summaryrefslogtreecommitdiff
path: root/benchmark
diff options
context:
space:
mode:
Diffstat (limited to 'benchmark')
-rw-r--r--benchmark/README.md75
-rw-r--r--benchmark/app_answer.rb (renamed from benchmark/bm_app_answer.rb)0
-rw-r--r--benchmark/app_aobench.rb (renamed from benchmark/bm_app_aobench.rb)14
-rw-r--r--benchmark/app_erb.yml23
-rw-r--r--benchmark/app_factorial.rb (renamed from benchmark/bm_app_factorial.rb)0
-rw-r--r--benchmark/app_fib.rb (renamed from benchmark/bm_app_fib.rb)2
-rw-r--r--benchmark/app_lc_fizzbuzz.rb (renamed from benchmark/bm_app_lc_fizzbuzz.rb)0
-rw-r--r--benchmark/app_mandelbrot.rb (renamed from benchmark/bm_app_mandelbrot.rb)0
-rw-r--r--benchmark/app_pentomino.rb (renamed from benchmark/bm_app_pentomino.rb)129
-rw-r--r--benchmark/app_raise.rb (renamed from benchmark/bm_app_raise.rb)0
-rw-r--r--benchmark/app_strconcat.rb (renamed from benchmark/bm_app_strconcat.rb)0
-rw-r--r--benchmark/app_tak.rb (renamed from benchmark/bm_app_tak.rb)0
-rw-r--r--benchmark/app_tarai.rb (renamed from benchmark/bm_app_tarai.rb)0
-rw-r--r--benchmark/app_uri.rb (renamed from benchmark/bm_app_uri.rb)0
-rw-r--r--benchmark/array_flatten.yml19
-rw-r--r--benchmark/array_intersection.yml14
-rw-r--r--benchmark/array_large_literal.yml19
-rw-r--r--benchmark/array_max_float.yml30
-rw-r--r--benchmark/array_max_int.yml31
-rw-r--r--benchmark/array_max_str.yml30
-rw-r--r--benchmark/array_min.yml31
-rw-r--r--benchmark/array_sample.yml4
-rw-r--r--benchmark/array_sample_100k_10.rb2
-rw-r--r--benchmark/array_sample_100k_11.rb2
-rw-r--r--benchmark/array_sample_100k__100.rb2
-rw-r--r--benchmark/array_sample_100k__1k.rb2
-rw-r--r--benchmark/array_sample_100k__6k.rb2
-rw-r--r--benchmark/array_sample_100k___10k.rb2
-rw-r--r--benchmark/array_sample_100k___50k.rb2
-rw-r--r--benchmark/array_shift.rb (renamed from benchmark/bm_array_shift.rb)0
-rw-r--r--benchmark/array_small_and.rb17
-rw-r--r--benchmark/array_small_diff.rb17
-rw-r--r--benchmark/array_small_or.rb17
-rw-r--r--benchmark/array_sort_block.rb2
-rw-r--r--benchmark/array_sort_float.rb2
-rw-r--r--benchmark/array_sort_int.yml15
-rw-r--r--benchmark/array_values_at_int.rb2
-rw-r--r--benchmark/array_values_at_range.rb2
-rw-r--r--benchmark/attr_accessor.yml29
-rw-r--r--benchmark/bighash.rb1
-rw-r--r--benchmark/bm_app_erb.rb26
-rw-r--r--benchmark/bm_require.rb7
-rw-r--r--benchmark/bm_require_thread.rb15
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rw-r--r--benchmark/bm_vm1_attr_ivar.rb14
-rw-r--r--benchmark/bm_vm1_attr_ivar_set.rb14
-rw-r--r--benchmark/bm_vm1_block.rb10
-rw-r--r--benchmark/bm_vm1_const.rb8
-rw-r--r--benchmark/bm_vm1_ensure.rb11
-rw-r--r--benchmark/bm_vm1_float_simple.rb7
-rw-r--r--benchmark/bm_vm1_gc_short_lived.rb10
-rw-r--r--benchmark/bm_vm1_gc_short_with_complex_long.rb27
-rw-r--r--benchmark/bm_vm1_gc_short_with_long.rb13
-rw-r--r--benchmark/bm_vm1_gc_short_with_symbol.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_ary.rb12
-rw-r--r--benchmark/bm_vm1_gc_wb_ary_promoted.rb14
-rw-r--r--benchmark/bm_vm1_gc_wb_obj.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_obj_promoted.rb17
-rw-r--r--benchmark/bm_vm1_ivar.rb8
-rw-r--r--benchmark/bm_vm1_ivar_set.rb6
-rw-r--r--benchmark/bm_vm1_length.rb9
-rw-r--r--benchmark/bm_vm1_lvar_init.rb18
-rw-r--r--benchmark/bm_vm1_lvar_set.rb5
-rw-r--r--benchmark/bm_vm1_neq.rb8
-rw-r--r--benchmark/bm_vm1_not.rb7
-rw-r--r--benchmark/bm_vm1_rescue.rb7
-rw-r--r--benchmark/bm_vm1_simplereturn.rb9
-rw-r--r--benchmark/bm_vm1_swap.rb8
-rw-r--r--benchmark/bm_vm1_yield.rb10
-rw-r--r--benchmark/bm_vm2_bigarray.rb106
-rw-r--r--benchmark/bm_vm2_bighash.rb5
-rw-r--r--benchmark/bm_vm2_case.rb14
-rw-r--r--benchmark/bm_vm2_defined_method.rb9
-rw-r--r--benchmark/bm_vm2_method_missing.rb12
-rw-r--r--benchmark/bm_vm2_method_with_block.rb9
-rw-r--r--benchmark/bm_vm2_mutex.rb9
-rw-r--r--benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_raise1.rb18
-rw-r--r--benchmark/bm_vm2_raise2.rb18
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_string_literal.rb5
-rw-r--r--benchmark/bm_vm2_struct_big_aref_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aref_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_href_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_href_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_hset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aref.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_href.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_hset.rb7
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rw-r--r--benchmark/bm_vm_thread_alive_check1.rb6
-rw-r--r--benchmark/bm_vm_thread_pass_flood.rb8
-rw-r--r--benchmark/buffer_each.yml27
-rw-r--r--benchmark/buffer_get.yml25
-rw-r--r--benchmark/cgi_escape_html.yml31
-rw-r--r--benchmark/class_superclass.yml23
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/constant_invalidation.rb22
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/driver.rb400
-rw-r--r--benchmark/enum_lazy_flat_map.yml16
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/enum_lazy_zip.yml22
-rw-r--r--benchmark/enum_minmax.yml25
-rw-r--r--benchmark/enum_sort.yml15
-rw-r--r--benchmark/enum_sort_by.yml53
-rw-r--r--benchmark/enum_tally.yml4
-rw-r--r--benchmark/erb_escape_html.yml31
-rw-r--r--benchmark/erb_render.yml24
-rw-r--r--benchmark/fiber_chain.yml36
-rw-r--r--benchmark/fiber_locals.yml8
-rw-r--r--benchmark/file_basename.yml6
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_dirname.yml6
-rw-r--r--benchmark/file_extname.yml6
-rw-r--r--benchmark/file_join.yml7
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/float_methods.yml14
-rw-r--r--benchmark/float_neg_posi.yml8
-rw-r--r--benchmark/float_to_s.yml7
-rw-r--r--benchmark/gc/aobench.rb2
-rw-r--r--benchmark/gc/binary_trees.rb2
-rw-r--r--benchmark/gc/gcbench.rb3
-rw-r--r--benchmark/gc/pentomino.rb2
-rw-r--r--benchmark/hash_aref_array.rb5
-rw-r--r--benchmark/hash_aref_dsym.rb (renamed from benchmark/bm_hash_aref_dsym.rb)0
-rw-r--r--benchmark/hash_aref_dsym_long.rb (renamed from benchmark/bm_hash_aref_dsym_long.rb)0
-rw-r--r--benchmark/hash_aref_fix.rb (renamed from benchmark/bm_hash_aref_fix.rb)0
-rw-r--r--benchmark/hash_aref_flo.rb (renamed from benchmark/bm_hash_aref_flo.rb)0
-rw-r--r--benchmark/hash_aref_miss.rb (renamed from benchmark/bm_hash_aref_miss.rb)0
-rw-r--r--benchmark/hash_aref_str.rb (renamed from benchmark/bm_hash_aref_str.rb)0
-rw-r--r--benchmark/hash_aref_str_lit.yml20
-rw-r--r--benchmark/hash_aref_sym.rb (renamed from benchmark/bm_hash_aref_sym.rb)0
-rw-r--r--benchmark/hash_aref_sym_long.rb (renamed from benchmark/bm_hash_aref_sym_long.rb)0
-rw-r--r--benchmark/hash_defaults.yml6
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_first.yml11
-rw-r--r--benchmark/hash_flatten.rb (renamed from benchmark/bm_hash_flatten.rb)0
-rw-r--r--benchmark/hash_ident_flo.rb (renamed from benchmark/bm_hash_ident_flo.rb)0
-rw-r--r--benchmark/hash_ident_num.rb (renamed from benchmark/bm_hash_ident_num.rb)0
-rw-r--r--benchmark/hash_ident_obj.rb (renamed from benchmark/bm_hash_ident_obj.rb)0
-rw-r--r--benchmark/hash_ident_str.rb (renamed from benchmark/bm_hash_ident_str.rb)0
-rw-r--r--benchmark/hash_ident_sym.rb (renamed from benchmark/bm_hash_ident_sym.rb)0
-rw-r--r--benchmark/hash_key.yml5
-rw-r--r--benchmark/hash_keys.rb (renamed from benchmark/bm_hash_keys.rb)0
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_new.yml16
-rw-r--r--benchmark/hash_shift.rb (renamed from benchmark/bm_hash_shift.rb)0
-rw-r--r--benchmark/hash_shift_u16.rb10
-rw-r--r--benchmark/hash_shift_u24.rb10
-rw-r--r--benchmark/hash_shift_u32.rb10
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb9
-rw-r--r--benchmark/hash_values.rb (renamed from benchmark/bm_hash_values.rb)0
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_close.yml13
-rw-r--r--benchmark/io_close_contended.yml21
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb (renamed from benchmark/bm_io_file_create.rb)0
-rw-r--r--benchmark/io_file_read.rb (renamed from benchmark/bm_io_file_read.rb)0
-rw-r--r--benchmark/io_file_write.rb (renamed from benchmark/bm_io_file_write.rb)0
-rw-r--r--benchmark/io_nonblock_noex.rb (renamed from benchmark/bm_io_nonblock_noex.rb)0
-rw-r--r--benchmark/io_nonblock_noex2.rb21
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb (renamed from benchmark/bm_io_select.rb)0
-rw-r--r--benchmark/io_select2.rb (renamed from benchmark/bm_io_select2.rb)0
-rw-r--r--benchmark/io_select3.rb (renamed from benchmark/bm_io_select3.rb)0
-rw-r--r--benchmark/io_write.rb22
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/iseq_load_from_binary.yml25
-rw-r--r--benchmark/ivar_extend.yml23
-rw-r--r--benchmark/kernel_clone.yml6
-rw-r--r--benchmark/kernel_float.yml5
-rw-r--r--benchmark/kernel_tap.yml6
-rw-r--r--benchmark/kernel_then.yml6
-rw-r--r--benchmark/keyword_arguments.yml13
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/ractor.rb122
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_each.yml4
-rw-r--r--benchmark/loop_for.rb (renamed from benchmark/bm_loop_for.rb)0
-rw-r--r--benchmark/loop_generator.rb (renamed from benchmark/bm_loop_generator.rb)2
-rw-r--r--benchmark/loop_times.rb (renamed from benchmark/bm_loop_times.rb)0
-rw-r--r--benchmark/loop_times_megamorphic.yml7
-rw-r--r--benchmark/loop_whileloop.rb (renamed from benchmark/bm_loop_whileloop.rb)0
-rw-r--r--benchmark/loop_whileloop2.rb (renamed from benchmark/bm_loop_whileloop2.rb)0
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/marshal_dump_flo.rb (renamed from benchmark/bm_marshal_dump_flo.rb)0
-rw-r--r--benchmark/marshal_dump_load_geniv.rb (renamed from benchmark/bm_marshal_dump_load_geniv.rb)0
-rw-r--r--benchmark/marshal_dump_load_integer.yml22
-rw-r--r--benchmark/marshal_dump_load_time.rb (renamed from benchmark/bm_marshal_dump_load_time.rb)0
-rw-r--r--benchmark/masgn.yml53
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/method_bind_call.yml16
-rw-r--r--benchmark/module_eqq.yml32
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/nilclass.yml16
-rw-r--r--benchmark/num_zero_p.yml8
-rw-r--r--benchmark/numeric_methods.yml29
-rw-r--r--benchmark/object_allocate.yml49
-rw-r--r--benchmark/object_class.yml40
-rw-r--r--benchmark/object_id.yml4
-rw-r--r--benchmark/objspace_dump_all.yml13
-rw-r--r--benchmark/other-lang/fact.py2
-rw-r--r--benchmark/pm_array.yml19
-rw-r--r--benchmark/prepare_require.rb25
-rw-r--r--benchmark/prepare_require_thread.rb2
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/ractor_const.yml4
-rw-r--r--benchmark/ractor_float_to_s.yml8
-rw-r--r--benchmark/ractor_string_fstring.yml18
-rw-r--r--benchmark/range_bsearch_bignum.yml10
-rw-r--r--benchmark/range_bsearch_endpointless.yml21
-rw-r--r--benchmark/range_bsearch_fixnum.yml10
-rw-r--r--benchmark/range_count.yml11
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/range_min.yml2
-rw-r--r--benchmark/range_overlap.yml19
-rw-r--r--benchmark/range_reverse_each.yml16
-rw-r--r--benchmark/realpath.yml33
-rw-r--r--benchmark/regexp_dup.yml6
-rw-r--r--benchmark/regexp_new.yml7
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/scan.yaml16
-rw-r--r--benchmark/search.yaml16
-rw-r--r--benchmark/securerandom.rb (renamed from benchmark/bm_securerandom.rb)0
-rw-r--r--benchmark/set.yml261
-rw-r--r--benchmark/so_ackermann.rb (renamed from benchmark/bm_so_ackermann.rb)2
-rw-r--r--benchmark/so_array.rb (renamed from benchmark/bm_so_array.rb)2
-rw-r--r--benchmark/so_binary_trees.rb (renamed from benchmark/bm_so_binary_trees.rb)0
-rw-r--r--benchmark/so_concatenate.rb (renamed from benchmark/bm_so_concatenate.rb)2
-rw-r--r--benchmark/so_count_words.yml (renamed from benchmark/wc.input.base)91
-rw-r--r--benchmark/so_exception.rb (renamed from benchmark/bm_so_exception.rb)2
-rw-r--r--benchmark/so_fannkuch.rb (renamed from benchmark/bm_so_fannkuch.rb)0
-rw-r--r--benchmark/so_fasta.rb (renamed from benchmark/bm_so_fasta.rb)2
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb (renamed from benchmark/bm_so_lists.rb)0
-rw-r--r--benchmark/so_mandelbrot.rb (renamed from benchmark/bm_so_mandelbrot.rb)0
-rw-r--r--benchmark/so_matrix.rb (renamed from benchmark/bm_so_matrix.rb)2
-rw-r--r--benchmark/so_meteor_contest.rb (renamed from benchmark/bm_so_meteor_contest.rb)7
-rw-r--r--benchmark/so_nbody.rb (renamed from benchmark/bm_so_nbody.rb)58
-rw-r--r--benchmark/so_nested_loop.rb (renamed from benchmark/bm_so_nested_loop.rb)2
-rw-r--r--benchmark/so_nsieve.rb (renamed from benchmark/bm_so_nsieve.rb)0
-rw-r--r--benchmark/so_nsieve_bits.rb (renamed from benchmark/bm_so_nsieve_bits.rb)0
-rw-r--r--benchmark/so_object.rb (renamed from benchmark/bm_so_object.rb)2
-rw-r--r--benchmark/so_partial_sums.rb (renamed from benchmark/bm_so_partial_sums.rb)0
-rw-r--r--benchmark/so_pidigits.rb (renamed from benchmark/bm_so_pidigits.rb)2
-rw-r--r--benchmark/so_random.rb (renamed from benchmark/bm_so_random.rb)0
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb (renamed from benchmark/bm_so_sieve.rb)0
-rw-r--r--benchmark/so_spectralnorm.rb (renamed from benchmark/bm_so_spectralnorm.rb)0
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_casecmp.yml28
-rw-r--r--benchmark/string_casecmp_p.yml26
-rw-r--r--benchmark/string_concat.yml51
-rw-r--r--benchmark/string_downcase.yml18
-rw-r--r--benchmark/string_dup.yml7
-rw-r--r--benchmark/string_fstring.yml16
-rw-r--r--benchmark/string_gsub.yml43
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_rpartition.yml18
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_slice.yml11
-rw-r--r--benchmark/string_split.yml22
-rw-r--r--benchmark/string_swapcase.yml18
-rw-r--r--benchmark/string_upcase.yml18
-rw-r--r--benchmark/struct_accessor.yml37
-rw-r--r--benchmark/time_at.yml7
-rw-r--r--benchmark/time_new.yml4
-rw-r--r--benchmark/time_now.yml4
-rw-r--r--benchmark/time_parse.yml10
-rw-r--r--benchmark/time_strftime.yml7
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/time_xmlschema.yml27
-rw-r--r--benchmark/vm_array.yml4
-rw-r--r--benchmark/vm_attr_ivar.yml14
-rw-r--r--benchmark/vm_attr_ivar_set.yml14
-rw-r--r--benchmark/vm_backtrace.rb (renamed from benchmark/bm_vm3_backtrace.rb)0
-rw-r--r--benchmark/vm_bigarray.yml105
-rw-r--r--benchmark/vm_bighash.yml4
-rw-r--r--benchmark/vm_block.yml9
-rw-r--r--benchmark/vm_block_handler.yml27
-rw-r--r--benchmark/vm_blockparam.yml7
-rw-r--r--benchmark/vm_blockparam_call.yml8
-rw-r--r--benchmark/vm_blockparam_pass.yml12
-rw-r--r--benchmark/vm_blockparam_yield.yml8
-rw-r--r--benchmark/vm_call_bmethod.yml37
-rw-r--r--benchmark/vm_call_kw_and_kw_splat.yml25
-rw-r--r--benchmark/vm_call_method_missing.yml62
-rw-r--r--benchmark/vm_call_send_iseq.yml77
-rw-r--r--benchmark/vm_call_symproc.yml83
-rw-r--r--benchmark/vm_case.yml13
-rw-r--r--benchmark/vm_case_classes.yml9
-rw-r--r--benchmark/vm_case_lit.yml23
-rw-r--r--benchmark/vm_clearmethodcache.rb (renamed from benchmark/bm_vm3_clearmethodcache.rb)0
-rw-r--r--benchmark/vm_const.yml13
-rw-r--r--benchmark/vm_cvar.yml20
-rw-r--r--benchmark/vm_defined_method.yml8
-rw-r--r--benchmark/vm_dstr.yml6
-rw-r--r--benchmark/vm_dstr_ary.rb (renamed from benchmark/bm_vm2_dstr.rb)2
-rw-r--r--benchmark/vm_dstr_bool.rb (renamed from benchmark/bm_vm2_method.rb)8
-rw-r--r--benchmark/vm_dstr_class_module.rb10
-rw-r--r--benchmark/vm_dstr_digit.rb7
-rw-r--r--benchmark/vm_dstr_int.rb (renamed from benchmark/bm_vm2_newlambda.rb)2
-rw-r--r--benchmark/vm_dstr_nil.rb6
-rw-r--r--benchmark/vm_dstr_obj.rb6
-rw-r--r--benchmark/vm_dstr_obj_def.rb8
-rw-r--r--benchmark/vm_dstr_str.rb (renamed from benchmark/bm_vm2_array.rb)3
-rw-r--r--benchmark/vm_dstr_sym.rb (renamed from benchmark/bm_vm2_eval.rb)4
-rw-r--r--benchmark/vm_ensure.yml14
-rw-r--r--benchmark/vm_eval.yml4
-rw-r--r--benchmark/vm_fiber_allocate.yml8
-rw-r--r--benchmark/vm_fiber_count.yml10
-rw-r--r--benchmark/vm_fiber_reuse.yml14
-rw-r--r--benchmark/vm_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm_fiber_switch.yml9
-rw-r--r--benchmark/vm_float_simple.yml8
-rw-r--r--benchmark/vm_freezeobj.yml6
-rw-r--r--benchmark/vm_freezestring.yml10
-rw-r--r--benchmark/vm_gc.rb (renamed from benchmark/bm_vm3_gc.rb)0
-rw-r--r--benchmark/vm_gc_old_full.rb4
-rw-r--r--benchmark/vm_gc_old_immediate.rb4
-rw-r--r--benchmark/vm_gc_old_lazy.rb4
-rw-r--r--benchmark/vm_gc_short_lived.yml9
-rw-r--r--benchmark/vm_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm_gc_short_with_long.yml13
-rw-r--r--benchmark/vm_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm_gc_wb_ary.yml12
-rw-r--r--benchmark/vm_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm_gc_wb_obj.yml15
-rw-r--r--benchmark/vm_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm_iclass_super.yml20
-rw-r--r--benchmark/vm_ivar.yml6
-rw-r--r--benchmark/vm_ivar_embedded_obj_init.yml14
-rw-r--r--benchmark/vm_ivar_extended_obj_init.yml16
-rw-r--r--benchmark/vm_ivar_generic_get.yml17
-rw-r--r--benchmark/vm_ivar_generic_set.yml14
-rw-r--r--benchmark/vm_ivar_get.yml100
-rw-r--r--benchmark/vm_ivar_get_unintialized.yml12
-rw-r--r--benchmark/vm_ivar_ic_miss.yml20
-rw-r--r--benchmark/vm_ivar_lazy_set.yml12
-rw-r--r--benchmark/vm_ivar_memoize.yml85
-rw-r--r--benchmark/vm_ivar_of_class.yml12
-rw-r--r--benchmark/vm_ivar_of_class_set.yml11
-rw-r--r--benchmark/vm_ivar_set.yml5
-rw-r--r--benchmark/vm_ivar_set_on_instance.yml94
-rw-r--r--benchmark/vm_ivar_set_subclass.yml20
-rw-r--r--benchmark/vm_length.yml8
-rw-r--r--benchmark/vm_lvar_cond_set.yml8
-rw-r--r--benchmark/vm_lvar_init.yml21
-rw-r--r--benchmark/vm_lvar_set.yml4
-rw-r--r--benchmark/vm_method.yml8
-rw-r--r--benchmark/vm_method_missing.yml11
-rw-r--r--benchmark/vm_method_splat_calls.yml13
-rw-r--r--benchmark/vm_method_splat_calls2.yml27
-rw-r--r--benchmark/vm_method_with_block.yml8
-rw-r--r--benchmark/vm_module_ann_const_set.yml4
-rw-r--r--benchmark/vm_module_const_set.yml8
-rw-r--r--benchmark/vm_mutex.yml8
-rw-r--r--benchmark/vm_neq.yml7
-rw-r--r--benchmark/vm_newlambda.yml4
-rw-r--r--benchmark/vm_not.yml6
-rw-r--r--benchmark/vm_poly_method.yml24
-rw-r--r--benchmark/vm_poly_method_ov.yml24
-rw-r--r--benchmark/vm_poly_same_method.yml25
-rw-r--r--benchmark/vm_poly_singleton.yml18
-rw-r--r--benchmark/vm_proc.yml12
-rw-r--r--benchmark/vm_raise1.yml16
-rw-r--r--benchmark/vm_raise2.yml16
-rw-r--r--benchmark/vm_regexp.yml8
-rw-r--r--benchmark/vm_rescue.yml6
-rw-r--r--benchmark/vm_send.yml14
-rw-r--r--benchmark/vm_send_cfunc.yml14
-rw-r--r--benchmark/vm_simplereturn.yml7
-rw-r--r--benchmark/vm_string_literal.yml4
-rw-r--r--benchmark/vm_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm_struct_big_aset.yml11
-rw-r--r--benchmark/vm_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm_struct_big_hset.yml11
-rw-r--r--benchmark/vm_struct_small_aref.yml7
-rw-r--r--benchmark/vm_struct_small_aset.yml11
-rw-r--r--benchmark/vm_struct_small_href.yml7
-rw-r--r--benchmark/vm_struct_small_hset.yml7
-rw-r--r--benchmark/vm_super.yml17
-rw-r--r--benchmark/vm_super_splat_calls.yml25
-rw-r--r--benchmark/vm_swap.yml7
-rw-r--r--benchmark/vm_symbol_block_pass.rb (renamed from benchmark/bm_vm_symbol_block_pass.rb)0
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb (renamed from benchmark/bm_vm_thread_close.rb)0
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb (renamed from benchmark/bm_vm_thread_create_join.rb)0
-rw-r--r--benchmark/vm_thread_mutex1.rb (renamed from benchmark/bm_vm_thread_mutex1.rb)2
-rw-r--r--benchmark/vm_thread_mutex2.rb (renamed from benchmark/bm_vm_thread_mutex2.rb)2
-rw-r--r--benchmark/vm_thread_mutex3.rb (renamed from benchmark/bm_vm_thread_mutex3.rb)2
-rw-r--r--benchmark/vm_thread_pass.rb (renamed from benchmark/bm_vm_thread_pass.rb)6
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb (renamed from benchmark/bm_vm_thread_pipe.rb)2
-rw-r--r--benchmark/vm_thread_queue.rb (renamed from benchmark/bm_vm_thread_queue.rb)4
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--benchmark/vm_unif1.yml7
-rw-r--r--benchmark/vm_yield.yml13
-rw-r--r--benchmark/vm_zsuper.yml18
-rw-r--r--benchmark/vm_zsuper_splat_calls.yml28
452 files changed, 5572 insertions, 1760 deletions
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..9f9192685e
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,75 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+benchmark-driver --help
+Usage: benchmark-driver [options] RUBY|YAML...
+ -r, --runner TYPE Specify runner type: ips, time, memory, once, block (default: ips)
+ -o, --output TYPE Specify output type: compare, simple, markdown, record, all (default: compare)
+ -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+ --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+ --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
+ --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
+ --alternate Alternate executables instead of running the same executable in a row with --repeat-count
+ --bundler Install and use gems specified in Gemfile
+ --filter REGEXP Filter out benchmarks with given regexp
+ --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
+ --timeout SECONDS Timeout ruby command execution with timeout(1)
+ -v, --verbose Verbose mode. Multiple -v options increase visibility (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/app_aobench.rb
index ffab116fcd..c1546e08ab 100644
--- a/benchmark/bm_app_aobench.rb
+++ b/benchmark/app_aobench.rb
@@ -1,3 +1,5 @@
+# coding: US-ASCII
+
# AO render benchmark
# Original program (C) Syoyo Fujita in Javascript (and other languages)
# https://code.google.com/p/aobench/
@@ -9,6 +11,8 @@ IMAGE_HEIGHT = 256
NSUBSAMPLES = 2
NAO_SAMPLES = 8
+srand(0)
+
class Vec
def initialize(x, y, z)
@x = x
@@ -147,7 +151,7 @@ def clamp(f)
i.to_i
end
-def otherBasis(basis, n)
+def orthoBasis(basis, n)
basis[2] = Vec.new(n.x, n.y, n.z)
basis[1] = Vec.new(0.0, 0.0, 0.0)
@@ -179,7 +183,7 @@ class Scene
def ambient_occlusion(isect)
basis = Array.new
- otherBasis(basis, isect.n)
+ orthoBasis(basis, isect.n)
ntheta = NAO_SAMPLES
nphi = NAO_SAMPLES
@@ -229,7 +233,7 @@ class Scene
w.times do |x|
rad = Vec.new(0.0, 0.0, 0.0)
- # Subsmpling
+ # Subsampling
nsubsamples.times do |v|
nsubsamples.times do |u|
@@ -278,12 +282,14 @@ end
alias printf_orig printf
def printf *args
+ # $fp.printf(*args)
end
# File.open("ao.ppm", "w") do |fp|
+ # $fp = fp
printf("P6\n")
printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n")
Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
# end
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+benchmark:
+ app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/bm_app_factorial.rb
+++ b/benchmark/app_factorial.rb
diff --git a/benchmark/bm_app_fib.rb b/benchmark/app_fib.rb
index 34a7b2e725..e61bc8aa32 100644
--- a/benchmark/bm_app_fib.rb
+++ b/benchmark/app_fib.rb
@@ -1,4 +1,4 @@
-def fib n
+def fib(n)
if n < 3
1
else
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ b/benchmark/app_lc_fizzbuzz.rb
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/bm_app_mandelbrot.rb
+++ b/benchmark/app_mandelbrot.rb
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/app_pentomino.rb
index 59c63f358e..47be7b203f 100644
--- a/benchmark/bm_app_pentomino.rb
+++ b/benchmark/app_pentomino.rb
@@ -128,132 +128,3 @@ mkboard
$p[4] = [$p[4][0]]
$pnum = (0...$p.length).to_a
setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
- for x in nb
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- for d in [-ROW, -1, 1, ROW]
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- end
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- end
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- for i in 0...ROW*COL
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- end
-end
-
-def pboard
- print "No. #$no\n"
- for i in 0...COL
- print "|"
- for j in 0...ROW-NP
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- end
- print "\n"
- end
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- for s in x do
- if $b[pos+s] != -1
- f=1
- break
- end
- end
- if f == 0 then
- for s in x do
- $b[pos+s] = i
- end
- a << i
- setpiece(a.dup, pos)
- a.pop
- for s in x do
- $b[pos+s] = -1
- end
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/bm_app_raise.rb
+++ b/benchmark/app_raise.rb
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/bm_app_strconcat.rb
+++ b/benchmark/app_strconcat.rb
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+ small_flat_ary = 5.times.to_a
+ large_flat_ary = 100.times.to_a
+ small_pairs_ary = [[1, 2]] * 5
+ large_pairs_ary = [[1, 2]] * 100
+ mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+ small_flat_ary.flatten: small_flat_ary.flatten
+ small_flat_ary.flatten!: small_flat_ary.flatten!
+ large_flat_ary.flatten: large_flat_ary.flatten
+ large_flat_ary.flatten!: large_flat_ary.flatten!
+ small_pairs_ary.flatten: small_pairs_ary.flatten
+ small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+ large_pairs_ary.flatten: large_pairs_ary.flatten
+ large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+ mostly_flat_ary.flatten: mostly_flat_ary.flatten
+ mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+ small1 = [1, 2, 3]
+ small2 = [1, 2, 3, 4, 5]
+ small3 = [2, 3, 4, 5]
+ small4 = [2]
+ big1 = [1, 2, 3, 4] * 64
+ big2 = [1, 2, 3] * 64
+ big3 = [1, 2] * 64
+
+benchmark:
+ small-&: small1 & small2 & small3 & small4
+ small-intersection: small1.intersection(small2, small3, small4)
+ big-&: big1 & big2 & big3
+ big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
new file mode 100644
index 0000000000..423d68391f
--- /dev/null
+++ b/benchmark/array_large_literal.yml
@@ -0,0 +1,19 @@
+prelude: |
+ def def_array(size)
+ Object.class_eval(<<-END)
+ def array_#{size}
+ x = 1
+ [#{(['x'] * size).join(',')}]
+ end
+ END
+ end
+ def_array(100)
+ def_array(1000)
+ def_array(10000)
+ def_array(100000)
+benchmark:
+ array_100: array_100
+ array_1000: array_1000
+ array_10000: array_10000
+ array_100000: array_100000
+
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_f).shuffle
+ ary10 = 10.times.map(&:to_f).shuffle
+ ary100 = 100.times.map(&:to_f).shuffle
+ ary500 = 500.times.map(&:to_f).shuffle
+ ary1000 = 1000.times.map(&:to_f).shuffle
+ ary2000 = 2500.times.map(&:to_f).shuffle
+ ary3000 = 2500.times.map(&:to_f).shuffle
+ ary5000 = 5000.times.map(&:to_f).shuffle
+ ary10000 = 10000.times.map(&:to_f).shuffle
+ ary20000 = 20000.times.map(&:to_f).shuffle
+ ary50000 = 50000.times.map(&:to_f).shuffle
+ ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+ ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_s).shuffle
+ ary10 = 10.times.map(&:to_s).shuffle
+ ary100 = 100.times.map(&:to_s).shuffle
+ ary500 = 500.times.map(&:to_s).shuffle
+ ary1000 = 1000.times.map(&:to_s).shuffle
+ ary2000 = 2500.times.map(&:to_s).shuffle
+ ary3000 = 2500.times.map(&:to_s).shuffle
+ ary5000 = 5000.times.map(&:to_s).shuffle
+ ary10000 = 10000.times.map(&:to_s).shuffle
+ ary20000 = 20000.times.map(&:to_s).shuffle
+ ary50000 = 50000.times.map(&:to_s).shuffle
+ ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.min: ary2.min
+ ary10.min: ary10.min
+ ary100.min: ary100.min
+ ary500.min: ary500.min
+ ary1000.min: ary1000.min
+ ary2000.min: ary2000.min
+ ary3000.min: ary3000.min
+ ary5000.min: ary5000.min
+ ary10000.min: ary10000.min
+ ary20000.min: ary20000.min
+ ary50000.min: ary50000.min
+ ary100000.min: ary100000.min
+ ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+ - ary.sample
+ - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/bm_array_shift.rb
+++ b/benchmark/array_shift.rb
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 & arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 - arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 | arr2
+ end
+ end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+ ary2.sort: ary2.sort
+ ary10.sort: ary10.sort
+ ary100.sort: ary100.sort
+ ary1000.sort: ary1000.sort
+ ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+ class C
+ attr_accessor :x
+ def initialize
+ @x = nil
+ end
+ class_eval <<-END
+ def ar
+ #{'x;'*256}
+ end
+ def aw
+ #{'self.x = nil;'*256}
+ end
+ def arm
+ m = method(:x)
+ #{'m.call;'*256}
+ end
+ def awm
+ m = method(:x=)
+ #{'m.call(nil);'*256}
+ end
+ END
+ end
+ obj = C.new
+benchmark:
+ attr_reader: "obj.ar"
+ attr_writer: "obj.aw"
+ attr_reader_method: "obj.arm"
+ attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
- require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
- while true
- i = i+1 # dummy loop
- end
-end
-
-1.upto(100) do |i|
- require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_reader :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = obj.a
- k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_accessor :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- obj.a = 1
- obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m{
- }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = Const
- k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
- i += 1
- begin
- begin
- ensure
- end
- ensure
- end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
- i += 1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
- if n == 0
- ''
- else
- 10.times{
- h[Object.new] = nested_hash(h, n-1)
- }
- end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- short_lived_ary[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
- GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
- attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- short_lived_obj.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
- attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
- GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = @a
- k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- @a = 1
- @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a.length
- b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
- unless v
- # unreachable code
- v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
- v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
- v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
- v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
- v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
- end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
- i += 1
- m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- begin
- rescue
- end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- i = 0
- while i<30_000_000 # while loop 1
- i += 1
- yield
- end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
- i += 1
- a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
- case :foo
- when :bar
- raise
- when :baz
- raise
- when :boo
- raise
- when :foo
- i += 1
- end
-end
-
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
- define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def method_missing mid
- end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 7362f738c5..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
- o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
-# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
- b
-end
-
-pr = m{
- a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
- if n > 0
- rec n-1
- else
- raise
- end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
-
- begin
- rec 1
- rescue
- # ignore
- end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
- if n > 0
- rec n-1
- else
- raise
- end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
-
- begin
- rec 10
- rescue
- # ignore
- end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
- /hoge/ =~ str
- i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def m
- end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
deleted file mode 100644
index 1d73036849..0000000000
--- a/benchmark/bm_vm2_string_literal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
- def m
- 1
- end
-end
-
-class CC < C
- def m
- super()
- end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- obj.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
- i += 1
- m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
- def m a
- 1
- end
-end
-
-class CC < C
- def m a
- super
- end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
- obj.m 10
- i += 1
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
- t = Thread.new{}
- while t.alive?
- Thread.pass
- end
-}
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index 27157d1a6f..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-1000.times{
- Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
- i += 1
-end
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+ # frozen_string_literal: true
+ Warning[:experimental] = false
+ string = "The quick brown fox jumped over the lazy dog."
+ array = string.bytes
+ buffer = IO::Buffer.for(string)
+benchmark:
+ string.each_byte: |
+ upcased = String.new
+ string.each_byte do |byte|
+ upcased << (byte ^ 32)
+ end
+ array.each: |
+ upcased = String.new
+ array.each do |byte|
+ upcased << (byte ^ 32)
+ end
+ buffer.each: |
+ upcased = String.new
+ buffer.each(:U8) do |offset, byte|
+ upcased << (byte ^ 32)
+ end
+ buffer.each_byte: |
+ upcased = String.new
+ buffer.each_byte do |byte|
+ upcased << (byte ^ 32)
+ end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+ # frozen_string_literal: true
+ Warning[:experimental] = false
+ string = "The quick brown fox jumped over the lazy dog."
+ buffer = IO::Buffer.for(string)
+ format = [:U32, :U32, :U32, :U32]
+benchmark:
+ string.unpack1: |
+ [
+ string.unpack1("N"),
+ string.unpack1("N", offset: 4),
+ string.unpack1("N", offset: 8),
+ string.unpack1("N", offset: 12),
+ ]
+ buffer.get_value: |
+ [
+ buffer.get_value(:U32, 0),
+ buffer.get_value(:U32, 4),
+ buffer.get_value(:U32, 8),
+ buffer.get_value(:U32, 12),
+ ]
+ buffer.get_values: |
+ buffer.get_values(format, 0)
+ string.unpack: |
+ string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'cgi/escape'
+benchmark:
+ - script: CGI.escapeHTML("")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("abcde")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("abcd<")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("'&\"<>")
+ loop_count: 5000000
+ - prelude: long_no_escape = "abcde" * 300
+ script: CGI.escapeHTML(long_no_escape)
+ loop_count: 1000000
+ - prelude: long_all_escape = "'&\"<>" * 10
+ script: CGI.escapeHTML(long_all_escape)
+ loop_count: 1000000
+ - prelude: | # http://example.com/
+ example_html = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: CGI.escapeHTML(example_html)
+ loop_count: 1000000
diff --git a/benchmark/class_superclass.yml b/benchmark/class_superclass.yml
new file mode 100644
index 0000000000..847ff811f1
--- /dev/null
+++ b/benchmark/class_superclass.yml
@@ -0,0 +1,23 @@
+prelude: |
+ class SimpleClass; end
+ class OneModuleClass
+ 1.times { include Module.new }
+ end
+ class MediumClass
+ 10.times { include Module.new }
+ end
+ class LargeClass
+ 100.times { include Module.new }
+ end
+benchmark:
+ object_class_superclass: |
+ Object.superclass
+ simple_class_superclass: |
+ SimpleClass.superclass
+ one_module_class: |
+ OneModuleClass.superclass
+ medium_class_superclass: |
+ MediumClass.superclass
+ large_class_superclass: |
+ LargeClass.superclass
+loop_count: 20000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+ [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+ constants
+
+ # With previous behavior, this would cause all of the constant caches
+ # associated with the constant lookups listed above to invalidate, meaning
+ # they would all have to be fetched again. With current behavior, it only
+ # invalidates when a name matches, so the following constant set shouldn't
+ # impact the constant lookups listed above.
+ INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+ max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index defe3c30be..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,400 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
- require 'optparse'
-rescue LoadError
- if first
- first = false
- $:.unshift File.join(File.dirname(__FILE__), '../lib')
- retry
- else
- raise
- end
-end
-
-require 'benchmark'
-require 'pp'
-
-class BenchmarkDriver
- def self.benchmark(opt)
- driver = self.new(opt[:execs], opt[:dir], opt)
- begin
- driver.run
- ensure
- driver.show_results
- end
- end
-
- def self.load(input, type, opt)
- attrs = [:executables, :results]
- case type
- when 'yaml'
- require 'yaml'
- h = YAML.load(input)
- when 'json'
- require 'json'
- h = JSON.load(input)
- else
- h = eval(input.read)
- end
- obj = allocate
- obj.instance_variable_set("@execs", h[:executables] || h["executables"])
- obj.instance_variable_set("@results", h[:results] || h["results"])
- obj.instance_variable_set("@opt", opt)
- obj
- end
-
- def output *args
- puts(*args)
- @output and @output.puts(*args)
- end
-
- def message *args
- output(*args) if @verbose
- end
-
- def message_print *args
- if @verbose
- print(*args)
- STDOUT.flush
- @output and @output.print(*args)
- end
- end
-
- def progress_message *args
- unless STDOUT.tty?
- STDERR.print(*args)
- STDERR.flush
- end
- end
-
- def initialize execs, dir, opt = {}
- @execs = execs.map{|e|
- e.strip!
- next if e.empty?
-
- if /(.+)::(.+)/ =~ e
- # ex) ruby-a::/path/to/ruby-a
- label = $1.strip
- path = $2
- version = `#{path} -v`.chomp
- else
- path = e
- version = label = `#{path} -v`.chomp
- end
- [path, label, version]
- }.compact
-
- @dir = dir
- @repeat = opt[:repeat] || 1
- @repeat = 1 if @repeat < 1
- @pattern = opt[:pattern] || nil
- @exclude = opt[:exclude] || nil
- @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
- @output = opt[:output] ? open(opt[:output], 'w') : nil
- @loop_wl1 = @loop_wl2 = nil
- @ruby_arg = opt[:ruby_arg] || nil
- @opt = opt
-
- # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
- @results = []
-
- if @verbose
- @start_time = Time.now
- message @start_time
- @execs.each_with_index{|(path, label, version), i|
- message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
- }
- end
- end
-
- def adjusted_results name, results
- s = nil
- results.each_with_index{|e, i|
- r = e.min
- case name
- when /^vm1_/
- if @loop_wl1
- r -= @loop_wl1[i]
- r = 0 if r < 0
- s = '*'
- end
- when /^vm2_/
- if @loop_wl2
- r -= @loop_wl2[i]
- r = 0 if r < 0
- s = '*'
- end
- end
- yield r
- }
- s
- end
-
- def show_results
- case @opt[:format]
- when :tsv
- strformat = "\t%1$s"
- numformat = "\t%1$*2$.3f"
- minwidth = 0
- name_width = 0
- when :markdown
- markdown = true
- strformat = "|%1$-*2$s"
- numformat = "|%1$*2$.3f"
- when :plain
- strformat = " %1$-*2$s"
- numformat = " %1$*2$.3f"
- end
-
- name_width ||= @results.map {|v,*| v.size}.max
- minwidth ||= 7
- width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
- output
-
- if @verbose
- message '-----------------------------------------------------------'
- message 'raw data:'
- message
- message PP.pp(@results, "", 79)
- message
- message "Elapsed time: #{Time.now - @start_time} (sec)"
- end
-
- if rawdata_output = @opt[:rawdata_output]
- h = {}
- h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
- h[:executables] = @execs
- h[:results] = @results
- if (type = File.extname(rawdata_output)).empty?
- type = rawdata_output
- rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
- end
- case type
- when 'yaml'
- require 'yaml'
- h = YAML.dump(h)
- when 'json'
- require 'json'
- h = JSON.pretty_generate(h)
- else
- require 'pp'
- h = h.pretty_inspect
- end
- open(rawdata_output, 'w') {|f| f.puts h}
- end
-
- output '-----------------------------------------------------------'
- output 'benchmark results:'
-
- if @verbose and @repeat > 1
- output "minimum results in each #{@repeat} measurements."
- end
-
- output "Execution time (sec)"
- output if markdown
- output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
- output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
- @results.each{|v, result|
- rets = []
- s = adjusted_results(v, result){|r|
- rets << sprintf(numformat, r, width[rets.size])
- }
- v += s if s
- output [v.ljust(name_width), rets].join("")
- }
-
- if @execs.size > 1
- output
- output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
- output if markdown
- output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
- output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
- @results.each{|v, result|
- rets = []
- first_value = nil
- s = adjusted_results(v, result){|r|
- if first_value
- if r == 0
- rets << "Error"
- else
- rets << sprintf(numformat, first_value/r, width[rets.size+1])
- end
- else
- first_value = r
- end
- }
- v += s if s
- output [v.ljust(name_width), rets].join("")
- }
- end
-
- if @opt[:output]
- output
- output "Log file: #{@opt[:output]}"
- end
- end
-
- def files
- flag = {}
- @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
- next if @pattern && /#{@pattern}/ !~ File.basename(file)
- next if @exclude && /#{@exclude}/ =~ File.basename(file)
- case file
- when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
- flag[$1] = true
- end
- file
- }.compact
-
- if flag['vm1'] && !flag['whileloop']
- @files << File.join(@dir, 'bm_loop_whileloop.rb')
- elsif flag['vm2'] && !flag['whileloop2']
- @files << File.join(@dir, 'bm_loop_whileloop2.rb')
- end
-
- @files.sort!
- progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
- @files
- end
-
- def run
- files.each_with_index{|file, i|
- @i = i
- r = measure_file(file)
-
- if /bm_loop_whileloop.rb/ =~ file
- @loop_wl1 = r[1].map{|e| e.min}
- elsif /bm_loop_whileloop2.rb/ =~ file
- @loop_wl2 = r[1].map{|e| e.min}
- end
- }
- end
-
- def measure_file file
- name = File.basename(file, '.rb').sub(/^bm_/, '')
- prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
- load prepare_file if FileTest.exist?(prepare_file)
-
- if @verbose
- output
- output '-----------------------------------------------------------'
- output name
- output
- output File.read(file)
- output
- end
-
- result = [name]
- result << @execs.map{|(e, v)|
- (0...@repeat).map{
- message_print "#{v}\t"
- progress_message '.'
-
- m = measure(e, file)
- message "#{m}"
- m
- }
- }
- @results << result
- result
- end
-
- unless defined?(File::NULL)
- if File.exist?('/dev/null')
- File::NULL = '/dev/null'
- end
- end
-
- def measure executable, file
- cmd = "#{executable} #{@ruby_arg} #{file}"
-
- m = Benchmark.measure{
- system(cmd, out: File::NULL)
- }
-
- if $? != 0
- output "\`#{cmd}\' exited with abnormal status (#{$?})"
- 0
- else
- m.real
- end
- end
-end
-
-if __FILE__ == $0
- opt = {
- :execs => [],
- :dir => File.dirname(__FILE__),
- :repeat => 1,
- :output => nil,
- :raw_output => nil,
- :format => :tsv,
- }
- formats = {
- :tsv => ".tsv",
- :markdown => ".md",
- :plain => ".txt",
- }
-
- parser = OptionParser.new{|o|
- o.on('-e', '--executables [EXECS]',
- "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
- e.split(/;/).each{|path|
- opt[:execs] << path
- }
- }
- o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
- opt[:dir] = d
- }
- o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
- opt[:pattern] = p
- }
- o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
- opt[:exclude] = e
- }
- o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
- opt[:repeat] = n.to_i
- }
- o.on('-o', '--output-file [FILE]', "Output file"){|f|
- opt[:output] = f
- }
- o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
- opt[:ruby_arg] = a
- }
- o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
- opt[:rawdata_output] = r
- }
- o.on('--load-rawdata=FILE', 'input rawdata'){|r|
- opt[:rawdata_input] = r
- }
- o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
- opt[:format] = r
- }
- o.on('-v', '--verbose'){|v|
- opt[:verbose] = v
- }
- o.on('-q', '--quiet', "Run without notify information except result table."){|q|
- opt[:quiet] = q
- opt[:verbose] = false
- }
- }
-
- parser.parse!(ARGV)
- opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-
- if input = opt[:rawdata_input]
- b = open(input) {|f|
- BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
- }
- b.show_results
- else
- BenchmarkDriver.benchmark(opt)
- end
-end
-
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+ num = (1..).lazy.take(100)
+ ary2 = [[1,2]].cycle.lazy.take(10)
+ ary10 = [[*1..10]].cycle.lazy.take(10)
+ ary20 = [[*1..20]].cycle.lazy.take(10)
+ ary50 = [[*1..50]].cycle.lazy.take(10)
+ ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+ num3: num.flat_map {|x| x}.take(3).to_a
+ num10: num.flat_map {|x| x}.take(3).to_a
+ ary2: ary2.flat_map {|x| x}.take(3).to_a
+ ary10: ary10.flat_map {|x| x}.take(3).to_a
+ ary20: ary20.flat_map {|x| x}.take(3).to_a
+ ary50: ary50.flat_map {|x| x}.take(3).to_a
+ ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+ a = (1..3).lazy
+ b = a.map {|x| x}
+
+benchmark:
+ first_ary: a.zip(["a", "b", "c"]).first
+ first_nonary: a.zip("a".."c").first
+ first_noarg: a.zip.first
+
+ take3_ary: a.zip(["a", "b", "c"]).take(3).force
+ take3_nonary: a.zip("a".."c").take(3).force
+ take3_noarg: a.zip.take(3).force
+
+ chain-first_ary: b.zip(["a", "b", "c"]).first
+ chain-first_nonary: b.zip("a".."c").first
+ chain-first_noarg: b.zip.first
+
+ chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+ chain-take3_nonary: b.zip("a".."c").take(3).force
+ chain-take3_noarg: b.zip.take(3).force
+
+ block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+ set2 = 2.times.to_a.shuffle.to_set
+ set10 = 10.times.to_a.shuffle.to_set
+ set100 = 100.times.to_a.shuffle.to_set
+ set1000 = 1000.times.to_a.shuffle.to_set
+ set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+ set2.min: set2.min
+ set10.min: set10.min
+ set100.min: set100.min
+ set1000.min: set1000.min
+ set10000.min: set10000.min
+ set2.max: set2.max
+ set10.max: set10.max
+ set100.max: set100.max
+ set1000.max: set1000.max
+ set10000.max: set10000.max
+ set2.minmax: set2.minmax
+ set10.minmax: set10.minmax
+ set100.minmax: set100.minmax
+ set1000.minmax: set1000.minmax
+ set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+ set2 = 2.times.to_a.shuffle.to_set
+ set10 = 10.times.to_a.shuffle.to_set
+ set100 = 100.times.to_a.shuffle.to_set
+ set1000 = 1000.times.to_a.shuffle.to_set
+ set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+ set2.sort_by: set2.sort_by { 0 }
+ set10.sort_by: set10.sort_by { 0 }
+ set100.sort_by: set100.sort_by { 0 }
+ set1000.sort_by: set1000.sort_by { 0 }
+ set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
new file mode 100644
index 0000000000..d386353888
--- /dev/null
+++ b/benchmark/enum_sort_by.yml
@@ -0,0 +1,53 @@
+prelude: |
+ array_length = 2
+ fixnum_array2 = array_length.times.to_a.map {rand(10000)}
+ float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
+ string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
+ mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+ all_zero_array2 =array_length.times.to_a.map {0}
+
+ array_length = 10
+ fixnum_array10 = array_length.times.to_a.map {rand(10000)}
+ float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
+ string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
+ mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+ all_zero_array10 =array_length.times.to_a.map {0}
+
+ array_length = 1000
+ fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
+ float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
+ string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+ mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+ all_zero_array1000 =array_length.times.to_a.map {0}
+
+ array_length = 100000
+ fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
+ float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
+ string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+ mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+ all_zero_array100000 =array_length.times.to_a.map {0}
+
+benchmark:
+ fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
+ float_array2.sort_by: float_array2.sort_by {|a| a}
+ string_length2.sort_by: string_array2.sort_by {|a| a.length}
+ mix_array2.sort_by: mix_array2.sort_by {|a| a}
+ all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
+
+ fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
+ float_array10.sort_by: float_array10.sort_by {|a| a}
+ string_length10.sort_by: string_array10.sort_by {|a| a.length}
+ mix_array10.sort_by: mix_array10.sort_by {|a| a}
+ all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
+
+ fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
+ float_array1000.sort_by: float_array1000.sort_by {|a| a}
+ string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
+ mix_array1000.sort_by: mix_array1000.sort_by {|a| a}
+ all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
+
+ fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
+ float_array100000.sort_by: float_array100000.sort_by {|a| a}
+ string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
+ mix_array100000.sort_by: mix_array100000.sort_by {|a| a}
+ all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+ list = ("aaa".."zzz").to_a*10
+benchmark:
+ tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'erb'
+benchmark:
+ - script: ERB::Util.html_escape("")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("abcde")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("abcd<")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("'&\"<>")
+ loop_count: 5000000
+ - prelude: long_no_escape = "abcde" * 300
+ script: ERB::Util.html_escape(long_no_escape)
+ loop_count: 1000000
+ - prelude: long_all_escape = "'&\"<>" * 10
+ script: ERB::Util.html_escape(long_all_escape)
+ loop_count: 1000000
+ - prelude: | # http://example.com/
+ example_html = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: ERB::Util.html_escape(example_html)
+ loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+
+ src = "def self.render(title, content); #{ERB.new(data).src}; end"
+ mod = Module.new
+ mod.instance_eval(src, "(ERB)")
+benchmark:
+ erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+ def make_link(previous)
+ Fiber.new do
+ while message = previous.resume
+ Fiber.yield(message)
+ end
+ end
+ end
+
+ def make_chain(length = 1000, &block)
+ chain = Fiber.new(&block)
+
+ (length - 1).times do
+ chain = make_link(chain)
+ end
+
+ return chain
+ end
+
+ message = "Hello World!"
+
+ chain = make_chain do
+ while true
+ Fiber.yield(message)
+ end
+ end
+benchmark:
+ make_chain: |
+ make_chain(100) do
+ while true
+ Fiber.yield(message)
+ end
+ end
+ resume_chain: |
+ chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+ th = Thread.current
+ th[:key] = :val
+benchmark:
+ key?: th.key?(:key)
+ []: th[:key]
+ keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_basename.yml b/benchmark/file_basename.yml
new file mode 100644
index 0000000000..fbd78785aa
--- /dev/null
+++ b/benchmark/file_basename.yml
@@ -0,0 +1,6 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ long: File.basename("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+ long_name: File.basename("Users_george_src_github.com_ruby_ruby_benchmark_file_dirname.yml")
+ withext: File.basename("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml", ".yml")
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+ File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_dirname.yml b/benchmark/file_dirname.yml
new file mode 100644
index 0000000000..43a81c9371
--- /dev/null
+++ b/benchmark/file_dirname.yml
@@ -0,0 +1,6 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ long: File.dirname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+ short: File.dirname("foo/bar")
+ n_4: File.dirname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml", 4)
diff --git a/benchmark/file_extname.yml b/benchmark/file_extname.yml
new file mode 100644
index 0000000000..fb16e55840
--- /dev/null
+++ b/benchmark/file_extname.yml
@@ -0,0 +1,6 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ long: File.extname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+ long_name: File.extname("Users_george_src_github.com_ruby_ruby_benchmark_file_dirname.yml")
+ short: File.extname("foo/bar")
diff --git a/benchmark/file_join.yml b/benchmark/file_join.yml
new file mode 100644
index 0000000000..845257cf1e
--- /dev/null
+++ b/benchmark/file_join.yml
@@ -0,0 +1,7 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ two_strings: File.join(__FILE__, "path")
+ many_strings: File.join(__FILE__, "path", "a", "b", "c", "d")
+ array: File.join([__FILE__, "path", "a", "b", "c", "d"])
+ mixed: File.join(__FILE__, "path", "a", "b", ["c", "d"])
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+ File.rename(a, b)
+ File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ to_f: |
+ flo.to_f
+ abs: |
+ flo.abs
+ magnitude: |
+ flo.magnitude
+ -@: |
+ -flo
+ zero?: |
+ flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ negative?: |
+ flo.negative?
+ positive?: |
+ flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+ floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+ to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 2eed7abc83..275f58b924 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../bm_app_aobench.rb'
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index af8ea722aa..83347cdd20 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../bm_so_binary_trees.rb'
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 09a404466a..23d0b91c6c 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,11 +3,12 @@ require 'pp'
require 'optparse'
$list = true
-$gcprof = true
+$gcprof = false
opt = OptionParser.new
opt.on('-q'){$list = false}
opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
opt.parse!(ARGV)
script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 94ba74be89..8ebdff7d1d 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../bm_app_pentomino.rb'
+require_relative '../app_pentomino'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
index af4f8c36d4..af4f8c36d4 100644
--- a/benchmark/bm_hash_aref_dsym.rb
+++ b/benchmark/hash_aref_dsym.rb
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
index 9d7759379e..9d7759379e 100644
--- a/benchmark/bm_hash_aref_dsym_long.rb
+++ b/benchmark/hash_aref_dsym_long.rb
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
index 1346890582..1346890582 100644
--- a/benchmark/bm_hash_aref_fix.rb
+++ b/benchmark/hash_aref_fix.rb
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/bm_hash_aref_flo.rb
+++ b/benchmark/hash_aref_flo.rb
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/bm_hash_aref_miss.rb
+++ b/benchmark/hash_aref_miss.rb
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/bm_hash_aref_str.rb
+++ b/benchmark/hash_aref_str.rb
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
new file mode 100644
index 0000000000..ed8142bcf1
--- /dev/null
+++ b/benchmark/hash_aref_str_lit.yml
@@ -0,0 +1,20 @@
+prelude: |
+ # frozen_string_literal: true
+ hash = 10.times.to_h do |i|
+ [i, i]
+ end
+ dyn_sym = "dynamic_symbol".to_sym
+ binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
+ iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
+
+ hash[:some_symbol] = 1
+ hash[dyn_sym] = 2
+ hash["small"] = 3
+ hash["frozen_string_literal"] = 4
+ hash[iseq_literal_string] = 5
+benchmark:
+ symbol: hash[:some_symbol]
+ dyn_symbol: hash[dyn_sym]
+ small_lit: hash["small"]
+ frozen_lit: hash["frozen_string_literal"]
+ iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/bm_hash_aref_sym.rb
+++ b/benchmark/hash_aref_sym.rb
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ b/benchmark/hash_aref_sym_long.rb
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+ h = Hash.new { :foo }
+benchmark:
+ default_aref: h[1]
+ default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+ small_hash = { a: 1 }
+ larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+ dup_small: small_hash.dup
+ dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+ hash1 = 1_000_000.times.to_h { [rand, true]}
+ hash2 = hash1.dup
+ hash2.keys[1..100_000].each { hash2.delete _1 }
+ hash2.delete hash2.first[0]
+
+benchmark:
+ hash1: hash1.first
+ hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/bm_hash_flatten.rb
+++ b/benchmark/hash_flatten.rb
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/bm_hash_ident_flo.rb
+++ b/benchmark/hash_ident_flo.rb
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/bm_hash_ident_num.rb
+++ b/benchmark/hash_ident_num.rb
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/bm_hash_ident_obj.rb
+++ b/benchmark/hash_ident_obj.rb
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/bm_hash_ident_str.rb
+++ b/benchmark/hash_ident_str.rb
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/bm_hash_ident_sym.rb
+++ b/benchmark/hash_ident_sym.rb
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
new file mode 100644
index 0000000000..cab4cf9ca4
--- /dev/null
+++ b/benchmark/hash_key.yml
@@ -0,0 +1,5 @@
+prelude: |
+ obj = Object.new
+ hash = { obj => true }
+benchmark: hash.key?(obj)
+loop_count: 30000000
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/bm_hash_keys.rb
+++ b/benchmark/hash_keys.rb
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
new file mode 100644
index 0000000000..9d8e34187f
--- /dev/null
+++ b/benchmark/hash_new.yml
@@ -0,0 +1,16 @@
+prelude: |
+ has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
+ strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
+ strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
+benchmark:
+ new: Hash.new
+ new_with_capa_1k: |
+ h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
+ strings_1k.each do |x|
+ h[x] = true
+ end
+ new_with_capa_100k: |
+ h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
+ strings_100k.each do |x|
+ h[x] = true
+ end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/bm_hash_shift.rb
+++ b/benchmark/hash_shift.rb
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do |i|
+ [i].map(&h)
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/bm_hash_values.rb
+++ b/benchmark/hash_values.rb
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_close.yml b/benchmark/io_close.yml
new file mode 100644
index 0000000000..a552872884
--- /dev/null
+++ b/benchmark/io_close.yml
@@ -0,0 +1,13 @@
+prelude: |
+ ios = 1000.times.map do
+ 100.times.map{IO.pipe}
+ end
+benchmark:
+ # Close IO
+ io_close: |
+ # Process each batch of ios per iteration of the benchmark.
+ ios.pop.each do |r, w|
+ r.close
+ w.close
+ end
+loop_count: 100
diff --git a/benchmark/io_close_contended.yml b/benchmark/io_close_contended.yml
new file mode 100644
index 0000000000..1d9e4e0d0f
--- /dev/null
+++ b/benchmark/io_close_contended.yml
@@ -0,0 +1,21 @@
+prelude: |
+ ios = 100.times.map do
+ 10.times.map do
+ pipe = IO.pipe.tap do |r, w|
+ Thread.new do
+ r.read
+ rescue IOError
+ # Ignore
+ end
+ end
+ end
+ end
+benchmark:
+ # Close IO
+ io_close_contended: |
+ # Process each batch of ios per iteration of the benchmark.
+ ios.pop.each do |r, w|
+ r.close
+ w.close
+ end
+loop_count: 10
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ src = Zero.new
+ dst = File.open(IO::NULL, 'wb')
+ n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+ # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ require 'socket'
+ src = Zero.new
+ rd, wr = UNIXSocket.pair
+ pid = fork do
+ wr.close
+ buf = String.new
+ while rd.read(16384, buf)
+ end
+ end
+ rd.close
+ IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+ # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+ wr.close if wr
+ Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/bm_io_file_create.rb
+++ b/benchmark/io_file_create.rb
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/bm_io_file_read.rb
+++ b/benchmark/io_file_read.rb
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/bm_io_file_write.rb
+++ b/benchmark/io_file_write.rb
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
index da9357fdc6..da9357fdc6 100644
--- a/benchmark/bm_io_nonblock_noex.rb
+++ b/benchmark/io_nonblock_noex.rb
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, exception: false)
+ r.read_nonblock(1, buf, exception: false)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+ i += 1
+ w.write(src)
+ r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/bm_io_select.rb b/benchmark/io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/bm_io_select.rb
+++ b/benchmark/io_select.rb
diff --git a/benchmark/bm_io_select2.rb b/benchmark/io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/bm_io_select2.rb
+++ b/benchmark/io_select2.rb
diff --git a/benchmark/bm_io_select3.rb b/benchmark/io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/bm_io_select3.rb
+++ b/benchmark/io_select3.rb
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+ while i.read(1024)
+ end
+end
+
+100.times do
+ o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'irb/color'
+ code = <<~'CODE'
+ def self.foo # bar
+ :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+ end
+ CODE
+benchmark:
+ irb_color_complete: |
+ IRB::Color.colorize_code(code, complete: true)
+ irb_color_incomplete: |
+ IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'rbconfig'
+ irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+ irb_exec: |
+ IO.popen(irb_f, 'w') do |io|
+ io.write('exit')
+ end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+ symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+ define_method = RubyVM::InstructionSequence.compile(%{
+ def foo; end
+ def bar; end
+ def baz; end
+ def egg; end
+ def spam; end
+ }).to_binary
+
+ all = RubyVM::InstructionSequence.compile(%{
+ module Foo; def foo; :foo; end; end
+ module Bar; def bar; :bar; end; end
+ module Baz; def baz; :baz; end; end
+ class Egg; def egg; :egg; end; end
+ class Spaml; def spam; :spam; end; end
+ }).to_binary
+
+benchmark:
+ symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+ define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+ all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+ class Embedded
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ end
+ end
+
+ class Extended
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ @d = 1
+ @e = 1
+ @f = 1
+ end
+ end
+benchmark:
+ embedded: Embedded.new
+ extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+ clone: "object.clone"
+ clone_true: "object.clone(freeze: true)"
+ clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+ float: "Float(42)"
+ float_true: "Float(42, exception: true)"
+ float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+ x = nil
+benchmark:
+ kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+ kernel_then: 1.then { |i| i + 1 }
+ kernel_then_enum: 1.then
+ kernel_yield_self: 1.yield_self { |i| i + 1 }
+ kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+ h = {a: 1}
+ def kw(a: 1) a end
+ def kws(**kw) kw end
+benchmark:
+ kw_to_kw: "kw(a: 1)"
+ kw_splat_to_kw: "kw(**h)"
+ kw_to_kw_splat: "kws(a: 1)"
+ kw_splat_to_kw_splat: "kws(**h)"
+ kw_and_splat_to_kw: "kw(a: 1, **h)"
+ kw_splats_to_kw: "kw(**h, **h)"
+ kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+ kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+ def initialize(*)
+ super
+ @stdout = $stdout
+ @strio = StringIO.new
+ $stdout = IOMultiplexer.new(@stdout, @strio)
+ end
+
+ def with_benchmark(*)
+ super
+ ensure
+ logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+ puts "\nLog file: #{logfile}"
+
+ $stdout = @stdout
+ File.write(logfile, @strio.tap(&:rewind).read)
+ end
+
+ class IOMultiplexer
+ def initialize(io1, io2)
+ @io1 = io1
+ @io2 = io2
+ end
+
+ [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+ define_method(method) do |*args|
+ @io1.send(method, *args)
+ @io2.send(method, *args)
+ end
+ end
+ end
+ private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cstime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cutime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ jobs = jobs.map do |job|
+ job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+ end
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => value }, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render) do |path|
+ output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+ if $?.success?
+ Integer(f.read)
+ else
+ $stdout.print(output)
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def target
+ 'peak'
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def metric
+ METRIC
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ def render
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+ key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+ key = ms.respond_to?(:rss) ? :rss : :size
+else
+ raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ end
+
+ if times > 1
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ else
+ content
+ end
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..fd9c2dd4db
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob) do
+ attr_accessor :ractor
+ end
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(ractor: 1, **kwargs)
+ super(**kwargs).each do |job|
+ job.ractor = ractor
+ end
+ end
+ })
+
+ private
+
+ unless private_instance_methods.include?(:run_benchmark)
+ raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+ end
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ results = job.ractor.times.map do
+ Tempfile.open('benchmark_driver_result')
+ end
+ duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+ success = execute(*context.executable.command, path, exception: false)
+ if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+ value
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ results.each(&:close)
+
+ value_duration(
+ loop_count: job.loop_count,
+ duration: duration,
+ )
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(results:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+ __bmdv_loop_before = 0
+ __bmdv_loop_after = 0
+else
+ __bmdv_loop_before = Time.new
+ #{while_loop('', loop_count, id: 0)}
+ __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+ __bmdv_time = Time
+ __bmdv_script_before = __bmdv_time.new
+ #{while_loop(script, loop_count, id: 1)}
+ __bmdv_script_after = __bmdv_time.new
+
+ (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:value)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+ RUBY
+ end
+
+ private
+
+ # id is to prevent:
+ # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+ def while_loop(content, times, id:)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+ #{content}
+ __bmdv_i#{id} += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Peak#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Peak#target
+ def target
+ 'size'
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :stime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ raise 'missing loop_count is not supported in Ruby repository'
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render(result: f.path, target: target)) do |path|
+ IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # This method is overridden by some subclasses
+ def metric
+ METRIC
+ end
+
+ # This method is overridden by some subclasses
+ def target
+ :total
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:, target:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+ #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :utime
+ end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+# 1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+ x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+ x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+ x.report %q{
+ h = {a: 1, b: 2, c: 3, d: 4}
+ }
+}
+=end
+#
+# 2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
new file mode 100644
index 0000000000..1c757185a8
--- /dev/null
+++ b/benchmark/loop_each.yml
@@ -0,0 +1,4 @@
+prelude: |
+ arr = [nil] * 30_000_000
+benchmark:
+ loop_each: arr.each{|e|}
diff --git a/benchmark/bm_loop_for.rb b/benchmark/loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/bm_loop_for.rb
+++ b/benchmark/loop_for.rb
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/loop_generator.rb
index d3375c744c..6a3194b670 100644
--- a/benchmark/bm_loop_generator.rb
+++ b/benchmark/loop_generator.rb
@@ -1,4 +1,4 @@
-max = 600000
+max = 6000000
if defined? Fiber
gen = (1..max).each
diff --git a/benchmark/bm_loop_times.rb b/benchmark/loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/bm_loop_times.rb
+++ b/benchmark/loop_times.rb
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
new file mode 100644
index 0000000000..f9343ba897
--- /dev/null
+++ b/benchmark/loop_times_megamorphic.yml
@@ -0,0 +1,7 @@
+prelude: |
+ eval(<<~EOS)
+ def loop_times_megamorphic
+ #{"1.times {|i|};" * 1000}
+ end
+ EOS
+benchmark: loop_times_megamorphic
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/bm_loop_whileloop.rb
+++ b/benchmark/loop_whileloop.rb
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/bm_loop_whileloop2.rb
+++ b/benchmark/loop_whileloop2.rb
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
-end
-
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/bm_marshal_dump_flo.rb
+++ b/benchmark/marshal_dump_flo.rb
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
index 8252ad90fa..8252ad90fa 100644
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ b/benchmark/marshal_dump_load_geniv.rb
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+ smallint_array = 1000.times.map { |x| x }
+ bigint32_array = 1000.times.map { |x| x + 2**32 }
+ bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+ smallint_dump = Marshal.dump(smallint_array)
+ bigint32_dump = Marshal.dump(bigint32_array)
+ bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+ marshal_dump_integer_small: |
+ Marshal.dump(smallint_array)
+ marshal_dump_integer_over_32_bit: |
+ Marshal.dump(bigint32_array)
+ marshal_dump_integer_over_64_bit: |
+ Marshal.dump(bigint64_array)
+ marshal_load_integer_small: |
+ Marshal.load(smallint_dump)
+ marshal_load_integer_over_32_bit: |
+ Marshal.load(bigint32_dump)
+ marshal_load_integer_over_64_bit: |
+ Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
index e29743b791..e29743b791 100644
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ b/benchmark/marshal_dump_load_time.rb
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+ a = [nil] * 3
+ b = Class.new{attr_writer :a, :b, :c}.new
+ c = d = e = f = g = h = i = nil
+benchmark:
+ array2_2: "c = (a[0], a[1] = 1, 2)"
+ array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+ array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+ array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+ attr2_2: "c = (b.a, b.b = 1, 2)"
+ attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+ attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+ attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+ lvar2_2: "c = (d, e = 1, 2)"
+ lvar2_3: "c = (d, e = 1, 2, 3)"
+ lvar3_2: "c = (d, e, f = 1, 2)"
+ lvar3_3: "c = (d, e, f = 1, 2, 3)"
+ array2_2p: "(a[0], a[1] = 1, 2; nil)"
+ array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+ array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+ array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+ attr2_2p: "(b.a, b.b = 1, 2; nil)"
+ attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+ attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+ attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+ lvar2_2p: "(d, e = 1, 2; nil)"
+ lvar2_3p: "(d, e = 1, 2, 3; nil)"
+ lvar3_2p: "(d, e, f = 1, 2; nil)"
+ lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+ array2_2lv: "c = (a[0], a[1] = g, h)"
+ array2_ilv: "c = (a[0], a[1] = g, h, i)"
+ arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+ arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+ attr2_2lv: "c = (b.a, b.b = g, h)"
+ attr2_ilv: "c = (b.a, b.b = g, h, i)"
+ attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+ attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+ lvar2_2lv: "c = (d, e = g, h)"
+ lvar2_ilv: "c = (d, e = g, h, i)"
+ lvari_2lv: "c = (d, e, f = g, h)"
+ lvari_ilv: "c = (d, e, f = g, h, i)"
+ array2_2plv: "(a[0], a[1] = g, h; nil)"
+ array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+ arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+ arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+ attr2_2plv: "(b.a, b.b = g, h; nil)"
+ attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+ attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+ attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+ lvar2_2plv: "(d, e = g, h; nil)"
+ lvar2_iplv: "(d, e = g, h, i; nil)"
+ lvari_2plv: "(d, e, f = g, h; nil)"
+ lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+ named_module = Kernel
+
+ module FakeName
+ def self.name
+ "NotMyame".freeze
+ end
+ end
+
+ MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+ fastpath: MOD_NAME.bind_call(Kernel)
+ slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..2f9c490d92
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,32 @@
+prelude: |
+ module SomeModule; end
+ class SimpleClass; end
+ class MediumClass
+ 10.times { include Module.new }
+ end
+ class LargeClass
+ 100.times { include Module.new }
+ end
+ class HugeClass
+ 300.times { include Module.new }
+ end
+ SimpleObj = SimpleClass.new
+ MediumObj = MediumClass.new
+ LargeObj = LargeClass.new
+ HugeObj = HugeClass.new
+benchmark:
+ simple_class_eqq_simple_obj: |
+ SimpleClass === SimpleObj
+ medium_class_eqq_simple_obj: |
+ MediumClass === SimpleObj
+ simple_class_eqq_medium_obj: |
+ SimpleClass === MediumObj
+ simple_class_eqq_large_obj: |
+ SimpleClass === LargeObj
+ simple_class_eqq_huge_obj: |
+ SimpleClass === HugeObj
+ simple_class_eqq_module: |
+ SimpleClass === HugeObj
+ module_eqq_module: |
+ SomeModule === HugeObj
+loop_count: 10000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+ class Niller; def nil?; true; end; end
+ xnil, notnil = nil, Object.new
+ niller = Niller.new
+benchmark:
+ - xnil.nil?
+ - notnil.nil?
+ - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..66234c4cdf
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,16 @@
+prelude: |
+ def a = nil
+benchmark:
+ rationalize:
+ nil.rationalize
+ to_c: |
+ nil.to_c
+ to_i: |
+ nil.to_i
+ to_f: |
+ nil.to_f
+ to_r: |
+ nil.to_r
+ splat: |
+ a(*nil)
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+ - 0.zero?
+ - 1.zero?
+ - 0r.zero?
+ - 1r.zero?
+ - 0i.zero?
+ - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+ int = 42
+ flo = 4.2
+benchmark:
+ real?: |
+ int.real?
+ integer?: |
+ flo.integer?
+ finite?: |
+ int.finite?
+ infinite?: |
+ int.infinite?
+ integer_real: |
+ int.real
+ float_real: |
+ flo.real
+ integr_imag: |
+ int.imag
+ float_imag: |
+ flo.imag
+ integer_conj: |
+ int.conj
+ float_conj: |
+ flo.conj
+ integer_numerator: |
+ int.numerator
+ integer_denominator: |
+ int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..c6269923f0
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,49 @@
+prelude: |
+ class Eight
+ 8.times { include(Module.new) }
+ end
+ class ThirtyTwo
+ 32.times { include(Module.new) }
+ end
+ class SixtyFour
+ 64.times { include(Module.new) }
+ end
+ class OneTwentyEight
+ 128.times { include(Module.new) }
+ end
+ class OnePositional
+ def initialize a; end
+ end
+ class TwoPositional
+ def initialize a, b; end
+ end
+ class ThreePositional
+ def initialize a, b, c; end
+ end
+ class FourPositional
+ def initialize a, b, c, d; end
+ end
+ class KWArg
+ def initialize a:, b:, c:, d:
+ end
+ end
+ class Mixed
+ def initialize a, b, c:, d:
+ end
+ end
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ allocate_8_deep: Eight.new
+ allocate_32_deep: ThirtyTwo.new
+ allocate_64_deep: SixtyFour.new
+ allocate_128_deep: OneTwentyEight.new
+ allocate_1_positional_params: OnePositional.new(1)
+ allocate_2_positional_params: TwoPositional.new(1, 2)
+ allocate_3_positional_params: ThreePositional.new(1, 2, 3)
+ allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
+ allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
+ allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
+ allocate_no_params: "Object.new"
+ allocate_allocate: "Object.allocate"
+loop_count: 100000
diff --git a/benchmark/object_class.yml b/benchmark/object_class.yml
new file mode 100644
index 0000000000..1e5409d1e2
--- /dev/null
+++ b/benchmark/object_class.yml
@@ -0,0 +1,40 @@
+prelude: |
+ def get_class(obj)
+ i = 10_000
+ while i > 0
+ i -= 1
+ # 100 times per loop
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+ end
+ end
+
+ class Obj
+ end
+ obj = Obj.new
+
+ singleton = Obj.new
+ def singleton.bar
+ end
+
+ extended = Obj.new
+ 2.times do
+ extended.extend Module.new
+ end
+
+ immediate = 1.4
+benchmark:
+ obj: get_class(obj)
+ extended: get_class(extended)
+ singleton: get_class(singleton)
+ immediate: get_class(immediate)
+loop_count: 1000
diff --git a/benchmark/object_id.yml b/benchmark/object_id.yml
new file mode 100644
index 0000000000..2bd52b923f
--- /dev/null
+++ b/benchmark/object_id.yml
@@ -0,0 +1,4 @@
+benchmark:
+ baseline: "Object.new"
+ object_id: "Object.new.object_id"
+# loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'objspace'
+ require 'tempfile'
+ $objs = 1_000.times.map { Object.new }
+ $strings = 1_000.times.map { |i| "string #{i}" }
+ $file = Tempfile.new('heap')
+ $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+ dump_all_string: "ObjectSpace.dump_all(output: :string)"
+ dump_all_file: "ObjectSpace.dump_all(output: $file)"
+ dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 01593965d9..1ce9f76275 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
def factL(n):
r = 1
- for x in range(2, n):
+ for x in range(2, n+1):
r *= x
return r
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+ def call(*val)
+ case val
+ in [String => body]
+ [200, {}, [body]]
+ in [Integer => status]
+ [status, {}, [""]]
+ in [Integer, String] => response
+ [response[0], {}, [response[1]]]
+ in [Integer, Hash, String] => response
+ [response[0], response[1], [response[2]]]
+ end
+ end
+
+benchmark:
+ first_match: call("ok")
+ second_match: call(401)
+ third_match: call(200, "ok")
+ fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
deleted file mode 100644
index c4786f04ad..0000000000
--- a/benchmark/prepare_require.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require "fileutils"
-
-def prepare
- num_files = 10000
-
- basename = File.dirname($0)
- data_dir = File.join(basename, "bm_require.data")
-
- # skip if all of files exists
- if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
- return
- end
-
- FileUtils.mkdir_p(data_dir)
-
- 1.upto(num_files) do |i|
- f = File.open("#{data_dir}/c#{i}.rb", "w")
- f.puts <<-END
- class C#{i}
- end
- END
- end
-end
-
-prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
deleted file mode 100644
index 339ecb8b39..0000000000
--- a/benchmark/prepare_require_thread.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-load File.join(File.dirname(__FILE__), "prepare_require.rb")
-
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+ ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+ FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+ ractor_float_to_s: |
+ FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/ractor_string_fstring.yml b/benchmark/ractor_string_fstring.yml
new file mode 100644
index 0000000000..14b92d8fd8
--- /dev/null
+++ b/benchmark/ractor_string_fstring.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+ ractor_fstring_random: |
+ i = 0
+ str = "same".dup
+ while i < 2000000
+ -(i.to_s.freeze)
+ i += 1
+ end
+ ractor_fstring_same: |
+ i = 0
+ str = "same".dup
+ while i < 2000000
+ -str
+ i += 1
+ end
+loop_count: 1
+ractor: 4
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
new file mode 100644
index 0000000000..5730c93fcf
--- /dev/null
+++ b/benchmark/range_bsearch_bignum.yml
@@ -0,0 +1,10 @@
+prelude: |
+ first = 2**100
+ last = 2**1000
+ mid = (first + last) / 2
+ r = first..last
+
+benchmark:
+ first: r.bsearch { |x| x >= first }
+ mid: r.bsearch { |x| x >= mid }
+ last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
new file mode 100644
index 0000000000..8d7bedb662
--- /dev/null
+++ b/benchmark/range_bsearch_endpointless.yml
@@ -0,0 +1,21 @@
+prelude: |
+ re = (1..)
+ rb = (..0)
+
+benchmark:
+ 'endless 10**0': re.bsearch { |x| x >= 1 }
+ 'endless 10**1': re.bsearch { |x| x >= 10 }
+ 'endless 10**2': re.bsearch { |x| x >= 100 }
+ 'endless 10**3': re.bsearch { |x| x >= 1000 }
+ 'endless 10**4': re.bsearch { |x| x >= 10000 }
+ 'endless 10**5': re.bsearch { |x| x >= 100000 }
+ 'endless 10**10': re.bsearch { |x| x >= 10000000000 }
+ 'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
+ 'beginless -10**0': rb.bsearch { |x| x >= -1 }
+ 'beginless -10**1': rb.bsearch { |x| x >= -10 }
+ 'beginless -10**2': rb.bsearch { |x| x >= -100 }
+ 'beginless -10**3': rb.bsearch { |x| x >= -1000 }
+ 'beginless -10**4': rb.bsearch { |x| x >= -10000 }
+ 'beginless -10**5': rb.bsearch { |x| x >= -100000 }
+ 'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
+ 'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
new file mode 100644
index 0000000000..59416531b9
--- /dev/null
+++ b/benchmark/range_bsearch_fixnum.yml
@@ -0,0 +1,10 @@
+prelude: |
+ first = 1
+ last = 10000
+ mid = (first + last) / 2
+ r = first..last
+
+benchmark:
+ first: r.bsearch { |x| x >= first }
+ mid: r.bsearch { |x| x >= mid }
+ last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
new file mode 100644
index 0000000000..58f53a0236
--- /dev/null
+++ b/benchmark/range_count.yml
@@ -0,0 +1,11 @@
+prelude: |
+ r_1 = 1..1
+ r_1k = 1..1000
+ r_1m = 1..1000000
+ r_str = 'a'..'z'
+
+benchmark:
+ 'int 1': r_1.count
+ 'int 1K': r_1k.count
+ 'int 1M': r_1m.count
+ string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - (1..1_000_000).last(100)
+ - (1..1_000_000).last(1000)
+ - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+ - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
new file mode 100644
index 0000000000..700a00053c
--- /dev/null
+++ b/benchmark/range_overlap.yml
@@ -0,0 +1,19 @@
+prelude: |
+ class Range
+ unless method_defined?(:overlap?)
+ def overlap?(other)
+ other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
+ end
+ end
+ end
+
+benchmark:
+ - (2..3).overlap?(1..1)
+ - (2..3).overlap?(2..4)
+ - (2..3).overlap?(4..5)
+ - (2..3).overlap?(2..1)
+ - (2..3).overlap?(0..1)
+ - (2..3).overlap?(...1)
+ - (2...3).overlap?(..2)
+ - (2...3).overlap?(3...)
+ - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
new file mode 100644
index 0000000000..a32efeccc6
--- /dev/null
+++ b/benchmark/range_reverse_each.yml
@@ -0,0 +1,16 @@
+prelude: |
+ rf_1 = 0..1
+ rf_1k = 0..1000
+ rf_1m = 0..1000000
+ big = 2**1000
+ rb_1 = big..big+1
+ rb_1k = big..big+1000
+ rb_1m = big..big+1000000
+
+benchmark:
+ "Fixnum 1": rf_1.reverse_each { _1 }
+ "Fixnum 1K": rf_1k.reverse_each { _1 }
+ "Fixnum 1M": rf_1m.reverse_each { _1 }
+ "Bignum 1": rb_1.reverse_each { _1 }
+ "Bignum 1K": rb_1k.reverse_each { _1 }
+ "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..6b6a4836b0
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,33 @@
+prelude: |
+ f = File
+ pwd = Dir.pwd
+ Dir.mkdir('b') unless f.directory?('b')
+ f.write('b/a', '') unless f.file?('b/a')
+
+ relative = 'b/a'
+ absolute = File.join(pwd, relative)
+ dir = 'b'
+ file = 'a'
+
+ relative_dir = 'b/c'
+ absolute_dir = File.join(pwd, relative_dir)
+ file_dir = 'c'
+teardown: |
+ require 'fileutils'
+ FileUtils.rm_rf('b')
+benchmark:
+ relative_nil: "f.realpath(relative, nil)"
+ absolute_nil: "f.realpath(absolute, nil)"
+ relative_relative: "f.realpath(file, dir)"
+ absolute_relative: "f.realpath(absolute, dir)"
+ relative_absolute: "f.realpath(relative, pwd)"
+ relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+ absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+ relative_relative_dir: "f.realdirpath(file_dir, dir)"
+ absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+ relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+ relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+ absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+ relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+ absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+ relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
new file mode 100644
index 0000000000..52f89991cd
--- /dev/null
+++ b/benchmark/regexp_dup.yml
@@ -0,0 +1,6 @@
+prelude: |
+ str = "a" * 1000
+ re = Regexp.new(str)
+
+benchmark:
+ dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
new file mode 100644
index 0000000000..bc9ab3ca21
--- /dev/null
+++ b/benchmark/regexp_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+ str = "a" * 1000
+ re = Regexp.new(str)
+
+benchmark:
+ string: Regexp.new(str)
+ regexp: Regexp.new(re)
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
- <<-EOP
- $DRIVER_PATH = '#{File.dirname($0)}'
- $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
- require 'benchmark'
- require 'yarvutil'
-# print '#{type}'
- begin
- puts Benchmark.measure{
- #{w}('#{file}')
- }.utime
- rescue Exception => exec_command_error_variable
- puts "\t" + exec_command_error_variable.message
- end
- EOP
-end
-
-def benchmark cmd
- rubybin = ENV['RUBY'] || RbConfig.ruby
-
- IO.popen(rubybin, 'r+'){|io|
- io.write cmd
- io.close_write
- return io.gets
- }
-end
-
-def ruby_exec file
- prog = exec_command 'ruby', file, 'load'
- benchmark prog
-end
-
-def yarv_exec file
- prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
- benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
- file = File.dirname($0) + "/bm_#{bench}.rb"
- r = ruby_exec(file).to_f
- y = yarv_exec(file).to_f
- puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
- r = ruby_exec.to_f
- y = yarv_exec.to_f
- puts r/y
-end
-
-if $0 == __FILE__
- %w{
- whileloop
- whileloop2
- times
- const
- method
- poly_method
- block
- rescue
- rescue2
- }.each{|bench|
- measure bench
- }
-end
-
-
-
-
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ 1.upto(10000) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require_thread: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ i=0
+ t = Thread.new do
+ while true
+ i = i+1 # dummy loop
+ end
+ end
+
+ 1.upto(100) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+ t.kill
+loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results = []
-
-# prepare 'wc.input'
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
-
-def bm file
- prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
- return if prog.empty?
-
- /[a-z]+_(.+)\.rb/ =~ file
- bm_name = $1
- puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
- puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
- begin
- result = [bm_name]
- result << matzruby_exec(file) unless $rubyonly
- result << ruby_exec(file) unless $matzrubyonly
- $results << result
-
- rescue Exception => e
- puts
- puts "** benchmark failure: #{e}"
- puts e.backtrace
- end
-end
-
-def benchmark file, bin
- m = Benchmark.measure{
- `#{bin} #{$opts} #{file}`
- }
- sec = '%.3f' % m.real
- puts " #{sec}"
- sec
-end
-
-def ruby_exec file
- print 'ruby'
- benchmark file, $ruby_program
-end
-
-def matzruby_exec file
- print 'matz'
- rubylib = ENV['RUBYLIB']
- ENV['RUBYLIB'] = ''
- r = benchmark file, $matzruby_program
- ENV['RUBYLIB'] = rubylib
- r
-end
-
-if $0 == __FILE__
- ARGV.each{|arg|
- case arg
- when /\A--ruby=(.+)/
- $ruby_program = $1
- when /\A--matzruby=(.+)/
- $matzruby_program = $1
- when /\A--opts=(.+)/
- $opts = $1
- when /\A(-r|--only-ruby)\z/
- $rubyonly = true
- when /\A(-m|--only-matzruby)\z/
- $matzrubyonly = true
- end
- }
- ARGV.delete_if{|arg|
- /\A-/ =~ arg
- }
-
- puts "MatzRuby:"
- system("#{$matzruby_program} -v")
- puts "Ruby:"
- system("#{$ruby_program} -v")
- puts
-
- if ARGV.empty?
- Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
- bm file
- }
- else
- ARGV.each{|file|
- Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
- # file = "#{File.dirname(__FILE__)}/#{file}.rb"
- bm ef
- }
- }
- end
-
- puts
- puts "-- benchmark summary ---------------------------"
- $results.each{|res|
- print res.shift, "\t"
- (res||[]).each{|result|
- /([\d\.]+)/ =~ result
- print $1 + "\t" if $1
- }
- puts
- }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
- puts file
- file = File.join(File.dirname($0), 'contrib', file)
- Benchmark.bm{|x|
- x.report('ruby'){
- system("#{$rubybin} #{file}")
- }
- x.report('yarv'){
- system("#{$rubybin} -rite -I.. #{file}")
- }
- }
-end
-
-ARGV.each{|file|
- runfile file
-}
-
-
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
new file mode 100644
index 0000000000..62ad1d6862
--- /dev/null
+++ b/benchmark/scan.yaml
@@ -0,0 +1,16 @@
+prelude: |
+ $LOAD_PATH.unshift(File.expand_path("lib"))
+ require "strscan"
+ str = "test string"
+ scanner = StringScanner.new(str)
+ str = "test"
+ reg = /test/
+benchmark:
+ check(reg): |
+ scanner.check(reg)
+ check(str): |
+ scanner.check(str)
+ match?(reg): |
+ scanner.match?(reg)
+ match?(str): |
+ scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
new file mode 100644
index 0000000000..42a50c90e6
--- /dev/null
+++ b/benchmark/search.yaml
@@ -0,0 +1,16 @@
+prelude: |
+ $LOAD_PATH.unshift(File.expand_path("lib"))
+ require "strscan"
+ str = "test string"
+ scanner = StringScanner.new(str)
+ str = "string"
+ reg = /string/
+benchmark:
+ check_until(reg): |
+ scanner.check_until(reg)
+ check_until(str): |
+ scanner.check_until(str)
+ exist?(reg): |
+ scanner.exist?(reg)
+ exist?(str): |
+ scanner.exist?(str)
diff --git a/benchmark/bm_securerandom.rb b/benchmark/securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/bm_securerandom.rb
+++ b/benchmark/securerandom.rb
diff --git a/benchmark/set.yml b/benchmark/set.yml
new file mode 100644
index 0000000000..061509cb1f
--- /dev/null
+++ b/benchmark/set.yml
@@ -0,0 +1,261 @@
+prelude: |
+ # First 1000 digits of pi
+ pi = <<~END.gsub(/\D/, '')
+ 31415926535897932384626433832795028841971693993751058209749445923078164062862089
+ 98628034825342117067982148086513282306647093844609550582231725359408128481117450
+ 28410270193852110555964462294895493038196442881097566593344612847564823378678316
+ 52712019091456485669234603486104543266482133936072602491412737245870066063155881
+ 74881520920962829254091715364367892590360011330530548820466521384146951941511609
+ 43305727036575959195309218611738193261179310511854807446237996274956735188575272
+ 48912279381830119491298336733624406566430860213949463952247371907021798609437027
+ 70539217176293176752384674818467669405132000568127145263560827785771342757789609
+ 17363717872146844090122495343014654958537105079227968925892354201995611212902196
+ 08640344181598136297747713099605187072113499999983729780499510597317328160963185
+ 95024459455346908302642522308253344685035261931188171010003137838752886587533208
+ 38142061717766914730359825349042875546873115956286388235378759375195778185778053
+ 21712268066130019278766111959092164201989380952572010654505906988788448549
+ END
+ array1 = 10.times.flat_map do |i|
+ pi[i...].chars.each_slice(10).map(&:join)
+ end
+ array2 = array1.map(&:reverse)
+ array1.map!(&:to_i)
+ array2.map!(&:to_i)
+ a1 = array1[...10]
+ a2 = array1[...100]
+ a3 = array1
+ oa1 = array2[...10]
+ oa2 = array2[...100]
+ oa3 = array2
+ s0 = Set.new
+ s0 = Set.new
+ s1 = Set.new(a1)
+ s2 = Set.new(a2)
+ s3 = Set.new(a3)
+ o0 = Set.new
+ o1 = Set.new(array2[...10])
+ o2 = Set.new(array2[...100])
+ o3 = Set.new(array2)
+ d0 = s0.dup
+ d1 = s1.dup
+ d2 = s2.dup
+ d3 = s3.dup
+ ss1 = s1 - a1[-1..-1]
+ ss2 = s2 - a2[-1..-1]
+ ss3 = s3 - a3[-1..-1]
+ os1 = o1 - oa1[-1..-1]
+ os2 = o2 - oa2[-1..-1]
+ os3 = o3 - oa3[-1..-1]
+ member = a1.first
+ cbi = s0.dup.compare_by_identity
+ ns = Set[s3, o3, d3]
+ set_subclass = Class.new(Set)
+
+benchmark:
+ new_0: Set.new
+ new_10: Set.new(a1)
+ new_100: Set.new(a2)
+ new_1000: Set.new(a3)
+ aref_0: Set[]
+ aref_10: Set[*a1]
+ aref_100: Set[*a2]
+ aref_1000: Set[*a3]
+ amp_0: s0 & o0
+ amp_10: s1 & o1
+ amp_100: s2 & o2
+ amp_1000: s3 & o3
+ amp_same_0: s0 & d0
+ amp_same_10: s1 & d1
+ amp_same_100: s2 & d2
+ amp_same_1000: s3 & d3
+ minus_0: s0 - o0
+ minus_10: s1 - o1
+ minus_100: s2 - o2
+ minus_1000: s3 - o3
+ minus_same_0: s0 - d0
+ minus_same_10: s1 - d1
+ minus_same_100: s2 - d2
+ minus_same_1000: s3 - d3
+ spaceship_0: s0 <=> o0
+ spaceship_diff_10: s1 <=> o1
+ spaceship_diff_100: s2 <=> o2
+ spaceship_diff_1000: s2 <=> o3
+ spaceship_sub_10: s1 <=> ss1
+ spaceship_sub_100: s2 <=> ss2
+ spaceship_sub_1000: s2 <=> ss3
+ spaceship_sup_10: ss1 <=> s1
+ spaceship_sup_100: ss2 <=> s2
+ spaceship_sup_1000: ss2 <=> s3
+ eq_0: s0 == o0
+ eq_10: s1 == o1
+ eq_100: s2 == o2
+ eq_1000: s3 == o3
+ eq_same_0: s0 == d0
+ eq_same_10: s1 == d1
+ eq_same_100: s2 == d2
+ eq_same_1000: s3 == d3
+ xor_0: s0 ^ o0
+ xor_10: s1 ^ o1
+ xor_100: s2 ^ o2
+ xor_1000: s3 ^ o3
+ xor_same_0: s0 ^ d0
+ xor_same_10: s1 ^ d1
+ xor_same_100: s2 ^ d2
+ xor_same_1000: s3 ^ d3
+ pipe_0: s0 | o0
+ pipe_10: s1 | o1
+ pipe_100: s2 | o2
+ pipe_1000: s3 | o3
+ pipe_same_0: s0 | d0
+ pipe_same_10: s1 | d1
+ pipe_same_100: s2 | d2
+ pipe_same_1000: s3 | d3
+ add: a3.each { s0.add(it) }
+ add_exist: a3.each { s3.add(it) }
+ addq: a3.each { s0.add?(it) }
+ addq_exist: a3.each { s3.add?(it) }
+ classify_0: s0.classify { it }
+ classify_10: s1.classify { it & 2 }
+ classify_100: s2.classify { it & 8 }
+ classify_1000: s3.classify { it & 32 }
+ clear: s0.clear
+ collect_0: s0.collect! { it }
+ collect_10: s1.collect! { it }
+ collect_100: s2.collect! { it }
+ collect_1000: s3.collect! { it }
+ compare_by_identity_0: s0.dup.compare_by_identity
+ compare_by_identity_10: s1.dup.compare_by_identity
+ compare_by_identity_100: s2.dup.compare_by_identity
+ compare_by_identity_1000: s3.dup.compare_by_identity
+ compare_by_identityq_false: s0.compare_by_identity?
+ compare_by_identityq_true: cbi.compare_by_identity?
+ clone_0: s0.clone
+ clone_10: s1.clone
+ clone_100: s2.clone
+ clone_1000: s3.clone
+ delete: a3.each { s3.delete(it) }
+ delete_not_exist: a3.each { o3.delete(it) }
+ deleteq: a3.each { s3.delete?(it) }
+ deleteq_not_exist: a3.each { o3.delete?(it) }
+ delete_if_0: s0.delete_if { it }
+ delete_if_10: s1.delete_if { it & 2 == 0 }
+ delete_if_100: s2.delete_if { it & 2 == 0 }
+ delete_if_1000: s3.delete_if { it & 2 == 0 }
+ disjoint_0: s0.disjoint? o0
+ disjoint_10: s1.disjoint? o1
+ disjoint_100: s2.disjoint? o2
+ disjoint_1000: s3.disjoint? o3
+ disjoint_same_0: s0.disjoint? d0
+ disjoint_same_10: s1.disjoint? d1
+ disjoint_same_100: s2.disjoint? d2
+ disjoint_same_1000: s3.disjoint? d3
+ divide_1arity_0: s0.divide { true }
+ divide_1arity_10: s1.divide { it & 2 }
+ divide_1arity_100: s2.divide { it & 8 }
+ divide_1arity_1000: s3.divide { it & 32 }
+ divide_2arity_0: s0.divide { true }
+ divide_2arity_10: s1.divide { (_1 & 2) == (_2 & 2) }
+ divide_2arity_100: s2.divide { (_1 & 8) == (_2 & 8) }
+ divide_2arity_1000: s3.divide { (_1 & 32) == (_2 & 32) }
+ dup_0: s0.dup
+ dup_10: s1.dup
+ dup_100: s2.dup
+ dup_1000: s3.dup
+ each_0: s0.each { it }
+ each_10: s1.each { it }
+ each_100: s2.each { it }
+ each_1000: s3.each { it }
+ empty_true: s0.empty?
+ empty_false: s3.empty?
+ flatten: ns.flatten
+ flattenb: ns.flatten!
+ include_true_0: s0.include? member
+ include_true_10: s1.include? member
+ include_true_100: s2.include? member
+ include_true_1000: s3.include? member
+ include_false_0: s0.include?(-1)
+ include_false_10: s1.include?(-1)
+ include_false_100: s2.include?(-1)
+ include_false_1000: s3.include?(-1)
+ intersect_0: s0.intersect? o0
+ intersect_10: s1.intersect? o1
+ intersect_100: s2.intersect? o2
+ intersect_1000: s3.intersect? o3
+ intersect_same_0: s0.intersect? d0
+ intersect_same_10: s1.intersect? d1
+ intersect_same_100: s2.intersect? d2
+ intersect_same_1000: s3.intersect? d3
+ join_0: s0.join
+ join_10: s1.join
+ join_100: s2.join
+ join_1000: s3.join
+ join_arg_0: s0.join ""
+ join_arg_10: s1.join ""
+ join_arg_100: s2.join ""
+ join_arg_1000: s3.join ""
+ keep_if_0: s0.keep_if { it }
+ keep_if_10: s1.keep_if { it & 2 == 0 }
+ keep_if_100: s2.keep_if { it & 2 == 0 }
+ keep_if_1000: s3.keep_if { it & 2 == 0 }
+ merge_set: s0.dup.merge(s3, o3)
+ merge_enum: s0.dup.merge(array1, array2)
+ proper_subset_0: s0.proper_subset? s0
+ proper_subset_10: s1.proper_subset? ss1
+ proper_subset_100: s2.proper_subset? ss2
+ proper_subset_1000: s3.proper_subset? ss3
+ proper_subset_false_10: s1.proper_subset? os1
+ proper_subset_false_100: s2.proper_subset? os2
+ proper_subset_false_1000: s3.proper_subset? os3
+ proper_superset_0: s0.proper_superset? s0
+ proper_superset_10: ss1.proper_superset? s1
+ proper_superset_100: ss2.proper_superset? s2
+ proper_superset_1000: ss3.proper_superset? s3
+ proper_superset_false_10: os1.proper_superset? s1
+ proper_superset_false_100: os2.proper_superset? s2
+ proper_superset_false_1000: os3.proper_superset? s3
+ reject_0: s0.reject! { it }
+ reject_10: s1.reject! { it & 2 == 0 }
+ reject_100: s2.reject! { it & 2 == 0 }
+ reject_1000: s3.reject! { it & 2 == 0 }
+ replace_0: s = Set.new; array1.each { s.replace(s0) }
+ replace_10: s = Set.new; array1.each { s.replace(s1) }
+ replace_100: s = Set.new; array1.each { s.replace(s2) }
+ replace_1000: s = Set.new; array1.each { s.replace(s3) }
+ reset_0: s0.reset
+ reset_10: s1.reset
+ reset_100: s2.reset
+ reset_1000: s3.reset
+ select_0: s0.select! { it }
+ select_10: s1.select! { it & 2 == 0 }
+ select_100: s2.select! { it & 2 == 0 }
+ select_1000: s3.select! { it & 2 == 0 }
+ size_0: s0.size
+ size_10: s1.size
+ size_100: s2.size
+ size_1000: s3.size
+ subtract_set: s3.dup.subtract(os3)
+ subtract_enum: s3.dup.subtract(oa3)
+ subtract_same_set: s3.dup.subtract(s3)
+ subtract_same_enum: s3.dup.subtract(a3)
+ subset_0: s0.subset? s0
+ subset_10: s1.subset? ss1
+ subset_100: s2.subset? ss2
+ subset_1000: s3.subset? ss3
+ subset_false_10: s1.subset? os1
+ subset_false_100: s2.subset? os2
+ subset_false_1000: s3.subset? os3
+ superset_0: s0.superset? s0
+ superset_10: ss1.superset? s1
+ superset_100: ss2.superset? s2
+ superset_1000: ss3.superset? s3
+ superset_false_10: os1.superset? s1
+ superset_false_100: os2.superset? s2
+ superset_false_1000: os3.superset? s3
+ to_a_0: s0.to_a
+ to_a_10: s1.to_a
+ to_a_100: s2.to_a
+ to_a_1000: s3.to_a
+ to_set_0: s0.to_set
+ to_set_10: s1.to_set
+ to_set_100: s2.to_set
+ to_set_1000: s3.to_set
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/so_ackermann.rb
index 7db5be9050..4effa1ecaf 100644
--- a/benchmark/bm_so_ackermann.rb
+++ b/benchmark/so_ackermann.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
diff --git a/benchmark/bm_so_array.rb b/benchmark/so_array.rb
index 2b8fce8f99..767e03db5f 100644
--- a/benchmark/bm_so_array.rb
+++ b/benchmark/so_array.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
# with help from Paul Brannan and Mark Hubbart
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/bm_so_binary_trees.rb
+++ b/benchmark/so_binary_trees.rb
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/so_concatenate.rb
index 873214de7c..4468e20ac8 100644
--- a/benchmark/bm_so_concatenate.rb
+++ b/benchmark/so_concatenate.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
diff --git a/benchmark/wc.input.base b/benchmark/so_count_words.yml
index 41143fbac0..f7322a8541 100644
--- a/benchmark/wc.input.base
+++ b/benchmark/so_count_words.yml
@@ -1,25 +1,66 @@
-Subject: Re: Who was Izchak Miller?
-From: "Jane D. Anonymous" <nobody@yale.edu>
-Date: 1996/04/28
-Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
-References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-To: 75176.2330@compuserve.com
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url: news:4lk6vl$gde@ns.oar.net
-Mime-Version: 1.0
-Newsgroups: rec.games.roguelike.nethack
-X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father. When I was younger I spent
-many a night, hunched over the keyboard with a cup of tea, playing
-nethack with him and my brother. my dad was a philosopher with a strong
-weakness for fantasy/sci fi. I remember when he started to get involved
-with the Nethack team- my brother's Dungeons and Dragons monster book
-found a regular place beside my dad's desk. it's nice to see him living
-on in the game he loved so much :-).
- Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+prelude: |
+ #!/usr/bin/ruby
+
+ wc_input_base = <<EOS
+ Subject: Re: Who was Izchak Miller?
+ From: "Jane D. Anonymous" <nobody@yale.edu>
+ Date: 1996/04/28
+ Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
+ References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+ To: 75176.2330@compuserve.com
+ Content-Type: text/plain; charset=us-ascii
+ Organization: Yale University
+ X-Url: news:4lk6vl$gde@ns.oar.net
+ Mime-Version: 1.0
+ Newsgroups: rec.games.roguelike.nethack
+ X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+ Hello there, Izchak Miller was my father. When I was younger I spent
+ many a night, hunched over the keyboard with a cup of tea, playing
+ nethack with him and my brother. my dad was a philosopher with a strong
+ weakness for fantasy/sci fi. I remember when he started to get involved
+ with the Nethack team- my brother's Dungeons and Dragons monster book
+ found a regular place beside my dad's desk. it's nice to see him living
+ on in the game he loved so much :-).
+ Tamar Miller
+
+ The following is a really long word of 5000 characters:
+
+ wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+ EOS
+
+ # prepare 'wc.input'
+
+ def prepare_wc_input(wcbase)
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ unless FileTest.exist?(wcinput)
+ data = wcbase.dup
+ 13.times{
+ data << data
+ }
+ File.write(wcinput, data)
+ end
+ at_exit {File.unlink(wcinput) rescue nil}
+ end
+
+ prepare_wc_input(wc_input_base)
+
+benchmark:
+ so_count_words: |
+ # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+ # http://www.bagley.org/~doug/shootout/
+ # with help from Paul Brannan
+
+ nl = nw = nc = 0
+ File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
+ while tmp = input.read(4096)
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+ end
+ end
+ # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/bm_so_exception.rb b/benchmark/so_exception.rb
index deb003a594..eb205b4df1 100644
--- a/benchmark/bm_so_exception.rb
+++ b/benchmark/so_exception.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/bm_so_fannkuch.rb
+++ b/benchmark/so_fannkuch.rb
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/so_fasta.rb
index 3f759ba7ae..dcc6b39507 100644
--- a/benchmark/bm_so_fasta.rb
+++ b/benchmark/so_fasta.rb
@@ -3,7 +3,7 @@
# Contributed by Sokolov Yura
$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
+def gen_random(max, im=139968, ia=3877, ic=29573)
(max * ($last = ($last * ia + ic) % im)) / im
end
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_k_nucleotide
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(100_000)
+ script: |
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org
+ #
+ # contributed by jose fco. gonzalez
+ # modified by Sokolov Yura
+
+ seq = String.new
+
+ def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+ end
+
+ def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+ end
+
+ def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+ line = input.gets while line !~ /^>THREE/
+ line = input.gets
+
+ while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+ end
+
+ [1,2].each {|i| sort_by_freq( seq,i ) }
+
+ %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+ loop_count: 1
diff --git a/benchmark/bm_so_lists.rb b/benchmark/so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/bm_so_lists.rb
+++ b/benchmark/so_lists.rb
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/bm_so_mandelbrot.rb
+++ b/benchmark/so_mandelbrot.rb
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/so_matrix.rb
index e2c5c8e559..2d1e72bda9 100644
--- a/benchmark/bm_so_matrix.rb
+++ b/benchmark/so_matrix.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
index 17e9c046a8..d8c8e3ab9c 100644
--- a/benchmark/bm_so_meteor_contest.rb
+++ b/benchmark/so_meteor_contest.rb
@@ -155,7 +155,7 @@ class Rotation
# given a set of directions places the piece (as defined by a set of directions) on the board at
# a location that will not take it off the edge
- def get_values ( directions )
+ def get_values( directions )
start = start_adjust(directions)
values = [ start ]
directions.each do | direction |
@@ -260,7 +260,7 @@ end
# support function that create three utility maps:
# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a a five bit representation of the bits below it
+# to the a five bit representation of the bits below it
# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
# a region array has three values the first is a mask of bits in the region,
@@ -447,7 +447,7 @@ end
# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# diminish over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
# maximum number
def find_top( rotation_skip)
@@ -561,4 +561,3 @@ create_collector_support
@boards_found = 0
find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/so_nbody.rb
index d6c5bb9e61..9884fc4edc 100644
--- a/benchmark/bm_so_nbody.rb
+++ b/benchmark/so_nbody.rb
@@ -12,38 +12,38 @@ def _puts *args
end
class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
end
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
end
def energy(bodies)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/so_nested_loop.rb
index a0513f8c47..766fcf7b84 100644
--- a/benchmark/bm_so_nested_loop.rb
+++ b/benchmark/so_nested_loop.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
# from Avi Bryant
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/bm_so_nsieve.rb
+++ b/benchmark/so_nsieve.rb
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/bm_so_nsieve_bits.rb
+++ b/benchmark/so_nsieve_bits.rb
diff --git a/benchmark/bm_so_object.rb b/benchmark/so_object.rb
index e8607c7199..131f44624c 100644
--- a/benchmark/bm_so_object.rb
+++ b/benchmark/so_object.rb
@@ -1,5 +1,5 @@
#!/usr/bin/ruby
-# -*- mode: ruby -*-
+# -*- Ruby -*-
# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
# http://www.bagley.org/~doug/shootout/
# with help from Aristarkh Zagorodnikov
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/bm_so_partial_sums.rb
+++ b/benchmark/so_partial_sums.rb
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/so_pidigits.rb
index c7d6fbfb4d..9a537b2d1c 100644
--- a/benchmark/bm_so_pidigits.rb
+++ b/benchmark/so_pidigits.rb
@@ -38,7 +38,7 @@ end
class Transformation
attr_reader :q, :r, :s, :t
- def initialize (q, r, s, t)
+ def initialize(q, r, s, t)
@q,@r,@s,@t,@k = q,r,s,t,0
end
diff --git a/benchmark/bm_so_random.rb b/benchmark/so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/bm_so_random.rb
+++ b/benchmark/so_random.rb
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_reverse_complement
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(2_500_000)
+ script: |
+ # The Great Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ #
+ # Contributed by Peter Bjarke Olsen
+ # Modified by Doug King
+
+ seq=Array.new
+
+ def revcomp(seq)
+ seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+ stringlen=seq.length
+ 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+ while input.gets
+ if $_ =~ />/
+ if seq.length != 0
+ revcomp(seq.join)
+ seq=Array.new
+ end
+ puts $_
+ else
+ $_.sub(/\n/,'')
+ seq.push $_
+ end
+ end
+ revcomp(seq.join)
+ loop_count: 1
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/bm_so_sieve.rb
+++ b/benchmark/so_sieve.rb
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/bm_so_spectralnorm.rb
+++ b/benchmark/so_spectralnorm.rb
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+ str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ capitalize-1: str1.capitalize
+ capitalize-10: str10.capitalize
+ capitalize-100: str100.capitalize
+ capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..88a3555c8a
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,28 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp-1: lstr1.casecmp(ustr1)
+ casecmp-10: lstr10.casecmp(ustr10)
+ casecmp-100: lstr100.casecmp(ustr100)
+ casecmp-1000: lstr1000.casecmp(ustr1000)
+ casecmp-1000vs10: lstr1000.casecmp(ustr10)
+ casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+ casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+ casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+ casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
+ casecmp-nonascii1000vs10: lnonascii1000.casecmp(unonascii10)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp_p-1: lstr1.casecmp?(ustr1)
+ casecmp_p-10: lstr10.casecmp?(ustr10)
+ casecmp_p-100: lstr100.casecmp?(ustr100)
+ casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+ casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+ casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+ casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+ casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..f11f95ee9a
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,51 @@
+prelude: |
+ CHUNK = "a" * 64
+ UCHUNK = "é" * 32
+ SHORT = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] / 2)
+ LONG = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] * 2)
+ GC.disable # GC causes a lot of variance
+benchmark:
+ binary_concat_7bit: |
+ buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ utf8_concat_7bit: |
+ buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ utf8_concat_UTF8: |
+ buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ interpolation: |
+ buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
+ interpolation_same_heap: |
+ buffer = "#{SHORT}#{SHORT}"
+ interpolation_switching_heaps: |
+ buffer = "#{SHORT}#{LONG}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"A".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ downcase-1: str1.upcase
+ downcase-10: str10.upcase
+ downcase-100: str100.upcase
+ downcase-1000: str1000.upcase
+ downcase-nonascii1: nonascii1.downcase
+ downcase-nonascii10: nonascii10.downcase
+ downcase-nonascii100: nonascii100.downcase
+ downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_dup.yml b/benchmark/string_dup.yml
new file mode 100644
index 0000000000..90793f9f2a
--- /dev/null
+++ b/benchmark/string_dup.yml
@@ -0,0 +1,7 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ uplus: |
+ +"A"
+ dup: |
+ "A".dup
diff --git a/benchmark/string_fstring.yml b/benchmark/string_fstring.yml
new file mode 100644
index 0000000000..cafef1f3fe
--- /dev/null
+++ b/benchmark/string_fstring.yml
@@ -0,0 +1,16 @@
+benchmark:
+ fstring_random: |
+ i = 0
+ str = "same".dup
+ while i < 5_000_000
+ -(i.to_s.freeze)
+ i += 1
+ end
+ fstring_same: |
+ i = 0
+ str = "same".dup
+ while i < 10_000_000
+ -str
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/string_gsub.yml b/benchmark/string_gsub.yml
new file mode 100644
index 0000000000..0f964337dd
--- /dev/null
+++ b/benchmark/string_gsub.yml
@@ -0,0 +1,43 @@
+prelude: |
+ # frozen_string_literal: true
+ STR = ((("a" * 31) + "<") * 1000).freeze
+ STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze
+ ESCAPED_CHARS_BINARY = {
+ "\u2028".b => '\u2028'.b,
+ "\u2029".b => '\u2029'.b,
+ ">".b => '\u003e'.b.freeze,
+ "<".b => '\u003c'.b.freeze,
+ "&".b => '\u0026'.b.freeze,
+ }
+ BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)
+
+ ESCAPED_CHARS = {
+ "\u2028" => '\u2028',
+ "\u2029" => '\u2029',
+ ">" => '\u003e',
+ "<" => '\u003c',
+ "&" => '\u0026',
+ }
+ ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)
+
+
+benchmark:
+ escape: |
+ str = STR.dup
+ str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+ str
+
+ escape_bin: |
+ str = STR.b
+ str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+ str.force_encoding(Encoding::UTF_8)
+
+ escape_utf8: |
+ str = STR_UNICODE.dup
+ str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+ str
+
+ escape_utf8_bin: |
+ str = STR_UNICODE.b
+ str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+ str.force_encoding(Encoding::UTF_8)
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "あ" * 1024 + "い" # not single byte optimizable
+str2 = "い"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_rpartition.yml b/benchmark/string_rpartition.yml
new file mode 100644
index 0000000000..37e9d1b071
--- /dev/null
+++ b/benchmark/string_rpartition.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"a".."z",*"0".."9"].join("")
+ str10 = str1 * 10 + ":"
+ str100 = str1 * 100 + ":"
+ str1000 = str1 * 1000 + ":"
+ nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10 + ":"
+ nonascii100 = nonascii1 * 100 + ":"
+ nonascii1000 = nonascii1 * 1000 + ":"
+benchmark:
+ rpartition-1: str1.rpartition(":")
+ rpartition-10: str10.rpartition(":")
+ rpartition-100: str100.rpartition(":")
+ rpartition-1000: str1000.rpartition(":")
+ rpartition-nonascii1: nonascii1.rpartition(":")
+ rpartition-nonascii10: nonascii10.rpartition(":")
+ rpartition-nonascii100: nonascii100.rpartition(":")
+ rpartition-nonascii1000: nonascii1000.rpartition(":")
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+ long_string = "x"*1000+"-hår"
+benchmark:
+ regexp-short: |
+ "x-hår".slice!(/-(.)(.)(.)/, 3)
+ regexp-long: |
+ long_string.dup.slice!(/-(.)(.)(.)/, 3)
+ string-short: |
+ "x-hår".slice!("r")
+ string-long: |
+ long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+ str1 = [*0..5].join(" ") + " "
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ to_chars-1: str1.split('')
+ to_chars-10: str10.split('')
+ to_chars-100: str100.split('')
+ to_chars-1000: str1000.split('')
+ to_words-1: str1.split(' ')
+ to_words-10: str10.split(' ')
+ to_words-100: str100.split(' ')
+ to_words-1000: str1000.split(' ')
+ re_chars-1: str1.split(//)
+ re_chars-10: str10.split(//)
+ re_chars-100: str100.split(//)
+ re_chars-1000: str1000.split(//)
+ re_space-1: str1.split(/ /)
+ re_space-10: str10.split(/ /)
+ re_space-100: str100.split(/ /)
+ re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ swapcase-1: str1.swapcase
+ swapcase-10: str10.swapcase
+ swapcase-100: str100.swapcase
+ swapcase-1000: str1000.swapcase
+ swapcase-nonascii1: nonascii1.swapcase
+ swapcase-nonascii10: nonascii10.swapcase
+ swapcase-nonascii100: nonascii100.swapcase
+ swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"a".."z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ upcase-1: str1.upcase
+ upcase-10: str10.upcase
+ upcase-100: str100.upcase
+ upcase-1000: str1000.upcase
+ upcase-nonascii1: nonascii1.upcase
+ upcase-nonascii10: nonascii10.upcase
+ upcase-nonascii100: nonascii100.upcase
+ upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/struct_accessor.yml b/benchmark/struct_accessor.yml
new file mode 100644
index 0000000000..d95240e2dd
--- /dev/null
+++ b/benchmark/struct_accessor.yml
@@ -0,0 +1,37 @@
+prelude: |
+ C = Struct.new(:x) do
+ def initialize(...)
+ super
+ @ivar = 42
+ end
+
+ attr_accessor :ivar
+
+ class_eval <<-END
+ def r
+ #{'x;'*256}
+ end
+ def w
+ #{'self.x = nil;'*256}
+ end
+ def rm
+ m = method(:x)
+ #{'m.call;'*256}
+ end
+ def wm
+ m = method(:x=)
+ #{'m.call(nil);'*256}
+ end
+ def r_ivar
+ #{'ivar;'*256}
+ end
+ END
+ end
+ C.new(nil) # ensure common shape is known
+ obj = C.new(nil)
+benchmark:
+ member_reader: "obj.r"
+ member_writer: "obj.w"
+ member_reader_method: "obj.rm"
+ member_writer_method: "obj.wm"
+ ivar_reader: "obj.r_ivar"
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ - 'Time.at(0)'
+ - 'Time.at(0, 500)'
+ - 'Time.at(0, in: "+09:00")'
+ - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - 'Time.new(2021)'
+ - 'Time.new(2021, 8, 22)'
+ - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..9336877cd4
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - 'Time.now'
+ - 'Time.now(in: "+09:00")'
+ - 'Time.now.year'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+ require 'time'
+ inspect = "2021-08-23 09:57:02 +0900"
+ iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+ - Time.iso8601(iso8601)
+ - Time.parse(iso8601)
+ - Time.parse(inspect)
+ - Time.new(iso8601) rescue Time.iso8601(iso8601)
+ - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strftime.yml b/benchmark/time_strftime.yml
new file mode 100644
index 0000000000..28f62aec87
--- /dev/null
+++ b/benchmark/time_strftime.yml
@@ -0,0 +1,7 @@
+prelude: |
+ # frozen_string_literal: true
+ time = Time.now
+benchmark:
+ - time.strftime("%FT%T") # 19B
+ - time.strftime("%FT%T.%3N") # 23B
+ - time.strftime("%FT%T.%6N") # 26B
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'time'
+benchmark:
+ - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+ - Time.strptime("1", "%s")
+ - Time.strptime("0 +0100", "%s %z")
+ - Time.strptime("0 UTC", "%s %z")
+ - Time.strptime("1.5", "%s.%N")
+ - Time.strptime("1.000000000001", "%s.%N")
+ - Time.strptime("20010203 -0200", "%Y%m%d %z")
+ - Time.strptime("20010203 UTC", "%Y%m%d %z")
+ - Time.strptime("2018-365", "%Y-%j")
+ - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/time_xmlschema.yml b/benchmark/time_xmlschema.yml
new file mode 100644
index 0000000000..654e5cfcbc
--- /dev/null
+++ b/benchmark/time_xmlschema.yml
@@ -0,0 +1,27 @@
+prelude: |
+ # frozen_string_literal
+ unless Time.method_defined?(:xmlschema)
+ class Time
+ def xmlschema(fraction_digits=0)
+ fraction_digits = fraction_digits.to_i
+ s = strftime("%FT%T")
+ if fraction_digits > 0
+ s << strftime(".%#{fraction_digits}N")
+ end
+ s << (utc? ? 'Z' : strftime("%:z"))
+ end
+ end
+ end
+ time = Time.now
+ utc_time = Time.now.utc
+ fraction_sec = Time.at(123456789.quo(9999999999)).getlocal("+09:00")
+ future_time = Time.utc(10000)
+benchmark:
+ - time.xmlschema
+ - utc_time.xmlschema
+ - time.xmlschema(6)
+ - utc_time.xmlschema(6)
+ - time.xmlschema(9)
+ - utc_time.xmlschema(9)
+ - fraction_sec.xmlschema(10)
+ - future_time.xmlschema
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_array: |
+ a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ attr_reader :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+ end
+ obj = C.new
+benchmark:
+ vm_attr_ivar: |
+ j = obj.a
+ k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ attr_accessor :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+ end
+ obj = C.new
+benchmark:
+ vm_attr_ivar_set: |
+ obj.a = 1
+ obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/vm_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/bm_vm3_backtrace.rb
+++ b/benchmark/vm_backtrace.rb
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+ vm_bigarray: |
+ a = [
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_bighash: |
+ a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+ def m
+ yield
+ end
+benchmark:
+ vm_block: |
+ m{
+ }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+ p = proc{_1}
+ o = Object.new
+ def o.each
+ i = 0
+ while i < 3_000_000 do
+ yield i
+ i += 1
+ end
+ end
+
+benchmark:
+ - name: block_handler_type_iseq
+ script: |
+ o.each{_1}
+
+ - name: block_handler_type_symbol
+ script: |
+ o.each(&:itself)
+
+ - name: block_handler_type_proc
+ script: |
+ o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m &b
+ end
+benchmark:
+ vm_blockparam: |
+ m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m &b
+ b.call
+ end
+benchmark:
+ vm_blockparam_call: |
+ m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+ def bp_yield
+ yield
+ end
+
+ def bp_pass &b
+ bp_yield &b
+ end
+benchmark:
+ vm_blockparam_pass: |
+ bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def bp_yield &b
+ yield
+ end
+benchmark:
+ vm_blockparam_yield: |
+ bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_call_bmethod.yml b/benchmark/vm_call_bmethod.yml
new file mode 100644
index 0000000000..40136e5aa4
--- /dev/null
+++ b/benchmark/vm_call_bmethod.yml
@@ -0,0 +1,37 @@
+prelude: |
+ define_method(:a0){}
+ define_method(:a1){|a| a}
+ define_method(:s){|*a| a}
+ define_method(:b){|kw: 1| kw}
+
+ t0 = 0.times.to_a
+ t1 = 1.times.to_a
+ t10 = 10.times.to_a
+ t100 = 100.times.to_a
+ kw = {kw: 2}
+benchmark:
+ bmethod_simple_0: |
+ a0
+ bmethod_simple_1: |
+ a1(1)
+ bmethod_simple_0_splat: |
+ a0(*t0)
+ bmethod_simple_1_splat: |
+ a1(*t1)
+ bmethod_no_splat: |
+ s
+ bmethod_0_splat: |
+ s(*t0)
+ bmethod_1_splat: |
+ s(*t1)
+ bmethod_10_splat: |
+ s(*t10)
+ bmethod_100_splat: |
+ s(*t100)
+ bmethod_kw: |
+ b(kw: 1)
+ bmethod_no_kw: |
+ b
+ bmethod_kw_splat: |
+ b(**kw)
+loop_count: 6000000
diff --git a/benchmark/vm_call_kw_and_kw_splat.yml b/benchmark/vm_call_kw_and_kw_splat.yml
new file mode 100644
index 0000000000..aa6e549e0c
--- /dev/null
+++ b/benchmark/vm_call_kw_and_kw_splat.yml
@@ -0,0 +1,25 @@
+prelude: |
+ h1, h10, h100, h1000 = [1, 10, 100, 1000].map do |n|
+ h = {kw: 1}
+ n.times{|i| h[i.to_s.to_sym] = i}
+ h
+ end
+ eh = {}
+ def kw(kw: nil, **kws) end
+benchmark:
+ 1: |
+ kw(**h1)
+ 1_mutable: |
+ kw(**eh, **h1)
+ 10: |
+ kw(**h10)
+ 10_mutable: |
+ kw(**eh, **h10)
+ 100: |
+ kw(**h100)
+ 100_mutable: |
+ kw(**eh, **h100)
+ 1000: |
+ kw(**h1000)
+ 1000_mutable: |
+ kw(**eh, **h1000)
diff --git a/benchmark/vm_call_method_missing.yml b/benchmark/vm_call_method_missing.yml
new file mode 100644
index 0000000000..f890796f11
--- /dev/null
+++ b/benchmark/vm_call_method_missing.yml
@@ -0,0 +1,62 @@
+prelude: |
+ class A0
+ def method_missing(m); m end
+ end
+ class A1
+ def method_missing(m, a) a; end
+ end
+ class S
+ def method_missing(m, *a) a; end
+ end
+ class B
+ def method_missing(m, kw: 1) kw end
+ end
+ class SB
+ def method_missing(m, *a, kw: 1) kw end
+ end
+
+ t0 = 0.times.to_a
+ t1 = 1.times.to_a
+ t10 = 10.times.to_a
+ t200 = 200.times.to_a
+ kw = {kw: 2}
+
+ a0 = A0.new
+ a1 = A1.new
+ s = S.new
+ b = B.new
+ sb = SB.new
+benchmark:
+ method_missing_simple_0: |
+ a0.()
+ method_missing_simple_1: |
+ a1.x(1)
+ method_missing_simple_0_splat: |
+ a0.(*t0)
+ method_missing_simple_1_splat: |
+ a1.(*t1)
+ method_missing_no_splat: |
+ s.()
+ method_missing_0_splat: |
+ s.(*t0)
+ method_missing_1_splat: |
+ s.(*t1)
+ method_missing_10_splat: |
+ s.(*t10)
+ method_missing_200_splat: |
+ s.(*t200)
+ method_missing_kw: |
+ b.(kw: 1)
+ method_missing_no_kw: |
+ b.()
+ method_missing_kw_splat: |
+ b.(**kw)
+ method_missing_0_splat_kw: |
+ sb.(*t0, **kw)
+ method_missing_1_splat_kw: |
+ sb.(*t1, **kw)
+ method_missing_10_splat_kw: |
+ sb.(*t10, **kw)
+ method_missing_200_splat_kw: |
+ sb.(*t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_call_send_iseq.yml b/benchmark/vm_call_send_iseq.yml
new file mode 100644
index 0000000000..60ff23c475
--- /dev/null
+++ b/benchmark/vm_call_send_iseq.yml
@@ -0,0 +1,77 @@
+prelude: |
+ def a0; end
+ def a1(a) a; end
+ def s(*a) a; end
+ def b(kw: 1) kw end
+ def sb(*a, kw: 1) kw end
+
+ t0 = 0.times.to_a
+ t1 = 1.times.to_a
+ t10 = 10.times.to_a
+ t200 = 200.times.to_a
+
+ a0_t0 = [:a0, *t0]
+ a1_t1 = [:a1, *t1]
+ s_t0 = [:s, *t0]
+ s_t1 = [:s, *t1]
+ s_t10 = [:s, *t10]
+ s_t200 = [:s, *t200]
+ sb_t0 = [:sb, *t0]
+ sb_t1 = [:sb, *t1]
+ sb_t10 = [:sb, *t10]
+ sb_t200 = [:sb, *t200]
+ kw = {kw: 2}
+benchmark:
+ send_simple_0: |
+ send(:a0)
+ send_simple_1: |
+ send(:a1, 1)
+ send_simple_0_splat: |
+ send(:a0, *t0)
+ send_simple_1_splat: |
+ send(:a1, *t1)
+ send_simple_0_splat_comb: |
+ send(*a0_t0)
+ send_simple_1_splat_comb: |
+ send(*a1_t1)
+ send_no_splat: |
+ send(:s)
+ send_0_splat: |
+ send(:s, *t0)
+ send_1_splat: |
+ send(:s, *t1)
+ send_10_splat: |
+ send(:s, *t10)
+ send_200_splat: |
+ send(:s, *t200)
+ send_0_splat_comb: |
+ send(*s_t0)
+ send_1_splat_comb: |
+ send(*s_t1)
+ send_10_splat_comb: |
+ send(*s_t10)
+ send_200_splat_comb: |
+ send(*s_t200)
+ send_kw: |
+ send(:b, kw: 1)
+ send_no_kw: |
+ send(:b)
+ send_kw_splat: |
+ send(:b, **kw)
+ send_0_splat_kw: |
+ send(:sb, *t0, **kw)
+ send_1_splat_kw: |
+ send(:sb, *t1, **kw)
+ send_10_splat_kw: |
+ send(:sb, *t10, **kw)
+ send_200_splat_kw: |
+ send(:sb, *t200, **kw)
+ send_0_splat_comb_kw: |
+ send(*sb_t0, **kw)
+ send_1_splat_comb_kw: |
+ send(*sb_t1, **kw)
+ send_10_splat_comb_kw: |
+ send(*sb_t10, **kw)
+ send_200_splat_comb_kw: |
+ send(*sb_t200, **kw)
+loop_count: 3000000
diff --git a/benchmark/vm_call_symproc.yml b/benchmark/vm_call_symproc.yml
new file mode 100644
index 0000000000..16e0ac579e
--- /dev/null
+++ b/benchmark/vm_call_symproc.yml
@@ -0,0 +1,83 @@
+prelude: |
+ def self.a0; end
+ def self.a1(a) a; end
+ def self.s(*a) a; end
+ def self.b(kw: 1) kw end
+ def self.sb(*a, kw: 1) kw end
+
+ t0 = 0.times.to_a
+ t1 = 1.times.to_a
+ t10 = 10.times.to_a
+ t200 = 200.times.to_a
+
+ a0_t0 = [self, *t0]
+ a1_t1 = [self, *t1]
+ s_t0 = [self, *t0]
+ s_t1 = [self, *t1]
+ s_t10 = [self, *t10]
+ s_t200 = [self, *t200]
+ sb_t0 = [self, *t0]
+ sb_t1 = [self, *t1]
+ sb_t10 = [self, *t10]
+ sb_t200 = [self, *t200]
+ kw = {kw: 2}
+
+ a0 = :a0.to_proc
+ a1 = :a1.to_proc
+ s = :s.to_proc
+ b = :b.to_proc
+ sb = :sb.to_proc
+benchmark:
+ symproc_simple_0: |
+ a0.(self)
+ symproc_simple_1: |
+ a1.(self, 1)
+ symproc_simple_0_splat: |
+ a0.(self, *t0)
+ symproc_simple_1_splat: |
+ a1.(self, *t1)
+ symproc_simple_0_splat_comb: |
+ a0.(*a0_t0)
+ symproc_simple_1_splat_comb: |
+ a1.(*a1_t1)
+ symproc_no_splat: |
+ s.(self)
+ symproc_0_splat: |
+ s.(self, *t0)
+ symproc_1_splat: |
+ s.(self, *t1)
+ symproc_10_splat: |
+ s.(self, *t10)
+ symproc_200_splat: |
+ s.(self, *t200)
+ symproc_0_splat_comb: |
+ s.(*s_t0)
+ symproc_1_splat_comb: |
+ s.(*s_t1)
+ symproc_10_splat_comb: |
+ s.(*s_t10)
+ symproc_200_splat_comb: |
+ s.(*s_t200)
+ symproc_kw: |
+ b.(self, kw: 1)
+ symproc_no_kw: |
+ b.(self)
+ symproc_kw_splat: |
+ b.(self, **kw)
+ symproc_0_splat_kw: |
+ sb.(self, *t0, **kw)
+ symproc_1_splat_kw: |
+ sb.(self, *t1, **kw)
+ symproc_10_splat_kw: |
+ sb.(self, *t10, **kw)
+ symproc_200_splat_kw: |
+ sb.(self, *t200, **kw)
+ symproc_0_splat_comb_kw: |
+ sb.(*sb_t0, **kw)
+ symproc_1_splat_comb_kw: |
+ sb.(*sb_t1, **kw)
+ symproc_10_splat_comb_kw: |
+ sb.(*sb_t10, **kw)
+ symproc_200_splat_comb_kw: |
+ sb.(*sb_t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+ vm_case: |
+ case :foo
+ when :bar
+ raise
+ when :baz
+ raise
+ when :boo
+ raise
+ when :foo
+ # noop
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+ vm_case_classes: |
+ case :foo
+ when Hash
+ raise
+ when Array
+ raise
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_case_lit: |
+ i = 0
+ @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+ def foo(i)
+ @ret[i % @ret.size]
+ end
+
+ while i<6_000_000
+ case foo(i)
+ when "foo" then :foo
+ when true then true
+ when false then false
+ when :sym then :sym
+ when 6 then :fix
+ when nil then nil
+ when 0.1 then :float
+ when 0xffffffffffffffff then :big
+ end
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ b/benchmark/vm_clearmethodcache.rb
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..8939ca0cd3
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,13 @@
+prelude: |
+ Const = 1
+ A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1
+ def foo
+ A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z
+ end
+benchmark:
+ vm_const: |
+ j = Const
+ k = Const
+ vm_const_many: |
+ foo
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class A
+ @@foo = 1
+
+ def self.foo
+ @@foo
+ end
+
+ ("A".."Z").each do |module_name|
+ eval <<-EOM
+ module #{module_name}
+ end
+
+ include #{module_name}
+ EOM
+ end
+ end
+benchmark:
+ vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+ class Object
+ define_method(:m){}
+ end
+benchmark:
+ vm_defined_method: |
+ m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+ x = y = 'z'
+benchmark:
+ vm_dstr: |
+ str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/vm_dstr_ary.rb
index 58c0f7bbc3..1d3aa3b97b 100644
--- a/benchmark/bm_vm2_dstr.rb
+++ b/benchmark/vm_dstr_ary.rb
@@ -1,5 +1,5 @@
i = 0
-x = y = 'z'
+x = y = []
while i<6_000_000 # benchmark loop 2
i += 1
str = "foo#{x}bar#{y}baz"
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/vm_dstr_bool.rb
index a8ccff7138..631ca54755 100644
--- a/benchmark/bm_vm2_method.rb
+++ b/benchmark/vm_dstr_bool.rb
@@ -1,9 +1,7 @@
-def m
- nil
-end
-
i = 0
+x = true
+y = false
while i<6_000_000 # benchmark loop 2
i += 1
- m; m; m; m; m; m; m; m;
+ str = "foo#{x}bar#{y}baz"
end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/vm_dstr_int.rb
index 6422c9b0d0..ed380d7595 100644
--- a/benchmark/bm_vm2_newlambda.rb
+++ b/benchmark/vm_dstr_int.rb
@@ -1,5 +1,5 @@
i = 0
while i<6_000_000 # benchmark loop 2
i += 1
- lambda {}
+ str = "foo#{i}bar#{i}baz"
end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/vm_dstr_str.rb
index df9037c83c..45fc107892 100644
--- a/benchmark/bm_vm2_array.rb
+++ b/benchmark/vm_dstr_str.rb
@@ -1,5 +1,6 @@
i = 0
+x = y = ""
while i<6_000_000 # benchmark loop 2
i += 1
- a = [1,2,3,4,5,6,7,8,9,10]
+ str = "foo#{x}bar#{y}baz"
end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/vm_dstr_sym.rb
index 307cfc28ef..484b8f8150 100644
--- a/benchmark/bm_vm2_eval.rb
+++ b/benchmark/vm_dstr_sym.rb
@@ -1,6 +1,6 @@
i = 0
+x = y = :z
while i<6_000_000 # benchmark loop 2
i += 1
- eval("1")
+ str = "foo#{x}bar#{y}baz"
end
-
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+ vm_ensure: |
+ i = 0
+ while i<30_000_000
+ i += 1
+ begin
+ begin
+ ensure
+ end
+ ensure
+ end
+ end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_eval: |
+ eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ vm_fiber_allocate: |
+ fiber = Fiber.new{Fiber.yield}
+ fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+ fibers = []
+benchmark:
+ vm_fiber_count: |
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+ GC.disable
+ fibers = []
+benchmark:
+ vm_fiber_reuse: |
+ 1024.times do
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+ end
+
+ fibers.clear
+ GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+ fibers = []
+benchmark:
+ vm_fiber_reuse_gc: |
+ 2000.times do
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+ end
+ fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+ # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+ fib = Fiber.new do
+ loop { Fiber.yield }
+ end
+benchmark:
+ vm_fiber_switch: |
+ fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+ f = 0.0
+benchmark:
+ vm_float_simple: |
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezeobj.yml b/benchmark/vm_freezeobj.yml
new file mode 100644
index 0000000000..69a795a354
--- /dev/null
+++ b/benchmark/vm_freezeobj.yml
@@ -0,0 +1,6 @@
+prelude: |
+ objs = 100000.times.map { Object.new }
+benchmark:
+ vm_freeze_obj: |
+ objs.map(&:freeze)
+loop_count: 600
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+ class String
+ def freeze
+ -self
+ end
+ end
+benchmark:
+ vm_freezestring: |
+ "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/vm_gc.rb
index e668026915..e668026915 100644
--- a/benchmark/bm_vm3_gc.rb
+++ b/benchmark/vm_gc.rb
diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
new file mode 100644
index 0000000000..cfdfc8c5a5
--- /dev/null
+++ b/benchmark/vm_gc_old_full.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+100.times do
+ GC.start
+end
diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
new file mode 100644
index 0000000000..ad22feb655
--- /dev/null
+++ b/benchmark/vm_gc_old_immediate.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+ GC.start(full_mark: false, immediate_sweep: true)
+end
diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
new file mode 100644
index 0000000000..b74d44baf1
--- /dev/null
+++ b/benchmark/vm_gc_old_lazy.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+ GC.start(full_mark: false, immediate_sweep: false)
+end
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+ vm_gc_short_lived: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+ def nested_hash h, n
+ if n == 0
+ ''
+ else
+ 10.times{
+ h[Object.new] = nested_hash(h, n-1)
+ }
+ end
+ end
+
+ long_lived = Hash.new
+ nested_hash long_lived, 6
+
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_complex_long: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+ long_lived = Array.new(1_000_000){|i| "#{i}"}
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_long: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+ 50_000.times{|i| sym = "sym#{i}".to_sym}
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_symbol: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+ short_lived_ary = []
+
+ if RUBY_VERSION >= "2.2.0"
+ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_ary: |
+ short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+ long_lived = []
+
+ if RUBY_VERSION > "2.2.0"
+ 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+ elsif
+ GC.start
+ end
+
+ short_lived = ''
+
+benchmark:
+ vm_gc_wb_ary_promoted: |
+ long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+ class C
+ attr_accessor :foo
+ end
+ short_lived_obj = C.new
+
+ if RUBY_VERSION >= "2.2.0"
+ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_obj: |
+ short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C
+ attr_accessor :foo
+ end
+ long_lived = C.new
+
+ if RUBY_VERSION >= "2.2.0"
+ 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+ elsif
+ GC.start
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_obj_promoted: |
+ long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class C
+ def m
+ 1
+ end
+
+ ("A".."M").each do |module_name|
+ eval <<-EOM
+ module #{module_name}
+ def m; super; end
+ end
+ prepend #{module_name}
+ EOM
+ end
+ end
+
+ obj = C.new
+benchmark:
+ vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+ vm_ivar: |
+ j = @a
+ k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_embedded_obj_init.yml b/benchmark/vm_ivar_embedded_obj_init.yml
new file mode 100644
index 0000000000..74fe20a630
--- /dev/null
+++ b/benchmark/vm_ivar_embedded_obj_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_embedded_obj_init: |
+ c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_extended_obj_init.yml b/benchmark/vm_ivar_extended_obj_init.yml
new file mode 100644
index 0000000000..f054bab282
--- /dev/null
+++ b/benchmark/vm_ivar_extended_obj_init.yml
@@ -0,0 +1,16 @@
+prelude: |
+ class C
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ @d = nil
+ @e = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_extended_obj_init: |
+ c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_get.yml b/benchmark/vm_ivar_generic_get.yml
new file mode 100644
index 0000000000..dae2d37671
--- /dev/null
+++ b/benchmark/vm_ivar_generic_get.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C < Array
+ attr_reader :a, :b, :c
+ def initialize
+ @a = nil
+ @b = nil
+ @c = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_generic_get: |
+ c.a
+ c.b
+ c.c
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_set.yml b/benchmark/vm_ivar_generic_set.yml
new file mode 100644
index 0000000000..102a6577fb
--- /dev/null
+++ b/benchmark/vm_ivar_generic_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C < Array
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_generic_set: |
+ c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_get.yml b/benchmark/vm_ivar_get.yml
new file mode 100644
index 0000000000..1e0dad665f
--- /dev/null
+++ b/benchmark/vm_ivar_get.yml
@@ -0,0 +1,100 @@
+prelude: |
+ class Example
+ def initialize
+ @levar = 1
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+ end
+
+ def get_value_loop
+ sum = 0
+
+ i = 0
+ while i < 100_000
+ # 10 times to de-emphasize loop overhead
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ i += 1
+ end
+
+ return sum
+ end
+
+ @levar = 1
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+
+ def self.get_value_loop
+ sum = 0
+
+ i = 0
+ while i < 100_000
+ # 10 times to de-emphasize loop overhead
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ i += 1
+ end
+
+ return sum
+ end
+ end
+
+ class GenExample < Time
+ def initialize
+ @levar = 1
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+ end
+
+ def get_value_loop
+ sum = 0
+
+ i = 0
+ while i < 100_000
+ # 10 times to de-emphasize loop overhead
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ i += 1
+ end
+
+ return sum
+ end
+ end
+
+ obj = Example.new
+ gen = GenExample.new
+benchmark:
+ vm_ivar_get_on_obj: |
+ obj.get_value_loop
+ vm_ivar_get_on_class: |
+ Example.get_value_loop
+ vm_ivar_get_on_generic: |
+ gen.get_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_get_unintialized.yml b/benchmark/vm_ivar_get_unintialized.yml
new file mode 100644
index 0000000000..a1ccfb06ce
--- /dev/null
+++ b/benchmark/vm_ivar_get_unintialized.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class Example
+ def read
+ @uninitialized
+ end
+ end
+
+ obj = Example.new
+benchmark:
+ vm_ivar_get_uninitialized: |
+ obj.read
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_ic_miss.yml b/benchmark/vm_ivar_ic_miss.yml
new file mode 100644
index 0000000000..944fb1a9e6
--- /dev/null
+++ b/benchmark/vm_ivar_ic_miss.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class Foo
+ def initialize diverge
+ if diverge
+ @a = 1
+ end
+
+ @a0 = @a1 = @a2 = @a3 = @a4 = @a5 = @a6 = @a7 = @a8 = @a9 = @a10 = @a11 = @a12 = @a13 = @a14 = @a15 = @a16 = @a17 = @a18 = @a19 = @a20 = @a21 = @a22 = @a23 = @a24 = @a25 = @a26 = @a27 = @a28 = @a29 = @a30 = @a31 = @a32 = @a33 = @a34 = @a35 = @a36 = @a37 = @a38 = @a39 = @a40 = @a41 = @a42 = @a43 = @a44 = @a45 = @a46 = @a47 = @a48 = @a49 = @a50 = @a51 = @a52 = @a53 = @a54 = @a55 = @a56 = @a57 = @a58 = @a59 = @a60 = @a61 = @a62 = @a63 = @a64 = @a65 = @a66 = @a67 = @a68 = @a69 = @a70 = @a71 = @a72 = @a73 = @a74 = @b = 1
+ end
+
+ def b; @b; end
+ end
+
+ a = Foo.new false
+ b = Foo.new true
+benchmark:
+ vm_ivar_ic_miss: |
+ a.b
+ b.b
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_lazy_set.yml b/benchmark/vm_ivar_lazy_set.yml
new file mode 100644
index 0000000000..7372ffcfbc
--- /dev/null
+++ b/benchmark/vm_ivar_lazy_set.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class Example
+ def lazy_set
+ @uninitialized ||= 123
+ end
+ end
+
+ objs = 10000000.times.map { Example.new }
+benchmark:
+ vm_ivar_lazy_set: |
+ objs.each(&:lazy_set)
+loop_count: 1
diff --git a/benchmark/vm_ivar_memoize.yml b/benchmark/vm_ivar_memoize.yml
new file mode 100644
index 0000000000..90f6b07f05
--- /dev/null
+++ b/benchmark/vm_ivar_memoize.yml
@@ -0,0 +1,85 @@
+prelude: |
+ IVARS = 60
+ class Record
+ def initialize(offset = false)
+ @offset = 1 if offset
+ @first = 0
+ IVARS.times do |i|
+ instance_variable_set("@ivar_#{i}", i)
+ end
+ end
+
+ def first
+ @first
+ end
+
+ def lazy_set
+ @lazy_set ||= 123
+ end
+
+ def undef
+ @undef
+ end
+ end
+
+ Record.new # Need one alloc to right size
+
+ BASE = Record.new
+ LAZY = Record.new
+ LAZY.lazy_set
+
+ class Miss < Record
+ @first = 0
+ IVARS.times do |i|
+ instance_variable_set("@i_#{i}", i)
+ end
+ end
+
+ Miss.new # Need one alloc to right size
+ MISS = Miss.new
+
+ DIVERGENT = Record.new(true)
+
+benchmark:
+ vm_ivar_stable_shape: |
+ BASE.first
+ BASE.first
+ BASE.first
+ BASE.first
+ BASE.first
+ BASE.first
+ vm_ivar_memoize_unstable_shape: |
+ BASE.first
+ LAZY.first
+ BASE.first
+ LAZY.first
+ BASE.first
+ LAZY.first
+ vm_ivar_memoize_unstable_shape_miss: |
+ BASE.first
+ MISS.first
+ BASE.first
+ MISS.first
+ BASE.first
+ MISS.first
+ vm_ivar_unstable_undef: |
+ BASE.undef
+ LAZY.undef
+ BASE.undef
+ LAZY.undef
+ BASE.undef
+ LAZY.undef
+ vm_ivar_divergent_shape: |
+ BASE.first
+ DIVERGENT.first
+ BASE.first
+ DIVERGENT.first
+ BASE.first
+ DIVERGENT.first
+ vm_ivar_divergent_shape_imbalanced: |
+ BASE.first
+ DIVERGENT.first
+ DIVERGENT.first
+ DIVERGENT.first
+ DIVERGENT.first
+ DIVERGENT.first
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class C
+ @a = 1
+ def self.a
+ _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+ _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+ end
+ end
+benchmark:
+ vm_ivar_of_class: |
+ a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+ class C
+ @a = 1
+ def self.a o
+ @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+ end
+ end
+benchmark:
+ vm_ivar_of_class_set: |
+ a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+ vm_ivar_set: |
+ @a = 1
+ @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_on_instance.yml b/benchmark/vm_ivar_set_on_instance.yml
new file mode 100644
index 0000000000..6ce53a86ec
--- /dev/null
+++ b/benchmark/vm_ivar_set_on_instance.yml
@@ -0,0 +1,94 @@
+prelude: |
+ class TheClass
+ def initialize
+ @levar = 1
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+ end
+
+ def set_value_loop
+ # 100k
+ i = 0
+ while i < 100_000
+ # 10 times to de-emphasize loop overhead
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ i += 1
+ end
+ end
+ end
+
+ class Generic < Time
+ def initialize
+ @levar = 1
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+ end
+
+ def set_value_loop
+ # 100k
+ i = 0
+ while i < 100_000
+ # 10 times to de-emphasize loop overhead
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ i += 1
+ end
+ end
+ end
+
+ obj = TheClass.new
+ gen_obj = Generic.new
+
+ class SomeClass
+ @levar = 1
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+
+ def self.set_value_loop
+ # 100k
+ i = 0
+ while i < 100_000
+ # 10 times to de-emphasize loop overhead
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ i += 1
+ end
+ end
+ end
+
+benchmark:
+ vm_ivar_set_on_instance: |
+ obj.set_value_loop
+ vm_ivar_set_on_generic: |
+ gen_obj.set_value_loop
+ vm_ivar_set_on_class: |
+ SomeClass.set_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..bc8bf5bf6b
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class A
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ @d = nil
+ @e = nil
+ end
+ end
+ class B < A; end
+ class C < A; end
+
+ b = B.new
+ c = C.new
+benchmark:
+ vm_ivar_init_subclass: |
+ b.set_ivars
+ c.set_ivars
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+ a = 'abc'
+ b = [1, 2, 3]
+benchmark:
+ vm_length: |
+ a.length
+ b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_cond_set.yml b/benchmark/vm_lvar_cond_set.yml
new file mode 100644
index 0000000000..1845f9d12e
--- /dev/null
+++ b/benchmark/vm_lvar_cond_set.yml
@@ -0,0 +1,8 @@
+benchmark:
+ vm_lvar_cond_set: |
+ a ||= 1
+ b ||= 1
+ c ||= 1
+ d ||= 1
+ nil
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+ vm_lvar_init: |
+ def m v
+ unless v
+ # unreachable code
+ v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+ v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+ v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+ v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+ v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+ end
+ end
+
+ i = 0
+
+ while i<30_000_000
+ i += 1
+ m i
+ end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_lvar_set: |
+ a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m
+ nil
+ end
+benchmark:
+ vm_method: |
+ m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+ class C
+ def method_missing mid
+ end
+ end
+
+ obj = C.new
+benchmark:
+ vm_method_missing: |
+ obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_splat_calls.yml b/benchmark/vm_method_splat_calls.yml
new file mode 100644
index 0000000000..f2f366e99c
--- /dev/null
+++ b/benchmark/vm_method_splat_calls.yml
@@ -0,0 +1,13 @@
+prelude: |
+ def f(x=0, y: 0) end
+ a = [1]
+ ea = []
+ kw = {y: 1}
+ b = lambda{}
+benchmark:
+ arg_splat: "f(1, *ea)"
+ arg_splat_block: "f(1, *ea, &b)"
+ splat_kw_splat: "f(*a, **kw)"
+ splat_kw_splat_block: "f(*a, **kw, &b)"
+ splat_kw: "f(*a, y: 1)"
+ splat_kw_block: "f(*a, y: 1, &b)"
diff --git a/benchmark/vm_method_splat_calls2.yml b/benchmark/vm_method_splat_calls2.yml
new file mode 100644
index 0000000000..d33dcd7e8b
--- /dev/null
+++ b/benchmark/vm_method_splat_calls2.yml
@@ -0,0 +1,27 @@
+prelude: |
+ def named_arg_splat(*a) end
+ def named_arg_kw_splat(*a, **kw) end
+ def anon_arg_splat(*) end
+ def anon_kw_splat(**) end
+ def anon_arg_kw_splat(*, **) end
+ def anon_fw_to_named(*, **) named_arg_kw_splat(*, **) end
+ def fw_to_named(...) named_arg_kw_splat(...) end
+ def fw_to_anon_to_named(...) anon_fw_to_named(...) end
+ def fw_no_kw(...) named_arg_splat(...) end
+ a = [1]
+ kw = {y: 1}
+benchmark:
+ named_multi_arg_splat: "named_arg_splat(*a, *a)"
+ named_post_splat: "named_arg_splat(*a, a)"
+ anon_arg_splat: "anon_arg_splat(*a)"
+ anon_arg_kw_splat: "anon_arg_kw_splat(*a, **kw)"
+ anon_multi_arg_splat: "anon_arg_splat(*a, *a)"
+ anon_post_splat: "anon_arg_splat(*a, a)"
+ anon_kw_splat: "anon_kw_splat(**kw)"
+ anon_fw_to_named_splat: "anon_fw_to_named(*a, **kw)"
+ anon_fw_to_named_no_splat: "anon_fw_to_named(1, y: 1)"
+ fw_to_named_splat: "fw_to_named(*a, **kw)"
+ fw_to_named_no_splat: "fw_to_named(1, y: 1)"
+ fw_to_anon_to_named_splat: "fw_to_anon_to_named(*a, **kw)"
+ fw_to_anon_to_named_no_splat: "fw_to_anon_to_named(1, y: 1)"
+ fw_no_kw: "fw_no_kw(1, 2)"
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m
+ nil
+ end
+benchmark:
+ vm_method_with_block: |
+ m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_module_ann_const_set: |
+ Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+ module M
+ end
+ $VERBOSE = nil
+benchmark:
+ vm_module_const_set: |
+ M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+ require 'thread'
+
+ m = Thread::Mutex.new
+benchmark:
+ vm_mutex: |
+ m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+ obj1 = Object.new
+ obj2 = Object.new
+benchmark:
+ vm_neq: |
+ obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_newlambda: |
+ lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+benchmark:
+ vm_not: |
+ !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_method: |
+ class C1
+ def m
+ 1
+ end
+ end
+ class C2
+ def m
+ 2
+ end
+ end
+
+ o1 = C1.new
+ o2 = C2.new
+
+ i = 0
+ while i<6_000_000
+ o = (i % 2 == 0) ? o1 : o2
+ o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_method_ov: |
+ class C1
+ def m
+ 1
+ end
+ end
+ class C2
+ def m
+ 2
+ end
+ end
+
+ o1 = C1.new
+ o2 = C2.new
+
+ i = 0
+ while i<6_000_000
+ o = (i % 2 == 0) ? o1 : o2
+ # o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+ module AR; end
+ class AR::Base
+ def create_or_update
+ nil
+ end
+ def save
+ create_or_update
+ end
+ end
+ class Foo < AR::Base; end
+ class Bar < AR::Base; end
+ o1 = Foo.new
+ o2 = Bar.new
+benchmark:
+ vm_poly_same_method: |
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml
@@ -0,0 +1,18 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_singleton: |
+ class C1
+ def m; 1; end
+ end
+
+ o1 = C1.new
+ o2 = C1.new
+ o2.singleton_class
+
+ i = 0
+ while i<6_000_000 # benchmark loop 2
+ o = (i % 2 == 0) ? o1 : o2
+ o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml
new file mode 100644
index 0000000000..2f8de6c272
--- /dev/null
+++ b/benchmark/vm_proc.yml
@@ -0,0 +1,12 @@
+prelude: |
+ def m &b
+ b
+ end
+
+ pr = m{
+ a = 1
+ }
+benchmark:
+ vm_proc: |
+ pr.call
+loop_count: 6000000
diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml
new file mode 100644
index 0000000000..247d9f70ee
--- /dev/null
+++ b/benchmark/vm_raise1.yml
@@ -0,0 +1,16 @@
+prelude: |
+ def rec n
+ if n > 0
+ rec n-1
+ else
+ raise
+ end
+ end
+benchmark:
+ vm_raise1: |
+ begin
+ rec 1
+ rescue
+ # ignore
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml
new file mode 100644
index 0000000000..f0fa047b3c
--- /dev/null
+++ b/benchmark/vm_raise2.yml
@@ -0,0 +1,16 @@
+prelude: |
+ def rec n
+ if n > 0
+ rec n-1
+ else
+ raise
+ end
+ end
+benchmark:
+ vm_raise2: |
+ begin
+ rec 10
+ rescue
+ # ignore
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml
new file mode 100644
index 0000000000..2aa3d94dbd
--- /dev/null
+++ b/benchmark/vm_regexp.yml
@@ -0,0 +1,8 @@
+prelude: |
+ str = 'xxxhogexxx'
+benchmark:
+ vm_regexp: |
+ /hoge/ =~ str
+ vm_regexp_invert: |
+ str =~ /hoge/
+loop_count: 6000000
diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml
new file mode 100644
index 0000000000..b4a0af521f
--- /dev/null
+++ b/benchmark/vm_rescue.yml
@@ -0,0 +1,6 @@
+benchmark:
+ vm_rescue: |
+ begin
+ rescue
+ end
+loop_count: 30000000
diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml
new file mode 100644
index 0000000000..f31bc7ac89
--- /dev/null
+++ b/benchmark/vm_send.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ def m
+ end
+ end
+
+ o = C.new
+ m = :m
+benchmark:
+ vm_send: |
+ o.__send__ :m
+ vm_send_var: |
+ o.__send__ m
+loop_count: 6000000
diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml
new file mode 100644
index 0000000000..6f12b65176
--- /dev/null
+++ b/benchmark/vm_send_cfunc.yml
@@ -0,0 +1,14 @@
+prelude: |
+ ary = []
+ kw = {a: 1}
+ empty_kw = {}
+ kw_ary = [Hash.ruby2_keywords_hash(a: 1)]
+ empty_kw_ary = [Hash.ruby2_keywords_hash({})]
+benchmark:
+ vm_send_cfunc: itself
+ vm_send_cfunc_splat: itself(*ary)
+ vm_send_cfunc_splat_kw_hash: equal?(*kw_ary)
+ vm_send_cfunc_splat_empty_kw_hash: itself(*empty_kw_ary)
+ vm_send_cfunc_splat_kw: equal?(*ary, **kw)
+ vm_send_cfunc_splat_empty_kw: itself(*ary, **empty_kw)
+loop_count: 20000000
diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml
new file mode 100644
index 0000000000..c9829cff0b
--- /dev/null
+++ b/benchmark/vm_simplereturn.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m
+ return 1
+ end
+benchmark:
+ vm_simplereturn: m
+loop_count: 30000000
diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml
new file mode 100644
index 0000000000..64439c7980
--- /dev/null
+++ b/benchmark/vm_string_literal.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_string_literal: |
+ x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml
new file mode 100644
index 0000000000..4cf78970cb
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_aref_hi: |
+ x.z # x[25]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml
new file mode 100644
index 0000000000..c91af27fa5
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_aref_lo: |
+ x.k # x[10]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml
new file mode 100644
index 0000000000..69550d14ea
--- /dev/null
+++ b/benchmark/vm_struct_big_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_struct_big_aset: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+ i = 0
+ while i<6_000_000
+ i += 1
+ x.k = i # x[10] = i
+ end
+loop_count: 1
diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml
new file mode 100644
index 0000000000..09b764dd13
--- /dev/null
+++ b/benchmark/vm_struct_big_href_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_href_hi: |
+ x[:z]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml
new file mode 100644
index 0000000000..d2f00b220f
--- /dev/null
+++ b/benchmark/vm_struct_big_href_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_href_lo: |
+ x[:k]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml
new file mode 100644
index 0000000000..fc45cbee9c
--- /dev/null
+++ b/benchmark/vm_struct_big_hset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_struct_big_hset: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+ i = 0
+ while i<6_000_000
+ i += 1
+ x[:k] = i
+ end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml
new file mode 100644
index 0000000000..5a83251d1e
--- /dev/null
+++ b/benchmark/vm_struct_small_aref.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+benchmark:
+ vm_struct_small_aref: |
+ x.a
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml
new file mode 100644
index 0000000000..74f435f126
--- /dev/null
+++ b/benchmark/vm_struct_small_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_struct_small_aset: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+ i = 0
+ while i<6_000_000
+ i += 1
+ x.a = i
+ end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml
new file mode 100644
index 0000000000..6b7d7f39e7
--- /dev/null
+++ b/benchmark/vm_struct_small_href.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+benchmark:
+ vm_struct_small_href: |
+ x[:a]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml
new file mode 100644
index 0000000000..5d43b150de
--- /dev/null
+++ b/benchmark/vm_struct_small_hset.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+benchmark:
+ vm_struct_small_hset: |
+ x[:a] = 1
+loop_count: 6000000
diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml
new file mode 100644
index 0000000000..0d1e965c6e
--- /dev/null
+++ b/benchmark/vm_super.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C
+ def m
+ 1
+ end
+ end
+
+ class CC < C
+ def m
+ super()
+ end
+ end
+
+ obj = CC.new
+benchmark:
+ vm_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_super_splat_calls.yml b/benchmark/vm_super_splat_calls.yml
new file mode 100644
index 0000000000..795e44e4da
--- /dev/null
+++ b/benchmark/vm_super_splat_calls.yml
@@ -0,0 +1,25 @@
+prelude: |
+ @a = [1].freeze
+ @ea = [].freeze
+ @kw = {y: 1}.freeze
+ @b = lambda{}
+ extend(Module.new{def arg_splat(x=0, y: 0) end})
+ extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+ extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+ extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+ extend(Module.new{def splat_kw(x=0, y: 0) end})
+ extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+ extend(Module.new{def arg_splat; super(1, *@ea) end})
+ extend(Module.new{def arg_splat_block; super(1, *@ea, &@b) end})
+ extend(Module.new{def splat_kw_splat; super(*@a, **@kw) end})
+ extend(Module.new{def splat_kw_splat_block; super(*@a, **@kw, &@b) end})
+ extend(Module.new{def splat_kw; super(*@a, y: 1) end})
+ extend(Module.new{def splat_kw_block; super(*@a, y: 1, &@b) end})
+benchmark:
+ arg_splat: "arg_splat"
+ arg_splat_block: "arg_splat_block"
+ splat_kw_splat: "splat_kw_splat"
+ splat_kw_splat_block: "splat_kw_splat_block"
+ splat_kw: "splat_kw"
+ splat_kw_block: "splat_kw_block"
diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml
new file mode 100644
index 0000000000..e824a65e0a
--- /dev/null
+++ b/benchmark/vm_swap.yml
@@ -0,0 +1,7 @@
+prelude: |
+ a = 1
+ b = 2
+benchmark:
+ vm_swap: |
+ a, b = b, a
+loop_count: 30000000
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb
index 1d433353e1..1d433353e1 100644
--- a/benchmark/bm_vm_symbol_block_pass.rb
+++ b/benchmark/vm_symbol_block_pass.rb
diff --git a/benchmark/vm_thread_alive_check.yml b/benchmark/vm_thread_alive_check.yml
new file mode 100644
index 0000000000..d21737d3e8
--- /dev/null
+++ b/benchmark/vm_thread_alive_check.yml
@@ -0,0 +1,8 @@
+benchmark:
+ vm_thread_alive_check: |
+ t = Thread.new{}
+ while t.alive?
+ Thread.pass
+ end
+loop_count: 50_000
+
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/vm_thread_close.rb
index 3e9a265ce8..3e9a265ce8 100644
--- a/benchmark/bm_vm_thread_close.rb
+++ b/benchmark/vm_thread_close.rb
diff --git a/benchmark/vm_thread_condvar1.rb b/benchmark/vm_thread_condvar1.rb
new file mode 100644
index 0000000000..feed27c3ad
--- /dev/null
+++ b/benchmark/vm_thread_condvar1.rb
@@ -0,0 +1,28 @@
+# two threads, two mutex, two condvar ping-pong
+require 'thread'
+m1 = Thread::Mutex.new
+m2 = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 100000
+i = 0
+wait = nil
+m2.synchronize do
+ wait = Thread.new do
+ m1.synchronize do
+ m2.synchronize { cv2.signal }
+ while (i += 1) < max
+ cv1.wait(m1)
+ cv2.signal
+ end
+ end
+ end
+ cv2.wait(m2)
+end
+m1.synchronize do
+ while i < max
+ cv1.signal
+ cv2.wait(m1)
+ end
+end
+wait.join
diff --git a/benchmark/vm_thread_condvar2.rb b/benchmark/vm_thread_condvar2.rb
new file mode 100644
index 0000000000..6590c4134b
--- /dev/null
+++ b/benchmark/vm_thread_condvar2.rb
@@ -0,0 +1,35 @@
+# many threads, one mutex, many condvars
+require 'thread'
+m = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 1000
+n = 100
+waiting = 0
+scvs = []
+waiters = n.times.map do |i|
+ start_cv = Thread::ConditionVariable.new
+ scvs << start_cv
+ start_mtx = Thread::Mutex.new
+ start_mtx.synchronize do
+ th = Thread.new(start_mtx, start_cv) do |sm, scv|
+ m.synchronize do
+ sm.synchronize { scv.signal }
+ max.times do
+ cv2.signal if (waiting += 1) == n
+ cv1.wait(m)
+ end
+ end
+ end
+ start_cv.wait(start_mtx)
+ th
+ end
+end
+m.synchronize do
+ max.times do
+ cv2.wait(m) until waiting == n
+ waiting = 0
+ cv1.broadcast
+ end
+end
+waiters.each(&:join)
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/vm_thread_create_join.rb
index 393cd45df9..393cd45df9 100644
--- a/benchmark/bm_vm_thread_create_join.rb
+++ b/benchmark/vm_thread_create_join.rb
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/vm_thread_mutex1.rb
index 5c9f85dfb7..66e42c85e1 100644
--- a/benchmark/bm_vm_thread_mutex1.rb
+++ b/benchmark/vm_thread_mutex1.rb
@@ -1,7 +1,7 @@
# one thread, one mutex (no contention)
require 'thread'
-m = Mutex.new
+m = Thread::Mutex.new
r = 0
max = 2000
lmax = max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/vm_thread_mutex2.rb
index 10de59054f..6e6c804c31 100644
--- a/benchmark/bm_vm_thread_mutex2.rb
+++ b/benchmark/vm_thread_mutex2.rb
@@ -1,7 +1,7 @@
# two threads, one mutex
require 'thread'
-m = Mutex.new
+m = Thread::Mutex.new
r = 0
max = 2000
lmax = (max * max)/2
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/vm_thread_mutex3.rb
index 7f9a44b39d..c750dc542a 100644
--- a/benchmark/bm_vm_thread_mutex3.rb
+++ b/benchmark/vm_thread_mutex3.rb
@@ -1,7 +1,7 @@
# 1000 threads, one mutex
require 'thread'
-m = Mutex.new
+m = Thread::Mutex.new
r = 0
max = 2000
(1..max).map{
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/vm_thread_pass.rb
index b5b3c0bc85..438bd08d45 100644
--- a/benchmark/bm_vm_thread_pass.rb
+++ b/benchmark/vm_thread_pass.rb
@@ -1,8 +1,8 @@
-# Plenty Thtread.pass
+# Plenty Thread.pass
# A performance may depend on GVL implementation.
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
+tmax = (ARGV.shift || 8).to_i
+lmax = 400_000 / tmax
(1..tmax).map{
Thread.new{
diff --git a/benchmark/vm_thread_pass_flood.rb b/benchmark/vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..65df8e6154
--- /dev/null
+++ b/benchmark/vm_thread_pass_flood.rb
@@ -0,0 +1,10 @@
+# n.b. this is a good test for GVL when pinned to a single CPU
+
+5_000.times{
+ Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10_000
+ i += 1
+end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/vm_thread_pipe.rb
index 272d231eba..112a621905 100644
--- a/benchmark/bm_vm_thread_pipe.rb
+++ b/benchmark/vm_thread_pipe.rb
@@ -1,4 +1,4 @@
-# Mesure small and plenty pipe read/write.
+# Measure small and plenty pipe read/write.
# A performance may depend on GVL implementation.
lmax = 100_000
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/vm_thread_queue.rb
index 37381ae62b..1dd3696a3c 100644
--- a/benchmark/bm_vm_thread_queue.rb
+++ b/benchmark/vm_thread_queue.rb
@@ -1,7 +1,7 @@
require 'thread'
-n = 1_000_000
-q = Queue.new
+n = 10_000_000
+q = Thread::Queue.new
consumer = Thread.new{
while q.pop
# consuming
diff --git a/benchmark/vm_thread_sized_queue.rb b/benchmark/vm_thread_sized_queue.rb
new file mode 100644
index 0000000000..7b9af5482b
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue.rb
@@ -0,0 +1,20 @@
+require 'thread'
+# on producer, one consumer
+
+n = 1_000_000
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new{
+ while q.pop
+ # consuming
+ end
+}
+
+producer = Thread.new{
+ while n > 0
+ q.push true
+ n -= 1
+ end
+ q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue2.rb b/benchmark/vm_thread_sized_queue2.rb
new file mode 100644
index 0000000000..de9f55e978
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue2.rb
@@ -0,0 +1,23 @@
+require 'thread'
+# one producer, many consumers
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = m.times.map do
+ Thread.new do
+ while q.pop
+ # consuming
+ end
+ end
+end
+
+producer = Thread.new do
+ while n > 0
+ q.push true
+ n -= 1
+ end
+ m.times { q.push nil }
+end
+
+producer.join
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sized_queue3.rb b/benchmark/vm_thread_sized_queue3.rb
new file mode 100644
index 0000000000..ce5f1796d8
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue3.rb
@@ -0,0 +1,22 @@
+require 'thread'
+# many producers, one consumer
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new do
+ while q.pop
+ # consuming
+ end
+end
+
+producers = m.times.map do
+ Thread.new do
+ while n > 0
+ q.push true
+ n -= 1
+ end
+ end
+end
+producers.each(&:join)
+q.push nil
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue4.rb b/benchmark/vm_thread_sized_queue4.rb
new file mode 100644
index 0000000000..a9b7d80ec0
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue4.rb
@@ -0,0 +1,26 @@
+require 'thread'
+# many producers, many consumers
+nr = 1_000_000
+n = 10
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = n.times.map do
+ Thread.new do
+ while q.pop
+ # consuming
+ end
+ end
+end
+
+producers = m.times.map do
+ Thread.new do
+ while nr > 0
+ q.push true
+ nr -= 1
+ end
+ end
+end
+
+producers.each(&:join)
+n.times { q.push nil }
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sleep.yml b/benchmark/vm_thread_sleep.yml
new file mode 100644
index 0000000000..96901d8466
--- /dev/null
+++ b/benchmark/vm_thread_sleep.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_thread_sleep: |
+ Thread.new { sleep }
+loop_count: 10_000
diff --git a/benchmark/vm_unif1.yml b/benchmark/vm_unif1.yml
new file mode 100644
index 0000000000..04187bb0e2
--- /dev/null
+++ b/benchmark/vm_unif1.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m a, b
+ end
+benchmark:
+ vm_unif1: |
+ m 100, 200
+loop_count: 6000000
diff --git a/benchmark/vm_yield.yml b/benchmark/vm_yield.yml
new file mode 100644
index 0000000000..230be3d84f
--- /dev/null
+++ b/benchmark/vm_yield.yml
@@ -0,0 +1,13 @@
+# while loop cost is not removed due to benchmark_driver.gem's limitation
+benchmark:
+ vm_yield: |
+ def m
+ i = 0
+ while i<30_000_000
+ i += 1
+ yield
+ end
+ end
+
+ m{}
+loop_count: 1
diff --git a/benchmark/vm_zsuper.yml b/benchmark/vm_zsuper.yml
new file mode 100644
index 0000000000..bfb5837578
--- /dev/null
+++ b/benchmark/vm_zsuper.yml
@@ -0,0 +1,18 @@
+prelude: |
+ class C
+ def m a
+ 1
+ end
+ end
+
+ class CC < C
+ def m a
+ super
+ end
+ end
+
+ obj = CC.new
+benchmark:
+ vm_zsuper: |
+ obj.m 10
+loop_count: 6000000
diff --git a/benchmark/vm_zsuper_splat_calls.yml b/benchmark/vm_zsuper_splat_calls.yml
new file mode 100644
index 0000000000..82dc22349d
--- /dev/null
+++ b/benchmark/vm_zsuper_splat_calls.yml
@@ -0,0 +1,28 @@
+prelude: |
+ a = [1].freeze
+ ea = [].freeze
+ kw = {y: 1}.freeze
+ b = lambda{}
+ extend(Module.new{def arg_splat(x=0, y: 0) end})
+ extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+ extend(Module.new{def arg_splat_post(x=0, y: 0) end})
+ extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+ extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+ extend(Module.new{def splat_kw(x=0, y: 0) end})
+ extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+ extend(Module.new{def arg_splat(x, *a) super end})
+ extend(Module.new{def arg_splat_block(x, *a, &b) super end})
+ extend(Module.new{def arg_splat_post(*a, x) super end})
+ extend(Module.new{def splat_kw_splat(*a, **kw) super end})
+ extend(Module.new{def splat_kw_splat_block(*a, **kw, &b) super end})
+ extend(Module.new{def splat_kw(*a, y: 1) super end})
+ extend(Module.new{def splat_kw_block(*a, y: 1, &b) super end})
+benchmark:
+ arg_splat: "arg_splat(1, *ea)"
+ arg_splat_block: "arg_splat_block(1, *ea, &b)"
+ arg_splat_post: "arg_splat_post(1, *ea, &b)"
+ splat_kw_splat: "splat_kw_splat(*a, **kw)"
+ splat_kw_splat_block: "splat_kw_splat_block(*a, **kw, &b)"
+ splat_kw: "splat_kw(*a, y: 1)"
+ splat_kw_block: "splat_kw_block(*a, y: 1, &b)"