal_exit %q{
+ begin
+ r = Marshal.load("\x04\bU:\rRational[\ai\x06i\x05")
+ r + r
+ rescue
+ end
+}, '[ruby-dev:34536]'
+
+assert_equal 'ok', %q{
+ "#{}""#{}ok"
+}, '[ruby-dev:38968]'
+
+assert_equal 'ok', %q{
+ "#{}o""#{}k""#{}"
+}, '[ruby-core:25284]'
+
+assert_equal 'ok', %q{ # long array literal
+ x = nil
+ eval "a = [#{(1..10_000).map{'x'}.join(", ")}]"
+ :ok
+}
+
+assert_equal 'ok', %q{ # long array literal (optimized)
+ eval "a = [#{(1..10_000).to_a.join(", ")}]"
+ :ok
+}
+
+assert_equal 'ok', %q{ # long hash literal
+ x = nil
+ eval "a = {#{(1..10_000).map{|n| "#{n} => x"}.join(', ')}}"
+ :ok
+}
+
+assert_equal 'ok', %q{ # long hash literal (optimized)
+ eval "a = {#{(1..10_000).map{|n| "#{n} => #{n}"}.join(', ')}}"
+ :ok
+}
+
+assert_equal 'ok', %q{
+ [print(:ok), exit] # void literal with side-effect
+ :dummy
+}
diff --git a/bootstraptest/test_literal_suffix.rb b/bootstraptest/test_literal_suffix.rb
new file mode 100644
index 0000000000..4316c9e040
--- /dev/null
+++ b/bootstraptest/test_literal_suffix.rb
@@ -0,0 +1,54 @@
+# numbers with suffix
+assert_equal '0/1', '0r'
+assert_equal 'Rational', '0r.class'
+assert_equal '1/1', '1r'
+assert_equal 'Rational', '1r.class'
+assert_equal '-1/1', '-1r'
+assert_equal 'Rational', '(-1r).class'
+assert_equal '1/1', '0x1r'
+assert_equal 'Rational', '0x1r.class'
+assert_equal '1/1', '0b1r'
+assert_equal 'Rational', '0b1r.class'
+assert_equal '1/1', '0d1r'
+assert_equal 'Rational', '0d1r.class'
+assert_equal '1/1', '0o1r'
+assert_equal 'Rational', '0o1r.class'
+assert_equal '1/1', '01r'
+assert_equal 'Rational', '01r.class'
+assert_equal '6/5', '1.2r'
+assert_equal 'Rational', '1.2r.class'
+assert_equal '-6/5', '-1.2r'
+assert_equal 'Rational', '(-1.2r).class'
+assert_equal '0+0i', '0i'
+assert_equal 'Complex', '0i.class'
+assert_equal '0+1i', '1i'
+assert_equal 'Complex', '1i.class'
+assert_equal '0+1i', '0x1i'
+assert_equal 'Complex', '0x1i.class'
+assert_equal '0+1i', '0b1i'
+assert_equal 'Complex', '0b1i.class'
+assert_equal '0+1i', '0d1i'
+assert_equal 'Complex', '0d1i.class'
+assert_equal '0+1i', '0o1i'
+assert_equal 'Complex', '0o1i.class'
+assert_equal '0+1i', '01i'
+assert_equal 'Complex', '01i.class'
+assert_equal '0+1.2i', '1.2i'
+assert_equal 'Complex', '1.2i.class'
+assert_equal '0+1/1i', '1ri'
+assert_equal 'Complex', '1ri.class'
+assert_equal '0+6/5i', '1.2ri'
+assert_equal 'Complex', '1.2ri.class'
+assert_equal '0+10.0i', '1e1i'
+assert_equal 'Complex', '1e1i.class'
+assert_equal '1', '1if true'
+assert_equal '1', '1rescue nil'
+assert_equal '10000000000000000001/10000000000000000000',
+ '1.0000000000000000001r'
+
+assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
+ %q{begin eval('1ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
+assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
+ %q{begin eval('1.2ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
+assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
+ %q{begin eval('1e1r', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
diff --git a/bootstraptest/test_load.rb b/bootstraptest/test_load.rb
new file mode 100644
index 0000000000..e63c93a8f4
--- /dev/null
+++ b/bootstraptest/test_load.rb
@@ -0,0 +1,27 @@
+assert_equal 'ok', %q{
+ open("require-lock-test.rb", "w") {|f|
+ f.puts "sleep 0.1"
+ f.puts "module M"
+ f.puts "end"
+ }
+ $:.unshift Dir.pwd
+ vs = (1..2).map {|i|
+ Thread.start {
+ require "require-lock-test"
+ M
+ }
+ }.map {|t| t.value }
+ vs[0] == M && vs[1] == M ? :ok : :ng
+}, '[ruby-dev:32048]'
+
+assert_equal 'ok', %q{
+ %w[a a/foo b].each {|d| Dir.mkdir(d)}
+ open("b/foo", "w") {|f| f.puts "$ok = :ok"}
+ $:.replace(%w[a b])
+ begin
+ load "foo"
+ $ok
+ rescue => e
+ e.message
+ end
+}, '[ruby-dev:38097]'
diff --git a/bootstraptest/test_marshal.rb b/bootstraptest/test_marshal.rb
new file mode 100644
index 0000000000..7e34176169
--- /dev/null
+++ b/bootstraptest/test_marshal.rb
@@ -0,0 +1,5 @@
+
+assert_normal_exit %q{
+ Marshal.load(Marshal.dump({"k"=>"v"}), lambda {|v| v})
+}
+
diff --git a/bootstraptest/test_massign.rb b/bootstraptest/test_massign.rb
new file mode 100644
index 0000000000..0f63dd424a
--- /dev/null
+++ b/bootstraptest/test_massign.rb
@@ -0,0 +1,183 @@
+assert_equal '[[1], 2, 3]', '*v1, (a, b) = [1,[2, 3]]; [v1, a, b]'
+assert_equal '[[1], 2, 3]', '*v1,(*), (a, b) = [1,:x,[2, 3]]; [v1, a, b]'
+
+assert_equal '[]', '*a = *nil; a'
+assert_equal '[nil]', '*a = nil; a'
+assert_equal '2', 'a, a = 1, 2; a', "[ruby-dev:31522]"
+assert_equal '[1, 2]', 'a, b = 1, 2'
+assert_equal '[1, 2]', %q{
+ ans = []
+ trace_var(:$a){|v| ans << v}
+ trace_var(:$b){|v| ans << v}
+ $a, $b = 1, 2
+ ans
+}
+
+assert_equal 'ok', %q{
+ r = :ok
+ :ng.tap {|(r)|}
+ r
+}, '[ruby-dev:31507]'
+
+=begin
+# generated by this script:
+
+3.times{|i|
+ 8.times{|e|
+ ary = (0...e).to_a
+ a,b,c,d,e,f = nil
+ vals = %w(a b c d e f)
+ vals[i] = '*' + vals[i]
+ program = "#{vals.join(", ")} = *ary"
+ eval(program)
+ ans = [a,b,c,d,e,f]
+ puts %Q{
+ assert_equal "#{ans.inspect}", %q{
+ ary = #{ary.inspect}
+ #{program}; [a, b, c, d, e, f]
+ }}
+ }
+}
+=end
+
+ assert_equal "[[], nil, nil, nil, nil, nil]", %q{
+ ary = []
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[], 0, nil, nil, nil, nil]", %q{
+ ary = [0]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[], 0, 1, nil, nil, nil]", %q{
+ ary = [0, 1]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[], 0, 1, 2, nil, nil]", %q{
+ ary = [0, 1, 2]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[], 0, 1, 2, 3, nil]", %q{
+ ary = [0, 1, 2, 3]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[], 0, 1, 2, 3, 4]", %q{
+ ary = [0, 1, 2, 3, 4]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[0], 1, 2, 3, 4, 5]", %q{
+ ary = [0, 1, 2, 3, 4, 5]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[[0, 1], 2, 3, 4, 5, 6]", %q{
+ ary = [0, 1, 2, 3, 4, 5, 6]
+ *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[nil, [], nil, nil, nil, nil]", %q{
+ ary = []
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [], nil, nil, nil, nil]", %q{
+ ary = [0]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [], 1, nil, nil, nil]", %q{
+ ary = [0, 1]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [], 1, 2, nil, nil]", %q{
+ ary = [0, 1, 2]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [], 1, 2, 3, nil]", %q{
+ ary = [0, 1, 2, 3]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [], 1, 2, 3, 4]", %q{
+ ary = [0, 1, 2, 3, 4]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [1], 2, 3, 4, 5]", %q{
+ ary = [0, 1, 2, 3, 4, 5]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, [1, 2], 3, 4, 5, 6]", %q{
+ ary = [0, 1, 2, 3, 4, 5, 6]
+ a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[nil, nil, [], nil, nil, nil]", %q{
+ ary = []
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, nil, [], nil, nil, nil]", %q{
+ ary = [0]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, 1, [], nil, nil, nil]", %q{
+ ary = [0, 1]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, 1, [], 2, nil, nil]", %q{
+ ary = [0, 1, 2]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, 1, [], 2, 3, nil]", %q{
+ ary = [0, 1, 2, 3]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, 1, [], 2, 3, 4]", %q{
+ ary = [0, 1, 2, 3, 4]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, 1, [2], 3, 4, 5]", %q{
+ ary = [0, 1, 2, 3, 4, 5]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+ assert_equal "[0, 1, [2, 3], 4, 5, 6]", %q{
+ ary = [0, 1, 2, 3, 4, 5, 6]
+ a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+ }
+
+
+#