NEWS: Add an example for the warning of "yield in singleton class"

author: Yusuke Endoh <mame@ruby-lang.org> 2019-11-18 09:12:50 -0600
committer: Yusuke Endoh <mame@ruby-lang.org> 2019-11-18 09:12:50 -0600
commit: 373769c93995abeeb546bdcd9e6527c77aefa1d4 (patch)
tree: cefefc55ddfe9d5616dfd6376ded994c0e1cdb57 /tool/m4/ruby_check_signedness.m4
parent: f09fc1b0344e65aeb9c11aaeb23c99954265fe4d (diff)
0 files changed, 0 insertions, 0 deletions
diff --git a/.cvsignore b/.cvsignore
deleted file mode 100644
index a72211d03f..0000000000
--- a/.cvsignore
+++ /dev/null
@@ -1,48 +0,0 @@
-*.bak
-*.orig
-*.rej
-*.sav
-*~
-.*.list
-.*.time
-.ccmalloc
-.ppack
-.ext
-.git
-.svn
-.pc
-COPYING.LIB
-ChangeLog.pre-alpha
-ChangeLog.pre1_1
-Makefile
-README.fat-patch
-README.v6
-README.atheos
-archive
-autom4te*.cache
-automake
-beos
-config.cache
-config.h
-config.h.in
-config.log
-config.status
-configure
-libruby.so.*
-miniruby
-newdate.rb
-newver.rb
-parse.c
-patches
-ppack
-preview
-rbconfig.rb
-repack
-riscos
-rubicon
-ruby
-ruby-man.rd.gz
-tmp
-web
-y.output
-y.tab.c
diff --git a/.document b/.document
index 230c50e387..8a05d61beb 100644
--- a/.document
+++ b/.document
@@ -6,6 +6,9 @@
 # Process all the C source files
 *.c
 
+# prelude
+prelude.rb
+
 # the lib/ directory (which has its own .document file)
 
 lib
@@ -14,3 +17,6 @@ lib
 # and some of the ext/ directory (which has its own .document file)
 
 ext
+
+# rdoc files
+doc/*.rdoc
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..2a38da8892
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,757 @@
+define rp
+  if ruby_dummy_gdb_enums.special_consts
+  end
+  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+  else
+  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+    if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+      printf "SYMBOL(:%c)\n", $id
+    else
+    if $id == idDot2
+      echo SYMBOL(:..)\n
+    else
+    if $id == idDot3
+      echo SYMBOL(:...)\n
+    else
+    if $id == idUPlus
+      echo SYMBOL(:+@)\n
+    else
+    if $id == idUMinus
+      echo SYMBOL(:-@)\n
+    else
+    if $id == idPow
+      echo SYMBOL(:**)\n
+    else
+    if $id == idCmp
+      echo SYMBOL(:<=>)\n
+    else
+    if $id == idLTLT
+      echo SYMBOL(:<<)\n
+    else
+    if $id == idLE
+      echo SYMBOL(:<=)\n
+    else
+    if $id == idGE
+      echo SYMBOL(:>=)\n
+    else
+    if $id == idEq
+      echo SYMBOL(:==)\n
+    else
+    if $id == idEqq
+      echo SYMBOL(:===)\n
+    else
+    if $id == idNeq
+      echo SYMBOL(:!=)\n
+    else
+    if $id == idEqTilde
+      echo SYMBOL(:=~)\n
+    else
+    if $id == idNeqTilde
+      echo SYMBOL(:!~)\n
+    else
+    if $id == idAREF
+      echo SYMBOL(:[])\n
+    else
+    if $id == idASET
+      echo SYMBOL(:[]=)\n
+    else
+      printf "SYMBOL(%ld)\n", $id
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+  else
+  if ($arg0) == RUBY_Qfalse
+    echo false\n
+  else
+  if ($arg0) == RUBY_Qtrue
+    echo true\n
+  else
+  if ($arg0) == RUBY_Qnil
+    echo nil\n
+  else
+  if ($arg0) == RUBY_Qundef
+    echo undef\n
+  else
+  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+    echo immediate\n
+  else
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+    printf "T_NONE: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+    printf "T_NIL: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+    printf "T_OBJECT: "
+    print (struct RObject *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+    printf "T_CLASS%s: ", ($flags & RUBY_FL_SINGLETON) ? "*" : ""
+    print (struct RClass *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+    printf "T_ICLASS: "
+    print (struct RClass *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+    printf "T_MODULE: "
+    print (struct RClass *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+    printf "T_FLOAT: %.16g ", (((struct RFloat*)($arg0))->float_value)
+    print (struct RFloat *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    printf "T_STRING: "
+    set print address off
+    output (char *)(($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary)
+    set print address on
+    printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.len : \
+            (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    if !($flags & RUBY_FL_USER1)
+      printf "(embed) "
+    else
+      if ($flags & RUBY_FL_USER2)
+        printf "(shared) "
+      end
+      if ($flags & RUBY_FL_USER3)
+        printf "(assoc) "
+      end
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+      printf "coderange:unknown "
+    else
+    if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+      printf "coderange:7bit "
+    else
+    if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+      printf "coderange:valid "
+    else
+      printf "coderange:broken "
+    end
+    end
+    end
+    print (struct RString *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+    set $regsrc = ((struct RRegexp*)($arg0))->src
+    set $rsflags = ((struct RBasic*)$regsrc)->flags
+    printf "T_REGEXP: "
+    set print address off
+    output (char *)(($rsflags & RUBY_FL_USER1) ? \
+	    ((struct RString*)$regsrc)->as.heap.ptr : \
+	    ((struct RString*)$regsrc)->as.ary)
+    set print address on
+    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    if $flags & RUBY_FL_USER6
+      printf "(none) "
+    end
+    if $flags & RUBY_FL_USER5
+      printf "(literal) "
+    end
+    if $flags & RUBY_FL_USER4
+      printf "(fixed) "
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    print (struct RRegexp *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if ($flags & RUBY_FL_USER1)
+      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+      printf "T_ARRAY: len=%ld ", $len
+      printf "(embed) "
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	printf " "
+      end
+    else
+      set $len = ((struct RArray*)($arg0))->as.heap.len
+      printf "T_ARRAY: len=%ld ", $len
+      if ($flags & RUBY_FL_USER2)
+	printf "(shared) shared="
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	printf " "
+      else
+	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+      end
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	printf " "
+      end
+    end
+    print (struct RArray *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+    printf "T_FIXNUM: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+    printf "T_HASH: ",
+    if ((struct RHash *)($arg0))->ntbl
+      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    end
+    print (struct RHash *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+    printf "T_STRUCT: len=%ld ", \
+      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+       ((struct RStruct *)($arg0))->as.heap.len)
+    print (struct RStruct *)($arg0)
+    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+          ((struct RStruct *)($arg0))->as.ary : \
+          ((struct RStruct *)($arg0))->as.heap.ptr)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+    printf "T_BIGNUM: sign=%d len=%ld ", \
+      (($flags & RUBY_FL_USER1) != 0), \
+      (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+    if $flags & RUBY_FL_USER2
+      printf "(embed) "
+    end
+    print (struct RBignum *)($arg0)
+    x/xw (($flags & RUBY_FL_USER2) ? \
+          ((struct RBignum*)($arg0))->as.ary : \
+          ((struct RBignum*)($arg0))->as.heap.digits)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+    printf "T_RATIONAL: "
+    print (struct RRational *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+    printf "T_COMPLEX: "
+    print (struct RComplex *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+    printf "T_FILE: "
+    print (struct RFile *)($arg0)
+    output *((struct RFile *)($arg0))->fptr
+    printf "\n"
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+    printf "T_TRUE: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+    printf "T_FALSE: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+    if ((struct RTypedData *)($arg0))->typed_flag == 1
+      printf "T_DATA(%s): ", ((struct RTypedData *)($arg0))->type->wrap_struct_name
+      print (struct RTypedData *)($arg0)
+    else
+      printf "T_DATA: "
+      print (struct RData *)($arg0)
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+    printf "T_MATCH: "
+    print (struct RMatch *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+    printf "T_SYMBOL: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+    printf "T_UNDEF: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+    printf "T_NODE("
+    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+    printf "): "
+    print *(NODE *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+    printf "T_ZOMBIE: "
+    print (struct RData *)($arg0)
+  else
+    printf "unknown: "
+    print (struct RBasic *)($arg0)
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp
+  Print a Ruby's VALUE.
+end
+
+define nd_type
+  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+  Print a Ruby' node type.
+end
+
+define nd_file
+  print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+  Print the source file name of a node.
+end
+
+define nd_line
+  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+  Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_alen
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+define nd_next
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_cond
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_body
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_else
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_orig
+  printf "u3.value: "
+  rp ($arg0).u3.value
+end
+
+
+define nd_resq
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_ensr
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_1st
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_2nd
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+
+define nd_stts
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+
+define nd_entry
+  printf "u3.entry: "
+  p ($arg0).u3.entry
+end
+
+define nd_vid
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_cflag
+  printf "u2.id: "
+  p ($arg0).u2.id
+end
+
+define nd_cval
+  printf "u3.value: "
+  rp ($arg0).u3.value
+end
+
+
+define nd_cnt
+  printf "u3.cnt: "
+  p ($arg0).u3.cnt
+end
+
+define nd_tbl
+  printf "u1.tbl: "
+  p ($arg0).u1.tbl
+end
+
+
+define nd_var
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_ibdy
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_iter
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_value
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_aid
+  printf "u3.id: "
+  p ($arg0).u3.id
+end
+
+
+define nd_lit
+  printf "u1.value: "
+  rp ($arg0).u1.value
+end
+
+
+define nd_frml
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_rest
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+define nd_opt
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+
+define nd_recv
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_mid
+  printf "u2.id: "
+  p ($arg0).u2.id
+end
+
+define nd_args
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_noex
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_defn
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_old
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_new
+  printf "u2.id: "
+  p ($arg0).u2.id
+end
+
+
+define nd_cfnc
+  printf "u1.cfunc: "
+  p ($arg0).u1.cfunc
+end
+
+define nd_argc
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+
+define nd_cname
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_super
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_modl
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_clss
+  printf "u1.value: "
+  rp ($arg0).u1.value
+end
+
+
+define nd_beg
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_end
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_state
+  printf "u3.state: "
+  p ($arg0).u3.state
+end
+
+define nd_rval
+  printf "u2.value: "
+  rp ($arg0).u2.value
+end
+
+
+define nd_nth
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+
+define nd_tag
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_tval
+  printf "u2.value: "
+  rp ($arg0).u2.value
+end
+
+define rb_p
+  call rb_p($arg0)
+end
+
+define rb_numtable_entry
+  set $rb_numtable_tbl = $arg0
+  set $rb_numtable_id = (st_data_t)$arg1
+  set $rb_numtable_key = 0
+  set $rb_numtable_rec = 0
+  if $rb_numtable_tbl->entries_packed
+    set $rb_numtable_p = $rb_numtable_tbl->bins
+    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->bins+$rb_numtable_tbl->num_entries
+      if (st_data_t)$rb_numtable_p[0] == $rb_numtable_id
+	set $rb_numtable_key = (st_data_t)$rb_numtable_p[0]
+	set $rb_numtable_rec = (st_data_t)$rb_numtable_p[1]
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p + 2
+      end
+    end
+  else
+    set $rb_numtable_p = $rb_numtable_tbl->bins[$rb_numtable_id % $rb_numtable_tbl->num_bins]
+    while $rb_numtable_p
+      if $rb_numtable_p->key == $rb_numtable_id
+	set $rb_numtable_key = $rb_numtable_p->key
+	set $rb_numtable_rec = $rb_numtable_p->record
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p->next
+      end
+    end
+  end
+end
+
+define rb_id2name
+  rb_numtable_entry global_symbols.id_str (ID)$arg0
+  if $rb_numtable_rec
+    rp $rb_numtable_rec
+  else
+    echo undef\n
+  end
+end
+document rb_id2name
+  Print the name of id
+end
+
+define rb_method_entry
+  set $rb_method_entry_klass = (struct RClass *)$arg0
+  set $rb_method_entry_id = (ID)$arg1
+  set $rb_method_entry_me = (rb_method_entry_t *)0
+  while !$rb_method_entry_me && $rb_method_entry_klass
+    rb_numtable_entry $rb_method_entry_klass->m_tbl $rb_method_entry_id
+    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+    if !$rb_method_entry_me
+      set $rb_method_entry_klass = (struct RClass *)$rb_method_entry_klass->ptr->super
+    end
+  end
+  if $rb_method_entry_me
+    print *$rb_method_entry_klass
+    print *$rb_method_entry_me
+  else
+    echo method not found\n
+  end
+end
+document rb_method_entry
+  Search method entry by class and id
+end
+
+define rb_classname
+  call classname($arg0)
+  rb_p $
+  print *(struct RClass*)($arg0)
+end
+
+define rb_backtrace
+  call rb_backtrace()
+end
+
+define iseq
+  if dummy_gdb_enums.special_consts
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_NONE
+    echo [none]\n
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_LABEL
+    print *(LABEL*)($arg0)
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_INSN
+    print *(INSN*)($arg0)
+    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+      set $i = 0
+      set $operand_size = ((INSN*)($arg0))->operand_size
+      set $operands = ((INSN*)($arg0))->operands
+      while $i < $operand_size
+	rp $operands[$i++]
+      end
+    end
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+    print *(ADJUST*)($arg0)
+  end
+end
+
+define rb_ps
+  rb_ps_vm ruby_current_vm
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+  print $ps_vm = (rb_vm_t*)$arg0
+  set $ps_threads = (st_table*)$ps_vm->living_threads
+  if $ps_threads->entries_packed
+    set $ps_threads_i = 0
+    while $ps_threads_i < $ps_threads->num_entries
+      set $ps_threads_key = (st_data_t)$ps_threads->bins[$ps_threads_i * 2]
+      set $ps_threads_val = (st_data_t)$ps_threads->bins[$ps_threads_i * 2 + 1]
+      rb_ps_thread $ps_threads_key $ps_threads_val
+      set $ps_threads_i = $ps_threads_i + 1
+    end
+  else
+    set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
+    while $ps_threads_ptr
+      set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
+      set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
+      rb_ps_thread $ps_threads_key $ps_threads_val
+      set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+    end
+  end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_id = $arg1
+  print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+end
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..57557c9c2e
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,131 @@
+*-*-*.def
+*.a
+*.bak
+*.dSYM
+*.dylib
+*.inc
+*.log
+*.o
+*.orig
+*.rej
+*.sav
+*.swp
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+Makefile
+extconf.h
+y.output
+y.tab.c
+
+# /
+/*.pc
+/*_prelude.c
+/COPYING.LIB
+/ChangeLog-1.8.0
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
+/Doxyfile
+/GNUmakefile
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/beos
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/doc/capi
+/enc.mk
+/enc/trans/*.c
+/encdb.h
+/exts.mk
+/goruby
+/id.h
+/largefile.h
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-man.rd.gz
+/test.rb
+/tmp
+/transdb.h
+/uncommon.mk
+/web
+/yasmdata.rb
+
+# /benchmark/
+/benchmark/bmx_*.rb
+
+# /enc/trans/
+/enc/trans/*.c
+
+# /ext/
+/ext/extinit.c
+
+# /ext/dl/
+/ext/dl/*.func
+
+# /ext/dl/callback/
+/ext/dl/callback/*.func
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
+
+# /ext/iconv/
+/ext/iconv/config.charset
+/ext/iconv/iconv.rb
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /ext/tk/
+/ext/tk/config_list
+
+# /spec/
+/spec/mspec
+/spec/rubyspec
+
+# /win32/
+/win32/*.ico
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..6a207a0554
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,21 @@
+-bap
+-nbbb
+-nbc
+-br
+-nbs
+-ncdb
+-ce
+-cli0.5
+-ndj
+-ei
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+
+-TID
+-TVALUE
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..286342c1cc
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,8 @@
+# no installation...
+before_script: autoconf
+script: "./configure && make all test"
+
+branches:
+  only:
+    - trunk
+    - ruby_1_9_3
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..82725534fa
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2010 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/COPYING b/COPYING
index 9043404a83..a1f19ff99d 100644
--- a/COPYING
+++ b/COPYING
@@ -1,6 +1,6 @@
 Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-version 2 (see the file GPL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
 
   1. You may make and give away verbatim copies of the source form of the
      software without restriction, provided that you duplicate all of the
diff --git a/COPYING.ja b/COPYING.ja
index 933cc7cb9a..5b5b91c149 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,6 +1,6 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
-Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
-$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(B2-clause BSDL
+$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G$-$^$9(B
+2-clause BSDL$B$K$D$$$F$O(BBSDL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
 
   1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
 
diff --git a/ChangeLog b/ChangeLog
index 6bc32bbd17..b34ed8cda1 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,20956 +1,16435 @@
-Thu Jan 22 15:11:09 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Nov 10 00:37:02 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* marshal.c (marshal_load): arg.data is no longer a VALUE but a
-	  st_table, and freed in load_ensure.  pointed out by pegacorn.
-	  [ruby-dev:37008]
+	* siphash.h: check configure macros before include newer headers.
 
-Thu Jan 22 15:11:09 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Nov 10 00:37:02 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (rb_mark_set): new function to mark keys.
+	* siphash.c (sip_init_state): use union to suppress warnings by gcc
+	  4.7.
 
-	* marshal.c (struct dump_arg, struct load_arg): added wrappers to mark
-	  data entries.  backport from trunk r13527,r13528,r13961,r16533.
-	  [ruby-dev:36082]
+Sat Nov 10 00:37:02 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jan 21 10:56:20 2009  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* random.c (rb_memhash): use siphash.
 
-	* win32/win32.c (filetime_to_timeval): new function, split from
-	  gettimeofday().
+Fri Nov  9 16:17:09 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (gettimeofday): use above function.
+	* file.c (append_fspath): revert a part of r37562.
 
-	* win32/win32.c (filetime_to_unixtime): ditto. [ruby-dev:36135]
+	* file.c (rb_file_expand_path_internal): ditto.
 
-Wed Jan 21 10:56:20 2009  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* file.c (rb_file_expand_path_internal): ignore the encoding of the
+	  given path name and use filesystem encoding, except when the result
+	  is 8bit range and the filesystem encoding is US-ASCII.
+	  [ruby-dev:39393] [Bug #2154]
 
-	* win32/win32.c (gettimeofday): tv_usec is usec, not msec.
-	  [ruby-dev:36094]
+Fri Nov  9 16:15:50 2012  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-Wed Jan 21 10:56:20 2009  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/csv/test_features.rb: add require for Tempfile.
+	* test/csv/test_serialization.rb: ditto.
 
-	* win32/win32.c (gettimeofday): calc tv_sec and tv_usec from system
-	  time by myself. [ruby-dev:36084]
+Fri Nov  9 13:47:45 2012  Luis Lavena  <luislavena@gmail.com>
 
-Wed Jan 21 10:56:20 2009  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/win32ole/test_win32ole.rb (test_s_codepage_changed):
+	  FileSystemObject only supports ANSI or UTF-16LE encoding.
+	  Patch by bosko (Bosko Ivanisevic) [ruby-trunk - Bug #6650]
 
-	* win32/win32.c (gettimeofday): shouldn't use mktime(2) because it's
-	  buggy about handling summer time.
-	  reported by Yoshikawa <yoshixool AT gmail.com> at [ruby-dev:36071]
+Fri Nov  9 13:16:16 2012  Kenta Murata  <mrkn@mrkn.jp>
 
-Tue Jan 20 12:22:12 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* bignum.c (bigmul0): enable big_mul_toom3.
+	  [ruby-core:48552] [Bug #7242]
 
-	* lib/scanf.rb (Scanf::FormatSpecifier#initialize): %i should accept
-	  single digit decimal.  [ruby-core:18355]
+	* bignum.c (bigmul1_toom3): fix incorrect calculation.
+	  the patch is made by Heesob Park.
+	  [ruby-core:48552] [Bug #7242]
 
-Mon Jan 19 18:24:13 2009  Tanaka Akira  <akr@fsij.org>
+Fri Nov  9 13:16:16 2012  Kenta Murata  <mrkn@mrkn.jp>
 
-	* configure.in (rb_cv_broken_glibc_ia64_erfc): renamed from
-	  rb_broken_glibc_ia64_erfc.
-	  [ruby-core:18228]
+	* bignum.c (bigmul0): disable big_mul_toom3 temporalily.
+	  [ruby-core:48552] [Bug #7242]
 
-Sat Jan 17 12:13:10 2009  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_bignum.rb (test_mul_large_numbers):
+	  add a test for bigmul1_toom3 suggested in [Bug #7242].
 
-	* random.c (Init_Random): always initialize seed.
+Thu Nov  8 17:37:54 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jan 17 12:11:06 2009  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* file.c (append_fspath): filesystem encoding is prior to the encoding
+	  of argument.
 
-	* marshal.c (dump_ensure, load_ensure): should return values.
+	* file.c (rb_file_expand_path_internal, EXPAND_PATH_BUFFER): ignore
+	  the encoding of the given path name, use filesystem encoding always
+	  instead.  [ruby-dev:39393] [Bug #2154]
 
-Fri Jan 16 10:55:51 2009  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_file_exhaustive.rb: removed 2.0 spec tests.
 
-	* class.c (clone_method): should copy cbase in cref as well.
-	  [ruby-dev:35116]
+Thu Nov  8 17:33:53 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* node.h (NEW_CREF): new NEW_ macro.
+	* ext/zlib/extconf.rb: Recognize zlibwapi as linking library.
+	  Patch by Daniel Berger.
 
-	* eval.c (PUSH_CREF): use NEW_CREF().
+	  [ruby-core:44979] [Feature #6421]
 
-Thu Jan 15 14:34:32 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov  8 16:17:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* gc.c (STACK_LEVEL_MAX, ruby_stack_length): returns size_t.
-	  [ruby-core:18207]
-Wed Jan 14 10:32:13 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_dir_m17n.rb: remove a garbage.
 
-	* stable/ext/socket/socket.c (NI_MAXHOST, NI_MAXSERV): fixed invalid
-	  preprocessor directives.  a patch from Peter Bowen at
-	  [ruby-core:18211].
+Thu Nov  8 15:22:09 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jan 13 04:39:30 2009  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/ruby/test_dir_m17n.rb: sorry, typo.
 
-	* lib/net/ftp.rb (login): raise FTPReplyError if passwd or acct
-	  is not supplied.  backported from trunk.  fixed [ruby-core:18058].
+Thu Nov  8 14:50:02 2012  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-Mon Jan 12 00:21:49 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/win32ole/test_win32ole_variant.rb: setting WIN32OLE.locale
+	  to pass some assertion.  Thanks to Hiroshi Shirosaki.
+	  [ruby-core:46873][Bug #6814]
 
-	* gc.c (gc_sweep, obj_free, run_final): defer finalizers of IO and
-	  Data.  [ruby-dev:35578]
+Thu Nov  8 14:46:17 2012  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* gc.c (rb_gc_call_finalizer_at_exit): self-referencing finalizers
-	  cannot be invoked.  [ruby-dev:35681]
+	* test/win32ole/test_win32ole.rb (test_s_codepage_changed):
+	  FileSystemObject only supports ANSI or UTF-16LE encoding.
+	  Patch by h.shirosaki (Hiroshi Shirosaki) [ruby-trunk - Bug #6650]
 
-Sun Jan 11 11:31:52 2009  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/net/ftp.rb (chdir): handle 5xx errors correctly.
-	  backported from trunk.  fixed [ruby-core:18057].
+Thu Nov  8 14:43:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jan  9 19:22:24 2009  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/ruby/test_dir_m17n.rb: refactoring. RE should be in the left side
+	  of the =~ operator, and compare the result with nil is meaningless.
 
-	* lib/net/imap.rb (disconnect): do not refer SSL::SSLSocket for
-	  environments without OpenSSL.  backported from trunk.
-	  fixed [ruby-dev:35755].
+Thu Nov  8 14:43:17 2012  Luis Lavena  <luislavena@gmail.com>
 
-Thu Jan  8 13:20:15 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_dir_m17n.rb (create_and_check_raw_file_name): add new
+	  helper method to ease encoding testing. Patch by Oleg Sukhodolsky.
+	  [ruby-core:46589][Bug #6765]
 
-	* parse.y (deferred_nodes, compstmt, arg, fixup_nodes, range_op): fix
-	  up fixnum range literal in conditional as automagical line number
-	  comparison.  [ruby-core:12124], [ruby-dev:35731]
+	* test/ruby/test_dir_m17n.rb (test_filename_extutf8): use filesystem
+	  encoding when reading entries and comparing.
 
-Wed Jan  7 10:06:12 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_name): removed.
 
-	* eval.c (timeofday): use monotonic clock.  based on a patch
-	  from zimbatm <zimbatm@oree.ch> in [ruby-core:16627].
+	* test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_jp_name): split test.
 
-Tue Jan  6 09:02:14 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov  8 14:16:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (yylex): 8 and 9 in octal integer should cause compile
-	  error.  [ruby-dev:35729]
+	* lib/mkmf.rb (MakeMakefile#timestamp_file): use .-. instead of !, a
+	  special character of NMAKE and BSD make.  [Bug #7265]
 
-Mon Jan  5 11:12:39 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov  8 14:16:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_schedule): runs deferred finalizers.
+	* lib/mkmf.rb (MakeMakefile#timestamp_file): use ! instead of %, a GNU
+	  make special character.
 
-	* gc.c (gc_sweep): sets rb_thread_pending to run deferred finalizers.
+Thu Nov  8 14:16:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* rubysig.h (CHECK_INTS): now checks rb_thread_pending even on
-	  platforms where setitimer is not available.  [ruby-core:18045]
+	* lib/mkmf.rb (create_makefile): use timestamp for destination
+	  directories to make them before making or copying files there.
+	  [ruby-dev:46067] [Bug #6904]
 
-Mon Jan  5 11:12:39 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov  8 14:13:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* rubysig.h (CHECK_INTS): gives the chance to perform to deferred
-	  finalizers before explicit GC.start or the process termination.
-	  [ruby-core:18045]
+	* configure.in (visibility_option): visibility attribute is not
+	  available before GCC 4, so do not use -fvisibility option in that
+	  case.  [ruby-core:48147] [Bug #7205]
 
-Sun Jan  4 04:47:57 2009  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov  8 14:11:49 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_telldir): just returns loc.
+	* vm.c (rb_vm_jump_tag_but_local_jump): pass through thrown objects.
+	  [ruby-dev:46234] [Bug #7185]
 
-	* win32/win32.c (rb_w32_rewinddir): needs to intialize loc.
-	  [ruby-core:18041]
+	* vm_eval.c (rb_eval_cmd): if state is non-zero, val should be nil and
+	  rb_vm_jump_tag_but_local_jump() just jump tag.
 
-Thu Jan  1 08:39:36 2009  Tadayoshi Funaba  <tadf@dotrb.org>
+Thu Nov  8 14:09:18 2012  Kenta Murata  <mrkn@mrkn.jp>
 
-	* lib/date.rb (Date::Infinity#<=>): didn't work.  A patch from
-	  Dirkjan Bussink <d.bussink AT gmail.com> [ruby-core:15098].
-	  This is a bug obviously.  However it didn't affect the library's
-	  functions.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_add),
+	  test/bigdecimal/test_bigdecimal.rb:
+	  need to specify precision for converting Rational and Float.
+	  [ruby-core:48045] [Bug #7176]
 
-	* lib/date.rb, lib/date/format.rb: some trivial changes.
+Thu Nov  8 14:05:31 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Aug 11 09:34:52 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/win32.c (has_redirection): should use shell (cmd.exe) when
+	  the commandline containts '&'.
+	  reported by Roger Pack at [ruby-core:47912] [Bug #7143], and
+	  patched by Heesob Park at [ruby-core:47931].
 
-	* ext/dl/dl.c (rb_str_to_ptr): should propagate taint to dlptr.
+Fri Oct 26 17:22:18 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/dl/dl.c (rb_ary_to_ptr): ditto.
+	* file.c (append_fspath): need to set the encoding to result always.
 
-	* ext/dl/sym.c (rb_dlsym_call): should check taint of DLPtrData as
-	  well.
+Fri Oct 26 11:03:46 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug  8 10:53:52 2008  Tanaka Akira  <akr@fsij.org>
+	* file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
+	  (rb_enc_path_last_separator, rb_enc_path_end)
+	  (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
+	  path handling functions.
 
-	* lib/resolv.rb: randomize source port and transaction id.
-	  CVE-2008-1447.
+	* file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
+	  (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
+	  (rb_file_join): should respect the encodings of arguments than
+	  file system encoding.  [ruby-dev:45145] [Bug #5919]
 
-	* lib/resolv-replace.rb (UDPSocket#bind): don't resolv host if host is
-	  "".
+	* dir.c (check_dirname, ruby_glob0): ditto.
 
-Mon Aug  4 14:15:58 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/pathname/pathname.c (path_sub_ext): ditto.
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils#split_header_value):
-	  reduce backtrack.  based on a fix by Christian Neukirchen
-	  <chneukirchen AT gmail.com>.
+Fri Oct 26 11:03:46 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Aug  4 14:10:01 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* util.c, include/ruby/util.h (ruby_add_suffix): remove the function.
+	  [Bug #5153] [ruby-core:38736]
 
-	* regex.c (xmalloc, xrealloc, xfree): not to use ruby managed memory.
+	* io.c (argf_next_argv): remove the call of above function.
 
-	* regex.c (DOUBLE_STACK, re_compile_fastmap0, re_adjust_startpos),
-	  (re_search, re_match_exec): check if failed to allocate memory.
+	* ext/-test-/add_suffix, test/-ext-/test_add_suffix.rb: remove the test
+	  extension module because this is only for testsing ruby_add_suffix().
 
-Mon Aug  4 13:49:36 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* LEGAL: remove the mention about a part of util.c, because now we
+	  removed the part.
 
-	* bignum.c (rb_big2str0, bigsqr): made interruptible.  [ruby-Bugs-20622]
+	* io.c (argf_next_argv): now the new filename is not guranteed to
+	  use, so should check the return value of rename(2).
 
-Mon Aug  4 13:39:53 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_argf.rb (TestArgf#test_inplace_rename_impossible):
+	  now we expect same result with other platforms on no_safe_rename
+	  platforms (=Windows).
 
-	* ext/openssl/openssl_missing.h (d2i_of_void): define for older
-	  versions.  [ruby-dev:35637]
+Thu Oct 25 18:16:25 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Aug  4 12:25:08 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/rubygems/installer.rb (check_that_user_bin_dir_is_in_path):
+	  test_generate_bin_bindir_with_user_install_warning(TestGemInstaller)
+	  fails on Windows with msys bash. It makes comparing paths
+	  case-insensitive.
+	  pick from upstream to fix a failure of test-all [ruby-core:47711]
+	  https://github.com/rubygems/rubygems/commit/c474edb2f3704206f04da1c8c6cf9fb079d84abe
 
-	* numeric.c (check_uint, rb_num2uint, rb_fix2uint): fixed wrong check
-	  about 64bit positive value.
-Mon Aug  4 12:25:08 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Oct 25 17:55:01 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* numeric.c (check_uint, rb_num2uint, rb_fix2uint): strict check.
-	  fixed [ruby-dev:33683]
+	* test/etc/test_etc.rb (TestEtc#test_getpwuid): `s' is never set to nil.
 
-Mon Aug  4 12:11:29 2008  Tanaka Akira  <akr@fsij.org>
+Thu Oct 25 16:59:17 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* gc.c (Init_GC): fix syntax error.
+	* test/ruby/test_file_exhaustive.rb: fix test introduced in r36811 for
+	  posix environments where HOME is not defined.  [ruby-core:47322]
 
-Mon Aug  4 12:11:29 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Oct 25 16:59:17 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* error.c (rb_exc_new3): keeps the given string itself.
+	* configure.in (mingw): add shlwapi to the list of dependency
+	  libs for Windows.
+	* win32/Makefile.sub (EXTSOLIBS): ditto.
 
-	* eval.c (Init_Proc), gc.c (Init_GC): freeze messages of preallocated
-	  special exceptions also.
+	* internal.h: declare internal functions rb_w32_init_file,
+	  rb_file_expand_path_internal and rb_file_expand_path_fast.
 
-Thu Jul 17 21:37:39 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* file.c (Init_File): invoke Windows initialization rb_w32_init_file
 
-	* lib/net/smtp.rb (Net::SMTP::start): revert to avoid RFC2821
-	  violation. [ruby-dev:35487]
+	* win32/file.c (rb_file_load_path_internal): new function.
+	  Windows-specific implementation that replaces file_expand_path.
+	  [Bug #6836][ruby-core:46996]
 
-Thu Jul 17 21:31:46 2008  Tanaka Akira  <akr@fsij.org>
+	* win32/file.c (rb_w32_init_file): new function. Initialize codepage
+	  cache for faster conversion encodings lookup.
 
-	* string.c (rb_str_format_m): make tmp volatile to avoid possible GC
-	  problem.
+	* file.c (file_expand_path): rename to rb_file_expand_path_internal.
+	  Conditionally exclude from Windows.
 
-Thu Jul 17 21:29:34 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c (rb_file_expand_path_fast): new function. delegates to
+	  rb_file_expand_path_internal without performing a hit to the
+	  filesystem.
 
-	* lib/optparse.rb (OptionParser#environment): requires shellwords.
-	  [ruby-dev:35466]
+	* file.c (file_expand_path_1): use rb_file_expand_path_internal without
+	  path expansion (used by require).
+	* file.c (rb_find_file_ext_safe): ditto.
+	* file.c (rb_find_file_safe): ditto.
 
-Thu Jul 17 01:36:02 2008  Yusuke Endoh  <mame@tsg.ne.jp>
+	* load.c (rb_get_expanded_load_path): use rb_file_expand_path_fast.
+	* load.c (rb_feature_provided): ditto.
 
-	* ext/zlib/zlib.c (rb_gzfile_set_mtime): fix typo.  [ruby-core:17713]
+	* file.c (rb_file_expand_path): use rb_file_expand_path_internal with
+	  path expansion.
+	* file.c (rb_file_absolute_path): ditto.
 
-Sun Jul 13 00:07:07 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_file_exhaustive.rb: new tests to exercise
+	  rb_file_expand_path_internal implementation and compliance with
+	  existing behaviors.
 
-	* lib/ipaddr.rb (IPAddr#initialize): get rid of ArgumentError in
-	  IPAddr#to_range.  a patch from okkez <okkez000 AT gmail.com> in
-	  [ruby-dev:35091].
+Thu Oct 25 16:59:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jul 13 00:02:26 2008  Tanaka Akira  <akr@fsij.org>
+	* win32/file.c (INVALID_FILE_ATTRIBUTES): define for old SDK.
 
-	* configure.in (erfc): erfc of glibc comes with Debian GNU/Linux Etch
-	  on IA64 is broken.  erfc(10000.0) aborts.
-	  use missing/erf.c instead.
-	  http://sources.redhat.com/ml/libc-hacker/2005-08/msg00008.html
+Thu Oct 25 16:59:17 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 10 18:44:01 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/makedirs.bat: new command to make intermediate
+	  directories, and not to report any errors if the directory
+	  already exists.
 
-	* file.c (rb_file_s_extname): fix for file name with spaces.
-	  [ruby-talk:307404]
+	* win32/Makefile.sub (MAKEDIRS): enable command extensions.
 
-Thu Jul 10 18:39:17 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Oct 25 16:59:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/net/ftp.rb (Net::FTP#sendport): use divmod.  [ruby-core:17557]
+	* win32/Makefile.sub (MAKEDIRS): use mkdir of cmd.exe instead of ruby.
+	  [Bug #6103] [ruby-core:43012]
 
-Thu Jul 10 18:35:07 2008  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* win32/README.win32: added a notice about command extension of cmd.exe.
 
-	* ruby.c: Mac OS X needs origargc times of '\0' in
-	  origargv. [ruby-dev:35308]
+Thu Oct 25 16:59:17 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-Thu Jul 10 13:51:03 2008  Tanaka Akira  <akr@fsij.org>
+	* Makefile.in (PLATFORM_DIR): add a variable for `win32` directory.
+	* Makefile.in (clean-platform): add new target.
+	  It cleans `win32` directory.
 
-	* include/ruby/ruby.h (POSFIXABLE): use FIXNUM_MAX+1 instead of
-	  FIXNUM_MAX to make it possible to convert to double accurately.
-	  It assumes FLT_RADIX is 2.
-	  fix RubyForge bug #14102.
-	  backported from 1.9.
-
-Mon Jul  7 16:14:05 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/net/smtp.rb (Net::SMTP::start): use 'localhost' instead of
-	  'localhost.localdomain'.  [ruby-dev:35333]
-
-	* lib/net/smtp.rb (Net::SMTP::SMTP.start): ditto.
-
-Mon Jul  7 12:07:28 2008  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: avoid creating Ruby object during
-	  GC. thanks to arton <artonx AT yahoo.co.jp>. [ruby-dev:35313]
-
-	* ext/win32ole/tests: add test_win32ole_event.rb, remove
-	  testOLEEVENT.rb
-
-	* ext/win32ole/tests/testWIN32OLE.rb(test_convert_bignum):
-	  fix test.
-
-Mon Jul  7 12:07:28 2008  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* gc.c: add rb_during_gc(). based on a patch from arton <artonx AT
-	  yahoo.co.jp> at [ruby-dev:35313].   
-
-	* intern.h: ditto.
-
-Thu Jul  3 17:15:04 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* win32/win32.c: revert r17290, requested by NAKAMURA Usaku
-	  <usa at ruby-lang.org>
-
-Wed Jul  2 19:05:35 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::QueryExtension.read_multipart): blanks inside
-	  double quotes are allowed.  [ruby-list:45140]
-
-Wed Jul  2 19:01:13 2008  Tanaka Akira  <akr@fsij.org>
-
-	* numeric.c (num_coerce): call rb_Float(x) first.  don't depend on
-	  evaluation order of function arguments.
-
-Wed Jul  2 18:55:50 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syslog/syslog.c (syslog_write): syslog operations should be
-	  protected from $SAFE level 4.  a patch from Keita Yamaguchi
-	  <keita.yamaguchi at gmail.com>.
-
-	* ext/syslog/syslog.c (mSyslog_close): ditto.
-
-	* ext/syslog/syslog.c (mSyslog_set_mask): ditto.
-
-Wed Jul  2 18:25:17 2008  Tanaka Akira  <akr@fsij.org>
-
-	* math.c (domain_check): fix preprocess condition.
-
-Wed Jul  2 18:19:45 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/tmpdir.rb (@@systmpdir): prior LOCAL_APPDATA if possible, and
-	  should be clean.  based on a patch from arton <artonx AT
-	  yahoo.co.jp> at [ruby-dev:35269]
-
-Wed Jul  2 18:13:30 2008  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (date2time_str): fix the overflow in
-	  some situation. [ruby-bugs-20793]
-
-Wed Jul  2 17:38:01 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_iconv): fixed backport miss.
-	  [ruby-core:17115]
-
-Tue Jul  1 15:09:37 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_fill): check if beg is too big.
-
-Mon Jun 30 20:34:05 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_buf_cat): check for self concatenation.
-
-Sun Jun 29 21:38:52 2008  Tanaka Akira  <akr@fsij.org>
-
-	* eval.c (rb_obj_respond_to): use RTEST to test the result of
-	  respond_to? method.
-
-Sun Jun 29 20:40:57 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* array.c (rb_ary_fill): (compatibility) do not raise
-	  ArgumentError on negative length.  This behaviour shall change
-	  in a future release.
-
-Sun Jun 29 20:06:45 2008  Tanaka Akira  <akr@fsij.org>
-
-	* time.c (time_timeval): fix rounding negative float.
-
-Sun Jun 29 18:35:23 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/inlinetest.rb (InlineTest.in_progname): workaround for frozen
-	  $0.  [ruby-dev:35261]
-
-	* lib/test/unit/ui/console/testrunner.rb (TestRunner#finished): ditto.
-
-Sun Jun 29 18:35:23 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (set_arg0, ruby_prog_init): freeze $0.  a patch from Keita
-	  Yamaguchi <keita.yamaguchi at gmail.com>.
-
-Sun Jun 29 18:32:19 2008  Tanaka Akira  <akr@fsij.org>
-
-	* process.c: include sys/resource.h if HAVE_SYS_RESOURCE_H is defined.
-	  pointed by TOYOFUKU Chikanobu.  [ruby-dev:35258]
-
-Sun Jun 29 18:25:03 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_f_trace_var): should not be allowed at safe level 4.  
-	  a patch from Keita Yamaguchi <keita.yamaguchi at gmail.com>.
-
-	* eval.c (rb_call0): wrong condition to check insecure method.
-	  a patch from Keita Yamaguchi <keita.yamaguchi at gmail.com>.
-
-Sun Jun 29 18:24:13 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_fill): not depend on unspecified behavior at integer
-	  overflow.  reported by Vincenzo Iozzo <snagg AT openssl.it>.
-
-Sun Jun 29 18:21:23 2008  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c(ole_invoke): fix memory leak.
-	  [ruby-bugs-20792]
-
-Sun Jun 29 17:34:11 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* eval.c (PUSH_FRAME, PUSH_CLASS): Add volatile to avoid a
-	  possible optimization bug on OS X/PPC.  This at least makes
-	  build with gcc -O1 and `make test' pass.
-
-Sun Jun 29 17:23:51 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc#collect_first_comment): skip
-	  magic comment.
-
-Sun Jun 29 17:21:08 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_each, strio_readlines): IO#each and
-	  IO#readlines do not affect $_.  [ruby-core:17277]
-
-Sun Jun 29 17:18:45 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_readline, strio_each)
-	  (strio_readlines): set lastline.  [ruby-core:17257]
-
-Sun Jun 29 17:10:30 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/openssl/ossl.h: include winsock.h if USE_WINSOCK2 is not defined.
-	  a patch from arton <artonx at yahoo.co.jp> in [ruby-dev:35078]
-
-Sun Jun 29 17:07:30 2008  wanabe  <s.wanabe@gmail.com>
-
-	* util.c (ruby_strtod): ruby_strtod don't allow a trailing
-	  decimal point like "7.". [ruby-dev:34835] [ruby-dev:35009]
-
-Sun Jun 29 16:56:57 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/set.rb (Set#delete_if): Call to_a.
-	  (SortedSet#delete_if, TC_SortedSet#test_sortedset): Use super to
-	  yield elements in sorted order; [ruby-core:17144] by Arthur
-	  Schreiber.
-	  (SortedSet#each, SortedSet#each, TC_Set#test_each)
-	  (TC_SortedSet#test_sortedset): Return self; [ruby-dev:35002] by
-	  Arthur Schreiber.
-
-Sun Jun 29 16:49:11 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (search_method, remove_method, error_print, rb_alias)
-	  (rb_eval, rb_rescue2, search_required, Init_eval, rb_thread_create),
-	  gc.c (rb_source_filename, Init_stack), io.c (rb_io_getline),
-	  parse.y (rb_id2name, rb_parser_free): suppress warnings.
-
-Sat Jun 28 19:26:43 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* class.c (clone_method): use rb_copy_node_scope.
-	  fixed [ruby-list:45102]
-	  fixed [ruby-core:17393]
-
-Sat Jun 28 19:25:56 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* eval.c (rb_copy_node_scope), node.h: Rename from copy_node_scope
-	  and export.
-
-Fri Jun 27 17:38:21 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/zlib/zlib.c (rb_deflate_initialize, Init_zlib): Fix up
-	  initialize_copy; [ruby-list:45016], [ruby-list:45018].
-
-Fri Jun 27 17:28:39 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (rb_open_file, rb_io_s_sysopen): fmode should be unsigned int.
-	  fixed [ruby-dev:34979]
-
-Fri Jun 27 17:20:40 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.h: include ws2tcpip.h. fixed [ruby-Bugs-20528]
-
-Fri Jun 27 15:57:05 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_iconv): fixed backport miss.
-	  [ruby-core:17115]
-
-Fri Jun 27 15:57:05 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_iconv): fix for length argument and now
-	  allows range.  [ruby-core:17092]
-
-Tue Jun 24 15:38:52 2008  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/erb.rb (ERB::Compiler::TrimScanner#explicit_trim_line): Fix 
-	  without strscan problems. [ruby_core:17028].
-
-	* test/erb/test_erb.rb (TestERBCoreWOStrScan): Add test class for 
-	  without strscan.
-
-Sun Jun 22 00:09:20 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/delegate.rb (DelegateClass, Delegator#respond_to?):
-	  respond_to? should now take optional second argument; submitted
-	  by Jeremy Kemper <jeremy at bitsweat.net> in [ruby-core:17045].
-
-Fri Jun 20 18:24:18 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_buf_append): should infect.
-
-Fri Jun 20 15:52:30 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_store, rb_ary_splice): not depend on unspecified
-	  behavior at integer overflow.
-
-	* string.c (str_buf_cat): ditto.
-
-Wed Jun 18 22:25:10 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* array.c (ary_new, rb_ary_initialize, rb_ary_store,
-	  rb_ary_aplice, rb_ary_times): integer overflows should be
-	  checked. based on patches from Drew Yao <ayao at apple.com>
-	  fixed CVE-2008-2726
-
-	* string.c (rb_str_buf_append): fixed unsafe use of alloca,
-	  which led memory corruption. based on a patch from Drew Yao
-	  <ayao at apple.com> fixed CVE-2008-2726
-
-	* sprintf.c (rb_str_format): backported from trunk.
-
-	* intern.h: ditto.
-
-Fri Jun 20 01:40:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_equal, rb_ary_eql, rb_ary_hash, rb_ary_cmp):
-	  Make Array#eql?, #hash, #== and #<=> use rb_protect_inspect() and
-	  handle recursive data properly.  [ruby-dev:35181]
+	* common.mk (clean): add a dependency for `win32` directory.
+	* common.mk (distclean): ditto.
+	* common.mk (distclean-platform): add new target.
+	  It cleans `win32` directory.
+	* common.mk ($(PLATFORM_D)): add new target to make `win32` directory.
+	* common.mk (win32/win32.$(OBJEXT)): move win32.o into `win32`
+	  directory.
+	* common.mk (win32/file.$(OBJEXT)): add new target for win32/file.c.
 
-Wed Jun 18 15:20:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: move win32.o into `win32` directory and add
+	  win32/file.o to MISSING.
 
-	* marshal.c (w_object, marshal_dump, r_object0, marshal_load): search
-	  public methods only.  [ruby-core:17283]
+	* file.c (file_load_ok, rb_file_load_ok): replace static
+	  file_load_ok() with public rb_file_load_ok().
+	  It's to link Windows implementation in win32/file.c.
+	* file.c (rb_find_file_ext_safe): ditto.
+	* file.c (rb_find_file_safe): ditto.
 
-	* object.c (convert_type): ditto.
+	* win32/file.c (rb_file_load_ok): new file. Add Windows specific
+	  optimized implementation of rb_file_load_ok(). We created a
+	  separated file to avoid too many #ifdef macro which is unreadable.
 
-	* lib/singleton.rb (Singleton#_dump): conversion method should be
-	  public.
+	* win32/Makefile.sub (PLATFORM_DIR): add a variable for `win32`
+	  directory.
+	* win32/Makefile.sub (MISSING): move win32.obj into `win32`
+	  directory and add win32/file.obj to MISSING.
+	* win32/Makefile.sub (MAKEDIRS): replace MINIRUBY with BASERUBY.
+	  It's because miniruby doesn't exist when making `win32` directory.
+	* win32/Makefile.sub (clean-platform): add new target to clean `win32`
+	  directory.
+	* win32/Makefile.sub ({$(srcdir)}.c{}.obj): make it not match
+	  win32/file.c to build properly.
+	* win32/Makefile.sub (win32/win32.$(OBJEXT)): move win32.obj into
+	 `win32` directory.
 
-Wed Jun 18 13:19:55 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	  Patch created with Luis Lavena.
+	  [ruby-core:42480] [Feature #5999]
 
-	* file.c: fixes to compile on mswin32.  Patch from U. Nakamura
-	  <usa at garbagecollect.jp>. [ruby-dev:35127]
+Fri Oct 19 13:28:29 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun 17 22:16:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (opt-dir): allow multiple directories separated by
+	  $PATH_SEPARATOR as well as dir_config in mkmf.rb. [ruby-core:47868]
+	  [Bug #7120]
 
-	* configure.in (LIBPATHFLAG, RPATHFLAG): no needs to be quoted,
-	  it is done by libpathflag in mkmf.rb.
+Tue Oct 16 11:18:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jun 16 15:43:07 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/mkmf.rb (dir_config, init_mkmf): use configured libdir value as
+	  default library path.  [ruby-core:43726] [Bug #6207]
 
-	* proc.c (proc_dup): should copy safe_level from src proc
-	  properly.  a patch from Keita Yamaguchi
-	  <keita.yamaguchi at gmail.com>
+Tue Oct 16 10:56:55 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun 15 23:31:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c (rb_find_file_ext_safe, rb_find_file_safe): default to
+	  US-ASCII for encdb and transdb.
 
-	* ext/zlib/extconf.rb: search zlib1, and regard mswin32 later than VC6
-	  as WIN32.  [ruby-core:16984]
+	* load.c (search_required): keep encoding of feature name.  set
+	  loading path to filesystem encoding.  [Bug #6377][ruby-core:44750]
 
-Sun Jun 15 23:28:15 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (add_modules, require_libraries): assume default external
+	  encoding as well as ARGV.
 
-	* marshal.c (w_object, marshal_dump, r_object0, marshal_load): search
-	  private methods too.  [ruby-dev:34671]
+Tue Oct 16 10:47:43 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (convert_type): ditto.
+	* random.c (random_s_rand): ensure default PRNG is re-initialized
+	  after fork.  patched by Eric Wong.  [ruby-core:41209][Bug #5661]
 
-Sun Jun 15 23:26:50 2008  Akinori MUSHA  <knu@iDaemons.org>
+Tue Oct 16 10:21:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (flo_divmod): Revert the behavior change; do not
-	  suppress an exception when div is NaN or Inf. [ruby-dev:34857]
+	* ruby.c (rb_f_sub, rb_f_gsub): pass the given block.
+	  [ruby-core:47967] [Bug #7157]
 
-Sun Jun 15 23:24:32 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Oct 16 09:47:47 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* file.c (BUFCHECK): wrong condition. [ruby-core:16921]
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): use
+	  Regexp.new instead of literal to ignore a parser warning.
 
-	* file.c (file_expand_buf): shouldn't use buflen for length of string.
+Tue Oct 16 09:47:47 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun 15 23:21:22 2008  Akinori MUSHA  <knu@iDaemons.org>
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): ignoring
+	  warnings are already set in setup method.
 
-	* marshal.c (r_object0, Init_marshal): Fix the garbled s_call
-	  definition; fixes [ruby-dev:34843].
+Sun Oct 14 01:21:42 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun 15 23:19:53 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* regparse.c (parse_char_class): should match with a hyphen after a
+	  range in a character class.
 
-	* object.c (rb_cstr_to_dbl): should clear errno before calling
-	  strtod(3).  [ruby-dev:34834]
+	* test/ruby/test_regexp.rb (TestRegexp#test_char_class): fixed wrong
+	  test.
 
-Sun Jun 15 23:18:15 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_regexp.rb (TestRegexp#check): now can accept the
+	  error message.
 
-	* marshal.c (marshal_load): should initialize arg.data used for
-	  reentrant check.  [ruby-dev:34837]
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): renamed
+	  because the previous name was wrong.
 
-Sun Jun 15 23:13:23 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): added
+	  more test pattern.
 
-	* parse.y (top_local_setup): fixed memory leak bug based on a
-	  patch from Roger Pack <rogerpack2005 at gmail.com> in
-	  [ruby-core:16610].
-Sun Jun 15 23:16:26 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Oct 13 01:41:38 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* marshal.c (reentrant_check): check reentrance via callcc.
-	  [ruby-dev:34802]
+	* regparse.c (parse_char_class): also need to check the type of token
+	  after raw hyphen in regexp class, because the charcter code area
+	  is union'ed with the property of TK_CHAR_TYPE.
+	  reported by Bushi Zhang at [ruby-core:47115] [Backport #6853].
 
+Sat Oct 13 01:39:46 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun 15 23:09:00 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_regexp.rb
+	  (TestRegexp#test_raw_hyphen_and_type_char_after_range): added new
+	  test. ref [ruby-core:47115] [Backport #6853]
 
-	* sprintf.c (rb_f_sprintf): fixed SEGV on win32 with "% 0e" % 1.0/0.0.
+Fri Oct 12 18:19:35 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun 15 23:07:46 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* file.c (rb_get_path_check): path name must not contain NUL bytes.
 
-	* process.c (rb_f_system): set last_status when status == -1 because
-	  there is no path to set it on win32. this patch is derived from
-	  [ruby-core:16787], submitted by Luis Lavena <luislavena at gmail.com>
+Fri Oct 12 17:51:43 2012  Shugo Maeda  <shugo@ruby-lang.org>
 
-Sun Jun 15 23:02:12 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* error.c (exc_to_s, name_err_to_s, name_err_mesg_to_str): do not
+	  taint messages.
 
-	* lib/webrick/httpservlet/filehandler.rb: should normalize path
-	  name in path_info to prevent script disclosure vulnerability on
-	  DOSISH filesystems. (fix: CVE-2008-1891)
-	  Note: NTFS/FAT filesystem should not be published by the platforms
-	  other than Windows. Pathname interpretation (including short
-	  filename) is less than perfect.
+Fri Oct 12 16:11:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httpservlet/abstract.rb
-	  (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
-	  should escape the value of Location: header.
+	* configure.in (LIBDIR_BASENAME): use configured libdir value to fix
+	  --enable-load-relative on systems where libdir is not default value,
+	  overridden in config.site files.  [ruby-core:47267] [Bug #6903]
 
-	* lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
-	  command line arguments.
+	* ruby.c (ruby_init_loadpath_safe): ditto.
 
-Sun Jun 15 23:02:12 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Oct 12 13:56:01 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* file.c (file_expand_path): support for alternative data stream
-	  and ignored trailing garbages of NTFS.
+	* test/rexml/test_encoding.rb:
+	  Add require 'require 'rexml/document'
 
-	* file.c (rb_file_s_basename): ditto.
+Fri Oct 12 13:36:32 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* file.c (rb_file_s_extname): ditto.
+	* numeric.c (flodivmod): must through the same pass if HAVE_FMOD or not.
+	  this is a bugfix of r35013.
 
-Sun Jun 15 22:53:20 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Oct 12 13:28:37 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c (rb_str_cat): fixed buffer overrun reported by
-	  Christopher Thompson <cthompson at nexopia.com> in [ruby-core:16746]
+	* io.c (rb_cloexec_fcntl_dupfd): get rid of compile error on windows.
+	  reported by Donovan Lampa at [ruby-core:43152] [Backport #6127],
+	  based on a patch by Hiroshi Shirosaki at [ruby-core:47917].
 
-Sun Jun 15 22:51:24 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Oct 12 00:30:17 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (is_defined): add NODE_OP_ASGN_{OR,AND}.  "defined?(a||=1)"
-	  should not operate assignment.  [ruby-dev:34645]
+	* io.c (ioctl_narg_len, linux_iocparm_len): reinstantiate linux
+	  specific narg length calculation.
+	* test/ruby/test_io.rb (test_ioctl_linux2): add new test for old and
+	  unstructured ioctl.
 
-Sun Jun 15 22:49:45 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Oct 12 00:30:17 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_select): backport from trunk.
-	  [ruby-talk:300743]
+	* io.c (ioctl_narg_len): don't use _IOC_SIZE macro on Linux.
+	  On Linux some constants for ioctl(2) doesn't include the size of
+	  its return value and 16bit value; for example FIONREAD 0x541B.
+	  Moreover the manual, ioctl_list(2),  says "Note  that  the  size
+	  bits  are  very unreliable: in lots of cases they are wrong,
+	  either because of buggy macros using sizeof(sizeof(struct)),
+	  or because of legacy values."
+	  So we shouldn't use it.
 
-Sun Jun 15 22:48:26 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Sep 25 09:30:36 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/delegate.rb (SimpleDelegator::dup): removed needless argument.
-	  [ruby-list:44910]
+	* win32/mkexports.rb: should not export DllMain().
+	  reported by luis at [ruby-core:46743] [Bug #6790], solved by
+	  Heesob Park, and confirmed by nobu.
 
-	* lib/delegate.rb (clone, dup): keep relationship with the target
-	  object.
+Mon Sep 24 16:34:07 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-Sun Jun 15 22:46:34 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/win32.h (rb_w32_pow): add new function.
+	  We use powl() instead of broken pow() for x64-mingw32. This workaround
+	  fixes test failures related to floating point numeric.
+	  [ruby-core:46686] [Bug #6784]
 
-	* util.c (ruby_strtod): backported from 1.9.  a patch from Satoshi
-	  Nakagawa <psychs at limechat.net> in [ruby-dev:34625]. 
-	  fixed: [ruby-dev:34623]
+Mon Sep 24 10:38:55 2012  Luis Lavena  <luislavena@gmail.com>
 
-Sun Jun 15 22:44:25 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/win32ole/test_win32ole_method.rb (is_ruby64?): Correct platform
+	  used to identify mingw-w64 (x64-mingw32). Patch by Hiroshi Shirosaki.
+	  [ruby-core:46651][Bug #6782]
 
-	* struct.c (rb_struct_s_def): to_str should be called only once.
-	  [ruby-core:16647]
+Mon Sep 24 10:37:56 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Jun 15 22:42:54 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit/parallel.rb: workaround fix for rubygems.
+	  RubyGems can't find rake if the source directory is not equal to
+	  the directory which is running the test. [Bug #6604]
 
-	* ext/zlib/zlib.c (gzreader_gets): may cause infinite loop.
-	  a patch from Kouya <kouyataifu4 at gmail.com> in
-	  [ruby-reference-manual:762].
+Fri Sep 21 19:53:38 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun 15 22:34:09 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+	* ext/dl/cfunc.c (rb_dlcfunc_call): should convert a Bignum value to
+	  unsigned long long on Win64.
+	  [ruby-core:44636][Bug #6364] reported by raylinn@gmail.com (ray linn)
 
-	Merged 16241 from trunk.
+Fri Sep 21 18:45:20 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* lib/net/telnet.rb:  Fixing a bug where line endings would not be properly
-	  escaped when the two character ending was broken up into separate TCP
-	  packets.  Issue reported and patched by Brian Candler.
+	* include/ruby/win32.h: undef stat to silence mingw-w64 stat
+	  redefinition warnings (GCC 4.6.3).
 
-Sun Jun 15 22:31:47 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep 21 17:54:54 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (rb_reg_search): use local variable.  a patch from wanabe
-	  <s.wanabe AT gmail.com> in [ruby-dev:34537].  [ruby-dev:34492]
+	* configure.in: add -Wall always.
 
-Sun Jun 15 22:20:45 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Sep 20 10:23:37 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* sprintf.c (rb_f_sprintf): should protect temporary string from
-	  GC.   [ruby-dev:34480]
+	* thread_pthread.c (native_cond_initialize): destroy condattr
+	  after using it. Patch by Stanislav Sedov. Thank you.
+	  [Bug #7041] [ruby-core:47619]
 
-Sun Jun 15 22:18:30 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Sep  9 23:01:43 2012  Tanaka Akira  <akr@fsij.org>
 
-	* regex.c (re_search): string might be NULL.  [ruby-core:16478]
+	* ext/zlib/extconf.rb: detect z_crc_t type which will be defined
+	  since zlib-1.2.7.
 
-Sun Jun 15 22:16:21 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/zlib/zlib.c (rb_zlib_crc_table): use z_crc_t if available.
 
-	* time.c (rb_strftime): check errno to detect strftime(3)'s error.
-	  this is workaround for recent version of MSVCRT.
-	  [ruby-dev:34456]
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jun 15 22:12:07 2008  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/zlib/extconf.rb: Use an exception instaed of bare puts.
 
-	* lib/yaml/types.rb: Likewise, pass self to YAML::quick_emit;
-	  merged from 1.9.
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/yaml.rb (quick_emit): use combination of object_id and hash to
-	  identify repeated object references, since GC will reuse memory of
-	  objects during output of YAML. [ruby-Bugs-8548] [ruby-Bugs-3698];
-	  merged from 1.9.
+	* ext/psych/extconf.rb: Use an exception instaed of bare abort.
 
-Sun Jun 15 22:09:02 2008  Akinori MUSHA  <knu@iDaemons.org>
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/syck/rubyext.c: Node#value defined twice.
+	* ext/fiddle/extconf.rb: Use an exception instaed of bare abort.
 
-	* lib/yaml/: several method redefinitions causing warnings.
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jun 15 22:04:44 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/readline/extconf.rb: Use an exception instead of bare exit.
 
-	* marshal.c (w_object): add volatile to avoid potential GC bug.  a
-	  patch from Tomoyuki Chikanaga <chikanag at nippon-control-system.co.jp>
-	  in [ruby-dev:34311].
+Sun Sep  9 02:34:39 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jun 15 21:59:22 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/extmk.rb: Show a message when extconf.rb raised an exception.
+	* ext/openssl/extconf.rb: Use exception raising instead of message
+	  and/or abort. We want to display error message to console _and_
+	  logging into mkmf.log.
 
-	* re.c (rb_reg_quote): should always copy the quoting string.
-	  [ruby-core:16235]
+Sun Sep  9 02:30:20 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jun 15 21:27:46 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_mutex_lock): stop multiple threads use
+	  pthread_cond_timedwait() concurrently. [Bug #6278] [ruby-core:44275]
 
-	* lib/net/pop.rb (Net::POP3::do_finish): clear @n_mails and
-	  @n_bytes as well.  [ruby-core:16144]
+Thu Aug 30 09:24:43 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Jun 15 21:08:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/uri/ftp.rb (URI::FTP#initialize): raise InvalidURIError if "//"
+	  is not present [ruby-core:47344] [Bug #6945]
 
-	* lib/resolv.rb (Resolv::Config.default_config_hash): requires
-	  win32/resolv to use Win32::Resolv.  [ruby-dev:34138]
+Tue Aug 28 00:40:14 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun 15 20:54:07 2008  Akinori MUSHA  <knu@iDaemons.org>
+	* test/webrick/test_cgi.rb (TestWEBrickCGI#start_cgi_server): there are
+	  no guarantee of existance of RbConfig::CONFIG['LIBPATHENV'].
+	  it only exists in Unix-like environments.
 
-	* parse.y (yycompile): Always prepare a new array for each file's
-	  SCRIPT_LINES__ storage, instead of appending source lines every
-	  time a file is re-loaded; submitted by Rocky Bernstein in
-	  #18517.
+	* test/webrick/test_filehandler.rb
+	  (WEBrick::TestFileHandler#test_script_disclosure): ditto.
 
-Sun Jun 15 20:30:01 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 23 12:08:25 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* lib/resolv.rb (Resolv::Hosts): should not use win32/resolv on cygwin.
-	  [ruby-dev:29945], [ruby-dev:34095]
+	* test/ruby/test_file_exhaustive.rb
+	  (TestFileExhaustive#test_stat_special_file): add a test.
+	  GetFileAttributesExW fails to get attributes of special files
+	  such as pagefile.sys.
 
-	* lib/win32/registry.rb (Win32::Registry.expand_environ): try upcased
-	  name too for cygwin.  [ruby-dev:29945]
+	* win32/win32.c (check_valid_dir): for performance, check the path
+	  by FindFirstFileW only if the path contains "...".
 
-	* lib/win32/resolv.rb (Win32::Resolv.get_hosts_path): use expand_path.
+	* win32/win32.c (winnt_stat): use GetFileAttributesExW instead of
+	  FindFirstFileW since GetFileAttributesExW is faster.
+	  Based on the patch by Dusan D. Majkic.
+	  [ruby-core:47083] [Feature #6845]
 
-Sun Jun 15 20:27:59 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 23 11:19:51 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-mode): should use `run-mode-hooks' instead
-	  of calling `run-hooks' directly to run the mode hook.  patch from
-	  Chiyuan Zhang <pluskid AT gmail.com> in [ruby-core:15915]
+	* thread_pthread.c (ruby_init_stack): STACK_GROW_DIR_DETECTION is
+	  necessary on platforms with unknown stack direction.  [Bug #6761]
 
-Sun Jun 15 20:20:59 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 23 11:19:51 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* numeric.c (fix_coerce): try conversion before type check.
-	  [ruby-core:15838]
+	* thread_pthread.c (get_stack): Linux is the only OS which includes
+	  the size of guard page into the stack size.
 
-Sun Jun 15 19:56:53 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 23 11:19:51 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (BIGZEROP): fix for longer Bignum zeros.  [ruby-Bugs-17454]
+	* gc.h (IS_STACK_DIR_UPPER): utility macro.
 
-Sun Jun 15 19:54:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c (get_stack): seems stack size does not include
+	  guard size on Mac OS X.
 
-	* bignum.c (big2str_find_n1): check integer overflow.
+	* thread_pthread.c (ruby_init_stack): adjust stack size for offset of
+	  addr from the bottom.
 
-Sun Jun 15 19:52:20 2008  Tanaka Akira  <akr@fsij.org>
+Thu Aug 23 11:19:51 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (STACK_LENGTH) [SPARC] : 0x80 offset removed.  [ruby-dev:33857]
+	* thread_pthread.c (ruby_init_stack): use stack info if possible.
 
-Sun Jun 15 19:50:20 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Aug 20 17:11:01 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/readline/readline.c (readline_event): prevent polling.  based on
-	  a patch from error errorsson in [ruby-Bugs-17675].
+	* file.c (file_path_convert): don't convert it when the path string is
+	  ascii only. [ruby-core:41556] [Bug #5733]
+	  tests are contributed by nobu.
 
-Sun Jun 15 19:44:52 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug  9 22:48:58 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (yycompile): clear ruby_eval_tree_begin if parse failed.
+	* pack.c (pack_unpack): when unpack('M') occurs an illegal byte
+	  sequence, output the "=" character and the following character in
+	  the decoded data without any transformation.
+	  [ruby-dev:44875] [Bug #5635]
 
-Sun Jun 15 19:44:52 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jul 31 10:36:12 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* parse.y (yycompile): clear ruby_eval_tree_begin too before parse.
+	* ext/psych/lib/psych.rb: updated to released version.
 
-Sun Jun 15 19:22:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/psych.gemspec: ditto
 
-	* ext/pty/lib/expect.rb (IO#expect): check if peer is closed.
-	  [ruby-Bugs-17940]
+Thu Jul 19 09:33:46 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Sun Jun 15 19:20:13 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/emitter.c (initialize): allow a configuration object to be
+	  passed to the constructor so that mutation isn't required after
+	  instantiation.
 
-	* ext/iconv/iconv.c (iconv_convert): check upper bound.  a patch from
-	  Daniel Luz at [ruby-Bugs-17910].
+	* ext/psych/lib/psych/handler.rb: add configuration object
 
-Sun Jun 15 19:13:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/emitter.rb: use configuration object if
+	  extra configuration is present.
 
-	* configure.in (ftruncate): check if available.
+Tue Jul 17 03:56:34 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* file.c (rb_file_truncate): check if ftruncate instead of truncate.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: strings with YAML anchors
+	  are properly referenced. Patched by Joe Rafaniello via Github:
+	    https://github.com/tenderlove/psych/pull/69
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
+	* test/psych/test_alias_and_anchor.rb: test for change
 
-Sun Jun 15 19:02:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun 16 01:27:14 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* configure.in (sigsetmask): check when signal semantics is not POSIX.
+	* ext/psych/lib/psych.rb: bumping psych to 1.3.3
+	* ext/psych/psych.gemspec: ditto
 
-	* signal.c (USE_TRAP_MASK): set true if sigprocmask or sigsetmask is
-	  available.
+Fri May 18 15:53:05 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Jun 14 16:49:41 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/extconf.rb: Use an exception instaed of bare abort.
 
-	* lib/timeout.rb (Timeout::timeout): made sensitive to location on the
-	  stack.  [ruby-core:15458]
+Fri May 18 01:28:21 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Jun 13 13:14:31 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/psych/parser.c (transcode_string): fix encoding index names.
+	  Thanks markizko for reporting.
 
-	* ext/dl/ptr.c (dlmem_each_i): typo fixed.  a patch from IKOMA
-Sun Jun 15 21:06:12 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed May 16 05:11:29 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* class.c (clone_method): should copy cref as well.
-	  [ruby-core:15833]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix a bug with string
+	  subclass dumping and loading.
 
-	  Yoshiki <ikoma@mb.i-chubu.ne.jp> in [ruby-dev:33776].
+	* test/psych/test_array.rb: pertinent tests
 
-Fri Jun 13 13:13:23 2008  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* test/psych/test_string.rb: ditto
 
-	* gc.c (rb_newobj): prohibit call of rb_newobj() during gc.
-	  Submitted by Sylvain Joyeux [ruby-core:12099].
+Wed May 16 01:31:21 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/dl/ptr.c: do not use LONG2NUM() inside dlptr_free().
-	  Slightly modified fix bassed on a patch by Sylvain Joyeux
-	  [ruby-core:12099] [ ruby-bugs-11859 ] [ ruby-bugs-11882 ]
-	  [ ruby-patches-13151 ].
+	* ext/psych/lib/psych/visitors/to_ruby.rb: convert omap tagged maps to
+	  Psych::Omap objects rather than hashes. [Bug #6425]
 
-Fri Jun 13 12:10:13 2008  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/psych/test_omap.rb: pertinent test.
 
-	* lib/benchmark.rb (Job::Benchmark#item): fix typo.
+Wed May 16 01:15:45 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Jun 13 12:06:17 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: keep a reference to
+	  custom coders so that GC does not impact dumped yaml reference ids.
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_to_f): use strtod() for more
-	  precision.  [ruby-talk:290296]
+Mon Apr 30 04:43:53 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/bigdecimal/bigdecimal.c (BASE_FIG): made constant.
+	* ext/psych/lib/psych/json/yaml_events.rb: implicit styles should not
+	  be changeable for JSON events.
 
-	* ext/bigdecimal/extconf.rb: ditto.  [ruby-dev:33658]
+Sun Jul 29 04:32:31 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jun 13 12:01:57 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (ruby_pc): make configurable.  [Bug #6051]
 
-	* lib/irb.rb (IRB::Irb::eval_input): rescues Interrupt and other than
-	  SystemExit and SignalException.  [ruby-core:15359]
+Sun Jul 29 04:32:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jun 13 11:57:46 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* template/ruby.pc.in: added rubylibprefix, {rubylib,vendor,site}dir
+	  and {ruby,vendor,site}archdir.  [ruby-core:42766][Feature #6052]
 
-	* lib/benchmark.rb (Benchmark::realtime): make Benchmark#realtime
-	  a bit faster.  a patch from Alexander Dymo <dymo@ukrpost.ua> in
-	  [ruby-core:15337].
+Sun Jul 29 04:31:01 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jun 13 11:50:59 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* bignum.c: Added #include <strings.h> for ffs(). Patch by Perry
+	  Smith. Thank you. [Bug #6748]
 
-	* io.c (rb_open_file): should check NUL in path.
-	  <http://www.rubyist.net/~matz/20080125.html#c01>.
+Sat Jul 28 04:04:01 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c (rb_io_s_popen): ditto.
+	* include/ruby/intern.h (rb_num_zerodiv): Added NORETURN.
+	  Patched by Xi Wang. [Bug #6736]
 
-	* io.c (rb_io_reopen): ditto.
+Wed Jul  4 19:36:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* io.c (next_argv): ditto.
+	* ext/dl/cfunc.c (rb_dlcfunc_call): also needed the workaround for VC8
+	  for x64.  [ruby-dev:45875] [Bug #6676]
+	  reported by aves_ramphastos (Seigo Ishigane)
 
-	* io.c (rb_io_s_foreach): ditto.
+Tue Jul  3 19:37:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_io_s_readlines): ditto.
+	* file.c (rmext): no extension to strip if empty string.
 
-	* io.c (rb_io_s_read): ditto.
+	* proc.c (rb_vm_rewrite_dfp_in_errinfo): Fix `unexpected return'
+	occurs when a proc is called in ensure. [Backport #6460]
 
-Wed Jun 11 15:23:13 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jul  3 11:44:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/uri/generic.rb (URI::Generic::inspect): use Kernel#to_s instead
-	 object_id with printf.  [ruby-dev:33347]
+	* file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
+	  (rb_enc_path_last_separator, rb_enc_path_end)
+	  (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
+	  path handling functions.
 
-Wed Jun 11 15:00:55 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
+	  (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
+	  (rb_file_join): should respect the encodings of arguments than
+	  file system encoding.  [ruby-dev:45145] [Bug #5919]
 
-	* configure.in: Remove wrong assumptions about Cygwin.  a patch from
-	  Corinna Vinschen in [ruby-Bugs-17018].
+	* dir.c (check_dirname, ruby_glob0): ditto.
 
-Mon Jun  9 18:09:20 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/pathname/pathname.c (path_sub_ext): ditto.
 
-	* eval.c (eval): check if backtrace is empty.  [ruby-core:15040]
+Tue Jul  3 11:43:46 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 06:08:26 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (dir_chdir, check_dirname): get rid of optimization-out.
 
-	* eval.c (rb_define_alloc_func, rb_undef_alloc_func): should
-	  define/undef on a signleton class.  [ruby-core:09959]
+Thu Jun 28 17:57:49 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun  8 06:04:41 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (is_socket, is_console): add prototypes to fix compile
+	  problem with gcc introduced at r32549.
 
-	* time.c (time_arg): use converted object.  [ruby-core:14759]
+Wed Jun 27 08:31:50 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 06:02:11 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* insns.def (splatarray): make new array if flag is set.
 
-	* io.c (fptr_finalize): clear errno first.  [ruby-talk:284492]
+	* compile.c (iseq_compile_each): make new array with
+	  splat. [ruby-core:21901][Feature #1125]
 
-Sun Jun  8 05:59:36 2008  Tadayoshi Funaba  <tadf@dotrb.org>
+Wed Jun 27 04:23:26 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/date.rb: don't freeze nil even if 1.8 will not be aware of
-	  the issue. [ruby-dev:32677]
+	* win32/win32.c (rb_w32_sysinit): let the system not display the
+	  critical-error-handler message box and the Windows Error Reporting
+	  dialog.  [ruby-core:45389] [Bug #6535]
 
-Sun Jun  8 05:54:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun 27 04:20:41 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (TIMEZONE_VOID): check whether timezone requires zero
-	  arguments.  [ruby-dev:32631]
+	* bignum.c (rb_big_pow): estimate result bit size more precisely.
+	  [ruby-core:30735][Feature #3429]
 
-Sun Jun  8 05:37:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 26 20:36:53 2012  Tanaka Akira  <akr@fsij.org>
 
-	* parse.y (f_rest_arg): check if duplicated.  [ruby-core:14140]
+	* lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
+	  OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
+	  http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
+	  reported by Bohuslav Kabrda.
+	  [ruby-core:43844] [ruby-trunk - Bug #6221]
 
-Sun Jun  8 05:32:45 2008  Tanaka Akira  <akr@fsij.org>
+Tue Jun 26 20:35:59 2012  Eric Hodel  <drbrain@segment7.net>
 
-	* gc.c (stack_end_address): use local variable address instead of
-	  __builtin_frame_address(0) to avoid SEGV on SunOS 5.11 on x86 with 
-	  gcc (GCC) 3.4.3 (csl-sol210-3_4-20050802).
+	* ext/zlib/zlib.c (do_inflate):  Inflate more data if buffered data
+	  exists.  Allows Zlib::Inflate#set_dictionary to work.
+	  [ruby-trunk - Bug #5929]
 
-Sun Jun  8 05:24:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 21 13:42:57 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* configure.in (RUBY_CHECK_VARTYPE): check if a variable is defined
-	  and its type.
+	* thread.c (rb_threadptr_execute_interrupts_common):
+	  test_signal_requiring of test/ruby/test_signal.rb fail if the sub
+	  process is killed on waiting IO in lex_io_gets in rb_load_file in
+	  rb_load_internal in require.
+	  This is because
+	  (1) the process receive the killing signal in
+	      rb_thread_io_blocking_region in rb_read_internal in lex_io_gets.
+	  (2) set th->errinfo as INT2FIX(TAG_FATAL) at
+	      rb_threadptr_execute_interrupts_common.
+	  (3) escape rb_load_file in rb_load_internal and jump to EXEC_TAG()
+	      without set loaded as TRUE.
+	  (4) call first rb_exc_raise(GET_THREAD()->errinfo); because loaded
+	      is FALSE as above. this errinfo should be an exception object
+	      but this is INT2FIX(TAG_FATAL).
+	  Don't call first rb_exc_raise if GET_THREAD()->errinfo is Fixnum.
 
-	* configure.in (timezone, altzone): check for recent cygwin.
+Mon Jun 11 19:56:22 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* missing/strftime.c (strftime): fix for timezone.  [ruby-dev:32536]
+	* test/webrick/test_cgi.rb (class TestWEBrickCGI): respect
+	  RbConfig::CONFIG["LIBPATHENV"]. [Bug #5135] [ruby-core:38653]
+	* test/webrick/test_filehandler.rb (class WEBrick): ditto.
 
-	* lib/mkmf.rb (try_var): should fail for functions.
+Tue Jun  5 14:03:53 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* ext/readline/extconf.rb: should use have_func for functions instead
-	  of have_var.
+	* lib/ipaddr.rb: Inhibit zero-filled octets in an IPv4 address in
+	  all platforms. [ruby-dev:45671]
 
-Sun Jun  8 05:08:35 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/ipaddr.rb: Allow the x:x:x:x:x:x:d.d.d.d form not limited to
+	  IPv4 mapped/compatible addresses.  This change also makes it
+	  possible for the parser to understand IPv4 mapped and compatible
+	  IPv6 addresses in non-compressed form.
 
-	* lib/cgi.rb (read_multipart): exclude blanks from header values.
-	  [ruby-list:44327]
+	* lib/ipaddr.rb: Stop exposing IPSocket.valid*? methods which were
+	  only usable on non-IPv6-ready platforms.
 
-Sun Jun  8 05:02:25 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun  2 18:49:39 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* bignum.c (rb_cstr_to_inum): trailing spaces may exist at sqeezing
-	  preceeding 0s.  [ruby-core:13873]
+	* string.c (rb_enc_cr_str_buf_cat): don't reset coderange as unknown.
+	  the condition 'ptr_a8 && str_cr != ENC_CODERANGE_7BIT' means not
+	  unknown, str is also ASCII-8BIT because str_encindex == ptr_encindex,
+	  and nont (str_cr == ENC_CODERANGE_UNKNOWN) and
+	  str_cr != ENC_CODERANGE_7BIT means str_cr is valid because ASCII-8BIT
+	  can't be broken. [ruby-dev:45688] [Bug #6509]
 
-Sun Jun  8 04:58:05 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 30 17:19:56 2012  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (error_print): put newline unless multiple line message ends
-	  with a newline.  [ruby-dev:32429]
+	* ext/zlib/zlib.c (do_inflate):  Inflate more data if buffered data
+	  exists.  Allows Zlib::Inflate#set_dictionary to work.
+	  [ruby-trunk - Bug #5929]
 
-Sun Jun  8 04:55:26 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+Mon May 28 11:40:19 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	Merged 14070 from trunk.
-	
-	* lib/xmlrpc/server.rb (XMLRPC::Server#server): Improve signal handling so
-	  pressing control-c in the controlling terminal or sending SIGTERM stops
-	  the XML-RPC server.
+	* io.c (rb_io_extract_modeenc): fail only if conflicting
+	  text/binary modes given explicitly.  [ruby-dev:45268][Bug #6055]
 
-Sun Jun  8 04:49:43 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 25 17:18:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (newline_node): set line from outermost node before removing
-	  NODE_BEGIN.  [ruby-dev:32406]
+	* parse.y (f_arglist): should reset lexical states after empty
+	  argument list with no parenthesis as well as parenthesized list,
+	  so that reserved name method definition work.  [ruby-dev:45626]
+	  [Bug #6403]
 
-Sun Jun  8 04:37:34 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 25 10:40:31 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* parse.y (stmt): remove unnecessary NODE_BEGIN.  [ruby-core:13814]
+	* include/ruby/win32.h (FD_SET): change function to macro.
+	  To avoid buffer overflow when smaller FD_SETSISE is used in ext
+	  libraries.
 
-Sun Jun  8 04:16:35 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (rb_w32_fdset): this function is not used anymore.
+	  But we leave this for compatibility.
 
-	* eval.c (rb_alias): do not call hook functions until initialization
-	  finishes.  [ruby-talk:279538]
+	* win32/win32.c (rb_w32_select_with_thread): fix SEGV when smaller
+	  FD_SETSISE is used in ext libraries. Dereference of fd_set pointer
+	  causes SEGV.
 
-Sun Jun  8 04:14:16 2008  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* test/-ext-/win32/test_fd_setsize.rb(TestFdSetSize): add tests for
+	  above.
+	* ext/-test-/win32/fd_setsize/depend: ditto.
+	* ext/-test-/win32/fd_setsize/extconf.rb: ditto.
+	* ext/-test-/win32/fd_setsize/fd_setsize.c: ditto.
 
-	* ext/win32ole/win32ole.c (ole_invoke): bug fix. [ruby-talk:279100]
+	  [ruby-core:44588] [Bug #6352]
 
-Sun Jun  8 03:59:31 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri May 25 10:38:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/curses/extconf.rb: check macro if cannot find func.
-	  [ruby-list:44224]
+	* io.c (io_strip_bom): check EOF.  [Bug #6487][ruby-core:45203]
 
-Sun Jun  8 03:52:53 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri May 25 10:36:38 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::FileStore::restore): use
-	  lockfile for exclusive locks.  a patch from <tommy AT tmtm.org>.
-	  [ruby-dev:32296]
+	* parse.y (f_arglist): should reset lexical states after empty
+	  argument list with no parenthesis as well as parenthesized list,
+	  so that reserved name method definition work.  [ruby-dev:45626]
+	  [Bug #6403]
 
-Sun Jun  8 03:49:15 2008  Tanaka Akira  <akr@fsij.org>
+Mon May 21 16:24:40 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* missing/isinf.c (isinf): don't define if the macro is defined.
+	* ext/syslog/syslog.c (mSyslog_inspect): Use rb_sprintf().
 
-Sun Jun  8 03:42:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/syslog/syslog.c (mSyslog_inspect): Make sure self is a
+	  module before calling rb_class2name().
 
-	* numeric.c (round): fallback definition.
+Sat May 19 14:42:37 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* numeric.c (flo_divmod, flo_round): use round() always.
-	  [ruby-dev:32269]
+	* test/drb/drbtest.rb ({DRbCore,DRbAry}#teardown}: cannot pass SIGTERM
+	  to another process on Windows, so use SIGINT instead.
 
-Sun Jun  8 03:42:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May 19 14:42:20 2012  Tanaka Akira  <akr@fsij.org>
 
-	* numeric.c (flodivmod): work around for infinity.
+	* lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
+	  OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
+	  http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
+	  reported by Bohuslav Kabrda.
+	  [ruby-core:43844] [ruby-trunk - Bug #6221]
 
-	* numeric.c (flo_divmod): work around for platforms have no round().
-	  [ruby-dev:32247]
+Sat May 19 14:41:45 2012  Tanaka Akira  <akr@fsij.org>
 
-Sun Jun  8 03:42:10 2008  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* test/drb/drbtest.rb: rescue Errno::ESRCH for Process.kill.
+	  reported by NARUSE, Yui.  [ruby-dev:45551]
 
-	* numeric.c (flo_divmod): round to the nearest integer.
-	  [ ruby-Bugs-14540 ]
+Sat May 19 14:41:09 2012  Tanaka Akira  <akr@fsij.org>
 
-Sun Jun  8 03:28:53 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/drb/extservm.rb (DRb::ExtServManager): don't use /bin/sh to
+	  invoke service subprocess.  mark detach threads for clean up.
 
-	* lib/rexml/encodings/SHIFT-JIS.rb (REXML::Encoding): place -x for
-	  nkf conversion.  a patch from <moonwolf AT moonwolf.com>.
-	  [ruby-dev:32183]
+	* test/drb/drbtest.rb: clean up the service subprocess in teardown.
 
-Sun Jun  8 03:07:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/drb/test_drb.rb: set @service_name for teardown.
 
-	* lib/optparse.rb (OptionParser::Switch::summarize): fix for long form
-	  option with very long argument.  a patch from Kobayashi Noritada
-	  <nori1 AT dolphin.c.u-tokyo.ac.jp> in [ruby-list:44179].
+	* test/drb/test_drbunix.rb: ditto.
 
-Sun Jun  8 03:04:38 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/drb/test_drbssl.rb: ditto.
 
-	* numeric.c (fix_pow): returns infinity for 0**-1.  [ruby-dev:32084]
+Sat May 19 14:40:49 2012  Tanaka Akira  <akr@fsij.org>
 
-Sun Jun  8 02:58:19 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+	* lib/drb/ssl.rb: close accepted TCP socket if SSL accept is failed.
+	  [ruby-dev:45541]
 
-	Merged 13781 from trunk.
+Sat May 19 14:39:50 2012  Tanaka Akira  <akr@fsij.org>
 
-	* lib/net/telnet.rb (Net::Telnet#login): Allowing "passphrase" in
-	  addition to "password" for Telnet login prompts. [ruby-Bugs-10746]
+	* lib/webrick/utils.rb: fix fcntl call.
 
-Wed Oct 25 06:46:21 2007  James Edward Gray II  <jeg2@ruby-lang.org>
+	* lib/drb/unix.rb: ditto.
 
-	Merged 13779 from trunk.
+Fri May 18 18:13:44 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/telnet.rb (Net::Telnet#login): Making the password prompt
-	  pattern case insensitive. [ruby-Bugs-10746]
+	* lib/mkmf.rb (MakeMakefile#configuration): keep space at end of
+	  OUTFLAG and COUTFLAG.  [ruby-dev:45650]
 
-Sun Jun  8 02:55:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 18 00:04:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_io_tell, rb_io_seek): check errno too.  [ruby-dev:32093]
+	* win32/win32.c (rb_w32_fstat, rb_w32_fstati64): convert FILETIME
+	  to time_t directly, not to be affected by TZ unnecessarily.
 
-Sun Jun  8 01:53:50 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+	* win32/win32.c (unixtime_to_filetime): convert time_t to FILETIME
+	  simply.
 
-	Merged 13767, 13768, 13769, and 13770 from trunk.
+Wed May 16 01:07:46 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/xmlrpc/parser.rb (XMLRPC::Convert::dateTime): Fixing a bug that
-	  caused time zone conversion to fail for some ISO 8601 date formats.
-	  [ruby-Bugs-12677]
+	* ext/digest/md5/extconf.rb: use pkg_config for openssl so that
+	  customized ssl paths are used for linking.  Backports fixes for
+	  [ruby-core:44755].
+	* ext/digest/rmd160/extconf.rb: ditto
+	* ext/digest/sha1/extconf.rb: ditto
+	* ext/digest/sha2/extconf.rb: ditto
 
-	* lib/xmlrpc/client.rb (XMLRPC::Client#do_rpc): Explicitly start
-	  the HTTP connection to support keepalive requests. [ruby-Bugs-9353]
+Mon May 14 17:14:10 2012  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* lib/xmlrpc/client.rb (XMLRPC::Client#do_rpc): Improving the error
-	  message for Content-Type check failures. [ruby-core:12163]
+	* test/ruby/test_io.rb (test_flush_in_finalizer1): don't use IO.for_fd
+	  to close IO objects. it create IO object with already closed fd, and
+	  cause occasional Errno::EBADF in following tests. [ruby-core:45020]
+	  [Bug #6228]
 
-	* lib/xmlrpc/utils.rb (XMLRPC::ParseContentType#parse_content_type):
-	  Making Content-Type checks case insensitive. [ruby-Bugs-3367]
+Mon May 14 17:14:10 2012  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-Sun Jun  8 01:50:07 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO): revert r35631. it broke the intent of
+	  test_flush_in_finalizer1.  [ruby-core:43951] [Bug ##6228]
 
-	* marshal.c (r_bytes0): refined length check.  [ruby-dev:32059]
+Mon May 14 13:18:56 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 01:50:07 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (parser_tokadd_string): insert a backslash only if
+	  quoted by single quotes.  [ruby-dev:45281] [Bug #6069]
 
-	* marshal.c (r_bytes0): check if source has enough data.
-	  [ruby-dev:32054]
+Mon May 14 13:17:57 2012  Luis Lavena  <luislavena@gmail.com>
 
-Sun Jun  8 01:41:19 2008  Tanaka Akira  <akr@fsij.org>
+	* test/ruby/test_io.rb (class TestIO):  Disable GC during IO tests to
+	  avoid file descriptors being GC'ed. Suggestion by Tomoyuki Chikanaga
+	  [ruby-core:43951][Bug #6228]
 
-	* ext/socket/socket.c (s_accept_nonblock): make accepted fd
-	  nonblocking.  [ruby-talk:274079]
+Fri May 11 14:09:48 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 01:36:26 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (PUSH): to prevent VALUE from GC,
+	  must not cast it to unsigned long, which may be shorter than
+	  VALUE, and the result can be mere garbage.
 
-	* configure.in (AC_SYS_LARGEFILE): keep results also in command
-	  options, to vail out of mismatch.  [ruby-list:44114]
+Fri May 11 01:04:54 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* mkconfig.rb, lib/mkmf.rb (configuration): add DEFS.
+	* io.c (io_unread): fix IO#pos with mode 'r' bug on Windows.
+	  If the end of reading buffer is CR, io_unread() needs to unread one
+	  more byte.
+	  [ruby-core:44874] [Bug #6401]
 
-Sun Jun  8 01:31:17 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_pos_with_buffer_end_cr):
+	  add a test for above.
 
-	* win32/mkexports.rb: deal with __fastcall name decorations.
-	  [ruby-list:44111]
+Wed May  9 15:59:17 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 01:27:06 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (RUBY_WERROR_FLAG): append all warning flags which
+	  are enabled to compile, so that printf format modifiers properly
+	  fail.  [ruby-core:41351] [Bug #5679]
 
-	* {bcc,win}32/mkexports.rb: explicit data.  [ruby-list:44108]
+Mon May  7 20:23:29 2012  Tanaka Akira  <akr@fsij.org>
 
-Sun Jun  8 01:15:50 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/securerandom.rb (random_bytes): call to_int method for the
+	  argument at first.
 
-	* lib/net/http.rb, lib/open-uri.rb: remove
-	  Net::HTTP#enable_post_connection_check.  [ruby-dev:31960]
+Mon May  7 20:23:29 2012  Tanaka Akira  <akr@fsij.org>
 
-	* lib/net/imap.rb: hostname should be verified against server's
-	  indentity as persented in the server's certificate. [ruby-dev:31960]
+	* lib/securerandom.rb: show actual read length in an error message.
 
-	* ext/openssl/lib/net/telnets.rb, ext/openssl/lib/net/ftptls.rb: ditto.
+Mon May  7 11:09:20 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Jun  5 16:21:16 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal): define IDs before
+	  they are used. [ruby-core:44900] [Bug #6406]
 
-	* win32/win32.c (make_cmdvector): adjust escaped successive
-	  double-quote handling. (merge from trunk)
+Fri Apr 27 11:02:33 2012  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Thu Jun  5 12:26:45 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/rinda/test_rinda.rb (test_core_03_notify): Fixed test failures
+	  [ruby-dev:44430] [Ruby 1.9 - Bug #372]
 
-	* win32/win32.c (init_env): initialize HOME and USER environment
-	  variables unless set. [ruby-core:12328] (merge from trunk)
+Fri Apr 27 08:29:51 2012  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* win32/win32.c (NtInitialize, getlogin): ditto.
+	* test/rinda/test_rinda.rb: fix sticks on some testsf problem 
+	  [Bug #6272]
 
-	* configure.in, win32/Makefile.sub (LIBS): need to link shell32
-	  library for SH* functions on mswin32 and mingw32.
+Wed Apr 25 05:56:56 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jun  5 12:22:28 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/optparse.rb (OptionParser#to_a): split for each lines.
+	  [ruby-dev:45568][Bug #6348]
 
-	* gc.c (id2ref): valid id should not refer T_VALUE nor T_ICLASS.
-	  [ruby-dev:31911]
+Tue Apr 24 21:20:39 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Jun  4 16:41:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/optparse.rb (OptionParser#to_a): should split by end-of-line,
+	  and MUST TEST IT, MUST RUN THE TEST, MUST VERIFY BEFORE BACKPORT.
+	  [ruby-dev:45568][Bug #6348]
 
-	* Makefile.in (ext/extinit.o): use $(OUTFLAG) as well as other
-	  objects.  [ruby-Bugs-14228]
+Tue Apr 24 14:55:41 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun  3 16:15:27 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/optparse.rb (OptionParser#to_a): String#to_a is no longer
+	  defined.  [ruby-dev:45568][Bug #6348]
 
-	* parse.y (yyerror): limit error message length.  [ruby-dev:31848]
+Sat Apr 21 07:16:16 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_mbc_startpos): separated from re_adjust_startpos.
+	* strftime.c (rb_strftime_with_timespec): fix padding of time zone
+	  offset.  [ruby-dev:43287][Bug #4458]
 
-Tue Jun  3 15:45:00 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* strftime.c (rb_strftime_with_timespec): add an interim digit for
+	  the timezone offset which is less than an hour.
 
-	* gc.c (os_obj_of, os_each_obj): hide objects to be finalized.
-	  [ruby-dev:31810]
+	* strftime.c (rb_strftime_with_timespec): fix carry-up bug and
+	  overwrite '+' with '-' if negative offset less than a hour.
+	  [ruby-core:44447][Bug #6323]
 
-Wed Jun  4 19:16:40 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Apr 20 12:30:06 2012  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (remove_method): should not remove undef place holder.
-	  [ruby-dev:31817]
+	* lib/rubygems/ssl_certs/AddTrustExternalCARoot.pem:  Removed to avoid
+	  conflict with ca-bundle.pem
+	* lib/rubygems/ssl_certs/VerisignClass3PublicPrimaryCertificationAuthority-G2.pem:
+	  ditto.
+	* lib/rubygems/ssl_certs/Entrust_net-Secure-Server-Certification-Authority.pem:
+	  ditto.
 
-Tue Jun  3 15:22:47 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr 20 08:30:55 2012  Eric Hodel  <drbrain@segment7.net>
 
-	* process.c (struct rb_exec_arg): proc should be a VALUE.
+	* lib/rubygems:  Update to RubyGems 1.8.23 which contains security
+	  fixes:
 
-	* process.c (rb_f_exec): suppress a warning.
+	  RubyGems now disallows redirection from HTTPS to HTTP.
 
-       * process.c (rb_detach_process): cast for the platforms where size of
-         pointer differs from size of int.
+	  RubyGems now verifies SSL connections.
 
-       * process.c (rb_f_exec, rb_f_system): should not exceptions after
-         fork.  [ruby-core:08262]
+	  See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
+	  changes since 1.8.22.
+	* test/rubygems:  ditto.
 
-Wed May 21 01:32:56 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Apr 20 07:39:50 2012  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/webrick/httpservlet/filehandler.rb: should normalize path
-	  name in path_info to prevent script disclosure vulnerability on
-	  DOSISH filesystems. (fix: CVE-2008-1891)
-	  Note: NTFS/FAT filesystem should not be published by the platforms
-	  other than Windows. Pathname interpretation (including short
-	  filename) is less than perfect.
+	* lib/rubygems:  Update to RubyGems 1.8.22 plus r33517 and r35337 which
+	  were ported to the rubygems git repository.
 
-	* lib/webrick/httpservlet/abstract.rb
-	  (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
-	  should escape the value of Location: header.
+	  See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
+	  changes since 1.8.11.
 
-	* lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
-	  command line arguments.
+	* test/rubygems:  ditto.
 
-Sun May 18 01:57:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rubygems/version.rb:  Fixed init_with warning by calling into
+	  yaml_initialize (for syck) from psych's init_with
 
-	* file.c (isdirsep): backslash is valid path separator on cygwin too.
-	  backported from 1.8 HEAD.
+Thu Apr 19 12:55:31 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 17 23:53:57 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/-test-/win32/dln/extconf.rb: need import library for ordinal
+	  entry even on mingw.  [ruby-core:44441][Bug #6320]
 
-	* file.c (file_expand_path): fix for short file name on Cygwin.
+Wed Apr 18 23:08:58 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 17 23:50:29 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (DOT, DOXYGEN): use AC_CHECK_PROGS instead of
+	  AC_CHECK_PROG which needs the third argument.  [ruby-core:44433]
+	  [Bug #6316]
 
-	* file.c (OpenFile): prevent conflict on Windows.
+	* configure.in (PKG_CONFIG): fix condition to skip older version
+	  of pkg-config.  continue in backticks does not affect outside.
 
-	* file.c (USE_NTFS): fixed merge miss.
+Tue Apr 17 21:35:47 2012  Kouhei Sutou  <kou@cozmixng.org>
 
-Sat May 17 12:36:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rexml/parsers/baseparser.rb, test/rexml/test_namespace.rb:
+	  fix the default xml namespace URI validation.
+	  [ruby-dev:45169] [Bug #5956]
+	  Reported by Miho Hiramatsu. Thanks!!!
 
-	* file.c (file_expand_path): rb_str_set_len is not backported.
+Mon Apr 17 14:27:22 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 17 12:15:48 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dln.c (rb_w32_check_imported): skip ordinal entries.  based on a
+	  patch by phasis68 (Heesob Park) at [ruby-core:44381].
+	  [ruby-core:44371][Bug #6303]
 
-	* file.c (file_expand_path): support for alternative data stream
-	  and ignored trailing garbages of NTFS.
+Sun Apr 15 14:57:00 2012  Tanaka Akira  <akr@fsij.org>
 
-	* file.c (rb_file_s_basename): ditto.
+	* test/test_pty.rb (test_pty_check_default): call PTY.check until
+	  "cat" command is finished.
 
-	* file.c (rb_file_s_extname): ditto.
+Sun Apr 15 14:54:16 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat May 17 10:18:44 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_process.rb (TestProcess#windows?): new method.
 
-	* re.c (rb_reg_search): need to free allocated buffer in re_register.
+	* test/ruby/test_process.rb (TestProcess#*): use above method.
 
-Mon Mar  3 23:34:13 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/ruby/test_process.rb (TestProcess#test_execopts_redirect):
+	  windows doesn't support FD_CLOEXEC.
 
-	* lib/webrick/httpservlet/filehandler.rb: should normalize path
-	  separators in path_info to prevent directory traversal attacks
-	  on DOSISH platforms.
-	  reported by Digital Security Research Group [DSECRG-08-026].
+Sun Apr 15 06:40:28 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* lib/webrick/httpservlet/filehandler.rb: pathnames which have
-	  not to be published should be checked case-insensitively.
+	* include/ruby/win32.h (rb_w32_aspawn_flags): add the declaration of
+	  new function.
 
-Mon Dec  3 08:13:52 2007  Kouhei Sutou  <kou@cozmixng.org>
+	* process.c (enum): add EXEC_OPTION_PGROUP and move the position
+	  above for the usage in proc_spawn_n().
 
-	* test/rss/test_taxonomy.rb, test/rss/test_parser_1.0.rb,
-	  test/rss/test_image.rb, test/rss/rss-testcase.rb: ensured
-	  declaring XML namespaces.
+	* process.c (proc_spawn_n): add an argument to pass new option
+	  `new_pgroup`. The option specifies CREATE_NEW_PROCESS_GROUP flag to
+	  CreateProcessW(). This flag is necessary for the usage of
+	  Process.kill on the subprocess on Windows.
 
-Sun Sep 23 21:57:25 2007  GOTOU Yuuzou  <gotoyuzo@notwork.org>  
+	* process.c (rb_exec_arg_addopt): ditto.
 
-	* lib/net/http.rb: an SSL verification (the server hostname should
-	  be matched with its certificate's commonName) is added.
-	  this verification can be skipped by
-	  "Net::HTTP#enable_post_connection_check=(false)".
-	  suggested by Chris Clark <cclark at isecpartners.com>
+	* process.c (rb_spawn_process): ditto.
 
-	* lib/net/open-uri.rb: use Net::HTTP#enable_post_connection_check to
-	  perform SSL post connection check.
+	* process.c (documentation for rb_f_spawn): add documentation for new
+	  option `new_pgroup` of spawn.
 
-	* ext/openssl/lib/openssl/ssl.c
-	  (OpenSSL::SSL::SSLSocket#post_connection_check): refine error message.
+	* test/ruby/test_process.rb (TestProcess#test_execopts_new_pgroup):
+	  add tests for option `new_pgroup`.
 
-Sun Sep 23 07:49:49 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_thread.rb
+	  (TestThreadGroup#test_thread_timer_and_interrupt):
+	  add option `new_pgroup: true` to spawn on Windows. It's needed for
+	  Process.kill on a subprocess.
 
-	* eval.c, intern.h, ext/thread/thread.c: should not free queue while
-	  any live threads are waiting.  [ruby-dev:30653]
+	* win32/win32.c (CreateChild): add an argument to pass
+	  dwCreationFlags of CreateProcessW().
 
-Sun Sep 23 06:05:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (rb_w32_spawn): ditto.
 
-	* ext/stringio/stringio.c (strio_init): separate from strio_initialize
-	  to share with strio_reopen properly.  [ruby-Bugs-13919]
+	* win32/win32.c (rb_w32_aspawn_flags): add new function to pass
+	  dwCreationFlags.
 
-Sun Sep 23 05:42:35 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* win32/win32.c (rb_w32_aspawn): refactor to move the content to
+	  rb_w32_aspawn_flags().
+	  [ruby-core:43245][Bug #6131]
 
-	* lib/rdoc/options.rb (Options::check_diagram): dot -V output
-	  changed. [ ruby-Bugs-11978 ], Thanks Florian Frank.
+Sun Apr 15 06:40:28 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-Wed Sep 19 11:13:07 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_thread.rb
+	  (TestThreadGroup#test_thread_timer_and_interrupt): skip on Windows.
+	  Process.kill cannot kill a subprocess if CREATE_NEW_PROCESS_GROUP
+	  flag is not specified in a call to CreateProcessW().
 
-	* bignum.c (bigtrunc): RBIGNUM(x)->len may be zero.  out of bound
-	  access.  [ruby-dev:31404]
+	* win32/win32.c (CreateChild): revert the usage of
+	  CREATE_NEW_PROCESS_GROUP flag for compatibility.
+	  [ruby-core:43245][Bug #6131]
 
-Mon Sep 17 05:24:13 2007  Sylvain Joyeux <sylvain.joyeux@m4x.org>
+Sun Apr 15 04:35:48 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* ext/thread/thread.c (lock_mutex): should take care of threads
-	  not waiting any longer; there cases of a thread raising
-	  exceptions. [ ruby-Bugs-11901 ]
+	* io.c (rb_io_eof): use eof() instead of io_fillbuf(). It's because
+	  io_unread() doesn't work properly when reading CRLF with read(length)
+	  and mode 'r'.
+	  [ruby-core:44189][Bug #6271]
 
-	* test/thread/test_thread.rb (test_mutex_exception_handling):
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_read_crlf_and_eof):
 	  test for above.
 
-Mon Sep 17 05:01:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* runruby.rb: fix incomplete backport r12339.
-
-Mon Sep 17 04:56:28 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/thread/test_thread.rb (test_local_barrier),
-	  test/thread/lbtest.rb: test for [ruby-dev:30653].
-
-Mon Sep 17 04:52:21 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ruby.c (proc_options): -W should be allowed in RUBYOPT
-	  environment variable.  [ruby-core:12118]
-
-Mon Sep 17 04:37:10 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* range.c (range_step): fixed integer overflow.  [ruby-dev:31763]
-
-Fri Sep  7 17:06:16 2007  Vincent Isambart <vincent.isambart@gmail.com>
-
-	* eval.c (rb_thread_start_0): should unset time_thread_alive_p.
-	  [ruby-talk:257219], [ruby-core:11542], [ruby-dev:31253]
-
-Fri Sep  7 16:39:23 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_subseq): need integer overflow check.
-	  [ruby-dev:31736]
-
-	* array.c (rb_ary_splice): ditto.  [ruby-dev:31737]
-
-	* array.c (rb_ary_fill): ditto.  [ruby-dev:31738]
-
-	* string.c (rb_str_splice): integer overflow for length.
-	  [ruby-dev:31739]
-
-Fri Sep  7 16:33:23 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* include/ruby/defines.h (flush_register_windows): call "ta 0x03"
-	  even on Linux/Sparc.  [ruby-dev:31674]
-
-Fri Sep  7 16:09:39 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_type_progid, reg_enum_key, 
-	  reg_get_val, ole_wc2mb): fix the bug. Thanks, arton. 
-	  [ruby-dev:31576]
-
-Fri Sep  7 15:50:50 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (mnew): should preserve noex as safe_level.
-
-	* eval.c (rb_call0): tighten security check condition..
-
-Fri Sep  7 15:43:43 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tk/tcltklib.c (Init_tcltklib): use rb_set_end_proc().
-
-Fri Sep  7 15:42:07 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (detach_process_watcher): should not pass the pointer
-	  to an auto variable to the thread to be created.  pointed and
-	  fix by KUBO Takehiro <kubo at jiubao.org>  [ruby-dev:30618]
-
-Fri Sep  7 15:40:47 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sample/test.rb, test/ruby/test_system.rb(valid_syntax?): keep
-	  comment lines first.
-
-Wed Aug 22 12:40:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_hash_delete_key): delete the entry without calling block.
-
-	* hash.c (rb_hash_shift): should consider iter_lev too.
-
-	* hash.c (delete_if_i): use rb_hash_delete_key() so that the block
-	  isn't called twice.  [ruby-core:11556]
-
-Sun Arg 12 03:56:30 2007  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/tuplespace.rb: fix Rinda::TupleSpace keeper thread bug.
-	  the thread is started too early. [ruby-talk:264062] 
-
-	* test/rinda/test_rinda.rb: ditto.
-
-Wed Aug 22 12:31:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (ac_cv_func_isinf): set yes also on OpenSolaris.
-	  [ruby-Bugs-12859]
-
-Wed Aug 22 12:30:42 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rexml/encodings/{ISO-8859-15,CP-1252}.rb: fixed invalid syntax.
-
-Wed Aug 22 12:29:36 2007  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/README: fixed a typo.
-
-Wed Aug 22 12:13:54 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): save all CONFIG values.
-
-	* ext/extmk.rb (extmake): remove mkmf.log at clean, and extconf.h at
-	  distclean, respectively.
-
-	* ext/extmk.rb: remove rdoc at clean, and installed list file at
-	  distclean, respectively.
-
-Wed Aug 22 11:49:00 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): should not check positional number as
-	  width.  [ruby-core:11838]
-
-Wed Aug 22 11:47:11 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (rb_big_aref): check for Bignum index range.
-	 [ruby-dev:31271]
-
-Wed Aug 22 11:41:44 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dln.c (conv_to_posix_path): removed.
-
-	* ruby.c (rubylib_mangled_path, rubylib_mangled_path2): return
-	  VALUE instead of a pointer to static buffer.
-
-	* ruby.c (push_include_cygwin): fixed buffer overflow.
-	  [ruby-dev:31297]
-
-	* ruby.c (ruby_init_loadpath): not convert built-in paths.
-
-Wed Aug 22 11:39:31 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* intern.h (is_ruby_native_thread): removed since declared as an int
-	  function in ruby.h already.
-
-Wed Aug 22 11:00:20 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (init_mkmf): should remove mkmf.log too.
-
-Wed Aug 22 10:57:50 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/openssl/ossl_config.c (ossl_config_set_section): do not
-	  initialize aggregations with dynamic values.  [ruby-talk:259306]
-
-Wed Aug 22 10:55:00 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (get_backtrace): check the result more.
-	  [ruby-dev:31261] [ruby-bugs-12398]
-
-Wed Aug 22 10:36:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (rb_big_lshift, rb_big_rshift): separated functions
-	  to get rid of infinite recursion.  fixed calculation in edge
-	  cases.  [ruby-dev:31244]
-
-	* numeric.c (rb_fix_lshift, rb_fix_rshift): ditto.
-
-Wed Aug 22 10:29:45 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (rb_big_pow): refine overflow check.  [ruby-dev:31242]
-
-Wed Aug 22 10:26:59 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_succ): Time#succ should return a time object in the
-	  same timezone mode to the original.  [ruby-talk:260256]
-
-Wed Aug 22 10:24:00 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (fix_pow): integer power calculation: 0**n => 0, 
-	  1**n => 1, -1**n => 1 (n: even) / -1 (n: odd).
-
-	* test/ruby/test_fixnum.rb (TestFixnum::test_pow): update test
-	  suite.  pow(-3, 2^64) gives NaN when pow(3, 2^64) gives Inf.
-
-Wed Aug 22 10:23:01 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/base64.rb (Base64::b64encode): should not specify /o option
-	  for regular expression.  [ruby-dev:31221]
-
-Wed Aug 22 10:20:32 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): more checks for format argument.
-	  [ruby-core:11569], [ruby-core:11570], [ruby-core:11571],
-	  [ruby-core:11573]
-
-Wed Aug 22 10:13:45 2007  pegacorn  <subscriber.jp AT gmail.com>
-
-	* ext/digest/digest.c (rb_digest_instance_update,
-	  rb_digest_instance_finish, rb_digest_instance_reset,
-	  rb_digest_instance_block_length): %s in rb_raise() expects char*.
-	  [ruby-dev:31222]
-
-	* ext/openssl/ossl.h: include ossl_pkcs5.h.  [ruby-dev:31231]
-
-	* ext/openssl/ossl_pkcs5.h: new file for PKCS5.  [ruby-dev:31231]
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): use ossl_raise()
-	  instead of rb_raise().  [ruby-dev:31222]
-
-	* ext/sdbm/_sdbm.c: DOSISH platforms need io.h.  [ruby-dev:31232]
-
-	* ext/syck/syck.h: include stdlib.h for malloc() and free().
-	  [ruby-dev:31232]
-
-	* ext/syck/syck.h (syck_parser_set_input_type): prototype added.
-	  [ruby-dev:31231]
-
-	* win32/win32.c: include mbstring.h for _mbspbrk().  [ruby-dev:31232]
-
-	* win32.h (rb_w32_getcwd): prototype added.  [ruby-dev:31232]
-
-Wed Aug 22 10:11:59 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (rb_cstr_to_inum): check leading non-digits.
-	  [ruby-core:11691]
-
-Wed Aug 22 10:07:48 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (rb_big_neg): SIGNED_VALUE isn't in 1.8.
-
-	* bignum.c (bigtrunc): do not empty Bignum.  [ruby-dev:31229]
-
-Wed Aug 22 10:02:42 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (fix_pow): 0**2 should not raise floating point
-	  exception.  [ruby-dev:31216]
-
-Wed Aug 22 10:01:08 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (CreateChild): enclose command line except for
-	  command.com which can not handle quotes.  [ruby-talk:258939]
-
-Wed Aug 22 09:58:30 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (link_command, cc_command, cpp_command): do not expand
-	  ::CONFIG which is an alias of MAKEFILE_CONFIG.
-
-Wed Aug 22 09:55:08 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* struct.c (rb_struct_init_copy): disallow changing the size.
-	  [ruby-dev:31168]
-
-Wed Aug 22 09:54:28 2007  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* random.c: documentation fix.  srand(0) initializes PRNG with '0',
-	  not with random_seed.
-
-Wed Aug 22 09:53:14 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bcc32/{Makefile.sub,setup.mak}: remove surplus slash from srcdir.
-
-Wed Aug 22 09:46:25 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): sign bit extension should not be done
-	  if FPLUS flag is specified.  [ruby-list:39224]
-
-Wed Aug 22 09:41:56 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_initialize): should call rb_ary_modify() first.
-	  [ruby-core:11562]
-
-Wed Aug 22 09:40:25 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (yylex): return non-valid token for an invalid
-	  instance/class variable name.  a patch from from Yusuke ENDOH
-	  <mame AT tsg.ne.jp>.  [ruby-dev:31095]
-
-Wed Aug 22 09:39:26 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (dsym): return non-null NODE even if yyerror().  based on a
-	  patch from from Yusuke ENDOH <mame AT tsg.ne.jp>.  [ruby-dev:31085]
-
-Wed Aug 22 09:38:43 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (proc_exec_v, rb_proc_exec): preserve errno.
-
-Wed Aug 22 09:00:23 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): return EXIT_FAILURE if any exceptions occured
-	  in at_exit blocks.  [ruby-core:11263]
-
-Wed Aug 22 08:52:02 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_path2class): get rid of dangling pointer caused by
-	  optimized out value.
-
-Wed Aug 22 08:51:20 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/dl/lib/dl/win32.rb: seems that dl doesn't accept void argument.
-	  fixed [ruby-bugs:PR#5489].
-
-Wed Aug 22 08:49:47 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (darwin): prohibit loading extension libraries to
-	  miniruby.
-
-Wed Aug 22 08:34:20 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_kill_thread): renamed in order to get rid of conflict
-	  with a BeOS system function.  [ruby-core:10830]
-
-Wed Aug 22 08:32:32 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (ruby_setreuid, ruby_setregid): rename to get rid of name
-	  clash.
-Wed Aug 22 08:27:53 2007  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (ResponseParser#next_token): fixed
-	  error message. (backported from HEAD)
-
-	* lib/net/imap.rb (ResponseParser#parse_error): fixed
-	  the condition not to refer @token.symbol unexpectedly.
-	  Thanks, Dick Monahan. (backported from HEAD)
-
-Wed Aug 22 08:26:33 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_extended): erroneous check condition when dump
-	  method is defined.  [ruby-core:10646]
-
-Mon Jun 18 11:29:49 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* intern.h, ext/thread/thread.c: moved prototype of rb_thread_status()
-	  to get rid of error in C++.  [ruby-list:43615]
-
-Sun Jun 10 13:47:36 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb (test_should_propagate_signaled):
-	  get rid of invoking shell.  [ruby-dev:30942]
-
-Sat Jun  9 10:40:00 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* stable version 1.8.6-p36 released.
-
-Fri Jun  8 17:50:17 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval.c (rb_thread_cancel_timer): fix undefined function
-
-Wed May 30 05:17:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): get rid of SEGV at ZSUPER in a block
-	  [ruby-dev:30836]
-
-Wed May 30 04:29:43 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (thread_timer): timer thread should not receive any
-	  signals.  submitted by Sylvain Joyeux.  [ruby-core:08546]
-
-Wed May 30 04:18:37 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval_cmd): just return if no exceptions.
-	  [ruby-dev:30820]
-
-Tue May 29 11:01:06 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_opendir): store attributes of the second
-	  entries or later too.
-
-	* win32/win32.c (rb_w32_opendir, rb_w32_readdir): eliminate magic
-	  numbers.
-
-Thu Jun  7 20:10:51 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c, intern.h, ext/thread/thread.c: should not free queue
-	  while any live threads are waiting.
-	  [ruby-dev:30653]
-
-Thu Jun  7 14:53:46 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* eval.c (method_inspect): show proper class name.
-	  [ruby-talk:248647], Thanks Calamitas.
-
-Sun May 27 05:24:56 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* runruby.rb: eliminate uninitialized variable.
-	  [ruby-core:11255]
+Sun Apr 15 03:00:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun May 27 05:19:03 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* io.c (io_unread): fixed memory leak.  report by nagachika via IRC.
 
-	* eval.c (mnew): call of super via a method object should work again.
-	  [ruby-talk:248647], Thanks Calamitas.
+Sun Apr 15 03:00:54 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* test/ruby/test_method.rb (TestMethod::test_method_super): test for
-	  above fix.
+	* io.c (static int io_fflush): add the definition.
+	  Use it in set_binary_mode_with_seek_cur().
 
-Wed May 23 07:29:53 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* io.c (set_binary_mode_with_seek_cur): refactoring to split the
+	  content into io_unread(). Fix the possibility of buffer overflow.
 
-	* process.c (proc_exec_v): terminate timer thread in advance.
-	  [ruby-dev:30581], Thanks H. Holon.
+	* io.c (io_unread): add new implementation for Windows. Previous one
+	  caused invalid cursor position using IO#pos with OS text mode. New
+	  one fixes the bug.
 
-Wed May 23 06:51:46 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_pos_dont_move_cursor_position): add a test for
+	  above bug.
+	  [ruby-core:43497] [Bug #6179]
 
-	* lib/cgi.rb (CGI#[]): get rid of exceptions being raised.
-	  [ruby-dev:30740], Thanks Kentaro KAWAMOTO.
+Sun Apr 15 03:00:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed May 23 05:49:49 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#test_pos_with_getc): updated.
+	  see [ruby-core:43550]
 
-	* ext/extmk.rb, ext/purelib.rb, lib/mkmf.rb, runruby.rb: clear default
-	  load path to get rid of load pre-installed extensions/libraries.
-	  [ruby-core:11017]
+Sun Apr 15 03:00:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed May 23 06:14:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#test_pos_with_getc): added.
+	  see [Bug #6179][ruby-core:43518]
 
-	* win32/win32.c (move_to_next_entry): loc also must move forward.
-	  [ruby-talk:251987]
+Wed Apr 11 16:22:16 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed May 23 05:55:04 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/-test-/add_suffix/bug.c (ruby_add_suffix): no static
+	  declaration.  [ruby-core:44277][Bug #6279]
 
-	* win32/win32.c (init_stdhandle): stderr should be without buffering,
-	  but mswin32 use buffering when stderr is not connected to tty.
+Sun Apr  8 06:53:55 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed May 23 05:35:42 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_unread): cast as long the value for extra_max.
+	  [ruby-core:44137] [Bug #6257]
 
-	* bignum.c (rb_big_pow): truncate all zero BDIGITs. [ruby-dev:30733]
+Sat Apr  7 10:28:40 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Wed May 23 05:17:33 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/psych/lib/psych.rb: bumping up psych version to match release.
+	* ext/psych/psych.gemspec: ditto
 
-	* ext/iconv/iconv.c (iconv_s_conv): rdoc fix.
+Sat Apr  7 02:07:00 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Wed May 23 05:10:02 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/parser.c: fall back to any encoding if the external
+	  encoding is wrong.  [ruby-core:44163]
+	* test/psych/test_encoding.rb: fix test
 
-	* eval.c (rb_thread_priority): rdoc fix; the initial value is
-	  inherited from the creating thread.  [ruby-core:10607]
+Wed Apr  4 18:29:15 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed May 23 04:22:57 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): syntax error.
 
-	* dir.c (do_stat, do_lstat, do_opendir): should not warn ENOTDIR.
-	  [ruby-talk:248288]
+	* test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): call uname
+	  only on linux because it's a workaround for linux only.
 
-Wed May 23 03:50:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Apr  4 11:32:09 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (libpathflag): not to append RPATHFLAG to current
-	  directory.
-
-	* lib/mkmf.rb (init_mkmf): add current directory to default
-	  library path with highest priority.  [ruby-core:10960]
-
-	* lib/mkmf.rb (LINK_SO): LIBPATH to be placed before DLDFLAGS.
-
-Wed May 23 03:33:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/monitor.rb (ConditionVariable#wait, mon_enter, mon_exit_for_cond):
-	  ensures Thread.critical to be false.  [ruby-talk:248300]
-
-Wed May 23 03:25:13 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* util.c (ruby_strtod): exponent is radix 10.  [ruby-talk:248272]
-
-Wed May 23 03:12:17 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (LDFLAGS): prepend -L. instead appending it to
-	  XLDFLAGS.  [ruby-core:10933]
-
-	* configure.in (Makefile): remove $U for automake from MISSING.
-	  [ruby-talk:248171]
-
-Wed May 23 02:09:32 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_yield_0): should not clear state on TAG_NEXT when
-	  it's invoked from within lambda body.  [ruby-talk:248136]
-
-	* eval.c (proc_invoke): handle TAG_NEXT which would be caused by
-	  next in the lambda body as well.
-
-Wed May 23 01:55:49 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_fclose, rb_w32_close): need to save errno
-	  before calling original fclose()/close().
-
-Wed May 23 01:42:29 2007  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (disconnect): call shutdown for
-	  SSLSocket. Thanks, Technorama Ltd.
-
-Wed May 23 01:28:14 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (rb_notimplement), io.c (pipe_open): removed definite
-	  articles and UNIX manual section from messages.  [ruby-dev:30690]
-
-	* io.c (pipe_open): raise NotImplementedError for command "-" on
-	  platforms where fork(2) is not available.  [ruby-dev:30681]
-
-Wed May 23 00:03:42 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (s_recv, s_recvfrom): some systems (such as
-	  windows) doesn't set fromlen if the socket is connection-oriented.
-	  reported by Bram Whillock in [ruby-core:10512] [ruby-Bugs#9061]
-
-Sat Mar 24 23:40:29 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.h (struct rb_thread.locals): explicit as struct.
-	  [ruby-core:10585]
-
-	* eval.c, node.h (enum rb_thread_status, struct rb_thread,
-	  rb_curr_thread, rb_main_thread): prefixed.  [ruby-core:10586]
-
-	* file.c (chompdirsep): made an unprefixed name static.
-
-	* io.c (io_fread): ditto.
-
-Tue May 22 23:27:16 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): exit by SystemExit and SignalException in END
-	  block.  [ruby-core:10609]
-
-	* test/ruby/test_beginendblock.rb (test_should_propagate_exit_code):
-	  test for exit in END block.  [ruby-core:10760]
-
-	* test/ruby/test_beginendblock.rb (test_should_propagate_signaled):
-	  test for signal in END block.
-
-Tue May 22 23:14:19 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_provided): check for extension library if SOEXT is
-	  explicitly given.  [ruby-dev:30657]
-
-Tue May 22 21:29:08 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (rb_big2str0): round up for the most significant digit.
-	  [ruby-core:10686]
-
-Tue May 22 20:53:02 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/thread.c (remove_one): Preserve List invariants;
-	  submitted by: MenTaLguY <mental AT rydia.net>
-	  in [ruby-core:10598] and [ruby-bugs:PR#9388].
-
-Tue Mar 20 15:37:24 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
-
-	* distruby.rb: Add zip generation.
-
-Fri Mar 16 21:48:11 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/dl/dl.c (rb_ary2cary): Fix a bug in type validation;
-	  submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
-	  in [ruby-dev:30554].
-
-Fri Mar 16 18:28:06 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/etc/etc.c (etc_getgrgid): Fix a bug in Etc::getgrgid()
-	  always returning the (real) group entry of the running process;
-	  reported by: UEDA Hiroyuki <ueda AT netforest.ad.jp>
-	  in [ruby-dev:30586].
-
-Fri Mar 16 16:33:58 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/thread.c (unlock_mutex_inner): Make sure that the
-	  given mutex is actually owned by the caller; submitted by:
-	  Sylvain Joyeux <sylvain.joyeux AT m4x.org> in [ruby-core:10598].
-
-Fri Mar 16 16:21:35 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/thread.c (wait_condvar, lock_mutex): Fix a problem in
-	  ConditionVariable#wait that occurs when two threads that are
-	  trying to access the condition variable are also in concurrence
-	  for the given mutex; submitted by: Sylvain Joyeux
-	  <sylvain.joyeux AT m4x.org> and MenTaLguY <mental AT rydia.net>
-	  in [ruby-core:10598].
-
-Fri Mar 16 16:17:27 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* test/thread/test_thread.rb: Add a test script for the `thread'
-	  library.  This should result in failure as of now with
-	  ext/thread; submitted by: Sylvain Joyeux <sylvain.joyeux AT
-	  m4x.org> in [ruby-core:10598].
-
-Wed Mar 14 12:30:00 2007  Shigeo Kobayashi  <shigeo@tinyforest.jp>
-
-	* ext/bigdecimal/bigdecimal.c: BigDecimal("-.31") is now
-	  treated as ("-0.31") not as ("0.31").
-
-Tue Mar 13 04:04:04 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* stable version 1.8.6 released.
-
-Tue Mar 13 02:54:17 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/cgi.rb (CGI::header): IIS >= 5.0 does not need the nph
-	  assumption any more; submitted by MIYASAKA Masaru <alkaid AT
-	  coral.ocn.ne.jp> in [ruby-dev:30537].
-
-Mon Mar 12 11:07:44 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/openssl/ossl_asn1.c (Init_ossl_asn1): Let rdoc know about
-	  externally defined modules; submitted by Technorama
-	  Ltd. <oss-ruby AT technorama.net> in [ruby-bugs:PR#4704].
-
-	* ext/openssl/ossl_bn.c (Init_ossl_bn): Ditto.
-
-	* ext/openssl/ossl_cipher.c (Init_ossl_cipher): Ditto.
-
-	* ext/openssl/ossl_digest.c (Init_ossl_digest): Ditto.
-
-	* ext/openssl/ossl_hmac.c (Init_ossl_hmac): Ditto.
-
-	* ext/openssl/ossl_pkey.c (Init_ossl_pkey): Ditto.
-
-	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): Ditto.
-
-	* ext/openssl/ossl_pkey_dsa.c (Init_ossl_dsa): Ditto.
-
-	* ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): Ditto.
-
-	* ext/openssl/ossl_rand.c (Init_ossl_rand): Ditto.
-
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): Ditto.
-
-Mon Mar 12 01:23:50 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/dl/sym.c (rb_dlsym_inspect): Use "0x%x" rather for pointers.
-	  This might not be very right but it is commonly used in other
-	  parts of the code; submitted by sheepman <sheepman AT
-	  sheepman.sakura.ne.jp> in [ruby-dev:30532].
-
-	* ext/dl/ptr.c (rb_dlptr_inspect): Ditto.
-
-	* ext/dl/lib/dl/import.rb (DL::Importable::Internal::import,
-	  DL::Importable::Internal::callback): Avoid race condition for an
-	  instance variable; submitted by sheepman <sheepman AT
-	  sheepman.sakura.ne.jp> in [ruby-dev:30530].
-
-Sun Mar 11 19:04:29 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/README: Add a note about ruby-electric.el. 
-
-	* misc/ruby-mode.el (ruby-non-block-do-re): Fix
-	  ruby-non-block-do-re. [ruby-core:03719]
-
-	* misc/inf-ruby.el: Synchronize the comment section with trunk.
-
-	* misc/README, misc/rdebug.el: Add rdebug.el, Emacs ruby-debug
-	  interface based on rubydb3x.el; submitted by Martin Nordholts
-	  <enselic AT gmail.com> in [ruby-bugs:PR#9023].
-
-Sun Mar 11 17:51:46 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/dl/mkcallback.rb (mkfunc): Make sure that a callback
-	  function is found in the function table before trying to call
-	  it; submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
-	  in [ruby-dev:30524].
-
-Sun Mar 11 17:30:53 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (error_handle): no message when exiting by signal.
-
-	* eval.c (ruby_cleanup): re-send signal.  [ruby-dev:30516]
-
-	* eval.c (rb_thread_interrupt): instantiate SignalException.
-
-	* eval.c (rb_thread_signal_raise): now takes signal number instead
-	  of signal name.
-
-	* intern.h (rb_thread_signal_raise, ruby_default_signal): prototypes.
-
-	* signal.c (esignal_init): takes a signal number and an optional
-	  signal name.
-
-	* signal.c (interrupt_init): pass SIGINT always.
-
-	* signal.c (ruby_default_signal): invoke system default signal
-	  handler.
-
-	* signal.c (rb_signal_exec, trap): handle SIGTERM.  [ruby-dev:30505]
-
-Tue Mar  6 19:03:42 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/digest/lib/md5.rb (MD5::new, MD5::md5): Do not modify
-	  Digest::MD5.
-
-	* ext/digest/lib/sha1.rb (SHA1::new, SHA1::sha1): Ditto.
-
-	* lib/shell/process-controller.rb: fix thread synchronization
-	  problem for [ruby-dev:30477].
-
-	* ext/digest/lib/md5.rb (MD5::new, MD5::md5): Catch up with
-	  Digest's API changes; noted by: Kazuhiro Yoshida <moriq AT
-	  moriq.com> in [ruby-dev:30500].
-
-	* ext/digest/lib/sha1.rb (SHA1::new, SHA1::sha1): Ditto.
-
-	* time.c (time_to_s): Back out the format changes; discussed
-	  in [ruby-dev:30495].
-
-	* ext/tk/sample/irbtkw.rbw: fails to exit process.
-
-Mon Mar  5 20:26:10 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* time.c (time_to_s): Correct the wrong format which did not
-	  really conform to RFC 2822; pointed out by: OHARA Shigeki <os at
-	  iij.ad.jp> in [ruby-dev:30487].
-
-Sun Mar  4 23:53:27 2007  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mv): could not move a directory between
-	  different filesystems. [ruby-dev:30411]
-
-Sun Mar  4 23:46:40 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_utime): allow nil to set the current time.
-
-	* lib/fileutils.rb (touch): ditto, and added :mtime and :nocreate
-	  options.  fixed: [ruby-talk:219037]
-
-Sun Mar  4 23:19:00 2007  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* util.c (push_element): should return a int value.
-
-Sun Mar  4 01:06:55 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/set.rb (Set#^, Set#&): Correct documentation.  Those methods
-	  return sets, not arrays; noted by Oliver Frank Wittich <nietz AT
-	  mangabrain.de>.
-
-Sat Mar  3 21:41:31 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* eval.c (stack_check): Unset inline to fix build with GCC 3.4.6;
-	  submitted by: NISHIMATSU Takeshi <t_nissie AT yahoo.co.jp> in
-	  [ruby-list:43218].
-	  cf. http://gcc.gnu.org/bugzilla/show_bug.cgi?id=24556
-
-Sat Mar  3 19:07:05 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/thread.c (push_list): Use ALLOC().
-
-	* ext/thread/thread.c (rb_mutex_alloc): Ditto.
-
-	* ext/thread/thread.c (rb_condvar_alloc): Ditto.
-
-Sat Mar  3 18:56:40 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* NEWS: Add a note for String#intern.
-
-Sat Mar  3 18:36:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_provided): return true only for features loaded from
-	  .rb files, and not search actual library type.  [ruby-dev:30414]
-
-	* eval.c (rb_feature_p): check loading_tbl if the given ext is
-	  empty.  [ruby-dev:30452]
-
-	* eval.c (rb_feature_p): fix possible buffer overrun.
-
-Sat Mar  3 16:30:39 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* env.h (SCOPE_CLONE): Introduce a new scope flag to prevent a
-	  local_tbl region from getting freed many times; submitted by
-	  Chikanaga Tomoyuki <chikanag AT nippon-control-system.co.jp> in
-	  [ruby-dev:30460].
-
-	* eval.c (proc_invoke): Ditto.
-
-	* gc.c (obj_free): Ditto.
-
-	* parse.y (top_local_setup_gen): Ditto.
-
-Sat Mar  3 16:09:27 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* object.c (rb_obj_ivar_set): RDoc updated according to a
-	  suggestion from Brian Candler <B.Candler AT pobox.com>.
-	  [ruby-core:10469]
-
-Sat Mar  3 15:41:33 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt, arg): should not omit lhs of OP_ASGN1 even if
-	  empty.  [ruby-dev:30452]
-
-Thu Mar  1 04:08:30 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/-test-/add_suffix/bug.c: make all functions in util.c static
+	  to get rid of multiple definitions.  reported at
+	  https://trac.macports.org/ticket/33814
 
-	* mkconfig.rb (patchlevel): read from version.h.
+Tue Apr  3 18:34:33 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar  1 03:42:09 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* process.c (setreuid, setregid): suppress warnings.
+	  [ruby-core:43374][Bug #6169]
 
-	* ext/digest/digest.c (get_digest_base_metadata): Allow inheriting
-	  Digest::Base subclasses, which was unintentionally made
-	  impossible while restructuring Digest classes.
+Sat Mar 31 12:11:21 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Feb 28 22:10:55 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/openssl/ossl_x509cert.c: Fix doc typo.
 
-	* doc/NEWS-1.8.0: Rename NEWS to NEWS-1.8.0.  This is way too old
-	  NEWS.
+Fri Mar 30 14:17:17 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* NEWS: Add NEWS, a document file to keep user visible feature
-	  changes between releases.
+	* ext/openssl/ossl_pkcs7.c: fix crash when parsing garbage data.
+	* test/openssl/test_pkcs7.rb: assert correct behavior for it.
+	  Thanks to Matt Venables for reporting the issue.
+	  [ruby-core:43250][Bug #6134]
 
-	* configure.in (ac_cv_func_fcntl): fcntl support for MinGW.
+Fri Mar 30 14:17:17 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* missing/flock.c: workaround for MinGW.
+	* test/openssl/test_x509cert.rb: exclude test that fails when issuing
+	  a certificate with RSA signature and DSS1 digest for earlier
+	  OpenSSL versions when used in conjunction with OpenSSL 1.0.1.
+	  Thanks, Vit Ondruch, for reporting the issue.
+	  [ruby-core:42949][Bug #6089]
 
-	* ext/openssl/extconf.rb: no need to check unistd.h and sys/time.h.
-	  they are already checked at configure.
-	  reported by KOBAYASHI Yasuhiro [ruby-list:43225]
+Fri Mar 30 14:15:40 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb ($DEFLIBPATH): default library paths ($(topdir), etc)
-	  should be the first elements of library paths list.
-	  reported by KOBAYASHI Yasuhiro [ruby-list:43225]
+	* string.c (str_new_empty): should copy also the encoding as an
+	  empty substring.  [ruby-dev:45441][Bug #6206]
 
-	* test/{dbm,gdbm}/test_{dbm,gdbm}.rb: shouldn't use host_os. use
-	  target_os instead. reported by KOBAYASHI Yasuhiro [ruby-list:43225]
+Fri Mar 30 14:14:36 2012  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* mkconfig.rb (RbConfig): add CONFIG['PATCHLEVEL']
+	* ext/date/date_core.c (datetime_s_now): [ruby-core:43256].
 
-	* common.mk: new target dist
+Fri Mar 30 14:12:53 2012  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* distruby.rb: new file
+	* numeric.c: fix flodivmod for cornercases [Bug #6044]
+	  add ruby_float_mod
 
-	* configure.in (--enable-auto-image-base): avoid the neccessity to
-	  rebase the shared libs as much as possible;
-	  submitted by Corinna Vinschen <spam at vinschen.de> in
-	  [ruby-talk:240964].
+	* insns.def (opt_mod): use ruby_float_mod
 
-Wed Feb 28 20:51:32 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* internal.h: declare ruby_float_mod
 
-	* pack.c (pack_unpack): properly ignore non-base64 octets such as
-	  UTF-8 encoded BOMs; submitted by SOUMA Yutaka <holon@radastery.jp>
-	  to fix [ruby-core:10437]
+	* test/ruby/test_float.rb: tests for above
 
-Tue Feb 27 21:50:10 2007  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* test/ruby/envutil.rb: create helper assert_is_minus_zero
 
-	* util.c (__crt0_glob_function): use ruby_glob() instead of rb_globi().
+Wed Mar 28 08:44:24 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* configure.in (ac_cv_func_setrlimit): workaround for djgpp.
+	* ext/psych/lib/psych.rb: updating version to match gem
+	* ext/psych/psych.gemspec: ditto
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fixing deprecation warning
 
-Tue Feb 27 20:49:19 2007  Akinori MUSHA  <knu@iDaemons.org>
+Mon Jul 18 13:36:47 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/base64.rb (Base64::b64encode): Fix documentation; submitted
-	  by David Symonds <dsymonds@gmail.com> in [ruby-core:10432].
+	* ext/psych/lib/psych.rb: define a new BadAlias error class.
 
-	* regex.c (calculate_must_string, slow_search, re_search): Silence
-	  warnings regarding char * vs. unsigned char * mismatch;
-	  submitted by Lyle Johnson <lyle.johnson@gmail.com>
-	  in [ruby-core:10416].
+	* ext/psych/lib/psych/visitors/to_ruby.rb: raise an exception when
+	  deserializing an alias that does not exist.
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_load): Ditto.
+	* test/psych/test_merge_keys.rb: corresponding test.
 
-	* ext/digest/sha1/sha1ossl.c (SHA1_Finish): Ditto.
+Fri Mar  9 06:29:22 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/digest/rmd160/rmd160ossl.c (RMD160_Finish): Ditto.
+	* ext/psych/lib/psych.rb (load, parse): stop parsing or loading after
+	  the first document has been parsed.
 
-	* ext/digest/digest.c (rb_digest_base_finish,
-	  rb_digest_base_update): Ditto.
+	* test/psych/test_stream.rb: pertinent tests.
 
-	* ext/nkf/nkf.c (rb_str_resize, rb_nkf_kconv, rb_nkf_guess1,
-	  rb_nkf_guess2): Ditto.
+Fri Mar  9 06:17:05 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/thread/thread.c (wait_list_cleanup, rb_mutex_try_lock):
-	  Eliminate rb_thread_critical switching where unnecessary;
-	  implied by shugo in [ruby-dev:30412].
+	* ext/psych/lib/psych.rb (parse_stream, load_stream): if a block is
+	  given, documents will be yielded to the block as they are parsed.
+	  [ruby-core:42404] [Bug #5978]
 
-	* ext/thread/thread.c (set_critical): Merge in
-	  thread_exclusive_ensure().
+	* ext/psych/lib/psych/handlers/document_stream.rb: add a handler that
+	  yields documents as they are parsed
 
-	* ext/thread/thread.c: Consistently use 0 and 1 for
-	  rb_thread_critical values.
+	* test/psych/test_stream.rb: corresponding tests.
 
-	* ext/thread/thread.c: Use xmalloc()/xfree() instead of
-	  malloc()/free(); pointed out by shugo in [ruby-dev:30412].
+Tue Mar  6 02:31:20 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::initialize):
-	  Initialize @workdir properly to silence a warning under -w.
-	  Submitted by <tommy at tmtm.org> in [ruby-dev:30400].
+	* ext/psych/lib/psych/core_ext.rb: only extend Kernel if IRB is loaded
+	  in order to stop method pollution.
 
-Sun Feb 25 02:50:51 2007  Akinori MUSHA  <knu@iDaemons.org>
+Tue Feb 28 10:28:51 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* defines.h: Pull the RUBY_MBCHAR_MAXSIZE definition from trunk,
-	  which is necessary for dir.c to compile on djgpp and emx.
+	* ext/psych/lib/psych.rb: default open YAML files with utf8 external
+	  encoding. [ruby-core:42967]
+	* test/psych/test_tainted.rb: ditto
 
-Sat Feb 24 17:04:01 2007   Tadayoshi Funaba  <tadf@dotrb.org>
+Fri Feb 24 13:54:33 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/date/format.rb: updated based on date2 4.0.3.
+	* ext/psych/parser.c: prevent a memory leak by protecting calls to
+	  handler callbacks.
+	* test/psych/test_parser.rb: test to demonstrate leak.
 
-Sat Feb 24 17:01:02 2007  Minero Aoki  <aamine@loveruby.net>
+Fri Feb 24 08:08:38 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/racc/cparse/cparse.c (cparse_params_mark): remove useless
-	  rb_gc_mark.  Thanks Tomoyuki Chikanaga. [ruby-dev:30405]
+	* ext/psych/parser.c: set parser encoding based on the YAML input
+	  rather than user configuration.
+	* test/psych/test_encoding.rb: corresponding tests.
+	* test/psych/test_parser.rb: ditto
+	* test/psych/test_tainted.rb: ditto
 
-Sat Feb 24 16:53:09 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Feb 10 03:41:31 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* signal.c (sighandler): need to tell to be interrupted to main
-	  context when handler is installed.
+	* ext/psych/parser.c: removed external encoding setter, allow parser
+	  to be reused.
+	* ext/psych/lib/psych/parser.rb: added external encoding setter.
+	* test/psych/test_parser.rb: test parser reuse
 
-	* win32/win32.[ch] (rb_win32_interrupted): new function to listen
-	  interrupt.
-
-	* win32/win32.c (set_pioinfo_extra): new function for VC++8 SP1
-	  workaround. [ruby-core:10259]
-
-	* win32/win32.c (NtInitialize): call above function.
-
-Fri Feb 23 13:04:43 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* numeric.c (fix_cmp, fix_equal): Remove FIX2LONG() to optimize.
-	  suggested in
-	  http://t-a-w.blogspot.com/2007/02/making-ruby-faster.html.
-	  [ruby-talk:240223]
-
-Fri Feb 23 12:47:13 2007  James Edward Gray II  <james@grayproductions.net>
-
-	* lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): Make the
-	  Content-Length parameter optional for responses in
-	  xmlrpc/client.rb; suggested by Daniel Berger
-	  <Daniel.Berger@qwest.com> and approved by the maintainer.
-
-	* lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): Add DateTime
-	  support to xmlrpc; approved by the maintainer.
-
-Mon Feb 19 18:33:30 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/socket/socket.c (unix_peeraddr): wrong syscall name in error
-	  message for #peeraddr. a patch from Sam Roberts
-	  <sroberts at uniserve.com>.  [ruby-core:10366]
-
-Mon Feb 19 18:27:42 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* configure.in, defines.h, eval.c (rb_feature_p, rb_provided,
-	  load_wait, search_required, rb_require_safe), ext/extmk.rb: Fix
-	  a bug where a statically linked extension cannot be autoloaded.
-	  [ruby-dev:30023] / [ruby-dev:30239]
-
-Thu Feb 15 20:31:07 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/uri/ftp.rb: Revert the previous change pending discussion.
-
-Fri Feb 16 11:18:21 2007  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/.document: Apply patch for irb, e2mmap and README by Hugh Sasse
-	  <hgs at dmu.ac.uk> from [ruby-core:10135]
-
-	* lib/prettyprint.rb: Suppress RDoc for PrettyPrint test suite.
-
-Thu Feb 15 18:10:09 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* dir.c (glob_helper): Fix the function declaration.
-
-Thu Feb 15 16:55:33 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* version.h: Branch off ruby_1_8_6 from ruby_1_8 in preparation
-	  for the forthcoming 1.8.6 release.
-
-Thu Feb 15 16:44:14 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/uri/generic.rb (URI::Generic::userinfo): Considering how
-	  `scheme://user:@...', `scheme://:password@...' and
-	  `scheme://:@...' are parsed, an empty user name or password
-	  should be allowed and represented as it is.
-
-Thu Feb 15 11:46:05 2007  KIMURA Koichi  <hogemuta@gmail.com>
-
-	* dir.c, win32/win32.c, win32/dir.h, ruby.h, intern.h: Bring
-	  encoding aware globbing support in from trunk.  Dir.[] and
-	  Dir.glob() can now take many patterns in an array.  Minor fixes
-	  will follow.
-
-Thu Feb 15 11:00:26 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/uri/generic.rb (URI::Generic::userinfo): should support
-	  empty password.  [ruby-core:10290]
-
-	* lib/uri/generic.rb (URI::Generic::set_password): password can be
-	  cleared by nil.  [ruby-core:10290]
-
-	* lib/uri/common.rb (escape): regard second string argument as a
-	  character set properly. [ruby-dev:27692]
-
-	* lib/uri/ftp.rb: Attempt to conform to RFC 1738 with regard to
-	  relative/absolute paths.
-
-	* lib/uri: Lovely RDOC patches from mathew (metaATpoboxDOTcom).
-
-Thu Feb 15 10:57:38 2007  Tietew  <tietew@tietew.net>>
-
-	* lib/cgi.rb (CGI::unescapeHTML): invalid decoding for single
-	  unescaped ampersand.  a patch from Tietew
-	  <tietew+ruby-dev at tietew.net> in [ruby-dev:30292].
-	  fixed: [ruby-dev:30289]
-
-Thu Feb 15 10:48:40 2007  MenTaLguY  <mental@rydia.net>
-
-	* ext/thread/thread.c: Handle interrupted waits correctly.
-	  [ruby-bugs:PR#8663]
-
-Wed Feb 14 19:22:15 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/digest/lib/digest.rb (Digest::self.const_missing): Drop
-	  autoloads for sha2 classes in favor of handling in
-	  const_missing(), to work around a problem exposed on OS X.
-
-Tue Feb 13 02:21:12 2007  Sam Roberts  <sroberts@uniserve.com>
-
-	* io.c (rb_f_syscall): Fix buffer overflow with syscall
-	  arguments.  [ruby-bugs:PR#8541]
-
-Sun Feb 11 07:46:45 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): Properly parse
-	  a quoted-string in a Content-Disposition value.
-
-Sun Feb 11 06:27:54 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* configure.in, ext/thread/extconf.rb, lib/thread.rb: Add a
-	  configure option `--disable-fastthread', to choose the original,
-	  pure ruby version of the "thread" library instead of the new,
-	  much faster implementation in ext/thread.
-
-Sun Feb 11 06:22:20 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/Setup: Add thread except for platforms without threads
-	  support.
-
-Sun Feb 11 06:15:16 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/lib/thread.rb: Add a replacement of thread.rb that
-	  loads this extension.
-
-Sun Feb 11 05:39:47 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/thread.rb: Remove an ineffective part of the code.
-
-Sun Feb 11 05:32:54 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/thread.c (rb_thread_exclusive): Implement
-	  Thread.exclusive.
-
-Sun Feb 11 05:26:51 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread/thread.c: Get rid of use of a dummy function.
-
-Sun Feb 11 01:45:31 2007  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/thread/thread.c (Init_thread): Define missing aliases:
-	  Queue#enq and SizedQueue#enq.
-
-Sat Feb 10 09:27:35 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_variant2val): fix compile error
-	  on VC++.
-
-Sat Feb 10 07:41:52 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_variant2val): fix the bug when
-	  SAFEARRAY pointer is NULL.
-
-Sat Feb 10 00:13:11 2007  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: fix typo (TkConfigMethod::__confinfo_cmd,
-	  __conv_keyonly_opts).
-
-Fri Feb  9 20:44:53 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/thread: Make style fixes (mostly de-K&R'ism) to match the
-	  rest of the source code.
-
-	* ext/thread: Make USE_MEM_POOLS an extconf option.
-
-Fri Feb  9 20:43:01 2007  Akinori MUSHA  <knu@iDaemons.org>
+Wed Jan 18 12:49:15 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/thread: Import the "fastthread" implementation by MenTaLguY
-	  in the original form.  This module is not hooked into the build
-	  yet since it needs some style fixes and adjustments.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Added support for loading
+	  subclasses of String with ivars
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Added support for dumping
+	  subclasses of String with ivars
+	* test/psych/test_string.rb: corresponding tests
 
-Fri Feb  9 15:46:09 2007  Akinori MUSHA  <knu@iDaemons.org>
+Wed Jan 18 10:39:47 2012  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/bigdecimal: Synchronize with trunk.  Better function
-	  prototypes, removal of a useless method `!=', and document
-	  updates.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Added ability to load array
+	  subclasses with ivars.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Added ability to dump
+	  array subclasses with ivars.
+	* test/psych/test_array.rb: corresponding tests
 
-Tue Feb 06 22:06:45 2007  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Dec 21 02:25:36 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-        * ext/nkf/nkf-utf8/{nkf.c,utf8tbl.c}:
-          imported nkf 2007-01-28.
-          * Fixed: can't decode MIME encode JIS string.
-          * Fixed: Fullwitdh-halfwidth conversion.
-          * Support DoCoMo's and Softbank's EMOJI
-          * Support CP932, CP5022x, eucJP-ms UDC
-          * Support UTF-32 encoding
-          * Support beyond BMP
-          [ruby-dev:29700] [ruby-dev:29922] [ruby-dev:30144]
+	* ext/psych/emitter.c: fixing clang warnings. Thanks Joey!
 
-Wed Jan 31 14:52:09 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Dec 18 12:42:48 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* eval.c (rb_iterate): need to PUSH_ITER in proper order.
-	  [ruby-core:10125]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: BigDecimals can be restored
+	  from YAML.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: BigDecimals can be dumped
+	  to YAML.
+	* test/psych/test_numeric.rb: tests for BigDecimal serialization
 
-	* test/ruby/test_iterator.rb (TestIterator::test_block_given_within_iterator):
-	  add new test.  [ruby-core:10125]
+Sun Dec 18 12:03:13 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Jan 30 14:58:51 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/psych/lib/psych/scalar_scanner.rb: Strings that look like dates
+	  should be treated as strings and not dates.
 
-	* string.c (rb_str_sub_bang): calling rb_str_modify() should be just
-	  before actually modifying the string.
-	  fixed: [ruby-dev:30211] (originally reported by zunda)
+	* test/psych/test_scalar_scanner.rb: corresponding tests.
 
-Tue Jan 30 12:05:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec  7 08:04:31 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* mkconfig.rb: autoconf 2.61 support.  [ruby-core:10016]
+	* ext/psych/lib/psych.rb (module Psych): parse and load methods take
+	  an optional file name that is used when raising Psych::SyntaxError
+	  exceptions
+	* ext/psych/lib/psych/syntax_error.rb (module Psych): allow nil file
+	  names and handle nil file names in the exception message
+	* test/psych/test_exception.rb (module Psych): Tests for changes.
 
-Sat Jan 27 15:20:11 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Nov 30 09:09:37 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* parse.y (dyna_var_lookup): should not alter dvar->val not to
-	  destroy living value.  [ruby-core:10076]
+	* ext/psych/parser.c (parse): parse method can take an option file
+	  name for use in exception messages.
+	* test/psych/test_parser.rb: corresponding tests.
 
-	* parse.y (dyna_init): ditto.
+Tue Nov 22 04:46:22 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Jan 26 12:03:39 2007  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/psych/lib/psych.rb: remove autoload from psych
+	* ext/psych/lib/psych/json.rb: ditto
 
-	* ext/tk/lib/tk.rb (TkConfigMethod#__confinfo_cmd,
-	  __conv_keyonly_optkeys): make them private [ruby-dev:30074].
+Wed Nov  9 04:52:16 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk/txtwin_abst.rb: fix typo [ruby-dev:30073].
+	* ext/psych/lib/psych/tree_builder.rb: dump complex numbers,
+	  rationals, etc with reference ids.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
+	* ext/psych/lib/psych/visitors/to_ruby.rb: loading complex numbers,
+	  rationals, etc with reference ids.
+	* test/psych/test_object_references.rb: corresponding tests
 
-	* ext/tk/lib/tk/canvas.rb (TkCanvas#scan_dragto): lack of an argument.
+Mon Nov  7 20:31:52 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk/canvas.rb: clarify the including module name
-	  [ruby-dev:30080].
+	* ext/psych/lib/psych/scalar_scanner.rb: make sure strings that look
+	  like base 60 numbers are serialized as quoted strings.
+	* test/psych/test_string.rb: test for change.
 
-	* ext/tk/lib/tk/scrollable.rb: change primary name of modules
-	  [ruby-dev:30080].
+Thu Oct 27 08:47:38 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Jan 24 18:05:39 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/psych/parser.c: remove unused variable.
 
-	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): fix
-	  regexp font-lock bug.  [ruby-talk:235758]
+Wed Oct  5 02:50:27 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Jan 23 11:02:33 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
- 	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest::read_line):
-
-Tue Jan 23 18:26:12 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): use == instead
-	  of ===.  [ruby-dev:30176]
-
-Tue Jan 23 10:48:17 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c: added documentation for Hash about how it uses eql? and
-	  hash methods for the keys.  [ruby-core:09995]
-
-Mon Jan 22 14:57:25 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c: fix errors in socket sample code.
-	  [ruby-core:09992]
-
-Sat Jan 13 23:54:48 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_free, ole_type_free,
-	  olemethod_free, olevariable_free, oleparam_free,
-	  ole_event_free): fix memory leak.  [ruby-core:09846]
-
-Fri Jan 12 11:13:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/etc/etc.c (etc_getpwuid, etc_getgrgid): fix to correctly
-	  convert uid/gid from VALUE. (backport of r11521)
-
-Wed Jan 10 18:57:57 2007  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c (strscan_do_scan): should set kcode option
-	  before match. [ruby-dev:29914]
-
-	* test/strscan/test_stringscanner.rb: test it.
-
-	* re.c: export kcode_set_option and kcode_reset_option (with "rb_"
-	  prefix).
-
-	* intern.h: ditto.
-
-Tue Jan  9 17:45:17 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (rb_find_file): should not call fpath_check() with NULL.
-	  fixed: [ruby-core:09867]
-
-Tue Jan  9 03:54:38 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_upto): String#upto from empty string makes
-	  inifinite loop.  [ruby-core:09864]
-
-Sun Jan  7 12:13:26 2007  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment):
-	  Look for class and module comments above rb_define_class and
-	  rb_define_module.  Patch by Daniel Berger <djberg96 at gmail.com>
-
-Sun Jan  7 10:32:12 2007  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#handle_constants):
-	  Properly handle escaping of : in comments.
-	* test/rdoc/parsers/test_parse_c.rb:
-	  Test RDoc::C_Parser#do_classes and Rdoc::C_Parser#find_class_comment.
-
-Sun Jan  7 09:33:02 2007  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date/format.rb: updated based on date2 4.0.1.
-
-Wed Jan  3 11:36:51 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (ruby_dup): start GC on ENOMEM as well.
-
-Mon Jan  1 06:13:11 2007  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/c_parser.rb: Make Rdoc accessible.  Update constant
-	  value information.
-
-Mon Jan  1 06:13:11 2007  Eric Hodel  <drbrain@segment7.net>
-
-	* ext/bigdecimal/bigdecimal.c: Update constant comments to provide
-	  values for RDoc.
-
-Mon Jan  1 06:05:55 2007  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#handle_constansts):
-	  Allow RDoc comment to give friendly value for rb_define_const.  Patch
-	  by Daniel Berger <djberg96 at gmail.com>, [ruby-patches-7499].
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#handle_constansts): Fix
-	  whitespace handling in constant comments.
-
-Sun Dec 31 00:31:16 2006  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date.rb, lib/date/format.rb: updated based on date2 4.0.
-
-Thu Dec 14 18:29:13 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/readline/readline.c: NetBSD editline does not have
-	  rl_username_completion_function() and rl_completion_matches().
-	  a patch from Takahiro Kambe <taca at back-street.net>.
-	  [ruby-dev:30008]
-
-Thu Dec 14 18:20:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/locale.rb (IRB::Locale::puts): typo fixed.  a patch from
-	  NAKAMURA Usaku <usa@ruby-lang.org>.  [ruby-dev:30012]
-
-Mon Dec 11 11:58:36 2006  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/digest/sha2/lib/sha2.rb: Moved one level up from under
-	  the superfluous subdirectory digest/.
-
-Mon Dec 11 11:46:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_define_const): typo fixed.
-
-Mon Dec 11 09:36:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_aset): index double decode problem.
-	  [ruby-core:09695]
-
-Sat Dec  9 21:39:24 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): keep the exception till after END blocks.
-	  [ruby-core:09675]
-
-Sat Dec  9 11:22:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/psych/lib/psych/syntax_error.rb: Add file, line, offset, and
+	  message attributes during parse failure.
+	* ext/psych/parser.c: Update parser to raise exception with correct
+	  values.
+	* test/psych/test_exception.rb: corresponding tests.
 
-	* lib/irb/locale.rb (IRB::Locale::search_file): ues File.exist?
-	  instead of File.exists?.  a patch from Yutaka Kanemoto
-	  <kinpoco at gmail.com> in [ruby-dev:30000].
+Wed Oct  5 01:52:16 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Dec  7 09:29:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/psych/parser.c (parse): Use context_mark for indicating error
+	  line and column.
 
-	* lib/weakref.rb (WeakRef::__setobj__): should support
-	  marshaling.  [ruby-talk:228508]
+Wed Oct  5 01:22:08 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/delegate.rb (Delegator::marshal_load): need to call
-	  __setobj__.
+	* ext/psych/lib/psych/scalar_scanner.rb: use normal begin / rescue
+	  since postfix rescue cannot receive the exception class. Thanks
+	  nagachika!
 
-Wed Dec  6 23:56:14 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 27 22:22:50 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Makefile.in, common.mk (NULLCMD): moved for platforms that empty
-	  command does not run.  fixed: [ruby-dev:29994]
+	* configure.in (RUBY_STACK_GROW_DIRECTION): substitute CPU name as
+	  shell variable name.  based on the patch by The Written Word Inc. at
+	  [ruby-core:40421].  [Bug #5488]
 
-Wed Dec  6 17:17:26 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+Mon Mar 26 09:57:12 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* configure.in (SITE_DIR): fixed to emtpy RUBY_SITE_LIB in config.h on
-	  NetBSD.  fixed: [ruby-dev:29358]
+	* parse.y (parser_nextc): set encoding for the buffer of ripper.
 
-Tue Dec  5 00:59:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Mar 18 13:23:28 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-parse-partial): need to parse "/=" as
-	  self assignment operator, not regex.  [ruby-talk:227324]
+	* encoding.c (rb_enc_compatible): return ASCII-8BIT even if 2nd string
+	  is ascii only string. [ruby-core:42354] [Bug #5968]
 
-Mon Dec  4 10:48:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar  6 18:55:37 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h (OFFT2NUM): use LONG2NUM() if sizeof(long) equals to
-	  sizeof(off_t).
+	* lib/test/unit/assertions.rb (assert_send, assert_not_send):
+	  parenthesize non-empty arguments.
 
-Mon Dec  4 10:43:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar  6 18:55:37 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (dyna_init_gen): dvar initialization only if dvar is
-	  assigned inner block.  [ruby-talk:227402]
+	* lib/test/unit/assertions.rb (assert_send): make arguments in
+	  the default message clearer.
 
-Mon Dec  4 08:32:49 2006  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Mar  6 12:48:08 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): should quote
-	  boundary. JVN#84798830
+	* ext/io/console/console.c (set_rawmode): clear ECHOE and ECHOK
+	  bits too.
 
-Sat Dec  2 07:09:04 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/io/console/console.c (echo_p): ignore ECHOE and ECHOK bits.
+	  [ruby-dev:45309] [Bug #6116]
 
-	* ext/openssl/ossl_ocsp.c: OpenSSL::OCSP::OSCPError should be
-	  subclass of OpenSSL::OpenSSLError. [ruby-dev:29980]
+	* ext/io/console/console.c (console_raw): fix rdoc.
 
-Fri Dec  1 17:01:49 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/io/console/console.c (console_set_echo): mentioned about
+	  platform dependency.
 
-	* gc.c (ruby_init_stack): decrease "stack level too deep" in Windows.
-	  merge from trunk.
+Tue Mar  6 12:40:08 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec  1 16:31:53 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/io/console/console.c (console_raw, console_set_raw)
+	  (console_getch): optional parameters.  [EXPERIMENTAL]
 
-	* ext/tk/tcltklib.c: shouldn't run the killed thread at callback.
-	  [ruby-talk: 227408]
+Tue Mar  6 12:39:27 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov 27 17:18:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/io/console/console.c (console_cooked, console_set_cooked):
+	  new methods to reset cooked mode.  [EXPERIMENTAL]
 
-	* sprintf.c (rb_f_sprintf): need not to truncate string if no
-	  width specifier given for %s.  [ruby-dev:29952]
+Tue Mar  6 12:31:47 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Nov 26 16:36:46 2006  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* ext/io/console/console.c (io_getch): default delegating method
+	  for StringIO.  https://github.com/nobu/io-console/issues/4
 
-	* version.h: addition of RUBY_PATCHLEVEL.
-	* version.c: ditto.
+	* ext/stringio/stringio.c: moved some methods to hidden modules.
 
-Fri Nov 24 10:17:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar  6 12:29:34 2012  Eric Hodel  <drbrain@segment7.net>
 
-	* bignum.c (bignorm): avoid segmentation.  a patch from Hiroyuki
-	  Ito <ZXB01226@nifty.com>.  [ruby-list:43012]
+	* io.c (Init_IO):  Mention io/console methods.  [Ruby 1.9 - Bug #5602]
+	* ext/io/console/console.c:  Mention that io/console must be required
+	  similar to lib/time.rb
 
-Thu Nov 23 10:38:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar  6 11:42:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_mod_define_method): set implicit visibility only when
-	  it's called for the target class (ruby_cbase).
+	* ext/syck/lib/syck/rubytypes.rb (Exception.yaml_new): fix bug
+	  that causes YAML serialization problem for Exception.
+	  Exception#initialize doesn't use visible instance variable for
+	  the exception message, so call the method with the message.
+	  patched by Jingwen Owen Ou <jingweno AT gmail.com>.
+	  http://github.com/ruby/ruby/pull/41
 
-Wed Nov 22 16:00:49 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Mar  2 22:09:03 2012  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* ext/tk/extconf.rb: support --with-X11/--without-X11 option.
+	* .travis.yml: Backport TravisCI configuration from trunk.
 
-	* ext/tk/README.tcltklib: add description about --with-X11-* option
-	  [ruby-talk:225166] and --with-X11/--without-X11 option.
+Thu Mar  1 18:39:44 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/tkutil/extconf.rb: able to be called manually
-	  [ruby-talk:225950].
+	* file.c (rb_file_join): honor input encodings than ASCII-8BIT.
+	  [ruby-core:40338] [Bug #5483]
 
-Wed Nov 15 23:22:54 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 28 11:56:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (test_grpowned, rb_stat_grpowned): should honor
-	  supplementary group IDs.  [ruby-core:09546]
+	* configure.in (debugflags): check if -ggdb is accepted.
+	  [ruby-core:42875][Bug #6080]
 
-Thu Nov  9 03:15:22 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Feb 27 17:25:40 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (BEGIN_CALLARGS): ruby_block may be NULL even when
-	  ITER_PRE.
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): since methods
+	  can be overridden, so should not make an assumption on the type
+	  of results.  [ruby-core:42969][Bug #6093]
 
-Tue Nov  7 18:34:34 2006  Akinori MUSHA  <knu@iDaemons.org>
+Mon Feb 27 02:28:17 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/digest/lib/digest/hmac.rb: Keep this out of the 1.8 tree
-	  until we reach a consensus that HMAC should be put under Digest.
+	* regparse.c (add_code_range_to_buf0): wrong condition of duplicated
+	  warnings.
 
-Tue Nov  7 18:05:01 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Feb 26 12:26:26 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/itemconfig.rb: minor bug fix.
+	* compile.c (iseq_compile_each): call on special object instead of
+	  self.  since stabby lambda is a syntax, so it should not be
+	  affected by the context.  [ruby-core:42349][Bug #5966]
 
-Mon Nov  6 20:11:20 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* insns.def (send): no special deal for FCALL.  self should be put
+	  on TOS instead.
 
-	* lib/rss/0.9.rb (RSS::Rss): removed needless include.
+Sat Feb 25 23:47:49 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov  6 15:41:55 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* file.c (utime_internal): fix a variable missed to replace.
+	  [ruby-core:42864] [Bug #6077]
 
-	* ext/tk/lib/tk/itemconfig.rb: ext/tk/lib/tk/itemconfig.rb: bug
-	  fix on 'itemconfiginfo' method, and modify to make it easy to
-	  override 'itemconfiginfo' method.
+Sat Feb 25 21:29:09 2012  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/tile/treeview.rb : support Tile 0.7.8.
+	* test/ruby/test_literal.rb (TestRubyLiteral#test_special_const):
+	  test for https://bugs.php.net/bug.php?id=61095
 
-	* ext/tk/lib/tkextlib/version.rb : [new] add Tk::Tkextlib_RELEASE_DATE
-	  to get the information from scripts.
+Sat Feb 25 21:29:09 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: load 'tkextlib/version.rb', and update RELEASE_DATE
+	* dir.c, file.c, io.c (rb_sys_fail_path): use rb_sys_fail_str.
 
-	* ext/tk/lib/tkextlib/SUPPORT_STATUS: update.
+	* error.c: new functions to deal exceptions with string instances.
 
-	* ext/tk/sample/editable_listbox.rb: [new] the listbox with editable
-	  items. It's one of the example about usage of Place geometry manager.
+	* dir.c, file.c, io.c: use rb_sys_fail_path.
 
-	* ext/tk/sample/tktextio.rb: improve the functions of TkTextIO class.
-	  Those are required by 'irbtkw.rbw'.
+Sat Feb 25 21:18:12 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/irbtkw.rbw: [new] IRB on Ruby/Tk. It doesn't need any
-	  real console. IRB works on a text widget without I/O blocking. That
-	  is, thread switching on IRB will work properly, even if on Windows.
+	* dir.c (dir_inspect), io.c (rb_io_inspect): keep encoding of path.
+	  [Bug #6072]
 
-Sun Nov  5 19:53:49 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Sat Feb 25 21:18:12 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/date.rb: updated based on date2 3.9.7.
+	* dir.c (dir_initialize): keep path in original encoding.
 
-Sat Nov  4 13:13:57 2006  Shugo Maeda  <shugo@ruby-lang.org>
+	* error.c (syserr_initialize): prefer the encoding of message over
+	  locale.  [ruby-dev:45279][Bug #6071]
 
-	* lib/net/imap.rb: accept NOMODSEQ. [ruby-core:9002]
-	  (backported from HEAD)
+Sat Feb 25 17:10:51 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Nov  3 00:16:37 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/fileutils.rb: use chomp(?/) instead of sub to optimize and avoid
+	  to regexping invalid string.
 
-	* ext/socket/socket.c (ruby_getnameinfo__aix): AF_INET6 workaround
-	  for AIX.  a patch from Yutaka Kanemoto <kinpoco AT gmail.com>.
-	  [ruby-dev:29744]
+Sat Feb 25 16:39:13 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Nov  2 15:43:39 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* complex.c (nucomp_marshal_load): raise error on invalid data.
+	  reported by John Firebaugh [ruby-core:42860] [Bug #6076]
 
-	* parse.y (primary): should set NODE even when compstmt is NULL.
-	  merge from trunk. fixed: [ruby-dev:29732]
+Fri Feb 24 23:49:05 2012  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Thu Nov  2 14:48:30 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/ostruct.rb (delete_field): Bug fix so previous value is
+	  returned. Patch by Nick Recobra [Bug #6063]
 
-	* lib/set.rb (Set#^): Fix XOR operation against a container that
-	  holds duplicate values. [issue: #6444]
+Fri Feb 24 08:53:28 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov  1 02:41:38 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* parse.y (parser_tokadd_string, parser_yylex): insert a backslash
+	  if the next character is non-ascii.  [ruby-dev:45278] [Bug #6069]
 
-	* ext/digest/lib/digest/hmac.rb (Digest::HMAC::update): Minor
-	  optimization.
+Thu Feb 23 14:44:36 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/digest/digest.c (rb_digest_instance_equal): Allow comparing
-	  a digest instance with another of a different class.
+	* lib/uri/common.rb (URI::Parser#initialize_regexp):
+	  use \A \z instead of ^ $. [Bug #5843]
 
-Wed Nov  1 01:05:13 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Feb 23 08:08:23 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_call0): fixed bug of zsuper with both of opt and rest.
-	  fixed: [ruby-list:42928]
+	* win32/win32.c (rb_w32_uchmod): typo.  [Bug#5671] [ruby-dev:44898]
 
-	* test/ruby/test_super.rb: add tests to check above bug.
+	* test/ruby/test_file.rb (TestFile#test_chmod_m17n): test of above bug.
 
-Tue Oct 31 17:03:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb 22 23:27:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* time.c (time_dup): duplicate the class of original time.
-	  [ruby-core:09357]
+	* test/iconv/test_option.rb: enabled.  [ruby-core:42802][Bug #6061]
 
-	* lib/time.rb (Time::make_time, Time::rfc2822, Time::httpdate):
-	  should respect subclasses.  [ruby-core:09357]
+Wed Feb 22 22:04:15 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 30 23:40:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_s_foreach): argument check before making Enumerator.
+	  [ruby-dev:31525]
 
-	* Makefile.in (miniruby): add XLDFLAGS.
+Wed Feb 22 22:04:15 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (aix): use -bE option for miniruby.  [ruby-dev:29698]
+	* io.c (rb_io_s_foreach): return enumerator including kerword
+	  arguments.  [ruby-dev:45267][Bug #6054]
 
-	* dir.c (glob_helper): get rid of possible memory leak.
+Wed Feb 22 21:42:16 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* win32/win32.c (cmdglob, rb_w32_cmdvector, rb_w32_opendir,
-	  rb_w32_get_environ): not to use GC before initialization.
+	* configure.in: remove workaround replacement from gcc to gcc-4.2.
+	  [Backport #6043]
 
-Mon Oct 30 19:29:20 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Feb 22 08:11:06 2012  Narihiro Nakamura  <authornari@gmail.com>
 
-	* bignum.c (rb_big2str0): use better approximation.
+	* gc.c : remove gc_clear_mark_on_sweep_slots() and use
+	  rest_sweep() instead of it, because some dead objects might be
+	  marked in next the mark phase by false pointers.
+	  [ruby-core:42672]
 
-Mon Oct 30 18:35:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 19 12:27:24 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (rb_big2str0): wrong allocation length.  a patch from
-	  U.Nakamura <usa at garbagecollect.jp> [ruby-dev:29710]
+	* configure.in: ignore all warnings from an arbitrary
+	  header in /usr/local/include.
 
-Mon Oct 30 12:34:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 17 12:51:25 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_eval): fix commit miss.  [ruby-dev:29707]
+	* lib/mkmf.rb (create_header): log the content of header.
 
-Mon Oct 30 12:20:58 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 17 12:26:15 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* bignum.c (rb_big2str0): a bug in length adjustment.
+	* test/readline/test_readline.rb (test_completion_proc_empty_result):
+	  ensure clearance of Readline's line_buffer after the test.
 
-Mon Oct 30 11:15:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 17 11:46:39 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sprintf.c (rb_str_format): should preserve leading zero
-	  information for negative %b and %x.  [ruby-talk:221347]
+	* test/readline/test_readline.rb (test_line_buffer__point): use
+	  lambda not to exit entire method by "return".  or "next" for
+	  proc.  [ruby-dev:45042] [Bug #5802]
 
-Thu Oct 26 21:05:58 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Feb 17 10:15:54 2012  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_verify): should clear error.
-	  (fix http://bugs.debian.org/394336)
+	* ext/dbm/extconf.rb: check _DB_H_ macro unavailable except
+	  Berkeley DB library.
 
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): ditto.
+Fri Feb 17 10:14:47 2012  Tanaka Akira  <akr@fsij.org>
 
-Thu Oct 26 15:21:10 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/dbm/test_dbm.rb: fix skip condition for libgdbm 1.8.0 or prior.
+	  reported by Bohuslav Kabrda.
+	  [ruby-core:42685] [ruby-trunk - Bug #6036]
 
-	* ext/digest/digest.c (Init_digest): typo.
+Fri Feb 17 09:53:46 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Oct 25 17:23:28 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* tool/transcode-tblgen.rb (import_ucm): don't use \h because the
+	  script should work with ruby 1.8.
 
-	* ext/digest, test/digest/test_digest.rb: Merge from trunk:
-	  - Introduce versioning in Digest::Base API, and prefix C
-	    constants with RUBY_ and C type names with rb_ to avoid name
-	    clash in writing extensions.
-	  - Introduce Digest::Class and Digest::Instance for ease of
-	    implementing subclasses and add-ons.
-	  - Digest::Instance module requires and assumes that any instance
-	    be resettable and clonable.  An instance method #new() is
-	    added so digest instances work just like digest classes.
-	  - The constructor does no longer take an initial string to feed;
-	    digest() and hexdigest() now do, instead.  This allows digest
-	    classes to take their own hashing parameters.
-	  - Make some changes to digest() and hexdigest() class methods,
-	    which now take extra arguments, which are passed through to
-	    the constructor in an internal call.
-	  - Add #digest_length/size/length() and #block_length(),
-	  - Add the Digest::SHA2 class to wrap up SHA2 variants: SHA256,
-	    SHA384 and SHA512, hoping this module would make a decent
-	    example of a digest subclass written in Ruby.
-	  - Rip BubbleBabble support out of the base class and have a
-	    separate module named digest/bubblebabble.
-	  - Remove RD documents in favor of newly written and embedded
-	    RDoc documentation.
+	* tool/enc-unicode.rb: ditto.
 
-Wed Oct 25 08:03:23 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Thu Feb 16 17:54:14 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/date/format.rb: updated based on date2 3.9.6.
-	  [ruby-core:09323]
+	* ext/dbm/extconf.rb: merge trunk's ext/dbm/extconf.rb and
+	  related functions of lib/mkmf.rb. [Backport #6021]
 
-Sun Oct 22 14:48:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Feb 16 09:25:52 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* signal.c (ruby_signal): don't set SA_RESTART.  a backport from
-	  the HEAD.  [ruby-talk:220937]  [ruby-talk:147220]
+	* configure.in (enable_pthread): use -pthread on OpenBSD without
+	  explicit option. patched by Jeremy Evans. [ruby-core:38572]
 
-	* signal.c (Init_signal): avoid duplicated installation of SIGCHLD
-	  handler.
+Thu Feb 16 07:34:34 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Sun Oct 22 16:47:56 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* cont.c (rb_fiber_reset_root_local_storage): add a new function to
+	  restore rb_thread_t::local_storage.
 
-	* string.c (rb_str_substr): should be infected with only original
-	  string, but not the shared string.  fixed: [ruby-core:09152]
+	* cont.c (rb_obj_is_fiber): add a new function to tell finalizer to
+	  prevent fibers from destroy.
 
-	* string.c (rb_str_new4): keep shared string untainted when orignal
-	  string is tainted.  fixed: [ruby-dev:29672]
+	* gc.c (rb_objspace_call_finalizer): don't sweep fibers at finalizing
+	  objspace.
 
-Sun Oct 22 05:20:34 2006  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* internal.h (rb_fiber_reset_root_local_storage, rb_obj_is_fiber):
+	  add prototypes.
 
-	* configure.in: alloca is broken; use C_ALLOCA instead.
-	  [ruby-dev:29416]
+	* vm.c (ruby_vm_destruct): reset main thread's local_storage before
+	  free main thread. rb_thread_t::local_storage is replaced by fiber's
+	  local storage when forked from fiber, and it should be already freed
+	  when the fiber was destroyed. [ruby-core:41456] [Bug #5700]
 
-Fri Oct 20 10:47:43 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_fiber.rb (test_fork_from_fiber): add test for fork
+	  from fiber.
 
-	* lib/mkmf.rb: fixed the bug of handling COMMON_MACROS.
+Thu Feb 16 06:30:37 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 20 08:42:38 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/fiddle/closure.c (callback): deal with unsinged integers.
+	  [ruby-core:42458][Bug #5991][Bug #6022]
 
-	* common.mk (NULLCMD): dummy command.
+	* ext/fiddle/conversions.c (value_to_generic, generic_to_value):
+	  ditto.
 
-	* bcc32/Makefile.sub (post-install-*): Borland make cannot ignore
-	  command-less double-colon rules.  [ruby-dev:29676]
+	* ext/fiddle/closure.c (callback): same as r34506.
 
-Fri Oct 20 00:37:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb 15 10:35:43 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bcc32/Makefile.sub ($(LIBRUBY_SO)): execute pre-link hook.
+	* include/ruby/ruby.h (FIXNUM_P): simple flag should be int.
 
-	* ext/extmk.rb: workaround for Borland make.
+Wed Feb 15 10:33:41 2012  Eric Hodel  <drbrain@segment7.net>
 
-Wed Oct 18 23:02:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_eval.c (check_funcall):  Call respond_to? with matching arity for
+	  legacy single-argument implementations.  [ruby-trunk - Bug #6000]
 
-	* array.c (rb_ary_shift): shorten copy size.  fixed: [ruby-list:42907]
+Wed Feb 15 10:25:22 2012  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* signal.c (Init_signal): handle SIGTERM.  fixed: [ruby-list:42895]
+	* vm_eval.c (check_funcall): set array elements one-by-one to fix
+	  compile error with Fujitsu C Compiler 5.6 on Solaris 10 on Sparc.
 
-	* win32/win32.c (rb_w32_utime): allow NULL to set the current time.
-	  [ruby-talk:219248]
+Wed Feb 15 10:25:22 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 18 00:55:33 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_object.rb: tests that respond_to? returns false.
 
-	* parse.y (parser_yylex): use particular enums.  [ruby-core:09221]
+Wed Feb 15 10:25:22 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 16 08:30:43 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_eval.c (check_funcall): try respond_to? first if redefined.
+	  [Bug #5158]
 
-	* mkconfig.rb: *OBJS are not needed for extension libraries.
+Wed Feb 15 07:15:50 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* {bcc32,wince,win32}/Makefile.sub (config.status): fixed typo,
-	  missing comma.
+	* compile.c (defined_expr): guard the whole expression.
+	  [ruby-dev:45021][Bug#5786]
 
-Sun Oct 15 01:03:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb 15 05:08:25 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect): append base
-	  directory but not prepend.
+	* ext/dl/cptr.c (rb_dlptr_s_to_ptr): use rb_check_funcall.
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect_file): do not
-	  join with dot.  fixed: [ruby-core:09179]
+	* ext/dl/cfunc.c (dlcfunc_mark), ext/dl/cptr.c (dlptr_mark):
+	  workaround to mark wrapped object.  this is not a true fix,
+	  because [Bug #4929] is caused by the interface design of DL.
 
-Sat Oct 14 23:39:50 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb 15 05:04:47 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (singleton): no need to re-create NODE_SELF() again.
-	  [ruby-core:09177]
+	* ext/dl/cptr.c (rb_dlptr_aref, rb_dlptr_aset): check NULL pointer
+	  dereference.
 
-Sat Oct 14 23:25:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rinda/test_rinda.rb: decrease the code that depends on timing.
+	  [Bug #372] [Bug #4160]
 
-	* parse.y (parser_warning, parser_warn): some error message may
-	  contain format specifiers.  a patch from Akinori MUSHA <knu at
-	  iDaemons.org>.  [ruby-dev:29657]
+Wed Feb 15 05:03:41 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/bigdecimal/bigdecimal.c (VpException): ditto.
+	* test/rinda/test_rinda.rb (test_remote_array_and_hash):
+	  add local variables to protect objects from GC. [ruby-dev:44253]
+	  [Bug #5104]
 
-	* ext/dl/handle.c (rb_dlhandle_initialize): ditto.
+Wed Feb 15 05:02:43 2012  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* ext/gdbm/gdbm.c (rb_gdbm_fatal): ditto.
+	* test/win32ole/test_err_in_callback.rb (test_err_in_callback): 
+	  skip test if ADODB.connection is not available.
 
-Sat Oct 14 08:24:45 2006  Akinori MUSHA  <knu@iDaemons.org>
+Wed Feb 15 04:49:23 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* ext/digest/lib/digest/hmac: Back out the addition of digest/hmac
-	  for now because the API is too premature for a stable branch.
+	* parse.y (debug_lines, coverage): set file path encoding for coverage
+	  result.  [ruby-dev:44950]
 
-Sat Oct 14 00:55:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 14 16:57:11 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* bcc32/Makefile.sub (post-install-ext): no longer needed.
+	* lib/rake/file_list.rb (Rake::FileList#egrep): there is no need to
+	  open files in binary mode.
+	  see more details in https://github.com/jimweirich/rake/issues/74
 
-	* bcc32/configure.bat: get rid of a quirk of Borland make, which
-	  sets empty macro in command line to "1".
+Tue Feb 14 16:52:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Oct 13 22:50:43 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* lib/rdoc/encoding.rb (RDoc::Encoding.read_file): fixup newline chars
+	  on Windows.
+	  see https://github.com/rdoc/rdoc/issues/87
 
-	* lib/date.rb: updated based on date2 3.9.5.
+	* test/rdoc/test_rdoc_markup_pre_process.rb
+	  (TestRDocMarkupPreProcess#test_include_file, 
+	  TestRDocMarkupPreProcess#test_include_file_encoding_incompatible):
+	  follow above change.
 
-Fri Oct 13 22:33:28 2006  Minero Aoki  <aamine@loveruby.net>
+Tue Feb 14 16:34:11 2012  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/fileutils.rb (FileUtils.cp_r): dereference_root=true is
-	  default in Ruby 1.8.  This line is wrongly removed in last commit.
+	* test/rubygems/test_gem_commands_help_command.rb: Add one
+	  `require` because if run test-all with test/unit parallel
+	  running, sometimes this test fails by some constants not found.
+	  The error reason is some worker doesn't require the file needed by
+	  this test. This issue is related to [ruby-core:36168].
 
-Fri Oct 13 18:19:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Feb 14 15:58:31 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c: Class#inherited RDoc added.  a patch from Daniel
-	  Berger <djberg96 at gmail.com>  [ruby-core:08942]
+	* gc.c (initial_params): pack in a struct.
 
-Fri Oct 13 02:30:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (rb_gc_set_params): set parameters always.
+	  [ruby-dev:44648] [Bug #5467]
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect): prepend
-	  base directory to load path.
+Tue Feb 14 15:44:42 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect_file): should
-	  use the given File-like interface, but not File directly.
+	* test/irb/test_completion.rb: skip if cannot load irb/completion
+	  (maybe readline does not exist).
 
-	* test/testunit/collector/test_dir.rb (TestDir::FileSystem): implement
-	  File-like methods correctly.
+Tue Feb 14 15:07:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 13 01:48:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit/assertions.rb (build_message): skip escaped
+	  question marks.
 
-	* lib/date.rb (Date::self.complete_hash): need to check if g is
-	  nil before dereference.  [ruby-core:09116]
+Mon Feb 13 12:06:29 2012  Loren Segal  <lsegal@soen.ca>
 
-Fri Oct 13 00:34:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (Init_IO): use directive hack to make ARGF documentable
+	  in other tools.  [ruby-core:42515][Bug #6007]
 
-	* object.c (rb_mod_cvar_defined): wrong id check.  a patch from
-	  Mauricio Fernandez <mfp at acm.org>.  [ruby-core:09158]
+Sun Feb 12 16:57:56 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* object.c (rb_mod_cvar_get): typo fixed.  [ruby-core:09168]
+	* misc/rdoc-mode.el (rdoc-imenu-create-index): Add imenu support
+	  to rdoc-mode.
 
-	* object.c (rb_mod_cvar_set): ditto.
+	* misc/rdoc-mode.el (rdoc-mode): Fix regexp patterns containing
+	  "\s " where CR/LF is not supposed to match.
 
-Wed Oct 11 22:21:41 2006  Akinori MUSHA  <knu@iDaemons.org>
+Sun Feb 12 16:56:23 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* ext/digest: Merge from trunk; metadata location changed,
-	  Digest::Base#reset() added, Digest::Base#equal() changed, and
-	  digest/hmac added with some modifications made for ruby 1.8.
+	* misc/rdoc-mode.el (rdoc-mode): Add provide so that requiring
+	  this library succeeds.
 
-Tue Oct 10 17:24:12 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Feb 12 16:53:18 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* {bcc32,win32,wince}/Makefile.sub (config.status): shouldn't use
-	  copy command instead of install. use -run install.
+	* lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): Just
+	  call File.unlink and ignore ENOENT because existence check
+	  before unlinking does not help in terms of race condition.
 
-Tue Oct 10 16:49:16 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): My
+	  comment about thread safeness is obsolete.
 
-	* ext/digest/digest.c (hexdigest_str_new, bubblebabble_str_new):
-	  Perform StringValue() checks properly.
+Sun Feb 12 16:50:28 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* ext/digest/digest.c: Use RSTRING_{PTR,LEN} macros.
+	* lib/shellwords.rb: Fix rdoc markups.
 
-Tue Oct 10 13:49:53 2006  Akinori MUSHA  <knu@iDaemons.org>
+Sun Feb 12 16:50:28 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* ext/digest: Merge from trunk; apply all changes since the
-	  initial import, except for the removal of compatibility stub
-	  libraries (md5.rb and sha1.rb).
+	* lib/shellwords.rb (Shellwords#shellsplit): Fix a bug where
+	  consecutive backslashes in double quotes are all removed except
+	  the one at the tail.
 
-Mon Oct  9 23:46:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 12 16:38:13 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* lib/parsedate.rb: documentation patch from Konrad Meyer
-	  <konrad.meyer@gmail.com>.  [ruby-doc:1238]
+	* lib/shellwords.rb (Shellwords#shellescape): Drop the //n flag
+	  that only causes warnings with no real effect.  [Bug #5637]
 
-	* lib/open3.rb, lib/ping.rb: ditto.
+Sun Feb 12 16:34:55 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-Mon Oct  9 22:56:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* tool/merger.rb (#default_merge_branch): Add support for
+	  Subversion 1.7 which adopted a whole new working directory
+	  structure.
 
-	* lib/rexml/encoding.rb (REXML::Encoding::check_encoding): spaces
-	  are allowed around equal sign.  [ruby-core:09032]
+Sun Feb 12 09:38:46 2012  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser): ditto.
+	* vm_method.c (rb_add_method): should not call method_added hook
+	  for undef operation. [Bug #5015]
 
-Sat Oct  7 23:53:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 12 09:29:28 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_scan): small documentation fix.
-	  [ruby-core:09007]
+	* regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): Power PC does not
+	  allow unaligned word access.
 
-Sat Oct  7 23:44:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* st.c (UNALIGNED_WORD_ACCESS): x86_64 allows unaligned word
+	  access as well as i386.
 
-	* bignum.c (rb_big_rshift): a bug in right shift of negative
-	  bignums.  [ruby-core:09020]
+Sat Feb 11 08:06:12 2012  Tanaka Akira  <akr@fsij.org>
 
-Sat Oct  7 00:27:58 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/openssl/test_ssl.rb (test_multibyte_read_write): start server
+	  for each length to avoid race condition.
 
-	* class.c (rb_include_module): remove unnecessary check.
-	  [ruby-talk:218402]
+Sat Feb 11 06:13:07 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Oct  6 04:30:30 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* dir.c (fnmatch): The * needs to be escaped to avoid formatting in
+	  fnmatch comment.
+	  patched by @dalton. https://github.com/ruby/ruby/pull/91
 
-	* sample/openssl/c_rehash.rb: Use digest/md5 instead of obsolete md5.
+Sat Feb 11 03:38:48 2012  Hiroshi Shirosaki <h.shirosaki@gmail.com>
 
-Wed Oct  4 18:47:25 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* io.c (rb_sys_fail_path): move the definition.
+	  Move above for using it in set_binary_mode_with_seek_cur().
 
-	* ext/tk/lib/tkextlib/*: bugfix and update
-	  (see ext/tk/ChangeLog.tkextlib).
+	* io.c (set_binary_mode_with_seek_cur): fix improper seek cursor.
+	  Seeking file cursor with setting binary mode has possibility to
+	  cause infinite loop. Fixed the bug and refined error handling.
+	  Introduced at r34043.
 
-Wed Oct  4 17:25:14 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  And cleanups as below.
+	  Remove unnecessary parentheses of `fptr`.
+	  Use return value of setmode().
 
-	* eval.c (rb_call): check protected visibility based on real self,
-	  not ruby_frame->self.  [ruby-talk:217822]
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_seek_with_setting_binmode): add a test for abobe.
+	  [ruby-core:41671] [Bug #5714]
 
-Wed Oct  4 08:52:30 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 11 03:38:48 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/optparse/test_getopts.rb: changed the class name of test case
-	  to get rid of conflict with test_optparse.rb.
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_{read_with_binmode_and_get[cs]}): only for Windows.
 
-Tue Oct  3 23:32:27 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 11 03:38:48 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/testcase.rb (Test::Unit::TestCase.suite): test name
-	  must be string.  fixed: [ruby-core:08978]
+	* win32/win32.c, include/ruby/win32.h (rb_w32_fd_is_text): new function.
 
-Mon Oct  2 23:47:55 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (init_stdhandle): set default mode of stdin as binmode.
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::COLLECTORS):
-	  base directory should be lower precedence.  fixed: [ruby-dev:29622]
+	* io.c (set_binary_mode_with_seek_cur): new function to replace
+	  SET_BINARY_MODE_WITH_SEEK_CUR macro.  now returns previous mode of the
+	  fd and take care of LF in rbuf.
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): typo.
+	* io.c (do_writeconv): set text mode when needed.
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  load expanded path.  fixed: [ruby-dev:29621]
+	* io.c (io_read): need to change the mode of the IO to binmode
+	  temporally when the length for IO#read, because IO#read with length
+	  must behave so.
 
-Mon Oct  2 15:49:19 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_{read_with_length,
+	  read_with_length_binmode,get[cs]_and_read_with_binmode,
+	  read_with_binmode_and_get[cs],read_write_with_binmode}): tests for
+	  above changes.
 
-	* instruby.rb: batfile should be CRLF'ed.
+	all patches are written by Hiroshi Shirosaki. [ruby-core:41496]
+	[Feature #5714]
 
-Mon Oct  2 01:24:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 11 03:37:56 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* common.mk (test-all): separate directory where running test cases
-	  from source tree.
+	* test/rexml/test_order.rb (OrderTester#test_more_ordering): use
+	  GZip::GzReader.open instead of GZip::GzReader.new with File.new.
+	  fixed a test error on Windows introduced at r33946.
 
-	* lib/test/unit/autorunner.rb (options): added --basedir, --workdir
-	  and --load-path options.
+Sat Feb 11 03:37:34 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb (recursive_collect, collect_file):
-	  base directory support.
+	* ext/zlib/zlib.c (rb_gzreader_initialize): revert a part of r33937.
+	  1st, to change the mode of an IO is very sensitive problem, so
+	  fixed test errors on Windows introduced at r33953.
+	  the maintainer of this library should judge it.
+	  2nd, usually Zlib::GzReader.new is not called directly.  #initialize
+	  is called via .open, and in the method the I/O is opened in binary
+	  mode, so there is no problem without changing the mode in #initialize.
 
-Sun Oct  1 23:56:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  fixed test errors on Windows introduced at r33947.
+Sat Feb 11 03:23:58 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* Makefile.in, common.mk, ext/extmk.rb, win{32,ce}/Makefile.in: keep
-	  LIBRUBY_SO unless need to be removed.
+	* ext/zlib/zlib.c (rb_gzreader_initialize): use binary mode by default
+	  under Windows. Patch by Hiroshi Shirosaki. [ruby-core:40706]
+	  [Feature #5562]
 
-Sun Oct  1 23:12:19 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* include/ruby/encoding.h (void rb_econv_binmode): define NEWLINE
+	  decorator.
 
-	* lib/optparse.rb (OptionParser#make_switch): pass arguments directly.
+	* io.c (rb_cloexec_fcntl_dupfd): Introduce NEED_READCONV and
+	  NEED_WRITECONV to replace universal newline decorator by CRLF only
+	  when required to improve file reading and writing under Windows.
+	  Patch by Hiroshi Shirosaki. [ruby-core:40706] [Feature #5562]
+	* io.c (do_writeconv): adjust binary mode if required.
+	* io.c (read_all, appendline, swallow, rb_io_getline_1): ditto.
+	* io.c (io_getc, rb_io_each_codepoint, rb_io_ungetc): ditto.
+	* io.c (rb_io_binmode, rb_io_ascii8bit_binmode): ditto.
+	* io.c (rb_io_extract_modeenc, rb_sysopen): ditto.
+	* io.c (pipe_open, prep_stdio, io_encoding_set): ditto.
+	* io.c (rb_io_s_pipe, copy_stream_body): ditto.
 
-Sat Sep 30 15:12:25 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* test/ruby/test_io_m17n.rb (EOT): add test for pipe and stdin in
+	  binary mode.
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.4.
+	* win32/win32.c (init_stdhandle): remove O_BINARY from stdhandle
+	  initialization.
+	* win32/win32.c (rb_w32_write): use FTEXT mode accordingly.
 
-Fri Sep 29 12:11:04 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Feb 11 03:20:22 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* jcode.rb (succ!): call original succ! if $KCODE == 'n'.
-	  fixed: [ruby-talk:216845]
+	* io.c (argf_next_argv): wrong timing of setting ecflags.
+	  fixed the failure of TestArgf#test_textmode introduced at r33662.
 
-Fri Sep 29 11:43:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 11 03:19:45 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/mkmf.rb (try_func): revert fallback checking undeclared function.
-	  fixed: [ruby-core:08949]
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_default_stdout_stderr_mode): new test for
+	  r33627-33629.  see [backport #5565]
+Sat Feb 11 03:20:22 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Sep 29 09:56:56 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_READ_MASK,
+	  ECONV_NEWLINE_DECORATOR_WRITE_MASK): new macro.
 
-	* ext/extmk.rb: extout is needed for also clean.
-	  fixed: [ruby-core:08944]
+	* io.c (rb_io_extract_modeenc, pipe_open, prep_stdio, argf_next_argv):
+	  set TEXTMODE_NEWLINE_DECORATOR_ON_WRITE for textmode on creating IO
+	  if the flag is available.
 
-	* lib/optparse.rb (OptionParser::Switch#conv_arg): unsplat by
-	  Proc#call if no conversion is given.
+	* io.c (make_writeconv): drop decorators for reading.
 
-Thu Sep 28 23:59:31 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (make_readconv): drop decorators for writing.
 
-	* node.h (struct thread): declare win32_exception_list on cygwin and
-	  win32 regardless if it is implemented.  Provisional fix for
-	  [ruby-core:08917].
+	* io.c (do_writeconv): existing writeconv is not the condition to raise
+	  ArgumentError.  should check textmode or not.
 
-Thu Sep 28 20:53:16 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_{cr,lf,crlf}_decorator_on_stdout): test above
+	  changes.
 
-	* lib/tmpdir.rb: use return value of getdir.call for length.
 
-Wed Sep 27 01:04:49 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 11 03:19:45 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/mkmf.rb (try_func): check function pointer first and macro next.
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
+	  default_mode_on_unix,text_mode,binary_mode}): sorry for wrong test
+	  committed in r33144.  I'd misunderstood the spec of ruby's universal
+	  newline.
 
-	* lib/mkmf.rb (have_type): simplified with typedef and sizeof.
+Sat Feb 11 03:17:41 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Sep 26 23:57:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
+	  default_mode_on_unix,text_mode,binary_mode}): tests for [Bug #5164].
 
-	* lib/optparse.rb (OptionParser#getopts): use strings as key.
-	  fixed: [ruby-dev:29614]
+Sat Feb 11 03:13:27 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 26 15:31:26 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* transcode.c: enabled econv newline option.
 
-	* {win32,wince}/Makefile.sub (CPP): check predefined value.
+Sat Feb 11 02:39:09 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Sep 26 07:55:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* variable.c (set_const_visibility): clear inine-cache when constant's
+	  visibility is modified. [ruby-dev:44929]
 
-	* array.c (rb_ary_shift): should not move memory region if array
-	  body is shared.  a patch from Kent Sibilev <ksruby at gmail.com>.
-	  [ruby-core:08922]
+	* test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
+	  add test for it.
 
-Mon Sep 25 22:26:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* file.c (rb_path_end): skip root directory.  fixed: [ruby-core:08913]
+	* variable.c (set_const_visibility): print a warning when no argument
+	  is passwd to Module#private_constant.  [ruby-list:48558]
 
-	* lib/mkmf.rb (init_mkmf): set default $LDFLAGS.  Patch by Michal
-	  Suchanek <hramrach at centrum.cz>.  [ruby-talk:216256]
+	* vm_method.c (set_method_visibility): ditto for
+	  Module#private_class_method.
 
-Mon Sep 25 08:14:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* array.c (rb_ary_shift): should clear shifting top element.
-	  [ruby-talk:216055]
+	* variable.c (set_const_visibility): Module#private_constant has
+	  changed the visibility of only the first argument.  Now it changes
+	  all of them.  [ruby-list:48558]
 
-	* array.c (rb_ary_shift): avoid creating shared object if array
-	  size is small.
+	* test/ruby/test_module.rb: add a test for above.
 
-Mon Sep 25 08:11:35 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Feb 11 02:39:09 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* random.c (rb_f_rand): RDoc typo fix.  a patch from Frederick
-	  Cheung <fred at 82ask.com>.  [ruby-talk:216047]
+	* variable.c (set_const_visibility): clear inine-cache when constant's
+	  visibility is modified. [ruby-dev:44929]
 
-Sun Sep 24 22:28:20 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
+	  add test for it.
 
-	* runruby.rb: extension library scripts moved into common directory.
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Sun Sep 24 14:59:50 2006  Tanaka Akira  <akr@fsij.org>
+	* variable.c (set_const_visibility): print a warning when no argument
+	  is passwd to Module#private_constant.  [ruby-list:48558]
 
-	* node.h (struct thread): ia64 support is broken by sandbox patch.
+	* vm_method.c (set_method_visibility): ditto for
+	  Module#private_class_method.
 
-Sun Sep 24 12:11:16 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.3.
+	* variable.c (set_const_visibility): Module#private_constant has
+	  changed the visibility of only the first argument.  Now it changes
+	  all of them.  [ruby-list:48558]
 
-Sat Sep 23 23:24:57 2006  why the lucky stiff  <why@ruby-lang.org>
+	* test/ruby/test_module.rb: add a test for above.
 
-	* eval.c (rb_thread_save_context, rb_thread_restore_context):
-	  sandbox hook to save and restore sandbox state.
+Sat Feb 11 02:26:51 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* eval.c (thread_no_ensure): added THREAD_NO_ENSURE thread flag.
+	* lib/openssl/buffering.rb: Force multi-byte strings to be treated as
+	  binary data.
+	* test/openssl/test_ssl.rb: Add test for it.
 
-	* eval.c (rb_thread_kill_bang): Thread#kill! uses the above flag
-	  to circumvent ensure, in order to prevent endless loops.
-	  [ruby-core:08768]
+	Thanks to Niklas Baumstark for reporting the issue!
 
-	* eval.c (rb_thread_kill): fix Thread#kill docs, which returns
-	  the thread object in all cases.
+	[Ruby 1.9 - Bug #5233] [ruby-core:39120]
 
-	* node.h: expose the rb_jmpbuf_t and rb_thread_t structs, along
-	  with the thread flags.  used by the sandbox extension.
+Fri Feb 10 17:25:28 2012  Tanaka Akira  <akr@fsij.org>
 
-	* ruby.h: extern rb_eThreadError, so sandbox can swap it.
+	* lib/set.rb (SortedSet.setup): remove old_init after initialize
+	  method is redefined.  The remove before redefinition makes the
+	  warning prevention fragile.  [ruby-dev:44892]
 
-Sat Sep 23 21:34:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 10 17:02:12 2012  okkez  <okkez000@gmail.com>
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): CGI content
-	  may be empty.  a patch from Jamis Buck <jamis at 37signals.com>.
+	* thread_pthread.c (rb_thread_create_timer_thread): fix memory
+	  leak. [ruby-dev:44904] [Bug #5688]
 
-Sat Sep 23 08:35:53 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 10 05:22:32 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_options.rb: prevent NameError.  [ruby-dev:29597]
+	* cont.c (fiber_setcontext): Use longjmp() instead of swapcontext() on
+	  FreeBSD 9. [ruby-dev:41316] [Bug #3295] [Bug #5526]
 
-Sat Sep 23 01:04:20 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Fri Feb 10 05:13:12 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.2.
+	* object.c: Added examples for Object#is_a? and
+	  Object#instance_of? patcheed from Manoj Kumar.
+	  [Bug #5880] [ruby-core:42057]
 
-Fri Sep 22 02:06:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb 10 05:11:43 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* .cvsignore: ignore timestamp files and installed list file.
+	* io.c (argf_next_argv): reset ARGF.next_p on ARGV.replace.
+	  r34409 breaks replacing ARGV.
+	  [ruby-dev:45160] [Bug #5952]
 
-Fri Sep 22 01:36:34 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb 10 05:11:43 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* instruby.rb: include FileUtils unconditionally.
+	* io.c (argf_close): skip stdin, which should be readable again.
+	  [ruby-dev:45160] [Bug #5952]
 
-Thu Sep 21 22:56:20 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (argf_readlines): reinitialize after all read to be
+	  readable again.
 
-	* common.mk (no-install): not install rdoc actually.
+Fri Feb  9 01:36:19 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* common.mk (install-doc, no-install-doc): use instruby.rb.
+	* backport r34482 from trunk
 
-	* instruby.rb: rdoc installation.
+	* ext/openssl/ossl_ssl.c: Add SSL constants and allow to unset SSL
+	  option to prevent BEAST attack. See [Bug #5353].
 
-	* ext/extmk.rb: expand ruby executable names.
+	  In OpenSSL, OP_DONT_INSERT_EMPTY_FRAGMENTS is used to prevent
+	  TLS-CBC-IV vulunerability described at
+	  http://www.openssl.org/~bodo/tls-cbc.txt
+	  It's known issue of TLSv1/SSLv3 but it attracts lots of attention
+	  these days as BEAST attack. (CVE-2011-3389)
 
-Thu Sep 21 13:55:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  Until now ossl sets OP_ALL at SSLContext allocation and call
+	  SSL_CTX_set_options at connection.  SSL_CTX_set_options updates the
+	  value by using |= so bits set by OP_ALL cannot be unset afterwards.
+	  This commit changes to call SSL_CTX_set_options only 1 time for each
+	  SSLContext. It sets the specified value if SSLContext#options= are
+	  called and sets OP_ALL if not.
 
-	* ext/etc/etc.c (etc_getpwuid): uid integer should be wraped in
-	  uid_t value.  [ruby-core:08897]
+	  To help users to unset bits in OP_ALL, this commit also adds several
+	  constant to SSL such as
+	  OpenSSL::SSL::OP_DONT_INSERT_EMPTY_FRAGMENTS.  These constants were
+	  not exposed in Ruby because there's no way to unset bits in OP_ALL
+	  before.
 
-	* ext/etc/etc.c (etc_getpwuid): uid_t may be bigger than plain
-	  'int' type.
+	  Following is an example to enable 0/n split for BEAST prevention.
 
-Wed Sep 20 23:17:41 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	    ctx.options = OP_ALL & ~OP_DONT_INSERT_EMPTY_FRAGMENTS
 
-	* common.mk (pre-install-doc): create data directory before install.
+	* test/openssl/test_ssl.rb: Test above option exists.
 
-	* lib/mkmf.rb (dir_re): fixed typo.
+Thu Feb  9 17:08:20 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/mkmf.rb (install_dirs): remove extra slash.
+	* cont.c (cont_mark): mark original Thread object from saved_thread.
+	  [ruby-dev:44567] [Bug #5386]
 
-Wed Sep 20 09:53:38 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Feb  9 17:05:07 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* {bcc32,win32,wince}/Makefile.sub (INSTALLED_LIST): need to define
-	  this macro to install.
+	* cont.c (HAVE_GETCONTEXT): see getcontext(3) because DragonFly BSD
+	  x64 port doesn't have it.
 
-Wed Sep 20 09:43:10 2006  Shugo Maeda  <shugo@ruby-lang.org>
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/net/imap.rb: allow extra spaces in responses.
-	  Thanks, Tom Soderlund. (backported from HEAD)
+	* test/ruby/memory_status.rb (Memory::Win32): 64bit support.
 
-Wed Sep 20 09:25:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/gdbm/gdbm.c: add RDoc documentation. a patch from Peter
-	  Adolphs <futzilogik at users dot sourceforge dot net>.
-	  [ruby-doc:1223]
+	* ext/dl/lib/value.rb (DL::ValueUtil.{unsigned_value,signed_value}):
+	  currenly pack/unpack does not accept "q!" and "Q!".
 
-Tue Sep 19 01:28:00 2006  Minero Aoki  <aamine@loveruby.net>
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/fileutils.rb: backport from HEAD (rev 1.71).
+	* ext/fiddle/conversions.c (value_to_generic): src is not guranteed as
+	  a Bignum if the type is LONG_LONG.  it may be a Fixnum if the value
+	  is small.
 
-	* lib/fileutils.rb (FileUtils.cp_r): new option
-	  :remove_destination.
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Sep 19 00:42:15 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/dl/lib/types.rb: Win64 support.
 
-	* object.c (rb_obj_ivar_defined, rb_mod_cvar_defined): new methods,
-	  Kernel#instance_variable_defined? and Module#class_variable_defined?.
-	  [ruby-dev:29587]
+Thu Feb  9 11:11:15 2012  Hiroshi Shirosaki <h.shirosaki@gmail.com>
 
-	* lib/date/format.rb (Date::Bag#method_missing): use new method,
-	  instance_variable_defined? to check if an instance variable is
-	  defined.  fixed: [ruby-dev:29554]
-	  -- This didn't fix anything.
+	* ext/dbm/dbm.c (Init_dbm): fix a build error on mswin32.
+	  use `extern __declspec(dllimport)` for dll link with VC.
+	  [ruby-core:41996] [Bug #5869]
 
-Sun Sep 17 23:44:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb  9 11:11:15 2012  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc#document): scan only files modified
-	  after the previous generation.
+	* ext/dbm/dbm.c: use db_version() instead of DB_VERSION_STRING to
+	  detect runtime Berkeley DB version.
+	  use dpversion instead of _QDBM_VERSION to detect runtime QDBM
+	  version.
+	  [ruby-dev:44948]
 
-Sun Sep 17 17:42:13 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb  9 11:11:15 2012  Tanaka Akira  <akr@fsij.org>
 
-	* common.mk (install-doc): reverted.
+	* ext/dbm/extconf.rb: detect gdbm_version in libgdbm.
 
-	* instruby.rb: stores file name list without destdir prefix.
+	* ext/dbm/dbm.c: make DBM::VERSION more informative for gdbm, qdbm and
+	  Berkeley DB 1.x.  [ruby-dev:44944]
 
-	* lib/rdoc/generators/ri_generator.rb: do not chdir twice.
+Thu Feb  9 07:32:40 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Sep 16 23:14:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* numeric.c (rb_enc_uint_char): raise RangeError when added codepoint
+	  is invalid. [Feature #5855] [Bug #5863] [Bug #5864]
 
-	* ext/pty/pty.c (establishShell): remove remaining unused line.
+	* string.c (rb_str_concat): ditto.
 
-Sat Sep 16 16:40:44 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_concat): set encoding as ASCII-8BIT when the string
+	  is US-ASCII and the argument is an integer greater than 127.
 
-	* Makefile.in, common.in, instruby.rb, ext/extmk.rb, lib/mkmf.rb:
-	  use instruby.rb to install extensions instead of ext/extmk.rb.
+	* regenc.c (onigenc_mb2_code_to_mbclen): rearrange error code.
 
-	* instruby.rb: store installed list into the file.
+	* enc/euc_jp.c (code_to_mbclen): ditto.
 
-	* ext/dbm/extconf.rb: allow multiple candidates for dbm-type.
+	* enc/shift_jis.c (code_to_mbclen): ditto.
 
-	* ext/io/wait/extconf.rb: suspicious checking_for.
+Thu Feb  9 07:28:43 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/pty/pty.c (establishShell): parent pid is not used.
+	* test/pathname/test_pathname.rb: not read but binread.
+	  patched by Benoit Daloze, [ruby-core:42440] [Bug #5984]
 
-	* ext/pty/pty.c (freeDevice): not used.
+Wed Feb  8 22:29:59 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/pty/pty.c (get_device_once): removed garbage right brace.
+	* string.c (rb_str_modify_expand): fix memory leak.
 
-	* lib/mkmf.rb (checking_for): improved the messages.
+Wed Feb  8 10:58:45 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep 14 16:11:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  respect encodings.  [Bug #5941]
 
-	* string.c (rb_str_intern): raise SecurityError only when $SAFE
-	  level is greater than zero.  [ruby-core:08862]
+Wed Feb  8 10:56:00 2012  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* parse.y (rb_interned_p): new function to check if a string is
-	  already interned.
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  fix compile error.
 
-	* object.c (str_to_id): use rb_str_intern().
+Wed Feb  8 10:56:00 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 13 18:43:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  empty completion result does not mean memory error.
 
-	* README.EXT: English adjustment.  [ruby-core:08851] and
-	  [ruby-core:08852]
+Wed Feb  8 10:54:49 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 13 18:25:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/readline/readline.c (readline_readline): check if outstream
+	  is closed to get rid of a bug of readline 6.  [ruby-dev:45043]
+	  [Bug #5803]
 
-	* misc/ruby-mode.el (ruby-parse-partial): better here-doc support.
-	  a patch from Marshall T. Vandegrift <llasram at gmail.com>.
-	  [ruby-core:08804]
+Wed Feb  8 10:52:51 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Sep 13 16:43:36 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/readline/readline.c (Init_readline): like r18313, libedit's
+	  replace_history_entry may use offset instead of which.
+	  so introduce history_replace_offset_func and initialize it.
 
-	* string.c (rb_str_intern): prohibit interning tainted string.
+	* ext/readline/readline.c (hist_set): use history_replace_offset_func.
 
-Wed Sep 13 01:14:21 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb  8 10:52:36 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#getopts): works with pre-registered
-	  options.  [ruby-core:08826]
+	* ext/readline/readline.c (Init_readline): fix wrong condition.
 
-Sun Sep 10 20:27:13 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Wed Feb  8 10:50:11 2012  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.1.
+	* test/ruby/test_rubyoptions.rb (test_script_from_stdin): slave pty
+	  should be manipulated because master pty may not be a tty on some
+	  environment (e.g. Solaris). [Bug:#5222] [ruby-dev:44420]
 
-Tue Jan 10 09:18:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb  8 10:38:36 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (stack_extend): fixed prototype.
+	* Makefile.in (CFLAGS): append ARCH_FLAG.
 
-	* eval.c (rb_require_safe): prevent extension from loading twice.
-	  fixed: [ruby-dev:29523]
+	* configure.in (ARCH_FLAG): exclude from CFLAGS.
 
-Sat Sep  9 23:50:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb 08 09:19:00 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* bignum.c (rb_big_mul0): bignum multiplication without
-	  normalization.
+	* ext/openssl/ossl_cipher.c: Add warning about key as IV.
 
-	* bignum.c (rb_big_pow): use rb_big_mul0().  [ruby-dev:29547]
+Wed Feb  8 10:37:31 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Sat Sep  9 14:08:38 2006  Eric Hodel  <drbrain@segment7.net>
+	* ext/openssl/ossl_cipher.c: Update and complete documentation.
 
-	* lib/test/unit/testcase.rb (Test::Unit::TestCase#run): Rescue
-	  Exception in Test::Unit::TestCase#run.  [ruby-core:08783]
+Wed Feb 08 09:57:33 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Sat Sep  9 04:55:59 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_asn1.c: Call INT2NUM only once for GeneralString.
+	  Thanks to Mantas Mikulenas for noticing and providing a patch!
+	  [ruby-core:42358] [Bug #5972]
 
-	* lib/pstore.rb: open all in binary mode, and get rid of the quirk of
-	  msvcrt.  fixed: [ruby-dev:29518]
+Wed Feb  8 10:34:59 2012  TAKAO Kouji  <kouji@takao7.net>
 
-Sat Sep  9 04:54:42 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  in Readline module with GNU Readline 6 case, Readline module
+	  resets completion_append_character to " ", after it executes
+	  completion. So, Readline module stores
+	  completion_append_character, and Readline module always sets it
+	  after Readline module executes completion. [ruby-dev:43456]
+	  [Feature #4635]
 
-	* Makefile.in, win32/Makefile.sub (MINIRUBY): append MINIRUBYOPT.
+Wed Feb  8 09:47:52 2012  Tanaka Akira  <akr@fsij.org>
 
-	* mkconfig.rb, ext/extmk.rb, lib/mkmf.rb, win32/mkexports.rb: suppress
-	  warnings with $VERBOSE.
+	* test/ruby/test_sleep.rb (test_sleep_5sec): 0.1sec tolerance is too
+	  small for busy environment.
 
-	* ext/extmk.rb: Proc#call does not pass the block in 1.8.
+Wed Feb  8 09:45:23 2012  Tanaka Akira  <akr@fsij.org>
 
-	* win32/resource.rb: add more info.
+	* test/dbm/test_dbm.rb: split tests for read only database.
 
-Fri Sep  8 10:03:59 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/gdbm/test_gdbm.rb: ditto.
 
-	* lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookies): new
-	  method to parse multiple cookies per Set-Cookie header.
-	  Thanks to Aaron Patterson <aaron_patterson at speakeasy.net>.
-	  [ruby-core:08802]
+Wed Feb  8 09:43:48 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Fri Sep  8 08:59:30 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (name_err_mesg_to_str): clear rb_thread_t::errinfo when
+	  ignore exception under rb_protect(). [ruby-core:41612] [Bug #5755]
 
-	* win32/Makefile.sub, win32/configure.bat win32/setup.mak: program
-	  name transform.
+	* test/ruby/test_exception.rb (test_exception_in_name_error_to_str):
+	  add a corresponding test.
 
-Fri Sep  8 01:33:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb  8 09:36:42 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h (RSTRING_PTR): add migration macro.
+	* encoding.c (require_enc): reject only loading from untrusted
+	  load paths.  [ruby-dev:44541] [Bug #5279]
 
-	* ruby.h (RARRAY_PTR): ditto.
+	* transcode.c (load_transcoder_entry): ditto.
 
-Thu Sep  7 23:27:05 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb  8 09:36:42 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (path_check_0, fpath_check): disable path check on cygwin.
-	  [ruby-talk:213074]
+	* encoding.c (load_encoding): predefined encoding names are safe.
+	  [ruby-dev:44469] [Bug #5279]
 
-Wed Sep 06 12:05:19 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+	* transcode.c (load_transcoder_entry): ditto.
 
-	* ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): fix regexp for euc-jp
-	  [ruby-dev:29344]
+Tue Feb  7 14:29:16 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/nkf/lib/kconv.rb (Kconv::toeuc): remove -m0 [ruby-dev:29505]
+	* st.c (st_foreach): should not yield same pair when checking
+	  after unpacking.
 
-Tue Sep  5 06:47:22 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb  7 14:03:45 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* time.c (time_to_s): variable declaration after an execution
-	  statement.
+	* lib/tempfile.rb (Tempfile#_close): clear @tempfile and @data[1] even
+	  when exception is raised at @tempfile.close. [ruby-dev:45113]
 
-Tue Sep  5 05:56:51 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/tempfile.rb (Tempfile#unlink): fix a typo.
 
-	* numeric.c (flo_hash): improve collision.  fixed: [ruby-dev:29352]
+Tue Feb  7 14:02:32 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Sep  5 05:49:41 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io.rb (test_autoclose_true_closed_by_finalizer,
+	  test_autoclose_true_closed_by_finalizer): skip if IO objects are
+	  not recycled yet. [ruby-dev:45098] [Bug #5850]
 
-	* file.c (path_check_0): check if sticky bit is set on parent
-	  directories for executable path.  fixed: [ruby-dev:29415]
+Tue Feb  7 13:59:26 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Sep  5 05:03:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (run_finalizer): clear rb_thread_t::errinfo when ignore
+	  an exception under rb_protect(). [ruby-dev:45113]
 
-	* numeric.c (fix_plus): addition in Fixnum will never overflow
-	  long.  a patch from Ondrej Bilka <neleai at seznam.cz>.
-	  [ruby-core:08794]
+Mon Feb  6 15:34:47 2012  Tanaka Akira  <akr@fsij.org>
 
-	* numeric.c (fix_minus): ditto.
+	* ruby.c (fill_standard_fds): use fstat() instead of fcntl(F_GETFD)
+	  for MinGW.  reported by Luis Lavena.  [ruby-core:40526] [Bug #5516]
 
-	* bignum.c (rb_big_pow): eagerly truncate resulting bignum.
-	  [ruby-core:08794]
+Mon Feb  6 15:34:47 2012  Tanaka Akira  <akr@fsij.org>
 
-Mon Sep  4 23:15:34 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ruby.c (fill_standard_fds): new function to open closed standard
+	  file descriptors.
+	  (ruby_sysinit): call fill_standard_fds.
 
-	* time.c (time_to_s): make it conform to RFC2822 date format.
-	  [ruby-dev:29467]
+Mon Feb  6 15:19:17 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Sep  4 21:43:57 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_fsync,rb_io_fdatasync): release GVL during fsync().
+	  fsync() and fdatasync() may take a long time on slow disks and/or
+	  if there is much dirty data.
+	  Patch by Eric Wong. [Feature #5665] [ruby-core:41247]
 
-	* ext/dbm/extconf.rb: create makefile according to the result of check
-	  for dbm header.  fixed: [ruby-dev:29445]
+Mon Feb  6 15:01:55 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep  4 21:42:35 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* vm_eval.c (vm_call0): should pass block to enumerators.  patched
+	  by Kazuki Tsujimoto.  [ruby-dev:44961][Bug #5731]
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.
+	* vm_eval.c (method_missing), vm_insnhelper.c (vm_call_method):
+	  ditto.  patched by satoshi shiba.
 
-Mon Sep  4 21:14:20 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Feb  6 21:52:20 2012  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* time.c (time_strftime): include nul character.  fixed: [ruby-dev:29422]
+	* common.mk (INSTRUBY_ARGS): added --mantype to apply mdoc2man.rb
+	  to man pages.  Fixes #5598.
+	  (do-install-nodoc, do-install-local, do-install-man,
+	  dont-install-nodoc, dont-install-local, dont-install-man):
+	  No longer needs --mantype.
 
-Mon Sep  4 16:29:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  Reported by Rainer Orth <ro AT cebitec.uni-bielefeld.de>,
+	  patch by George Koehler <xkernigh AT netscape.net>.
 
-	* lib/cgi.rb (CGI::out): specify -m0 -x option for nkf.
-	  [ruby-dev:29284]
+Mon Feb  6 21:21:46 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Sep  4 16:13:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/unit/assertions.rb (MINI_DIR): quick dirty hack to get rid of
+	  warnings when using assert/assert_respond_to.
 
-	* io.c (pipe_open): command name should not contain null bytes.
-	  [ruby-dev:29421]
+Mon Feb  6 20:38:19 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c (proc_spawn): ditto.
+	* file.c (file_expand_path): reset coderange after expanding path.
 
-	* process.c (proc_spawn_n): ditto.
+Mon Feb  6 20:32:17 2012  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* process.c (rb_f_system): ditto.
+	* ext/date/date_strptime.c: moved detector of leftover.
 
-Sun Sep  3 15:32:44 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Feb  6 20:32:17 2012  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/mkmf.rb: get rid of nil.to_s.
+	* ext/date/date_parse.c: [ruby-core:42173].
 
-Sun Sep  3 06:24:38 2006  Tanaka Akira  <akr@fsij.org>
+Mon Feb  6 20:31:35 2012  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/socket/socket.c (ruby_connect): sockerrlen should be socklen_t.
+	* ext/date/date_core.c: uses to_integer instead.
+	* test/date/test_switch_hitter.rb: added a test.
 
-Sun Sep  3 04:40:42 2006  Tanaka Akira  <akr@fsij.org>
+Mon Feb  6 20:31:35 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/socket/extconf.rb: check arpa/inet.h for ntohs.
+	* ext/date/date_core.c (wholenum): fix the type of the return value.
 
-	* ext/socket/socket.c: include arpa/inet.h if available.
+Mon Feb  6 20:31:35 2012  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Sep  3 02:34:55 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/date/date_core.c:  [ruby-dev:45008].
 
-	* lib/drb/unix.rb (DRbUNIXSocket#close): don't get path if client mode.
-	  [ruby-dev:29417]
+Mon Feb  6 16:38:56 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Sep  3 01:45:17 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* win32/win32.c (unixtime_to_filetime): should check the return value
+	  of localtime().  reported by snowjail at gmail.com.
+	  [ruby-dev:44838] [Bug #5596]
 
-	* lib/drb/acl.rb (ACLEntry#initialize): examine whether '*' is
-	  included before IPAddr.new. [ruby-dev:29406]
+Mon Feb  6 16:36:25 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep  2 13:23:01 2006  Tanaka Akira  <akr@fsij.org>
+	* io.c (rb_update_max_fd): fstat(2) can fail with other than
+	  EBADF.  [ruby-dev:44837] [Bug #5593].  Cf.
+	  http://pubs.opengroup.org/onlinepubs/9699919799/functions/fstat.html
 
-	* common.mk (ia64.o): use the compiler driver to assemble ia64.s
-	  to use appropriate ABI.
+Mon Feb  6 16:31:16 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Sep  2 03:36:22 2006  Tanaka Akira  <akr@fsij.org>
+	* io.c (io_fwrite): call rb_w32_write_console() only if FMODE_TTY is
+	  set.  this is the one of the reason of IO writing slowness of Windows
+	  in 1.9.3 or later.
 
-	* common.mk, configure.in, defines.h, eval.c, gc.c, main.c,
-	  numeric.c, ruby.h, ia64.s: backport IA64 HP-UX support.
+Mon Feb  6 16:21:57 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep  1 13:52:57 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* file.c (file_expand_path): reset coderange after expanding path.
 
-	* ext/tk/lib/tk/font.rb: TkFont#current_configinfo() doesn't work
-	  on Tcl/Tk8.x.
+Mon Feb  6 00:06:39 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Aug 31 12:46:55 2006  why the lucky stiff  <why@ruby-lang.org>
+	* ext/json/parser/parser.rl (json_string_unescape): workaround fix
+	  for over optimization of GCC 4.7. [ruby-core:42085] [Bug #5888]
+	  http://gcc.gnu.org/bugzilla/show_bug.cgi?id=51862
 
-	* eval.c (ruby_init): rename top_cref to ruby_top_cref and export,
-	  along with ruby_cref, for use by the sandbox. [ruby-core:08762]
+Fri Feb  3 16:16:10 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* node.h: ditto.
+	* test/ruby/envutil.rb (EnvUtil.invoke_ruby): yield also child pid
+	  in block form.
 
-Tue Aug 29 19:10:10 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb  3 16:16:10 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* hash.c (rb_hash_s_create): fixed memory leak, based on the patch
-	  by Kent Sibilev <ksruby at gmail.com>.  fixed: [ruby-talk:211233]
+	* test/ruby/test_thread.rb
+	  (TestThreadGroup#test_thread_timer_and_interrupt): skip exit status
+	  assertion because we cannot get signal status on Windows.
 
-Mon Aug 28 11:36:02 2006  Eric Hodel  <drbrain@segment7.net>
+	* win32/win32.c (CreateChild): create process group to receive the
+	  signal by GenerateConsoleCtrlEvent().
 
-	* lib/rdoc/parsers/parse_rb.rb: Fix typo.  Submitted by
-	  <calamitas at gmail.com>.  [ruby-core:08724]
+	* win32/win32.c (kill): use CTRL_BREAK_EVENT instead of CTRL_C_EVENT
+	  if a process group is specified. CTRL_C_EVENT signal cannot be
+	  generated for process groups for the specification.
+	  [ruby-dev:45149] [Bug #5812]
 
-Mon Aug 28 07:53:44 2006  Eric Hodel  <drbrain@segment7.net>
+Fri Feb  3 16:16:10 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/rdoc/ri/ri_formatter.rb: Don't unescape HTML in HtmlFormatter.
-	  Submitted by Kent Sibilev <ksruby at gmail.com>.  [ruby-core:08392].
+	* test/ruby/envutil.rb (invoke_ruby): remove :timeout option before
+	  pass it to Kernel#spawn.
 
-Mon Aug 28 07:25:45 2006  Eric Hodel  <drbrain@segment7.net>
+Fri Feb  3 10:10:02 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* file.c (File#size?): Fix documentation submitted by Rick Ohnemus.
-	  ruby-Bugs-5529.  [ruby-core:08725]
+	* thread_pthread.c (ping_signal_thread_list): remove return value.
+	* thread_pthread.c (check_signal_thread_list): add a new function to
+	  check if signal thread list is empty.
+	* thread_pthread.c (thread_timer): check signal thread list after
+	  timer_thread_function(). main thread might be added into signal thread
+	  list during timer_thread_function().
 
-Sat Aug 26 08:07:13 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Fri Feb  3 10:10:02 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.8.2.
+	* thread_pthread.c (ubf_select): call rb_thread_wakeup_timer_thread()
+	  only when it is not timer_thread. [Bug #5757] [ruby-dev:44985]
+	  patched by Tomoyuki Chikanaga.
 
-Fri Aug 25 22:32:04 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb  1 09:50:10 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rexml/source.rb (REXML::IOSource#initialize): encoding have to
-	  be set with the accessor.  fixed: [ruby-list:42737]
+	* doc/re.rdoc (Repetition): fix typo.  reported by Ori Avtalion
+	  and patched by Zachary Scott.  [Bug #5947]
 
-Fri Aug 25 17:15:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Jan 24 11:38:05 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* stable version 1.8.5 released.
+	* lib/uri/common.rb (URI.encode_www_form_component): initialize on
+	  requiring to support JRuby, which runs parallel multithreads.
+	  [ruby-core:42222] [Bug #5925]
 
-Fri Aug 25 17:02:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/uri/common.rb (URI.decode_www_form_component): initialize on
 
-	* gc.c (gc_sweep): typo fixed.
+Sat Jan 28 05:53:34 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug 22 18:47:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/irb/completion.rb (IRB::InputCompletor::CompletionProc):
+	  ignore non-string name modules.  [ruby-core:42244][Bug #5938]
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_method):
-	  rdoc documents C module methods as instance methods. a patch in
-	  [ruby-core:08536].
+Mon Jan 23 18:18:58 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Aug 19 14:15:02 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* encoding.c (rb_enc_compatible): fix segv on symbols.
+	  [ruby-core:42204] [Bug #5921]
 
-	* win32/Makefile.sub (config.status): include winsock2.h instead of
-	  winsock.h when --with-winsock2 is specified.
-	  fixed: [ruby-dev:29296]
+Tue Jan 17 17:18:41 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug 19 11:28:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (SPT_TYPE): enable as SPT_REUSEARGV on Darwin.
 
-	* file.c (rb_file_s_rename): use errno if set properly.
-	  fixed: [ruby-dev:29293]
+	* missing/setproctitle.c (ruby_init_setproctitle): changed prefix.
 
-Sat Aug 19 11:09:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jan 16 16:41:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (then): remove semicolon warning.  [ruby-dev:29299]
+	* lib/optparse.rb (Regexp): fix incorrect options when casting to
+	  a Regexp, and suppress encoding option warnings.
+	  https://github.com/ruby/ruby/pull/82
 
-Thu Aug 17 19:15:16 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jan 13 15:22:43 2012  Tanaka Akira  <akr@fsij.org>
 
-	* file.c (rb_stat_[rRwWxX]): check for super user.
-	  fixed: [ruby-core:08616]
+	* time.c (TIME_COPY_GMT): copy vtm.utc_offset and vtm.zone too.
+	  patch by Tomoyuki Chikanaga.
+	  [ruby-dev:44827] [Bug #5586]
 
-Thu Aug 17 14:47:06 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jan 12 13:52:13 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/mkmf.rb: added rdoc by Daniel Berger.  [ruby-core:08177]
+	* cont.c (cont_restore_0): prevent optimizing out `sp'. sp is used for
+	  reserving a memory space with ALLOCA_N for restoring machine stack
+	  stored in cont->machine_stack, but clang optimized out it (and
+	  maybe #5851 is also caused by this).
+	  This affected TestContinuation#test_check_localvars.
 
-Thu Aug 17 00:39:05 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* cont.c (cont_restore_1): revert workaround introduced in r32201.
 
-	* lib/rinda/ring.rb (do_reply): Fix for RingServer fails to find a
-	  TupleSpace when TupleSpace resides in the same ruby process with
-	  RingServer. a patch from Kent Sibilev. [ruby-core:08453]
+Thu Jan 12 01:40:33 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Aug 16 11:45:36 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#test_autoclose): Tempfile.new doesn't
+	  accept the block argument.
 
-	* process.c (proc_setuid, proc_setgid, proc_seteuid, proc_setegid):
-	  get rid of bogus implementations on Mac OS X.
+Sat Jan  7 22:46:36 2012  Kouhei Sutou  <kou@cozmixng.org>
 
-Tue Aug 15 19:10:18 2006  Eric Hodel  <drbrain@segment7.net>
+	* lib/rexml/parsers/baseparser.rb: use private instead of _xxx
+	  method name. This is Ruby code not Python code.
+	  refs #5696
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment): Fix
-	  broken class-level documentation.
+Tue Jan 03 23:57:37 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-Wed Aug 16 11:09:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rexml/parsers/baseparser.rb: rexml BaseParser uses
+	  instance_eval unnecessarily on listener add.
+	  patch from Charles Nutter. [Bug #5696] [ruby-core:41437]
 
-	* ruby.c (set_arg0): fill argv other than the first with an empty
-	  string instead of NULL.
+Tue Jan 03 19:13:05 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-Wed Aug 16 11:08:00 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rexml/test_sax.rb: add require 'rexml/document'.
+	  [Backport #5834] [ruby-dev:45079]
 
-	* win32/win32.h: removed an excess macro.  fixed: [ruby-dev:29258]
+Tue Jan  3 19:05:42 2012  Naohisa Goto  <ngotogenome@gmail.com>
 
-Tue Aug  8 23:49:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/defines.h (FLUSH_REGISTER_WINDOWS): move sparc asm code
+	  to a separete file sparc.c for preventing inlining optimization.
+	  Patched by Jurij Smakov. [Bug #5244] [ruby-core:40685]
+	* sparc.c (rb_sparc_flush_register_windows): ditto.
+	* configure.in: ditto.
 
-	* lib/irb/extend-command.rb (IRB::ExtendCommandBundle): pacify
-	  RDoc.  a patch from Eric Hodel <drbrain at segment7.net>.
-	  [ruby-core:08522]
+Mon Jan  2 23:52:20 2012  TAKAO Kouji  <kouji@takao7.net>
 
-Tue Aug  8 11:32:54 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/readline/readline.c (Init_readline): libedit check
+	  rl_getc_function only when rl_initialize() is called, and
+	  using_history() call rl_initialize(). This assignment should be
+	  placed before using_history(). [ruby-core:40641] [Bug #5539]
 
-	* Makefile.in, common.mk, configure.in: fix for platforms without
-	  rm. patches from Yutaka kanemoto <kinpoco at gmail.com>.
-	  [ruby-dev:29215]
+Mon Jan  2 23:47:58 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug  7 17:56:59 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* tool/rbinstall.rb (install_recursive, bin-comm): split mere
+	  string not path name.  [ruby-core:40462] [Bug #5492]
 
-	* ext/bigdecimal/bigdecimal.c, ext/digest/rmd160/rmd160ossl.c,
-	  ext/digest/sha1/sha1ossl.c, ext/readline/readline.c: move
-	  incluion of config.h to pacify AIX.  a patch from Yutaka
-	  Kanemoto <kinpoco at gmail.com>.  [ruby-dev:29197]
+Mon Jan  2 23:41:57 2012  Tajima Akil <artonx@yahoo.co.jp>
 
-Mon Aug  7 15:55:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/Makefile.sub (CONFIG_H): have stdint.h if VC2010.
+	  [Bug #5243]
 
-	* ext/syck/syck.c (syck_move_tokens): should avoid negative
-	  memmove.  [ruby-list:42625]
+Mon Jan  2 21:40:45 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Aug  7 14:37:48 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* tool/merger.rb (#version_up): version.h date should be Japanese
+	  locale date.
 
-	* configure.in, common.mk: AIX link issue.  a patch from Yutaka
-	  Kanemoto <kinpoco at gmail.com>.  [ruby-dev:29190]
+Mon Jan  2 21:36:56 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* ext/socket/socket.c: AIX socket support.  [ruby-dev:29190]
+	* configure.in: check -fno-omit-frame-pointer acceptance and usage
+	  under MinGW. [ruby-core:39957] [Bug #5407]
 
-Mon Aug  7 12:05:28 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jan  2 20:05:10 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* dln.c, eval.c, gc.c, regex.c, ruby.h: shut up AIX alloca
-	  warning.  a patch from Yutaka Kanemoto <kinpoco at gmail.com>.
-	  [ruby-dev:29191]
+	* include/ruby/ruby.h (SIZE_MAX): define SIZE_MAX if not defined.
+	  patched by The Written Word Inc. [ruby-core:40422] [Bug #5489]
 
-Sun Aug  6 20:40:41 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Mon Jan  2 20:00:01 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/date/format.rb (str[fp]time): %[EO]U didn't denote %U.
+	* ext/pty/pty.c (pty_check): should return nil until the child
+	  terminates or stops.  [ruby-dev:44600] [Bug #2642]
 
-Sat Aug  5 17:07:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jan  2 19:27:18 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* parse.y (top_local_setup): local_vars[-1] should point
-	  ruby_scope itself to protect local_tbl from garbage collection.
-	  [ruby-dev:29049]
+	* thread.c (update_coverage): skip coverage count up if the current
+	  line is out of the way.  rb_sourceline() is unreliable when source
+	  code is big.  [ruby-dev:44413]
 
-Sat Aug  5 13:54:03 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* test/coverage/test_coverage.rb: add a test for above.
 
-	* lib/date/format.rb (str[fp]time): "%\n" means "\n".
+Mon Jan  2 19:08:54 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Aug  4 15:21:00 2006  Eric Hodel  <drbrain@segment7.net>
+	* thread_pthread.c (gvl_yield): don't prevent concurrent sched_yield().
+	  [Bug #5130] [ruby-core:38647]
 
-	* lib: Merge RDoc and .document from HEAD.
-	* lib/drb/ssl.rb: Close socket on SSLError [ruby-core:7197]
+Mon Jan  2 18:54:52 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Aug  4 19:13:41 2006  Keiju Ishitsuka  <keiju@ruby-lang.org>
+	* win32/configure.bat: disable delayed expansion of enironment variable.
+	  [Bug #5517] [ruby-core:40531]
 
-	* lib/irb/{init.rb,ruby-lex.rb,slex.rb}: can't input '\c' for
-	  [ruby-core: 7122].
+Wed Dec 28 11:22:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug  4 14:02:14 2006  James Edward Gray II  <james@grayproductions.net>
+	* lib/fileutils.rb (FileUtils::Entry_#entries): use utility method
+	  instead of typoed regexp.  [ruby-core:41829] [Bug #5817]
 
-	* lib/date/format.rb (__strptime, strftime): allow multi-line patterns
-	  in Date#strftime the same as Time#strftime accepts.
-	  fixed: [ruby-core:08466]
+Thu Dec 15 10:44:54 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug  4 13:56:51 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_reject_bang, rb_ary_delete_if): update rdoc.
+	  documentation from Thomas Leitner <t_leitner AT gmx.at> in
+	  [ruby-core:41616].  [Bug #5752]
 
-	* pack.c (pack_pack): check argument overrun for 'P'.  based on a
-	  patch by rucila <rucila at yahoo.cojp>.  fixed: [ruby-dev:29182]
+Wed Dec 14 15:28:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  1 17:44:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* transcode.c (str_encode): about the extension of :fallback
+	  option since 1.9.3.
 
-	* win32/win32.c (init_stdhandle): assign standard file handles.
+Tue Oct  4 06:43:47 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Aug  1 12:24:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/lib/psych.rb: update psych version.
+	* ext/psych/psych.gemspec: generate new gemspec for new version.
 
-	* eval.c (Init_Binding): fix old commit miss.
+Tue Oct  4 06:29:55 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Jul 31 17:08:20 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/psych/lib/psych.rb: calling `yaml` rather than `to_yaml`.
+	* ext/psych/lib/psych/nodes/node.rb: Rename `to_yaml` to just `yaml`
+	  in order to avoid YAML::ENGINE switching from replacing this method.
+	* test/psych/helper.rb: fix tests for method name change.
+	* test/psych/test_document.rb: ditto
+	* test/psych/visitors/test_emitter.rb: ditto
 
-	* win32/win32.c (exit_handler): new function; release winsock and
-	  environment work area.
+Tue Oct  4 06:20:19 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* win32/win32.c (NTInitialize): setup exit_handler.
+	* ext/psych/lib/psych/scalar_scanner.rb: Match values against the
+	  floating point spec defined in YAML to avoid erronious parses.
+	* test/psych/test_numeric.rb: corresponding test.
 
-	* win32/win32.c (StartSockets): use exit_handler.
+Tue Oct  4 05:59:24 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* win32/win32.c (rb_w32_getenv): use GetEnvironmentStrings() instead
-	  of GetEnvironmentVariable(), because the latter cannot distinguish
-	  wheather a null environment variable exists or not.
-	  fixed: [ruby-talk:205123]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: ToRuby visitor can be
+	  constructed with a ScalarScanner.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: ScalarScanner can be
+	  passed to the YAMLTree visitor.
 
-Mon Jul 31 16:15:13 2006  Tanaka Akira  <akr@fsij.org>
+Tue Oct  4 05:47:23 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* test/ruby/test_process.rb (TestProcess#test_rlimit_nofile):
-	  setrlimit may fail with EINVAL.
-	  reported by MIYAMUKO Katsuyuki.  [ruby-dev:29174]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Define Regexp::NOENCODING
+	  for 1.9.2 backwards compatibility.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Fix Date string
+	  generation for 1.9.2 backwards compatibility.
 
-Mon Jul 31 13:38:22 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Sep  2 04:05:25 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/webrick/httprequest.rb (WEBrick::HTTPReuqest#parse_uri): improve
-	  for the value of IPv6 address in the Host: header field.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: emit strings tagged as
+	  ascii-8bit as binary in YAML.
+	* test/psych/test_string.rb: corresponding test.
 
-Mon Jul 31 09:22:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Dec  7 19:04:22 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h: use ifdef (or defined) for macro constants that may or
-	  may not be defined to shut up gcc's -Wundef warnings.
-	  [ruby-core:08447]
+	* configure.in (rpath): fix typo in the help string.  a patch from
+	  Yuji Yamano <yyamano AT kt.rim.or.jp> in [ruby-list:48568].
 
-Sun Jul 30 23:26:22 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 30 18:22:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_call0): trace call/return of method defined from block.
-	  fixed: [ruby-core:08329]
+	* complex.c (nucomp_rationalize): fix function.  [ruby-core:40667]
+	  [Bug #5546]
 
-	* eval.c (rb_trap_eval): make the current thread runnable to deal with
-	  exceptions which occurred within the trap.  fixed: [ruby-dev:27729]
+Thu Nov 17 10:36:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/cgi/session.rb, lib/cgi/session/pstore.rb: suppress warnings.
-	  fixed: [ruby-talk:204896]
+	* ext/psych/lib/psych.rb (load_file): make sure opened yaml files are
+	  also closed. [ruby-core:41088]
 
-Sat Jul 29 06:12:06 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Nov 30 02:58:46 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/tk/lib/multi-tk.rb: freeze ip_name for security reason.
+	* numeric.c (dbl2ival): Fix Float#divmod and #round for 32 bit
+	  platform. part 1 of [bug #5276]
 
-Sat Jul 29 01:23:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Nov 30 02:58:46 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* lib/logger.rb: improves the amount of documentation that Rdoc
-	  picks up when processing logger.rb by moving the require
-	  statement back before the comment block.  a patch from Hugh
-	  Sasse <hgs at dmu.ac.uk>.  [ruby-core:08422]
+	* numeric.c (flo_round): Fix criteria for 32 bits platform
+	  part 2 of [bug #5276]
 
-Thu Jul 27 22:21:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 30 02:37:32 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* time.c (time_to_s): fixed format mismatch.
+	* numeric.c (flo_round): Make Float#round round big values [bug
+	  #5272]
 
-Thu Jul 27 21:19:54 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Nov 30 02:37:32 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (domain_check): a new function to check domain error
-	  explicitly for systems that return NaN like FreeBSD.
-	  [ruby-core:07019]
+	* numeric.c (flo_round): substitute machine dependent magic number.
 
-	* math.c (math_acos, math_asin, math_acosh, math_atanh, math_log,
-	  math_log10, math_sqrt): use domain_check().
+Wed Nov 30 02:28:22 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* math.c (math_sqrt): fix documentation flaw.
+	* numeric.c (int_round): Integer#round always returns an Integer [Bug
+	  #5271]
 
-Thu Jul 27 18:12:12 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri Nov  4 01:56:30 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* time.c: need to declare time_utc_offset.
+	* io.c (make_writeconv): unversal_newline converter is for reading.
+	  so, if the io is text mode and has ECONV_UNIVERSAL_NEWLINE_DECORATOR
+	  flag, use crlf_newline converter for writing.
+	  this change fixes the problem about the luck of CR up Kernel.p and
+	  Kernel.puts to stdout/stderr on Windows.
 
-Thu Jul 27 17:01:01 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Nov  7 23:39:23 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-	* io.c (io_close): always calls "close" method of the receiver.
-	  [ruby-core:6911] [ruby-core:8112]
+	* io.c (io_fflush): remove fsync().
+	* io.c (rb_io_flush, rb_io_rewind): fsync() here.
+	  These pathces are backports of trunk r33651 for [Bug #5585]
 
-Thu Jul 27 16:49:01 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct 10 22:33:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* time.c (time_to_s): use +0900 style timezone string for local time.
-	  [ruby-dev:29143]
+	* test/-ext-/old_thread_select/test_old_thread_select.rb:
+	  select() with timeout may return early in old Linux kernels
+	  with 250 Hz tickrate and no dynticks, so skip everything older
+	  than 2.6.32 (which has long term support).
+	  And, Make the timing assertions consistently use assert_operator with
+	  timing difference in error message
+	  Patch by Eric Wong. [Bug #5335] [ruby-core:39618]
 
-Thu Jul 27 16:41:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Oct  4 16:17:50 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl.h: move <ruby.h> inclusion point to shut up
-	  Solaris compiler.  [ruby-core:08114]
+	* lib/time.rb (Time.strptime): use Time.at if d[:seconds] is set.
+	  Reported by Christopher Eberz. [ruby-core:39903] Bug #5399
 
-Wed Jul 26 22:20:59 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Oct  4 11:44:10 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* configure.in: add support for as and ASFLAGS.  [ruby-dev:29138]
+	* gc.c (rb_gc_set_params): ruby_verbose can be Qnil, so use RTEST.
 
-Wed Jul 26 22:13:45 2006  Minero Aoki  <aamine@loveruby.net>
+Mon Oct  3 23:56:39 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/net/http.rb: sync with HEAD (rev 1.132).
+	* gc.c (rb_gc_set_params): output GC parameter change messages only
+	  if -w/-v options are specified. these messages are output to stderr,
+	  not to stdout. [ruby-core:39795] [Bug #5380]
 
-	* lib/net/http.rb (Net::HTTP#post, request_post, request): should
-	  set Content-Type: x-www-form-urlencoded by default.
+	* test/ruby/test_gc.rb (test_gc_parameter): add test for it.
 
-	* lib/net/http.rb (Net::HTTPHeader#content_type): should return
-	  nil when there's no Content-Type.
+Wed Sep 28 09:14:16 2011  Nobuyoshi Nakada  <>
 
-	* lib/net/http.rb (Net::HTTPHeader#sub_type): should return nil
-	  when there's no sub Content-Type (e.g. "Content-Type: text").
+	* configure.in (pthread_np.h): needs pthread.h to be included
+	  previously on OpenBSD.  a patch by George Koehler <xkernigh AT
+	  netscape.net> at [ruby-core:39752].  [Bug #5376]
 
-	* lib/net/http.rb (Net::HTTPHeader#type_params): wrongly failed
-	  when there's no Content-Type.
+Tue Sep 13 15:02:48 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jul 26 18:35:38 2006  Minero Aoki  <aamine@loveruby.net>
+	* lib/pstore.rb (PStore): always open in binary mode even if
+	  default encodings are set.  [Bug #5311] [ruby-core:39503]
 
-	* ext/strscan/strscan.c: sync with HEAD (rev 1.25).
+Sat Oct  8 07:31:42 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/strscan/strscan.c (strscan_do_scan):
-	  StringScanner.new("").scan(//) should return "". [ruby-Bugs:4361]
+	* array.c (ary_join_1): should not copy the encoding of non-string
+	  element after string element.  [ruby-core:39776] [Bug #5379]
 
-Wed Jul 26 18:14:19 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct  8 06:51:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/pty/pty.c (getDevice): retry once after GC on failure.
-	  [ruby-core:08282]
+	* lib/rubygems:  Update to RubyGems 1.8.11.  Move Deprecate into the
+	  Gem namespace.
 
-Wed Jul 26 17:28:16 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct  8 06:37:08 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* sprintf.c (rb_f_sprintf): prepend ".." to %u for negative bignum,
-	  but not "-".  fixed: [ruby-core:08167]
+	* gc.c (rb_gc_set_params): output GC parameter change messages only
+	  if -w/-v options are specified. these messages are output to stderr,
+	  not to stdout. [ruby-core:39795] [Bug #5380]
 
-Wed Jul 26 16:39:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_gc.rb (test_gc_parameter): add test for it.
 
-	* string.c (rb_str_scan): add string modification check.
-	  [ruby-core:7216]
+Sat Oct  8 06:26:24 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Wed Jul 26 16:06:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (add_heap_slots, init_heap): reset heaps_inc zero when
+	  heap slots are expanded by environment variable RUBY_HEAP_MIN_SLOTS.
+	  [ruby-core:39777] [Bug #5380]
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): check
-	  multipart boundary end.  a patch from Fujioka <fuj at rabbix.jp>
-	  [ruby-dev:28470]
+	* test/ruby/test_gc.rb (test_gc_parameter): add test for it.
 
-Wed Jul 26 01:02:59 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/envutil.rb (assert_normal_exit): add :child_env option to
+	  enable pass environemnt variables to child process.
 
-	* configure.in: suppress warnings by automake 1.8 or later.
+Sat Oct  8 05:45:28 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Jul 25 00:30:06 2006  Eric Hodel  <drbrain@segment7.net>
+	* proc.c (proc_call):  Update documentation to match argument handling
+	  of proc/Proc.new/lambda/->()
 
-	* lib/prettyprint.rb: RD to RDoc conversion by Hugh Sasse.
+Sat Oct  8 05:38:29 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Jul 25 14:49:51 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* proc.c (proc_call):  Fix documentation of Proc#call vs Proc#===.
+	  [Ruby 1.9 - Bug #5349]
 
-	* lib/mkmf.rb (configuration): typo.
+Tue Sep 27 13:05:39 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Tue Jul 25 13:14:32 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_asn1.c: fix int_ossl_asn1_decode0_cons when being
+	  fed arbitrary string values.
+	  Clearly distinguish between the cases "universal, infinite and
+	  not a SEQUENCE or SET" and "universal SEQUENCE or SET, possibly
+	  infinite". Raise error for universal tags that are not infinite.
+	* test/openssl/test_asn1.rb: add a test for this.
 
-	* process.c (rb_proc_times): rename hz to hertz to avoid name
-	  crash on AIX.  [ruby-dev:29126]
+	  Thanks to Hiroshi Yoshida for reporting this bug.
+	  [Bug #5363] [ruby-dev:44542]
 
-Mon Jul 24 22:03:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Sep 17 23:34:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (backtrace): skip frames successive on node and method name.
+	* parse.y (parser_data_type): inherit the core type in ripper so
+	  that checks in core would work.  [ruby-core:39591] [Bug #5331]
 
-Mon Jul 24 17:55:55 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Sep 23 14:15:01 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* process.c (rb_f_system): add security check.  [ruby-talk:202947]
+	* ext/openssl/ossl_asn1.c
+	  ext/openssl/ossl_pkey.c: Remove unused variables.
 
-	* process.c (rb_f_system): move signal right before fork to avoid
-	  signal handler intervention.
+Fri Sep 23 06:54:44 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Mon Jul 24 15:51:52 2006  Tanaka Akira  <akr@fsij.org>
+	* backport r33315 from trunk.
 
-	* ext/readline/readline.c (readline_readline): rl_deprep_term_function
-	  may be NULL with libedit.  reported by Ryan Davis.  [ruby-dev:29070]
+	* test/openssl/test_ssl_session.rb: execute test_session_exts_read
+	  only for OpenSSL versions >= 0.9.8k. Thanks, Eric Wong, for
+	  reporting this.
+	  [Bug #4961] [ruby-core:37726]
 
-Mon Jul 24 15:19:55 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Sep 23 12:18:52 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* eval.c (rb_call0): revert last change.  [ruby-dev:29112]
-	  [ruby-core:08374]
+	* backport r33311 from trunk.
 
-Sun Jul 23 22:59:49 2006  Tanaka Akira  <akr@fsij.org>
+	* test/openssl/test_ssl_session.rb: ensure server calls callbacks in
+	  test_ctx_server_session_cb. Thanks to Eric Wong for the patch.
+	  [Bug #5336] [ruby-core:39619]
 
-	* test/socket/test_unix.rb: disabled on cygwin.
-	  reported by Kouhei Yanagita.  [ruby-dev:29080]
+Thu Sep 22 19:45:22 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Fri Jul 21 21:21:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c (ubf_select): activate timer thread when interrupt
+	  blocking thread.
+	  A patch created by Koichi Sasada. [ruby-core:39634] [Bug #5343]
+	  to cover race condition, timer thread periodically send SIGVTARLM to
+	  threads in signal thread list. so you should activate timer thread
+	  when interrupt a thread.
 
-	* eval.c (rb_call0): include funcalled methods in caller list.
-	  fixed: [ruby-core:08290]
+Wed Sep 21 16:57:03 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jul 21 12:11:00 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/io/wait/test_io_wait.rb (TestIOWait#setup): of course, the
+	  behavior of mingw is just same with mswin.
 
-	* ext/extmk.rb, lib/mkmf.rb (with_destdir): remove drive letter before
-	  prepending destdir on DOSISH.
+Sat Sep 17 22:21:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 20 15:07:14 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm.c (rb_vm_make_env_object, rb_vm_get_sourceline): export as a
+	  workaround for ruby-debug19 for the time being.
+	  [ruby-core:38972] [Bug #5193]
 
-	* ruby.h: export classes/modules to implement sandbox.
-	  [ruby-core:08283]
+Fri Sep 16 01:08:19 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Jul 20 00:06:29 2006  Keiju Ishitsuka  <keiju@ishitsuka.com>
+	* NEWS: cosmetic changes.
 
-	* lib/irb/completion.rb: support for completion of numeric
-    	  number. [ruby-dev: 29038]
+Wed Sep 14 12:39:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Jul 19 23:53:05 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* configure.in: do not use gcc-4.2 as the default compiler.
 
-	* lib/rss/parser.rb, lib/rss/utils.rb: added documents.
+	* NEWS: describe the issue about Xcode.
 
-Tue Jul 18 22:10:13 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 14 11:46:30 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* process.c (rb_f_system): block SIGCHLD during the process
-	  execution, like glibc system(3) does.  [ruby-talk:202361]
+	* thread.c (rb_fd_rcopy): added an argument guard.
+	  Patch by NAKAMURA Usaku. [Bug #5306] [ruby-core:39435]
 
-Tue Jul 18 23:12:14 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Sep 13 09:28:58 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/win32.c (open_ifs_socket): should not use plain malloc.
+	* NEWS: wrote about rb_reserved_fd_p() and objspace.
 
-	* win32/win32.c (rb_w32_opendir): should not use plain realloc.
+Mon Sep 12 20:47:52 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 18 18:05:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_thread_select): fix a typo to initialize efds
+	  properly.  [Bug #5299] [ruby-core:39380]
 
-	* test/ruby/test_float.rb (TestFloat::test_strtod): update test to
-	  conform strtod change.
+Mon Sep 12 20:41:20 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Jul 18 15:49:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_thread_select): fix to ignore an argument
+	  modification of rb_thread_fd_select().
+	  based on a patch by Eric Wong. [Bug #5306] [ruby-core:39435]
+	* thread.c (rb_fd_rcopy): New. for reverse fd copy.
 
-	* pack.c (pack_unpack): propagate association array to copied
-	  string.  [ruby-core:08223]
+	* test/-ext-/old_thread_select/test_old_thread_select.rb
+	(test_old_select_false_positive): test for bug5306.
 
-	* pack.c (pack_unpack): return referenced string itself if it has
-	  same length as specified.  a patch from <nobu at ruby-lang.org>
-	  in [ruby-core:08225].
+	* ext/-test-/old_thread_select/old_thread_select.c (fdset2array):
+	  New. convert fdsets to array.
+	* ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
+	  return 'read', 'write', 'except' argument of rb_thread_select()
+	  to ruby script.
 
-	* pack.c (pack_pack): taint 'p' packed strings.
+Tue Sep  6 13:15:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 18 14:03:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* encoding.c (load_encoding): predefined encoding names are safe.
+	  [ruby-dev:44469] [Bug #5279]
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer::unmount): remove
-	  inpect argument from sprintf.  [ruby-dev:29039]
+	* transcode.c (load_transcoder_entry): ditto.
 
-Tue Jul 18 10:53:37 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep  9 16:02:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* object.c (rb_cstr_to_dbl): limit out-of-range message.
+	* insns.def (concatstrings): don't use initial ASCII-8BIT string.
+	  [ruby-core:38635] [Bug #5126]
 
-	* util.c (ruby_strtod): return end pointer even if ERANGE occurred.
-	  fixed: [ruby-dev:29041]
+Thu Sep  8 21:17:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Jul 18 00:43:05 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/nkf/nkf-utf8/nkf.c: import nkf 2.1.2 (be9c280)
+	  Bump version number/release date only.
 
-	* util.c (ruby_strtod): stop at dot not followed by digits.
-	  fixed: [ruby-dev:29035]
+Wed Sep  7 23:42:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 18 00:01:27 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (argf_next_argv): open in default text mode.
+	  [ruby-core:39234] [Bug #5268]
 
-	* ext/extmk.rb: remove LIBRUBY_SO if static linked extensions exist.
+Mon Sep  5 15:06:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Jul 17 23:30:46 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rubygems/test_gem_security.rb
+	  (test_class_build_self_signed_cert): reset opt[:trust_dir] to apply
+	  temporary Gem.user_home.
 
-	* configure.in (rb_cv_msvcrt): defaulted to msvcrt.  Workaround for a
-	  bug of cygwin 1.5.20.
+Sun Sep  4 00:56:58 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-Mon Jul 17 13:43:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* backport r33177 from trunk.
 
-	* pack.c (define_swapx): should not use plain malloc.
+	* test/ruby/test_fiber.rb (TestFiber#test_no_valid_cfp):
+	  add a test. Unlike TestThread#test_no_valid_cfp,
+	  this test succeeds even if win32ole is required (see r33153).
 
-Mon Jul 17 12:58:41 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri Sep  2 21:11:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in: should use ac_cv_lib_dl_dlopen=no on MinGW.
+	* io.c (validate_enc_binmode, prep_stdio): default to text mode on
+	  dosish platforms.  [ruby-core:38822] [Bug #5164]
 
-Sat Jul 15 23:50:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* transcode.c (rb_econv_prepare_options): keep default ecflags
+	  unchanged if no options.
 
-	* eval.c (rb_require_safe): wait for another thread requiring the same
-	  feature.  fixed: [ruby-core:08229]
+Fri Sep  2 14:36:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jul 15 01:27:13 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_search_const_defined_class): search
+	  ancestors only when global scope.  [ruby-core:39227] [Bug #5264]
 
-	* dir.c (has_magic): glob names contain alphabets to enable case fold
-	  search also for directories.  fixed: [ruby-talk:201917]
+Fri Sep  2 09:58:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jul 15 01:09:22 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (parser_tokadd_string, parser_yylex): ignore a backslash
+	  which prefixes an non-ascii character, which has no escape
+	  syntax.  [ruby-core:39222] [Ruby 1.9 - Bug #5262]
 
-	* st.c (malloc): use xmalloc/xcalloc instead of plain
-	  malloc/calloc, to detect memory allocation failure.  see
-	  <http://www.nongnu.org/failmalloc/>.
+Thu Sep  1 17:31:22 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (rb_memerror): should not raise empty nomem_error.
+	* insns.def (defineclass), vm_insnhelper.c (vm_get_cvar_base): see
+	  also inherited constants for classes without superclass and
+	  modules.  [ruby-core:37698] [Bug #3423]
 
-Fri Jul 14 13:08:13 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Sep  1 14:11:16 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: add methods for new features of latest Tcl/Tk8.5.
+	* test/ruby/test_thread.rb (TestThread#test_no_valid_cfp): skip when
+	  win32ole is required.  in such case, win32ole redefines
+	  Thread#initialize, and the block argument becomes to be not the top
+	  of the thread, then this testcase always fails.
 
-	* ext/tk/lib/tk/namespace.rb: ditto.
+Wed Aug 31 16:02:45 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Jul 14 02:30:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/json: Merge json gem v1.5.4 (3dab4c5a6a97fac03dac).
 
-	* lib/monitor.rb: document patch from Hugh Sasse <hgs at dmu.ac.uk>.
-	  [ruby-core:08205]
+Wed Aug 31 13:19:31 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Fri Jul 14 01:09:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* numeric.c (flo_round): Avoid overflow by optimizing for trivial
+	  cases
+	  [Bug #5227]
 
-	* parse.y (then): error in warning action.
+Wed Aug 31 06:45:32 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 14 00:10:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in: fix r32835. $withval can't be used outer AC_ARG_WITH().
 
-	* array.c (rb_ary_pop): may cause realloc oscillation.  a patch
-	  from MORITA Naoyuki <mlgetter at kidou.sakura.ne.jp>.
-	  [ruby-dev:29028]
+Wed Aug 31 05:29:03 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Jul 13 22:23:56 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* win32/win32.c (rb_w32_select_with_thread): and my typo. we all must
+	  be more careful.
 
-	* ext/tk/lib/tk/composite.rb: improve handling of the classname on the
-	  option database for the widget class which includes TkComposite.
+Wed Aug 31 05:28:45 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Jul 13 20:32:19 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* thread.c (rb_thread_select): critical typo in r33117.
 
-	* lib/rss/parser.rb: updated documents by a patch from
-	  Hugh Sasse <hgs at dmu.ac.uk>. [ruby-core:8194]
+Wed Aug 31 05:28:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jul 12 13:54:09 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/-ext-/old_thread_select/test_old_thread_select.rb
+	  (TestOldThreadSelect#test_old_select_read_timeout): if the machine
+	  is fast enough, the time used by code around IO.select may be smaller
+	  than Time implement threshold.
 
-	* parse.y (then): we'd like to reserve colon here for the future.
-	  warning added.
+Wed Aug 31 05:27:59 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jul 11 20:58:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
+	  typo.
 
-	* ruby.h: export rb_cMethod.  [ruby-talk:201259]
+	* test/-ext-/old_thread_select/test_old_thread_select.rb
+	  (TestOldThreadSelect#test_old_select_signal_safe): use SIGINT instead
+	  of SIGUSR1 because the former is general and the latter is platform
+	  dependent.
 
-Tue Jul 11 19:13:33 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Aug 31 05:26:30 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: remove restriction on the class of
-	  pseudo-toplevel.
+	* win32/win32.c, include/ruby/intern.h (rb_w32_fd_copy): implement
+	  for rb_thread_select() in thread.c.  the use of rb_fd_copy() is
+	  introduced in r33117.
+	  [Bug #5229] [ruby-core:39102]
 
-Tue Jul 11 18:00:57 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread.c (rb_thread_select): must call rb_fd_init() before using
+	  rb_fdset_t.  see the implementations of rb_fd_init()s if you want to
+	  know the reason.
 
-	* ext/tk/lib/multi-tk.rb: security fix.
+Tue Aug 30 11:25:21 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Jul 11 17:33:39 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/json: Merge json gem 1.5.4+ (2149f4185c598fb97db1).
+	  [Bug #5173] [ruby-core:38866]
 
-	* string.c (rb_str_dump): need to extend len for \b.
+Tue Aug 30 09:53:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jul 10 22:00:00 2006  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* cont.c (fiber_entry): fix stack allocation failure on Debian
+	  GNU/kFreeBSD.
+	  Patch by Lucas Nussbaum <lucas at lucas-nussbaum dot net>.
+	  [Bug #5241] [ruby-core:39147]
 
-	* ext/bigdecimal/bigdecimal.c: Allows '_' to appear within
-	  digits.  [ruby-dev:28872]
+Tue Aug 30 09:52:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/bigdecimal/lib/bigdecimal/util.rb: Bug in to_r reported by
-	  [ruby-list:42533] fixed.
+	* backport r33117 from trunk.
 
-Mon Jul 10 19:22:19 2006  Tanaka Akira  <akr@fsij.org>
+	* thread.c (rb_thread_select): rewrite by using
+	  rb_thread_fd_select(). old one is EINTR unsafe.
+	  Patch by Eric Wong. [Bug #5229] [ruby-core:39102]
 
-	* gc.c (gc_sweep): expand heap earlier.
-	  reported by MORITA Naoyuki.  [ruby-dev:28960]
+	* test/-ext-/old_thread_select/test_old_thread_select.rb:
+	  a testcase for rb_thread_select().
+	* ext/-test-/old_thread_select/old_thread_select.c: ditto.
+	* ext/-test-/old_thread_select/depend: ditto.
+	* ext/-test-/old_thread_select/extconf.rb: ditto.
 
-Mon Jul 10 18:59:34 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Aug 30 09:16:17 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/font.rb: sorry. mistaken to patch.
+	* configure.in: fix a build failure on GNU Hurd.
+	  Patch by Samuel Thibault <sthibault at debian dot org>. Thank you!
+	  [Bug #5250] [ruby-core:39185]
 
-Mon Jul 10 18:46:52 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Aug 28 15:38:17 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/tk/tcltklib.c: make SEGV risk lower at exit.
+	* backport r33106 from trunk.
 
-	* ext/tk/lib/tk.rb: ditto.
+	* ext/date/date_parse.c (date_zone_to_diff): keep a temporary string
+	  stored in variable while the contents buffer is beeing used.
 
-	* ext/tk/lib/multi-tk.rb: fail to call function-style methods on slave
-	  interpreters. The strategy (MultiTkIp_PseudoToplevel_Evaluable) to
-	  fix the problem is a little tricky. You may have to take care of
-	  conflicting with it.
+	* ext/date/date_parse.c (date_zone_to_diff): get rid of out of bounds
+	  memory read. [ruby-dev:44409] [Bug #5213]
 
-	* ext/tk/lib/tk.rb: a little change for the pseudo-toplevel strategy.
+Sun Aug 28 05:29:50 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* ext/tk/lib/tk/font.rb: ditto.
+	* backport r33102 from trunk.
 
-	* ext/tk/lib/tk/msgcat.rb: ditto.
+	* lib/minitest/*: Imported minitest 2.5.1 (r6596)
+	* test/minitest/*: ditto
 
-	* ext/tk/lib/tkextlib/itk/incr_tk.rb: ditto.
+Sat Aug 27 20:54:54 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* ext/tk/sample/demos-en/widget: fail to call function-style methods
-	  on sample scripts. To fix it, a strategy which similar to the way
-	  on MultiTiIp is used. Please take care when re-write and re-run a
-	  demo script on the Widget-Demo code viewer.
+	* backport r33099 from trunk.
 
-	* ext/tk/sample/demos-jp/widget: ditto.
+	* vm.c (rb_vm_rewrite_dfp_in_errinfo): change return type
+	  to suppress a warning.
 
-Mon Jul 10 13:58:40 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_core.h: ditto.
 
-	* signal.c (ruby_nativethread_signal, posix_nativethread_signal,
-	  sigsend_to_ruby_thread, install_nativethread_sighandler):
-	  nativethread-support on signal handler. RE-backport from 1.9.
+Sat Aug 27 19:03:44 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
+	* backport r33096 from trunk.
 
-	* eval.c (ruby_native_thread_kill): ditto.
+	* proc.c (proc_new): force to rewrite errinfo when calling Proc.new in ensure.
+	  [Bug #5234] [ruby-core:39125]
 
-Mon Jul 10 10:54:14 2006  Ryan Davis  <ryand@zenspider.com>
+	* vm.c (rb_vm_rewrite_dfp_in_errinfo): new function.
 
-	* lib/rdoc/parsers/parse_f95.rb: massive overhaul from Yasuhiro
-	  Morikawa including new file suffixes, function support, public
-	  variables and constants, derived-types, defined operators and
-	  assignments, namelists, and subroutine and function
-	  arguments. Truly massive.
+	* vm.c (vm_make_env_each): changed accordingly.
 
-	* lib/rdoc/diagram.rb: diagrams are now cached.
+	* vm_core.h: ditto.
 
-	* lib/irb/completion.rb: fixed a crasher when completing against
-	  an unnamed class/module.
+	* bootstraptest/test_flow.rb: add tests for above.
 
-	* lib/rdoc/parsers/parse_c.rb: private comment (--/++) support in
-	  C-file rdoc.
+Sat Aug 27 08:59:12 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/debug.rb: minor clarification in help.
+	* NEWS:  Update version of rake to 0.9.2.2.
 
-	* lib/pp.rb: minor clarification on exception.
+Sat Aug 27 08:44:58 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Jul 10 09:29:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* backport r33087 from trunk
 
-	* eval.c (rb_clear_cache_for_undef): clear entries for included
-	  module.  fixed: [ruby-core:08180]
+	* lib/rdoc:  Import RDoc 3.9.4.  Typo and grammar fixes by Luke Gruber.
+	  [Ruby 1.9 - Bug #5203]
 
-Mon Jul 10 01:48:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Aug 27 07:53:34 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* st.h (st_data_t): use pointer sized integer for st_data_t.
-	  [ruby-dev:28988]
+	* backport r33087 from trunk.
 
-Sun Jul  9 18:06:47 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/open-uri.rb:  Fix indentation of OpenURI::OpenRead#open.  Use ++
+	  instead of `' for method arguments in open-uri.rb
 
-	* lib/mkmf.rb (try_constant): fix for value 1 at cross compiling.
+Sat Aug 27 07:22:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (create_makefile): prevent substitution of macro
-	  definition.  fixed: http://www.yotabanana.com/lab/20060624.html#p02
+	* backport r33086 from trunk.
 
-Sun Jul  9 00:54:34 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/pathname/lib/pathname.rb:  Fix typos and grammar mistakes.  Patch
+	  by Luke Gruber.  [#5203]
+	* ext/pty/lib/expect.rb:  ditto
+	* lib/mathn.rb:  ditto
+	* lib/net/http.rb:  ditto
+	* lib/open-uri.rb:  ditto
+	* lib/ostruct.rb:  ditto
+	* lib/tempfile.rb:  ditto
+	* lib/thread.rb:  ditto
+	* lib/weakref.rb:  ditto
+	* sample/webrick/httpproxy.rb:  ditto
 
-	* eval.c (next_jump): deal with destination of next.
-	  fixed: [ruby-core:08169]
+Fri Aug 26 10:10:37 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Jul  7 00:38:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* backport r33074 from trunk.
 
-	* hash.c (rb_hash_default): should not call default procedure if
-	  no key is given.  [ruby-list:42541]
+	* lib/rubygems:  Update to RubyGems 1.8.10.  Fixes security issue in
+	  creating ruby-format gemspecs.  Fixes Gem.dir not being at the front
+	  of Gem.path to fix uninstall and cleanup commands.  Fixes gem
+	  uninstall stopping on the first missing gem.
 
-Fri Jul  7 00:29:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Aug 24 09:49:10 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* time.c (time_mload): a patch from Daniel Berger
-	  <Daniel.Berger at qwest.com>.  [ruby-core:08128]
+	* backport r33045 from trunk.
 
-Thu Jul  6 22:21:57 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* insns.def (defined): fix to checking class variable.
+	  A patch by Magnus Holm <judofyr@gmail.com>.  Thanks!
 
-	* process.c (rb_proc_times): use sysconf(_SC_CLK_TCK) value prior to
-	  HZ and CLK_TCK.  fixed: [ruby-talk:200293]
+Fri Aug 26 08:21:10 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Jul  6 22:17:21 2006  Minero Aoki  <aamine@loveruby.net>
+	* test/ruby/test_variable.rb: add a test for above.
 
-	* ext/racc/cparse/cparse.c: sync with original code, rev 1.8.
+Thu Aug 25 09:43:16 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/racc/cparse/cparse.c: should mark CparseParams objects.
+	* backport r33066 from trunk.
 
-	* lib/racc/parser.rb: sync with original code, rev 1.8.
+	* ext/openssl/lib/openssl/bn.rb:  Hide copyright info from RDoc.
+	* ext/openssl/lib/openssl/digest.rb:  ditto
+	* ext/openssl/lib/openssl/cipher.rb:  ditto
 
-	* lib/racc/parser.rb: update coding style.
+Thu Aug 25 09:25:48 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Jul  3 19:04:38 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* backport r33065 from trunk.
 
-	* ext/tk/tcltklib.c (ip_make_menu_embeddable): help to make a menu
-	  widget embeddable (pack, grid, and so on) like as a general widget.
-	  However, an embeddable menu may require to be definied some event
-	  bindings for general use.
+	* ext/openssl/ossl_digest.c:  Document OpenSSL::Digest::digest and add
+	  an example to OpenSSL::Digest.  Patch by Sylvain Daubert.
+	  [Ruby 1.9 - Bug #5166]
+	* ext/openssl/lib/openssl/digest.rb (module OpenSSL):  ditto
 
-	* ext/tk/lib/tk/event.rb: [bug fix] Tk.callback_break and
-	  Tk.callback_continue don't work on MultiTkIp.
+Thu Aug 25 08:19:43 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+	* vm.c (vm_make_env_each): work around to solve Bug #2729.
+	  fixes: Bug #2729
+	  a patch from Kazuki Tsujimoto <kazuki@callcc.net>
+	  This problem is caused by changing dfp (dynamic env pointer)
+	  from saved dfp.  Saved dfp is pointed env in VM stack.  However,
+	  the dfp can be moved because VM copies env from VM stack to
+	  the heap.  At this copying, dfp was also changed.  To solve this
+	  problem, I'll try to change throw mechanism (not save target dfp,
+	  but save target cfp).
 
-	* ext/tk/lib/tk.rb: lack of Tk.callback_return.
+	* bootstraptest/test_flow.rb: add a test for above.
 
-	* ext/tk/lib/tk/menu.rb: improve creating clone menus.
+Thu Aug 25 08:04:08 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Mon Jul  3 14:42:06 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* numeric.c (int_round): Fix Integer#round [ruby-core:39096]
 
-	* ext/etc/extconf.rb (PW_UID2VAL, PW_GID2VAL): defaulted to conversion
-	  from int, and sys/types.h needs to be included before grp.h.
-	  fixed: [ruby-dev:28938]
+Thu Aug 25 06:51:08 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Jul  3 01:14:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/psych/lib/psych.rb: Fixing psych version number.
 
-	* string.c (rb_str_inspect): encode \b (\010) for escape.
-	  [ruby-dev:28927]
+Thu Aug 25 06:11:35 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* string.c (rb_str_dump): ditto.
+	* ext/psych/lib/psych/nodes/node.rb: default `to_yaml` encoding to be
+	  UTF-8.
+	* test/psych/test_encoding.rb: test yaml dump encoding.
 
-Sun Jul  2 19:17:56 2006  Minero Aoki  <aamine@loveruby.net>
+Wed Aug 24 08:53:06 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/racc/cparse/cparse.c: sync with original code (rev 1.7).
+	* backport r33043 from trunk.
 
-	* ext/racc/cparse/cparse.c: use rb_catch instead of rb_iterate.
-	  Giving a block to a Ruby-level method by rb_iterate is obsolete on
-	  Ruby 1.9.  Note that current cparse.c still includes one
-	  rb_iterate call on Ruby 1.8, but it is not a problem (at least
-	  just now).
+	* lib/rdoc:  Update to RDoc 3.9.3.  Fixes RDoc with `ruby -Ku`.  Allows
+	  HTTPS image paths to be turned into <img> tags.  Prevents special
+	  markup inside <tt> from being processed.
 
-Sat Jul  1 15:15:49 2006  Tanaka Akira  <akr@m17n.org>
+Wed Aug 24 07:57:43 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/socket/test_nonblock.rb: add timeout to send/receive
-	  an empty UDP packet.
-	  [ruby-dev:28820]
+	* backport r33040 from trunk.
 
-Fri Jun 30 23:46:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rubygems:  Update to RubyGems 1.8.9.  Fixes uninstalling multiple
+	  gems and gem cleanup.
 
-	* configure.in: should test isinf for Solaris with GCC compiler.
-	  a patch from <ville.mattila at stonesoft.com>.  [ruby-core:07791]
+Wed Aug 24 06:45:20 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* configure.in: -shared patch from Andrew Morrow
-	  <andrew.c.morrow at gmail.com>.  [ruby-core:08100]
+	* backport r33036 from trunk.
 
-Thu Jun 29 18:58:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/minitest/*: Imported minitest 2.5.0 (r6557)
+	* test/minitest/*: ditto
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_version): fix patch
-	  failure.
+Tue Aug 23 15:23:56 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Jun 29 18:00:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* backport r33027 from trunk.
 
-	* ext/bigdecimal/bigdecimal.c: add RDoc document.  a patch from
-	  mathew <meta at pobox.com>.   [ruby-core:07050]
+	* load.c (rb_f_require):  Improve documentation of Kernel#require.
+	  [Ruby 1.9 - Bug #5210]
 
-Wed Jun 28 15:47:14 2006  Eric Hodel  <drbrain@segment7.net>
+Tue Aug 23 15:11:48 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* lib/optparse.rb: RDoc patch from Robin Stocker <robin@nibor.org>
-	  [ruby-core:08087]
+	* backport r33023 from trunk.
 
-Wed Jun 28 19:04:34 2006  Tanaka Akira  <akr@m17n.org>
+	* ext/zlib/zlib.c (gzfile_read_header): Ensure that each section of
+	  gzip header is readable to avoid SEGV.
 
-	* test/socket/test_unix.rb: test_seqpacket_pair removed.
-	  [ruby-dev:28846]
+	* test/zlib/test_zlib.rb (test_corrupted_header): Test it.
 
-Tue Jun 27 23:03:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Aug 22 23:43:33 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* string.c: RDoc update for =~ method.  a patch from Alex Young
-	  <alex at blackkettle.org>.  [ruby-core:08068]
+	* backport r33021 from trunk.
 
-Tue Jun 27 22:47:18 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* sprintf.c (rb_str_format): add RB_GC_GUARD to prevent temporary
+	  strings from GC.
 
-	* ext/tk/tcltklib.c: forgot to update TCLTKLIB_RELEASE_DATE.
+Sun Aug 21 17:58:38 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* ext/tk/lib/tk.rb (tk_tcl2ruby): [bug fix] sometimes fail to convert
-	  a tcl string to a ruby object if the tcl string includes "\n".
+	* backport r33019 from trunk.
 
-Tue Jun 27 16:04:05 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* iseq.c (iseq_s_disasm): remove variable which is no longer used
+	  since r33013.
 
-	* win32/win32.h: define isascii on MinGW for msvcrt compatibility.
+Sun Aug 21 14:20:58 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* configure.in: set ac_cv_header_sys_time_h=no on MinGW
-	  for msvcrt compatibility.
+	* configure.in: use LD_LIBRARY_PATH_64 on 64-bit Solaris.
 
-Tue Jun 27 11:36:02 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Aug 21 11:13:54 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/etc/etc.c (setup_passwd, setup_group): allow bignum uid, gid and
-	  so on.  [ruby-talk:199102]
+	* backport r32895 from trunk.
 
-Mon Jun 26 13:37:27 2006  Eric Hodel  <drbrain@segment7.net>
+	* ext/fiddle/conversions.c (generic_to_value): ffi_arg and ffi_sarg
+	  should be used to handle shorter return value. fix [Bug #3861]
+	  [ruby-core:32504]
 
-	* lib/rdoc: Merge from HEAD.
-	  Add options to limit the ri search path.
+	* ext/fiddle/closure.c (callback): ditto
 
-Tue Jun 27 00:54:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/fiddle/conversions.h (fiddle_generic): ditto
 
-	* util.c (powersOf10): constified.
+	* ext/fiddle/conversions.c (value_to_generic): char, short and int
+	  are strictly distinguished on big-endian CPU, e.g. sparc64.
 
-Mon Jun 26 18:37:44 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Aug 20 13:28:32 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* ext/tk/tcltklib.c (ip_delete): fix SEGV when a slave-ip is
-	  deleted on callback.
+	* backport r33013 from trunk.
 
-Mon Jun 26 10:47:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* iseq.c (iseq_s_disasm): fix a bug that may cause SEGV.
 
-	* io.c (pipe_open): avoid closing uninitialized file descriptors.
-	  a patch from <tommy at tmtm.org> [ruby-dev:28600]
+	* test/ruby/test_method.rb (test_body): add a test for the above change.
 
-Mon Jun 26 09:56:22 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Aug 20 10:43:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.[ch] (rb_w32_send, rb_w32_sendto): constified.
+	* ext/stringio/stringio.c (strio_read): return new string if nil
+	  is explicitly given as a buffer ([Bug #5207]), otherwise set the
+	  encoding.  also removed dead code.
 
-Sun Jun 25 23:02:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Aug 19 14:25:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Makefile.in, mkconfig.rb: catch-up for latest autoconf.
+	* process.c (proc_spawn_v, proc_spawn): should not wait the
+	  spawned process.
 
-Sat Jun 24 06:35:00 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* process.c (proc_spawn_v): fix missing argument, and try with
+	  /bin/sh only if failed with ENOEXEC.
 
-	* signal.c: revert last change.
+Fri Aug 19 14:12:57 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ruby.h: ditto.
+	* backport r33007 from trunk.
 
-	* eval.c: ditto.
+	* lib/net/imap.rb (idle): raises a Net::IMAP::Error when the
+	  connection is closed.  based on the patch by Hugo Barauna.
+	  [Bug #5190] [ruby-core:38930]
 
-Thu Jun 22 11:52:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Aug 19 11:28:58 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/net/http.rb (Net::HTTPResponse): duplicated error 501;
-	  HTTPInternalServerError should be error 500.  [ruby-core:08037]
+	* backport r33001 from trunk.
 
-Thu Jun 22 05:15:58 2006  Tanaka Akira  <akr@m17n.org>
+	* lib/net/imap.rb (msg_att): accepts extra space before ')'.
+	  based on the patch by art lussos.  [Bug #5163] [ruby-core:38820]
 
-	* ext/socket/socket.c (sock_s_socketpair): try GC only once.
-	  [ruby-dev:28778]
+Wed Aug 17 15:27:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Jun 21 21:28:32 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* backport r32996 from trunk.
 
-	* lib/date.rb (jd_to_commercial): now works fine even if in
-	  mathn-ized context.
+	* ext/bigdecimal/bigdecimal.c (cannot_be_coerced_into_BigDecimal):
+	  add a new function for raising error when an object cannot coerce
+	  into BigDecimal.  [Bug #5172]
 
-Wed Jun 21 17:32:31 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/bigdecimal/bigdecimal.c (BigDecimalValueWithPrec): use
+	  cannot_be_coerced_into_BigDecimal function.
 
-	* signal.c (ruby_nativethread_signal, posix_nativethread_signal,
-	  sigsend_to_ruby_thread, install_nativethread_sighandler):
-	  nativethread-support on signal handler (backport from 1.9).
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_exp): ditto.
 
-	* ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_log): ditto.
 
-	* eval.c (ruby_native_thread_kill): ditto.
+	* test/bigdecimal/test_bigdecimal.rb: test for the avobe changes.
 
-Wed Jun 21 08:39:54 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/bigdecimal/testbase.rb (under_gc_stress): add a new utility
+	  method to run tests under the condition of GC.stress = true.
 
-	* lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): merge Date
-	  and Time processing.  [ruby-core:08033]
+Wed Aug 17 10:16:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Jun 21 01:40:25 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* backport r32994 from trunk.
 
-	* parse.y (yylex, reswords): modifier token is no longer returned in
-	  fname state.  [ruby-dev:28775]
+	* rational.c (nurat_coerce): Rational#coerce should converts itself
+	  into Complex if the argument is a Complex with non-zero imaginary
+	  part.  [Bug #5020] [ruby-dev:44088]
 
-Wed Jun 21 01:12:46 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* test/ruby/test_rational.rb (test_coerce): test for the above change.
 
-	* lib/rss/rss.rb: RSS::Element.def_corresponded_attr_writer
-	  supported date type.
+Wed Aug 17 06:33:19 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Tue Jun 20 22:08:36 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* backport r32992 from trunk.
 
-	* test/rss/test_parser.rb: split parser tests into ...
-	* test/rss/test_parser_1.0.rb: ... RSS 1.0 parsing tests and ...
-	* test/rss/test_parser_2.0.rb: ... RSS 2.0 parsing tests.
+	* ext/openssl/ossl_x509cert.c: Add class documentation for
+	  OpenSSL::X509::Certificate.
 
-Tue Jun 20 21:19:06 2006  Kouhei Sutou  <kou@cozmixng.org>
+Wed Aug 17 05:02:25 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/rss/rss.rb: provided default RSS::Element#children.
+	* backport r32987 from trunk.
 
-	* lib/rss/0.9.rb: used default RSS::Element#children.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
+	* ext/openssl/ossl_pkey.c: corrected docs, OpenSSL::PKey::DH does
+	  *not* support #sign/verify.
 
-Tue Jun 20 21:04:33 2006  Kouhei Sutou  <kou@cozmixng.org>
+Tue Aug 16 18:56:54 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/rss.rb: provided default RSS::Element#_tags.
+	* vm.c (ruby_threadptr_data_type): rename to hide.
+	  [ruby-core:38972]
 
-	* lib/rss/0.9.rb: used default RSS::Element#_tags.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
+Tue Aug 16 18:52:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun 20 20:47:07 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* win32/mkexports.rb (Exports::Mswin#each_export): exclude Init_
+	  and _threadptr_ functions, as well as mingw.
 
-	* lib/rss/rss.rb: hide RSS::Element.install_model.
-	  (RSS::Element.install_have_child_element,
-	   RSS::Element.install_have_children_element,
-	   RSS::Element.install_text_element,
-	   RSS::Element.install_date_element): call
-	  RSS::Element.install_model internally.
+Tue Aug 16 09:38:37 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rss/0.9.rb: followed new API.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/content.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* backport r32981 and r32982 from trunk.
 
-Tue Jun 20 20:18:05 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/dl:  Add documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #5192]
 
-	* ext/openssl/extconf.rb: add check for OBJ_NAME_do_all_sorted.
+	* ext/.document (fiddle):  Remove duplicate entry
 
-	* ext/openssl/ossl_cipher.c (ossl_s_ciphers): new method
-	  OpenSSL::Cipher.ciphers. it returns all the cipher names.
+	* ext/fiddle:  Complete documentation of Fiddle.  Patch by Vincent
+	  Batts.  [#5192]
 
-	* ext/openssl/lib/openssl/cipher.rb:
-	  - add constants AES128, AES192, AES256. [ruby-dev:28610]
-	  - reimplement without eval()
+Tue Aug 16 08:00:15 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/openssl/lib/openssl/digest.rb: reimplement without eval().
+	* backport r32977 from trunk
 
-	* test/openssl/test_cipher.rb, test_digest: fix about reimplemented
-	  features.
+	* ext/socket:  Make Socket documentation appear.  Add documentation for
+	  Socket, TCPServer, SOCKSSocket.  Patch by Sylvain Daubert.
+	  [Ruby 1.9 - Feature #5182]
 
-	* sample/openssl/cipher.rb: rewrite all.
+Mon Aug 15 10:16:55 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+	* backport r32973 from trunk.
 
-Sat Jun 19 11:21:46 2006  Eric Hodel  <drbrain@segment7.net>
+	* ext/openssl/ossl_ssl.c: Support disabling OpenSSL compression.
 
-	* lib/test/unit/assertions.rb: Merge RDoc from HEAD.
+	* test/openssl/test_ssl.rb: Add a test for it.
+	  Thanks to Eric Wong for the patch.
+	  [Ruby 1.9 - Feature #5183] [ruby-core:38911]
 
-Tue Jun 20 01:06:57 2006  Kouhei Sutou  <kou@cozmixng.org>
+Sat Aug 13 22:17:27 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/rss.rb:
-	  - cleanup validation mechanism. Now, #XXX_validation is
-	    needless.
-	  - changed internal variable name RSS::Element::MODEL to
-	    RSS::Element::MODELS.
-	  - RSS::Element.install_model requires uri.
+	* tool/mkconfig.rb: do not make the entries related to sitedir and
+	  verdordir if disabled by --without options.  [ruby-core:38922]
+	  [Bug #5187]
 
-	* lib/rss/0.9.rb: followed new validation API.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/content.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+Sat Aug 13 17:06:57 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Jun 19 23:40:59 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/date/date_core.c: [ruby-core:38861]
 
-	* ext/nkf/lib/kconv.rb: remove default -m0 and fix document.
+Sat Aug 13 16:59:51 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/nkf/nkf-8/{nkf.c, config.h, utf8tbl.c, utf8tbl.h}:
-	  imported nkf 2.0.7.
+	* test/date/test_*.rb: added tests.
 
-Mon Jun 19 22:31:59 2006  Kouhei Sutou  <kou@cozmixng.org>
+Sat Aug 13 09:36:19 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/rss/rss.rb:
-	  - provided default #to_s as RSS::Element#to_s.
-	  - removed RSS::Element#other_element.
-	  - RSS::Element#tag requires attributes as Hash instead of Array.
+	* ext/date/date_parse.c (parse_ddd_cb): fix r32896. RB_GC_GUARD
+	  insertion position was mistaken. [ruby-dev:44337] [Bug #5152]
 
-	* lib/rss/0.9.rb: removed #to_s to use RSS::Element#to_s.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+Sat Aug 13 09:26:24 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/rss/2.0.rb: removed #other_element.
+	* ext/psych/lib/psych/core_ext.rb: Make Kernel#y private.
+	  [ruby-core:38913]
 
-Mon Jun 19 22:09:16 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* test/psych/test_yaml.rb: corresponding test.
 
-	* ext/win32ole/win32ole.c(ole_invoke): support some kind of
-	  method of word. [ruby-Bugs#3237]
+Sat Aug 13 09:15:16 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/win32ole/tests/test_word.rb: ditto.
+	* ext/date/date_core.c (date_strftime_alloc): followed the change
+	  of r32885.
 
-	* ext/win32ole/tests/testall.rb: ditto.
+	* NEWS: followed the above change.
 
-Mon Jun 19 00:02:17 2006  Kouhei Sutou  <kou@cozmixng.org>
+Sat Aug 13 08:49:05 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/rss/rss.rb: automatically detected attributes.
+	* ext/date/date_core.c: [ruby-core:38855].
 
-	* lib/rss/0.9.rb: removed #_attrs.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+Sat Aug 13 03:41:37 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rss/parser.rb: followed new internal API.
+	* backport r32953 from trunk.
 
-Mon Jun 19 00:00:17 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/uri/common.rb:  Fix documentation of URI::Parser.new.  Patch by
+	  Steve Klabnik.  [Ruby 1.9 - Bug #5177]
 
-	* ext/tk/lib/multi-tk.rb: fix bug: initialize improper tables.
+Sat Aug 13 02:19:57 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sun Jun 18 22:36:13 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* backport r32950 from trunk.
 
-	* lib/rss/rss.rb: RSS::Element#initialize accepts initial
-	  attributes.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* ext/digest/digest.c:  Add documentation for the Digest module.  Patch
+	  by Sylvain Daubert.  [Ruby 1.9 - Bug #5167]
 
-	* lib/rss/utils.rb: added Utils.element_initialize_arguments? to
-	  detect backward compatibility initial arguments.
+Fri Aug  5 13:32:43 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/rss/parser.rb: user initial attributes to initialize
-	  RSS::Element.
+	* backport r32856 from trunk.
 
-Sun Jun 18 18:24:42 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* lib/xmlrpc/client.rb, lib/xmlrpc/server.rb: should use
+	  String#bytesize instead of String#size.
 
-	* lib/rss/converter.rb: use NKF for Uconv fallback.
+Fri Aug 12 13:53:03 2011  Narihiro Nakamura  <narihiro@netlab.jp>
 
-Sun Jun 18 18:22:04 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* backport r32894 from trunk.
 
-	* test/rss/test_image.rb: shared name space configuration.
+	* gc.c (gc_lazy_sweep): if sweep target slots are not found, we
+	  try heap_increment() because it might be able to expand the
+	  heap. [Bug #5127] [ruby-dev:44285]
 
-Sun Jun 18 18:13:25 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* gc.c (gc_clear_mark_on_sweep_slots): if a sweeping was
+	  interrupted, we expand the heap if at all possible.
 
-	* lib/rss/rss.rb: improved ignore_unknown_element
-	  handling. RSS::NotExpectedTagError provides tag URI.
-	* lib/rss/parser.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/content.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+Fri Aug 12 12:28:17 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/rss/rss-assertions.rb: checked URI of not expected tag too.
-	* test/rss/test_parser.rb: ditto.
+	* lib/rake:  Update to Rake 0.9.2.2.  Prevent pollution of toplevel
+	  namespace by Commands.  Remove unused variable and debugging
+	  statement in tests.
 
-Sun Jun 18 18:08:36 2006  Kouhei Sutou  <kou@cozmixng.org>
+Fri Aug 12 09:00:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rss/rss.rb: changed empty namespace URI representation to ""
-	  from nil.
-	* lib/rss/parser.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
+	* backport r32941 from trunk
 
-Sun Jun 18 18:03:50 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* lib/rubygems:  Import RubyGems 1.8.8.  Fixes encoding of YAML gemspec
+	  from gems.  Github Issue #149
 
-	* lib/rss/parser.rb: removed a guard for requiring open-uri.
+Fri Aug 12 03:24:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sun Jun 18 18:01:26 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* backport r32935 from trunk
 
-	* lib/rss/rss.rb: fixed typo: except -> expect
-	* lib/rss/parser.rb: ditto.
-	* test/rss/rss-assertions.rb: ditto.
-	* test/rss/test_parser.rb: ditto.
+	* lib/rdoc:  Import RDoc 3.9.2.  Fixes TIDYLINK for HTML output.
 
-Sun Jun 18 17:52:39 2006  Kouhei Sutou  <kou@cozmixng.org>
+Tue Aug  2 22:04:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rss/rss.rb: RSS::Element#calc_indent became to be deprecated.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* backport r32815 from trunk.
 
-	* test/rss/test_1.0.rb: removed RSS::Element.indent_size tests.
-	* test/rss/test_2.0.rb: ditto.
+	* gc.c (init_heap): allocate sigaltstack after heaps are allocated.
+	  [ruby-dev:44315] [Bug #5139]
 
-Sun Jun 18 00:49:11 2006  Tanaka Akira  <akr@m17n.org>
+	* vm.c (thread_free): use free because objspace is not ready.
 
-	* ext/socket/socket.c (bsock_recv_nonblock): new method
-	  BasicSocket#recv_nonblock.
-	  (udp_recvfrom_nonblock): renamed from ip_recvfrom_nonblock.
-	  IPSocket#recvfrom_nonblock is moved to UDPSocket#recvfrom_nonblock.
-	  (unix_recvfrom_nonblock): removed.
-	  UNIXSocket#recvfrom_nonblock is removed.
+	* vm.c (th_init): use malloc because objspace is not ready.
 
-Sat Jun 17 22:17:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Aug 11 19:04:38 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* lib/mathn.rb (Integer::prime_division): raise ZeroDivisionError
-	  on zeros.  [ruby-dev:28739]
+	* backport r32931 from trunk.
 
-Sat Jun 17 14:53:32 2006  Tanaka Akira  <akr@m17n.org>
+	* variable.c (autoload_delete): An autoload entry is still in a
+	  RCLASS_IV_TBL, not in a RCLASS_CONST_TBL, so take back the table
+	  changed in r29600. And an autoload entry keeps not a
+	  rb_const_entry_t but a NODE so remove rb_const_entry_t thing added
+	  in r29602.
 
-	* lib/pathname.rb: backport from 1.9.
-	  (Kernel#Pathname): new method.
+Thu Aug 11 15:07:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jun 17 10:30:41 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* lib/mkmf.rb (link_command): use LIBRUBYARG in rbconfig for
+	  unbundled extensions.  [ruby-core:38802] [Bug #5147]
 
-	* lib/rss/rss.rb (Hash#merge, Enumerable#sort_by): removed.
+	* lib/mkmf.rb (init_mkmf): revert r32902.  [ruby-core:38903]
 
-	* lib/rss/rss.rb (RSS::RootElementMixin#to_xml): added.
-	  [ruby-talk:197284]
+Wed Aug 10 19:30:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	  We can convert RSS version easily like the following:
-	    rss10 = RSS::Parser.parse(File.read("1.0.rdf"))
-	    File.open("2.0.rss", "w") {|f| f.print(rss10.to_xml("2.0"))}
+	* backport r32903 from trunk.
 
-	* test/rss/test_1.0.rb: added #to_xml test.
-	* test/rss/test_2.0.rb: ditto.
+	* complex.c (nucomp_rationalize): calls rationalize of real part if
+	  imaginary part is exactly zero.  The patch is made by Marc-Andre
+	  Lafortune.  fixes [Bug #5178] [ruby-core:38885]
 
-	* test/rss/rss-testcase.rb: added some helper methods that
-	  generates sample RSS 2.0.
+	* test/ruby/test_complex.rb (test_rationalize): add a test for the
+	  above change.
 
-	* sample/rss/convert.rb: added a sample script to convert RSS format.
+	* complex.c (nucomp_to_r): fix RDoc comment.  The patch is made by
+	  Marc-Andre Lafortune.
 
-Sat Jun 17 10:23:22 2006  Kouhei Sutou  <kou@cozmixng.org>
+Wed Aug 10 14:11:07 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/rss.rb (Kernel#funcall): removed.
-	* lib/rss/parser.rb (Kernel.URI): removed.
+	* lib/mkmf.rb (init_mkmf): set $LIBRUBYARG regardless of shared
+	  option.  [ruby-core:38802] [Bug #5147]
 
-	* lib/rss/maker/: supported
-	    xxx.new_yyy do |yyy|
-	      yyy.zzz = zzz
-	      ...
-	    end
-	  style and this style became the style of the recommendation.
+Wed Aug 10 02:57:01 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	  Old style
-	    yyy = xxx.new_yyy
-	    yyy.zzz = zzz
-	    ...
-	  is supported too but this style isn't recommended.
-	  [ruby-talk:197284]
+	* lib/net/http.rb: come back autoload. OpenSSL constant is used
+	  some places, so it leads mistakes like HTTP.start.
 
-	* test/rss/test_*maker*.rb: used new recommended style.
+Tue Aug  9 22:57:45 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Sat Jun 17 09:03:47 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/date/date_parse.c (date_zone_to_diff): add RB_GC_GUARD.
+	  [ruby-dev:44337] [Bug #5152]
 
-	* lib/rss, test/rss: backported from trunk. (2005-11-16 - now)
+	* ext/date/data_parse.c (parse_ddd_cb): ditto.
 
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.5 -> 0.1.6.
-	* test/rss/test_version.rb (RSS::TestVersion#test_version): ditto.
+Tue Aug  9 12:20:33 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/rss/trackback.rb: added TrackBack prefix.
-	* lib/rss/maker/trackback.rb: ditto.
+	* test/fiddle/helper.rb (libc_so, libm_so): Solaris support added.
+	  [ruby-core:38853] [Bug #5168]
 
-	* lib/rss/rss.rb : removed needless argument 'prefix'.
-	* lib/rss/parser.rb: ditto.
+	* test/dl/test_base.rb (libc_so, libm_so): on Solaris, remove libc
+	  and libm version numbers for detecting default libc and libm.
 
-	* lib/rss/1.0.rb: added rdf:Bag.
+Tue Aug  9 10:49:52 2011  Igor Zubkov  <igor.zubkov@gmail.com>
 
-	* lib/rss/taxonomy.rb: implemented taxonomy module.
-	* test/rss/test_taxonomy.rb: added tests for taxonomy support.
+	* array.c: Fix typo. https://github.com/ruby/ruby/pull/36
 
-	* lib/rss/1.0.rb: added convenience method 'resources'.
-	* lib/rss/taxonomy.rb: ditto.
-	* test/rss/rss-assertions.rb: added test for 'resources'.
-	* test/rss/test_taxonomy.rb: ditto.
+Mon Aug  8 00:10:45 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-	* lib/rss/rss.rb: fixed a indentation bug.
-	* lib/rss/taxonomy.rb: fixed <taxo:topic> #to_s bug.
-	* test/rss/test_taxonomy.rb: added a #to_s test.
+	* test/test_syslog.rb (TestSyslog#test_log): Do not be too
+	  specific about the log line format.  Fixes #5081.
 
-	* lib/rss/maker/taxonomy.rb: implemented taxonomy module for RSS
-	  Maker.
-	* lib/rss/taxonomy.rb: supported RSS Maker.
-	* lib/rss/maker.rb: added taxonomy module support.
+Sun Aug  7 23:39:44 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/rss.rb: adjusted to other element API.
-	* lib/rss/1.0.rb: adjusted to other element API but backward
-	  compatibility is reserved.
-	* lib/rss/0.9.rb: ditto.
+	* time.c (rb_strftime_alloc): raise ERANGE if width is too large.
+	  Patch by Nobuyoshi Nakada. [Bug #4457] [ruby-dev:43285]
 
-	* test/rss/test_maker_taxo.rb: added test case for taxonomy module
-	  for RSS Maker.
-	* test/rss/test_setup_maker_1.0.rb: added tests for taxo:topic.
+	* test/ruby/test_time.rb (class TestTime): add a test for the
+	  above change.
 
-	* test/rss/test_setup_maker_1.0.rb: added backward compatibility
-	  test.
-	* test/rss/test_setup_maker_0.9.rb: ditto.
-	* test/rss/test_setup_maker_2.0.rb: ditto.
+Sun Aug  7 14:15:10 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* test/rss/rss-testcase.rb: added convenience method for setting
-	  up taxo:topic.
-	* test/rss/rss-assertions.rb: added assertion for taxo:topic.
+	* backport r32876 from trunk.
 
-	* sample/rss/blend.rb: followed new API.
+	* ext/objspace/objspace.c: fix typos in a document.
 
-	* lib/rss/taxonomy.rb: changed class or module prefix to
-	  Taxonomy from Taxo.
-	* lib/rss/maker/taxonomy.rb: ditto.
+Sun Aug  7 04:42:36 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/rss/test_taxonomy.rb: use #reject directory.
+	* marshal.c (w_object):  Fix exception message when _dump_data
+	  is not defined on a T_DATA object.
 
-	* lib/rss/: use #__send__ instead of #send.
-	* test/rss/: ditto.
+Sat Aug  6 06:14:20 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rss/parser.rb: added entity handling type predicate.
-	* lib/rss/rexmlparser.rb: ditto.
-	* lib/rss/xmlparser.rb: ditto.
-	* lib/rss/xmlscanner.rb: ditto.
+	* lib/rdoc:  Update to 3.9.1.  Fixes === lines in verbatim sections.
+	  Fixes :nodoc: on class aliases.  Fixes :stopdoc: creating references
+	  to Object.  Fixes spacing when class comments are merged in ri.
+	  Fixes `ri []` crash.  Fixes bug report URL when rdoc crashes.  Adds
+	  :doc: and :nodoc: to allow hiding of implementation details in ruby.
+	  Makes `rdoc` and `ri` gem-aware.
 
-	* lib/rss/xmlscanner.rb: more robust entity handling.
+Sat Aug  6 03:19:45 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/rss/test_parser.rb: added an entity handling test.
+	* lib/rubygems:  Import RubyGems 1.8.7:
+	  Added missing require for `gem uninstall --format-executable`.
 
-	* test/rss/test_2.0.rb: added RSS 2.0 tests.
-	* test/rss/rss-assertions.rb: extended XML stylesheet assertion.
-	* lib/rss/0.9.rb: added initialize method.
-	* test/rss/test_1.0.rb: cleanup.
+	  The correct name of the executable being uninstalled is now displayed
+	  with --format-executable.
 
-	* lib/rss/image.rb: added Image prefix.
-	* lib/rss/maker/image.rb: ditto.
+	  Fixed `gem unpack uninstalled_gem` default version picker.
 
-	* lib/rss/rss.rb: improved type conversion.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
+	  RubyGems no longer claims a nonexistent gem can be uninstalled.
 
-	* test/rss/test_2.0.rb: added type conversion tests.
-	* test/rss/test_accessor.rb: ditto.
-	* test/rss/test_to_s.rb: ditto.
-	* test/rss/test_syndication.rb: ditto.
-	* test/rss/test_setup_maker_2.0.rb: ditto.
-	* test/rss/test_setup_maker_1.0.rb: ditto.
-	* test/rss/test_setup_maker_0.9.rb: ditto.
-	* test/rss/test_maker_sy.rb: ditto.
-	* test/rss/test_maker_image.rb: ditto.
-	* test/rss/test_maker_2.0.rb: ditto.
-	* test/rss/test_maker_0.9.rb: ditto.
-	* test/rss/test_image.rb: ditto.
+	  `gem which` no longer claims directories are requirable files.
 
-	* test/rss/test_maker_1.0.rb: use assert instead of assert_equal.
+	  `gem cleanup` continues cleaning up gems if one can't be uninstalled
+	  due to permissions.  Issue #82.
 
-	* test/rss/rss-assertions.rb: improved type conversion assertions.
+	  Gem repository directories are no longer created world-writable.
+	  Patch by Sakuro OZAWA.  [Ruby 1.9 - Bug #4930]
 
-	* lib/rss/rss.rb: added backward compatibility codes.
-	* lib/rss/parser.rb: ditto.
-	* test/rss/test_parser.rb: ditto.
-	* test/rss/test_2.0.rb: ditto.
+Fri Aug  5 23:08:39 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sat Jun 17 02:01:00 2006  Tanaka Akira  <akr@m17n.org>
+	* backport r32845 from trunk.
 
-	* lib/pp.rb (Kernel#pretty_inspect): defined for pretty printed
-	  string.
+	* configure.in: when Solaris cc, use $(CC) to link shared libs.
 
-Sat Jun 17 00:23:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Aug  5 22:16:20 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* parse.y (reswords): kDO_BLOCK was missing.  fixed: [ruby-core:7995]
+	* numeric.c (rb_infinity, rb_nan): use WORDS_BIGENDIAN to get endian.
+	  fix [Bug #5160] [ruby-dev:44356]
 
-Sat Jun 17 00:02:15 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Fri Aug  5 15:57:10 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/win32ole/win32ole.c (ole_propertyput): support
-	  PROPERTYPUTREF. [ruby-talk:183042]
+	* complex.c (f_signbit): fix compile error in gcc4 on Solaris with
+	  CFLAGS="-std=gnu99".  [ruby-dev:44355] fix [Bug #5159]
 
-	* ext/win32ole/tests/test_propertyputref.rb: ditto.
+	* math.c: ditto.
 
-Thu Jun 15 23:02:47 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Thu Aug  5 10:09:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/win32ole/win32ole.c (fole_methods): The return value
-	  of WIN32OLE#ole_methods should include PROPERTYPUTREF methods.
+	* backport r32846 from trunk.
 
-	* ext/win32ole/win32ole.c (fole_put_methods): The return value
-	  of WIN32OLE#ole_put_methods should include PROPERTYPUTREF methods.
+	* thread_pthread.c (native_cond_signal): retry to call pthread_cond_signal
+	  and pthread_cond_broadcast if they return EAGAIN in
+	  native_cond_signal and native_cond_broadcast, respectively.
+	  It is for the pthread implementation of Mac OS X 10.7 (Lion).
+	  fixes #5155.  [ruby-dev:44342].
 
-	* ext/win32ole/tests/test_ole_methods.rb: ditto.
+	* thread_pthread.c (native_cond_broadcast): ditto.
 
-	* ext/win32ole/tests/testall.rb : ditto.
+	* thread_pthread.c (struct cached_thread_entry): stop using
+	  pthread_cond_t and its functions directly.
 
-Wed Jun 14 18:23:28 2006  Eric Hodel  <drbrain@segment7.net>
+	* thread_pthread.c (register_cached_thread_and_wait): ditto.
 
-	* enum.c (enum_any): Documentation typo.
+	* thread_pthread.c (use_cached_thread): ditto.
 
-Wed Jun 14 15:01:09 2006  Eric Hodel  <drbrain@segment7.net>
+Fri Aug  5 07:35:00 2011  Luis Lavena  <luislavena@gmail.com>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser#warn): Don't print
-	  warnings when -q is set.
+	* lib/rubygems/installer.rb (class Gem): Correct path check on Windows
+	  Possible fix for [Ruby 1.9 - Bug #5111]
 
-Wed Jun 14 23:03:53 2006  Tanaka Akira  <akr@m17n.org>
+	* test/rubygems/test_gem_installer.rb (load Gem): ditto
+	  Backported from trunk r32804
 
-	* configure.in: check sizeof(rlim_t).
-	  check setrlimit.
+Fri Aug  5 07:00:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (proc_getrlimit): new method Process.getrlimit.
-	  (proc_setrlimit): new method Process.setrlimit.
+	* test/io/console/test_io_console.rb (test_noctty): daemon() on
+	  Fedora Rawhide seems not to detach the controlling terminal,
+	  when the argument noclose is non-zero.  ref: [Bug #5135]
 
-	* ruby.h (NUM2ULL): new macro.
+Wed Aug  4 02:35:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Mon Jun 12 22:25:09 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in: use build_os variable for checking C and C++ compilers
+	  matching.
 
-	* sprintf.c (rb_f_sprintf): adjust precision length to prevent
-	  splitting multi-byte characters.  [ruby-list:42389]
+	* configure.in: use clang++ if clang is used.
 
-Sun Jun 11 23:20:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug  4 02:21:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser::Arguable#getopts): pass self to the
-	  parser.
+	* lib/mkmf.rb (link_command): use static library only for bundled
+	  extensions.  [Bug #5147]
 
-Sun Jun 11 10:00:57 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Aug  3 00:11:08 2011  Tanaka Akira  <akr@fsij.org>
 
-	* win32/win32.h (write): not need to define on bcc.
+	* lib/prettyprint.rb: update document.  [ruby-core:36776]
 
-Sun Jun 11 08:30:33 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#getopts): new methods.
+Tue Aug  2 20:10:16 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Sat Jun 10 18:02:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/test_parallel.rb: pass "--ruby" option to
+	  test/testunit/tests_for_parallel/runner.rb. [Bug #5132] [ruby-dev:44303]
+	  Backported from trunk r32812.
 
-	* ext/bigdecimal/lib/bigdecimal/newton.rb (Newton::nlsolve): typo
-	  fixed: raize -> raise.  [ruby-talk:196608]
+Tue Aug  2 12:03:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jun  8 14:19:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* hash.c (recursive_hash): hash value of emptied hash should be
+	  equal to an empty hash.  [ruby-core:38650]
 
-	* win32/win32.[ch] (rb_w32_read, rb_w32_write): new functions.
-	  use recv() and send() when fd is socket. fixed: [ruby-dev:28694]
+Tue Aug  2 11:42:15 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jun  7 16:22:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (rb_enc_symname2_p): :! is valid symbol.  [Bug #5136]
 
-	* lib/tempfile.rb (Tempfile::make_tmpname): put dot between
-	  basename and pid.  [ruby-talk:196272]
+Tue Aug  2 03:26:02 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jun  7 14:53:04 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/rake/test_rake_directory_task.rb (TestRakeDirectoryTask#
+	  test_directory_win32): fixed wrong test.
+	  backported r32670 from trunk.
 
-	* win32/win32.c (errmap): add some winsock errors.
+Mon Aug  1 15:45:23 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Jun  7 11:34:38 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/rake/test_rake_functional.rb:  Don't assume the binary name of
+	  ruby is "ruby".  [Ruby 1.9 - Bug #5114]
+	* test/rake/helper.rb:  ditto
 
-	* configure.in: add new configure option `--with-winsock2' for mingw.
+Mon Aug  1 05:21:42 2011  TAKANO Mitsuhiro (takano32)  <tak@no32.tk>
 
-	* win32/Makefile.sub (config.h): define USE_WINSOCK2 in config.h
-	  instead of in CPPFLAGS.
+	* cont.c (cont_save_thread): fix missing semicolon.
 
-	* ext/socket/extconf.rb: determine whether to use winsock2 or not
-	  by using with_config.
+Sun Jul 31 22:57:16 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Wed Jun  7 10:45:10 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* enc/Makefile.in (ECHO1): Same as the recent fix in common.mk.
+	  ":" in a make variable replacement cause a syntax error with
+	  /usr/ccs/bin/make on Solaris.  Uses $(NULLCMD) instead.
 
-	* win32/{configure.bat, setup.mak, Makefile.sub, win32.h}: add
-	  new configure option `--with-winsock2'.
+Sun Jul 31 22:44:08 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* win32/win32.c (StartSockets): ditto.
+	* configure.in: fix typos.
 
-	* ext/socket/extconf.rb: ditto.
+Sun Jul 31 21:19:51 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* win32/win32.c (open_ifs_socket): new function.
+	* lib/mkmf.rb (configuration:ECHO1): Same as the recent fix in
+	  common.mk.
+	  ":" in a make variable replacement cause a syntax error with
+	  /usr/ccs/bin/make on Solaris.  Uses $(NULLCMD) instead.
 
-	* win32/win32.c (StartSockets, rb_w32_socket): use open_ifs_socket()
-	  instead of socket().
-	  ifs socket support is backported from trunk.
+Sun Jul 31 21:16:02 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Wed Jun  7 09:14:44 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* complex.c (f_signbit): gcc4 on Solaris DOES have signbit but does
+	  not have it on header.
 
-	* eval.c (rb_call0): binding for the return event hook should have
-	  consistent scope.  [ruby-core:07928]
+	* math.c: ditto.
 
-	* eval.c (EXEC_EVENT_HOOK): trace_func may remove itself from
-	  event_hooks.	no guarantee for arbitrary hook deletion.
-	  [ruby-dev:28632]
+Sun Jul 31 21:09:04 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Mon Jun  5 18:12:12 2006  Tanaka Akira  <akr@m17n.org>
+	* common.mk (node_name.inc): Use $(Q) for consistency.
 
-	* ext/socket/socket.c (sock_s_unpack_sockaddr_in): reject
-	  non-AF_INET/AF_INET6 sockaddr.
-	  (sock_s_unpack_sockaddr_un): reject non-AF_UNIX sockaddr.
-	  [ruby-dev:28691]
+	* Makefile.in (INSNS): ditto.
 
-Sun Jun  4 20:40:19 2006  Tanaka Akira  <akr@m17n.org>
+Sun Jul 31 20:39:12 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* ext/socket/socket.c: fix sockaddr_un handling.
-	  [ruby-dev:28677]
+	* common.mk (ECHO1): nmake does not allow parenthesis in make variable
+	  replacement.
 
-Fri Jun  2 22:08:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 31 20:21:36 2011  "Yuki Sonoda (Yugui)"  <yugui@yugui.jp>
 
-	* lib/forwardable.rb: RDoc typo fix from Jan Svitok
-	  <jan.svitok at gmail.com>.  [ruby-core:07943]
+	* common.mk (ECHO1): ":" in a make variable replacement cause a syntax
+	  error with /usr/ccs/bin/make on Solaris.  Uses $(NULLCMD) instead.
 
-Fri Jun  2 19:02:09 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* configure.in (NULLCMD): new check.
 
-	* ext/openssl/extconf.rb: use create_header.
+	* Makefile.in (NULLCMD): Reflects checking in configure.
 
-	* ext/openssl/ossl.h, ext/openssl/openssl_missing.h:
-	  include RUBY_EXTCONF_H.
+	* win32/Makefile.sub (NULLCMD): new assignment.
 
-Fri Jun  2 17:16:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jul 31 11:31:07 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* lib/mkmf.rb (CLEANINGS): remove extconf.h by distclean if created.
+	* backport r32768 from trunk.
 
-Fri Jun  2 00:11:19 2006  Tanaka Akira  <akr@m17n.org>
+	* vm.c: check if cfp is valid. [Bug #5083] [ruby-dev:44208]
 
-	* ext/socket/socket.c (s_recvfrom): alen may be zero with UNIXSocket
-	  too.  (tested on NetBSD 3.0)
-	  (s_recvfrom_nonblock): extracted from sock_recvfrom_nonblock.
-	  (sock_recvfrom_nonblock): use s_recvfrom_nonblock.
-	  (ip_recvfrom_nonblock): new method: IPSocket#recvfrom_nonblock
-	  (unix_recvfrom_nonblock): new method: UNIXSocket#recvfrom_nonblock
-	  (s_accept_nonblock): extracted from sock_accept_nonblock.
-	  (sock_accept_nonblock): use s_accept_nonblock.
-	  (tcp_accept_nonblock): new method: TCPServer#accept_nonblock
-	  (unix_accept_nonblock): new method: UNIXServer#accept_nonblock
+Sat Jul 31 01:23:45 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Jun  1 19:12:37 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* backport r32762 from trunk.
 
-	* win32/win32.c (rb_w32_cmdvector): backslashes inside single-quotes
-	  no longer has special meanings.  fixed: [ruby-list:42311]
+	* test/bigdecimal/test_bigdecimal.rb (test_version): removed.
 
-Thu Jun  1 16:14:41 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Jul 30 23:51:44 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* win32/win32.c (rb_w32_getcwd): runtime's getcwd() will not success
-	  if the length of the cwd is longer than MAX_PATH.
-	  fixed [ruby-list:42335]
+	* lib/cmath.rb (cbrt): should return a real number if possible.
 
-Thu Jun  1 11:29:14 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Jul 30 23:48:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* win32/win32.c (rb_w32_getcwd): set errno if not set.
-	  fixed [ruby-list:42346]
+	* ext/date/date_core.c: an issue that is same as  [ruby-dev:44071].
 
-Sat May 27 11:29:46 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
+	* ext/date/date_strftime.c: identical to [ruby-dev:44112].
 
-	* ext/extmk.rb (extmake): remove extinit files if no statically linked
-	  extensions.
+Sat Jul 30 23:19:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri May 26 09:05:11 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
+	* defs/default_gems: separate from tool/rbinstall.rb.
 
-	* ruby.h, lib/mkmf.rb (create_header): clear command line options for
-	  macros moved to extconf.h.
+Sat Jul 30 23:14:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/extmk.rb (extract_makefile, extmk): made RUBY_EXTCONF_H and
-	  EXTSTATIC permanent.
+	* io.c (rb_io_each_byte): rbuf can be refreshed during yield.
+	  [Bug #5119]
 
-	* ext/{dbm,digest/*,socket,zlib}/extconf.rb: used $defs and $INCFLAGS.
+Sat Jul 30 22:35:50 2011  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* {bcc32,win32,wince}/Makefile.sub (COMPILE_C, COMPILE_CXX): added
-	  $(INCFLAGS).
+	* strftime.c (NEEDS): avoid SEGV due to integer overflow in
+	  sparc-solaris2.10 and i686-linux.  fix [Bug #4456] [ruby-dev:43284]
 
-	* lib/mkmf.rb (configuration): add $defs unless extconf.h was created.
+Sat Jul 30 14:27:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu May 25 01:52:07 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
+	* backport r32754 from trunk.
 
-	* lib/mkmf.rb (pkg_config): particular config commands support.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_version): version 1.1.0.
 
-	* ext/extmk.rb: deal with $static set in extconf.rb.
+	* ext/bigdecimal/bigdecimal.gemspec: turn into a default gem.
 
-	* mkconfig.rb: merge multiple entries to an entry with multiple lines.
+	* tool/rbinstall.rb: ditto.
 
-	* lib/mkmf.rb: allow a series of commands to link.
+Sat Jul 30 13:52:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* win32/Makefile.sub: embed manifests.
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
+	  revive zero and implicit precision support as a deprecated feature.
 
-	* win32/setup.mak: suffix OS name by runtime version.
+	* test/bigdecimal/test_bigdecimal_util.rb: modify a test for the above
+	  change.
 
-Wed May 24 23:52:11 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
+	* NEWS: describes the above change.
 
-	* configure.in (ac_install_sh): ignore dummy install-sh.
-	  [ruby-talk:193876]
+Sat Jul 30 10:58:10 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed May 24 03:10:48 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm.c (th_init): preallocate alternative stack.
+	  NoMemoryError is better than rb_bug, of course.
+	  Patch by Eric Wong. [ruby-core:38572][ruby-core:38594].
 
-	* ext/openssl/lib/openssl/ssl.rb
-	  (OpenSSL::SSL::SocketForwarder#setsockopt,getsockopt): typo fixed.
+	* signal.c (rb_register_sigaltstack): ditto.
 
-Mon May 22 17:54:12 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_core.h: moved ALT_STACK_SIZE definition from signal.c.
 
-	* ext/socket/socket.c (sock_recvfrom_nonblock): use rb_read_pending
-	  instead of rb_io_read_pending.
-	  [ruby-dev:28663]
+	* vm.c (thread_free): use xfree() instead of free().
 
-Mon May 22 17:30:04 2006  Tanaka Akira  <akr@m17n.org>
+Sat Jul 30 07:20:49 2011  Tanaka Akira  <akr@fsij.org>
 
-	* rubyio.h (rb_io_set_nonblock): declared.
+	* ext/socket/lib/socket.rb (udp_server_sockets): unused variable
+	  removed.
+	  patch by Jeremy Evans.  [ruby-core:38600]
 
-	* io.c (rb_io_set_nonblock): new function.
-	  (io_getpartial): nonblocking read support.
-	  (io_read_nonblock): new method: IO#read_nonblock.
-	  (io_write_nonblock): new method: IO#write_nonblock.
+Fri Jul 29 23:56:32 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/socket/socket.c
-	  (sock_connect_nonblock): new method: Socket#connect_nonblock.
-	  (sock_accept_nonblock): new method: Socket#accept_nonblock.
-	  (sock_recvfrom_nonblock): new method: Socket#recvfrom_nonblock.
+	* lib/securerandom.rb: call OpenSSL::Random.seed at the
+	  SecureRandom.random_bytes call.
+	  based on the patch by Masahiro Tomita.  [ruby-dev:44270]
 
-	  [ruby-core:7917]
+Fri Jul 29 20:48:39 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon May 22 15:57:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/mkconstants.rb: fix typos.
 
-	* eval.c (umethod_bind): should not update original class.
-	  [ruby-dev:28636]
+Fri Jul 29 20:28:56 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon May 22 13:38:57 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/mkconstants.rb: use whitespaces as a separator.
 
-	* eval.c (ev_const_get): should support constant access from
-	  within instance_eval().  [ruby-dev:28327]
+Fri Jul 29 18:59:07 2011  Tanaka Akira  <akr@fsij.org>
 
-Thu May 18 17:51:32 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/mkconstants.rb: add documents for constants.
+	  patch by Eric Hodel.  [ruby-core:37853] [Bug #4989]
 
-	* time.c (time_timeval): should round for usec floating
-	  number.  [ruby-core:07896]
+Mon Jul 25 23:51:01 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* time.c (time_add): ditto.
+	* backport r32671 from trunk.
 
-Thu May 18 17:11:45 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* proc.c: pre-allocate the unlinked_method_entry_list_entry struct to
+	  avoid memory allocation during GC.  based on a patch from Eric Wong.
+	  [ruby-core:38498]
 
-	* lib/cgi.rb (CGI::out): support utf-8.  a patch from Fujioka
-	  <fuj at rabbix.jp>.  [ruby-dev:28649]
+Mon Jul 25 22:36:11 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Thu May 18 00:42:12 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
+	* backport r32669 from trunk.
 
-	* ext/extmk.rb, lib/mkmf.rb: use BUILD_FILE_SEPARATOR in Makefiles.
+	* proc.c (struct METHOD), gc.c (gc_marks), vm_method.c
+	  (rb_gc_mark_unlinked_live_method_entries): fix SEGV bug.
+	  rb_method_entry_t was free'd even when the method is still on the
+	  stack if it is BMETHOD (i.e., Method#call).  This is because
+	  rb_method_entry_t is embedded in struct METHOD.  This commit
+	  separates them and marks the live method entries.
+	  See [ruby-core:38449] in detail.  fix [Bug #5047] [ruby-core:38171]
 
-Wed May 17 17:55:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jul 28 23:36:28 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* dir.c (sys_warning): should not call a vararg function
-	  rb_sys_warning() indirectly.  [ruby-core:07886]
+	* ext/fiddle/closure.c (callback): use rb_ary_tmp_new() instead of
+	  xmalloc() to allocate an array for arguments of callback procedure,
+	  to prevent arguments from being swept by GC. [ruby-core:38546]
+	  [Bug #4929]
 
-Wed May 17 08:17:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jul 28 22:51:27 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* util.c (ruby_strtod): try to reduce errors using powersOf10
-	  table.  [ruby-dev:28644]
+	* backport r32723 from trunk.
 
-Tue May 16 15:34:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_cipher.c (ossl_cipher_initialize): Avoid possible
+	  SEGV from AES encryption/decryption. Processing data by
+	  Cipher#update without initializing key (meaningless usage of Cipher
+	  object since we don't offer a way to export a key) could cause SEGV.
 
-	* re.c (rb_reg_initialize): should not allow modifying literal
-	  regexps.  frozen check moved from rb_reg_initialize_m as well.
+	  In OpenSSL, the EVP which has EVP_CIPH_RAND_KEY flag (such as DES3)
+	  allows uninitialized key, but other EVPs (such as AES) does not
+	  allow it. Calling EVP_CipherUpdate() without initializing key causes
+	  SEGV so we set the data filled with "\0" as the key by default. See
+	  #2768.
 
-Tue May 16 09:20:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/openssl/test_cipher.rb: test it.
 
-	* re.c (rb_reg_initialize): should not modify untainted objects in
-	  safe levels higher than 3.
+Thu Jul 28 04:53:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* re.c (rb_memcmp): type change from char* to const void*.
+	* lib/delegate.rb:  Move file-level documentation to the appropriate
+	  classes.
 
-	* dir.c (dir_close): should not close untainted dir stream.
+Thu Jul 28 00:33:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* dir.c (GetDIR): add tainted/frozen check for each dir operation.
+	* test/fileutils/test_fileutils.rb: add OpenBSD case.
+	  patched by Jeremy Evans [ruby-core:38530] see #5097
 
-Mon May 15 17:42:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_process.rb: ditto.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_symbol_arg):
-	  typo fixed.  a patch from Florian Gross <florg at florg.net>.
+Wed Jul 27 17:59:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat May 13 16:14:05 2006  Tanaka Akira  <akr@m17n.org>
+	* include/ruby/missing.h: define __syscall if the platform has
+	  __syscall in the library but doesn't define it in headers
+	  for example Mac OS X.
 
-	* lib/pp.rb (PP.mcall): new method.
-	  (Struct#pretty_print): call Kernel#class and Struct#members even if
-	  overridden.
-	  (Struct#pretty_print_cycle): ditto.
-	  [ruby-core:7865]
+Wed Jul 27 15:39:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu May 11 19:57:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* object.c:  Add usage documentation for BasicObject.  Based on patch
+	  by Thomas Sawyer.  [Ruby 1.9 - Bug #5067]
 
-	* util.c (ruby_strtod): differ addition to minimize error.
-	  [ruby-dev:28619]
+Wed Jul 27 12:24:17 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Aug 11 15:39:25 2006  Eric Hodel  <drbrain@segment7.net>
+	* lib/rubygems/uninstaller.rb:  Add missing require and update
+	  messaging to avoid confusion with uninstall --format-executable.
+	  [Ruby 1.9 - Bug #4062]
 
-	* lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
-	  documented.
+Wed Jul 27 10:47:57 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu May 11 18:10:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rubygems:  Update to RubyGems 1.8.6.1.
 
-	* util.c (ruby_strtod): should not raise ERANGE when the input
-	  string does not have any digits.  [ruby-dev:28629]
+Wed Jul 27 10:04:06 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Sun May  7 03:09:51 2006  Stephan Maka  <stephan@spaceboyz.net>
+	* backport r32690 from trunk.
 
-	* lib/resolv.rb (Resolv::DNS::Requester::ConnectedUDP#initialize):
-	  Use AF_INET6 for nameservers containing colons.
+	* test/openssl/test_pkcs12.rb: Add test and intermediate certificates.
+	  [ Ruby 1.9 - Feature #3793 ] [ruby-core:32088]
 
-Sat May  6 00:38:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jul 27 01:26:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* signal.c (trap): sig should be less then NSIG.  Coverity found
-	  this bug.  a patch from Kevin Tew <tewk at tewk.com>.
-	  [ruby-core:07823]
+	* NEWS: add changes of bigdecimal and bigdecimal/util.
 
-Thu May  4 02:24:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jul 27 01:13:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/syck/emitter.c (syck_scan_scalar): avoid accessing
-	  uninitialized array element.  a patch from Pat Eyler
-	  <rubypate at gmail.com>.  [ruby-core:07809]
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
+	  zero or negative precision is error.  fixes #5098.
+	  [ruby-dev:44210]
 
-	* array.c (rb_ary_fill): initialize local variables first.  a
-	  patch from Pat Eyler <rubypate at gmail.com>.  [ruby-core:07810]
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Float#to_d): modified for
+	  specifying precision.  fixes #5098.  [ruby-dev:44210]
 
-	* ext/syck/yaml2byte.c (syck_yaml2byte_handler): need to free
-	  type_tag.  a patch from Pat Eyler <rubypate at gmail.com>.
-	  [ruby-core:07808]
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Integer#to_d): added
+	  for symmetry to BigDecimal() function with an Integer.
+	  fixes #5098.  [ruby-dev:44210]
 
-Wed May  3 02:12:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/lib/bigdecimal/util.rb (BigDecimal#to_d): added
+	  for adapting other Numeric subclasses.  [ruby-dev:44245]
 
-	* ext/socket/socket.c (make_hostent_internal): accept ai_family
-	  check from Sam Roberts <sroberts at uniserve.com>.
-	  [ruby-core:07691]
+	* test/bigdecimal/test_bigdecimal_util.rb: add tests for the above
+	  changes.
 
-Mon May  1 12:23:19 2006    <sinara@blade.nagaokaut.ac.jp>
+Wed Jul 27 00:54:38 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* numeric.c (num_div): use floor rather than rb_Integer().
-	  [ruby-dev:28589]
+	* bigdecimal/bigdecimal.c (VpDup) a new function for duplicating
+	  a BigDecimal.
 
-	* numeric.c (flo_divmod): the first element of Float#divmod should
-	  be an integer. [ruby-dev:28589]
+	* bigdecimal/bigdecimal.c (BigDecimal_new): support generating a new
+	  BigDecimal from another BigDecimal using BigDecimal global function
+	  or constructor.  [ruby-dev:44245]
 
-	* test/ruby/test_float.rb: add tests for divmod, div, modulo and remainder.
+Mon Jul 25 22:24:09 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Sat Apr 29 22:42:08 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* backport r32666 from trunk.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): should initialize
-	  flag. [ruby-core:07785]
+	* lib/xmlrpc/client.rb: Fix possible HTTP header formatting failure by
+	  'Basic' header. Long username caused the base64 String truncation in
+	  HTTP header which is not allowed. See #5046.
 
-Fri Apr 28 10:53:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/xmlrpc/test_webrick_server.rb: test it.
 
-	* util.c (ruby_strtod): should not cut off 18 digits for no
-	  reason.  [ruby-core:07796]
+Mon Jul 25 15:36:07 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* util.c (ruby_strtod): fixed wrong conversion.
+	* ext/openssl/lib/openssl/{x509.rb,ssl.rb}: Add deprecation warning
+	  for openssl/{x509,ssl} usage. Users should require "openssl" instead
+	  of "openssl/ssl" and "openssl/x509". Start of transition period
+	  introduced by [ruby-dev:38018].
 
-Thu Apr 27 01:38:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jul 25 13:50:33 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* array.c (rb_ary_fill): internalize local variable "beg" to
-	  pacify Coverity.  [ruby-core:07770]
+	* backport r32662 from trunk.
 
-Wed Apr 26 16:59:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/lib/openssl/x509.rb: Cosmetic change: move definition
+	  introduced in r30152 to x509-internal.rb.
 
-	* pack.c (pack_unpack): now supports CRLF newlines.  a patch from
-	  <tommy at tmtm.org>.  [ruby-dev:28601]
+Mon Jul 25 13:35:20 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Tue Apr 25 18:00:05 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* backport r32658 from trunk.
 
-	* ext/tk/tcltklib.c (delete_slaves): maybe increment the reference
-	  count of a NULL Tcl_Obj [ruby-core:07759].
+	* ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Avoid randomly generated
+	  SSLError from SSLSocket just after invoking SSLSocket#close.
+	  OpenSSL's SSL_shutdown could try to send alert packet and it might
+	  set SSLerr(global error stack) as the result. It causes the next
+	  SSL read/write operation to fail by unrelated reason.
 
-Tue Apr 25 07:55:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  By design, we're ignoring any error at SSL_shutdown() so we clear
+	  global error stack after SSL_shutdown is called. See #5039.
 
-	* lib/jcode.rb (String::tr_s): should have translated non
-	  squeezing character sequence (i.e. a character) as well.  thanks
-	  to Hiroshi Ichikawa <gimite at gimite.ddo.jp> [ruby-list:42090]
+Sun Jul 24 20:29:53 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Apr 25 00:08:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/extconf.rb: refine the recvmsg test.
 
-	* regex.c (re_compile_pattern): should check if c is not a
-	  multibyte character.  a patch from KIMURA Koichi
-	  <kimura.koichi at canon.co.jp>.  [ruby-dev:28598]
+Sun Jul 24 20:02:31 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Apr 21 15:19:13 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/socket/extconf.rb: fix the recvmsg test.
 
-	* ext/tk/tcltklib.c (lib_eventloop_ensure): refer freed pointer
-	  [ruby-core:07744] and memory leak.
+Sun Jul 24 08:42:51 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Apr 21 12:14:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/extconf.rb: test recvmsg allocates file descriptors for
+	  fd passing even with MSG_PEEK.
 
-	* ext/socket/socket.c: document update patch from Sam Roberts
-	  <sroberts at uniserve.com>.  [ruby-core:07701]
+	* ext/socket/ancdata.c: use the above test result.
 
-Wed Apr 19 13:55:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 24 01:24:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* parse.y (arg): too much NEW_LIST()
+	* lib/rubygems/specification.rb:  Restore behavior of
+	  Gem::Specification#loaded.  [Ruby 1.9 - Bug #5032]
 
-	* eval.c (SETUP_ARGS0): remove unnecessary access to nd_alen.
+Sun Jul 24 01:14:49 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Apr 19 11:57:04 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rake/test_rake_functional.rb (setup): Use __FILE__ for the base
+	  directory. Current directory is not the top source directory when
+	  the building process runs on other than there.
 
-	* eval.c (rb_eval): use ARGSCAT for NODE_OP_ASGN1.
-	  [ruby-dev:28585]
+	* test/rake/test_rake_rake_test_loader.rb: ditto.
 
-	* parse.y (list_concat): revert last change.
+	* test/rake/test_rake_task_argument_parsing.rb
+	  (test_terminal_width_using_hardcoded_80): hardcoded 80 is used
+	  when app.unix? is false.
 
-	* parse.y (arg): use NODE_ARGSCAT for placeholder.
+Sun Jul 24 00:42:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Apr 19 11:13:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in: change the default compiler to gcc-4.2 if target os
+	  is OS X 10.7 (Lion).
 
-	* lib/getoptlong.rb (GetoptLong::get): RDoc update patch from
-	  mathew <meta at pobox.com>.  [ruby-core:07738]
+Sat Jul 23 17:06:25 2011  Tanaka Akira  <akr@fsij.org>
 
-Wed Apr 19 10:13:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (rb_update_max_fd): validate fd.
 
-	* variable.c (rb_const_set): raise error when no target klass is
-	  supplied.  [ruby-dev:28582]
+	* ext/socket/rubysocket.h (rsock_discard_cmsg_resource): add
+	  msg_peek_p argument for the declaration.
 
-Wed Apr 19 09:49:36 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/ancdata.c (discard_cmsg): add msg_peek_p argument.
+	  assume FreeBSD, NetBSD and MacOS X doesn't generate passed fd
+	  when MSG_PEEK.
+	  (rsock_discard_cmsg_resource): add msg_peek_p argument.
+	  (bsock_recvmsg_internal): call rsock_discard_cmsg_resource with
+	  msg_peek_p argument.
 
-	* parse.y (list_concat): should not modify nodes other than
-	  NODE_ARRAY.  [ruby-dev:28583]
+	* ext/socket/unixsocket.c (unix_recv_io): call
+	  rsock_discard_cmsg_resource with msg_peek_p argument.
 
-Tue Apr 18 17:40:37 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Jul 23 14:38:28 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/multi-tk.rb: add a binding to a container for a slave IP.
+	* test/rake*: Remove dependencies on flexmock and session gems.
+	  [Ruby 1.9 - Bug #4987]
 
-	* ext/tk/lib/tk.rb: update RELEASE_DATE.
+Fri Jul 22 21:46:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/tcltklib.c: forget to reset a Tcl interpreter.
+	* vm_insnhelper.c (vm_call_cfunc): added volatile for a workaround
+	  of cfp consistency error problem on OS X 10.7 (Lion). It's
+	  suspected llvm optimization bug.
+	  [Bug #5076] [ruby-dev:44185]
 
-	* ext/tk/stubs.c: fix potential bugs about handling rb_argv0.
+Fri Jul 22 21:50:16 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Apr 18 00:11:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/uri/generic.rb (WFKV_): unroll the loop of regexp.
 
-	* eval.c: block_unique should be 1, not frame_unique.
-	  [ruby-dev:28577]
+	* lib/uri/generic.rb (URI.decode_www_form_component): ditto.
 
-Fri Aug 11 15:39:25 2006  Eric Hodel  <drbrain@segment7.net>
+Fri Jul 22 21:49:48 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_body): Make RDoc
-	  ignore C function prototypes.  Patch by Tilman Sauerbeck
-	  <tilman at code-monkey.de>.  [ruby-core:8574]
-	* lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
-	  documented.
+	* enum.c (enum_inject): remove empty line to notify rdoc
+	  Enumerable#reduce is alias. patched by milki@github.
+	  https://github.com/ruby/ruby/pull/26
 
-Mon Apr 10 01:03:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 22 21:49:28 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* prec.c (prec_prec_f): documentation patch from
-	  <gerardo.santana at gmail.com>.  [ruby-core:07689]
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#each):
+	  Allow HTTP/0.9 request which doesn't has any header or body.
+	  patched by Felix Jodoin. [ruby-core:38040] [Bug #5022]
 
-Sat Apr  8 02:34:34 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 22 21:45:21 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* bignum.c (rb_big_pow): second operand may be too big even if
-	  it's a Fixnum.  [ruby-talk:187984]
+	* ext/dl/handle.c (dlhandle_sym): clear previous error with dlerror()
+	  before calling dlsym(). [ruby-dev:44091] [Bug #5021]
 
-Sat Apr  8 02:12:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 22 19:05:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* README.EXT: update symbol description.  [ruby-talk:188104]
+	* parse.y (rb_enc_symname2_p): get rid of potential out-of-bound
+	  access.
 
-Thu Apr  6 23:28:47 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 22 13:55:59 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* COPYING: explicitly note GPLv2.  [ruby-talk:187922]
+	* lib/net/http.rb:  Net::HTTP#finish is used to manually close
+	  connections.  [Ruby 1.9 - Bug #5045]
 
-Thu Apr  6 11:18:37 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jul 22 13:51:29 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/panedwindow.rb: lack of arguments. [ruby-core:7681]
+	* ext/readline/readline.c:  Add examples for Readline.completion_proc=.
+	  [Ruby 1.9 - Bug #5057]
 
-Thu Apr  6 01:04:47 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jul 22 13:20:33 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/tcltklib.c: fix SEGV when embedding to an application.
-	  [ruby-core:7600]
+	* tool/rbinstall.rb (default gems):  Install executables into the fake
+	  gem dir for Gem.bin_path.  [Ruby 1.9 - Bug #4485]
 
-	* ext/tk/tcltklib.c: fix SEGV at exit. [ruby-talk:186489]
+Fri Jul 22 13:03:12 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/tkutil/tkutil.c: follow to changing specification of
-	  instance_eval on ruby-1.9.x.
+	* backport r32609 from trunk.
 
-	* ext/tk/lib/tk.rb: ditto.
+	* ext/openssl/ossl_hmac.c: Revert checking return type of
+	  HMAC_Init_ex as it is not compatible with OpenSSL < 1.0.0.
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+Fri Jul 22 11:22:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/lib/tk.rb: remove warning about redefinition of methods.
+	* backport r32606 from trunk.
 
-	* ext/tk/lib/tk/variable.rb: remove warning about unseting Tcl
-	  variables.
+	* ext/openssl/ossl_digest.c: Check return value of EVP_DigestInit_ex.
+	* ext/openssl/ossl_hmac.c: Check return value of HMAC_Init_ex.
+	  Thanks, Jared Jennings, for the patch.
+	  [ Ruby 1.9 - Bug #4944 ] [ruby-core:37670]
 
-Wed Mar 29 20:54:44 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Fri Jul 22 09:17:43 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/win32ole/win32ole.c (fole_getproperty): WIN32OLE#[] should accept
-	  multi arguments.
+	* backport r32604 from trunk.
 
-	* ext/win32ole/tests/testWIN32OLE.rb (test_setproperty_bracket): ditto.
+	* ext/openssl/ossl_engine.c: Avoid double free of ENGINE reference.
+	* test/openssl/test_engine.rb: Add a test for it.
+	  Thanks to Ippei Obayashi for providing the patch.
+	  [ Ruby 1.9 - Bug #5062 ] [ruby-dev:44173]
 
-Wed Mar 29 10:07:44 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Jul 22 06:39:34 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/nkf/nkf-utf8/nkf.c (nkf_each_char_to_hex, encode_fallback_subchar,
-	  e2w_conv): support C90 compiler.
+	* lib/csv.rb: Do not modify CSV.generate's argument [ruby-core:38356]
 
-Wed Mar 29 06:48:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jul 21 20:02:11 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* eval.c (backtrace): reports aliased method names in a generated
-	  backtrace.  a patch from "U.Nakamura" <usa at garbagecollect.jp>.
-	  [ruby-dev:28471]
+	* thread.c (set_trace_func, thread_set_trace_func_m): reset tracing
+	  state when set_trace_func hook is removed.  This is workaround patch
+	  to force to reset tracing state that is broken by continuation call.
+	  a patch from James M. Lawrence.  [Feature #4347] [ruby-core:34998]
 
-Mon Mar 27 22:19:09 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/ruby/test_continuation.rb (class TestContinuation): add a test
+	  for above.  a patch from James M. Lawrence.
 
-	* ext/nkf/nkf-utf8/{nkf.c, utf8tbl.c, config.h}: imported nkf 2.0.6.
-	  * Add --ic / --oc option and mapping tables.
-	  * Add fallback option.
-	  * Add --no-best-fit-chars option.
-	  * Fix some bugs.
+Thu Jul 21 20:59:59 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/nkf/nkf.c (nkf_split_options): added for parse option string.
+	* ext/socket/ancdata.c (discard_cmsg): workaround for MacOS X Lion.
 
-	* ext/nkf/lib/kconv.rb (Kconv.to*): add -m0.
-	  Note that Kconv.to* still imply -X.
 
-Mon Mar 27 03:17:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jul 21 07:07:57 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_call0): insecure calling should be checked for non
-	  NODE_SCOPE method invocations too.
+	* backport r32579, r32581, r32587 by akr and r32588 by kazu.
 
-	* eval.c (rb_alias): should preserve the current safe level as
-	  well as method definition.
+	r32579:
 
-Fri Mar 24 23:14:30 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (rb_update_max_fd): new function.
 
-	* eval.c (yield_under_i): pass self again for instance_eval().
-	  [ruby-dev:28466]
+	* internal.h (rb_update_max_fd): declare rb_update_max_fd.
 
-Fri Mar 24 17:20:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread_pthread.c (rb_thread_create_timer_thread): update max fd when
+	  timer thread pipe is created.
 
-	* process.c (rb_f_sleep): remove description about SIGALRM which
-	  is not valid on the current implementation.  [ruby-dev:28464]
+	r32581:
 
-Thu Mar 23 10:47:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (UPDATE_MAXFD): removed.
 
-	* eval.c (method_missing): should support argument splat in
-	  super.  [ruby-talk:185438]
+	r32587:
 
-Mon Mar 20 12:05:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/intern.h (rb_update_max_fd): declaration moved from
+	  internal.h.
 
-	* configure.in: Solaris SunPro compiler -rapth patch from
-	  <kuwa at labs.fujitsu.com>.  [ruby-dev:28443]
+	* file.c: ditto.
 
-Mon Mar 20 09:40:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c: call rb_update_max_fd for each new fds.
 
-	* configure.in: remove enable_rpath=no for Solaris.
-	  [ruby-dev:28440]
+	* process.c: ditto.
 
-Fri Mar 17 19:08:49 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* random.c: ditto.
 
-	* ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: fix typo.
-	  [ruby-core:07571]
+	* ruby.c: ditto.
 
-Wed Mar 15 16:54:21 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/io/console/console.c: ditto.
 
-	* lib/mkmf.rb (create_makefile): support libraries without *.so.
+	* ext/openssl/ossl_bio.c: ditto.
 
-Wed Mar 15 16:35:43 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/pty/pty.c: ditto.
 
-	* ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: should use
-	  "rb_str_new(0, 0)" to make empty string.
+	* ext/socket/init.c: ditto.
 
-Sat Mar 11 14:24:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/socket.c: ditto.
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::wrap): removed
-	  space before argument parenthesis.  [ruby-talk:183630]
+	* ext/socket/ancdata.c: ditto.
 
-	* ruby.1: a clarification patch from David Lutterkort
-	  <dlutter at redhat.com>.  [ruby-core:7508]
+	* ext/socket/unixsocket.c: ditto.
 
-Sat Mar  4 15:26:40 2006  Tanaka Akira  <akr@m17n.org>
+	r32588:
 
-	* gc.c (id2ref): fix symbol test.
+	* io.c (rb_update_max_fd): remove parentheses. they are not in
+	  macro.
 
-Sat Mar  4 01:08:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 17 08:07:31 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/rdoc/ri/ri_paths.rb (RI::Paths): adding paths from rubygems
-	  directories.  a patch from Eric Hodel <drbrain at segment7.net>.
-	  [ruby-core:07423]
+	* backport r32563 from trunk
 
-Thu Mar  2 19:44:18 2006  Tanaka Akira  <akr@m17n.org>
+	* test/openssl/test_ssl_session.rb: add PEM SSL session without TLS
+	  extensions. Use this as the default for the tests to ensure
+	  compatibility with OpenSSL 0.9.7.
+	  [ Ruby 1.9 - Bug #4961 ] [ruby-core:37726]
 
-	* gc.c: align VALUE with sizeof(RVALUE) globally.
-	  (is_pointer_to_heap): check alignment out of loop.
-	  (id2ref): avoid collision between symbols and objects.
-	  (rb_obj_id): ditto.  moved from object.c.
-	  [ruby-talk:178364] [ruby-core:7305]
+Sat Jul 16 17:29:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar  2 18:58:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in (RUBY_UNIVERSAL_ARCH): restore arch flag.
+	  Bug #4977
 
-	* eval.c (rb_thread_fd_writable): should not re-schedule output
-	  from KILLED thread (must be error printing).
+Sat Jul 16 11:18:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Mar  2 17:57:49 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* win32/setup.mak: support to build x64-mswin64 on Windows7 (and Vista,
+	  perhaps).
+	  backported r32521 from trunk
 
-	* gc.c: commited magic for reducing RVALUE size on windows. (24->20byte)
-	  [ruby-core:7474]
+Sat Jul 16 06:31:23 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Thu Mar  2 12:59:14 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/uri/common.rb (module): Remove optional parser argument to
+	  Kernel#URI
+	  [ruby-core:38061]
 
-	* win32/win32.c (filetime_to_unixtime): should set tm_isdst to -1.
-	  stat() didn't treat daylight saving time property on WinNT.
-	  [ruby-talk:182100]
+	* lib/uri/generic.rb (module): ditto
 
-Thu Mar  2 08:02:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jul 16 01:15:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* gc.c (add_heap): heap_slots may overflow.  a patch from Stefan
-	  Weil <weil at mail.berlios.de>.
+	* time.c (time_dup): used rb_obj_class() instead of CLASS_OF().
+	  The patch is made by Kazuki Tsujimoto. [Bug #5012] [ruby-dev:44071]
 
-Wed Mar  1 00:24:31 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/ruby/test_time.rb (TestTime#test_getlocal_dont_share_eigenclass):
+	  added a new test for eigenclass of time object.
 
-	* lib/rdoc/parsers/parse_rb.rb (read_escape): could not handle /\^/.
-	  merged Mr. Ishizuka's lib/irb/ruby-lex.rb 's patch rev 1.29.
-	  [ruby-talk:181631] [ruby-dev:28404]
+Fri Jul 15 19:11:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Tue Feb 28 09:32:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* bignum.c (bigsub_int): add RB_GC_GUARD.  This patch is made by
+	  Makoto Kishimoto.  fixes #4223 [ruby-dev:42907]
 
-	* lib/drb/extservm.rb (invoke_service_command): cannot invoke command
-	  if command name is quoted on mswin32. [ruby-dev:28400]
+	* bignum.c (bigadd_int): ditto.
 
-Mon Feb 27 00:19:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 15 09:59:12 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* ruby.h (SYM2ID): should not cast to signed long.
-	  [ruby-core:07414]
+	* backport r32546 from trunk.
 
-Fri Feb 24 20:07:23 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/digest/sha2/sha2.c (SHA256_Update, SHA512_Update): avoid Bus
+	  Error caused by unalignment access on Sparc-Solaris (and possibly on
+	  other similar environment.) This patch just do memcpy always instead
+	  of checking architecture. I see no perf drop on my 64bit env. For
+	  more details, see #4320.
 
-	* test/drb/drbtest.rb (add_service_command): quote pathnames in the
-	  server's command line for space contained directory names.
-	  Thanks, arton. [ruby-dev:28386]
+	* test/digest/test_digest.rb: add test for unalignment access.
 
-Fri Feb 24 12:11:08 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* instruby.rb: install *.exe.manifest and *.dll.manifest if exist.
-	  It's for VC++8.
+Thu Jul 14 12:40:07 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Fri Feb 24 11:33:52 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* backport r32537 from trunk.
 
-	* bcc32/Makefile.sub (HAVE_HYPOT): bcc32 has hypot().
+	* ext/openssl/ossl.c (ossl_verify_cb): trap the exception from
+	  verify callback of SSLContext and X509Store and make the
+	  verification fail normally. Raising exception directly from callback
+	  causes orphan resources in OpenSSL stack. Patched by Ippei Obayashi.
+	  See #4445.
 
-Fri Feb 24 11:19:58 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/openssl/test_ssl.rb
+	  (test_exception_in_verify_callback_is_ignored): test it.
 
-	* time.c (time_new_internal): add prototype to tell the compiler
-	  arugments types.
+Wed Jul 13 08:20:08 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* win32/win32.c (NtInitialize): need to set a handler for VC++8.
+	* lib/test/unit.rb(Test::Unit::Options#process_args): Fix bug.
+	  Fix process_args didn't return `@option` after r30939. Backported
+	  r32526 from trunk.
 
-Fri Feb 24 08:19:16 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Jul 11 23:50:39 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
 
-	* test.rb: Removed.  Obsolete by test/nkf.
+	* time.c: can't compile time.c on AIX due to missing declaration for
+	  ffs(). It is declared in strings.h on AIX. backported r32518 from
+	  trunk.
 
-	* ext/.document: enabled documents in nkf and kconv
+Mon Jul 11 23:47:00 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
 
-	* ext/nkf/nkf.c ext/nkf/lib/kconv.rb: Add rdoc.
+	* thread_pthread.c (get_stack):  need to adjust stack addr for
+	  [Bug #1813] on AIX. backported r32511 from trunk.
 
-Thu Feb 23 22:39:59 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Mon Jul 11 15:17:03 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* bcc32/Makefile.sub: use borlndmm.dll if possible. bcc32's RTL internal
-	  memory manager cannot handle large memory block properly.
-	  ex: 10000.times { "" << "." * 529671; GC.start } # crash
-	  [ruby-dev:28230]
+	* numeric.c (rb_num2ull): use FIX2LONG instead of FIX2ULONG. see
+	  rb_num2ulong(). fixed the problem of ObjectSpace._id2ref of IL32LLP64
+	  platforms, introduced at r32433.
+	  backported r32512 from trunk.
 
-Thu Feb 23 13:20:28 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Jul 10 23:58:55 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* eval.c (SETUP_ARGS0): fixed memory corruption. [ruby-dev:28360]
+	* version.h: 1.9.3 is no longer trunk.
 
-Tue Feb 21 02:18:46 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Jul 10 23:24:29 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* configure.in (mingw): have link.  [ruby-list:41838]
+	* class.c (rb_mix_module): reverted r31873.
+	  (check_mix_method_i, do_mix_method_i) reverted r31917.
 
-	* win32/Makefile.sub (config.h): ditto.
+	* test/ruby/test_module.rb (TestModule#test_mix_const): reverted
+	  r31918.
 
-Tue Feb 21 02:07:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 10 22:50:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* parse.y (f_arglist): should set command_start = Qtrue for
-	  command body.  [ruby-talk:180648]
+	* ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): fix
+	  precision treatment errors.
 
-Mon Feb 20 17:37:26 2006  Tanaka Akira  <akr@m17n.org>
+	* test/bigdecimal/test_bigdecimal.rb: add tests for the above change.
+	  fix precision treatment errors.
 
-	* mkconfig.rb: alias RbConfig for Config.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_power): precision argument
+	  should be optional for its compatibility.
 
-Mon Feb 20 12:27:53 2006  Kent Sibilev  <ksruby@gmail.com>
+Sun Jul 10 22:38:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rational.rb (Integer::gcd): small typo fix.
-	  [ruby-core:07395]
+	* parse.y (var_ref): distinguish vcall from local variable
+	  references.  based on a patch by Michael Edgar michael.j.edgar
+	  AT dartmouth.edu.  Bug #5002
 
-Mon Feb 20 01:05:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 10 21:51:29 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rational.rb (Integer::gcd): replaced by gcd4 in
-	  [ruby-core:07390].  [ruby-core:07377]
+	* internal.h: add comments (cautions).
 
-Mon Feb 20 00:57:02 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Jul 10 20:59:38 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* ext/openssl/ossl.h (OSSL_Debug): should not use __func__.
-	  [ruby-dev:28339]
+	* lib/test/unit.rb: Add new class variable `@@testfile_prefix`.
+	  This is for changing test name prefix. (For testing)
 
-Sun Feb 19 04:46:29 2006  Guy Decoux  <ts@moulon.inra.fr>
+	* test/testunit/tests_for_parallel/ptest_first.rb: Renamed from
+	  test_first.rb
 
-	* eval.c: initial value for block_unique must be 1.
-	  [ruby-talk:180420]
+	* test/testunit/tests_for_parallel/ptest_second.rb: Renamed from
+	  test_second.rb
 
-Sat Feb 18 23:58:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/tests_for_parallel/ptest_third.rb: Renamed from
+	  test_third.rb
 
-	* lib/tracer.rb (Tracer::Tracer.add_filter): turn on tracer mode
-	  only when caller() level size is one.  [ruby-core:07389]
+	* test/testunit/tests_for_parallel/ptest_forth.rb: Renamed from
+	  test_forth.rb
 
-	* lib/rdoc/parsers/parse_rb.rb: need not to require "tracer".
-	  [ruby-core:07389]
+	* test/testunit/tests_for_parallel/runner.rb: Remove misc.rb
 
-	* sample/rtags.rb: ditto.
+	* test/testunit/tests_for_parallel/ptest_first.rb: ditto.
 
-Sat Feb 18 12:18:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/tests_for_parallel/ptest_second.rb: ditto.
 
-	* lib/fileutils.rb (FileUtils::fu_world_writable): make it
-	  private.  [ruby-core:07383]
+	* test/testunit/tests_for_parallel/ptest_third.rb: ditto.
 
-Sat Feb 18 00:22:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/tests_for_parallel/ptest_forth.rb: ditto.
 
-	* lib/tracer.rb: merged a minor clarification patch from Daniel
-	  Berger <Daniel.Berger at qwest.com>.  [ruby-core:07376]
+	* test/testunit/tests_for_parallel/misc.rb: Removed because no longer
+	  needed.
 
-Fri Feb 17 11:18:42 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/testunit/test_parallel.rb: Fix assertions for above.
 
-	* util.c (ruby_strtod): Float("1e") should fail. [ruby-core:7330]
+Sun Jul 10 16:57:08 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* pack.c (EXTEND32): unpack("l") did not work where sizeof(long) != 4.
-	  [ruby-talk:180024]
+	* vm_insnhelper.c (vm_throw): check a class frame.
+	  Fixes Bug #4648.
+	  The patch is contributed by Kazuki Tsujimoto.
 
-	* pack.c (pack_unpack): fixed integer overflow on template "w".
-	  [ruby-talk:180126]
+	* bootstraptest/test_proc.rb: add tests for above.
 
-Fri Feb 17 09:39:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 10 17:28:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_thread_wait_for): sleep should always sleep for
-	  specified amount of time.  [ruby-talk:180067]
+	* thread_pthread.c (mutex_debug): use exit(EXIT_FAILURE) instad of
+	  exit(1).
+	* thread_pthread.c (add_signal_thread_list): ditto.
+	* thread.c (rb_thread_call_with_gvl): ditto.
+	* util.c (Bug): ditto.
 
-Thu Feb 16 01:10:48 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 10 15:58:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (backtrace): frame->orig_func may not be initialized.
-	  [ruby-core:07367]
+	* ext/json: Merge json gem 1.5.4+ (f7f78896607b6f6226cd).
+	  [Bug #4700]
 
-Wed Feb 15 16:52:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 10 16:41:32 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_eval): NODE_OP_ASGN1 should allow splat in its
-	  argument list.  [ruby-core:07366]
+	* vm_core.h (typedef struct rb_vm_struct): create a new
+	  'inhibit_thread_creation' field.
+	* thread.c (rb_thread_terminate_all): set inhibit_thread_creation.
+	* thread.c (thread_s_new): don't permit to create new thread
+	  if the VM is under destruction. Otherwise evil finalizer code
+	  can make SEGV. [Bug #4992][ruby-core:37858]
 
-	* parse.y (arg): avoid unnecessary extra argument.
-	  [ruby-core:07366]
+	* bootstraptest/test_objectspace.rb: new test for this fix.
 
-	* eval.c (rb_eval): honor visibility on OP_ASGN1 and
-	  OP_ASGN2. [ruby-core:07366]
+Sun Jul 10 16:06:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Feb 15 10:09:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* signal.c (sigsegv): use abort() instead of exit() when nested
+	  SEGV was happen. Because unnested SEGV use abort().
+	  [Bug #5013][ruby-dev:44078]
 
-	* eval.c (yield_under_i): should not pass self as an argument to
-	  the block for instance_eval.  [ruby-core:07364]
+Sun Jul 10 15:30:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Feb 15 09:20:35 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* load.c (rb_f_autoload): prevent to autoload for singleton
+	  classes.  fixes [Bug #4886] [ruby-dev:43816]
 
-	* eval.c (rb_obj_instance_eval): should be no singleton classes for
-	  true, false, and nil.  [ruby-dev:28186]
+	* bootstraptest/test_autoload.rb: add tests for the above change.
 
-Tue Feb 14 18:48:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jul 10 15:09:17 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* eval.c (DMETHOD_P): accessing wrong frame.  [ruby-dev:28181]
+	* lib/test/unit/assertions.rb: Import documentation patch by Justin
+	  Collins. [ruby-core:37225] [Feature #4903]
 
-	* eval.c (proc_invoke): preserve FRAME_DMETH flag.
+Sun Jul 10 14:57:36 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Feb 14 15:13:51 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/date/date_core.c: canonicalizes nth and sf.
 
-	* ext/zlib/zlib.c: supress warning on test/zlib. [ruby-dev:28323]
+Sun Jul 10 14:13:50 2011  Koichi Sasada  <ko1@atdot.net>
 
-Tue Feb 14 14:01:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* internal.h (rb_thread_call_with_gvl, rb_thread_call_without_gvl):
+	  make them visible as experimental C APIs.  fixes Feature #4328.
 
-	* time.c (search_time_t): support non 32bit time_t environments.
+Sun Jul 10 12:18:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* win32/Makefile.sub (config.h): VC++8 has ``long long'' type.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_power): support non-integral
+	  exponent.  fixes [Bug #3271]
 
-	* win32/Makefile.sub (config.h): VC++8's time_t is 64bit value.
+	* ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): ditto.
 
-	* win32/win32.c (rb_w32_utime): drop read-only attribute before
-	  changing file time.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_power_op): add a function to
+	  only use for "**" operator.
 
-	  all changes are backported from CVS HEAD.
+	* test/bigdecimal/test_bigdecimal.rb: add a bunch of tests for the
+	  above changes.
 
-Tue Feb 14 11:21:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (is_integer): add an utility function.
 
-	* io.c (argf_forward): should not use frame->argv.
-	  [ruby-core:07358]
+	* ext/bigdecimal/bigdecimal.c (is_negative): ditto.
 
-Mon Feb 13 18:08:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (is_positive): ditto.
 
-	* eval.c (rb_call0): argument update propagation.  [ruby-dev:28044]
+	* ext/bigdecimal/bigdecimal.c (is_zero): ditto.
 
-	* env.h: remove argv member from struct FRAME.
+	* ext/bigdecimal/bigdecimal.c (is_one): ditto.
 
-Mon Feb 13 13:27:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (is_even): ditto.
 
-	* eval.c (eval): should push class from binding if supplied.
-	  [ruby-core:07347]
+Sun Jul 10 12:08:39 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Mon Feb 13 00:04:00 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* compile.c (when_vals): when a string literal is written on when
+	  clause, skip string creation to make it faster.  [ruby-dev:44068]
+	  [Feature #5000]
 
-	* lib/erb.rb (ERB::Compiler): add instance variable @insert_cmd to
-	  change <%='s behavior. (backported 1.15 - 1.16)
+Sun Jul 10 11:35:29 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Sat Feb 11 02:04:11 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (reduce_nodes_gen): NODE_RETURN in rescue body must not be
+	  reduced when there is an else clause.  This caused bizarre behavior
+	  in [Bug #4473] [ruby-core:35629] [ruby-core:37884].
 
-	* eval.c (eval): no need to push ruby_class.  [ruby-dev:28176]
+Sun Jul 10 09:46:14 2011  Masaya Tarui  <tarui@ruby-lnag.org>
 
-Sat Feb 11 01:57:44 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* range.c (range_max): fix behavior with excluded end value.
+	  [Bug #4591]
 
-	* eval.c (rb_f_autoload): check if ruby_cbase is nil (during
-	  instance_eval for objects cannot have singleton classes,
-	  e.g. fixnums and symbols).  [ruby-dev:28178]
+Sun Jul 10 09:13:18 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Feb  7 23:03:24 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* NEWS:  Fix RubyGems version.  [Ruby 1.9 - Bug #5004]
 
-	* ext/zlib/zlib.c: should not access ruby objects in finalizer.
-	  [ruby-dev:28286]
+Sat Jul  9 20:01:59 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Feb  6 16:02:51 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* internal.h: rb_rational_reciprocal is defined in rational.c.
 
-	* file.c (rb_thread_flock): ERROR_NOT_LOCKED is not an error on Cygwin.
-	  In such situation, flock() should return 0.
+Sat Jul  9 19:48:31 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Feb  6 00:41:08 2006  Tanaka Akira  <akr@m17n.org>
+	* internal.h: added declarations.
+	* complex.c: followed the above change.
 
-	* ruby.h (RSTRUCT_LEN, RSTRUCT_PTR): defined for source level
-	  compatibility with ruby 1.9.
+Sat Jul  9 17:24:41 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Feb  5 21:05:34 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* NEWS: bigdecimal is not a builtin.
 
-	* numeric.c (fix_to_s): removed workaround for radix 2. Historically,
-	  rb_fix2str could only handle radix 8, 10, 16. (Rev1.37) But for now,
-	  it can handle radix 2..36. [ruby-Bugs#3438] [ruby-core:7300]
+Sat Jul  9 17:17:53 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Feb  5 18:55:08 2006  Minero Aoki  <aamine@loveruby.net>
+	* ext/date/date_core.c: some improvements for performance.
 
-	* lib/net/http.rb: imported from trunk, rev 1.129
+Sat Jul  9 16:56:01 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/http.rb (add_field, get_fields): keep 1.8.2 backward
-	  compatibility.
+	* atomic.h (ATOMIC_OR): _InterlockedOr is unavailable in VC6.
 
-	* lib/net/https.rb: imported from trunk, rev 1.3.
+	* numeric.c (ULLONG_MAX): fallback definition.
 
-	* lib/net/https.rb: #use_ssl? definition moved from net/http.rb.
+Sat Jul  9 15:59:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb  5 14:22:15 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* win32/win32.c (rb_w32_{read,write}): should be signed.
+	  Bug #5001
 
-	* lib/pstore.rb: should return default value if name is not found.
-	  [ruby-core:7304]
+Sat Jul  9 14:02:20 2011  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
 
-	* lib/pstore.rb: should raise PStore::Error if not in transaction.
+	* lib/cgi/core.rb: fix multipart form parsing bug. [Bug #3866]
 
-Sat Feb  4 22:51:43 2006  Tanaka Akira  <akr@m17n.org>
+Sat Jul  9 11:41:03 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* eval.c: apply the FreeBSD getcontext/setcontext workaround
-	  only before FreeBSD 7-CURRENT.
+	* lib/matrix.rb: Add Vector#normalize [ruby-dev:43829]
 
-Sat Feb  4 21:19:23 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Jul  9 09:25:06 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* win32/win32.c (LK_ERR): ERROR_NOT_LOCKED is not an error.
-	  In such situation, flock() should return 0.
+	* enumerator.c:  Remove "enumeration sequenced by".
+	  [Ruby 1.9 - Bug #4757]
 
-Sat Feb  4 15:56:37 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul  9 09:14:56 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* numeric.c (fix_to_s): (2**32).to_s(2) fails with exception where
-	  sizeof(int) == 4 < sizeof(long). [ruby-core:7300]
+	* io.c:  Note that methods other than IO#gets may increase IO#lineno.
+	  [Ruby 1.9 - Bug #4902]
 
-Fri Feb  3 15:06:50 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul  9 08:39:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/syck.c (syck_move_tokens): should reset p->cursor or etc
-	  even if skip == 0. This causes buffer overrun.
-	  (ex: YAML.load('--- "..' + '\x82\xA0' * 511 + '"'))
+	* common.mk (RUN_OPT): disable gems.
 
-Thu Feb  2 23:51:18 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul  9 08:37:05 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/emitter.c (syck_emitter_write): should not set '\0' on
-	  emitter's marker. if marker points to the end of buffer, this causes
-	  buffer overrun. (ex: YAML.dump("." * 12288))
+	* io.c (rb_io_close): close(2) on a fd which is being read by
+	  another thread causes deadlock on Mac OS X 10.5
 
-Thu Feb  2 16:01:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul  8 21:20:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (eval): need not to protect $SAFE value.
-	  [ruby-core:07177]
+	* addr2line.c: use USE_ELF instead of __ELF__ because Solaris
+	  doesn't define it. USE_ELF is already provided by configure.
+	  patched by Naohisa Goto. [ruby-dev:44066] [Bug #4998]
 
-Thu Feb  2 14:45:53 2006  Ville Mattila  <ville.mattila@stonesoft.com>
+	* addr2line.h: ditto.
 
-	* configure.in: The isinf is not regognized by autoconf
-	  library guesser on solaris 10. [ruby-core:7138]
+	* vm_dump.c: ditto.
 
-Wed Feb  1 22:01:47 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri Jul  8 16:40:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in, hash.c (ruby_setenv): use setenv(3) and unsetenv(3)
-	  where they are supported. modifing environ variable seems to
-	  segfault solaris 10. [ruby-core:7276] [ruby-dev:28270]
+	* ext/json/parser/parser.rl (convert_encoding): should not modify
+	  the argument.
 
-	* ruby.c (set_arg0): if use setenv(3), environ space cannot be used
-	  for altering argv[0].
+	* ext/json/parser/parser.rl (convert_encoding): no needs to use
+	  force_encoding.
 
-Tue Jan 31 14:46:28 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul  8 15:53:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* struct.c (rb_struct_select): update RDoc description.
-	  [ruby-core:7254]
+	* error.c (rb_bug): get rid of segfault after all threads
+	  disposed.
 
-Tue Jan 31 11:58:51 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jul  8 15:01:06 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#eval and bg_eval.
+	* ext/openssl/ossl.h: include openssl/e_os2.h before checking the
+	  definition of OPENSSL_SYS_WIN32.
 
-	* ext/tk/lib/tk/namespace.rb: TkNamespace#eval was enbugged at the
-	  last commit. Now it will return a proper object.
+Fri Jul  8 14:40:39 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jan 31 00:10:26 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* win32/win32.c (wunlink): reverted a part of r32426. it was mistakenly
+	  mixed.
 
-	* ext/syck/rubyext.c (syck_resolver_transfer): workaround for SEGV.
-	  ex: ruby -ryaml -e 'YAML.load("!map:B {}")' [ruby-core:7217]
+Fri Jul  8 14:29:47 2011  Narihiro Nakamura  <authornari@gmail.com>
 
-Sat Jan 28 07:56:57 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* configure.in: can't subtract void *.
 
-	* lib/rdoc/usage.rb: support "a:0:33" style caller[-1]. In this case
-	  file name is "a:0". I don't know this really happens though...
-	  [ruby-Bugs:3344]
+Fri Jul  8 14:33:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jan 25 22:29:04 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/Makefile.sub (config.h): define GC_MARK_STACKFRAME_WORD.
+	  fixed build problem of r32438.  the value (30) is temporary value.
+	  maybe it's enough by 20~24 according to my observation.
 
-	* configure.in, dln.c, file.c, intern.h, missing.h (eaccess): use
-	  system routine if provided.  fixed: [ruby-core:07195]
+Fri Jul  8 13:47:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jan 22 23:27:13 2006  Go Noguchi  <gonoguti@yahoo.co.jp>
+	* thread.c (rb_mutex_unlock_all): folded into
+	  rb_threadptr_unlock_all_locking_mutexes.
+	* thread.c (rb_threadptr_unlock_all_locking_mutexes) ditto.
 
-	* lib/test/unit/autorunner.rb (process_args): ignore arguments after
-	  '--' so that test scripts can handle them.  fixed: [ruby-dev:28258]
+Fri Jul  8 13:36:02 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jan 22 22:09:52 2006  Tanaka Akira  <akr@m17n.org>
+	* thread.c (thread_unlock_all_locking_mutexes): rename to
+	  rb_threadptr_unlock_all_locking_mutexes and remove static.
+	* vm_core.h: add rb_threadptr_unlock_all_locking_mutexes declaration.
+	* thread.c (thread_start_func_2): adjust the above rename.
 
-	* eval.c (POST_GETCONTEXT): define separately from PRE_GETCONTEXT on
-	  IA64 to avoid reusing variable address.
+	* eval.c (ruby_cleanup): call rb_threadptr_unlock_all_locking_mutexes
+	  again after finalizer. [Bug #4988] [ruby-dev:44049]
 
-Sun Jan 22 20:03:35 2006  Tanaka Akira  <akr@m17n.org>
+Fri Jul  8 13:06:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (ruby_setjmp): define PRE_GETCONTEXT and POST_GETCONTEXT
-	  instead of FUNCTION_CALL_MAY_RETURN_TWICE.
-	  define PRE_GETCONTEXT to clear carry flag for workaround of
-	  FreeBSD/i386 getcontext/setcontext bug.
-	  [ruby-dev:28263]
+	* cont.c (FIBER_MACHINE_STACK_ALLOCATION_SIZE): Fiber stack size
+	  don't need to keep multiple number of sizeof(VALUE).
 
-Sat Jan 21 00:36:47 2006  Tanaka Akira  <akr@m17n.org>
+Fri Jul  8 11:39:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): use only on SPARC and IA64
-	  before gcc 4.0.3.
-	  [ruby-dev:28247]
+	* common.mk (sudo-precheck): true command is not standard on
+	  Windows.
 
-Thu Jan 19 22:21:23 2006  Minero Aoki  <aamine@loveruby.net>
+Fri Jul  8 10:39:52 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/fileutils.rb (mv): should remove file after copying.
-	  [ruby-dev:28223]
+	* thread_pthread.c (gvl_destroy): fix cond_t leak.
 
-Wed Jan 18 23:37:06 2006  Tanaka Akira  <akr@m17n.org>
+Fri Jul  8 09:17:59 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): don't clobber %l7 of SPARC
-	  if enable-shared.
-	  (ruby_setjmp): call FUNCTION_CALL_MAY_RETURN_TWICE after getcontext
-	  too.
-	  reported by Pav Lucistnik and Marius Strobl.
-	  http://lists.freebsd.org/pipermail/freebsd-sparc64/2006-January/003739.html
+	* gc.c:  Improve documentation
 
-Tue Jan 17 11:32:46 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Jul  7 23:35:31 2011  Narihiro Nakamura  <authornari@gmail.com>
 
-	* win32/setup.mak (MAKE): workaround for nmake 8.
+	* gc.c: change water_mark value that may call
+	  gc_mark(lev <= GC_LEVEL_MAX) in gc_mark().
+	  In ruby_stack_check(), water_mark is a value that may call some
+	  C function. Fixes Bug #3781
 
-Tue Jan 17 11:10:21 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* configure.in: define GC_MARK_STACKFRAME_WORD that approximate
+	  size of gc_mark() and gc_mark_children() stackframes.
 
-	* win32/{Makefile.sub,setup.mak}: invoke .bat via shell. workaround
-	  for nmake 8.
+Thu Jul  7 17:55:05 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Jan 16 10:26:23 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/testunit/test_parallel.rb (TestParallelWorker#teardown): wait
+	  the child process even if the communication pipe is broken.
 
-	* ext/syck/emitter.c (syck_emit_seq, syck_emit_map, syck_emit_item):
-	  should output complex key mark even if map's key is empty seq/map.
-	  [ruby-core:7129]
+Thu Jul  7 15:44:42 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jan 14 05:37:06 2006  Tanaka Akira  <akr@m17n.org>
+	* encoding.c (rb_enc_set_index, rb_enc_associate_index): should
+	  check if frozen.
 
-	* io.c (READ_DATA_PENDING, READ_DATA_PENDING_COUNT): defined
-	  for DragonFly BSD 1.4.0.
+	* parse.y (rb_intern3), ruby.c (process_options, ruby_script):
+	  defer freezing after associating encodings.
 
-Sat Jan 14 03:43:24 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jul  7 15:16:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* file.c (rb_file_s_chmod): avoid warning where sizeof(int) !=
-	  sizeof(void*).
+	* numeric.c (rb_num2ull): use own switch sentence.
+	  Current implementation can't convert 18446744073709551615.
 
-Fri Jan 13 19:14:56 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jul  7 06:56:15 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/diagram.rb:
-	    - properly quote bare element attributes
-	    - terminates dangling elements (e.g. <img>, <br>, <link>, etc)
-	    - converts "CVS" to the more HTML-friendly acronym element
-	    - adds missing type attributes to style elements
+	* cont.c (FIBER_STACK_FLAGS): workaround fix for r32420 on FreeBSD.
 
-	  based on Paul Duncan's patch <pabs@pablotron.org> [ruby-core:7028]
+Thu Jul  7 06:46:12 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rdoc/generators/html_generator.rb: ditto.
-	* lib/rdoc/generators/template/html/hefss.rb: ditto.
-	* lib/rdoc/generators/template/html/html.rb: ditto.
-	* lib/rdoc/generators/template/html/kilmer.rb: ditto.
+	* benchmark/driver.rb:  Add difference column to report that averages
+	  across all runs of a benchmark.  [Ruby 1.9 - Feature #4982]
 
-Thu Jan 12 11:53:08 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jul  7 06:19:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/sample/tkballoonhelp.rb: [bug fix] couldn't add to a widget
-	  which is constructed with TkComposite module.
-	  [new feature] support 'command' option which is called just before
-	  popping up the balloon help.
+	* lib/rubygems.rb:  Reduce requires to improve `make benchmark`.
+	  [#4962]
+	* lib/rubygems/specification.rb:  Delay initialization of rubygems
+	  until require is called.
 
-Wed Jan 11 15:00:00 2006  Ville Mattila  <mulperi@iki.fi>
+Thu Jul  7 04:31:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (READ_PENDING*): Support solaris 64-bit environments.
-	  Solaris defines a opaque FILE struct when compiling 64 bit
-	  binaries. This means that we dont have access to _ptr etc.
-	  members anymore. The solution by Steven Lumos is to define
-	  FILE64 that has needed members available. I've modified
-	  the origanal patch a bit so that it compiles both with gcc
-	  and now free sun studio 11 compiler and both amd64 and sparc.
-	  NOTE! We have to 64 bit solaris FILE structure time to time
-	  otherwise we'll get breakage.
-	  [ruby-core:7106]
+	* parse.y (arg): rescue_mod is in inverse order from other
+	  modifiers.  patched by michael.j.edgar AT dartmouth.edu at
+	  [ruby-core:36248].  fixed #4716.
 
-Tue Jan 10 19:42:33 2006  Tanaka Akira  <akr@m17n.org>
+Thu Jul  7 00:40:16 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* gc.c (garbage_collect): mark ruby_current_node.
-	  if an exception is raised in a finalizer called written in C by
-	  rb_gc_call_finalizer_at_exit, ruby_set_current_source may use
-	  collected ruby_current_node and mark_source_filename may corrupt
-	  memory.
+	* win32/win32.c (kill): check that the process exited or not before
+	  terminating it. [Bug #4943]
 
-Tue Jan 10 13:30:34 2006  akira yamada  <akira@ruby-lang.org>
+Wed Jul  6 23:13:19 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/syck/rubyext.c (syck_resolver_transfer): should be able to load
-	  !ruby/object:Bignum syntax 1.8.3 dumped. [ruby-core:6159]
+	* parse.y (opt_call_args): allow trailing comma after assoc
+	  argument e.g. 'foo(bar:1,)'.  fixed #3456
 
-Tue Jan 10 12:47:41 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jul  6 22:11:12 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/yaml/rubytypes.rb (Fixnum): Bignum could not be loaded in
-	  ruby 1.8.3/1.8.4. [ruby-core:6115]
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Validate date in
+	  "Date:" header
 
-	* lib/yaml/rubytypes.rb (Numeric): Subclass of Numeric could not
-	  be dumped properly. [ruby-core:7047]
+Wed Jul  6 21:29:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Jan 10 12:00:48 2006  Aaron Schrab  <aaron @nospam@ schrab.com>
+	* cont.c (fiber_machine_stack_alloc): cleanup pointer arithmetic.
+	  "size/sizeof(VALUE)" is ugly and easy confusing.
+	* cont.c (fiber_initialize_machine_stack_context): ditto.
 
-	* lib/yaml/rubytypes.rb (Symbol#yaml_new): YAML loading of quoted
-	  Symbols broken. [ruby-Bugs:2535]
+Wed Jul  6 21:24:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jan  9 19:54:35 2006  arton  <artonx@yahoo.co.jp>
+	* cont.c (fiber_machine_stack_alloc): fix mprotect misuse. A stack
+	  guard page should have PROT_NONE.
+	* cont.c (fiber_initialize_machine_stack_context):
+	  th->machine_stack_maxsize shouldn't be included guard pages size.
+	  [Bug #4983][ruby-dev:44043]
 
-	* ext/zlib/extconf.rb: zlib compiled DLL version 1.2.3 distributed by
-	  http://www.zlib.net/ has zdll.lib. [ruby-dev:28209]
+Wed Jul  6 21:23:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jan  9 14:17:12 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* cont.c (fiber_machine_stack_alloc): use MAP_STACK if it's provided.
 
-	* win32/Makefile.sub (OPTFLAGS): I have experienced trouble on y- flag,
-	  (VisualC++6) so use -O2b2xg- if  $(MSC_VER) < 1400. [ruby-core:7040]
+Wed Jul  6 21:22:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jan  9 14:17:12 2006  Kero van Gelder  <rubyforge @nospam@ kero.tmfweb.nl>
+	* cont.c (fiber_machine_stack_alloc): use MAP_FAILED instead of -1.
 
-	* lib/webrick/httpservlet/filehandler.rb: fixed typo. [ruby-core:7075]
+Wed Jul  6 21:21:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Jan  7 15:40:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* cont.c (fiber_machine_stack_alloc): remove unnecessary cast.
 
-	* parse.y (singleton): get rid of segfault on syntax error.
-	  fixed: [ruby-core:07070]
+Wed Jul  6 18:10:13 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Fri Jan  6 10:16:20 2006  Steven Lumos  <steven@lumos.us>
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Adding space after
+	  comma.
 
-	* io.c (READ_DATA_PENDING): defined for 64bit Solaris on SPARC.
-	  [ruby-core:7057]
-	  (READ_DATA_PENDING_COUNT): ditto.
-	  (READ_DATA_PENDING_PTR): ditto.
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Remove variable
+	  `now`. Suppress warning.
 
-Sun Jan  1 17:07:59 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jul  6 12:18:09 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* win32/win32.c (rb_w32_seekdir): should not segfault even if passed
-	  the location which rb_w32_telldir didn't return. [ruby-core:7035]
-	  (I think HEAD implementation is better. but binary compatibility)
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Fix bug depends to
+	  time. The test fails if time past 1 second in line 136-145
 
-	* test/ruby/test_dir.rb: added.
+Tue Jul  5 15:28:04 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec 31 22:57:00 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (parser_here_document): should dispatch heredoc_end
+	  scanner event on an empty here document.  fixed Bug#4543.
 
-	* eval.c (rb_thread_save_context): should not recycle scope object used
-	  in a thread.  fixed: [ruby-dev:28177]
+Tue Jul  5 13:49:26 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Fri Dec 30 18:22:42 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* addr2line.c: fix r32407 to check HAVE_ALLOCA_H.
 
-	* gc.c (garbage_collect): mark objects refered from aborting threads.
-	  [ruby-dev:28190]
+Tue Jul  5 14:05:43 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* win32/Makefile.sub: VC++8 support.
+	* lib/webrick/httpauth/digestauth.rb (_authenticate):
+	  Literal texts in HTTP ABNF is case-insensitive (RFC2616 2.1),
+	  and a sample implementation in RFC2617 also ignores the case
+	  of algorithms. So now this ignores those cases.
+	  [ruby-dev:43965] [Feature #4936]
 
-Fri Dec 30 14:24:53 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/webrick/httpauth/digestauth.rb (initialize):
+	  Because of above, opera_hack is useless and removed.
 
-	* dir.c (glob_helper): do not use TRUE for djgpp.
+Tue Jul  5 01:30:01 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Fri Dec 30 04:54:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread_pthread.c (native_sleep): cut the waiting time up to
+	  100,000,000 because Solaris cond_timedwait() return EINVAL if an
+	  argument is greater than current_time + 100,000,000.  This is
+	  considered as a kind of spurious wakeup.  The caller to native_sleep
+	  should care about spurious wakeup.
 
-	* file.c (eaccess): workaround for VC++8 runtime.
+Tue Jul  5 01:24:26 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* win32/win32.c (ioinfo): VC++8 support.
+	* cont.c: disable FIBER_USE_NATIVE on Solaris because resuming any
+	  Fiber caused SEGV.  I haven't follow up the issue deeply, but it
+	  works when disabling the feature.
 
-Thu Dec 29 23:59:37 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jul  5 01:22:46 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* eval.c (rb_gc_mark_threads): leave unmarked threads which won't wake
-	  up alone, and mark threads in the loading table.  [ruby-dev:28154]
+	* addr2line.c: include <alloca.h> to fix a build issue on Solaris.
 
-	* eval.c (rb_gc_abort_threads), gc.c (gc_sweep): kill unmarked
-	  threads.  [ruby-dev:28172]
+Tue Jul  5 00:49:05 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Thu Dec 29 17:02:07 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/coverage/coverage.c: resurrect r32071 + add GC guard for
+	  rb_coverages. [ruby-core:37352] [Bug #4927]
+	  [ruby-core:36539] [Feature #4796]
 
-	* test/ruby/envutil.rb (EnvUtil.rubybin): search "ruby" instead of
-	  "miniruby".  [ruby-dev:28140]
+	* test/coverage/test_coverage.rb resurrect r32071.
 
-Tue Dec 27 16:59:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jul  4 22:24:46 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* test/drb/drbtest.rb (DRbService::self.ext_service): increase
-	  timeout limit.  a patch from Kazuhiro NISHIYAMA
-	  <zn at mbf.nifty.com>. [ruby-dev:28132]
+	* thread_pthread.c (get_stack): For NetBSD/FreeBSD, use
+	  pthread_attr_getstack() if possible. and, remove an assumption
+	  of stack growing direction.
 
-Tue Dec 27 08:29:18 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Jul  4 20:42:31 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket#post_connection_chech):
-	  treat wildcard character in commonName. [ruby-dev:28121]
+	* ext/coverage/coverage.c: revert r32071.  The commit caused SEGV on
+	  some minor nonfree OS.  I have no means of debugging the bug.  My
+	  personal opinion is that such OS should be unsupported unless there
+	  is an active maintainer.  [ruby-core:37352]
 
-Mon Dec 26 22:32:47 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/coverage/test_coverage.rb: ditto.
 
-	* eval.c (rb_eval), gc.c (gc_mark_children), node.h (NEW_ALIAS,
-	  NEW_VALIAS), parse.y (fitem): allow dynamic symbols to
-	  NODE_UNDEF and NODE_ALIAS.
-	  backported from trunk.  fixed: [ruby-dev:28105]
+Mon Jul  4 07:14:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Dec 26 08:50:36 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread_pthread.c (get_stack): the return address of get_stack
+	  must be the highest address of the current thread's stack.
 
-	* eval.c (ev_const_get): fixed a bug in constant reference during
-	  instance_eval.  [yarv-dev:707]
+Mon Jul  4 06:37:22 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (ev_const_defined): ditto.
+	* include/ruby/intern.h, thread_pthread.c (rb_reserved_fd_p,
+	  RB_RESERVED_FD_P): added.  This C API is to limit to access
+	  fds which are used by RubyVM internal.  In this version of
+	  CRuby, return 1 if fd is communication pipe.
+	  If your application needs to close all file descriptors to
+	  present resource leak, skip internal fds using this C API.
+	  We also define a macro RB_RESERVED_FD_P(fd).  So you can write
+	    #ifndef RB_RESERVED_FD_P
+	    #define RB_RESERVED_FD_P(fd) 0
+	    #endif
+	  for Ruby 1.9.2 or previous version to write compatible extensions.
+	  See [ruby-core:37727]
 
-	* lib/yaml.rb (YAML::add_domain_type): typo fixed.  a patch from
-	  Joel VanderWerf <vjoel at path.berkeley.edu>.
-	  [ruby-talk:165285] [ruby-core:6995]
+	* thread_win32.c (rb_reserved_fd_p): added (return 0 for any fds).
 
-Sat Dec 24 18:58:14 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (rb_io_initialize): raise ArgumentError if given fd is reserved by Ruby.
 
-	* stable version 1.8.4 released.
+Sun Jul  3 23:43:56 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Fri Dec 23 10:30:23 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/extmk.rb (extmake): suppresses outputs from extconf.rb.
+	  (extmake) warns a failure in extconf.rb.
 
-	* ext/digest/sha2/sha2.c (ULL): support AIX C.  a patch from
-	  Kailden <kailden at gmail.com>.  [ruby-core:06984]
+Sun Jul  3 13:44:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 21 16:53:06 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* array.c (ary_reject_bang): should not remove elements which are
+	  not yielded.  [Bug #2545]
 
-	* file.c (w32_io_info): should return handle because FileIndex is
-	  valid only while file is open. [ruby-dev:28088]
+Sun Jul  3 06:10:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Dec 21 14:53:26 2005  Tanaka Akira  <akr@m17n.org>
+	* thread_pthread.c (get_stack): pthread_attr_getstack() doesn't
+	  return stack start address, but stack base address. Thus,
+	  we need to add stack size for getting stack start address.
+	  And, we don't have to decrease guard size twice.
+	* thread_pthread.c (thread_start_func_1): don't use inaccurate
+	  stack start guess if native_thread_init_stack() can be used.
+	  [Bug #1813] [ruby-core:24540]
 
-	* lib/pathname.rb (test_kernel_open): use File.identical?.
-	  [ruby-talk:171804]
+Sun Jul  3 04:50:08 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Dec 20 22:41:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c (get_stack): add to a care of guard page on Mac
+	  OS X. [Bug #1813] [ruby-core:24540]
+	* signal.c (ruby_signal): SIGBUS use alternative stack too.
+	* signal.c (sigbus): On Mac, thread stack overflow makes SIGBUS
+	  instead of SIGSEGV. thus, added stackoverflow check.
+	* signal.c (default_handler): get rid of compilation warning.
+	* signal.c (Init_signal): ditto.
 
-	* eval.c (eval_under_i): evaluate source in caller's frame.
-	  [ruby-dev:28076]
+Sat Jul 02 08:59:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* eval.c (rb_call_super): use original method name on exception.
-	  [ruby-dev:28078]
+	* test/openssl/test_ocsp.rb
+	* test/openssl/test_x509_cert.rb: Perform SHA-256 tests only if
+	  supported by the available OpenSSL version. Versions < 0.9.8 don't
+	  support it. [ruby-core:37724]
 
-Tue Dec 20 13:11:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul  2 07:17:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/rubyext.c: fixed GC problem (backported HEAD 1.55 - 1.62)
-	  [ruby-dev:27839]
+	* array.c (rb_ary_reject_bang, rb_ary_delete_if): rejected
+	  elements should be removed.  fixed [Bug #2545]
 
-	* ext/syck/syck.h (S_FREE): small hack. no need to check if pointer is
-	  NULL or not before S_FREE.
+Sat Jul  2 01:57:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* st.c: uses malloc instead of xmalloc to avoid GC. syck uses st_insert
-	  in gram.c to insert node from rb_syck_bad_anchor_handler into
-	  SyckParser's hash table. if GC occurs in st_insert, it's not under
-	  SyckParser's mark system yet. so RString can be released wrongly.
-	  [ruby-dev:28057]
+	* NEWS: remove a description of Kernel#respond_to? because it has
+	  been reverted at revision 28564.
 
-Tue Dec 20 12:53:23 2005  why the lucky stiff  <why@ruby-lang.org>
+Sat Jul  2 00:58:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/syck/rubyext.c (syck_emitter_reset): to ensure compatibility
-	  with previous Ruby versions, documents are no longer headless.
+	* NEWS: describe a change of multiplication of Bignum.
 
-Tue Dec 20 01:46:48 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jul  1 18:52:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c (rb_f_backquote): fix a GC problem on
-	  IA64 with gcc 4.0.3 20051216 (prerelease) -O3.
+	* benchmark/bm_app_erb.rb: increase loop count. too short
+	  measurement time makes less accuracy.
+	* benchmark/bm_app_factorial.rb: ditto.
+	* benchmark/bm_app_mandelbrot.rb: ditto.
+	* benchmark/bm_app_strconcat.rb: ditto.
 
-Mon Dec 19 23:32:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* benchmark/bm_io_file_create.rb: ditto.
+	* benchmark/bm_io_file_read.rb: ditto.
+	* benchmark/bm_io_file_write.rb: ditto.
 
-	* parse.y (rb_symname_p): fixed wrong validation.  [ruby-dev:28047]
+	* benchmark/bm_so_concatenate.rb: ditto.
+	* benchmark/bm_so_lists.rb: ditto.
+	* benchmark/bm_so_matrix.rb: ditto.
+	* benchmark/bm_so_random.rb: ditto.
+	* benchmark/bm_so_sieve.rb: ditto.
 
-Sat Dec 17 03:57:01 2005  Tanaka Akira  <akr@m17n.org>
+	* benchmark/bm_vm_thread_mutex1.rb: ditto.
+	* benchmark/bm_vm_thread_mutex2.rb: ditto.
+	* benchmark/bm_vm_thread_mutex3.rb: ditto.
 
-	* bignum.c (rb_big_rshift): fix a GC problem on
-	  IA64 with gcc 4.0.3 20051216 (prerelease).
+	* benchmark/bm_vm1_block.rb: cleanup.
+	* benchmark/bm_vm1_const.rb: cleanup.
+	* benchmark/bm_vm1_ensure.rb: cleanup.
+	* benchmark/bm_vm1_ivar.rb: cleanup.
+	* benchmark/bm_vm1_length.rb: cleanup.
+	* benchmark/bm_vm1_neq.rb: cleanup.
+	* benchmark/bm_vm1_not.rb: cleanup.
+	* benchmark/bm_vm1_rescue.rb: cleanup.
+	* benchmark/bm_vm1_simplereturn.rb: cleanup.
+	* benchmark/bm_vm1_swap.rb: cleanup.
 
-Sat Dec 17 03:30:23 2005  Tanaka Akira  <akr@m17n.org>
+	* benchmark/bm_vm2_array.rb: cleanup.
+	* benchmark/bm_vm2_case.rb: cleanup.
+	* benchmark/bm_vm2_defined_method.rb: cleanup.
+	* benchmark/bm_vm2_eval.rb: cleanup.
+	* benchmark/bm_vm2_method.rb: cleanup.
+	* benchmark/bm_vm2_mutex.rb: cleanup.
+	* benchmark/bm_vm2_poly_method.rb: cleanup.
+	* benchmark/bm_vm2_poly_method_ov.rb: cleanup.
+	* benchmark/bm_vm2_proc.rb: cleanup.
+	* benchmark/bm_vm2_regexp.rb: cleanup.
+	* benchmark/bm_vm2_send.rb: cleanup.
+	* benchmark/bm_vm2_super.rb: cleanup.
+	* benchmark/bm_vm2_unif1.rb: cleanup.
+	* benchmark/bm_vm2_zsuper.rb: cleanup.
 
-	* eval.c (bmcall): fix a GC problem by tail call on
-	  IA64 with gcc 4.0.3 20051216 (prerelease).
+	* benchmark/bm_vm_thread_alive_check1.rb: cleanup.
 
-Fri Dec 16 00:54:06 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul  1 15:23:00 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* signal.c (Init_signal): revert C++ style comment.
-	  [ruby-dev:28041]
+	* lib/matrix: Add LUP decomposition
 
-Thu Dec 15 12:35:14 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul  1 15:21:14 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* lib/tmpdir.rb: merged RDoc patch from Eric Hodel <drbrain at
-	  segment7.net>.  [ruby-core:06894]
+	* lib/matrix.rb: Allow non integer exponents for Matrix#**
 
-Thu Dec 15 01:33:31 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jul  1 15:13:25 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/zlib/zlib.c (zstream_run): fix a GC problem by tail call on
-	  x86_64 with gcc 4.0.3 20051111 (prerelease) (Debian 4.0.2-4)
+	* lib/matrix: Add Eigenvalue Decomposition
 
-Wed Dec 14 12:11:46 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri Jul  1 15:10:22 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* test/gdbm/test_gdbm.rb: specify pid for the argument of
-	  Process.wait.  workaround for Cygwin.
+	* lib/matrix: Add Matrix#round
 
-Wed Dec 14 12:01:26 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jul  1 11:41:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* marshal.c (r_object0): fix a GC problem for reading a bignum on
-	  IA64 with gcc 3.3.5 (Debian 1:3.3.5-13).
+	* string.c (tr_trans): free heap ptr when the str is not embedded.
+	  patched by Eric Wong. [Bug #4956] [ruby-core:37708]
 
-Tue Dec 13 12:23:47 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jul  1 11:07:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (rb_reg_regcomp): fix a GC problem on x86_64 with
-	  gcc 3.3.5 (Debian 1:3.3.5-13).
+	* thread.c (do_select): fix memory leak.
+	  Patch by Eric Wong. Thank you! [Bug #4953] [ruby-core:37702]
 
-Tue Dec 13 01:44:16 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jul  1 08:21:28 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* array.c (rb_ary_diff): fix a GC problem on IA64 with
-	  gcc 3.3.5 (Debian 1:3.3.5-13).
-	  When rb_ary_push is called, there was no register which contains
-	  `hash' but `&RHASH(hash)->tbl' instead.
+	* vm_insnhelper.c (vm_getivar): check vm state version
+	  to invalidate inline cache (ivar index).
+	  fixes Bug #4926.
 
-Tue Dec 13 00:08:09 2005  Tanaka Akira  <akr@m17n.org>
+	* vm_insnhelper.c (vm_setivar): ditto.
 
-	* sprintf.c (rb_str_format): fix a GC problem.
-	  [ruby-dev:28001]
+Fri Jul  1 08:03:15 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 12 15:54:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* error.c, thread_pthread.c (WRITE_CONST): suppress warnings
+	  `ignoring return value'.
 
-	* test/openssl/test_ssl.rb (test_parallel): call GC.start to close
-	  unused files. [ruby-dev:27981]
+Fri Jul  1 06:41:36 2011  Koichi Sasada  <ko1@atdot.net>
 
-Mon Dec 12 00:33:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_threadptr_check_signal): only wake up main thread.
 
-	* ext/digest/digest.c (rb_digest_base_s_digest): add volatile to
-	  protect temporary context object.  [ruby-dev:27979]
+	* thread.c (rb_threadptr_execute_interrupts_common): check signal
+	  delivery if it is main thread.
+	  fixes [ruby-dev:44005] [Ruby 1.9 - Bug #4950]
 
-	* ext/iconv/iconv.c (Init_iconv): rb_gc_register_address() should
-	  be called before actual variable initialization.
-	  [ruby-dev:27986]
+	* bootstraptest/test_fork.rb: add a test for above.
 
-Fri Dec  9 23:31:02 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* signal.c (rb_get_next_signal): skip if signal_buff is empty.
+	  (check signal_buff.size first)
 
-	* lib/rexml/encoding.rb (encoding=): give priority to particular
-	  conversion to iconv.  [ruby-core:06520]
+	* vm_core.h: remove unused variable rb_thread_t::exec_signal.
 
-Thu Dec  8 02:07:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (rb_thread_check_trap_pending): check
+	  rb_signal_buff_size() because rb_thread_t::exec_signal
+	  is no longer available.
 
-	* eval.c (umethod_bind): adjust invoking class for module method.
-	  [ruby-dev:27964]
+Fri Jul  1 03:28:25 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Dec  8 00:40:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* class.c (Init_class_hierarchy): should name BasicObject
+	  explicitly.
 
-	* eval.c (call_trace_func): klass parameter should be a
-	  class/module that defines calling method.  [ruby-talk:169307]
+	* variable.c (rb_const_defined_0): should not check for
+	  superclasses as const_get.
 
-Wed Dec  7 17:10:27 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Fri Jul  1 03:24:03 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* sprintf.c (rb_f_sprintf): [ruby-dev:27967]
+	* ext/date/date_core.c: mathn is still alive (should die soon).
 
-Wed Dec  7 15:31:35 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jun 30 23:50:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* sprintf.c (rb_str_format): integer overflow check added.
+	* misc/ruby-mode.el (ruby-indent-beg-re): Fix broken regular
+	  expression.  Fixes #4546
 
-	* sprintf.c (GETASTER): ditto.
+Thu Jun 30 23:43:30 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Dec  7 01:02:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/ossl.c/.h: Added ossl_x509_name_sk2ary.
+	* ext/openssl/ossl.c: Replaced ossl_x509_ary2k by generic macro to
+	  simplify future conversions.
+	* ext/openssl/ossl_ssl.c: Implement SSLSocket#client_ca.
+	* test/openssl/test_ssl.rb: Add test for SSLSocket#client_ca.
+	  Thanks to Ippei Obayashi for providing the patch!
+	  [ Ruby 1.9 - Feature #4481 ] [ruby-core:35461]
 
-	* ext/tk/README.macosx-aqua: [new document] tips to avoid the known
-	  bug on platform specific dialogs of Tcl/Tk Aqua on MacOS X.
+Thu Jun 30 22:38:58 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/tcltklib.c: fix bug on switching threads and waiting on the
-	  deleted interpreter on vwait and tkwait command.
+	* benchmark/bm_vm2_defined_method.rb: added to measure performance of
+	  bmethod (method defined by define_method()).
 
-	* ext/tk/lib/multi-tk.rb: kill the meaningless loop for the deleted Tk
-	  interpreter.
+Thu Jun 30 22:17:04 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/sample/demos-jp/image3.rb: [bug fix] wrong argument.
+	* vm_insnhelper.c (vm_call_bmethod): fix to hook call/return event
+	  for methods defined by define_method().  fixes Bug #4613.
 
-	* ext/tk/sample/demos-en/image3.rb: ditto.
+	* thread.c (call_trace_proc): Fix to skip if class is not given (0).
+	  Note that ID and Class object are passed for call/return event
+	  if the called method was defined by define_method().
+	  If you are author of tracer/profiler/debugger, this may be an
+	  important change.  You should check passed class as zero or
+	  non-zero instead of checking the event type.
 
-	* ext/tk/sample/demos-jp/menu.rb: fix message for MacOS X.
+	* test/ruby/test_settracefunc.rb: add a test for above.
 
-	* ext/tk/sample/demos-jp/menu8x.rb: ditto.
+Thu Jun 30 21:18:35 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
 
-	* ext/tk/sample/demos-en/menu.rb: ditto.
+	* configure.in: Add warnflags for XL/C on AIX during configure
+	  to avoid [Bug #3971]. See [ruby-core:32859]
 
-Tue Dec  6 16:37:57 2005  Yuya Nishida  <yuya@j96.org>
+Thu Jun 30 21:16:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (exec_under): avoid accessing ruby_frame->prev.
-	  [ruby-dev:27948]
+	* ext/date/date_core.c (m_ajd): refers a constant.
 
-Thu Dec  1 00:50:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 30 20:54:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_funcall2): allow to call protected methods.
-	  fixed: [ruby-dev:27890]
+	  * ext/io/console/io-console.gemspec: spin-off gem for 1.9.2.
 
-Wed Nov 30 23:52:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 30 20:36:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* parse.y (NEWHEAP, ADD2HEAP): set count after pointer was set.
-	  fixed: [ruby-dev:27896]
+	* ext/date/date_core.c: trivial changes.
 
-Wed Nov 30 13:43:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jun 30 20:12:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-expr-beg): support $! at the end of
-	  expression.   [ruby-dev:27868]
+	* test/ruby/test_module.rb: tests for [Bug #3422] and [Bug #3423].
 
-Mon Nov 28 18:55:43 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Jun 30 20:03:39 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/socket/socket.c (init_inetsock_internal): remove setting
-	  SO_REUSEADDR option on server socket on Cygwin.
-	  fixed: [ruby-core:6765] ([ ruby-Bugs-2872 ])
+	* ext/date/date_core.c: modified doc.
 
-Mon Nov 28 13:08:54 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 19:09:19 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/win32.c (rb_w32_strerror): remove all CR and LF. (avoid broken
-	  error message on bccwin32 + winsock)
+	* thread_pthread.c (thread_timer): ignore unknown errno.
+	  (we observed that select(2) was canceled by errno=514 on
+	  boron == Linux/Xen environment)
 
-Mon Nov 28 09:21:49 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 17:33:25 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/mkmf.rb (create_makefile): should not change sodir with
-	  dir.gsub!. (bccwin32 failed to install third party exntesions)
-	  [ruby-dev:27834]
+	* ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
+	  Fix rdoc.  Fixes Bug #3892.
 
-Sun Nov 27 00:56:13 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
+	  Change key type if the klass of a object is zero (internal object).
+	  Read rdoc for details.
 
-	* lib/wsdl/xmlSchema/complexContent.rb: missing
-	  ComplexContent#elementformdefault method.
+	* internal.h: export rb_objspace_data_type_name().
 
-Sat Nov 26 19:57:45 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu Jun 30 17:25:08 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* dln.c (conv_to_posix_path): should initialize posix.
+	* thread_pthread.c (ping_signal_thread_list, thread_timer):
+	  fix to keep polling state if there are any ping-tasks.
 
-Thu Nov 24 21:05:58 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Jun 30 12:25:34 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in (AC_CHECK_FUNCS): need to check link().
-	  fixed: [ruby-dev:27814]
+	* thread_pthread.c (rb_thread_create_timer_thread): allocate
+	  machine stack for the timer thread at least 12KB.  FreeBSD 8.2
+	  AMD64 causes machine stack overflow (SIGSEGV) only with
+	  PTHREAD_STACK_MIN (maybe defined as 2KB).
 
-Thu Nov 24 01:22:25 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 09:36:37 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* file.c (w32_io_info): CreateFile failed on Win9x if file was already
-	  opened. (FILE_SHARE_READ was needed, but actually I don't understand
-	  the flags of CreateFile well...)
+	* lib/weakref.rb:  Attach documentation to WeakRef and add missing
+	  documentation
 
-Wed Nov 23 20:59:01 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jun 30 09:30:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk.rb: add Tk.pkgconfig_list and Tk.pkgconfig_get
-	  [Tk8.5 feature].
+	* lib/yaml.rb:  Document toplevel YAML and YAML::ENGINE to describe
+	  Psych vs Syck engines.
 
-	* ext/tk/lib/tk/text.rb: supports new indices modifires on a Text
-	  widget [Tk8.5 feature].
+Thu Jun 30 09:21:52 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/virtevent.rb: add TkNamedVirtualEvent.
+	* lib/cmath.rb:  Hide handle_no_method_error from RDoc.
+	* error.c:  Document or hide undocumented error classes.
 
-	* ext/tk/lib/tk/autoload.rb: ditto.
+Thu Jun 30 07:49:04 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/event.rb: add :data key for virtual events [Tk8.5
-	  feature].
+	* hash.c:  Document ENV
 
-Wed Nov 23 18:55:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 06:37:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (w32_io_info): should not call GetFileInformationByHandle
-	  for pipe.
+	* ruby.c (ruby_init_loadpath_safe): ensure RUBYLIB_PREFIX stored
+	  before RUBYLIB, even if MANGLED_PATH is enabled.  fixed #1679.
+	  MANGLED_PATH is disabled by the default and will be removed
+	  completely in the future.
 
-	* file.c (w32_io_info): checks return value from rb_w32_get_osfhandle.
+Thu Jun 30 06:32:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* file.c (w32_io_info): now can identify directory on WinNT.
+	* lib/drb/drb.rb:  Hide deprecated toplevel DRb constants.
 
-Wed Nov 23 03:40:49 2005  Guy Decoux  <ts@moulon.inra.fr>
+Thu Jun 30 06:17:02 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* re.c (KR_REHASH): should cast to unsigned for 64bit CPU.
-	  [ruby-core:06721]
+	* lib/cmath.rb (CMath.log): second argument: b can be nil.
 
-Wed Nov 23 11:01:33 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 06:23:28 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* intern.h, file.c: failed to compile on windows.
+	* thread.c (ruby_thread_s_pass):  Fix typo.
 
-Wed Nov 23 07:26:44 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Jun 30 06:16:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/openssl/extconf.rb: check for X509V3_EXT_nconf_nid.
+	* lib/rdoc:  Update to RDoc 3.8 which contains fixes for documentation
+	  in trunk.
 
-	* ext/openssl/ossl_x509ext.c (MakeX509ExtFactory): should use
-	  OPENSSL_malloc to allocate X509V3_CTX.
+Thu Jun 30 02:53:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext): use
-	  X509V3_EXT_nconf_nid to avoid SEGV (and to build extensions which
-	  values are placed in separate section).
+	* thread.c (rb_threadptr_execute_interrupts_common): remove
+	  meaningless native_thread_yield(). It never close a race.
 
-	* test/openssl/test_x509ext.rb: new file.
+Thu Jun 30 02:41:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Nov 23 01:22:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (rb_thread_schedule_limits): minor optimization.
+	  eliminate machine context saving when running time is enough small.
 
-	* file.c (test_identical): test if two files are identical.
+Thu Jun 30 02:28:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* file.c (rb_f_test): support DOSISH systems where st_ino is not
-	  reliable.  fixed: [ruby-core:06672]
+	* thread.c (rb_thread_schedule_rec): move interrupt_flag check to
+	  rb_thread_schedule().
+	  And also rename to rb_thread_schedule_limits() and remove
+	  sched_depth argument. It's no longer called recursive.
+	* thread.c (rb_thread_schedule): add to check interrupt_flag as
+	  above explained.
 
-	* win32.h, win32.c (rb_w32_osid): check the running platform.
+	* thread.c (rb_threadptr_execute_interrupts_rec): rename to
+	  rb_threadptr_execute_interrupts_common() and remove sched_depth
+	  argument. It's no longer called recursive.
 
-Tue Nov 22 23:52:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (rb_thread_sleep): adapt the renaming.
+	* thread.c (rb_threadptr_execute_interrupts): ditto.
+	* thread.c (rb_thread_execute_interrupts): ditto.
 
-	* lib/optparse.rb: match incomplete (in current enconding) multibyte
-	  string.  http://inamode6.tokuhirom.dnsalias.org/show/1551
+Thu Jun 30 01:31:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Nov 22 18:36:11 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* thread.c (thread_s_pass): change RDoc description and remove
+	  a sample code. The actual implementation never behave as explained by
+	  an example. It's a documentation bug.
 
-	* win32/win32.c (winnt_stat): set mapped errno instead of ENOENT.
+Thu Jun 30 00:54:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Nov 22 14:46:57 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread.c (rb_thread_stop): change RDoc sample code. The old
+	  example is buggy and may cause deadlock. The patch is
+	  suggested by Heesob Park <phasis@gmail.com>. Thank you!
+	  [Bug #3606][ruby-core:31454]
 
-	* file.c (rb_file_s_basename): skip slashes just after UNC top slashes.
+Thu Jun 30 00:49:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* test/ruby/test_path.rb (test_dirname, test_basename): follow new
-	  spec. and add new tests.
+	* thread.c (rb_thread_wakeup): change RDoc sample code. The old
+	  example is buggy and may not display anything by a race.
+	  The patch is suggested by Heesob Park <phasis@gmail.com>.
+	  Thank you! [Bug #3606][ruby-core:31454]
 
-Tue Nov 22 13:18:32 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 30 00:43:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* win32/win32.c (rb_w32_stat): Dir.chdir('//server/shared');
-	  p Dir.glob('*') should work on WinNT. (implemented our own
-	  stat(2) on WinNT) [ruby-list:41552] [ruby-dev:27711]
+	* thread.c (rb_thread_run): change RDoc. The old example is buggy
+	  and may cause deadlock. The patch is suggested by Heesob Park
+	  <phasis@gmail.com>. Thank you! [Bug #3606][ruby-core:31454]
 
-Tue Nov 22 02:31:53 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jun 30 00:30:15 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* ext/tk/lib/tkextlib/tile.rb: bug fix (Tk::Tile::USE_TTK_NAMESPACE
-	  is not defined).
+	* lib/cmath.rb: make same exception for Math. fix [Bug #3137].
 
-Tue Nov 22 01:45:21 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 30 00:03:20 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* file.c (rb_file_s_basename): DOSISH_UNC is defined on cygwin but
-	  DOSISH is not.  fixed: [ruby-dev:27797]
+	* lib/irb/completion.rb: complement correctly string literal. fix
+	  [Bug #1145].
 
-Mon Nov 21 22:50:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun 29 23:42:51 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* file.c (rb_path_skip_prefix, rb_file_s_basename): UNC without path
-	  should not be splitted.  fixed: [ruby-dev:27776] [ruby-dev:27786]
+	* ext/date/date_core.c: avoided using timev.
+	* ext/date/date_strftime.c: ditto.
+	* ext/date/date_tmx.h: ditto.
 
-	* parse.y (dsym): prohibit empty symbol literal by interpolation.
-	  fixed: [ruby-talk:166529]
+Wed Jun 29 23:17:57 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Mon Nov 21 16:03:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl.h (OPENSSL_SYS_WIN32): support for mingw(msys).
 
-	* win32/setup.mk: findstr doesn't exist on win9x.
-	  fixed: [ruby-dev:27756]
+Wed Jun 29 23:09:14 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Sun Nov 20 22:34:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/extconf.rb (intptr_t, uintptr_t): support for the latest ActiveTcl with mingw.
 
-	* parse.y (rb_symname_p): [ not followed by ] is not valid symbol.
-	  fixed: [ruby-talk:166520]
+Wed Jun 29 22:49:10 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-Sat Nov 19 19:57:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/irb/cmd/help.rb: support RDoc 3.7. fix [Bug #3760].
 
-	* lib/fileutils.rb (FileUtils::ln): ln documentation fix.
-	  [ruby-core:06661]
+Wed Jun 29 22:04:14 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Sat Nov 19 07:34:32 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/tracer.rb: Tracer.on only if required by -r command-line option.
+	  and consider --disable-gems option.
+	* test/test_tracer.rb: add tests for it.
 
-	* ext/tk/lib/tk/font.rb: remove dependency on Ruby's version (1.8
-	  or 1.9).
+Wed Jun 29 13:55:36 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/ICONS/icons.rb: ditto.
+	* variable.c (rb_const_get_0): should not look for superclasses if
+	  the second optional argument is given for #const_get().
+	  fix [Bug #3422] [Bug #3423]
 
-	* ext/tk/sample/tkextlib/treectrl/demo.rb: ditto.
+Wed Jun 29 12:07:27 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Nov 18 17:57:08 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* math.c:  Attach documentation for Math.
+	* object.c:  Document NIL, TRUE, FALSE.
+	* io.c:  Improve grammar in ARGF comment.  Document STDIN/OUT/ERR.
+	  Document ARGF global constant.
+	* lib/rake:  Hide deprecated toplevel constants from RDoc (import from
+	  rake trunk).
+	* lib/thwait.rb:  Document ThWait.
+	* lib/mathn.rb:  Hide Math redefinition from RDoc
+	* lib/sync.rb:  Add a basic comment for Sync_m, Synchronizer_m, Sync,
+	  Synchronizer.
+	* parse.y:  Document SCRIPT_LINES__.
+	* hash.c:  Document ENV class and global constant.
+	* vm.c:  Document TOPLEVEL_BINDING.
+	* version.c:  Document RUBY_* constants.
+	* ruby.c:  Document DATA and ARGV.
 
-	* file.c (rb_file_s_dirname): should use skipprefix for UNC path.
-	  pointed out by nobu ([ruby-dev:27744]). fixed: [ruby-core:5076]
+Wed Jun 29 10:13:12 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Fri Nov 18 17:35:09 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/matrix.rb: Matrix.zero can build rectangular matrices.
+	  Vector#r should be called #magnitude
 
-	* ext/tk/lib/multi-tk.rb: add restriction to access the entried
-	  command table and manipulate other IPs (for reason of security).
-	  Now, a IP object can be controlled by only its master IP or the
-	  default IP.
+Wed Jun 29 10:11:08 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/tk/lib/remote-tk.rb: add restriction to manipulate.
+	* lib/matrix.rb: Add Matrix#diagonal?, hermitian?, normal?,
+	  orthogonal?
+	  permutation?, symmetric?, {lower|upper}triangular?, unitary?, zero?
 
-	* ext/tk/tcltklib.c (ip_is_slave_of_p): add TclTkIp#slave_of?(ip)
-	  to check manipulability.
+Wed Jun 29 10:09:35 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/tk/lib/tk.rb: bug fix on handling of Tcl's namespaces.
+	* lib/matrix.rb: Specialize Matrix#find_index to return [row, col]
+	  and accept the same optional argument as #each
 
-	* ext/tk/lib/tk/namespace.rb: ditto.
+Wed Jun 29 10:07:32 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Fri Nov 18 17:26:06 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/matrix.rb: Matrix#each{_with_index} can iterate over a subset
+	  of the Matrix
 
-	* file.c (rb_file_s_dirname): added checks for some patterns with drive
-	  letter. fixed: [ruby-dev:27738]
+Wed Jun 29 06:21:02 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/test_path.rb (test_dirname): added tests for above
-	  patterns.
+	* thread_pthread.c (native_stop_timer_thread): skip to close
+	  communication pipe to avoid timing bug (process termination timing).
+	  The communication pipe will closed by OS.
 
-Fri Nov 18 12:18:02 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jun 29 06:09:54 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/win32.h (S_IFIFO): r,w = IO.pipe; r.stat.pipe? now
-	  returns true on VisualC++6.
+	* error.c (rb_async_bug_errno): async-safe bug report function.
+	  In timer thread, signal handler should use it.
+	  The patch is contributed by Eric Wong <normalperson@yhbt.net>.
+	  Refs: [ruby-core:37644] and [ruby-core:37647]
 
-Wed Nov 16 23:24:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c: use rb_async_bug_errno().
+	  And replace all fprintf() to write().
 
-	* common.mk (static-ruby): overridable.
+	* internal.h (rb_async_bug_errno): add decl. of above func.
 
-	* ext/extmk.rb (parse_args): force to link extensions statically only
-	  if static is given for extstatic.
+Tue Jun 28 23:46:08 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* ext/extmk.rb (RUBY, RUBYW): overridable.
+	* lib/tracer.rb: count only non-internal libraries in stack trace,
+	  ignoring custom_require.
 
-Tue Nov 15 23:46:35 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Jun 28 21:44:58 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* lib/find.rb (Find::find): should not ignore symbolic links to
-	  non-existing files.  [ruby-talk:165866]
+	* lib/irb/ruby-lex.rb: recognize '\char' in ruby statement.
 
-Tue Nov 15 16:23:26 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Jun 28 20:39:29 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* array.c (rb_ary_fill): previous commit disabled this usage:
+	* lib/debug.rb (var_list): Command 'var *' did not work on 1.9(!).
+	  global_variables, local_variables, and instance_variables returns
+	  Symbols from 1.9 and need to stringify before evaling it.
+	  See #4931.
 
-	    a = [0,1,2,3,4,5,6,7,8,9]
-	    a.fill {|i| a[i] * 10} #=> [nil, nil, ...., nil]
+Tue Jun 28 19:23:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	  previous commit has the advantage of early garbage collection, but
-	  potensially this would break some script. so I reverted behavior.
+	* signal.c: Now, USE_TRAP_SIGMASK depend on HAVE_PTHREAD_SIGMASK.
+	  The code have already depended on pthread_sigmask since r27464.
 
-Tue Nov 15 16:04:10 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Jun 28 15:09:21 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* array.c (rb_ary_fill): tail elements were vanished when the middle
-	  part of array was filled. (ie: [0,1,2,3,4].fill(-1,2,1) => [0,1,-1])
+	* lib/benchmark.rb: merge eregon/benchmark.
+	  https://github.com/eregon/ruby/tree/benchmark
+	  patched by Benoit Daloze. [ruby-core:37593] [Bug #4940]
 
-	* test/ruby/test_array.rb (test_fill): added.
+	* lib/benchmark (Benchmark#bmbm): bmbm should be consistent with bm
+	  for the return value.
 
-Tue Nov 15 14:39:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/benchmark: remove preemptive test instead of skipping
+	  I removed the preemptive test I wrote for Feature #4197.
+	  I'll add it back when the implementation will be able to satisfy it.
 
-	* array.c (rb_ary_fill): should adjust array length correctly when
-	  an array is expanded in the fill process.  [ruby-core:06625]
+	* lib/benchmark (Benchmark#bmbm): remove useless explicit call,
+	  #format is an alias of #to_s test/benchmark: add a test for
+	  format of long time.
 
-Mon Nov 14 23:49:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/benchmark: fix label width: always add 1 to ensure there is a
+	  space delimiter even with times over 100s
+	  When I asked for Feature #4197, I wanted to make delimiting spaces
+	  consistent for #bm and #bmbm.
+	  But with times over 100s, the output contains no space between the
+	  label and the first time (user).
+	  Now both ensure there is always a space, even if that means 3 spaces
+	  with times under 10s (because it is formatted as %10.6f)
 
-	* file.c (rb_file_s_readlink): ERANGE will occur only on GPFS.
-	  [ruby-dev:27699]
+	* test/benchmark: let labels be a constant
+	  lib/benchmark (Benchmark#realtime): avoid creating an unused Proc
+	  lib/benchmark (Benchmark#benchmark): use ensure clause to restore
+	  STDOUT.sync, as in #bmbm
 
-Mon Nov 14 17:36:22 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Jun 28 13:41:51 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* array.c (rb_ary_first): RDoc update from Daniel Berger
-	  <djberg96@yahoo.com>.  [ruby-core:06577].
+	* thread_win32.c (native_stop_timer_thread): fixed commit miss of
+	  r32244.  grep sources before changing the signature of a function.
 
-Fri Nov 11 10:31:44 2005  Zach Dennis  <zdennis@mktec.com>
+Tue Jun 28 11:49:14 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/socket.c: Socket Documentation. [ruby-core:6552]
+	* thread_pthread.c (consume_communication_pipe):
+	  Make "buff" as static.  (Maybe) "buff" can be shared between
+	  any caller (any threads) because no one use the read values.
+	  "buff" (1024 byte) on stack may cause stack overflow on
+	  several environment (we found a crash on FreeBSD).
+	  And remove const value "buff_size", and define CCP_READ_BUFF_SIZE
+	  macro.
 
-Fri Nov 11 08:20:56 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 28 11:45:30 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* Makefile.in (OUTFLAG): keep trailing spaces.  [ruby-dev:27666]
+	* lib/rake:  Update rake to fix some bugs and hide deprecated features
+	  from RDoc.
+	* lib/rake/version.rb:  Bump version to 0.9.2.1 to distinguish it from
+	  the released version.
+	* NEWS:  ditto
 
-	* mkconfig.rb: substitution refereces added.
+Tue Jun 28 11:17:28 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Nov 11 07:44:18 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/rdoc:  Update to RDoc 3.7 (final)
+	* NEWS:  ditto
 
-	* configure.in: undef HAVE_LINK on BeOS. (link(2) always returns
-	  EINVAL, and this causes error in test/fileutils.)
+Tue Jun 28 10:18:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* file.c: overwride chown(2) and fchown(2) on BeOS. (these functions
-	  should not change user/group id if -1 is passed as corresponding
-	  argument, and this causes error in test/fileutils too)
-	  [ruby-dev:27672]
+	* process.c (rb_daemon): fix wrong #endif position.
 
-	* file.c (rb_file_s_link): checks HAVE_LINK.
+Tue Jun 28 07:50:32 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Nov  8 15:32:27 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* object.c (Init_Object):  Teach RDoc what Init_class_hierarchy does to
+	  hook up ri for BasicObject, Object, Module and Class.
 
-	* lib/drb/ssl.rb (DRb::SSLConfig#accept): fixed typo.
-	  [ruby-dev:27560] [ruby-core:4627]
+Tue Jun 28 05:03:32 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Mon Nov  7 13:43:51 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread.c (rb_thread_local_aref): RDoc fix. Thread#[] example
+	  had a race. See #4480.
 
-	* ext/tk/stubs.c (_nativethread_consistency_check): use simpler
-	  (low cost) way to check whether the Tcl interpreter was compiled
-	  with threads enabled of not.
+Tue Jun 28 01:22:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/tk/tcltklib.c: reduce warnings.
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_log): move BigMath.log from
+	  bigdecimal/math.rb.
 
-	* ext/tk/tkutil/tkutil.c: ditto.
+	* ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
 
-Mon Nov  7 00:06:58 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/bigdecimal/test_bigdecimal.rb: move test for BigMath.log from
+	  test/bigdecimal/test_bigmath.rb.
 
-	* lib/yaml.rb: removed :nodoc: to generate Kernel doc. [ruby-core:6324]
+	* test/bigdecimal/test_bigmath.rb: ditto.
 
-Sun Nov  6 23:39:13 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 28 01:19:52 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* ext/iconv/iconv.c (Iconv::BrokenLibrary): exception when detected a
-	  bug of underlying library.
+	* lib/irb/ruby-lex.rb: fix [Bug #4232].
 
-Sun Nov  6 21:46:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Jun 28 00:14:13 2011  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* ext/tk/stubs.c (ruby_tcl_create_ip_and_stubs_init): should touch
-	  interpreter after initialization is done. [ruby-dev:27638]
+	* lib/drb/drb.rb: fix [Bug #4409]. add DRbServer#here?.
 
-Sun Nov  6 20:13:27 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/drb/test_drb.rb: ditto.
 
-	* file.c (rb_file_s_readlink): readlink(2) on AIX fails with ERANGE if
-	  buffer size is less than required.  fixed: [ruby-dev:27634]
+	* test/drb/drbtest.rb: ditto.
 
-Wed Nov  2 20:25:28 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/drb/ut_eq.rb: ditto.
 
-	* ext/tk/extconf.rb: ext/tk/extconf.rb: change the check parameter
-	  for Win32.
+Tue Jun 28 00:08:43 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-Wed Nov  2 20:14:53 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/irb/workspace.rb: fix BUG#4793.
 
-	* ext/tcltklib: merge into ext/tk and remove.
+Mon Jun 27 22:06:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Nov  2 19:03:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c (consume_communication_pipe): don't use C99
+	  style variable length array.
 
-	* ext/tcltklib/tcltklib.c (ip_rbUpdateObjCmd,
-	  ip_rb_threadUpdateObjCmd): passed improper flags to DoOneEvent().
+Mon Jun 27 22:04:27 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/tkutil.c: use rb_obj_respond_to() instead of rb_respond_to().
+	* thread_pthread.c (consume_communication_pipe): change return
+	  type to void. caller doesn't use it.
 
-Tue Nov  1 14:20:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun 27 21:29:50 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_call_super): should call method_missing if super is
-	  called from Kernel method.
+	* thread_pthread.h (rb_global_vm_lock_struct): add volatile to
+	  gvl->waiting. now thread_timer() access it w/o lock.
 
-	* eval.c (exec_under): frame during eval should preserve external
-	  information.
+Mon Jun 27 21:16:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Nov  1 10:50:17 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* thread_pthread.c: s/__gvl_acquire/gvl_acquire_common/ and
+	  s/__gvl_release/gvl_release_common/.
 
-	* ext/openssl/extconf.rb: should check ERR_peek_last_error().
-	  [ruby-dev:27597]
+Mon Jun 27 11:41:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_raise): ditto.
+	* thread_pthread.c (rb_thread_create_timer_thread):
+	  the type of return value of write(2) is ssize_t.
 
-Mon Oct 31 17:34:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun 27 09:57:02 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in: use proper option for Sun linker. A patch from
-	  Shinya Kuwamura <kuwa at labs.fujitsu.com>.  [ruby-dev:27603]
+	* thread_pthread.c (rb_thread_create_timer_thread):
+	  Fixes missing initialization of oflags.
 
-Mon Oct 31 11:27:22 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Jun 27 09:07:42 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb (test_s_open_error):
-	  skip on Win32/DOS platforms.
+	* thread_pthread.c: Stop polling in the timer thread when there are
+	  no waiting thread.  If there are 2 or more runnable threads,
+	  the timer thread does polling.  Avoid polling makes power save
+	  for several computers (0.2W per a Ruby process, when I measured).
+	  If outside-event such as signal or Thread#kill was occurred
+	  when the timer thread does not do polling, then wake-up
+	  the timer thread using communication-pipe (the timer thread
+	  waits this communication-pipe with select(2)).
+	  The discussion about this modification can be found from the post
+	  [ruby-core:33456] and other related posts.
+	  Note that Eric Wong and KOSAKI Motohiro give us the huge
+	  contributions for this modification.  Thanks.
 
-Mon Oct 31 05:49:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* thread_pthread.c (rb_thread_wakeup_timer_thread): add a function.
+	  This function wakes up the timer thread using communication-pipe.
 
-	* ext/openssl/ossl_cipher.c (ossl_cipher_update): input data must
-	  not be empty. [ruby-talk:161220]
+	* thread.c (rb_thread_stop_timer_thread): add a parameter which
+	  specify closing communication-pipe or not.
 
-	* test/openssl/test_cipher.rb: add test for Cipher#update("").
+	* thread.c (rb_thread_terminate_all): do not stop timer thread here
+	  (ruby_cleanup() terminate timer thread).
 
-Mon Oct 31 05:37:20 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* signal.c: wake up timer thread using
+	  rb_thread_wakeup_timer_thread() from signal handler.
 
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIHandler#do_GET): the value of Set-Cookie:
-	  header field should be splited into each cookie.  [ruby-Bugs:2199]
+	* eval.c (ruby_cleanup): use rb_thread_stop_timer_thread(1).
 
-	* lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookie): new method
-	  to parse the value of Set-Cookie: header field.
+	* process.c: use rb_thread_stop_timer_thread(0)
+	  (reuse communication-pipe).
 
-	* test/webrick/test_cookie.rb, test/webrick/test_cgi.rb,
-	  test/webrick/webrick.cgi: add some test for cookie.
+	* thread_win32.c (rb_thread_wakeup_timer_thread): add a dummy
+	  function.
 
-Mon Oct 31 03:19:36 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_core.h: add and fix decl. of functions.
 
-	* ext/readline/readline.c (readline_readline): type check.
-	  [ruby-core:6089]
+Mon Jun 27 08:01:19 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* numeric.c (fix_rshift): RDoc fix.  [ruby-core:6351]
+	* ext/date/date_parse.c: should use ALLOCA_N.
 
-	* util.h (strtod): add #undef for platforms defines strtod()
-	  macro.   [ruby-dev:27563]
+Mon Jun 27 01:34:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 31 02:35:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/etc/test_etc.rb (TestEtc#test_get{pw,gr}nam): skip entries
+	  start with + sign, which means NIS.  these are returned in the
+	  case that passwd and group entries in /etc/nsswitch.conf are set
+	  to use "nis" explicitly on Debian.  fixed #3683
 
-	* test/ruby/test_float.rb (test_precision): test by assert_in_delta.
-	  [ruby-dev:27575]
+Mon Jun 27 00:44:53 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Oct 29 01:58:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (rb_parser_end_seen_p): fix documentation about return
+	  value. patched by Sho Hashimoto. [Bug #4511]
 
-	* ext/etc/etc.c: document update from mathew <meta@pobox.com>.
-	  [ruby-core:06473]
+Mon Jun 27 00:40:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/fcntl/fcntl.c: ditto.
+	* hash.c (rb_hash_reject): add documentation that Hash#reject
+	  without block returns enumerator.
+	  patched by Michael Edgar [Bug #4847] [ruby-core:36800]
 
-Thu Oct 27 16:45:31 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jun 26 23:49:21 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* string.c (scan_once): wrong condition to use mbclen2().
-	  [ruby-dev:27535]
+	* test/date/test_switch_hitter.rb: added a test.
 
-Wed Oct 26 09:27:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+ Sun Jun 26 22:21:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/syck/implicit.c (syck_type_id_to_uri): should return
-	  newly allocated memory. otherwise, type_id will be freed
-	  twice. [ruby-dev:27384] [ruby-core:6385]
+	* ext/date/date_core.c: refactoring.
 
-Wed Oct 26 09:04:51 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Jun 26 18:03:30 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ruby.h (Qfalse, Qtrue, Qnil, Qundef): make sure these immediate
-	  values have VALUE type. there is an environment where sizeof(VALUE)
-	  != sizeof(int) like IA64. if 32bit integer (Qtrue) is passed to ANYARGS
-	  and received by 64bit integer (VALUE), upper bits may have garbage value.
-	  [ruby-dev:27513]
+	* parse.y: comma at the end of line is no longer allowed.
+	  A patch from Yukihiro Matsumoto  <matz AT ruby-lang.org>.
+	  (fixed #3456).
 
-Wed Oct 26 01:58:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jun 26 13:35:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* configure.in (RUBY_EXTERN): macro to export symbols in shared
-	  library.  [ruby-core:05528]
+	* vm_dump.c (rb_vm_bugreport): change CrashReporter suggestion messages
+	  on Mac. It should be placed after "-- C level backtrace" line.
+	  Suggested by Endoh-san.
 
-	* defines.h, {bcc32,win32,wince}/Makefile.sub (RUBY_EXTERN): moved to
-	  configuration pass.
+	  <before>
+	  -- See Crash Report log file under ~/Library/Logs/CrashReporter or ---------
+	  -- /Library/Logs/CrashReporter, for the more detail of ---------------------
+	  -- C level backtrace information -------------------------------------------
 
-	* ext/extmk.rb (extmake): RUBY_EXTERN for static linked extensions.
+	<after>
+	  -- C level backtrace information -------------------------------------------
 
-Tue Oct 25 15:32:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	     See Crash Report log file under ~/Library/Logs/CrashReporter or
+	     /Library/Logs/CrashReporter, for the more detail of.
 
-	* lib/rational.rb: applied documentation patch from Gavin Sinclair
-	  <gsinclair@gmail.com>.  [ruby-core:06364]
+Sun Jun 26 10:08:28 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/irb.rb (IRB::Irb::eval_input): handle prompts with newlines
-	  in irb auto-indentation mode.  [ruby-core:06358]
+	* ext/openssl/extconf.rb
+	* ext/openssl/ossl_missing.h/.c: add ASN1_put_eoc if missing.
 
-Tue Oct 25 02:12:08 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_asn1.c: introduce ossl_asn1_object_size and
+	  ossl_asn1_put_object to wrap functionality depending on OpenSSL
+	  version in use.
+	  Fixes	[ Ruby 1.9 - Bug #4916 ] reported by Hiroshi Nakamura.
+	  [ruby-core:37286]
 
-	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::LABEL_LIST_RE):
-	  reduce redundant backtrack.  [ruby-talk:161771]
+Sun Jun 26 01:00:15 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Oct 25 00:27:35 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/date/date_core.c (date_strftime_internal): removed meaningless braces.
+	* ext/date/date_core.c (gengo): the value should be int.
 
-	* lib/rinda/*: RDoc documentation from Eric Hodel
-	  <drbrain@segment7.net> added.
+Sat Jun 25 23:45:30 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Mon Oct 24 21:14:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_search_superclass): avoid control frame
+	  stack overrun. currently super() in Proc created in a method
+	  defined by Module#define_method raise NoMethodError. [Bug #4881]
+	* test/ruby/test_method.rb t_super_in_proc_from_define_method):
+	  add test for it.
 
-	* configure.in, io.c: use sys/syscall.h if syscall.h is not available.
-	  [ruby-core:06247]
+Sat Jun 25 23:23:14 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Mon Oct 24 20:49:45 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread.c (sleep_forever): now Kernel#sleep don't wakeup by
+	  signal handler execution. [Bug #4072]
 
-	* ext/Win32API/lib/win32/resolv.rb (get_info): support multiple DNS.
-	  fixed: [ruby-list:40058], [ruby-dev:27479]
+Sat Jun 25 23:14:47 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Mon Oct 24 07:57:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_threadptr_check_signal): remove unnecessary th->status
+	  backup. fix race condition which may results unexpected main thread's
+	  status transition. see #4072
 
-	* ext/tk/lib/tk/canvas.rb (TkCanvasItemConfig::__item_val2ruby_optkeys):
-	  typo fixed.  [ruby-talk:162187]
+Fri Jun 24 19:57:30 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* ext/tk/lib/tk/menu.rb (TkMenuEntryConfig::__item_val2ruby_optkeys):
-	  ditto.  [ruby-core:06359]
+	* lib/webrick/httprequest.rb (setup_forwarded_info): Parsing request
+	  header failed when the request is from 2 or more Apache reverse
+	  proxies. It's said that all X-Forwarded-* headers will contain more
+	  than one (comma-separated) value if the original request already
+	  contained one of these headers.  Since we could use these values as
+	  Host header, we choose the initial(first) value. See #4922.
 
-Sun Oct 23 21:50:15 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/webrick/test_httprequest.rb (test_forwarded): Test it.
 
-	* ext/enumerator/enumerator.c: applied documentation patch from
-	  James Edward Gray II <james@grayproductions.net>.
-	  [ruby-core:06348]
+Fri Jun 24 17:06:33 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 23 07:11:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* process.c (proc_daemon): should not start timer thread
+	  twice.  fixed Bug#4920.
 
-	* ext/tcltklib/extconf.rb: improve messages [ruby-core:06325].
+Fri Jun 24 15:54:14 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb, ext/tk/lib/tk/canvas.rb, ext/tk/lib/tk/entry.rb,
-	  ext/tk/lib/tk/frame.rb, ext/tk/lib/tk/image.rb,
-	  ext/tk/lib/tk/itemconfig.rb, ext/tk/lib/tk/labelframe.rb,
-	  ext/tk/lib/tk/listbox.rb, ext/tk/lib/tk/menu.rb,
-	  ext/tk/lib/tk/radiobutton.rb, ext/tk/lib/tk/scale.rb,
-	  ext/tk/lib/tk/spinbox.rb, ext/tk/lib/tk/text.rb,
-	  ext/tk/lib/tk/toplevel.rb: improve conversion of option values.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Try to shutdown SSL
+	  connection more gracefully. Call SSL_shutdown() max 4 times until it
+	  returns 1 (success). Bi-directional SSL close has several states but
+	  SSL_shutdown() kicks only 1 transition per call. Max 4 is from
+	  mod_ssl.c of Apache httpd that says 'max 2x pending + 2x data = 4'.
+	  See #4237.
 
-	* ext/tk/lib/tkextlib/*: ditto.
+Fri Jun 24 07:24:37 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tkextlib/*: update to support ActiveTcl8.4.11.2.
+	* lib/rake/version.rb:  Fixed VERSION to work with tool/rbinstall.rb
+	* bin/rake:  Import bin/rake from 0.9.2
+	* tool/rbinstall.rb (install):  Rake::VERSION is now in
+	  lib/rake/version.rb.  Fixes `make install`
 
-	* ext/tk/lib/tkextlib/trofs/*: support Trofs 0.4.3.
+Fri Jun 24 07:11:37 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tkextlib/tile/*: support Tile 0.7.2.
+	* lib/rake: Import Rake 0.9.2
 
-	* ext/tk/lib/tkextlib/vu/*: support vu 2.3.0.
+Fri Jun 24 00:44:15 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/tkextlib/tcllib/*: support Tcllib 1.8 (Tklib 0.3).
+	* ext/date/date_core.c (c_valid_{julian,gregorian}_p): fixed the range of month.
 
-Sat Oct 22 23:54:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 24 00:14:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/extmk.rb, lib/mkmf.rb (with_config): support --with-extension
-	  options.  [ruby-dev:27449]
+	* ext/date/date_core.c: trivial changes on text.
 
-Sat Oct 22 13:26:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 23 22:46:57 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* object.c (sym_inspect), parse.y (parser_yylex, rb_symname_p): check
-	  if valid as a symbol name more strictly.  [ruby-dev:27478]
+	* ext/openssl/ossl_x509name.c: Add X509::Name#hash_old as a wrapper
+	  for X509_NAME_hash_old in OpenSSL 1.0.0. See #4805
 
-	* test/ruby/test_symbol.rb: tests for [ruby-core:03573].
+	* test/openssl/test_x509name.rb (test_hash): Make test pass with
+	  OpenSSL 1.0.0.
 
-	* time.c (rb_strftime): removed meaningless volatile modifiers, and
-	  concatenate successive nul characters at once.  [ruby-dev:27472]
+	* NEWS: Add it.
 
-Fri Oct 21 19:21:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 23 19:30:53 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* rubysig.h (CHECK_INTS): fixed typo. (I believe bit-or is improper)
+	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_time): Check
+	  argument type with NUM2LONG if the arg is not a Time object.
+	  See #4919.
 
-Fri Oct 21 17:49:32 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_timeout): Check
+	  type with NUM2LONG. Time as an arg is not allowed. See #4919.
 
-	* bin/erb (ERB::Main::run): typo fixed.  [ruby-core:06337]
+	* test/openssl/test_ssl_session.rb (test_session_time,
+	  test_session_timeout): Test it.
 
-Fri Oct 21 15:27:17 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jun 23 13:30:30 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* bignum.c (bignew_1): convertion from `int' to `char' discards
-	  upper bits, (ie. (char)0xff00 -> 0) so it's better to test if
-	  nonzero and set 0 or 1 instead of simply casting ... as a flag usage.
-	  (but I believe this won't cause actual bug in current implementation)
-	  [ruby-dev:27055]
+	* signal.c(ruby_atomic_exchange): Fix definition style.
 
-	* time.c: should use LONG_LONG instead of `long long'.
+Wed Jun 22 22:34:05 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Thu Oct 20 09:37:15 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_session_new_cb): Return 0 to
+	  OpenSSL from the callback for SSL_CTX_sess_set_get_cb().
+	  Returning 0 means to OpenSSL that the session is still valid
+	  (since we created Ruby Session object) and was not freed by us with
+	  SSL_SESSION_free(). Call SSLContext#remove_session(sess) in
+	  session_get_cb block if you don't want OpenSSL to cache the session
+	  internally.
+	  This potential issue was pointed by Ippei Obayashi. See #4416.
 
-	* lib/mkmf.rb (create_makefile): Borland make seems not to allow
-	  empty dependency list. If this change is not good, please correct
+	* test/openssl/test_ssl_session.rb (test_ctx_server_session_cb): Test
 	  it.
 
-Thu Oct 20 07:55:09 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): get rid of a restriction
-	  of Borland make.  fixed: [ruby-dev:27460]
-
-Thu Oct 20 00:13:18 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* rubysig.h (CHECK_INTS): fix typo.
+Wed Jun 22 22:21:17 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Oct 19 23:58:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_ssl_session.c: Respect T_BIGNUM time values. Patch by
+	  Tomoyuki Chikanaga.
+	  [ Ruby 1.9 - Bug #4919 ] [ruby-dev:43869]
 
-	* lib/mkmf.rb (create_makefile): do not create unnecessary empty
-	  directories.  fixed: [ruby-dev:27451]
+Wed Jun 22 21:29:25 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Oct 19 19:26:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/depend (SOCK_HEADERS): use $(top_srcdir) instead of
+	  $(topdir). sorry!
 
-	* parse.y (rb_gc_mark_parser): get rid of segfault with old yacc.
-	  fixed: [ruby-dev:27439]
+Wed Jun 22 19:47:03 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Oct 19 08:28:32 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* cont.c (cont_capture): add volatile.
+	  On clang -O, it is needed to avoid the optimization.
+	  With this and llvm/clang's recent fix, clang 3.0 can
+	  build ruby-trunk with -O option.
 
-	* file.c (rb_file_join): elements may contain null pointer strings.
-	  report and fixed by Lloyd Zusman (hippoman): [ruby-core:06326]
+	* cont.c (cont_capture): use for-loop.
 
-Wed Oct 19 02:34:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_each): add volatile and use it.
 
-	* eval.c, gc.c, time.c: made internal symbols static.  [ruby-dev:27435]
+	* vm_insnhelper.c (vm_call_cfunc): ditto.
 
-Wed Oct 19 01:27:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun 22 18:20:46 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): numeric literal inside character class
-	  disabled succeeding backtrack.  fixed: [ruby-list:41328]
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_session_remove_cb):
+	  OpenSSL::SSL::SSLContext#session_remove_cb was broken. It wrongly
+	  tried to call the session_*new*_cb callback.
 
-Mon Oct 17 21:18:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/openssl/test_ssl_session.rb (class OpenSSL): Test it.
 
-	* parse.y (parser_heap): byacc never free parser stack.
-	  fixed: [ruby-dev:27428]
+Wed Jun 22 17:37:49 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Mon Oct 17 16:04:47 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl.h: Introduced OSSL_BIO_reset macro for PEM/DER
+	  fallback scenarios.
 
-	* file.c (chmod_internal, lchmod_internal): fixed type of 2nd argument.
-
-Sun Oct 16 22:16:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: omit non-existing directories.
-
-Sun Oct 16 14:30:05 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb (Rinda::Tuple#initialize): check remote hash
-	  tuple. fixed: [ruby-list:41227]
-
-	* test/rinda/test_rinda.rb: test it.
-
-Sun Oct 16 03:38:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* rubysig.h (CHECK_INTS): prevent signal handler to run during
-	  critical section.  [ruby-core:04039]
-
-	* eval.c (load_wait): need not to call rb_thread_schedule()
-	  explicitly.  [ruby-core:04039]
-
-	* eval.c (rb_thread_schedule): clear rb_thread_critical.
-	  [ruby-core:04039]
-
-Sat Oct 15 19:56:38 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* bin/erb: typo fixed, again. thanks, Doug Kearns.
-
-Fri Oct 14 22:08:26 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (ioctl): should set errno.
-
-Fri Oct 14 16:57:32 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/config.rb (Config::FileHandler): :UserDir should be nil.
-	  It is harmful to permit the access to ~/public_html by default.
-	  suggested by Hiroyuki Iwatsuki.
-
-Thu Oct 13 23:29:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (HEAPCNT): bison allocates indivisible size.
-	  fixed: [ruby-core:06261]
-
-	* io.c, pack.c, ext/syck/rubyext.c, ext/syck/syck.h, missing/isinf.c:
-	  get rid of warnings.  fixed: [ruby-core:06247]
-
-Wed Oct 12 12:52:57 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (Init_openssl): should call
-	  OpenSSL_add_ssl_algorithms().
-
-Wed Oct 12 11:08:54 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* file.c (rb_f_test): typo in RDoc comments.
-
-Tue Oct 11 21:41:58 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_obj_respond_to): check if obj responds to the given
-	  method with the given visibility.  [ruby-dev:27408]
-
-	* eval.c (rb_respond_to): conform to Object#respond_to?.  [ruby-dev:27411]
-
-Tue Oct 11 00:01:21 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* st.c (st_free_table): do not call free() but xfree().
-	  [ruby-core:06205]
-
-Sat Oct  8 20:04:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (Init_Binding): add Binding#dup method.  [yarv-dev:666]
-
-	* parse.y (rb_parser_malloc, rb_parser_free): manage parser stack on
-	  heap.  [ruby-list:41199]
-
-	* ext/iconv/charset_alias.rb: parse config.charset_alias file directly.
-
-Fri Oct  7 09:54:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::Cookie::parse): Cookies from Nokia devices may
-	  not be parsed correctly.  A patch from August Z. Flatby
-	  (augustzf) in [ruby-Patches-2595].  [ruby-core:06183]
-
-Thu Oct  6 20:12:16 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c (strscan_free): remove useless code.
-	  [ruby-dev:26368] [ruby-dev:27389]
-	  (backported from trunk, rev 1.22)
-
-Wed Oct  5 04:42:38 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/xmlrpc/server.rb (XMLRPC::Server#initialize): should mount the
-	  servlet on "/".
-
-Wed Oct  5 03:59:09 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/xmlrpc/server.rb (XMLRPC::Server#serve): delete wrong call
-	  of "join".
-
-Mon Oct  3 00:04:00 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* pack.c (EXTEND16): [ruby-dev:27383]
-
-Thu Sep 29 10:26:18 2005  Tanaka Akira  <akr@m17n.org>
-
-	* ext/dl/dl.c (rb_io_to_ptr): abolish sizeof(FILE).
-	  [ruby-dev:27317]
-
-Thu Sep 29 07:22:05 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* evalc. (rb_f_send): underscores need to be escaped.
-	  fixed by Doug Kearns.  [ruby-core:06053]
-
-Thu Sep 29 00:57:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ev_const_get), variable.c (rb_const_get_0): retry only when
-	  autoload succeeded.
-
-	* variable.c (rb_autoload_load): now return true if autoload
-	  succeeded.  fixed: [ruby-dev:27331]
-
-Wed Sep 28 23:42:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (apply2files): add prototype.
-
-	* file.c (rb_stat_inspect): constified.
-
-	* class.c (rb_mod_init_copy, rb_class_init_copy), file.c (rb_stat_init_copy),
-	  numeric.c (num_init_copy), object.c (rb_obj_init_copy, Init_Object),
-	  re.c (match_init_copy, rb_reg_init_copy), time.c (time_init_copy):
-	  undocumented.
-
-Wed Sep 28 23:09:23 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb: document update from James Edward Gray II
-	  <james@grayproductions.net>.  [ruby-core:06027]
-
-Wed Sep 28 15:14:19 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI#start): req.query_string should
-	  refer the value of QUERY_STRING. [ruby-list:41186]
-
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#query_string=):
-	  add new method.
-
-Wed Sep 28 10:45:44 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: cannot compile with Tcl/Tk8.0.x
-	  [ruby-dev:27335].
-
-Wed Sep 28 08:12:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (read_buffered_data): check if reached EOF.  fixed: [ruby-dev:27334]
-
-Wed Sep 28 07:56:52 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/yaml/basenode.rb (YAML::BaseNode::match_segment): fix typo.
-	  [ruby-dev:27237], [ruby-core:05854]
-
-	* lib/yaml/tag.rb (Module#yaml_as): suppress warnings.
-
-	* lib/yaml/types.rb (YAML::PrivateType, YAML::DomainType): ditto.
-
-Wed Sep 28 03:23:35 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* rubysig.h: fixed build problem with --enable-pthread on platforms
-	  which don't have setitimer().
-
-Mon Sep 26 22:32:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (set_trace_func): add rb_secure(4) to prevent adding
-	  tracing function.
-
-Sun Sep 25 12:05:10 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* bin/erb: typo fixed.
-
-Sun Sep 25 01:46:43 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-calculate-indent): arrange deep-indent
-	  closing parenthesis at same column as the opening.
-
-Sun Sep 25 00:42:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-expr-beg): deal with heredoc separately.
-	  fixed: [ruby-list:41168]
-
-	* misc/ruby-mode.el (ruby-calculate-indent): not to deepen indent
-	  level for continuous line inside parentheses.
-	  http://nabeken.tdiary.net/20050915.html#p02
-
-Sun Sep 25 00:18:11 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (unknown_node): show more information.  [ruby-dev:26196]
-
-Sat Sep 24 08:56:01 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (cd): no longer accept :noop option, related
-	  code is useless (backported from trunk, rev 1.67).
-	  [ruby-core:05858] [ruby-Bugs:2494]
-
-Sat Sep 24 08:38:07 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: fix visibility of FileUtils::NoWrite, Verbose,
-	  DryRun (backported from trunk, rev 1.66). [ruby-core:05954]
-
-	* test/fileutils/test_nowrite.rb: test it.
-
-	* test/fileutils/test_dryrun.rb: new file.
-
-	* test/fileutils/test_verbose.rb: new file.
-
-Sat Sep 24 02:40:20 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb: document update from James Edward Gray II
-	  <james@grayproductions.net>.  [ruby-core:05942]
-
-Thu Sep 22 23:36:24 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (find_executable0): default path if environment is not
-	  set.  [ruby-dev:27281]
-
-Thu Sep 22 16:33:12 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/readline/test_readline.rb (TestReadline::replace_stdio):
-	  merged the patch of [ruby-dev:25232] instead of [ruby-dev:25223].
-
-Wed Sep 21 23:30:44 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (configuration): generalized nmake dependent code.
-
-Wed Sep 21 09:07:55 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* stable version 1.8.3 released.
-
-Wed Sep 21 08:52:25 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/token.c: correctly compute identation of a block
-	  scalar's parent node. [ruby-talk:150620]
-
-Wed Sep 21 08:20:24 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* README.EXT, README.EXT.ja: add new features.
-
-Wed Sep 21 07:43:58 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (default_argv, Arguable#options): defaults strings
-	  to be parsed to Arguable instance.
-
-Wed Sep 21 02:44:09 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (path_check_0): disallow sticky world writable directory
-	  in PATH (and $LOAD_PATH).  [ruby-dev:27226]
-
-	* file.c (fpath_check): typo fixed.
-
-Tue Sep 20 22:29:49 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/wsdl/simpletype/rpc/test_rpc.rb, test/wsdl/ref/test_ref.rb,
-	  test/wsdl/any/test_any.rb test/soap/wsdlDriver/test_calc.rb:
-	  suppress deliberate warnings with $VERBOSE = nil.
-
-Tue Sep 20 21:26:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/wait/lib/nonblock.rb: disable on platforms non-blocking flag
-	  is not available.  fixed: [ruby-dev:27187]
-
-Tue Sep 20 18:23:04 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (thread_mark): mark th->last_status.  [ruby-dev:27179]
-
-Tue Sep 20 18:20:33 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/yaml.rb: require 'yaml/constants'.  [ruby-core:5776]
-
-Tue Sep 20 17:48:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): add charset
-	  information to content-type header.[ruby-core:5127]
-
-	* lib/xmlrpc/server.rb (CGIServer::serve): ditto.
-
-	* lib/xmlrpc/server.rb (ModRubyServer::serve): ditto.
-
-	* lib/xmlrpc/server.rb (WEBrickServlet::service): ditto.
-
-Tue Sep 20 17:34:46 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/webrick/test_cgi.rb: set ENV["PATH"] to CGIEnvPath on
-	  windows. bcc32's runtime is not installed into system directory,
-	  so it cannot be found without this setting. [ruby-dev:27166]
-
-Tue Sep 20 17:10:38 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* test/dbm/test_dbm.rb (TestDBM::test_s_open_error): remove
-	  test_s_open_error test to detect duplicate open.
-	  [ruby-dev:27202]
-
-Tue Sep 20 17:08:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* io.c: PIPE_BUF is not defined on BeOS. use _POSIX_PIPE_BUF instead.
-	  [ruby-dev:27185]
-
-Tue Sep 20 16:53:53 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* test/readline/test_readline.rb (TestReadline::replace_stdio):
-	  BSD seek support from [ruby-dev:25223].  fixed: [ruby-dev:27150]
-
-Tue Sep 20 15:39:40 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/emitter.c (syck_scan_scalar): prevent indicators from
-	  appearing alone or at the end of plain scalars. [ruby-core:5826]
-
-	* ext/syck/emitter.c (syck_emit_scalar): treat typed scalar nodes
-	  as complex keys.
-
-	* lib/syck.h: version 0.60.
-
-	* lib/yaml/basenode.rb (YAML::BaseNode#at): transform keys during
-	  key searches.
-
-	* ext/syck/rubyext.c: loading of binary-typed nodes.  prevent
-	  emission of plain strings that look like symbols, but which aren't.
-
-Tue Sep 20 05:50:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/xmlrpc/test_webrick_server.rb (setup_http_server):
-	  should not include 'webrick/https' unless 'use_ssl' because
-	  it fails where openssl is not installed.
-
-Tue Sep 20 00:34:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_close): call rb_io_close() directly if io is a T_FILE
-	  object.  [ruby-dev:27156]
-
-Mon Sep 19 19:09:08 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* file.c (rb_file_chown): should accept nil. [ruby-dev:27171]
-	  (backport from trunk, rev 1.208)
-
-Mon Sep 19 18:35:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dl/dl.c (rb_io_to_ptr): fix DragonFlyBSD support.
-	  [ruby-dev:27151]
-
-Mon Sep 19 14:17:04 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/syck/emitter.c (syck_emit): passing an int* value to the
-	  long* parameter causes unaligned access on LP64 systems.
-	  [ruby-dev:27161]
-
-Mon Sep 19 13:44:03 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: avoid core dump with WIN32OLE_EVENT.
-	  [ruby-dev:27133]
-
-Mon Sep 19 10:36:06 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (cp_r): default is :dereference_root=>true for
-	  backward compatibility. [ruby-dev:27145]
-
-	* test/fileutils/test_fileutils.rb (test_cp_r): test it.
-
-Mon Sep 19 09:57:39 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: backported from trunk (1.36).
-	  (again) [ruby-dev:27145]
-
-Mon Sep 19 07:45:37 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey.h, ossl_pkey_rsa.c, ossl_pkey_dsa.c:
-	  an instance variable "private" is added to OpenSSL::PKey class.
-	  this ivar is a flag that shows whether there is a private key
-	  in the instance.
-
-	* ext/openssl/ossl_engine.c: (ossl_engine_load_privkey): set private
-	  key flag.
-
-Mon Sep 19 06:41:32 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: backported from trunk (rev 1.65):
-
-	* lib/fileutils.rb (rm_r): new option :secure.
-
-	* lib/fileutils.rb (rm_rf): new option :secure.
-
-	* lib/fileutils.rb: new method #remove_entry_secure.
-
-	* lib/fileutils.rb (cd): remove option :noop.
-
-	* lib/fileutils.rb (cp_r): new option :dereference_root.
-
-	* lib/fileutils.rb (cp_r): new option :dereference_root.
-
-	* lib/fileutils.rb: new method #remove_entry.
-
-	* lib/fileutils.rb: new method #chmod_R.
-
-	* lib/fileutils.rb: new method #chown.
-
-	* lib/fileutils.rb: new method #chown_R.
-
-	* lib/fileutils.rb: new method .commands.
-
-	* lib/fileutils.rb: new method .options.
-
-	* lib/fileutils.rb: new method .have_option?.
-
-	* lib/fileutils.rb: new method .options_of.
-
-	* lib/fileutils.rb: new method .collect_method.
-
-	* lib/fileutils.rb: use module_function instead of single extend.
-
-	* test/fileutils/test_fileutils.rb: backported from trunk (1.36).
-
-Mon Sep 19 03:17:48 2005  Tanaka Akira  <akr@m17n.org>
-
-	* file.c (rb_thread_flock): wrap the flock system call by
-	  TRAP_BEG/TRAP_END to enable signals.  [ruby-dev:27122]
-
-	* ext/socket/socket.c (bsock_send): wrap the sendto and send system
-	  call by TRAP_BEG/TRAP_END to enable signals when writing to a socket
-	  which is full.  [ruby-dev:27132]
-
-	* io.c (rb_io_syswrite): wrap the write system call by
-	  TRAP_BEG/TRAP_END to enable signals when writing to a pipe which is
-	  full.  [ruby-dev:27134]
-
-Mon Sep 19 03:02:08 2005  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (io_fwrite): wrap the write system call by TRAP_BEG/TRAP_END to
-	  enable signals when writing to a pipe which is full.
-
-Sun Sep 18 02:10:47 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: remove comments that are bungling up
-	  the rdoc and ri output.  output symbols as plain scalars.
-
-	* ext/syck/rubyext.c (syck_emitter_reset): emit headless
-	  documents always.
-
-	* ext/syck/emitter.c (syck_scan_scalar): quote scalars with any
-	  kind of surrounding line space, tabs or spaces alike.
-
-	* ext/syck/token.c: accept tabs as whitespace, not for indentation,
-	  but strip from plain scalars.
-
-	* test/yaml/test_yaml.rb: remove outdated tests.
-
-Sat Sep 17 23:25:04 2005  sheepman  <sheepman@sheepman.sakura.ne.jp>
-
-	* lib/mathn.rb (Rational::inspect): should preserve original
-	  operand.  [ruby-core:05806]
-
-Sat Sep 17 23:20:27 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::Cookie): should handle multiple values for a
-	  cookie name.  [ruby-talk:156140]
-
-Sat Sep 17 10:42:13 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
-	  should call Kernel.eval on caller's safe-level instead of slave's
-	  safe-level (Of course, the given script should be evaluated on
-	  slave's safe-level).
-
-Sat Sep 17 09:45:26 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_substr): should propagate taintness even for
-	  empty strings.  [ruby-dev:27121]
-
-	* string.c (rb_str_aref): should infect result if range argument
-	  is tainted.  [ruby-dev:27121]
-
-Sat Sep 17 08:35:39 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker/base.rb (RSS::Maker::ItemsBase#normalize): fixed
-	  strange RSS::Maker::Item#max_size behavior.
-	  Thanks to Kazuhiko <kazuhiko@fdiary.net>.
-
-	* test/rss/test_maker_1.0.rb (RSS::TestMaker10#test_items): ditto.
-
-Fri Sep 16 23:09:20 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_search_event_at): bug fix
-	  in ext/win32ole/sample/ienavi.rb.
-
-	* ext/win32ole/win32ole/tests/testOLEEVENT.rb: ditto.
-
-Fri Sep 16 22:41:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_extname): empty string for path name ending with a
-	  period.  fixed: [ruby-core:05651]
-
-	* file.c (rb_file_join): smarter behavior at edge cases.
-	  fixed: [ruby-core:05706]
-
-Fri Sep 16 18:34:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/node.c (syck_replace_str): was using return from the
-	  void function.  a patch from MIYAMUKO Katsuyuki
-	  <miyamuko at mtb.biglobe.ne.jp>.  [ruby-dev:27111]
-
-Fri Sep 16 14:48:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: fix typo on MultiTkIp#bg_eval_string
-
-Fri Sep 16 12:02:12 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_resolver_transfer): remove C++ style
-	  comment (//).  [ruby-core:05793]
-
-Fri Sep 16 00:14:14 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/logger/test_logger.rb: unintentionally overwritten changes by
-	  Usa.  reverted.
-
-Fri Sep 16 00:06:18 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#initialize): should set
-	  $stdout.binmode.
-
-Thu Sep 15 23:25:21 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.5.
-
-	  #nnn is a ticket number at http://dev.ctor.org/soap4r
-
-	  * SOAP
-
-	    * allow to configure an envelope namespace of SOAP request. (#124)
-	   	TemporaryNamespace = 'http://www.w3.org/2003/05/soap-envelope'
-	  	@client.options["soap.envelope.requestnamespace"] =
-		  TemporaryNamespace
-	 	@client.options["soap.envelope.responsenamespace"] =
-		  TemporaryNamespace
-		@client.do_proc(...)
-
-	    * let SOAP request XML indent space configuable.  see
-	      "soap.envelope.no_indent" option. (#130)
-
-	    * let external CES configuable.
-	      ex. client["soap.mapping.external_ces"] = 'SJIS'.  $KCODE is used
-	      by default. (#133)
-		external CES ::= CES used in Ruby object of client and server
-		internal CES ::= CES used in SOAP/OM
-
-	    * add iso-8859-1 external CES support. (#106)
-
-	    * fixed illegal 'qualified' handling of elements.  it caused
-	      ASP.NET inteoperability problem. (#144)
-
-	    * added 'soap.envelope.use_numeric_character_reference' (boolean)
-	      option to let query XML use numeric character reference in XML,
-	      not plain UTF-8 character.  !GoogleSearch server seems to not
-	      allow plain UTF-8 character since 2005-08-15 update. (#147)
-
-	    * SOAP::Header::SimpleHeader (de)serialization throws an exception
-	      on !SimpleHeader.on_(in|out)bound when header is a String.  so we
-	      could not use a simple single element headerItem.  fixed.  thanks
-	      to emil. (#129)
-
-	    * out parameter of rpc operation did not work.  (#132)
+	* ext/openssl/ossl_pkey_dsa.c
+	* ext/openssl/ossl_x509req.c
+	* ext/openssl/ossl_pkey_rsa.c
+	* ext/openssl/ossl_pkey_ec.c
+	* ext/openssl/ossl_ssl_session.c
+	* ext/openssl/ossl_x509crl.c
+	* ext/openssl/ossl_pkey.c
+	* ext/openssl/ossl_pkey_dh.c
+	* ext/openssl/ossl_x509cert.c
+	* ext/openssl/ossl_pkcs7.c: Use OSSL_BIO_reset.
 
-	    * follow HTTP redirect only if using http-access2.  (#125) (#145)
+	* ext/openssl/ossl_ssl.c
+	* ext/openssl/ossl_cipher.c
+	* ext/openssl/ossl_pkey_ec.c
+	* ext/openssl/ossl_pkcs12.c
+	* ext/openssl/ossl_ssl_session.c: Replace rb_raise occurrences by
+	  ossl_raise. This automatically flushes OpenSSL's error queue.
 
-	    * add a workaround for importing an WSDL whose path begins with
-	      drive letter.  (#115)
+	* ext/openssl/ossl_pkcs7.c: Raise error if DER fallback for parsing
+	  fails.
 
-	  * WSDL
+	* test/openssl/test_pkey_ec.rb
+	* test/openssl/test_pkey_dsa.rb
+	* test/openssl/test_pkey_rsa.rb: Add assertions that OpenSSL.errors is
+	  empty.
 
-	    * SOAP Data which is defined as a simpletype was not mapped
-	      correctly to Ruby obj when using wsdl2ruby.rb generated classdef
-	      file. (#123)
+	* test/openssl/test_pkey_rsa.rb: Remove initial OpenSSL.errors call in
+	  test_new.
+	  [ Ruby 1.9 - Bug #4885 ] [ruby-core:37134]
 
-	    * rpc/literal support. (#118)
+Wed Jun 22 15:01:24 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	    * re-implemented local element qualify/unqualify control.  handles
-	      elementFormDefault and form in WSDL.  (#119)
+	* ext/openssl/ossl_ssl.c: Use SSL_MODE_RELEASE_BUFFERS if available.
+	  Thanks, Eric Wong, for providing the patch.
+	  [ Ruby 1.9 - Feature #4672 ] [ruby-core:36127]
 
-	    * Array of an element which has simpleType causes a crash. (#128)
+Wed Jun 22 14:47:53 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	    * prarmeterOrder may not contain return part so it can be shorter
-	      than parts size.  Thanks to Hugh.  (#139)
+	* test/openssl/test_buffering.rb
+	* test/openssl/test_pkcs12.rb: Inherit from Test::Unit::TestCase
+	  instead of MiniTest::Unit::TestCase. [ruby-core:37275]
 
-	  * Samples
+Wed Jun 22 12:41:03 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	    * added !BasicAuth client sample. (#117)
+	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der):
+	  OpenSSL::SSL::Session#to_der was broken. Fix buffer handling.
 
-	    * added Base64 client/server sample.
+	* test/openssl/test_ssl_session.rb (test_session): Test it.
 
-	    * added Flickr SOAP interface client sample. (#122)
+Wed Jun 22 12:38:52 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	    * added !SalesForce client sample. (#135)
+	* test/openssl/test_ssl_session.rb: Split out SSL::Session related
+	  tests from test_ssl.rb
 
-	    * updated Thawte CA certificate for !GoogleAdWords sample.
+Wed Jun 22 03:20:52 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	    * updated a client script with the newer version made by Johan.
-	      thanks!
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Fix cyclic references of
+	  objects.  Thanks to CvX for reporting the bug and a test case.
+	* test/psych/test_object.rb: test for cyclic object references.
 
-	    * shortened long file names. (#120)
+Wed Jun 22 02:39:54 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	    * fixed typo in authheader sample. (#129)
+	* lib/net/http.rb (Net::HTTP.post_form): Do not ignore query part of
+	  the given URI to post. See #655.
 
-	    * updated deprecated method usage.  (#138)
+	* test/net/http/test_http.rb, test/net/http/utils.rb: Test it.
 
-Thu Sep 15 23:02:57 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jun 22 01:28:13 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* win32/win32.h (rb_w32_stat): added prototype.
+	* test/openssl/test_x509store.rb (test_set_errors): Redhat is
+	  distributing a patched version of OpenSSL that allows multiple CRL
+	  for a key (multi-crl.patch.) Make test pass on such env. See #4122,
+	  #4554.
 
-Thu Sep 15 22:35:55 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Jun 21 21:50:37 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* test/ruby/test_signal.rb (test_exit_action): skip the test using
-	  fork on fork-less platforms.
+	* lib/webrick/httpresponse.rb (HTTPResponse#setup_header): Close
+	  HTTP/1.1 connection when returning an IO object as response body
+	  without setting HTTPResponse#chunked to true. See #855 no.1.
 
-Thu Sep 15 11:39:18 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/webrick/test_httpserver.rb: Test it.
 
-	* ext/tk/lib/tk/dialog.rb: If a dialog does not show up yet,
-	  TkDialogObj#name raises an exception. [ruby-talk:156109]
+Tue Jun 21 21:27:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Sep 15 01:39:19 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* internal.h: move rb_thread_io_blocking_region() declaration
+	  from intern.h to internal.h. It's still experimental API and
+	  need more discussion. [ruby-dev:43698]
+	* include/ruby/intern.h: ditto.
 
-	* lib/rinda/tuplespace.rb (Rinda::TemplateEntry::initialize): pull
-	  up method. Tabs converted to spaces.
+	* ext/socket/rubysocket.h: include internal.h.
+	* ext/socket/depend: add internal.h dependency.
+	* ext/socket/extconf.rb: add $INCFLAGS to topdir.
 
-Thu Sep 15 00:18:24 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Jun 21 20:38:47 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/net/telnet.rb (Net::Telnet::waitfor): replace sysread with
-	  readpartial.  [ruby-talk:127641]
+	* ext/date/date_core.c (datetime_s_*): canonicalize 24 o'clock.
 
-Wed Sep 14 22:40:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 21 19:46:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* dir.c (ruby_glob): glob function not using ruby exception system.
+	* test/ruby/test_thread.rb (TestThread#test_priority): enable
+	  this test again. Current GVL respect thread priority rather
+	  than past.
 
-Wed Sep 14 01:26:03 2005  Minero Aoki  <aamine@loveruby.net>
+Tue Jun 21 13:25:35 2011  TAKAO Kouji  <kouji@takao7.net>
 
-	* lib/net/https.rb: backported from trunk, rev 1.3.
-	  [ruby-dev:25673] (again), [ruby-dev:26617] (again),
-	  [ruby-dev:27062]
+	* ext/readline/readline.c (readline_getc): applied a patch in
+	  #3827 by by Akio Tajima <artonx AT yahoo.co.jp>. (see #3827)
 
-	* ext/openssl/lib/net/https.rb: removed.
+Tue Jun 21 13:16:31 2011  TAKAO Kouji  <kouji@takao7.net>
 
-	* ext/openssl/lib/net/protocols.rb: removed.
+	* ext/readline/extconf.rb: fixed bug, specify --disable-libedit
+	  then disable libedit, does not specify then check readline and
+	  libedit if failed checking readline. (fixes #3375)
 
-	* lib/net/http.rb: #use_ssl?, #use_ssl are moved from net/https.
+Mon Jun 20 22:52:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Sep 13 22:09:40 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* process.c (before_exec): use sig_do_nothing instead of SIG_DFL
+	  for avoiding a race.
+	* process.c (sig_do_nothing): new function.
 
-	* lib/logger.rb (Logger): added formatter accessor to logger for
-	  dictating the way in which the logger should format the messages it
-	  displays.  Thanks to Nicholas Seckar (cf. [ruby-talk:153391]) and
-	  Daniel Berger.
+Mon Jun 20 21:31:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/logger.rb (Logger): added VERSION constant.
+	* thread_pthread.c (thread_timer): rename timeout_10ms to
+	  time_quantum. it's no longer 10ms.
 
-	* lib/logger.rb: removed document for LogDevice. It is an
-	  implementation detail and is not a public interface.
+Mon Jun 20 18:46:02 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* test/logger/test_logger.rb: added tests.
+	* ext/openssl/ossl_cipher.c, ext/openssl/lib/openssl/cipher.rb:
+	  Documentation fix by Ippei Obayashi. See #4419.
 
-Tue Sep 13 21:47:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jun 20 15:41:33 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* eval.c (BEGIN_CALLARGS): pop halfly pushed status.
-	  fixed: [ruby-dev:26881]
+	* lib/webrick/cookie.rb (WEBrick::Cookie.parse): Revert r31228.
+	  r31228 was for allowing the 'Cookie:' header which did not have no
+	  SP after ';' for separating cookie-pairs but RFC6265 requires single
+	  SP after ';' there.  We allow multiple SPs here for compatibility
+	  with older WEBrick version.
 
-Tue Sep 13 16:26:45 2005  Minero Aoki  <aamine@loveruby.net>
+	* test/webrick/test_cookie.rb: Test it.
 
-	* lib/net/http.rb: backported from trunk, rev 1.128.
-	  [ruby-dev:25673] [ruby-dev:26617]
+Sun Jun 19 13:31:26 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/net/protocol.rb: backported from trunk, rev 1.78.
+	* NEWS: Introduce --hide-skip on test/unit.
 
-	* lib/net/protocol.rb: new method #old_open to support net/smtp
-	  and net/pop.
+Sun Jun 19 10:05:16 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/net/smtp.rb: use #old_open.
+	* lib/test/unit/parallel.rb: Override Test::Unit::TestCase#on_parallel_worker?
+	  only when $0 == __FILE__.
 
-	* lib/net/pop.rb: ditto.
+	* lib/test/unit/parallel.rb: Run Test::Unit::Worker.run only when
+	  $0 == __FILE__.
 
-Tue Sep 13 12:33:05 2005  why the lucky stiff  <why@ruby-lang.org>
+Sat Jun 18 23:59:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/yaml.rb: reworking YAML::Stream to use the new
-	  emitter.
+	* io.c (fill_cbuf): finish reading at EOF, and the readconv has
+	  been cleared by another thread while io_fillbuf() is waiting at
+	  select().  a patch in [ruby-core:37197] by Hiroshi Shirosaki
+	  <h.shirosaki AT gmail.com>.  fixed #3840
 
-	* lib/yaml/stream.rb: ditto.
+Sat Jun 18 21:36:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/yaml/rubytypes.rb: added Object#yaml_new.
+	* thread_pthread.c: remove GVL_DEBUG
 
-	* lib/yaml/tag.rb: the tag_subclasses? method now
-	  shows up in the class.  allow taguri to be set using an accessor.
-	  continue support of Object#to_yaml_type.
+Sat Jun 18 21:32:02 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/syck/rubyext.c: new emitter code.  yaml_new and yaml_initialize
-	  get called, should they be present.  consolidated all the diaspora of internal
-	  node types into the family below YAML::Syck::Node -- Map,
-	  Seq, Scalar -- all of whom are SyckNode structs pointing to
-	  Ruby data.  moved Object#yaml_new into the node_import and made it the
-	  default behavior.  the target_class is always called wih yaml_new, prepended
-	  a parameter, which is the klass.  loaded nodes through GenericResolver show their style.
-	  new Resolver#tagurize converts type ids to taguris.
+	* vm.c, vm_core.h (rb_vm_stack_to_heap): remove const.
+	  It makes compilations warnings.
 
-	* ext/syck/implicit.re: were 'y' and 'n' seriously omitted??
+Sat Jun 18 18:54:15 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/syck/emitter.c: renovated emitter, walks the tree in advance.
-	  consolidated redundant block_styles struct into
-	  the scalar_style struct.  (this means loaded nodes can now
-	  be sent back to emitter and preserve at least its very basic
-	  formatting.)
+	* vm.c, vm_core.h (rb_vm_stack_to_heap): fix "const" place.
 
-	* ext/syck/gram.c: headless documents of any kind allowed.
+Sat Jun 18 17:23:38 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/syck/node.c: new syck_replace_str methods and syck_empty_*
-	  methods for rewriting node contents, while keeping the ID
-	  and other setup info.  added syck_seq_assign.
+	* eval.c, hash.c, load.c, proc.c, range.c, thread.c, time.c: don't
+	  declare internal functions.
 
-	* ext/syck/syck.h: reflect block_styles and new node functions.
+	* internal.h, vm_core.h: declare internal functions.
 
-Mon Sep 12 20:53:06 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* array.c: include internal.h.
 
-	* test/openssl/test_pkcs7.rb (test_enveloped): skip this test
-	  to avoid a bug of PKCS7_enctypt() (only if ext/openssl is
-	  compiled with OpenSSL-0.9.7d or earlier versions).
-	  http://www.mail-archive.com/openssl-dev@openssl.org/msg17376.html
+	* common.mk: update dependency for array.o.
 
-Mon Sep 12 14:03:33 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jun 18 13:39:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* test/dbm/test_dbm.rb: remove locking test, which may not be
-	  supported on some platforms.  [ruby-dev:27030]
+	* internal.h: declarations declared in include/ruby/*.h removed.
 
-Mon Sep 12 10:45:58 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jun 18 12:42:17 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/dl/dl.c (rb_io_to_ptr): merged a patch for DragonFly BSD
-	  from Takahiro Kambe <taca at back-street.net>.  [ruby-dev:27023]
+	* method.h, internal.h iseq.h: declare internal functions.
 
-Sun Sep 11 22:05:51 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* compile.c, eval.c, iseq.c, object.c, parse.y, proc.c, process.c,
+	  thread.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c: don't
+	  declare internal functions.
 
-	* bin/erb (ERB::Main#run): set ERB#filename so that it is used
-	  when reporting syntax/runtime errors. Tabs converted to spaces.
+	  Note that rb_method_entry_eq() is defined in vm_method.c but
+	  there was a declaration in proc.c with different const-ness.
+	  Now it is declared in method.h with same const-ness to the
+	  definition.
 
-Sat Sep 10 10:17:03 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* object.c (rb_mod_module_exec): don't declare functions declared in
+	  include/ruby/intern.h.
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_by_id):
-	  OpenSSL::Engine.by_id calls given block before calling
-	  ENGINE_init (block parameter is the return value of this method
-	  itself).  this functionality is useful to load dynamic shared
-	  engines. the following code is a sample of loading a key using
-	  OpenSC PKCS #11 module.
+Sat Jun 18 12:05:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-		require "openssl"
-		pkcs11 = OpenSSL::Engine.by_id("dynamic"){|e|
-		  e.ctrl_cmd("SO_PATH", "/usr/lib/opensc/engine_pkcs11.so")
-		  e.ctrl_cmd("LIST_ADD", "1")
-		  e.ctrl_cmd("LOAD")
-		}
-		pkcs11.ctrl_cmd("PIN", "secret")
-		key = pkcs11.load_private_key
+	* include/ruby/backward/classext.h: for evil gems.  fixed #4803
 
-	* ext/openssl/ossl_engine.c (ossl_engine_ctrl_cmd): new method
-	  OpenSSL::Engine#ctrl_cmd. it wraps ENGINE_ctrl_cmd_string.
+Sat Jun 18 11:12:13 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_engine.c (ossl_engine_get_cmds): new method
-	  OpenSSL::Engine#cmds. it returms engine command definitions.
+	* common.mk: update dependencies.
 
-Sat Sep 10 10:09:47 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Jun 18 11:09:03 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_asn1.c (asn1str_to_str): new function.
+	* io.c: suppress warnings.
 
-	* ext/openssl/ossl_pkcs7.c: new class OpenSSL::PKCS7::RecipientInfo.
-	  this class wraps PKCS7_RECIP_INFO struct.
+Sat Jun 18 10:22:39 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_pkcs7.c: OpenSSL::PKCS7::Signer is renamed to
-	  OpenSSL::PKCS7::SignerInfo. ("Signer" remains as an alias of
-	  SignerInfo.)
+	* internal.h: declare more internal functions.
 
-	* test/openssl/test_pkcs7.rb: new file.
+	* iseq.h (rb_method_get_iseq): declared.
 
-Sat Sep 10 10:05:51 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* compile.c, eval.c, eval_error.c, iseq.c, parse.y, proc.c, range.c,
+	  ruby.c, time.c, util.c, vm.c: don't declare internal functions.
 
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): assume that
-	  the argument is a DER string if Base64 decoding failed.
+	* eval.c, parse.y, thread_pthread.c: non-existing function declarations
+	  removed.
 
-	* ext/openssl/ossl_ns_pki.c (ossl_spki_to_der): new method.
+Sat Jun 18 08:12:54 2011  Tanaka Akira  <akr@fsij.org>
 
-	* test/openssl/test_ns_spki.rb: add new file.
+	* common.mk: dependencies updated.
 
-Sat Sep 10 09:56:24 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* tool/update-deps: new file to assist update dependencies in
+	  common.mk.
 
-	* ext/openssl/lib/digest.rb: added SHA224, SHA256, SHA384 and SHA512.
-	  these features are enabled if this library is compiled with
-	  OpenSSL 0.9.8 or later.
+Sat Jun 18 07:27:27 2011  Tanaka Akira  <akr@fsij.org>
 
-	* test/openssl/test_digest.rb: add test for new digests.
+	* internal.h: declare internal functions here.
 
-Sat Sep 10 09:51:30 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* node.h: declare NODE dependent internal functions here.
 
-	* ext/openssl/ossl.c (ossl_raise): should use ERR_peek_last_error
-	  to get last error on the current thread. And should report
-	  errors on the stack while OpenSSL.debug is true.
+	* iseq.h: declare rb_iseq_t dependent internal functions here.
 
-	* ext/openssl/ossl.c (ossl_get_errors): new method for debugging
-	  this library.
+	* vm_core.h: declare rb_thread_t dependent internal functions here.
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): fix error message.
+	* bignum.c, class.c, compile.c, complex.c, cont.c, dir.c, encoding.c,
+	  enumerator.c, error.c, eval.c, file.c, gc.c, hash.c, inits.c, io.c,
+	  iseq.c, load.c, marshal.c, math.c, numeric.c, object.c, parse.y,
+	  proc.c, process.c, range.c, rational.c, re.c, ruby.c, string.c,
+	  thread.c, time.c, transcode.c, variable.c, vm.c,
+	  tool/compile_prelude.rb: don't declare internal functions declared
+	  in above headers.  include above headers if required.
 
-	* ext/openssl/ossl_x509req.c (ossl_x509req_set_attributes): get rid
-	  of unused variable.
+	  Note that rb_thread_mark() was declared as
+	  void rb_thread_mark(rb_thread_t *th) in cont.c but defined as
+	  void rb_thread_mark(void *ptr) in vm.c.  Now it is declared as
+	  the later in internal.h.
 
-	* ext/openssl/ossl_x509store.c (ossl_x509store_initialize): should
-	  set @time to avoid warning.
+Sat Jun 18 02:36:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths,
-	  X509_STORE_add_cert, X509_STORE_add_crl): should raise error if
-	  wrapped functions failed.
+	* ext/bigdecimal/bigdecimal.c (VpNewRbClass): fix type of the 2nd
+	  argument.
 
-	* test/openssl/test_x509store.rb: add test for errors.
+	* ext/bigdecimal/bigdecimal.h: ditto.
 
-Fri Sep  9 22:13:19 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jun 18 02:30:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* eval.c (rb_call0): prohibit calling tainted method (>2) when
-	  $SAFE == 0.
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_exp): move BigMath.exp from
+	  bigdecimal/math.rb.
 
-Fri Sep  9 16:45:25 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
 
-	* string.c (rb_str_times): make empty strings to keep taintness,
-	  and a little improvement.  [ruby-dev:26900]
+	* test/bigdecimal/test_bigdecimal.rb: move test for BigMath.exp from
+	  test/bigdecimal/test_bigmath.rb.
 
-	* ext/iconv/iconv.c (iconv_try), ext/iconv/extconf.rb: get rid of meta
-	  characters in command line option.  fixed: [ruby-talk:155369]
+	* test/bigdecimal/test_bigmath.rb: ditto.
 
-Thu Sep  8 14:58:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jun 18 00:20:54 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* merged a patch from Takahiro Kambe <taca at back-street.net> to
-	  support DragonFly BSD.  [ruby-dev:26984]
+	* ext/date/date_core.c: do not define wnum[01].
 
-Wed Sep  7 12:55:08 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jun 17 18:57:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/open-uri.rb: abolish mod === tempfile to avoid a problem
-	  [ruby-dev:26967].
+	* compile.c (iseq_compile_each): fix return value of obj[a,*b]=c.
 
-Wed Sep  7 10:45:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 17 13:09:45 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_thread_switch): convert all exceptions to
-	  SystemExit.  fixed: [ruby-core:05724]
+	* ext/curses/curses.c:  Clean up documentation.
 
-	* eval.c (rb_thread_terminated): show backtrace before propagate
-	  exceptions to main thread.
+Fri Jun 17 09:25:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Sep  7 08:35:04 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/curses/curses.c:  Document curses constants.  Patch by Vincent
+	  Batts.  [Ruby 1.9 - Bug #4880]
 
-	* Makefile.in, configure.in (MINIOBJS): miniruby on HP-UX can not load
-	  extension libraries.
+Fri Jun 17 09:11:05 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* bignum.c (bignew_1, bigadd): K&R style argument actually can't be
-	  defined as char.
+	* object.c:  Document Module#method_added and #method_removed.
+	  Patch by Bryce Kerley.  [Ruby 1.9 - Feature #4867]
 
-	* missing/vsnprintf.c: ANSI compiler supports const keyword.
+Fri Jun 17 08:50:16 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/digest/sha2/extconf.rb: reject platforms which has inttypes.h
-	  but no 64bit integer.
+	* io.c:  Improve documentation of IO and File open and new.
+	  Patch by Roger Pack.  [Ruby 1.9 - Bug #4790]
 
-	* lib/mkmf.rb (what_type?): guesstimate type.
+Fri Jun 17 07:53:50 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/etc/etc.c (setup_passwd), ext/etc/extconf.rb: pw_age might be
-	  char*.  fixed: [ruby-core:05470]
+	* lib/csv.rb:  Document #raw_encoding.  Patch by David Czarnecki.
+	  [Ruby 1.9 - Bug #4874]
 
-Wed Sep  7 08:32:47 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jun 17 07:46:50 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* object.c (rb_mod_cvar_get, rb_mod_cvar_set): document fix from
-	  sheepman <sheepman@sheepman.sakura.ne.jp>; a bug in visibility
-	  description.  [ruby-dev:26965]
+	* lib/benchmark.rb:  Document Benchmark::Tms#memberwise.  Patch by
+	  David Czarnecki.  [Ruby 1.9 - Bug #4873]
 
-	* sprintf.c (rb_f_sprintf): warn "too many argument" on verbose
-	  mode (-v/-w); backported from 1.9.  [ruby-dev:26963]
+Fri Jun 17 07:38:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Sep  5 17:03:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/prettyprint.rb:  Improve documentation.  Patch by Ysiad
+	  Ferreiras.  [#4834]
 
-	* lib/ostruct.rb: a patch from Florian Gross <florgro at gmail.com>
-	  merged to allow recursive inspect (and to_s) for OpenStruct.
-	  [ruby-core:05532]
+Fri Jun 17 07:23:03 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Sep  5 07:01:12 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* array.c (rb_ary_drop):  Improve documentation.  Patch by Caley Woods.
+	  [Ruby 1.9 - Bug #4858]
 
-	* ext/openssl/openssl/lib/openssl/buffering.rb (Buffering#do_write):
-	  should clear data from the buffer which already been output.
+Fri Jun 17 06:11:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Sep  2 23:51:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/log.rb:  Improve documentation of BasicLog and Log.
+	  Patch by Olivier Brisse.  [Ruby 1.9 - Bug #4833]
+	* lib/webrick/httpstatus.rb:  Improve documentation of
+	  WEBrick::HTTPStatus.  Patch by Olivier Brisse.
+	  [Ruby 1.9 - Bug #4833]
 
-	* lib: do not use __send__ to access private methods.  [ruby-dev:26935]
+Fri Jun 17 04:48:22 2011  Koichi Sasada  <ko1@atdot.net>
 
-Fri Sep  2 03:29:00 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
+	* thread_pthread.c, thread_pthread.h: remove unused variables.
+	  (native_thread_data_t::gvl_cond, native_thread_data_t::gvl_next)
 
-	* lib/irb/init.rb: make IRB -I option that is same befavior for ruby.
-	  [ruby-dev:26872], [ruby-dev: 26920]
+Thu Jun 16 14:32:31 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/irb/locale.rb: support to print help message when OS locale is
-	  ja_JP.utf-8. [ruby-dev:26872]
+	* time.c (rb_time_new): prevent overflow by "* 1000".
 
-Thu Sep  1 17:11:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jun 17 03:07:36 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_call0): wrong condition for $SAFE restoration.
+	* benchmark/bm_vm4_thread_create_join.rb,
+	  benchmark/bm_vm4_thread_mutex[1-3].rb: renamed to
+	  bm_thread_* (fix last rename).
 
-Thu Sep  1 14:12:45 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jun 17 02:26:47 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/multi-tk.rb: On Tcl8.5, MultiTkIp#invoke_hidden doesn't
-	  work (gives wrong order of arguments).
+	* thread_pthread.c (native_thread_create): fix debug message.
+	  (add last newline)
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#invoke_hidden_on_namespace
-	  to support '-namespace' option of 'interp invokehidden' command
-	  on Tcl8.5.
+Thu Jun 16 23:40:49 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Aug 31 14:43:15 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread.c (rb_thread_schedule_rec): fix {UN,}LIKELY macro misuse.
+	* gc.c (rb_newobj): ditto.
+	* vm_insnhelper.c (vm_method_search): ditto.
 
-	* win32/Makefile.sub (OPTFLAGS): default global optimization to
-	  disabled for all VC++ versions.  fixed: [ruby-dev:26897]
+Thu Jun 16 20:06:15 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Wed Aug 31 11:35:43 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/testunit/test_parallel.rb: Fix Regexp for test.
 
-	* test/gdbm/test_gdbm.rb (teardown): should remove GDBM temporary
-	  file.
+	* test/testunit/tests_for_parallel/test_third.rb: Use
+	  Test::Unit::TestCase#on_parallel_worker? for detecting worker.
 
-Wed Aug 31 10:30:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/test/unit/testcase.rb(Test::Unit::TestCase#on_parallel_worker?):
+	  New Method Test::Unit::TestCase#on_parallel_worker? returns true
+	  when a testcase is running on parallel worker.
+	* lib/test/unit/parallel.rb(Test::Unit::TestCase#on_parallel_worker?):
+	  ditto.
 
-	* process.c (proc_detach, proc_setmaxgroups): missing argument type
-	  declaration. (I recommend ANSI-style function)
+Thu Jun 16 19:27:12 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Tue Aug 30 23:20:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/test_securerandom.rb: Add testcase.  This testcase does NOT aim
+	  to test cryptographically strongness and randomness.  It includes
+	  the test for PID recycle issue of OpenSSL described in #4579 but
+	  it's disabled by default.
 
-	* eval.c (rb_rescue2): initialization miss.  fixed: [ruby-dev:26917]
+Thu Jun 16 17:55:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/mkmf.rb (xsystem, xpopen): no longer expand by Config.
+	* test/ruby/test_io.rb (TestIO#test_copy_stream_socket): fix
+	  test hanging up issue. Patch by CHIKANAGA Tomoyuki.
 
-	* lib/mkmf.rb (link_command, cc_command, cpp_command): expand
-	  variables at once, and quote hdrdir.  fixed: [ruby-core:05680]
+Thu Jun 16 15:17:39 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (libpathflag): quote paths.
+	* variable.c (const_missing):  Add simple example of const_missing.
+	  Patch by Anuj Dutta.  [Ruby 1.9 - Bug #4794]
 
-Tue Aug 30 19:34:27 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Jun 16 15:09:29 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/digest/md5/md5ossl.h, ext/digest/rmd160/rmd160ossl.h,
-	  ext/digest/sha1/sha1ossl.h: include <stddef.h> to avoid
-	  error in compilation with OpenSSL-0.9.8. [ruby-list:41068]
+	* lib/monitor.rb:  Improve documentation.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4823]
 
-Mon Aug 29 19:54:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jun 16 14:54:09 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rdoc/usage.rb: improper exceptions. [ruby-dev:26870]
+	* lib/webrick/utils.rb: Document WEBrick::Utils.  Patch by Olivier
+	  Brisse.  [Ruby 1.9 - Bug #4819]
 
-	* lib/rdoc/usage.rb: support the case when non-ruby code exists before
-	  shebang. (this is needed when ri.bat is executed on windows)
+Thu Jun 16 14:26:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Aug 29 17:48:17 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/webrick/httpservlet/erbhandler.rb:  Allow the ERB document to
+	  alter the content-type of the response.  [Ruby 1.9 - Bug #4685]
 
-	* eval.c (method_arity): should return proper arity value.
-	  [ruby-dev:26390]
+Thu Jun 16 14:15:47 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Aug 29 01:19:57 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/timeout.rb: Clarify timeout duration types.  Patch by Alf Mikula.
+	  [Ruby 1.9 - Bug #4791]
+	* lib/net/http.rb: ditto
 
-	* lib/time.rb (Time.parse): extract fractional seconds using
-	  Date._parse.  [ruby-talk:153859]
+Thu Jun 16 13:25:25 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Aug 27 20:20:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/rdoc*:  Import RDoc 3.7 release candidate
 
-	* ext/curses/curses.c ({curses,window}_clrtoeol): added. suggested
-	  by Reyn Vlietstra.
+Thu Jun 16 11:35:09 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/curses/curses.c: chtype in curses is not `char', rahter `long'.
-	  [ruby-Bugs:2298]
+	* lib/net/imap.rb (search_response): parses SEARCH responses from
+	  the Yahoo IMAP server correctly.  patched by Mark Nadig.  [Bug #4509]
 
-	* ext/curses/view.rb: String =~ String is deprecated.
+Thu Jun 16 09:12:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 24 10:53:28 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* fix for build on solaris 10.
 
-	* test/logger/test_logger.rb (test_shifting_size): should close log
-	  device before unlink, since some platform cannot unlink opened
-	  file.
+Thu Jun 16 09:08:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Aug 21 00:13:27 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/io/console/test_io_console.rb (TestIO_Console#test_sync):
+	  fix for daemon process.
 
-	* lib/wsdl/xmlSchema/importer.rb (WSDL::XMLSchema::Importer#fetch): add
-	  a workaround for importing an WSDL whose path begins with drive
-	  letter.  [ruby-dev:26242]
+Thu Jun 16 07:58:01 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Sat Aug 20 22:37:13 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/testunit/test_parallel.rb(test_ignore_tzero): Test for r32109.
 
-	* lib/logger.rb (write, shift_log?, shift_log): file shifting race
-	  condition bug fixed.  [ruby-dev:26764]
+	* test/testunit/tests_for_parallel/test_third.rb: Use another way to
+	  detect that test is running on worker. This fixes sometimes
+	  TestParallel failing.
 
-	* test/logger/test_logger.rb: tests.
+Thu Jun 16 07:20:06 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Fri Aug 19 18:13:39 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/test/unit.rb(Test::Unit::Runner#_run_parallel): Ignore -j0
+	  because it makes blocking forever by IO.select.
 
-	* lib/time.rb (Time.apply_offset): fix a problem with last day of
-	  month.  reported by Lucas Nussbaum.  [ruby-talk:152866]
+Thu Jun 16 03:08:11 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Aug 18 12:46:28 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/testunit/test_parallel.rb (TestParallel::TestParallelWorker#
+	  setup): now can run on Windows, probably.
 
-	* bcc32/Makefile.sub (COMMON_HEADERS): reverted 1.42.2.24.
-	  I misunderstood, bccwin32 on ruby_1_8 uses winsock2 originally.
-	  [ruby-dev:26806]
+	* test/testunit/test_parallel.rb (TestParallel::TestParallel#setup):
+	  ditto.
 
-	* win32/win32.h: include winsock2.h instead of winsock.h. (bcc32)
+Thu Jun 16 03:00:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Aug 17 23:58:05 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (do_select): Windows: no need to poll if select(2) is
+	  cancelable.
 
-	* object.c (rb_to_integer): argument constified.
+	* thread_win32.c (native_fd_select): new function to make select(2)
+	  cancelable.
 
-	* eval.c (terminate_process): take String message.
+	* thread_win32.c (rb_w32_check_interrupt): new function for checking
+	  interrupt.
 
-	* eval.c (rb_thread_switch): propagate the exception caused thread
-	  termination directly.  fixed: [ruby-core:05552]
+	* win32/win32.c (rb_w32_select_with_thread): new function. cancelable
+	  select(2).
 
-Wed Aug 17 00:05:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/win32.c (rb_w32_select): use above function internally.
 
-	* eval.c (rb_add_method): preserve safe level in the environment
-	  where a method is defined .
+Wed Jun 15 23:30:45 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_call0): restore preserved safe level in the method
-	  execution.
+	* gc.c: fix a regression by r31690 on AIX because AIX malloc
+	  return NULL if it's passed 0. But some caller don't expect it.
+	  patch by Yutaka Kanemoto. [ruby-dev:43779]
+	(vm_malloc_prepare): return calculated size.
+	(vm_xmalloc): use above result.
+	(vm_xcalloc): ditto.
 
-Mon Aug 15 00:38:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun 15 23:11:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_rescue2): reduce PUSH_TAG() as well as NODE_RESCUE.
-	  [ruby-dev:26800]
+	* thread.c: remove BLOCKING_REGION_CORE() macro. It's no longer used
+	  since r32022.
 
-	* range.c (range_check, range_init): reduce useless exceptions.
+Wed Jun 15 21:00:47 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Sat Aug 13 18:51:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/openssl/test_config.rb: execute based on the existence of the
+	  OpenSSL module.
 
-	* eval.c (rb_block_pass): distinguish current block from others.
-	  fixed: [ruby-dev:26274]
+Wed Jun 15 12:35:11 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/stringio/stringio.c (strio_set_string): disallow nil.
-	  http://www.rubyist.net/~nobu/t/20050811.html#c05
+	* test/ruby/test_io.rb (test_copy_stream_socket): wait a child process
+	  before SIGUSR1 handler is removed.
 
-Thu Aug 11 23:29:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/pathname/test_pathname.rb (define_assertion): use line number
+	  for test method names.
 
-	* ext/stringio/stringio.c: keep holding string after closed.
+Wed Jun 15 10:37:43 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Aug 11 13:01:48 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* file.c (rb_stat_rdev): use DEVT2NUM.
 
-	* lib/rss: fixed sort bug. [ruby-list:41018]
+	* file.c (rb_stat_rdev_major): ditto.
 
-	* lib/rss/1.0.rb (RSS::RDF::Channel#setup_maker_attributes):
-	  removed self.
+	* file.c (rb_stat_rdev_minor): ditto.
 
-	* lib/rss/maker/base.rb (RSS::Maker::ItemsBase#<=>): use #date
-	  instead of @date.
-	  (RSS::Maker::Base::self.def_array_element): added #size.
+Wed Jun 15 05:12:59 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* lib/rss/maker/1.0.rb
-	  (RSS::Maker::RSS10::Channel#to_rss,
-	   RSS::Maker::RSS10::Items::Item#to_rss): cleared dc_dates set
-	  upped by using #date.
+	* ext/tk/tcltklib.c (lib_eventloop_core): revert the last change (it's
+	  the part for ruby_1_8), and use rb_thread_check_ints() when RUBY_VM
+	  is defined.
 
-	* lib/rss/maker/dublincore.rb
-	  (RSS::Maker::ChannelBase, RSS::Maker::ItemsBase::ItemBase):
-	  fixed opposite alias.
+Wed Jun 15 04:42:47 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* test/rss/test_setup_maker_1.0.rb
-	  (RSS::TestSetupMaker10::test_setup_maker_items_sort): added some
-	  tests for RSS::Maker::ItemsBase#do_sort.
+	* benchmark/bm_vm3_thread_*.rb: renamed bm_vm3_thread_*.rb to
+	  benchmark/bm_vm_thread_*.rb.
 
-Wed Aug 10 10:29:40 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Jun 15 04:28:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk.rb: fix bug on handling __ruby2val_optkeys().
+	* benchmark/bm_vm4_thread_pass.rb: rename bm_vm4* to
+	  bm_vm_thread_*. suggested by ko1.
+	* benchmark/bm_vm4_pipe.rb: ditto.
+	* benchmark/bm_vm4_alive_check1.rb: ditto.
+	* benchmark/bm_vm4_pass_flood.rb: ditto.
 
-	* ext/tk/lib/tk/itemconfig.rb: fix bug on handling
-	  __item_ruby2val_optkeys().
+Wed Jun 15 03:52:50 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/canvas.rb: didn't check __item_ruby2val_optkeys().
+	* benchmark/bm_vm4_pass_flood.rb: new benchmark for GVL fairness.
+	* benchmark/bm_vm4_alive_check1.rb: ditto.
 
-	* ext/tk/lib/tkextlib/blt/component.rb: ditto.
+Wed Jun 15 01:27:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Aug  9 15:12:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c (gvl_yield): fix live lock issue on 1-2 cpus
+	  system. It's additional fix for r32021.
+	* thread_pthread.c (gvl_init): add switch_wait_cond.
+	* thread_pthread.h (typedef struct rb_global_vm_lock_struct): ditto.
 
-	* ext/tcltklib/tcltklib.c: remove dangerous 'rb_jump_tag's.
+Tue Jun 14 23:16:22 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk.rb: add __val2ruby_optkeys and __ruby2val_optkeys to
-	  help to convert option values between ruby and tcl.
+	* bootstraptest/runner.rb (show_progress): refine verbose mode.
+	  (exec_test): ditto.
 
-	* ext/tk/lib/tk/itemconfig.rb: add __item_val2ruby_optkeys and
-	  __item_ruby2val_optkeys to help to convert option values between
-	    ruby and tcl.
+Tue Jun 14 23:02:36 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk/radiobutton.rb: use __ruby2val_optkeys for 'variable'
-	  option (for the reason of backward compatibility).
+	* bootstraptest/runner.rb (show_progress): extracted from assert_check.
+	  (assert_check): use show_progress.
+	  (assert_normal_exit): ditto.
+	  (assert_finish): ditto.
+	  (flunk): ditto.
 
-	* ext/tk/lib/tk/composite.rb: clarify the arguments of super().
+Tue Jun 14 22:51:42 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/tk/spinbox.rb: ditto.
+	* test/date/test_*.rb: added tests.
 
-	* ext/tk/lib/tk/text.rb: ditto.
+Tue Jun 14 22:09:58 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/tk/validation.rb: ditto.
+	* ext/date/date_core.c: renamed some functions.
+	* ext/date/date_core.c: modified doc.
 
-	* ext/tk/lib/tkextlib/*: support to treat tkvariable-type
-	  configure options.
+Tue Jun 14 21:26:01 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Aug  9 20:30:19 2005  Tadashi Saito  <shiba@mail2.accsnet.ne.jp>
+	* cont.c (cont_save_thread): add new utility function.
+	  rb_context_t::saved_thread.machine_stack_start and
+	  machine_stack_end should be cleared immediately after a snapshot of
+	  current thread is stored to saved_thread. [ruby-dev:43680] [Bug #4855]
+	  this change aims to get rid of unnecessary GC mark at machine stack.
 
-	* bignum.c (rb_big_coerce): allow bignum x bignum coercing.
-	  [ruby-dev:26778]
+Tue Jun 14 19:50:49 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Aug  8 20:43:02 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/ruby/test_autoload.rb: remove temporary directory.
 
-	* test/ruby/test_method.rb: added.  [ruby-dev:26761]
+Tue Jun 14 11:05:03 2011  Narihiro Nakamura  <narihiro@netlab.jp>
 
-Sun Aug  7 23:50:14 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* gc.c (rb_gc_set_params): call initial_expand_heap if
+	  initial_heap_min_slots is set.
 
-	* test/ruby/test_super.rb: added from HEAD. [ruby-dev:26743]
+Tue Jun 14 11:02:08 2011  Narihiro Nakamura  <narihiro@netlab.jp>
 
-Sun Aug  7 01:31:15 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* gc.c: use size_t.
 
-	* ext/win32ole/win32ole.c (WIN32OLE_EVENT#on_event): should set
-	  only one event handler.
+Tue Jun 14 01:10:38 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* ext/win32ole/tests/testOLEEVENT.rb: ditto.
+	* test/coverage/test_coverage.rb: add a test for restart.  a patch
+	  from Xavier Shay.  [ruby-core:36745]
 
-	* ext/win32ole/tests/testOLEPARAM.rb: remove re-defined
-	  test_ole_type_detail method.
+Tue Jun 14 01:05:10 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Sat Aug  6 12:35:24 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/coverage/coverage.c: make it restartable.  [ruby-core:36539]
 
-	* ext/tk/lib/{tk.rb,tk/itemconfig.rb}: configure creates
-	  TkVariable if key name is 'variable' or 'textvariable'
-	  by default. [ruby-dev:26749]
+Mon Jun 13 23:55:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/{label,radiobutton}.rb: removed its own
-	  {variable,textvariable} function.
+	* thread.c (rb_thread_schedule_rec): call gvl_yield() unconditionally.
+	* thread_pthread.c: remove HAVE_GVL_YIELD macro.
+	* thread_win32.c (gvl_yield): new. this fallback logic was moved from
+	  rb_thread_schedule_rec().
 
-	* ext/tk/lib/tk/variable.rb: retains backward conpatibility.
+Mon Jun 13 23:50:25 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Aug  5 12:50:32 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/io/console/console.c (console_dev): typo.
 
-	* ext/tcltklib/tcltklib.c: fixed memory leak when tk_funcall raised
-	  exception. (copies argv into heap in tk_funcall instead of
-	  caller)
+Mon Jun 13 23:38:23 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug  5 12:42:57 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* parse.y (parser_parse_string): flush delayed token.  based on a
+	  patch by Masaya Tarui in [ruby-dev:43762].  Bug #4544
 
-	* lib/mkmf.rb (create_makefile): need to convert path separetor
-	  before invoking install command.
+	* parse.y (yylex): revert r24557.  delayed token at the end of
+	  string should be flushed already by the above change.
 
-Fri Aug  5 00:27:04 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Mon Jun 13 23:33:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: refactoring - extract ruby string <->
-	  tcl object conversion as get_str_from_obj and get_obj_from_str.
+	* ext/io/console/console.c (console_dev): console should be
+	  unbuffered.
 
-Fri Aug  5 00:19:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/io/console/console.c (console_dev): take care of no-ctty
+	  case.
 
-	* extmk.rb (extmake): needs to be wrapped in an Array.
+Mon Jun 13 23:06:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Aug  4 18:38:36 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c: rewrite GVL completely. This fix improve some
+	  benchmark dramatically (e.g. vm3_thread_mutex result changed
+	  form 120.601sec to 3.426sec).
+	* thread_win32.c: ditto.
+	* thread_pthread.h: ditto.
+	* vm_core.h: ditto.
+	* thread.c: ditto.
 
-	* ext/tcltklib/tcltklib.c: cannot compile for Tcl7.6/Tk4.2.
+Mon Jun 13 23:11:52 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tcltklib/tcltklib.c: add nativethread consistency check.
+	* test/socket/test_unix.rb: don't use Thread.abort_on_exception.
 
-	* ext/tcltklib/stubs.c: ditto.
+Mon Jun 13 23:05:01 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk.rb: forgot to define TclTkIp.encoding and encoding=
-	  when Tcl is 7.6 or 8.0.
+	* ext/socket/unixsocket.c (unix_send_io): race condition fixed.
+	  (unix_recv_io): ditto.
+	  fixed by Eric Wong.  [ruby-core:35574]
 
-	* ext/tk/lib/tk/wm.rb: support to make some methods as options of
-	  root or toplevel widget. [ruby-talk:150336]
+	* test/socket/test_unix.rb: test added for above problem.
 
-	* ext/tk/lib/tk/root.rb: ditto.
+Mon Jun 13 21:41:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/toplevel.rb: ditto.
+	* thread_win32.c (native_cond_signal): remove unnecessary rb_bug().
+	  It's additional fix for r32021. [Bug #4696]
 
-	* ext/tk/lib/tkextlib/SUPPRT_STATUS: update RELEASE_DATE
+Mon Jun 13 20:50:49 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Thu Aug  4 08:03:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/openssl/test_ec.rb
+	  test/openssl/test_pkey_ec.rb: merge both files into test_pkey_ec.rb.
+	  Removed redundant group instantiation from PKey tests.
+	* test/openssl/utils.rb: only create TEST_PKEY_EC_P256V1 if EC is
+	  defined.
 
-	* ext/extmk.rb (extmake): should not modify $mflags for each
-	  extentions.
+Mon Jun 13 20:28:24 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Thu Aug  4 00:25:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/openssl/digest.rb: remove MDC2 from test, it is not available
+	  by default in an OpenSSL installation.
 
-	* common.mk, Makefile.in, {bcc32,win32,wince}/Makefile.sub: integrated
-	  macro definitions.
+Mon Jun 13 20:18:55 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* bcc32/Makefile.sub: LIBRUBY_SO should use DLDOBJS, not EXTOBJS.
+	* vm_core.h, vm_insnhelper.h: move decl. of
+	  ruby_vm_global_state_version and related macros
+	  from vm_core.h to vm_insnhelper.h.
 
-	* {win32,wince}/Makefile.sub: separate config.h for compiler versions.
+	* vm.c (vm_clear_all_cache): added.  This function is called
+	  when ruby_vm_global_state_version overflows.
+	  TODO: vm_clear_all_inline_method_cache() is only place holder.
+	        We need to implement it ASAP.
 
-Wed Aug  3 21:59:16 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_method.c (vm_clear_global_method_cache): added.
 
-	* ext/tk/lib/tk/variable.rb: TkVariable#trace didn't work on
-	  TkVariable retrived from TkVariable.new_hash.ref. [ruby-dev:26721]
+Mon Jun 13 19:46:21 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-Wed Aug  3 08:22:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/cmath.rb: add new method Object#real?. fix #3137
 
-	* ext/socket/socket.c (ruby_connect): revert [ruby-talk:111654]
-	  changes at 2004-09-07.  [ruby-dev:26656]
+Mon Jun 13 18:52:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Tue Aug  2 10:20:54 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/bigdecimal/bigdecimal.c (is_kind_of_BigDecimal): new function to
+	  examine the whether the object is kind of BigDecimal.
 
-	* ext/tcltklib/tcltklib.c: use Tcl_[GS]etVar2Ex instead of
-	  Tcl_Obj[GS]etVar2. (avoid Tcl_NewStringObj on supported platforms)
+Mon Jun 13 18:49:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/tcltklib/tcltklib.c: use ip_{get,set,unset}_variable2_core from
-	  ip_{get,set,unset}_variable.
+	* ext/bigdecimal/bigdecimal.c (BigDecimalCmp): use GetVpValueWithPrec
+	  for Float and Rational arguments.
 
-	* ext/tcltklib/tcltklib.c: replaced Tcl_Panic with rb_bug.
+	* test/bigdecimal/test_bigdecimal.rb (test_new, test_cmp, test_power):
+	  add and modify tests for the above change.
 
-Tue Aug  2 01:41:28 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/bigdecimal/bigdecimal.c (BigDecimalCmp): modify coding style to
+	  match ruby's standard.
 
-	* lib/ping.rb (Ping.pingecho): should rescue StandardError.
-	  [ruby-dev:26677]
+Mon Jun 13 18:33:04 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Aug  1 19:09:41 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/securerandom.rb (SecureRandom.random_bytes): modify PRNG state
+	  to prevent random number sequence repetition at forked child
+	  process which has same pid.
+	  reported by Eric Wong.  [ruby-core:35765]
 
-	* ext/tcltklib/tcltklib.c: refactoring - replaced rb_ivar_defined &
-	  rb_ivar_get with single rb_attr_get call.
+Mon Jun 13 17:02:34 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Aug  1 18:45:07 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/net/http.rb (Net::HTTP#use_ssl?): require 'openssl' only when
+	  https is needed. fixes r31933.
 
-	* ext/tcltklib/tcltklib.c (Tcl_GetStringResult): refactoring - define
-	  alternative macro on Tcl7.x or earlier.
+Mon Jun 13 14:35:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Mon Aug  1 13:57:35 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/cmath.rb (CMath.cbrt): returns the principal value of the cube
+	  root of the argument.  fix #3676
 
-	* ext/tcltklib/tcltklib.c (deleted_ip): refactoring - interpreter
-	  deletion check. [ruby-dev:26664]
+	* test/test_cmath.rb (test_cbrt_returns_principal_value_of_cube_root):
+	  test for the above change.
 
-Mon Aug  1 01:17:40 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Mon Jun 13 14:17:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* lib/drb/drb.rb (check_insecure_method): use private_methods and
-	  protected_methods instead of respond_to? to check method visibility.
-	  [ruby-dev:26616]
+	* lib/test/unit.rb (Test::Unit::GlobOption#non_options): fix typo.
 
-	* test/drb/drbtest.rb: ditto.
+Mon Jun 13 13:04:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* test/drb/ut_drb.rb: ditto.
+	* ext/openssl/ossl_digest.c: fix error for digests that have no oid
+	(e.g. DSS1).
+	* test/openssl/test_digest.c: add tests for this.
 
-Mon Aug  1 00:07:32 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
-	* lib/irb/context.rb: fix `irb --readline` option. [ruby-list:40955]
+Mon Jun 13 12:51:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Jul 29 09:59:38 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/yaml.rb: load psych only when syck is not loaded.
 
-	* eval.c (rb_yield_0): push yielded node instead of yielding.
-	  fixed: [yarv-dev:549]
+Mon Jun 13 12:23:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Jul 28 18:09:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Jun 13 12:23:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/stubs.c: When --enable-tcltk-stubs, the initialize
-	  routine creates a Tcl/Tk interpreter and deletes it. However,
-	  init cost of Tk's MainWindow is not so small. And that makes it
-	  impossible to use libraries written with Tcl functions only on
-	  an environment without a graphical display. This changes support
-	  delaying initalization of Tk_Stubs until the script needs Tk.
+	* ext/psych/lib/psych/deprecated.rb (Object#to_yaml_properties):
+	  undef to_yaml_properties before redefine it.
 
-	* ext/tcltklib/stubs.h: New file. Define prototypes and return
-	  codes of functions on stubs.c.
+	* ext/syck/lib/syck/rubytypes.rb: ditto.
 
-	* ext/tcltklib/tcltklib.c: Support delaying initalization of
-	  Tk_Stubs until the script needs Tk.
+Mon Jun 13 11:30:10 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tcltklib/tcltklib.c: Show friendly error messages for errors
-	  on initialization.
+	* ext/openssl/ossl_digest.c: allow Digests to be created by sn, ln or
+	  oid.
+	* test/openssl/test_digest.rb: add tests for this.
+	  [Ruby 1.9 - Feature #4412] [ruby-core:35319]
 
-	* ext/tcltklib/tcltklib.c: Avoid SEGV on ip_finalize() when ruby is
-	  exiting and $DEBUG is true. (Not fix. If you know the reason of
-	  why, please fix it.)
+Mon Jun 13 10:54:03 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/tkutil.c (ary2list, ary2list2): bug fix on handling of
-	  encoding.
+	* ext/openssl/pkey_dh.c: corrected documentation.
+	* test/openssl/utils.rb: add test key for DH.
+	* test/openssl/test_pkey_dh.rb: add tests.
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
-	  don't work propery.
+Mon Jun 13 10:13:08 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/lib/tk.rb: Forget extending Tk::Encoding module to Tk.
-	* ext/tk/lib/tk/variable.rb: TkVarAccess fails to initialize the
-	  object for an element of a Tcl's array variable.
+	* ext/openssl/pkey_dh.c: clarify difference between DH#public_key and
+	DH#pub_key in documentation.
 
-Wed Jul 27 23:23:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun 13 05:50:43 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* gc.c (obj_free): make message format consistent with one from
-	  gc_mark().  [ruby-talk:149668]
+	* NEWS: introduce PKey.read.
 
-Wed Jul 27 22:11:37 2005  Kouhei Sutou  <kou@cozmixng.org>
+Mon Jun 13 05:17:29 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* sample/rss/tdiary_plugin: removed. because the plugin
-	  is imported in the tDiary plugin packages.
+	* ext/openssl/ossl_pkey.c: added PKey.read module function that allows
+	  reading arbitrary public/private keys from DER-/PEM-encoded File or
+	  string instances.
+	* ext/openssl/ossl_pkey_dh.c: improved documentation.
+	* test/openssl/utils.rb: added EC test key.
+	* test/openssl/test_pkey_rsa.rb
+	  test/openssl/test_pkey_dsa.rb: Test PKey.read. Reuse keys from
+	  OpenSSL::TestUtils.
+	* test/openssl/test_pkey_ec.rb: Created test file for EC tests.
+	  Test PKey.read.
+	  [Ruby 1.9 - Feature #4424] [ruby-core:35330]
 
-Wed Jul 27 10:59:02 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun 13 04:42:24 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* dir.c (dir_each): rewinddir(3) before iteration.
-	  [ruby-talk:149628]
+	* ext/objspace/objspace.c (total_i): fix to skip no ruby objects.
 
-Tue Jul 26 12:57:49 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Jun 13 03:07:38 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/openssl_missin.c: include <openssl/engine.h> before
-	  <openssl/x509_vfy.h> to avoid compilation error of mswin32.
-	  suggested by NAKAMURA Usaku.
+	* test/benchmark/test_benchmark.rb (capture_output):
+	  replace '-' as space. On NetBSD, subtract between two Process.times
+	  after and before the short process may return negative value like:
+	  t0=Process.times; yield; t1=Process.times; p t1.utime-t0.utime
 
-Mon Jul 25 21:30:46 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jun 13 02:40:23 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* {bcc32,win32,wince}/Makefile.sub: moved CPPFLAGS only for ruby
-	  source to XCFLAGS.
+	* test/openssl/test_pkey_dsa.rb: Test for DSA#syssign/sysverify.
 
-Mon Jul 25 13:45:18 2005  NAJIMA Hiroki  <najima@mickey.ai.kyutech.ac.jp>
+Mon Jun 13 01:59:19 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* io.c: check HAVE_SYS_IOCTL_H before including the header.
-	  [ruby-dev:26610]
+	* ext/openssl/ossl_pkey_dh.c: completed documentation.
+	* ext/openssl/ossl_pkey_dsa.c: corrected examples. Improved parameter
+	  sections.
 
-Mon Jul 25 14:10:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Jun 13 00:25:10 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/lib/multi-tk.rb: fix en-bugged part in the last commit.
+	* ext/openssl/ossl_pkey_dsa.c: completed documentation.
 
-Sat Jul 23 16:49:04 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Jun 12 23:36:46 2011  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should check
-	  OPENSSL_NO_STATIC_ENGINE.
+	* lib/drb/drb.rb (kill_sub_thread): remove the method. [ruby-core:34185]
 
-Fri Jul 22 21:06:08 2005  Tadashi Saito  <shiba@mail2.accsnet.ne.jp>
+Sun Jun 12 21:01:56 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* bignum.c (rb_big_eq): reduce isnan().  [ruby-dev:26600]
+	* ext/date/date_core.c (d_lite_marshal_load): should give converted value.
 
-	* numeric.c (flo_eq, flo_gt, flo_ge, flo_lt, flo_le): ditto.
+Sun Jun 12 20:36:30 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Jul 22 15:02:39 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/date/date_core.c: edited doc.
 
-	* lib/rss/rss.rb: moved copyright description to lib/rss.rb.
+Sun Jun 12 18:12:07 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss.rb: added for convenience.
+	* benchmark/bm_vm3_clearmethodcache.rb: added.
 
-	* sample/rss/re_read.rb: added #to_s sample.
+Sun Jun 12 17:40:29 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* sample/rss/blend.rb: use 'require "rss"' instead of
-	  'require "rss/*"'.
-	* sample/rss/list_description.rb: ditto.
-	* sample/rss/rss_recent.rb: ditto.
-	* sample/rss/tdiary-plugin/rss-recent.rb: ditto.
+	* vm_method.c (rb_clear_cache*): update only vm state version.
 
-	* sample/rss/tdiary-plugin/rss-recent.rb: 0.0.6 -> 0.0.7.
+	* vm_method.c (rb_method_entry_get_without_cache, rb_method_entry):
+	  Fill method cache entry with vm state version, and
+	  check current vm state version for method (cache) look up.
+	  This modification speed-up invalidating of global method cache table.
+	  [Ruby 1.9 - Feature #3905] [ruby-core:36908]
 
-Fri Jul 22 14:37:43 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sun Jun 12 16:19:48 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* lib/rss/parser.rb (RSS::Parser#initialize): accept HTTP/FTP
-	  URI and local file path too.
+	* ext/tk/extconf.rb: fail on Mac OS X. [Bug #4853][ruby-dev:43655]
 
-	* test/rss/test_parser.rb (RSS::TestParser#test_parse): test
-	  for the above.
+Sun Jun 12 15:56:08 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 22 07:01:42 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread.c: remove th->transition_for_lock. It's thread unsafe.
+	  [Bug #4723][ruby-dev:43563]
 
-	* ext/tk/tkutil.c (tk_conv_args): forget to revert thread_critical
-	  and gc_disable when raise ArgumentError.
+Sun Jun 12 15:47:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/remote-tk.rb: RemoteTkIp doesn't need to include TkUtil.
+	* thread.c: introduce spurious wakeup safe deadlock check.
+	  [Bug #4696][ruby-dev:43554]
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp#has_mainwindow? method.
+Sun Jun 12 13:33:52 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk.rb: add Tk.has_mainwindow? method.
+	* benchmark/bm_vm3_thread_mutex.rb: remove it.
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#has_mainwindow? method.
+	* benchmark/bm_vm3_thread_mutex[1-3].rb: added 3 benchmarks.
+	    1: one thread with one mutex (no contention).
+	    2: two threads with one mutex (contention).
+	    3: 1000 threads with one mutex (huge number of contention)
+	  Above removed benchmark was type 3.
+	  Therefore, this commit adds type 1 and 2 benchmark.
 
-	* ext/tk/lib/remote-tk.rb: add RemoteTkIp#has_mainwindow? method.
+Sun Jun 12 11:16:59 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/multi-tk.rb: slave IP fail to exit itself when $SAFE==4.
+	* io.c: use select() appropriately for sendfile().
+	  Fixed by Eric Wong.  [ruby-core:36150]
+	  (maygvl_copy_stream_wait_readwrite): removed.
+	  (nogvl_copy_stream_sendfile): use nogvl_copy_stream_wait_write and
+	  maygvl_copy_stream_wait_read instead of
+	  maygvl_copy_stream_wait_readwrite.
 
-	* ext/tk/lib/multi-tk.rb: remove constants from MultiTkIp module to
-	  avoid access from external.
+Sun Jun 12 09:32:13 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: check_root flag is ignored on slave IPs'
-	  mainloop.
+	* atomic.h (ATOMIC_OR): _InterlockedOr is not available on mingw.h
+	* gc.c (rb_gc_set_params): VM_OBJSPACE is disabled on mingw.
 
-	* ext/tk/lib/multi-tk.rb: hang-up Tk.mainloop called on a slave IP
-	  with $SAFE==4.
+Sun Jun 12 01:07:09 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#bg_eval_proc doesn't work
-	  properly.
+	* ext/date/date_core.c: edited doc.
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#set_cb_error(proc) and
-	  cb_error(exc) to log errors at callbacks on safe slave IPs.
+Sat Jun 11 23:18:00 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: fail to get an available slave IP object
-	  when call Tk.mainloop in the block which is given to new_* method,
-	    because cannot finish initialize while the root widget is alive.
+	* vm_core.h (RUBY_VM_SET_TIMER_INTERRUPT, RUBY_VM_SET_INTERRUPT,
+	  RUBY_VM_SET_FINALIZER_INTERRUPT): use atomic ops for preventing
+	  interrupt_flag bit lost. [Bug #4770][ruby-dev:43467]
+	* thread.c (rb_threadptr_execute_interrupts_rec): ditto.
+	* vm_core.h (typedef struct rb_thread_struct): change type of
+	  interrupt_flag to rb_atomic_t.
+	* atomic.h: move atomic ops definition from signal.c.
+	* signal.c: remove atomic ops definition.
+	* common.mk (gc, signal, thread, cont): add to dependency to atomic.h.
 
-	* ext/tk/lib/multi-tk.rb: fail to control a slave IP when Tk.mainloop
-	  runs on the IP.
+Sat Jun 11 23:23:52 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Jul 20 19:20:37 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/date/date_core.c: edited doc.
 
-	* io.c (S_ISREG): need to define S_ISREG before it is used first.
+Sat Jun 11 23:02:36 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Wed Jul 20 18:40:50 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/openssl/lib/openssl/buffering.rb (module OpenSSL):
+	  Buffering#each_byte should return String in accordance with IO in
+	  1.9.
 
-	* io.c (wsplit_p): patch for the environment where
-	  fcntl(F_GETFL, O_NONBLOCK) is not supported. in that case,
-	  set FMODE_WSPLIT without fcntl check. [ruby-dev:26566]
+	* test/openssl/test_buffering.rb (class OpenSSL): add tests for getc
+	  and each_byte.
 
-Wed Jul 20 18:07:11 2005  Tanaka Akira  <akr@m17n.org>
+Sat Jun 11 22:41:37 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* io.c (rb_io_ctl): update FMODE_WSPLIT_INITIALIZED and FMODE_WSPLIT
-	  by F_SETFL.
+	* time.c: a correction of doc for strftime (%v).
 
-Wed Jul 20 10:04:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jun 11 22:30:53 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* variable.c (rb_class_path): need to adjust snprintf() len for
-	  teminating NUL.  [ruby-dev:26581]
+	* ext/date/date_core.c: replaced doc for strftime based on Time's one.
 
-Wed Jul 20 04:01:55 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jun 11 22:07:56 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/socket/socket.c: sorry, BeOS also uses HAVE_CLOSESOCKET,
-	  so reverted.
+	* ext/date/date_core.c (datetime_s_{iso8601,rfc3339,xmlschema,rfc2822,httpdate}):
+	  do not take argument comp.
 
-	* ext/socket/extconf.rb: should not define HAVE_CLOSESOCKET
-	  on windows.
+Sat Jun 11 21:58:31 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Jul 20 03:16:43 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/date/date_core.c: added examples.
 
-	* ext/socket/socket.c: should not undef close() on win32.
-	  it's defined to rb_w32_close(), otherwise handle leaks.
-	  [ruby-Bugs-2131]
+Sat Jun 11 19:40:45 2011  Narihiro Nakamura  <authornari@gmail.com>
 
-Wed Jul 20 00:48:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c: expand heap if initial_heap_min_slots is bigger than
+	  HEAP_MIN_SLOTS.
 
-	* error.c (syserr_initialize): don't use str before StringValue()
-	  check.  [ruby-dev:26579]
+Sat Jun 11 19:42:50 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Tue Jul 19 22:47:29 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ChangeLog (vim): set shiftwidth to 2.
 
-	* error.c (syserr_initialize): add 1 byte for snprintf() size for
-	  NUL at the end.  [ruby-dev:26574]
+Sat Jun 11 19:27:06 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Tue Jul 19 16:39:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_x509req.c: raise RequestError instead of
+	  CertificateError when Request#to_der gets an error from OpenSSL.
+	  Patch from Ippei Obayashi, see #4420. I cannot write a test for
+	  this... Request does not allow to create broken bytes...
 
-	* io.c (rb_io_inspect): replace sprintf() with "%s" format all
-	  over the place by snprintf() to avoid integer overflow.
+Sat Jun 11 19:34:51 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Jul 19 14:08:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/date/date_core.c (Date::(ABBR_)?(MONTH|DAY)NAMES): should be usascii.
 
-	* ext/tcltklib/tcltklib.c: rbtk_eventloop_depth is used as int.
+Sat Jun 11 19:24:33 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tcltklib/tcltklib.c: rbtk_pending_exception is tested with
-	  NIL_P, so should assign Qnil instead of 0 (Qfalse).
+	* ext/date/date_core.c: rewrote doc.
 
-	* ext/tcltklib/tcltklib.c (ip_invoke_real): fixed memory leak when
-	  ip is deleted.
+Sat Jun 11 19:04:15 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 19 13:19:46 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/test/unit.rb (Test::Unit::GlobOption#non_options): should run
+	  with 1.8.
 
-	* ext/tk/lib/tk/variable.rb: For symmetry, add TkVariable#string. It
-	  returns a string even if the default value type of the TkVariable
-	  object is not "string".
+Sat Jun 11 18:05:57 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Mon Jul 18 21:40:20 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* bootstraptest/runner.rb: should initialize $stress to avoid warnings.
 
-	* eval.c (rb_call0): make the pointer to NODE volatile
-	  instead of NODE itself.
+Sat Jun 11 18:02:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jul 18 14:32:21 2005  Tanaka Akira  <akr@m17n.org>
+	* io.c (io_getc): should be 7bit if ascii.  fixes #4557
 
-	* eval.c (rb_call0): make body volatile to avoid optimization problem.
-	  [ruby-dev:26195]
+Sat Jun 11 16:52:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jul 18 12:23:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* numeric.c (rb_enc_uint_chr): fix message format. Bug#4869
 
-	* ext/io/wait/wait.c: wrong backport from trunk.  fixed: [ruby-dev:26562]
+Sat Jun 11 16:28:25 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon Jul 18 09:36:25 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/rexml/formatters/pretty.rb
+	  (REXML::Formatters::Pretty#write_text),
+	  test/rexml/test_core.rb
+	  (Tester#test_pretty_format_long_text_finite): don't ignore
+	  'width' parameter in pretty formatter. fixes #4498
+	  Reported by Michael Frasca. Thanks!!!
 
-	* rubyio.h (FMODE_WSPLIT, FMODE_WSPLIT_INITIALIZED): new constant.
+Sat Jun 11 16:11:36 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-	* io.c (wsplit_p): new function.
-	  (io_fwrite): split writing data by PIPE_BUF if wsplit_p is true in
-	  multi-threaded mode.
-	  [ruby-dev:26540]
+	* test/rexml/test_core.rb
+	  (Tester#test_pretty_format_long_text_finite): remove needless
+	  assert_nothing_raised.
 
-Sun Jul 17 13:46:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun 11 16:04:03 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/io/wait/extconf.rb, ext/io/wait/wait.c: Win32 platforms support.
+	* lib/rexml/parsers/xpathparser.rb
+	  (REXML::Parsers::XPathParser#parse),
+	  test/rexml/test_elements.rb
+	  (ElementsTester#test_each_with_frozen_condition):
+	  don't modify original XPath. fixes #4161
+	  Reported by Pavel Shved. Thanks!!!
 
-Fri Jul 15 23:59:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun 11 15:53:27 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-	* lib/rdoc/parsers/parse_c.rb (handle_class_module): handle a
-	  module enclosed in a built-in module.  fixed: [ruby-talk:148239]
+	* test/rexml/test_elements.rb (ElementsTester): remove needless
+	  prefix from test name.
 
-	* lib/rdoc/parsers/parse_c.rb (find_body): allow macros as methods.
+Sat Jun 11 15:36:36 2011  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* common.mk: fixed a grammatical error
 
-	* lib/rdoc/parsers/parse_c.rb (find_call_seq): allow :nodoc: modifier
-	  in C.  [ruby-core:04572]
+Sat Jun 11 14:20:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 15 18:00:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm.c (thread_memsize): don't ignore size of th->local_storage.
 
-	* bcc32/Makefile.sub (COMMON_HEADERS): ruby_1_8 is using winsock.h.
-	  failed to compile ext/socket on bcc5.6.4. [ruby-dev:26193]
+Sat Jun 11 10:32:46 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 15 07:58:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/mkmf.rb: should quote arch_hdrdir and libpath for the case
+	  installed prefix contains spaces.
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#accept_client):
-	  sockets should be non-blocking mode. [ruby-dev:26405]
+Sat Jun 11 10:20:52 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/utils.rb (WEBrick::Utils.set_non_blocking): new method.
+	* thread_pthread.c (native_cond_timeout): wrap conditionally used
+	  label.
 
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#read_chunked):
-	  should call sock.read repeatedly until the preferred size data
-	  is obtained.
+	* thread_pthread.c (native_sleep): remove unused variable.
 
-Thu Jul 14 18:27:16 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jun 11 10:15:50 2011  Tanaka Akira  <akr@fsij.org>
 
-	* win32/win32.c (rb_w32_strerror): should return correct message
-	  for ENAMETOOLONG and ENOTEMPTY. (bcc32) [ruby-dev:26533]
+	* thread.c (rb_thread_execute_interrupts): use GetThreadPtr to extract
+	  rb_thread_t from VALUE.
+	  reported by Motohiro KOSAKI.  [ruby-dev:43700]
 
-	* win32/win32.c (rb_w32_strerror): stripped CR LF on the tail.
-	  (bcc32) [ruby-dev:26533]
+Sat Jun 11 10:00:49 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 14 00:45:42 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (ruby_process_options): add missing return type.
 
-	* LEGAL (ext/nkf/nkf-utf8): updated from nkf1.7 to nkf-utf8.
+Fri Jun 10 23:18:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Jul 13 19:37:47 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/tk/tcltklib.c (lib_eventloop_core): replace CHECK_INTS with
+	  rb_thread_check_ints(). Because current code can't be compiled.
 
-	* win32/win32.c (rb_w32_mkdir): should set EEXIST (not EACCES)
-	  if file or directory already exists. (bcc32) [ruby-dev:26508]
+Fri Jun 10 16:38:13 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_rmdir): should set ENOTDIR (not EINVAL)
-	  if it is not directory. (bcc32, win32)
+	* encoding.c (rb_locale_charmap): When ruby process is run as Windows
+	  Service the console codepage is not set, GetConsoleCP returns 0.
+	  So on such environment, use GetACP().
+	  http://blogs.msdn.com/b/michkap/archive/2005/02/08/369197.aspx
+	  patched by Rafal Bigaj [ruby-core:36832] [Bug #4854]
 
-	* win32/win32.c (rb_w32_rmdir, rb_w32_unlink): restore
-	  FILE_ATTRIBUTE_READONLY flag on function failure.
+Fri Jun 10 14:34:24 2011  Koichi Sasada  <ko1@atdot.net>
 
-Wed Jul 13 12:40:00 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* common.mk: restore TESTRUN_SCRIPT to "$(srcdir)/test.rb".
+	  TESTRUN_SCRIPT is used by "make run", "make gdb" and so on.
 
-	* ext/tcltklib/tcltklib.c: TclTkLib.do_one_event doesn't work.
+Fri Jun 10 13:01:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: Tk.thread_update is available.
+	* test/ruby/test_module.rb (TestModule#remove_rake_mixins): remove all
+	  module related to Rake.
 
-Tue Jul 12 23:32:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 10 09:52:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb: keep curdir unexpanded.
+	* encoding.c:  Mention that Encoding.compatible? can work with more
+	  than just Strings.
 
-Mon Jul 11 08:31:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 10 02:25:53 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* regex.c (read_special): fix parsing backslashes following \c in
-	  regexp.  fixed: [ruby-dev:26500]
+	* ext/psych/lib/psych.rb: updating version to match released gem.
 
-Mon Jul 11 02:53:00 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Jun 10 01:06:29 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
-	  mistook in merging the patch of [ruby-dev:26235] at
-	  revision 1.4.2.6.
+	* ext/bigdecimal (BigDecimal_to_i): Integer#** may return flonum.
 
-Sun Jul 10 23:58:04 2005  Tanaka Akira  <akr@m17n.org>
+Fri Jun 10 00:35:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/pathname.rb (Pathname#unlink): try Dir.unlink first to
-	  avoid unlink a directory by root.
-	  cf. [ruby-dev:26237]
+	* complex.c (string_to_c_internal): uses rb_reg_nth_match;
+	* rational.c (string_to_r_internal): ditto.
 
-Sun Jul 11 05:18:17 2005  Michael Neumann  <mneumann@ruby-lang.org>
+Fri Jun 10 00:25:03 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/xmlrpc/server.rb (XMLRPC::Server): Switch from GServer over to
-	  WEBrick. This makes file lib/xmlrpc/httpserver.rb obsolete (at least it is
-		no further used by the XML-RPC library).
+	* gc.c: remove an unused declaration.
 
-Sun Jul 10 12:47:01 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 10 00:24:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/debug.rb (debug_command): added a deficient format specifier.
-	  fixed: [ruby-core:05419]
+	* rational.c (string_to_r): Rational#** may return flonum.
 
-Sat Jul  9 21:28:46 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Thu Jun  9 23:57:53 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/win32ole/win32ole.c (ole_method_dispid): convert dispid
-	  in Ruby and C by INT2NUM and NUM2INT.
+	* io.c: fix IO.copy_stream interrupt handling.
+	  based on the patch by Eric Wong.  [ruby-core:36156]
 
-	* ext/win32ole/win32ole.c (ole_invoke2): ditto.
+	* vm_core.h (rb_thread_call_with_gvl): don't declare here.
 
-	* ext/win32ole/test/testWIN32OLE.rb: ditto.
+	* thread.c: include internal.h.
+	  (rb_thread_execute_interrupts): new function.
 
-	* ext/win32ole/test/testOLEMETHOD.rb: ditto.
+	* internal.h (rb_thread_execute_interrupts): declared.
+	  (rb_thread_call_with_gvl): declared.
 
-Fri Jul  8 15:45:04 2005  Kouhei Sutou  <kou@cozmixng.org>
+Thu Jun  9 23:34:01 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.4 -> 0.1.5.
+	* gc.c (rb_objspace_call_finalizer): use rb_typeddata_is_kind_of() for
+	  type check to get rid of a double free when main Thread has singleton
+	  class. [ruby-core:36741] [Bug #4828]
+	* thread.c (rb_obj_is_mutex): add a new utility function.
+	* vm.c (rb_obj_is_thread): ditto.
 
-	* test/rss/test_version.rb (RSS::TestVersion#test_version):
-	  ditto.
+Thu Jun  9 22:53:49 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/rss/0.9.rb (RSS::Rss::Channel::Item::Category):
-	  domain attribute of <category> is optional. Thanks to
-	  Chris Lee <clee@kde.org>.
+	* test/ruby/test_thread.rb (TestThread#test_kill_thread_subclass):
+	  add test for Thread.kill with Thread subclass instance.
 
-	* test/rss/test_parser.rb (RSS::TestParser#test_category20):
-	  adjusted test case.
+Thu Jun  9 22:31:47 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Jul  5 23:44:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_thread.rb (TestThread#test_kill_wrong_argument):
+	  test for [ruby-core:35086].
+	  partially forward porting r31402 from ruby_1_9_2 branch.
 
-	* instruby.rb: expand source library path.
+Thu Jun  9 18:36:00 2011  Kenta Murata <mrkn@mrkn.jp>
 
-Tue Jul  5 23:27:14 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c: Fix the ambiguous description of the behavior of
+	  rb_str_aref_m with a range.  It returns nil when the beginning of
+	  the range is greater than the end of the string rather than the range.
 
-	* array.c (sort_2): get rid of yet another bcc's bug.
-	  fixed: [ruby-core:05152]
+Thu Jun  9 10:57:03 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* eval.c (rb_thread_save_context): must not switch contexts during
-	  re-allocating stack.  fixed: [ruby-core:05219]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Hash subclasses can be read
+	  from YAML files.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Hash subclasses can be
+	  dumped to YAML files.
+	* test/psych/test_hash.rb: corresponding test.
 
-Tue Jul  5 15:15:10 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jun  9 09:18:51 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/tkutil.c: fix typo.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Ruby modules can be loaded
+	  from YAML files.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby modules can be
+	  dumped to YAML files.
+	* test/psych/test_class.rb: corresponding test.
 
-Tue Jul  5 14:51:35 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jun  9 09:05:04 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tcltklib/tcltklib.c: bug fix on treating Unicode strings.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Ruby classes can be loaded
+	  from YAML files.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby classes can be
+	  dumped to YAML files.
+	* test/psych/test_class.rb: corresponding test.
 
-	* ext/tcltklib/tcltklib.c: add methods to treat encoding mode.
+Wed Jun  8 21:38:57 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/tcltklib/MANUAL.eng: add description of TclTkLib#encoding,
-	  encoding_system, and so on.
+	* cont.c (root_fiber_alloc): set root fiber's status RUNNING.
+	  in cont_mark() only RUNNING fiber's machine stack is marked.
+	  root fiber's status should be RUNNING at the beginning regardless of
+	  FIBER_USE_NATIVE. [ruby-core:36735] fixes #4827
 
-	* ext/tcltklib/MANUAL.euc: ditto.
+Tue Jun  7 20:50:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/tkutil.c: fail to create a Tcl's list string from an
-	  array including multiple kind of encoded strings.
+	* doc/irb/irb.rd: fix typo. patch by Nobuhiro IMAI.
+	  [Bug #4843] [ruby-dev:43639]
+	* doc/irb/irb.rd.ja: ditto.
+	* doc/ChangeLog-YARV: ditto.
 
-	* ext/tk/lib/tk.rb: ditto.
+Tue Jun  7 18:52:55 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: 2nd arg of _{to|from}UTF8 is omissible.
+	* lib/rubygems/user_interaction.rb (Gem::StreamUI#tty?): IO#tty? of
+	  Windows has been fixed at r29969.
 
-	* ext/tk/lib/remote-tk.rb: ditto.
+	* test/rubygems/test_gem_stream_ui.rb: now can run tests.
 
-	* ext/tk/lib/tk.rb: override TclTkLib#encoding and encoding= to
-	  use TkCore::INTERP.encoding and encoding=.
+Tue Jun  7 18:36:41 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: when "require 'tk'" and $KCODE=='NONE', check
-	  DEFAULT_TK_ENCODING to decide Ruby/Tk's system encoding mode.
+	* test/rubygems/test_gem.rb (TestGem#{test_self_user_home_userprofile,
+	  test_self_user_home_user_drive_and_path}): should simply ignore
+	  meaningless tests instead of skipping them.
 
-	* ext/tk/lib/tk/encodedstr.rb: check both of Tk.encoding and
-	  Tk.encoding_system. Tk.encoding has higher priority.
+Tue Jun  7 18:15:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/optiondb.rb: ditto.
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  should show some messages when skipping tests.
 
-	* ext/tk/lib/tk/spinbox.rb: ditto.
+Tue Jun  7 13:59:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/validation.rb: ditto.
+	* ext/date/date_core.c (date_s_today, datetime_s_now): check the
+	  result of localtime_r().
 
-	* ext/tk/lib/tk/namespace.rb: arguemnts for TclTkIp#_merge_tklist
-	  should be UTF-8 strings.
+Tue Jun  7 13:36:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jul  4 14:35:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/tk/extconf.rb: use $defs not $CPPFLAGS to get rid of
+	  command line escape issues on Windows.  fixed #4835.
 
-	* sample/svr.rb: service can be stopped by ill-behaved client; use
-	  tsvr.rb instead.
+Tue Jun  7 03:18:45 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Mon Jul  4 13:25:21 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#test_s_{,bin}write): do not create a
+	  file under /tmp. [Bug #4846]
 
-	* missing/erf.c: original erf.c by prof. Okumura is confirmed to
-	  be public domain.  reverted BSD implementation.
+Mon Jun  6 22:51:43 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Mon Jul  4 11:15:37 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* cont.c: use #if FIBER_USE_NATIVE instead of #ifdef.
+	  you can suppress use of setcontext for Fiber with compile option
+	  -DFIBER_USE_NATIVE=0
 
-	* test/{dbm,gdbm,sdbm}/test_{dbm,gdbm,sdbm}.rb: skip some tests
-	  which using fork on fork-less platforms.
+Mon Jun  6 21:59:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Jul  3 23:26:30 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/date/test_switch_hitter.rb: added a test.
 
-	* test/wsdl/document/test_rpc.rb: compare formatted time string of
-	  Time objects instead of comparing Time objects itself to avoid
-	  unintended conflict of usec part.  [ruby-dev:26220]
+Mon Jun  6 21:37:45 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sat Jul  2 22:41:04 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/date/date_core.c: added notes.
 
-	* ext/socket/socket.c (unix_send_io, unix_recv_io): support x86-64 and
-	  IA64.
+Mon Jun  6 21:02:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sat Jul  2 17:06:23 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/date/date_core.c: flattened format to strftimev.
+	* ext/date/date_core.c (date_strftime_internal): taints run.
 
-	* defines.h (FLUSH_REGISTER_WINDOWS): defined for IA64.
-	  (flush_register_windows): declare flush_register_windows.
+Mon Jun  6 15:10:17 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (flush_register_windows): new function.
+	* include/ruby/{defines,missing}.h (rb_infinity, rb_nan): move from
+	  defines.h to missing.h.  (couldn't use RUBY_EXTERN there.)
 
-Fri Jul  1 17:48:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun  6 14:35:48 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* bignum.c (get2comp): revert all prior changes, and calculate
-	  proper 2's complement for negative numbers.  backported from
-	  HEAD.
+	* test/rdoc/test_rdoc_markup_pre_process.rb (TestRDocMarkupPreProcess#
+	  {test_include_file,test_include_file_encoding_incompatible}): no
+	  need to write such workaround.  don't hide the bug of ruby. (and the
+	  bug is already fixed.)
 
-Fri Jul  1 15:50:12 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Jun  6 14:11:11 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* missing/erf.c: need to include some headers for some platforms.
+	* ext/date/date_core.c (valid_jd_sub): need to convert from VALUE to
+	  double.
 
-	* win32/win32.h (copysign, scalb): define for compatibility with
-	  other platforms. [ruby-dev:26430]
+	* ext/date/date_core.c (offset_to_sec): get rid of a compiler warning.
 
-Fri Jul  1 15:37:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun  6 14:09:08 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* missing/crypt.c: modified to make it compilable on platforms
-	  other than BSD.  [ruby-dev:26430]
+	* include/ruby/defines.h (rb_infinity, rb_nan): export for Windows.
 
-	* missing/erf.c: ditto.  code from <exp.c> merged.
+Mon Jun  6 10:54:45 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Fri Jul  1 12:44:56 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/test/unit.rb(Test::Unit::Runner#puke):
+	  Add overriding from MiniTest::Unit#puke. This reverts minitest's fix
+	  that skip messages are hidden when not verbose mode (-v option).
+	  To hide skip messages, use --hide-skip option instead.
 
-	* lib/open-uri.rb (OpenURI.open_http): refine post_connection_check
-	  call.
+Mon Jun  6 10:52:13 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Jul  1 11:34:08 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/net/http.rb: don't use autoload.
 
-	* missing/crypt.c: replaced with 4.4BSD version.
+Mon Jun  6 09:39:43 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* missing/erf.c: ditto.
+	* ext/psych/parser.c (parse): release event objects to plug memory
+	leak.  Thanks Mark J. Titorenko!
 
-	* missing/vsnprintf.c: removed the third provision from the old
-	  BSD license.  [ruby-core:05177]
+Sun Jun  5 23:26:15 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul  1 01:45:21 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c: remove rb_thread_stop_timer_thread function declaration.
+	  Instead, include vm_core.h.
+	* process.c: ditto.
 
-	* enum.c (enum_min, enum_max): must not return Qundef.
-	  fixed: [ruby-core:05299]
+Sun Jun  5 21:38:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul  1 00:18:40 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread_pthread.c (thread_timer): add to care a spurious wakeup.
+	  When native_cond_timedwait() return 0 by spurious wakeup, we
+	  don't have to neither 1) call timer_thread_function and 2)
+	  exit the timer thread.
 
-	* lib/delegate.rb (Delegator::respond_to): respond_to? must check
-	  destination object.  [ruby-talk:146894]
+Sun Jun  5 17:50:01 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Jun 30 19:00:21 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
-	* lib/irb/ruby-lex.rb (RubyLex::identify_number): alternative implements
-	  for [ruby-dev:26410]. And support a numeric form of 0d99999.
+	* ext/date/date_core.c (m_real_cwyear): new.  derived from m_cwyear.
+	* ext/date/date_strftime.c: trivial changes.
 
-Thu Jun 30 17:28:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jun  5 17:22:01 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* lib/irb/ruby-lex.rb (RubyLex::identify_number): should not treat
-	  plain zero as an octal number.  [ruby-dev:26410]
+	* ext/tk/config_list.in: add new options for tcltklib.
 
-Thu Jun 30 15:13:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jun  5 10:06:50 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (rb_eval): pre-evaluate argument for unambiguous
-	  evaluation order.  [ruby-dev:26383]
+	* ext/date/date_tmx.h: now does not place decoded data.  allows to
+	  access indirectly via functions on demand.
+	* ext/date/date_strftime.c: ditto.
+	* ext/date/date_core.c: ditto.
+	* ext/date/date_core.c ({d|dt}_lite_to_s): use strftime.
 
-Thu Jun 30 09:53:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jun  5 06:22:02 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/delegate.rb (Delegator::method_missing): forward unknown
-	  method to the destination.  suggested by
-	  <christophe.poucet@gmail.com>.  [ruby-talk:146776]
+	* NEWS: wrote about changes of date.
 
-Tue Jun 28 21:59:29 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Sat Jun  4 16:59:26 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* dir.c, eval.c, hash.c, process.c, ruby.c: avoid warning "unused
-	  variable" [ruby-dev:26387]
+	* ext/date/date_core.c (d_lite_inspect): changed the format.
+	* ext/date/date_core.c: refactoring and fixing some bugs.
 
-Sat Jun 25 17:15:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Jun  4 04:04:41 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_query): should
-	  discard if key=val pair is empty. patch from Gary Wright.
+	* test/rubygems/test_gem_commands_which_command.rb:
+	  "missing" exists on ruby's top source directory. [Bug #4815]
 
-Sat Jun 25 23:30:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jun  3 21:48:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c (detach_process_watcher): terminate process watcher
-	  thread right after rb_waitpid() succeed.  [ruby-talk:146430]
+	* lib/rubygems/test_case.rb: Refix for test-all in separate directory.
+	  r31147 + r31151.
 
-Sat Jun 25 15:49:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun  3 20:58:47 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* enum.c (enum_min, enum_max): do not ignore nil as the first element.
+	* ext/date/date_core.c (d_lite_plus): get rid of compiler warnings.
 
-Sat Jun 25 14:40:17 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri Jun  3 20:56:40 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/sdbm/init.c (fsdbm_select): SDBM#select had returned the array
-	  which contained each elements twice. [ruby-dev:26358]
+	* include/ruby/missing.h, numeric.c (round): moved prototype of round()
+	  from numeric.c to missing.h.  (note: round() is C99 feature, so ruby
+	  provides it if not exist in C runtime.)
 
-Fri Jun 25 05:06:47 2005  Michael Neumann  <mneumann@ruby-lang.org>
+Fri Jun  3 20:42:04 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/xmlrpc/*, test/xmlrpc/*: backported changes from HEAD into 1.8
+	* lib/test/unit/parallel.rb: Keep $stdin, $stdout before run testcase
+	  and restore after run. Because some test break $stdin, $stdout.
+	  Fixes [Bug #4433] [ruby-core:35353]
 
-Fri Jun 24 17:00:00 2005  Shigeo Kobayashi  <shigeo@tinyforest.jp>
+Fri Jun  3 19:58:14 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/bigdecimal/bigdecimal.c: patch from "NATORI Shin"
-	  (u-tokyo.ac.jp) applied to fix rounding bug.
+	* io.c (io_fflush): windows -- call fsync() only when the FD is tied to
+	  file, because if the FD is pipe, it blocks.
 
-Fri Jun 24 13:06:45 2005  akira yamada  <akira@ruby-lang.org>
+Fri Jun  3 09:27:31 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/uri/common.rb, lib/uri/generic.rb: fixed typo in documents and
-	  replaced some existent domain name with "example.com".
+	* lib/net/http.rb (URI::HTTP#request_uri): return nil when the uri
+	  is path-rootless form. Bug #4759
 
-Fri Jun 24 12:23:19 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jun  2 23:51:03 2011  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: fix typo on Tk.grid_propagate.
+	* lib/csv.rb: Improve the line ending detection algorithm
+	  patch by Alexey).
 
-	* ext/tk/lib/tk.rb: Tk.event_generate and TkWindow#event_generate
-	  accept TkEvent::Event object as context argument.
+Thu Jun  2 20:05:57 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/event.rb: add TkEvent::Event#valid_fields and
-	  valid_for_generate to get field parameters of event_generate.
+	* io.c (rb_io_s_write, rb_io_s_binwrite): return!!!
 
-Thu Jun 23 23:55:59 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun  2 16:29:34 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* runruby.rb: should load built rbconfig.rb.
+	* io.c: Add File.write, File.binwrite. [Feature #1081] [ruby-core:21701]
 
-Thu Jun 23 16:53:15 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/ruby/test_io.rb: Test for File.write, File.binwrite.
 
-	* ext/tk/lib/tk/canvastag.rb: TkcGroup.new cannot include given items.
-	  TkcGroup#exclude calls wrong method.
-	  Add alias TkcGroup#add [ruby-talk:146049].
+	* NEWS: News for above.
 
-	* ext/tk/lib/tk/canvas.rb: TkCanvas#dtag and some subcommands of
-	  TkCanvas#addtag fail to treat a TkcTag argument.
+Thu Jun  2 12:33:09 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/event.rb: add TkEvent::Event#generate to help to send
-	  current event to other widgets.
+	* io.c (io_fflush, rb_io_flush): need to fsync() when ruby calls
+	  internal flush. [ruby-core:36670] [Bug #4813]
 
-Mon Jun 20 18:44:04 2005  Tanaka Akira  <akr@m17n.org>
+Thu Jun  2 07:56:24 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): DUMMY_SETJMP is replaced
-	  because setjmp is not enough to fix getcontext and SPARC register
-	  window problem.
+	* ext/tk/tcltklib.c: reduce CPU power required by an eventloop.
 
-Mon Jun 20 16:48:36 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue May 31 21:28:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/dbm/dbm.c (fdbm_closed): new method DBM#closed?
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
+	  redirect stderr to null device.
 
-	* ext/gdbm/gdbm.c (fgdbm_closed): new method GDBM#closed?
+Thu Jun  2 00:45:26 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/sdbm/init.c (fsdbm_closed): new method SDBM#closed?
+	* ext/tk/extconf.rb: fix for uninitialized global variables.
+	  [Ruby 1.9 - Bug #4811]
 
-	* test/dbm/test_dbm.rb, test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb
-	  (teardown): close all db objects before deleting data files.
+Wed Jun  1 21:57:08 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* win32/win32.{ch} (unlink): hook runtime function to change
-	  file attribute before unlinking.
-	  fixed: [ruby-dev:26360]
+	* thread_pthread.c (native_sleep): fix 1000times calculation error.
+	  this is a regression since r31457. [Bug #4808] [ruby-dev:43606]
 
-Mon Jun 20 02:15:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun  1 17:19:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* gc.c (define_final): document fix: finalizers never get called
-	  before target object is destroyed.
+	* thread_pthread.c: remove unused macro.
 
-Mon Jun 20 01:26:49 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Jun  1 15:42:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/openssl_missing.c, ext/openssl/ossl.h,
-	  ext/openssl/ossl_asn1.c, ext/openssl/ossl_bio.c,
-	  ext/openssl/ossl_pkcs12.h, ext/openssl/ossl_x509req.c: avoid
-	  compiler warnings. suggested by Michal Rokos.
+	* parse.y (peek_n): new macro to see next nth char.
 
-Sun Jun 19 14:09:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun  1 15:40:46 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (run_final): reduce unnecessary object allocation during
-	  finalization.
+	* tool/rbinstall.rb (gem): fix for rubygems change.
 
-	* gc.c (rb_gc_call_finalizer_at_exit): deferred finalizers list should
-	  be cleared before calling them.  fixed: [ruby-talk:145790]
+Wed Jun  1 14:07:57 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Fri Jun 17 13:01:40 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/minitest/*: Imported minitest 2.2.2 (r6281)
+	* test/minitest/*: ditto
 
-	* lib/time.rb (Time.parse): fix previous leap seconds support.
-	  (Time.rfc2822): ditto.
-	  (Time.xmlschema): ditto.
+Wed Jun  1 12:35:50 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Thu Jun 16 15:06:55 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/rubygems*: Import rubygems 1.8.5 (released @ 137c80f)
+	* test/rubygems: Ditto
 
-	* ext/tcltklib/tcltklib.c (ip_rb_threadVwaitCommand): Tcl_Release
-	  was missing.
+Wed Jun  1 12:34:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Jun 16 13:34:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* NEWS: add new features of bigdecimal.
 
-	* ext/tk/lib/tk.rb: add Tk.getMultiple{Open|Save}File() which return
-	  an Array of selected files.
+Wed Jun  1 09:41:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Jun 16 12:53:24 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/cgi/util.rb:  Improve documentation.  Patch by Kuba Fietkiewicz.
+	  [Ruby 1.9 - Bug #4775]
+	* lib/cgi/core.rb:  ditto
 
-	* lib/time.rb (Time.parse): "Fri Jan  1 08:59:60 +0900 1999" was
-	  parsed as "Fri Jan 01 09:00:00 JST 1999" even on an environment
-	  which supports leap seconds.
-	  (Time.rfc2822): ditto.
-	  (Time.xmlschema): ditto.
+Wed Jun  1 09:26:05 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Jun 16 08:29:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/mathn.rb:  Improve documentation and attach it to Numeric.
+	  Modified from patch by Anil V.  [Ruby 1.9 - Bug #4762]
 
-	* ext/dl/sym.c (rb_dlsym_call): needs FREE_ARGS before return.
-	  fixed memory leak. [ruby-Bugs-2034]
+Wed Jun  1 09:21:30 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Jun 15 18:26:39 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/prime.rb:  Indent examples enough to appear as code sections.
+	  Note that Prime is Enumerable.  [#4762]
 
-	* ext/tk/lib/tk.rb: support "tk inactive" sub-command [for Tcl/Tk8.5a3]
+Wed Jun  1 07:34:57 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/namespace.rb: support "namespace path" sub-command and
-	  'namespace ensemble' sub-command [for Tcl/Tk8.5a3]
+	* hash.c (key_i):  Change rdoc from "the first occurrence" to "an
+	  occurrence" since first occurrence is not a specification of
+	  Hash#key.  [Ruby 1.9 - Bug #4760]
 
-Tue Jun 14 02:02:43 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Jun  1 07:26:19 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/tkutil.c: add TkUtil::CallbackSubst.subst_arg(m, ...) &
-	  _define_attribute_aliases(hash) to get substitution-argument from
-	  attributes (e.g. subst_arg(:x,:y,:num,:button) --> "%x %y %b %b ").
+	* ext/pty/pty.c (pty_check):  Restore "not reached" comment.
+	  [Ruby 1.9 - Bug #4756]
 
-	* ext/tk/lib/tk/event.rb: use _define_attribute_aliases().
+Wed Jun  1 07:21:40 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Jun 13 13:01:05 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/zlib/zlib.c:  Fix document-method declarations for set_sync and
+	  set_comment.  [Ruby 1.9 - Bug #4695]
 
-	* hash.c (ruby_setenv): fixed SEGV. [ruby-dev:26186]
+Wed Jun  1 06:43:13 2011  Masaya Tarui  <tarui@ruby-lang.org>
 
-Mon Jun 13 01:54:20 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* load.c (loaded_feature_path): cut nonsense loop execution to fix
+	  performance bug.
 
-	* signal.c (sigexit): call rb_thread_signal_exit() instead of
-	  rb_exit().  [ruby-dev:26347]
+Wed Jun  1 01:16:02 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_signal_exit): a new function to exit on main
-	  thread.
+	* class.c (rb_mix_module): implement Module#mix.
 
-	* eval.c (rb_thread_switch): exit status should be retrieved from
-	  ruby_errinfo.
+Wed Jun  1 01:15:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_f_exit): ensure exit(0) should call
-	  exit(EXIT_SUCCESS).
+	* io.c (io_encoding_set): should honor already set ecflags since it
+	  might be set by mode option.  fixed #4804
 
-Mon Jun 13 01:20:02 2005  Tanaka Akira  <akr@m17n.org>
+Wed Jun  1 00:34:04 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* eval.c (rb_gc_mark_threads): curr_thread may not be part of the
-	  thread list.  [ruby-dev:26312]
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): remove unused
+	  variable.
 
-Fri Jun 10 23:35:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jun  1 00:32:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* missing/mkdir.c: remove. [ruby-core:05177]
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): support instantiation from
+	  a Float through Rational.
 
-Fri Jun 10 22:54:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_new): ditto.
 
-	* missing.h: fd_set stuffs need sys/types.h.  fixed: [ruby-core:05179]
+	* test/bigdecimal/test_bigdecimal.rb (test_global_new_float): add a test for
+	  the above changes.
 
-Thu Jun  9 23:58:12 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/bigdecimal/test_bigdecimal.rb (test_new_with_float): ditto.
 
-	* ext/Win32API/Win32API.c (Win32API_Call): disable global
-	  optimization. fixed: [ruby-core:05143]
+Wed Jun  1 00:07:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Jun  9 23:35:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_coerce): support coerce with a
+	  Rational.  The precision used for instantiate a BigDecimal from the
+	  given Rational is obtained from the receiver BigDecimal.
 
-	* enum.c (enum_inject): default the result value to Qundef to use
-	  first element as initial value if not given.
+	* test/bigdecimal/test_bigdecimal.rb (test_coerce): add a test for the
+	  above change.
 
-Thu Jun  9 19:55:41 2005  Tanaka Akira  <akr@m17n.org>
+Tue May 31 23:49:08 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (ruby_longjmp): new macro to call longjmp, setcontext, etc.
-	  (ruby_setjmp): new macro to call setjmp, getcontext, etc.
-	  (ruby_setjmp): call setjmp before getcontext to avoid IA64 register
-	  stack problem.
-	  [ruby-talk:144939]
+	* ext/date/date_core.c (offset_to_sec): fixed invalid validation.
 
-	* gc.c (Init_stack): remove IA64_MAGIC_STACK_LIMIT.
+Tue May 31 23:43:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Jun  9 11:55:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): replace the algorithm for
+	  coercing from a Rational to stop requiring "bigdecimal/util.rb".
+	  [ruby-core:34318]
 
-	* lib/delegate.rb (SimpleDelegator::__setobj__): need check for
-	  recursive delegation.  [ruby-core:04940]
+	* ext/bigdecimal/bigdecimal.c (GetVpValue): refactoring.
 
-Wed Jun  8 18:47:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation from a
+	  Rational.
 
-	* misc/ruby-mode.el (ruby-expr-beg): fix looking point drift.
+	* test/bigdecimal/test_bigdecimal.rb (test_global_new_with_rational): add a
+	  test for the above change.
 
-Wed Jun  8 11:11:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/bigdecimal/test_bigdecimal.rb (test_new_with_rational): ditto.
 
-	* bignum.c (get2comp): calculate proper 2's complement for
-	  negative numbers.  a bug in normalizing negative numbers
-	  reported from Honda Hiroki <hhonda@ipflex.com>.
+Tue May 31 22:44:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Jun  8 08:33:10 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation a
+	  BigDecimal object from an Integer.
 
-	* enum.c (enum_min_by, enum_max_by): return nil if no iteration.
-	  fixed: [ruby-dev:26245]
+	* test/bigdecimal/test_bigdecimal.rb (test_new_with_integer):
+	  add for testing the above change.
 
-	* eval.c (rb_need_block): ensure a block is given.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_global_new): replace its body
+	  with a BigDecimal_new call.
 
-	* eval.c (backtrace): skip successive frames sharing same node.
+	* test/bigdecimal/test_bigdecimal.rb (test_global_new_with_integer):
+	  add for testing the above change.
 
-Wed Jun  8 00:15:08 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue May 31 22:24:39 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/socket/socket.c (ruby_getaddrinfo__aix): merged a patch from
-	  KUBO Takehiro <kubo at jiubao.org> to support AIX.  [ruby-list:40832]
+	* ext/date/date_core.c: use simple/complex mode instead of light/right mode.
+	* test/date/*.rb: followed the above changes.
 
-Wed Jun  8 00:09:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue May 31 21:28:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/yaml/rubytypes.rb (Array::to_yaml): merged a patch from
-	  Tilman Sauerbeck <tilman at code-monkey.de>.  [ruby-core:05055]
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
+	  initialize SIGINT handler.
 
-	* lib/yaml/rubytypes.rb (Hash::to_yaml): ditto.
+Tue May 31 17:03:24 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Wed Jun  8 00:00:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/net/http.rb, lib/net/protocol.rb: Allow to configure to wait
+	  server returning '100 continue' response before sending HTTP request
+	  body. See NEWS for more detail. See #3622.
+	  Original patch is made by Eric Hodel <drbrain@segment7.net>.
 
-	* ext/curses/curses.c (curses_insertln): merged a patch from
-	  TAKAHASHI Tamotsu <ttakah at lapis.plala.or.jp>.  [ruby-ext:02305]
+	* test/net/http/test_http.rb: test it.
 
-Tue Jun  7 19:34:15 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* NEWS: Add new feature.
 
-	* lib/irb/init.rb (IRB::IRB.rc_file_generators): more flexible
-	  IRB.rc_file_generators.  [ruby-core:05163]
+Tue May 31 14:17:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jun  7 18:39:31 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (rb_io_s_pipe): potential bug. the mode of read IO is set as
+	  DEFAULT_TEXTMODE in call of io_set_encoding(), and of write IO is
+	  also set as it in call of io_new_instance() via rb_protect().
+	  so, if DEFAULT_TEXTMODE is not 0, we should check the result of
+	  extract_binmode() and avoid crush of default IO mode and the result.
 
-	* lib/thread.rb: RDoc documentation from Eric Hodel
-	  <drbrain at segment7.net> added.  [ruby-core:05148]
+Tue May 31 13:00:17 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Tue Jun  7 18:30:04 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* strftime.c (rb_strftime_with_timespec): improved style consistency.
+	  constified some variables.
 
-	* lib/mkmf.rb (create_makefile): add .SUFFIXES from depend file.
-	  fixed: [ruby-dev:26294]
+	* test/test_time.rb (TestTime#test_huge_precision): test for #4456.
 
-Tue Jun  7 17:39:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue May 31 12:53:10 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* object.c (rb_mod_cvar_get): Module#class_variable_get(): back
-	  ported from CVS HEAD.  [ruby-talk:144741]
+	* test/io/wait/test_io_wait.rb (TestIOWait#{test_nread,test_ready?,
+	  test_wait}: give system some time to process the written data.
 
-	* object.c (rb_mod_cvar_set): Module#class_variable_set().
-	  [ruby-talk:144741]
+Tue May 31 12:40:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jun  7 16:32:53 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#test_open_mode): MUST release resources
+	  explicitly. fix problem of r31671
 
-	* sprintf.c (rb_f_sprintf): raise exception on debug mode (-d),
-	  not verbose mode (-v/-w).  [ruby-core:05123]
+Tue May 31 10:49:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Jun  7 10:30:49 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_exec.c: remove conditions for clang
+	  because clang version 3.0 (trunk 132165) doesn't need them.
 
-	* ext/tk/lib/multi-tk.rb: slave-ip fails to call procedures
-	  delegated by master-ip.
+Mon May 30 22:19:33 2011  Tanaka Akira  <akr@fsij.org>
 
-Sun Jun  5 23:00:35 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring): don't
+	  close stderr.
 
-	* ext/tk/lib/tk/console.rb: create console when required
+Mon May 30 20:22:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/sample/tkextlib/tile/demo.rb: fix TypeError & create Console
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring): small
+	  but critical typo of r31642.  sorry...
+	  [Bug #4798] [ruby-core:36550]
 
-Sat Jun  4 14:55:18 2005  Tanaka Akira  <akr@m17n.org>
+Mon May 30 15:44:16 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/dbm/test_dbm.rb: merged from ext/dbm/testdbm.rb.
+	* insns.def (opt_mult): as r31805, volatile it.
+	  Without this, clang -O fails calculation.
 
-	* test/gdbm/test_gdbm.rb: merged from ext/gdbm/testgdbm.rb.
+	* numeric.c (fix_mul): ditto.
 
-	* test/sdbm/test_sdbm.rb: renamed from ext/sdbm/testsdbm.rb with
-	  modification to use test/unit.
+	* rational.c (f_imul): ditto.
 
-Fri Jun  3 14:06:12 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon May 30 10:26:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: fix typo.
+	* numeric.c (int_pow): make sure to assign the result of x * z.
+	  If xz is optimized out, the value won't overflow.
 
-Wed Jun  1 11:32:42 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun May 29 23:17:29 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* bcc32/Makefile.sub: can use single quote character in DESTDIR.
-	  [ruby-dev:26205]
+	* re.c (rb_reg_match): fix rdoc of Regexp#=~.
+	  patched by Tsuyoshi Sawada. [Bug #4781]
 
-Mon May 30 23:48:29 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun May 29 23:10:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/macpkg.rb: add PACKAGE_NAME information of Tcl/Tk
-	  Extension.
+	* lib/webrick/https.rb (WEBrick::HTTPRequest#parse_uri):
+	  keep parse_uri as private. patched by okkez. [Bug #4773]
 
-	* ext/tk/lib/tk/msgcat.rb: ditto.
+Sun May 29 17:53:03 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/tk/lib/tk/winpkg.rb: ditto.
+	* numeric.c: add #include "internal.h" for rb_big_uminus() prototype.
 
-	* ext/tk/lib/tkextlib/*: ditto.
+Sun May 29 15:09:05 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 28 16:40:15 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* numeric.c (flo_round): fix for negative value.
 
-	* test/openssl/test_x509store.rb: add test for expired CRL
-	  and refine some assertions.
+Sun May 29 02:16:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat May 28 05:15:51 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/net/http/utils.rb (TestNetHTTPUtils#teardown): add nil check.
 
-	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_time): should
-	  not set internal flag directry.
+Sun May 29 00:22:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat May 28 02:00:11 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* process.c (before_exec, after_exec): change from macro to function.
 
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
-	  ENV["REQUEST_URI"] is better to get correct Request-URI
-	  than ENV["SCRIPT_NAME"] + ENV["PATH_INFO"].  [ruby-dev:26235]
+Sat May 28 19:30:17 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri May 27 16:32:04 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* process.c (before_exec, after_exec): change SIGPIPE handler to SIG_DFL
+	  before calling execve(). Because r31760 reintroduced an issue that
+	  system() may hang up (i.e. [ruby-dev:12261]).
+	* process.c (save_sigpipe, restore_sigpipe): new.
 
-	* lib/mkmf.rb: use the semicolon as the path separator
-	  in the environment of MSYS.  fixed: [ruby-dev:26232]
+Sat May 28 16:08:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu May 26 06:08:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* signal.c (Init_signal, default_handler): change default SIGPIPE handler
+	  from empty function to SIG_IGN. [ruby-dev:43215]
+	* signal.c (sigpipe): removed.
 
-	* ext/tk/lib/tk.rb: add shortcut-methods of tk_call + tk_split_list
+Sat May 28 03:04:27 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed May 25 22:52:42 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* io.c (fill_cbuf): return MORE_CHAR_SUSPENDED when cbuf is not empty.
 
-	* lib/irb/input-method.rb: do not use Readline::HISTORY.pop.
-	  (backported from HEAD)
+Sat May 28 02:22:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed May 25 21:55:40 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* string.c (rb_str_bytesize): rb_str_bytesize() should use LONG2NUM().
+	  Patch by Nikolai Weibull. [Bug #4789] [ruby-core:36511]
 
-	* ext/readline/readline.c: supported libedit. (backported from HEAD)
+Sat May 28 02:06:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/readline/extconf.rb: ditto.
+	* io.c (fill_cbuf): Fix test-all crash.
 
-	* test/readline/test_readline.rb: ditto.
+Sat May 28 00:58:40 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Wed May 25 20:06:27 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/ostruct.rb (method_missing): Handle [] and []= correctly.
+	  Based on a patch by Caius Durling, bug #4179 [ruby-core:33792]
 
-	* ext/tk/lib/tk.rb: TkComm#tk_split_*list fail to split a kind of SJIS
-	  strings. To avoid the trouble, add arguments to control converting
-	  encoding, and do split on a UTF8 string.
+Fri May 27 23:56:54 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/tk/lib/multi-tk.rb: modify to attend encoding.
+	* test/rexml/test_core.rb (Tester::test_text_frozen): split frozen
+	  string test. refs #4783
 
-	* ext/tk/lib/remote-tk.rb: ditto.
+Fri May 27 22:46:23 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/itemconfig.rb: ditto.
+	* tool/rbinstall.rb (gem): install gemspec of json.  fixed #4784
 
-	* ext/tk/lib/tk/listbox.rb: ditto.
+Fri May 27 22:45:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/namespace.rb: ditto.
+	* io.c (validate_enc_binmode): do not clear textmode flag if
+	  default.  fixed #4732
 
-	* ext/tk/lib/tk/panedwindow.rb: ditto.
+	* io.c (fill_cbuf): finish reading at EOF.
 
-	* ext/tk/lib/tk/text.rb: ditto.
+Fri May 27 11:31:51 2011  misfo <tedwardo2@gmail.com>
 
-	* ext/tk/lib/tk/textmark.rb: ditto.
+	* lib/rexml/text.rb (REXML::Text#initialize): prevent an error
+	  when passing a frozen string to REXML::Text.new
 
-	* ext/tk/lib/tk/texttag.rb: ditto.
+	  dup the string passed in instead of cloning so that it's frozen
+	  state is ignored
 
-	* ext/tk/lib/tk/variable.rb: ditto.
+Fri May 27 08:47:26 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/tk/lib/tk/winfo.rb: ditto.
+	* thread.c (ppoll): typo bug fix.
 
-	* ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb: ditto.
+Fri May 27 08:35:04 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb: ditto.
+	* ext/tk/lib/tk.rb: hang-up at exit before calling Tk.mainloop.
 
-	* ext/tk/lib/tk.rb: add TkWindow#lower_window/raise_window and
-	  Tk#lower_window/raise_window by reason of method-name conflict
+	* ext/tk/lib/tk/extconf.rb: cannot make on MinGW [Ruby 1.9 - Bug #4141].
 
-	* ext/tk/lib/tk/canvas.rb: bug fix on TkCanvas#delete when given
-	  non-TkcItem arguments.
+Thu May 27 00:34:07 2011  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb: ditto.
+    * lib/csv.rb: Enhance each() to support Enumerator.
 
-Wed May 25 12:59:48 2005  Tanaka Akira  <akr@m17n.org>
+Thu May 26 10:32:11 2011  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* lib/open-uri.rb (OpenURI::Meta::RE_QUOTED_STRING): a content of
-	  quoted-string should be zero or more characters.
+    * lib/csv.rb: Documentation improvements from Ysiad Ferreiras.
+      [Ruby 1.9 - Bug #4785]
 
-Tue May 24 23:42:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu May 26 15:42:02 2011  Cezary Baginski <cezary.baginski@gmail.com>
 
-	* numeric.c (fix_pow): support Fixnum ** Float case directly
-	  without coercing.  [ruby-talk:142697] [ruby-talk:143054]
+	* lib/xmlrpc/parser.rb (FaultException): fix to_s and inspect
 
-Tue May 24 16:57:24 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/xmlrpc/parser.rb: test for the above
 
-	* ruby.c (require_libraries): caused SEGV when continuation jumped
-	  in to the required library code.
+Wed May 25 11:54:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue May 24 11:56:25 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/curses/curses.c:  Remove color constants block.
+	  [Ruby 1.9 - Bug #4748]
 
-	* lib/getopts.rb: should warn only if verbose mode.
-	  fixed: [ruby-dev:26201]
+Wed May 25 09:56:45 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue May 24 06:45:31 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/curses/curses.c:  Add missing documentation for button state, MIN
+	  and MAX comments.  Add Curses. to TABSIZE= and ESCDELAY= methods.
+	  [Ruby 1.9 - Bug #4747]
 
-	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): string
-	  literals to be matched non-greedy.
+Wed May 25 09:35:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue May 24 00:34:32 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/benchmark.rb:  Restore nodoc for Benchmark::Job and
+	  Benchmark::Report.  [Ruby 1.9 - Bug #4726]
 
-	* test/soap/calc: method name 'set' was able to crash with a class Set.
-	  [ruby-dev:26210]
+Wed May 25 09:29:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/wsdl/document/test_rpc.rb: dateTime comparison failed under
-	  TZ=right/Asia/Tokyo (with leap second.) [ruby-dev:26208]
+	* lib/net/pop.rb:  Hide implementation details from RDoc.
+	  [Ruby 1.9 - Bug #4711]
 
-Mon May 23 16:24:05 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed May 25 09:26:29 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tcltklib/extconf.rb: Framework support on MacOS X Tiger.
+	* lib/net/ftp.rb:  Add :nodoc: for private methods.
+	  [Ruby 1.9 - Bug #4710]
 
-	* ext/tcltklib/README.1st: add description of Framework support options.
+Wed May 25 09:19:17 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon May 23 12:21:37 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/zlib/zlib.c:  Fix Document-method declarations.  Improve
+	  Zlib::GzipFile's method catalog.  [Ruby 1.9 - Bug #4695]
 
-	* re.c (make_regexp): should not return junk address during
-	  compile time.  [ruby-dev:26206]
+Wed May 25 08:22:12 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sun May 22 21:54:06 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/erb.rb:  Hide documentation for implementation details of ERB.
+	  [Ruby 1.9 - Bug #4694]
 
-	* lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.4.
+Wed May 25 07:58:14 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  == SOAP client and server ==
+	* lib/tempfile.rb (Tempfile.{mkdir,rmdir}): revert for backward
+	  compatibility.
 
-	  === for both client side and server side ===
+Wed May 25 07:13:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  * improved document/literal service support.
-	    style(rpc,document)/use(encoding, literal) combination are all
-	    supported.  for the detail about combination, see
-	    test/soap/test_style.rb.
+	* spec/README: update the description.
 
-	  * let WSDLEncodedRegistry#soap2obj map SOAP/OM to Ruby according to
-	    WSDL as well as obj2soap.  closes #70.
+Wed May 25 07:12:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  * let SOAP::Mapping::Object handle XML attribute for doc/lit service.
-	    you can set/get XML attribute via accessor methods which as a name
-	    'xmlattr_' prefixed (<foo name="bar"/> -> Foo#xmlattr_name).
+	* lib/tempfile.rb (Tempfile.{lock,unlock}_tempfile): refactor.
 
-	  === client side ===
+Tue May 24 17:30:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	  * WSDLDriver capitalized name operation bug fixed.  from
-	    1.5.3-ruby1.8.2, operation which has capitalized name (such as
-	    KeywordSearchRequest in AWS) is defined as a method having
-	    uncapitalized name. (converted with GenSupport.safemethodname
-	    to handle operation name 'foo-bar').  it introduced serious
-	    incompatibility; in the past, it was defined as a capitalized.
-	    define capitalized method as well under that circumstance.
+	* spec/README: fix typo.
+	  patched by bowsersenior. https://github.com/ruby/ruby/pull/24
 
-	  * added new factory interface 'WSDLDriverFactory#create_rpc_driver'
-	    to create RPC::Driver, not WSDLDriver (RPC::Driver and WSDLDriver
-	    are merged).  'WSDLDriverFactory#create_driver' still creates
-	    WSDLDriver for compatibility but it warns that the method is
-	    deprecated.  please use create_rpc_driver instead of create_driver.
+Tue May 24 07:06:34 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	  * allow to use an URI object as an endpoint_url even with net/http,
-	    not http-access2.
+	* ext/tk/lib/tk.rb: fail to start Tk.mainloop (exit immediately) on
+	  some environment (reported on [ruby-talk:381444]).
 
-	  === server side ===
+	* ext/tk/lib/tk/canvas.rb: support creating a canvas item object from
+	  an item ID number.
 
-	  * added mod_ruby support to SOAP::CGIStub.  rename a CGI script
-	    server.cgi to server.rb and let mod_ruby's RubyHandler handles the
-	    script.  CGIStub detects if it's running under mod_ruby environment
-	    or not.
+	* ext/tk/lib/tk/image.rb: import documents which are pull-requested.
+	  [Ruby 1.9 - Feature #4595]
 
-	  * added fcgi support to SOAP::CGIStub.  see the sample at
-	    sample/soap/calc/server.fcgi.  (almost same as server.cgi but has
-	    fcgi handler at the bottom.)
+	* ext/tk/lib/tk/extconf.rb: search directories for 64bit library (e.g.
+	  /usr/lib64), add some new configure options (see README.tcltklib),
+	  and bug fix.
 
-	  * allow to return a SOAPFault object to respond customized SOAP fault.
+	* ext/tk/lib/tk/README.tcltklib: modify docs for some new configure
+	  options.
 
-	  * added the interface 'generate_explicit_type' for server side
-	    (CGIStub, HTTPServer).  call 'self.generate_explicit_type = true'
-	    if you want to return simplified XML even if it's rpc/encoded
-	    service.
+Tue May 24 04:01:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	  == WSDL ==
+	* lib/yaml.rb: switch default YAML engine to Psych, old syck engine
+	  may be enabled via YAML::ENGINE.yamler = "syck". [ruby-core:36374]
 
-	  === WSDL definition ===
+Mon May 23 09:45:26 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	  * improved XML Schema support such as extension, restriction,
-	    simpleType, complexType + simpleContent, ref, length, import,
-	    include.
+	* include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. Forgot to
+	  include this file in the commit r31692. __APPLE__ is not
+	  CASEFOLD_FILESYSTEM again, from this time.
 
-	  * reduced "unknown element/attribute" warnings (warn only 1 time for
-	    each QName).
+Mon May 23 10:01:02 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	  * importing XSD file at schemaLocation with xsd:import.
+	* ext/openssl/ossl_asn1.c: Do not parse zero-tagged values as EOC. Do
+	  not let current length become negative for infinite length constructed
+	  values. Support constructed values of length zero. Added tests.
 
-	  === code generation from WSDL ===
+Mon May 23 09:19:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-	  * generator crashed when there's '-' in defined element/attribute
-	    name.
+	* lib/net/smtp.rb:  Document Net::SMTP::Response.  Patch by J.R. Garcia.
+	  [Ruby 1.9 - Bug #4768]
 
-	  * added ApacheMap WSDL definition.
+Mon May 23 09:03:52 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* sample/{soap,wsdl}: removed.
+	* lib/test/unit/parallel.rb: Never Ignore SIGINT. When received
+	Interrupt, immediately puts result and exit. [ruby-dev:43571]
 
-Sun May 22 19:11:35 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/test/unit.rb: When received Interrupt, wait results from workers
+	and collect them. [ruby-dev:43571]
 
-	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#intialize):
-	  should initialize session id context. [ruby-core:4663]
+Mon May 23 09:08:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): add session id support.
+	* lib/mathn.rb:  Improve documentation.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4767]
 
-Sat May 21 10:24:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Mon May 23 08:45:55 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* bcc32/Makefile.sub: tds files were not deleted when DESTDIR
-	  included '\' path delimiter. [ruby-dev:26193]
+	* lib/ostruct.rb:  Improve documentation.  Patch by Franklin Webber.
+	  [Ruby 1.9 - Bug #4761]
 
-Thu May 19 19:04:29 2005  speakillof  <speakillof@yahoo.co.jp>
+Mon May 23 08:35:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rexml/encodings/SHIFT-JIS.rb: encoding and decoding were
-	  swapped. [ruby-core:4772]
+	* hash.c:  Improve documentation of Hash#key.  Patch by Utkarsh
+	  Kukreti.  [Ruby 1.9 - Bug #4760]
 
-Wed May 18 23:42:25 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon May 23 08:32:59 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* error.c (exc_exception): reverted to call Exception#initialize
-	  directly.  fixed: [ruby-dev:26177]
+	* enumerator.c:  Improve documentation.  Patch by Dave Copeland.
+	  [Ruby 1.9 - Bug #4757]
 
-Wed May 18 23:39:09 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon May 23 07:19:45 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* dir.c (glob_helper): get rid of using String.  [ruby-dev:26180]
+	* NEWS (openssl): Infinite length support. Different behavior of
+	  Constructive and Primitive constructors.
 
-	* dir.c (push_braces): should skip balanced braces.
+Mon May 23 06:58:33 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* eval.c (ruby_options), win32/win32.c (NtInitialize): move argument
-	  intialization back.  [ruby-dev:26180]
+	* ext/openssl/ossl_asn1.c: Forbid Constructives whose value is not an
+	  Array to prevent segfault. Added test.
 
-Tue May 17 15:31:31 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon May 23 06:33:17 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should
-	  break the loop if the socket reached to EOF. [ruby-talk:142285]
+	* ext/openssl/ossl_asn1.c: Forbid Constructive without infinite
+	  length. This also prevents a segfault. Added test and improved
+	  documentation.
 
-Tue May 17 11:52:18 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon May 23 05:58:14 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* win32/win32.c (unixtime_to_filetime): use localtime() instead of
-	  gmtime() when using FileLocalTimeToFileTime().
+	* ext/openssl/ossl_asn1.c: Fix decoding of infinite length values.
+	  Simplified ossl_asn1_decode0 by splitting it into three separate
+	  functions. Add tests.
+	  [Ruby 1.9 - Bug #4374][ruby-core:35123]
 
-Mon May 16 22:28:43 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon May 23 04:03:46 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* win32/win32.h, {bcc32,win32,wince}/Makefile.sub: moved rb_[ugp]id_t
-	  to get rid of redefinition warnings on mingw.
+	* ext/openssl/ossl_asn1.c (ossl_asn1_initialize): Allow creation of
+	  Constructives with an explicit tag_class parameter without
+	  automatically setting tagging to :EXPLICIT. Fixes a bug when encoding
+	  infinite length primitive values.
 
-	* class.c (rb_class_init_copy): singleton class is disallowed to copy,
-	  from its definition.  fixed: [ruby-talk:142749]
+Mon May 23 04:03:46 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Mon May 16 08:52:29 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/openssl/ossl_asn1.c (ossl_asn1_cons_to_der): Add an additional
+	  EOC for infinite length Constructives that are supposed to be encoded
+	  with explicit tagging. Also tabify method correctly.
 
-	* win32/win32.{h,c}: define rb_[pgu]id_t.
+Mon May 23 03:44:39 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Mon May 16 00:21:02 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/openssl/ossl_asn1.c (ossl_asn1data_to_der): Remove redundant
+	  flag tmp_cons.
 
-	* lib/pathname.rb (Pathname#unlink): use SystemCallError instead of
-	  Errno::EISDIR because EISDIR is not portable.
-	  [ruby-core:5001]
+Mon May 23 00:35:00 2001  Kenta Murata  <mrkn@mrkn.jp>
 
-Sun May 15 22:11:33 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* bignum.c (dump_bignum, bigmul1_balance, big_split, biglsh_bang),
+	  (bigrsh_bang, big_split3, bigmul1_toom3, bigmul0): implement Toom3 (Toom-Cook)
+	  multiplication.
 
-	* lib/drb/drb.rb (DRbObject#method_missing): use raise(exception).
-	  [ruby-dev:26164]
+	* include/ruby/defines.h: add format prefixes for BDIGIT and BDIGIT_DBL.
 
-Sun May 15 18:56:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May 22 23:24:02 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* configure.in, ruby.h: define rb_[pgu]id_t macros instead of typedefs
-	  to get rid of types which might not be defined yet.  [ruby-dev:26165]
+	* ext/openssl/ossl_asn1.c: Instead of rb_intern use static symbols to
+	  improve performance.
 
-Sun May 15 14:35:46 2005  Tanaka Akira  <akr@m17n.org>
+Sun May 22 21:56:51 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/pathname.rb (Pathname#unlink): unlink a symlink to a directory
-	  was failed.  [ruby-core:4992]
+	* ext/openssl/ossl_asn1.c: Use OpenSSL constants V_ASN1_xxx instead of
+	  hardcoded numbers for initializing class_tag_map.
 
-Sun May 15 09:57:30 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May 22 21:29:29 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* win32/win32.c (unixtime_to_filetime): deal with DST.
-	  [ruby-talk:141817]
+	* include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. See #4255.
+	  Now __APPLE__ is not CASEFOLD_FILESYSTEM again.
 
-Sat May 14 23:59:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* load.c (loaded_feature_path, rb_feature_p, load_lock): Revert r30508.
+	  See #4255. Make $LOADED_FEATURES scanning case-sensitive again.
 
-	* error.c (exc_exception, {exit,name_err,syserr}_initialize): call
-	  Execption#initialize.  fixed: [ruby-talk:142593]
+Sun May 22 18:59:27 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Sat May 14 23:57:26 2005  Erik Huelsmann  <ehuels@gmail.com>
+	* ext/openssl/ossl_asn1.c(ossl_asn1_default_tag): avoid using RCLASS_SUPER
+	  to make it compilable. Plus, tabify and change variable definition style.
 
-	* configure.in: Check for the availability of pid_t, gid_t and uid_t and
-	  remove AC_TYPE_UID_T.  fixed: [ruby-core:04745]
+Sun May 22 18:26:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* defines.h: Remove pid_t typedef.
+	* gc.c (vm_xcalloc): use calloc provided by platforms.
+	  fixes #4754
 
-	* ruby.h: Define rb_pid_t, rb_gid_t and rb_uid_t in accordance with
-	 the available system types.
+Sun May 22 11:44:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* process.c: Change instances of pid_t and gid_t to their rb_*
-	 counterparts.
+	* ext/pty/pty.c:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4756]
 
-	* ext/pty/pty.c: Change pid_t to rb_pid_t.
+Sun May 22 11:26:39 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* vms/config.h: Define HAVE_{P,G,U}ID_T to 1.
+	* lib/timeout.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4755]
 
-	* win32/Makefile.sub: Remove #define for {g,u}id_t.
+Sun May 22 11:21:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* win32/win32.c: Change pid_t to rb_pid_t.
+	* lib/ipaddr.rb:  Improve documentation.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4753]
 
-	* wince/Makefile.sub: Remove #define for {g,u}id_t.
+Sun May 22 11:14:40 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* wince/sys/types.h: Remove definitions of {p,g,u}id_t.
+	* lib/forwardable.rb:  Document def_delegator.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4752]
 
-Fri May 13 23:44:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May 22 11:11:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/extmk.rb: keep srcdir unexpanded.
+	* lib/fileutils.rb:  Document block behavior of FileUtils.cd.  Patch by
+	  Bil Kleb.  [Ruby 1.9 - Bug #4751]
 
-	* lib/mkmf.rb (create_makefile): quote topdir and hdrdir if necessary.
-	  fixed: [ruby-core:04932]
+Sun May 22 11:07:47 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (configuration), {bcc32,win32,wince}/Makefile.sub: make
-	  also INSTALL_PROG and INSTALL_DATA system dependent.
-	  fixed: [ruby-core:04931]
+	* ext/curses/curses.c:  Complete documentation.  Patch by Vincent
+	  Batts.  [Ruby 1.9 - Bug #4748]
 
-Fri May 13 17:54:39 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun May 22 09:29:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* variable.c (generic_ivar_get): rb_attr_get should not warn.
-	  [ruby-dev:26010]
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  use spawn. it prevent that other tests inherit renamed $0.
 
-Fri May 13 12:28:43 2005  Daniel Berger  <djberge@qwest.com>
+Sun May 22 08:57:13 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* array.c (rb_ary_select): can remove argc check. [ruby-core:4911]
+	* ext/openssl/ossl_asn1.c: Default tag lookup in constant time via hash
+	  instead of previous linear algorithm.
+	  [Ruby 1.9 - Feature #4309][ruby-core:34813]
 
-	* test/ruby/test_array.rb: add test for find_all.
+Sun May 22 07:54:16 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Fri May 13 11:29:00 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_digest.c: Explain DSS and DSS1 in documentation.
 
-	* eval.c (unknown_node): add volatile directive to prototype.
+Sun May 22 07:10:25 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Thu May 12 17:08:48 2005  Tanaka Akira  <akr@m17n.org>
+	* test/openssl/test_pkey_dsa.rb: Add tests for sign/verify.
 
-	* io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
-	  (swallow, rb_io_each_byte, rb_io_getc): revert previous change.
+Sun May 22 06:07:17 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* io.c (rb_io_eof, io_fread, appendline, swallow, rb_io_each_byte)
-	  (rb_io_getc, rb_getc): call clearerr before getc to avoid
-	  stdio incompatibility.
+	* test/openssl/test_x509cert.rb: Merge DSA-related tests from ruby_1_8
+	  branch.
 
-Thu May 12 16:52:20 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun May 22 04:11:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb: more readability for mixing
-	  progress "c..." and warning message.
+	* thread.c (Init_Thread): add a code comment why the meaningless
+	  line is necessary.
 
-Thu May 12 16:31:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+Sun May 22 01:35:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 2.0.5
+	* ext/date/date_core.c: modified documentation.
 
-Thu May 12 16:15:01 2005  Tanaka Akira  <akr@m17n.org>
+Sat May 21 22:46:26 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
-	  (swallow, rb_io_each_byte, rb_io_getc): don't rely EOF flag.
-	  [ruby-talk:141527]
+	* ext/date/date_strftime(date_strftime_with_tmx): "%v" means "%e-%b-%Y".
 
-Thu May 12 15:56:20 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+Sat May 21 22:14:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb: show parsing progress for C files.
-	  [ruby-core:4341]
+	* io.c (rb_io_extract_modeenc): accept combination hash and
+	  File::Constants. (eg. File.open('yo', :mode => File::WRONLY))
+	  [Feature #4742][ruby-core:36338]
+	* test/ruby/test_io.rb (TestIO#test_open_mode): new test.
 
-Thu May 12 13:47:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat May 21 21:44:14 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* test/drb/test_drb{ssl,unix}.rb: can test drb
-	  before install. (backported from HEAD) [ruby-dev:26146]
+	* test/date/test_switch_hitter.rb: new.
 
-Thu May 12 09:53:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May 21 21:18:29 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* version.c (ruby_show_version): flush for non-tty stdout.
+	* ext/date/date_{core,parse}.c: moved nearly all core code from ext/date/lib.
+	* ext/date/lib/{date,date/format}.rb: removed nearly all code.
 
-Thu May 12 09:07:07 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat May 21 02:58:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/ruby/envutil.rb, test/drb/drbtest.rb: can test drb
-	  before install. (backported from HEAD) [ruby-Bugs-1672]
+	* ext/.document:  Add curses to documented extensions.
+	* ext/curses/curses.c:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4747]
 
-Thu May 12 01:23:55 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May 21 02:51:01 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_eval), parse.y (arg): reduce fixnum range literal at
-	  parser.  fixed: [ruby-dev:26113]
+	* ext/bigdecimal/lib/bigdecimal/util.rb:  Improve documentation.  Patch
+	  by Pete Higgins.  [Ruby 1.9 - Bug #4746]
 
-	* eval.c (unknown_node): ignore broken NODE to get rid of accessing
-	  possibly inaccessible address.  fixed: [ruby-dev:26122]
-	  should emit more useful information like [ruby-dev:26126], though.
+Sat May 21 02:44:10 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed May 11 16:20:01 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/bigdecimal/lib/bigdecimal/jacobian.rb:  Document isEqual.  Patch
+	  by Kuba Fietkiewicz.  [Ruby 1.9 - Bug #4744]
 
-	* lib/webrick/cgi.rb: new methods WEBrick::CGI#[], WEBrick::CGI#logger
-	  and WEBrick::CGI#config. (backported from HEAD)
+Sat May 21 02:22:34 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape_path): should
-	  not use String#split("/"). (backported from HEAD)
+	* ext/date/lib/date/format.rb:  Document date formats.  Patch by
+	  Clinton Nixon.  [Ruby 1.9 - Bug #4743]
 
-Wed May 11 15:58:39 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri May 20 05:15:19 2011  Nobuhiro Iwamatsu  <iwamatsu@nigauri.org>
 
-	* eval.c (break_jump): break should not cross functions.
-	  [ruby-list:40818]
+	* gc.c: Fix build on m68k by 'error: too few arguments to
+	  function 'mark_locations_array''.
 
-Wed May 11 10:39:37 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri May 20 04:23:42 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/tempfile.rb (Tempfile#unlink): fixed typo.
+	* lib/scanf.rb:  Improve documentation.  Patch by Gabe McArthur.
+	  [Ruby 1.9 - Bug #4735]
 
-Wed May 11 01:03:36 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 20 00:58:01 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (TMP_ALLOC): use macro NEW_NODE() to get rid of warnings on
-	  platforms which have no alloca().  fixed: [ruby-talk:141301]
+	* enc/trans/ibm737-tbl.rb: greek code page.  fixes #4738
 
-Sun May  8 23:17:47 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu May 19 14:44:05 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/timer.rb: fix typo.
+	* test/ruby/test_signal.rb (test_signal_requiring): skip on Windows.
+	  we can send SIGINT only to pid 0 and the process itself.
 
-Sun May  8 16:52:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu May 19 09:07:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/profiler.rb: fixed "undefined method `[]' for nil:NilClass"
-	  [ruby-core:4775] [ruby-talk:140401] [ruby-dev:26118]
+	* lib: revert r31635-r31638 and untabify with expand(1).
 
-Sat May  7 22:58:00 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu May 19 07:47:26 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/mkmf.rb (have_var): no libs argument is given.
+	* test/openssl/test_pkey_rsa.rb: Add tests for sign/verify.
 
-Sun May  1 09:58:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu May 19 07:19:16 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ruby.c (process_sflag): replace '-' in variable names with '_'.
-	  [ruby-dev:26107]
+	* ext/openssl/ossl_pkey.c: Add documentation.
 
-	* ruby.c (set_arg0): use also environment variable space for setting
-	  $0.  [ruby-core:04774]
+Thu May 19 07:06:56 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Apr 27 23:42:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/benchmark.rb:  Fix indentation.
+	* lib/net/imap.rb:  Fix indentation of regular expressions.
 
-	* win32/Makefile.sub (OPTFLAGS): default global optimization to
-	  disabled only for VC++6.
+Thu May 19 06:36:11 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Apr 26 22:58:00 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/net/imap.rb:  Fix indentation of EOF for heredoc.
+	* lib/debug.rb (Commands):  Fix indentation of EOHELP for heredoc.
 
-	* ext/tcltklib/tcltklib.c (ip_invoke_core): call Tcl's "::unknown"
-	  command when can't get information of target command.
+Thu May 19 06:30:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Apr 25 01:18:43 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/mkmf.rb:  Fix indentation of EOM for heredoc.
 
-	* regex.c: declare rb_warn to have variadic argument.  [ruby-core:4751]
+Thu May 19 06:16:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Apr 23 19:45:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib:  Convert tabs to spaces for ruby files per
+	  http://redmine.ruby-lang.org/projects/ruby/wiki/DeveloperHowto#coding-style
+	  Patch by Steve Klabnik [Ruby 1.9 - Bug #4730]
+	  Patch by Jason Dew [Ruby 1.9 - Feature #4718]
 
-	* ext/tcltklib/tcltklib.c (ip_RubyExitCommand): exit with status code
-	  via TclTkIp#_eval didn't work. [ruby-talk:139390]
+Thu May 19 06:06:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Apr 22 16:41:50 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/cgi/util.rb:  Improve documentation.  Patch by Clinton Nixon.
+	  [Ruby 1.9 - Bug #4733]
+	* lib/cgi/core.rb:  ditto
+	* lib/cgi/cookie.rb:  ditto
 
-	* ext/tcltklib/tcltklib.c (ip_set_exc_message): fixed memory leak.
+Thu May 19 06:02:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tcltklib/tcltklib.c: eTkCallbackReturn was not initialized.
+	* lib/tempfile.rb:  Document Dir.mkdir and Dir.rmdir.  Patch by Clinton
+	  Nixon.  [Ruby 1.9 - Bug #4728]
 
-Thu Apr 21 00:07:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu May 19 05:57:52 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (create_makefile): support platforms have file separator
-	  other than /.
+	* encoding.c:  Improve documentation for Encoding#default_external and
+	  Encoding#default_internal.
 
-	* {bcc32,win32,wince}/Makefile.sub (BUILD_FILE_SEPARATOR): separator
-	  of building platform.
+Wed May 18 22:45:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* {bcc32,win32,wince}/Makefile.sub (CP, INSTALL): use COPY command.
+	* ext/io/console/lib/console/size.rb (IO#console_size): new
+	  method.  (EXPERIMENTAL)
 
-Wed Apr 20 23:22:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 18 22:41:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Makefile.in, common.mk: miniruby depens on MINIOBJS.
+	* internal.h: add for internal use only.
 
-	* dmydln.c (dln_load): dummy function to raise LoadError.
+Wed May 18 22:36:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* cygwin/GNUmakefile.in, {bcc32,win32,wince}/Makefile.sub: miniruby
-	  can't load extensions on Windows.
+	* eval.c (setup_exception): internal exception should be hidden
 
-Wed Apr 20 23:01:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 18 20:25:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* win32/ifchange.bat: delete testing files.
+	* lib/timeout.rb (Timeout#timeout): don't leak "execution expired"
+	  exception. [Bug #4283] [ruby-core:34534].
 
-Wed Apr 20 07:27:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 18 06:09:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* {bcc32,win32,wince}/configure.bat, {bcc32,win32,wince}/setup.mak:
-	  add extout option.
+	* lib/cmath.rb:  Add some examples and improve documentation.  Patch by
+	  Sandor Szucs.  [Ruby 1.9 - Bug #4727]
 
-	* bcc32/setup.mak: make configuration variables overridable.
+Wed May 18 05:40:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Apr 20 04:15:27 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
+	* lib/benchmark.rb:  Remove nodoc from Benchmark::Job and
+	  Benchmark::Report.  Patch by Sandor Szucs.  [Ruby 1.9 - Bug #4726]
 
-	* lib/irb.rb lib/irb/* doc/irb: IRB 0.9.5
+Wed May 18 05:29:26 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Apr 19 23:37:09 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/webrick/compat.rb:  Improve documentation.  Patch by Sandor
+	  Szucs.  [Ruby 1.9 - Bug #4725]
 
-	* lib/ftools.rb (File.safe_unlink): do not modify a symlinked file.
+Wed May 18 05:10:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Apr 19 00:06:20 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/tracer.rb:  Improve documentation.  Patch by Richard Ramsden.
+	  [Ruby 1.9 - Feature #4720]
 
-	* ext/extmk.rb: expand path for ext/**/extconf.rb.
+Wed May 18 04:53:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Apr 18 11:25:14 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/cmath.rb:  Improve documentation.  Patch by Jason Dew.
+	  [Ruby 1.9 - Feature #4717]
 
-	* ext/zlib/zlib.c (zstream_run): fixed SEGV. [ruby-core:4712]
+Wed May 18 04:50:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sun Apr 17 23:57:49 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/ftp.rb:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4710]
 
-	* ext/extmk.rb (extmake, parse_args): do not expand destdir.
+Wed May 18 03:14:49 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/extmk.rb (relative_from): treat mere drive letter as an absolute
-	  path.
+	* test/test_singleton.rb:  Add tests from lib/singleton.rb.  Patch by
+	  Pete Higgins.  [Ruby 1.9 - Bug #4715]
 
-Sat Apr 16 17:01:16 2005  Kouhei Sutou  <kou@cozmixng.org>
+Wed May 18 03:03:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* sample/rss/tdiary_plugin/rss-recent.rb (rss_recent_cache_rss):
-	  use the first date information of items as site date information
-	  if channel doesn't have date information.
+	* lib/singleton.rb:  Improve documentation.  Patch by Pete Higgins.
+	  [Ruby 1.9 - Bug #4709]
 
-Sat Apr 16 15:27:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue May 17 21:24:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* configure.in (RUBY_PROG_INSTALL): not add -p option to INSTALL.
-	  files need timestamps to be kept are only ar-archive on a few
-	  platforms, and be installed by instruby.rb but not INSTALL.
-	  fixed: [ruby-core:04721]
+	* thread.c (rb_mutex_lock): remove remove_signal_thread_list() call.
+	  It's meaningless because lock_interrupt doesn't call
+	  add_signal_thread_list().
 
-	* mkconfig.rb: purge autoconf value variables.
+Tue May 17 20:20:49 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Apr 16 10:36:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm_core.h (rb_thread_struct): add volatile to
+	  transition_for_lock because it is not protected by lock.
 
-	* bcc32/Makefile.sub: quick hack... prepend DESTDIR.
-	  still have restriction on DESTDIR ("", "/", "e:")
+Tue May 17 20:08:53 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Apr 16 03:59:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* LEGAL (missing/{elf,tgamma,lgamma_r}.c): they've been replaced by
+	  public domain implementations.
 
-	* ext/openssl/extconf.rb: check for OPENSSL_cleanse.
+	* LEGAL (vsnprintf.c): it has moved to srcdir from missing/.
 
-	* ext/openssl/openssl_missing.h: ditto.
+	* LEGAL (missing/crypt.c): list its original license.
 
-Thu Apr 14 19:18:30 2005  Minero Aoki  <aamine@loveruby.net>
+Tue May 17 19:54:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/fileutils.rb (remove_file): ignore exceptions caused by
-	  chmod.
+	* LEGAL (configure): add missing/setproctitle.c
 
-	* lib/fileutils.rb (remove_dir): try to get rights to rmdir.
-	  [ruby-Bugs:1502] (2 items backportted from HEAD, rev 1.53-54)
+Tue May 17 19:35:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	Fix FreeBSD test failure.
 
-Thu Apr 14 16:57:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  use ps -o command instead of ps -o cmd. FreeBSD doesn't support
+	  -o cmd option.
 
-	* bcc32/Makefile.sub: failed to remove debug information files.
-	  fixed: [ruby-dev:26034]
+Tue May 17 08:04:26 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Apr 13 23:40:21 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/openssl/ossl_digest.c: Add documentation.
 
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.3 -> 0.1.4.
+Tue May 17 07:14:58 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rss/rss.rb (RSS::Element#converter): fixed converter
-	  transmission bug.
+	* lib/net/http.rb:  Improve documentation of proxy configuration
+	  methods.  Patch by Alf Mikula.  [Ruby 1.9 - Bug #4714]
 
-Wed Apr 13 21:20:35 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue May 17 07:09:01 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* configure.in (mingw32): extract msvcr*.dll from objdump result.
+	* lib/net/pop.rb:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4711]
+	* lib/net/telnet.rb:  ditto
 
-Wed Apr 13 20:24:30 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue May 17 07:00:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* configure.in (mingw32): use actual runtime DLL name as ruby DLL
-	  name and default load path.
+	* lib/net/http.rb:  Fix nodoc for Net::HTTP::version_1_1?.  Patch by
+	  Alf Mikula.  [Ruby 1.9 - Bug #4713]
 
-	* win32/Makefile.sub, win32/setup.mak: ditto.
+Tue May 17 06:56:26 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Apr 12 15:33:09 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/optparse.rb:  Add link to make_switch to improve documentation.
+	  Patch by David Copeland.  [Ruby 1.9 - Bug #4708]
 
-	* ext/tcltklib/tcltklib.c (ip_finalize): better modification than the
-	  previous commit [ruby-dev:26029].
+Tue May 17 06:50:40 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Apr 12 12:38:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/observer.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4707]
 
-	* ext/tcltklib/tcltklib.c (ip_finalize): fix SEGV when Tcl_GlobalEval()
-	  modifies the argument string to eval.
+Tue May 17 06:42:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Apr 12 02:21:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/logger.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4706]
 
-	* ext/tcltklib/tcltklib.c (ip_finalize): add existence check of
-	  Tcl commands before calling Tcl_GlobalEval().
+Tue May 17 06:28:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Apr 11 23:47:21 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* lib/gserver.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4705]
 
-	* lib/drb/drb.rb: [druby-ja:123] fix: When reference of my object is
-	  loaded, the object is tainted.
+Tue May 17 06:21:15 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/drb/test_drb.rb: ditto.
+	* lib/cgi.rb: Add toplevel documentation to class CGI
+	* lib/cgi/session.rb: Add overview documentation to CGI::Cookie
+	* lib/cgi/html.rb:  Don't add CGI::TagMaker documentation to CGI.
+	  Patch by David Copeland.  [Ruby 1.9 - Bug #4704]
+	* lib/cgi/core.rb:  Clean up CGI documentation.  Patch by David
+	  Copeland.  [Ruby 1.9 - Bug #4704]
+	* lib/cgi/cookie.rb:  Clean up CGI::Cookie documentation.  Patch by
+	  David Copeland.  [Ruby 1.9 - Bug #4704]
 
-Mon Apr 11 22:18:23 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue May 17 05:52:30 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* dir.c, file.c (lstat): avoid warnings for mingw.
+	* ext/digest: Improve documentation of Digest, Digest::HMAC and
+	  Digest::SHA2.  Patch by Pete Higgins.  [Ruby 1.9 - Bug #4702]
 
-Mon Apr 11 20:11:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue May 17 03:51:42 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tcltklib/tcltklib.c (ip_finalize): adhoc patch to avoid SEGV
-	  when exit on Tcl/Tk8.3.x.
+	* lib/abbrev.rb:  Hide copyright and revision information from RDoc.
+	  Inspired by patch from David Copeland, bug #4703.
 
-Mon Apr 11 15:26:25 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue May 17 03:33:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (configuration): shouldn't output hdrdir twice.
+	* lib/timeout.rb (module Timeout):  Hide internal constants.  Patch by
+	  Pete Higgins.  [Ruby 1.9 - Bug #4701]
 
-Mon Apr 11 12:09:05 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Mon May 16 11:21:09 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* {bcc32,win32,wince}/Makefile.sub: ri data was not installed
-	  into correct path. [ruby-dev:26011]
+	* configure.in, win32/Makefile.sub (RUBY_SO_NAME): add CPU as prefix
+	  of RUBY_SO_NAME on x64/ia64 mswin/mingw.
+	  [Feature #4602]
 
-	* bcc32/Makefile.sub: defaulted install-nodoc. [ruby-dev:26011]
+Mon May 16 08:00:05 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sun Apr 10 10:12:42 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* lib/rdoc.rb:  Update to RDoc 3.6.1, allows OpenSSL::Digest to be
+	  found.
 
-	* ext/win32ole/win32ole.c(ole_invoke): retry after converting Qnil
-	  to VT_EMPTY.
+Mon May 16 05:49:54 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/win32ole/win32ole/tests/testWIN32OLE.rb: correct error
-	  message string "Unknown" => "unknown".
+	* lib/drb/acl.rb:  Add documentation.
 
-Sat Apr  9 18:20:31 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon May 16 05:13:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/lib/tk/image.rb: support to create TkImage object without
-	  creating a new image object on Tk.
+	* ext/openssl/ossl_asn1.c: Add documentation.
 
-	* ext/tk/lib/tk/menu.rb: use TkCommandNames on create_self()
+Mon May 16 00:32:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/root.rb: TkRoot.to_eval() returns '.'.
+	* test/ruby/test_signal.rb (TestSignal#test_signal_process_group):
+	  skip if the platform doesn't have :pgroup capability. (i.e. skip
+	  if mswin32)
 
-	* ext/tk/lib/tk/text.rb: add methods to create a TkText::IndexString
-	  from (x, y) coords.
+Sun May 15 23:53:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib/tile/: add demo and update support status.
+	* include/ruby/intern.h: resurrect old rb_fd_copy().
+	* thread.c (rb_fd_copy): ditto.
 
-Sat Apr  9 14:42:29 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sun May 15 23:45:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* sample/rss/tdiary_plugin/rss-recent.rb: supported configuration
-	  via Web browser.
+	* include/ruby/intern.h: remove rb_fd_copy() to rb_fd_dup() and
+	  rb_w32_fdcopy() to rb_w32_fd_dup().
+	* win32/win32.c: ditto.
+	* thread.c: ditto.
 
-Sat Apr  9 11:59:57 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sun May 15 22:26:39 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/rss: backoported from HEAD.
+	* signal.c (rb_f_kill): accept '-SIGXXX' style signal with Symbol or
+	  implicit convertion with #to_str. [ruby-dev:43169] fixes #4362
+	* test/ruby/test_signal.rb (test_signal_process_group): add a test
+	  for send signal to process group.
 
-	* lib/rss: refactored.
-	  - gave a name to 'x'.
-	  - undef_method -> remove_method for avoiding a warning in ruby 1.6.
+Sun May 15 21:22:35 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
+	* cont.c (cont_init): clear macihne_stack_start/end of saved thread to
+	  prevent mark machine stack of GC'ed Thread. root Fiber is not
+	  initialized by fiber_init().
+	  based on a patch by Serge Balyuk [ruby-core:35891] fixes #4612
+	* test/ruby/test_fiber.rb (test_gc_root_fiber): add test for it.
 
-	* lib/rss/parser.rb: @@setter -> @@setters.
+Sun May 15 21:04:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/parser.rb
-	  (RSS::BaseListener.register_uri)
-	  (RSS::BaseListener.uri_registered?)
-	  (RSS::BaseListener.install_get_text_element):
-	  swapped the first argument and the second argument.
+	* transcode.c (econv_init): revert r31353.  [ruby-dev:43512]
 
-	* lib/rss/taxonomy.rb: swapped the first argument and the second
-	  argument for RSS::BaseListener.install_get_text_element.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/parser.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/content.rb: ditto.
+Sun May 15 03:39:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/rss/parser.rb
-	  (RSS::BaseListener.install_setter)
-	  (RSS::BaseListener.register_uri): changed fallback way.
+	* ext/zlib/zlib.c:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4695]
 
-	* lib/rss/parser.rb: added class name registry for complex model
-	  elements. (ex. have childlen elements, have some attributes and
-	  a child element and so on.)
+Sun May 15 03:23:46 2011  Eric Hodel  <drbrain@segment7.net>
 
+	* lib/erb.rb:  Document ERB::Compiler.  Patch by Simon Chiang.
+	  [Ruby 1.9 - Bug #4694]
 
-	* lib/rss/dublincore.rb: supported multiple Dublin Core items.
-	* lib/rss/maker/dublincore.rb: ditto.
+Sun May 15 00:58:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	fix mswin32 build error.
 
-	* lib/rss/maker/image.rb: supproted new Dublin Core API.
+	* missing/setproctitle.c: add #ifdef HAVE_UNISTD_H.
+	* win32/Makefile.sub (MISSING): add setproctitle.obj
 
+Sat May 14 22:45:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/maker/base.rb: added default current_element implementation.
+	* missing/setproctitle.c: add to include "ruby/util.h".
 
+Sat May 14 19:52:22 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/trackback.rb (RSS::TrackBackUtils.new_with_value_if_need):
-	  moved to RSS::Utils.
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  add for $0 test.
 
-	* lib/rss/utils.rb (RSS::Utils.new_with_value_if_need):
-	  moved from RSS::TrackBackUtils.
+Sat May 14 19:50:46 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
+	* missing/setproctitle.c (compat_init_setproctitle): use
+	  ruby_strdup() instead of strdup().
 
-	* lib/rss/maker/image.rb: fixed invalid argument of
-	  add_need_initialize_variable bug.
-	* lib/rss/maker/trackback.rb: ditto.
+Sat May 14 19:37:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
+	* include/ruby/missing.h: add setproctitle() declaration.
+	* missing/setproctitle.c: added.
+	* configure.in: add check for missing/setproctitle.c.
 
-	* lib/rss/rss.rb (Hash#merge): added for ruby 1.6.
+	* ruby.c (ruby_process_options): add to call compat_init_setproctitle().
+	* ruby.c (set_arg0): remove all platform specific code. it's
+	  moved to missing/setproctitle.c.
+	* ruby.c (origarg): remove len field. It's no longer used.
+	* ruby.c (get_arglen): removed.
 
-	* lib/rss/rss.rb (RSS::BaseModel.date_writer): changed to accept nil
-	  for date value.
+	This patch makes a lot of cleanup set_arg0 related code and fixes
+	[Feature #4689].
 
+Sat May 14 17:42:21 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* test/test_dublincore.rb: added tests for plural accessor and
-	  multiple Dublin Core items.
+	* process.c (rb_proc_times): improve documentation.
+	  [ruby-core:35785] fixes #4581, reported by Andrew Grimm.
 
-	* test/test_setup_maker_1.0.rb: fixed swapped actual and expected
-	  values.
+Sat May 14 12:12:54 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* test/rss/rss-assertions.rb (assert_multiple_dublin_core): added
-	  an assertion for testing multiple Dublin Core items.
+	* test/openssl/test_pkey_dsa.rb: Add basic tests and tests that
+	  ensure new public key PEM encoding behavior and ensure backward
+	  compatibility.
+	  [Ruby 1.9 - Bug #4422] [ruby-core:35328]
+	* test/openssl/test_pkey_rsa.rb: Remove line with 'puts'.
 
-	* test/rss/test_maker_dc.rb (test_rss10_multiple): added a test
-	  for making multiple Dublin Core items.
+Sat May 14 12:06:49 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/rss/test_maker_dc.rb (test_date): added a test for #date=
-	  and #dc_date=.
+	* lib/rdoc/context.rb (class RDoc):  Fix infinite loop caused by
+	  re-encountering BasicObject.
 
+Sat May 14 10:32:36 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* sample/rss/tdiary_plugin/rss-recent.rb:
-	  new option: @options['rss-recent.use-image-link']:
-	  use image as link instread of text if available.
+	* test/openssl/test_pkey_rsa.rb: Add tests that ensure new public key
+	  encoding behavior and also ensure backward compatibility.
+	  [Ruby 1.9 - Bug #4421] [ruby-core:35327]
 
-	* sample/rss/tdiary_plugin/rss-recent.rb (RSS_RECENT_VERSION):
-	  0.0.5 -> 0.0.6.
+Sat May 14 09:50:10 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Apr  8 20:17:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/yaml/dbm.rb:  Add documentation.  Patch by Justin Collins.
+	  [Ruby 1.9 - Bug #4693]
+	* lib/yaml/store.rb:  ditto
 
-	* ext/extmk.rb (extmake): hdrdir needs to be defined also in
-	  Config::CONFIG.
+Sat May 14 09:31:43 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (configuration, create_makefile): get rid of recursive
-	  macro reference.
+	* lib/rdoc.rb: Updated to RDoc 3.6
 
-Fri Apr  8 18:26:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat May 14 07:30:29 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/openssl/ossl_ssl.c: add callbacks to OpenSSL::SSL::SSLContexts.
-	  - SSLContext#client_cert_cb=(aProc). it is called when a client
-	    certificate is requested by a server and no certificate was not
-	    set for the SSLContext. it must return an Array which includes
-	    OpenSSL::X509::Certificate and OpenSSL::PKey::RSA/DSA objects.
-	  - SSLContext#tmp_dh_callback=(aProc). it is called in key
-	    exchange with DH algorithm. it must return an OpenSSL::PKey::DH
-	    object.
+	* ext/psych/lib/psych.rb: released a new gem, so increasing version.
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): ignore the
-	  argument if it's nil.
+Sat May 14 05:08:32 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
+	* ext/openssl/ossl_digest.c
 	* ext/openssl/ossl_pkey.c
-	  (GetPrivPKeyPtr, ossl_pkey_sign): should call rb_funcall first.
-	  (DupPrivPKeyPtr): new function.
-
-	* ext/openssl/ossl_pkey_dh.c: add default DH parameters.
+	* ext/openssl/ossl_pkey.h
+	* test/openssl/pkey/test_pkey_rsa.rb
+	  Reverted premature commit. Sorry for the noise!
 
-	* ext/openssl/ossl_pkey.h: ditto.
+Sat May 14 05:02:58 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Apr  8 01:55:20 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/uri.rb:  Add toplevel documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4690]
 
-	* ext/tk/sample/demos-{en,jp}/goldberg.rb: reduced window size.
-	  [ruby-dev:25992]
+Sat May 14 04:19:06 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Thu Apr  7 23:58:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* NEWS: Describe altered behaviour for RSA and DSA public key
+	  encoding. [Ruby 1.9 - Bug #4421, Bug #4422]
+	  [ruby-core:35327,35328]
 
-	* ext/extmk.rb (extmake): keep directory names in Makefile as macros.
+Sat May 14 02:57:52 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (configuration, create_makefile): ditto.
+	* lib/ipaddr.rb (unless Socket):  Document valid*? methods.  Patch by
+	  Sebastian Martinez.  [Ruby 1.9 - Feature #4687]
 
-	* lib/mkmf.rb (CXX_EXT): separate C++ extensions.
+Sat May 14 02:54:04 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Apr  7 17:43:25 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* lib/rexml/functions.rb:  Add some documentation for REXML::Functions.
+	  Patch by Sebastian Martinez.  [Ruby 1.9 - Feature #4688]
 
-	* eval.c (rb_call0): "return" event hook should be always executed
-	  if event_hooks is set.  fixed: [ruby-core:04662]
-	  (backported from HEAD)
+Sat May 14 02:51:42 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Apr  4 23:17:52 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/resolv.rb:  Hide private method and state-tracking constants from
+	  RDoc.  Patch by Mark Turner.  [Ruby 1.9 - Feature #4691]
 
-	* ext/tk/lib/tk.rb (TkComm#array2tk_list): accept enc-mode argument to
-	  decide whether convert encoding of each element or not.
+Fri May 13 19:23:21 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/tk/lib/tk/variable.rb (TkVariable#value=): fail to convert the
-	  encoding of array elements when assign an array to an TkVariable
-	  object.
+	* numeric.c (flo_coerce): Add #flo_coerce documentation.
+	  Patch by Sebastian Martinez.
+	  https://github.com/ruby/ruby/pull/21
 
-Mon Apr  4 10:26:48 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri May 13 18:42:22 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/tk/lib/tk/dialog.rb: fixed typo.
+	* README.EXT: fix typo.  Patch by William Blackerby.
+	  https://github.com/ruby/ruby/pull/19
 
-Sun Apr  3 17:16:33 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* README.EXT.ja: ditto.
 
-	* win32/win32.{h,c} (rb_w32_fdopen): avoid warning on bcc32.
-	  (backported from HEAD)
-
-Sat Apr  2 23:38:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (CP, INSTALL): get rid of less portable options.
-
-	* lib/mkmf.rb (configuration, create_makefile): correct configuration
-	  variable.
+Fri May 13 15:22:34 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* {bcc32,win32,wince}/{Makefile.sub,setup.mak}: leave prefix empty in
-	  config.status for backward compatibility.  fixed: [ruby-core:04649]
+	* win32/win32.c (rb_w32_select): check invalid handle before doing
+	  select operations.  see [ruby-dev:43513], [ruby-dev:43535]
 
-	* lib/mkmf.rb (create_makefile): ensure library directories get made
-	  before copying libraries there.
+Fri May 13 08:34:00 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Apr  2 16:59:46 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/rdoc/rdoc.rb:  Output summary after documentation report.
+	* lib/rdoc/stats/normal.rb:  Don't output information for users when
+	  we're not on a TTY
 
-	* ext/tk/lib/tk.rb: forgot to update RELEASE_DATE
+Fri May 13 07:49:02 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/variable.rb: fix namespace trouble when autoloading
+	* lib/fileutils.rb:  Hide internal methods from RDoc.  Patch by Darragh
+	  Curran.  [Ruby 1.9 - Bug #4684]
 
-	* ext/tk/lib/tk/palette.rb: define Tcl variable 'tkPalette' as global
+Fri May 13 07:36:23 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/dialog.rb: use array2tk_list method when calling
-	  Tk.ip_eval.
+	* lib/webrick/httpservlet/erbhandler.rb:  Add documentation.
 
-	* ext/tk/lib/tk/autoload.rb: add autoload entry 'TkDialogObj' and
-	  'TkWarningObj'
+Fri May 13 07:04:33 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Apr  2 02:19:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/mathn.rb:  Fix indentation.  Patch by Jason Dew.
+	  [Ruby 1.9 - Feature #4682]
 
-	* ext/tk/lib/tk.rb (TkWindow.initialize): accept 'without_creating'
-	  option without 'widgetname' option to allow creating a widget object
-	  which is used as an argument of Tcl/Tk's widget allocation commands.
+Fri May 13 06:50:43 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/image.rb (TkImage.initialize): accept 'imagename'
-	  option to create a image object by the given name.
+	* lib/mathn.rb:  Add documentation.  Patch by Jason Dew.  [Ruby 1.9 -
+	  Feature #4667]
 
-Thu Mar 31 22:23:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 13 05:44:19 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/mkmf.rb (SRC_EXT): exclude just case different suffixes on case
-	  insensitive file system platforms.
+	* lib/logger.rb (class Logger):  Document Logger#datetime_format.
+	  Patch by Sergio Gil Perez de la Manga.  [Ruby 1.9 - Bug #4678]
 
-	* README.EXT, README.EXT.ja (Appendix C): utility functions.
+Fri May 13 05:39:11 2011  Eric Hodel <drbrain@segment7.net>
 
-Thu Mar 31 14:15:44 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* re.c (Init_Regexp): Document option constants.  Patch by Vincent
+	  Batts.  [Ruby 1.9 - Bug #4677]
+	* lib/uri/common.rb (module URI):  Documentation for URI.  Patch by
+	  Vincent Batts.  [Ruby 1.9- Bug #4677]
+	* lib/uri/ftp.rb (module URI):  ditto
+	* lib/uri/generic.rb (module URI):  ditto
+	* lib/uri/http.rb (module URI):  ditto
+	* lib/uri/https.rb (module URI):  ditto
+	* lib/uri/ldap.rb (module URI):  ditto
+	* lib/uri/ldaps.rb (module URI):  ditto
+	* lib/uri/mailto.rb (module URI):  ditto
+	* process.c (Init_process):  Document Process constants.  Patch by
+	  Vincent Batts.  [Ruby 1.9- Bug #4677]
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should return
-	  value. [ruby-dev:25971]
+Fri May 13 05:16:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Mar 31 08:25:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rss/atom.rb (module RSS):  Document URIs.  Patch by Mark Turner.
+	  [Ruby 1.9 - #4671]
+	* lib/rss/rss.rb (module RSS):  Document exception classes.  Patch by
+	  Mark Turner.  [Ruby 1.9 - #4671]
 
-	* common.mk (RUBYOPT): clear for the environment RubyGems installed.
+Fri May 13 02:15:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* common.mk (clean-local): keep $(PREP) files till distclean.
+	* io.c (select_internal): remove unused variable (interrupt_flag).
 
-	* common.mk (check): do all tests.
+Thu May 12 18:24:34 2011  Kouhei Sutou  <kou@clear-code.com>
 
-Thu Mar 31 06:00:20 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* configure.in: limit to "T" type for prefix of external symbols
+	  because x86_64-w64-mingw32-gcc on Debian GNU/Linux generates the
+	  following symbol:
+	    0000000068483390 D _GLOBAL__F__conftest_external
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should not raise
-	  error even if the specified engine could not be loaded. (Dynamic
-	  engines don't have fixed name to load.)
+	  Approved by nobu.
 
-Thu Mar 31 00:18:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu May 12 14:50:52 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* win32/ifchange.bat, win32/rm.bat: backported from HEAD.
+	* test/dl/test_base.rb (Fiddle::LIBC_SO): its always msvc*.dll on
+	  mswin/mingw.
 
-Wed Mar 30 23:44:50 2005  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+Thu May 12 14:47:53 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* Makefile.in, */Makefile.sub, */configure.bat,
-	  cygwin/GNUmakefile.in, common.mk, configure.in, ext/extmk.rb,
-	  lib/mkmf.rb, instruby.rb, runruby.rb: backport extout.
-	  [ruby-dev:25963]
+	* lib/mkmf.rb (Logging.postpone): copy only when temporary logfile
+	  exists.
 
-Wed Mar 30 17:41:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu May 12 12:24:22 2011  Nobuhiro Iwamatsu  <iwamatsu@nigauri.org>
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp#_create_console() method to
-	  create a Tcl/Tk's console window.
+	* ext/openssl/ossl_ssl.c: By trunk@31346, function check of SSLv2 is
+	  executed.
+	  However, the problem is not revised in this.
+	  This adds the control of using function of SSLv2 in made macro by
+	  function check.
 
-	* ext/tk/lib/multi-tk.rb: support TclTkIp#_create_console() method.
+Thu May 12 08:10:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/remote-tk.rb: ditto.
+	* lib/set.rb (class Set):  Add nodoc to internal-use methods.  Patch
+	  by Pete Higgins.  [Ruby 1.9 - Bug #4665]
 
-	* ext/tk/lib/tk/console.rb: ditto.
+Thu May 12 08:01:14 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/tk/lib/tk.rb: update RELEASE_DATE
+	* ext/openssl/ossl_pkey_ec.c: Allow encryption when PEM-encoding
+	  Elliptic Curve private keys.
+	  [ruby-core:35329] [Bug #4423]
 
-	* ext/tk/sample/demo-*/check2.rb: use 'return' in the Proc object.
+Thu May 12 07:54:59 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/sample/tkextlib/**: ditto.
+	* object.c (rb_obj_equal):  Add documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4664]
+	* lib/rexml:  ditto
+	* lib/mkmf.rb:  ditto
+	* ext/socket/lib/socket.rb:  ditto
 
-Tue Mar 29 22:11:56 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Thu May 12 07:30:08 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* test/rinda/test_rinda.rb: use DRbObject.new_with instead of reinit.
-	  [ruby-dev:25961]
+	* Various .document files: Update .document files to match files which
+	  have documentation.
 
-Mon Mar 28 23:40:40 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Thu May 12 07:18:45 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/drb/drb.rb: move method DRbObject#reinit to DRbObject.new_with.
-	  extract method DRbObject.prepare_backtrace. add DRb.regist_server,
-	  remove_server, fetch_server. change server in thread variable if
-	  in-proc server. [druby-ja:113]
+	* ext/openssl/ossl_pkey_dsa.c: Use generic X.509 SubjectPublicKeyInfo
+	  format for PEM-encoding DSA public keys.
+	  [ruby-core:35328] [Bug #4422]
 
-	* lib/drb/gw.rb: ditto.
+Thu May 12 06:27:31 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Mon Mar 28 20:43:34 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_pkey_rsa.c: Use generic X.509 SubjectPublicKeyInfo
+	  format for encoding RSA public keys.
+	  [ruby-core:35327] [Bug #4421]
 
-	* ext/syck/rubyext.c: get rid of warnings caused by a bug of VC.
+Wed May 11 19:45:27 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-Mon Mar 28 08:39:49 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/forwardable.rb: support 'delegate :foo => :bar' for to meet
+	  by specification of RDOC.
 
-	* ext/iconv/iconv.c (iconv_create): Iconv::Failure requires 3
-	  arguments.  (pointed out by NaHi)
+Wed May 11 08:36:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Mar 26 22:51:33 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/webrick: Add documentation for WEBrick::HTTPAuth
 
-	* ext/tk/lib/tk.rb (_callback_entry_class?): add for checking whether
-	  a class is available for a callback entry.
+Wed May 11 03:06:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk.rb (after_cancel): add Tk.after_cancel(afterID) method.
+	* lib/rss.rb: Add documentation for RSS.  Patch by Steve Klabnik.
+	  [Ruby 1.9 - Bug #4663]
 
-	* ext/tk/lib/tk.rb (array2tk_list): change from private module method
-	  of TkComm to public module method.
+Tue May 10 14:50:32 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* ext/tk/lib/tk.rb (cget): add check that slot argument is not
-	  empty string.
+	* lib/test/unit.rb: Add option for hiding skip messages when test
+	  ends. #4657
 
-	* ext/tk/lib/tk.rb (configinfo): ditto.
+	* test/testunit/test_hideskip.rb, test/testunit/test4test_hideskip.rb:
+	  test for above.
 
-	* ext/tk/lib/tk/itemconfig.rb (itemcget): add check that slot argument
-	  is not empty string.
+Tue May 10 10:53:04 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/itemconfig.rb (itemconfiginfo): ditto.
+	* common.mk (rdoc): Add rdoc-coverage rule
 
-	* ext/tk/lib/tk/entry.rb: add TkEntry#icursor and icursor= (alias of
-	  cursor and cursor= method).
+Tue May 10 09:13:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/font.rb: improve font treatment when the font name is
-	  empty string.
+	* lib/webrick: Add Documentation
 
-	* ext/tk/lib/tk/variable.rb: add :variable, :window and :procedure
-	  type.
+Tue May 10 04:22:09  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/variable.rb: improve treatment of array-type
-	  tkvariable.
+	* lib/webrick/log.rb: Hide copyright info from ri
+	* lib/webrick/httpstatus.rb: ditto
+	* lib/webrick/htmlutils.rb: ditto
+	* lib/webrick/httpversion.rb: ditto
+	* lib/webrick/version.rb: ditto
+	* lib/webrick/httpauth/userdb.rb: ditto
+	* lib/webrick/httpauth/authenticator.rb: ditto
+	* lib/webrick/accesslog.rb: ditto
 
-	* ext/tk/lib/tkextlib/blt.rb: add commands for zooming.
+Mon May  9 20:57:13 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/tkextlib/blt/*: bug fix.
+	* test/ruby/test_{complex,rational}.rb: added tests.
 
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and add methods
-	  to call TreeCtrl commands for bindings.
+Mon May  9 20:29:44 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/sample/tkextlib/blt/*: new sample scripts.
+	* complex.c (string_to_c_internal): a refactoring.
 
-	* ext/tk/sample/tkextlib/treectrl/*: ditto.
+Mon May  9 18:33:05 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Mar 25 10:53:16 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* string.c: Improve documentation for String#start_with? and
+	  String#end_with?. fixes #4652
+	  patched by Andrew Grimm <andrew.j.grimm at gmail.com>
 
-	* configure.in (WIN32_LEAN_AND_MEAN): removed because a lot of
-	  troubles.  [ruby-list:40721]
+Mon May  9 13:49:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Mar 24 23:10:44 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* complex.c (string_to_c_internal): support scientific notation.
+	  patched by Tinco Andringa. https://github.com/ruby/ruby/pull/16
+	  [ruby-core:36046][Bug #4655]
 
-	* lib/mkmf.rb (macro_defined?): try to compile for an old compiler
-	  which doesn't bail out at #error directive.  [ruby-dev:25818]
+Mon May  9 11:52:48 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/mkmf.rb (check_sizeof): refine logging messages.
+	* numeric.c (int_ord): remove K&R style.
+	  patched by Daehyub Kim. https://github.com/ruby/ruby/pull/17
 
-Thu Mar 24 03:57:48 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun May  8 22:17:24 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/webrick/utils.rb (WEBrick::Utils.create_listeners):
-	  - should raise ArgumentError if no port is specified.
-	  - even if the specified port is 0, all TCPServers should be
-	  initialized with the port given to the first one.
+	* test/ruby/test_{complex2,complexrational}.rb: use skip.
+	* test/date/*.rb: ditto.
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#initialize): if :Port
-	  parameter is 0, it should be updated with the port number which
-	  actually listened.
+Sun May  8 21:02:31 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Mar 23 00:35:10 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/ruby/test_{complex2,complexrational}.rb: NEVER SKIP.
 
-	* test/ruby/test_settracefunc.rb (test_event): added tests for
-	  "class" and "end" and "raise".
+Sun May  8 21:01:21 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Mar 22 22:40:18 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/date/test_date_base.rb: fixed.
 
-	* eval.c (rb_call0): check event_hooks instead of trace_func.
+Sun May  8 20:54:11 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Mar 22 17:30:44 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/date/*.rb: NEVER SKIP.
 
-	* eval.c (rb_add_event_hook): new function to add a hook function for
-	  interpreter events. (backported form HEAD)
+Sun May  8 20:37:33 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Mar 20 22:51:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/date/*.rb: reverted 31432.
 
-	* lib/mkmf.rb (mkmf_failed): check if Makefile is created without
-	  create_makefile.
+Sun May  8 20:32:43 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sat Mar 19 23:48:10 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/date/*.rb: reverted 31483.
 
-	* misc/ruby-mode.el (ruby-expr-beg): returned true always.
-	  fixed: [ruby-list:40683]
+Sun May  8 19:39:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Mar 19 00:41:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c (native_cond_timedwait): add to care EINTR.
+	* thread_pthread.c (thread_timer): remove EINTR check.
 
-	* ext/tk/lib/tk/font.rb: add some TkFont class methods to get font
-	  information without creating a TkFont object.
+Sun May  8 19:04:15 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and define some
-	  classes for components of Tk::TreeCtrl
+	* lib/time.rb (xmlschema): avoid passing any negative numbers.
 
-Thu Mar 17 17:42:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun May  8 18:40:03 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* struct.c (make_struct): allow non local-id field
-	  names. [ruby-core:04575]
+	* ext/date/date_{parse,strptime}.c: introduced some macros.
 
-	* struct.c (inspect_struct): ditto.
+Sun May  8 17:17:13 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Mar 16 23:36:02 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/date/*.rb: use skip /w messages.
 
-	* eval.c (rb_call0): call_cfunc() should be protected.
+Sun May  8 17:04:55 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* test/ruby/test_settracefunc.rb: added test for c-return.
+	* ext/date/lib/date/format.rb (_httpdate): omitted to call zone_to_diff.
 
-Wed Mar 16 22:20:25 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun May  8 16:56:19 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* object.c (str_to_id): fixed typo.
+	* ext/date/date_core.c (date_s_test_*): use macros.
 
-Wed Mar 16 18:08:32 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun May  8 10:24:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_call0): reorganize "return" event post.
+	* thread_pthread.c: cleanup signal_thread_list related ifdef.
+	  1) we don't have to use #ifdef FOO-PLATFORM directly 2) About
+	  half #ifdef didn't care symbian properly.
 
-Tue Mar 15 23:49:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May  8 05:19:37 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/iconv/iconv.c (Init_iconv): InvalidEncoding also should include
-	  Iconv::Failure.
+	* test/io/wait/test_io_wait.rb: Linux socketpair(2) only support
+	  AF_UNIX, but windows socketpair doesn't support it. we can't
+	  avoid platform check. sigh!
 
-Tue Mar 15 16:38:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun May  8 00:13:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/tkutil.c (ary2list): give wrong arguments to hash2kv()
+	* test/io/wait/test_io_wait.rb: use Socket.pair instead of pipe.
+	  Windows can only treat a socket.
 
-Mon Mar 14 19:39:33 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat May  7 22:43:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/timer.rb (TkTimer): forgot to clear @return_value
-	  when restarting
+	* thread.c (rb_fd_zero): remove redundant zero fill.
 
-	* ext/tk/lib/tk/sample/cd_timer.rb: new sample of TkRTTimer
+Sat May  7 22:38:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Mar 14 12:21:03 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread.c (rb_fd_init): remove volatile qualifier.
 
-	* ext/tk/lib/tk/timer.rb (TkRTTimer): forgot to reset the callback
-	  time. So, 'continue' do all callbacks between 'stop' and 'continue'.
+Sat May  7 22:34:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Mar 14 08:14:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_fd_init_copy): new internal api. It provide efficient
+	  copy constructor semantics.
+	* thread.c (do_select): use rb_fd_init_copy().
 
-	* object.c (str_to_id): warn for NUL containing strings.
+Sat May  7 15:18:06 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	fix incorrect native_cond_signal call when deadlock was detected.
 
-Mon Mar 14 00:13:49 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread.c (lock_func): decrement cond_waiting if timeout was happen.
 
-	* ext/tk/lib/tk/timer.rb (TkRTTimer): correct calculation of offset
-	  value. get a little better accuracy.
+Sat May  7 18:28:37 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/demos-en/widget: use a binding with no local variables
-	  when eval a sample script.
+	* thread_pthread.c (USE_MONOTONIC_COND): check the availability
+	  more strictly.
 
-	* ext/tk/sample/demos-en/bind.rb: ditto.
+	* thread_pthread.h (rb_thread_cond_t): ditto.
 
-	* ext/tk/sample/demos-en/tcolor: ditto.
+Sat May  7 15:15:10 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/demos-jp/widget: ditto.
+	fix win32 native_cond_timedwait() makes SIGSEGV.
 
-	* ext/tk/sample/demos-jp/bind.rb: ditto.
+	* thread_win32.h (rb_thread_cond_struct): add prev field instead of
+	  last. (ie cond_event_entry is now using double linked list instead of
+	  single)
+	* thread_win32.c (cond_event_entry): add prev field.
 
-	* ext/tk/sample/demos-jp/tcolor: ditto.
+	* thread_win32.c (__cond_timedwait): remove entry properly if timeout
+	  was happen.
 
-Sun Mar 13 10:04:17 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* thread_win32.c (native_cond_signal): change for double linked list.
+	* thread_win32.c (native_cond_broadcast): ditto.
+	* thread_win32.c (native_cond_initialize): ditto.
 
-	* test/rinda/test_rinda.rb: remove test_gc. [ruby-dev:25871]
+Sat May  7 12:41:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	fix mutex deadlock test hang-up.
 
-Thu Mar 10 19:12:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_win32.c (abs_timespec_to_timeout_ms): fix 1000x calculation
+	  mistake. (ie fix hang-up native_cond_timedwait())
 
-	* ext/tcltklib/tcltklib.c (lib_eventloop_ensure): mis-delete a timer
-	  handler when exit from a recursive called eventloop
+Sat May  7 03:14:13 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/timer.rb: new TkRTTimer class, which can works for a
-	  realtime operation
+	sleep_cond use monotonic time if possible.
 
-	* ext/tk/sample/tkrttimer.rb: sample of TkRTTimer class
+	* thread_pthread.c (native_thread_init): change sleep_cond
+	  attribute to monotonic.
+	* thread_pthread.c (native_sleep): use native_cond_timeout().
 
-	* ext/tk/lib/tk/textmark.rb: move  TkTextMark#+ and TkTextMark#- to
-	  TkText::IndexModMethods
+	* thread_pthread.c (native_cond_timeout): add overflow care.
+	* thread_win32.c (native_cond_timeout): ditto.
 
-	* ext/tk/lib/tk/text.rb: improve TkTextMark#+ and TkTextMark#-, and
-	  add them to TkText::IndexModMethods module
+Sat May  7 02:49:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	  fix win32 compile error.
 
-	* ext/tk/sample/tktextio.rb: add test part of "seek by text index
-	  modifiers"
+	* thread_win32.c (RB_CONDATTR_CLOCK_MONOTONIC): define
+	  RB_CONDATTR_CLOCK_MONOTONIC always.
+	* thread_pthread.c (RB_CONDATTR_CLOCK_MONOTONIC): ditto.
 
-Thu Mar 10 08:10:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat May  7 02:29:41 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (make_regexp): need to free internal regexp structure when
-	  compilation fails.  [ruby-talk:133228]
+	  mutex: deadlock check timeout use monotonic time.
 
-Wed Mar  9 20:25:58 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* thread_pthread.c (native_cond_timeout): new internal api.
+	  it calculate a proper time for argument of native_cond_timedwait().
+	* thread_win32.c (native_cond_timeout): ditto.
 
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_write): call
-	  rb_sys_fail if errno isn't 0. [ruby-dev:25831]
+	* thread_pthread.c (thread_timer): use native_cond_timeout()
+	  instead of get_ts.
+	* thread.c (lock_func): ditto.
 
-	* ext/openssl/lib/openssl/cipher.rb: fix typo. [ruby-dev:24285]
+	* thread_pthread.c (get_ts): removed. use native_cond_timeout().
+	* thread.c (init_lock_timeout): ditto.
 
-Wed Mar  9 15:46:35 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat May  7 01:54:21 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#start): should
-	  restore @token if accept failure. suggested by Dominique Brezinski.
-	  [ruby-core:04518]
+	* thread_pthread.c (get_ts): add monotonic clock capability.
+	* thread_pthread.c (rb_thread_create_timer_thread): use monotonic
+	  clock if possible.
 
-Wed Mar  9 13:37:57 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat May  7 01:43:37 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/tktextio.rb: fix bug of handling 'end' position.
-	  support initial text, overwrite setting and pos_gravity control.
+	* thread_pthread.h (rb_thread_cond_t): add clockid field. it's
+	  no longer an alias of pthread_cond_t.
+	* thread_pthread.c: adapt new rb_thread_cond_t type.
+	* thread.c (mutex_alloc): ditto.
+	* thread_win32.c (native_cond_initialize): ditto.
+	* configure.in: add check for pthread_cond_attr_setclock() and
+	  clockid_t type.
 
-Tue Mar  8 18:16:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri May  6 23:29:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/tktextio.rb: New sample script. TkTextIO class in this
-	  sample supports to use a text widget as if it is a I/O stream (such
-	  like as StringIO class).
+	* thread.c (rb_wait_for_single_fd): use ppoll() instead of poll()
+	  if possible. based on a patch from Eric Wong. [ruby-core:36003].
 
-Tue Mar  8 13:54:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri May  6 23:13:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c: workaround for some of 4.4BSD-Lite derived OSs.
+	* configure.in: remove nanosleep check. we no longer use it.
+	  r20124 removed last usage.
 
-Tue Mar  8 12:36:17 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri May  6 22:35:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c: document from Sam Roberts
-	  <sroberts@uniserve.com> for getsockopt and setsockopt is merged.
-	  [ruby-doc:824]
+	* ext/syck/rubyext.c (mktime_do): extra digits are not used.
 
-Tue Mar  8 01:27:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri May  6 17:43:07 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.66
-	  fixed: [ruby-dev:25828]
+	* ext/syck/rubyext.c (mktime_do): remove unused variable offset.
 
-Mon Mar  7 21:35:02 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/syck/syck.h: use #ifdef instead of #if DEBUG.
 
-	* sample/webrick/httpsd.rb: fix typo in comment. suggested by
-	  Kazuhiko Shiozaki.
+Fri May  6 16:27:33 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Mar  7 14:55:43 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/date/date_core.c (DAY_IN_NANOSECONDS): refix: 31438.
+	  check with LONG_MAX and cast as long; without this the calculation
+	  will be done as int and overflow.
 
-	* eval.c (block_pass): should not push unique number if a block is
-	  not an orphan.  [ruby-dev:25808]
+Fri May  6 15:01:11 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Wed Feb 16 02:55:21 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/syck/rubyext.c (mktime_do): avoid buffer overrun, by
+	  silently ignoring lesser significant digits.  Required buffer
+	  length can be computable so you might at first think of
+	  allocating enough memory space on the fly using alloca().  That
+	  is a wrong idea because when using alloca there is always risk
+	  of integer overflow.  A function that accepts outer-process
+	  resources like this should not blindly trust its inputs.  In
+	  this particular case we just want to generate milliseconds
+	  resolution by strtod() so the string in question needs no more
+	  length than what we originally have.  Ignoring lesser
+	  significant digits should suffice I believe.
 
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_read,
-	  ossl_ssl_write):
-	  - need to set errno on Win32 platform.
-	  - should call rb_sys_fail instead of rasing SSLError if
-	    SSL_ERROR_SYSCALL occured.
-	  - should wait for that the underlying IO become readable or
-	    writable if the error was SSL_ERROR_WANT_READ or
-	    SSL_ERROR_WANT_WRITE. [ruby-dev:25795]
+Fri May  6 14:25:53 2011  Tinco Andringa <mail@tinco.nl>
 
-	* ext/openssl/lib/openssl/buffering.rb
-	  (Buffering#initialize): should set @eof and @rbuffer.
-	  (Buffering#fill_rbuff): should rescue Errno::EAGAIN.
-	  (Buffering#consume_rbuf): pointless eof flag resetting is deleted.
-	  (Buffering#read): should return an empty string if the specified
-	  size is zero.
-	  (Buffering#readpartial): new method.
-	  (Buffering#readline): fix typo.
-	  (Buffering#getc): return the first character of string correctly.
-	  (Buffering#each): fix typo.  suggested by Brian Ollenberger.
-	  (Buffering#readchar): fix typo.
-	  (Buffering#eof?): should read again it the input buffer is empty.
-	  (Buffering#do_write): should rescue Errno::EAGAIN.
-	  (Buffering#puts): use "\n" as the output field separator.
+	* ext/syck/rubyext.c (mktime_do): YAML.load time correctly parse
+	  usecs smaller than 1 fixes #4571
 
-	* ext/openssl/lib/openssl/ssl.rb: set non-blocking flag to the
-	  underlying IO.
+Thu May  5 22:23:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/openssl/extconf.rb: get rid of GNUmakefile generation.
+	* thread_pthread.c (native_mutex_reinitialize_atfork): removed
+	  unused macro.
+	* thread_win32.c (native_mutex_reinitialize_atfork): ditto.
 
-	* text/openssl/test_pair.rb: test for IO like methods.
+Thu May  5 22:09:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/ut_eof.rb: test about empty file.
+	* ext/date/date_core.c (DAY_IN_NANOSECONDS): long long int is not
+	  available on all platforms.
 
-Mon Mar  7 10:22:06 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu May  5 17:36:31 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/un.rb: should use OptionParser. (backported form HEAD)
+	* eval.c (frame_func_id): store result of method_entry_of_iseq() to
+	  cfp->me because method_entry_of_iseq() might become expensive.
 
-Mon Mar  7 09:18:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu May  5 15:03:51 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* string.c (rb_str_cmp_m): should not return false but nil.
-	  fixed: [ruby-dev:25811]
+	* eval.c (frame_func_id): __method__ return different name from
+	  methods defined by Module#define_method with a same block.
+	  [ruby-core:35386] fixes #4606
+	* eval.c (method_entry_of_iseq): new helper function. search control
+	  frame stack for a method entry which has given iseq.
+	* test/ruby/test_method.rb: add tests for #4606
 
-Mon Mar  7 01:22:14 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed May  4 22:13:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/tkutil.c: remove the some codes which depend on the
-	  difference between Ruby1.8 and 1.9, because st.c on Ruby1.9
-	  was changed.
+	* benchmark/bm_vm4_pipe.rb: Reduced iterations. Too slow benchmark
+	  is bad.
+	* benchmark/bm_vm4_thread_pass.rb: ditto.
 
-Mon Mar  7 00:01:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed May  4 22:08:22 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: fail to call TclTkLib.mainloop when $SAFE==4
+	* test/date/test_date_base.rb: don't use no message skip().
 
-Sun Mar  6 16:41:33 2005  Minero Aoki  <aamine@loveruby.net>
+Wed May  4 21:11:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/net/http.rb: HTTPHeader holds its header fields as an array
-	  (backport from CVS HEAD rev 1.112-1.123). [ruby-list:40629]
+	* benchmark/bm_io_select2.rb: reduce number of using file
+	  descriptors. because gdb need some fds.
 
-	* test/net/http/test_httpheader.rb: new file.
+Wed May  4 19:00:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Mar  6 11:47:10 2005  Sam Roberts  <sroberts@uniserve.com>
+	* thread.c (rb_wait_for_single_fd): Fix wrong return value.
+	* test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb
+	  (TestWaitForSingleFD#test_wait_for_closed_pipe): test for it.
 
-	* lib/pp.rb: rdoced.  [ruby-core:4490]
+Wed May  4 18:46:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Mar  6 11:36:37 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/-test-/wait_for_single_fd: New. for testing
+	  rb_wait_for_single_fd() internal function.
+	  The patch was written by Eric Wong. [ruby-core:35991]
 
-	* lib/pp.rb (File::Stat#pretty_print): Etc.getpwuid and Etc.getgrgid
-	  may return nil.  [ruby-talk:129826]
-	  reported by Daniel Berger.
+	* test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb: ditto.
 
-Sat Mar  5 18:06:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed May  4 12:46:25 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* dir.c (fnmatch): removed unnecessary code. (ruby_1_8 didn't have
-	  String#clear, so [ruby-dev:24749] didn't affect it)
+	* thread.c (rb_wait_for_single_fd): Added POLLNVAL check.
+	  based on a patch from Eric Wong at [ruby-core:35991].
 
-	* win32/win32.c (NtInitialize): ditto. (by numeric.c 1.101.2.14)
+Wed May  4 11:51:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Mar  5 16:29:26 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* io.c (rb_f_select): remove useless ifdef.
 
-	* ext/tk/lib/multi-tk.rb: freeze callback-entry objects
+Wed May  4 11:42:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib/tile.rb: support tile-0.6
+	* ext/socket/init.c (wait_connectable): fix error handling code.
+	  RB_WAITFD_OUT is turned on even though an error occur.
 
-Fri Mar  4 19:39:28 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May  4 10:12:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#do_includes): replace
-	  also locally defined modules.
+	* ext/readline/readline.c (readline_event): use rb_wait_for_single_fd().
+	The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-	* ext/iconv/iconv.c: backport Iconv::InvalidEncoding from CVS HEAD.
+Wed May  4 10:10:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/strscan/strscan.c: moved misplaced rdoc.
+	* ext/socket/init.c (wait_connectable): use rb_wait_for_single_fd().
+	  The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-Fri Mar  4 15:58:12 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/init.c (try_wait_connectable, wait_connectable_ensure):
+	  removed.
 
-	* lib/cgi-lib.rb: add deprecation warning. [ruby-dev:25499]
-	  getopts.rb, parsearg.rb, importenv.rb as well.
+Wed May  4 10:07:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Mar  4 11:17:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/io/wait/wait.c (io_wait): use rb_wait_for_single_fd().
+	  The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-	* ext/tcltklib/tcltklib.c (ip_rbUpdateCommand): get rid of
-	  warnings with Tcl/Tk 8.3 or former (backport from CVS_HEAD).
+Wed May  4 10:01:27 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (ip_rb_threadUpdateCommand): ditto.
+	* thread.c (rb_wait_for_single_fd): new. poll(2) based backend for
+	  rb_wait_for_single_fd().
+	  Now only Linux uses it.
 
-Fri Mar  4 10:15:30 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-	* lib/set.rb (SortedSet::setup): a hack to shut up warning.
-	  [ruby-talk:132866]
+Wed May  4 09:56:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Mar  4 07:07:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+	* thread.c (rb_wait_for_single_fd): new.
+	* thread.c (select_single): select(2) based backend for
+	  rb_wait_for_single_fd().
 
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.63
+	* io.c (make_writeconv): use rb_wait_for_single_fd() instead of
+	  rb_thread_fd_select().
+	* io.c (rb_io_wait_readable): ditto.
+	* thread.c (rb_thread_wait_fd_rw): ditto.
 
-Thu Mar  3 23:49:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+	* io.c (wait_readable): removed.
+	* thread.c (init_set_fd): new helper function.
+	* include/ruby/io.h (RB_WAITFD_IN, RB_WAITFD_PRI, RB_WAITFD_OUT):
+	  new constant for rb_single_wait_fd().
 
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.62
+	The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-Thu Mar  3 11:49:51 2005  Kouhei Sutou  <kou@cozmixng.org>
+Wed May  4 08:04:59 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* sample/rss/tdiary_plugin/rss-recent.rb: added site information.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix time dumping so that
+	  Syck can load UTC times that Psych dumps.
 
-Wed Mar  2 19:53:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May  4 07:33:00 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/extmk.rb (parse_args): add DESTDIR only when not directed
-	  already.  fixed: [ruby-dev:25781]
+	* thread.c (rb_fd_copy): fix wrong argument.This issue was pointed
+	  out by Eric Wong. [ruby-core:35982]
 
-Wed Mar  2 17:14:18 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue May  3 20:29:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (lib_eventloop_core): fix typo
+	* test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
+	  Skip sticky bit test if the platform is FreeBSD. It doesn't allow to
+	  change sticky bit if a target is regular file.
 
-Wed Mar  2 16:00:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue May  3 18:23:57 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* ext/tcltklib/tcltklib.c: enforce thread-check and exception-handling
-	  to avoid SEGV trouble.
-	  [KNOWN BUG] When supports pthread and running multiple Tk
-	  interpreters, an interrupt signal causes SEGV frequently. That
-	  may be a trouble of Ruby's signal handler.
+	* test/date/test_date.rb (TestDate#test_coerce):
+	  test for [ruby-core:35127].
 
-	* ext/tk/tkutil/tkutil.c; fix a bug on converting a SJIS string array
-	  to a Tcl's list string.
+Tue May  3 04:27:53 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/tcltklib.c: wrap Tcl's original "namespace" command to
-	  protect from namespace crash.
+	* thread.c (rb_thread_select): preserve errno if no error
+	  occurred.
 
-	* ext/tk/lib/multi-tk.rb: enforce exception-handling.
+Tue May  3 03:57:04 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: catch IRB_EXIT to work on irb.
+	* include/ruby/intern.h (rb_w32_fdcopy): add prototype.  fixes
+	  #4640
 
-	* ext/tk/lib/tk.rb: ditto.
+Mon May  2 01:02:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/tcltklib.c: add TclTkLib.mainloop_thread?
+	* lib/fileutils.rb (FileUtils#chmod): accept symbolic mode argument.
+	  The patch was written by takkanm. [ruby-core:26029][Feature #2190]
 
-	* ext/tk/lib/multi-tk.rb: (bug fix) callback returns a value.
+	* lib/fileutils.rb (FileUtils#fu_mode): new helper function.
+	* lib/fileutils.rb (FileUtils#symbolic_modes_to_i): ditto.
+	* lib/fileutils.rb (FileUtils#mode_mask): ditto.
+	* lib/fileutils.rb (FileUtils#user_mask): ditto.
 
-	* ext/tk/lib/tk/canvas.rb (delete): bug fix when multiple arguments.
+	* test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
+	  new test for the above symbolic mode.
+	* test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_R): ditto.
 
-	* ext/tk/lib/clock.rb: fix 'no method error'.
+Mon May  2 00:36:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/clock.rb (self.clicks): accept a Symbol argument.
+	* ext/socket/init.c (rsock_connect): add to care EINTR. based
+	  on a patch from Eric Wong at [ruby-core:35621][Bug #4555]
 
-	* ext/tk/lib/variable.rb: be able to set default_value_type; :numeric,
-	  :bool, :string, :symbol, :list, :numlist or nil (default; same to
-	  :string). If set a type, TkVariable#value returns a value of the
-	  type.
+Sun May  1 01:06:24 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib/tclx/tclx.rb: add Tk::TclX.signal to warn the
-	  risk of using TclX extension's 'signal' command.
+	* thread.c (rb_thread_select): release GVL while waiting select().
 
-	* ext/tk/sample/irbtk.rb: irb with Ruby/Tk.
+Sat Apr 30 23:10:15 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/demos-*/anilabel.rb: bug fix on 'show code'
+	* win32/win32.c (rb_w32_fdcopy): New. This can copy even though
+	  fdset size exceed FD_SETSIZE.
+	* include/ruby/intern.h (rb_fd_copy): use rb_w32_fdcopy()
 
-	* ext/tk/sample/demos-*/aniwave.rb: new Ruby/Tk animation demo.
+Sat Apr 30 20:18:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/demos-*/pendulum.rb: ditto.
+	* thread.c (do_select): Change argument type to rb_fdset_t.
+	  Now do_select() is free from unexpected hangup if
+	  HAVE_RB_FD_INIT=1 [Bug #4636]
 
-	* ext/tk/sample/demos-*/goldberg.rb: ditto.
+	* thread.c (rb_thread_fd_select, rb_thread_wait_fd_rw):
+	  adapt new argument type.
 
-	* ext/tk/sample/demos-*/widget: add entries of animation demos.
+	* thread.c (rb_thread_select): make dummy implementation.
 
-Tue Mar  1 00:47:43 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sat Apr 30 20:16:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* test/rinda/test_rinda.rb: backport from CVS_HEAD. use
-	  MockClock.sleep instead of Kernel.sleep [ruby-dev:25387]
+	* thread.c (rb_fd_copy): Change function argument. Now
+	  rb_fd_copy() has fully copy semantics.
+	* include/ruby/intern.h: ditto.
 
-Tue Mar  1 00:34:24 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sat Apr 30 20:11:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rinda/tuplespace.rb (Rinda::TupleSpace): improved keeper thread.
+	* include/ruby/intern.h (rb_thread_select): mark as deprecated.
 
-	* test/rinda/test_rinda.rb: ditto.
+	* ext/io/wait/wait.c (wait_readable): use rb_thread_fd_select
+	  instead of rb_thread_select.
+	* ext/socket/init.c (wait_connectable0): ditto.
+	* ext/readline/readline.c (readline_event): ditto.
+	* io.c (rb_io_wait_readable, wait_readable, rb_io_wait_writable,
+	  wait_writable): ditto.
 
-Mon Feb 28 11:42:23 2005  Ian Macdonald  <ian@caliban.org>
+Sat Apr 30 20:06:36 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* exception error messages updated.  [ruby-core:04497]
+	* thread.c (do_select): remove useless ifdef. time calculation
+	  is not heavy weight.
 
-Mon Feb 28 09:03:09 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Apr 30 16:48:36 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c (Init_socket): add bunch of Socket
-	  constants.  Patch from Sam Roberts <sroberts@uniserve.com>.
-	  [ruby-core:04409]
+	* benchmark/bm_io_select3.rb: New.
 
-Wed Feb 23 15:04:32 2005  akira yamada  <akira@ruby-lang.org>
+Sat Apr 30 16:27:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/uri/generic.rb (split_userinfo): should split ":pass" into ""
-	  and "pass".  [ruby-dev:25667]
+	* io.c (copy_stream_body, rb_io_s_copy_stream): move rb_fd_init()
+	  from copy_stream_body to rb_io_s_copy_stream. fds of passing
+	  rb_fd_term() have to be guaranteed initialized.
 
-Wed Feb 23 08:00:18 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Apr 30 16:13:17 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* array.c (rb_ary_s_create): no need for negative argc check.
-	  [ruby-core:04463]
+	* benchmark/bm_io_select.rb, benchmark/bm_io_select2.rb: New.
+	  based on a patch from Eric Wong at [Feature #4531]
 
-	* array.c (rb_ary_unshift_m): ditto.
+Sat Apr 30 03:25:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Feb 23 01:57:46 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/io/wait/test_io_wait.rb: New. for testing ext/io/wait.
+	  the patch was written by Eric Wong. [Feature #4531]
 
-	* lib/net/imap.rb (initialize): handle certs correctly. Thanks,
-	  NABEYA Kenichi. (backported from CVS HEAD)
+Sat Apr 30 00:34:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Feb 22 07:25:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* include/ruby/win32.h: remove redundant declaration of
+	  rb_w32_time_subtract().
 
-	* parse.y (parser_yylex): identfier after dot must not be a variable.
+Sat Apr 30 00:16:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Feb 21 10:04:49 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread_pthread.c (gvl_init): fix hangup if GVL_SIMPLE_LOCK=1.
+	  We don't have to call mutex_unlock() before initialize it!
 
-	* {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
+Fri Apr 29 13:15:15 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* win32/win32.[ch] (fcntl): ditto.
+	* thread_win32.c (native_cond_timedwait): New. r31373 caused
+	  win32 build failure.
 
-	* win32/win32.c (rb_w32_connect): support nonblocking mode.
+	* thread_win32.c (__cond_timedwait, abs_timespec_to_timeout_ms):
+	  New helper functions.
 
-	* ext/socket/socket.c (wait_connectable, ruby_connect): support
-	  nonblocking connect on various platforms.
-	  all changes are backported from CVS HEAD. [ruby-core:3154],
-	  [ruby-core:4364].
+	* win32/win32.c (rb_w32_time_subtract): rename from subtract and
+	  remove static.
 
-Sun Feb 20 00:48:48 2005  Tanaka Akira  <akr@m17n.org>
+Fri Apr 29 10:43:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/open-uri.rb (URI::FTP#buffer_open): access mechanism
-	  re-implemented according to RFC 1738.
-	  reported by Guillaume Marcais.  [ruby-talk:131650]
+	* benchmark/bm_vm4_pipe.rb: Add two new benchmark for GVL
+	  performance. They was written by Koichi Sasada.
+	* benchmark/bm_vm4_thread_pass.rb: ditto.
 
-Sat Feb 19 18:11:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Fri Apr 29 10:25:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/drb/drb.rb (DRbObject#respond_to?): take two arguments.
-	  [ruby-dev:25722]
+	* vm_method.c (rb_clear_cache_by_class): Revert r29673. It made
+	  a segmentation fault regression. [Bug #4289][ruby-core:34554].
 
-	* test/drb/drbtest.rb: ditto.
+Fri Apr 29 10:24:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Feb 19 13:52:02 2005  Tanaka Akira  <akr@m17n.org>
+	* io.c (make_writeconv): do not add textmode newline decorator if any
+	  newline decorator is set already.  fixes #4618, fixes #4619
 
-	* lib/open-uri.rb: call OpenSSL::SSL::SSLSocket#post_connection_check
-	  after connection is made.
+Fri Apr 29 10:17:42 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Feb 19 01:32:03 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* thread.c (lock_func): small cleanup.
 
-	* ext/bigdecimal/lib/bigdecimal/newton.rb: resolved LoadError.
-	  [ruby-dev:25685]
+Fri Apr 29 10:07:13 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/bigdecimal/sample/linear.rb: ditto.
+	* thread.c (rb_mutex_lock, lock_func): Avoid busy loop and
+	  performance regression. bm_vm3_thread_mutex.rb performance
+	  change from 109.064sec to 16.331sec. [Feature #4607]
 
-	* ext/bigdecimal/sample/nlsolve.rb: ditto.
+	* thread.c (init_lock_timeout): New helper function.
 
-	* ext/bigdecimal/lib/bigdecimal/nlsolve.rb: removed because this file
-	  is sample script and same file exists in ext/bigdecimal/sample.
+Thu Apr 28 16:15:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Feb 18 17:14:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/{win32.c,dir.h} (rb_w32_uopendir): new API to pass UTF-8 path.
 
-	* lib/xmlrpc/parser.rb (XMLRPC::FaultException): make it subclass
-	  of StandardError class, not Exception class.  [ruby-core:04429]
+	* win32/win32.c (opendir_internal, rb_w32_opendir): extract and merge
+	  common part of rb_w32_opendir() and rb_w32_uopendir().
 
-Thu Feb 17 20:11:18 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* dir.c (do_opendir, glob_helper): encoding.
 
-	* lib/drb/drb.rb (DRbServer.default_safe_level): fix typo.
+	* dir.c (dir_initialize, do_opendir): convert path to UTF-8 and call
+	  rb_w32_uopendir() instead of rb_w32_opendir() on Windows.
+	  fixes #4491, reported by Joey Zhou.
 
-Thu Feb 17 20:11:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Apr 28 15:32:53 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/digest/test_digest.rb: separate test case for each algorithms.
-	  [ruby-dev:25412]
+	* test/dl/test_base.rb (DL::LIBC_SO): its always msvc*.dll on
+	  mswin/mingw.
 
-Thu Feb 17 11:54:00 2005  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Thu Apr 28 06:07:06 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/collector.rb (collect_file): now deletes paths added
-	  to $LOAD_PATH instead of restoring it verbatim.
+	* lib/csv.rb (CSV::open): suppress universal newline decorator.
+	  fixes #4603
 
-	* lib/test/unit/autorunner.rb (AutoRunner.run): fixed so that
-	  'ruby -rtest/unit -rtest1 -rtest2 -e0' will use the objectspace
-	  collector again. Also tried to simplify the calling convention.
+	* lib/csv.rb (CSV.read): no mode is needed.
 
-	* test/runner.rb: adjusted for new AutoRunner semantics.
+Thu Apr 28 06:06:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit.rb: ditto.
+	* io.c (rb_io_extract_modeenc, rb_f_backquote): set default text
+	  mode.  fixes #4619
 
-Thu Feb 17 04:21:47 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (pipe_open): set universal newline decorator if needed.
 
-	* lib/open3.rb (Open3::popen3): $? should not be EXIT_FAILURE.
-	  fixed: [ruby-core:04444]
+Wed Apr 27 11:33:08 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Feb 17 00:09:45 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* enc/trans/emoji_iso2022_kddi.trans: ISO-2022-JP-KDDI doesn't have
+	  CP932 UDA. Another reason is emacs-mule: the implementation of
+	  stateless-iso-2022-jp doesn't support beyond 94x94 (0x7fxx);
+	  but CP932 UDA is in 7Fxx-92xx.
 
-	* test/drb/ignore_test_drb.rb: move TestDRbReusePort to new file
-	  [ruby-dev:25238]
+Wed Apr 27 07:42:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/drb/test_drb.rb: add method DRbService.ext_service, move
-	  TestDRbReusePort to new file [ruby-dev:25238]
+	* configure.in (STRIP): use proper toolchain.  based on a patch
+	  from Jon Forums at [ruby-core:35909].  fixes #4617
 
-	* test/drb/test_drb.rb: ditto.
+Wed Apr 27 01:20:59 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* test/drb/test_drbssl.rb: ditto.
+	* ext/date/date_core.c (date_zone_to_diff): renamed.
+	* ext/date/date_parse.c: ditto.
+	* ext/date/date_strptime.c: ditto.
 
-	* test/drb/test_drbunix.rb: ditto.
+Wed Apr 27 01:16:59 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/drb/ut_drb.rb: reduce sleep.
+	* encoding.c (enc_find): accept Encoding objects.
 
-Thu Feb 17 00:02:27 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Apr 27 00:55:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (is_defined): NODE_IASGN is an assignment.
+	* transcode.c (econv_opts): add newline option.
 
-Wed Feb 16 23:34:30 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* io.c (validate_enc_binmode, rb_io_extract_modeenc): set newline
+	  decorator according to open mode.
 
-	* lib/drb/drb.rb: add lazy stop_service. ([druby-ja:109])
+	* transcode.c (rb_econv_prepare_options): new function, to prepare
+	  econv options with newline flags.
 
-	* lib/drb/extserv.rb: ditto.
+	* include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_MASK): add.
 
-Wed Feb 16 17:07:57 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Apr 27 00:51:01 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/tkutil.c: Follow the change of st.c (st_foreach)
-	  [ruby-list:40623].
-	  Sometimes mis-convert from a Ruby's Array of SJIS Strings, which
-	  includes some kind of SJIS characters, to a Tcl's UTF8 list string.
+	* file.c (rb_file_truncate): fix function.
 
-Mon Feb 14 23:58:17 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* include/ruby/win32.h (ftruncate, truncate, ftello, fseeko): non-64
+	  versions on mingw are useless because they use int32_t.  fixes #4564
 
-	* lib/rss/parser.rb (RSS::ListenerMixin::tag_end):
-	  fixed invalid namespace handling bug.
+Wed Apr 27 00:50:33 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Feb 14 13:12:38 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/date/date_core.c: modified validation methods.
+	* ext/date/lib/date.rb: ditto.
 
-	* ext/openssl/lib/openssl/ssl.rb
-	 (OpenSSL::SSL::SSLSocket#post_connection_check): new method.
+Wed Apr 27 00:00:37 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Feb 14 00:40:49 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/date/date_core.c (dt_lite_set_tmx): should get df value.
 
-	* lib/drb/drb.rb (InvokeMethod.perform): pass DRb info to sub thread.
+Tue Apr 26 22:34:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* test/drb/test_drb.rb (test_01_safe1_safe4_eval): fix test case.
+	* ext/date/lib/date/format.rb (_iso8601): allowed day only civil
+	  date.  disallowed separatorless day only ordinal date.
 
-Sun Feb 13 23:13:46 2005  Kouhei Sutou  <kou@cozmixng.org>
+Mon Apr 25 21:31:36 2011  Nobuhiro Iwamatsu  <iwamatsu@nigauri.org>
 
-	* lib/rss/dublincore.rb (RSS::DublicCoreModel#date{,=}): added
-	  convenient methods.
+	* ext/openssl/extconf.rb: Should check SSLv2_*method.
+	  openssl compiled with "no-ssl2" the extconf don't fail
+	  when running `make' having this compilation errors.
+	  Patched by Laurent Arnoud. fixes #4562, #4556
 
-	* lib/rss/0.9.rb (RSS::Rss::Channel#date{,=}): ditto.
+Mon Apr 25 20:53:32 2011  Tajima, Akio <artonx@yahoo.co.jp>
 
-	* lib/rss/2.0.rb (RSS::Rss::Channel::Item#date{,=}): ditto.
+	* win32/win32.c (kill): accept 0 only sig is SIGINT #4596
 
-	* test/rss/: added tests for the convenient methods.
+Mon Apr 25 19:59:47 2011  Tajima, Akio <artonx@yahoo.co.jp>
 
-Sun Feb 13 22:43:03 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* win32/win32.c (kill): accept 0 as pid, fixes #4596
 
-	* lib/drb/drb.rb (DRbServer): add default_safe_level, safe_level,
-	  config[:safe_level] ([druby-ja:120])
+Mon Apr 25 16:43:45 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/drb/test_drb.rb, ut_eval.rb, ut_safe1.rb: ditto.
+	* random.c (random_rand): remove unused variables.
 
-Sun Feb 13 16:56:52 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* struct.c (rb_struct_define_without_accessor): ditto.
 
-	* lib/webrick/cgi.rb (WEBrick::CGI.start): should set reason-phrase
-	  to the value of status header field. ([ruby-dev:40617])
+	* strftime.c (rb_strftime_with_timespec): ditto.
 
-Sun Feb 13 00:52:33 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* sprintf.c: ditto.
 
-	* lib/erb.rb (ERB::Util.h, u): make it module_function.
+	* time.c (time_asctime): remove useless GetTimeval().
 
-Sat Feb 12 17:29:19 2005  Tanaka Akira  <akr@m17n.org>
+	* thread_pthread.c: cast to (void *) for %p.
 
-	* lib/open-uri.rb (OpenURI.open_loop): send authentication only for
-	  the URI directly specified.
+Mon Apr 25 11:02:11 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Feb 12 15:07:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/ripper/lib/ripper/sexp.rb: fix rdoc around sexp.
+	  patched by Sho Hashimoto. fixes #4599
 
-	* random.c (rand_init): suppress warning.
+Mon Apr 25 08:24:04 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Sat Feb 12 13:54:03 2005  Tanaka Akira  <akr@m17n.org>
+	* random.c (rb_f_rand, random_s_rand): RDocs for them.
 
-	* lib/open-uri.rb: support https if the platform provides CA
-	  certificates.
+Mon Apr 25 07:18:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Sat Feb 12 06:18:28 2005  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* random.c (random_s_rand, Init_Random): Random.rand should behave as
+	  Random::DEFAULT.rand rather than Kernel#rand.
 
-	* ext/etc/etc.c (Init_etc): sGroup needs HAVE_ST_GR_PASSWD check.
-	  [ruby-dev:25675]
+	* random.c (rand_range, random_rand): rand_range function extracted
+	  from random_rand function.
 
-Fri Feb 11 17:40:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* random.c (rb_f_rand): accept a Range argument as Random#rand
+	  [ruby-dev:43427] #4605
 
-	* ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths):
-	  new method OpenSSL::X509::Store#set_default_paths.
+Mon Apr 25 03:31:06 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Feb 11 11:33:53 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/time.rb: require 'date'.
+	* ext/date/lib/date/format.rb: removed require line.
 
-	* lib/open-uri.rb (URI::HTTP#proxy_open): new option supported:
-	  :http_basic_authentication.
-	  suggested by Kent Sibilev.  [ruby-core:4392]
+Mon Apr 25 03:08:39 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Feb 11 06:30:07 2005  George Ogata  <g_ogata@optushome.com.au>
+	* ext/date/lib/date/format.rb: require 'date'.
 
-	* misc/ruby-mode.el: ignore parenthesis inside heredoc.
-	  [ruby-core:04415]
+Mon Apr 25 03:04:16 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Feb 11 04:54:13 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+	* ext/date/lib/date/format.rb (_iso8601): added a pattern.
 
-	* lib/rdoc/generators/html_generator.rb: [ruby-core:04412]
+Mon Apr 25 02:51:22 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/generators/ri_generator.rb: ditto.
+	* ext/date/lib/date/format.rb: require 'date_core.so'.
+	  date/format needs methods which are now in date_core.so.
+	  This breaks make rdoc which uses Date._parse from time.rb.
 
-Thu Feb 10 11:14:17 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Apr 25 02:47:46 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* win32/Makefile.sub (COMMON_HEADERS): shouldn't include winsock2.h.
+	* ext/date/lib/date/format.rb (_iso8601): fixed a bug of regex.
 
-	* ext/socket/extconf.rb (sockaddr_storage): remove workaround for
-	  mswin32.
+Mon Apr 25 02:12:26 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Feb 10 10:29:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/date/lib/date/format.rb: an adjustment of regex.
 
-	* ext/curses/curses.c: don't need to check HAVE_WCOLOR_SET excluding
-	  window_color_set().
+Mon Apr 25 01:58:50 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Feb 10 00:47:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/date/lib/date/format.rb: omitted to call _parse.
 
-	* struct.c (make_struct): fixed: [ruby-core:04402]
+Mon Apr 25 01:03:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Feb  9 08:07:08 2005  Paul Duncan  <pabs@pablotron.org>
+	* string.c (rb_to_id): remove unused variable.
 
-	* ext/curses/curses.c (window_color_set): [ruby-core:04393]
+Sun Apr 24 22:19:05 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Feb  8 23:51:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* complex.c, rational.c: omitted some method calls.
 
-	* lib/drb/drb.rb: reject :instance_eval, :class_eval, :module_eval
-	  [druby-ja:117]
+Sun Apr 24 02:57:27 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Feb  8 13:06:12 2005  Sam Roberts  <sroberts@uniserve.com>
+	* ext/date/date_parse.c (n2i): takes long.
 
-	* ext/socket/socket.c (Init_socket): SO_REUSEPORT added.
-	  [ruby-talk:130092]
+Sun Apr 24 02:51:06 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Feb  8 09:30:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/date/date_parse.c: reverted.
 
-	* lib/cgi.rb (CGI::Cookie): [ruby-talk:130040]
+Sun Apr 24 02:25:23 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Feb  8 00:19:02 2005  Tanaka Akira  <akr@m17n.org>
+	* include/ruby/intern.h: pcc can't use __builtin_constant_p.
 
-	* lib/resolv.rb (Resolv::DNS::Name#subdomain_of?): new method.
-	  (Resolv::DNS::Name#inspect): ditto.
-	  Suggested by Sam Roberts.  [ruby-talk:129086]
+	* vm_exec.c: change condition.
 
-Mon Feb  7 10:06:30 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Apr 24 01:58:01 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* object.c: [ruby-doc:818]
+	* ext/date/date_core.c (leap_p): suppress warning: parentheses.
 
-Mon Feb  7 01:56:20 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/date/date_core.c (date_s__parse_internal): remove unused
+	  variable "str".
 
-	* instruby.rb, rubytest.rb (srcdir): no longer embed srcdir into
-	  rbconfig.rb. (backported from CVS HEAD)
+	* ext/date/date_parse.c (parse_ddd_cb): use RSTRING_LENINT.
 
-	* ext/socket/extconf.rb (sockaddr_storage): winsock2.h have the
-	  definition of struct sockaddr_storage, but socket.c doesn't
-	  include it because this version of ruby still has binary level
-	  compatibility with winsock1.
+	* ext/date/date_strftime.c (date_strftime_with_tmx): remove unused
+	  variable.
 
-	* lib/mkmf.rb (create_makefile): should support header files in
-	  depend file.
+Sun Apr 24 00:34:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Feb  7 01:21:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/date/date_parse.c: removed some unused macros.  use strchr()
+	  instead of index().
 
-	* ext/socket/extconf.rb: check if getaddrinfo() works fine only when
-	  wide-getaddrinfo option is not given.  fixed: [ruby-dev:25422]
+Sat Apr 23 21:29:42 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/mkmf.rb ($extmk): check if under ext directory.
+	* ext/date/date_core.c: replacement of implementation of
+	  _parse.  [experimental]
+	* ext/date/date_parse.c: new.
+	* ext/date/lib/date/format.rb: removed ruby version of _parse.
 
-	* lib/mkmf.rb (Logging.postpone): allow recursive operation.
+Fri Apr 22 12:04:15 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/mkmf.rb (try_constant): make sure if really a constant, reduce
-	  the number of times of compile.
+	* array.c (rb_ary_sort_bang): fix rdoc.
+	  patched by burningTyger. https://github.com/ruby/ruby/pull/11
 
-	* lib/mkmf.rb (have_macro, have_var, byte_order): new functions.
+Fri Apr 22 11:49:49 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/mkmf.rb (find_library): allow directory list with separators.
+	* lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
+	  XML-RPC's int is 32bit int, and Fixnum also may be beyond 32bit.
 
-	* lib/mkmf.rb (arg_config): manage provided configuration options.
+	* lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
+	  XML-RPC doesn't allow Infinity and NaN.
+	  http://www.xmlrpc.com/spec
 
-	* lib/mkmf.rb (dir_config): accept arrays of directory names as
-	  default values.
+Fri Apr 22 04:16:14 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* mkconfig.rb: no longer embed srcdir and compile_dir into
-	  rbconfig.rb.
+	* ext/psych/parser.c (parse): strings from psych have proper taint
+	  markings.
 
-	* lib/mkmf.rb (create_makefile): fix unbalanced parens.
+	* test/psych/test_tainted.rb: test for string taint
 
-Sun Feb  6 19:23:01 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Apr 21 01:30:02 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (stack_extend): add prototype because VC++8 doesn't
-	  accept __declspec(noinline) with K&R style function definitions.
-	  (backported from CVS HEAD)
+	* random.c (rb_f_srand): fix rdoc: srand(0)'s 0 is a seed.
+	  [ruby-core:35833] fixes #4590
 
-Sun Feb  6 14:14:26 2005  Tadayoshi Funaba  <tadf@dotrb.org>
+Thu Apr 21 01:01:28 2011  Masaya Tarui  <tarui@ruby-lang.org>
 
-	* lib/date.rb (new_with_hash): changed messages of exception.
+	* win32/win32.c (CreateChild): maximum length of lpCommandLine is
+	  32,768 characters, including the Unicode terminating null character.
 
-	* lib/date/format.rb (str[fp]time): undocumented conversion
-	  specifications %[1-3] are now deprecated.
+Wed Apr 20 21:32:11 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Feb  6 12:20:11 2005  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/date/date_strptime.c (date__strptime_internal): do not
+	  overwrite local variables.
 
-	* bignum.c (rb_big2ulong_pack): One too many arguments are passed
-	  to big2ulong().
+Wed Apr 20 14:41:28 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* re.c (rb_reg_init_copy, rb_reg_initialize_m): One too many
-	  arguments are passed to rb_reg_initialize().
+	* string.c (rb_str_each_line): check string's length when compare
+	  separator and string. [ruby-core:35815] fixes #4586
 
-Sun Feb  6 03:24:20 2005  Tanaka Akira  <akr@m17n.org>
+Wed Apr 20 00:02:13 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/resolv.rb (Resolv::DNS::Resource::TXT): multiple strings was not
-	  handled.
-	  (Resolv::DNS::Resource::TXT#strings): new method to return all
-	  strings.
-	  (Resolv::DNS::Message::MessageEncoder#put_string_list): new method.
-	  (Resolv::DNS::Message::MessageDecoder#get_string_list): ditto.
-	  based on [ruby-talk:129732] by Sam Roberts.
+	* misc/ruby-mode.el (ruby-parse-partial): use position of open paren.
 
-Fri Feb  4 00:30:45 2005  Kouhei Sutou  <kou@cozmixng.org>
+Tue Apr 19 01:00:21 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-	* lib/rss: supported Image module.
-	  http://web.resource.org/rss/1.0/modules/image/
+	* test/ruby/test_io.rb (TestIO#test_cross_thread_close_fd):
+	  skip cross thread pipe close if windows
 
-Thu Feb  3 23:42:36 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Apr 18 12:15:46 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_close, strio_close_read, strio_close_write):
-	  should return nil instead of self as well as IO.  [ruby-dev:25623]
+	* test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
+	  avoid float error. [ruby-core:35804]
 
-	* ext/stringio/stringio.c (strio_extend, strio_putc): fill with zero
-	  extended portion.  [ruby-dev:25626]
+Sun Apr 17 00:20:14 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Feb  2 23:52:53 2005  sheepman  <sheepman@tcn.zaq.ne.jp>
+	* ext/date/date_{core,strftime}.c: use struct tmx instead of vtm.
+	* ext/date/date_tmx.h: new.
 
-	* ext/stringio/stringio.c (strio_truncate): should MEMZERO an extended
-	  part.  [ruby-dev:25618]
+Sat Apr 16 22:23:52 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Feb  2 21:56:01 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/date/date_strftime.c (date_strftime_wo_timespec): changed
+	  the way of validation of locale modifiers.
 
-	* lib/rss/rss.rb (RSS::Element#convert): added.
+Sat Apr 16 21:55:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/rss/rss.rb: convert -> need_convert.
+	* ext/date/date_core.c: replacement of implementation of
+	  _strptime.  [experimental]
+	* ext/date/date_strptime.c: new.
+	* ext/date/lib/date/format.rb: removed ruby version of _strptime.
 
-	* lib/rss/1.0.rb: ditto.
+Sat Apr 16 10:18:30 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/rss/0.9.rb: ditto.
+	* vm.c (Init_VM): suppress warning: "OPT_BASIC_OPERATIONS" is not
+	  defined.
 
-	* lib/rss/2.0.rb: ditto.
+Fri Apr 15 23:41:18 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/rss/trackback.rb: ditto.
+	* ruby.c (proc_options): suppress warning:
+	  "ALLOW_DEFAULT_SOURCE_ENCODING" is not defined.
 
-Tue Feb  1 22:48:48 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Fri Apr 15 15:10:29 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-	* lib/drb/drb.rb (DRb::DRbObject#respond_to?): check marshal_dump and
-	  _dump.
+	* lib/uri/generic.rb (#route_from_path): Fix a bug where
+	  URI('http://h/b/').route_to('http://h/b') wrongly returned './'
+	  (should be '../b'). [Bug #4476]
 
-Tue Feb  1 00:20:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr 15 14:58:06 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-	* configure.in (aix): fix linker flags on AIX.  [ruby-talk:125460]
+	* lib/fileutils.rb (FileUtils#touch): Fix corrupted output when
+	  mtime is specified in addition to nocreate (and verbose).
+	  ref [ruby-dev:43401]
 
-Mon Jan 31 13:33:21 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Apr 14 23:43:43 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: add invalid namespace check
+	* numeric.c (ruby_float_step): wrong loop condition.
+	  fixes [ruby-core:35753], reported by Joey Zhou.
 
-	* ext/tk/lib/multi-tk.rb: add invalid_namespace? method
+	* test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
+	  test above change.
 
-	* ext/tk/lib/remote-tk.rb: ditto
+Thu Apr 14 22:48:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jan 31 10:29:18 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::Options#setup_options): set possible
+	  values for completion. no conversion is needed.
 
-	* lib/irb/context.rb (IRB::Context::initialize): [ruby-core:04330]
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#initialize): use
+	  positional arguments instead of keyword arguments.
 
-Sat Jan 29 09:42:12 2005  Sam Roberts  <sroberts@uniserve.com>
+	* lib/test/unit.rb (Test::Unit::Runner#jobs_status): io/console may
+	  not be available. use 80 as the last resort if IO#winsize and
+	  COLUMNS are unavailable.
 
-	* lib/resolv.rb (Resolv::DNS::Resource::IN::SRV): Added RFC2782 SRV
-	  resource record for specifying location of services.
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#died): rename using a
+	  verb.
 
-Fri Jan 28 17:16:55 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/test/unit.rb (Test::Unit::Runner#_run_parallel): check if worker
+	  is signaled and use its exit status.
 
-	* lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf):
-	  parse options line for ndots option.
-	  (Resolv::Hosts#lazy_initialize): return self.
-	  (Resolv::DNS#lazy_initialize): ditto.
-	  (Resolv::DNS::Config#lazy_initialize): ditto.
-	  Suggested by Sam Roberts.
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#dead): no longer @in
+	  and @out are separated.
 
-Thu Jan 27 13:18:03 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Apr 14 21:23:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* st.c (st_foreach): report success/failure by return value.
-	  [ruby-Bugs-1396]
+	* variable.c (rb_autoload_p): search superclasses as same as actual
+	  loading.  fixes [ruby-core:35679]
 
-Thu Jan 27 00:15:29 2005  Minero Aoki  <aamine@loveruby.net>
+Thu Apr 14 21:21:06 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb (setup): support BSD-style
-	  directory group inheritance. (backport from HEAD, rev 1.32)
+	* include/ruby/win32.h (frexp, modf): wrongly declared as pure in
+	  mingw math.h.
 
-	* test/fileutils/fileasserts.rb (assert_same_entry): show entry
-	  difference. (backport from HEAD, rev 1.4)
+	* include/ruby/win32.h (ftruncate, truncate): mingw64 misses
+	  prototypes.
 
-Wed Jan 26 23:09:11 2005  Minero Aoki  <aamine@loveruby.net>
+	* win32/win32.c (rb_w32_read): suppress warning.
 
-	* lib/net/protocol.rb (WriteAdapter#puts): should append \n, not
-	  prepend. [ruby-talk:128302] (backport from HEAD, rev 1.75)
+Thu Apr 14 19:55:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Jan 26 10:51:50 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/fileutils.rb (FileUtils#touch): fix corrupted output when
+	  FileUtils.touch(:nocreate => true, :verbose => true) case.
+	  The patch was written by Hiroyuki Iwatsuki. [ruby-dev:43401]
 
-	* win32/win32.c (flock_winnt, flock_win95): unlock file even if
-	  LOCK_NB is specified. (backported from CVS HEAD)
+Thu Apr 14 16:01:45 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Jan 25 17:11:51 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* io.c (rb_f_syscall): suppress warning: "HAVE___SYSCALL" is not
+	  defined.
 
-	* ruby.c (proc_options): correct -T option in RUBYOPT. (backported
-	  from CVS HEAD)
+Thu Apr 14 00:41:09 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Jan 25 14:05:52 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread.c (thread_fd_close_i): IOError exception should be assigned
+	  to rb_thread_t::thrown_errinfo.
 
-	* ext/tcltklib/tcltklib.c: fix SEGV bug; trouble on canceling remained
-	  after scripts [ruby-dev:25479]: NULL current namespace when deleting
-	    Tk interpreter [ruby-talk:126225]
+Wed Apr 13 20:12:26 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/tcltklib/extconf.rb: bug fix; TCL_ENABLE_THREAD flag is inverted
-	  [ruby-talk:126360]
+	* io.c (rb_io_fdatasync): remove unused variable.
 
-	* ext/tcltklib/extconf.rb: add yet another native-thread check
+Tue Apr 12 20:54:12 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/tkutil.c: fix SEGV bug; NULL string pointer when finalize
-	  Ruby interpreter
+	* include/ruby/st.h: parenthesize macro arguments.
 
-	* ext/tk/lib/multi-tk.rb: avoid warning for deleted safeTk ip frame
+Tue Apr 12 19:19:50 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/bindtag.rb: bug fix; new method of named bindtag
-	  doesn't return the created object [ruby-dev:25479]
+	* lib/uri/common.rb: avoid race condition. fixes #4572
 
-	* ext/tk/lib/tk/menu.rb: bug on treating arguments [ruby-dev:25479]
+Tue Apr 12 18:07:13 2011  TAKAO Kouji  <kouji@takao7.net>
 
-	* ext/tk/lib/tk.rb: bug fix; cannot accept a callback ID string for
-	  a command argument [ruby-dev:25479]
+	* ext/readline/extconf.rb: --disable-libedit to disable
+	  libedit. fixes #4550
 
-	* ext/tk/lib/multi-tk.rb: ditto
+Tue Apr 12 10:37:39 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/*.rb: ditto
+	* include/ruby/win32.h: VC doesn't have ftruncate() and others, but
+	  ruby needs HAVE_ macros to use our emulation functions.
+	  (fix the problem of 31262)
 
-	* ext/tk/lib/tkextlib/*.rb: ditto
+Tue Apr 12 01:33:00 2011  Luis Lavena  <luislavena@gmail.com>
 
-	* ext/tk/sample/demos-jp/anilabel.rb: new demo script
+	* configure.in: properly evaluate existence of truncate, ftruncate
+	  and ftello for MinGW. [ruby-core:35678]
+	* win32/win32.c: rename truncate, ftruncate and ftello to avoid
+	  redefinitions.
+	* win32/win32.h: ditto.
 
-	* ext/tk/sample/demos-en/anilabel.rb: ditto
+Mon Apr 11 21:51:52 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/tkHTML/ss.rb: local variable scope bug fix
-	  [ruby-dev:25479]
+	* io.c: revert r31230. Because it made a regression.
+	  [ruby-core:35631]
 
-Mon Jan 24 15:44:25 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+Mon Apr 11 21:49:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb: allow whitespace after function names.
-	  [ruby-core:4296]
+	* test/ruby/test_io.rb: Added TestIO#test_cross_thread_close_stdio
+	  and TestIO#test_cross_thread_close_fd.
+	  The patch was written by Eric Wong. [ruby-core:35669]
 
-	* lib/rdoc/parsers/parse_simple.rb: adds support for private comments
-	  in the "simple" parser. [ruby-core:4301]
+Mon Apr 11 21:15:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jan 24 15:44:25 2005  Charles Mills  <cmills@freeshell.org>
+	* file.c (rb_group_member): kill 256K of stack usage.
+	  the patch was written by Eric Wong. [ruby-core:35699]
 
-	* lib/rdoc/parsers/parse_c.rb: adds support for constants
-	  (rb_define_const), accessors (rb_define_attr), and makes a
-	  couple fixes. [ruby-core:4307]
+Mon Apr 11 07:24:13 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Jan 24 15:44:25 2005  Florian Gro  <florgro@gmail.com>
+	* ext/openssl/ossl.c:  Fix typo, document version constants.
 
-	* lib/rdoc/parsers/parse_rb.rb: Logic for def Builtin.method() end
-	  [ruby-core:4302]
+Sun Apr 10 22:23:45 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Jan 24 15:44:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/ruby.h: parenthesize macro arguments.
 
-	* document updates - [ruby-core:04296], [ruby-core:04301],
-	  [ruby-core:04302], [ruby-core:04307]
+Sat Apr  9 23:31:47 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Sun Jan 23 12:41:16 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_each, strio_readlines):
+	  Use `NUM2LONG` instead of `FIX2INT`. Fixes [ruby-dev:43395].
 
-	* lib/soap/wsdlDriver.rb: from 1.5.3-ruby1.8.2, operation which has
-	  capitalized name (such as KeywordSearchRequest in AWS) is defined as
-	  a method having uncapitalized name. (converted with
-	  GenSupport.safemethodname to handle operation name 'foo-bar').  it
-	  introduced serious incompatibility; in the past, it was defined as a
-	  capitalized.
+Sat Apr  9 23:22:27 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	  define capitalized method as well under that circumstance.
+	* ext/stringio/stringio.c (strio_each):
+	  Fix exception message and don't raise immediately if block is not
+	  given.
+	  Fixes [ruby-dev:43394].
 
-Sun Jan 23 05:24:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/stringio/test_stringio.rb (test_each_line_limit_0):
+	  Fix test for above.
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_to_der): should call
-	  GetOCSPReq at first.
+Sat Apr  9 21:54:15 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Sat Jan 22 23:09:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/stringio/stringio.c (strio_each, strio_readlines):
+	  limit must not be zero. Fixes [ruby-dev:43392].
 
-	* lib/drb/ssl.rb (accept): rescue SSLError. [druby-ja:110]
+	* test/stringio/test_stringio.rb: Add tests for above.
 
-Sat Jan 22 22:35:03 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sat Apr  9 18:01:36 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/drb/unix.rb: fail if UNIXFileOwner is set. [druby-ja:111]
+	* include/ruby/util.h: parenthesize macro arguments.
 
-Fri Jan 21 23:58:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Apr  8 16:01:56 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_set_pos): clear EOF flag.
-	  [ruby-talk:127511]
+	* ext/stringio/stringio.c (strio_getline): check whether str is
+	  a string when str and lim are given.
+	  https://twitter.com/watson1978/status/56225052152168449
 
-Fri Jan 21 20:07:02 2005  Tanaka Akira  <akr@m17n.org>
+Thu Apr  7 20:03:52 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/resolv.rb (Resolv::DNS::Config.resolv): don't raise ResolvError.
-	  reported by Sam Roberts.  [ruby-talk:127133]
+	* include/ruby/io.h: parenthesize macro arguments.
 
-Fri Jan 21 16:58:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Apr  6 21:08:31 2011  Tanaka Akira  <akr@fsij.org>
 
-	* dir.c (rb_push_glob): should work for NUL delimited patterns.
+	* include/ruby/intern.h: parenthesize macro arguments.
 
-Fri Jan 21 13:58:37 2005  Shugo Maeda  <shugo@ruby-lang.org>
+Wed Apr  6 15:12:40 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/net/imap.rb (u8tou16): fixed typo. fixed: [ruby-list:40546]
-	  (backported from CVS HEAD)
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize):
+	  pop pushed error after each try of reading. fixes #4550
 
-Fri Jan 21 09:30:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
 
-	* rubyio.h (rb_eof_error): should mark as NORETURN. (backported
-	  from CVS HEAD)
+	* ext/openssl/ossl_pkey_ec.c (ossl_ec_initialize): ditto.
 
-Fri Jan 21 00:31:36 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Apr  6 11:36:44 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/syck/rubyext.c (syck_parser_bufsize_set): avoid VC++ warning
-	  "local variable 'size' used without having been initialized".
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize):
+	  pop pushed error after each try of reading. fixes #4550
 
-Thu Jan 20 19:03:24 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Apr  5 20:33:43 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/extmk.rb (extmake): shouldn't set $extflags on mswin32.
+	* include/ruby/encoding.h: parenthesize macro arguments.
 
-	* win32/Makefile.sub (LIBRUBY_SO): should use $DLDOBJS instead of
-	  $EXTOBJS.
-	  fixed: [ruby-core:04290] (backported from CVS HEAD)
+Mon Apr  4 22:02:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Jan 20 11:42:02 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/io/nonblock/nonblock.c (io_nonblock_set): Avoid F_SETFL if
+	  we're not changing the O_NONBLOCK bit. F_SETFL is an expensive
+	  operation since it needs to affect all processes with the same
+	  file object.
+	  The patch is written by Eric Wong. [ruby-core:35556]
 
-	* string.c (rb_str_new4): should propagate taintedness.
+Mon Apr  4 21:41:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* struct.c (rb_struct_set): use original method name, not callee
-	  name, to retrieve member slot.  [ruby-core:04268]
+	* io.c (rb_io_syswrite): While local FS writes are usually
+	  buffered, the buffers can be full or the file opened with
+	  O_SYNC. IO#syswrite can also be used on blocking IOs
+	  (pipe/socket) just like IO#write.
+	  The patch is written by Eric Wong. [ruby-core:35554]
 
-	* time.c (time_strftime): protect from format modification from GC
-	  finalizers.
+Mon Apr  4 11:50:40 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jan 19 18:06:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/test_tempfile.rb: simply ignore platform dependent testcases
+	  instead of skipping.
 
-	* lib/ipaddr.rb (to_s, test_to_s): too many colons with some cases.
-	  (backported from CVS HEAD)
+Sun Apr  3 22:52:22 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Wed Jan 19 01:16:30 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/syslog/syslog.c: improve rdoc.
+	  a patch by Jonas Pfenniger. [ruby-core:35592] fixes #4545
 
-	* lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf): ignore
-	  domain and search directive without an argument.
-	  reported by Sam Roberts.  [ruby-talk:126781]
+Sun Apr  3 22:10:09 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Jan 18 15:03:05 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/zlib/zlib.c: parenthesize macro arguments.
 
-	* lib/webrick/ssl.rb (WEBrick::Config::SSL): the default value
-	  of :SSLEnable is false.
+Sun Apr  3 21:33:58 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/server.rb (WEBrick::Daemon.start): prepared stdio
-	  don't allow changing its mode.
+	* configure.in: disable fdatasync again on Mac OS X.
+	  [ruby-core:35493][Bug #4500]
 
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_service):
-	  should delete trailing LF from the result of pack("m*").
+Sun Apr  3 21:16:20 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
-	  - should delete trailing LF from the result of pack("m*").
-	  - clear Request-Line not to send the response by HTTPServer#run.
+	* io.c (io_reopen): IO#close releases GVL if possible.
+	  close() may block for certain file types (NFS, SO_LINGER
+	  sockets, inotify), so let other threads run. The patch was
+	  created by Eric Wong [ruby-core:35555][Bug #4527]
 
-	* lib/webrick/httputils (WEBrick::HTTPUtils.parse_qvalues):
-	  refine regexp (and change the name of a local variable).
+	* io.c (fptr_finalize): ditto.
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils#escape_path): add
-	  new method to escape URI path component.
+	* io.c (maygvl_fclose): new.
+	* io.c (nogvl_fclose): ditto.
+	* io.c (maygvl_close): ditto.
+	* io.c (nogvl_close): ditto.
 
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line): should
-	  escape SCRIPT_NAME and PATH_INFO before being parsed as a URI.
+Fri Apr  1 22:25:50 2011  Tanaka Akira  <akr@fsij.org>
 
-	* test/webrick/*, sample/webrick/httpproxy.rb: add new file.
+	* ext/syslog/syslog.c: parenthesize macro arguments.
 
-Mon Jan 17 23:33:46 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr 1 18:53:06 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* configure.in (aix): fix typo.  [ruby-talk:126401]
+	* lib/webrick/cookie.rb (WEBrick::Cookie.parse): 'white space is
+	  permitted between tokens' according to RFC2965. Though 'Netscape
+	  spec' does not define the syntax clearly, make it tolerant as a
+	  server. As a real-world example, rest-client gem sends
+	  'Cookie: foo=1;bar=2'
 
-Mon Jan 17 07:08:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/webrick/test_cookie.rb (test_parse_non_whitespace): test it.
 
-	* ext/readline/readline.c: suppress warnings.
+Fri Apr  1 13:19:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/irb/extend-command.rb (IRB::ContextExtender.def_extend_command):
-	  ditto.
+	* vm_core.h (RUBY_VM_CHECK_INTS_TH): merge a patch by ko1
+	  in [ruby-dev:43373].
 
-	* lib/irb/ext/history.rb (IRB::Context::set_last_value): ditto.
+Thu Mar 31 23:15:46 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/irb/ext/history.rb (IRB::Context::eval_history): ditto.
+	* misc/ruby-mode.el (ruby-brace-to-do-end, ruby-do-end-to-brace):
+	  adjust space between block beginning and block arguments
 
-	* lib/irb/locale.rb (IRB::Locale::real_load): ditto.
+Thu Mar 31 20:42:05 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/irb/slex.rb (SLex::Node::create_subnode): remove garbage.
+	* ext/strscan/strscan.c:  parenthesize macro arguments.
 
-Mon Jan 17 00:09:42 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu Mar 31 18:06:12 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/uri/common.rb (PORT): typo fix. fixed: [ruby-core:04256]
+	* vm_insnhelper.c (vm_get_ev_const): should ignore crefs with
+	  the NODE_FL_CREF_PUSHED_BY_EVAL flag.
 
-Sat Jan 15 14:57:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Mar 31 16:49:56 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ruby.c (proc_options): ignore trailing CRs at the end of short
-	  options as well as long options.  fixed: [ruby-core:04232]
+	* vm_insnhelper.c (vm_get_ev_const): search root cref properly.
+	  [ruby-dev:43365]
 
-Sat Jan 15 13:35:16 2005  Kouhei Sutou  <kou@cozmixng.org>
+Thu Mar 31 14:50:25 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.2 -> 0.1.3.
+	* eval.c (rb_mod_s_constants): should ignore crefs with
+	  the NODE_FL_CREF_PUSHED_BY_EVAL flag.
 
-	* lib/rss/rss.rb: accept inheritance. [ruby-talk:126104]
+Wed Mar 30 22:55:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan 13 04:48:53 2005  Tanaka Akira  <akr@m17n.org>
+	* misc/ruby-mode.el (ruby-toggle-block): toggle do/end and {}.
 
-	* io.c (io_fread): don't warn nonblocking behavior by default.
+	* misc/ruby-mode.el (ruby-move-to-block): move to opening of
+	  block.
 
-Wed Jan 12 00:36:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar 30 14:35:15 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* object.c (rb_class_superclass): superclass of singleton class also
-	  should be a singleton class.  fixed: [ruby-list:40519]
+	* vm_insnhelper.h (COPY_CREF): should copy
+	  the NODE_FL_CREF_PUSHED_BY_EVAL flag to hide constants from
+	  methods defined by class_eval.  [ruby-dev:43365]
 
-Tue Jan 11 09:44:40 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Mar 30 00:24:53 2011  Tanaka Akira  <akr@fsij.org>
 
-	* numeric.c (Init_Numeric): turn off floating point exceptions
-	  on bcc32. "1e300".to_f had crashed by overflow.
+	* ext/stringio/stringio.c: parenthesize macro arguments.
 
-Tue Jan 11 03:10:10 2005  Minero Aoki  <aamine@loveruby.net>
+Tue Mar 29 21:51:31 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/fileutils.rb (copy_entry): could not copy symbolic link.
-	  [ruby-talk:125733]
+	* object.c (rb_String): Kernel#String should call to_str before to_s.
 
-	* lib/fileutils.rb (copy_stream): use read/write instead of
-	  sysread/syswrite.
+Tue Mar 29 10:28:08 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Jan 10 23:08:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/webrick/test_filehandler.rb
+	  (WEBrick::TestFileHandler#test_short_filename): the cgi doesn't exist
+	  on current directory.
 
-	* variable.c (rb_autoload): hide internal data from ruby level.
-	  fixed: [ruby-dev:25435], [ruby-list:40498]
+Tue Mar 29 05:19:57 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Jan 10 01:22:55 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/raddrinfo.c: parenthesize macro arguments.
 
-	* gc.c (rb_data_object_alloc): klass may be NULL.
-	  [ruby-list:40498]
+Tue Mar 29 00:03:51 2011 Tajima Akio <artonx@yahoo.co.jp>
 
-Sun Jan  9 03:12:58 2005  Tanaka Akira  <akr@m17n.org>
+	* test/webrick/test_filehandler.rb (test_short_filename):
+	  read real short filename by cmd because smb mounted files
+	  have different naming convention.
 
-	* io.c (io_fread): warn nonblocking behavior.
-	  (io_readpartial): new method IO#readpartial.
+Mon Mar 28 11:38:08 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Jan  8 04:38:47 2005  why the lucky stiff  <why@ruby-lang.org>
+	* ext/date/date_core.c (date_s_today): use int for year.
 
-	* lib/yaml.rb: Kernel#y requires an argument.
+	* ext/date/date_core.c (datetime_s_now): ditto.
 
-Fri Jan  7 21:12:29 2005  TAMURA Takashi  <sheepman@tcn.zaq.ne.jp>
+Mon Mar 28 11:07:41 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* random.c (rand_init): use ALLOC_N instead of ALLOCA_N
-	  [ruby-dev:25426]
+	* ext/extmk.rb: set MFLAGS from MAKEFLAGS when using nmake.
 
-Fri Jan  7 18:03:35 2005  Tanaka Akira  <akr@m17n.org>
+Mon Mar 28 11:07:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* gc.c (mark_locations_array): avoid core dump with -O3.
-	  [ruby-dev:25424]
+	* common.mk (love): all you need is love.
 
-Thu Jan  6 20:31:07 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Mar 27 23:16:31 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/zlib/zlib.c (zstream_end): should return value. (backported
-	  from CVS HEAD)
+	* ext/socket/ipsocket.c: parenthesize macro arguments.
 
-Thu Jan  6 19:55:13 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Mar 27 16:55:34 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_close): didn't close socket handle.
-	  [ruby-dev:25414]
+	* misc/ruby-mode.el (ruby-mode-map): remove unnecessary
+	  binding. fixes
+	  http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=468952
 
-	* win32/win32.c (rb_w32_open_osfhandle): bcc32's _open_osfhandle
-	  never set EMFILE.
+	* misc/ruby-mode.el: suppress warnings at byte compile.  fixes
+	  http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=502926
 
-Thu Jan  6 17:14:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Mar 27 11:18:35 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* random.c (random_seed): O_NONBLOCK isn't defined on some
-	  platforms. [ruby-dev:25417]
+	* ext/date/date_core.c: removed unused variables.
 
-Thu Jan  6 13:45:35 2005  Tanaka Akira  <akr@m17n.org>
+Sat Mar 26 15:16:09 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/time.rb: recognize +00:00 and GMT as a localtime.
+	* ext/socket/getaddrinfo.c: parenthesize macro arguments.
 
-Thu Jan  6 07:58:28 2005  Dave Thomas  <dave@pragprog.com>
+Sat Mar 26 05:27:34 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/usage.rb (RDoc::RDoc.usage_no_exit): Allow for colons
-	  in path names on DOS machines. (thanks to Johan Nilsson)
+	* ext/date/lib/date/format.rb (DateTime#strftime): removed because
+	  date_core defines it.
 
-Wed Jan  5 20:16:32 2005  Tanaka Akira  <akr@m17n.org>
+Fri Mar 25 21:59:45 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* random.c (limited_big_rand): didn't work if SIZEOF_BDIGITS == 2.
-	  [ruby-dev:25408]
+	* ext/date/date_core.c: should not force cast with macros.
 
-	* random.c (random_seed): refined.
+Fri Mar 25 21:56:10 2011  Tanaka Akira  <akr@fsij.org>
 
-Wed Jan  5 12:49:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/sdbm/init.c: parenthesize macro arguments.
 
-	* eval.c (rb_thread_initialize): Thread objects cannot be initialized
-	  again.  fixed: [ruby-core:04067]
+Fri Mar 25 19:39:40 2011  Ben Walton <bwalton@artsci.utoronto.ca>
 
-Wed Jan  5 10:48:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/test_syslog.rb:
+	  Skip syslog tests that rely on LOG_PERROR unless it's defined
 
-	* dir.c (dir_s_mkdir): win32 special processing doesn't need any
-	  longer. (backported from CVS HEAD)
+	  Instead of checking looking at the platform to determine if the tests
+	  relying on LOG_PERROR should be run, look for the definition of the
+	  constant as this will be robust against all platforms as long as the
+	  underlying syslog.c code sets it up correctly.
 
-	* win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
-	  interface. (backported from CVS HEAD)
+	  This specifically addresses failures on Solaris 9.
 
-	* win32/win32.[ch] (rb_w32_rmdir): new function. (backported from CVS
-	  HEAD)
+	  Use LOG_PID instead of LOG_PERROR in Syslog.open test
 
-Wed Jan  5 02:30:11 2005  Tanaka Akira  <akr@m17n.org>
+	  LOG_PERROR isn't a POSIX option for syslog, so it fails on platforms
+	  that don't define it.  Solaris 9 and 10 are examples of this.
 
-	* random.c (init_by_array): imported from mt19937ar-cok.tgz.
-	  (genrand_int32): ditto.
-	  (genrand_real): replaced with genrand_res53 in mt19937ar-cok.
-	  (rand_init): support bignum for longer seed.
-	  (random_seed): generate longer seed.
-	  (make_mask): new function.
-	  (limited_rand): ditto.
-	  (limited_big_rand): ditto.
-	  (rb_f_rand): call limited_rand and limited_big_rand.
-	  [ruby-dev:25403]
+	  Use LOG_PID instead.
 
-Tue Jan  4 23:25:29 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Mar 25 15:42:17 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* bignum.c (rb_big_rand): should return positive random number.
-	  [ruby-dev:25401]
+	* ext/sdbm/_sdbm.c (sdbm_open): use size_t.
 
-Tue Jan  4 11:15:29 2005  TAMURA Takashi  <sheepman@tcn.zaq.ne.jp>
+	* ext/syck/bytecode.c: ditto.
 
-	* bignum.c (rb_big_rand): do not use rb_big_modulo to generate
-	  random bignums.  [ruby-dev:25396]
+	* ext/sdbm/_sdbm.c (delpair): use ptrdiff_t.
 
-Mon Jan  3 14:01:54 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/sdbm/init.c: use RSTRING_LENINT.
 
-	* random.c (random_seed): don't use /dev/urandom if it is not
-	  character device.
+	* ext/dl/handle.c: suppress warning: shorten-64-to-32.
 
-Mon Jan  3 11:37:42 2005  Tanaka Akira  <akr@m17n.org>
+	* ext/strscan/strscan.c: ditto.
 
-	* random.c (random_seed): use /dev/urandom if available.
-	  [ruby-dev:25392]
+	* ext/syck/emitter.c: ditto.
 
-Mon Jan  3 07:46:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/syck/implicit.c: ditto.
 
-	* lib/webrick/httpauth/htpasswd.rb (WEBrick::Htpasswd#reload):
-	  raise NotImplementedError if password is encrypted by digest
-	  algorithms. This patch is contributed by sheepman. [ruby-list:40467]
+	* ext/syck/syck.c: ditto.
 
-	* lib/webrick/httpauth/digestauth.rb
-	  (WEBrick::HTTPAuth::DigestAuth#_authenticate): fix digest calculation.
-	  This patch is contributed by sheepman. [ruby-list:40482]
+	* ext/syck/token.c: ditto.
 
-	* lib/webrick/{httpauth.rb,httpauth/basicauth.rb,httpproxy.rb}: use
-	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
-	  encoding/decoding. fixed: [ruby-dev:25336]
+Fri Mar 25 12:14:58 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/webrick/test_httpauth.rb: new file.
+	* ext/nkf/nkf-utf8/nkf.c: import nkf 7f18e30.
 
-Sat Jan  1 04:20:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Mar 25 11:49:29 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_set_challenge): should call
-	  StringValue before GetSPKI. fixed: [ruby-dev:25359].
+	* test/ruby/test_process.rb (TestProcess#test_no_curdir): skip silently
+	  on Windows, because this tests a platform specific feature and it'll
+	  never be supported on ruby on Windows.
 
-Sat Jan  1 01:13:28 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_dir_m17n.rb
+	  (TestDir_M17N#test_filename_extutf8_invalid,
+	  TestDir_M17N#test_filename_as_bytes_extutf8): ditto.
 
-	* variable.c (rb_autoload): [ruby-dev:25373]
+	* test/open-uri/test_open-uri.rb
+	  (TestOpenURI#test_find_proxy_case_sensitive_env): ditto.
 
-Fri Dec 31 14:10:43 2004  Dave Thomas  <dave@pragprog.com>
+	* test/dl/test_handle.rb (DL::TestHandle#test_NEXT,
+	  DL::TestHandle#test_DEFAULT): ditto.
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item): Fix problem
-	  if heading contains formatting.
+Thu Mar 24 23:06:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec 30 00:41:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_insnhelper.c (vm_get_ev_const): should not autoload in
+	  defined? mode.
 
-	* eval.c (svalue_to_avalue): [ruby-dev:25366]
+	* variable.c (rb_const_defined_0): fix autoloading base.
+	  [ruby-core:35509]
 
-	* string.c (rb_str_justify): [ruby-dev:25367]
+Thu Mar 24 22:48:43 2011  Tanaka Akira  <akr@fsij.org>
 
-Wed Dec 29 11:07:07 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/sdbm/_sdbm.c: parenthesize macro arguments.
 
-	* lib/rdoc/generators/template/html/kilmer.rb: Update to use new
-	  sections.
+Thu Mar 24 14:45:57 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Dec 28 22:31:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl.c: suppress warning: shorten-64-to-32.
 
-	* string.c (rb_str_justify): create buffer string after argument type
-	  conversion.  fixed: [ruby-dev:25341]
+	* ext/openssl/ossl.h: ditto.
 
-Tue Dec 28 15:41:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_asn1.c: ditto.
 
-	* ext/nkf/nkf-utf8/nkf.c (reinit): should initialize all static
-	  variables.  fixed: [ruby-list:40445]
+	* ext/openssl/ossl_bio.c: ditto.
 
-Tue Dec 28 15:25:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_bn.c: ditto.
 
-	* ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): second byte is up to
-	  0xfe.
+	* ext/openssl/ossl_cipher.c: ditto.
 
-	* ext/nkf/lib/kconv.rb (Kconv#kconv): should handle UTF8 and UTF16
-	  properly.
+	* ext/openssl/ossl_hmac.c: ditto.
 
-Tue Dec 28 13:35:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_ns_spki.c: ditto.
 
-	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate): ensure
-	  freeing internal zstreams.  fixed: [ruby-dev:25309]
+	* ext/openssl/ossl_ocsp.c: ditto.
 
-	* ext/zlib/zlib.c (rb_deflate_init_copy): replace rb_deflate_clone.
+	* ext/openssl/ossl_pkcs5.c: ditto.
 
-Tue Dec 28 12:26:45 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_pkey.c: ditto.
 
-	* win32/Makefile.sub, win32/setup.mak (RDOCTARGET, install,
-	  install-nodoc, install-doc): rdoc support for mswin32.
+	* ext/openssl/ossl_pkey_dh.c: ditto.
 
-	* win32/configure.bat (--enable-install-doc, --disable-install-doc):
-	  ditto.
+	* ext/openssl/ossl_pkey_dsa.c: ditto.
 
-Mon Dec 27 20:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/ossl_pkey_ec.c: ditto.
 
-	* ext/tcltklib/tcltklib.c: fix SEGV bug when deleting Tk interp
+	* ext/openssl/ossl_pkey_rsa.c: ditto.
 
-	* ext/tk/lib/multi-tk.rb: ditto
+	* ext/openssl/ossl_rand.c: ditto.
 
-Mon Dec 27 16:55:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/openssl/ossl_ssl.c: ditto.
 
-	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): should use
-	  rb_hash_new to get exactly a Hash. fix [ruby-dev:25325].
+	* ext/openssl/ossl_x509ext.c: ditto.
 
-Mon Dec 27 16:29:56 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_x509name.c: ditto.
 
-	* string.c (rb_str_justify): [ruby-dev:25341]
+Thu Mar 24 11:48:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Dec 27 15:47:48 2004  Minero Aoki  <aamine@loveruby.net>
+	* ext/openssl/ossl_rand.c (ossl_rand_egd_bytes): use NUM2INT because
+	  the result is used with functions whose argument is int.
 
-	* test/fileutils/fileasserts.rb: sync with HEAD.
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): ditto.
 
-	* test/fileutils/test_fileutils.rb: ditto.
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_purpose): ditto.
 
-	* test/fileutils/test_nowrite.rb: ditto.
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_trust): ditto.
 
-Mon Dec 27 15:21:07 2004  Minero Aoki  <aamine@loveruby.net>
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_purpose): ditto.
 
-	* lib/fileutils.rb (mv): should raise error when moving a
-	  directory to the (empty) directory. [ruby-talk:124368]
-	  (backport from HEAD 1.48)
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_trust): ditto.
 
-	* lib/fileutils.rb (mv): wrongly did not overwrite file on Win32
-	  platforms. (backport from HEAD 1.48)
+Thu Mar 24 11:36:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Dec 25 11:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_x509name.c: id_aref's type is ID.
 
-	* stable version 1.8.2 released.
+Thu Mar 24 10:04:35 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Dec 25 04:23:49 2004  Minero Aoki  <aamine@loveruby.net>
+	* ext/io/console/console.c (console_set_winsize):
+	  suppress warning: shorten-64-to-32.
 
-	* lib/fileutils.rb (mkdir, mkdir_p): should ensure directory
-	  permission. (backportted from HEAD, 1.47)
+Thu Mar 24 09:56:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/fileutils.rb (traverse, remove_dir): untaint trasted
-	  objects. (backportted from HEAD, 1.46)
+	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify): flags is VALUE,
+	  so it should use NUM2INT.
 
-Sat Dec 25 01:28:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ocsp.c (ossl_ocspbres_verify): ditto.
 
-	* io.c: cancel io_reopen() change on Dec. 24th.
+Wed Mar 23 21:09:29 2011  Tanaka Akira  <akr@fsij.org>
 
-	* dln.c: use <dlfcn.h> for NetBSD.  [ruby-dev:25313]
+	* ext/readline/readline.c: parenthesize macro arguments.
 
-	* io.c (rb_f_select): IO list could be altered.  [ruby-dev:25312]
+Wed Mar 23 08:07:33 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec 24 23:51:48 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* numeric.c (flo_round): fix inaccurate results.
 
-	* bcc32/Makefile.sub: bcc32 should use RTL dll (backport from HEAD)
-	  [ruby-dev:25306]
+Wed Mar 23 00:12:16 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-	* win32/win32.[ch]: ditto.
+	* win32/win32.c: wait process real termination after reading
+	  exit code. fixes #4518
 
-Fri Dec 24 23:27:18 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Mar 22 21:20:10 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/image.rb: TkPhotoImage#cget bug fix
+	* lib/rubygems/test_case.rb: save current dir to @current_dir
+	  before Dir.chdir.
 
-Fri Dec 24 18:39:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Mar 22 20:10:04 2011  Tanaka Akira  <akr@fsij.org>
 
-	* win32/win32.[ch]: failed to compile on bcc32 (and probably wince)
-	  [ruby-dev:25306]
+	* ext/psych/parser.c: parenthesize macro arguments.
 
-Fri Dec 24 02:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 22 20:10:01 2011  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (io_reopen, rb_io_reopen): prohibit to change access mode for
-	  special IO ports.  [ruby-dev:25225]
+	* ext/openssl/ruby_missing.h: parenthesize macro arguments.
 
-Fri Dec 24 02:22:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 22 13:33:22 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
+	* ext/openssl/lib/openssl/buffering.rb: removed circular require of
+	  openssl.rb.
 
-	* ext/syck/rubyext.c (syck_loader_transfer): check type conversion.
+	* ext/openssl/lib/openssl/*: removed following comment for transition
+	  measures of avoiding circular require. No one claimed about this as
+	  far as I know.
+	  ##
+	  # Should we care what if somebody require this file directly?
+	  # require "openssl"
 
-	* ext/syck/rubyext.c (syck_parser_assign_io, rb_new_syck_node): duck
-	  typing.
+Tue Mar 22 10:57:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/syck/rubyext.c (syck_parser_s_alloc, syck_parser_initialize):
-	  allocation framework.
+	* test/runner.rb: set Gem::TestCase's @@project_dir.
 
-	* ext/syck/rubyext.c (syck_emitter_s_alloc, syck_emitter_initialize):
-	  ditto.
+	* lib/rubygems/test_case.rb: set Gem::TestCase's @@project_dir only
+	  when it is not defined.
 
-Fri Dec 24 01:21:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Mar 22 09:38:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/blt.rb: add BLT extension support
+	* numeric.c (flo_round): use pow instead of while-loop. fixes #4510
+	  patched by Alex Young [ruby-core:35526]
 
-	* ext/tk/lib/tkextlib/blt/*.rb: ditto
+Tue Mar 22 06:47:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/blt/tile/*.rb: ditto
+	* ext/date/date_strftime.c (date_strftime_wo_timespec):
+	  suppress warning: shorten-64-to-32.
 
-Thu Dec 23 23:36:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 22 06:42:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c (proc_setgroups): check if the argument lenght is
-	  modified.  fixed: [ruby-dev:25285]
+	* ext/date/date_core.c: suppress warning: shorten-64-to-32.
 
-Thu Dec 23 13:13:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Mar 22 06:41:37 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: define TclTkLib::COMPILE_INFO and
-	  RELEASE_DATE
+	* lib/test/unit/parallel.rb: remove unused variable.
 
-	* ext/tcltklib/extconf.rb: ditto
+Tue Mar 22 06:19:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/tkutil.c: define TkUtil::RELEASE_DATE
+	* enc/utf_16le.c: suppress warning: shorten-64-to-32.
 
-	* ext/tk/lib/tk.rb: define Tk::RELEASE_DATE
+	* ext/dbm/dbm.c: ditto.
 
-Thu Dec 23 09:38:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/gdbm/gdbm.c: ditto.
 
-	* io.c (io_reopen): restore exact mode.  fixed: [ruby-core:04003]
+	* parse.y (Init_ripper): suppress warning: unused value.
 
-Thu Dec 23 00:16:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Mar 21 11:21:32 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* configure.in (bsdi): use $(CC) for LDSHARED.  fixed [ruby-dev:25270]
+	* lib/test/unit.rb: Refactoring. Unified if and elsif.
 
-Wed Dec 22 11:14:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Mar 20 23:09:34 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* io.c (rb_io_mode_modenum): replace O_ACCMODE with O_RDWR.
-	  fixed: [ruby-dev:25273]
+	* ext/date/date_strftime.c: checks duplicated modifiers.
 
-Wed Dec 22 08:34:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Mar 20 22:32:30 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/dl/sym.c (rb_dlsym_initialize): extract internal pointers after
-	  all argument conversion.  fixed: [ruby-dev:25271]
+	* ext/date/date_strftime.c: removed unused code and arguments.
 
-Wed Dec 22 00:08:01 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sun Mar 20 21:34:49 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/soap/*, test/soap/*, sample/soap/authheader/*: eval cleanup.
+	* ext/date/date_core.c: replacement of implementation of
+	  strftime. It has some limitations that is same as Time's
+	  one.  [experimental]
+	* ext/date/date_strftime.c: new.
+	* ext/date/lib/date/format.rb: removed ruby version of strftime.
 
-Tue Dec 21 22:07:33 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Mar 20 12:43:12 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
-	  ossl_asn1_decode_all): temporary value should be marked volatile.
+	* ext/openssl/ossl_x509store.c: parenthesize macro arguments.
 
-Tue Dec 21 14:40:02 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Mar 20 01:39:48 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
-	  ossl_asn1_decode_all): use rb_str_new4 to avoid SEGV.
-	  fix [ruby-dev:25261]
+	* hash.c (ruby_setenv): check env process block size with OS ver.
+	* win32/win32.c: export rb_w32_osver for above patch.
+	* include/ruby/win32.h: declare rb_w32_osver for Win32 Libs.
 
-	* test/openssl/test_asn1.rb: add tests for OpenSSL::ASN1.
+Sat Mar 19 18:35:05 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-Tue Dec 21 12:22:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (ruby_setenv): calculate total env block size for win32.
+	* test/ruby/test_env.rb: add test for above patch.
 
-	* io.c (io_reopen): keep duplex pipe in correct mode for exception
-	  safeness.  fixed: [ruby-dev:25152]
+Sat Mar 19 17:14:46 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-Tue Dec 21 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* hash.c (ruby_setenv): checking with max process environment
+	  block size for Win32. 32767 for 2000/XP, 2003. if failed to
+	  read the block, then checking with 5120 for earlier Windows.
 
-	* ext/tk/lib/tk/grid.rb: rescue bug of 'grid configure' on Tcl/Tk8.3-
+Sat Mar 19 12:30:25 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Dec 21 00:53:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_x509revoked.c: parenthesize macro arguments.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse): [ruby-dev:25261]
+Fri Mar 18 20:44:36 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_decode): ditto.
+	* ext/openssl/ossl_x509req.c: parenthesize macro arguments.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_decode_all): ditto.
+Fri Mar 18 08:48:06 2011  Oleg Shaldybin  <oleg.shaldybin@gmail.com>
 
-Mon Dec 20 23:22:26 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/fileutils.rb (FileUtils::Entry_#copy_file): updated FileUtils.cp
+	  to still copy file permissions when :preserve is false (as cp does
+	  this even when -p isn't set).
 
-	* added files:
-	  * lib/soap/mapping/wsdl*.rb
-	  * lib/wsdl/soap/element.rb
-	  * lib/wsdl/xmlSchema/simpleContent.rb
+Fri Mar 18 00:59:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* modified files:
-	  * lib/soap/*
-	  * lib/wsdl/*
-	  * lib/xsd/*
-	  * test/soap/*
-	  * test/wsdl/*
-	  * test/xsd/*
-	  * sample/soap/*
-	  * sample/sdl/*
+	* ext/win32ole/extconf.rb (create_docfile): removed.  should not
+	  modify source directory unnecessarily, platform dependent
+	  documentation should be dealt with by rdoc.  [ruby-core:35495]
 
-	* summary
-	  * imported from the soap4r repository.  Version: 1.5.3-ruby1.8.2
+Fri Mar 18 00:54:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  * added several XSD basetype support: nonPositiveInteger,
-	    negativeInteger, nonNegativeInteger, unsignedLong, unsignedInt,
-	    unsignedShort, unsignedByte, positiveInteger
+	* include/ruby/ruby.h (rb_funcall_passing_block): add prototype.
+	  a patch by James M. Lawrence at [ruby-core:35501]
 
-	  * HTTP client connection/send/receive timeout support.
+Wed Mar 17 06:23:31 2011  Tanaka Akira  <akr@fsij.org>
 
-	  * HTTP client/server gzipped content encoding support.
+	* ext/openssl/ossl_x509name.c: parenthesize macro arguments.
 
-	  * improved WSDL schema definition support; still is far from
-	    complete, but is making step by step improovement.
+Wed Mar 16 20:36:56 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Dec 20 22:56:39 2004  Tanaka Akira  <akr@m17n.org>
+	* ext/socket/ipsocket.c (init_inetsock_internal): raise an error on
+	  listen(2) failure.
+	  reported by Xavier Shay.  [ruby-core:35505]
 
-	* gc.c (stack_end_address): gcc noinline attribute is available since
-	  gcc-3.1.
+Wed Mar 16 15:06:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Dec 20 14:07:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/lib/openssl/buffering.rb (module OpenSSL): #flush should
+	  not change sync mode on exception.
+	* test/openssl/test_buffering.rb: added
 
-	* ext/tk/lib/multi-tk.rb: supports new features of Tcl/Tk8.5a2
+Wed Mar 16 13:45:28 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/tk/lib/tk/clock.rb: ditto
+	* ext/openssl/lib/openssl/buffering.rb: de-nest Buffering module
 
-	* ext/tk/lib/tk/text.rb: ditto
+	* ext/openssl/lib/openssl/buffering.rb: add RDoc
 
-	* ext/tk/lib/tk/panedwindow.rb: ditto
+Wed Mar 16 08:40:39 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Dec 20 12:47:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/openssl/ossl_x509ext.c: parenthesize macro arguments.
 
-	* ext/openssl/lib/net/https.rb,protocols.rb,telnets.rb: delete
-	  doc and code about SSLContext#{key_file,cert_file}.
-	  fixed: [ruby-dev:25243]
+Tue Mar 15 18:34:27 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Dec 20 12:42:17 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_x509crl.c: parenthesize macro arguments.
 
-	* io.c (io_fwrite): workaround for MSVCRT's bug.
-	  fixed: [ruby-core:03982]
+Tue Mar 15 09:49:03 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Mon Dec 20 11:21:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/misc/test_ruby_mode.rb (test_singleton_class): Skip for Pending.
 
-	* io.c (rb_io_eof): check if closed before clearerr().
-	  fixed: [ruby-dev:25251]
+Mon Mar 14 21:20:44 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Mon Dec 20 03:30:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_require.rb (test_require_too_long_filename):
+	  increase path length, because MAXPATHLEN is defined as 4096 on linux.
 
-	* lib/cgi/session.rb (CGI::Session#initialize): empty session id was
-	  used if request had no session key.  fixed: [ruby-core:03981]
+	* test/ruby/test_require.rb (test_require_path_home_1): ditto.
 
-Mon Dec 20 01:51:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_require.rb (test_require_path_home_2): ditto.
 
-	* struct.c (make_struct): [ruby-dev:25249]
+Mon Mar 14 19:54:37 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Dec 20 00:28:20 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/openssl/ossl_x509cert.c: parenthesize macro arguments.
 
-	* lib/rexml/encodings/SHIFT-JIS.rb: backported from CVS HEAD.
+Sun Mar 13 18:11:28 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rexml/encodings/SHIFT_JIS.rb: ditto.
+	* ext/openssl/ossl_x509attr.c: parenthesize macro arguments.
 
-Sun Dec 19 17:19:48 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Mar 13 16:07:58 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* ext/openssl/ossl_x509store.c
-	  (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
-	  (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
+	* lib/pstore.rb: Fix don't raise "nested transaction" when thread_safe
+	  is true. Patch by Masaki Matsushita (Glass_saga). [ruby-dev:43337]
 
-	* test/openssl/ossl_x509store.rb: test certificate validity times.
+	* test/test_pstore.rb: Test for above.
+	  Patch by Masaki Matsushita (Glass_saga) [ruby-dev:43337]
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
-	  second argument to specify the output format (see also
-	  X509_NAME_print_ex).
+Sat Mar 12 04:12:41 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
-	  OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
-	  OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
+	* ext/openssl/ossl_ssl_session.c: parenthesize macro arguments.
 
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
-	  new module to provide the parse for RFC2253 DN format.
+Sat Mar 12 02:27:07 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
-	  new method to parse RFC2253 DN format.
+	* ext/date/date_core.c ({d,dt}_lite_marshal_load): checks the given
+	  argument.
 
-	* test/openssl/ossl_x509name.rb: add tests about RFC2253 DN.
+Sat Mar 12 01:26:24 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* text/openssl/ssl_server.rb: try to listen ports from 20443 to 20542
-	  while EADDRINUSE is raised.
+	* ext/date/date_core.c: changed some directives.
 
-	* all changes in this entry are backport from 1.9.
+Sat Mar 12 01:16:02 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Dec 19 17:24:59 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/date/date_core.c, ext/date/lib/*: moved rdoc descriptions.
 
-	* configure.in (enable_rpath): use rpath flag to embed the library
-	  path into extensions on ELF environment.  [ruby-dev:25035]
+Sat Mar 12 00:06:24 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sun Dec 19 11:01:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/date/lib: moved from lib.
 
-	* lib/test/unit.rb: use standalone runner for -e.
+Fri Mar 11 23:32:38 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
-	  multiple -p and -x options.
+	* lib/date/delta*: removed undocumented delta.
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
-	  ditto.
+Fri Mar 11 18:42:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec 18 16:36:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (find_executable0): should exclude directories.
 
-	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
-	  disallow interrupt by type conversion.  fixed: [ruby-dev:25226]
+Fri Mar 11 01:40:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Dec 18 15:16:41 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* process.c (proc_getmaxgroups, proc_setmaxgroups): Process#maxgroups
+	  and Process#maxgroups= now raise NotImplementedError if the
+	  platform don't support supplementary groups concept.
 
-	* lib/webrick/httpauth.rb,
-	  lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
-	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
-	  encoding/decoding.
+Fri Mar 11 01:25:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Dec 18 10:51:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (get_sc_ngroups_max): return -1 if platform don't
+	  support NGROUPS_MAX.
 
-	* dir.c (dir_open_dir): new function.  [ruby-dev:25242]
+Thu Mar 10 22:28:15 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Dec 17 18:07:01 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/openssl/ossl_ssl.h: parenthesize macro arguments.
 
-	* test/readline/test_readline.rb: fix for BSD. Thanks, GOTOU Yuuzou.
-	  fixed: [ruby-dev:25218]
+Thu Mar 10 21:59:37 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Dec 17 16:28:12 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* parse.y (parser_encode_length): add exception as UTF8-MAC for
+	  magic comment's emacs newline specifier
+	  patched by James M. Lawrence [ruby-core:35476] fixes #4489
 
-	* ext/tk/lib/tk.rb: fix bug on setting up system encoding
+Thu Mar 10 16:00:22 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/event.rb: fix error on require process
+	* parse.y (parser_encode_length): fix typo: the length of
+	  "-dos" and "-mac" is not 5 but 4.
+	  patched by James M. Lawrence [ruby-core:35476] fixes #4489
 
-	* ext/tk/lib/tk/font.rb: fix abnormal termination error on Windows
+Thu Mar 10 10:52:01 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
-	  accepts event-sequence arguments
+	* test/ruby/test_require.rb: setting too long string to ENV causes
+	  Errno::EINVAL on Windows.  long path name errors may causes over
+	  about 1024 bytes, then limit it about 4000 bytes.
 
-	* ext/tk/lib/tk/text.rb: fail to dump embedded images
+Thu Mar 10 10:09:35 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/text.rb: tag_nextrange and tag_prevrange returns wrong
-	  types of values
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#read): fix for the case
+	  when IO#read or IO#gets returns nil.
 
-	* ext/tk/lib/tk/texttag.rb: nextrange and prevrange returns wrong
-	  types of values
+Thu Mar 10 07:12:03 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* ext/tk/lib/tk/text.rb: add TkText::IndexModMethods module and
-	  TkText::IndexString class to treat text index modifiers
+	* lib/rubygems*: Import rubygems 1.6.2 (release candidate @ 2026fbb5)
+	* test/rubygems: Ditto
+	* test/runner.rb: Added test to load path to fix test requires.
 
-	* ext/tk/lib/tk/texttag.rb: use TkText::IndexModMethods module
+Thu Mar 10 03:00:43 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk/textmark.rb: ditto
+	* ext/openssl/ossl_ssl.c: parenthesize macro arguments.
 
-	* ext/tk/lib/tk/textimage.rb: ditto
+Wed Mar  9 23:51:26 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/tk/lib/tk/textwindow.rb: ditto
+	* test/ruby/test_io_m17n.rb (test_io_new_enc): "sjis" is now an alias
+	  of Windows-31J.
 
-	* ext/tk/lib/tk/textimage.rb: wrong gravity of text mark for embedded
-	  image
+Wed Mar  9 23:06:13 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/textwindow.rb: wrong gravity of text mark for
-	  embedded window
+	* misc/ruby-mode.el (ruby-parse-partial): fix indent after aref.
 
-Fri Dec 17 13:50:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+Wed Mar  9 12:50:24 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* vms/vmsruby_private.c, vms/vmsruby_private.h: private routines
-	  for VMS port are added.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Rescue exceptions when
+	  people implement the method method. Thanks Lin Jen-Shin.
+	  [ruby-core:35255]
 
-	* eval.c (ruby_init): change to call VMS private intialization routine.
+	* test/psych/visitors/test_yaml_tree.rb: test for implementation of
+	  method method.
 
-Fri Dec 17 13:33:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar  9 11:53:31 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session#initialize): control adding
-	  session_id hidden fields.  fixed: [ruby-talk:123850]
+	* enc/shift_jis.c: Change SJIS as an alias of Windows-31J.
+	  [ruby-dev:43027] fixes #4280
 
-Thu Dec 16 23:25:25 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* enc/shift_jis.c: Add PCK as an alias of Windows-31J.
 
-	* lib/drb/drb.rb, lib/drb/ssl.rb: backported from CVS HEAD.
-	  [druby-ja:101]
+Wed Mar  9 00:45:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/drb/test_drb.rb: adjust and reduce sleep (backported from
-	  CVS HEAD.)
+	* ext/extmk.rb: nmake substitutes all occurrences in macro.
 
-Thu Dec 16 18:44:58 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/extmk.rb: workaround for nmake.
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
-	  for reading request till data arrive. [ruby-talk:121068]
+Tue Mar  8 23:49:45 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
-	  should log about all accepted socket. [ruby-core:03962]
+	* process.c (proc_setgroups): cleanup.
 
-	* lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
-	  "%%" and "%u" are supported. [webricken:135]
+Tue Mar  8 23:40:30 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#check_filename):
-	  :NondisclosureName is acceptable if it is Enumerable.
+	* test/misc/test_ruby_mode.rb: test for ruby-mode.el.
 
-	* lib/webrick/config.rb (WEBrick::Config::FileHandler):
-	  default value of :NondisclosureName is [".ht*", "*~"].
+Tue Mar  8 23:27:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Dec 16 18:36:52 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* process.c (get_sc_ngroups_max): try to use NGROUPS_MAX at first if
+	  _SC_NGROUP_MAX is not defined.
 
-	* ext/openssl/ossl.c (ossl_raise): refine message format.
+Tue Mar  8 23:10:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec 16 16:29:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* misc/ruby-mode.el (ruby-parse-partial): fix for array in block.
 
-	* ext/tk/sample/demos-en/widget: modify version check for
-	  supporting features
+Tue Mar  8 21:44:49 2011  Tanaka Akira  <akr@fsij.org>
 
-Thu Dec 16 16:03:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/ossl_rand.c: parenthesize macro arguments.
 
-	* ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
+Tue Mar  8 16:45:31 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
+	* hash.c (ruby_setenv): MSDN says that Windows XP or earlier limits
+	  the total size of environment block to 5,120 chars.  and on such
+	  OS, putenv() causes SEGV.  So, ruby should limit the size of an
+	  environment variable to 5,120 bytes for workaround.
 
-	* ext/tk/lib/tk.rb: add TkComm._callback_entry?()
+Tue Mar  8 15:57:20 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
+	* test/rubygems/test_gem_spec_fetcher.rb
+	  (TestGemSpecFetcher#test_cache_dir_escapes_windows_paths): cache_dir
+	  may have driveletter and `:' for base of cache_dir itself, so need
+	  to skip it for checking.
 
-	* ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
+Tue Mar  8 12:30:06 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/canvastag.rb: ditto
+	* misc/ruby-mode.el (ruby-deep-indent-paren-p, ruby-calculate-indent):
+	  do not apply deep-indent inside parens at the beginning of
+	  expressions.
 
-	* ext/tk/lib/tk/dialog.rb: ditto
+Tue Mar  8 09:32:48 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/optiondb.rb: ditto
+	* common.mk (configure-ext, build-ext), ext/extmk.rb (extmake):
+	  support parallel-make under ext.
 
-	* ext/tk/lib/tk/text.rb: ditto
+Tue Mar  8 09:25:23 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/texttag.rb: ditto
+	* process.c (proc_setgroups): use getgrnam() if getgrnam_r() is
+	  not available.
 
-	* ext/tk/lib/tk/textwindow.rb: ditto
+	* process.c: RARRAY_LEN() returns long int.
 
-	* ext/tk/lib/tk/timer.rb: ditto
+Tue Mar  8 09:07:03 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/validation.rb: ditto
+	* configure.in (RUBY_REPLACE_TYPE): enclose in quotes for multiple
+	  type names.
 
-	* ext/tk/lib/tkextlib/*: ditto
+Tue Mar  8 01:43:11 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Dec 16 03:14:28 2004  Minero Aoki  <aamine@loveruby.net>
+	* process.c (get_sc_ngroups_max): define to wrap sysconf(3).
+	  this also supports Windows which doesn't have sysconf(3).
 
-	* lib/net/http.rb (basic_encode): return value of pack('m') may
-	  include multiple CR/LFs.  Backported from main trunk (rev 1.112).
-	  [ruby-dev:25212]
+	* process.c (maxgroups): use get_sc_ngroups_max.
 
-Thu Dec 16 00:33:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (proc_setmaxgroups): ditto.
 
-	* hash.c (Init_Hash): remove custom "hash" and "eql?".
+Tue Mar  8 01:16:49 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Dec 15 18:57:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (rb_objspace): an initializer must be a constant.
 
-	* lib/set.rb (Set::eql): wrong definition.  [ruby-dev:25207]
+Tue Mar  8 01:11:44 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Dec 15 18:48:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* process.c (maxgroups): cast because sysconf(3)'s return value is long.
 
-	* ext/curses/curses.c (window_subwin): call NUM2INT() before
-	  GetWINDOW(). (backported from CVS HEAD)
+	* process.c (proc_setmaxgroups): ditto.
 
-Wed Dec 15 17:03:50 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* process.c (proc_setgroups): cast because RARRAY_LEN() is long.
 
-	* win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
-	  isatty because it never sets errno. (backported from CVS HEAD)
+Tue Mar  8 00:02:47 2011  Tanaka Akira  <akr@fsij.org>
 
-Wed Dec 15 15:39:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/openssl/ossl_pkey_rsa.c: parenthesize macro arguments.
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_a): avoid SEGV
-	  (rollback the previous commit).
+Mon Mar  7 22:59:39 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Wed Dec 15 16:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/pstore.rb: Delete variable @transaction and fix #4474. Patch by
+	  Masaki Matsushita (Glass_saga).
 
-	* object.c (rb_obj_id_obsolete): warn always.
+	* test/test_pstore.rb(test_thread_safe): Add test for #4474.
 
-	* eval.c (rb_enable_super): ditto.
+Mon Mar  7 21:31:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Dec 15 15:31:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (proc_setgroups): replace getgrnam() with getgrnam_r()
+	  because getgrnam() isn't thread safe.
 
-	* lib/set.rb (Set#==): [ruby-dev:25206]
+Mon Mar  7 20:49:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Dec 15 14:22:10 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* process.c (proc_getmaxgroups, proc_setmaxgroups): reflect
+	  platform maxgroups limitation by default instead hardcoded 65536.
 
-	* win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
-	  fixed: [ruby-core:03959]
+Mon Mar  7 17:13:00 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Dec 15 10:30:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (rb_gc_set_params): allow GC parameter configuration by
+	  environment variables.  based on a patch from funny-falcon at
+	  https://gist.github.com/856296, but honors safe level.
 
-	* ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
+Mon Mar  7 09:05:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec 14 17:10:09 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* process.c: NUM2RLIM is defined but no getrlimit and setrlimit on
+	  mingw.
 
-	* win32/win32.c (rb_w32_close): need to reset osfhnd().
+Mon Mar  7 08:38:14 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec 14 14:03:57 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/date/date_core.c (DateTimeData): should not use bare 'long long'
+	  and 'long double', which are not defined by C89.
 
-	* ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
-	  [ruby-dev:25187]
+	* ext/date/date_core.c (dt_lite_plus): get rid of overflow at casting
+	  down double to integer.
 
-Tue Dec 14 12:36:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Mar  7 00:21:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/cgi/session.rb (CGI::Session::initialize): generate new
-	  session if given session_id does not exist.  [ruby-list:40368]
+	* process.c (proc_getgroups): get rid of maxgroups dependency.
+	  ngroups can be calculated dynamically.
 
-Mon Dec 13 18:13:52 2004  Tanaka Akira  <akr@m17n.org>
+Sun Mar  6 23:45:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* gc.c (stack_end_address): new function to obtain stack end address.
-	  stack_end_address calls __builtin_frame_address(0) to obtain the
-	  frame pointer of a stack frame of stack_end_address.  The address
-	  is the stack pointer of the caller's stack frame.
-	  (SET_STACK_END): use stack_end_address.
-	  This makes the conservative garbage collector to scan a stack frame
-	  of the garbage_collect function itself.  This is required because
-	  callee-save registers may be stored in the frame.
-	  [ruby-dev:25158]
+	* configure.in: rlim_t use standard RUBY_REPLACE_TYPE mechanism.
 
-Mon Dec 13 00:58:02 2004  Tanaka Akira  <akr@m17n.org>
+Sun Mar  6 23:26:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/pathname.rb (cleanpath_aggressive): make it private.
-	  (cleanpath_conservative): ditto.
-	  Suggested by Daniel Berger.  [ruby-core:3914]
+	* process.c (proc_setmaxgroups): added negative value check.
+	  This was suggested by Daniel Berger. Thanks Daniel!
+	  [ruby-core:35426][Bug#4467]
 
-Sun Dec 12 20:06:38 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sun Mar  6 23:18:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/drb/drb.rb: backported from CVS HEAD.
+	* process.c (maxgroups, proc_setmaxgroups): increase max groups
+	  limitation up to 65536.
 
-Sun Dec 12 10:35:10 2004  Dave Thomas  <dave@pragprog.com>
+Sun Mar  6 22:20:59 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
-	  show an accessor's r/w flag if none was specified
+	* ext/openssl/ossl_pkey_ec.c: parenthesize macro arguments.
 
-Sun Dec 12 10:14:03 2004  Dave Thomas  <dave@pragprog.com>
+Sun Mar  6 21:49:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
-	  explicitly given on the command line.
+	* sample/list.rb (MyElem#initialize): initialize @head
+	  explicitly. Otherwise -W2 option makes following warning.
+	  "warning: instance variable @head not initialized".
+	  This issue was founded by Andrew Grimm. Thanks Andrew!
+	  [ruby-core:35435][Bug#4471]
 
-Sun Dec 11 23:54:07 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Mar  6 05:21:41 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/*: update to support libraries in ActiveTcl8.4.12.0
-	  (see ext/tk/ChangeLog.tkextlib).
+	* class.c: fix camelCase to snake_case in documentation code examples.
+	  patched by Andrew Grimm. fixes Bug #4469
 
-	* ext/tk/sample/scrollframe.rb: add a new sample.
+	* marshal.c: ditto.
 
-Sat Dec 11 20:12:21 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* proc.c: ditto.
 
-	* lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
-	  [ruby-list:40390]
+	* sample/biorhythm.rb: ditto.
 
-	* test/drb/drbtest.rb: ditto.
+	* vm_eval.c: ditto.
 
-	* test/drb/ut_drb.rb: ditto.
+	* vm_method.c: ditto.
 
-Sat Dec 11 15:38:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/jcode.rb (String::succ): [ruby-dev:25156]
+Sun Mar  6 03:22:27 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Dec 11 12:41:55 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* io.c (io_cntl): use rb_thread_io_blocking_region() instead
+	  rb_thread_blocking_region().
 
-	* eval.c (run_trap_eval): prototype; avoid VC++ warnings.
+Sat Mar  5 22:54:36 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/socket/getaddrinfo.c: fix typo. fixed: [ruby-core:03947]
+	* include/ruby/intern.h: fix a typo of prototype declaration.
+	  rb_mutex_try_lock -> rb_mutex_trylock [ruby-dev:43213]
 
-	* win32/win32.c: need to include dln.h.
+Sat Mar  5 19:44:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Dec 11 00:10:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#test_fcntl_lock): small clean up.
 
-	* io.c (io_reopen): [ruby-dev:25150]
+Sat Mar  5 01:33:46 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Dec 10 08:39:27 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_cntl, nogvl_io_cntl): IO.fcntl() and IO.ioctl()
+	  release GVL during calling kernel interface.
+	  Suggested by Eric Wong. [ruby-core:35417][Bug #4463]
 
-	* ext/socket/socket.c (sock_listen): get OpenFile just before calling
-	  listen(2).  fixed: [ruby-dev:25149]
+	* test/ruby/test_io.rb (TestIO#test_fcntl_lock): add new test for
+	  IO.fcntl().
 
-Thu Dec  9 17:00:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+Fri Mar  4 23:09:12 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/socket/socket.c, ext/socket/getaddrinfo.c: port to VMS
+	* test/testunit/test_parallel.rb
+	  (test_should_run_all_without_any_leaks): consider that the order of
+	  testcase could change. [ruby-dev:43300] [Bug #4466]
 
-Thu Dec  9 16:31:02 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Mar  4 22:01:14 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/sdbm/init.c (GetDBM): typo.
+	* io.c (io_cntl): change 'cmd' type to int. ioctl and fcntl need to
+	  be passed int.
+	* io.c (rb_io_ctl): ditto.
 
-Thu Dec  9 16:05:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+Fri Mar  4 21:10:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* defines.h: change path of vms.h
-	* vms/vms.h: delete reference for snprintf()
-	* vms/config.h: new file
-	* vms/config.h_in: deleted
+	* configure.in: save warnflags. the patch is created by Eric Wong.
+	  [Bug #4465]
 
-Thu Dec  9 14:38:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar  2 21:15:00 2011  Tanaka Akira  <akr@fsij.org>
 
-	* string.c (rb_str_inspect): escape # which starts an expression
-	  substitution.  fixed: [ruby-core:03922]
+	* ext/openssl/ossl_pkey_dsa.c: parenthesize macro arguments.
 
-	* string.c (rb_str_dump): not escape # which isn't a substitution.
+Thu Mar  3 22:10:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Dec  9 10:54:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (check_exec_redirect_fd, check_exec_redirect): raise
+	  ArgumentError if fd >= 3 on Windows because the feature is not
+	  supported.
 
-	* ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
+	* test/ruby/test_process.rb (test_execopts_redirect): remove meaningless
+	  argument.
 
-	* ext/sdbm/init.c: ditto.
+Thu Mar  3 21:21:42 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/gdbm/gdbm.c: ditto.
+	* test/ruby/test_process.rb (test_execopts_redirect): redirecting fd
+	  >= 3 is not supported on Windows, so should not specify such options
+	  when calling spawn or others.
 
-Thu Dec  9 03:08:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Mar  3 18:59:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
-	  the running script is '-e one-liner' or '-' (stdin).
+	* string.c (rb_str_slice_bang): raise error when the string is frozen.
 
-	* ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
-	  stub libs
+Thu Mar  3 14:25:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
-	  have a wrong parent class.
+	* strftime.c (STRFTIME): return 0 and ERANGE when precision is too
+	  large. [ruby-dev:43284] fixes #4456
 
-	* ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
-	  TkWarning2 --> TkWarningObj (old names are changed to alias names)
+Thu Mar  3 00:46:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
-	  option and hashes for configuration
+	* addr2line.c (uleb128): cast the value to unsigned long.
 
-	* ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
-	  button name
+	* addr2line.c (fill_lines): print error when lseek fails.
 
-	* ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
-	  get_value() and value=(val) ==> set_value(val).
+Thu Mar  3 00:36:29 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
+	* lib/rexml/encoding.rb (REXML::Encoding#encoding=): store @encoding
+	  a String which means the name of the encoding.
+	  this partially revert r29646.
 
-	* ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
-	  TkOptionMenuButton = TkOptionMenubutton)
+	* lib/rexml/document.rb: follow above.
 
-	* ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
-	  event_generate) for Event object
+	* lib/rexml/output.rb: ditto.
 
-	* ext/tk/lib/tk/font.rb: configinfo returns proper types of values
+	* lib/rexml/parsers/baseparser.rb: ditto.
 
-	* ext/tk/lib/tk.rb: bind methods accept subst_args + block
+	* lib/rexml/source.rb: ditto.
 
-	* ext/tk/lib/tk/canvas.rb: ditto
+	* lib/rexml/xmldecl.rb: ditto.
 
-	* ext/tk/lib/tk/canvastag.rb: ditto
+Wed Mar  2 23:19:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/frame.rb: ditto
+	* string.c (str_byte_substr): return nil for negative length.
 
-	* ext/tk/lib/tk/text.rb: ditto
+Wed Mar  2 21:15:00 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk/texttag.rb: ditto
+	* ext/openssl/ossl_pkey_dh.c: parenthesize macro arguments.
 
-	* ext/tk/lib/tk/toplevel.rb: ditto
+Wed Mar  2 14:24:04 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* ext/tk/lib/tkextlib/*: ditto and bug fix
+	* lib/test/unit/parallel.rb: Fix name from `inclement_io` to
+	  `increment_io`.
 
-Wed Dec  8 23:54:29 2004  Dave Thomas  <dave@pragprog.com>
+Wed Mar  2 14:06:01 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
-	  meant that h2 tag was invisible.
+	* string.c (rb_str_slice_bang): move treatments which is only needed
+	  when the result is not nil.
 
-Wed Dec  8 21:56:31 2004  Kouhei Sutou  <kou@cozmixng.org>
+Wed Mar  2 14:02:29 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/rss, test/rss, sample/rss: backported from CVS HEAD.
+	* test/testunit/test_parallel.rb(TestParallel#spawn_runner):
+	  Fix outputing empty line in running test.
 
-Wed Dec  8 14:31:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/tests_for_parallel/test_third.rb: Remove `sleep`
 
-	* io.c (io_fwrite): change dereference for cosmetic reason.
+Tue Mar  1 22:29:10 2011  Tanaka Akira  <akr@fsij.org>
 
-	* sprintf.c (rb_f_sprintf): [ruby-dev:25104]
+	* ext/openssl/ossl_pkey.h: parenthesize macro arguments.
 
-Tue Dec  7 19:08:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+Tue Mar  1 22:02:35 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* io.c (io_fwrite): fix offset incrementation (for VMS and Human68k)
+	* lib/test/unit/parallel.rb: Fix number.
 
-Tue Dec  7 00:27:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar  1 21:48:22 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* process.c (proc_setgroups): [ruby-dev:25081]
+	* lib/test/unit/parallel.rb: For Windows.
 
-Mon Dec  6 18:08:10 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/test_parallel.rb(TestParallelWorker#test_quit_in_test):
+	  Fix for above specification change.
+	* test/testunit/test_parallel.rb(TestParallel#spawn_runner):
+	  Fix outputing empty line in running test.
 
-	* re.c (rb_reg_eqq): document fix.  [ruby-talk:122541]
+Tue Mar  1 20:51:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Dec  6 17:19:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_system.rb (TestSystem#test_system_at):
+	  remove tests for [bug#4396]. because we decided to reject this
+	  ticket.
 
-	* rubysig.h (TRAP_BEG, TRAP_END): safe errno around CHECK_INTS.
-	  (backported from CVS HEAD)  [ruby-dev:24993]
+Tue Mar  1 19:46:19 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Dec  6 10:18:17 2004  Dave Thomas  <dave@pragprog.com>
+	* test/date/{test_date.rb,test_date_attr.rb}: [ruby-dev:43280]
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in):
-	  Oops - 1.8 doesn't have String#clear
+Tue Mar  1 18:40:38 2011  Ryan Davis  <ryan@YPCMC09457>
 
-Mon Dec  6 09:59:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rubygems*: Import rubygems 1.6.0 (released version @ 58d8a0b9)
+	* test/rubygems: Ditto
 
-	* ext/socket/socket.c (sock_connect): use rb_str_new4().
-	  [ruby-dev:25052]
+Tue Mar  1 16:22:22 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Dec  6 01:42:08 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* win32/win32.c: revert r30987 because it causes some failures in
+	  test-all, especially webrick.
 
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
-	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
-	  ossl_rsa_private_decrypt): should take an optional argument
-	  to specify padding mode. [ruby-talk:122539]
+Tue Mar  1 15:59:53 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
-	  PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
-	  under OpenSSL::PKey::RSA.
+	* string.c (rb_str_byteslice): the resulted encoding should keep
+	  original encoding. this also fixes the encoding when the result
+	  shares internal string. [ruby-core:35376]
 
-	* test/openssl/test_pkey_rsa.rb: new file.
+Tue Mar  1 13:25:00 2011  Kenta Murata <mrkn@mrkn.jp>
 
-Sun Dec  5 19:39:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (VpMemAlloc): CVE-2011-0188.
+	  Fixes a bug reported by Drew Yao <ayao at apple.com>
 
-	* lib/optparse.rb (OptionParser::Completion#complete): new parameter
-	  to direct case insensitiveness.
+Tue Mar  1 10:34:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#order!): ignore case only for long
-	  option.  [ruby-dev:25048]
+	* string.c (rb_str_byteslice): Add String#byteslice. [ruby-core:35376]
 
-Sat Dec  4 22:54:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar  1 00:12:49 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-	* io.c (io_write): remove rb_str_locktmp().  [ruby-dev:25050]
+	* include/ruby/win32.h: define WIN32 if neither _WIN64 nor WIN32
+	  defined. it forces to use push/pop for pack(4) pragma.
 
-	* io.c (io_fwrite): takes VALUE string as an argument.
-	  [ruby-dev:25050]
+Mon Feb 28 23:52:13 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
-	  [ruby-dev:25050]
+	* test/testunit/test_rake_integration.rb (test_with_rake_runner):
+	  use assert_in_out_err for suppress messages.
 
-	* ext/socket/socket.c (udp_connect): [ruby-dev:25045]
+Mon Feb 28 22:48:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c (udp_bind): ditto.
+	* win32/win32.c (rb_w32_spawn): use shell if a commandline contain
+	  double-quote character.
+	* win32/win32.c (is_internal_cmd): similar, use shell if a commandline
+	  contain caret character.
 
-	* ext/socket/socket.c (udp_send): ditto.
+	* test/ruby/test_system.rb (TestSystem#test_system_at): fix
+	  wrong test case. if system() invoke a command by using shell,
+	  system() never return nil. Also, "" quotation must not appear
+	  twice in a command line.
 
-	* ext/socket/socket.c (bsock_send): ditto.
+Mon Feb 28 17:36:57 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/socket/socket.c (s_recvfrom): ditto.
+	* ext/openssl/ossl_pkcs7.c: parenthesize macro arguments.
 
-	* hash.c (rb_hash_hash): should provide "hash" method where "eql?"
-	  is redefined.  [ruby-talk:122482]
+Mon Feb 28 16:48:42 2011  Tanaka Akira  <akr@fsij.org>
 
-Sat Dec  4 14:54:52 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/openssl/ossl_pkcs12.c: parenthesize macro arguments.
 
-	* eval.c (proc_invoke): use volatile `tmp' rather than `args'.
-	  [ruby-core:03882]
+Mon Feb 28 16:28:15 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Dec  4 14:28:56 2004  Dave Thomas  <dave@pragprog.com>
+	* string.c (tr_trans): when the hash for multibyte repl is empty,
+	  tr is inverse mode, and a character doesn't much the table, the
+	  character should be replaced by last replacement. Bug #4449
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
-	  Section comments may now be bracketed by lines which are
-	  ignored. You can now write
-	      # -----------
-	      # :section: Dave's Section
-	      # comment material
-	      # -----------
-	   The lines before :section: are removed, and identical lines at the end are
-	   also removed if present.
+Mon Feb 28 16:38:56 2011  Tanaka Akira  <akr@fsij.org>
 
-Sat Dec  4 03:33:45 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/openssl/ossl_ocsp.c: parenthesize macro arguments.
 
-	* ext/readline/readline.c: check $SAFE. (backported from CVS HEAD)
+Mon Feb 28 13:02:15 2011  Danial Pearce <github@tigris.id.au>
 
-	* test/readline/test_readline.rb: added tests for readline.
-	  (backported from CVS HEAD)
+	* lib/tempfile.rb: Fix example file paths in docs for tempfile.
+	  https://github.com/ruby/ruby/pull/5
 
-Sat Dec  4 02:24:00 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Feb 28 12:56:18 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/nkf/nkf.c: add constant NKF::VERSION
+	* ext/openssl/ossl_cipher.c (ossl_cipher_init): typo fix.
+	  https://github.com/ruby/ruby/pull/8
 
-	* ext/nkf/nkf.c(guess): this becomes an alias of guess2
+Mon Feb 28 12:28:13 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/nkf/test.rb(mime_out2): add --no-cp932
+	* ext/date/date_core.c (datetime_s_now): localtime() and localtime_r()
+	  required time_t pointer as 1st parameter, and tv_sec member of struct
+	  timeval is long.
 
-	* ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
+Mon Feb 28 11:57:40 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Sat Dec  4 00:35:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/testunit/test_parallel.rb: Temporally disable test on Windows.
 
-	* ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
+Mon Feb 28 07:28:35 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Fri Dec  3 18:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb(Test::Unit::Runner#after_worker_quit):
+	  method name more be natural English.
 
-	* lib/ostruct.rb: 1.9 marshaling support back-ported.
-	  [ruby-core:03871]
+	* lib/test/unit.rb(Test::Unit::Runner::Worker.launch):
+	  IO.sync doesn't need. Should use "b" for mode.
 
-Fri Dec  3 13:45:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 27 21:59:37 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (proc_invoke): copy arguments to frame.argv.
-	  [ruby-core:03861]
+	* test/ruby/test_system.rb (TestSystem#test_system_redirect_win):
+	  add test for system().
 
-Fri Dec  3 12:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Feb 27 18:00:09 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* st.h: fix prototypes.
+	* lib/test/unit.rb: Refactoring; Worker never use Hash for internal
+	  storage.
 
-Fri Dec  3 00:21:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb: Never use Kernel#spawn. Use IO.popen instead.
 
-	* object.c (convert_type): use rb_respond_to() again.
-	  [ruby-dev:25021]
+Sun Feb 27 13:16:48 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_respond_to): funcall respond_to? if it's redefined.
-	  [ruby-dev:25021]
+	* ext/openssl/ossl_ns_spki.c: parenthesize macro arguments.
 
-Fri Dec  3 01:55:24 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Feb 26 17:07:53 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
-	  returns proper object. "widget.option = val" returns val, and
-	  "widget.option(val)" returns self.
+	* lib/date.rb: [Feature #4257]
 
-	* ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
+	* ext/date/extconf.rb: new
 
-	* ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
-	  TkRadiobutton#value=(val).
+	* ext/date/date_core.c: new
 
-	* ext/tk/lib/tk/spinbox.rb: callback substitution support on
-	  command option.
+Sat Feb 26 16:10:23 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* ext/tk/sample/demos-en/widget: bug fix (wrong image height)
+	* lib/test/unit.rb: --jobs-status won't puts over 2 lines.
 
-	* ext/tk/sample/demos-jp/widget: ditto.
+	* test/testunit/test_parallel.rb: Fix test for above.
 
-Fri Dec  3 00:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/*: refactoring.
 
-	* io.c (rb_file_initialize): [ruby-dev:25032]
+Sat Feb 26 07:10:05 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Dec  2 16:41:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/lib/psych/scalar_scanner.rb: fix parsing timezone's whose
+	  whose format is (+/-)hhmm.  Thanks Goncalo Silva!
 
-	* eval.c (rb_protect): prevent continuations created inside from being
-	  called from the outside.  [ruby-dev:25003]
+	* test/psych/test_scalar_scanner.rb: test for bug.
 
-	* eval.c (rb_callcc, rb_cont_call): prohibit calling from different
-	  signal contexts.  [ruby-dev:25022]
+Thu Feb 24 23:02:55 2011  Tanaka Akira  <akr@fsij.org>
 
-Thu Dec  2 09:57:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_hmac.c: parenthesize macro arguments.
 
-	* lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
-	  marshaled again.  [ruby-core:03862]
+Thu Feb 24 22:53:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec  2 09:30:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* common.mk (love): for the birthday.
 
-	* eval.c (thread_mark): mark thread group.  [ruby-dev:25020]
+Thu Feb 24 22:51:54 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thgroup_add): check whether the argument is really a Thread.
+	* vm.c (ruby_vm_destruct): run vm exit hooks after all objects are
+	  destructed.
 
-Thu Dec  2 07:57:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Feb 24 14:40:33 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* io.c (rb_io_ctl): [ruby-dev:25019]
+	* ChangeLog (vim): Modeline for vim
 
-Wed Dec  1 02:21:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Feb 24 13:39:25 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* signal.c (sighandler): call handler immediately only for default
-	  handlers.  [ruby-dev:25003]
+	* common.mk: Use $RUNRUBY for worker process.
 
-Tue Nov 30 23:38:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit.rb: Fix bug.
 
-	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
+	* lib/test/unit.rb: @options[:ruby](@opts[:ruby]) is now Array.
 
-	* io.c (read_all): remove unnecessary rb_str_resize().
-	  [ruby-dev:24996]  (backported from CVS HEAD)
+	* test/testunit/parallel.rb: Fix for above.
 
-	* io.c (io_readpartial): ditto.
+Thu Feb 24 10:05:55 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* io.c (io_read): ditto.
+	* test/testunit/tests_for_parallel/misc.rb: Fix bug in r30947.
 
-Tue Nov 30 16:18:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb, lib/test/unit/assertions.rb: For this test.
 
-	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
+Wed Feb 23 23:07:38 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* io.c (read_all): remove unnecessary rb_str_resize().
-	  [ruby-dev:24996]
+	* test/testunit/test_parallel.rb, test/testunit/parallel/*:
+	  Test for r30939.
 
-	* io.c (io_read): ditto.
+	* lib/test/unit.rb: For test.
 
-Tue Nov 30 00:49:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/parallel.rb: For test.
 
-	* io.c (rb_io_sysread): use temporary lock.  [ruby-dev:24992]
+	* lib/test/unit/testcase.rb: For test.
 
-Mon Nov 29 16:06:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb 23 22:05:13 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/stringio/stringio.c (strio_write): insufficiently filled string
-	  being extended when overwriting.  [ruby-core:03836]
+	* ext/openssl/ossl_engine.c: parenthesize macro arguments.
 
-Mon Nov 29 15:59:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Feb 22 23:15:17 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* lib/ostruct.rb (OpenStruct::method_missing): check method
-	  duplication for -d.
+	* lib/test/unit.rb: Fix --ruby option doesn't effect.
 
-	* lib/ostruct.rb (OpenStruct::initialize): ditto.
+	* lib/test/unit.rb: Fix typo.
 
-Mon Nov 29 15:22:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 22 21:39:28 2011  Tanaka Akira  <akr@fsij.org>
 
-	* test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
-	  not supported.
+	* ext/openssl/ossl_digest.c: parenthesize macro arguments.
 
-Mon Nov 29 03:08:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Feb 22 14:34:26 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* object.c (convert_type): direct call conversion methods for the
-	  performance.  [ruby-core:03845]
+	* lib/test/unit.rb: Fix merging miss.
 
-	* eval.c (rb_funcall_rescue): new function.
+Tue Feb 22 12:27:26 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* object.c (rb_Array): avoid using rb_respond_to().
+	* lib/test/unit.rb: Add new options; --jobs,-j,--ruby,--jobs-status,
+	  --no-retry.
+	  [Feature #4415] [ruby-dev:43226],[ruby-dev:43222],[ruby-core:35294]
 
-	* object.c (rb_Integer): ditto.
+	* lib/test/unit/parallel.rb: Used at test/unit --jobs(-j) option.
 
-	* parse.y (reduce_nodes): empty body should return nil.
+	* test/csv/test_serialization.rb: test/unit parallel running ready.
 
-	* string.c (rb_str_aset): the original string should not be
-	  affected by modifying duplicated string.  [ruby-dev:24981]
+	* test/rake/test_file_task.rb: test/unit parallel running ready.
 
-Mon Nov 29 13:57:38 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Feb 22 06:09:10 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* win32/win32.c (CreateChild): search executable file if no program
-	  name given. (backported from CVS HEAD)
+	* ext/syslog/syslog.c: Apply documentation patch from mathew murphy.
+	  [Bug #4149]
 
-Mon Nov 29 13:37:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 22 03:09:10 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* io.c (fptr_finalize): must not use FILE after fclose().
-	  [ruby-dev:24985]
+	* ext/psych/lib/psych.rb: increase Psych to 1.1.0 for help with
+	  debugging.
 
-Mon Nov 29 13:16:31 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Feb 22 03:04:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* win32/win32.c (CreateChild): push back the last space before next
-	  loop because CharNext() eats it.
+	* ext/psych/lib/psych/streaming.rb: refactor streaming methods to a
+	  module.
+	* ext/psych/lib/psych/stream.rb: extracted streaming specific methods
+	  to a module.
+	* ext/psych/lib/psych/json/stream.rb: JSON stream inherits from
+	  JSONTree and includes streaming methods.
+	* ext/psych/lib/psych/visitors/json_tree.rb: JSON does not support
+	  object references, so remove object reference testing when building
+	  JSON trees.
 
-Mon Nov 29 01:18:18 2004  Tanaka Akira  <akr@m17n.org>
+Tue Feb 22 02:41:51 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* io.c (rb_io_check_writable): call io_seek regardless of
-	  NEED_IO_SEEK_BETWEEN_RW.  [ruby-dev:24986]
+	* ext/psych/lib/psych/visitors/yaml_tree.rb (accept): use Hash#key?
+	  when looking up object references to err on the side of cache
+	  misses.
 
-Sat Nov 27 21:43:39 2004  Tanaka Akira  <akr@m17n.org>
+Mon Feb 21 10:58:39 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* io.c: avoid data lost with nonblocking fd and
-	  stdio buffering in sync mode.  [ruby-dev:24966]
-	  based on matz's patch [ruby-dev:24967]
-	  (io_fwrite): new primitive writing function which writes
-	  directly if sync mode.
-	  (rb_io_fwrite): wrapper for io_fwrite now.
-	  (io_write): call io_fwrite instead of rb_io_fwrite.
+	* ext/psych/lib/psych/json/yaml_events.rb: refactoring JSON event
+	  handling methods to a module for reuse.
+	* ext/psych/lib/psych/json/tree_builder.rb: AST builder uses JSON
+	  event methods.
+	* ext/psych/lib/psych/json/stream.rb: stream emitter uses JSON event
+	  methods.
 
-Sat Nov 27 14:44:15 2004  Kent Sibilev  <ksibilev@bellsouth.net>
+Mon Feb 21 10:54:29 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/cgi/session.rb (CGI::Session::initialize): create_new_id is
-	  now a instance method.  [ruby-core:03832]
+	* ext/psych/lib/psych/json/stream.rb: do not emit custom tags in maps
+	  or sequences when emitting JSON.
+	* ext/psych/lib/psych/json/tree_builder.rb: do not emit custom tags in
+	  sequences when emitting JSON.
+	* test/psych/json/test_stream.rb: tests for custom stream emits.
+	* test/psych/test_json_tree.rb: tests for JSON emits.
 
-Sat Nov 27 09:41:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Feb 21 10:05:10 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* io.c (io_fread): old rb_io_fread with file closing checking.
-	  (rb_io_fread): wrapper for io_fread now.
-	  [ruby-dev:24964]
+	* ext/psych/lib/psych/json/ruby_events.rb: DRY up ruby event handling
+	  for JSON.
+	* ext/psych/lib/psych/visitors/json_tree.rb: use ruby events module
+	* ext/psych/lib/psych/json/stream.rb: ditto
 
-Fri Nov 26 18:02:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Feb 21 10:01:01 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
+	* ext/psych/lib/psych/json/stream.rb: fix JSON stream emits to use
+	  double quotes during stream.
+	* test/psych/json/test_stream.rb: tests to reflect changes.
 
-	* ext/tk/lib/tk/image.rb: bug fix
+Mon Feb 21 00:38:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
+	* test/ruby/test_system.rb (TestSystem#test_system_at):
+	  add testcase for bug4396.
 
-	* ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
+Sun Feb 20 19:59:32 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Nov 26 13:49:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_cipher.c: parenthesize macro arguments.
 
-	* eval.c (method_missing): raise TypeError for classes do not
-	  have allocators.  [ruby-core:03752]
+Sun Feb 20 16:26:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/erb.rb: add RDoc by James Edward Gray II.  [ruby-core:03786]
+	* thread.c (exec_recursive): prevent temporary objects from GC.
 
-Fri Nov 26 13:29:02 2004  Dave Thomas  <dave@pragprog.com>
+	* prevent temporary objects from GC, and should not use
+	  RSTRING_PTR() for function calls since it evaluates the argument
+	  a couple of times.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
-	  out of preprocessing when we find a :section: directive (previously cleared out the
-	  comment, but this apparently now generates an error in gsub!)
+Sun Feb 20 16:22:53 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov 26 00:17:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* file.c (rb_file_flock): use rb_thread_io_blocking_region for the
+	  time being.
 
-	* io.c (io_read): move StringValue() check before GetOpenFile().
-	  [ruby-dev:24959]
+Sun Feb 20 05:33:17 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Thu Nov 25 20:14:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/minitest/*.rb: Imported minitest 2.0.2 r6207.
+	* test/minitest/*: ditto
 
-	* lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
-	  threads should be also processed.  [ruby-talk:121320]
+Sun Feb 20 02:14:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Nov 25 10:14:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* signal.c (sig_trap): avoid pthread_sigmask(xx, &mask, &mask) usage
+	  because FreeBSD don't permit it. If it's used, it behave as
+	  pthread_sigmask(xx, NULL, &mask).
 
-	* dir.c (push_braces): do not reuse buffer strings.  [ruby-core:03806]
+	* signal.c (init_sigchld): ditto.
 
-Thu Nov 25 07:59:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 20 00:46:51 2011  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (read_all): stringify non-nil buffer argument, and always
-	  taint the result.  [ruby-dev:24955]
+	* ext/openssl/ossl_bn.c: parenthesize macro arguments.
 
-Wed Nov 24 01:01:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Feb 19 22:37:42 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* io.c (io_read): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24952]
+	* vm_insnhelper.c (vm_check_if_namespace): guard temporary object
+	  from GC.
 
-	* configure.in, io.c: cancel [ ruby-Patches-1074 ].
+Sat Feb 19 06:36:27 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Nov 23 08:09:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/test/unit.rb: partial revert of r30849. [ruby-core:32864]
 
-	* ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
+	* test/testunit/test_rake_integration.rb: adding an integration test
+	  with the rake loader to prevent regressions.
 
-Tue Nov 23 02:00:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 18 19:31:31 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* file.c (rb_file_chown): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24949]
+	* lib/fileutils.rb (FileUtils::remove_entry_secure): there is a
+	  race condition in the case where the given path is a directory,
+	  and some other user can move that directory, and create a
+	  symlink while this method is executing.
+	  Reported by: Nicholas Jefferson <nicholas at pythonic.com.au>
 
-Tue Nov 23 00:10:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 18 00:28:39 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* file.c (rb_file_chown): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24947]
+	* compile.c (get_exception_sym2type): guard temporary object from GC.
 
-	* file.c (rb_file_truncate): ditto.
+Thu Feb 17 23:54:29 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* file.c (rb_file_s_truncate): ditto.
+	* iseq.c (prepare_iseq_build): initialize iseq_compile_data::err_info
+	  with nil. this fix exception in rb_iseq_load().
 
-	* dir.c (dir_seek): use NUM2OFFT().
+Thu Feb 17 22:32:35 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* misc/ruby-mode.el (ruby-non-block-do-re): should not match words
-	  start with block keyword and underscore.  [ruby-core:03719]
+	* test/ruby/test_marshal.rb (test_marshal_dump_extra_iv):
+	  fix a typo of local variable. [Bug #3720] [ruby-dev:42083]
 
-Mon Nov 22 22:33:02 2004  Dave Thomas  <dave@pragprog.com>
+Thu Feb 17 21:32:53 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
-	  of variables or constants when oarsing 'require'
+	* ext/openssl/ossl.h: parenthesize macro arguments.
 
-Mon Nov 22 00:13:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb 16 20:37:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* dir.c (dir_seek): should retrieve dir_data after NUM2INT().
-	  [ruby-dev:24941]
+	* eval_jump.c (rb_exec_end_proc): changed at_exit and END proc
+	  evaluation order. [Bug #4400] [ruby-core:35237]
+	* eval_jump.c (rb_mark_end_proc): ditto.
 
-Sat Nov 20 23:57:33 2004  Dave Thomas  <dave@pragprog.com>
+	* test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_nested_at_exit):
+	  added a test for nested at_exit.
+	* test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_beginendblock):
+	  changed the test to adopt new spec.
 
-	* lib/rdoc/README (et al): Add a new directive, :section:, and
-	  change the output format to accomodate. :section: allows to to
-	  group together methods, attributes, constants, etc under
-	  headings in the output. If used, a table of contents is
-	  generated.
+Wed Feb 16 20:17:06 2011  Tanaka Akira  <akr@fsij.org>
 
-Sat Nov 20 23:56:54 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/openssl/openssl_missing.h: parenthesize macro arguments.
 
-	* lib/rdoc/options.rb (Options::parse): Force --inline-source if
-	  --one-file option given
+Tue Feb 15 21:37:45 2011  Tanaka Akira  <akr@fsij.org>
 
-Sat Nov 20 23:55:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/gdbm/gdbm.c: parenthesize macro arguments.
 
-	* string.c (rb_str_splice): should place index wrapping after
-	  possible modification.  [ruby-dev:24940]
+Tue Feb 15 20:34:53 2011  Tanaka Akira  <akr@fsij.org>
 
-Sat Nov 20 13:26:03 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* array.c (ary_join_1): fix array size.
 
-	* ext/nkf/nkf-utf8/utf8tbl.c: original revision 1.7
+Tue Feb 15 19:43:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Nov 20 05:34:24 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* configure.in: fix and resubmit r30621. [ruby-dev:43203]
 
-	* ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
+Tue Feb 15 15:41:30 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/nkf/test.rb: add test for mime encode/decode
+	* array.c (array_join): copy the encoding of the first element as
+	  an initial encoding.
 
-Sat Nov 20 01:37:34 2004  Johan Holmberg  <holmberg@iar.se>
+	* array.c (array_join_0): ditto.
 
-	* eval.c (error_print): nicer traceback at interrupt.
-	  [ruby-core:03774]
+	* array.c (array_join_1): ditto.
 
-Sat Nov 20 00:07:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* array.c (inspect_ary): ditto.
 
-	* string.c (str_gsub): internal buffer should not be listed by
-	  ObjectSpace.each_object() by String#gsub.  [ruby-dev:24931]
+	* array.c (array_join_1): add an argument to check the appending is
+	  first one or not.
 
-Fri Nov 19 01:20:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Feb 15 15:40:53 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
-	  exception if data corresponding to session specified from the
-	  client does not exist.
+	* hash.c (inspect_i): copy the encoding of the first key as
+	  an initial encoding.
 
-Fri Nov 19 00:59:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Feb 14 15:00:16 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (str_gsub): internal buffer should not be listed by
-	  ObjectSpace.each_object().  [ruby-dev:24919]
+	* array.c (inspect_ary): don't taint the inspected result of a
+	  recursive array.
 
-Thu Nov 18 18:41:08 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Tue Feb 15 15:43:29 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/ruby/test_stringchar.rb (test_bang): added.
+	* encoding.c (rb_enc_compatible): change the rule for empty strings:
+	  remove the special treatment of the US-ASCII encoded empty string.
+	  Now Encoding.compatible? usually respect the encoding of the
+	  receiver.
 
-	* string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
-	  (rb_str_swapcase_bang): missing rb_str_modify().  [ruby-dev:24915]
+Tue Feb 15 15:39:37 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Nov 18 00:21:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_enc_cr_str_buf_cat): remove special treatment of
+	  ASCII-8BIT receivers.
 
-	* process.c (proc_getpgrp): prohibit for $SAFE=2.
-	  [ruby-dev:24899]
+	* string.c (str_gsub): set initial encoding of the buffer as the
+	  same of the receiver. [ruby-core:35141]
 
-	* process.c (get_pid): ditto.  [ruby-dev:24904]
+Tue Feb 15 09:49:33 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* process.c (get_ppid): ditto.
+	* test/ruby/test_system.rb (TestSystem#test_system_at): use findstr
+	  command instead of find command, because the latter is confusing
+	  another famous Unix command.
 
-	* array.c (rb_ary_delete): defer rb_ary_modify() until actual
-	  modification.  [ruby-dev:24901]
+Mon Feb 14 23:01:19 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Thu Nov 18 10:10:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (rb_thread_io_blocking_region): reset th->waiting_fd
+	  after blocking region, because remaining waiting_fd might
+	  cause unnecessary IOError.
 
-	* io.c, rubyio.h (rb_io_modenum_flags): exported.
+Mon Feb 14 21:06:50 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
-	  well as IO.new does.  [ruby-dev:24896]
+	* configure.in: revert r30621.  That revision introduced mkmf test
+	  failures and it turned out to be OK to revert. [ruby-dev:43203]
 
-Wed Nov 17 23:42:40 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Mon Feb 14 21:04:01 2011  Tanaka Akira  <akr@fsij.org>
 
-	* test/ruby/test_settracefunc.rb: added.  [ruby-dev:24884]
+	* ext/fiddle/conversions.h: parenthesize macro arguments.
 
-Wed Nov 17 13:56:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Feb 14 18:41:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
+	* win32/setup.mak (USE_RUBYGEMS): fixed r30835. It didn't work on
+	  mswin32 port. If you changed win32/configure.bat, you should change
+	  setup.mak too.
 
-	* parse.y (string_content): should not use FL_UNSET.
+Mon Feb 14 17:28:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* node.h (NODE_NEWLINE): remove unused bit to utilize flag field
-	  in nodes.
+	* test/ruby/test_system.rb (TestSystem#test_system_at):
+	  added test. [ruby-core:35218] (#4393)
 
-Wed Nov 17 13:09:40 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Feb 14 13:15:35 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* {bcc32,win32,wince}/Makefile.sub (test): should build ruby.exe
-	  before running test. [ruby-core:03756]
+	* win32/win32.c (is_internal_cmd): if the first char of prog is '@',
+	  execute it via shell.  [ruby-core:35218] (#4393)
 
-Wed Nov 17 04:33:01 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Feb 14 10:33:45 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* pack.c: all features are backport from 1.9. [ruby-dev:24826]
+	* lib/test/unit.rb: revert r30863, because it causes too many noise.
 
-	* bignum.c (rb_big2ulong_pack): new function to pack Bignums.
+Mon Feb 14 07:34:55 2011  Tanaka Akira  <akr@fsij.org>
 
-Wed Nov 17 03:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/curses/curses.c: parenthesize macro arguments.
 
-	* string.c (rb_str_splice): move rb_str_modify() after
-	  StringValue(), which may alter the receiver.  [ruby-dev:24878]
+Sun Feb 13 19:41:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 16 23:45:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::RequireFiles#non_options): skip
+	  test suites failed to load instead of mere messages.
 
-	* numeric.c (flo_divmod): protect float values from GC by
-	  assignment to local variables.  [ruby-dev:24873]
+Sun Feb 13 09:56:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 16 16:30:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/openssl/test_config.rb (OpenSSL#test_freeze): fix error
+	  message assertion.
 
-	* {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
-	  config.status to force updating them.
+	* test/io/nonblock/test_flush.rb (TestIONonblock#flush_test):
+	  return true to finish the test.
 
-Tue Nov 16 16:20:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/syck/test_string.rb (Syck::TestString#test_non_binary_string):
+	  use assert_not instead of refute, unless required minitest
+	  explicitly.
 
-	* ext/stringio/stringio.c (strio_read): position was ignored when a
-	  buffer was passed.  http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
+	* test/test_prime.rb (TestPrime::sieve.Integer): ditto.
 
-Tue Nov 16 11:19:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/xmlrpc/webrick_testing.rb (WEBrick_Testing#start_server):
+	  catch IOError when server socket was closed.
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
-	  Regexp conversion.
+Sun Feb 13 07:39:51 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Nov 16 01:41:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enum.c (enum_inject): typo fixed. a patch from Gaku Ueda in
+	  [ruby-core:35216].
 
-	* string.c (str_mod_check): frozen check should be separated.
-	  [ruby-core:3742]
+Sun Feb 13 00:48:47 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* array.c (rb_ary_update): pedantic check to detect
-	  rb_ary_to_ary() to modify the receiver.  [ruby-dev:24861]
+	* lib/date.rb (Date#===): [ruby-core:35127]
 
-Mon Nov 15 13:50:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 13 00:29:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_justify): typo fixed.  [ruby-dev:24851]
+	* lib/test/unit.rb (Test::Unit::Options#process_args): always
+	  return options.
 
-Mon Nov 15 11:50:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::RequireFiles#non_options): return
+	  if any test case get loaded.
 
-	* misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
-	  operator symbols.  [ruby-talk:120177]
+	* lib/test/unit.rb (Test::Unit::AutoRunner#initialize): do not add
+	  default directory if it is nil.
 
-Sun Nov 14 13:27:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::AutoRunner#process_args): return
+	  true if any test cases to run.
 
-	* lib/pp.rb (PP#object_address_group): remove odd number of 'f'
-	  prefixed to negative address.
+Sat Feb 12 23:17:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Nov 14 08:51:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/test/unit.rb (assert_include): add alias.
 
-	* test/logger/test_logger.rb: Logger just expects
-	  Logger#datetime_format to be used for Time#strftime independently of
-	  locale. [ruby-dev:24828]
+Sat Feb 12 14:44:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov 12 15:03:26 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread.c (rb_thread_io_blocking_region): new function to run
+	  blocking region with GIL released, for fd.
 
-	* eval.c (ruby_options): now we cannot call rb_glob() before
-	  ruby_init(), so call rb_w32_cmdvector() at ruby_options().
+	* thread.c (rb_thread_fd_close): implement.  [ruby-core:35203]
 
-	* win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
-	  export it.
+	* vm.c (th_init): rename from th_init2.
 
-Fri Nov 12 14:08:01 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Feb 12 14:41:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
+	* lib/test/unit.rb (Test::Unit::AutoRunner#initialize): use
+	  default_dir if no test case given.
 
-	* ext/tk/lib/tk.rb: ditto
+	* lib/test/unit.rb (Test::Unit::Runner): rename from Test::Unit::Mini.
 
-Fri Nov 12 00:31:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::GlobOption#non_options): run tests
+	  under base directory if no argument given.
 
-	* ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
-	  pointer.  [ruby-dev:24783]
+Sat Feb 12 08:03:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov 11 17:36:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_settracefunc.rb (TestSetTraceFunc): ensure to use
+	  method_added hook defined in Module.
 
-	* dir.c (rb_globi): also should call back via rb_glob_caller().
-	  [ruby-dev:24775]
+Sat Feb 12 01:04:02 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov 11 16:47:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ruby.c (proc_options): enable rubygems if --gem option is given.
 
-	* test/ruby/test_file.rb (test_truncate_wbuf): we want to test
-	  only File#truncate, not behaviour of seek(2).
+	* ruby.c (process_options): load rubygems if it is disabled but
+	  --gem option is given.
 
-Thu Nov 11 09:41:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 11 23:27:50 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* dir.c (push_braces): was confusing VALUE and char*.
+	* ruby.c (proc_options): add --gem=enabled as an alias of
+	  --enable=gems and --gem=disabled as an alias of --disable=gems.
+	  Gem named "enabled" or "disabled" has already been reserved
+	  legitimately for this purpose.
 
-	* dir.c (rb_push_glob): Dir.glob should have called its block.
+Fri Feb 11 23:17:04 2011  Tanaka Akira  <akr@fsij.org>
 
-Thu Nov 11 01:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/dl/cfunc.c: parenthesize macro arguments.
 
-	* error.c (syserr_initialize): use stringified object.
-	  [ruby-dev:24768]
+Fri Feb 11 21:41:53 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov 10 22:49:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* bin/testrb, test/runner.rb, lib/test/unit.rb: improve backward
+	  compatibility.
 
-	* lib/delegate.rb (SimpleDelegator::dup): wrong number of
-	  arguments.
+Fri Feb 11 19:45:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/delegate.rb (DelegateClass::dup): ditto.
+	* eval.c (ruby_cleanup): use rb_ary_free to free internal object.
 
-Wed Nov 10 12:31:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.h (RUBY_FREE_UNLESS_NULL): get rid of double free.
+	  [ruby-core:35192]
 
-	* README.EXT (Example): extconf.rb is indispensable now.
+Fri Feb 11 16:57:03 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov 10 03:33:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/ruby/test_transcode.rb (test_from_cp50221): fix wrong
+	  assertion and move back.
 
-	* ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
-	  or older
+Fri Feb 11 14:33:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/tile/style.rb: bug fix
+	* lib/test/unit/assertions.rb (assert_no_match): alias for
+	  backward compatibility.
 
-Tue Nov  9 14:27:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb 11 12:06:48 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
+	* ruby.c (add_gems, require_libraries, proc_options): add
+	  --require and --gem options.
 
-Tue Nov  9 01:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Feb 11 12:03:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (rb_glob2): do not allocate buffer from heap to avoid
-	  memory leaks.  use string object for buffering instead.
-	  [ruby-dev:24738]
+	* configure.in (rubygems): add --disable-rubygems option.
 
-	* dir.c (join_path): ditto.
+Fri Feb 11 11:39:03 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_read): external input buffer may be modified even after
-	  rb_str_locktmp().  [ruby-dev:24735]
+	* template/fake.rb.in (CROSS_COMPILING): get rid of NameError.
 
-	* dir.c (fnmatch): p or s may be NULL.  [ruby-dev:24749]
+Thu Feb 10 23:12:34 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Nov  9 00:53:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/dl/dl.h: parenthesize macro arguments.
 
-	* regex.c (slow_match): avoid GCC 3.4.x warnings.
+Wed Feb  9 23:11:27 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Nov  9 00:50:06 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/pty/pty.c: parenthesize macro arguments.
 
-	* lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
+Tue Feb  8 11:47:11 2011  Loren Sands-Ramshaw  <lorensr@gmail.com>
 
-Mon Nov  8 23:38:35 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* array.c: documentation clarification in rotate, rotate!,
+	  index, and rindex. [ruby-core:35144]
 
-	* lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
-	  [ruby-dev:24743]
+Wed Feb  9 09:45:43 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Nov  8 22:20:19 2004  Dave Thomas  <dave@pragprog.com>
+	* test/rdoc/test_rdoc_encoding.rb: remove unnecessary (and wrong)
+	  platform-dependent hacks.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Fix bug where parent class wasn't being detected if the
-	  child class was defined using the A::B notation.
+Wed Feb  9 00:47:18 2011  Tanaka Akira  <akr@fsij.org>
 
-Mon Nov  8 00:14:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/etc/etc.c: parenthesize macro arguments.
 
-	* configure.in: add setup for mignw32 cross compiling.
-	  [ruby-talk:119413]
+Tue Feb  8 19:38:00 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Nov  7 23:49:26 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* misc/ruby-mode.el (ruby-expr-beg): fix for invalid nest errors.
 
-	* ext/tk/lib/tk.rb: bind-event methods accept multi substitution
-	  arguments.
+Tue Feb  8 19:22:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/canvas.rb: ditto.
+	* configure.in (AC_MSG_CHECKING): fixed typo. the patch is
+	  created by Benoit Daloze. Thanks a lot. [Bug #4384][ruby-core:35148]
 
-	* ext/tk/lib/tk/canvastag.rb: ditto.
+Tue Feb  8 16:04:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/text.rb: ditto.
+	* io.c (rb_io_s_sysopen): use NUM2MODET() instead NUM2UINT().
 
-	* ext/tk/lib/tk/texttag.rb: ditto.
+Tue Feb  8 15:59:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib: ditto.
+	* process.c (rb_run_exec_options_err): use MODET2NUM() instead
+	  LONG2NUM().
 
-Sat Nov  6 14:58:44 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Feb  8 13:59:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/server.rb (WEBrick::HTTPServer#start): remove
-	  :DoNotReverseLookup option. (Socket#do_not_reverse_lookup is a
-	  ruby 1.9 feature)
+	* configure.in: revert r30725. Now we have proper runtime fallback.
+	  Therefore, no need compile time disabling. (see r30762).
 
-Sat Nov  6 11:31:04 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+Tue Feb  8 01:00:21 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* lib/date.rb (_parse): checks whether zone was given.
+	* process.c (proc_setgroups): add GC guard to prevent intermediate
+	  variable from GC.
 
-Sat Nov  6 00:46:27 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Feb  8 00:56:33 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_locktmp): check STR_TMPLOCK flag before
-	  locking.  [ruby-dev:24727]
+	* misc/ruby-mode.el (ruby-expr-beg, ruby-in-here-doc-p): tell
+	  singleton class definitions from here documents.
 
-Fri Nov  5 18:12:42 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial): keyword
+	  followed by colon is label.
 
-	* ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
-	  X_Scrollable and Y_Scrollable
+Mon Feb  7 22:56:16 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
+	* lib/benchmark.rb (Benchmark#bmbm): use ensure clause instead of
+	  Object#tap to restore STDOUT.sync.
 
-	* ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
-	  Y_Scrollable
+Mon Feb  7 22:34:20 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Nov  5 16:05:32 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/net/http.rb (Net::HTTP#connect): support SNI (Server Name
+	  Indication) for HTTPS.  [ruby-dev:43164]
+	  http://stackoverflow.com/questions/4685736/openssl-server-name-indication-support-in-ruby
 
-	* ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
+Mon Feb  7 16:05:32 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Nov  5 13:22:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/rdoc: Upgrade to RDoc 3.5.3  Fixes [Bug #4376]
 
-	* ext/tk/lib/tk/text.rb: sorry. bug fix again.
+Mon Feb  7 11:46:59 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Nov  5 13:17:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* common.mk (rdoc): add --encoding=UTF-8; ruby's rdoc must be UTF-8.
 
-	* ext/tk/lib/tk/text.rb: bug fix
+Mon Feb  7 10:21:50 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
+	  there is no easy way to create owner unreadable file on Windows.
+	  So, skip the test.
 
-	* gc.c (gc_mark): stricter GC stack check.
+Sun Feb  6 13:48:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/json/lib/json/common.rb (JSON::MissingUnicodeSupport.iconv):
+	  should not drop rest of the result.  use Iconv.conv instead.
 
-	* gc.c (gc_mark): stricter GC stack check.
+Sun Feb  6 12:46:02 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Nov  5 08:34:43 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (gsub): Ensure result encoding is the same as input
+	  encoding.  [Bug #4340].
 
-	* string.c (str_gsub): should have removed rb_str_unlocktmp(str).
-	  [ruby-dev:24708]
+Sun Feb  6 12:18:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 21:25:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (words, qwords): dispatch array events.  based on a
+	  patch from Michael Edgar.  [Bug #4365].
 
-	* string.c (str_gsub): string modify check no longer based on
-	  tmplock.  [ruby-dev:24706]
+Sun Feb  6 12:12:59 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 19:27:46 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/fileutils/fileasserts.rb (FileAssertions): separate module.
 
-	* io.c (rb_f_open): fix typo.
+Sun Feb  6 11:29:23 2011  Tanaka Akira  <akr@fsij.org>
 
-Thu Nov  4 15:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/dbm/dbm.c: parenthesize macro arguments.
 
-	* ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
-	  of TkVarAccess objects
+Sat Feb  5 22:01:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Nov  4 09:11:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  revert r30796. r30797 and r30798 are an alternative fix.
+	  [ruby-dev:43174]
 
-	* gc.c (gc_mark): enable GC stack checking.
+Sat Feb  5 21:47:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 03:11:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (mlhs_basic): include mlhs_post for ripper.  a patch
+	  from Michael Edgar at [ruby-core:35078].
 
-	* string.c (str_gsub): lock strings temporarily.  [ruby-dev:24687]
+Sat Feb  5 21:22:21 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (s_recvfrom): tmplock input buffer.
-	  [ruby-dev:24705]
+	* lib/test/unit/assertions.rb (assert_block): move from
+	  test/fileutils/fileasserts.rb.
 
-Wed Nov  3 22:32:12 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/fileutils/fileasserts.rb (assert_block): pass arguments
+	  as-is.  [ruby-dev:43174]
 
-	* process.c: On NetBSD don't use setruid() and setrgid().
+Sat Feb  5 16:47:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Nov  3 22:24:17 2004  Daigo Moriwaki  <techml@sgtpepper.net>
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  msg can be passed nil. [Bug #4371] [ruby-dev:43174]
 
-	* lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
-	  avoid warnings.
+Sat Feb  5 15:18:25 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Nov  3 17:19:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rdoc: Upgrade to RDoc 3.5.2
 
-	* array.c (rb_ary_uniq_bang): do not push frozen string from hash
-	  table.  [ruby-dev:24695]
+Sat Feb  5 12:05:27 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_and): ditto.
+	* ext/syck/rubyext.c (syck_node_init_copy): SyckNode is not
+	  copiable.  [ruby-core:35094]
 
-	* array.c (rb_ary_or): ditto.
+Sat Feb  5 11:48:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov  3 17:13:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/ossl_cipher.c (ossl_cipher_alloc): leave data ptr
+	  NULL.
 
-	* io.c (pipe_open): fix compile error
+	* ext/openssl/ossl_cipher.c (ossl_cipher_new, ossl_cipher_initialize):
+	  allocate internal structure.  [ruby-core:35094]
 
-Wed Nov  3 16:58:07 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/ossl_cipher.c (ossl_cipher_copy): ditto.
 
-	* ext/tk/lib/tk.rb: support to use different Tcl commands between
-	  configure and configinfo
+Sat Feb  5 11:29:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/font.rb: ditto.
+	* ext/json/parser/parser.h (GET_PARSER): raise TypeError.
 
-	* ext/tk/lib/itemconfig.rb: support to use different Tcl commands
-	  between item_configure and item_configinfo
+	* ext/json/parser/parser.rl (cParser_initialize): ditto.
 
-	* ext/tk/lib/itemfont.rb: ditto.
+	* ext/json/parser/parser.h (GET_PARSER): check if initialized.
+	  [ruby-core:35079]
 
-	* ext/tk/extconf.rb: install SUPPORT_STATUS
+	* ext/json/parser/parser.rl (cParser_initialize): ditto.
 
-	* ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
+Sat Feb  5 10:09:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov  3 16:30:41 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* load.c (rb_get_expanded_load_path): always expand load paths.
 
-	* ext/nkf: follow nkf 2.0.4
+Sat Feb  5 09:38:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov  3 15:53:34 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* transcode.c (encoded_dup): extract.
 
-	* test/rss/test_maker_*.rb: added tests for RSS Maker.
+Sat Feb  5 03:37:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/maker.rb: added RSS Maker.
+	* lib/fileutils.rb (FileUtils::LowMethods): make low level methods
+	  in NoWrite and DryRun to do nothing.  [ruby-dev:43129]
 
-	* lib/rss/maker/*.rb: ditto.
+	* test/fileutils/fileasserts.rb: add message arguments.
 
-Tue Nov  2 16:35:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/fileutils/fileasserts.rb (Test::Unit::Assertions#assert_block):
+	  show the given message.
 
-	* ext/enumerator/enumerator.c (each_cons_i): pass copy of an
-	  internal consequent array.  [ruby-talk:118691]
+Sat Feb  5 02:09:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov  2 16:05:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (lex_getline, parser_set_encode): set encoding of lines
+	  in SCRIPT_LINES__ as source encoding.  [ruby-dev:43168]
 
-	* process.c (rb_f_fork): need to flush stdout and stderr before
-	  fork(2).  [ruby-talk:117715]
+Sat Feb  5 02:08:37 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov  2 01:20:09 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm.c (ruby_thread_data_type): add prefix.
 
-	* eval.c (proc_invoke): nail down dyna_var node when Proc object
-	  or continuation is created.  [ruby-dev:24671]
+Sat Feb  5 00:59:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Nov  1 13:59:28 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* vm_core.h (GetThreadPtr): use TypedData_Get_Struct() instead
+	  CoreDataFromValue() because we need type check. Otherwise,
+	  type mismatch can cause segmentation fault crash.
+	  [ruby-core:35086] [Ruby 1.9-Bug#4367]
 
-	* ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
+	* vm.c (thread_data_type): remove static.
 
-	* ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
-	  ext/stringio/extconf.rb: added.
+Fri Feb  4 19:14:27 2011  Tanaka Akira  <akr@fsij.org>
 
-	* MANIFEST, ext/**/MANIFEST: removed.
+	* enc/trans/utf8_mac.trans: parenthesize macro arguments.
 
-	* README.EXT, README.EXT.ja: remove MANIFEST stuff.
+Fri Feb  4 12:11:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Nov  1 01:14:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (str_utf8_nth): fixed a condition of optimized lead
+	  byte counting. [Bug #4366][ruby-dev:43170]
 
-	* io.c (rb_f_open): create copy of popen specifier.  [ruby-dev:24656]
+Fri Feb  4 01:50:13 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Nov  1 00:36:48 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* string.c (count_utf8_lead_bytes_with_word): wrote function
+	  comments.
 
-	* main.c (_stklen): move to gc.c.
+Fri Feb  4 00:14:55 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 31 00:22:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/zlib/zlib.c (gzfile_reader_get_unused): no need to dup
+	  before rb_str_resurrect.
 
-	* string.c (rb_str_locktmp): lock string temporarily.
+Thu Feb  3 20:04:44 2011  Tanaka Akira  <akr@fsij.org>
 
-	* string.c (str_independent): add tmplock check.
+	* ext/curses/curses.c (CHECK): unused macro removed.
 
-	* io.c (io_write): lock output string temporarily.
-	  [ruby-dev:24649]
+Thu Feb  3 18:33:26 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (io_write): use rb_str_locktmp().
+	* ext/zlib/zlib.c (gzfile_reader_get_unused): use rb_str_resurrect
+	  because gz->z.input is hidden string. [ruby-core:35057]
 
-	* io.c (read_all): ditto.
+Thu Feb  3 16:34:10 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Oct 30 06:53:24 2004  Peter Vanbroekhoven  <peter.vanbroekhoven@cs.kuleuven.ac.be>
+	* enc/shift_jis.c (code_to_mbc): cast as int from the subtraction of
+	  pointers.
 
-	* eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
+	* enc/utf_16le.c (utf16le_mbc_enc_len): use ptrdiff_t.
 
-Sat Oct 30 00:19:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/utf_32be.c (utf32be_left_adjust_char_head): ditto.
 
-	* enum.c (enum_sort_by): protect continuation jump in.
-	  [ruby-dev:24642]
+	* enc/utf_32le.c (utf32le_left_adjust_char_head): ditto.
 
-Fri Oct 29 21:27:51 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb  3 16:31:43 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (rb_io_check_initialized): new function to check uninitialized
-	  object.  [ruby-talk:118234]
+	* include/ruby/missing.h: don't use HAVE_STDDEF_H because it never
+	  defined by configure though configure.bat defines it.
 
-	* file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
+	* include/ruby/ruby.h: move include stddef.h to defines.h
 
-Fri Oct 29 10:00:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/defines.h: ditto.
 
-	* eval.c (rb_thread_start_0): forget to free some memory chunks.
-	  [ruby-core:03611]
+Wed Feb  2 20:25:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
-	  should be wrapped by PUSH_TAG/POP_TAG().  [ruby-dev:24627]
+	* include/ruby/encoding.h (rb_enc_step_back): cast 4th argument 'n'
+	  as int because Ruby usually treats length value as long but
+	  onigenc_step_back's 4th argument is int.
 
-Thu Oct 28 08:42:02 2004  Tanaka Akira  <akr@m17n.org>
+Thu Feb  3 07:20:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* io.c (argf_forward): use ANSI style.
-	  (argf_read): call argf_forward with argv argument.
-	  [ruby-dev:24624]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: use Regexp::NOENCODING
+	  rather than magic number.
 
-Thu Oct 28 23:32:54 2004  akira yamada  <akira@ruby-lang.org>
+	* ext/syck/lib/syck/rubytypes.rb: ditto
 
-	* ext/zlib/zlib.c (zstream_detach_input): resets klass of z->input if
-	  z->input isn't nil.
+Thu Feb  3 07:16:11 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Oct 28 23:19:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* re.c (Init_Regexp): added a constant for ARG_ENCODING_NONE
+	  [ruby-core:35054]
 
-	* ext/extmk.rb: prefer relative path.  [ruby-talk:93037]
+	* test/ruby/test_regexp.rb: corresponding test.
 
-Wed Oct 27 18:49:11 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Feb  3 07:02:16 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* gc.c: prototype; rb_io_fptr_finalize() doesn't return any value
-	  at this version.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: ARG_ENCODING_NONE regular
+	  expressions can round trip. [ruby-core:34969]
 
-Wed Oct 27 17:27:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/psych/test_yaml.rb: test for ARG_ENCODING_NONE regex
 
-	* gc.c (gc_sweep): recover ruby_in_compile variable.
+	* ext/sych/lib/syck/rubytypes.rb: ARG_ENCODING_NONE regular
+	  expressions can round trip.
 
-Wed Oct 27 09:17:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/syck/test_yaml.rb: test for ARG_ENCODING_NONE regex
 
-	* string.c (str_gsub): use a string object for exception safeness.
-	  [ruby-dev:24601]
+Wed Feb  2 17:09:22 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Oct 26 23:52:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_fdatasync): Use fsync(2) if the underlying
+	  operating system does not support fdatasync(2).
 
-	* io.c (rb_io_getline): rs modification check should not interfere in the loop.
+Wed Feb  2 14:51:08 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Oct 26 23:30:39 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/rdoc/markup/to_tt_only.rb: commit miss
+	* test/rdoc/test_rdoc_markup_to_tt_only.rb: ditto
+	* test/rdoc/test_rdoc_single_class.rb: ditto
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
-	  Restore correct :nopdoc: behavior with nested classes and modules.
+Wed Feb  2 09:27:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Oct 26 18:21:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rdoc: Upgrade to RDoc 3.5.1
 
-	* string.c (RESIZE_CAPA): check string attribute before modifying
-	  capacity member of string structure.  [ruby-dev:24594]
+Wed Feb  2 00:30:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
+	* include/ruby/st.h (st_table): Added comment why we need __extension__.
 
-	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
-	  performance.  [ruby-talk:117701]
+Tue Feb  1 20:45:44 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/encdb.c: parenthesize macro arguments.
 
-	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
-	  arguments, unless (digit)$ style used.
+Tue Feb  1 15:12:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
+	* test/ruby/test_require.rb (TestRequire#test_require_with_unc):
+	  use ``127.0.0.1'' instead of ``localhost'' as host name, because
+	  XP or earlier cannot resolv it as NBT hostname.
 
-	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
-	  performance.  [ruby-talk:117701]
+Tue Feb  1 13:20:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/benchmark/test_benchmark.rb (#capture_bench_output):
+	  Added explicit sleep. Windows have imprecise time support.
+	  Thus Tms.new.Add!{} may be or may be not equal 0. The
+	  test failure started since r30747.
 
-	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
-	  arguments, unless (digit)$ style used.
+Tue Feb  1 11:03:47 2011  Ryan Davis  <ryan@lust.local>
 
-Mon Oct 25 18:35:39 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/rubygems*: Import rubygems 1.5.0 (released version @ 1fb59d0)
+	* test/rubygems: Ditto
 
-	* win32/win32.c (isUNCRoot): should check NUL after '.'.
-	  [ruby-dev:24590]
+Tue Feb  1 08:01:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (isUNCRoot): fixed buffer overrun.
+	* ext/io/console/console.c (console_set_winsize): new method to set
+	  console size.  [EXPERIMENTAL]
 
-Mon Oct 25 08:03:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/io/console/console.c (console_winsize): use GetWriteFD.
 
-	* eval.c (get_backtrace): ignore illegal backtrace.  [ruby-dev:24587]
+Tue Feb  1 02:28:14 2011  Masaya Tarui  <tarui@ruby-lnag.org>
 
-Sun Oct 24 00:41:09 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* include/ruby/win32.h, win32/win32.c: add rb_w32_inet_ntop.
+	  inet_ntop's minimum supported client is Vista.
 
-	* eval.c (rb_load, search_required, rb_require_safe, rb_require): use
-	  frozen shared string to avoid outside modification.  [ruby-dev:24580]
+Tue Feb  1 00:10:30 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Oct 23 22:18:32 2004  Guy Decoux  <ts@moulon.inra.fr>
+	* lib/benchmark.rb: fix benchmark to work with current ruby.
+	  patched by Benoit Daloze [ruby-core:33846] [ruby-dev:43143]
+	  merged from https://github.com/eregon/ruby/commits/benchmark
 
-	* eval.c (frame_free): Guy Decoux solved the leak problem.
-	  Thanks.  [ruby-core:03549]
+	*  lib/benchmark (Report#width): update documentation
+	*  lib/benchmark: document the return value of #benchmark and the
+	   :list attribute in Report
+	*  lib/benchmark (Tms#format): rename variables, use String#%
+	   instead of Kernel.format
+	*  lib/benchmark: remove undocumented Benchmark::times (an alias
+	   of Process::times used twice)
+	*  lib/benchmark (#benchmark): use label_width for the caption
+	*  lib/benchmark (Tms#initialize): rename variables
+	*  lib/benchmark: allow title to not be a String and call #to_s
+	*  lib/benchmark (Benchmark#bm): return an Array of the times with
+	   the labels
+	*  lib/benchmark: correct output for Benchmark#bmbm
+	   (remove the extra space)
+	*  lib/benchmark: add a few tests for Benchmark::Tms output
+	*  lib/benchmark: improve style (enumerators, ljust, unused vars)
+	*  lib/benchmark: add spec about output and return value
+	*  lib/benchmark: improve basic style and consistency
+	   no parenthesis for print and use interpolation instead of printf
+	*  lib/benchmark: remove unnecessary conversions and variables
+	*  lib/benchmark: correct indentation
+	*  lib/benchmark: rename the FMTSTR constant and variable to FORMAT
+	*  lib/benchmark: remove useless exception
 
-Sat Oct 23 00:20:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	*  test/benchmark: remove unused variable warnings
 
-	* ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
-	  to avoid potential vulnerability.
+Mon Jan 31 23:27:23 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
-	  to avoid SEGV.  [ruby-dev:24568]
+	* node.c (add_id): remove duplicated rb_id2str() call.
 
-Fri Oct 22 12:02:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jan 30 17:19:46 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_alias): was warning for wrong condition.
-	  [ruby-dev:24565]
+	* missing/langinfo.c: parenthesize macro arguments.
 
-Fri Oct 22 10:36:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Jan 31 21:57:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
-	  should check if path_info is not nil.
+	* configure.in: revert r30698.
 
-Fri Oct 22 00:22:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jan 31 21:32:44 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/zlib/zlib.c (zstream_shift_buffer): should restore class
-	  field of a buffer.  [ruby-dev:24562]
+	* thread.c (thread_start_func_2): check deadlock condition before
+	  release thread stack. fix memory violation when deadlock detected.
+	  reported by Max Aller. [Bug #4009] [ruby-core:32982]
 
-Fri Oct 22 00:20:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jan 31 14:45:47 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* string.c (rb_str_include): should not treat char as negative value.
-	  [ruby-dev:24558]
+	* lib/irb/locale.rb (IRB::Locale::#search_file):
+	  Gem might be undefined if --disable-gems. [ruby-core:34990]
 
-Thu Oct 21 21:32:30 2004  IWATSUKI Hiroyuki  <don@na.rim.or.jp>
+Mon Jan 31 12:26:14 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/pstore.rb (PStore#transaction): Use the empty content when a
-	  file is not found.  [ruby-dev:24561]
+	* addr2line.c: suppressed shorten-64-to-32 warnings.
+	* regcomp.c: ditto.
+	* regexec.c: ditto.
+	* regint.h: ditto.
+	* regparse.c: ditto.
+	* regparse.h: ditto.
+	* time.c: ditto.
+	* variable.c: ditto.
 
-Thu Oct 21 19:06:15 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Jan 31 04:45:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
-	  ensure to close @body. (http://bugs.debian.org/277520)
+	* array.c (rb_ary_uniq_bang): call ARY_SET_LEN(ary, 0) before
+	  ary_resize_capa because ary_resize_capa expects resized length is
+	  smaller than current array length. call rb_ary_unshare before
+	  ary_resize_capa because ary_resize_capa lost the reference to
+	  original shared array. [ruby-core:34997]
 
-Thu Oct 21 00:36:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jan 30 17:19:46 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_alias): should warn on method discarding.
-	  [ruby-dev:24546]
+	* missing/crypt.c: parenthesize macro arguments.
 
-	* ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
-	  string buffer by clearing klass.  [ruby-dev:24548]
+Sun Jan 30 16:40:27 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 20 19:45:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rubygems/test_gem_security.rb (TestGemSecurity): valid only
+	  if OpenSSL is available.
 
-	* string.c (str_gsub): 	reentrant check.  [ruby-dev:24432]
+	* test/dl/test_dl2.rb (TestDL#test_sin): math functions do not
+	  work on x86_64 due to the design of DL2.
 
-	* backport all SEGV bug fixes from CVS HEAD.  [ruby-dev:24536]
+	* test/dl/test_func.rb (DL::TestFunc#test_{sinf,sin): ditto.
 
-Wed Oct 20 04:17:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jan 30 16:09:22 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
-	  is a string.  [ruby-dev:24490]
+	* strftime.c (rb_strftime_with_timespec): %G produces 4 digits.
 
-	* ext/sdbm/init.c (fsdbm_delete_if): ditto.
+Sun Jan 30 15:13:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 20 01:37:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/emacs_mule.c (emacsmule_islead): 7bit range is also leading
+	  byte.
 
-	* array.c (rb_ary_times): Array#* should return an instance of
-	  the class of right operand.  [ruby-dev:24526]
+Sun Jan 30 13:03:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/zlib/zlib.c (zstream_detach_buffer): should not expose
-	  class-less object to Ruby world. [ruby-dev:24530]
+	* hash.c (rb_hash_fetch_m): use useful message for longer key, not a
+	  nonsense id value.
 
-	* eval.c (proc_dup): provide Proc#dup as well.  [ruby-talk:116915]
+	* string.c (rb_str_ellipsize): new function to ellipsize a string.
 
-	* eval.c (ruby_exec): stack marking position may be higher than
-	  expected.  thanks to Guy Decoux.  [ruby-core:03527]
+	* include/ruby/encoding.h (rb_enc_step_back): new function to step
+	  back n characters.
 
-Tue Oct 19 22:43:12 2004  Dave Thomas  <dave@pragprog.com>
+Sun Jan 30 12:53:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
-	  we come across 'attr' in a context where it isn't
-	  followed by a symbol, just issue a warning.
+	* enc/emacs_mule.c (emacsmule_islead): fix inverse condition.
 
-Tue Oct 19 20:41:37 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Sun Jan 30 09:37:25 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
 
-	* ext/win32ole.c(ole_invoke): retrieve the result value when
-	  retrying the IDispatch::invoke.
+	* io.c (struct argf): char behaves like an unsigned char
+	  by default on AIX.
 
-Tue Oct 19 17:24:11 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jan 30 08:02:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (read_all): block string buffer modification during
-	  rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
+	* configure.in: Mac OS X wrongly reports it has fdatasync(3).
 
-	* dir.c (rb_push_glob): block call at once the end of method.
-	  [ruby-dev:24487]
+Sun Jan 30 03:29:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/enumerator/enumerator.c (enum_each_slice): remove
-	  rb_gc_force_recycle() to prevent potential SEGV.
-	  [ruby-dev:24499]
+	* ext/openssl/ossl_bn.c (GetBNPtr): add missing nil case.
+	  patched by Martin Bosslet. [ruby-core:34987]
 
-	* ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
-	  buffer by clearing klass.  [ruby-dev:24510]
+Sun Jan 30 01:02:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Oct 19 16:12:18 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* include/ruby/ruby.h: Added NUM2MODET() and MODET2NUM() default
+	  definition.
+	  Because r30686 introduced win32 build failure.
 
-	* ext/tk/tkutil.c: backport from CVS HEAD
+Sat Jan 29 22:16:26 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Oct 19 08:54:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_join): [].join.encoding must be US-ASCII.
+	  [ruby-list:47790]
 
-	* intern.h, object.c (rb_class_inherited_p): export.
+Sat Jan 29 20:22:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Oct 19 08:46:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* benchmark/driver.rb (BenchmarkDriver#measure): Show command line
+	  when abnormal exiting occur.
 
-	* string.c (rb_str_upto): method result must be checked.  [ruby-dev:24504]
+Sat Jan 29 10:53:16 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* eval.c (error_print): ditto.  [ruby-dev:24519]
+	* vm_insnhelper.c (vm_get_ev_const): no-scope reference to toplevel
+	  private constant has been prohibited incorrectly.
 
-Mon Oct 18 23:37:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_module.rb (test_toplevel_private_constant): add a
+	  test for above.
 
-	* marshal.c (r_object0): check inheritance by the internal function.
-	  [ruby-dev:24515]
+Sat Jan 29 08:43:23 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Mon Oct 18 15:58:01 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/rubygems*: Import rubygems 1.5.0 (release candidate @ 09893d9)
+	* test/rubygems: Ditto
 
-	* range.c (range_step, range_each): need cast.
+Sat Jan 29 02:02:37 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Fri Oct 29 16:34:19 2004  Daiki Ueno  <ueno@unixuser.org>
+	* variable.c (rb_mod_const_of, sv_i): Module#constant should exclude
+	  private constants.  see [ruby-core:32912].
 
-	* misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
-	  line after opening heredoc identifier.  [ruby-dev:24635]
+	* test/ruby/test_module.rb (test_constants_with_private_constant): add
+	  a test for above.
 
-Mon Oct 18 07:26:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jan 29 01:36:41 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* file.c (rb_file_truncate): discard read buffer before truncation.
-	  [ruby-dev:24197]
+	* variable.c (rb_const_set): const_set should preserve constant
+	  visibility.  see [ruby-core:32912].
 
-Mon Oct 18 02:11:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/ruby/test_module.rb: add a test for above.
 
-	* lib/webrick/config.rb (WEBrick::Config::General): add default values:
-	  - WEBrick::Config[:DoNotReverseLookup]
-	  - WEBrick::Config[:RequestCallback] (it used as an alias of
-	    :RequestHandler in WEBrick::HTTPServer#run)
-	  - WEBrick::Config::FileHandler[:AcceptableLanguages]
+Sat Jan 29 01:24:57 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#set_filename): search files
-	  having suffix of language-name which Accept-Language header field
-	  includes if :AcceptableLanguages options is present.
+	* compile.c (NODE_CLASS, NODE_MODULE), insns.def (defineclass): raise
+	  an exception when "class Foo::Bar" is evaluated and Foo::Bar is
+	  private.  To implement this, define_type of "defineclass" is added
+	  so that the instruction can distinguish whether the class definition
+	  is scoped (class Foo::Bar) or not (class Bar).
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
-	  search servlet correspond to the suffix of filename.
+	* test/ruby/test_class.rb (test_redefine_private_class),
+	  test/ruby/test_module.rb
+	  (test_define_module_under_private_constant): add tests for above.
 
-	* lib/webrick/httprequest.rb: add attributes access methods: accept,
-	  accept_charset, accept_encoding, accept_language, content_length
-	  and content_type.
+Sat Jan 29 01:19:17 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/webrick/httpresponse.rb: add attribute access methods:
-	  content_length, content_length=, content_type and content_type=.
+	* constant.h, variable.c: to ensure compatibility, rb_const_get_* must
+	  not raise an exception even when the constant is private.  Instead,
+	  rb_public_const_get_* and rb_public_const_defined_* are introduced,
+	  which raise an exception when the referring constant is private.
+	  see [ruby-core:32912].
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
-	  use the second suffix to detect media type. (the first suffix
-	  may be a language name.)
+	* vm_insnhelper.c (vm_get_ev_const): use rb_public_const_get_* instead
+	  of rb_const_get_* to follow the constant visibility when user code
+	  refers a constant.
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
-	  add method to parse Accept header field. it returns an Array of
-	  values sorted by the qvalues.
+	* test/ruby/test_marshal.rb (test_marshal_private_class): add a test.
+	  This test had failed because of incompatibility of rb_const_get.
 
-Mon Oct 18 02:04:11 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Jan 29 00:30:44 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): new
-	  method to register virtual hosting servers.
+	* variable.c (set_const_visibility): fix typo.  a patch from Tomoyuki
+	  Chikanaga in [ruby-core:32919].
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#accept): call
-	  do_not_reverse_lookup for each socket if :DoNotReverseLookup
-	  is set.  [ruby-core:02357]
+Fri Jan 28 23:20:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Oct 18 00:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create,
+	  TestGDBM2#test_writer_open_notexist): We only need to skip libgdbm
+	  1.8.0, not all 1.8.x. 1.8.1 or later don't have GDBM_WRITER sickness.
 
-	* ext/socket/socket.c (sock_s_getservbyaname): protocol string
-	  might be altered.  [ruby-dev:24503]
+Fri Jan 28 21:56:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (rb_str_upto): check if return value from succ is a
-	  string.  [ruby-dev:24504]
+	* ext/dbm/extconf.rb: Added new header places for Fedora13.
 
-Sun Oct 17 23:03:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 28 21:49:30 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
+	* ext/zlib/zlib.c: parenthesize macro arguments.
 
-Sun Oct 17 13:05:04 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Fri Jan 28 17:47:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
-	* ext/win32ole/win32ole.c (fole_get_methods): ditto.
-	* ext/win32ole/win32ole.c (fole_put_methods): ditto.
-	* ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
-	  WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
+	* test/gdbm/test_gdbm.rb (TestGDBM2#test_writer_open_notexist):
+	  gdbm 1.8.x changed GDBM::WRITER behavior. Thus our testcase need
+	  to be changed too.
 
-Sat Oct 16 14:45:28 2004  Kouhei Sutou  <kou@cozmixng.org>
+Fri Jan 28 17:33:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create): skip
+	  the test if gdbm version is 1.8.x.
 
-Sat Oct 16 13:42:49 2004  Kouhei Sutou  <kou@cozmixng.org>
+Fri Jan 28 16:30:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/: untabified.
-	* test/rss/: untabified.
-	* lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
+	* test/ruby/test_require.rb (TestRequire#test_require_too_long_filename):
+	  Added -w option because too long path error don't output a message
+	  by default since r30660. [Bug #4336] [ruby-dev:43134]
 
-Sat Oct 16 13:34:56 2004  Kouhei Sutou  <kou@cozmixng.org>
+Fri Jan 28 16:19:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss: supported prety print.
-	* test/rss/test_1.0.rb: added test for calculating default indent size.
+	* test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2}):
+	  Added -w option because too long path error don't output a message
+	  by default since r30660. [Bug #4336] [ruby-dev:43134]
 
-Fri Oct 15 18:04:35 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 28 16:04:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
-	  acceptable. Add TkTimer.start ( == new + start ).
+	* test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2,3}):
+	  split from test_require_path_home.
 
-Fri Oct 15 12:43:09 2004  Tanaka Akira  <akr@m17n.org>
+Fri Jan 28 13:04:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (Init_stack): make prototype declaration consistent with
-	  the definition in gc.c.
+	* configure.in (--with-valgrind): Fixed r29683. Now this option
+	  is really default on.
 
-Thu Oct 14 14:34:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri Jan 28 12:05:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
+	* configure.in: Add #include<sys/stat.h> when struct stat is
+	  tested. Otherwise, incomplete type dereference error will occur.
 
-Thu Oct 14 13:33:59 2004  Kouhei Sutou  <kou@cozmixng.org>
+Fri Jan 28 11:53:19 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/rss.rb: added link to Tutorial.
+	* configure.in: redundant variable names made strange conftest
+	  error. Fixed it.
 
-Mon Oct 11 13:48:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 28 11:47:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/*: untabify
+	* test/ruby/test_process.rb (TestProcess#test_too_long_path{,2}):
+	  should handle Errno::E2BIG, because this test checks crash of ruby,
+	  not the error type system.
 
-Sun Oct 10 12:32:08 2004  Dave Thomas  <dave@pragprog.com>
+Fri Jan 28 11:23:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
-	  to be used as a variable name
+	* io.c (rb_io_open): Use NUM2MODET() instead NUM2UINT().
+	* io.c (rb_scan_open_args): ditto.
 
-Sat Oct  9 21:23:37 2004  Kouhei Sutou  <kou@cozmixng.org>
+Fri Jan 28 10:58:20 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/converter.rb: changed to try to use Iconv for default
+	* configure.in: Added mode_t type checking.
+	* process.c (rb_exec_arg_addopt): Use NUM2MODET() instead
+	  NUM2LONG because clang makes compile error by this narrowing
 	  conversion.
+	* process.c (rb_run_exec_options_err): ditto.
 
-	* lib/rss/rss.rb: 0.0.9 -> 0.1.0.
-
-Sat Oct  9 19:50:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_getline): should not treat char as negative value.
-	  [ruby-dev:24460]
-
-Fri Oct  8 09:49:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): pointer modification check before each
-	  iteration.  [ruby-dev:24445]
-
-Fri Oct  8 01:13:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/optiondb.rb: make it more secure
-
-Thu Oct  7 23:47:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
-	  cannot propagate view port information from the source widget
-	  (that calls 'set') to other assigned widgets.
-
-Thu Oct  7 17:36:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
-	  a Fixnum for 2nd element (it's pid) of the return value.
-
-Thu Oct  7 12:55:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_read): should freeze buffer before thread context
-	  switch. [ruby-dev:24442]
-
-	* pack.c (pack_unpack): string conversion should at the top of the
-	  method.  [ruby-dev:24439]
-
-	* io.c (io_read): buffer should be frozen only after the length
-	  check.  [ruby-dev:24440]
-
-Thu Oct  7 02:56:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c: use FMODE_APPEND.
-
-Thu Oct  7 01:05:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
-
-Thu Oct  7 00:08:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
-	  ALLOCA_N() to prevent modification.  [ruby-dev:24438]
-
-Wed Oct  6 09:21:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_mode_flags): preserve append mode flag.
-	  [ruby-dev:24436]
-
-	* io.c (rb_io_modenum_mode): do not use external output buffer.
-
-	* string.c (rb_str_justify): differ pointer retrieval to prevent
-	  padding string modification.  [ruby-dev:24434]
-
-	* range.c (range_each_func): allow func to terminate loop by
-	  returning RANGE_EACH_BREAK.
-
-	* range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
-
-Mon Oct  4 14:04:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
-	  while GC.  [ruby-dev:24408]
-
-Mon Oct  4 12:53:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/optiondb.rb: support definition of command
-	  resources on widgets
-
-	* ext/tk/lib/tk/image.rb: bug fix
-
-Sun Oct  3 21:20:03 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
-	  version of Microsoft Exchange Server. (backported from HEAD)
-
-	* lib/net/imap.rb (RTEXT_REGEXP): ditto.
-
-	* lib/net/imap.rb (CTEXT_REGEXP): ditto.
-
-Sat Oct  2 20:34:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.h (NEW_DVAR): extra semicolon.
-
-Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (r_byte): retrieve pointer from string value for each
-	  time.  [ruby-dev:24404]
-
-	* marshal.c (r_bytes0): ditto.
-
-	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
-
-	* io.c (io_read): should freeze all reading buffer.
-	  [ruby-dev:24400]
-
-	* string.c (rb_str_sum): should use bignums when bits is greater
-	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
-
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
-
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
-
-	* string.c (rb_str_sum): wrong cast caused wrong result.
-	  [ruby-dev:24385]
-
-	* enum.c (enum_sort_by): hide temporary array from
-	  ObjectSpace.each_object.  [ruby-dev:24386]
-
-	* string.c (rb_str_sum): check was done with false pointer.
-	  [ruby-dev:24383]
-
-	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
-
-Mon Oct 11 17:51:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
-	  avoid mode string modification.  [ruby-dev:24454]
-
-	* io.c (rb_io_getline_fast): should take delim as unsigned char to
-	  distinguish EOF and '\377'.  [ruby-dev:24460]
-
-	* io.c (rb_io_getline): add check for RS modification.
-	  [ruby-dev:24461]
-
-	* enum.c (enum_sort_by): use qsort() directly instead using
-	  rb_iterate().  [ruby-dev:24462]
-
-	* enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
-	  prevent access to recycled object (via continuation for
-	  example).  [ruby-dev:24463]
-
-Fri Oct  1 11:40:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
-	  sourcefile string modification.  [ruby-dev:24373]
-
-	* io.c (io_read): block string buffer modification during
-	  rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
-
-	* io.c (rb_io_s_popen): mode argument may be altered.
-	  [ruby-dev:24375]
-
-	* file.c (rb_file_s_basename): ext argument may be altered.
-	  [ruby-dev:24377]
-
-	* enum.c (enum_sort_by): use NODE instead of 2 element arrays.
-	  [ruby-dev:24378]
-
-	* string.c (rb_str_chomp_bang): StringValue() may change the
-	  receiver.  [ruby-dev:24371]
-
-Fri Oct  1 11:25:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/grid.rb: revive TkGrid.grid
-
-	* ext/tk/lib/tk/pack.rb: revive TkPack.pack
-
-	* ext/tk/lib/tk/place.rb: revive TkPlace.place
-
-Thu Sep 30 00:50:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_init): bug fix
-
-	* ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
-
-	* ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
-
-	* ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
-	  matting pattern argument
-
-Wed Sep 29 10:58:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (sort_by_i): internally used object must not be changed
-	  outside.  [ruby-dev:24368]
-
-Mon Sep 27 13:46:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
-	  accessors.  [ruby-dev:24342]
-
-	* marshal.c (w_object, r_object0): use accessors.
-
-Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
-	  [ruby-talk:113807]
-
-Fri Sep 24 16:09:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
-	  to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
-
-Fri Sep 24 08:29:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_subseq): original object might be modified after
-	  sharing data creation.  [ruby-dev:24327]
-
-	* array.c (rb_ary_replace): ditto.
-
-	* array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
-
-	* struct.c (struct_members): always check struct size and size of
-	  members list in the class.  [ruby-dev:24320]
-
-Thu Sep 23 09:29:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_sub_bang): check if string is not modified
-	  during iteration.  [ruby-dev:24315]
-
-	* hash.c (rb_hash_rehash): replace st_foreach() by its deep
-	  checking counterpart.  [ruby-dev:24310]
-
-Wed Sep 22 13:38:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_hash_rehash): add iteration check.  [ruby-dev:24301]
-
-	* st.c (st_foreach): add deep check.
-
-Wed Sep 22 13:06:14 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
-	  merge from HEAD.
-
-Wed Sep 22 00:11:12 2004  Dave Thomas  <dave@pragprog.com>
-
-	* process.c: Add documentation for fork()
-
-Wed Sep 22 09:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_collect_bang): element size might change during
-	  comparison.  [ruby-dev:24300]
-
-	* array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
-
-	* array.c (rb_ary_eql): ditto. [ruby-dev:24300]
-
-Tue Sep 21 18:29:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_equal): merge miss.
-
-	* array.c (rb_ary_uniq_bang): element size might change during
-	  comparison.  [ruby-dev:24298]
-
-Mon Sep 20 00:24:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* enum.c (enum_sort_by): do not use qsort directly.  use
-	  rb_ary_sort_bang() instead.  [ruby-dev:24291]
-
-	* enum.c (enum_sort_by): pedantic type check added.
-	  [ruby-dev:24291]
-
-	* hash.c (rb_hash_foreach_iter): check iter_lev after each
-	  iteration.  [ruby-dev:24289]
-
-	* array.c (rb_ary_and): element size might change during
-	  comparison.  [ruby-dev:24290]
-
-	* array.c (rb_ary_or): ditto. [ruby-dev:24292]
-
-	* array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
-
-Sat Sep 18 15:02:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_equal): element size might change during
-	  comparison.  [ruby-dev:24254]
-
-	* array.c (rb_ary_diff): ditto. [ruby-dev:24274]
-
-	* array.c (rb_ary_select): ditto. [ruby-dev:24278]
-
-	* array.c (rb_ary_delete): ditto. [ruby-dev:24283]
-
-	* array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
-
-	* array.c (rb_ary_initialize): element size might change during
-	  initializing block.  [ruby-dev:24284]
-
-Sat Sep 18 14:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
-	  the original directory when exception has caused in changing
-	  direcotry or within block.  thanks to Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:03446]
-
-Fri Sep 17 20:20:27 2004  Minero Aoki  <aamine@loveruby.net>
+Fri Jan 28 02:37:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/fileutils.rb (mkdir_p): backport from CVS HEAD 1.45. [ruby-core:03420]
+	* re.c (rb_reg_raise): add GC guard to prevent intermediate
+	  variable from GC.
 
-Fri Sep 17 17:11:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jan 28 02:35:41 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* array.c (rb_ary_delete): element comparison might change array
-	  size. [ruby-dev:24273]
+	* hash.c (rb_hash_fetch_m): add GC guard to prevent intermediate
+	  variable from GC.
 
-	* file.c (rb_file_truncate): clear stdio buffer before truncating
-	  the file.  [ruby-dev:24191]
+Fri Jan 28 01:33:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
-	  which might return singleton class.  [ruby-dev:24202]
+	* test/ruby/test_process.rb (TestProcess#test_too_long_path)
+	  TestProcess#test_too_long_path): Reduced string size from 100MB
+	  to 10MB. 100MB may cause no memory error. It isn't intended.
 
-Fri Sep 17 16:07:09 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 28 01:27:42 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: improve exit operation
+	* test/ruby/test_process.rb (TestProcess#test_too_long_path2):
+	  Factored out from test_too_long_path. A test should only do
+	  one test.
 
-Fri Sep 17 15:01:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 27 23:29:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
-	  (thread_)tkwait
+	* st.c (st_foreach): check if unpacked.
 
-	* ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
+Thu Jan 27 23:14:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
-	  interpreters (however, the 'real' eventloop must be run on the
-	  Default Master IP)
+	* misc/ruby-mode.el (ruby-mode-map): remove deprecated binding.
+	  use M-; instead.
 
-	* ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
+Thu Jan 27 21:58:32 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/remote-ip_sample2.rb: ditto
+	* bignum.c (rb_str_to_inum): get rid of too huge alloca().
 
-	* ext/tk/sample/tkoptdb-safeTk.rb: ditto
+Thu Jan 27 21:43:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Sep 16 18:12:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* object.c (rb_str_to_dbl): rewrite again. use ALLOCV instead
+	  rb_str_tmp_new().
 
-	* lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
-	  to request.user attribute.
+Thu Jan 27 21:41:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#initialize): should expand
-	  the pathname of document root directory.
+	* win32/win32.c: get rid of STRNDUPA(). It's dangerous API.
 
-Thu Sep 16 15:49:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jan 27 21:31:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (rb_str_intern): protect string argument from GC.
-	  [ruby-core:03411]
+	* win32/win32.c (rb_w32_aspawn): get rid of too huge alloca().
+	  [Bug #4330] [ruby-core:34898]
 
-Wed Sep 15 20:22:23 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 27 20:30:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
-	  of MultiTkIp
+	* win32/win32.c (rb_w32_spawn): get rid of too huge alloca().
 
-Tue Sep 14 23:54:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 27 18:49:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
-	  the previous changes.
+	* win32/win32.c (open_dir_handle): get rid of too huge alloca().
 
-Tue Sep 14 23:45:44 2004  Dave Thomas  <dave@pragprog.com>
+Thu Jan 27 18:34:58 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
-	  Add Eric Hodel's simpleformatter.
+	* file.c (w32_io_info): get rid of too huge alloca().
+	  [Bug #4313] [ruby-core:34830]
 
-Tue Sep 14 16:59:37 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 27 18:19:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: fix SEGV
+	* win32/win32.c (wstati64): get rid of too huge alloca().
+	  [Bug #4316] [ruby-core:34834]
 
-	* ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
+Thu Jan 27 15:11:52 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
+	* win32/win32.c (rb_w32_spawn, rb_w32_aspawn): get rid of too huge
+	  alloca(). this is the real fix of [ruby-core:34833].
 
-	* ext/tk/sample/safe-tk.rb: new sample script
+Thu Jan 27 12:46:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 14 00:15:15 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* process.c (ALLOC_ARGV_WITH_STR): fix void pointer arithmetic.
 
-	* ext/zlib/zlib.c: backported from HEAD.
+Thu Jan 27 08:41:40 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep 13 19:16:33 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* process.c (proc_exec_v, rb_proc_exec_n, rb_proc_exec)
+	  (proc_spawn_n, proc_spawn): get rid of too huge alloca().
+	  [ruby-core:34827], [ruby-core:34833]
 
-	* eval.c (blk_copy_prev): need frame_dup().  [ruby-dev:24103]
+Thu Jan 27 08:32:17 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep 13 16:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* include/ruby/ruby.h (ALLOCV): new API for exception-safe
+	  temporary buffer.  [ruby-core:34844]
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
-	  safe-level value argument
+	* string.c (rb_alloc_tmp_buffer, rb_free_tmp_buffer):
+	  implementation of the API.
 
-Mon Sep 13 10:20:45 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Jan 27 08:22:49 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (nil_inspect): fix typo.
+	* dln_find.c (dln_find_1): use rb_warning and return immediately
+	  if fname is longer than buffer.
 
-Mon Sep 13 01:03:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Jan 26 22:57:30 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
+	* class.c (clone_method): add GC guard to prevent intermediate
+	  variable from GC. [Bug #4321] [ruby-dev:43107]
 
-	* ext/tcltklib/tcltklib.c: store original 'exit' command
+Wed Jan 26 22:45:16 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/tkutil.c: fix(?) SEGV
+	* template/id.h.tmpl: parenthesize macro arguments.
 
-Sun Sep 12 23:46:23 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jan 26 22:28:49 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* util.c (ruby_strdup): remove unnecessary code. (xmalloc never
-	  returns NULL.)
+	* vm_eval.c (rb_throw_obj): add GC guard to prevent intermediate
+	  variable from GC. [Bug #4322] [ruby-dev:43108]
 
-	* util.c (ruby_getcwd): fix memory leak on failure.
+Wed Jan 26 17:08:59 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sun Sep 12 02:41:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): OpenSSL::ASN1.decode
+	  should reject indefinite length primitive encodings as that is
+	  illegal. Patch by Martin Bosslet. See #4324.
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
-	  allow_ruby_exit=
+Wed Jan 26 10:36:28 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
+	* string.c (=~): documentation fix; the return value is nil when
+	  it doesn't match. patched by Andrei Kulakov [ruby-core:34562]
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+Tue Jan 25 08:41:58 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/remote-tk.rb: ditto.
+	* dln_find.c (dln_find_1): omit too long pathnames.
 
-	* ext/tcltklib/MANUAL.euc: ditto.
+Tue Jan 25 08:28:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/MANUAL.eng: ditto.
+	* string.c (rb_str_resize): get rid of out-of-bound access.
 
-	* ext/tcltklib/tcltklib.c: fix some reasons of SEGV
+Tue Jan 25 07:48:22 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/tk/tkutil.c: ditto.
+	* test/ruby/test_thread.rb: remove unused variables.
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+Tue Jan 25 07:45:44 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/tk/lib/tk/timer.rb: ditto.
+	* test/ruby/test_thread.rb (TestThread#test_condvar_nolock_2): get
+	  rid of method redefined.
 
-Sat Sep 11 16:09:46 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jan 25 07:00:52 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
+	* string.c (rb_string_value_cstr): rb_str_modify can change
+	  RSTRING_PTR.
 
-Fri Sep 10 20:20:53 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Jan 25 03:24:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
-	  pointer conversion.
+	* test/ruby/test_thread.rb: Added various ConditionVariable tests.
 
-Fri Sep 10 02:43:54 2004  Dave Thomas  <dave@pragprog.com>
+Mon Jan 24 22:26:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/generators/template/kilmer.rb: James Buck's
-	  patch for call-seq.
+	* object.c (rb_str_to_dbl): Fix again. use rb_str_tmp_new()
+	  instead ALLOC_N.
 
-Thu Sep  9 13:58:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Jan 24 21:50:48 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
-	  'argv' and 'argv0' variable
+	* vm_insnhelper.h: parenthesize macro arguments.
 
-	* ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
+Mon Jan 24 21:28:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Sep  9 11:46:18 2004  Dave Thomas  <dave@pragprog.com>
+	* object.c (rb_str_to_dbl): use ALLOC_N instead ALLOCA_N because
+	  ALLOC_N may cause stack overflow.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
-	  spaces aroun parameter to define_method_under (James Buck)
+Mon Jan 24 21:04:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep  8 18:44:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (rb_invalid_str): prevent intermediate variable from GC.
+	  [ruby-core:34820]
 
-	* ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
-	  [ruby-dev:24190]
+Sun Jan 23 23:01:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Sep  8 15:19:49 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/io/console/test_io_console.rb: Don't run test if the system
+	  don't support io/console.
 
-	* ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
+Sun Jan 23 22:17:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
-	  and error treatment
+	* test/fiddle/test_fiddle.rb: Don't run test if the system don't support
+	  fiddle.
 
-	* ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
+	* test/fiddle/test_function.rb: ditto.
+	* test/fiddle/test_closure.rb: ditto.
 
-	* ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear,	and
-	  erase
+Sun Jan 23 11:39:18 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk/text.rb: add TkText#clear and erase
+	* vm_exec.h: parenthesize macro arguments.
 
-Tue Sep  7 15:17:49 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jan 23 10:33:02 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (ruby_connect): break immediately if a
-	  socket is non-blocking.  [ruby-talk:111654]
+	* template/fake.rb.in (ruby): suppress warnings.
 
-Mon Sep  6 11:08:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Jan 23 08:00:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
+	* string.c (str_nth_len, str_utf8_nth): return the rest length together.
 
-Mon Sep  6 11:00:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_str_substr): get rid of measure the length always
+	  to improve performance for huge string.  [ruby-core:34648]
 
-	* dir.c (dir_s_chdir): the patch to shut up false warning when
-	  exception occurred within a block.  a patch was given from Johan
-	  Holmberg <holmberg at iar.se>.  [ruby-core:03292]
+Sun Jan 23 00:40:10 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Sep  6 07:51:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/test_syslog.rb: Fix to make a lot of test failure if
+	  the platform doesn't support syslog.
 
-	* eval.c (cvar_cbase): singletons should refer outer cvar scope.
-	  [ruby-dev:24223]
+Sat Jan 22 11:49:55 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* eval.c (rb_load): should preserve previous ruby_wrapper value.
-	  [ruby-dev:24226]
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fixing merge key support
+	  when multiple merge keys are specified.
 
-Sat Sep  4 01:14:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/psych/test_merge_keys.rb: tests for multi-merge key support
 
-	* eval.c (cvar_cbase): class variables cause SEGV in
-	  instance_eval() for fixnums and symbols. [ruby-dev:24213]
+Sat Jan 22 11:33:04 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Sep  3 17:47:58 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/to_ruby.rb: merge keys are actually
+	  part of YAML 1.1, so they should be supported.  Remove warning and
+	  merge keys to parent.  [ruby-core:34679]
 
-	* struct.c (make_struct): remove redefining constant when
-	  conflict.  [ruby-dev:24210]
+	* test/psych/test_merge_keys.rb: test for merge keys
 
-Fri Sep  3 11:31:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Jan 22 10:25:19 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
-	  [ruby-dev:24207]
+	* ext/psych/parser.c (parse): add the file name to the exception when
+	  parse errors occur.
 
-Fri Sep  3 02:12:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/psych/test_parser.rb: test for parse error file name
 
-	* ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
+Sat Jan 22 10:12:30 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk/text.rb: fix typo
+	* ext/psych/parser.c (parse): fix assertion error when reusing a
+	  parser after an exception has been raised
 
-	* ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
+	* test/psych/test_parser.rb: test for assertion error
 
-Fri Sep  3 01:54:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jan 22 04:09:22 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/extmk.rb: already built-in libraries satisfy dependencies.
-	  [ruby-dev:24028]
+	* ext/psych/lib/psych/nodes/node.rb: Make Psych::Nodes::Node
+	  enumerable.
 
-Thu Sep  2 11:36:20 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/depth_first.rb: Add a depth-first
+	  visitor to enumerate over a YAML AST in a depth-first fashion
 
-	* eval.c (rb_obj_instance_eval): backported from HEAD.
+	* test/psych/nodes/test_enumerable.rb: test for enumerating nodes
 
-Wed Sep  1 21:18:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/psych/visitors/test_depth_first.rb: test for depth-first
+	  visitor
 
-	* ext/tk/lib/tk/spinbox.rb: fix typo
+Sat Jan 22 00:53:42 2011  Tanaka Akira  <akr@fsij.org>
 
-Tue Aug 31 18:24:04 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm_core.h: parenthesize macro arguments.
 
-	* ext/tk/tkutil.c (cbsubst_init): fix memory leak
+Fri Jan 21 18:15:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
+	* configure.in: should not use -Werror=* flags while conftests.
 
-Tue Aug 31 16:04:22 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 21 09:17:00 2011  Luis Lavena  <luislavena@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
-	  destroy its root widget
+	* configure.in: Fix incorrectly detected x86_64-w64-mingw32 due
+	  canonalization of target_os. Bug #3889 [ruby-core:32634]
 
-Tue Aug 31 12:30:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 20 23:44:00 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (del_root): fix SEGV
+	* configure.in: Fix rb_cv_va_args_macro was broken. We are using
+	  -Werror=implicit-function-declaration compile option. therefore
+	  we need a function declaration explicitly.
 
-Mon Aug 30 23:11:06 2004  Dave Thomas  <dave@pragprog.com>
+Thu Jan 20 23:58:02 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
-	  if it finds the same class in multiple places.
+	* node.h: parenthesize macro arguments.
 
-Mon Aug 30 22:40:30 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 20 23:25:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
+	* configure.in: Add '#include <stdlib.h>' to
+	  rb_cv_localtime_overflow test too. It's reported by Tomoyuki
+	  Chikanaga. Thanks.
 
-Mon Aug 30 21:50:14 2004  Dave Thomas  <dave@pragprog.com>
+Thu Jan 20 16:11:00 2011  Kenta Murata <mrkn@mrkn.jp>
 
-	* object.c: Add RDoc for Module.included.
+	* README.EXT, README.EXT.ja: You shouldn't choose ``conftest.c'' as a
+	  name of a source file.
 
-Mon Aug 30 15:10:46 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu Jan 20 12:15:44 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
+	* configure.in: Add stdlib.h inclusion into rb_cv_negative_time_t
+	  test because it's required for exit(3). The patch is
+	  created by Tomoyuki Chikanaga. [Bug #4287] [ruby-dev:43060]
 
-Mon Aug 30 11:29:35 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Jan 20 11:39:41 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* win32/win32.c (CreateChild): strip trailing spaces. [ruby-dev:24143]
-	  merge from HEAD.
-
-Sun Aug 29 14:08:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
-
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
-
-Sat Aug 28 23:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (rb_big_and): protect parameters from GC.
-	  [ruby-talk:110664]
-
-Thu Aug 26 04:38:29 2004  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c (return_jump): Minor typo in error message. Now reads
-	  "return can't jump across threads".
-
-Tue Aug 24 17:30:00 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
-	  use a session id as a filename. (backported from HEAD)
-
-	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
-
-	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
-	  Dir::tmpdir. (backported from HEAD)
-
-Tue Aug 24 14:40:16 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/webrick/utils.rb (TestWEBrick::RubyBin): test CGI does not need
+	  to load rubygems.  if it activated, ruby raises LoadError about
+	  rbconfig.rb.
 
-	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
-	  session id after check. (backported from HEAD)
+Thu Jan 20 09:19:42 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Aug 24 09:09:01 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/psych/lib/psych/visitors/json_tree.rb: Fix JSON emit for
+	  DateTime and Time classes.
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
-	  functions may replace the pointer indicated by the first argument.
+	* test/psych/test_json_tree.rb: test for JSON emit
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+Thu Jan 20 08:02:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
+	* ext/psych/lib/psych/coder.rb (represent_object): arbitrary objects
+	  may be passed to the Psych::Coder object.
 
-Mon Aug 23 14:04:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: support for visiting
+	  arbitrary objects set on the coder.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read):
-	  - should return an empty string if specified length to read is 0.
-	  - should check for pending data and wait for fd before reading.
-	  - call underlying IO's sysread if SSL session is not started.
-	  [ruby-dev:24072], [ruby-dev:24075]
+	* test/psych/test_coder.rb: supporting test case.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write):
-	  - call underlying IO's syswrite if SSL session is not started.
+Thu Jan 20 06:03:17 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
-	  OpenSSL::SSL#pending.
+	* method.h: parenthesize macro arguments.
 
-	* ext/openssl/lib/openssl/buffering.rb: should not use select.
+Wed Jan 19 13:16:05 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Aug 23 12:40:56 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/rubygems/commands/sources_command.rb: Finish removing code,
+	  (fixes sources command test).
 
-	* lib/resolv.rb (Config.default_config_hash): when multiple domains
-	  are set, Win32::Resolv.get_resolv_info returns Array.
+Wed Jan 19 13:04:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Aug 22 01:15:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* proc.c (proc_call): Add gc guard to avoid segfault. The fix
+	  is created by Tomoyuki Chikanaga. [Bug #4238][ruby-dev:42963]
 
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
-	  should call :ProxyContentHandler before finishing CONNECT.
+Wed Jan 19 12:31:28 2011  Eric Hodel <drbrain@segment7.net>
 
-Sat Aug 21 06:41:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rubygems.rb: Since gem_prelude requires rubygems, enable
+	  custom_require always.
 
-	* ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
+Wed Jan 19 12:08:08 2011  Eric Hodel <drbrain@segment7.net>
 
-	* lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
-	  uniformly.  [ruby-dev:24118]
+	* lib/rubygems/commands/dependency_command.rb: Remove require of
+	  deleted file.
+	* lib/rubygems/commands/fetch_command.rb: ditto
+	* lib/rubygems/commands/setup_command.rb: ditto
+	* lib/rubygems/commands/sources_command.rb: ditto
+	* lib/rubygems/commands/specification_command.rb: ditto
 
-Thu Aug 19 16:29:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Jan 19 08:13:59 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
+	* lib/rubygems*: Import rubygems 1.5.0 (release candidate)
+	* test/rubygems: Ditto
 
-	* ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
+Tue Jan 18 23:31:01 2011  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* ext/tk/lib/menu.rb: typo bug.
+	* parse.y: avoid NULL reference.  [ruby-dev:43067]
 
-Thu Aug 19 15:15:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jan 19 02:54:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* dir.c (free_dir): fix memory leak.  reported by yamamoto
-	  madoka.
+	* vsnprintf.c (cvt): set first byte of buf to NUL for the case when
+	  no bytes are written to the buf. [ruby-dev:43062]
 
-Thu Aug 19 11:00:00 2004  Akiyoshi, Masamichi  <masamichi.akiyoshi@hp.com>
+Tue Jan 18 23:04:51 2011  Tanaka Akira  <akr@fsij.org>
 
-	* dln.c (dln_load): Modify to call lib$find_image_symbol for VMS.
-	* io.c (rb_io_fwrite): Use fputc() for VMS non-stream file.
+	* gc.h: parenthesize macro arguments.
 
-Thu Aug 19 06:07:45 2004  why the lucky stiff  <why@ruby-lang.org>
+Tue Jan 18 18:31:14 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* ext/syck/token.c: re2c no longer compiled with bit vectors.  caused
-	  problems for non-ascii characters. [ruby-core:03280]
-	* ext/syck/implicit.c: ditto.
-	* ext/syck/bytecode.c: ditto.
+	* lib/irb/completion.rb: Irb tab completion support for XX::method
+	  forms.
 
-	* lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
-	  fixed problem with extra line feeds at end of folding, whitespace
-	  opening scalar blocks.
+Tue Jan 18 15:05:55 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* lib/yaml/rubytypes.rb: subtelties in handling strings with
-	  non-printable characters and odd whitespace patterns.
+	* lib/logger.rb: added RDoc document for logging message escape
+	  by Hal Brodigan. See #3869
 
-Wed Aug 18 23:41:33 2004  Minero Aoki  <aamine@loveruby.net>
+Tue Jan 18 07:53:52 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/net/protocol.rb (rbuf_fill): OpenSSL::SSL::SSLSocket has its own
-	  buffer, select(2) might not work. [ruby-dev:24072]
+	* eval_intern.h: parenthesize macro arguments.
 
-Wed Aug 18 17:10:12 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue Jan 18 04:42:44 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
-	  Tcl_FindExecutable() for Tcl/Tk 8.4.
+	* ext/psych/lib/psych/parser.rb (Mark): Adding a class to wrap
+	  marker information
 
-Wed Aug 18 12:52:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/parser.c (mark): Add a method to return the mark object
+	  for the parser
 
-	* eval.c (rb_obj_instance_eval): evaluates under special singleton
-	  classes as for special constants.
+	* test/psych/test_parser.rb: tests for the Mark class.
 
-Tue Aug 17 17:20:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Jan 18 02:46:55 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* io.c (rb_io_reopen): should clear allocated OpenFile.  pointed
-	  out by Guy Decoux. [ruby-core:03288]
+	* ext/psych/lib/psych/visitors/json_tree.rb (visit_String): JSON
+	  strings should be dumped with double quotes. [ruby-core:34186]
 
-Tue Aug 17 01:36:32 2004  Dave Thomas  <dave@pragprog.com>
+	* test/psych/test_json_tree.rb: test for double quotes
 
-	* lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
-	  parsing so RDoc::usage plays better with OptionParser.
+Mon Jan 17 23:36:33 2011  Tanaka Akira  <akr@fsij.org>
 
-Sat Aug 14 13:09:10 2004  Minero Aoki  <aamine@loveruby.net>
+	* array.c (rb_ary_times): less MEMCPY calls.
 
-	* lib/fileutils.rb: backport from CVS HEAD (rev1.44).
+Mon Jan 17 22:54:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/fileutils.rb: cp_r should copy symlink itself, except cp_r
-	  root.
+	* debug.h: parenthesize macro arguments.
 
-	* lib/fileutils.rb: new option mv :force.
+Mon Jan 17 21:40:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/fileutils.rb: new module FileUtils::DryRun.
+	* ruby.c (process_options): revert r30549.
 
-Sat Aug 14 02:48:16 2004  Dave Thomas  <dave@pragprog.com>
+Sun Jan 16 20:55:45 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/usage.rb: Added. Allows command line programs
-	  to report usage using their initial RDoc comment.
+	* vsnprintf.c: parenthesize macro arguments.
 
-Fri Aug 13 13:23:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Jan 15 11:57:30 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
-	  fix regex for range-spec.
+	* configure.in (warnflags): add -Werror=implicit-function-declaration
+	  if available.
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
-	  multipart/byteranges response was broken.
+	* lib/mkmf.rb (init_mkmf): ignore warnings in mkmf tests.
 
-	* lib/webrick/httpservlet/erbhandler.rb
-	  (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
-	  by suffix of script filename.
+	* test/mkmf/base.rb (setup, teardown): restore config values.
 
-	* lib/xmlrpc/server.rb: refine example code.
+	* test/mkmf/test_flags.rb: split from test_find_executable.rb.
 
-Wed Aug 11 17:17:50 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Jan 15 10:04:14 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
+	* ruby.c (process_options): autoload rubygems.
 
-Sun Aug  8 00:43:31 2004  why the lucky stiff  <why@ruby-lang.org>
+	* tool/compile_prelude.rb (Prelude#initialize): ignore empty
+	  preludes.
 
-	* lib/implicit.c: added sexagecimal float#base60.
+	* ruby.c (ruby_init_prelude): get rid of global namespace
+	  pollution.
 
-	* ext/syck/rubyext.c (yaml_org_handler): ditto.
+Sat Jan 15 09:42:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/token.c: indentation absolutely ignored when processing flow
-	  collections.  plain scalars are trimmed if indentation follows in
-	  an ambiguous flow collection.
+	* include/ruby/io.h: missing prototypes.
 
-Sat Aug  7 00:50:01 2004  Tanaka Akira  <akr@m17n.org>
+Fri Jan 14 23:25:55 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
+	* vm_method.c: parenthesize macro arguments.
 
-Tue Aug  3 13:49:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 14 15:32:29 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk/namespace.rb: bug fix
+	* test/net/imap/test_imap.rb: call neither logout nor disconnect
+	  unless connected.  patch by Kazuhiro NISHIYAMA.  [ruby-dev:42860]
 
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
+Fri Jan 14 14:56:57 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Aug  2 18:04:21 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/net/imap.rb: use bytesize for binary strings.
+	  patched by Yoshimasa Niwa. [ruby-core:34222]
 
-	* ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
-	  trans_str to the same as src_str when trans_str is not given.)
+Fri Jan 14 14:01:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Aug  2 11:53:06 2004  Dave Thomas  <dave@pragprog.com>
+	* pack.c (pack_unpack): the resulted string of unpack('M') must have
+	  ASCII-8BIT encoding (and ENC_CODERANGE_VALID). [ruby-core:34482]
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
-	  looking up some top level symbols (batsman)
+Fri Jan 14 13:38:58 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Aug  2 11:48:29 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/zlib/zlib.c (gzfile_check_footer): ISIZE (Input SIZE) in
+	  gzip's header is the size of uncompressed input data modulo 2^32.
+	  [ruby-core:34481] http://www.ietf.org/rfc/rfc1952.txt
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
-	  variable names to support SWIG generated files (Hans Fugal)
+Fri Jan 14 11:36:25 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Jul 31 17:40:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in, win32/Makefile.sub (RUNRUBY): require path should
+	  include "." because rbconfig.rb is there.
 
-	* misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
-	  ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
-	  ruby-backward-sexp): keywords must match word-wise.
+Fri Jan 14 10:40:11 2011  Ryan Davis  <ryan@lust.local>
 
-Sat Jul 31 05:47:37 2004  why the lucky stiff  <why@ruby-lang.org>
+	* gem_prelude.rb: Just require rubygems. Fixes rubygems 1.4.
+	* lib/rubygems.rb: removed all Gem::Quickloader code.
+	* ruby.c: renamed ruby_init_gems to ruby_init_prelude. Set
+	  $disable_rubygems since there is no fine grained mechanism to
+	  skip parts of the prelude. Open to suggestions on how to do this
+	  better.
+	* test/*.rb: Load path isn't set up correctly, so add
+	  --disable-gems as needed to failing tests that are explicitly
+	  testing stderr w/ ==.
 
-	* lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
+Fri Jan 14 07:30:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/yaml/rubytypes.rb: exceptions were using an older
-	  YAML.object_maker. [ruby-core:03080]
+	* io.c (argf_next_argv): go advance when the next file cannot be
+	  read.  [ruby-core:34446]
 
-	* ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
-	  handline CR-LFs.  "\000" was showing up on folded blocks which
-	  stopped at EOF.
+Thu Jan 13 20:49:19 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/syck/token.c: re2c compiled with bit vectors now.
-	* ext/syck/implicit.c: ditto.
-	* ext/syck/bytecode.c: ditto.
+	* vm_insnhelper.c: parenthesize macro arguments.
 
-Fri Jul 30 16:10:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jan 13 13:21:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
-	  the unknown encoding name is given.
+	* vm_dump.c: delete dashes to make lines 80 chars, Patched by
+	  Shota Fukumori (sora_h).  [Bug #4275] [ruby-dev:43021]
 
-	* ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
+Thu Jan 13 13:21:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
+	* vm_dump.c: fix misspelling of CrashReporter, Patched by Shota
+	  Fukumori (sora_h).  [Bug #4275] [ruby-dev:43021]
 
-	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
+Thu Jan 13 06:27:29 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Wed Jul 28 18:59:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* error.c: Exception#to_s should actually call to_s.
 
-	* lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
-	  and CGI_COOKIES.  they will no longer be used.
+Thu Jan 13 00:32:54 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Jul 28 01:04:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* addr2line.c (get_nth_dirname): decrement the directory index
+	  because the index specifies the index of given included_directories
+	  which is separated by NUL and its index is begun from 1.
+	  Note that 0 specifies the current directory of the compilation.
+	  see also http://www.dwarfstd.org/doc/dwarf-2.0.0.pdf
 
-	* gc.c (run_final): wrong order of data. [ruby-dev:23984]
+Thu Jan 13 00:06:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Jul 27 07:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (rb_f_syscall): Add warning messages. [ruby-core:34062]
 
-	* eval.c (rb_eval): copy on write for argument local variable
-	  assignment.
+Thu Jan 13 00:00:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (assign): ditto.
+	* io.c (rb_f_syscall): Some syscall return unsigned or pointer value.
+	  Therefore we should only check the result is -1 or not.
+	  [ruby-core:34062]
 
-	* eval.c (rb_call0): update ruby_frame->argv with the default
-	  value used for the optional arguments.
+Wed Jan 12 23:55:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* object.c (Init_Object): "===" calls rb_obj_equal() directly.
-	  [ruby-list:39937]
+	* io.c (rb_f_syscall): Add 64bit Linux support. Some syscall takes
+	  long type arguments.
 
-Mon Jul 26 11:22:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Jan 12 19:37:10 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
-	  escape space.
+	* vm_dump.c: parenthesize macro arguments.
 
-Sun Jul 25 11:05:21 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Wed Jan 12 19:28:23 2011  Tanaka Akira  <akr@fsij.org>
 
-	* win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
-	  {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
+	* vm.c (thread_free): reset ruby_current_thread if it points the
+	  thread to free.
+	* gc.c (slot_sweep): don't call RUBY_VM_SET_FINALIZER_INTERRUPT if
+	  there is no current thread.
+	  [ruby-dev:43000]
 
-Sat Jul 24 13:32:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jan 12 19:09:29 2011  Tanaka Akira  <akr@fsij.org>
 
-	* range.c (rb_range_beg_len): returns Qnil only when "beg" points
-	  outside of a range.  No boundary check for "end".
+	* enum.c (sort_by_i): reenter check more strictly.
+	  (sort_by_cmp): ditto.
+	  [ruby-dev:43003] reported by Usaku NAKAMURA.
 
-Fri Jul 23 16:40:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jan 12 16:25:12 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* gc.c (define_final): should not disclose NODE* to Ruby world.
-	  [ruby-dev:23957]
+	* lib/net/http.rb (Net::HTTP#connect): makes it timeout during
+	  SSL handshake too. [ruby-core:34203]
+	  Patch by Marc Slemko.
 
-Fri Jul 23 09:03:16 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/net/http/test_http.rb (TestNetHTTP_v1_2#test_timeout_during_HTTP_session):
+	  test for [ruby-core:34203]
 
-	* lib/net/imap.rb (disconnected?): new method. (backported from HEAD)
-
-Thu Jul 22 16:41:54 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
-	 permission of the session data file to 0600.
-
-	* lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
+	* test/net/http/test_https.rb (TestNetHTTPS#test_timeout_during_SSL_handshake):
 	  ditto.
 
-Thu Jul 22 00:02:21 2004  Masahiro Kitajima  <katonbo@katontech.com>
-
-	* process.c (rb_f_system): not need to call last_status_set() any
-	  longer on _WIN32.
-
-Tue Jul 20 09:15:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/fileutils/test_fileutils.rb: File.link raises EINVAL on BeOS.
-
-Mon Jul 19 01:15:07 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
-	  variable to CGI process on Windows native platforms. [ruby-dev:23936]
-
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIhandler#do_GET): use $?.exitstatus and
-	  refine log message.
-
-Sun Jul 18 16:14:29 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
-	  ( wrong number of argument )
-
-Sun Jul 18 08:13:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): remove extra sign digit.
-
-Sun Jul 18 03:21:42 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* dir.c (range): use NULL instead of 0.
-
-	* dir.c (range): get rid of a gcc 3.4 warning.
-
-Sun Jul 18 03:12:11 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (receive_responses): return if a LOGOUT response
-	  received. (backported from HEAD)
-	* lib/net/imap.rb (send_string_data): wait command continuation
-	  requests before sending octet data of literals. (backported from HEAD)
-
-Sat Jul 17 23:54:59 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
-
-Sat Jul 17 22:04:44 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
-
-Sat Jul 17 18:29:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt): not to show same error messages twice.
-
-Sat Jul 17 13:13:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
-	  process expression interpolation.  [ruby-talk:106691]
-
-Sat Jul 17 05:26:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/diagram.rb: Incorporate Micheal Neuman's
-	  client-side imagemao patch
-
-Sat Jul 17 01:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
-	  [ruby-talk:106657]  The solution was found by Guy Decoux.
-
-Fri Jul 16 22:30:28 2004  Michael Neumann  <mneumann@ntecs.de>
-
-	* file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
-	  #dev_minor. [ruby-core:03195]
-
-Fri Jul 16 15:23:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (return_jump, break_jump): raise unexpceted local jump
-	  exception directly.  [ruby-dev:23740]
-
-	* lib/base64.rb (Deprecated): super in bound method calls original
-	  name method in stable version.  [ruby-dev:23916]
-
-Fri Jul 16 11:31:49 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
-	  garbage (patch from akira yamada) [ruby-dev:23911]
-
-Fri Jul 16 11:20:00 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
-	  "%f" or etc on MSVCRT platforms. (backported from HEAD)
-
-Fri Jul 16 11:17:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
-	  [ruby-dev:23913]
-
-	* error.c (exit_success_p): new method SystemExit#success?.
-	  [ruby-dev:23912]
-
-	* error.c (syserr_initialize): initialization for subclasses.
-	  [ruby-dev:23912]
-
-Thu Jul 15 23:53:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
-	  no longer has to_str method.
-
-Thu Jul 15 22:59:48 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/readline/extconf.rb: added dir_config for curses, ncurses,
-	  termcap. (backported from HEAD)
-
-Thu Jul 15 20:29:15 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* class.c, error.c, eval.c, intern.h, object.c, variable.c:
-	  do not set path if it is a singleton class.  [ruby-dev:22588]
-	  (backport from 1.9)
-
-Thu Jul 15 10:15:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/, ext/tcltklib/: bug fix
-
-	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
-	  callbacks.
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-	* ext/tk/lib/tk/variable.rb: ditto.
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
-	  to define validatecommand methods easier
-
-	* ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
-	  classes
-
-	* ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
-	  check for items (e.g. canvas items; depends on the class) to
-	  avoid some troubles on Tk extension widget class definition.
-
-	* ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
-
-	* ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
-
-
-Wed Jul 14 18:08:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
-	  argument. [ruby-dev:23891]
-
-	* test/openssl/test_x509store.rb: prune tests for CRL checking
-	  unless X509::V_FLAG_CRL_CHECK is defined.
-
-Wed Jul 14 12:29:07 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): should not convert string in the form of
-	  "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
-
-	* test/ruby/test_float.rb (test_strtod): add test for bug fix.
-
-Wed Jul 14 00:31:15 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c: rdoc patch. merged patch from Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:3170]
-
-Tue Jul 13 19:39:12 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic#merge_path):
-	  "URI('http://www.example.com/foo/..') + './'" should return
-	  "URI('http://www.example.com/')".  [ruby-list:39838]
-	  "URI('http://www.example.com/') + './foo/bar/..'" should return
-	  "URI('http://www.example.com/foo/')".  [ruby-list:39844]
-
-	* test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
-
-Tue Jul 13 15:51:45 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
-	   extmk mode.
-
-	* lib/mkmf.rb (dir_config): Prepend a new library path instead of
-	  appending so it is tried first.
-
-Tue Jul 13 00:50:48 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
-
-Mon Jul 12 21:20:36 2004  Dave Thomas  <dave@pragprog.com>
-
-	* html_generator.rb: Support hyperlinks of the form {any text}[xxx]
-	  as well as stuff[xxx]
-
-Sat Jul 10 09:30:24 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/marshal/test_struct.rb: use qualified build-tin class name
-	  (::Struct) to avoid name crash.
-
-Sat Jul 10 04:21:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
-	  callbacks.
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-	* ext/tk/lib/tk/variable.rb: ditto.
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb (__def_validcmd):  add a module
-	  function of Tk::ValidateConfigure to define validatecommand
-	  methods easier
-
-Fri Jul  9 22:36:36 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
-
-	* numeric.c: rdoc patch.
-
-Fri Jul  9 19:26:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
-	  notice https is not supported.
-
-Fri Jul  9 14:28:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_raise): accept third argument as well as
-	  Kernel#raise, and evaluate the arguments to create an exception in
-	  the caller's context.  [ruby-talk:105507]
-
-Fri Jul  9 01:47:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib : bug fix
-	* ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
-	* ext/tk/lib/tkextlib/itk  : add [incr Tk] support
-	* ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
-	* ext/tk/sample/tkextlib/iwidgets : very simple examples of
-	  [incr Widgets]
-
-Thu Jul  8 22:52:19 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
-	  validation and validation which disregard order of elements.
-	* test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
-	  validation.
-	* test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
-	  name.
-
-Thu Jul  8 00:05:23 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile::initialize): got out code of
-	  generating tmpname.  [ruby-dev:23832][ruby-dev:23837]
-
-Wed Jul  7 15:53:14 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* string.c (rb_str_match): raise TypeError when both arguments are
-	  strings. [ruby-dev:22869] (backported from HEAD)
-
-	* string.c (rb_str_match2): removed.
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
-	  wince/Makefile.sub (string.c): now not depend on version.h.
-
-Wed Jul  7 00:48:34 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tk/lib/tkextlib/tktrans.rb,
-	  ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
-
-Tue Jul  6 18:38:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib : improve framework of developping Tcl/Tk extension
-	  wrappers
-
-Mon Jul  5 23:56:42 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{trackback,syndication,dublincore,content}.rb: worked
-	  with ruby 1.6 again.
-
-	* test/rss/rss-assertions.rb: ditto.
-
-Mon Jul  5 22:54:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
-
-Mon Jul  5 09:02:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
-	  is a set of bit flags.  [ruby-dev:23859]
-
-Mon Jul  5 01:27:32 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
-	  the socket whose last-access-time is oldest. (and add new one)
-	  [ruby-dev:23860]
-
-Sun Jul  4 12:24:50 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb: added copyright header.
-
-Sun Jul  4 00:24:40 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* added files
-	  * lib/soap/attachment.rb
-	  * lib/soap/header
-	  * lib/soap/mimemessage.rb
-	  * lib/soap/rpc/httpserver.rb
-	  * lib/wsdl/soap/cgiStubCreator.rb
-	  * lib/wsdl/soap/classDefCreator.rb
-	  * lib/wsdl/soap/classDefCreatorSupport.rb
-	  * lib/wsdl/soap/clientSkeltonCreator.rb
-	  * lib/wsdl/soap/driverCreator.rb
-	  * lib/wsdl/soap/mappingRegistryCreator.rb
-	  * lib/wsdl/soap/methodDefCreator.rb
-	  * lib/wsdl/soap/servantSkeltonCreator.rb
-	  * lib/wsdl/soap/standaloneServerStubCreator.rb
-	  * lib/wsdl/xmlSchema/enumeration.rb
-	  * lib/wsdl/xmlSchema/simpleRestriction.rb
-	  * lib/wsdl/xmlSchema/simpleType.rb
-	  * lib/xsd/codegen
-	  * lib/xsd/codegen.rb
-	  * sample/soap/authheader
-	  * sample/soap/raa2.4
-	  * sample/soap/ssl
-	  * sample/soap/swa
-	  * sample/soap/whois.rb
-	  * sample/soap/calc/samplehttpd.conf
-	  * sample/soap/exchange/samplehttpd.conf
-	  * sample/soap/sampleStruct/samplehttpd.conf
-	  * sample/wsdl/raa2.4
-	  * sample/wsdl/googleSearch/samplehttpd.conf
-	  * test/openssl/_test_ssl.rb
-	  * test/soap/header
-	  * test/soap/ssl
-	  * test/soap/struct
-	  * test/soap/swa
-	  * test/soap/wsdlDriver
-	  * test/wsdl/multiplefault.wsdl
-	  * test/wsdl/simpletype
-	  * test/wsdl/test_multiplefault.rb
-
-	* modified files
-	  * lib/soap/baseData.rb
-	  * lib/soap/element.rb
-	  * lib/soap/generator.rb
-	  * lib/soap/marshal.rb
-	  * lib/soap/netHttpClient.rb
-	  * lib/soap/parser.rb
-	  * lib/soap/processor.rb
-	  * lib/soap/property.rb
-	  * lib/soap/soap.rb
-	  * lib/soap/streamHandler.rb
-	  * lib/soap/wsdlDriver.rb
-	  * lib/soap/encodingstyle/handler.rb
-	  * lib/soap/encodingstyle/literalHandler.rb
-	  * lib/soap/encodingstyle/soapHandler.rb
-	  * lib/soap/mapping/factory.rb
-	  * lib/soap/mapping/mapping.rb
-	  * lib/soap/mapping/registry.rb
-	  * lib/soap/mapping/rubytypeFactory.rb
-	  * lib/soap/mapping/wsdlRegistry.rb
-	  * lib/soap/rpc/cgistub.rb
-	  * lib/soap/rpc/driver.rb
-	  * lib/soap/rpc/element.rb
-	  * lib/soap/rpc/proxy.rb
-	  * lib/soap/rpc/router.rb
-	  * lib/soap/rpc/soaplet.rb
-	  * lib/soap/rpc/standaloneServer.rb
-	  * lib/wsdl/data.rb
-	  * lib/wsdl/definitions.rb
-	  * lib/wsdl/operation.rb
-	  * lib/wsdl/parser.rb
-	  * lib/wsdl/soap/definitions.rb
-	  * lib/wsdl/xmlSchema/complexContent.rb
-	  * lib/wsdl/xmlSchema/complexType.rb
-	  * lib/wsdl/xmlSchema/data.rb
-	  * lib/wsdl/xmlSchema/parser.rb
-	  * lib/wsdl/xmlSchema/schema.rb
-	  * lib/xsd/datatypes.rb
-	  * lib/xsd/qname.rb
-	  * sample/soap/calc/httpd.rb
-	  * sample/soap/exchange/httpd.rb
-	  * sample/soap/sampleStruct/httpd.rb
-	  * sample/soap/sampleStruct/server.rb
-	  * sample/wsdl/amazon/AmazonSearch.rb
-	  * sample/wsdl/amazon/AmazonSearchDriver.rb
-	  * sample/wsdl/googleSearch/httpd.rb
-	  * test/soap/test_basetype.rb
-	  * test/soap/test_property.rb
-	  * test/soap/test_streamhandler.rb
-	  * test/soap/calc/test_calc.rb
-	  * test/soap/calc/test_calc2.rb
-	  * test/soap/calc/test_calc_cgi.rb
-	  * test/soap/helloworld/test_helloworld.rb
-	  * test/wsdl/test_emptycomplextype.rb
-	  * test/wsdl/axisArray/test_axisarray.rb
-	  * test/wsdl/datetime/test_datetime.rb
-	  * test/wsdl/raa/test_raa.rb
-	  * test/xsd/test_xmlschemaparser.rb
-	  * test/xsd/test_xsd.rb
-
-	* summary
-	  * add SOAP Header mustUnderstand support.
-
-	  * add HTTP client SSL configuration and Cookies support (works
-	    completely with http-access2).
-
-	  * add header handler for handling sending/receiving SOAP Header.
-
-	  * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
-	    Model.  it caused error.
-
-	  * add WSDL simpleType support to restrict lexical value space.
-
-	  * add SOAP with Attachment support.
-
-Sat Jul  3 17:19:44 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
-
-Thu Jul  1 23:15:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/pstore.rb (transaction): safer backup scheme.  [ruby-list:39102]
-
-	* lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
-	  [ruby-dev:23157]
-
-	* lib/pstore.rb (transaction): allow overriding dump and load.
-	  [ruby-dev:23567]
-
-	* lib/pstore.rb (PStore#transaction): get rid of opening in write mode
-	  when read only transaction.  [ruby-dev:23842]
-
-	* lib/yaml/store.rb: follow lib/pstore.rb's change.
-
-Thu Jul  1 18:36:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tcltklib : bug fix
-
-	* ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
-
-Thu Jul  1 11:59:45 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
-	  EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
-	  EVP_DigestFinal_ex and EVP_DigestInit_ex.
-
-	* ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
-
-	* ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
-	  EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
-	  OpenSSL 0.9.6.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
-	  re-implemnt (the arguments for this method is ).
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
-	  OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
-	  ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
-	  ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
-	  and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
-	  and EVP_CIPHER_CTX_init should only be called once.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
-	  OpenSSL::Cipher::Cipher#key_len=.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
-	  finction; print warning for Cipher#<<.
-
-	* ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
-	  EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
-	  and EVP_MD_CTX_init should only be called once.
-
-	* ext/openssl/ossl_digest.c (digest_final): should call
-	  EVP_MD_CTX_cleanup to avoid memory leak.
-
-	* ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
-	  into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
-
-	* ext/openssl/ossl_hmac.c (hmac_final): should call
-	  HMAC_CTX_cleanup to avoid memory leak.
-
-	* test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
-	  test/openssl/test_hmac.rb: new file.
-
-Thu Jul  1 04:08:30 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
-	  workaround for the versions earlier than OpenSSL-0.9.7.
-
-Thu Jul  1 03:33:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
-	  empty pkey object if no argument is passed. [ruby-talk:103328]
-
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
-
-	* ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
-	  OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
-	  OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
-	  OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
+Wed Jan 12 16:24:53 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
-	  OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
-	  OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
-	  OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
-	  OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
+	* ext/readline/extconf.rb: new checks for RL_PROMPT_START_IGNORE
+	  and RL_PROMPT_END_IGNORE. [ruby-core:34331]
 
-Thu Jul  1 03:16:09 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/readline/readline.c: enables USE_INSERT_IGNORE_ESCAPE only if
+	  RL_PROMPT_{START,END}_IGNORE are available to get rid of compilation
+	  error with libedit.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
-	  to specify a string to be written.
+Wed Jan 12 15:53:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
-	  take optional second argument to specify a string to be written.
+	* README.EXT.ja (rb_ensure): typo.
 
-	* ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
-	  refine regexp for end-of-line.
+Wed Jan 12 11:33:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/opnessl/lib/openssl/ssl.rb
-	  (OpenSSL::SSL::SocketForwarder#listen): fix typo.
+	* addr2line.c: OpenBSD uses the elf_abi.h header file instead of the
+	  elf.h header file. patched by Jeremy Evans [ruby-core:34384]
 
-Wed Jun 30 11:38:51 2004  Mikael Brockman  <phubuh@phubuh.org>
+Wed Jan 12 03:59:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (primary): should not be NULL.  [ruby-core:03098]
+	* test/webrick/test_cgi.rb: Removes usage of deprecated
+	  :RequestHandler option.
+	  patched by Peter Weldon [ruby-core:34010]
 
-Wed Jun 30 02:53:24 2004  why the lucky stiff  <why@ruby-lang.org>
+	* test/webrick/test_httpproxy.rb: ditto.
 
-	* ext/syck/rubyext.c (syck_emitter_new): set buffer after
-	  Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
+	* test/webrick/test_httpserver.rb: Add a test of the deprecation
+	  behaviour.
 
-Tue Jun 29 10:31:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jan 12 08:37:07 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
+	* hash.c (hash_i): return different values for inverse hash.
+	  [ruby-core:34334]
 
-	* gc.c (define_final, run_final): preserve and restore safe level for
-	  finalizers.  [ruby-core:03058]
+Tue Jan 11 20:32:59 2011  Tanaka Akira  <akr@fsij.org>
 
-	* signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
-	  safe level for signal handlers.  [ruby-dev:23829]
+	* variable.c: parenthesize macro arguments.
 
-Mon Jun 28 14:57:56 2004  Jeff Mitchell  <quixoticsycophant@yahoo.com>
+Tue Jan 11 13:06:38 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
-	  DOSISH compilers.  [ruby-core:03107]
+	* array.c (rb_ary_resize): should care of embeded array when extending
+	  the array.
 
-Mon Jun 28 00:30:19 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* array.c (rb_ary_resize): need to set capa when changing the real
+	  size of the array.
+	  these are latent bugs.
 
-	* sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
+Mon Jan 10 22:46:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun 27 22:39:51 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* include/ruby/defines.h (CASEFOLD_FILESYSTEM): HFS+ is case
+	  insensitive.
 
-	* sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
+	* load.c (loaded_feature_path, rb_feature_p, load_lock): on a
+	  case-insensitive filesystem, loaded features search should
+	  ignore case.  [ruby-core:34297]
 
-Sun Jun 27 12:19:46 2004  Kouhei Sutou  <kou@cozmixng.org>
+Mon Jan 10 21:34:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
+	* common.mk (showflags): show LD commands.
 
-Sat Jun 26 11:07:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jan 10 14:32:55 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (aix): -b must come at the start of the command line,
-	  and -e must not appear while testing libraries.  [ruby-talk:104501]
+	* test/ruby/test_method.rb (TestMethod#test_define_method): method
+	  transplanting between class and module is impossible.
 
-	* lib/mkmf.rb (dir_config): quote directory names if necessary.
-	  [ruby-talk:104505]
+Mon Jan 10 13:51:17 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jun 25 15:33:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* misc/rdoc-mode.el (rdoc-mode): show trailing whitespace.
 
-	* ext/iconv/extconf.rb: check stricter.  [ruby-talk:104501]
+Mon Jan 10 11:22:02 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/iconv/extconf.rb: include iconv.h for libiconv.  [ruby-dev:22715]
+	* util.c: parenthesize macro arguments.
 
-Fri Jun 25 08:31:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jan 10 07:41:31 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* eval.c (rb_thread_atfork): remove "fork terminates thread"
-	  warning.  [ruby-dev:23768]
+	* misc/README: mention rdoc-mode.el and ruby-style.el.
 
-	* object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
-	  [ruby-core:02786][ruby-core:03067]
+Sun Jan  9 20:37:21 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
-	  should give us packed address, not struct sockaddr.
-	  [ruby-core:03053]
+	* transcode.c: parenthesize macro arguments.
 
-Fri Jun 25 02:04:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Jan  9 16:31:53 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
-	  including version.h. [ruby-talk:104456] (backported from HEAD)
+	* io.c (Kernel.#syscall): implemented on LP64/LLP64 environments too.
+	  also uses __syscall if available for *BSD on 64bit architecture.
+	  [ruby-core:34062]
 
-Thu Jun 24 14:23:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jan  9 16:31:34 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* io.c (rb_io_fread): return already read data when system call is
-	  interrupted.  [ruby-talk:97206]
-
-Thu Jun 24 01:32:43 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* version.h: added declarations of ruby_version,
-	  ruby_release_date, ruby_platform.
-	  (backported from HEAD)
-
-Wed Jun 23 22:23:37 2004  Dave Thomas  <dave@pragprog.com>
-
-	* ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
-	  with OS X not returning 'from' parameter to recvfrom for
-	  connection-oriented sockets.
-
-Wed Jun 23 01:45:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
-	  Fix problem with the 'r' being dropped from %r{xxx}
-
-Wed Jun 23 00:20:20 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
-	  CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
-
-Wed Jun 23 00:00:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_initialize): should check fcntl result.  [ruby-dev:23742]
-
-Tue Jun 22 21:11:36 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
-	  dLibraries().
-
-	* ext/win32ole/win32ole.c (ole_event_free): ditto.
-
-	* ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
-	  before CR.
-
-Tue Jun 22 16:47:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
-	  Thanks, Rutger Nijlunsing.
-
-Mon Jun 21 10:19:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
-	  FindClose() instead of _findfirst()/_findnext()/_findclose().
-	  merge from HEAD.
-
-Sat Jun 19 13:24:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (method_call): allow changing $SAFE.  [ruby-dev:23713]
-
-Fri Jun 18 23:12:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
-	  safe level.
-
-Wed Jun 16 23:05:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_mod_freeze): prepare string representation before
-	  freezing. [ruby-talk:103646]
-
-Wed Jun 16 16:04:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* object.c (rb_mod_le): singleton class inherits Class rather than its
-	  object's class.  [ruby-dev:23690]
-
-Wed Jun 16 16:01:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (stack_grow_direction): memoize the direction.
-
-	* gc.c (Init_stack): should always move to end of VALUE.
-
-Tue Jun 15 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
-
-Mon Jun 14 18:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/remote-tk.rb: bug fix
-
-Sun Jun 13 00:23:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
-
-	* ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
-	  eliminate warning about instance variable access
-
-	* ext/tk/lib/tk/menubar.rb: improve supported menu_spec
-
-	* ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
-
-	* ext/tk/lib/tk/root.rb: add menu_spec support
-
-	* ext/tk/lib/tk/text.rb: bug fix
-
-	* ext/tk/lib/tk/toplevel.rb: add menu_spec support
-
-	* ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
-
-Sat Jun 12 11:15:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (target_os): strip -gnu suffix on Linux.
-
-Fri Jun 11 17:08:21 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess: Restore a wrongly removed hyphen.
-
-Fri Jun 11 14:30:08 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess: Attempt to avoid system name change on
-	  Darwin platforms also.
-
-Fri Jun 11 14:22:45 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess, config.sub: Attempt to avoid system name change on
-	  Linux platforms.  We have been using "linux" instead of
-	  "linux-gnu" on this branch.
-
-Thu Jun 10 19:19:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
-	  [ruby-talk:103062]
-
-Wed Jun  9 18:04:14 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic::merge,
-	  URI::Generic::route_from): accepts non-hierarchical URI.
-	  [ruby-dev:23631]
-
-	* test/uri/test_generic.rb (TestGeneric::test_route,
-	  TestGeneric::test_merge): added tests for above changes.
-
-Wed Jun  9 17:39:37 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess, config.sub: Update to a more recent version as of
-	  2004-01-20.
-
-	* configure.in: Add support for DragonFly BSD.
-
-Wed Jun  2 20:16:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_new4): should share shared instance if it already
-	  exists.  [ruby-dev:23665]
-
-Wed Jun  2 12:41:53 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_gets_m): set lastline ($_) even when read line is
-	  nil.  [ruby-dev:23663]
-
-Fri May 28 11:20:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): bad influence on frame node.
-
-	* eval.c (eval): reverted wrongly removed condition.  [ruby-dev:23638]
-
-Thu May 27 23:15:18 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb: leading 0 padding of timestamp usec part.
-
-	* lib/csv.rb (CSV.parse): [CAUTION] behavior changed.  in the past,
-	  CSV.parse accepts a filename to be read-opened (it was just a
-	  shortcut of CSV.open(filename, 'r')).  now CSV.parse accepts a
-	  string or a stream to be parsed e.g.
-	  CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
-
-	* lib/csv.rb: CSV::Row and CSV::Cell are deprecated.  these classes
-	  are removed in the future.  in the new csv.rb, row is represented
-	  as just an Array.  since CSV::Row was a subclass of Array, it won't
-	  hurt almost all programs except one which depended CSV::Row#match.
-	  and a cell is represented as just a String or nil(NULL).  this
-	  change will cause widespread destruction.
-
-	      CSV.open("foo.csv", "r") do |row|
-		row.each do |cell|
-		  if cell.is_null       # using Cell#is_null
-		    p "(NULL)"
-		  else
-		    p cell.data         # using Cell#data
-		  end
-		end
-	      end
-
-	    must be just;
-
-	      CSV.open("foo.csv", "r") do |row|
-		row.each do |cell|
-		  if cell.nil?
-		    p "(NULL)"
-		  else
-		    p cell
-		  end
-		end
-	      end
-
-	* lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
-	  change.  CSV.open, CSV.parse, and CSV,generate now do not force
-	  opened file binmode.  formerly it set binmode explicitly.
-
-	  with CSV.open, binmode of opened file depends the given mode
-	  parameter "r", "w", "rb", and "wb".  CSV.parse and CSV.generate open
-	  file with "r" and "w".
-
-	  setting mode properly is user's responsibility now.
-
-	* lib/csv.rb: accepts String as a fs (field separator/column separator)
-	  and rs (record separator/row separator)
-
-	* lib/csv.rb (CSV.read, CSV.readlines): added.  works as IO.read and
-	  IO.readlines in CSV format.
-
-	* lib/csv.rb: added CSV.foreach(path, rs = nil, &block).  CSV.foreach
-	  now does not handle "| cmd" as a path different from IO.foreach.
-	  needed?
-
-	* test/csv/test_csv.rb: updated.
-
-	* test/ruby/test_float.rb: added test_strtod to test Float("0").
-
-Thu May 27 21:37:50 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#initialize): refine pathname initialization
-	  by pathname.
-
-Thu May 27 20:22:05 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
-
-Thu May 27 14:53:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
-	  add errno checking.  [ruby-dev:23627]
-
-Wed May 26 14:19:42 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval, eval): make line number consistent on eval with
-	  Proc.  [ruby-talk:101253]
-
-Wed May 26 13:59:17 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
-	  'do' after for statement
-
-Wed May 26 13:56:03 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
-	  relative path to code CSS file
-
-Wed May 26 13:14:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_init_copy): copy also positions.  [ruby-talk:100910]
-
-Wed May 26 00:00:00 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.c (syck_new_parser): clear parser on init.
-	  thanks, ts. [ruby-core:02931]
-
-	* ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
-	  thanks, ts. [ruby-core:02929]
-
-	* lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
-
-	* lib/yaml.rb: added rdoc to beginning of lib.
-
-Mon May 24 10:46:26 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
-	  must be absolute URIs
-
-Sat May 22 12:00:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* MANIFEST: add new encodings in rexml.
-
-	* ext/tk/MANIFEST: add recent files.
-
-Sat May 22 05:37:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
-	  on the other processes by Tcl/Tk's 'send' command
-
-Fri May 21 09:22:05 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
-	  Add ()'s around parameters that don't have them
-
-Thu May 20 17:02:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (check_sizeof): define result size.  [ruby-core:02911]
-
-	* lib/mkmf.rb (create_header): macro name should not include equal
-	  sign.
-
-Thu May 20 15:59:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
-
-Thu May 20 14:35:52 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c: check SCM_RIGHTS macro addition to
-	  the msg_control field to test existence of file descriptor passing
-	  by msg_control.
-
-Thu May 20 12:38:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (flo_eq): always check if operands are NaN.
-	  [ruby-list:39685]
-
-Thu May 20 12:34:39 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
-	  At Ryan Davis' suggestion, honor visibility modifers if guarded by a
-	  statement modifier
-
-Thu May 20 12:22:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (have_type): do not check pointer to incomplete type,
-	  which always get compiled.  [ruby-list:39683]
-
-Wed May 19 11:09:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
-	  private to public
-
-Tue May 18 14:00:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.h (NEW_DSTR): adjust list length.
-
-	* parse.y (literal_concat): ditto.
-
-Mon May 17 16:14:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
-	  instead of "0.0e+00". [ruby-dev:23480]
-
-	* numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
-	  outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
-	  is considered, but there is assumption DBL_DIG == 15 in current
-	  implementation)
-
-Mon May 17 10:13:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (setup_domain_and_type): honor duck typing.
-	  [ruby-dev:23522]
-
-	* ext/socket/socket.c (sock_s_getnameinfo): ditto.
-
-Mon May 17 01:15:23 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml.rb: removed fallback to pure Ruby parser.
-
-	* lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
-	  of zero at times, which kept some blocks from getting indentation.
-
-	* lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
-
-	* ext/syck/syck.h: reports style of scalars now, be they plain, block
-	  single-, or double-quoted.
-
-	* ext/syck/syck.c: ditto.
-
-	* ext/syck/gram.c: ditto.
-
-	* ext/syck/node.c: ditto.
-
-	* ext/syck/token.c: ditto.
-
-	* ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
-	  if scalar style is plain.
-
-	* ext/syck/rubyext.c (yaml_org_handler): some empty strings were
-	  loaded as symbols.
-
-	* test/yaml/test_yaml.rb (test_perl_regexp): updated test to
-	  match new regexp serialization.
-
-Mon May 17 00:03:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/drb/drb.rb: Cosmetic documentation changes.
-
-Sun May 16 22:36:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
-	  RDoc operation), and added file-level comment.
-
-Sun May 16 20:55:49 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
-	  specify an open flag.
-	  (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
-	  and DBM::NEWDB.
-
-Sun May 16 13:10:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
-	  generating warnings, many were on private methods).
-
-Sat May 15 01:41:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): forgot to restore $SAFE value before evaluating
-	  compiled node.  [ruby-core:02872]
-
-Sat May 15 01:33:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* range.c (range_each_func): terminates loop if generating value
-	  is same to @end.  [ruby-talk:100269]
-
-Fri May 14 22:08:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_new4): should not reuse frozen shared string if
-	  the original is not an instance of String. [ruby-talk:100193]
-
-Fri May 14 18:39:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
-	  Now, supports all of the followings.
-	    TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
-	    TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
-	    TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
-	    TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
-	    TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
-	    TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
-
-Fri May 14 12:11:43 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
-	 [ruby-dev:23498]
-
-Thu May 13 15:47:30 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/net/telnet.rb (Net::Telnet::login): "options" can specify
-	  regexps for login prompt and/or password prompt.
-
-Thu May 13 14:23:45 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* hash.c (delete_if_i): use st_delete_safe() (via
-	  rb_hash_delete()) instead of returning ST_DELETE.
-	  backport from HEAD.  [ruby-dev:23487]
-
-Thu May 13 13:01:30 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
-
-Thu May 13 11:04:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* pack.c (pack_pack): always add with null for 'Z'.
-
-	* pack.c (pack_unpack): terminated by null for 'Z'.  [ruby-talk:98281]
-
-Wed May 12 19:59:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
-	  [ruby-talk:99788]
-
-Wed May 12 17:41:42 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/resolv.rb (Resolv::DNS::Config): make it configurable without
-	  external file such as /etc/resolv.conf.
-
-Wed May 12 14:37:27 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c: attribute value of DC (short name of
-	  domainComponent) should be IA5String.
-
-Wed May 12 13:20:19 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/composite.rb: improve configure methods (based on
-	  the proposal of [ruby-talk:99671]).
-
-Wed May 12 11:51:08 2004  Dave Thomas  <dave@pragprog.com>
-
-	* class.c (rb_obj_singleton_methods): fix rdoc
-
-Mon May 10 21:44:42 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Change scheme for
-	  looking up symbols in  HTML generator.
-
-Mon May 10 16:45:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): warning during eval should not cause deadlock.
-	  [ruby-talk:98651]
-
-	* eval.c (rb_eval): raise TypeError exception for superclass
-	  mismatch.  [ruby-list:39567]
-
-Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Hack to search parents
-	  for unqualified constant names.
-
-Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Hack to search parents
-	  for unqualified constant names.
-
-Sun May  9 22:37:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/net/ftp.rb: improved documentation
-	* lib/net/imap.rb: ditto
-	* lib/net/pop.rb: ditto
-	* lib/net/smtp.rb: ditto
-	* lib/net/telnet.rb: ditto
-
-Fri May  7 21:50:21 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
-	  multiple arguments to 'include'
-
-Fri May  7 21:31:56 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
-	  [ruby-core:02843]
-
-Fri May  7 11:25:53 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): "0.0000000000000000001" should be converted
-	  to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
-	  [ruby-talk:99318] [ruby-dev:23465]
-
-Fri May  7 10:00:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
-
-Thu May  6 22:13:17 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
-	  hostname.
-
-Thu May  6 14:22:29 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
-	  for Ranges, Strings, Structs, Regexps.
-
-	* lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
-	  String's flow style.
-
-	* lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
-
-	* ext/syck/gram.c: fixed transfer methods on structs, broke it
-	  last commit.
-
-Thu May  6 11:40:28 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (string): accept NIL.
-
-	* lib/net/imap.rb (body_type_basic): allow body-fields omissions.
-
-Thu May  6 01:59:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
-	  Don't include the &block parameter if we have explicit
-	  yield parameters.
-
-Wed May  5 03:40:29 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/ring.rb: use recv instead of recvfrom.
-
-Tue May  4 23:52:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/gserver.rb: documented
-
-Tue May  4 23:46:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/xmlrpc/README.txt: introduced for documentation purposes
-
-Mon May  3 09:47:24 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
-	  Fix parsing bug if yield called within 1 line block
-
-Sun May  2 01:04:38 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib, ext/tk: renewal Ruby/Tk
-
-Fri Apr 30 20:08:41 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
-
-Tue Apr 27 13:12:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
-
-Tue Apr 27 08:41:28 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: passing Range tests.
+	* lib/irb/locale.rb (IRB::Locale::LOCALE_NAME_RE):
+	  some platform has a locale without territory but with
+	  encoding.
+	  (#each_sub_locale): ditto.
 
-	* ext/syck/syck.h: version 0.44.
+Sun Jan  9 14:47:50 2011  TAKAO Kouji  <kouji@takao7.net>
 
-	* ext/syck/gram.c: transfers no longer open an indentation.
-	  fixed transfers which precede blocks.
+	* ext/readline/readline.c: apply a patch from Nobuyoshi Nakada.
+	  fixed #3616 [ruby-core:31484] IRB + readline incorrectly counts
+	  non-printing characters in prompt
 
-	* ext/syck/token.c: ditto.
+Sat Jan  8 21:47:26 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/syck/syck.c: fixed segfault if an anchor has been released already.
+	* enum.c (enum_sort_by): use rb_ary_resize.
+	  (ary_cutoff): removed.
 
-	* ext/syck/node.c (syck_free_members): organized order of free'd nodes.
+Sat Jan  8 21:24:17 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
-	  StringValue.
+	* pack.c (swapf): compilation condition simplified.
+	  (swapd): ditto.
 
-Mon Apr 26 23:56:54 2004  Daniel Kelley  <news-1082945587@dkelley.gmp.san-jose.ca.us>
+Sat Jan  8 20:51:25 2011  Tanaka Akira  <akr@fsij.org>
 
-	* README.EXT, README.EXT.ja: fixed wrong function signature.
-	  [ruby-talk:98349]
+	* pack.c (swapd): remove duplicated code.
 
-Mon Apr 26 21:40:09 2004  Dave Thomas  <dave@pragprog.com>
+Sat Jan  8 19:28:55 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
-	  to instance methods.
+	* thread.c: parenthesize macro arguments.
 
-Sat Apr 24 10:38:31 2004  Dave Thomas  <dave@pragprog.com>
+Fri Jan  7 23:07:40 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
-	  Fix bug where consecutive headings are merged.
+	* lib/mkmf.rb (configuration): backref needs to capture.
 
-Fri Apr 23 23:26:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jan  7 21:57:22 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb: $hdrdir should not contain macros for backward
-	  compatibility.  [bruby-dev:28]
+	* misc/ruby-mode.el (ruby-mode-variables), misc/ruby-style.el:
+	  show trailing whitespace.
 
-	* version.c (ruby_show_copyright): obtain copyright year from
-	  RUBY_RELEASE_YEAR.
+	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): highlight
+	  regexp after open bracket.  [ruby-core:34183]
 
-	* win32/resource.rb: ditto.
+Fri Jan  7 00:37:35 2011  Tanaka Akira  <akr@fsij.org>
 
-	* win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
-	  include them.
+	* string.c: parenthesize macro arguments.
 
-	* win32/resource.rb: include winver.h for older WindowsCE.
+Thu Jan  6 22:42:02 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Apr 23 16:38:46 2004  Tanaka Akira  <akr@m17n.org>
+	* bignum.c (bigmul1_karatsuba): avoid overflow that make assertion
+	  fail in certain case.  this patch is contributed from Ray Chason
+	  <chasonr at gmail.com> in personal communication.
 
-	* lib/pathname.rb: sync taint/freeze flag between
-	  a pathname object and its internal string object.
+Thu Jan  6 20:55:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Apr 23 14:52:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (create_makefile): ignore rest from first dot from
+	  TARGET to generate init function name.
+	  this is followup of r30464.
 
-	* parse.y (stmt, arg, aref_args): should not make sole splat into
-	  array, in aref_args other than aref with op_asgn.
+Thu Jan  6 11:27:01 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Apr 23 14:14:38 2004  Tanaka Akira  <akr@m17n.org>
+	* ext/psych/lib/psych/json/tree_builder.rb (start_mapping): tags
+	  should not be included in JSON mapping
 
-	* lib/resolv.rb: don't use Regexp#source to embed regexps.
-	  [ruby-dev:23432]
+Thu Jan  6 09:23:33 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Apr 22 04:15:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/protocol.rb (eof?): BufferedIO should proxy eof? to the
+	  underlying IO object.
 
-	* parse.y (aref_args): should pass expanded list.  [ruby-core:02793]
+Thu Jan  6 09:12:31 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Apr 22 01:12:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/mkmf.rb (configuration): fixing gsub when multiple error flags
+	  are passed to GCC.
 
-	* numeric.c (flo_to_s): tweak output string based to preserve
-	  decimal point and to remove trailing zeros.  [ruby-talk:97891]
+Thu Jan  6 05:25:49 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
-	  search.  [ruby-talk:97342]
+	* array.c (rb_ary_modify): export.
 
-Wed Apr 21 22:57:27 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Thu Jan  6 05:14:41 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
+	* ext/stringio/stringio.c (get_strio, strio_set_string)
+	  (strio_reopen): check if frozen.  [ruby-core:33648]
 
-Wed Apr 21 20:05:00 2004  Tanaka Akira  <akr@m17n.org>
+Thu Jan  6 05:10:58 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
-	  [ruby-list:39542]
+	* array.c (rb_ary_resize): new utility function.  [ruby-dev:42912]
 
-Mon Apr 19 18:11:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jan  6 05:03:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (rb_hash_equal): returns true if two hashes have same set
-	  of key-value set.  [ruby-talk:97559]
+	* dln.c (init_funcname_len): ignore rest from first dot.
+	  [ruby-dev:41774]
 
-	* hash.c (rb_hash_eql): returns true if two hashes are equal and
-	  have same default values.
+Thu Jan  6 02:55:48 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Apr 19 08:19:58 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: use YAML 1.0 output
+	  format for serializing nil values.  Thanks Eric Hodel!
 
-	* dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
-	  lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
-	  lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
-	  lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
-	  lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
-	  lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
-	  lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
-	  lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
+	* test/psych/test_nil.rb: test for nil values
 
-Mon Apr 19 08:14:18 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jan  5 14:21:34 2011  Mark Dodwell  <hi@mkdynamic.co.uk>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
-	  #ifdef HAVE_PROTOTYPES
+	* string.c: fix rdoc typo.
+	  https://github.com/shyouhei/ruby/pull/3
 
-Fri Apr 16 22:33:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Wed Jan  5 14:06:01 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/iconv/iconv.c: nearly finished RDoc comments.
+	* test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
+	  skip on Windows because chmod 0 doesn't mean unreadable by owner.
 
-Fri Apr 16 17:04:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jan  5 13:56:54 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-	* string.c (rb_str_equal): always returns true or false, never
-	  returns nil. [ruby-dev:23404]
+	* lib/net/http.rb (Net::HTTP#get): A header hash given should not
+	  be modified.
 
-Fri Apr 16 08:27:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jan  5 12:10:08 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/extmk.rb: skip linking when libraries to be preloaded not
-	  compiled.  [ruby-list:39561]
+	* ext/dl/{cfunc.c,dl.h,handle.c}, ext/fiddle/fiddle.{h,c}: Use _WIN32
+	  rather than checking for windows.h.  Thanks Jon Forums!
+	  [ruby-core:33977]
 
-Thu Apr 15 23:21:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jan  1 17:02:50 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* process.c (pst_success_p): new method Process::Status#success?.
-	  [ruby-dev:23385]
+	* lib/irb/locale.rb (IRB::Locale#search_file): make it possible
+	  to load a localization from a gem.
+	  (IRB::Locale#lc_path): obsoleted because of the change of #search_file
+	  (IRB::Locale#each_localized_path): new private method, based on
+	  lc_path
+	  (IRB::Locale#find): follows the change of #search_file.
+	  (IRB::Locale#load): removed duplicate with #find.
 
-Thu Apr 15 17:12:13 2004  Tanaka Akira  <akr@m17n.org>
+Sat Jan  1 11:44:42 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
-	  GDBM::WRCREAT and GDBM::NEWDB.
-	  (fgdbm_initialize): use specified read/write flag.
+	* strftime.c: parenthesize macro arguments.
 
-Wed Apr 14 11:29:56 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Jan  1 11:10:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (flo_eq): workaround for bcc32's bug.
-	  (ruby-bugs-ja:PR#594)
+	* ext/zlib/zlib.c: take care of platforms where long is bigger
+	  than int.
 
-Wed Apr 14 13:06:35 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
+Sat Jan  1 11:03:58 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
-	  process.c, re.c, string.c: typos in RDoc comments.  [ruby-core:02783]
+	* NEWS (optparse): shell completion support.
 
-Wed Apr 14 11:06:38 2004  Dave Thomas  <dave@pragprog.com>
+	* misc/README (rb_optparse.{bash,zsh}): for shell completion.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
-	  behavior of :enddoc: -- it now unconditionally terminates
-	  processing of the current file.
+	* include/ruby/intern.h (VALUE rb_ary_print_on): I have never seen
+	  this function anywhere.
 
-Wed Apr 14 11:03:22 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jan  1 04:20:11 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* defines.h: include <net/socket.h> to get fd_set definition in BeOS.
+	* win32/win32.c (rb_w32_write_console): don't raise exception when
+	  the conversion is for writing to console.
+	  Patched by Heesob Park [ruby-core:33999]
 
-Tue Apr 13 23:06:30 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Fri Dec 31 12:02:06 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rinda/rinda.rb: change pattern matching.
-	  a === b -> a == b || a === b. [druby-ja:98]
+	* enum.c (enum_sort_by): use less temporary objects.
 
-	* test/rinda/test_rinda.rb: ditto.
+Fri Dec 31 11:46:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Apr 13 19:54:29 2004  Minero Aoki  <aamine@loveruby.net>
+	* configure.in (warnflags), lib/mkmf.rb (configuration): turn
+	  warnings into errors only for bundled extensions.
+	  [ruby-core:33815]
 
-	* lib/net/http.rb: should not overwrite HTTP request header.
-	  [ruby-list:39543]
+Fri Dec 31 11:15:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Apr 13 01:30:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* ext/zlib/zlib.c (sizeof): zlib.h mistakenly assumes the result
+	  of sizeof to be int, not size_t.
 
-	* ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
-	* ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
+Fri Dec 31 10:27:34 2010  Tanaka Akira  <akr@fsij.org>
 
-Mon Apr 12 19:11:29 2004  Eric Hodel  <drbrain@segment7.net>
+	* st.c: parenthesize macro arguments.
 
-	* gc.c (rb_gc_copy_finalizer): typo.  [ruby-core:02774]
+Fri Dec 31 03:23:26 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Apr 12 18:52:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vsnprintf.c (BSD__uqtoa): Fix overflow when long != quad_t.
+	  patched by Peter Weldon <peter.weldon AT null.net>
+	  [ruby-core:33985]
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
-	  a value.
+Fri Dec 31 03:00:34 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Mon Apr 12 10:43:47 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* Makefile.in: remove unnecessary semicolons.
 
-	* dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
-	  rb_push_glob): fix memory leak. (leaked when block was interrupted)
+Thu Dec 30 23:09:47 2010  wanabe  <s.wanabe@gmail.com>
 
-Mon Apr 12 10:27:37 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm.c (vm_define_method): guard iseq from GC while method definition.
+	  [ruby-dev:42832]
 
-	* bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
+Thu Dec 30 20:18:32 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
 	* win32/Makefile.sub: ditto.
 
-	* wince/Makefile.sub: ditto.
-
-Sun Apr 11 19:12:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (require_libraries): restore source file/line after
-	  statically linked extensions initialized.  [ruby-dev:23357]
-
-Sun Apr 11 10:47:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
-	  classes and modules are a special case too... (handle extending existing
-	  classes with or without :enddoc:)
-
-Sat Apr 10 23:51:13 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
-	  made one too many assumptions...
-
-Sat Apr 10 00:00:19 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup/inline.rb: Fix problem
-	  with \_cat_<b>dog</b>
-
-Wed Apr  7 00:19:50 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: fix hash tuple bug.
-
-	* lib/rinda/tuplespace.rb: ditto.
-
-	* test/rinda/test_rinda.rb
-
-Tue Apr  6 18:24:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_reopen): should use rb_io_check_io().
-
-Tue Apr  6 16:46:09 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: check the size of time_t.
-
-	* time.c (time_add): new function.
-	  (time_plus): use time_add.
-	  (time_minus): use time_add.
-
-Tue Apr  6 13:21:30 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): must return value.
-
-Tue Apr  6 00:05:30 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: add require 'drb/drb'
-
-Mon Apr  5 08:18:23 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
-	  references work properly.
-
-Sun Apr  4 20:33:42 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* eval.c (Init_load): make $LOADED_FEATURES built-in.
-	  [ruby-dev:23299]
-
-	* ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
+Thu Dec 30 20:57:09 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
+	* Makefile.in: Check V=1 argument if run "make clean" or similar.
 
-Sun Apr  4 14:01:20 2004  Dave Thomas  <dave@pragprog.com>
+Thu Dec 30 20:41:50 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
-	  Fix bug where files weren't being excluded properly
+	* Makefile.in: Kill ugly line continuation.
 
-Sat Apr  3 17:11:05 2004  why the lucky stiff  <why@ruby-lang.org>
+Thu Dec 30 11:49:40 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/syck/syck.h: version 0.43.
+	* sprintf.c: parenthesize macro arguments.
 
-	* ext/syck/lib/gram.c: allow root-level inline collections.
-	 [ruby-talk:94922]
+Wed Dec 29 21:20:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
-	 [ruby-talk:94930]
+	* io.c (maygvl_copy_stream_wait_readwrite): define if USE_SENDFILE
 
-	* ext/syck/bytecode.c: turn off default implicit typing.
+Wed Dec 29 20:37:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/implicit.c: detect base60 integers.
+	* ext/extmk.rb: strip current directory prefix.
 
-	* ext/syck/rubyext.c: handle base60, as well as hex and octal
-	  with commas.  implicit typing of ruby symbols.
+	* enc/depend (clean): remove name2ctype.h when out-of-place build.
 
-Fri Apr  2 17:27:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/Makefile.sub (clean-enc): pass V to inferior make.
 
-	* eval.c (top_include): include in the wrapped load is done for
-	  the wrapper, not for a singleton class for wrapped main.
-	  [ruby-dev:23305]
+Wed Dec 29 18:23:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Apr  2 15:13:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* re.c (rb_reg_expr_str): need to escape if the coderange is invalid.
 
-	* bignum.c (rb_big_eq): use temporary double variable to save the
-	  result (internal float register may be bigger than 64 bits, for
-	  example, 80 bits on x86).  [ruby-dev:23311]
+Wed Dec 29 10:06:51 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Apr  2 14:35:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* signal.c: parenthesize macro arguments.
 
-	* eval.c (block_pass): should generate unique identifier of the
-	  pushing block.  [ruby-talk:96363]
+Wed Dec 29 07:22:15 2010  Eric Hodel  <drbrain@segment7.net>
 
-Fri Apr  2 07:31:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rake/rdoctask.rb: Deprecate in favor of rdoc/task.
 
-	* ext/socket/socket.c (make_hostent): fix memory leak, based on
-	  the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
+Wed Dec 29 07:07:06 2010  Eric Hodel  <drbrain@segment7.net>
 
-Thu Apr  1 22:55:33 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/rdoc: Import RDoc 3.1
 
-	* lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
-	  =begin rdoc/=end
+Tue Dec 28 18:36:38 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
-	  top-level method being taken as file comment.
+	* error.c, include/ruby/intern.h (rb_compile_error_with_enc): new
+	  function to raise syntax error, with source encoding'ed message.
 
-Thu Apr  1 22:55:04 2004  Dave Thomas  <dave@pragprog.com>
+	* parse.y (compile_error): use above function.
+	  [ruby-core:33951] (#4217)
 
-	* lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
+Tue Dec 28 07:37:38 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Apr  1 19:58:37 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ruby.c: parenthesize macro arguments.
 
-	* lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
-	  object with soap/marshal.
-	  added URIFactory class for URI mapping.  BasetypeFactory checks
-	  instance_variables when original mapping is not allowed (ivar must
-	  be empty).  Instance of URI have instance_variables but it must be
-	  llowed whenever original mapping is allowed or not.
+Tue Dec 28 07:17:11 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/xsd/datatypes.rb: check the smallest positive non-zero
-	  single-precision float exactly instead of packing with "f".
-	  [ruby-talk:88822]
+	* NEWS: add ARGF.write and so on.
 
-	* lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
-	  [ruby-dev:22588]
-	  c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
+Tue Dec 28 07:12:38 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Wed Mar 31 19:06:23 2004  Tanaka Akira  <akr@m17n.org>
+	* NEWS: add new magic-comment. (warn-indent) [ruby-core:25442]
 
-	* time.c (year_leap_p): new function.
-	  (timegm_noleapsecond): ditto.
-	  (search_time_t): use timegm_noleapsecond instead of
-	  mktime for first guess.
+Tue Dec 28 04:32:37 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Wed Mar 31 12:04:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/fiddle/extconf.rb: check for windows.h while building fiddle.
+	  Thanks Jon Forums! [ruby-core:33923]
 
-	* lib/delegate.rb (DelegateClass): define internal methods of the
-	  result class, but not metaclass of the caller.  [ruby-talk:96156]
+Tue Dec 28 01:45:12 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* intern.h: provide proper prototypes.  [ruby-core:02724]
+	* NEWS: Add Zlib.deflate and Zlib.inflate.
+	  [ruby-dev:42833]
 
-	* ruby.h: missing.h is now prerequisite to intern.h.
+Mon Dec 27 21:22:33 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Mar 30 20:25:34 2004  Tanaka Akira  <akr@m17n.org>
+	* win32/configure.bat: Remove obsoleted coding rule. Now, we
+	  don't support to build on Windows 95/98 and Me.
 
-	* time.c (search_time_t): limit guess range by mktime if it is
-	  available.  [ruby-dev:23274]
+Mon Dec 27 18:27:13 2010  Tanaka Akira  <akr@fsij.org>
 
-Sun Mar 28 14:16:59 2004  Minero Aoki  <aamine@loveruby.net>
+	* re.c: parenthesize macro arguments.
 
-	* lib/net/pop.rb (auth): failed when account/password include "%".
-	  [ruby-talk:95933]
+Mon Dec 27 15:22:23 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Mar 27 21:40:41 2004  Tanaka Akira  <akr@m17n.org>
+	* win32/README.win32: note to need NT based OS to build ruby.
 
-	* lib/open-uri.rb: permit extra semicolon in content-type field.
+Mon Dec 27 12:14:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Mar 27 10:40:48 2004  Tanaka Akira  <akr@m17n.org>
+	* common.mk (EXTMK_ARGS): specify to pass macro V, because nmake
+	  doesn't pass it via MAKEFLAGS.
 
-	* (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
-	  instead of PrettyPrint.
+Mon Dec 27 10:33:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Mar 25 23:28:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/zlib/zlib.c (Init_zlib): Add Zlib.deflate and Zlib.inflate.
+	  [ruby-dev:42833]
 
-	* time.c (time_overflow_p): backport 1.9 usec overflow function.
-	  (ruby-bugs PR#1307)
+Mon Dec 27 07:38:07 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Mar 25 23:15:24 2004  Dave Thomas  <dave@pragprog.com>
+	* misc/rb_optparse.zsh: add compdef for generator.
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
-	  Add --version option
+Mon Dec 27 07:32:07 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Mar 25 04:16:18 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/optparse.rb (OptionParser#compsys): escape brackets too.
+	  [ruby-dev:42754]
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
-	  which dumps our all known names
+Mon Dec 27 01:30:08 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Mar 25 03:57:47 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/socket/mkconstants.rb: add IF_NAMESIZE.
+	  add a default for INET6_ADDRSTRLEN.
 
-	* lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
-	  allow nested classes to be designated using "."--you must
-	  now use "::"
+Sun Dec 26 23:49:47 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Mar 25 02:00:18 2004  Dave Thomas  <dave@pragprog.com>
+	* win32/Makefile.sub: suppress a strange error message when RMALL
+	  found no such file.
+	* win32/rmall.bat: new.
 
-	* lib/rdoc/generators/template/html/one_page_html.rb (Page):
-	  Fix to work with C modules.
+Sun Dec 26 21:23:23 2010    <kosaki.motohiro@gmail.com>
 
-Wed Mar 24 21:17:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* win32/Makefile.sub: fix 'nmake clean-enc' breakage since r28322.
 
-	* lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
-	* lib/uri/common.rb: Ditto.
-	* lib/uri/ftp.rb: Ditto.
-	* lib/uri/generic.rb: Ditto.
-	* lib/uri/http.rb: Ditto.
-	* lib/uri/https.rb: Ditto.
-	* lib/uri/ldap.rb: Ditto.
-	* lib/uri/mailto.rb: Ditto.
-	  (All backported from 1.9)
+Sun Dec 26 22:25:07 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar 24 18:48:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/ripper/depend (ripper.y): fix messages with nmake.
+	  [ruby-dev:42896]
 
-	* lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
-	  DESTDIR after installed.
+Sun Dec 26 22:24:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (RUBY): / is not recognized as path separator on
-	  nmake/bmake. [ruby-list:39388]
+	* file.c (file_expand_path): get rid of warnings caused by
+	  -Wdeclaration-after-statement on cygwin.
 
-	* lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
+Sun Dec 26 20:28:34 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Mar 24 12:32:56 2004  Dave Thomas  <dave@pragprog.com>
+	* process.c (before_exec): add small comment.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
-	  Don't document methods if we don't know for sure the
-	  class or module.
+Sun Dec 26 20:52:21 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Don't store documentation for singleton classes if we
-	  don't know the real class.
+	* ext/socket/mkconstants.rb: define INET_ADDRSTRLEN as 16 if not
+	  available.  fix compilation error on mswin32-60.  reported by nobu.
 
-Wed Mar 24 11:11:26 2004  Dave Thomas  <dave@pragprog.com>
+Sun Dec 26 19:37:37 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
-	  Allow non-RDoc templates by putting a slash in the template name
+	* ext/socket/option.c: define IFNAMSIZ if not available.
+	  fix compilation error on mingw32.  reported by nobu.
 
-Mon Mar 22 16:19:57 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sun Dec 26 12:16:29 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.1: add -width option to .Bl for old groff.
+	* lib/rdoc/ri/paths.rb (RDoc::RI::Paths::HOMEDIR): no exception if
+	  HOME is not set.  [ruby-core:33867]
 
-Sun Mar 21 21:11:16 2004  Keiju Ishitsuka  <keiju@ishitsuka.com>
+Sun Dec 26 11:39:11 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/shell/*: bug fix for Shell#system(command_line_string).
+	* parse.y (stmt): missing ripper rule.  i.e., `a::B ||= c 1'.
+	  http://twitter.com/#!/wannabe53/status/18797576396472321
+	  http://twitter.com/#!/wannabe53/status/18798416150663168
 
-Sat Mar 20 20:57:10 2004  David Black  <dblack@wobblini.net>
+Sun Dec 26 11:15:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/scanf.rb: Backported 1.9 branch
-	  modifications/corrections to 1.8 branch
+	* test/with_different_ofs.rb (DifferentOFS): should not affect
+	  original classes.
 
-Sat Mar 20 23:51:03 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sun Dec 26 09:35:07 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_require_safe): preserve old ruby_errinfo.
-	  [ruby-talk:95409]
+	* rational.c: parenthesize macro arguments.
 
-	* eval.c (rb_f_raise): should not clear backtrace information if
-	  exception object already have one.
+Sun Dec 26 09:22:19 2010  Tanaka Akira  <akr@fsij.org>
 
-Sat Mar 20 15:25:36 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/socket/option.c (rb_if_indextoname): new function to abstract
+	  environments without if_indextoname.
+	  (inspect_ipv6_multicast_if): new function to inspect
+	  IPV6_MULTICAST_IF.
+	  Socket::Option.new(:INET6, :IPV6, :MULTICAST_IF,
+	  [2].pack("I!")).inspect is
+	  "#<Socket::Option: INET6 IPV6 MULTICAST_IF eth0>".
 
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
-	  page background to white.
+Sun Dec 26 04:31:15 2010  Luis Lavena  <luislavena@gmail.com>
 
-Sat Mar 20 09:52:33 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+	* ext/dl/win32/registry.rb: Corrected RegCreateKeyExA signature.
+	  Patch by Rafal Michalski [ruby-core:33874] [Ruby 1.9-Bug#4203]
 
-	* lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
-	  part of second minute that follows a comma or a full stop.
+Sun Dec 26 02:31:58 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Mar 19 01:55:57 2004  Mauricio Fernandez  <batsman.geo@yahoo.com>
+	* io.c (advice_arg_check): Change argument check.
+	  Now, an unsupported advice makes NotImplementedError.
+	  [ruby-dev:42887] [Ruby 1.9-Feature#4204]
 
-	* io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
+Sun Dec 26 03:00:53 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Mar 18 21:44:38 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/socket/extconf.rb: Fix build error which was introduced r30372.
 
-	* lib/drb/drb.rb: backport drb.rb 1.16.
+Sun Dec 26 01:37:10 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Mar 18 17:49:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/extconf.rb: check the existence of if_indextoname().
 
-	* struct.c (make_struct): allow const_id for accessor names.
-	  [ruby-core:04585]
+	* ext/socket/option.c: yesterday's akr's commits destroyed the build of
+	  some unrelated platforms (such as Windows).
 
-	* eval.c (rb_attr): check if attribute name is local_id or
-	  const_id.
+Sat Dec 25 23:29:11 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Mar 18 16:22:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/option.c (inspect_ipv4_add_drop_membership): new function
+	  to inspect struct ip_mreq and struct ip_mreqn for
+	  IP_ADD_MEMBERSHIP and IP_DROP_MEMBERSHIP.
+	  Socket::Option.new(:INET, :IP, :ADD_MEMBERSHIP,
+	  [239,255,99,81, 0,0,0,0].pack("CCCCCCCC")).inspect is now
+	  "#<Socket::Option: INET IP ADD_MEMBERSHIP 239.255.99.81 0.0.0.0>".
+	  (inspect_ipv4_multicast_if): new function to inspect struct in_addr
+	  and struct ip_mreqn for IP_MULTICAST_IF.
+	  Socket::Option.new(:INET, :IP, :MULTICAST_IF,
+	  [192,168,0,7].pack("CCCC")).inspect is now
+	  "#<Socket::Option: INET IP MULTICAST_IF 192.168.0.7>".
 
-	* eval.c (proc_eq): avoid false positive by using scope and
-	  dyna_vars.  no longer use frame.uniq.
+	* ext/socket/extconf.rb: check struct ip_mreq and struct ip_mreqn.
 
-Wed Mar 17 14:44:43 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Dec 25 22:49:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (range): fix possible "\0" overrun. (in case of "\0-")
+	* test/csv: DifferentOFS needs to be include in each classes.
 
-Mon Mar 15 07:39:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/digest/test_digest_extend.rb (TestDigestExtend#setup):
+	  should not depend on the result of previous tests
 
-	* eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
-	  yield is not break destination. [ruby-dev:23197]
-
-Sat Mar 13 14:28:16 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
-	  trunk)
-
-	* test/drb/test_drbunix.rb: ditto.
-
-Wed Mar 10 22:28:09 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (remove_dir): should handle symlink correctly.
-	  This patch is contributed by Christian Loew.  [ruby-talk:94635]
-	  (Backport from main trunk)
-
-Wed Mar 10 16:28:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (return_jump): set return value to the return
-	  destination.  separated from localjump_destination().
-
-	* eval.c (break_jump): break innermost loop (or thread or proc).
-
-	* eval.c (rb_yield_0): set exit_value for block break.
-
-Wed Mar 10 15:58:43 2004  Ryan Davis  <ryand@zenspider.com>
-
-	* eval.c (eval): Only print backtrace if generating the backtrace
-	  doesn't generate an exception.  [ruby-core:02621]
-
-Tue Mar  9 13:04:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_ungetc): raise IOError instead of calling
-	  rb_sys_fail().  [ruby-talk:23181]
-
-Mon Mar  8 19:32:28 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
-	  -> (?::#{PORT}).  [ruby-dev:23170]
-
-Mon Mar  8 15:31:41 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (range): treat incomplete '[' as ordinary character (like
-	  has_magic does).
-
-	* dir.c (range):  Cancel above change. More discussion is needed.
-
-Sun Mar  7 22:37:46 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
-
-	* test/drb/ut_eval.rb: ditto.
-
-	* test/drb/ut_large.rb: ditto.
-
-	* test/drb/ut_safe1.rb: ditto.
-
-	* test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
-
-Sun Mar  7 16:22:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* Makefile.in (lex.c): use $? instead of $<.
-
-Fri Mar  5 00:54:14 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/test/unit.rb: MOve RDoc documentation so that you can
-	  now say 'ri Test::Unit'
-
-Tue Mar  2 12:32:59 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
-	  defined? NORETURN. [ruby-dev:23100]
-
-Mon Mar  1 12:24:10 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
-	  Allow aliases to have parentheses
-
-Sun Feb 29 23:14:53 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Handle :nodoc: on singleton classes.
-
-Sat Feb 28 10:58:49 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* MANIFEST: add test_erb.rb
-
-	* lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
-	  if both filename and safe_level given. [ruby-dev:23050]
+	* test/with_different_ofs.rb (DifferentOFS::WithDifferentOFS): give
+	  name.
 
-Fri Feb 27 01:00:09 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* test/with_different_ofs.rb (DifferentOFS): test suite for test
+	  suites affected by $,.
 
-	* lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
+	* test/digest/test_digest_extend.rb (TestDigestExtend): should not
+	  assume $, invariant.
 
-Wed Feb 25 21:16:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/csv/test_data_converters.rb, test/csv/test_table.rb: don't
+	  call setup within tests.
 
-	* instruby.rb (with_destdir): should return the given argument if no
-	  DESTDIR is given.
+Sat Dec 25 20:01:40 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* instruby.rb: use path name expansion of cmd.exe.
+	* io.c (pipe_open): Added rb_thread_atfork(). We must reinitialize
+	  GVL at new process creation.
 
-Wed Feb 25 09:35:22 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Dec 25 18:26:55 2010  Tanaka Akira  <akr@fsij.org>
 
-	* error.c (NameError::Message): new class for lazy evaluation of
-	  message to ensure replaced before marshalling. merge from HEAD.
-	  (ruby-bugs-ja:PR#588)
+	* ext/socket/option.c (inspect_ipv6_mreq): new function to inspect
+	  struct ipv6_mreq for IPV6_JOIN_GROUP and IPV6_LEAVE_GROUP.
+	  Socket::Option.new(:INET6, :IPV6, :JOIN_GROUP,
+	  [0xff12,0,0,0,0,0,0,1, 2].pack("nnnnnnnnI!")).inspect is now
+	  "#<Socket::Option: INET6 IPV6 JOIN_GROUP ff12::1 eth0>".
 
-	* eval.c (rb_method_missing): use NameError::Message. merge from
-	  HEAD. (ruby-bugs-ja:PR#588)
+	* ext/socket/extconf.rb: check struct ipv6_mreq.
 
-Tue Feb 24 18:59:37 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Dec 25 18:04:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (glob_helper): '**/' should not match leading period
-	  unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
+	* lib/csv.rb (CSV.foreach): 'rb' mode is defaulted in open.
 
-Tue Feb 24 13:22:21 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/csv.rb (CSV#init_separators): cannonicalize encoding options
+	  as Encoding objects.
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
-	  heuristics on which files to include and exclude. Now only include
-	  non-standard files if they are explicitly named in ARGV.
+Sat Dec 25 18:30:34 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Feb 24 07:23:30 2004  Dave Thomas  <dave@pragprog.com>
+	* thread.c (rb_thread_atfork): Add small comment why we need
+	  reset random seed.
 
-	* lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
-	  choosing a default main page to display (ie. don't select a page
-	  if we don't have documentation for it).
+Sat Dec 25 17:33:55 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
+	* test/csv/base.rb (TestCSV.with_different_ofs): give name to
+	  anonymous classes.
 
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
-	  class variables in code listings
+	* lib/csv.rb (CSV#init_separators): use IO#gets with length
+	  parameter to get rid of wrong convertion.
 
-Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/csv.rb (CSV::foreach, CSV#initialize): directly use encoding
 
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
-	  class variables in code listings
+	* lib/csv.rb, test/csv: should not assume $, invariant.
 
-Tue Feb 24 06:32:27 2004  Dave Thomas  <dave@pragprog.com>
+Sat Dec 25 16:08:06 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
-	  aliases in C files.
+	* signal.c: change rb_atomic_t definition from uchar to uint.
 
-Tue Feb 24 06:16:22 2004  Dave Thomas  <dave@pragprog.com>
+Sat Dec 25 15:04:05 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
-	  parsing files.
+	* test/csv/test_encodings.rb (TestEncodings#setup): fix evil test
+	  suite writing to the source directory.
 
-Tue Feb 24 06:08:47 2004  Dave Thomas  <dave@pragprog.com>
+Sat Dec 25 15:08:08 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
-	  Start collecting text of constant values earlier: was missing
-	  values in output if there was no space after '='
+	* ext/pty/pty.c (chfunc): Added rb_thread_atfork_before_exec().
+	  We must reinitialize GVL at new process creation. Otherwise
+	  we may meet an insane deadlock. [Bug#4121][ruby-dev:42686]
 
-Tue Feb 24 06:08:25 2004  Dave Thomas  <dave@pragprog.com>
+Sat Dec 25 14:27:09 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/generators/html_generator.rb: Escape contant values.
+	* io.c (rb_io_extract_encoding_option): accept Encoding object as
+	  encoding: optional argument.  [ruby-dev:42884]
 
-Tue Feb 24 03:45:06 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Dec 25 13:37:55 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* ext/openssl/ossl_config.c (ossl_config_each): add new method
-	  OpenSSL::Config#each. it iterates with section name, field name
-	  and value.
+	* lib/minitest/*.rb: Imported minitest 2.0.2 r6093.
 
-	* ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
+Sat Dec 25 13:05:59 2010  Tanaka Akira  <akr@fsij.org>
 
-Mon Feb 23 09:16:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* random.c: parenthesize macro arguments.
 
-	* instruby.rb (DOSISH): embedded path in batch files should not be
-	  prefixed by DESTDIR.  [ruby-core:02186]
+Sat Dec 25 12:48:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb 22 09:54:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* load.c (rb_f_require_relative): don't omit return type.
 
-	* re.c: corrected documentation format (again)
+Sat Dec 25 11:06:00 2010  Eric Hodel  <drbrain@segment7.net>
 
-Sun Feb 22 09:43:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* load.c (rb_f_require_relative): Add documentation.
 
-	* re.c: corrected documentation format (rb_reg_initialize_m)
+Sat Dec 25 11:02:52 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Feb 21 22:36:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* ext/zlib/zlib.c (gzreader_gets): support optional length
+	  parameter.
 
-	* ext/zlib/zlib.c: documented, but needs more effort.
+	* ext/zlib/zlib.c (gzfile_read, gzfile_readpartial): length should
+	  be long.
 
-Sat Feb 21 11:12:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Dec 25 10:51:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* missing/os2.c, missing/x68.c: typo fix.  pointed out by greentea.
+	* ext/json/generator/generator.{c,h} (fbuffer_free_only_buffer):
+	  unused.
 
-Fri Feb 20 18:59:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_pkcs5.c (ossl_pkcs5_pbkdf2_hmac): add casts.
 
-	* lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
-	  irb. [ruby-dev:39243]
+Fri Dec 24 08:46:04 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
+	* process.c: parenthesize macro arguments.
 
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
-	  Support visibility modifiers for attributes
+Thu Dec 23 19:17:14 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
+	* test/net/imap/cacert.pem: updated because it has been expired.
 
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
-	  Support visibility modifiers for attributes
+	* test/net/imap/server.crt: signed again because CA cert was expired.
 
-Thu Feb 19 22:39:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Dec 23 11:16:52 2010  Tanaka Akira  <akr@fsij.org>
 
-	* test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
-	  DRb.start_service could handle this.
+	* parse.y: parenthesize macro arguments.
 
-Thu Feb 19 22:19:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Thu Dec 23 11:00:09 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/ostruct.rb: documented
+	* error.c (rb_check_type): check for type from extensions for ruby
+	  1.8.  see [ruby-core:33797].
 
-Thu Feb 19 21:28:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Thu Dec 23 08:12:59 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/strscan/strscan.c: improved documentation
+	* lib/net/smtp.rb: refactoring Net::SMTP#esmtp= to use an
+	  attr_accessor
 
-Thu Feb 19 03:10:52 2004  Minero Aoki  <aamine@loveruby.net>
+Thu Dec 23 06:35:41 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
+	* lib/net/smtp.rb: Net::SMTP should close the SSL connection if the
+	  connection verification fails.
 
-Thu Feb 19 02:30:34 2004  Minero Aoki  <aamine@loveruby.net>
+Thu Dec 23 01:47:58 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/strscan/strscan.c: documentation checked.
+	* NEWS: remove #object_id. [ruby-dev:42840]
 
-Thu Feb 19 00:11:05 2004  Dave Thomas  <dave@pragprog.com>
+Wed Dec 22 08:56:39 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
-	  Strip extraneous space from filenames in :include:
+	* NEWS: add Module#private_constant and Module#public_constant.
+	  [ruby-dev:39685][ruby-core:32698]
 
-Wed Feb 18 22:52:00 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Wed Dec 22 07:59:23 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
+	* NEWS: add IO#advise. [ruby-core:33110] [Ruby 1.9-Feature#4038]
 
-Wed Feb 18 22:47:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Tue Dec 21 23:45:31 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/strscan/strscan.c: documented
+	* gc.c (Init_GC): move back object_id to Kernel. [ruby-dev:42840]
 
-Wed Feb 18 22:03:11 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Tue Dec 21 12:45:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/*: should not depend on $KCODE.
+	* configure.in (target_archs): remove temporary objects.
 
-Wed Feb 18 17:18:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* enc/Makefile.in, enc/depend (clean): remove work directories.
 
-	* ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
+Tue Dec 21 07:39:12 2010  Tanaka Akira  <akr@fsij.org>
 
-Wed Feb 18 10:40:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* pack.c: parenthesize macro arguments.
 
-	* sprintf.c (rb_f_sprintf): do not prepend dots for negative
-	  numbers if FZERO is specified.  [ruby-list:39218]
+Tue Dec 21 06:25:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Feb 17 23:40:34 2004  Guy Decoux  <ts@moulon.inra.fr>
+	* test/rexml/test_contrib.rb (ContribTester#test_pos): should not
+	  use fixed path name for tests.  [ruby-dev:42827]
 
-	* sprintf.c (rb_f_sprintf): preserve original val for
-	  format_integer. [ruby-talk:92975]
+	* test/rexml/test_sax.rb (SAX2Tester#test_socket): should not use
+	  fixed port for tests.  [ruby-dev:42828]
 
-Tue Feb 17 23:28:45 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Tue Dec 21 06:10:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/marshaltestlib.rb: common marshal testcase added.
+	* compile.c (setup_args), vm.c (invoke_block_from_c),
+	  vm_insnhelper.c (caller_setup_args): reverted r30241 and r30243
+	  except for the test.
 
-	* test/ruby/test_marshal.rb: use above testsuite.
+Tue Dec 21 01:41:42 2010  Masaya Tarui  <tarui@ruby-lnag.org>
 
-	* test/soap/marshal/test_marshal.rb: ditto.
+	* io.c : add an extra byte to buffer for the specification of read
+	  in Windows. see [ruby-core:33460] and r29980. and, we have to
+	  discuss how to do this one byte.
 
-	* test/soap/marshal/cmarshal.rb: removed (not used).
+Tue Dec 21 01:18:06 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Feb 17 10:51:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* error.c: Fix build error for win32. This regression was
+	  introduced by r30271.
 
-	* ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
+Tue Dec 21 00:59:40 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Feb 17 01:35:28 2004  Tanaka Akira  <akr@m17n.org>
+	* thread.c (thread_cleanup_func): Moved interrupted_lock
+	  destroying code from native_thread_destroy() to
+	  thread_cleanup_func() because it's platform independent logic.
 
-	* eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
-	  to NODE_LIT.  [ruby-dev:22920]
+	* thread_win32.c (native_thread_destroy): ditto.
+	* thread_pthread.c (native_thread_destroy): ditto.
 
-Tue Feb 17 01:24:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec 21 00:46:20 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
-	  STACK_GROW_DIRECTION. [ruby-dev:22910]
+	* thread.c (thread_cleanup_func): Don't touch native threading
+	  resource at fork. Sadly this is purely bandaid. We need to
+	  implement proper fix later. [Bug #4169] [ruby-core:33767]
 
-	* bcc32/Makefile.sub (config.h): add newer checks.
+Tue Dec 21 00:22:44 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
+	* error.c (exit_success_p): Check status code more carefully.
+	  status code may have garbage in upper bit.
 
-Tue Feb 17 00:38:10 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Mon Dec 20 23:12:37 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
+	* node.c: parenthesize macro arguments.
 
-Tue Feb 17 00:18:03 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Mon Dec 20 20:04:41 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* test/rinda/test_rinda.rb: import test_rinda.rb
+	* NEWS: add #__id__ and #object_id. [ruby-dev:42778]
 
-Tue Feb 17 00:14:30 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Mon Dec 20 20:03:21 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* bcc32/Makefile.sub: avoid warning "Redefinition of macro
-	  'HAVE_GETLOGIN'".
+	* thread_pthread.c (native_thread_destroy): Fixed gvl_cond leak.
 
-	* vms/config.h_in: ditto.
+Mon Dec 20 13:49:05 2010  Eric Hodel  <drbrain@segment7.net>
 
-Mon Feb 16 23:28:14 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* NEWS: Add item for RDoc 3.0.1
 
-	* lib/csv.rb: document reduction.  [ruby-core:02429]
+	* lib/rdoc: Import RDoc 3.0.1, remove require for perl parser.
 
-Mon Feb 16 22:08:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Mon Dec 20 12:15:32 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/generator.rb: corrected doc format
-	* lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
-	* lib/rinda/tuplespace.rb: ditto
+	* lib/rdoc: Import RDoc 3.0.
 
-Mon Feb 16 20:41:32 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Mon Dec 20 01:55:03 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* bcc32/Makefile.sub: show more warnings. (refering to mingw)
+	* io.c (Init_IO): Added O_DIRECT. This feature was proposed by
+	  Run Paint Run Run.
+	  [Feature #4015] [ruby-core:33018]
 
-	* bcc32/setup.mak: ditto.
+Sun Dec 19 19:15:23 2010  Tanaka Akira  <akr@fsij.org>
 
-Mon Feb 16 13:39:44 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* marshal.c: parenthesize macro arguments.
 
-	* dir.c (rb_glob, rb_globi): add const.
+Sat Dec 18 21:52:37 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ruby.h: ditto.
+	* vsnprintf.c (BSD_vfprintf): suppress warning: "_WIN32" is not
+	  defined.
 
-Mon Feb 16 02:16:33 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Dec 18 16:02:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bcc32/Makefile.sub: should warn suspicious pointer conversion.
+	* compile.c (setup_args), vm.c (invoke_block_from_c),
+	  vm_insnhelper.c (caller_setup_args): fix of r30241. lambda block
+	  should check argument number.
 
-	* bcc32/setup.mak: ditto.
+Sat Dec 18 14:42:29 2010  Tanaka Akira  <akr@fsij.org>
 
-Sun Feb 15 19:06:42 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* load.c: parenthesize macro arguments.
 
-	* lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
-	  RequestExpiredError if not found.
+Sat Dec 18 10:07:04 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb 15 15:56:46 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* compile.c (setup_args, iseq_compile_each): optimize AMPER LAMBDA
+	  combination as block.
 
-	* ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
-	  Thanks, arton.
+Fri Dec 17 22:07:16 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Feb 15 01:46:05 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* gc.c (Init_GC): move #__id__ and #object_id to BasicObject.
+	  [ruby-dev:42778]
 
-	* lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
-	  [ruby-dev:22870]
+Fri Dec 17 19:35:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Feb 14 11:29:41 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* test/mkmf/base.rb (TestMkmf::FakeLog): capture output from mkmf.
 
-	* sample/drb/*: import lib/drb/sample
+	* test/mkmf/test_find_executable.rb (test_find_executable):
+	  suppress meaningless differences for chkbuild.
 
-Sat Feb 14 11:08:23 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Fri Dec 17 13:26:54 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/drb/drb.rb: add pretty_print, thanks gotoken.
+	* win32/setup.mak (BASERUBY): quit with an error when BASERUBY was not
+	  able to set, just like configure.in does. [ruby-dev:42782]
 
-Fri Feb 13 12:35:08 2004  Minero Aoki  <aamine@loveruby.net>
+Fri Dec 17 07:04:09 2010  Tanaka Akira  <akr@fsij.org>
 
-	* test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
-	  EACCES on Windows.
+	* iseq.c: parenthesize macro arguments.
 
-Thu Feb 12 21:45:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Fri Dec 17 04:18:37 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/ftools.rb: documented
+	* transcode.c (str_encode): Alter comment for better wording and ri
+	  output.
 
-Thu Feb 12 21:25:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Fri Dec 17 00:05:40 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/base64.rb: backported from HEAD (modularised and documented)
+	* io.c (rb_io_advise): New API. IO#advise() allows to tell the
+	  ruby runtime how it expects to use a file handle. This feature
+	  can be improved a performance some situations.
+	  Note: This feature is mainly developed by Run Paint Run Run.
+	  Thank you! [ruby-core:33110] [Ruby 1.9-Feature#4038]
 
-Thu Feb 12 20:31:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (do_io_advise): Helper function.
+	* io.c (io_advise_sym_to_const): ditto.
 
-	* lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
-	  directives in DOS line-ending files at all.
+Thu Dec 16 23:29:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Feb 12 02:23:56 2004  Tanaka Akira  <akr@m17n.org>
+	* tool/rbinstall.rb (bin-comm): use transformed name.
+	  [ruby-dev:42777]
 
-	* lib/pathname.rb: use assert_raise instead of assert_raises.
+Thu Dec 16 21:52:07 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/pp.rb: ditto.
+	* io.c: parenthesize macro arguments.
 
-	* lib/time.rb: ditto.
+Thu Dec 16 21:46:39 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/tsort.rb: ditto.
-	  use TSortHash and TSortArray instead of Hash and Array in test.
+	* tool/mkconfig.rb (RbConfig): honor ARCHFLAGS and RC_ARCHS to
+	  override embedded ARCH_FLAG value on universal-darwin.
 
-Wed Feb 11 20:01:12 2004  akira yamada  <akira@ruby-lang.org>
+Thu Dec 16 19:50:12 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
-	  File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
+	* win32/{configure.bat,setup.mak,Makefile.sub} (PROGRAM_PREFIX,
+	  PROGRAM_SUFFIX): unite the differences of the names of macros of
+	  prefix and suffix.
+	  reported by HANEDA Norikatsu. [ruby-dev:42775]
 
-	* test/ruby/test_proc.rb (TestProc::test_eq): added a
-	  test.  [ruby-dev:22599]
+Thu Dec 16 08:04:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_proc.rb (TestProc::test_eq): added tests for
-	   Proc#==.  [ruby-dev:22592], [ruby-dev:22601]
+	* node.h (RNode): match the type of flags to RBasic, and renamed
+	  nd_file as nd_reserved.
 
-Tue Feb 10 16:43:56 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* iseq.c (set_relation), vm_insnhelper.c (vm_cref_push): nd_file
+	  is always zero-cleared.
 
-	* eval.c (umethod_bind): purge unused check.  [ruby-dev:22850]
+Thu Dec 16 07:22:30 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Mon Feb  9 17:16:00 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/minitest/unit.rb: Imported minitest 2.0.1 r6079.
 
-	* lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
+Wed Dec 15 20:45:02 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Feb  9 13:00:55 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/test/unit.rb (process_args): need to setup @help to print options.
 
-	* dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
-	  [ruby-dev:22815]
+Wed Dec 15 11:19:33 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
-	  [ruby-dev:22819]
+	* test/zlib/test_zlib.rb (test_to_io): forgotten to fix with r30201.
 
-Sun Feb  8 16:46:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 15 11:07:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
-	  sign for higher heap areas.
+	* io.c (simple_sendfile): enable on Mac OS X.
 
-Fri Feb  6 22:48:16 2004  Dave Thomas  <dave@pragprog.com>
+	* io.c (nogvl_copy_stream_sendfile): moved precheck of copy length.
 
-	* lib/rdoc/generators/html_generator.rb (gen_url): Support
-	  https in RDoc hyperlinks
+	* io.c (nogvl_copy_stream_sendfile): should wait for both of
+	  read/write fds.
 
-Fri Feb  6 22:41:22 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Dec 15 07:11:55 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
-	  commit.  [ruby-dev:22813]
+	* hash.c: parenthesize macro arguments.
 
-Fri Feb  6 22:22:50 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Dec 15 04:02:00 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
-	  variable which is defined in the test.
+	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
+	  fix compile error when !HAVE_X509V3_SET_NCONF. Thanks
+	  Chikanaga-san. [ruby-dev:42761] [Ruby 1.9-Bug#4158]
 
-Fri Feb  6 00:48:37 2004  Tanaka Akira  <akr@m17n.org>
+Wed Dec 15 03:41:31 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
+	* test/ripper/test_parser_events.rb (TestRipper#test_block_variables):
+	  Limit address space 100MB instead 100KB. Quite frankly, This
+	  margin is too narrow to contain ruby. [ruby-dev:42763] [Bug#4159]
 
-Thu Feb  5 23:56:55 2004  Tanaka Akira  <akr@m17n.org>
+Tue Dec 14 23:53:52 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/prettyprint.rb (PrettyPrint#seplist): added.
+	* io.c (simple_sendfile): improve linux compatibility on FreeBSD,
+	  and now it works. But without cpuset -l 0, it still gets stuck.
 
-	* lib/pp.rb (PPMethods#pp_object): use seplist.
-	  (PPMethods#pp_hash): ditto.
-	  (Array#pretty_print): ditto.
-	  (Struct#pretty_print): ditto.
-	  (MatchData#pretty_print): ditto.
+Tue Dec 14 20:31:33 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/set.rb (Set#pretty_print): use seplist.
+	* gc.c: parenthesize macro arguments.
 
-Wed Feb  4 02:12:06 2004  Tanaka Akira  <akr@m17n.org>
+Tue Dec 14 18:31:48 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* file.c (test_l): fix wrong method name in document.
-	  (test_S): ditto.
-	  (test_b): ditto.
-	  (test_c): ditto.
-	  (test_suid): ditto.
-	  (test_sgid): ditto.
-	  (test_sticky): ditto.
+	* lib/test/unit.rb: help messages.
 
-Tue Feb  3 08:04:57 2004  Tanaka Akira  <akr@m17n.org>
+Tue Dec 14 18:19:03 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
+	* common.mk (help): there is no reason to use the abbreviation for here.
 
-Mon Feb  2 19:33:49 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue Dec 14 15:03:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* configure.in: backport from 1.9 for Interix.
+	* test/ruby/test_io.rb (test_reopen, test_reinitialize): should close
+	  the temporary files.
 
-	* dln.c (dln_load): ditto.
+Tue Dec 14 14:24:15 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Feb  2 13:31:51 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_io.rb (make_tempfile): change the prefix from 'foo'
+	  to 'test_io' because the old one is meaningless and inconvenient.
 
-	* lib/net/http.rb (canonical_each): fix merge miss.
+	* test/ruby/test_io.rb (test_binmode_after_closed): the temporary file
+	  maked by make_temfile is already closed.
 
-Mon Feb  2 01:54:00 2004  Tanaka Akira  <akr@m17n.org>
+Tue Dec 14 13:52:19 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/pp.rb (Struct#pretty_print): make it 1.8 style.
-	  (Numeric#pretty_print, FalseClass#pretty_print)
-	  (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
-	  with instance variables.  [ruby-talk:91157]
+	* test/ruby/test_io.rb (test_flush_in_finalizer[12]): should close
+	  temporary file because it's only used for taking pathname and
+	  unlinking the file after the end of the test (in GC phase).
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
-	  address.
+Tue Dec 14 13:34:33 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/resolv-replace.rb (BasicSocket#send): don't replace because
-	  it has no hostname argument.
-	  (IPSocket.getaddress): raise SocketError instead of
-	  Resolv::ResolvError for errors.
-	  (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
-	  (SOCKSSocket#initialize): use IPSocket.getaddress instead of
-	  Resolv.getaddress.
-	  (UDPSocket#send): recognize 3 arguments form.  try all addresses on
-	  4 arguments form.
+	* ext/zlib/zlib.c (gzfile_s_open): should close the IO if some error
+	  occurs in initializing.
 
-Sun Feb  1 18:17:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Tue Dec 14 13:04:16 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/net/http.rb: merged coding style changes from HEAD.
+	* lib/net/http.rb (Net::HTTPRequest#send_request_body_data):
+	  set binmode to tempfile.
 
-Sun Feb  1 16:15:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Tue Dec 14 12:55:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit.rb: rearranged documentation for RDoc's sake.
-	* lib/matrix.rb: improved documentation.
-	* lib/net/http.rb: slight documentation formatting improvement.
+	* test/zlib/test_zlib.rb (*): should close files associated with zlib.
 
-Sun Feb  1 05:30:06 2004  Tanaka Akira  <akr@m17n.org>
+Tue Dec 14 11:30:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
-	 raise an errror on non-http proxy URI.
-	 (OpenURI::Buffer#<<): make a tempfile binmode.  [ruby-talk:90793]
+	* test/ruby/test_argf.rb (test_inplace_rename_impossible): unlink
+	  the renamed temporary file on no_safe_rename platforms.
 
-Sat Jan 31 09:20:32 2004  NAKAMURA, Hiroshi  <nakahiro@sairon.co.jp>
+	* test/ruby/test_argf.rb (test_readlines_limit_0,
+	  test_each_line_limit_0): should close argf because the associated
+	  Tempfile object cannot unlink the temporary file when it's gc'ed
+	  on some platforms (Windows, etc.)
 
-	* sample/openssl/gen_csr.rb: wrong usage string.
+Tue Dec 14 11:27:07 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Jan 31 01:00:32 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/minitest/unit.rb (Minitest::Unit#_run_suite): split test
+	  name and its time. Thiw allows to know test's name when you are
+	  running tests and meet a test which spends long time at realtime.
 
-	* lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
-	  "parts" attribute of soap:body element in WSDL.
+Tue Dec 14 11:25:20 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/wsdl/xmlSchema/schema.rb: friendly warning message for
-	  simpleType element which is not supported for now.
+	* configure.in: Add -Werror=declaration-after-statement to default
+	  warning flag. If you are using GCC, this flag is useful to
+	  prevent breaking VC build.
 
-	* lib/soap/mapping/factory.rb: deleted unused methods.
+Tue Dec 14 10:25:57 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
-	  string <-> Ruby class name matching.
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): how many gcc-c99isms
+	  must a man mend; before he can build with VC? r30178
 
-	* test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
-	  files.
+Mon Dec 13 21:26:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Jan 29 23:56:00 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* io.c (simple_sendfile): disable the use of sendfile(2) on
+	  FreeBSD. It blocks on TestIO#test_copy_stream_socket.
 
-	* util.c (mblen): fix overrun.  [ruby-dev:22672]
+Mon Dec 13 18:35:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Jan 29 22:41:53 2004  Dave Thomas  <dave@pragprog.com>
+	* io.c: define USE_SENDFILE on FreeBSD or DragonFly BSD.
+	  Remove Mac OS X because its argument is different from them.
 
-	* lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
-	  THis means you can write "see f1[link:files/f1_rb.html]".
+Mon Dec 13 12:00:09 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Jan 29 15:33:23 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* file.c: parenthesize macro arguments.
 
-	* ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
-	  second argument. it expected to be a Hash not an Integer.
+Mon Dec 13 11:21:14 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
-	  function for OpenSSL::X509::Name#add_entry.
+	* io.c (simple_sendfile): added for BSD version of sendfile(2).
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
-	  tag number to each element of return value.
+Mon Dec 13 09:50:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
-	  OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
+	* lib/net/http.rb (Net::HTTPRequest#set_form): Added to support
+	  both application/x-www-form-urlencoded and multipart/form-data.
+	  There is a similar API, Net::HTTPRequest#set_form_data, but
+	  to keep its compatibility this is newly added. [ruby-dev:42729]
 
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
-	  second argument takes OBJECT_TYPE_TEMPLATE by default.
+Sun Dec 12 23:45:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
+	* compile.c (iseq_compile_each): fix for __goto__ and __label__
+	  where were totally broken.
 
-Wed Jan 28 04:29:41 2004  Eric Schwartz  <emschwar@fc.hp.com>
+Sun Dec 12 22:45:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi/session.rb: use LOCK_SH to read, and a few other
-	  improvements.  [ruby-core:02328]
+	* common.mk (ID_H_INCLUDES): now id.h depends on vm_opts.h.
 
-Tue Jan 27 11:09:29 2004  FUKUMOTO Atsushi  <fukumoto@nospam.imasy.or.jp>
+Sun Dec 12 20:42:47 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/socket/socket.c (s_recvfrom): sending length should be an
-	  invariant while retrying on EAGAIN.  [ruby-talk:89962]
+	* template/id.h.tmpl: suppress all warning: "SUPPORT_JOKE" is not
+	  defined.  [ruby-dev:42730]
 
-Tue Jan 27 10:35:18 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Dec 12 20:35:07 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/win32ole/win32ole.c (set_argv): fix condition.
+	* misc/rb_optparse.zsh: update how to install.
 
-Tue Jan 27 02:26:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* misc/rb_optparse.zsh: avoid error when setopt noclobber.
 
-	* lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
-	  refine regex for header-name.
+	* lib/optparse.rb: fix typo. pointed out at
+	  <http://d.hatena.ne.jp/nagachika/20101207>.
 
-Tue Jan 27 00:30:11 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Dec 12 13:27:35 2010  Tanaka Akira  <akr@fsij.org>
 
-	* win32/Makefile.sub: rollback.
+	* eval_error.c: parenthesize macro arguments.
 
-Mon Jan 26 22:53:04 2004  Dave Thomas  <dave@pragprog.com>
+Sun Dec 12 11:53:24 2010  Tanaka Akira  <akr@fsij.org>
 
-	* io.c: Remove documentation references to $defout.
+	* error.c: parenthesize macro arguments.
 
-Mon Jan 26 15:11:47 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Dec 12 04:01:58 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* sample/exyacc.rb: escape '}' to avoid warning.
+	* string.c (rb_str_inspect): fix: extra back slash is added when
+	  the string is dummy encoding and includes \x22 or \x5C.
 
-Mon Jan 26 14:41:46 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Dec 12 02:42:24 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/delegate.rb (Delegator::initialize): preserve
-	  singleton_method_added method [ruby-dev:22685]
+	* ext/openssl/ossl_asn1.c: indefinite length BER to DER encoding is
+	  properly supported.  Thanks Martin Bosslet! [ruby-core:33082]
 
-	* lib/delegate.rb (Delegator::initialize): use Kernel::raise
-	  instead of mere raise.  [ruby-dev:22681]
+Sat Dec 11 17:43:34 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Mon Jan 26 12:47:17 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/bigdecimal/bigdecimal.h: suppress "warning: 'VPrint' declared
+	  'static' but never defined".
 
-	* ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
+Sat Dec 11 09:24:57 2010  Tanaka Akira  <akr@fsij.org>
 
-Mon Jan 26 11:35:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* encoding.c: parenthesize macro arguments.
 
-	* ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
-	  (ruby-bugs:PR#1256)
+Sat Dec 11 08:12:48 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/win32ole/win32ole.c (set_argv): set real arguments to
-	  WIN32OLE::ARGV.  [ruby-list:39073]
+	* ext/openssl/ossl.c, ext/openssl/ossl_pkey_rsa.c: Document RSA, RSA
+	  encryption/decryption and PKCS #5 encryption/decryption.
 
-Thu Jan 22 22:54:53 2004  Shugo Maeda  <shugo@ruby-lang.org>
+Sat Dec 11 06:23:41 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
-	  strings for Novell GroupWise Internet Agent.
-	* lib/net/imap.rb (DATA_REGEXP): ditto.
+	* ext/openssl/ossl_x509name.c: include Comparable to provide #==.
+	  Document OpenSSL::X509::Name#<=>.  [Ruby 1.9-Feature#4116]
 
-Thu Jan 22 16:21:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Dec 11 05:48:28 2010  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* parse.y (string_content): reset lexical states at the beginning of
-	  string contents.  [ruby-list:39061]
+	* ext/tk/lib/multi-tk.rb: infinite loop on method_missing at loading.
+	  [ruby-dev:42716] [Ruby 1.9-Bug#4129]
 
-Wed Jan 21 21:55:51 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/tk/lib/multi-tk.rb: when no eventloop is running, ruby freezes at
+	  exit.
 
-	* lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
-	* lib/drb/extserv.rb: typo
+Sat Dec 11 02:23:15 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Wed Jan 21 17:57:56 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/openssl/extconf.rb: try pkgconfig first, then fall back to
+	  normal have_library, etc.  Thanks Erik Hollensbe. [ruby-core:32406]
 
-	* lib/net/imap.rb (envelope): allow NIL.
-	* lib/net/imap.rb (body): ditto.
-	* lib/net/imap.rb (number): ditto.
-	* lib/net/imap.rb (ensure_nz_number): show a detailed error
-	  message.
+Fri Dec 10 22:33:39 2010  Tanaka Akira  <akr@fsij.org>
 
-Wed Jan 21 16:44:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dln_find.c: parenthesize macro arguments.
 
-	* lib/mkmf.rb (merge_libs): squeeze successive same libraries.
-	  [ruby-dev:22652]
+Fri Dec 10 20:05:42 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jan 21 16:01:37 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* template/id.h.tmpl (ruby_method_ids): suppress warnings.
+	  [ruby-dev:42730]
 
-	* ext/digest/rmd160/extconf.rb: have_library appends found library.
+Fri Dec 10 18:29:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jan 21 11:36:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ruby.c (ruby_init_loadpath_safe): relatively called non-shared
+	  binary cannot be found in PATH, so use given pathname.
 
-	* parse.y (block_append): update nd_end for "real" head node.
-	  [ruby-list:39058]
+Fri Dec 10 18:28:40 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jan 20 14:48:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* cygwin/GNUmakefile.in (SCRIPTPROGRAMS): ignore backup files and etc.
 
-	* ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
-	  of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
+	* cygwin/GNUmakefile.in (scriptbin): set executable bit.
 
-Tue Jan 20 14:43:17 2004  Dave Thomas  <dave@pragprog.com>
+	* tool/rbinstall.rb (install_recursive): always skip default ignored
+	  files.  if block is given, call it instead of calling install.
 
-	* lib/base64.rb: Add RDoc
+	* tool/rbinstall.rb (bin-comm): use install_recursive.
 
-Tue Jan 20 14:25:51 2004  Dave Thomas  <dave@pragprog.com>
+Fri Dec 10 18:12:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/abbrev.rb: Add RDoc
+	* test/mkmf/base.rb (TestMkmf#config_value): extract macro value from
+	  config.h.
 
-Tue Jan 20 13:22:39 2004  Dave Thomas  <dave@pragprog.com>
+	* test/mkmf/test_sizeof.rb (TestMkmf::TestSizeof#test_sizeof_builtin),
+	  (TestMkmf::TestSizeof#test_sizeof_struct): more tests.
 
-	* lib/rdoc/generators/html_generator.rb: Document aliases at
-	  top-most level.
+	* lib/mkmf.rb (check_signedness): should use the prelude code.
+	  [ruby-dev:42731]
 
-	* lib/English.rb: Document English.rb.
+	* lib/mkmf.rb (Logging.log_close): separate from Logging.logfile.
 
-Tue Jan 20 02:49:22 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/mkmf/base.rb (TestMkmf::MKMFLOG): show mkmf.log at failures.
 
-	* ext/openssl/extconf.rb: add check for OpenSSL version.
-	  [ruby-list:39054]
+	* test/mkmf/base.rb (TestMkmf#teardown): close log file for each tests.
 
-Tue Jan 20 02:38:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 10 11:36:43 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* marshal.c (w_class): should not dump singleton class.
-	  [ruby-dev:22631]
+	* compile.c (enum): remove a comma at end of enumerator list.
 
-Tue Jan 20 01:31:36 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* constant.h (rb_const_flag_t): ditto.
 
-	* io.c (lineno): typo fix(FIX2INT -> INT2FIX).
+	* iseq.h (enum catch_type): ditto.
 
-Mon Jan 19 21:53:38 2004  akira yamada  <akira@ruby-lang.org>
+	* iseq.h (enum defined_type): ditto.
 
-	* io.c, re.c, string.c, time.c: fixed up positions of RDocs.
+	* vm_core.h (enum iseq_type): ditto.
 
-Mon Jan 19 07:09:20 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+	* vm_core.h (enum vm_special_object_type): ditto.
 
-	* lib/date.rb: zone was wrong when it was behind UTC.
-	  Thanks Mark J. Reed.
+Fri Dec 10 10:47:53 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/date/format.rb: %z is now always replaced by four digits
-	  with a leading plus or minus sign.
+	* sprintf.c (_HAVE_SANE_QUAD_): Don't forget LP64, r30156.
 
-	* sample/cal.rb: added a class, anyway.
+Fri Dec 10 10:37:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jan 18 20:47:35 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* sprintf.c (_HAVE_SANE_QUAD_): if a certain platform has LONG_LONG in
+	  8 byte, it might be sane quad. [ruby-core:33634]
 
-	* ruby.c: use translate_char() on Cygwin.
+Fri Dec 10 10:07:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Jan 18 02:33:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/net/http.rb: remove version 1.1 features.
 
-	* defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
+Fri Dec 10 02:18:02 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Sun Jan 18 00:23:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_cleanup): removing C
+	  implementation of `cleanup`.
 
-	* marshal.c (class2path): check anonymous class/module before
-	  checking referable, and allow singleton classes.
+	* ext/openssl/lib/openssl/x509.rb: adding ruby implementation of
+	  `cleanup`.  OpenSSL::X509::StoreContext#cleanup is deprecated since
+	  reusing the underlying struct doesn't make sense. [ruby-dev:42546]
 
-Fri Jan 16 14:33:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  9 20:14:39 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (class2path): get class path and check referable.
-	  [ruby-dev:22588]
+	* parse.y (lvar_defined_gen, shadowing_lvar_gen, dvar_defined): no
+	  warnings for unused method and block arguments.
+	  [ruby-dev:42718] [ruby-dev:42724]
 
-Fri Jan 16 09:52:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Dec  9 19:25:49 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (proc_eq): Proc with empty body may not be equal.
-	  [ruby-dev:22590]
+	* dln.c: parenthesize macro arguments.
 
-Thu Jan 15 13:03:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  9 18:51:06 2010  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (argf_read): do not append EOF.  (ruby-bugs-ja:PR#585)
+	* lib/webrick/accesslog.rb (WEBrick::AccessLog#format): support
+	  %{remote}p for logging remote (client) port number.
+	  [ruby-dev:42670]
 
-	* io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
-	  weird behavior.  [ruby-dev:22424]
+Thu Dec  9 11:00:30 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jan 14 13:31:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_dup): should copy contents only.  no instance
+	  variable, no class would be copied.  it would affect methods
+	  #sort, #reject, #transpose, #uniq, #compact, and #shuffle.
+	  [ruby-core:33640]
 
-	* ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
+	* array.c (rb_ary_reverse_m): ditto.
 
-Tue Jan 13 18:54:28 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* array.c (rb_ary_rotate_m): ditto.
 
-	* lib/logger.rb(Logger#msg2str): no special treatment for the object
-	  which responds to :to_str.  commited at 2004-01-11T21:46:27 by
-	  gsinclair.
+Wed Dec  8 21:38:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/logger.rb(LogDevice#initialize): remove type checking if the
-	  given object is a String.  Kernel.open handles it correctly.
-	  commited at 2004-01-11T21:46:27 by gsinclair.
+	* ext/dl/lib/dl/struct.rb: clean a warning: assigned but unused
+	  variable. patched by Kouhei Yanagita. [ruby-dev:42722]
 
-	* test/logger/test_logger.rb: follow above change (ArgumentError ->
-	  TypeError.)  follow above commit.
+	* ext/dl/lib/dl/import.rb: ditto.
 
-Tue Jan 13 14:27:13 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Wed Dec  8 21:36:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
-	  moved run method which allows output level.  [ruby-dev:22554]
+	* parse.y (shadowing_lvar_gen): fix line number.  [ruby-dev:42718]
 
-Tue Jan 13 04:29:52 2004  Dave Thomas  <dave@pragprog.com>
+Wed Dec  8 20:37:11 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
-	  Show fully-qualified class names in class list.
+	* dir.c: parenthesize macro arguments.
 
-Tue Jan 13 01:04:37 2004  Dave Thomas  <dave@pragprog.com>
+Tue Dec  7 22:37:15 2010  Masaya Tarui  <tarui@ruby-lnag.org>
 
-	* lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
-	  incorporating DESTDIR in the rdoc installation.
+	* io.c (io_read): duplicate string if shared. [ruby-dev:42719]
 
-Mon Jan 12 23:27:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec  7 22:31:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (primary): fix position after FCALL.  [ruby-dev:22574]
+	* lib/optparse.rb (OptionParser::Officious): separate completion
+	  options from --help.  [ruby-dev:42690]
 
-Mon Jan 12 12:07:22 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/optparse.rb (OptionParser::Completion#candidate),
+	  (OptionParser::Switch#compsys): remove unused variables.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
-	  Someone changed the "// in eval.c" comments to "/*...*/" style,
-	  so the parsing of the source file name broke.
+Tue Dec  7 22:05:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c: Remove spurious space in TrueClass documentation.
+	* transcode.c (transcode_loop): call default handler of the given
+	  hash, method, proc or [] method as fallback.  [ruby-dev:42692]
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
-	  bad regexp: if the code before a documented method contained
-	  a comment that wasn't terminated by whitespace, that comment
-	  and all intervening code was included in the following
-	  method's documentation.
+Tue Dec  7 21:59:37 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
-	  HTML formats need explicit line breaks.
+	* lib/rexml/light/node.rb: remove circular require.
 
-Mon Jan 12 11:46:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec  7 21:56:01 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
-	  quotes.  [ruby-dev:22564]
+	* test/rexml/test_light.rb: really suppress a warning.
 
-	* lib/mkmf.rb (libpathflag): do not enclose with quotes always.
+Tue Dec  7 21:51:57 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
+	* test/rexml/test_light.rb: suppress a warning.
 
-Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
+Tue Dec  7 21:14:03 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
-	  generation support to ri (Elliot Hughes)
+	* debug.c: parenthesize macro arguments.
 
-Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
+Tue Dec  7 21:06:38 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
-	  generation support to ri (Elliot Hughes)
+	* lib/rexml/doctype.rb, test/rexml/test_doctype.rb: suppress warnings.
+	  [ruby-core:33305]
+	  Reported by Aaron Patterson. Thanks!!!
 
-Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
+Tue Dec  7 18:56:52 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
-	  Also accept command line options via the 'RI' environment variable.
+	* ext/nkf/lib/kconv.rb (String#kconv): fix typo and update rdoc.
+	  patched by Kouhei Yanagita [ruby-dev:42696]
 
-Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
+Tue Dec  7 20:32:11 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
-	  Also accept command line options via the 'RI' environment variable.
+	* test/rexml/test_doctype.rb: add Accessor to test case name.
 
-Sat Jan 10 21:27:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Dec  7 20:31:02 2010  Kouhei Sutou  <kou@clear-code.com>
 
-	* eval.c (eval): need to add message delimiter. [ruby-dev:22561]
+	* test/rexml/test_doctype.rb: Doctype -> DocType.
 
-Sat Jan 10 01:54:50 2004  Eric Sunshine  <sunshine@sunshineco.com>
+Tue Dec  7 20:29:23 2010  Kouhei Sutou  <kou@clear-code.com>
 
-	* defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
-	  S_IRWXO, etc. macros are defined since future code might require
-	  them (even though present code only requires a subset).
+	* test/rexml/test_doctype_mixin.rb: rename to ...
+	* test/rexml/test_doctype.rb: ... this to remove needless name.
 
-	* defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
-	  correctly on Rhapsody when -arch compiler flag was used (via
-	  configure's --enable-fat-binary option).
+Tue Dec  7 17:03:16 2010  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Jan  9 10:05:14 2004  Siena.  <siena@faculty.chiba-u.jp>
+	* lib/net/imap.rb (xlist): supported the XLIST command, which is an
+	  extension by Apple and Google.  patch by Geoff Youngs.
+	  [ruby-core:33521]
 
-	* lib/mkmf.rb (libpathflag): use single quotes.  [ruby-dev:22440]
+Tue Dec  7 08:00:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan  8 23:49:21 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* configure.in, win32/Makefile.sub (WERRORFLAG): flag to treat
+	  warnings as errors.
 
-	* configure.in (RDOCTARGET): new macro.  if you want to install
-	  rdoc documentation, you need to run configure with
-	  --enable-install-doc.
+	* lib/mkmf.rb (Logging.postpone): yield log file object.
 
-Thu Jan  8 21:29:43 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/mkmf.rb (xsystem): add options, :werror only right now.
 
-	* ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
-	  public key only.
+	* lib/mkmf.rb (with_werror): check as if warnings are errors.
 
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
-	  OpenSSL::PKey::DH#to_der.
+	* lib/mkmf.rb (convertible_int): make declaration conflict
+	  warnings errors not to pass wrong type.  [ruby-dev:42684]
 
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
-	  OpenSSL::PKey::DSA#to_der.
+	* lib/mkmf.rb (COMMON_MACROS): get rid of conflicts.
 
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
-	  OpenSSL::PKey::RSA#to_der.
+	* win32/Makefile.sub (WARNFLAGS): make declaration conflict
+	  warnings errors if possible.
 
-Thu Jan  8 16:51:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sun Dec  7 21:16:10 2010  Tanaka Akira  <akr@fsij.org>
 
-	* test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
-	  dumps "E" at month-end.
+	* cont.c: parenthesize macro arguments.
 
-Thu Jan  8 11:20:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue Dec  7 00:27:14 2010  Masaya Tarui  <tarui@ruby-lnag.org>
 
-	* eval.c, object.c, process.c, re.c: don't use C++ style comments.
+	* win32/win32.c (rb_w32_read): fixed more for readline,
+	  and so on. [ruby-core:33511]
 
-Thu Jan  8 04:36:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Dec  6 23:18:22 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
-	  @config[:Logger] if it was not given.
+	* test/mkmf/base.rb (TestMkmf#setup): run quietly.
 
-	* sample/webrick/*: new files.
+	* test/mkmf/test_find_executable.rb (test_find_executable): use
+	  configured results.
 
-	* MANIFEST: add sample/webrick/*
+	* common.mk (test-build): test for build process.
 
-Wed Jan  7 13:00:18 2004  Dave Thomas  <dave@pragprog.com>
+Mon Dec  6 22:47:15 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
-	  being too eager to find matches of ambiguous method
-	  names (such as "ri Thread.join" would return both
-	  Thread.join and ThreadsWait.join)
+	* lib/optparse.rb (OptionParser#candidate): skip separators.
 
-Wed Jan  7 12:35:41 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* sample/optparse/opttest.rb: should not override --help.
+	  [ruby-dev:42690]
 
-	* lib/debug.rb: revert command parse regexps.  [ruby-list:39014] by
-	  Shirai,Kaoru.
+Mon Dec  6 19:00:48 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Wed Jan  7 08:21:04 2004  Dave Thomas  <dave@pragprog.com>
+	* misc/rb_optparse.zsh: fix typos.
 
-	* lib/rdoc/parsers/parserfactory.rb: Check for shebang
-	  line in files that would otherwise be treated as
-	  plain text.
+Mon Dec  6 18:59:04 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Jan  6 22:13:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* NEWS: add new encodings.
 
-	* eval.c (rb_mod_modfunc): should break if m has no super class.
-	  [ruby-dev:22498]
+Mon Dec  6 18:56:42 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Jan  6 21:55:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_string.rb (TestString#test_scan): add a test for
+	  [ruby-core:33338] #4087.
 
-	* io.c (fptr_finalize): should save errno just after failure.
-	  [ruby-dev:22492]
+Mon Dec  6 18:55:36 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Jan  6 14:53:14 2004  Dave Thomas  <dave@pragprog.com>
+	* test/uri/test_common.rb (TestCommon#test_encode_www_form): add
+	  tests for r30015.
 
-	* bin/ri: split out the display side, making it pluggable. Added
-	  new ri_driver and ri_display files in lib/rdoc/ri.
+Mon Dec  6 10:39:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Jan  6 06:37:53 2004  Dave Thomas  <dave@pragprog.com>
+	* lib/uri/common.rb (URI::Parser#initialize_pattern):
+	  refix for restrict the pattern.
 
-	* bin/rdoc: Add --ri-system switch
+Mon Dec  6 09:45:11 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/.document: Update with list of files that seem to have
+	* ext/openssl (OpenSSL): add toplevel documentation
+	* ext/openssl/ossl_ssl.c (SSLContext, SSLSocket: add additional
 	  documentation
+	* ext/openssl: move "let rdoc know about mOSSL" comments so they don't
+	  show up in output
 
-	* lib/test/unit.rb: Reorder comment to make it RDoc friendly.
-
-	* Makefile.in: add install-nodoc target, and make it
-	  generate RDoc on default install.
-
-	* lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
-	  --doc-dir option to ri.
-
-Tue Jan  6 00:04:40 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
-	  fix parsing if there are braces in a method parameter list
-
-Fri Jan  2 14:54:11 2004  Dave Thomas  <dave@pragprog.com>
-
-	* bin/ri: Add new --classes option, and arrange for
-	  help messages to be paged too.
-
-	* bin/rdoc: Add statistics.
-
-	* process.c: (MG) Added Process documentation
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
-	  Fix problem with labels not displaying in RI labeled
-	  lists using BS and ANSI modes.
-
-Fri Jan  2 01:50:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_eof): ARGF.eof? should not have any side effect.
-	  [ruby-dev:22469]
-
-Wed Dec 31 17:25:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_each_byte): should return self.  [ruby-dev:22465]
-
-Wed Dec 31 11:20:34 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
-	  file referenced in "// in sss.c" relative to current file.
-
-Wed Dec 31 11:17:37 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Fix problem when
-	  a public method was aliased, but the alias is then
-	  made private, and hence doesn't appear in RDoc output.
-
-Wed Dec 31 01:33:05 2003  Dave Thomas  <dave@pragprog.com>
-
-	* array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
-	  string.c, time.c: Add RDoc for Kernel functions, and tidy.
-
-Tue Dec 30 19:39:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_readline): should raise EOFError at the end of
-	  files.  [ruby-dev:22458]
-
-	* io.c (argf_read): should concatenate input files when length
-	  argument is nil. [ruby-dev:22450]
-
-	* io.c (argf_read): should update supplied string buffer (2nd
-	  argument) even when IO#read is called multiple times.
-
-	* io.c: should initialize lineno by zero. [ruby-dev:22460]
-
-Tue Dec 30 12:30:30 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
-	  class and a method have the same name, finding Xxx.abc was trying
-	  to find 'abc' in method 'Xxx', not class 'Xxx'.
-
-
-Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
-	  Handle undoing nesting of yield parameters correctly for:
-
-	  def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
-
-
-Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
-	  Handle undoing nesting of yield parameters correctly for:
-
-	    def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
-
-Mon Dec 29 12:51:02 2003  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c: Add RDoc for Kernel global functions.
-
-Mon Dec 29 11:00:16 2003  Dave Thomas  <dave@pragprog.com>
-
-	* array.c: Tidy up RDoc loose ends.
-
-Mon Dec 29 05:05:51 2003  Dave Thomas  <dave@pragprog.com>
-
-	* struct.c, random: Add RDoc comments
-
-Mon Dec 29 02:20:54 2003  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c: Add RDoc for class Proc, Method, UnboundMethod
-
-Mon Dec 29 00:41:44 2003  Dave Thomas  <dave@pragprog.com>
-
-	* math.c: Add RDoc comments
-
-Sun Dec 28 20:19:11 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
-	  raise EOFError.
-
-	* ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
-	  gzfile_read_all returns "".
-
-Sun Dec 28 15:25:08 2003  Dave Thomas  <dave@pragprog.com>
-
-	* class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
-	  Object, Module, etc...
-
-Sun Dec 28 11:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
-	  [ruby-talk:88852]
-
-	* test/csv/{bom.csv,mac.csv}: removed.
-
-Sun Dec 28 08:56:51 2003  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c: Thead[Group] RDoc (thanks to MG)
-
-Sun Dec 28 03:50:05 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
-	  Escape method names used in regexp
-
-Sun Dec 28 01:46:02 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
-	  Add support for rules in 'ri' output.
-
-Sun Dec 28 01:35:35 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
-	  Sometimes the Ruby source aliases two otherwise
-	  unrelated methods (for example Kernel#object_id and
-	  Kernel#hash are both the same C function). Provide a
-	  facility to allow the methods to be documented
-	  separately.
-
-Sun Dec 28 01:05:31 2003  Dave Thomas  <dave@pragprog.com>
-
-	* marshal.c, signal.c: RDoc collemts added by Elliott Hughes
-
-Sun Dec 28 00:48:47 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
-	  Some source files use lower case class or module names
-	  when naming the Init_XXX function in C.
-
-Sat Dec 27 23:41:46 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: fix "test: too many arguments" error.
-
-Sat Dec 27 15:32:19 2003  Dave Thomas  <dave@wireless_3.local.thomases.com>
-
-	* time.c: RDoc comments added
-
-Sat Dec 27 15:07:57 2003  Dave Thomas  <dave@pragprog.com>
-
-	* object.c: Add RDoc comments for Symbol class.
-
-Sat Dec 27 14:42:30 2003  Dave Thomas  <dave@pragprog.com>
-
-	* numeric.c: Add RDoc comments.
-
-Sat Dec 27 00:44:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (next_argv): warn always for stdin on inplace edit mode.
-
-	* io.c (read_all): need to check string value.
-
-	* io.c (argf_read): allow ARGF.read(nil).  [ruby-dev:22433]
-
-Fri Dec 26 23:02:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_backquote): need not to check nil result.
-	  [ruby-core:02078]
-
-	* io.c (rb_io_getline): should return nil when read_all gives
-	  empty string, even when nil rs is specified. [ruby-core:02077]
-
-Fri Dec 26 18:50:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check if getcontext and setcontext are available.
-
-	* eval.c: use presence of getcontext/setcontext.
-
-Fri Dec 26 16:40:53 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
-
-Fri Dec 26 09:26:58 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): add sign check for 'i', and 'l'.
-	  [ruby-dev:22427]
-
-	* bignum.c (rb_quad_pack): add range check for 'quad int'.
-
-Thu Dec 25 22:39:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Dec  6 09:16:46 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (rb_str_update): don't return any value.
+	* lib/uri/common.rb (URI::Parser#initialize_pattern):
+	  workaround fix pattern of hostname for RFC 3986. [ruby-dev:42672]
 
-Thu Dec 25 15:30:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Dec  6 09:14:38 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (rb_str_update): call rb_str_modify().
+	* lib/mkmf.rb (check_signedness): rename unused variable prelude.
 
-Thu Dec 25 05:08:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec  5 17:56:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (search_required): search actual file name once when no
-	  extension specified.
+	* class.c (make_metaclass): fix probable typo.  builtin type flag
+	  cannot be used with FL_TEST.
 
-Thu Dec 25 04:00:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Dec  5 12:09:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* stable version 1.8.1 released.
+	* lib/irb/init.rb (IRB.parse_opts): fix typo. [ruby-core:33574]
 
-Thu Dec 25 00:17:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Dec  5 11:27:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in: check for nanosleep, -lrt if required.
-	  [ruby-core:02059]
+	* ruby.c (load_file_internal): decrement for ungotten line.
+	  [ruby-dev:42680]
 
-	* eval.c (thread_timer): use select(2) if nanosleep(2) is not
-	  available.
+Sun Dec  5 10:32:11 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c: check __stub_getcontext for glibc on some platforms.
-	  [ruby-list:38984]
+	* complex.c: parenthesize macro arguments.
 
-Wed Dec 24 23:48:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sat Dec  4 11:39:17 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
-	  test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
-	  to express -0.0.  [ruby-talk:88786]
+	* ext/openssl/ossl_x509ext.c (initialize): add documentation.
 
-Wed Dec 24 23:29:30 2003  Tanaka Akira  <akr@m17n.org>
+Sat Dec  4 11:21:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/tsort.rb (test_orphaned_break): removed.
+	* hash.c (rb_hash_update_by): new API for Hash#update.
 
-Wed Dec 24 20:53:06 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Dec  4 11:18:10 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/sample/tkmulticolumnlist.rb: new sample
+	* class.c: parenthesize macro arguments.
 
-	* ext/tk/sample/tkmultilistframe.rb: bug fix
+Sat Dec  4 11:07:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 24 20:37:37 2003  Eric Sunshine  <sunshine@sunshineco.com>
+	* vm_core.h (rb_vm_inc_const_missing_count): missing prototype.
 
-	* configure.in (LDSHARED): Fixed typographical error in assignment of
-	  LDSHARED for Rhapsody which caused linking of extension modules to
-	  fail.
+Sat Dec  4 08:50:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 24 17:51:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/iconv/iconv.c (Init_iconv): no warnings if $VERBOSE is nil.
 
-	* file.c (rb_thread_flock): enable thread support again.
+Sat Dec  4 08:25:15 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 24 16:46:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_insnhelper.c (vm_call_method): revert r30064 and r30071,
+	  because of [ruby-core:26761]. Bug#4106 rejected.
 
-	* eval.c (catch_timer): do not call rb_thread_schedule() inside to
-	  avoid pthread_mutex_lock() deadlock.  interrupts to system calls
-	  are detected by TRAP_END via EINTR error.
+Sat Dec  4 07:46:48 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thread_timer): do not post signal unless it is
-	  absolutely necessary.
+	* lib/mkmf.rb (String#tr_cpp): substitute * with P like as
+	  autoconf.
 
-	* rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
+Fri Dec  3 22:36:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): check if nextp is smaller than
-	  pend.  [ruby-dev:22372]
+	* vm_insnhelper.c (vm_call_method): protected methods should be
+	  checked against the real class.
 
-	* eval.c (umethod_bind): remove method overridden check.
-	  [ruby-dev:22366]
+Fri Dec  3 20:23:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 24 16:13:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/mkmf.rb (convertible_int): define printf format prefix too.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
-	  status by SSL_get_error().
+	* lib/mkmf.rb (convertible_int): detect convertible integer type.
+	  port RUBY_REPLACE_INT from configure.in.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
+	* lib/mkmf.rb (check_sizeof): should return integer always.
 
-Wed Dec 24 14:23:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec  3 12:54:48 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_read): clear the buffer argument
-	  when returning nil.  [ruby-dev:22363]
+	* win32/Makefile.sub (RCFLAGS): VC10 and after only. fixed the problem
+	  of r30015. [ruby-core:33530]
 
-	* test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
-	  add buffer argument tests.
+Fri Dec  3 12:41:52 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Wed Dec 24 14:07:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (rb_objspace_free): With our "lazy-sweep" GC engine, it is
+	  possible for an object to survive until its surrounding object
+	  space is about to be freed.  Those objects, if any, remains
+	  leaked for the rest of a process life.  This is problematic
+	  because for instance a T_DATA object may have its own destructor
+	  to terminate something.
 
-	* lib/test/unit/assertions.rb: Modules are allowed to rescue.
+	* vm.c (ruby_vm_destruct): ruby_current_vm termination should be
+	  somewhere after rb_objspace_free for above reason.
 
-	* lib/test/unit/autorunner.rb: show output_level in order.
+Fri Dec  3 12:17:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb: get rid of successive same
-	  directories in load path.
+	* vm_insnhelper.c (vm_call_method): protected singleton methods should
+	  be visible from same real class methods.  [ruby-core:33506]
 
-	* test/testunit/test_assertions.rb (test_assert_nothing_raised,
-	  test_assert_raise): test for modules.
+Fri Dec  3 07:08:42 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 24 13:43:34 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_getline): round upto next char
+	  boundary.  [ruby-dev:42674]
 
-	* lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
-	  strings.
+Fri Dec  3 06:52:46 2010  Tanaka Akira  <akr@fsij.org>
 
-Wed Dec 24 11:26:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c: parenthesize macro arguments.
 
-	* test/fileutils/test_fileutils.rb: should not create any
-	  files or directories in current directory.  [ruby-talk:88724]
+Fri Dec  3 04:08:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Dec 24 10:29:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* encoding.c (enc_alias_internal): use st_insert2 and change return
+	  value to int.
 
-	* ext/stringio/stringio.c (strio_read): never return nil at
-	  unlimited read.  [ruby-dev:22334]
+	* encoding.c (enc_alias): follow enc_alias_internal.
 
-	* ext/stringio/stringio.c (strio_read): support second
-	  argument.  [ruby-dev:22350]
+Fri Dec  3 01:52:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Dec 24 09:38:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* encoding.c (enc_alias_internal): use xfree instead of free.
 
-	* parse.y (arg): should return 0 after error.  [ruby-dev:22360]
+Thu Dec  2 23:52:26 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Wed Dec 24 00:56:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* NEWS: entry for ruby_vm_at_exit().
 
-	* io.c (read_all): do not return nil at the end of file.
-	  [ruby-dev:22334]
+	* eval.c (ruby_cleanup): bug fix around at_exit (1) timing was
+	  wrong. (2) execution order was opposite.
 
-	* io.c (argf_read): do not depend on nil at eof behavior of
-	  IO#read().
+Thu Dec  2 23:05:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_thread_join): dup exception before re-raising it.
+	* win32/Makefile.sub (RCFLAGS): -nologo switch is only available in
+	  newer versions of rc.exe. fixed the problem of r30012.
 
-	* io.c (rb_io_eof): call clearerr() to prevent side effect.  this
-	  patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
-	  [ruby-dev:22234]
+Thu Dec  2 21:28:07 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* pack.c (OFF16): get offset for big endian machines.
+	* ext/json/lib/json/add/rails.rb: removed.
 
-	* pack.c (pack_pack): use OFF16 instead of OFF16B.
-	  [ruby-dev:22344]
+Thu Dec  2 21:22:05 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* pack.c (pack_unpack): ditto.
-
-Tue Dec 23 22:47:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_check_readable): set FMODE_RBUF always, even if
-	  NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
+	* encoding.c (enc_alias_internal): free the copied key and
+	  return NULL when given key is already registered.
 
-	* io.c (rb_io_check_writable): clear FMODE_RBUF before writing
-	  something.
+	* encoding.c (enc_alias): call set_encoding_const only when the
+	  alias is not registered yet.
 
-Tue Dec 23 22:25:00 2003  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Thu Dec  2 19:58:24 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* lib/optparse.rb: incomplete RDoc documentation added in place of
-	  existing RD comments.  Tabs converted to spaces.
+	* vm.c (ruby_vm_at_exit): new API.  This enables extension libs to
+	  hook a VM termination.  Right now, because the VM we have is
+	  process global, most extensions do not deallocate resources and
+	  leave them to Operating System's reaping userland processes.  But
+	  in a future we plan to have multiple VMs to run simultaneously in
+	  a single process (MVM project).  At that stage we can no longer
+	  rely on OSes and have to manage every resources to be reclaimed
+	  properly.  So it is.  For a forward-compatibility reason this API
+	  is introduced now, encouraging you to be as gentle as you can for
+	  your resources; that is, tidy up your room.
 
-Tue Dec 23 19:44:47 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* include/ruby/vm.h: ditto.
 
-	* test/soap/test_streamhandler.rb (test_basic_auth): removed.
-	  soap4r + basic_auth is not officially supported in ruby/1.8.1 even
-	  though soap4r + basic_auth + http-access2 should run fine.
+	* vm_core.h (rb_vm_struct): new field.
 
-Tue Dec 23 19:42:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c (vm_init2): initialize above new field.
 
-	* io.c (rb_io_ungetc): raise an exception at unread stream to
-	  avoid unspecified behavior.  [ruby-dev:22330]
+	* eval.c (ruby_cleanup): trigger those hooks.
 
-	* test/ruby/test_system.rb (test_syntax): glob relatively from
-	  __FILE__.
+Thu Dec  2 17:00:44 2010  Tanaka Akira  <akr@fsij.org>
 
-Tue Dec 23 18:09:40 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* bignum.c: parenthesize macro arguments.
 
-	* pack.c (pack_pack): remove unnecessary negative value check.
-	  [ruby-dev:22329]
+Thu Dec  2 15:31:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Dec 23 17:26:55 2003  KONISHI Hiromasa  <konishih@fd6.so-net.ne.jp>
+	* win32/win32.c (rb_w32_read): more fix. [ruby-core:33513]
 
-	* bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
+Thu Dec  2 13:41:43 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Dec 23 16:08:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* win32/win32.c (rb_w32_read): workaround for console reading troubles.
+	  fixed [ruby-core:33511]
 
-	* lib/rexml/encodings/US-ASCII.rb: typo.  [ruby-talk:88650]
+Thu Dec  2 13:10:42 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/ruby/test_system.rb: num of asserts depended on running dir.
+	* lib/uri/common.rb (URI.encode_www_form):
+	  split key-value when the value is Array like object.
 
-	* test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
-	  handle euc-jp.  install iconv, uconv or xmlscan.
+Thu Dec  2 10:39:39 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Dec 23 14:13:51 2003  akira yamada  <akira@ruby-lang.org>
+	* lib/net/http.rb (Net::HTTP#set_form_data):
+	  use URI.encode_www_form for application/x-www-form-urlencoded.
 
-	* lib/uri/generic.rb (URI::Generic::check_userinfo,
-	  URI::Generic::check_user, URI::Generic::check_password): tests
-	  conflicts/depends with other components closely.
+Thu Dec  2 10:38:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/uri/test_generic.rb (TestGeneric::test_set_component):
-	  added tets.
+	* ext/extmk.rb: remove $makeflags.defined?, it should be $mflags.
 
-Tue Dec 23 11:08:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Dec  2 10:19:47 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
-	  "euc-jp" might not be in supported encoding name list.
-	  [ruby-talk:88650]
+	* win32/Makefile.sub (rc): suppress meaningless message.
 
-Tue Dec 23 06:10:31 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Dec  2 10:09:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/webrick/cgi.rb (CGI): add support for mod_ruby.
+	* ext/json/generator/extconf.rb: remove the lines which set -O3
+	  when -O option is not set.
+	  Note that -O3 doesn't always exist.
 
-	* lib/webrick/cgi.rb (CGI::Socket): add check for existence of
-	  OpenSSL module in all HTTPS related methods.
+	* ext/json/parser/extconf.rb: ditto.
 
-	* lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
-	  value to OpenSSL::SSLSocket#cipher.
+Thu Dec  2 10:01:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
-	  set "connection: close" if @keep_alive is false.
+	* ext/extmk.rb: define $makeflags.defined? like $mflags.
 
-	* lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
-	  SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
+Thu Dec  2 07:20:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 22 23:00:05 2003  akira yamada  <akira@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::GCStressOption): --gc-stress
+	  option.
 
-	* lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
+	* lib/test/unit.rb (Test::Unit::Mini#_run_suites): show the result
+	  even when interrupted on the way.
 
-Mon Dec 22 21:59:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  2 07:08:38 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/iconv/iconv.c (map_charset): always ensure code is a String.
+	* ext/io/console/console.c (setattr): should retry on EINTR.
+	  [ruby-dev:42666]
 
-Mon Dec 22 21:15:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  2 02:30:50 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* class.c (rb_mod_init_copy): always copy singleton class.
-	  [ruby-dev:22325]
+	* lib/net/http.rb: fixed positional wording to match revised order.
 
-Mon Dec 22 20:44:36 2003  akira yamada  <akira@ruby-lang.org>
+Thu Dec  2 01:24:39 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
-	  has no host-part.
+	* ext/json/lib/json/common.rb: don't use iconv on 1.9.
+	  patched by Shota Fukumori [ruby-core:33164]
 
-	* test/uri/test_generic.rb (TestGeneric::test_route): added a test.
+Thu Dec  2 01:02:03 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Dec 22 20:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/json: Update github/flori/json from 1.4.2+ to
+	  e22b2f2bdfe6a9b0. this fixes some bugs.
 
-	* lib/cgi.rb: reduce eval.
+Thu Dec  2 00:05:44 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
-	  local_path.  [ruby-list:38883]
+	* lib/net/http.rb: improve rdoc.
+	  This change the order of chapter because such overview should
+	  begin with simple examples.
+	  patched by Eric Hodel [ruby-core:33469]
 
-Mon Dec 22 20:09:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Dec  1 22:01:49 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/soap/test_property.rb: remove duplicated test method.
+	* numeric.c (Init_Numeric): fixed a potential bug when using bccwin32
+	  ruby with Microsoft's dll, though we already gave up of supporting
+	  bccwin32. [ruby-core:33503]
 
-Mon Dec 22 18:22:04 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Dec  1 21:43:21 2010  Tanaka Akira  <akr@fsij.org>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
-	  HAVE_ISINF definition to follow previous commits of missing.h
-	  and win32/win32.h.
+	* array.c: parenthesize macro arguments.
 
-Mon Dec 22 17:23:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec  1 21:41:57 2010  Tanaka Akira  <akr@fsij.org>
 
-	* configure.in (ac_cv_func_setitimer): moved from defines.h
+	* test/socket/test_addrinfo.rb: extract Errno::EADDRINUSE as a method.
 
-	* defines.h, rubysig.h, signal.c: removed macro handling which
-	  should be done in configure.
+	* test/socket/test_socket.rb: ditto.
 
-	* configure.in (intrinsics.h): check if present.
+Wed Dec  1 15:08:32 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ruby.h: include intrinsics.h if available.
+	* test/openssl/test_ssl.rb (test_not_started_session): non socket
+	  argument of SSLSocket.new is not supported on Windows.
 
-	* bignum.c, marshal.c: include ieeefp.h if available.
+Wed Dec  1 14:36:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* missing.h (isinf): define as a macro if finite() and isnan()
-	  are available.  [ruby-core:02032]
+	* string.c (rb_memhash): zero-filled strings should return
+	  different values.  [ruby-core:33500]
 
-Mon Dec 22 17:07:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Wed Dec  1 14:27:49 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* configure.in (mingw): set isnan, finite and isinf to yes.
+	* lib/minitest/*.rb: Imported minitest 2.0.0 r5952.
+	* test/minitest/*.rb: ditto.
+	* lib/test/unit.rb: Compatibility fix for minitest changes.
 
-Mon Dec 22 13:40:19 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Dec  1 10:16:41 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/soap/property.rb: passing block by reference.
+	* string.c (rb_str_inspect): fix typo (not 0xFD but 0xFE).
 
-Mon Dec 22 00:32:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Dec  1 09:28:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
-	  ALLOW_INTS which may switch context.  [ruby-dev:22319]
+	* addr2line.c: Follow .gnu_debuglink section.
+	  A user of distribution provided ruby will see line
+	  info if s/he has a debug package for ruby.
+	  patched by Shinichiro Hamaji [ruby-dev:42655]
 
-	* ext/syck/emitter.c (syck_emitter_write): str bigger than
-	  e->bufsize causes buffer overflow.  [ruby-dev:22307]
+Wed Dec  1 01:29:15 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Dec 21 17:29:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_inspect): inspect as a dummy encoding string
+	  when a UTF-16/32 (not BE/LE) string does not have a BOM.
+	  Unicode and some RFCs say that a string labeled as UTF-16/32
+	  doesn't have a BOM, it should be considered big endian.
+	  But many Windows programs generates little endian UTF-16
+	  strings without a BOM. So String#inspect treats a string
+	  labeled UTF-16/32 without a BOM as a dummy encoding string.
+	  patched by Martin Duerst. [ruby-core:33461]
 
-	* class.c (rb_check_inheritable): new function.  [ruby-dev:22316]
+Tue Nov 30 17:04:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* intern.h: add prototype.
+	* addr2line.c (parse_debug_line_cu): ignore DW_LNE_set_discriminator.
+	  To ignore, it needs to read a single unsigned LEB128 integer.
 
-	* eval.c (superclass): use rb_check_inheritable().
+Tue Nov 30 16:29:19 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* object.c (rb_class_initialize): check argument validity.
+	* vm_dump.c: undef HAVE_BACKTRACE when the OS is FreeBSD (in other
+	  words backtrace() is libexecinfo) and it is optimized.
+	  This temporary hack may be also applied to other libexecinfo
+	  environments.
 
-Sun Dec 21 16:25:10 2003  Tanaka Akira  <akr@m17n.org>
+Tue Nov 30 16:23:23 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
-	  beginning of the argument.
-	  (Pathname#join): concatenate from the last argument.
-	  (Pathname#parent): just use Pathname#+.
+	* lib/net/http.rb: improve rdoc.
+	  patched by Eric Hodel ref #4100
 
-Sun Dec 21 00:12:37 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Nov 30 12:23:52 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
+	* win32/win32.c (rb_w32_read): read only 1 byte at once on console.
+	  workaround of Windows bug. see [ruby-core:33460].
+	  this is not the final solution.
 
-	* ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
+Tue Nov 30 11:39:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Dec 20 21:59:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/net/http.rb: improve rdoc.
+	  patched by mathew murphy [ruby-core:33472] ref #4100
 
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
+Tue Nov 30 05:03:44 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
-	  instead of Status: header field.
+	* lib/uri/common.rb (encode_www_form, encode_www_form_component):
+	  Improve English in documentation.
 
-	* lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
+	* ext/openssl/ossl_ssl.c (ssl_version=, ciphers=): Document
+	  #ssl_version=, add documentation for #ciphers=.
 
-Sat Dec 20 16:07:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov 29 22:55:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser::Completion::complete): wrong
-	  Regexp for word boundary.  pointed out by Gavin Sinclair.
+	* lib/uri/common.rb (URI::WFKV_): get rid of backtrack explosion
+	  by nested repeat operators.  [ruby-core:33464]
 
-	* lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
-	  missing.
+Mon Nov 29 22:53:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec 20 11:40:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/Makefile.sub (scriptbin.mk): fix generated rules.
 
-	* lib/yaml.rb (YAML::YAML): adjust Marshal version.
+	* win32/win32.c (rb_w32_write_console): fix argument type.
 
-Sat Dec 20 03:56:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Nov 29 21:12:51 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_with_disable_interrupt): prohibit thread context
-	  switch during proc execution.  [ruby-dev:21899]
+	* misc/ruby-mode.el (ruby-forward-sexp): stop after literal hash
+	  key labels.
 
-Sat Dec 20 02:41:02 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* misc/ruby-mode.el (ruby-font-lock-keywords): highlight literal
+	  hash key labels as symbols.
 
-	* lib/webrick/cgi.rb: add file. (yet another CGI library)
+Mon Nov 29 18:31:31 2010  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* MANIFEST: add lib/webrick/cgi.rb.
+	* test/ruby/test_transcode.rb (test_unicode_public_review_issue_121):
+	  - Removed commented-out options that are no longer under discussion.
+	  - Added two more tests for forthcomming clarifications.
 
-Sat Dec 20 02:18:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Nov 29 14:31:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-calculate-indent): proper indentation
-	  inside of parentheses.  [ruby-dev:22308]
+	* win32/win32.c (rb_w32_isatty): use GetConsoleMode() to determine the
+	  fd is console or not, just like rb_w32_write_console(). [experimental]
 
-Fri Dec 19 21:24:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Nov 29 14:19:40 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
-	  HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
+	* include/ruby/win32.h (rb_w32_write_console): wrong prototype.
 
-	* lib/webrick/https.rb (HTTPRequest#parse): should check presence
-	  of cert() method to detect SSLSocket.
+Mon Nov 29 14:10:55 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Dec 19 22:56:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* win32/win32.c (rb_w32_write_console): fixed indentation.
 
-	* lib/soap/property.rb (SOAP::Property#load): new method for loading
-	  property value into existing property tree.
+Sun Nov 28 22:13:39 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* test/soap/test_property.rb: add test.
+	* thread_pthread.c (NATIVE_MUTEX_LOCK_DEBUG): move and use it.
 
-Fri Dec 19 19:21:49 2003  akira yamada  <akira@ruby-lang.org>
+	* ChangeLog: fix my timezone.
 
-	* lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
-	  should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
+Mon Nov 28 21:58:58 2010  Koichi Sasada  <ko1@atdot.net>
 
-Fri Dec 19 17:36:49 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c: remove pthread_atfork().
 
-	* ext/tk/sample/tkmultilistbox.rb: bug fix
+Mon Nov 28 21:54:22 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/sample/tkmultilistframe.rb: new sample script
+	* thread_pthread.c (native_cond_*): Check return code.
+	  (Some OSes except Linux return error code).
 
-Fri Dec 19 03:44:27 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Nov 28 21:46:21 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httputils.rb (parse_form_data): should return an
-	  empty Hash if the body is empty.
+	* thread_pthread.c (thread_start_func_1): initialize native thread
+	  data immediately before starting.
 
-Thu Dec 18 21:47:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Nov 28 14:56:32 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (create_makefile): should remove deffile if it's
-	  made by miniruby. based on nobu's patch.
+	* io.c (struct argf): make lineno long, and reorder members.
 
-Thu Dec 18 21:44:21 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Nov 28 14:55:42 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (stack_extend): ignore inline optimization on VC7.
+	* thread_win32.c (gvl_release, gvl_init): suppress warnings.
 
-	* win32/Makefile.sub (OS, RT): can override.
+Sun Nov 28 14:48:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
-	  option. based on Tietew's patch [ruby-dev:22289]
+	* thread_pthread.c (gvl_release, gvl_init): suppress warnings.
 
-Thu Dec 18 16:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_core.h (rb_vm_gvl_destroy): add prototype.
 
-	* dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
-	  return NULL.
+Sun Nov 28 14:46:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec 18 15:27:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* thread_pthread.c (gvl_reinit): register atfork handler only in
+	  the parent process, to get rid of dead lock.
 
-	* lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
-	  [ruby-dev:21678]
+Sun Nov 28 12:23:57 2010  Koichi Sasada  <ko1@atdot.net>
 
-Wed Dec 17 15:15:30 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c, vm_core.h: make gvl_acquire/release/init/destruct
+	  APIs to modularize GVL implementation.
 
-	* lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
-	  String#[] if more than one arguments are specified.
+	* thread_pthread.c, thread_pthread.h: Two GVL implementations.
+	  (1) Simple locking GVL which is same as existing GVL.
+	  (2) Wake-up queued threads.  The wake-up order is simple FIFO.
+	     (We can make several queues to support exact priorities, however
+	      this causes some issues such as priority inversion and so on.)
+	      This impl. prevents spin-loop (*1) caused on SMP environments.
+	  *1: Only one Ruby thread acquires GVL again and again.
+	      Bug #2359 [ruby-core:26694]
 
-	* lib/delegate.rb: avoid using common instance name as "@obj".
+	* thread_win32.c, thread_win32.h: Using simple lock
+	  not by CRITICAL_SECTION but by Mutex.
+	  Bug #3890 [ruby-dev:42315]
 
-	* lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
-	  subclass of String, but DelegateClass(String).
+	* vm.c (ruby_vm_destruct): ditto.
 
-	* ext/curses/extconf.rb: restore function check for init_color.
-	  [ruby-list:38905]
+Sun Nov 28 04:40:00 2010  Luis Lavena  <luislavena@gmail.com>
 
-	* Makefile.in: need to specify $(MAINLIBS) for the miniruby
-	  generation rule.
+	* io.c (io_fwrite): use rb_w32_write_console under Windows.
 
-	* configure.in: better FreeBSD -lc_r support.
+	* win32/win32.c (rb_w32_write_console): added to write to write
+	  Unicode using WriteConsoleW for stdout/stderr. [ruby-core:33166]
 
-Wed Dec 17 00:16:14 2003  Minero Aoki  <aamine@loveruby.net>
+Sun Nov 28 03:58:47 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/strscan/strscan.c: new method
-	  StringScanner#beginning_of_line? (alias #bol?)
+	* lib/net/http.rb: improve rdoc.
+	  patched by Mike Perham [ruby-core:33433]
 
-	* ext/strscan/strscan.c: new method StringScanner#concat and #<<.
+Sat Nov 27 19:12:10 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
-	  nor freeze STR (allow destructive modification).
+	* time.c: parenthesize macro arguments.
 
-	* test/strscan/test_stringscanner.rb: test new methods above.
+Sat Nov 27 18:08:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/strscan/test_stringscanner.rb: test destructive string
-	  modification.
+	* time.c (leap_year_v_p): fixed typo.  [ruby-dev:42631]
 
-Tue Dec 16 21:20:47 2003  Tanaka Akira  <akr@m17n.org>
+Sat Nov 27 17:57:08 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/pp.rb: don't use local variable `pp'.
+	* resolv.rb (Resolv::DNS): use the same DNS server when retry using
+	  TCP.  reported by Julian Mehnle.  [ruby-core:32970]
 
-	* lib/prettyprint.rb: ditto.
+Sat Nov 27 15:45:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec 16 13:20:43 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_dump.c (rb_vm_bugreport): see CrashReport log on Mac OS X.
 
-	* ext/tk/lib/tk.rb: condition bug of if statement on
-	  {pack,grid}_propagate methods
+	* configure.in: link addr2line only for ELF.
 
-Tue Dec 16 03:17:29 2003  why the lucky stiff  <why@ruby-lang.org>
+Sat Nov 27 13:58:55 2010  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
+	* lib/optparse.rb (OptionParser#candidate): : was missing.  Thanks,
+	  Shota Fukumori.  [ruby-dev:42634]
 
-	* test/yaml/test_yaml.rb: add test.
+Sat Nov 27 12:07:05 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Dec 16 01:14:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* man/ruby.1: Ruby man page from Arthur Gunn in [ruby-core:33412]
 
-	* eval.c (catch_timer): check rb_thread_crtical in main native
-	  thread.
+Sat Nov 27 11:29:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thread_timer): just sends signals periodically, to
-	  prevent main native thread from receiving them in critical
-	  section.  [ruby-core:01959]
+	* lib/optparse.rb (OptionParser#candidate): get rid of 1.9 syntax
+	  so that BASERUBY can be 1.8.
 
-Mon Dec 15 13:32:22 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Nov 27 08:16:21 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (check_dirname): check string safety and remove extraneous
-	  trailing directory separators.  [ruby-dev:22279]
+	* addr2line.c (rb_dump_backtrace_with_lines): should close fd on
+	  edge case.
 
-	* file.c: renamed and externalized rb_path_next,
-	  rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
+Fri Nov 26 13:33:24 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
-	  rb_path_last_separator, rb_path_end.
+	* addr2line.c: apply a patch from shinichiro.h.
 
-Mon Dec 15 09:27:46 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Nov 26 12:21:20 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
-	  of rb_protect should take an argument of VALUE.
+	* addr2line.c: added to show source filename and line number of
+	  functions in backtrace. [ruby-dev:42625]
+	  a patch from shinichiro.h <shinichiro.hamaji AT gmail.com>
 
-Sun Dec 14 18:46:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* addr2line.h: ditto.
 
-	* ext/socket/socket.c (Init_socket): IPv6 is not supported although
-	  AF_INET6 is defined on MinGW.
+	* common.mk: add addr2line.$(OBJEXT).
 
-	* lib/ipaddr.rb (AF_INET6): workaround in the environment which does
-	  not support IPv6.
+	* configure.in: check dl_iterate_phdr.
 
-Sat Dec 13 18:55:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_dump.c (rb_vm_bugreport): use rb_dump_backtrace_with_lines in
+	  addr2line.c when the binary is ELF.
 
-	* ext/iconv/charset_alias.rb: preserve original order.
+Fri Nov 26 12:12:50 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/iconv/extconf.rb: remove wrapper file at clean.
+	* regcomp.c (setup_tree): restart setup_tree() for a node whose
+	  AnchorNode's type is ANCHOR_PREC_BEHIND or ANCHOR_PREC_BEHIND_NOT
+	  and divide_look_behind_alternatives() divided it to NT_ALT or
+	  NT_LIST. [ruby-core:33370]
 
-Sat Dec 13 18:09:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Nov 26 11:40:11 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (thread_timer): use timer by sub-thread and nanosleep.
-	  [ruby-talk:87519]
+	* vm_dump.c (dump_thread): get only required rights of the target
+	  thread because THREAD_ALL_ACCESS causes an access error on XP.
+	  reported by Masaya TARUI via IRC.
 
-	* gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
+Fri Nov 26 11:09:07 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Dec 13 17:17:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_dump.c (dump_thread): show the displacement from the beginning
+	  of the symbol.
 
-	* eval.c (proc_alloc): cache the created object at first time.
-	  [ruby-talk:61288], [ruby-dev:22240]
+Fri Nov 26 10:48:23 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Dec 13 09:01:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_dump.c (dump_thread): follow the output of glibc.
+	  see [ruby-dev:42627]
 
-	* configure.in: check ucontext.h.
+Fri Nov 26 09:48:45 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
-	  on ia64 or with native thread enabled.  [ruby-core:01932]
+	* re.c (rb_reg_initialize_str): should succeed the taint status from
+	  the origin. [ruby-core:33338]
 
-Sat Dec 13 03:09:14 2003  why the lucky stiff  <why@ruby-lang.org>
+Fri Nov 26 09:32:37 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
+	* vm_dump.c (dump_thread): seems to be necessary the 3rd argument of
+	  SymGetLineFromAddr64(), even though MSDN says it can be zero.
 
-	* test/yaml/test_yaml.rb: add test.
+Fri Nov 26 09:03:38 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Dec 12 22:36:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* regcomp.c (onig_is_prelude): added to check whether ruby is still
+	  in prelude (or other boot processes) or not.
 
-	* lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
-	  "#{aCell}" and so on.
+	* regcomp.c (optimize_node_left): use onig_is_prelude for printing.
 
-	* test/csv/test_csv.rb: add tests.
+	* regcomp.c (set_optimize_info_from_tree): ditto.
 
-Fri Dec 12 19:33:06 2003  Minero Aoki  <aamine@loveruby.net>
+	* regcomp.c (onig_compile): ditto.
 
-	* lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
+	* regcomp.c (print_compiled_byte_code_list): print its address.
 
-	* lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
+	* regcomp.c (print_indent_tree): print its contents tree of
+	    ANCHOR_PREC_READ(_NOT) and ANCHOR_PREC_BEHIND(_NOT).
 
-	* lib/fileutils.rb (rmdir_r): ditto.
+Thu Nov 25 23:10:49 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/fileutils.rb (fu_copy_dir): check if it is a directory after
-	  mkdir(2).
+	* regcomp.c (print_distance_range): use PRIuSIZE.
 
-Fri Dec 12 06:06:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regcomp.c (print_optimize_info): use %ld because the type of
+	  calculated value of integers is long.
 
-	* eval.c (proc_invoke): fix class name in warning message for
-	  define_method.  [ruby-dev:22235]
+	* regexec.c (onig_print_compiled_byte_code): add prototype.
 
-Thu Dec 11 21:24:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* regexec.c (match_at): add 2nd argument.
 
-	* ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
+Thu Nov 25 10:29:55 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl.[ch]: ditto.
+	* ext/dl/callback/mkcallback.rb (gencallback): shouldn't assume that
+	  VALUE is the same size with long.
 
-	* ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
+Thu Nov 25 10:03:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Dec 11 20:54:28 2003  Minero Aoki  <aamine@loveruby.net>
+	* test/win32ole/test_err_in_callback.rb (teardown): remove tmp file
+	  only when it exists.
 
-	* lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
-	  mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
+Thu Nov 25 01:38:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/fileutils.rb (fu_list): call to_str for all arguments.
+	* enc/trans/big5-hkscs-tbl.rb: Update table as HKSCS-2008.
+	  patched by oCameLo oTnTh [ruby-core:33256]
 
-Thu Dec 11 20:07:01 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* enc/big5.c: add alias Big5-HKSCS:2008 to Big5-HKSCS.
 
-	* lib/ftools.rb (makedirs): sync with fileutils.
+Wed Nov 24 15:18:07 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Dec 11 19:53:03 2003  Minero Aoki  <aamine@loveruby.net>
+	* vsnprintf (BSD_vfprintf): use QUADINT macro only when _HAVE_SANE_QUAD_
+	  macro is defined.
 
-	* lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
-	  (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
+Wed Nov 24 12:47:16 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Dec 11 19:08:02 2003  Minero Aoki  <aamine@loveruby.net>
+	* vsnprintf (BSD_vfprintf): added VC++ compatible size specifications
+	  (I, I32, I64).
 
-	* lib/fileutils.rb (mkdir_p): check if it is a directory after
-	  mkdir(2) instead of before mkdir(2), to avoid race condition.
-	  [ruby-talk:87730]
-	  Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
+Wed Nov 24 11:19:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Dec 11 18:49:30 2003  Minero Aoki  <aamine@loveruby.net>
+	* string.c (rb_str_inspect): treat UTF-16 and UTF-32 as BE or LE.
 
-	* lib/fileutils.rb: def m( arg ) -> def m(arg).
+Wed Nov 24 06:35:32 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Dec 11 11:39:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* enc/trans/utf_16_32.trans: add the UTF-32 converter.
 
-	* configure.in (ieeefp.h), numeric.c: needed for finite() on
-	  Solaris.  [ruby-core:01921]
+Wed Nov 24 05:40:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* file.c (rb_stat_inspect): adjust format specifier.
+Wed Nov 24 06:13:32 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.c (arg_prepend): nodetype() is for debug use.
+	* win32/win32.c (filecp, wstr_to_mbstr, mbstr_to_wstr):
+	  refactored.
 
-	* ruby.h (ISASCII, etc): cast to int to get rid of warning.
+Wed Nov 24 05:40:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ruby.h (alloca.h): include even in GCC.  [ruby-core:01925]
+	* enc/trans/utf_16_32.trans: add a converter from UTF-8 to UTF-16.
 
-	* ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
-	  specifier.
+Wed Nov 24 03:21:35 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
-	  BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
+	* enc/trans/utf_16_32.trans: raise error on unpaired upper
+	  surrogates.
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
+Wed Nov 24 01:40:23 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
-	  volatile.
+	* enc/utf_16_32.h: add UTF-16 and UTF-32 as a dummy encoding.
 
-	* ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
-	  format specifier.
+	* enc/trans/utf_16_32.trans: add a converter from UTF-16 to UTF-8.
 
-	* ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
-	  define unless used.
+Tue Nov 23 21:59:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/pty/pty.c (getDevice): get rid of warning.
+	* win32/win32.c (wlink, rb_w32_getppid): use typedef instead of
+	  repeating complicated function prototypes.
 
-	* ext/socket/socket.c (port_str, sock_s_getaddrinfo,
-	  sock_s_getnameinfo): FIX2INT() now returns long.
-
-	* ext/socket/socket.c (init_inetsock_internal): uninitialized
-	  variable.
+Tue Nov 23 18:54:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
+	* vm.c (rb_thread_mark): should mark self in control
+	  frames.  [ruby-core:33289]
 
-	* ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
-	  ISDIGIT() instead of isdigit() to avoid warnings and for
-	  platforms which don't support non-ascii charater.
+Tue Nov 23 07:57:31 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Dec 10 19:28:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/date/delta/parser.{ry,rb}: fixed a bug of token scanner.
 
-	* ext/stringio/stringio.c (strio_read): set EOF flag at short read.
-	  [ruby-dev:22223], [ruby-dev:22224]
+Tue Nov 23 07:29:24 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Dec 10 18:07:25 2003  Minero Aoki  <aamine@loveruby.net>
+	* complex.c, rational.c ({nucomp,nurat}_expt): added a check.
 
-	* lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
+Tue Nov 23 07:27:27 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Dec 10 17:54:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/date.rb (daynum): should be private.
 
-	* ext/stringio/stringio.c (strio_read): do not set EOF flag when
-	  requested length is zero.  [ruby-dev:22214]
+Tue Nov 23 07:22:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 10 17:17:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ChangeLog (change-log-indent-text): hanging indent.
 
-	* io.c (read_all): should return given string even if data read is
-	  empty.  [ruby-dev:22207]
+Tue Nov 23 06:30:51 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 10 17:16:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (SITE_DIR, VENDOR_DIR),
+	  version.c (ruby_initial_load_paths): exclude directories that
+	  are configured without them from $LOAD_PATH. [ruby-core:33267]
 
-	* ext/stringio/stringio.c (strio_read): adjust behavior at reading
-	  beyond EOF to IO.  [ruby-dev:22205]
+	* configure.in (rubylibprefix): No ruby, No libprefix.
 
-	* test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
-	  beyond EOF.
+Tue Nov 23 01:05:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
-	  TestEOF::Seek test case.
+	* vsnprintf.c (BSD_vfprintf): don't output floating point
+	  when the precision is 0. [ruby-dev:42615]
 
-Wed Dec 10 15:01:19 2003  Shugo Maeda  <shugo@ruby-lang.org>
+Mon Nov 22 21:30:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/monitor/test_monitor.rb (test_cond): use Queue#deq
-	  instead of sleep.
+	* string.c (rb_str_inspect): fix for ascii-compatible external
+	  encoding and different encoding string.  [ruby-core:33283]
 
-Wed Dec 10 14:45:39 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Mon Nov 22 18:45:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
-	  for TIOCSCTTY on *BSD.  based on gotoyuzo's patch.
-	  (ruby-bugs:PR#1211)
+	* lib/mkmf.rb (create_makefile): should not duplicate rules.
+	  bug fix of r29842.
 
-	* ext/pty/pty.c (establishShell): should close descriptors if fork
-	  failed.
+Mon Nov 22 18:04:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Dec 10 12:53:05 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* enc/big5.c: split CP950 from Big5.
 
-	* win32/win32.h: define execv() using do_aspawn().
+	* enc/big5.c: split CP951 from Big5-HKSCS.
 
-	* process.c (proc_exec_v): remove #ifdef's which stopped needing.
+	* enc/trans/big5.trans: import conversion table of Big5, Big5-HKSCS,
+	  CP950, and CP951 from ICU. they need fallback conversions.
+	  ref [ruby-core:33256]
+	  http://source.icu-project.org/repos/icu/data/trunk/charset/data/ucm/
 
-Tue Dec  9 23:32:23 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* tool/transcode-tblgen.rb (import_ucm): add to import ucm files.
 
-	* ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
-	  ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
-	  ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
-	  ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
-	  ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
-	  ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
-	  overrided instance methods, which are private methods on the super
-	  class, are changed to 'private'
-
-Tue Dec  9 19:53:02 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
-	  for host-part.
-
-	* test/uri/test_generic.rb (test_route): added tests for the above
-	  change.
+Mon Nov 22 18:33:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec  9 14:10:48 2003  Tanaka Akira  <akr@m17n.org>
+	* string.c (rb_str_inspect): append for each chars instead of bulk
+	  copy if encoding conversion is needed.  [ruby-core:33283]
 
-	* io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
-	  to avoid clearing EOF flag.
-	  (rb_io_check_writable): ditto.
+Mon Nov 22 14:22:45 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Dec  9 02:53:55 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* time.c (time_zone): use rb_locale_str_new_cstr to set encoding
+	  as locale and convert its content to internal encoding.
+	  [ruby-core:33278]
 
-	* ext/tk/sample/tkalignbox.rb: new sample script
+Mon Nov 22 11:58:11 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Dec  9 00:45:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* string.c (rb_str_concat): set ENC_CODERANGE_VALID when the
+	  receiver is 7BIT and the argument is non ASCII.
 
-	* lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
-	  and made the former call the latter. [ruby-core:01890]
+Mon Nov 22 01:48:58 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* test/testunit/test_assertions.rb: ditto.
+	* lib/date.rb: some improvements for performance.
 
-Tue Dec  9 00:07:35 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sat Nov 20 07:45:50 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
-	  methods as delegates to WEBrick.
+	* lib/mkmf.rb: adding compilation support for ObjC/ObjC++ extensions.
+	  Thanks Scott Gonyea! [ruby-core:33260]
 
-	* test/soap/calc/{test_calc.rb,test_calc2.rb},
-	  test/soap/helloworld/test_helloworld.rb,
-	  test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
-	  follow the change.
+Sat Nov 20 01:57:55 2010  Akio Tajima  <artonx@yahoo.co.jp>
 
-Mon Dec  8 22:48:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* common.mk: add dependency(insns.inc) to compile.obj
 
-	* lib/test/unit/autorunner.rb: remove dependency to a particular
-	  runner.  [ruby-core:01901], [ruby-list:38869]
+Fri Nov 19 23:05:48 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/ui/testrunnerutilities.rb: moved output level
-	  constants from Console.
+	* win32/Makefile.sub (insns_rules.mk): remove extra backslash.
 
-	* lib/test/unit/ui/console/testrunner.rb: ditto.
+	* cygwin/GNUmakefile.in, win32/Makefile.sub (clean): rc files are
+	  made at compile time, so should be removed by clean.
 
-	* lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
-	  accept output_level.
+Fri Nov 19 22:09:46 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon Dec  8 15:03:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rexml/test_core.rb
+	  (Tester#test_pretty_format_long_text_finite): skip a test that
+	  uses long string on small memory system. [ruby-dev:42599]
 
-	* ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
+Fri Nov 19 21:07:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec  8 13:02:11 2003  Minero Aoki  <aamine@loveruby.net>
+	* lib/optparse.rb: shell completion support for zsh.  based on
+	  <http://d.hatena.ne.jp/rubikitch/20071002/zshcomplete>
 
-	* lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
+	* lib/optparse.rb: shell completion support for bash.
 
-	* test/uri/test_common.rb: add test for URI.regexp.
+Fri Nov 19 00:00:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec  8 12:44:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* cygwin/GNUmakefile.in (SCRIPTPROGRAMS): no needs on cygwin.
 
-	* pack.c: define swap16 and swap32 only if they are not
-	  defined. OpenBSD defines these macros. [ruby-dev:22181]
+	* win32/Makefile.sub (scriptbin): create script binaries.
 
-Sun Dec  7 20:54:17 2003  Tanaka Akira  <akr@m17n.org>
+Thu Nov 18 23:21:23 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/iconv/iconv.c (map_charset): make case sensitive.
-	  ext/iconv/charset_alias.rb (charset_alias): don't ignore
-	  config.charset's information.  sort aliases.
+	* lib/rexml/formatters/pretty.rb (REXML::Formatters::Pretty#wrap):
+	  REXML::Formatters::Pretty#wrap used a recursive method call to
+	  format text.  This switches it to use an iterative approach.
+	  [ruby-core:33245]
+	  Patch by Jeremy Evans. Thanks!!!
 
-Sat Dec  6 22:58:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
-	  SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
-	  but not finished the handshake process, we should retry it.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
-
-Sat Dec  6 21:45:10 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (flush_before_seek): flush before seek on any platform.
-
-	* configure.in: ditto.
+	* test/rexml/test_core.rb: add a test for it.
 
-Sat Dec  6 17:23:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Nov 18 22:58:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
-	  as well as downcase one.
+	* include/ruby/io.h (rb_io_buffer_t): extract from rb_io_t.
 
-	* lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
+Thu Nov 18 07:37:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec  5 23:22:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* Makefile.in (reconfig): force reconfigure with previous options.
 
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
-	  Test::Unit::Assertions::assert_nothing_raised): use the last
-	  argument as message unless class object.
+	* common.mk (showconfig): show configure flags, like as
+	  `config.status --config' generated by recent autoconf.
 
-	* test/testunit/test_assertions.rb (test_assert_raises): test for
-	  multiple exception list.  [ruby-core:01891]
+Thu Nov 18 07:16:49 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/testunit/test_assertions.rb (test_assert_nothing_raised): test
-	  for non-exception classes.
+	* missing/langinfo.c (strncasecmp): get rid of redefinition.
 
-Fri Dec  5 22:23:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Nov 18 00:02:17 2010  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* lib/soap/netHttpClient.rb: proxy support did not work.  fixed.
+	* lib/csv.rb: Upgrading output encoding with ASCII content
+	  as needed.  [ruby-core:33229]
 
-	* lib/soap/property.rb: add class methods for loading property from
-	  stream/file/propertyfile.  propertyfile is a file which is located at
-	  somedir in $:.
+Wed Nov 17 23:19:21 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
-	  lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
-	  e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
+	* win32/configure.bat: remove quotes from arguments to be quoted.
 
-	* test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
+	* lib/mkmf.rb (create_makefile): use forward slashes in messages.
 
-Fri Dec  5 17:26:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (create_makefile): make extension libraries messages
+	  brief.
 
-	* eval.c (rb_exec_end_proc): maintain tmp_end_procs.
-	  [ruby-dev:22154]
+	* win32/Makefile.sub (MAKEDIRS): should not include silent flag.
 
-Fri Dec  5 13:36:59 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* common.mk (ext/ripper/ripper.c, ext/json/parser/parser.c): pass
+	  Q and ECHO.  [ruby-core:33226]
 
-	* eval.c (rb_exec_end_proc): should not clear end_procs and
-	  ephemeral_end_procs before execution. [ruby-dev:22144]
+Wed Nov 17 16:09:52 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* eval.c (rb_obj_extend): call Module#extended hook after
-	  extended_object.  [ruby-list:38866]
+	* test/test_tracer.rb: new test case.
+	  minimal regression test for r29280.
 
-	* object.c (Init_Object): Module#extended defined.
+Wed Nov 17 16:04:23 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Fri Dec  5 13:17:30 2003  Tanaka Akira  <akr@m17n.org>
+	* test/ruby/envutil.rb (Test::Unit::Assersions#assert_warn):
+	  new assertion to assert that a particular warning message is
+	  displayed.
+	  forward port from branches/ruby_1_9_2@29795.
 
-	* test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
+Wed Nov 17 15:16:48 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Dec  5 11:54:45 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regint.h (OnigOpInfoType): constify name.
 
-	* ext/stringio/stringio.c (strio_read): follow IO#read.
+	* regcomp.c (op2name): constify return value.
 
-	* test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
-	  test/stringio/test_stringio.rb: add EOF test.
+	* regcomp.c (onig_print_compiled_byte_code): use PRIuPTR and
+	  uintptr_t to clean warnings.
 
-Fri Dec  5 02:49:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regcomp.c (print_indent_tree): use PRIxPTR and intptr_t.
 
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
-	  allow multiple exception list.  [ruby-core:01884]
+	* regexec.c (match_at): use PRIdPTR and intptr_t.
 
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
-	  check whether arguments are subclass of Exception.
+Wed Nov 17 09:49:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Dec  4 23:54:00 2003  Rick Ohnemus  <rick.ohnemus@systemware.com>
+	* enc/shift_jis.c (property_name_to_ctype): fix memory leak.
 
-	* dln.c (aix_loaderror): should not use member named 'errno' which
-	  might be a macro (e.g. on AIX).
+	* enc/euc_jp.c (property_name_to_ctype): ditto.
 
-Thu Dec  4 23:32:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Nov 17 08:54:04 2010  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* io.c (read_all): do not depend on lseek position.
-	  [ruby-dev:22026]
+	* lib/csv.rb: Upgrading output encoding as needed.  [ruby-core:33135]
 
-Thu Dec  4 22:37:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 16 22:30:39 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* eval.c (rb_eval): preserve $! value when retry happens in the
-	  rescue clause.  [ruby-talk:86697]
+	* vm_insnhelper.c (vm_throw): remove fear of undefined behavior :-)
+	  Coverity Scan found this bug.
 
-Thu Dec  4 21:50:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 16 09:33:00 2010  Kenta Murata <mrkn@mrkn.jp>
 
-	* lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
-	  should rescue errors and re-raise DRbConnError on write too.
-	  [ruby-dev:22132]
+	* ext/bigdecimal/lib/bigdecimal/util.rb (to_digits): avoid unused
+	  variables warning, reported by Aaron Patterson.
 
-Thu Dec  4 16:41:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 16 06:39:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (exc_list): allow expanding list.  [ruby-dev:22134]
-
-Thu Dec  4 14:09:24 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb (test_cp): test if the error is
-	  kind of SystemCallError.  It is needless details that which errno
-	  is set on each systems.
-
-Thu Dec  4 13:24:13 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: use Object#__send__ instead of Object#send.
-
-Thu Dec  4 13:17:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/streamHandler.rb: support latest released version of
-	  http-access2.
-
-Thu Dec  4 13:04:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/soap.rb: add SOAP::Env module for environment repository
-	  such as HTTP_PROXY.
-
-	* lib/soap/property.rb: property implementation.
-
-	* lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
-	  lib/soap/rpc/driver.rb: use soap/property.rb.
-
-	* lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
-	  use SOAP::Env.
-
-	* lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
-	  management interface, but ignored for now.
-
-	* lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
-	  wiredump charset explicitly.  it was fixed to 'utf-8' when iconv or
-	  uconv module was found.
-
-Thu Dec  4 10:43:58 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
-	  feature.
-
-Thu Dec  4 10:27:12 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: update hyperlink to the Japanese document.
-
-Thu Dec  4 09:12:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
-	  the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
-
-Thu Dec  4 08:29:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  Exception to avoid unexpected aborting. [ruby-core:01853]
-
-	* lib/webrick/server.rb (GenericServer#start_thread): should check
-	  that peeraddr isn't nil before printing.
-
-	* lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
-	  rescue Exception to avoid unexpected aborting of thread.
-
-Thu Dec  4 03:48:59 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
-	  (Pathname#make_link, Pathname#make_symlink): new method.
-
-Thu Dec  4 01:45:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_read): should not terminate on empty string; wait
-	  until real EOF.  [ruby-dev:21969]
-
-	* io.c (argf_read): should adjust length to read, when length is
-	  specified and read spans command line argument files.
-
-Wed Dec  3 19:38:36 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
-
-Wed Dec  3 13:49:07 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
-
-	* ext/tk/lib/tkafter.rb: ditto.
-
-	* ext/tk/lib/tkcanvas.rb: ditto.
-
-	* ext/tk/lib/tkdialog.rb: ditto.
-
-	* ext/tk/lib/tktext.rb: ditto.
-
-Wed Dec  3 13:28:13 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (lex.c): try gperf first, and copy from the source
-	  directory if failed.  [ruby-dev:22123]
-
-	* ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
-
-	* lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
-
-Tue Dec  2 23:18:12 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: wrote the warning about HTTP_PROXY environment
-	  variable.
-
-Tue Dec  2 21:31:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bin/testrb: new test runner.  [ruby-core:01845]
-
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
-	  Test::Unit::AutoRunner#process_args): take test list to run and
-	  options.
+	* pack.c (PACK_ITEM_ADJUST): return nil not result array and yield
+	  values if block is given.  [ruby-core:33193]
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
-	  Test::Unit::AutoRunner#run): should not exit inside a library,
-	  just return the result instead.
+Tue Nov 16 00:21:20 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/test/unit.rb: ditto.
+	* regparse.c (and_cclass, or_cclass): fix memory leak.  Coverity Scan
+	  found this bug.  [ruby-dev:42579]
 
-	* test/runner.rb: exit with the test result.
+Tue Nov 16 00:07:32 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Tue Dec  2 20:18:48 2003  Eric Sunshine  <sunshine@sunshineco.com>
+	* gc.c (assign_heap_slot): fix fear of memory leak and memory
+	  violation.  Coverity Scan found this bug.
 
-	* configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
-	  instead of Bison or byacc.
+Mon Nov 15 23:54:45 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
-	  10000 (Bison's default) since some old versions of Yacc define it as
-	  low as 150 by default, which is too low for Ruby to parse some files,
-	  such as date/format.rb.  Among other issues, the parse problem causes
-	  "make test" to fail.
+	* eval_intern.h (CHECK_STACK_OVERFLOW): it was not intended to add
+	  size_t to a pointer typed VALUE*.  Coverity Scan found this defect.
 
-Tue Dec  2 20:03:20 2003  Minero Aoki  <aamine@loveruby.net>
+Mon Nov 15 23:41:21 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* test/fileutils/test_fileutils.rb: check if Pathnames are usable
-	  for arguments.
+	* compile.c (iseq_set_exception_local_table, iseq_set_local_table,
+	  rb_iseq_build_from_ary): fix type inconsistency (which is benign
+	  because sizeof(ID) == sizeof(ID*), though).  Coverity Scan found
+	  these bugs.
 
-Tue Dec  2 04:22:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Mon Nov 15 22:47:27 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/test/unit/assertions.rb: fixed #assert_no_match message.
+	* vm_eval.c (rb_funcall): ensure va_end after va_init_list.  Coverity
+	  Scan found this bug.
 
-	* test/testunit/test_assertions.rb: ditto.
+Mon Nov 15 08:36:12 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Dec  2 00:43:00 2003  why the lucky stiff  <why@ruby-lang.org>
+	* lib/racc/parser.rb (do_parse, yyparse): using class eval to define
+	  method and avoid __send__.
 
-	* ext/syck/syck.c: string buffering bug.  decrementing by full
-	  max_size now. [ruby-core:01834]
+Mon Nov 15 06:43:48 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Dec  1 21:33:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* etc/openssl/ossl_ssl.c (ossl_ssl_get_cert): raise exception if
+	  pointer is invalid.  Thanks Ippei Obayashi! [ruby-dev:42573]
 
-	* numeric.c (num_sadded): prohibit singleton method definition for
-	  Numerics.  fill yet another gap between Fixnum and Bignum.
+Sun Nov 14 17:57:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec  1 17:33:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/Makefile.in (distclean): should not remove sources which are
+	  distributed in tarball.
 
-	* pack.c (htov16): converts endian using swap16. htov32(), hton16,
-	  hton32 as well. [ruby-talk:85377]
+Sun Nov 14 16:48:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* pack.c (swap16): swap 2 bytes no matter how big short is on the
-	  platform.  swap32() is also prepared.
+	* parse.y (parser_set_token_info): turn on/off with directives.
+	  [ruby-core:25442]
 
-	* numeric.c (rb_num2int): returns long to preserve information.
-	  rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
-	  [ruby-talk:85377]
+Sun Nov 14 12:05:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (rb_num2uint): should not check for value range if the
-	  source value is negative.
+	* io.c (argf_readlines): forward to current_file for arguments
+	  check.  http://twitter.com/nagachika/status/3634254856589312
 
-Mon Dec  1 17:14:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Nov 14 08:48:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sample/optparse/opttest.rb: added.
+	* win32/setup.mak (-basic-vars-, -runtime-): suppress trailing
+	  space and compiler command line.
 
-Mon Dec  1 16:10:52 2003  Dave Thomas  <dave@pragprog.com>
+Sun Nov 14 04:22:32 2010  Alexander Zavorine  <alexandre.zavorine@nokia.com>
 
-	* lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
+	* symbian/setup (config.h): Added HAVE_LABS and HAVE_LLABS to config.h.
 
-Mon Dec  1 14:17:49 2003  Minero Aoki  <aamine@loveruby.net>
+	* symbian/configure.bat: Changed packaging version in line with API
+	  style 3 versioning.
 
-	* lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
-	  Pathname for arguments. [ruby-core:01795]
+Sat Nov 13 16:37:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb: does much strict test on
-	  "same" files detecting.
+	* common.mk (showflags, help): emit messages at once.
 
-Mon Dec  1 09:28:14 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* win32/Makefile.sub (MSG, EOM): remove surrounding quotes by %~I.
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): re-export $(XCFLAGS).
+Sat Nov 13 01:31:30 2010  Akio Tajima <artonx@yahoo.co.jp>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
+	* win32/Makefile.sub: reorder variable End Of Message (don't display it)
 
-Mon Dec  1 01:03:27 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri Nov 12 20:52:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
-	  and ARCH_FLAG.  [ruby-dev:22085]
+	* common.mk (showflags, help): use caret to quote leading spaces on
+	  Windows.
 
-Sun Nov 30 20:18:07 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* Makefile.in, common.mk, cygwin/GNUmakefile.in, enc/depend,
+	  ext/ripper/depend, lib/mkmf.rb, win32/Makefile.sub: caddle up.
 
-	* configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
-	  [ruby-core:01819]
+Fri Nov 12 16:35:31 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* Makefile.in: add ARCH_FLAG to CFLAGS.
+	* configure.in: support C level backtrace information on FreeBSD.
+	  When devel/libexecinfo is installed on FreeBSD, now ruby
+	  can show C level backtrace information.
+	  http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/libexecinfo/
 
-	* Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
+Fri Nov 12 09:58:30 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
+	* win32/setup.mak: use findstr.exe instead of find.exe, because all
+	  target build platforms should have findstr.exe, and, find.exe often
+	  means another command such as cygwin's.
 
-	* lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
+Fri Nov 12 00:30:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Makefile.in: add ARCH_FLAG to DLDFLAGS.
+	* win32/Makefile.sub (config.h): need PRI_LL_PREFIX.
 
-	* configure.in: should put getcwd in AC_CHECK_FUNCS, not
-	  AC_REPLACE_FUNCS.  [ruby-core:01826]
-
-Sun Nov 30 18:22:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
-	  DLDFLAGS and LDSHARED.
-
-	* configure.in: XCFLAGS for compiling ruby itself.  ARCH_FLAG is
-	  reflected in CFLAGS.
-
-	* lib/mkmf.rb: ditto.  do not import XCFLAGS from config.status.
-
-Sun Nov 30 17:37:36 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
-
-Sun Nov 30 13:02:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
-	  Conditional Expressions.
-
-	* lib/wsdl/soap/definitions.rb: refactoring - Move Method.
-
-	* test/xsd/{test_noencoding.rb,noencoding.xml}: new files.  test for
-	  encoding unspecified XML file parsing.
-
-	* test/wsdl/{test_fault.rb,map,datetime}: new files.  test of
-	  SOAPFault, dateTime and Apache's Map.
-
-Sun Nov 30 09:35:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_update): get rid of SEGV at just allocated String.
-	  [ruby-core:01812]
-
-Fri Nov 28 23:19:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (gc_mark): explicitly check mark recursion levels, instead
-	  of unreliable stack length.
-
-Fri Nov 28 22:49:56 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
-
-Fri Nov 28 21:44:40 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
-	  a directory for FreeBSD.
-
-Fri Nov 28 19:37:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (env_has_value, env_index): must match exactly.
-
-	* test/ruby/test_env.rb (test_has_value, test_index): condition for
-	  aboves.
-
-Fri Nov 28 17:59:20 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_env.rb: add tests for ENV.
-
-Fri Nov 28 17:47:46 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
-	  DRbConnError.
-
-Fri Nov 28 15:41:15 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
-	  argument.
-
-Fri Nov 28 14:41:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/streamHandler.rb: drop unused http parameters.
-
-	* lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
-	  lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
-	  lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
-	  under WSDL dynanic client environment.  fixed.
-
-	* test/wsdl/raa/*: add tests.
-
-	* lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
-	  bug of soap4r.  XSDDateTimeImple.to_time passed a Float to
-	  Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
-	  causes rounding error.
-
-	* test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
-
-Fri Nov 28 04:15:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (method_arity): used wrong Proc object.  [ruby-talk:86504]
-
-Fri Nov 28 00:47:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
-	  success, false as failure.  [ruby-dev:22067]
-
-	* eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
-	  ANSI macro instead of hard coded value.
-
-	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
-	  TYPEs.
-
-Thu Nov 27 22:05:48 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
-	  process to get the base address for the RSE backing store, so
-	  hardcode it for the moment.
-	  [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
-
-Thu Nov 27 17:36:42 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
-	  TkTimer#wait recieves the exception of the callback.
-	  The exception is kept on @return_value.
-
-Thu Nov 27 16:58:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
-
-Wed Nov 26 15:38:47 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/fileutils/test_fileutils.rb (test_ln_s): should take the
-	  existing symbolic link for OpenBSD.
-
-Wed Nov 26 04:48:42 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/token.c: removed YYTOKTMP references which
-	  were causing buffer overflows on large block scalars,
-	  comments, quoted scalars and plain scalars.
-
-	* ext/syck/rubyext.c: dynamic changing of buffer size.
-
-	* ext/syck/syck.h: default buffer size of 4k.
-
-Wed Nov 26 00:55:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
-
-	* lib/webrick/httpserver.rb (HTTPServer#run): should pass the
-	  request's keep_alive flag to the response.
-
-Tue Nov 25 21:41:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* defines.h (ENV_IGNORECASE): should define when DOSISH without
-	  human68k. [ruby-dev:22047]
-
-	* hash.c (env_has_value, env_index): don't ignore case of value.
-	  [ruby-dev:22048]
-
-Tue Nov 25 21:39:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (path_check_1): honor sticky bits always.
-	  [ruby-talk:86273]
-
-Tue Nov 25 20:02:14 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: do test in more deep
-	  directory.
+Thu Nov 11 23:38:32 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_nowrite.rb: ditto.
+	* configure.in: ANSI C-conforming const and volatile are mandatory
 
-Tue Nov 25 19:04:23 2003  Tanaka Akira  <akr@m17n.org>
+	* configure.in (AC_C_CONST, AC_C_INLINE, AC_C_VOLATILE): check
+	  before used in other checks.
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
-	  refined.
+	* configure.in (RUBY_CHECK_PRINTF_PREFIX): should not break from
+	  RUBY_WERROR_FLAG, so that ac_c_werror_flag gets restored.
 
-Tue Nov 25 18:13:30 2003  Minero Aoki  <aamine@loveruby.net>
+Thu Nov 11 23:04:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
-	  test. [ruby-dev:22045]
+	* ext/iconv/iconv.c (warn_deprecated): show caller position.
 
-	* test/fileutils/test_nowrite.rb: ditto.
+Thu Nov 11 23:03:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 25 17:52:11 2003  Tanaka Akira  <akr@m17n.org>
+	* io.c (argf_close): untie tied io before closing.
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
-	  if the environment variable is case sensitive.
+	* io.c (argf_write): add ARGF.write and so on.
 
-Tue Nov 25 16:41:33 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* io.c (argf_read_nonblock): add ARGF.read_nonblock.
 
-	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
-	  removed.  this test requires extra libraries in soap4r/1.5.*.
+Thu Nov 11 21:49:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 25 16:24:42 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/rdoc/stats.rb (RDoc#print): get rid of NaN.
 
-	* lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
-	  GPL2 -> Ruby's.
+Thu Nov 11 21:47:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
-	  lib/soap/streamHandler.rb: add interface to streamhandler.
+	* common.mk (SHOWFLAGS): show compile flags.
 
-	* lib/soap/marshal.rb: raise error if parse fails.
+	* common.mk: hide long command lines by default.  verbose-mode is
+	  turned on by V=1 as before.
+	  http://jarp.does.notwork.org/diary/200605b.html#200605121
 
-	* lib/soap/netHttpClient.rb: add https support.  Patched by
-	  Oliver M. Bolzer.
+Thu Nov 11 21:32:09 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
+	* lib/mkmf.rb (try_func): accept variable address.
 
-	* lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
-	  lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
-	  using charset for parsing response from buggy server.
+	* ext/win32ole/extconf.rb: libuuid is needed on cygwin.
 
-	* lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
-	  typed multi-ref array.
+Thu Nov 11 21:24:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
-	  SOAPStruct which has multi-accessors which name are the same, to an
-	  array.
+	* file.c (file_expand_path): use cygwin_conv_path on cygwin 1.7 or
+	  later.
 
-	* lib/soap/rpc/element.rb: fixed illegal parameter order.
+	* ruby.c (push_include_cygwin): ditto.
 
-	* lib/soap/rpc/element.rb: element name of response message could have
-	  the name other than 'return'.
+Thu Nov 11 20:49:48 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
-	  lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
-	  lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
-	  fault definition in a operation. [ruby-talk:84948]
+	* include/ruby/ruby.h (PRI_LL_PREFIX): format type specifier for
+	  LONG_LONG may vary on platforms.
 
-	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
-	  test for above fix.
+Thu Nov 11 20:45:23 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/wsdl/soap/complexType.rb: support WSDL array definition with
-	  maxOccures="unbound".
+	* configure.in (SYMBOL_PREFIX): separate from EXPORT_PREFIX.
 
-	* lib/xsd/charset.rb: use cp932 under emx.  Patched by
-	  Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
+	* win32/mkexports.rb (Exports#each_export): use SYMBOL_PREFIX.
 
-	* lib/xsd/xmlparser/parser.rb: set @charset nil by default.  Nil means
-	  'follow encoding declaration in XML'.
+Wed Nov 10 07:20:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
-	  sample/wsdl/googleSearch/sampleClient.rb,
-	  sample/wsdl/googleSearch/wsdlDriver.rb,
-	  test/wsdl/test_emptycomplextype.rb,
-	  test/wsdl/marshal/test_wsdlmarshal.rb,
-	  test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
-	  instead of File.open(...).read. [ruby-dev:21964]
+	* cygwin/GNUmakefile.in (scriptbin): make executable file from
+	  scripts with stub.
 
-	* test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
-	  simplify the test case.
+	* ruby.c (load_file_internal): assume xflag for exe file as well
+	  as no-shebang file.
 
-	* test/wsdl/axisArray/*: add tests for axis's array encoding.
+	* tool/rbinstall.rb: install script programs.
 
-Tue Nov 25 16:15:29 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* win32/mkexports.rb (Exports#initialize): alias ruby_sysinit for
+	  stub.
 
-	* ruby.h: don't treat Cygwin as Windows.
+	* win32/stub.c: stub for scripts.  [EXPERIMENTAL]
 
-Tue Nov 25 15:18:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Nov  9 21:57:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in: change default value of --enable-pthread (default: no)
+	* dln.c (init_funcname): allocate and build initialization
+	  funciton name at once.
 
-Tue Nov 25 07:31:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov  9 21:14:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (primary): allow newlines just before right argument
-	  parenthesis.  (ruby-bugs:PR#1221)
+	* configure.in (AC_FUNC_GETPGRP, AC_FUNC_SETPGRP): no need when
+	  not used.
 
-Mon Nov 24 23:32:06 2003  Tanaka Akira  <akr@m17n.org>
+	* configure.in (EXPORT_PREFIX): check generic prefix.
 
-	* lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
-	  catch/throw for redirection instead of exception.
-	  (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
+Tue Nov  9 13:24:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Nov 24 19:59:48 2003  Tanaka Akira  <akr@m17n.org>
+	* regenc.c (onigenc_minimum_property_name_to_ctype):
+	  \p{...} should be case insensitive. [ruby-core:33000]
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
-	  instead of HTTP_PROXY in the CGI environment.
-
-Mon Nov 24 19:32:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/etc/extconf.rb: check for pw_passwd in struct passwd and
-	  gr_passwd in struct group for DJGPP.
-
-	* ext/etc/etc.c: ditto.
-
-	* ext/Setup.dj: support for curses, etc, zlib.
-
-Mon Nov 24 17:00:00 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb: validate option names.
-	  :content_length_proc and :progress_proc option implemented.
-
-Mon Nov 24 14:53:10 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
-
-Sat Nov 22 23:09:45 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: set enable_pthread to no on MinGW.
-
-Sat Nov 22 22:56:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: add --enable-pthread option (default: yes)
-
-Sat Nov 22 22:48:46 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
-
-	* ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
-
-	* ext/tk/sample/tkcombobox.rb: new sample script
-
-	* ext/tcltklib/tcltklib.c: add native thread check
-
-Sat Nov 22 18:49:47 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
-	  libcruses returns no value, just like keypad().
-
-Sat Nov 22 17:36:36 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (HAVE_GETCWD): output to config.h.
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): output to config.status.
-
-Sat Nov 22 13:10:10 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
-
-Sat Nov 22 11:28:48 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (Init_stack): stack region is far smaller than usual if
-	  pthread is used.
-
-Sat Nov 22 07:30:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
-	  when an exception had no backtrace.
-
-	* test/testunit/util/test_backtracefilter.rb: ditto.
-
-Fri Nov 21 16:44:18 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
-	  substitutions on validatecommand option of TkEntry widget
-
-	* ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
-
-Fri Nov 21 16:12:11 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ruby.1: Fix markups and grammar.
-
-Fri Nov 21 14:49:42 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* ruby.1: wrote about ruby related environment variables.
-
-Fri Nov 21 12:28:03 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_extended): singleton methods should not be checked
-	  when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
-
-Fri Nov 21 01:40:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: check <pthread.h>
-
-	* ruby.h: include pthread.h if existence.
-	  define is_ruby_native() macro when not HAVE_NATIVETHREAD
-
-	* eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
-
-Fri Nov 21 00:43:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: use #__send__ instead of #send.
-
-	* lib/test/unit/testcase.rb: ditto.
-
-Thu Nov 20 19:19:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: don't find the Cygwin's pthread library on MinGW.
-
-Thu Nov 20 19:15:50 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
-	  have st_ino (always 0). [ruby-dev:21972]
-
-	* lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
-	  allow overwriting files by rename(2).
-
-	* test/fileutils/test_fileutils.rb: windows? ->
-	  have_drive_letter?, have_file_perm?
-
-Thu Nov 20 17:50:58 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkballoonhelp.rb: new sample script
-
-	* ext/tk/sample/tkmultilistbox.rb: ditto
-
-	* ext/tk/sample/tktextframe.rb: ditto
-
-Thu Nov 20 13:37:34 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ruby.h: define is_ruby_native_thread() for no native thread
-	  environment
-
-	* eval.c: ditto
-
-Thu Nov 20 12:42:47 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: always check existence of the pthread library
-
-	* ruby.h: define macros for ruby's native thread check
-
-	* eval.c: add ruby's native thread check
-
-	* gc.c: ditto
-
-Wed Nov 19 14:45:18 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (to_ary): print more friendly warning message.
-
-Wed Nov 19 14:32:08 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_same?): add djgpp and wince.
-
-	* lib/fileutils.rb (cannot_overwrite_file?): add wince.
-
-Wed Nov 19 11:04:47 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
-	  is same as mswin32.
-
-Wed Nov 19 07:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit.rb: do not run tests if $! is set.
-
-	* lib/test/unit/assertionfailederror.rb: extend StandardError instead
-	  Exception (irb catches the former but not the latter).
-
-Tue Nov 18 23:31:36 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* missing/memmove.c (memmove): take void *, not char *.
-
-	* missing.h (memmove): ditto.
-
-	* missing.h (strchr, strrchr): return char *, not int.
-
-Tue Nov 18 22:20:10 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_same?): temporal fix for windows.
-
-Tue Nov 18 19:05:04 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_same?): check by inode instead of path
-	  name, to detect two hard links pointing to the same content.
-
-	* test/fileutils.rb: did not create correctly looped symlinks.
-
-Tue Nov 18 18:23:05 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): behave as IO at empty string.
-	  [ruby-dev:21939], [ruby-dev:21941]
-
-	* ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
-
-	* ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
-	  clear EOF flag.
-
-	* test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
-
-Tue Nov 18 14:06:35 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
-	  [ruby-talk:85344] [ruby-core:01699]
-
-	* lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
-	  e.g. remote objects for receivers.
-
-	* lib/fileutils.rb: FileTest -> File.
-
-	* lib/fileutils.rb: put parentheses for arguments of File.xxxx?
-
-	* test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
-
-	* test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
-
-	* test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
-
-	* test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
-
-	* test/fileutils/test_fileutils.rb (test_install): test "install a a".
-
-	* test/fileutils/fileasserts.rb: new method assert_symlink.
-
-	* test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
-
-Mon Nov 17 19:38:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (getcwdofdrv): avoid using getcwd() directly, use
-	  my_getcwd() instead.
-
-	* merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
-	  <sunshine@sunshineco.com>.  [ruby-core:01596]
-
-Mon Nov 17 10:50:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Completion::complete): allow least
-	  common completion for three or more candidates.
-
-Mon Nov 17 09:41:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/ui/tk/testrunner.rb,
-	  lib/test/unit/ui/gtk/testrunner.rb:
-	  run GUI main loop in sub thread.
-
-	* lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
-
-	* lib/test/unit/autorunner.rb (keyword_display): sort keywords.
-
-Sun Nov 16 18:10:57 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): iterator should return value from next inside
-	  begin/rescue/end.  (ruby-bugs:PR#1218)
+	* regenc.c (onigenc_property_list_add_property):
+	  ditto.
 
-Sun Nov 16 13:26:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/euc_jp.c (init_property_list, property_name_to_ctype):
+	  to lowercase property names.
 
-	* marshal.c (w_object): LINK check earlier than anything else,
-	  i.e. do not dump TYPE_IVAR for already dumped objects.
-	  (ruby-bugs:PR#1220)
+	* enc/shift_jis.c (init_property_list, property_name_to_ctype):
+	  ditto.
 
-	* eval.c (rb_eval): call "inherited" only when a new class is
-	  generated; not on reopening.
+Tue Nov  9 13:29:36 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (eval): prepend error position in evaluating string to
-	  "mesg" attribute string only when it's available and is a
-	  string.
+	* win32/win32.c (overlapped_socket_io): get rid of a warning of 64bit
+	  mingw.
 
-Sun Nov 16 12:16:10 2003  Minero Aoki  <aamine@loveruby.net>
+Tue Nov  9 10:44:19 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/net/protocol.rb: logging response body. [experimental]
-	  [ruby-list:38800]
+	* util.c (ruby_strtod): this code uses FPU's rounding system.
+	  But x86's FPU calculates double precision floating-point
+	  numbers in 80bit precision, so it fails to round the value.
+	  So ensure the value is assigned a variable. [ruby-dev:42551]
+	  see also [ruby-math:00802]
+	  http://www.shudo.net/java-grandprix99/strictfp/
 
-Sun Nov 16 10:49:38 2003  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Tue Nov  9 07:30:15 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/thread.rb (Thread.exclusive): wrap method definition in
-	  class Thread to enable rdoc to process.
+	* error.c (rb_syserr_new): new function to make SystemCallError
+	  instance without errno.  [EXPERIMENTAL]
 
-Sun Nov 16 09:45:23 2003  Minero Aoki  <aamine@loveruby.net>
+	* error.c (rb_syserr_fail, rb_mod_syserr_fail): ditto.
 
-	* lib/net/http.rb (set_debug_output): warn if method is called
-	  after #start.  [ruby-dev:38798]
+Tue Nov  9 05:54:57 2010  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Sun Nov 16 04:41:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/*.rb: Remove unused variable warnings.
+	  Patch by Run Paint [ruby-core:30991]
 
-	* eval.c (eval): do not re-raise exception to avoid unnecessary
-	  exception copying, instead modify exception and internal
-	  information to adjust eval().
+	* lib/rubygems/*, lib/rdoc/*.rb, lib/rake/*.rb: ditto
 
-	* eval.c (backtrace): can return the current frame information
-	  only if lev < -1.
+Mon Nov  8 18:26:03 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Nov 15 22:16:42 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* util.c (ruby_hdtoa): fix type cast and bufsize.
 
-	* /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
-	  refine error message.
+Mon Nov  8 15:40:56 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Nov 15 10:05:40 2003  Tanaka Akira  <akr@m17n.org>
+	* vsnprintf.c (BSD_vfprintf): fix precision specifier doesn't
+	  work well on %f. [ruby-dev:42552]
 
-	* lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
-	  refactored to support options.
-	  (Buffer): maintain size by this class.
+Mon Nov  8 14:41:40 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Nov 15 07:40:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/win32.c (get_wsa_extension_function): typos.
 
-	* eval.c (rb_method_node): new API to retrieve method body.
+Mon Nov  8 13:41:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Nov 14 13:21:30 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* tool/enc-unicode.rb,
+	  enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+	  enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+	  Add Age property to regexp. [ruby-core:33019]
+	  patched by Ammar Ali, tested by Run Paint Run Run
 
-	* ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
+Mon Nov  8 12:16:39 2010  Ben Walton  <bwalton@artsci.utoronto.ca>
 
-	* ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
-	  argument [ruby-talk:85066]
+	* configure.in: support -h for solaris linker when gcc not used
 
-Thu Nov 13 20:53:35 2003  Tanaka Akira  <akr@m17n.org>
+Mon Nov  8 11:47:39 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
-	  [ruby-ext:02251]
+	* win32/win32.c (finish_overlapped_socket): refactoring.
 
-Thu Nov 13 19:17:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Nov  8 11:02:21 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
-	  (if available)
+	* win32/win32.c (get_proc_address): refactoring.
 
-Thu Nov 13 17:56:41 2003  Tanaka Akira  <akr@m17n.org>
+	* win32/win32.c (get_wsa_exetinsion_function): refactoring.
 
-	* lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
-	  reported by Take_tk <ggb03124@nifty.ne.jp>.
-	  [ruby-ext:02245]
+Mon Nov  8 09:45:35 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Nov 13 16:45:53 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* enc/trans/gbk-tbl.rb: Add euro sign. [ruby-core:33094]
+	  CP936, which is de facto definition of GBK, has it.
+	  http://msdn.microsoft.com/en-us/goglobal/cc305153.aspx
 
-	* ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
-	  X509::Request#to_der.
+Mon Nov  8 07:26:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov 13 11:31:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: check only the first symbol to get rid of
+	  duplication.  [ruby-core:33084] #4031
 
-	* lib/optparse.rb (OptionParser::Completion#complete): prior shorter
-	  name to containing longer name.
+Sun Nov  7 10:13:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov 13 06:08:54 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* configure.in (NM): check on all platforms.  #4031
 
-	* ext/tk/lib/tk.rb: stop freezing some classes
+Sun Nov  7 06:16:33 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+	* test/openssl/test_ocsp.rb: adding test for r29699.  Thanks Elise
+	  Huard! [ruby-core:32460]
 
-Wed Nov 12 17:32:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Nov  6 07:33:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
-	  uncaught throw in sub thread raises ThreadError.
+	* configure.in (rb_cv_export_prefix): check for prefixed
+	  underscore of exported symbols
 
-	* lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
+	* tool/rbinstall.rb (bin-comm): prepend prolog shell script if
 	  necessary.
 
-Wed Nov 12 14:09:43 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/monitor/test_monitor.rb: fix the timing problem by Queue.
-
-Wed Nov 12 12:59:44 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/monitor/test_monitor.rb: added.
-
-Wed Nov 12 10:14:28 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
-
-Wed Nov 12 06:11:39 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
-	  add functions to convert STACK into Array.
-
-	* ext/openssl/ossl.h: add prototypes.
-
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
-	  ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
-	  ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
-	  PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
-
-Wed Nov 12 00:47:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
-
-Tue Nov 11 23:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
-	  the case when the requested font is not available.
-
-Tue Nov 11 22:44:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (appendline): file may not end with newline.  a bug if
-	  READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
-
-Tue Nov 11 10:42:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: raise an exception when creating TkWindow
-	  object, because TkWindow class is an abstract class.
-
-Tue Nov 11 03:30:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
-	  if the specified value doesn't exist.
-
-	* lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
-	  a empty hash if the specified section doesn't exist.
-
-Mon Nov 10 11:40:29 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb (wait): return true on signal/broadcastfalse and
-	  false on timeout. Thanks Gennady Bystritsky.
-
-Mon Nov 10 00:07:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): primary_value may be 0 when syntax error.
-	  [ruby-talk:84893]
-
-Sun Nov  9 02:05:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
-	  maintain symmetry with #assert_nil. Also added better output for
-	  #assert_kind_of.
-
-	* test/testunit/tc_assertions.rb: ditto.
-
-Sat Nov  8 18:50:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
-	  reading.
-
-	* test/soap/marshal/*: backport from soap4r/1.5.1.  all differences are
-	  for ruby/1.6.
-
-	* lib/soap/*: backport from soap4r/1.5.1.  all differences are for
-	  ruby/1.6.
-
-	* lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
-	  ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
-	  [ruby-talk:84813]
-
-	* lib/wsdl/soap/definitions.rb: element name typo in custom exception
-	  struct definition which is needed for wsdlDriver; camelCase ->
-	  underscore_name.
-
-Sat Nov  8 13:49:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: improvement of pthread check
-
-Sat Nov  8 13:28:46 2003  Takaaki Tateishi  <ttate@ttsky.net>
-	* ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
-	  Thanks, Kaoru Shirai.
-
-Sat Nov  8 06:19:38 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
-	  TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
-	  (queueing a handler to the EventQueue).
-
-	* ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
-
-Fri Nov  7 23:23:04 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#+): if self or the argument is `.', return
-	  another.
-	  (Pathname#parent): if self is `.', return `..'.
-	  (Pathname#children): if self is `.', don't prepend self for a
-	  pathname in a result.
-	  (Pathname#join): re-implemented using Pathname#+.
-	  (Pathname#find): if self is `.', remove `./' prefix of yielding
-	  pathname.
-
-Fri Nov  7 10:23:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
-	  lookup failure.  (ruby-bugs:PR#1215)
-
-Fri Nov  7 04:08:05 2003  UENO Katsuhiro  <katsu@blue.sky.or.jp>
-
-	* ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
-	  an alias of Zlib::GzipReader#each.
-
-Fri Nov  7 01:03:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_load): save and restore rb_prohibit_interrupt.
-	  [ruby-dev:21857]
-
-Thu Nov  6 18:05:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_inspect): show the path also at a closed file.
-	  [ruby-dev:21851]
-
-Thu Nov  6 11:42:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_set_string, strio_reopen): check
-	  tainted.
-
-	* ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
-	  strio_putc): add infection.
-
-	* ext/stringio/stringio.c (strio_path): just nil.  [ruby-dev:21846]
-
-	* ruby.c (proc_options): reserve searched script path in the
-	  source file name table.  [ruby-list:38765]
-
-	* lib/optparse.rb (OptionParser::Completion#complete): default not to
-	  ignore case on completion.  [ruby-talk:84726]
-
-	* win32/win32.c (make_cmdvector): process backslashes even if a quote
-	  is not enclosed.
-
-Wed Nov  5 23:49:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* sample/openssl/gen_csr.rb: there (at least) is a CA which does not
-	  accept DN in UTF8STRING format.  it's a sample.
-
-Wed Nov  5 22:55:16 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in, eval.c, signal.c: : add '--with-pthread-ext'
-	  option to fix the pthread trouble on 'tcltklib'
-
-	* ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
-
-	* ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
-	  to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
-
-	* ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
-	  tk_menuSetFocus
-
-Wed Nov  5 17:33:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_load): allow interrupt during loaded program
-	  evaluation.  [ruby-dev:21834]
-
-	* hash.c (rb_hash_fetch): always warn if default argument and a
-	  block are supplied at the same time. [ruby-dev:21842]
-
-	* hash.c (env_fetch): ditto.
-
-	* array.c (rb_ary_fetch): ditto.
-
-Wed Nov  5 19:08:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
-	  do not remove next argument if empty value is placed.
-
-	* test/optparse: added.
-
-Wed Nov  5 17:05:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/ui/gtk/testrunner.rb: typo.
-
-Wed Nov  5 11:13:32 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* string.c: add #include "version.h". this file still depends on it.
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
-	  wince/Makefile.sub: add version.h dependency to string.c.
-
-Wed Nov  5 09:14:23 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: revert to the previous revision.
-
-Wed Nov  5 08:39:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
-
-	* lib/webrick/https.rb (HTTPRequest#meta_vars): create
-	  SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
-	  if no cert-chain was given.
-
-Tue Nov  4 23:44:48 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
-	  remove needless version.h dependency.
-
-Tue Nov  4 23:38:43 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* class.c, hash.c, string.c: remove #include "version.h".
-
-	* Makefile.in: remove needless version.h dependency.
-
-Tue Nov  4 06:54:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (read_all): fptr->f may be NULL, if IO is closed in the
-	  signal handler.
-
-	* io.c (io_read): ditto.
-
-	* string.c (get_pat): remove 1.8.0 warning code.
-
-	* string.c (rb_str_match): extend warning until 1.8.2.
-
-	* string.c (rb_str_match2): ditto.
-
-	* class.c (class_instance_method_list): remove 1.8.0 warnings.
-	  method_list now recurs.  [ruby-dev:21816]
-
-	* class.c (rb_obj_singleton_methods): ditto.
-
-	* array.c (rb_ary_select): remove select with block.
-	  [ruby-dev:21824]
-
-	* hash.c (rb_hash_select): ditto.
-
-	* hash.c (env_select): ditto.
-
-	* re.c (match_select): ditto.
-
-	* struct.c (rb_struct_select): ditto.
-
-Mon Nov  3 22:53:21 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/racc/parser.rb: synchronize with Racc 1.4.4.
-
-	* ext/racc/cparse/cparse.c: ditto.
-
-	* ext/racc/cparse/cparse.c (parse_main): should abort when
-	  the length of LR state stack <=1, not ==0.
-
-Mon Nov  3 08:50:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (check_uid_switch): remove duplicated error messages.
-
-	* process.c (check_gid_switch): ditto.
-
-Sun Nov  2 02:28:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/ssl.rb: new option :SSLExtraChainCert.
-
-Sun Nov  2 01:02:04 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* string.c (rb_str_hash): Update the HASH_PERL alternative hash
-	  algorithm in sync with Perl 5.8.
-
-	* st.c (strhash): Ditto.
-
-Sat Nov  1 18:21:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
-	  SSLSocket#peer_cert_chain.
-
-	* ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
-	  which returns underlying X509_REQ.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
-	  ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
-	  ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
-	  use underlying C struct without duplication not to leak momory.
-
-Sat Nov  1 01:49:03 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/mapping/factory.rb: mark marshalled basetype objects when
-	  @allow_original_mapping is true.  multi-referencing basetype node is
-	  prohibited in SOAP/1.1 encoding but soap4r's original ruby object
-	  mapping requires basetype to be marked to detect self referencing
-	  loop.  e.g. o = 1; o.instance_eval { @iv = o }  soap4r's original
-	  mapping is only used through soap/marshal API.
-
-	* test/soap/marshal/test_marshal.rb: add tests for self referencing
-	  immutable objects.
-
-	* test/soap/calc/test_calc_cgi.rb: fix test name.
-
-Fri Oct 31 22:26:29 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
-
-	* wince/string_wce.c (strrchr): should decrement pointer.
-
-	* wince/Makefile.sub: correct a range of isdigit().
-
-Fri Oct 31 12:55:24 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
-	  [ruby-dev:21791]
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
-
-Fri Oct 31 01:38:14 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
-	  at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
-
-Fri Oct 31 01:02:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* compar.c (cmp_equal): protect exceptions from <=> comparison
-	  again.  returns nil if any exception or error happened during
-	  comparison.
-
-	* eval.c (search_required): should update *featurep when DLEXT2 is
-	  defined. (ruby-bugs-ja:PR#581)
-
-Thu Oct 30 23:41:04 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: add DRbArray
-
-	* lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
-
-	* lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
-
-Thu Oct 30 23:19:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/generator.rb: better XML pretty printing.
-
-	* lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
-	  assignment in the element which has "encodingStyle" attribute, and
-	  add necessary namespace assignment for "arrayType" attribute.
-
-	* test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
-	  through CGI.
-
-Thu Oct 30 22:59:39 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/yaml2byte.c: HASH const too long.  Thanks, matz.
-
-Thu Oct 30 19:13:53 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/syck/MANIFEST: Add yamlbyte.h.
-
-Thu Oct 30 14:25:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
-	  buffer filled.
-
-	* io.c (rb_io_fptr_cleanup): move path deallocation to
-	  rb_io_fptr_finalize (finalizer called by GC).
+	* configure.in (LIBRUBY_RELATIVE): use rpath token expansion.
 
-Thu Oct 30 13:23:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Nov  6 07:24:01 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (logop): left may be NULL. [ruby-talk:84539]
+	* template/ruby.pc.in (arch, sitearch): reordered.
 
-	* eval.c (rb_eval): NODE_CASE nd_head may be NULL.
+	* configure.in: keep failed file.
 
-Thu Oct 30 10:14:51 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sat Nov  6 07:03:49 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/autorunner.rb: make fox runner work.
+	* process.c (rb_fork_err): save errinfo before fdopen.
 
-Thu Oct 30 09:32:26 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Nov  6 00:43:58 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* process.c (rb_f_system): fixed lack of security check before
-	  calling do_spawn() on win32. [ruby-talk:84555]
+	* ext/openssl/ossl_ocsp.c (ossl_ocspcid_initialize): an optional
+	  parameter may be used to specify the OpenSSL::OCSP::CertificateId on
+	  initialization.  Thanks Elise Huard! [ruby-core:32460]
 
-Thu Oct 30 02:46:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Nov  5 12:23:01 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (proc_invoke): single array value to normal Proc#call
-	  (i.e. not via lambda call), should be treated just like yield.
-	  [ruby-dev:21726]
+	* test/ruby/test_{process,system}.rb (test_fallback_to_sh):
+	  meaningless and wrong tests where /bin/sh does not exist.
 
-Thu Oct 30 02:25:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* process.c (proc_spawn_v): should spawn, not exec.
 
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
-	  add new method to inherit @sync from @io.sync.
+Fri Nov  5 01:21:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
-	  set sync flag explicitly.
+	* process.c (proc_exec_v, proc_spawn_v): try to execute with sh if
+	  no shebang.  [ruby-core:32745] [EXPERIMENTAL]
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
+Fri Nov  5 00:39:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
-	  certificates in @extra_chain_cert.
+	* io.c (rb_io_readlines, rb_io_each_line): limit must not be zero.
+	  a patch from Tomoyuki Chikanaga at [ruby-dev:42538].  #4024
 
-Wed Oct 29 22:02:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Nov  5 00:14:15 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
-	  interpreter to exec, instead of test/ruby/envutil.rb,
+	* ext/fiddle/extconf.rb: fixing ffi library location on windows.
+	  Thanks Usa! [ruby-core:32930]
 
-Wed Oct 29 19:58:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Nov  4 20:04:44 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
-	  defined and TCL_MAJOR_VERSION >= 8.
+	* gc.c (rb_newobj): force garbage_collect() if GC.stress == true.
 
-	* ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
-	  rb_threadVwaitProc): use CONST84 instead of CONST.
+Thu Nov  4 19:48:22 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
-	  ip_rb_threadTkWaitCommand): use CONST84 always.
+	* ChangeLog: missed to write a last ChangeLog.
 
-Wed Oct 29 17:27:05 2003  Tanaka Akira  <akr@m17n.org>
+	* gc.c (gc_finalize_deferred): removed.
 
-	* re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
+	* gc.c (rb_gc_finalize_deferred): Do not invoke a free_unused_heaps().
 
-	* lib/pathname.rb (realpath): examine Dir.pwd because it may have
-	  symlinks.
+Thu Nov  4 19:45:27 2010  Koichi Sasada  <ko1@atdot.net>
 
-Wed Oct 29 17:16:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (run_final): do not need argument obj.
 
-	* eval.c (rb_longjmp): must not disturb original jump.
-	  [ruby-dev:21733]
+Thu Nov  4 19:26:10 2010  Koichi Sasada  <ko1@atdot.net>
 
-Wed Oct 29 15:28:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (before_gc_sweep): fix commit miss.
 
-	* eval.c (Init_Proc): taint preallocated exception object
-	  sysstack_error. [ruby-talk:84534]
+Thu Nov  4 19:20:46 2010  Koichi Sasada  <ko1@atdot.net>
 
-Wed Oct 29 11:27:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (after_gc_sweep, before_gc_sweep):
+	  invoke rb_sweep_method_entry() as soon as possible.
 
-	* parse.y (ret_args): node may be NULL. [ruby-talk:84530]
+Thu Nov  4 19:13:58 2010  Koichi Sasada  <ko1@atdot.net>
 
-Tue Oct 28 15:20:12 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* gc.c (after_gc_sweep, slot_sweep): finalizers should be invoked
+	  as soon as possible.
 
-	* ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
-	  WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
-	  ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
-	  rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
-	  ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
-	  avoid VC++ warnings.
+Thu Nov  4 10:30:40 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Mon Oct 27 19:19:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (--with-valgrind): Now this option is default on.
+	  You can still explicitly disable this feature by specifying
+	  --without-valgrind.
 
-	* eval.c (rb_longjmp): ignore reentering error while warning.
-	  [ruby-dev:21730]
+Thu Nov  4 02:06:16 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Mon Oct 27 00:23:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* cont.c (fiber_t_alloc): raise an error when fiber is going to be
+	  initialized twice.  [ruby-dev:42524]
 
-	* ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
-	  calling 'exit' in the Tk callback procedure. [ruby-list:38656]
+Thu Nov  4 02:04:25 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Sat Oct 25 09:18:04 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* cont.c (rb_fiber_resume): raise an "double resume" error when root
+	  fiber is going to be resumed.  [ruby-dev:42523]
 
-	* eval.c (rb_method_missing): protect exception from within
-	  "inspect".  (ruby-bugs:PR#1204)
+Wed Nov  3 14:17:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 24 23:26:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/ostruct.rb (OpenStruct#delete_field): also undefine
+	  accessor methods.  [ruby-core:33010]
 
-	* hash.c (rb_hash_each): Hash#each should yield single value.
-	  [ruby-talk:84420]
+Wed Nov  3 14:13:46 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (env_each): ditto for ENV.each.
+	* string.c (rb_enc_cr_str_buf_cat): concatenation of valid
+	  encoding string and invalid encoding string should result
+	  invalid encoding.  [ruby-core:33027]
 
-Thu Oct 23 20:25:32 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Nov  3 08:58:59 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  IOError from IO::accept. [ruby-dev:21692]
+	* gc.c, vm.c, vm_core.h: remove USE_VALUE_CACHE option.
 
-Thu Oct 23 17:59:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov  3 07:47:25 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* eval.c (ruby_cleanup): initialize stack bottom for embedding.
-	  [ruby-dev:21686]
+	* lib/irb/ruby-lex.rb (RubyLex#identify_string): parse multiple
+	  regex options.  a patch from Heesob Park in [ruby-core:32988].
 
-	* ext/dl/extconf.rb: move list of files to clean from DEPEND file,
-	  to get rid of macro redefinitions.
+Wed Nov  3 07:33:57 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Oct 23 13:44:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_method.c (rb_clear_cache_by_class): just return if the class has
+	  no method.  reported by Eric Wong.  [ruby-core:32689]
 
-	* parse.y: integrate operations for stack_type.  [ruby-dev:21681]
+Tue Nov  2 22:50:25 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Thu Oct 23 00:41:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/visitor.rb (initialize): push accessor
+	  methods to subclass that actually uses them.
 
-	* test/soap/calc/*, test/soap/helloworld/*: set logging threshold
-	  to ERROR.
+Tue Nov  2 22:47:08 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Wed Oct 22 12:53:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/visitor.rb (accept): switch to
+	  a dispatch cache rather than case / when statement.
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  ignore tests which raised LoadError.
+Tue Nov  2 21:46:52 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
-	  test/ruby/test_system.rb: avoid requiring same file twice.
+	* NEWS: fix a typo.
 
-	* test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
-	  ARGV unless invoked directly.  do not create test cases unless
-	  required libraries are available.
+Tue Nov  2 20:10:32 2010  Tajima Akio <artonx@yahoo.co.jp>
 
-Wed Oct 22 02:31:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rake/test_tasks.rb: clear env var which is used by the test.
+	  [ruby-dev:42508]
 
-	* eval.c (ruby_cleanup): should not ignore exit_value in END
-	  execution. [ruby-dev:21670]
+Tue Nov  2 00:25:54 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Oct 21 23:16:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/extconf.rb: win64 is just same with win32 about socket.
+	  notice: but wince is not same.
 
-	* eval.c (ruby_cleanup): call finalizers and exit procs before
-	  terminating threads.
+Mon Nov  1 21:25:57 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
+	* main.c: <stdlib.h> is needed, to introduce the getenv(3)
+	  prototype declaration.  Without it a C compiler shall infer
+	  the getenv type as "int getenv(...);", but this is totally
+	  wrong, especially when your machine's sizeof(int) and
+	  sizeof(char*) differs.  On such environment a return value
+	  of getenv(3), which is in fact a char*, might first casted
+	  into a int (loses data here), and then casted back to char*
+	  by automatic integral promotion to fit to the prototype of
+	  ruby_set_debug_option().
 
-Tue Oct 21 15:57:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Oct 31 23:27:09 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  prepend the directory of target file to the load path.
+	* gc.c (finalizer_table, objspace->final.table):
+	  Create finalizer_table at Init_heap().
+	  Remove all null checks of finalizer_table.
 
-Tue Oct 21 15:08:53 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* gc.c (mark_tbl): skip if no table entries.
 
-	* win32/win32.c (do_spawn, do_aspawn): should wait child process even
-	  if callded with P_OVERLAY.
+	* gc.c (slot_swee): remove useless need_call_final check.
 
-	* win32/win32.c (do_spawn, do_aspawn): should return child's exit
-	  status to parent.
+Sun Oct 31 22:32:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 21 00:35:02 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* gc.c (rb_objspace_free): finalizers should be called separately
+	  from freeing objspace.  [ruby-dev:42479]
 
-	* test/soap/calc/*, test/soap/helloworld/*: catch the exception from
-	  test server thread and recover.
+Sun Oct 31 22:24:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 21 00:22:57 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* eval.c (ruby_cleanup): free current VM and its objspace even
+	  when exiting by SystemExit.
 
-	* test/drb/*: import drb/runit.
+Sun Oct 31 22:10:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 20 23:55:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (new_child_iseq): adjust argument types.
 
-	* eval.c (rb_eval): set current node after arguments evaluation.
-	  [ruby-dev:21632]
+	* iseq.c (prepare_iseq_build, rb_iseq_new),
+	  (rb_iseq_new_with_bopt_and_opt, rb_iseq_new_with_opt),
+	  (rb_iseq_new_with_bopt): ditto.
 
-	* eval.c (rb_yield_0): set current node and keep it at local jump.
+	* compile.c (iseq_set_exception_table): suppress warnings.
 
-Mon Oct 20 22:01:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* insns.def (putspecialobject, defined): ditto.
 
-	* eval.c (rb_thread_cleanup): keep thread group for main thread.
-	  [ruby-dev:21644]
+	* iseq.c (iseq_load): ditto.
 
-Mon Oct 20 18:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Oct 31 09:30:51 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_catch): backout.
+	* vm_core.h: some refactoring.
+	  - move decl. of rb_compile_option_struct to iseq.h.
+	  - define enum iseq_type.
+	  - define enum vm_special_object_type.
 
-Mon Oct 20 17:31:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c: some refactoring.
+	  - apply above changes.
+	  - (struct iseq_link_element): change value of type.
+	  - remove unused decl.
+	  - fix comment.
+	  - rename iseq_build_body and iseq_build_exception to
+	    iseq_build_from_ary_body and iseq_build_from_ary_exception.
 
-	* eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
-	  destination.
+	* iseq.h: define enum catch_type and enum defined_type.
 
-	* eval.c (localjump_destination): use unique number in ruby_frame
-	  for localjump destination.
+	* insns.def: apply above changes.
 
-Mon Oct 20 11:31:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* iseq.c: define ISEQ_MAJOR_VERSION and ISEQ_MINOR_VERSION.
 
-	* test/ruby/test_signal.rb (test_signal): restore old trap.
+Sat Oct 30 23:38:59 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon Oct 20 11:00:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rexml/encoding.rb: untabify.
 
-	* gc.c (gc_sweep): loosen page free condition to avoid add_heap()
-	  race condition. [ruby-dev:21633]
+Sat Oct 30 21:06:37 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* gc.c (gc_sweep): do not update malloc_limit when malloc_increase
-	  is smaller than malloc_limit.
+	* lib/rexml/encoding.rb: use Ruby native encoding mechanism.
+	  [ruby-dev:42464]
+	* lib/rexml/encodings/: remove.
 
-Mon Oct 20 09:45:12 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/rexml/document.rb, lib/rexml/formatters/default.rb,
+	  lib/rexml/output.rb, lib/rexml/parseexception.rb,
+	  lib/rexml/parsers/baseparser.rb, lib/rexml/source.rb,
+	  lib/rexml/xmldecl.rb: use Ruby's native Encoding object.
 
-	* lib/debug.rb (debug_command): remove debug print.
+	* test/rexml/, test/rss/: follow the above encoding changes.
 
-Wed Oct 20 00:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* NEWS: add REXML's incompatible change about encoding.
 
-	* eval.c (search_required): required name must not be changed before
-	  loading.  [ruby-dev:24492]
+Sat Oct 30 17:23:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 19 13:12:30 2003  Tanaka Akira  <akr@m17n.org>
+	* util.c (ruby_strtod): get rid of overflow/underflow as possible.
 
-	* lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
+Sat Oct 30 14:37:39 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 19 00:14:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* configure.in (ruby_pc): erase runtime-defined variables and
+	  check if generated pc file is valid.
 
-	* test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
-	  server. (17171)
+	* template/ruby.pc.in (DEFFILE): need for mingw.
 
-Sat Oct 18 23:01:32 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* template/ruby.pc.in (LIBRUBY): fix the order.
 
-	* missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
+Sat Oct 30 11:33:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Oct 18 05:48:59 2003  why the lucky stiff  <why@ruby-lang.org>
+	* win32/Makefile.sub (ruby_pc): ignore missing variables.
 
-	* ext/syck/rubyext.c: YAML::Syck::compile method.
+	* template/ruby.pc.in: add missing variables for mswin.
 
-	* ext/syck/syck.c: Buffer edge bug.
+Sat Oct 30 10:24:35 2010  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/syck/yaml2byte.c: YAML to bytecode converter.
+	* object.c: Make BasicObject.new accept no parameter.
+	  Revert of r26135 [ruby-core:27080], as per [ruby-core:32952].
 
-	* ext/syck/yamlbyte.h: Ditto.
+Sat Oct 30 09:40:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/bytecode.c: Bytecode parser fixes to empty collections
-	  and empty strings.
+	* enum.c: use constants in id.h.
 
-	* ext/syck/token.c: Ditto.
+Sat Oct 30 09:08:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 17 23:07:38 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/fiddle/closure.c (fiddle_closure): embed cif not reference
+	  so that the content surely get initialized.  [ruby-dev:42480]
 
-	* ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
-	  Provide Kernel#to_enum as an alias for Kernel#enum_for.  Maybe
-	  this is a better name.
+Sat Oct 30 07:01:53 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Oct 17 23:00:30 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/resolv-replace.rb: suppress warning.
 
-	* lib/generator.rb: Add rdoc documentation.
+	* lib/open-uri.rb: ditto.
 
-Fri Oct 17 22:16:42 2003  Akinori MUSHA  <knu@iDaemons.org>
+Sat Oct 30 06:32:52 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/set.rb: Reword and fix Overview.
+	* test/pathname/test_pathname.rb (TestPathname#test_grpowned?): the
+	  group of the created file is inherited from the parent
+	  directory on BSDs and MacOS X.  Linux also inherit the group if
+	  the setgid bit of the directory is set.  It causes the test fail.
+	  fixed by Shota Fukumori.  [ruby-dev:42458]
 
-	* lib/set.rb: It is not necessary to require
-	  'test/unit/ui/console/testrunner'.
+Sat Oct 30 05:58:54 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Oct 17 11:15:22 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/resolv.rb: retry via TCP if UDP reply is truncated.
+	  fixed by Julian Mehnle.  [ruby-core:32407]
 
-	* test/ruby/test_range.rb: added.
+Sat Oct 30 00:35:13 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* MANIFEST: add test/ruby/test_range.rb.
+	* iseq.c (iseq_s_compile): fix optional argument.
+	  a patch from Yutaka HARA [ruby-core:32953] [Ruby 1.9-Bug#4001]
 
-Fri Oct 17 03:21:23 2003  William Sobel  <will.sobel@barra.com>
+Sat Oct 30 00:24:42 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/socket.c (make_hostent): h_aliases may be NULL.
-	  (ruby-bugs:PR#1195)
+	* ext/objspace/objspace.c (memsize_of): take care of
+	  T_CLASS/const_tbl.
+	  a patch from nagachika <nagachika00@gmail.com> [ruby-dev:42490]
 
-	* ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
+Fri Oct 29 23:32:36 2010  Koichi Sasada  <ko1@atdot.net>
 
-Fri Oct 17 00:12:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/profile_test_all.rb: added.
+	  You can use test-all profiler with the following command:
+	    RUBY_TEST_ALL_PROFILE=true make test-all
+	  This command generates ./test_all_profile and you can analyze
+	  which tests consume memories.
 
-	* ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
-	  without initializing on TkComposite module.
+	* test/runner.rb: ditto.
 
-Thu Oct 16 23:51:04 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Oct 29 10:02:03 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
-	  in a callback operation, Ruby/Tk shows a (verbose) backtrace
-	  information on the callback process.
+	* tool/enc-unicode.rb,
+	  enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+	  enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+	  Add 'Unknown' Script.
+	  patched by Run Paint Run Run. [ruby-core:32937] #3998
 
-Thu Oct 16 17:09:19 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Oct 29 05:13:34 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
-	  debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
+	* ext/objspace/objspace.c (ObjectSpace.memsize_of_all): rename
+	  ObjectSpace.total_memsize_of_all_objects() to
+	  ObjectSpace.memsize_of_all([klass]).
+	  Accept Class object to filter the objects.
 
-Thu Oct 16 16:54:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/objspace/test_objspace.rb: fix test for above change.
 
-	* string.c (rb_str_upto): ("a"..."a").to_a should return [].
-	  [ruby-core:01634]
+Fri Oct 29 03:04:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Oct 16 16:40:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* string.c (rb_str_dump): fix expected length. [ruby-core:32935]
 
-	* ext/tk/lib/tk.rb:
-	  Add Tk::EncodedString and Tk::UTF8_String class to support
-	  characters using the \uXXXX escape to the UNICODE string.
+Thu Oct 28 23:31:39 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
-	  new demo-scripts (samples of Tk::UTF8_String)
+	* gc.c (before_gc_sweep, run_final): fix decrement timing of final_num.
 
-	* ext/tk/sample/{demos-en,demos-jp}/widget
-	  add entries for 'unicodeout.rb'
+Thu Oct 28 20:11:30 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Oct 16 08:38:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/enc-unicode.rb,
+	  enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+	  enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+	  Update Oniguruma for Unicode 6.
+	  patched by Run Paint Run Run. [ruby-core:32923] #3989
 
-	* test/digest/test_digest.rb (test_eq): show failed class.
+Thu Oct 28 20:06:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/ruby/test_iterator.rb (test_break, test_return_trace_func):
-	  test localjump destination.
+	* include/ruby/oniguruma.h (ONIGENC_CTYPE_SPECIAL_MASK):
+	  change mask from 128 to 256. [ruby-core:32931]
 
-Wed Oct 15 20:22:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Oct 28 12:06:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
-	  instance_eval('path_query').  [ruby-list:38575]
+	* lib/webrick/httprequest.rb (read_request_line): extend max
+	  length to 2083. This is from Internet Explorer's max uri
+	  length. http://support.microsoft.com/kb/208427 [ruby-core:32924]
 
-Wed Oct 15 17:24:45 2003  URABE Shyouhei  <root@mput.dip.jp>
+Thu Oct 28 04:00:08 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/cgi.rb (CGI::Cookie): tiny typo fix.
+	* gc.c (GC.stat): added.  [ruby-dev:38607]
 
-Wed Oct 15 15:00:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_gc.rb: add a test for above.
 
-	* eval.c (ruby_run): just return FAILURE instead of parse error
-	  count.  [ruby-list:38569]
+Thu Oct 28 03:13:06 2010  Koichi Sasada  <ko1@atdot.net>
 
-Wed Oct 15 13:17:02 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/objspace/objspace.c (memsize_of): fix rdoc.
 
-	* ext/digest/digest.c (rb_digest_base_alloc): need to initialize
-	  buffer. [ruby-dev:21622]
+	* ext/objspace/objspace.c (total_memsize_of_all_objects): added.
 
-Wed Oct 15 11:23:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/objspace/test_objspace.rb:
+	  - add a test for ObjectSpace.total_memsize_of_all_objects.
+	  - add two tests for ObjectSpace.memsize_of (for nil and Fixnum).
 
-	* marshal.c (w_object): dump extended modules as well.
+Wed Oct 27 23:55:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
-	  modules before invoking marshal_load.  these two fixes are done
-	  by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
+	* ext/iconv/iconv.c (Init_iconv): warn deprecated use.
 
-Wed Oct 15 09:30:34 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Oct 27 18:50:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
+	* bignum.c (rb_big2long, rb_big2ulong): rb2ulong() returns VALUE, but
+	  its real range is ulong. So, if the size of VALUE is bigger than
+	  ulong, upper bits are always zero even if the actual value is
+	  negative.
+	  fixed #3490
 
-	* ext/syck/syck.h: include stdio.h for definition of FILE.
+Wed Oct 27 18:27:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Oct 15 08:09:07 2003  why the lucky stiff  <why@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#pipe): should close write end of pipe
+	  before closing read end, to get rid of timing problem.
 
-	* ext/syck/bytecode.c: Checkin of YAML bytecode support.
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
 
-	* ext/syck/gram.c: Ditto.
+Wed Oct 27 18:14:27 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/syck/syck.c: Ditto.
+	* win32/win32.c (rb_w32_getppid): support Win64.
 
-	* ext/syck/token.c: Ditto.
+Wed Oct 27 15:07:19 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/syck/handler.c: Ditto.
+	* thread_win32.c (w32_error): should get error no only once, because
+	  the result of the second getting will indicate the error of the
+	  first FormatMessage() call.
 
-	* ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
+Wed Oct 27 13:51:25 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/syck/rubyext.c: Ditto (on both counts).
+	* test/ruby/test_io.rb (TestIO#pipe): need to propagate exceptions
+	  in read/write thread. fix r29541.
 
-Wed Oct 15 05:05:53 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
 
-	* lib/generator.rb: A new library which converts an internal
-	  iterator to an external iterator.
+Wed Oct 27 12:05:40 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/abbrev.rb: A new library which creates an abbreviation table
-	  from a list.
+	* class.c (clone_const): need to return value. fix r29602.
 
-Wed Oct 15 04:31:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Oct 27 11:58:58 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
-	  new demo-scripts
+	* include/ruby/ruby.h (NUM2LONG_internal): add cast to get rid of a
+	  non GCC compiler warning. this is intentional type conversion.
 
-	* ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
-	  add entries for 'entry3.rb'
+Wed Oct 27 09:25:46 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Oct 15 04:31:47 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* cont.c: apply documentation patch by Run Paint Run Run.
+	  [ruby-core:32915]
 
-	* test/digest/test_digest.rb: Moved from ext/digest/test.rb.
+Wed Oct 27 02:12:10 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Wed Oct 15 03:53:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* object.c (Init_Object), constant.h, variable.c
+	  (rb_mod_private_constant, rb_mod_public_constant,
+	  set_const_visibility, rb_const_get_0): add Module#public_constant
+	  and private_constant.  [ruby-dev:39685][ruby-core:32698]
 
-	* ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
-	  on the last commit).
+	* test/ruby/test_module.rb: add tests for above.
 
-Wed Oct 15 00:25:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Oct 27 02:02:54 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* parse.y (yylex): argument parentheses preceded by spaces should
-	  be warned; not error.  [ruby-talk:84103]
+	* class.c, constant.h, gc.c, method.h, object.c, variable.c,
+	  vm_insnhelper.c: use struct rb_constant_entry_t as entry of
+	  RCLASS_CONST_TBL.  RCLASS_CONST_TBL has contained VALUE of constant
+	  directly.  Now instead rb_const_entry_t is contained in
+	  RCLASS_CONST_TBL,  rb_const_entry_t is managed by malloc, and
+	  have not only the value itself but also visibility flag.
+	  This is another preparation for private constant (see
+	  [ruby-dev:39685][ruby-core:32698]).
 
-Wed Oct 15 00:20:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Oct 27 01:56:34 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
-	  switch on threads smoothly and avoid seg-fault.
+	* class.c, gc.c, object.c, variable.c, vm_insnhelper.c,
+	  include/ruby/ruby.h: separate RCLASS_CONST_TBL from RCLASS_IV_TBL.
+	  RCLASS_IV_TBL has contained not only instance variable table but
+	  also constant table.  Now the two table are separated to
+	  RCLASS_CONST_TBL and RCLASS_IV_TBL.  This is a preparation for
+	  private constant (see [ruby-dev:39685][ruby-core:32698]).
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
-	  _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
-	  and tkwait command wait on an eventloop.)
+Tue Oct 26 18:51:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
-	  _thread_tkwait.
+	* lib/scanf.rb (extract_float): allow 2.e+2 style.
+	  [ruby-dev:42452] #3978
 
-	* ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
-	  If 1st argument is true, waits on a thread. If false, waits on
-	  an eventloop. If 2nd argument is true, checks existence of
-	  rootwidgets. If false, doesn't. Default is wait(true, false).
+Tue Oct 26 18:09:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
-	  TkVariable#wait(arg, true). wait_visibility and wait_destroy
-	  have an argument for waiting on a thread or an eventloop.
+	* Makefile.in (ASFLAGS): needs INCFLAGS.
 
-	* ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
+	* configure.in (rb_cv_dynamic_alloca): check if extra source for
+	  dynamic size alloca.
 
-	* ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
-	  an eventloop'.
+	* missing/x86_64-chkstk.s (___chkstk): necessary for alloca of
+	  amd64-mingw32msvc-gcc on Ubuntu.
 
-Wed Oct 15 00:10:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* thread_win32.c (ruby_alloca_chkstk): check stack overflow
 
-	* lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
-	  SOAPBasetype and SOAPCompoundtype.
+Tue Oct 26 18:04:53 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
-	  Encoding methods signature change.  Pass SOAPGenerator as a parameter.
+	* template/ruby.pc.in (Libs): needs DLDFLAGS.
 
-	* lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
-	  for better marshalling/unmarshalling support.  Now I think SOAP
-	  marshaller supports all kind of object graph which is supported by
-	  Ruby's original marshaller.  Of course there could be bugs as always.
-	  Find it.  :-)
+Tue Oct 26 12:47:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
-	  DEBUG is too noisy.
+	* common.mk (pkgconfig-data): moved from Makefile.in.
 
-	* lib/xsd/datatypes.rb: DateTime#of is obsoleted.  Use DateTime#offset.
+	* tool/rbinstall.rb: install pc file only if non-empty.
+	  [ruby-core:32901] #3983
 
-	* test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
-	  useless warning.
+	* win32/Makefile.sub (ruby_pc): create pc file.
 
-Tue Oct 14 19:09:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Oct 26 09:13:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (ruby_finalize_0): return the given exit status unless
-	  SystemExit got raised.
+	* configure.in (rb_cv_gcc_atomic_builtins): check for atomic
+	  builtins, all are not available in Apple derivative gcc.
 
-Tue Oct 14 11:53:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Oct 26 00:29:26 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* intern.h (ruby_stop): never return.
+	* Makefile.in (pkgconfig-data): create pkg-config metadata file.
 
-	* ruby.h (ruby_run): ditto.
+	* tool/rbinstall.rb: install pkg-config metadata file.
 
-Tue Oct 14 04:43:55 2003  Tanaka Akira  <akr@m17n.org>
+	* template/ruby.pc.in: template of pkg-config metadata file.
 
-	* lib/pathname.rb (realpath): make ELOOP check bit more robust.
-	  (children): prepend self by default.
-	  (chroot): obsoleted.
+Mon Oct 25 16:38:07 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Tue Oct 14 02:29:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* signal.c  (rb_atomic_t): GCC (of  at least  recent versions)
+	  has  ubiquitous  support  for  atomic operations.   On  that
+	  compiler a C program can  issue a memory barrier using these
+	  dedicated  instructions.  According to  the GCC  manual they
+	  cargo culted  this feature form  the Itanium ABI  so chances
+	  are that  other compilers  could also support  this feature.
+	  But so far GCC is the  only compiler that I know to have it.
+	  Also note that this works on non-Itanium machines.
 
-	* eval.c (rb_require_safe): segfault after loading .so.
+Mon Oct 25 06:21:35 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 14 02:05:23 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* vsnprintf.c (BSD_vfprintf): prec digits fractal part should be
+	  appended to 0 if prec is given.  [ruby-dev:42453] #3979
 
-	* ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
-	  module for the Enumerable interface.
+Mon Oct 25 02:57:21 2010  Koichi Sasada  <ko1@atdot.net>
 
-Mon Oct 13 23:55:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* common.mk (run.gdb): Quit gdb on 'make gdb' when
+	  no signals are received.
 
-	* test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
-	  not "ruby".
+Mon Oct 25 00:25:23 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Oct 13 23:57:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/date.rb: some corrections of documentation.
 
-	* eval.c (rb_feature_p): match by classified suffix.
+Sun Oct 24 17:14:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_require_safe): require library in the specified safe
-	  level.
+	* array.c, gc.c, hash.c, object.c, string.c, struct.c,
+	  transcode.c, variable.c, vm.c, vm_insnhelper.c, vm_method.c:
+	  replace calls to rb_error_frozen() with rb_check_frozen().  a
+	  patch from Run Paint Run Run at [ruby-core:32014]
 
-	* variable.c (rb_autoload, rb_autoload_load): restore safe level
-	  when autoload was called.  [ruby-dev:21338]
+	* include/ruby/intern.h (rb_check_frozen): optimize.
+	  [ruby-core:32878]
 
-	* intern.h: prototypes; rb_require_safe.
+Sun Oct 24 15:16:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/runner.rb: accept non-option arguments.
+	* lib/test/unit.rb (Test::Unit::Mini#run): abort if interrupted.
 
-Mon Oct 13 20:49:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/test/unit.rb (Test::Unit::Mini#run_test_suites): show the
+	  result even when interrupted on the way.
 
-	* string.c (str_new4): should not preserve FL_TAINT status in the
-	  internal shared string. [ruby-dev:21601]
+	* lib/test/unit.rb (Test::Unit::Mini#run_test_suites): ensure
+	  output sync mode to be restored.
 
-	* string.c (rb_str_new4): ditto.
+Sun Oct 24 14:11:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
+	* vm.c (vm_define_method): defined method is run with the default
+	  public visibility regardless the visibility context of definition.
+	  [ruby-core:30638]
 
-	* process.c: ditto. [ruby-list:38521]
+Sun Oct 24 12:08:54 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Oct 13 19:51:02 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* lib/test/unit.rb: make test/unit play nicely with the rake test
+	  loader. [ruby-core:32864]
 
-	* lib/debug.rb (debug_command): should enter emacs mode when
-	  assigned any value to the environment variable "EMACS".
-	  On Meadow, (getenv "EMACS") is "meadow".
+Sun Oct 24 00:25:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 12 14:45:03 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* test/ruby/test_rubyoptions.rb (test_segv_test): follow up the
+	  change at r29556.
 
-	* ext/win32ole/extconf.rb: check "windows.h", not "windows".
-	  [ruby-talk:84051]
+Sat Oct 23 14:39:58 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Oct 11 20:41:03 2003  Corinna Vinschen  <corinna@vinschen.de>
+	* lib/mkmf.rb: $extmk should be true for test/runner.
 
-	* file.c (eaccess): Use access(2) on Cygwin.
+Sat Oct 23 10:55:37 2010  Koichi Sasada  <ko1@atdot.net>
 
-Sat Oct 11 17:09:21 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* vm_dump.c (rb_vm_bugreport): fix to add bug outputs.
+	  - loaded script ($0)
+	  - loaded features ($")
+	  - process memory map on Linux (/proc/self/maps)
 
-	* lib/rexml/quickpath.rb (REXML::QuickPath::match):
-	  escape '[' to avoid warning.
+	* vm_dump.c (rb_vmdebug_stack_dump_raw): fix header message.
 
-Sat Oct 11 16:08:41 2003  Tanaka Akira  <akr@m17n.org>
+Fri Oct 22 14:50:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/pathname.rb (realpath): check existence of the file.
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  assertion message must not be nil.
 
-	* lib/pathname.rb (realpath): re-implemented.
-	  (realpath_root?, realpath_rec): removed
+Fri Oct 22 13:59:50 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Oct 11 10:19:39 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  treat nil case. Please run test-all before commit such change.
 
-	* lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
-	  Bystritsky.
+Thu Oct 21 23:58:14 2010  Koichi Sasada  <ko1@atdot.net>
 
-Fri Oct 10 07:50:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (gc_lazy_sweep): Variable declarations should be at
+	  the head of block.
 
-	* eval.c (is_defined): inheritance line adjustment as like as
-	  rb_call_super().
+Thu Oct 21 23:56:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 10 01:19:00 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* gc.c (objspace_each_objects, rb_objspace_each_objects): use
+	  struct.
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
-	  optional argument to specify the DirectoryString type
-	  (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
-	  for DirectoryString, and strongly requires to use UTF8String for
-	  all certificates issued after December, 31 2003.
+	* gc.c (objspace_each_objects): fix return with no value.
 
-	* ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
+Thu Oct 21 23:47:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Oct  9 23:50:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (dir_initialize): remove useless intermediate variable.
 
-	* eval.c (rb_thread_start_0): prevent thread from GC.
-	  [ruby-dev:21572]
+Thu Oct 21 16:07:20 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Oct  9 19:11:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_f_select): change rdoc.
+	  patched by Eito Katagiri [ruby-core:31805]
 
-	* eval.c (rb_thread_start_0): non-volatile should be restored from
-	  volatile.
+Thu Oct 21 15:55:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Oct  9 17:43:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_save_safe_level, proc_get_safe_level,
-	  proc_set_safe_level): save/restore safe level 1..4.
-
-Thu Oct  9 16:33:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (r_object0): remove unnecessary iv restoration for
-	  USRMARSHAL. [ruby-dev:21582]
-
-	* marshal.c (w_object): dump generic instance variables from
-	  a string from '_dump'.
-
-	* variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
-	  is not set.
-
-	* time.c (time_dump): copy instance variables to dumped string, to
-	  be included in the marshaled data.
-
-	* bignum.c (rb_big2ulong): add range check to ensure round trip.
-
-Thu Oct  9 15:45:27 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (uv_to_utf8): change message to "out of range", since
-	  negative values are not "too big". [ruby-dev:21567]
-
-Thu Oct  9 14:05:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
-	  [ruby-dev:21557]
-
-Thu Oct  9 10:51:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_yield_0): no error if block is empty.
-
-Thu Oct  9 06:43:33 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (localjump_error): id should be ID.
-
-	* eval.c (rb_eval): nd_rval is set in copy_node_scope().
-
-	* eval.c (rb_yield_0): unused variable.
-
-	* eval.c (rb_yield_0): nothing to do for empty node.
-
-	* eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
-	  [ruby-dev:21551]
-
-	* eval.c (rb_thread_start_0): set the value by break as the result.
-	  [ruby-dev:21552]
-
-	* eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
-	  variables across THREAD_SAVE_CONTEXT.
-
-Thu Oct  9 12:05:46 2003  Eric Sunshine  <sunshine@sunshineco.com>
-
-	* configure.in: revived NextStep, OpenStep, and Rhapsody ports which
-	  had become unbuildable; enhanced --enable-fat-binary option so that
-	  it accepts a list of desired architectures (rather than assuming a
-	  fixed list), or defaults to a platform-appropriate list if user does
-	  not provide an explicit list; made the default list of architectures
-	  for MAB (fat binary) more comprehensive; now uses -fno-common even
-	  when building the interpreter (in addition to using it for
-	  extensions), thus allowing the interpreter to be embedded into a
-	  plugin module of an external project (in addition to allowing
-	  embedding directly into an application); added checks for
-	  <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
-	  ensures that -I/usr/local/include is employed when extensions'
-	  extconf.rb scripts invoke have_header() since extension checks on
-	  NextStep and OpenStep will fail without it if the desired resource
-	  resides in the /usr/local tree; fixed formatting of --help message.
-
-	* Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
-	  invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
-	  (see configure's --enable-fat-binary option); added rule for new
-	  missing/getcwd.c.
-
-	* defines.h: fixed endian handling during MAB build (see configure's
-	  --enable-fat-binary option) to ensure that all portions of the
-	  project see the correct WORDS_BIGENDIAN value (some extension modules
-	  were getting the wrong endian setting); added missing constants
-	  GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
-	  and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
-	  define in NeXT section.
-
-	* dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
-	  NextStep since, on some installations, this value always resolves
-	  uselessly to zero.
-
-	* dln.c: added error reporting to NextStep extension loader since the
-	  previous behavior of failing silently was not useful; now ensures
-	  that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
-	  for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
-	  on Rhapsody since this header lacks multiple-include protection,
-	  which resulted in "redefinition" compilation errors.
-
-	* main.c: also create hard reference to objc_msgSend() on NeXT
-	  platforms (in addition to Apple platforms).
-
-	* lib/mkmf.rb: now exports XCFLAGS from configure script to extension
-	  makefiles so that extensions can be built MAB (see configure's
-	  --enable-fat-binary option); also utilize XCFLAGS in cc_command()
-	  (but not cpp_command() because MAB flags are incompatible with
-	  direct invocation of `cpp').
-
-	* ext/curses/extconf.rb: now additionally checks for presence of these
-	  curses functions which are not present on NextStep or Openstep:
-	  bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
-	  setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
-	  wscrl(), wsetscrreg()
-
-	* ext/curses/curses.c: added appropriate #ifdef's for additional set of
-	  curses functions now checked by extconf.rb; fixed curses_bkgd() and
-	  window_bkgd() to correctly return boolean result rather than numeric
-	  result; fixed window_getbkgd() to correctly signal an error by
-	  returning nil rather than -1.
-
-	* ext/etc/etc.c: setup_passwd() and setup_group() now check for null
-	  pointers before invoking rb_tainted_str_new2() upon fields extracted
-	  from `struct passwd' and `struct group' since null pointers in some
-	  fields are common on NextStep/OpenStep (especially so for the
-	  `pw_comment' field) and rb_tainted_str_new2() throws an exception
-	  when it receives a null pointer.
-
-	* ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup().
-
-	* ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
-	  gethostbyaddr(), and gethostbyname() from (const char*) to non-const
-	  (char*) for older platforms such as NextStep and OpenStep.
-
-	* ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup(); include
-	  <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
-	  argument of gethostbyaddr() and getservbyname() from (const char*) to
-	  non-const (char*) for older platforms.
-
-	* ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup().
-
-Wed Oct  8 22:19:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit.rb: removed installation instructions.
-
-	* lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
-	  central location.
-
-	* lib/test/unit.rb: ditto.
-
-	* lib/test/unit.rb: extracted the running code in to AutoRunner.
-
-	* lib/test/unit/autorunner.rb: added.
-
-	* lib/test/unit/collector/objectspace.rb: extracted common test
-	  collection functionality in to a module.
-
-	* lib/test/unit/collector.rb: ditto; added.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-	* lib/test/unit/collector/dir.rb: added. Supports collecting tests out
-	  of a directory structure.
-
-	* test/testunit/collector/test_dir.rb: added.
-
-	* test/runner.rb: simplified to use the new capabilities.
-
-Tue Oct  7 15:23:09 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
-
-	* test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
-
-	* test/ruby/endblockwarn.rb: new file added to test of END-in-method
-	  warning.
-
-Tue Oct  7 12:23:47 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
-
-	* ext/socket/extconf.rb: useless assignment removed.
-
-Tue Oct  7 09:13:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
-	  allowed in eval.
-
-Tue Oct  7 04:15:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt): should not expand mrhs if lhs is solely starred.
-
-Tue Oct  7 02:57:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (stmt): rhs of multiple assignment should not be
-	  expanded using "to_a". [ruby-dev:21527]
-
-Tue Oct  7 01:42:34 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
-	  free function for ASN1_OBJECT.
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
-	  ASN1::ObjectId#sn; it returns short name text representation of OID.
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
-	  ASN1::ObjectId#ln; it returns long name text representation of OID.
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
-	  ASN1::ObjectId#oid; it returns numerical representation of OID.
-
-Mon Oct  6 22:59:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
-	  respond_to?(:binmode).  record separator was wrong when you gave
-	  text mode IO to Reader.parse and Writer.generate.
-
-	* test/csv/test_csv.rb: add tests for above change.
-
-Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
-
-	* ext/socket/socket.c (thread_read_select): restored.
-
-Mon Oct  6 16:23:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_object): wrong method name in the message.
-
-Mon Oct  6 16:02:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (stmt): END in method should cause warning.
-	  [ruby-dev:21519]
-
-Mon Oct  6 15:17:23 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_iterator.rb (test_block_argument_without_paren):
-	  added. (follows sample/test.rb)
-
-Mon Oct  6 11:57:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
-	  test for eval-ed BEGIN END order.
-
-Mon Oct  6 09:19:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): should pass "weak" value to next level.
-	  [ruby-dev:21496]
-
-	* eval.c (proc_alloc): should not use cached object if klass is
-	  different. [ruby-talk:83685]
-
-Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: version information is added in document.
-
-Sun Oct  5 23:07:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_f_END): block should be given.  [ruby-dev:21497]
-
-Sun Oct  5 22:51:23 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/ext/openssl/extconf.rb: add check for some engine functions
-	  unavailable in OpenSSL-0.9.6.
-
-	* lib/ext/openssl/ossl_engine.c: ditto.
-
-Sun Oct  5 17:56:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): fix evaluation order.  [ruby-list:38431]
-
-Sun Oct  5 15:05:06 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/uri/*: translated RUNIT to Test::Unit.
-
-Sun Oct  5 14:37:39 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
-
-	* test/soap/marshal/test_marshal.rb: ditto.
-
-	* test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
-	  RUBYBIN.
-
-Sun Oct  5 13:47:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
-	  about scope, order and allowed syntax.
-
-Sun Oct  5 11:54:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/envutil.rb: added.  split "rubybin" from test_system.rb.
-
-	* test/ruby/test_system.rb: use envutil.rb
-
-	* test/ruby/test_beginendblock.rb: added.
-
-	* test/ruby/beginmainend.rb: added.  used in test_beginendblock.rb.
-
-Sun Oct  5 11:23:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* test/testunit/runit/test_testresult.rb: removed some unnecessary
-	  cruft.
-
-Sun Oct  5 11:14:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/rubyunit.rb: aliasing TestCase into the top level is
-	  problematic.
-
-	* lib/runit/assert.rb: fixed a couple of bugs caused by recent
-	  refactoring in Test::Unit.
-
-	* test/testunit/runit/*: added.
-
-Sun Oct  5 10:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
-	  work.  [ruby-dev:21484]
-
-Sun Oct  5 09:52:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: will use pp for output if available.
-	  Can be disabled by setting Assertions.use_pp = false.
-
-	* test/testunit/test_assertions.rb: made a small change to exception
-	  formatting.
-
-Sun Oct  5 07:42:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: made small improvements to assertion
-	  messages. Deprecated Assertions#assert_not_nil; use #assert instead.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-	* test/testunit/util/test_procwrapper.rb: use #assert instead of
-	  #assert_not_nil.
-
-Sun Oct  5 04:10:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: refactored message building.
-
-Sun Oct  5 03:40:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.h: global symbols should be declared
-	  as external.
-
-Sun Oct  5 03:03:20 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_exception.rb (test_else): added.
-
-Sun Oct  5 02:12:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: changed assertion messages to rely more
-	  heavily on #inspect. Added backtrace filtering for exceptions in
-	  assertion messages.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-Sun Oct  5 02:12:00 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/acl.rb, lib/drb/ssl.rb: added.
-
-	* lib/drb/drb.rb: exit from a thread using 'break'.
-
-Sat Oct  4 21:49:14 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* gc.c (Init_stack): the type of space is changed to unsigned int
-	  from double.  [ruby-dev:21483]
-
-Sat Oct  4 17:52:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/netHttpClient.rb: follow http-access2.  hosts which matches
-	  ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
-	  - [,:] separated. ("ruby-lang.org:rubyist.net")
-	  - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
-	  - if you want specify host by IP address, give full address.
-	    ("192.168.1.1, 192.168.1.2")
-
-	* lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
-
-	* test/runner.rb: give testsuite name.
-
-Sat Oct  4 15:16:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): instance variable dump do not cause error
-	  for objects that cannot be dumped, if they traversed from
-	  marshal_dump.  they are just ignored.
-
-	* gc.c (Init_stack): cast "space" (doble value) into unsigned
-	  int.  should run on PowerPC.
-
-	* eval.c (rb_eval): should not execute else part if any exception
-	  is caught. [ruby-dev:21482]
-
-	* parse.y (f_args): should allow unparenthesized block argument.
-
-	* parse.y (f_rest_arg): should allow unparenthesized rest
-	  argument.
-
-Sat Oct  4 14:59:51 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (initialize): raise ArgumentError if argument has
-	  '\0' character.
-	  (relative_path_from): new method.
-	  (each_entry): new method for replacement of dir_foreach.
-	  (foreach, foreachline, dir_foreach, chdir): obsoleted.
-
-Sat Oct  4 12:58:48 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/uri/* (6 files): added.
-
-Sat Oct  4 12:44:45 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
-
-Sat Oct  4 07:33:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/testsuite.rb: changed #<< to return self, and added
-	  #delete.
-
-	* test/testunit/test_testsuite.rb: ditto. Also slightly refactored
-	  #test_size.
-
-	* lib/test/unit/collector/objectspace.rb: collector now preserves the
-	  hierarchy of suites.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-Sat Oct  4 04:48:49 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: default keys handled.
-
-	* ext/syck/syck.h: lowered default buffer size to 16k for increased
-	  performance.
-
-	* test/yaml: checkin of basic unit tests.
-
-Sat Oct  4 04:24:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: add check for X509V3_set_nconf.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
-	  cannot implement if X509V3_set_nconf doesn't exist.
-
-Sat Oct  4 02:12:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/xsd/datatypes.rb: dump sign by itself.  under the problematic
-	  platform, sprintf("%+.10g", -0.0) => +0.  sigh.
-
-	* sample/wsdl/amazon/*: update schema ver2 to ver3.
-
-Sat Oct  4 01:33:46 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (initialize): duplicate and freeze argument.
-	  (to_s): return duplicated string.
-	  (children): new method.
-	  (each_line): new alias to foreachline.
-
-Fri Oct  3 16:13:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c: add DER encoder and decoder.
-
-	* ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
-
-	* ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
-
-	* ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
-
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
-	  DER encoded data argument.
-
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
-	  DER encoded data in OpenSSL::ASN1 types.
-
-Fri Oct  3 13:02:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit.rb: refactored to use optparse.
-
-	* lib/test/unit.rb: added support for selecting the output
-	  level from the command-line.
-
-	* lib/test/unit.rb: added a command-line switch to stop processing
-	  the command-line, allowing arguments to be passed to tests.
-
-	* lib/test/unit.rb: changed the method for specifying a runner or a
-	  filter from the command-line.
-
-	* lib/test/unit/collector/objectspace.rb: fixed a bug causing all
-	  tests to be excluded when the filter was set to an empty array.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-Fri Oct  3 08:14:32 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
-	  'class ::Foo' syntax. [ruby-talk:83514]
-
-Fri Oct  3 08:01:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: added a default message for #assert,
-	  #assert_block, and #flunk.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-	* lib/test/unit/failure.rb: failures now show a better trace of where
-	  they occurred.
-
-	* test/testunit/test_failure.rb: ditto (added).
-
-	* lib/test/unit/testcase.rb: ditto.
-
-	* test/testunit/test_testcase.rb: ditto.
-
-	* lib/test/unit/util/backtracefilter.rb: added.
-
-	* test/testunit/util/test_backtracefilter.rb: added.
-
-	* lib/test/unit/error.rb: changed to use BacktraceFilter and improved
-	  output.
-
-	* test/testunit/test_error.rb: ditto.
-
-Thu Oct  2 20:33:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_failure_initialize): conform with
-	  orthodox initialization method.
-
-	* ext/iconv/iconv.c (iconv_fail): initialize exception instance
-	  from the class, and do not share instance variables with the
-	  others.  [ruby-dev:21470]
-
-Thu Oct  2 18:20:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* time.c (Init_Time): define initialize.  [ruby-dev:21469]
-
-Thu Oct  2 17:39:38 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
-	  it supports OpenSSL hardware cryptographic engine interface.
-
-	* ext/openssl/ossl_engine.h: ditto.
-
-	* ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
-
-	* ext/openssl/extconf.rb: add check for openssl/engine.h.
-
-	* ext/openssl/ossl.c: call Init_ossl_engine().
-
-	* ext/openssl/ossl.h: include openssl/engine.h.
-
-	* ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
-	  EVP_PKEY referes engine.
-
-Thu Oct  2 17:22:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_load): restore instance variables (if any) before
-	  loading from marshaled data.
-
-Thu Oct  2 14:19:15 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
-	  set error object to $!.
-
-	* ext/iconv/iconv.c (iconv_convert): error handler block should
-	  return appended part and the rest.  if rest is nil, the
-	  conversion stops.
-
-Thu Oct  2 12:00:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_const_defined_0): look up constants in Object as
-	  well.  [ruby-dev:21458]
-
-	* test/ruby/test_defined.rb (TestDefined::test_defined): test for
-	  constants.
-
-Thu Oct  2 11:17:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: should not capture an
-	  AssertionFailedError unless explicitly requested.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-	* test/testunit/collector/test_objectspace.rb: fixed a test failure
-	  caused by methods being returned in different orders on different
-	  platforms by moving test sorting from TestSuite into the locations
-	  where suites are constructed. [ruby-talk:83156]
-
-	* lib/test/unit/testcase.rb: ditto.
-
-	* lib/test/unit/testsuite.rb: ditto.
-
-	* lib/test/unit/collector/objectspace.rb: ditto.
-
-Thu Oct  2 03:25:01 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval.c (rb_thread_raise): prototype; avoid VC++ warning.
-
-Thu Oct  2 01:37:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_mdump): new marshal dumper. _dump is still
-	  available for compatibility.
-
-	* time.c (time_mload): new marshal loader.
-
-	* marshal.c (w_object): preserve instance variables for objects
-	  with marshal_dump.
-
-	* marshal.c (r_object0): restore instance variables before calling
-	  marshal_load.
-
-	* error.c (rb_warn_m): always return nil.
-
-Thu Oct  2 01:32:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_block_given_p): real required condition is
-	  ruby_frame->prev->iter == ITER_CUR.
-
-	* eval.c (rb_block_given_p): ditto.
-
-	* eval.c (block_pass): update ruby_frame->iter only when previous
-	  value is ITER_NOT.
-
-Thu Oct  2 01:02:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/webrick/httpauth/digestauth.rb
+	  (WEBrick::HTTPAuth::ProxyDigestAuth#check_uri): privated.
+	  [ruby-dev:42344]
 
-	* variable.c (rb_const_defined_at): should exclude constants from
-	  Object when TYPE(klass) == T_MODULE *and* exclude is on.
-	  [ruby-dev:21458]
+Thu Oct 21 15:50:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* variable.c (rb_const_get_0): do not lookup constants from Object
-	  when TYPE(klass) == T_MODULE *and* exclude is on.
+	* io.c (rb_f_select): add correct rdoc.
+	  patched by Dave Thomas [ruby-core:32467]
 
-Thu Oct  2 00:21:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Oct 21 15:42:01 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/logger/test_logger.rb: unlinking file before close causes
-	  problem under win32 box.
+	* lib/net/telnet.rb (Net::Telnet#close): added.
+	  patched by Erik Hollensbe [ruby-dev:42260] #3830
 
-	* lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
-	  when stringified and embedded into XML instance.  Ruby's sprintf may
-	  format -0.0 as "0.0" (no minus sign) depending on underlying C
-	  sprintf implementation.
+Thu Oct 21 13:08:00 2010  Narihiro Nakamura  <authornari@gmail.com>
 
-	* test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
+	* gc.c (rb_objspace_each_objects): don't lazy sweep in
+	  rb_objspace_each_objects. [Bug #3940] [ruby-dev:42369]
 
-	* test/soap/calc/*: give httpd config param "CGIInterpreter".
-	  "/usr/bin/env ruby" thing does not work under non-Unix boxes.
+Thu Oct 21 00:05:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_io.rb (TestIO#pipe): get rid of deadlock on pipe.
+	  a patch from Tomoyuki Chikanaga at [ruby-dev:42435].  #3970
 
-	* marshal.c (r_byte): retrieve pointer from string value for each
-	  time.  [ruby-dev:24404]
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
 
-	* marshal.c (r_bytes0): ditto.
+Wed Oct 20 23:54:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
+	* ext/dbm/dbm.c: rdoc based on a patch by mathew meta AT
+	  pobox.com, at [ruby-core:32853].
 
-	* io.c (io_read): should freeze all reading buffer.
-	  [ruby-dev:24400]
+Wed Oct 20 10:47:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (rb_str_sum): should use bignums when bits is greater
-	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+	* util.c (ruby_strtod): reject 0x1.p+0. [ruby-dev:42432] #3966
 
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
+Wed Oct 20 10:00:57 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (rb_str_sum): wrong cast caused wrong result.
-	  [ruby-dev:24385]
+	* vsnprintf.c (BSD_vfprintf): print floating point on "%#a".
+	  [ruby-dev:42431] Bug#3965
 
-	* enum.c (enum_sort_by): hide temporary array from
-	  ObjectSpace.each_object.  [ruby-dev:24386]
+Tue Oct 19 19:30:11 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (rb_str_sum): check was done with false pointer.
-	  [ruby-dev:24383]
+	* vsnprintf.c (BSD_vfprintf): clear ALT flag for %a.
+	  [ruby-core:32841] [ruby-core:32848]
 
-	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
+Tue Oct 19 12:19:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Oct  2 00:25:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vsnprintf.c (BSD_vfprintf): fix over-count of field size.
 
-	* signal.c (ruby_signal_name): adjust to the prototype.
+Tue Oct 19 03:08:52 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (pst_inspect): ditto.
+	* vsnprintf.c (BSD_vfprintf): use HEXPREFIX flag for prefix of %a.
+	  [ruby-core:32841]
 
-	* ext/etc/etc.c (etc_getgrent, Init_etc): typo.
+Mon Oct 18 13:18:01 2010  Akinori MUSHA  <knu@iDaemons.org>
 
-Wed Oct  1 20:49:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/digest/digest.c (rb_digest_class_init): Define
+	  Digest::Class.new(). [Feature #3954]
 
-	* gc.c (heaps): manage slots and limits together.  [ruby-dev:21453]
+Mon Oct 18 12:58:40 2010  Tanaka Akira  <akr@fsij.org>
 
-	* gc.c (add_heap): should not clear heaps slot even if realloc()
-	  failed.
+	* pack.c (pack_pack): refine the document.  [ruby-dev:42397]
+	  (pack_unpack): ditto.
 
-Wed Oct  1 20:36:49 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Mon Oct 18 10:19:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* MANIFEST: add wince/mkconfig_wce.rb.
+	* lib/net/http.rb (transport_request): @socket may be nil.
+	  patched by Egbert Eich [ruby-core:32829]
 
-Wed Oct  1 17:22:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct 18 09:57:28 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
-	  setgrent, getgrent, endgrent.
+	* sprintf.c (BSD_vfprintf): wrong padding around prefix and
+	  floating point with %a. [ruby-dev:42403] Bug #3956
 
-	* ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
+Sun Oct 17 22:36:33 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Oct  1 17:01:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/date/delta.rb: added an rdoc tag.
 
-	* eval.c (rb_load): Object scope had priority over required file
-	  scope.  [ruby-dev:21415]
+Sun Oct 17 10:47:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct  1 14:09:53 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+	* variable.c (rb_mod_remove_const): update rdoc.
+	  [ruby-core:31957]
 
-	* wince/mkconfig_wce.rb: sorry, forget to commit.
+Sun Oct 17 10:40:17 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct  1 10:08:42 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+	* class.c (rb_define_{class,module}_id_under): register to be
+	  marked, which probably are defined and used internally.
 
-	* wince/setup.mak: add sigmarionIII SDK support.
+Sat Oct 16 11:10:55 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* wince/Makefile.sub: ditto.
+	* ext/win32ole/win32ole.c (ole_encoding2cp): set codepage 20936
+	  according to GB2312. [Bug #3937] [ruby-core:32758]
 
-	* wince/mkexports.rb: fix linker error in SH4.
+Sat Oct 16 10:54:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
+	* Makefile.in (CPP): already used in .c.i rule.
 
-Wed Oct  1 08:02:52 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+	* cygwin/GNUmakefile.in (DLLWRAP, WINDRES): add --driver-name and
+	  --preprocessor options explicitly.  [ruby-core:32776]
 
-	* wince/time_wce.c (time): add zero check.
+Sat Oct 16 10:06:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 30 16:11:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/sdbm/_sdbm.c (SEEDUPS, BADMESS): make settable using command
+	  line options.
 
-	* Makefile.in: copy lex.c from $(srcdir) if it's not the current
-	  directory.  [ruby-dev:21437]
+	* ext/sdbm/_sdbm.c (makroom): suppress unused result warning.
 
-Tue Sep 30 11:29:23 2003  Tanaka Akira  <akr@m17n.org>
+	* ext/sdbm/extconf.rb: disable BADMESS, a library should not emit
+	  messages directly.
 
-	* process.c (pst_inspect): describe stopped process "stopped".
+Sat Oct 16 08:39:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 30 09:31:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dln.c (dln_strerror): get English message first, instead of
+	  system default. see [ruby-dev:42358].
 
-	* test/runner.rb: glob for directories.
+Sat Oct 16 00:08:00 2010  Koichi Sasada  <ko1@atdot.net>
 
-Tue Sep 30 09:11:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* hash.c (rb_hash_aref): skip calling "default" method
+	  if it is not needed, for speed-up.
 
-	* eval.c (rb_eval): while/until should not capture break unless
-	  they are destination of the break.
+Fri Oct 15 23:36:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 30 03:12:02 2003  Minero Aoki  <aamine@loveruby.net>
+	* file.c (NUM2DEVT, DEVT2NUM, PRI_DEVT_PREFIX): fallback to
+	  unsigned int.
 
-	* lib/net/http.rb (finish): revert to 1.93.
+Fri Oct 15 22:54:46 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* lib/net/pop.rb (finish): revert to 1.60.
+	* ext/win32ole/win32ole.c (ole_hresult2msg): get English message first,
+	  instead of system default. [ruby-core:32765]
 
-	* lib/net/smtp.rb (finish): revert to 1.67.
+Fri Oct 15 22:47:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/http.rb (do_start): ensure to close socket if failed to
-	  start session.
+	* include/ruby/ruby.h (VALUE): prefer long over uintptr_t,
+	  FIX2LONG expects VALUE to be long at least.
 
-	* lib/net/pop.rb (do_start): ditto.
+	* include/ruby/ruby.h (FIX2LONG): parenthesize the argument.
 
-	* lib/net/smtp.rb (do_start): ditto.
+Fri Oct 15 20:30:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/smtp.rb: SMTP#started? wrongly returned false always.
+	* configure.in (dev_t): use RUBY_REPLACE_TYPE.
 
-Tue Sep 30 02:54:49 2003  Minero Aoki  <aamine@loveruby.net>
+	* file.c (rb_stat_inspect): use PRI_DEVT_PREFIX.
 
-	* test/ruby/test_iterator.rb: new test
-	  test_break__nested_loop[123].
+Fri Oct 15 17:26:57 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Sep 29 23:39:13 2003  Minero Aoki  <aamine@loveruby.net>
+	* pack.c (pack_pack): simplify comparison of explicit_endian
+	  as pointed by nobu.
 
-	* lib/net/http.rb (finish): does not raise IOError even if
-	  !started?, to allow closing socket which was opened before
-	  session started.
+	* pack.c (pack_unpack): ditto.
 
-	* lib/net/pop.rb (finish): ditto.
+Fri Oct 15 16:40:37 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/net/smtp.rb (finish): ditto.
+	* pack.c (pack_pack): fix more than one modifiers appear in the
+	  format string. [ruby-core:32793]
 
-Mon Sep 29 19:06:51 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* pack.c (pack_unpack): ditto.
 
-	* ext/win32ole/extconf.rb: add windows.h checking.
-	  (ruby-bugs:PR#1185)
+Thu Oct 14 23:20:42 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-Mon Sep 29 16:18:30 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/win32ole/test_folderitem2_invokeverb.rb: refactoring.
 
-	* lib/logger.rb: check if the given logdevice object respond_to :write
-	  and :close, not is_a? IO.  duck duck.
+Thu Oct 14 22:18:29 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* test/logger/test_logger.rb: self IO.pipe reading/writing may be
-	  locked by the flood.  use tempfile.
+	* insns.def, iseq.c, vm_insnhelper.c: rename variable name
+	  (ip -> iseq).
 
-	* lib/wsdl/xmlSchema/data.rb: wrong constant reference.
+Thu Oct 14 20:41:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Sep 29 16:11:23 2003  Minero Aoki  <aamine@loveruby.net>
+	* pack.c (pack_pack): support endian modifiers: < and >.
+	  [ruby-dev:42376] Feature #3491
 
-	* test/fileutils/test_fileutils.rb: clean up temporary symlink.
-	  Patched by NaHi.  [ruby-dev:21420]
+	* pack.c (pack_unpack): ditto.
 
-Mon Sep 29 11:16:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Oct 14 20:50:51 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* eval.c (rb_thread_atfork): wrong format specifier.
-	  [ruby-dev:21428]
+	* ext/win32ole/win32ole.c (reg_get_val): expand environment in
+	  the pathname. [Bug #3907]
 
-	* process.c (pst_inspect): better description.
+Thu Oct 14 07:35:07 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Sep 29 02:31:44 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* file.c (DEVT2NUM): added. Size of dev_t is depend on the
+	  environment even if POSIX defines dev_t as unsigned integer.
+	  For example, OpenVMS, 64bit Solaris 9, and NetBSD 6 defines
+	  dev_t as 64bit unsigned integer.
 
-	* lib/webrick/utils.rb (Utils::su): use setgid and setuid to
-	  set real and effective IDs. and setup group access list by
-	  initgroups.
+	* file.c (rb_stat_dev): use DEVT2NUM.
 
-Sun Sep 28 11:14:19 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* file.c (rb_stat_dev_major): dev_t is not long. major(3)'s return
+	  value is int.
 
-	* ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
-	  `initialize_copy' should be defined.
+	* file.c (rb_stat_dev_minor): dev_t is not long. minor(3)'s return
+	  value is int.
 
-	* ext/stringio/stringio.c (Init_stringio): ditto.
+	* configure.in: check size of dev_t.
 
-Sat Sep 27 18:25:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Oct 14 07:22:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
-	  $KCODE = "NONE" environment.  check added.
+	* array.c (rb_ary_and, rb_ary_or), class.c (rb_mod_init_copy),
+	  gc.c (undefine_final), time.c (time_mload): get rid of
+	  type-punning casts.
 
-	* test/xsd/test_xsd.rb: add tests for above fix.
+Thu Oct 14 04:16:41 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Sep 27 15:58:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* numeric.c (ruby_float_step): fix Numeric#step with infinity unit
+	  doesn't works well. [ruby-core:32779]
 
-	* lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
+Wed Oct 13 23:16:46 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
-	  a chance to reset logging severity threshold.
+	* tool/enc-unicode.rb: get rid of lots of warnings.
 
-	* test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
-	  silent.
+	* iseq.c (insn_operand_intern, rb_iseq_disasm): fix format specifiers.
 
-Sat Sep 27 09:44:18 2003  Minero Aoki  <aamine@loveruby.net>
+	* vm.c (thread_free): ditto.
 
-	* test/fileutils/test_fileutils.rb: clear all errors on Windows.
-	  [ruby-dev:21417]
+	* numeric.c (check_uint): get rid of overflow on LLP64 platforms.
 
-	* test/fileutils/test_nowrite.rb: ditto.
+	* insns.def (opt_case_dispatch): use st_data_t.
 
-Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Oct 13 22:32:34 2010  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
 
-	* array.c (rb_ary_delete): comparison may change the capacity.
-	  [ruby-dev:24348]
+	* lib/cgi/util.rb (CGI::unescape): bugfix to unescape the multibyte
+	  string. Thanks nobu and tDiary dev members. [Bug #3909]
 
-	* array.c (rb_ary_fill): fill should honor length argument.
-	  [ruby-dev:24346]
+Wed Oct 13 21:13:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* array.c (rb_ary_replace): should not use ptr from shared array.
-	  [ruby-dev:24345]
+	* numeric.c (int_chr): raise error when the value is negative.
 
-	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
-	  [ruby-talk:113807]
+Wed Oct 13 19:24:08 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Sat Sep 27 04:57:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vm.c (ruby_vm_destruct): This function type was wrong; correct to the prototype.
 
-	* test/ruby/test_file.rb: new file.  only asserts unlink-before-close
-	  behaviour now.
+Wed Oct 13 14:58:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/soap/marshal/test_digraph.rb: should close before unlink.
-	  unlink-before-close pattern is not needed here.
+	* numeric.c (rb_num_to_uint): fix 32bit logic.
 
-Sat Sep 27 03:32:37 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Oct 13 12:53:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
-	  each module namespace.  TestMarshal in
-	  test/soap/marshal/test_marshal.rb crashed with
-	  test/ruby/test_marshal.rb.
+	* numeric.c (rb_num_to_uint): added to check the range of arguments.
+	  Mainly for negative value with NUM2UINT on 32bit environment.
 
-Sat Sep 27 01:30:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* string.c (rb_str_concat): use rb_num_to_uint.
 
-	* ext/socket/socket.c (ruby_connect): on win32, type of the 4th
-	  argument of getsockopt is char *.
+Wed Oct 13 12:10:02 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Sep 26 18:35:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_win32.c (w32_error): get English message first, instead
+	  of system default. see [ruby-core:32765].
+	  [experimental]
 
-	* lib/resolv-replace.rb: 1.8 compliance.  [ruby-talk:82946]
+Wed Oct 13 11:04:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 26 17:39:27 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* debug.c (ruby_set_debug_option): define always for binary
+	  compatibility with debug env enabled binary.
 
-	* test/ruby/test_marshal.rb: add test for ruby's objects.
+	* signal.c (ruby_enable_coredump): ditto.
 
-Fri Sep 26 09:52:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Oct 13 10:52:51 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* defines.h (flush_register_windows): use volatile only for gcc on
-	  Solaris.  [ruby-dev:21403]
+	* include/ruby/ruby.h (ruby_executable_node): missing prototype.
 
-	* lib/mkmf.rb (xsystem): use system directly to honor shell meta
-	  charaters.
+Wed Oct 13 05:23:04 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep 26 00:10:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* missing/strchr.c: add strlen's prototype.
 
-	* lib/README: updated.
+	* missing/strstr.c: ditto.
 
-Thu Sep 25 17:48:10 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Oct 13 00:21:17 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
-	  rb_protect.
+	* ext/syck/rubyext.c (struct mktime_arg): constified.
 
-	* ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
-	  value.
+	* ext/syck/rubyext.c (mktime_do, mktime_r, rb_syck_mktime): fix
+	  function signatures.
 
-Thu Sep 25 09:00:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Wed Oct 13 00:18:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/ostruct.rb: Added OpenStruct#==.
+	* st.c (MurmurMagic): get rid of literal overflow.
 
-	* test/ostruct/test_ostruct.rb: Added.
+	* configure.in (RUBY_CHECK_PRINTF_PREFIX): check for printf format
+	  specifier if possible.
 
-Thu Sep 25 07:55:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Oct 12 23:58:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
-	  ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
-	  not use C++ or C99 style comment yet.  (ruby-bugs:PR#1184)
+	* win32/win32.c (rb_w32_open_osfhandle, rb_w32_wopen, rb_w32_pipe):
+	  use uintptr_t instead of long for win64.
 
-Thu Sep 25 00:23:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* win32/win32.c (socketpair_internal): suppress warnings.
 
-	* MANIFEST: add SOAP4R.
+	* win32/win32.c (ftruncate): use HANDLE instead of long for win64.
 
-Thu Sep 25 00:13:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vsnprintf.c (BSD_vfprintf): fix cast.
 
-	* lib/soap/* (29 files): SOAP4R added.
+	* numeric.c (rb_num2fix): result of rb_num2long is SIGNED_VALUE.
 
-	* lib/wsdl/* (42 files): WSDL4R added.
+	* compile.c (iseq_build_body), error.c (set_syserr, get_syserr),
+	  (syserr_initialize), gc.c (define_final, rb_gc_copy_finalizer),
+	  (run_final), hash.c (rb_hash_aref, rb_hash_lookup2),
+	  (rb_hash_fetch_m, rb_hash_clear, rb_hash_aset, eql_i),
+	  iseq.c (iseq_load, iseq_data_to_ary), marshal.c (r_symlink),
+	  thread.c (rb_thread_local_aref),
+	  variable.c (generic_ivar_remove, ivar_get, rb_const_get_0),
+	  (rb_cvar_get), vm.c (rb_vm_check_redefinition_opt_method),
+	  vm_insnhelper.c (vm_get_ev_const), vm_method.c (remove_method),
+	  ext/iconv/iconv.c (map_charset): use st_data_t.
 
-	* lib/xsd/* (12 files): XSD4R added.
+	* compile.c (iseq_build_body), insns.def (getglobal, setglobal),
+	  iseq.c (iseq_load, iseq_data_to_ary), util.c (valid_filename):
+	  use VALUE.
 
-	* test/soap/* (16 files): added.
+	* gc.c (obj_free, rb_objspace_call_finalizer): fix truncating
+	  cast.
 
-	* test/wsdl/* (2 files): added.
+	* gc.c (mark_current_machine_context): suppress warnings.
 
-	* test/xsd/* (3 files): added.
+	* compile.c (iseq_compile_each): fix truncating cast.
 
-	* sample/soap/* (27 files): added.
+	* cont.c (fiber_setcontext): missing variable definition.
 
-	* sample/wsdl/* (13 files): added.
+Tue Oct 12 19:25:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Sep 24 02:08:11 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* error.c (exc_to_s): use OBJ_INFECT.
 
-	* lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
-	  [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
+	* error.c (name_err_to_s): ditto.
 
-Tue Sep 23 23:10:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* error.c (name_err_mesg_to_str): ditto.
 
-	* lib/logger.rb: add Logger#<<(msg) for writing msg without any
-	  formatting.
+	* error.c (syserr_initialize): ditto.
 
-	* test/logger/test_logger.rb: ditto.
+Tue Oct 12 19:07:55 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Sep 23 20:47:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* error.c (syserr_initialize): taint message if mesg is given
+	  and it is tainted.
 
-	* error.c (rb_warn_m): should not warn if -W0 is specified.
-	  [ruby-talk:82675]
+Tue Oct 12 18:25:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Sep 22 21:28:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* io.c (rb_io_ungetc): always see Bignum. On 32bit valid value
+	  may be a Bignum. On 64bit for errors. [ruby-dev:42366]
 
-	* MANIFEST: updated.
+Tue Oct 12 18:25:04 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Sep 22 19:22:26 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* string.c (rb_str_concat): use unsigned int for GB18030.
 
-	* configure.in (AC_CHECK_FUNCS): add setuid and setgid.
+Tue Oct 12 17:53:49 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Sep 22 12:34:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* numeric (check_uint): the mask must refer to VALUE.
 
-	* util.c (ruby_strtod): skip preceding zeros before counting
-	  digits in the mantissa. (ruby-bugs:PR#1181)
+Tue Oct 12 17:47:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Sep 21 04:12:36 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* numeric (check_uint): set MSB for negative value.
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
-	  should be a String.
+	* numeric (rb_num2uint): return value's type of rb_num2ulong
+	  is VALUE.
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
+	* numeric (int_chr): variable i can't be negative.
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
+Tue Oct 12 16:04:37 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+	* win32/win32.c (rb_w32_strerror): get English message first, instead
+	  of system default. see [ruby-dev:42358].
+	  [experimental]
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
+Tue Oct 12 15:52:35 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Sep 20 11:49:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* win32/win32.c (rb_w32_strerror): unmap some range of errno for
+	  workaround of VC10's strerror() and sys_nerr problem.
+	  based on a patch from Akio Tajima, [ruby-dev:42355].
 
-	* lib/logger.rb: typo fixed.
+Tue Oct 12 15:36:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/logger/test_logger.rb: new file.
+	* io.c (rb_io_ungetc): use unsigned int for GB18030.
 
-Fri Sep 19 11:39:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Tue Oct 12 15:14:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/testunit/*: Added.
+	* io.c (rb_io_putc): support multibyte characters.
+	  [ruby-core:30697]
 
-	* lib/test/unit.rb: Documentation update.
+Tue Oct 12 15:10:31 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
-	  Ditto.
+	* numeric.c (rb_enc_uint_chr): split from int_chr.
 
-	* lib/test/unit.rb: Factored out an ObjectSpace collector.
+	* numeric.c (int_chr): use rb_enc_uint_chr.
 
-	* lib/test/unit/collector/objectspace.rb: Ditto.
+	* include/ruby/encoding.h (rb_enc_uint_chr): added.
 
-	* sample/testunit/*: Added.
+Tue Oct 12 14:04:41 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep 19 01:00:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* numeric.c (int_chr): a codepoint of Ruby M17N must be 32bit
+	  unsigned int; GB18030 uses MSB. Also note that OnigCodePoint
+	  is defined as unsigned int.
 
-	* lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
-	  condition.
+Tue Oct 12 12:20:54 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/webrick/log.rb (BasicLog#format): add "\n" to message.
+	* vm_dump.c (dump_thread): foolish mistake.
 
-Thu Sep 18 22:43:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Oct 12 10:39:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
+	* configure.in (RUBY_MINGW32): canonicalize only on mingw.
 
-	* eval.c (proc_invoke): should update "result" for orphans.
+Mon Oct 11 20:20:23 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Sep 18 20:33:03 2003  Tietew  <tietew-ml-ruby-list@tietew.net>
+	* lib/net/http.rb (HTTP.get): specify ASCII-8BIT as the result
+	  encoding of Zlib::GzipReader.
+	  http://hibari.2ch.net/test/read.cgi/tech/1281473294/271
 
-	* parse.y (str_xquote): do not prepend escapes in
-	  backqoute literals.  [ruby-list:38409]
+Mon Oct 11 17:42:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Sep 18 20:30:17 2003  Tanaka Akira  <akr@m17n.org>
+	* error.c (syserr_initialize): use mesg's encoding when locale
+	  encoding is US-ASCII. If locale encoding is not US-ASCII,
+	  assume err has non ASCII characters. [ruby-dev:42358]
 
-	* lib/pathname.rb: update document.
+Mon Oct 11 14:03:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Sep 18 15:27:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* error.c (syserr_initialize): set the encoding of Errno::*#message
+	  as locale. [ruby-dev:42358]
 
-	* lib/logger.rb: new file.  Logger, formerly called devel-logger or
-	  Devel::Logger.
+Mon Oct 11 06:38:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* sample/logger/*: new file.  samples of logger.rb.
+	* ext/stringio/stringio.c (strio_set_encoding):
+	  StringIO#set_encoding can get 2nd argument and optional hash
+	  for API compatibility to IO. [ruby-dev:42356]
 
-Wed Sep 17 23:41:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct 11 06:11:30 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (localjump_destination): should not raise ThreadError
-	  exception for "break". [ruby-dev:21348]
+	* io.c (rb_io_set_encoding): use rb_funcall2 when the io is not
+	  a T_FILE. [ruby-dev:42356]
 
-	* eval.c (proc_invoke): use result instead of prot_tag->retval.
-	  retval is no longer propagated to the ancestors.
+Sun Oct 10 18:42:23 2010  Akinori MUSHA  <knu@iDaemons.org>
 
-Wed Sep 17 20:34:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/set.rb (Set#replace): Apply a bit of optimization.
 
-	* parse.y (tokadd_string, parse_string, yylex): escaped terminator
-	  is now interpreted as is.  [ruby-talk:82206]
+Sun Oct 10 10:20:07 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 17 18:52:36 2003  Minero Aoki  <aamine@loveruby.net>
+	* configure.in (RUBY_MINGW32): canonicalize as like mswin version.
 
-	* test/fileutils/fileassertions.rb: new file.
+Sun Oct 10 05:33:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb: new file.
+	* vm_core.h (rb_signal_buff_size, rb_signal_exec): moved
+	  declarations from thread.c.
 
-	* test/fileutils/test_nowrite.rb: new file.
+Sat Oct  9 16:54:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 17 18:51:02 2003  Minero Aoki  <aamine@loveruby.net>
+	* configure.in (RSHIFT): quote to get rid of argument expansion
+	  for autoconf 2.68.
 
-	* test/strscan/test_stringscanner.rb: require test/unit.
+Sat Oct  9 11:00:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 17 18:35:34 2003  Minero Aoki  <aamine@loveruby.net>
+	* thread.c (thread_reset_event_flags, exec_event_hooks): ignore
+	  hooks marked as removed.
 
-	* test/strscan/test_stringscanner.rb: new file.
+	* thread.c (thread_exec_event_hooks): remove hooks to be removed.
 
-Wed Sep 17 18:03:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* thread.c (rb_threadptr_remove_event_hook, rb_remove_event_hook):
+	  defer removing hooks if running the hooks.  [ruby-dev:42350]
 
-	* ext/openssl: all files are reviewed to simplify and avoid memory leak.
+Sat Oct  9 10:51:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/extconf.rb: add check for assert.h.
+	* thread.c (rb_threadptr_exec_event_hooks): suppress each event
+	  hooks separately.
 
-	* ext/openssl/ossl.c (ossl_buf2str): new function to convert
-	  C buffer to String and free buffer.
+	* thread.c (thread_suppress_tracing): split from
+	  ruby_suppress_tracing, accepting thread pointer and event mask.
 
-	* ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
-	  Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
+Sat Oct  9 08:16:01 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
-	  functions to convert object to DER string.
+	* thread.c (rb_threadptr_remove_event_hook): fix typo.
 
-	* ext/openssl/ossl.h: ditto.
+Fri Oct  8 10:52:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
-	  BIO to String object and free BIO.
+	* common.mk (RBCONFIG): depends on version.h due to
+	  RUBY_PATCHLEVEL.  [ruby-core:32709]
 
-	* ext/openssl/ossl_bio.h: ditto.
+Fri Oct  8 00:24:54 2010  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
+	* lib/csv.rb: Fixing documentation typos.  [ruby-core:32712]
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
+Thu Oct  7 09:14:28 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
+	* vm_exec.c (vm_exec_core):  Treat clang as non gcc on this
+	  context: It has __asm__ but doesn't works well.
 
-	* ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
-	  and reimplement in openssl/x509.rb.
+Wed Oct  6 12:28:22 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_x509attr.c: reimplemented and disable some
-	  method temporarily. this class doesn't work fine without ASN.1
-	  data support;-) I'll rewrite in near future.
+	* lib/uri/generic.rb (URI::Generic#hostname): new method.
+	  (URI::Generic#hostname=): ditto.
 
-	* ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
-	  unused code.
+	* lib/open-uri.rb: use URI#hostname
 
-	* ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
+	* lib/net/http.rb: ditto.
 
-Tue Sep 16 22:25:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	  reported by Adam Majer.  [ruby-core:32056]
 
-	* test/csv/test_csv.rb: add negative tests of row_sep.
+Wed Oct  6 11:52:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 16 18:02:36 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (fptr_finalize): write_mutex might have been destroyed
+	  already in finalization phase, as the order of finalizers is not
+	  guaranteed.  rb_mutex_t should be used in place of Mutex object
+	  in the future.
 
-	* regex.c (re_compile_pattern): should not translate character
-	  class range edge. [ruby-list:38393]
+Tue Oct  5 22:17:02 2010  wanabe  <s.wanabe@gmail.com>
 
-Tue Sep 16 16:47:56 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* win32/mkexports.rb: revert r29320 and r29402.
 
-	* MANIFEST: add test/csv/mac.csv.
+Mon Oct  4 12:43:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
+	* parse.y (regexp): dregexp has literal string only at the head
+	  and successors are array.  [ruby-core:32682]
 
-Mon Sep 15 19:02:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Mon Oct  4 10:22:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/csv.rb: add extra pamameter to specify row(record) separater
-	  character.  To parse Mac's CR separated CSV, do like this.
-	    CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
-	  The 3rd parameter in this example ?, is for column separater and the
-	  4th ?\r is for row separater.  Row separater is nil by default.  Nil
-	  separater means "\r\n" or "\n".
+	* random.c (rand_init): This checks the value is in 32bit or not,
+	  so use int32_t, not int.
 
-	* test/csv/test_csv.rb: add tests for above feature.
+Mon Oct  4 09:47:39 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/csv/mac.csv: added.  Sample CR separated CSV file.
+	* random.c (rand_init): remove useless assignment.
 
-Fri Sep 12 22:41:48 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+	* re.c (update_char_offset): remove unused variable.
 
-	* ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
+	* re.c (read_escaped_byte): ditto.
 
-	* ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
+Mon Oct  4 09:30:42 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_asn1.[ch]: new files
+	* ext/openssl/lib/openssl/bn.rb (Integer#to_bn): OpenSSL::BN.new
+	  accepts only Strings, so call Integer#to_s(16).
+	  16 is for an optimization. [ruby-dev:42336]
 
-	* ext/openssl/ossl_bio.[ch]: new files
+Mon Oct  4 07:57:51 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep 12 12:30:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* cont.c (fiber_memsize): Return size.
+	  Before this change, fiber_memsize always returns 0.
 
-	* intern.h (rb_disable_super, rb_enable_super): replace with dummy
-	  expressions instead of prototypes.  the functions remain yet for
-	  binary compatibility.  [ruby-talk:81758]
+Mon Oct  4 07:16:55 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep 12 12:09:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/unicode.c (onigenc_unicode_property_name_to_ctype):
+	  remove useless assignment.
 
-	* bignum.c (rb_big_and): convert argument using 'to_int'.
+	* vm.c (vm_make_proc_from_block): ditto.
 
-	* bignum.c (rb_big_or): ditto.
+	* variable.c (rb_ivar_count): ditto.
 
-	* bignum.c (rb_big_xor): ditto.
+Mon Oct  4 06:40:24 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep 12 07:06:14 2003  David Black  <dblack@superlink.net>
+	* Makefile.in (clean-rdoc): Don't use \ in variable expansion.
+	  BSD make treats it as an escape character.
 
-	* lib/scanf.rb: Took out useless @matched_item variable; some small
-	  refactoring.
+Mon Oct  4 00:01:53 2010  wanabe  <s.wanabe@gmail.com>
 
-Thu Sep 11 08:43:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* tool/config.sub: revert r29320, r29324, r29347, r29354, r29365
+	  to automake-1.11.1. [ruby-core:32634]
 
-	* eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
-	  name is not tainted.
+	* win32/mkexports.rb: no longer use 'mingw64'. a patch from Luis Lavena
+	  at [ruby-core:32678].
 
-	* lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
-	  Supports StringIO.
+Sun Oct  3 20:36:37 2010  Akio Tajima (arton)  <artonx@yahoo.co.jp>
 
-Wed Sep 10 22:47:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/win32ole/test_folderitem2_invokeverb.rb: Change creating
+	  shortcut verb to 'Link' [Bug #3339]
 
-	* ext/openssl/ossl.h: add a workaround for win32 platform.
-	  libeay32.dll doesn't export functions defined in conf_api.h.
+Sun Oct  3 19:44:23 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
+	* configure.in (Makefile): get rid of duplicated ruby target when
+	  already there it was.
 
-	* ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
+Sat Oct  2 22:59:32 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* ext/openssl/ossl_config.c (set_conf_section_i): should check
-	  if the argument is Array.
+	* test/win32ole/test_thread.rb: add for win32ole with Thread.
 
-Wed Sep 10 22:41:54 2003  Tietew  <tietew@tietew.net>
+Fri Oct  1 17:03:00 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* eval.c (win32_get_exception_list): avoid VC7 warning.
-	  [ruby-win32:577]
+	* test/webrick/test_httpproxy.rb (TestWEBrickHTTPProxy::test_upstream_proxy):
+	  My machine fails this test at this line, saying 503 service unavailable.
 
-Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Sep 30 16:11:08 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (struct tag): dst should be VALUE.
+	* win32/win32.c (rb_w32_getenv): should return NULL if specified name
+	  is empty. a patch from Heesob Park at [ruby-core:32650]
 
-Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Sep 30 15:18:23 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* eval.c (localjump_destination): stop at the scope where the current
-	  block was created.  [ruby-dev:21353]
+	* parse.y (command_asgn): allow command_call to be right hand side
+	  expression of chained assignment.  [ruby-dev:42313]
 
-Tue Sep  9 05:17:04 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Sep 30 10:55:38 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
+	* hash.c (ruby_setenv): workaround for old Windows. a patch from
+	  Heesob Park. [ruby-core:32353]
 
-Tue Sep  9 02:41:35 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+Thu Sep 30 09:29:06 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_config.c: Refine compatibility.
+	* lib/uri/common.rb (URI.encode_www_form): change treatment of
+	  undefined value in given array as latest internet draft for
+	  application/www-form-urlencoded.
+	  http://tools.ietf.org/html/draft-hoehrmann-urlencoded-01
 
-Tue Sep  9 01:50:45 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Sep 30 09:34:03 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
-	  the message.
+	* vm_dump.c (dump_thread): fixed wrong type of return value of
+	  SymGetModuleBase64(). [ruby-dev:42306]
 
-	* lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
+Wed Sep 29 21:04:05 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Mon Sep  8 22:15:33 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions::test_script_from_stdin):
+	  As usual, PTY is not always available.
 
-	* ext/tk/lib/multi-tk.rb: modify security check at creating
-	  a new interpreter
+Wed Sep 29 18:38:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep  8 20:00:12 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/config.sub (x64): regularize only for pc vendor, and strip
+	  useless 64 suffix.
 
-	* lib/optparse.rb, lib/optparse/version.rb: search also all
-	  capital versions.
+Wed Sep 29 17:53:02 2010  Kenta Murata <mrkn@mrkn.jp>
 
-Mon Sep  8 19:26:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/bigdecimal/bigdecimal.c (BIGDECIMAL_ENABLE_VPRINT):
+	  VPrint is usually disabled.  It's only used in debugging.
 
-	* ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
+Wed Sep 29 17:41:34 2010  Kenta Murata <mrkn@mrkn.jp>
 
-	* ext/openssl/ossl_config.c: refine all with backward compatibility.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_save_limit):
+	  return the result of a block.
 
-	* ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
+	* test/bigdecimal/test_bigdecimal.rb (test_save_limit):
+	  add a test for the above change.
 
-	* ext/openssl/ossl_x509.c: added new constants under X509 module.
-	  DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
-	  DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
+Wed Sep 29 16:18:03 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
-	  the members of the struct. it's left to GC.
+	* vm_dump.c (dump_thread): remove unused optional arguments.
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
+Wed Sep 29 13:26:30 2010  Kenta Murata <mrkn@mrkn.jp>
 
-	* ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
-	  add attr readers: issuer_certificate, subject_certificate,
-	  subject_request, crl and config.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_save_rounding_mode):
+	  return the result of a block.
 
-Mon Sep  8 18:26:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/bigdecimal/test_bigdecimal.rb (test_save_rounding_mode):
+	  add a test for the above change.
 
-	* lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
-	  instead of config[:Port] or req.request_uri.port.
+	* test/bigdecimal/test_bigdecimal.rb (test_save_exception_mode):
+	  add a test for the return value of BigDecimal.save_exception_mode.
 
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
+Wed Sep 29 12:45:30 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_div2, BigDecimal_add2,
+	  BigDecimal_sub2, BigDecimal_mult2, VpLimitRound): remove meaningless
+	  casts to get rid of compiler warnings.
 
-	* lib/webrick/config.rb: :Listen option never be used.
+Wed Sep 29 12:35:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
-	  option and add warning message.
+	* ext/bigdecimal/bigdecimal.c (VPrint, VpToString): fix format.
 
-	* lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
+Wed Sep 29 12:31:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
+	* lib/rdoc/known_classes.rb (RDoc::KNOWN_CLASSES): add Encoding.
 
-Sun Sep  7 16:08:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Sep 28 20:50:23 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
+	* tool/config.sub (x64): regularize same as mswin.
 
-	* ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
+Tue Sep 28 20:06:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Sep  6 02:26:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vm_dump.c (rb_vm_bugreport): add windows support.
+	  based on patches from Peter Weldon at [ruby-core:32551]
 
-	* test/ruby/test_*.rb: assert_same, assert_match, and so on.
+Mon Sep 27 23:30:34 2010  Koichi Sasada  <ko1@atdot.net>
 
-Sat Sep  6 18:45:46 2003  Mauricio Fernandez  <batsman.geo@yahoo.com>
+	* insns.def (opt_case_dispatch), vm_insnhelper.c:
+	  execute the procedures of "when" clauses by bytecode
+	  instead of st_foreach() when the object does not hit
+	  prepared hash.  [ruby-dev:42304]
 
-	* parse.y (assignable): call rb_compile_error(), not rb_bug().
-	  [ruby-core:01523]
+Mon Sep 27 15:54:03 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Sat Sep  6 17:40:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/net/http/test_https.rb: As always, localhost is not
+	  guaranteed to be resolved as 127.0.0.1.  But a SSL
+	  certificate needs a socket to listen on a specific address
+	  where a CN resolves to.  On situations where localhost is
+	  not 127.0.0.1, these tests are not possible.
 
-	* ext/openssl/ruby_missing.c: rid of unnecessary backward
-	  compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
-	  all sources.
+Mon Sep 27 15:25:05 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
+	* test/net/imap/test_imap.rb: resurrection of r29259.
+	  this change depends on minitest 1.7.1.
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
+	* lib/test/unit/assertions.rb: ditto.
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
+Sun Sep 26 22:59:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
+	* tool/config.sub (x86_64-pc-mingw64): regularize.
 
-Sat Sep  6 01:23:22 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Sep 26 22:21:07 2010  wanabe  <s.wanabe@gmail.com>
 
-	* win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
+	* ext/openssl/ossl_hmac.c (ossl_hmac_hexdigest, ossl_hmac_s_hexdigest),
+	  ext/openssl/ossl_pkey_ec.c (ossl_ec_group_set_seed),
+	  ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der),
+	  ext/openssl/ossl_pkcs7.c (numberof): suppress warnings.
+	  [ruby-core:31932]
 
-	* win32/win32.c (CreateChild): fix condition about whether to call
-	  shell or not.
+Sun Sep 26 10:25:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep  6 00:36:20 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+	* tool/config.{guess,sub}: updated to automake-1.11.1.
 
-	* Makefile.in (test): phony target.
+Sat Sep 25 22:48:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (have_library, find_library): configure by library
-	  name.
+	* configure.in (LIBRUBY_DLDFLAGS): fix quoting.
 
-	* lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
-	  array as argument.
+Sat Sep 25 10:30:37 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_*.rb: moved invariants to left side in
-	  assert_equal, and use assert_nil, assert_raises and so on.
+	* configure.in (LIBRUBY_DLDFLAGS): use -unexported_symbol only
+	  when available.  http://trac.macports.org/ticket/26341
 
-	* win32/win32.c (isInternalCmd): distinguish command.com and
-	  cmd.exe.
+Sat Sep 25 10:05:49 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* win32/win32.c (make_cmdvector): a character just after wildcard
-	  was ignored.  [ruby-core:01518]
+	* configure.in: Always add -mieee for Renesas SH4.
+	  Thanks, Nobuhiro Iwamatsu. [Feature #3874] [ruby-core:32548]
 
-Fri Sep  5 20:27:08 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sat Sep 25 01:34:41 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
+	* Makefile.in (install-cross): target to install cross-compiling
+	  stuff.
 
-Fri Sep  5 18:00:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Sep 24 23:44:59 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
+	* string.c (sym_call), vm.c (invoke_block_from_c),
+	  vm_insnhelper.c (vm_yield_with_cfunc): pass given block.
+	  [ruby-core:32075]
 
-	* ext/openssl/ossl_digest.c: add ossl_digest_new().
+	* vm_eval.c (rb_funcall_passing_block): new function to call
+	  method with passing given block.
 
-	* ext/openssl/ossl_digest.h: ditto.
+Fri Sep 24 15:50:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_cipher.c: add ossl_cipher_new().
+	* string.c (rb_str_to_i): fix rdoc: String#to_i raises an
+	  exception when base is invalid. [ruby-core:31685]
 
-	* ext/openssl/ossl_cipher.h: ditto.
+Fri Sep 24 15:28:35 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Sep  5 15:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_rindex): use rb_enc_prev_char instead of repeated
+	  str_nth.
+	  patched by Michael Selig [ruby-core:32498]
 
-	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
-	  search delimiter forward if found in backward.
+Fri Sep 24 14:19:12 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Fri Sep  5 13:32:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/test_pty.rb: Same as 229281; existence of PTY class do not
+	  guarantee a successful pty operation.
 
-	* test/runner.rb: arguments should be keys.
+Fri Sep 24 06:25:55 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Fri Sep  5 12:09:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/minitest/*.rb: Imported minitest 1.7.2 r5879.
+	* test/minitest/*.rb: ditto.
 
-	* test/ruby/test_system.rb (test_system): check existence of ruby
-	  interpreter.
+Thu Sep 23 23:09:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  5 11:32:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_get_cref0): cref is stacked only in normal
+	  iseqs, so check if it is the case first.
 
-	* lib/optparse.rb (--version): fix assignment/reference order.
+Thu Sep 23 23:08:41 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
-	  be deprecated in future.
+	* tool/config.sub: mingw64 should use x86_64.  [ruby-core:32514]
 
-	* lib/optparse/version.rb (OptionParser#show_version): hide Object.
+Thu Sep 23 21:40:40 2010  wanabe  <s.wanabe@gmail.com>
 
-	* test/runner.rb: fix optparse usage.
+	* ext/socket/raddrinfo.c (init_addrinfo, inspect_sockaddr): suppress
+	  warnings.  see [ruby-core:31932].
 
-	* test/runner.rb: glob all testsuits if no tests given.
+Thu Sep 23 19:27:57 2010  wanabe  <s.wanabe@gmail.com>
 
-Fri Sep  5 10:42:58 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* thread_win32.c (w32_wait_events, w32_close_handle): suppress warnings.
+	  see [ruby-core:31932].
 
-	* test/runner.rb: added.  gets testcases from command line and runs it.
+Thu Sep 23 18:54:39 2010  wanabe  <s.wanabe@gmail.com>
 
-	* test/ruby/test_gc.rb: remove useless part which was for dumping test
-	  result.
+	* tool/config.sub: add mingw64.
 
-Fri Sep  5 09:28:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* win32/mkexports.rb (Exports::Mingw64): added.
 
-	* test/ruby/test_gc.rb: added.  splitter.rb which I made to split
-	  sample/test.rb into test/ruby/test_* kindly removed GC test (the
-	  last section in the original test) to reduce things to be worried.
+	* win32/mkexports.rb (Exports::Mingw32): renamed from Exports::Mingw.
 
-Fri Sep  5 03:00:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Sep 23 09:01:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_iterator.rb (test_block_in_arg): add no block
-	  given tests.
+	* vm_insnhelper.c (vm_cref_push): no outer cref is needed for proc
+	  from method.  Bug #3786, Bug #3860, [ruby-core:32501]
 
-	* test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
-	  test.
+Wed Sep 22 17:12:01 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Fri Sep  5 01:10:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/openssl/utils.rb (OpenSSL#silent): always restore $VERBOSE.
+	  [ruby-dev:42285]
 
-	* test/ruby: tests for ruby itself.
+Wed Sep 22 16:59:40 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
-	  some tests could not be translates...  search '!!' mark to see it.
+	* test/test_prime.rb (TestPrime#test_new): the warning expected have
+	  not been displayed when $VERBOSE == nil. Patch by Shota Fukumori
+	  a.k.a. sora_h. [ruby-dev:42272]
+	  Recovers $stderr even if StringIO.new fails. Reported by unak.
 
-	* test/csv/test_csv.rb: should require 'csv', not '../lib/csv'.  test
-	  runner should set load path correctly.
+Wed Sep 22 01:55:48 2010  Koichi Sasada  <ko1@atdot.net>
 
-Fri Sep  5 01:03:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* bootstraptest/test_method.rb: fix last commit.
 
-	* test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
-	  opened file cannot be removed under win32 box.
+Wed Sep 22 01:49:52 2010  Koichi Sasada  <ko1@atdot.net>
 
-Thu Sep  4 23:59:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* bootstraptest/test_method.rb: add a test for [ruby-core:30534].
 
-	* parse.y (tokadd_string): newlines have no special meanings in
-	  %w/%W, otherwise they are ignored only when interpolation is
-	  enabled.  [ruby-dev:21325]
+Wed Sep 22 00:52:44 2010  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Thu Sep  4 19:38:25 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/rdoc/ri/store.rb (save_cache): remove duplicate entries.
 
-	* ext/io/wait/.cvsignore: added.
+Wed Sep 22 00:00:05 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/.cvsignore: added.
+	* ext/pathname/pathname.c (path_f_pathname): Pathname() translated
+	  from pathname.rb.
 
-Thu Sep  4 19:28:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Tue Sep 21 22:18:30 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* sample/openssl: added.  Sample of standard distribution library
-	  should be locate in sample/{module_name}/*.
+	* tool/mkconfig.rb: fixed build problem on mswin64 introduced in r29278.
 
-	* ext/openssl/sample/*: removed.  move to sample/openssl/*.
+Tue Sep 21 02:42:35 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Sep  4 18:02:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/pathname/test_pathname.rb (TestPathname#test_mkdir): fix typo.
 
-	* test/csv/test_csv.rb: use remove_const to reduce warnings.  use
-	  Dir.tmpdir to locate working files.
+Mon Sep 20 23:23:05 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep  4 17:41:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (bracket): get rid of scanning at the end of the pattern
+	  string, not to raise an exception while globbing command line.
+	  [ruby-core:32478]
 
-	* misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
-	  valid delimiter.
+Mon Sep 20 11:25:49 2010  Tanaka Akira  <akr@fsij.org>
 
-	* misc/ruby-mode.el (ruby-here-doc-end-match): must quote
-	  arbitrary string to use as regexp.
+	* ext/pathname/pathname.c (Init_pathname): Pathname#=~ undefinition
+	  translated from pathname.rb.
 
-	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
-	  call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
-	  matched.
+Mon Sep 20 02:34:11 2010  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Sep  4 15:40:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (check_rounding_mode, BigDecimal_mode):
+	  raise ArgumentError instead of TypeError passing invalid modes.
 
-	* test/csv/test_csv.rb: run on test/unit original layer.
+	* test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
+	  change against the above modifications.
 
-Thu Sep  4 12:54:50 2003  why the lucky stiff  <why@ruby-lang.org>
+Sun Sep 19 22:08:39 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* ext/syck/token.c: headerless documents with root-level spacing now
-	  honored.
+	* lib/mkmf.rb (try_link): rdoc
+	  (try_compile): ditto
+	  (try_cpp): ditto
+	  (try_func): ditto
+	  (try_var): ditto
+	  (try_run): ditto
+	  (egrep_cpp): ditto
 
-Thu Sep  4 00:06:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Sep 19 20:43:33 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* eval.c (mark_frame_adj): need to adjust argv pointer if using
-	  system's alloca. [ruby-core:01503]
+	* configure.in (--disable-install-doc): disables capi too, in addition
+	  to rdoc.
+	  (--disable-install-rdoc): a new option for disabling only rdoc.
+	  (--disable-install-capi): a new option for disabling only capi.
 
-Wed Sep  3 21:33:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sun Sep 19 20:37:45 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* test: add test directory.  Test::Unit aware testcases and needed
-	  files should be located in this directory.  dir/file name convention;
-	    test/{module_name}/test_{testcase_name}.rb
-	    test/{module_name}/{needed_files}
-	  someday, someone will write testrunner which searches test_*.rb and
-	  run testcases automatically.
+	* common.mk (clean): removes all documents on cleaning.o
+	  (CAPIOUT): new variable.
+	  (clean-capi, distclean-capi, realclean-capi): new targets
 
-	* test/csv/*: add testcase for lib/csv.rb.
+	* Makefile.in (clean-capi, distclean-capi, realclean-capi): ditto.
 
-Wed Sep  3 01:37:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/Makefile.sub (clean-capi, distclean-capi, realclean-capi):
+	  ditto.
 
-	* io.c (rb_f_gets): should call next_argv() before type check
-	  current_file. [ruby-list:38336]
+Sun Sep 19 13:44:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep  2 20:37:15 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* configure.in (LIBRUBY_SO): fix an oversight of replace
+	  RUBY_INSTALL_NAME with RUBY_SO_NAME.  a patch from Jeremy Evans
+	  at [ruby-core:32474].
 
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
-	  for skipping server verification.
+Sun Sep 19 07:48:20 2010  Tanaka Akira  <akr@fsij.org>
 
-Tue Sep  2 23:36:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/pathname/pathname.c (path_unlink): Pathname#unlink and
+	  Pathname#delete translated from pathname.rb.
 
-	* eval.c (proc_invoke): should retrieve retval when pcall is true.
+Sun Sep 19 06:06:07 2010  Kenta Murata  <mrkn@mrkn.jp>
 
-Tue Sep  2 14:09:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (check_rounding_mode): added for
+	  converting symbol to rounding mode number.
 
-	* ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
-	  the patch is submitted by nmu <nmu@users.sourceforge.jp>.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round):
+	  support to specify rounding mode by symbol.
 
-	* ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
-	  some platforms.
+	* test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
+	  add tests for above changes.
 
-	* ext/socket/getnameinfo.c (getnameinfo): ditto.
+Sun Sep 19 05:14:35 2010  Kenta Murata  <mrkn@mrkn.jp>
 
-Tue Sep  2 14:02:19 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/bigdecimal/bigdecimal.c: fix rounding algorithms for half-down
+	  and half-even.  This change is based on the patch created by Matthew
+	  Willson, the reporter of this bug.  [Bug #3803] [ruby-core:32136]
 
-	* ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
+	* test/bigdecimal/test_bigdecimal.rb: add tests for above changes.
 
-	* ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
-	  bug fix and improvement of font control
+Sat Sep 18 20:09:51 2010  Tanaka Akira  <akr@fsij.org>
 
-Tue Sep  2 09:51:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/pathname/pathname.c (path_each_entry): Pathname#each_entry
+	  translated from pathname.rb.
 
-	* eval.c (rb_eval): should not handle exceptions within rescue
-	  argument.  [ruby-talk:80804]
+Fri Sep 17 23:44:07 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Tue Sep  2 00:44:37 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rexml/xpath_parser.rb, test/rexml/test_xpath.rb:
+	  add missing method availability check. [ruby-core:32447]
+	  Reported by Wiebe Cazemier. Thanks!!!
 
-	* re.c (rb_memsearch): fix overrun.  [ruby-talk:80759]
+Fri Sep 17 23:23:26 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Tue Sep  2 00:41:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rexml/test_sax.rb: don't use thread and sleep to avoid slow test.
 
-	* ext/iconv/iconv.c (map_charset): use lower case keys.
+Fri Sep 17 23:10:44 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/iconv/iconv.c (iconv_fail): just yield error and return the
-	  result if a block is given.
+	* test/rexml/test_core.rb: enable.
 
-	* ext/iconv/iconv.c (iconv_convert): yield error and append the
-	  result if a block is given.
+Fri Sep 17 22:46:02 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/iconv/charset_alias.rb (charset_alias): optional third
-	  argument.
+	* test/rexml/: untabify.
 
-	* ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
-	  SHIFT_JIS on cygwin.
+Fri Sep 17 22:29:56 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon Sep  1 18:34:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rexml/: fix fixture data path. All REXML tests are worked.
 
-	* eval.c (rb_eval): make tail recursion in ELSE clause of
-	  RESCUE a jump.
+Fri Sep 17 22:15:15 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon Sep  1 18:00:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rexml/test_listener.rb: remove needless codes.
 
-	* parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
-	  Dave Butcher.
+Fri Sep 17 22:12:23 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* eval.c (Init_Thread): protect thgroup_default.  suggested by Guy
-	  Decoux in [ruby-talk:80623]
+	* test/rexml/: import REXML tests from
+	  http://www.germane-software.com/repos/rexml/trunk/test/.
+	  Many tests are failed temporary. I'll fix them quickly. Sorry.
 
-Mon Sep  1 16:59:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep 17 16:48:49 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
-	  thread termination.
+	* test/io/console/test_io_console.rb (TestIO_Console::helper):
+	  PTY.open is not guaranteed to work.  On my machine opening a
+	  pty is prohibited via process control group.  On those cases
+	  exceptions shall occur, and that doesn't mean our fault.
+	  Skip those tests on such situations.
 
-	* eval.c (rb_thread_start_0): should not error_print() within
-	  terminated thread, because $stderr used by it might be
-	  overriden now.  [ruby-dev:21280]
+Fri Sep 17 08:30:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Aug 31 22:46:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/tracer.rb: count only non-internal libraries in stack trace,
+	  ignoring custom_require.  [ruby-core:31858]
 
-	* eval.c (TAG_DST()): take no argument.
+Fri Sep 17 02:18:41 2010  Akinori MUSHA  <knu@iDaemons.org>
 
-	* process.c (p_gid_sw_ensure): return VALUE.
+	* tool/mkconfig.rb: Fix build with m4 1.4.15 generating duplicate
+	  lines in config.status.  According to nobu, the mswin32 port may
+	  depend on the piece of code in question, so the behavior is left
+	  unchanged on mswin32.
 
-Sun Aug 31 22:27:10 2003  Hidetoshi NAGAI  <nagai@dumbo.ai.kyutech.ac.jp>
+Thu Sep 16 23:47:59 2010  Tanaka Akira  <akr@fsij.org>
 
-	* process.c (p_gid_sw_ensure): lack of function type
+	* ext/pathname/pathname.c (path_opendir): Pathname#opendir translated
+	  from pathname.rb.
 
-Sun Aug 31 12:25:06 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+Thu Sep 16 21:40:37 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb: --version takes an optional argument; "all" or
-	  a list of package names.
+	* lib/test/unit.rb (Test::Unit::GlobOption): merged RejectOption.
 
-Sun Aug 31 10:17:02 2003  Tadayoshi Funaba  <tadf@dotrb.org>
+	* test/runner.rb: utilize GlobOption.
 
-	* lib/date/format.rb: yyyy/mm is not an acceptable format.
+Thu Sep 16 21:31:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/time.rb: follow above.
+	* lib/rdoc/ri/driver.rb (RDoc::RI::Driver.setup_options)
+	  (RDoc::RI::Driver.fixup_options): split from process_args.
+	  libraries should not parse ARGV inside, since it's a task of
+	  applications, not libraries.
 
-Sat Aug 30 14:25:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Sep 16 21:02:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_iter_break): should not call TAG_JUMP directly.
+	* lib/rdoc/ri/paths.rb (RDoc::RI::Paths.each): HOMEDIR can be nil
+	  if $HOME is unset.
 
-Sat Aug 30 03:58:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Sep 16 14:50:42 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
+	* test/ruby/test_file_exhaustive.rb (TestFileExhaustive::test_expand_path):
+	  ENV["HOME"] might not be set.  On those cases without it an
+	  exception raises here, which effectively disables later
+	  tests on this method.
 
-	* eval.c (POP_TAG): no longer propagate retval.  retval is now set
-	  directly by localjump_destination().
+Thu Sep 16 08:30:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (localjump_destination): new function to cast
-	  return/break local jump.
+	* sprintf.c (rb_f_sprintf): fix rdoc.  pointed out by Tomoyuki
+	  Chikanaga at [ruby-core:32395], and a patch from Daniel
+	  Bovensiepen at [ruby-core:32403].
 
-	* eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
+Thu Sep 16 08:27:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug 29 22:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* ext/etc/extconf.rb: use expanded sysconfdir with empty DESTDIR.
+	  [ruby-core:32394]
 
-	* bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
-	  then result will be the same as +,-,*,/ respectively.
+Thu Sep 16 06:07:24 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Aug 29 17:30:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/pathname/pathname.c (path_rmdir): Pathname#rmdir translated
+	  from pathname.rb.
 
-	* process.c: bug fix
+Thu Sep 16 00:36:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
+	* ext/readline/extconf.rb: Remove Readline 6 check because
+	  Ruby's license is now GPLv3 compatible. [ruby-core:28736]
 
-	* process.c: deny handling IDs during evaluating the block given to
-	  the Process::{UID,GID}.switch method
+Thu Sep 16 00:26:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
+	* COPYING: change Ruby's License from a dual license with GPLv2
+	  to a dual license with 2-clause BSDL.
+	  [ruby-dev:42166] [ruby-core:31971]
+	  [ruby-dev:39167] [ruby-core:25272]
 
-	* ext/tcltklib/tcltklib.c : can create a interpreter without Tk
+	* COPYING.ja: ditto.
 
-	* ext/tcltklib/tcltklib.c : bug fix on handling exceptions
+	* BSDL: added. this is from The FreeBSD License.
 
-	* ext/tcltklib/MANUAL.euc : modify
+Wed Sep 15 21:07:06 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk.rb : freeze some core modules
+	* ext/pathname/pathname.c (path_mkdir): Pathname#mkdir translated
+	  from pathname.rb.
 
-	* ext/tk/lib/multi-tk.rb : more secure
+Wed Sep 15 13:37:00 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
-	  Tk's list
+	* test/net/imap/test_imap.rb: "localhost" not guaranteed to
+	  resolve to "127.0.0.1".  On my machine it is "::1" instead.
+	  The problem is, you have to connect to the imaps server via
+	  the canonical name written in a server certificate, and that
+	  of the server.cert is "localhost".  So you have to listen to
+	  the address of what "localhost" resolves to.  I think this
+	  situation cannot be resolved in a handy manner because the
+	  test "test_imaps_post_connection_check" is actually
+	  expecting to connect to a server via an address other than
+	  the CN.  On my machine several assertions won't pass because
+	  the test cannot connect to the server.
 
-	* ext/tk/lib/tk.rb: improve accessibility of TkVariable object
+Wed Sep 15 09:12:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
-	  ext/tk/lib/tktext.rb : fix bug of font handling
+	* io.c (rb_io_puts): fix for wide char encoding strings.
+	  [ruby-dev:42212]
 
-	* ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
+Wed Sep 15 07:27:52 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Aug 28 22:07:12 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_str_format_m): mentioned about Hash argument.  a patch
+	  from Daniel Bovensiepen at [ruby-core:32386].
 
-	* variable.c (rb_autoload_load): call const_missing if autoloading
-	  constant is not defined to allow hook.
+	* sprintf.c (get_hash): ditto, and fix typo.
 
-	* eval.c (rb_eval): use rb_const_get_from() instead of
-	  rb_const_get_at().
+Wed Sep 15 07:22:20 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (is_defined): forgot to check NODE_COLON3.
+	* ext/pathname/pathname.c (path_entries): Pathname#entries translated
+	  from pathname.rb.
 
-Thu Aug 28 17:30:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 15 02:13:44 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* variable.c (rb_const_get_0): should check constants defined in
-	  included modules, if klass is Object. [ruby-talk:79302]
+	* ext/fiddle/closure.c : Don't use FFI closure alloc on OpenBSD.
+	  Thanks Jeremy Evans! [ruby-core:32384]
 
-	* numeric.c (check_uint): check should be done using UINT_MAX, not
-	  INT_MAX. this fix is submitted by Lyle Johnson
-	  <lyle@knology.net> in [ruby-core:01486]
+Tue Sep 14 20:17:48 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Aug 28 05:02:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/pathname/pathname.c (path_s_getwd): Pathname.getwd and
+	  Pathname.pwd translated from pathname.rb.
 
-	* parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
+Tue Sep 14 05:13:04 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Aug 28 02:37:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/pathname/pathname.c (path_s_glob): Pathname.glob translated
+	  from pathname.rb.
 
-	* eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
-	  consistent with *a = [1], which set [[1]] to a.
+Tue Sep 14 01:24:51 2010  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
 
-	* node.h: merge NODE_RESTARY to NODE_SPLAT.
+	* ext/socket/raddrinfo.c (ruby_getaddrinfo__aix): suppress a
+	  warning.
 
-	* parse.y: rules simplified a bit by removing NODE_RESTARY.
+Mon Sep 13 20:48:30 2010  Tanaka Akira  <akr@fsij.org>
 
-	* sample/test.rb: updated for new assignment behavior.
+	* ext/pathname/pathname.c (path_zero_p): Pathname#zero? translated
+	  from pathname.rb.
 
-Wed Aug 27 22:33:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 13 19:56:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* error.c (rb_bug): should not use other methods; this function is
-	  not for ordinary use.  [ruby-dev:21259]
+	* ext/socket/rubysocket.h (__DARWIN_ALIGNBYTES): workaround of a
+	  bug in system header of darwin 9.  [ruby-core:32341]
 
-Wed Aug 27 15:07:57 2003  Minero Aoki  <aamine@loveruby.net>
+Mon Sep 13 18:11:55 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
-	  response. [ruby-list:38279]
+	* lib/mkmf.rb (try_do): fix typo.  a patch from Peter Weldon
+	  at [ruby-core:32327].
 
-Wed Aug 27 05:10:15 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Sep 13 10:12:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* win32/win32.c (map_errno): support winsock error.
+	* util.c (ruby_strtod): reject Float('0x0.').
+	  [ruby-dev:42239] Bug #3820
 
-	* win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
-	  kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
-	  pass errno to map_errno().
+Mon Sep 13 09:23:58 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
-	  rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
-	  rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
-	  rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
-	  rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
-	  rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
-	  rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
-	  rb_w32_fclose, rb_w32_close): use map_errno().
+	* ext/openssl/ossl_bn.c (ossl_bn_is_prime): fix comparison
+	  with rb_scan_args. Before this fix, OpenSSL::BN#prime?
+	  is fully broken. [ruby-dev:42225]
 
-	* win32/win32.h: add winsock errors.
+Mon Sep 13 06:45:24 2010  Tanaka Akira  <akr@fsij.org>
 
-Tue Aug 26 23:53:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/pathname/pathname.c (path_writable_real_p):
+	  Pathname#writable_real? translated from pathname.rb.
 
-	* lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
-	  frozen OpenStruct. [ruby-talk:80214]
+Sun Sep 12 21:21:50 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Aug 26 20:03:50 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/date.rb: [ruby-core:32096]  Thanks Colin Bartlett.
 
-	* lib/mkmf.rb (create_tmpsrc): add the hook for source.
-	  [ruby-list:38122]
+Sun Sep 12 19:30:27 2010  Tanaka Akira  <akr@fsij.org>
 
-Tue Aug 26 15:59:53 2003  why the lucky stiff  <why@ruby-lang.org>
+	* ext/pathname/pathname.c (path_world_writable_p):
+	  Pathname#world_writable? translated from pathname.rb.
 
-	* implicit.c (syck_type_id_to_taguri): corrected detection of
-	  x-private types.
+Sun Sep 12 09:16:06 2010  Tanaka Akira  <akr@fsij.org>
 
-Sun Aug 24 01:02:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/pathname/pathname.c (path_writable_p): Pathname#writable?
+	  translated from pathname.rb.
 
-	* file.c (file_expand_path): performance improvement.
-	  [ruby-talk:79748]
+Sun Sep 12 08:36:15 2010  Tanaka Akira  <akr@fsij.org>
 
-Sat Aug 23 23:41:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (rlimit_resource_name2int): support more limits:
+	  RLIMIT_MSGQUEUE, RLIMIT_NICE, RLIMIT_RTPRIO, RLIMIT_RTTIME and
+	  RLIMIT_SIGPENDING.
+	  (Init_process): ditto.
+	  patch by Run Paint Run Run.  [ruby-core:32262]
 
-	* file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
-	  apparent cases. [ruby-talk:79748]
+Sun Sep 12 04:27:13 2010  Tanaka Akira  <akr@fsij.org>
 
-Sat Aug 23 18:56:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (rlimit_resource_name2int): use STRCASECMP to avoid
+	  ALLOCA_N.
 
-	* ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
-	  resize a string, rb_str_cat() disallows NULL.  [ruby-dev:21237]
+Sat Sep 11 16:47:41 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug 23 16:48:41 2003  Keiju Ishitsuka  <keiju@ishitsuka.com>
+	* hash.c (ruby_setenv): raise if putenv and SetEnvironmentVariable
+	  failed, because of the restriction of the size on Windows.
+	  based on a patch from Peter Weldon at [ruby-core:32304].  fix:
+	  Bug#3812, [ruby-core:32250]
 
-	* lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
+Sat Sep 11 15:19:57 2010  Eric Hodel  <drbrain@segment7.net>
 
-Sat Aug 23 15:59:58 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/httpauth/digestauth.rb (WEBrick::Config::DigestAuth):
+	  Add documentation
 
-	* eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
-	  EXEC_TAG() for retry.  [ruby-dev:21216]
+	* lib/webrick/config.rb (WEBrick::Config::DigestAuth): Add
+	  documentation
 
-Sat Aug 23 02:32:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Sep 11 12:32:05 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_yield_splat): should check if "values" is array.
+	* include/ruby/intern.h (rb_set_kcode, rb_get_kcode): removed
+	  zombie prototype declarations.  a patch from Eric Hodel
+	  at [ruby-core:32305].
 
-	* enum.c (each_with_index_i): typo.
+Sat Sep 11 06:53:12 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Aug 22 17:07:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/pathname/pathname.c (path_symlink_p): Pathname#symlink?
+	  translated from pathname.rb.
 
-	* enum.c (inject_i): use rb_yield_values.
+Fri Sep 10 23:03:43 2010  Tanaka Akira  <akr@fsij.org>
 
-	* enum.c (each_with_index_i): ditto.
+	* ext/pathname/pathname.c (path_sticky_p): Pathname#sticky? translated
+	  from pathname.rb.
 
-	* eval.c (rb_yield_splat): new function to call "yield *values".
+Fri Sep 10 19:11:13 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* string.c (rb_str_scan): use rb_yield_splat().
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#continue): add
+	  method for generating HTTP/1.1 100 continue response if the client
+	  expects it, otherwise does nothing.  Patch by Brian Candler.
+	  ref #855.
 
-Fri Aug 22 06:13:22 2003  why the lucky stiff  <why@ruby-lang.org>
+	* test/webrick/test_httprequest.rb: test added.
 
-	* ext/syck/rubyext.c: refactoring of the transfer method
-	  dispatch.  added yaml_org_handler for faster dispatch of
-	  transfers to base types.
+Fri Sep 10 17:49:34 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* lib/yaml/rubytypes.rb: removed handling of builtins from
-	  Ruby library.
+	* ext/openssl/lib/openssl/x509-internal.rb: removed unused local
+	  variable.
 
-	* ext/syck/token.c: quoted and block scalars are now implicit !str
+	* test/openssl/*: less warnings while test running with -w.
 
-	* ext/syck/implicit.c: empty string detected as !null.
+Fri Sep 10 16:49:20 2010  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri Aug 22 01:00:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* class.c (rb_scan_args): Add support for optional keyword
+	  argument hash. [ruby-dev:42221] [ruby-dev:38048]
 
-	* eval.c (block_pass): improve passing current block.
+	* README.EXT, README.EXT.ja: Update documentation accordingly.
 
-Fri Aug 22 00:13:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* dir.c (dir_initialize): Make use of the new rb_scan_args()
+	  feature.
 
-	* ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
-	  fixed, and VpNmlz() speed up.
+	* io.c (rb_io_s_popen, rb_scan_open_args, rb_io_initialize)
+	  (rb_io_s_pipe, open_key_args, io_s_foreach, io_s_readlines)
+	  (rb_io_s_read, rb_io_set_encoding): Ditto.
 
-Wed Aug 20 16:44:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* transcode.c (str_transcode, econv_args)
+	  (econv_primitive_convert): Ditto.
 
-	* ext/socket/socket.c (ruby_connect): many systems seem to have
-	  a problem in select() after EINPROGRESS.  [ruby-list:38080]
+	* ext/zlib/zlib.c (rb_gzreader_initialize): Ditto.
 
-Wed Aug 20 01:31:17 2003  why the lucky stiff  <why@ruby-lang.org>
+Fri Sep 10 10:33:18 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/syck/syck.h: Parser definition problems on HP-UX.
-	  [ruby-talk:79389]
+	* random.c (rb_genrand_ulong_limited): renamed from
+	  rb_rand_internal and now this is public API.
 
-	* ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
+	* include/ruby/ruby.h (rb_genrand_ulong_limited): added.
 
-	* ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
+	* bignum.c (big_sparse_p): use rb_genrand_ulong_limited.
 
-	* ext/syck/rubyext.c: Tainting issues.
+Fri Sep 10 13:07:22 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Tue Aug 19 23:20:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* ext/digest/lib/digest.rb: removed unused exception variable
+	  assignment to avoid a warning.
 
-	* ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
+Fri Sep 10 07:29:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
+	* ext/etc/etc.c (etc_systmpdir): assume system default tmpdir
+	  safe.  [ruby-dev:42089]
 
-Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Sep 10 07:03:23 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
+	* ext/pathname/pathname.c (path_size_p): Pathname#size? translated from
+	  pathname.rb.
 
-	* lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
+Fri Sep 10 02:15:29 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/webrick/compat.rb (File::fnmatch): remove old migration code.
+	* ext/socket/option.c (inspect_peercred): support OpenBSD-current.
+	  patch by Jeremy Evans.  [ruby-core:32240]
 
-	* lib/webrick/httpserver.rb (HTTPServer#run): ditto.
+Thu Sep  9 23:25:53 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/server.rb (GenericServer#listen): the body of this
-	  method is pull out as Utils::create_lisnteners.
+	* vm.c (vm_backtrace_each): skip allocator frames which have no
+	  name.  [ruby-core:32231]
 
-	* lib/webrick/utils.rb (Utils::create_lisnteners): new method.
+Thu Sep  9 22:39:08 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  unknown errors. and refine comments.
+	* ext/pathname/pathname.c (path_size): Pathname#size translated from
+	  pathname.rb.
 
-	* ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
-	  socket if SSLSocket raises error.
+Thu Sep  9 22:34:48 2010  wanabe  <s.wanabe@gmail.com>
 
-Tue Aug 19 11:19:33 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* compile.c (case_when_optimizable_literal): When float value can be
+	  treated as integer, add to table hash of case that way.
+	  based on a patch from Ikuo KOBORI. [ruby-dev:42038]
 
-	* io.c (next_argv): should not call GetOpenFile() if rb_stdout is
-	  not a IO (T_FILE).
+	* insns.def (opt_case_dispatch): ditto.
 
-Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/ruby/test_case.rb: add tests.
 
-	* ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
-	  a builtin.
+Thu Sep  9 17:15:15 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
+	* test/net/http/test_https.rb (test_identity_verify_failure): follows
+	  the SSL hostname check error message of openssl.
 
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
-	  add a return to the tails of each line.
+Thu Sep  9 10:44:46 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
+	* test/ruby/test_env.rb (test_aset): OpenBSD acts like NetBSD in
+	  that it ignores characters after = in ENV.
+	  patched by Jeremy Evans [ruby-core:32184]
 
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
+Thu Sep  9 09:02:01 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/sample/echo_svr.rb: use SSLServer.
+	* tool/rbinstall.rb (install?): gemspec filename should include
+	  its version. patched by Luis Lavena [ruby-core:32165]
 
-	* ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
+Wed Sep  8 22:46:31 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Tue Aug 19 01:24:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ssl_get_error): Thread context switch was
+	  blocked on Windows while blocking call for SSLSocket.  Need to
+	  convert errno for letting rb_io_wait_readable detect EWOULDBLOCK.
+	  Patch by arton. ref #3794.
 
-	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
-	  headers are inconsistent at this macro.  [ruby-core:01432]
+Wed Sep  8 20:56:57 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
+	* ext/pathname/pathname.c (path_setgid_p): Pathname#setgid? translated
+	  from pathname.rb.
 
-	* ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
-	  winspool.h
+Wed Sep  8 06:25:41 2010  Tanaka Akira  <akr@fsij.org>
 
-	* instruby.rb: make list at first instead of iterator.
-	  [ruby-talk:79347]
+	* ext/pathname/pathname.c (path_setuid_p): Pathname#setuid? translated
+	  from pathname.rb.
 
-Mon Aug 18 11:23:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Sep  7 21:03:35 2010  Tanaka Akira  <akr@fsij.org>
 
-	* dir.c (glob_helper): preserve raw order for **.
+	* ext/pathname/pathname.c (path_readable_real_p):
+	  Pathname#readable_real?  translated from pathname.rb.
 
-Sun Aug 17 23:39:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep  6 23:07:25 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
+	* ext/pathname/pathname.c (path_world_readable_p):
+	  Pathname#world_readable?  translated from pathname.rb.
 
-Sun Aug 17 17:10:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Sep  6 11:03:13 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
-	  method to specify if the underlying IO will be closed in
-	  SSLSocket#close.
+	* Fixed wrong check of missing functions. Patch by Adrian Quark.
+	  ref #3400
+	  The patch contains following comment:
+	    This patch should avoid unnecessary incompatibility with future
+	    versions of Openssl.  Changes suggested by bmaher_at_amazon.com.
 
-	* ext/openssl/lib/openssl/buffering.rb: add forwarders to
-	  setsockopt, getsockopt and fcntl.
+Mon Sep  6 10:46:55 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
+	* Fixed exception message for SSL post connection check failure. Patch
+	  by Paul Betteridge. ref [Bug #3704]
 
-Sun Aug 17 11:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep  6 10:31:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/extmk.rb (extmake): should not force to remake Makefile when
-	  installation and so on.
+	* ext/readline/readline.c (readline_s_get_line_buffer):
+	  Readline.line_buffer should return locale string.
+	  [ruby-dev:42184] #3791
 
-Sat Aug 16 23:58:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep  6 09:47:24 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* marshal.c (w_symbol, w_object): get rid of warnings.
+	* util.c (ruby_strtod): check there is at least 1 digit after
+	  "0x" before ".". [ruby-dev:42183] #3790
 
-	* re.c (rb_memsearch): ditto.
+Mon Sep  6 09:44:50 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* time.c (time_dump): ditto.
+	* util.c (ruby_strtod): check integer overflow.
+	  [ruby-dev:42180] #3789
 
-	* ext/extmk.rb (extmake): not continue making when extconf.rb
-	  failed.
+Mon Sep  6 06:17:21 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
+	* ext/pathname/pathname.c (path_readable_p): Pathname#readable?
+	  translated from pathname.rb.
 
-	* ext/openssl/ossl.h: remove version.h dependency.
+Sun Sep  5 23:02:34 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ruby_missing.h: ditto.
+	* ext/pathname/pathname.c (path_owned_p): Pathname#owned?
+	  translated from pathname.rb.
 
-	* lib/mkmf.rb (pkg_config): use --libs output except with
-	  only-L for other options.  [ruby-list:38099]
+Sat Sep  4 23:48:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (create_makefile): separate rule for static
-	  library from shared object.
+	* file.c (rb_file_s_readlink): symlink target should be in
+	  filesystem encoding.
 
-	* win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
-	  define exec_prefix and libdir.
+Sat Sep  4 10:40:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug 15 23:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* load.c (ruby_init_ext): export for golfers.
 
-	* ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
-	  method fixed.
+	* vm_core.h (rb_iseq_eval, rb_iseq_compile_with_option): ditto.
 
-	* ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
+Sun May 23 17:29:41 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* common.mk (capi): uses a timestamp file to get rid of
+	  generating twice.
 
-	* configure.in (HUGE_ST_INO): check whether struct stat.st_ino
-	  is larger than long.  [ruby-dev:21194]
-	  http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
+Fri Jun 18 01:33:21 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* error.c (syserr_eqq): errno might exceed Fixnum limit.
+	* enc/Makefile.in (realclean): has been missing. necessary
+	  for make realclean-enc.
 
-	* error.c (Init_Exception): moved base initialization from
-	  init_syserr().
+Fri Sep  3 23:51:26 2010  Tanaka Akira  <akr@fsij.org>
 
-	* inits.c (rb_call_inits): postpone initializing errnos until
-	  Bignum is available.
+	* ext/pathname/pathname.c (path_socket_p): Pathname#socket?
+	  translated from pathname.rb.
 
-Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep  3 06:40:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
-	  keyname() and so on be declared.
+	* ext/pty/pty.c (chfunc): pass through exceptions.
 
-	* ext/curses/curses.c (curses_resizeterm, window_resize):
-	  arguments conflicted with macros in term.h.
+	* io.c (rb_io_bufwrite, rb_io_bufread): added.
 
-	* ext/curses/curses.c (Curses module methods): ensure
-	  initialized.  [ruby-dev:21191]
+	* process.c (rb_fork_err): protect from exceptions.
 
-Fri Aug 15 02:08:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Sep  3 06:16:07 2010  Tanaka Akira  <akr@fsij.org>
 
-	* gc.c (id2ref): recycle check should be done by klass == 0.
-	  [ruby-core:01408]
+	* ext/pathname/pathname.c (path_pipe_p): Pathname#pipe?
+	  translated from pathname.rb.
 
-Fri Aug 15 01:34:23 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+Fri Sep  3 06:14:40 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey.c: move generate_cb here
+	* ext/pty/pty.c (chfunc): restore errno from SystemCallError and
+	  propagate proper exception to the parent.  [ruby-dev:41965]
 
-	* ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
+Thu Sep  2 22:10:38 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
+	* ext/pathname/pathname.c (path_file_p): Pathname#file?
+	  translated from pathname.rb.
 
-	* ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
+Thu Sep  2 09:12:02 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Aug 15 00:38:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* win32/win32.c (rb_w32_spawn, rb_w32_aspawn): don't forget to free
+	  memory.
 
-	* ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
+Thu Sep  2 09:01:13 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
+	* win32/win32.c (CreateChild): unicodize.
 
-	* ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
+	* win32/win32.c (rb_w32_spawn, rb_w32_aspawn): convert arguments of
+	  CreateChild() from ACP to WideChar.
 
-Thu Aug 14 21:19:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Sep  2 06:53:43 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (Init_Thread): Continuation#[] added.  [ruby-talk:79028]
+	* ext/pathname/pathname.c (path_directory_p): Pathname#directory?
+	  translated from pathname.rb.
 
-Thu Aug 14 20:03:34 2003  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Wed Sep  1 22:03:41 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/win32ole/win32ole.c (OLE_FREE): should not call
-	  ole_message_loop.
+	* ext/pathname/pathname.c (path_grpowned_p): Pathname#grpowned?
+	  translated from pathname.rb.
 
-	* ext/win32ole/win32ole.c (ole_event_free): ditto.
+Wed Sep  1 17:39:02 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* ext/win32ole/win32ole.c (ole_initialize): stop calling
-	  OleUninitialize at exit.
+	* lib/minitest/*.rb: Imported minitest 1.7.1 r5835.
+	* test/minitest/*.rb: ditto.
 
-Thu Aug 14 11:27:37 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Sep  1 16:50:42 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* gc.c (rb_data_object_alloc): check type of 1st argument.
-	  [ruby-dev:21192]
+	* string.c (tr_setup_table): optimized. don't create hash objects
+	  when given pattern is ASCII only.
 
-Thu Aug 14 00:21:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (tr_find): ditto.
 
-	* parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
+Wed Sep  1 14:35:29 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (lhs): ditto.
+	* array.c (rb_ary_rotate_m): fix typo of rdoc.
+	  patched by Andrei Kulakov [ruby-core:31975]
 
-	* parse.y (yylex): should return tCOLON3 right after kCLASS.
-	  [ruby-talk:78918]
+Wed Sep  1 14:33:36 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* error.c (exc_initialize): was converting argument to string too
-	  eagerly.  Only check was needed. [ruby-talk:78958]
+	* enum.c (enum_zip): fix typo of rdoc.
+	  patched by Andrei Kulakov [ruby-core:31974]
 
-Wed Aug 13 23:31:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Wed Sep  1 12:56:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
-	  BigDecimal::limit removed.
+	* thread.c (ruby_suppress_tracing): restore the state and invoke
+	  the func with normal state.  a patch from Satoshi Shiba <shiba
+	  AT rvm.jp> at [ruby-dev:42162].  [ruby-core:31783]
 
-Wed Aug 13 19:21:34 2003  Christian Neukirchen  <chneukirchen@yahoo.de>
+Tue Aug 31 21:10:23 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
-	  to SSLSocket. [ruby-talk:78919]
+	* ext/pathname/pathname.c (path_exist_p): Pathname#exist? translated
+	  from pathname.rb.
 
-Wed Aug 13 18:13:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 31 17:32:34 2010  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
+	* ext/tk/stubs.c: fix [Bug #3771] "VC++ can't make ext/tk with enabling
+	  stubs". Thanks, Akio Tajima [ruby-dev:42159].
 
-	* eval.c (proc_invoke): unpack return/break destination when block
-	  is already left.
+Tue Aug 31 03:42:14 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Aug 13 15:58:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* string.c (tr_setup_table): fix bug in r29146.
+	  Initialize table even if cflag is 0; tr_find see whether
+	  del is empty or not.
 
-	* object.c (rb_class_s_alloc): add function prototype to avoid VC++
-	  warning.
+	* string.c (tr_find): nodel can't be NULL; if NULL, it means
+	  it is not specified.
 
-Wed Aug 13 13:50:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Aug 30 21:29:21 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/Win32API/Win32API.c (Win32API_initialize): should pass some
-	  class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
+	* ext/pathname/pathname.c (path_executable_real_p):
+	  Pathname#executable_real? translated from pathname.rb.
 
-Tue Aug 12 16:55:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Aug 30 15:00:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* Makefile.in: static link libraries to LIBRUBY_SO with static linked
-	  ext.  [ruby-dev:21157]
+	* string.c (tr_setup_table): initialize negating table when
+	  negating string is given. [ruby-core:31851]
 
-	* ext/extmk.rb (extmake): sort extension library initialization order.
+	* string.c (tr_find): add a sentence for the time when
+	  target characters include negating one.
 
-	* ext/extmk.rb (extmake): compact $extlibs.
+	* string.c (rb_str_count): move definition.
 
-Tue Aug 12 02:48:56 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Aug 30 07:32:41 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
-	  flag before calling getcontext(2).
+	* ext/pathname/pathname.c (path_executable_p): Pathname#executable?
+	  translated from pathname.rb.
 
-	* eval.c (struct thread): add member to save backing store on
-	  IA64. (ruby-bugs PR1086)
+Sun Aug 29 23:54:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thread_mark): mark IA64 backing store region.
+	* lib/rdoc/parser/ruby.rb (RDoc#parse_call_parameters): don't
+	  include assignment.  [Bug #3759], [ruby-dev:42154]
 
-	* eval.c (thread_free): free saved IA64 backing store.
+	* lib/rdoc/parser/ruby.rb (RDoc#parse_class): ignore non-constant
+	  name singleton class.  [Bug #3759], [ruby-dev:42154]
 
-	* eval.c (rb_thread_save_context): save IA64 backing store as well.
+Sun Aug 29 23:25:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_restore_context): restore IA64 backing store.
+	* file.c (rb_get_path_check): clarify error message for
+	  ASCII-incompatible path name.
 
-	* eval.c (THREAD_ALLOC): initialize IA64 members.
+Sun Aug 29 16:02:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Aug 11 22:31:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-	* lib/debug.rb(debug_command): inspection command should inspect
-	  resulting value even if it's nil.  [ruby-dev:21180] by OMAE, jun
-	  <jun66j5@ybb.ne.jp>.
+	* common.mk (node_name.inc): remove command option -n and give
+	  file as stdin, because IronRuby 1.1 still doesn't support it.
+	  So now we can use ir.exe as BASERUBY.
 
-	* lib/debug.rb(debug_command): incomplete regexp.
+	* tool/node_name.rb: read stdin with while gets.
 
-Mon Aug 11 17:33:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Aug 29 13:22:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_call_super): do not use rb_block_given_p() for
-	  check. [ruby-talk:78656]
+	* vm.c (rb_thread_method_id_and_class): curried proc has no
+	  method.  [ruby-core:31871]
 
-	* eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
+Sun Aug 29 12:51:33 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Aug 10 10:43:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* load.c (rb_provide_feature): clarify error message for frozen
+	  $LOADED_FEATURES.  based on a patch from Run Paint Run Run at
+	  [ruby-core:31913].
 
-	* ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
-	  from 1k to 16k bytes. [ruby-talk:78603]
+Sun Aug 29 12:19:58 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
-	  partial write to allow interruption in SSLSocket#write.
+	* load.c (load_failed): should honor encoding.  [ruby-core:31915]
 
-Sun Aug 10 00:34:16 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sun Aug 29 09:35:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
-	  for ccache.
+	* common.mk (clean): exclude *.inc. [ruby-dev:41931]
 
-Sat Aug  9 10:36:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* common.mk (distclean): include *.inc.
 
-	* marshal.c (w_object): do not dump generic instance variable when
-	  marshal_dump is defined.
+	* common.mk (help): change description about clean and distclean.
 
-Sat Aug  9 00:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Sat Aug 29 06:34:52 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/bigdecimal.c: F style output(like 1234.56789) implemented
-	  to to_s method.
-	* ext/bigdecimal_??.html: F style output(like 1234.56789)
-	  implemented to to_s method.
+	* ext/pathname/pathname.c (path_chardev_p): Pathname#chardev?
+	  translated from pathname.rb.
 
-Fri Aug  8 12:33:17 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Aug 28 17:39:33 2010  Kenta Murata  <mrkn@mrkn.jp>
 
-	* bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
-	  add the -aa option to WLDFLAGS.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_save_exception_mode,
+	  BigDecimal_save_rounding_mode, BigDecimal_save_limit): added.
 
-Fri Aug  8 11:29:26 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* test/bigdecimal/test_bigdecimal.rb: added tests for the above
+	  features.
 
-	* marshal.c (w_object): should set `c_arg' at first.
+Sat Aug 28 08:11:05 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Aug  8 03:22:28 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/pathname/pathname.c (path_blockdev_p): Pathname#blockdev?
+	  translated from pathname.rb.
 
-	* lib/webrick/httputils.rb (FormData#list): should not take
-	  a side effect for the receiver.
+Fri Aug 27 16:20:01 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Thu Aug  7 14:40:37 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* string.c (rb_str_prepend): new method by Shota Fukumori (sora_h)
+	  [Feature #3765]
 
-	* cygwin/GNUmakefile: better --disbale-shared option support.
+Fri Aug 27 15:24:20 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* cygwin/GNUmakefile: add forwarding DLL target for cygwin.
+	* math.c (math_atan2): you should know that M_PI is not the feature
+	  of C90.
+	  fixed build failure caused by r29115.
 
-Thu Aug  7 14:21:05 2003  Corinna Vinschen  <vinschen@redhat.com>
+Fri Aug 27 15:26:33 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in: Fix Cygwin specific naming of libraries to
-	  be net distribution compliant. (ruby-bugs:PR#1077)
-	  cygwin-ruby18.dll -> cygruby18.dll
+	* file.c (null_device): move from io.c.
 
-Thu Aug  7 12:51:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Aug 27 12:47:44 2010  Kenta Murata  <mrkn@mrkn.jp>
 
-	* eval.c (rb_f_at_exit): should not be called without a block.
-	  block_given check added.
+	* math.c (math_atan2): change the behavior when x and y are zero.
+	  [ruby-dev:42090] [Bug #3736] [ruby-dev:42116]
 
-Thu Aug  7 06:46:06 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_math.rb (test_atan2): add tests for the above
+	  changes.
 
-	* eval.c (rb_call0): forgot to pop ruby_class.
+Fri Aug 27 12:26:23 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_call0): update ruby_class as well as ruby_cref.
-	  (ruby-bugs-ja:PR#540)
+	* object.c (rb_obj_class): remove mention of obsolete method.
+	  a patch from Run Paint Run Run at [ruby-core:31842].
 
-Thu Aug  7 04:52:50 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Aug 27 12:25:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
-	  ruby_cref.  [ruby-talk:78141]
+	* io.c (null_device): the name of null device.  [ruby-dev:41791]
 
-Thu Aug  7 04:19:15 2003  Akinori MUSHA  <knu@iDaemons.org>
+Fri Aug 27 07:57:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
-	  Linux/ia64.  This makes gc.c compile but miniruby coredumps for
-	  the moment.
+	* array.c (rb_ary_shuffle_bang): bail out from modification during
+	  shuffle.
 
-Thu Aug  7 00:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* array.c (rb_ary_sample): ditto.
 
-	* ext/bigdecimal.c: Comparison results adjusted to Float's.
-	* ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
+Fri Aug 27 05:11:51 2010  Tanaka Akira  <akr@fsij.org>
 
-Wed Aug  6 22:58:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* ext/pathname/pathname.c (path_sysopen): Pathname#sysopen translated
+	  from pathname.rb.
 
-	* lib/test/unit/testcase.rb: Added equality checking.
-	* lib/test/unit/testsuite.rb: Added equality checking.
-	* lib/test/unit/assertions.rb: Fixed a warning.
+Thu Aug 26 22:53:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug  6 17:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_shuffle): rdoc fix.  argument name was missing.
+	  a patch from Run Paint Run Run at [ruby-core:31848].
 
-	* ext/extmk.rb (extmake): pass LIBPATH to make ruby.  [ruby-dev:21137]
+Thu Aug 26 21:49:46 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/extmk.rb (extmake): set library name as source file name in
-	  Init_ext().  [ruby-dev:21137]
+	* ext/pathname/pathname.c (path_readlines): Pathname#readlines
+	  translated from pathname.rb.
 
-	* lib/mkmf.rb (Logging::postpone): postpone logging messages after
-	  heading message as the result of the block.
+Thu Aug 26 10:37:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/mkmf.rb (macro_defined?): append newline to src unless ended
-	  with it.
+	* regint.h (OnigStackIndex): the type should be intptr_t.
+	  Original Oniguruma assumes the size of long and that of void *
+	  are equal, but it's not true on LLP64 platform: mswin64.
+	  originally patched by shintaro kuwamoto [ruby-dev:42133]
 
-	* lib/mkmf.rb (have_library): treat nil function name as "main".
-	  (ruby-bugs:PR#1083)
+Thu Aug 26 10:38:11 2010  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
 
-	* lib/mkmf.rb (pkg_config): should append additional libraries to
-	  $libs but not $LIBS.  [ruby-dev:21137]
+	* test/dl/test_base.rb: AIX does not have dynamically loadable lib[cm].
 
-	* ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
+	* test/fiddle/helper.rb: AIX does not have dynamically loadable lib[cm].
 
-	* ext/digest/sha1/extconf.rb: have_library already appends library
-	  name.
+Thu Aug 26 09:49:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug  6 17:23:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* array.c (rb_ary_shuffle_bang): check number of argument.
 
-	* eval.c: initialize /* OK */ variables by Qnil to stop warnings.
+Tue Aug 26 09:11:40 2010  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Aug  6 04:58:32 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+	  rmpd_set_thread_local_exception_mode, VpGetException,
+	  VpSetException): thread-local exception mode.
 
-	* ext/Setup*: add io/wait and openssl.
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+	  rmpd_set_thread_local_precision_limit, VpGetPrecLimit,
+	  VpSetPrecLimit): thread-local precision limit.
 
-Wed Aug  6 01:13:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+	  rmpd_set_thread_local_rounding_mode, VpGetRoundMode,
+	  VpSetRoundMode, VpException, VpInternalRound):
+	  thread-local rounding mode.
 
-	* eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round,
+	  VpIsRoundMode, VpGetRoundMode, VpSetRoundMode, VpActiveRound,
+	  VpMidRound, VpLeftRound), ext/bigdecimal/bigdecimal.h:
+	  use unsigned short for rounding mode.
 
-	* eval.c (rb_f_autoload_p): ditto.
+	* test/bigdecimal/test_bigdecimal.rb (test_mode): add test for
+	  setting rounding mode.
 
-	* class.c (rb_mod_init_copy): no longer implements independent
-	  clone and dup methods.  override "initialize_copy" instead.
-	  [ruby-core:01352]
+	* test/bigdecimal/test_bigdecimal.rb (test_thread_local_mode):
+	  add test for setting mode thread-locally.
 
-	* object.c (rb_class_s_alloc): define Class allocation function.
-	  this makes Classes to follow clone framework that uses
-	  initialize_copy.
+Thu Aug 26 07:29:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (rb_class_initialize): separate instantiation and
-	  initialization.
+	* array.c (rb_ary_{shuffle_bang,sample}): use Random class object.
 
-	* object.c (rb_obj_alloc): prohibit instantiation from
-	  uninitialized class.
+	* random.c (try_get_rnd): use default_rand for Random as same as
+	  singleton methods.
 
-	* object.c (rb_class_superclass): check uninitialized class.
+	* random.c (rb_random_real): check the range of result.
 
-	* array.c (rb_ary_fill): wrong index processing with block.  this
-	  fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
+Wed Aug 25 22:11:11 2010  Tanaka Akira  <akr@fsij.org>
 
-	* marshal.c (w_object): should preserve generic ivar for nil,
-	  true, false, symbols, and fixnums.
+	* ext/pathname/pathname.c (path_binread): Pathname#binread translated
+	  from pathname.rb.
 
-	* marshal.c (w_uclass): base_klass check should be done after
-	  rb_class_real().
+Wed Aug 25 03:42:43 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Aug  6 01:18:50 2003  Minero Aoki  <aamine@loveruby.net>
+	* ext/dl/cfunc.c (rb_dlcfunc_call): workaround for VC9 for x64.
+	  reported by kuwamoto shintaro in [ruby-dev:42125].
 
-	* lib/net/http.rb: update document.
+Tue Aug 24 23:28:50 2010  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/net/pop.rb: ditto.
+	* .gitignore: updated.
 
-	* lib/net/protocol.rb: ditto.
+Tue Aug 24 22:07:28 2010  Tanaka Akira  <akr@fsij.org>
 
-Wed Aug  6 00:48:37 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* ext/pathname/pathname.c (path_read): Pathname#read translated from
+	  pathname.rb.
 
-	* marshal.c (w_object): should recommend marshal_dump rather than
-	  _dump_data.
+Tue Aug 24 10:11:04 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  5 17:58:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* configure.in: read API version from include/ruby/version.h.
 
-	* lib/fileutils.rb (install): should preserve timestamp only.
+	* {bcc,win}32/setup.mak (-version-): ditto.
 
-Tue Aug  5 17:31:59 2003  Ian Macdonald  <ian@caliban.org>
+	* version.h (RUBY_LIB_VERSION): use API version numbers.
 
-	* lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
-	  simple typo.
+Tue Aug 24 07:07:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  5 15:47:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_shuffle_bang, rb_ary_sample): add optional
+	  argument random.  [ruby-dev:41923] [EXPERIMENTAL]
 
-	* eval.c (rb_load): should preserve current source file/line.
+	* random.c (rb_random_{int32,real,bytes}): fallback to normal
+	  method invocation.
 
-Tue Aug  5 10:04:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 24 06:08:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_new4): ptr may refer null_str.
+	* include/ruby/version.h (RUBY_API_VERSION_*): renamed and moved
+	  from version.h.  [ruby-dev:42103]
 
-Mon Aug  4 17:25:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 24 05:58:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* stable version 1.8.0 released.
+	* ChangeLog: flushed.  [ruby-dev:42050]
 
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
 For the changes before 1.8.0, see doc/ChangeLog-1.8.0
 
 Local variables:
+coding: us-ascii
 add-log-time-format: (lambda ()
   (let* ((time (current-time))
+	 (system-time-locale "C")
 	 (diff (+ (cadr time) 32400))
 	 (lo (% diff 65536))
-	 (hi  (+ (car time) (/ diff 65536))))
+	 (hi (+ (car time) (/ diff 65536))))
   (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
 indent-tabs-mode: t
 tab-width: 8
+change-log-indent-text: 2
 end:
+vim: tabstop=8 shiftwidth=2
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..b97a08d928
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,5 @@
+#
+# This test file concludes tests which point out known bugs.
+# So all tests will cause failure.
+#
+
diff --git a/LEGAL b/LEGAL
index 908eb270f5..65706459cd 100644
--- a/LEGAL
+++ b/LEGAL
@@ -5,34 +5,59 @@ All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-regex.[ch]:
-
-  These files are under LGPL.  Treat them as LGPL says. (See the file
-  LGPL for details)
-
-    Extended regular expression matching and search library.
-    Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
-
-    The GNU C Library is free software; you can redistribute it and/or
-    modify it under the terms of the GNU Library General Public License as
-    published by the Free Software Foundation; either version 2 of the
-    License, or (at your option) any later version.
-
-    The GNU C Library is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-    Library General Public License for more details.
-
-    You should have received a copy of the GNU Library General Public
-    License along with the GNU C Library; see the file LGPL.  If not,
-    write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
-    Boston, MA 02111-1307, USA.  */
-
-    Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
-    Last change: May 21, 1993 by t^2
-    removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
-    Perl5 extension added by matz <matz@caelum.co.jp>
-    UTF-8 extension added Jan 16 1999 by Yoshida Masato  <yoshidam@tau.bekkoame.ne.jp>
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+   When this software is partly used or it is distributed with Ruby, 
+   this of Ruby follows the license of Ruby.
 
 configure:
 
@@ -43,9 +68,8 @@ configure:
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-config.guess:
-config.sub:
-parse.c:
+tool/config.guess:
+tool/config.sub:
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
@@ -72,7 +96,58 @@ parse.c:
     configuration script generated by Autoconf, you may include it under
     the same distribution terms that you use for the rest of that program.
 
+parse.c:
+
+  This file is licensed under the GPL, but is incorporated into Ruby and 
+  redistributed under the terms of the Ruby license, as permitted by the
+  exception to the GPL below.
+
+     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+     Free Software Foundation, Inc.
+
+     This program is free software; you can redistribute it and/or modify
+     it under the terms of the GNU General Public License as published by
+     the Free Software Foundation; either version 2, or (at your option)
+     any later version.
+
+     This program is distributed in the hope that it will be useful,
+     but WITHOUT ANY WARRANTY; without even the implied warranty of
+     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+     GNU General Public License for more details.
+
+     You should have received a copy of the GNU General Public License
+     along with this program; if not, write to the Free Software
+     Foundation, Inc., 51 Franklin Street, Fifth Floor,
+     Boston, MA 02110-1301, USA.  */
+
+  /* As a special exception, you may create a larger work that contains
+     part or all of the Bison parser skeleton and distribute that work
+     under terms of your choice, so long as that work isn't itself a
+     parser generator using the skeleton or a modified version thereof
+     as a parser skeleton.  Alternatively, if you modify or redistribute
+     the parser skeleton itself, you may (at your option) remove this
+     special exception, which will cause the skeleton and the resulting
+     Bison output files to be licensed under the GNU General Public
+     License without this special exception.
+
+     This special exception was added by the Free Software Foundation in
+     version 2.2 of Bison.  */
+
 util.c (partly):
+
+    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose without fee is hereby granted, provided that this entire notice
+    is included in all copies of any software which is or includes a copy
+    or modification of this software and in all copies of the supporting
+    documentation for such software.
+
+    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
 win32/win32.[ch]:
 
   You can apply the Artistic License to these files. (or GPL,
@@ -83,6 +158,32 @@ win32/win32.[ch]:
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
+util.c (partly):
+
+   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+
+   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+   SUCH DAMAGE.
+
 random.c
 
   This file is under the new-style BSD license.
@@ -130,72 +231,109 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
+vsnprintf.c:
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
+
 st.[ch]:
-x68/*:
 missing/alloca.c:
 missing/dup2.c:
+missing/erf.c:
 missing/finite.c:
 missing/hypot.c:
 missing/isinf.c:
 missing/isnan.c:
+missing/lgamma_r.c:
 missing/memcmp.c:
 missing/memmove.c:
-missing/strcasecmp.c:
 missing/strchr.c:
-missing/streror.c:
-missing/strftime.c:
-missing/strncasecmp.c:
 missing/strstr.c:
 missing/strtol.c:
+missing/tgamma.c:
 ext/digest/sha1/sha1.[ch]:
 
   These files are all under public domain.
 
-missing/strtod.c:
-
-  This file will not be used on most platforms depending on how the
-  configure script results.  In any case you must not receive any fee
-  with the file itself.
-
-    Copyright (c) 1988-1993 The Regents of the University of California.
-    Copyright (c) 1994 Sun Microsystems, Inc.
+missing/crypt.c:
 
-    Permission to use, copy, modify, and distribute this
-    software and its documentation for any purpose and without
-    fee is hereby granted, provided that the above copyright
-    notice appear in all copies.  The University of California
-    makes no representations about the suitability of this
-    software for any purpose.  It is provided "as is" without
-    express or implied warranty.
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-missing/strtoul.c:
+    Copyright (c) 1989, 1993
+    	The Regents of the University of California.  All rights reserved.
 
-  This file will not be used on most platforms depending on how the
-  configure script results.  In any case you must not receive any fee
-  with the file itself.
+    This code is derived from software contributed to Berkeley by
+    Tom Truscott.
 
-    Copyright 1988 Regents of the University of California
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
 
-    Permission to use, copy, modify, and distribute this
-    software and its documentation for any purpose and without
-    fee is hereby granted, provided that the above copyright
-    notice appear in all copies.  The University of California
-    makes no representations about the suitability of this
-    software for any purpose.  It is provided "as is" without
-    express or implied warranty.
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-missing/erf.c:
-missing/crypt.c:
-missing/vsnprintf.c:
+missing/setproctitle.c
 
   This file is under the old-style BSD license.  Note that the
   paragraph 3 below is now null and void.
 
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
-
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
+    Copyright 2003 Damien Miller
+    Copyright (c) 1983, 1995-1997 Eric P. Allman
+    Copyright (c) 1988, 1993
+    	The Regents of the University of California.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -221,10 +359,46 @@ missing/vsnprintf.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
+missing/strlcat.c
+missing/strlcpy.c
+
+  These files are under the new-style BSD license.
+
+   Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+   3. The name of the author may not be used to endorse or promote products
+      derived from this software without specific prior written permission.
+
+   THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+   INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+   AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
+   THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+   EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+   PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+   OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+   WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+   OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+   ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+missing/langinfo.c
+
+  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+  Ruby uses a modified version. The file contains the following
+  author/copyright notice:
+
+  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+  Permission to use, copy, modify, and distribute this software
+  for any purpose and without fee is hereby granted. The author
+  disclaims all warranties with regard to this software.
 
 ext/digest/md5/md5.[ch]:
 
@@ -264,18 +438,7 @@ ext/digest/rmd160/rmd160.[ch]:
     Copyright (c) Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-ext/digest/rmd160/rmd160hl.c:
-ext/digest/sha1/sha1hl.c:
-
-  These files are under the beer-ware license.
-
-    "THE BEER-WARE LICENSE" (Revision 42):
-    <phk@login.dkuug.dk> wrote this file.  As long as you retain this notice you
-    can do whatever you want with this stuff. If we meet some day, and you think
-    this stuff is worth it, you can buy me a beer in return.   Poul-Henning Kamp
-
 ext/digest/sha2/sha2.[ch]:
-ext/digest/sha2/sha2hl.c:
 
   These files are under the new-style BSD license.
 
diff --git a/LGPL b/LGPL
deleted file mode 100644
index b1e3f5a263..0000000000
--- a/LGPL
+++ /dev/null
@@ -1,504 +0,0 @@
-		  GNU LESSER GENERAL PUBLIC LICENSE
-		       Version 2.1, February 1999
-
- Copyright (C) 1991, 1999 Free Software Foundation, Inc.
-     59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
-[This is the first released version of the Lesser GPL.  It also counts
- as the successor of the GNU Library Public License, version 2, hence
- the version number 2.1.]
-
-			    Preamble
-
-  The licenses for most software are designed to take away your
-freedom to share and change it.  By contrast, the GNU General Public
-Licenses are intended to guarantee your freedom to share and change
-free software--to make sure the software is free for all its users.
-
-  This license, the Lesser General Public License, applies to some
-specially designated software packages--typically libraries--of the
-Free Software Foundation and other authors who decide to use it.  You
-can use it too, but we suggest you first think carefully about whether
-this license or the ordinary General Public License is the better
-strategy to use in any particular case, based on the explanations below.
-
-  When we speak of free software, we are referring to freedom of use,
-not price.  Our General Public Licenses are designed to make sure that
-you have the freedom to distribute copies of free software (and charge
-for this service if you wish); that you receive source code or can get
-it if you want it; that you can change the software and use pieces of
-it in new free programs; and that you are informed that you can do
-these things.
-
-  To protect your rights, we need to make restrictions that forbid
-distributors to deny you these rights or to ask you to surrender these
-rights.  These restrictions translate to certain responsibilities for
-you if you distribute copies of the library or if you modify it.
-
-  For example, if you distribute copies of the library, whether gratis
-or for a fee, you must give the recipients all the rights that we gave
-you.  You must make sure that they, too, receive or can get the source
-code.  If you link other code with the library, you must provide
-complete object files to the recipients, so that they can relink them
-with the library after making changes to the library and recompiling
-it.  And you must show them these terms so they know their rights.
-
-  We protect your rights with a two-step method: (1) we copyright the
-library, and (2) we offer you this license, which gives you legal
-permission to copy, distribute and/or modify the library.
-
-  To protect each distributor, we want to make it very clear that
-there is no warranty for the free library.  Also, if the library is
-modified by someone else and passed on, the recipients should know
-that what they have is not the original version, so that the original
-author's reputation will not be affected by problems that might be
-introduced by others.
-
-  Finally, software patents pose a constant threat to the existence of
-any free program.  We wish to make sure that a company cannot
-effectively restrict the users of a free program by obtaining a
-restrictive license from a patent holder.  Therefore, we insist that
-any patent license obtained for a version of the library must be
-consistent with the full freedom of use specified in this license.
-
-  Most GNU software, including some libraries, is covered by the
-ordinary GNU General Public License.  This license, the GNU Lesser
-General Public License, applies to certain designated libraries, and
-is quite different from the ordinary General Public License.  We use
-this license for certain libraries in order to permit linking those
-libraries into non-free programs.
-
-  When a program is linked with a library, whether statically or using
-a shared library, the combination of the two is legally speaking a
-combined work, a derivative of the original library.  The ordinary
-General Public License therefore permits such linking only if the
-entire combination fits its criteria of freedom.  The Lesser General
-Public License permits more lax criteria for linking other code with
-the library.
-
-  We call this license the "Lesser" General Public License because it
-does Less to protect the user's freedom than the ordinary General
-Public License.  It also provides other free software developers Less
-of an advantage over competing non-free programs.  These disadvantages
-are the reason we use the ordinary General Public License for many
-libraries.  However, the Lesser license provides advantages in certain
-special circumstances.
-
-  For example, on rare occasions, there may be a special need to
-encourage the widest possible use of a certain library, so that it becomes
-a de-facto standard.  To achieve this, non-free programs must be
-allowed to use the library.  A more frequent case is that a free
-library does the same job as widely used non-free libraries.  In this
-case, there is little to gain by limiting the free library to free
-software only, so we use the Lesser General Public License.
-
-  In other cases, permission to use a particular library in non-free
-programs enables a greater number of people to use a large body of
-free software.  For example, permission to use the GNU C Library in
-non-free programs enables many more people to use the whole GNU
-operating system, as well as its variant, the GNU/Linux operating
-system.
-
-  Although the Lesser General Public License is Less protective of the
-users' freedom, it does ensure that the user of a program that is
-linked with the Library has the freedom and the wherewithal to run
-that program using a modified version of the Library.
-
-  The precise terms and conditions for copying, distribution and
-modification follow.  Pay close attention to the difference between a
-"work based on the library" and a "work that uses the library".  The
-former contains code derived from the library, whereas the latter must
-be combined with the library in order to run.
-
-		  GNU LESSER GENERAL PUBLIC LICENSE
-   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
-  0. This License Agreement applies to any software library or other
-program which contains a notice placed by the copyright holder or
-other authorized party saying it may be distributed under the terms of
-this Lesser General Public License (also called "this License").
-Each licensee is addressed as "you".
-
-  A "library" means a collection of software functions and/or data
-prepared so as to be conveniently linked with application programs
-(which use some of those functions and data) to form executables.
-
-  The "Library", below, refers to any such software library or work
-which has been distributed under these terms.  A "work based on the
-Library" means either the Library or any derivative work under
-copyright law: that is to say, a work containing the Library or a
-portion of it, either verbatim or with modifications and/or translated
-straightforwardly into another language.  (Hereinafter, translation is
-included without limitation in the term "modification".)
-
-  "Source code" for a work means the preferred form of the work for
-making modifications to it.  For a library, complete source code means
-all the source code for all modules it contains, plus any associated
-interface definition files, plus the scripts used to control compilation
-and installation of the library.
-
-  Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope.  The act of
-running a program using the Library is not restricted, and output from
-such a program is covered only if its contents constitute a work based
-on the Library (independent of the use of the Library in a tool for
-writing it).  Whether that is true depends on what the Library does
-and what the program that uses the Library does.
-  
-  1. You may copy and distribute verbatim copies of the Library's
-complete source code as you receive it, in any medium, provided that
-you conspicuously and appropriately publish on each copy an
-appropriate copyright notice and disclaimer of warranty; keep intact
-all the notices that refer to this License and to the absence of any
-warranty; and distribute a copy of this License along with the
-Library.
-
-  You may charge a fee for the physical act of transferring a copy,
-and you may at your option offer warranty protection in exchange for a
-fee.
-
-  2. You may modify your copy or copies of the Library or any portion
-of it, thus forming a work based on the Library, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
-    a) The modified work must itself be a software library.
-
-    b) You must cause the files modified to carry prominent notices
-    stating that you changed the files and the date of any change.
-
-    c) You must cause the whole of the work to be licensed at no
-    charge to all third parties under the terms of this License.
-
-    d) If a facility in the modified Library refers to a function or a
-    table of data to be supplied by an application program that uses
-    the facility, other than as an argument passed when the facility
-    is invoked, then you must make a good faith effort to ensure that,
-    in the event an application does not supply such function or
-    table, the facility still operates, and performs whatever part of
-    its purpose remains meaningful.
-
-    (For example, a function in a library to compute square roots has
-    a purpose that is entirely well-defined independent of the
-    application.  Therefore, Subsection 2d requires that any
-    application-supplied function or table used by this function must
-    be optional: if the application does not supply it, the square
-    root function must still compute square roots.)
-
-These requirements apply to the modified work as a whole.  If
-identifiable sections of that work are not derived from the Library,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works.  But when you
-distribute the same sections as part of a whole which is a work based
-on the Library, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote
-it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Library.
-
-In addition, mere aggregation of another work not based on the Library
-with the Library (or with a work based on the Library) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
-  3. You may opt to apply the terms of the ordinary GNU General Public
-License instead of this License to a given copy of the Library.  To do
-this, you must alter all the notices that refer to this License, so
-that they refer to the ordinary GNU General Public License, version 2,
-instead of to this License.  (If a newer version than version 2 of the
-ordinary GNU General Public License has appeared, then you can specify
-that version instead if you wish.)  Do not make any other change in
-these notices.
-
-  Once this change is made in a given copy, it is irreversible for
-that copy, so the ordinary GNU General Public License applies to all
-subsequent copies and derivative works made from that copy.
-
-  This option is useful when you wish to copy part of the code of
-the Library into a program that is not a library.
-
-  4. You may copy and distribute the Library (or a portion or
-derivative of it, under Section 2) in object code or executable form
-under the terms of Sections 1 and 2 above provided that you accompany
-it with the complete corresponding machine-readable source code, which
-must be distributed under the terms of Sections 1 and 2 above on a
-medium customarily used for software interchange.
-
-  If distribution of object code is made by offering access to copy
-from a designated place, then offering equivalent access to copy the
-source code from the same place satisfies the requirement to
-distribute the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
-  5. A program that contains no derivative of any portion of the
-Library, but is designed to work with the Library by being compiled or
-linked with it, is called a "work that uses the Library".  Such a
-work, in isolation, is not a derivative work of the Library, and
-therefore falls outside the scope of this License.
-
-  However, linking a "work that uses the Library" with the Library
-creates an executable that is a derivative of the Library (because it
-contains portions of the Library), rather than a "work that uses the
-library".  The executable is therefore covered by this License.
-Section 6 states terms for distribution of such executables.
-
-  When a "work that uses the Library" uses material from a header file
-that is part of the Library, the object code for the work may be a
-derivative work of the Library even though the source code is not.
-Whether this is true is especially significant if the work can be
-linked without the Library, or if the work is itself a library.  The
-threshold for this to be true is not precisely defined by law.
-
-  If such an object file uses only numerical parameters, data
-structure layouts and accessors, and small macros and small inline
-functions (ten lines or less in length), then the use of the object
-file is unrestricted, regardless of whether it is legally a derivative
-work.  (Executables containing this object code plus portions of the
-Library will still fall under Section 6.)
-
-  Otherwise, if the work is a derivative of the Library, you may
-distribute the object code for the work under the terms of Section 6.
-Any executables containing that work also fall under Section 6,
-whether or not they are linked directly with the Library itself.
-
-  6. As an exception to the Sections above, you may also combine or
-link a "work that uses the Library" with the Library to produce a
-work containing portions of the Library, and distribute that work
-under terms of your choice, provided that the terms permit
-modification of the work for the customer's own use and reverse
-engineering for debugging such modifications.
-
-  You must give prominent notice with each copy of the work that the
-Library is used in it and that the Library and its use are covered by
-this License.  You must supply a copy of this License.  If the work
-during execution displays copyright notices, you must include the
-copyright notice for the Library among them, as well as a reference
-directing the user to the copy of this License.  Also, you must do one
-of these things:
-
-    a) Accompany the work with the complete corresponding
-    machine-readable source code for the Library including whatever
-    changes were used in the work (which must be distributed under
-    Sections 1 and 2 above); and, if the work is an executable linked
-    with the Library, with the complete machine-readable "work that
-    uses the Library", as object code and/or source code, so that the
-    user can modify the Library and then relink to produce a modified
-    executable containing the modified Library.  (It is understood
-    that the user who changes the contents of definitions files in the
-    Library will not necessarily be able to recompile the application
-    to use the modified definitions.)
-
-    b) Use a suitable shared library mechanism for linking with the
-    Library.  A suitable mechanism is one that (1) uses at run time a
-    copy of the library already present on the user's computer system,
-    rather than copying library functions into the executable, and (2)
-    will operate properly with a modified version of the library, if
-    the user installs one, as long as the modified version is
-    interface-compatible with the version that the work was made with.
-
-    c) Accompany the work with a written offer, valid for at
-    least three years, to give the same user the materials
-    specified in Subsection 6a, above, for a charge no more
-    than the cost of performing this distribution.
-
-    d) If distribution of the work is made by offering access to copy
-    from a designated place, offer equivalent access to copy the above
-    specified materials from the same place.
-
-    e) Verify that the user has already received a copy of these
-    materials or that you have already sent this user a copy.
-
-  For an executable, the required form of the "work that uses the
-Library" must include any data and utility programs needed for
-reproducing the executable from it.  However, as a special exception,
-the materials to be distributed need not include anything that is
-normally distributed (in either source or binary form) with the major
-components (compiler, kernel, and so on) of the operating system on
-which the executable runs, unless that component itself accompanies
-the executable.
-
-  It may happen that this requirement contradicts the license
-restrictions of other proprietary libraries that do not normally
-accompany the operating system.  Such a contradiction means you cannot
-use both them and the Library together in an executable that you
-distribute.
-
-  7. You may place library facilities that are a work based on the
-Library side-by-side in a single library together with other library
-facilities not covered by this License, and distribute such a combined
-library, provided that the separate distribution of the work based on
-the Library and of the other library facilities is otherwise
-permitted, and provided that you do these two things:
-
-    a) Accompany the combined library with a copy of the same work
-    based on the Library, uncombined with any other library
-    facilities.  This must be distributed under the terms of the
-    Sections above.
-
-    b) Give prominent notice with the combined library of the fact
-    that part of it is a work based on the Library, and explaining
-    where to find the accompanying uncombined form of the same work.
-
-  8. You may not copy, modify, sublicense, link with, or distribute
-the Library except as expressly provided under this License.  Any
-attempt otherwise to copy, modify, sublicense, link with, or
-distribute the Library is void, and will automatically terminate your
-rights under this License.  However, parties who have received copies,
-or rights, from you under this License will not have their licenses
-terminated so long as such parties remain in full compliance.
-
-  9. You are not required to accept this License, since you have not
-signed it.  However, nothing else grants you permission to modify or
-distribute the Library or its derivative works.  These actions are
-prohibited by law if you do not accept this License.  Therefore, by
-modifying or distributing the Library (or any work based on the
-Library), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Library or works based on it.
-
-  10. Each time you redistribute the Library (or any work based on the
-Library), the recipient automatically receives a license from the
-original licensor to copy, distribute, link with or modify the Library
-subject to these terms and conditions.  You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties with
-this License.
-
-  11. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License.  If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Library at all.  For example, if a patent
-license would not permit royalty-free redistribution of the Library by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Library.
-
-If any portion of this section is held invalid or unenforceable under any
-particular circumstance, the balance of the section is intended to apply,
-and the section as a whole is intended to apply in other circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system which is
-implemented by public license practices.  Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
-  12. If the distribution and/or use of the Library is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Library under this License may add
-an explicit geographical distribution limitation excluding those countries,
-so that distribution is permitted only in or among countries not thus
-excluded.  In such case, this License incorporates the limitation as if
-written in the body of this License.
-
-  13. The Free Software Foundation may publish revised and/or new
-versions of the Lesser General Public License from time to time.
-Such new versions will be similar in spirit to the present version,
-but may differ in detail to address new problems or concerns.
-
-Each version is given a distinguishing version number.  If the Library
-specifies a version number of this License which applies to it and
-"any later version", you have the option of following the terms and
-conditions either of that version or of any later version published by
-the Free Software Foundation.  If the Library does not specify a
-license version number, you may choose any version ever published by
-the Free Software Foundation.
-
-  14. If you wish to incorporate parts of the Library into other free
-programs whose distribution conditions are incompatible with these,
-write to the author to ask for permission.  For software which is
-copyrighted by the Free Software Foundation, write to the Free
-Software Foundation; we sometimes make exceptions for this.  Our
-decision will be guided by the two goals of preserving the free status
-of all derivatives of our free software and of promoting the sharing
-and reuse of software generally.
-
-			    NO WARRANTY
-
-  15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
-WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
-EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
-OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
-KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE.  THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
-LIBRARY IS WITH YOU.  SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
-THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
-  16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
-WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
-AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
-FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
-CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
-LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
-RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
-FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
-SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
-DAMAGES.
-
-		     END OF TERMS AND CONDITIONS
-
-           How to Apply These Terms to Your New Libraries
-
-  If you develop a new library, and you want it to be of the greatest
-possible use to the public, we recommend making it free software that
-everyone can redistribute and change.  You can do so by permitting
-redistribution under these terms (or, alternatively, under the terms of the
-ordinary General Public License).
-
-  To apply these terms, attach the following notices to the library.  It is
-safest to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least the
-"copyright" line and a pointer to where the full notice is found.
-
-    <one line to give the library's name and a brief idea of what it does.>
-    Copyright (C) <year>  <name of author>
-
-    This library is free software; you can redistribute it and/or
-    modify it under the terms of the GNU Lesser General Public
-    License as published by the Free Software Foundation; either
-    version 2.1 of the License, or (at your option) any later version.
-
-    This library is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-    Lesser General Public License for more details.
-
-    You should have received a copy of the GNU Lesser General Public
-    License along with this library; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
-
-Also add information on how to contact you by electronic and paper mail.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the library, if
-necessary.  Here is a sample; alter the names:
-
-  Yoyodyne, Inc., hereby disclaims all copyright interest in the
-  library `Frob' (a library for tweaking knobs) written by James Random Hacker.
-
-  <signature of Ty Coon>, 1 April 1990
-  Ty Coon, President of Vice
-
-That's all there is to it!
-
-
diff --git a/Makefile.in b/Makefile.in
index 314e1ed256..df521cae94 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,17 +1,27 @@
 SHELL = /bin/sh
-NULLCMD = :
+NULLCMD = @NULLCMD@
+RUNCMD = $(SHELL)
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
 
 #### Start of system configuration section. ####
 
 srcdir = @srcdir@
-VPATH = $(srcdir):$(srcdir)/missing
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
 
 CC = @CC@
-YACC = @YACC@
+CPP = @CPP@
+YACC = bison
 PURIFY =
 AUTOCONF = autoconf
 @SET_MAKE@
 MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+DOXYGEN = @DOXYGEN@
 
 prefix = @prefix@
 exec_prefix = @exec_prefix@
@@ -24,18 +34,29 @@ datadir = @datadir@
 arch = @arch@
 sitearch = @sitearch@
 sitedir = @sitedir@
+ruby_version = @ruby_version@
 
 TESTUI = console
 TESTS =
-RDOCTARGET = @RDOCTARGET@
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
 
 EXTOUT = @EXTOUT@
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
 
 empty =
 OUTFLAG = @OUTFLAG@$(empty)
-CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
-CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS = @CFLAGS@ $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
 LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
 EXTLDFLAGS = 
 XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
@@ -43,18 +64,34 @@ EXTLIBS =
 LIBS = @LIBS@ $(EXTLIBS)
 MISSING = @LIBOBJS@ @ALLOCA@
 LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) $(ARCH_FLAG)
 SOLIBS = @SOLIBS@
 MAINLIBS = @MAINLIBS@
-MINIOBJS = @MINIOBJS@
+ARCHMINIOBJS = @MINIOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
 
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
 RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
 RUBY_SO_NAME=@RUBY_SO_NAME@
 EXEEXT = @EXEEXT@
 PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
 RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@ $(MINIRUBYOPT)
-RUNRUBY = @RUNRUBY@
+MINIRUBY = @MINIRUBY@\
+	$(MINIRUBYOPT)
+RUNRUBY = @RUNRUBY@ $(RUNRUBYOPT) -- $(RUN_OPTS)
+XRUBY = @XRUBY@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+
+DEFAULT_PRELUDES = $(@USE_RUBYGEMS@_GEM_PRELUDE)
 
 #### End of system configuration section. ####
 
@@ -70,23 +107,50 @@ LIBRUBYARG    = @LIBRUBYARG@
 LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
 LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
 
+THREAD_MODEL  = @THREAD_MODEL@
+
 PREP          = @PREP@
 ARCHFILE      = @ARCHFILE@
 SETUP         =
 EXTSTATIC     = @EXTSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
 
+MAKEDIRS      = @MKDIR_P@
+CP            = cp
+MV            = mv
 RM            = rm -f
+RMDIR         = @RMDIR@
+RMDIRS        = @RMDIRS@
+RMALL         = @RMALL@
 NM            = @NM@
 AR            = @AR@
 ARFLAGS       = rcu
 RANLIB        = @RANLIB@
 AS            = @AS@
-ASFLAGS       = @ASFLAGS@
+ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE      = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP       = @OBJDUMP@
+OBJCOPY       = @OBJCOPY@
+VCS           = @VCS@
+VCSUP         = @VCSUP@
 
 OBJEXT        = @OBJEXT@
+ASMEXT        = S
+DLEXT         = @DLEXT@
 MANTYPE	      = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
 
 INSTALLED_LIST= .installed.list
+
+MKMAIN_CMD    = mkmain.sh
+
+SRC_FILE      = $<
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+
+configure_args = @configure_args@
 #### End of variables
 
 all:
@@ -97,48 +161,62 @@ all:
 .NOEXPORT:
 
 miniruby$(EXEEXT):
-		@$(RM) $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(MINIOBJS) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@
+		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(DMYEXT) $(LIBS) $(OUTFLAG)$@
 
 $(PROGRAM):
 		@$(RM) $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
 
 # We must `rm' the library each time this rule is invoked because "updating" a
 # MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
 # supported.
 $(LIBRUBY_A):
 		@$(RM) $@
-		$(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
+		$(ECHO) linking static-library $@
+		$(Q) $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
 		@-$(RANLIB) $@ 2> /dev/null || true
 
 $(LIBRUBY_SO):
 		@-$(PRE_LIBRUBY_UPDATE)
-		$(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
+		$(ECHO) linking shared-library $@
+		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
+		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
 		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
 						  File.symlink "$(LIBRUBY_SO)", link}' \
 				$(LIBRUBY_ALIASES) || true
 
-fake.rb:	Makefile
-		@echo ' \
-		class Object; \
-		  CROSS_COMPILING = RUBY_PLATFORM; \
-		  remove_const :RUBY_PLATFORM; \
-		  remove_const :RUBY_VERSION; \
-		  RUBY_PLATFORM = "@arch@"; \
-		  RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
-		end; \
-		if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
-		  class File; \
-		    remove_const :ALT_SEPARATOR; \
-		    ALT_SEPARATOR = "\\"; \
-		  end; \
-		end; \
-		' > $@
-
-Makefile:	$(srcdir)/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/common.mk
+fake: $(arch)-fake.rb
+$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
+		@./config.status --file=$@:$(srcdir)/template/fake.rb.in
+		@chmod +x $@
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+	$(ECHO) installing cross-compiling stuff
+	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+	$(Q) $(BASERUBY) -p \
+	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+	rbconfig.rb > fake-rbconfig.rb
+	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+	@$(RM) fake.rb fake-rbconfig.rb
+	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status
 		MAKE=$(MAKE) $(SHELL) ./config.status
 		@{ \
 		    echo "all:; -@rm -f conftest.mk"; \
@@ -148,33 +226,164 @@ $(MKFILES): config.status $(srcdir)/common.mk
 		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
 		{ echo "Makefile updated, restart."; exit 1; }
 
-config.status:	$(srcdir)/configure
-		MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
+uncommon.mk: $(srcdir)/common.mk
+		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
 
-$(srcdir)/configure: $(srcdir)/configure.in
-		cd $(srcdir) && $(AUTOCONF)
+.PHONY: reconfig
+reconfig-args = $(srcdir)/configure $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
+reconfig-exec-1 = set -x; "$$@"
 
-lex.c: keywords
-	@-$(RM) $@
-	gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
-	cp "$(srcdir)/$@" .
+reconfig config.status:	$(srcdir)/configure $(srcdir)/enc/Makefile.in
+	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
 
-.y.c:
-	$(YACC) $<
-	sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
-	rm -f y.tab.c
+$(srcdir)/configure: $(srcdir)/configure.in
+	$(CHDIR) $(srcdir) && exec $(AUTOCONF)
+
+incs: id.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+	@\
+	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+	  [ $(Q) ] && echo copying $@ || set -x; \
+	  $(CP) $(srcdir)/lex.c.blt $@; \
+	else \
+	  [ $(Q) ] && echo generating $@ || set -x; \
+	  gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(srcdir)/defs/lex.c.src && \
+	  $(CP) $@ $(srcdir)/lex.c.blt; \
+	fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  trap '$(RM) $@-1.h $@-2.h' 0 && \
+	  set -x; \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+	  gperf $(NAME2CTYPE_OPTIONS) < $? > $@-2.h && \
+	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
 
 .c.@OBJEXT@:
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
+	@$(ECHO) compiling $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
 
 .s.@OBJEXT@:
-	$(AS) $(ASFLAGS) -o $@ $<
+	@$(ECHO) assembling $<
+	$(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+	@$(ECHO) translating $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+	@$(ECHO) preprocessing $<
+	$(Q) $(CPP) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
 
 clean-local::
-	@$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
+	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output
+	-$(Q)$(RM) $(pkgconfig_DATA)
 
 distclean-local::
-	@$(RM) ext/config.cache $(RBCONFIG)
+	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+	-$(Q)$(RM) run.gdb
+	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h
+	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	set dummy `\
+	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
+	`; shift; \
+	cd ..; \
+	for dir do \
+	    echo $(@:-ext=)ing "$$dir"; \
+	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+	    case "$@" in \
+	    *distclean-ext*|*realclean-ext*) \
+		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+	    esac; \
+	done
+
+distclean-ext realclean-ext::
+	-$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+	-$(Q)$(RMDIRS) $(EXTOUT) 2> /dev/null || true
+
+clean-enc distclean-enc realclean-enc:
+	@test -f "$(ENC_MK)" || exit 0; \
+	echo $(@:-enc=ing) encodings; \
+	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
+
+clean-rdoc distclean-rdoc realclean-rdoc:
+	@echo $(@:-rdoc=ing) rdoc
+	$(Q)$(RMALL) $(RDOCOUT)
+clean-capi distclean-capi realclean-capi:
+	@echo $(@:-capi=ing) capi
+	$(Q)$(RMALL) $(CAPIOUT)
+
+clean-platform:
+	@$(RM) $(PLATFORM_D)
+	-$(Q) $(RMDIR) $(PLATFORM_DIR) 2> /dev/null || true
 
 ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(OUTFLAG)$@ -c ext/extinit.c
+	$(ECHO) compiling $@
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+up::
+	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+update-mspec:
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/mspec ]; then \
+	  cd spec/mspec; \
+	  echo updating mspec ...; \
+	  exec git pull; \
+	else \
+	  echo retrieving mspec ...; \
+	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+	fi
+
+update-rubyspec: update-mspec
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/rubyspec ]; then \
+	  cd spec/rubyspec; \
+	  echo updating rubyspec ...; \
+	  exec git pull; \
+	else \
+	  echo retrieving rubyspec ...; \
+	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+	fi
+
+test-rubyspec-precheck:
+	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
+
+INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+	  vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+	$(ECHO) generating $@
+	$(Q) $(BASERUBY) -Ks $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
diff --git a/NEWS b/NEWS
index de1dafb533..30fec33fdd 100644
--- a/NEWS
+++ b/NEWS
@@ -1,115 +1,341 @@
+# -*- rd -*-
 = NEWS
 
 This document is a list of user visible feature changes made between
-releases excluding bug fixes.
+releases except for bug fixes.
 
 Note that each entry is kept so brief that no reason behind or
 reference information is supplied with.  For a full list of changes
 with all sufficient information, see the ChangeLog file.
 
-== Changes with Ruby 1.8.5
+== Changes since the 1.9.2 release
+=== License
 
-=== New platforms/build tools support
+* Ruby's License is changed from a dual license with GPLv2
+  to a dual license with 2-clause BSDL.
 
-* IA64 HP-UX
+=== Known platform dependent issues
+==== OS X Lion
 
-* Visual C++ 8 SP1
+* You have to configure ruby with '--with-gcc=gcc-4.2' if you're using
+  Xcode 4.1, or, if you're using Xcode 4.2, you have to configure ruby
+  with '--with-gcc=clang'.
 
-* autoconf 2.6x
+=== C API updates
 
-=== Library updates (outstanding ones only)
-
-* date
-
-  * Updated based on date2 4.0.3.
-
-* digest
-
-  * New internal APIs for C and Ruby.
-
-  * Support for autoloading.
-
-  * See below for new features and compatibility issues.
-
-* nkf
-
-  * Updated based on nkf as of 2007-01-28.
-
-* tk
-
-  * Tk::X_Scrollable (Y_Scrollable) is renamed to Tk::XScrollable
-    (YScrollable). Tk::X_Scrollable (Y_Scrollable) is still available,
-    but it is an alias name.
-
-  * Updated Tile extension support based on Tile 0.7.8.
+* rb_scan_args() is enhanced with support for option hash argument
+  extraction.
 
-  * Support --without-X11 configure option for non-X11 versions of
-    Tcl/Tk (e.g. Tcl/Tk Aqua).
+* ruby_vm_at_exit() added.  This enables extension libs to hook a VM
+  termination.
 
-  * New sample script: irbtkw.rbw -- IRB on Ruby/Tk. It has no trouble
-    about STDIN blocking on Windows.
+* rb_reserved_fd_p() added.  If you want to close all file descriptors,
+  check using this API.  [ruby-core:37759]
 
-=== New methods and features
+=== Library updates (outstanding ones only)
 
 * builtin classes
 
-  * New method: Kernel#instance_variable_defined?
-
-  * New method: Module#class_variable_defined?
-
-  * New feature: Dir::glob() can now take an array of glob patterns.
-
-* digest
+  * ARGF
+    * new methods:
+      * ARGF.print
+      * ARGF.printf
+      * ARGF.putc
+      * ARGF.puts
+      * ARGF.read_nonblock
+      * ARGF.to_write_io
+      * ARGF.write
+
+  * Array
+    * extended method:
+      * Array#pack supports endian modifiers
+
+  * Bignum
+    * Multiplication algorithm for Bignums with a large number of digits over
+      150 BDIGITs is changed in order to reduce its calculation time.
+      Now such large Bignums are multiplied by using Toom-3 algorithm.
+
+  * Encoding
+    * new encodings:
+      * CP950
+      * CP951
+      * UTF-16
+      * UTF-32
+    * change alias:
+      * SJIS is Windows-31J
+
+  * File
+    * new constant:
+      * File::NULL
+        name of NULL device.
+      * File::DIRECT
+        name of O_DIRECT.
+
+  * IO
+    * extended method:
+      * IO#putc supports multibyte characters
+    * new methods:
+      * IO#advise
+      * IO.write(name, string, [offset] )
+        Write `string` to file `name`.
+        Opposite with File.read.
+      * IO.binwrite(name, string, [offset] )
+        binary version of IO.write.
+
+  * Kernel
+    * move #__id__ to BasicObject.
+    * extended method:
+      * Kernel#rand supports range argument
+
+  * Module
+    * new methods:
+      * Module#private_constant
+      * Module#public_constant
+
+  * Random
+    * extended method:
+      * Random.rand supports range argument
+
+  * String
+    * extended method:
+      * String#unpack supports endian modifiers
+    * new method:
+      * String#prepend
+      * String#byteslice
+
+  * Time
+    * extended method:
+      * Time#strftime supports %:z and %::z.
+
+  * Process
+    * Process#maxgroups and Process#maxgroups= now raise NotImplementedError if
+      the platform don't support supplementary groups concept.
+
+* bigdecimal
+
+  * BigDecimal#power and BigDecimal#** support non-integral exponent.
+
+  * Kernel.BigDecimal and BigDecimal.new now accept instances of Integer,
+    Rational, Float, and BigDecimal.  If you pass a Rational or a Float to
+    them, you must specify the precision to produce the digits of a BigDecimal.
+
+  * The behavior of BigDecimal#coerce with a Rational is changed.  It uses
+    the precision of the receiver BigDecimal to produce the digits of a
+    BigDecimal from the given Rational.
+
+* bigdecimal/util
+
+  * BigDecimal#to_d and Integer#to_d are added.
+
+  * Float#to_d accepts a precision.
+
+  * Rational#to_d raises ArgumentError when passing zero or negative
+    precision.
+
+  * Rational#to_d
+
+    * Zero and an implicit precision is deprecated.
+      This feature is removed at the next release of bigdecimal.
+
+    * A negative precision isn't supported.
+      Be careful it is an incompatible change.
 
-  * New digest class methods: file
+* date
 
-  * New digest instance methods: clone, reset, new,
-    inspect, digest_length (alias size or length),
-    block_length()
+  * Accepts flonum explicitly with limitations.
+    * If the given offset is flonum, DateTime assumes its precision is
+      at most second.
+
+      DateTime.new(2001,2,3,0,0,0,3.0/24) ==
+      DateTime.new(2001,2,3,0,0,0,'+03:00')
+        #=> true
+
+    * If the given operand for -/+ is flonum, DateTime assumes its
+      precision is at most nanosecond.
+
+      DateTime.new(2001,2,3) + 0.5 == DateTime.new(2001,2,3,12)
+        #=> true
+
+    * Precision of offset is always at most second.
+
+      Rational('0.5') == Rational('0.500001')  #=> false
+      DateTime.new(2001,2,3,0,0,0,Rational('0.5')) ==
+      DateTime.new(2001,2,3,0,0,0,Rational('0.500001'))
+        #=> true
+
+  * Ignores long offset and far reform day (with warning).
+
+    * Now accepts only:
+
+      -1<=offset<=1 (-24:00..+24:00)
+      2298874<=start<=2426355 or -/+oo
+        (proleptic Gregorian/Julian mean -/+oo)
+
+  * A method strftime cannot produce huge output (same as Time's one).
+
+    * Even though Date/DateTime can handle far dates, the following causes
+      an exception.
+
+      DateTime.new(1<<10000).strftime('%Y')  # Errno::ERANGE
+
+  * Changed the format of inspect.
+  * Changed the format of marshal (but, can load old dumps).
+
+* io/console
+  * new methods:
+    * IO#noecho {|io| }
+    * IO#echo=
+    * IO#echo?
+    * IO#raw {|io| }
+    * IO#raw!
+    * IO#getch
+    * IO#winsize
+    * IO.console
+
+* json
+  * updated to v1.5.4.
+
+* matrix
+  * new classes:
+    * Matrix::EigenvalueDecomposition
+    * Matrix::LUPDecomposition
+  * new methods:
+    * Matrix#diagonal?
+    * Matrix#eigen
+    * Matrix#eigensystem
+    * Matrix#hermitian?
+    * Matrix#lower_triangular?
+    * Matrix#lup
+    * Matrix#lup_decomposition
+    * Matrix#normal?
+    * Matrix#orthogonal?
+    * Matrix#permutation?
+    * Matrix#round
+    * Matrix#symmetric?
+    * Matrix#unitary?
+    * Matrix#upper_triangular?
+    * Matrix#zero?
+    * Vector#magnitude, #norm
+    * Vector#normalize
+  * extended methods:
+    * Matrix#each and #each_with_index can iterate on a subset of the elements
+    * Matrix#find_index returns [row, column] and can iterate on a subset
+      of the elements
+    * Matrix#** implements Numeric exponents (using the eigensystem)
+    * Matrix.zero can build rectangular matrices
+
+* minitest
+  * Minitest has been updated to version 2.2.2.
+  * For full details, see https://github.com/seattlerb/minitest/blob/master/History.txt
+
+* net/http
+  * SNI (Server Name Indication) supported for HTTPS.
+
+  * Allow to configure to wait server returning '100 continue' response
+    before sending HTTP request body. Set Net::HTTP#continue_timeout AND pass
+    'expect' => '100-continue' to a extra HTTP header.
+
+    For example, the following code sends HTTP header and waits for getting
+    '100 continue' response before sending HTTP request body. When 0.5 [sec]
+    timeout occurs or the server send '100 continue', the client sends HTTP
+    request body.
+      http.continue_timeout = 0.5
+      http.request_post('/continue', 'body=BODY', 'expect' => '100-continue')
+
+  * new method:
+    * Net::HTTPRequest#set_form): Added to support
+      both application/x-www-form-urlencoded and multipart/form-data.
+
+* objspace
+  * new method:
+    * ObjectSpace::memsize_of_all
+
+* openssl
+  * PKey::RSA and PKey::DSA now use the generic X.509 encoding scheme
+    (e.g. used in a X.509 certificate's Subject Public Key Info) when
+    exporting public keys to DER or PEM. Backward compatibility is
+    ensured by (already existing) fallbacks during creation.
+  * OpenSSL::ASN1::Constructive#new and OpenSSL::ASN1::Primitive#new
+    (and the constructors of their sub-classes) will no longer force
+    tagging to be set to :EXPLICIT when tag and/or tag_class are passed
+    as parameters. tagging must be set explicitly.
+  * Support for infinite length encodings via infinite_length attribute.
+  * OpenSSL::PKey.read( file | string [, pwd] ) allows to read arbitrary
+    public/private keys in DER-/PEM-encoded form with an optional password
+    for encrypted PEM encodings.
+  * Add new method OpenSSL::X509::Name#hash_old as a wrapper of
+    X509_NAME_hash_old() defined from OpenSSL 1.0.0. It returns OpenSSL 0.9.8
+    compatible hash value.
+
+* optparse
+  * support for bash/zsh completion.
+
+* Rake
+  * Rake has been upgraded from 0.8.7 to 0.9.2.2.  For full release notes see
+    https://github.com/jimweirich/rake/blob/master/CHANGES
+
+* RDoc
+  * RDoc has been upgraded to version 3.9.4.  For full release notes see
+    http://docs.seattlerb.org/rdoc/History_txt.html
+
+* rexml
+  * Support Ruby native encoding mechanism and iconv dependency is dropped.
+
+* RubyGems
+  * RubyGems has been upgraded to version 1.8.10. For full release notes see
+    http://rubygems.rubyforge.org/rubygems-update/History_txt.html
+
+* stringio
+  * extended method:
+    * StringIO#set_encoding can get 2nd argument and optional hash.
+
+* test/unit
+  * New arguments:
+    * -j N, --jobs=N: Allow run N testcases at once.
+    * --jobs-status: Show status of jobs when parallel running.
+    * --no-retry: Don't retry testcases which failed when parallel running.
+    * --ruby=RUBY: path to ruby for job(worker) process. optional.
+    * --hide-skip: Hide skip messages. You'll see the number of skips at end of
+      test result.
+
+* uri
+  * new methods:
+    * URI::Generic#hostname
+    * URI::Generic#hostname=
 
-  * New library: digest/bubblebabble
+* webrick
+  * new method:
+    * WEBrick::HTTPRequest#continue for generating '100 continue' response.
+  * new logging directive:
+    * %{remote}p for remote (client) port number.
 
-  * New function: Digest(name)
+* yaml
+  * The default YAML engine is now Psych. You may downgrade to syck by setting
+    YAML::ENGINE.yamler = 'syck'.
 
-* fileutils
+* zlib
+  * new methods:
+    * Zlib.deflate
+    * Zlib.inflate
 
-  * New option for FileUtils.cp_r(): :remove_destination
+* FileUtils
+  * extended method:
+    * FileUtils#chmod supports symbolic mode argument.
 
-* thread
+=== Language changes
 
-  * Replaced with much faster mutex implementation in C.
-    The former implementation is available with a
-    configure option `--disable-fastthread'.
+* Regexps now support Unicode 6.0. (new characters and scripts)
 
-* webrick
+* [experimental] Regexps now support Age property.
+  Unlike Perl, current implementation takes interpretation of the
+  interpretation of UTS #18.
+  http://www.unicode.org/reports/tr18/
 
-  * New method: WEBrick::Cookie.parse_set_cookies()
+* Turning on/off indentation warnings with directives.
+  ("# -*- warn-indent: true -*-" / "# -*- warn-indent: false -*-")
 
 === Compatibility issues (excluding feature bug fixes)
 
-* builtin classes
-
-  * String#intern now raises SecurityError when $SAFE level is greater
-    than zero.
-
-* fileutils
-
-  * A minor implementation change breaks Rake <=0.7.1.
-    Updating Rake to 0.7.2 fixes the problem.
-
-* digest
-
-  * The constructor does no longer take an initial
-    string to feed; digest() and hexdigest() now do,
-    instead.  The following examples show how to
-    migrate:
+  * Rational#to_d
 
-      # Before
-      md = Digest::MD5.new("string")
-      # After (works with any version)
-      md = Digest::MD5.new.update("string")
-        
-      # Before
-      hd = Digest::MD5.new("string").hexdigest
-      # After (works with any version)
-      hd = Digest::MD5.hexdigest("string")
+    See above.
diff --git a/README b/README
index cf836415ad..3d2e636e4d 100644
--- a/README
+++ b/README
@@ -16,8 +16,9 @@ Perl).  It is simple, straight-forward, and extensible.
   + Iterators and Closures
   + Garbage Collection
   + Dynamic Loading of Object files(on some architecture)
-  + Highly Portable(works on many UNIX machines, and on DOS,
-    Windows, Mac, BeOS etc.)
+  + Highly Portable (works on many Unix-like/POSIX compatible platforms
+    as well as Windows, Mac OS X, BeOS etc.)
+    cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatforms
 
 
 * How to get Ruby
@@ -26,11 +27,6 @@ The Ruby distribution files can be found in the following FTP site:
 
   ftp://ftp.ruby-lang.org/pub/ruby/
 
-The latest source code of this version series can be checked out
-through SVN with the following command:
-
-  $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
 The trunk of the Ruby source tree can be checked out with the
 following command:
 
@@ -70,6 +66,10 @@ This is what you need to do to compile and install Ruby:
 
   2. Run ./configure, which will generate config.h and Makefile.
 
+     Some C compiler flags may be added by default depending on your
+     environment.  Specify optflags=.. and warnflags=.. as necessary
+     to override them.
+
   3. Edit defines.h if you need.  Usually this step will not be needed.
 
   4. Remove comment mark(#) before the module names from ext/Setup (or
@@ -89,6 +89,32 @@ This is what you need to do to compile and install Ruby:
 
   7. Run 'make install'
 
+     This command will create following directories and install files
+     onto them.
+
+       * ${DESTDIR}${prefix}/bin
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib
+       * ${DESTDIR}${prefix}/lib/ruby
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/share/man/man1
+       * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
+
+     If Ruby's API version is `x.y.z', the ((|${MAJOR}|)) is `x', the
+     ((|${MINOR}|)) is `y', and the ((|${TEENY}|)) is `z'.
+
+     NOTE: teeny of the API version may be different from one of
+     Ruby's program version
+
      You may have to be a super user to install ruby.
 
 If you fail to compile ruby, please send the detailed error report with
diff --git a/README.EXT b/README.EXT
index 2fc2fd606a..de63f54699 100644
--- a/README.EXT
+++ b/README.EXT
@@ -31,10 +31,12 @@ The Ruby interpreter has the following data types:
 	T_STRING	string
 	T_REGEXP	regular expression
 	T_ARRAY		array
-	T_FIXNUM	Fixnum(31bit integer)
 	T_HASH		associative array
 	T_STRUCT	(Ruby) structure
 	T_BIGNUM	multi precision integer
+	T_FIXNUM	Fixnum(31bit or 63bit integer)
+	T_COMPLEX       complex number
+	T_RATIONAL      rational number
 	T_FILE		IO
 	T_TRUE		true
 	T_FALSE		false
@@ -46,9 +48,8 @@ In addition, there are several other types used internally:
 	T_ICLASS
 	T_MATCH
 	T_UNDEF
-	T_VARMAP
-	T_SCOPE
 	T_NODE
+	T_ZOMBIE
 
 Most of the types are represented by C structures.
 
@@ -78,7 +79,8 @@ There is the data-type check function
 
   void Check_Type(VALUE value, int type)
 
-which raises an exception if the VALUE does not have the type specified.
+which raises an exception if the VALUE does not have the type
+specified.
 
 There are also faster check macros for fixnums and nil.
 
@@ -87,42 +89,53 @@ There are also faster check macros for fixnums and nil.
 
 1.3 Convert VALUE into C data
 
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
 respectively.  They are singletons for the data type.
-
-The T_FIXNUM data is a 31bit length fixed integer (63bit length on
-some machines), which can be converted to a C integer by using the
-FIX2INT() macro.  There is also NUM2INT() which converts any Ruby
-numbers into C integers.  The NUM2INT() macro includes a type check, so
-an exception will be raised if the conversion failed.  NUM2DBL() can
-be used to retrieve the double float value in the same way.
-
-In version 1.7 or later it is recommended that you use the new macros
+The equivalent C constants are: Qnil, Qfalse, Qtrue.
+Note that Qfalse is false in C also (i.e. 0), but not Qnil.
+
+The T_FIXNUM data is a 31bit or 63bit length fixed integer.
+This size is depend on the size of long: if long is 32bit then
+T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
+T_FIXNUM can be converted to a C integer by using the
+FIX2INT() macro or FIX2LONG().  Though you have to check that the
+data is really FIXNUM before using them, they are faster.  FIX2LONG()
+never raises exceptions, but FIX2INT() raises RangeError if the
+result is bigger or smaller than the size of int.
+There are also NUM2INT() and NUM2LONG() which converts any Ruby
+numbers into C integers.  These macros includes a type check,
+so an exception will be raised if the conversion failed.  NUM2DBL()
+can be used to retrieve the double float value in the same way.
+
+You can use the macros
 StringValue() and StringValuePtr() to get a char* from a VALUE.
 StringValue(var) replaces var's value with the result of "var.to_str()".
 StringValuePtr(var) does same replacement and returns char*
-representation of var.  These macros will skip the replacement if var is
-a String.  Notice that the macros take only the lvalue as their
+representation of var.  These macros will skip the replacement if var
+is a String.  Notice that the macros take only the lvalue as their
 argument, to change the value of var in place.
 
-In version 1.6 or earlier, STR2CSTR() was used to do the same thing
-but now it is deprecated in version 1.7, because STR2CSTR() has a risk
-of a dangling pointer problem in the to_str() impliclit conversion.
+You can also use the macro named StringValueCStr(). This is just
+like StringValuePtr(), but always add nul character at the end of
+the result. If the result contains nul character, this macro causes
+the ArgumentError exception.
+StringValuePtr() doesn't guarantee the existence of a nul at the end
+of the result, and the result may contain nul.
 
 Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has the corresponding structure
-can be cast to retrieve the pointer to the struct.  The casting macro
-will be of the form RXXXX for each data type; for instance, RARRAY(obj). 
-See "ruby.h".
+for T_ARRAY etc. The VALUE of the type which has the corresponding
+structure can be cast to retrieve the pointer to the struct.  The
+casting macro will be of the form RXXXX for each data type; for
+instance, RARRAY(obj).  See "ruby.h".
 
-For example, `RSTRING(str)->len' is the way to get the size of the
-Ruby String object.  The allocated region can be accessed by
-`RSTRING(str)->ptr'.  For arrays, use `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
+There are some accessing macros for structure members, for example
+`RSTRING_LEN(str)' to get the size of the Ruby String object.  The
+allocated region can be accessed by `RSTRING_PTR(str)'.  For arrays,
+use `RARRAY_LEN(ary)' and `RARRAY_PTR(ary)' respectively.
 
 Notice: Do not change the value of the structure directly, unless you
-are responsible for the result.  This ends up being the cause of interesting
-bugs.
+are responsible for the result.  This ends up being the cause of
+interesting bugs.
 
 1.4 Convert C data into VALUE
 
@@ -152,9 +165,10 @@ range, but is a bit slower.
 
 1.5 Manipulating Ruby data
 
-As I already mentioned, it is not recommended to modify an object's internal
-structure.  To manipulate objects, use the functions supplied by the Ruby
-interpreter. Some (not all) of the useful functions are listed below:
+As I already mentioned, it is not recommended to modify an object's
+internal structure.  To manipulate objects, use the functions supplied
+by the Ruby interpreter. Some (not all) of the useful functions are
+listed below:
 
  String functions
 
@@ -163,6 +177,7 @@ interpreter. Some (not all) of the useful functions are listed below:
     Creates a new Ruby string.
 
   rb_str_new2(const char *ptr)
+  rb_str_new_cstr(const char *ptr)
 
     Creates a new Ruby string from a C string.  This is equivalent to
     rb_str_new(ptr, strlen(ptr)).
@@ -173,13 +188,58 @@ interpreter. Some (not all) of the useful functions are listed below:
     sources should be tainted.
 
   rb_tainted_str_new2(const char *ptr)
+  rb_tainted_str_new_cstr(const char *ptr)
 
     Creates a new tainted Ruby string from a C string.
 
+  rb_sprintf(const char *format, ...)
+  rb_vsprintf(const char *format, va_list ap)
+
+    Creates a new Ruby string with printf(3) format.
+
   rb_str_cat(VALUE str, const char *ptr, long len)
 
     Appends len bytes of data from ptr to the Ruby string.
 
+  rb_str_cat2(VALUE str, const char* ptr)
+
+    Appends C string ptr to Ruby string str.  This function is
+    equivalent to rb_str_cat(str, ptr, strlen(ptr)).
+
+  rb_str_catf(VALUE str, const char* format, ...)
+  rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+    Appends C string format and successive arguments to Ruby string
+    str according to a printf-like format.  These functions are
+    equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
+    rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
+
+  rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+  
+    Creates a new Ruby string with the specified encoding.
+     
+  rb_usascii_str_new(const char *ptr, long len)
+  rb_usascii_str_new_cstr(const char *ptr)
+
+    Creates a new Ruby string with encoding US-ASCII.
+
+  rb_str_resize(VALUE str, long len)
+
+    Resizes Ruby string to len bytes.  If str is not modifiable, this
+    function raises an exception.  The length of str must be set in
+    advance.  If len is less than the old length the content beyond
+    len bytes is discarded, else if len is greater than the old length
+    the content beyond the old length bytes will not be preserved but
+    will be garbage.  Note that RSTRING_PTR(str) may change by calling
+    this function.
+
+  rb_str_set_len(VALUE str, long len)
+
+    Sets the length of Ruby string.  If str is not modifiable, this
+    function raises an exception.  This function preserves the content
+    upto len bytes, regardless RSTRING_LEN(str).  len must not exceed
+    the capacity of str.
+
  Array functions
 
   rb_ary_new()
@@ -199,17 +259,35 @@ interpreter. Some (not all) of the useful functions are listed below:
 
     Creates an n-element array from a C array.
 
+  rb_ary_to_ary(VALUE obj)
+
+    Converts the object into an array.
+    Equivalent to Object#to_ary.
+
+ There are many functions to operate an array.
+ They may dump core if other types are given.
+
+  rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+    Equivaelent to Array#[].
+
+  rb_ary_entry(VALUE ary, long offset)
+
+    ary[offset]
+
+  rb_ary_subseq(VALUE ary, long beg, long len)
+
+    ary[beg, len]
+
   rb_ary_push(VALUE ary, VALUE val)
   rb_ary_pop(VALUE ary)
   rb_ary_shift(VALUE ary)
   rb_ary_unshift(VALUE ary, VALUE val)
 
-    Array operations.  The first argument to each functions must be an 
-    array.  They may dump core if other types are given.
 
 2. Extending Ruby with C
 
-2.1 Addding new features to Ruby
+2.1 Adding new features to Ruby
 
 You can add new features (classes, methods, etc.) to the Ruby
 interpreter.  Ruby provides APIs for defining the following things:
@@ -264,15 +342,23 @@ will be called like:
 where obj is the receiver, and args is the Ruby array containing
 actual arguments.
 
-There are two more functions to define methods.  One is to define
-private methods:
+There are some more functions to define methods. One takes an ID
+as the name of method to be defined. See 2.2.2 for IDs.
+
+  void rb_define_method_id(VALUE klass, ID name, 
+                           VALUE (*func)(ANYARGS), int argc)
+
+There are two functions to define private/protected methods:
 
   void rb_define_private_method(VALUE klass, const char *name, 
 			        VALUE (*func)(), int argc)
+  void rb_define_protected_method(VALUE klass, const char *name, 
+			          VALUE (*func)(), int argc)
 
-The other is to define module functions, which are private AND singleton
-methods of the module.  For example, sqrt is the module function
-defined in Math module.  It can be called in the following way:
+At last, rb_define_module_function defines a module functions,
+which are private AND singleton methods of the module.
+For example, sqrt is the module function defined in Math module.
+It can be called in the following way:
 
   Math.sqrt(4)
 
@@ -286,7 +372,7 @@ To define module functions, use:
   void rb_define_module_function(VALUE module, const char *name, 
 				 VALUE (*func)(), int argc)
 
-Oh, in addition, function-like methods, which are private methods defined
+In addition, function-like methods, which are private methods defined
 in the Kernel module, can be defined using:
 
   void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
@@ -295,13 +381,17 @@ To define an alias for the method,
 
   void rb_define_alias(VALUE module, const char* new, const char* old);
 
+To define a reader/writer for an attribute,
+
+  void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
 To define and undefine the `allocate' class method,
 
   void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
   void rb_undef_alloc_func(VALUE klass);
 
-func have to take the klass as the argument and return a newly
-allocated instance.  This instance should be empty as possible,
+func has to take the klass as the argument and return a newly
+allocated instance.  This instance should be as empty as possible,
 without any expensive (including external) resources.
 
 2.1.3 Constant definition
@@ -328,14 +418,26 @@ evaluate the string as Ruby program.  This function will do the job:
 Evaluation is done under the current context, thus current local variables
 of the innermost method (which is defined by Ruby) can be accessed.
 
+Note that the evaluation can raise an exception. There is a safer 
+function:
+
+  VALUE rb_eval_string_protect(const char *str, int *state)
+
+It returns nil when an error occur. Moreover, *state is zero if str was
+successfully evaluated, or nonzero otherwise.
+
+
 2.2.2 ID or Symbol
 
-You can invoke methods directly, without parsing the string.  First I need
-to explain about ID.  ID is the integer number to represent Ruby's
-identifiers such as variable names.  The Ruby data type corresponding to ID
-is Symbol.  It can be accessed from Ruby in the form:
+You can invoke methods directly, without parsing the string.  First I
+need to explain about ID.  ID is the integer number to represent
+Ruby's identifiers such as variable names.  The Ruby data type
+corresponding to ID is Symbol.  It can be accessed from Ruby in the
+form:
 
  :Identifier
+or
+ :"any kind of string"
 
 You can get the ID value from a string within C code by using
 
@@ -366,8 +468,8 @@ specified by the symbol mid.
 2.2.4 Accessing the variables and constants
 
 You can access class variables and instance variables using access
-functions.  Also, global variables can be shared between both environments.
-There's no way to access Ruby's local variables.
+functions.  Also, global variables can be shared between both
+environments.  There's no way to access Ruby's local variables.
 
 The functions to access/modify instance variables are below:
 
@@ -386,7 +488,8 @@ See 2.1.3 for defining new constant.
 
 3.1 Ruby constants that C can be accessed from C
 
-The following Ruby constants can be referred from C.
+As stated in section 1.3,
+the following Ruby constants can be referred from C.
 
   Qtrue
   Qfalse
@@ -416,23 +519,30 @@ function below.
 You can defined hooked variables.  The accessor functions (getter and
 setter) are called on access to the hooked variables.
 
-  void rb_define_hooked_variable(constchar *name, VALUE *var,
+  void rb_define_hooked_variable(const char *name, VALUE *var,
 				 VALUE (*getter)(), void (*setter)())
 
 If you need to supply either setter or getter, just supply 0 for the
 hook you don't need.  If both hooks are 0, rb_define_hooked_variable()
 works just like rb_define_variable().
 
-  void rb_define_virtual_variable(const char *name,
-				  VALUE (*getter)(), void (*setter)())
+The prototypes of the getter and setter functions are as follows:
+
+  VALUE (*getter)(ID id, VALUE *var);
+  void (*setter)(VALUE val, ID id, VALUE *var);
 
-This function defines a Ruby global variable without a corresponding C
+
+Also you can define a Ruby global variable without a corresponding C
 variable.  The value of the variable will be set/get only by hooks.
 
+  void rb_define_virtual_variable(const char *name,
+				  VALUE (*getter)(), void (*setter)())
+
 The prototypes of the getter and setter functions are as follows:
 
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+  VALUE (*getter)(ID id);
+  void (*setter)(VALUE val, ID id);
+
 
 3.3 Encapsulate C data into a Ruby object
 
@@ -448,6 +558,10 @@ function to free the pointer allocation.  If this is -1, the pointer
 will be just freed.  The functions mark and free will be called from
 garbage collector.
 
+These mark / free functions are invoked during GC execution.  No
+object allocations are allowed during it, so do not allocate ruby
+objects inside them.
+
 You can allocate and wrap the structure in one step.
 
   Data_Make_Struct(klass, type, mark, free, sval)
@@ -493,6 +607,9 @@ has only one source file, choosing ``LIBRARY.c'' as a file name is
 preferred.  On the other hand, in case your library has multiple source
 files, avoid choosing ``LIBRARY.c'' for a file name.  It may conflict
 with an intermediate file ``LIBRARY.o'' on some platforms.
+Note that some functions in mkmf library described below generate
+a file ``conftest.c'' for checking with compilation.  You shouldn't
+choose ``conftest.c'' as a name of a source file.
 
 Ruby will execute the initializing function named ``Init_LIBRARY'' in
 the library.  For example, ``Init_dbm()'' will be executed when loading
@@ -501,7 +618,8 @@ the library.
 Here's the example of an initializing function.
 
 --
-Init_dbm()
+void
+Init_dbm(void)
 {
     /* define DBM class */
     cDBM = rb_define_class("DBM", rb_cObject);
@@ -535,8 +653,8 @@ struct dbmdata {
 obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
 --
 
-This code wraps the dbmdata structure into a Ruby object.  We avoid wrapping
-DBM* directly, because we want to cache size information.
+This code wraps the dbmdata structure into a Ruby object.  We avoid
+wrapping DBM* directly, because we want to cache size information.
 
 To retrieve the dbmdata structure from a Ruby object, we define the
 following macro:
@@ -556,8 +674,7 @@ methods with a fixed number of arguments receive arguments like this:
 
 --
 static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
+fdbm_delete(VALUE obj, VALUE keystr)
 {
 	:
 }
@@ -571,10 +688,7 @@ arguments like this:
 
 --
 static VALUE
-fdbm_s_open(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+fdbm_s_open(int argc, VALUE *argv, VALUE klass)
 {
 	:
     if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -589,16 +703,17 @@ argument is the C array of the method arguments, and the third
 argument is the receiver of the method.
 
 You can use the function rb_scan_args() to check and retrieve the
-arguments.  For example, "11" means that the method requires at least one
-argument, and at most receives two arguments.
+arguments.  The third argument is a string that specifies how to
+capture method arguments and assign them to the following VALUE
+references.
+
 
-Methods with an arbitrary number of arguments can receive arguments
-by Ruby's array, like this:
+The following is an example of a method that takes arguments by Ruby's
+array:
 
 --
 static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
+thread_initialize(VALUE thread, VALUE args)
 {
 	:
 }
@@ -662,6 +777,11 @@ Try generating the Makefile by:
 
   ruby extconf.rb
 
+If the library should be installed under vendor_ruby directory
+instead of site_ruby directory, use --vendor option as follows.
+
+  ruby extconf.rb --vendor
+
 You don't need this step if you put the extension library under the ext
 directory of the ruby source tree.  In that case, compilation of the
 interpreter will do this step for you.
@@ -691,53 +811,120 @@ Appendix A. Ruby source files overview
 
 ruby language core
 
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
+  class.c         : classes and modules
+  error.c         : exception classes and exception mechanism
+  gc.c            : memory management
+  load.c          : library loading
+  object.c        : objects
+  variable.c      : variables and constants
+
+ruby syntax parser
   parse.y
-  variable.c
+    -> parse.c    : automatically generated
+  keywords        : reserved keywords
+    -> lex.c      : automatically generated
+
+ruby evaluator (a.k.a. YARV)
+  compile.c
+  eval.c
+  eval_error.c
+  eval_jump.c
+  eval_safe.c
+  insns.def           : definition of VM instructions
+  iseq.c              : implementation of VM::ISeq
+  thread.c            : thread management and context swiching
+  thread_win32.c      : thread implementation
+  thread_pthread.c    : ditto
+  vm.c
+  vm_dump.c
+  vm_eval.c
+  vm_exec.c
+  vm_insnhelper.c
+  vm_method.c
+
+  opt_insns_unif.def  : instruction unification
+  opt_operand.def     : definitions for optimization
+
+    -> insn*.inc      : automatically generated
+    -> opt*.inc       : automatically generated
+    -> vm.inc         : automatically generated
+
+regular expression engine (oniguruma)
+  regex.c
+  regcomp.c
+  regenc.c
+  regerror.c
+  regexec.c
+  regparse.c
+  regsyntax.c
 
 utility functions
 
-  dln.c
-  regex.c
-  st.c
-  util.c
+  debug.c       : debug symbols for C debuggger
+  dln.c         : dynamic loading
+  st.c          : general purpose hash table
+  strftime.c    : formatting times
+  util.c        : misc utilities
 
 ruby interpreter implementation
 
   dmyext.c
+  dmydln.c 
+  dmyencoding.c
+  id.c
   inits.c
   main.c
   ruby.c
   version.c
 
+  gem_prelude.rb
+  prelude.rb
+
+
 class library
 
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  prec.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
+  array.c       : Array
+  bignum.c      : Bignum
+  compar.c      : Comparable
+  complex.c     : Complex
+  cont.c        : Fiber, Continuation
+  dir.c         : Dir
+  enum.c        : Enumerable
+  enumerator.c  : Enumerator
+  file.c        : File
+  hash.c        : Hash
+  io.c          : IO
+  marshal.c     : Marshal
+  math.c        : Math
+  numeric.c     : Numeric, Integer, Fixnum, Float
+  pack.c        : Array#pack, String#unpack
+  proc.c        : Binding, Proc
+  process.c     : Process
+  random.c      : random number
+  range.c       : Range
+  rational.c    : Rational
+  re.c          : Regexp, MatchData
+  signal.c      : Signal
+  sprintf.c     : 
+  string.c      : String
+  struct.c      : Struct
+  time.c        : Time
+
+  defs/known_errors.def  : Errno::* exception classes
+    -> known_errors.inc  : automatically generated
+
+multilingualization
+  encoding.c    : Encoding
+  transcode.c   : Encoding::Converter
+  enc/*.c       : encoding classes
+  enc/trans/*   : codepoint mapping tables
+
+goruby interpreter implementation
+  
+  goruby.c
+  golf_prelude.rb     : goruby specific libraries.
+    -> golf_prelude.c : automatically generated
+
 
 Appendix B. Ruby extension API reference
 
@@ -793,10 +980,17 @@ void Check_SafeStr(VALUE value)
 
 ** Data type conversion
 
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
+FIX2INT(value), INT2FIX(i)
+FIX2LONG(value), LONG2FIX(l)
+NUM2INT(value), INT2NUM(i)
+NUM2UINT(value), UINT2NUM(ui)
+NUM2LONG(value), LONG2NUM(l)
+NUM2ULONG(value), ULONG2NUM(ul)
+NUM2LL(value), LL2NUM(ll)
+NUM2ULL(value), ULL2NUM(ull)
+NUM2OFFT(value), OFFT2NUM(off)
+NUM2SIZET(value), SIZET2NUM(size)
+NUM2SSIZET(value), SSIZET2NUM(ssize)
 NUM2DBL(value)
 rb_float_new(f)
 StringValue(value)
@@ -909,11 +1103,55 @@ Defines a singleton method.  Arguments are same as rb_define_method().
 
  rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
 
-Retrieve argument from argc, argv.  The fmt is the format string for
-the arguments, such as "12" for 1 non-optional argument, 2 optional
-arguments.  If `*' appears at the end of fmt, it means the rest of
-the arguments are assigned to the corresponding variable, packed in
-an array.
+Retrieve argument from argc and argv to given VALUE references
+according to the format string.  The format can be described in ABNF
+as follows:
+
+--
+scan-arg-spec  := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
+pre-arg-spec   := num-of-leading-mandatory-args [num-of-optional-args]
+post-arg-spec  := sym-for-variable-length-args [num-of-trailing-mandatory-args]
+pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
+option-hash-arg-spec := sym-for-option-hash-arg
+block-arg-spec := sym-for-block-arg
+
+num-of-leading-mandatory-args  := DIGIT ; The number of leading
+                                        ; mandatory arguments
+num-of-optional-args           := DIGIT ; The number of optional
+                                        ; arguments
+sym-for-variable-length-args   := "*"   ; Indicates that variable
+                                        ; length arguments are
+                                        ; captured as a ruby array
+num-of-trailing-mandatory-args := DIGIT ; The number of trailing
+                                        ; mandatory arguments
+sym-for-option-hash-arg        := ":"   ; Indicates that an option
+                                        ; hash is captured if the last
+                                        ; argument is a hash or can be
+                                        ; converted to a hash with
+                                        ; #to_hash.  When the last
+                                        ; argument is nil, it is
+                                        ; captured if it is not
+                                        ; ambiguous to take it as
+                                        ; empty option hash; i.e. '*'
+                                        ; is not specified and
+                                        ; arguments are given more
+                                        ; than sufficient.
+sym-for-block-arg              := "&"   ; Indicates that an iterator
+                                        ; block should be captured if
+                                        ; given
+--
+
+For example, "12" means that the method requires at least one
+argument, and at most receives three (1+2) arguments.  So, the format
+string must be followed by three variable references, which are to be
+assigned to captured arguments.  For omitted arguments, variables are
+set to Qnil.  NULL can be put in place of a variable reference, which
+means the corresponding captured argument(s) should be just dropped.
+
+The number of given arguments, excluding an option hash or iterator
+block, is returned.
 
 ** Invoking Ruby method
 
@@ -958,28 +1196,56 @@ Sets the value of the instance variable.
 
 ** Control Structure
 
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv,
+		     VALUE (*func) (ANYARGS), VALUE data2)
+
+Calls a method on the recv, with the method name specified by the
+symbol mid, with argc arguments in argv, supplying func as the
+block. When func is called as the block, it will receive the value
+from yield as the first argument, and data2 as the second argument.
+When yielded with multiple values (in C, rb_yield_values(),
+rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
+whereas yielded values can be gotten via argc/argv of the third/fourth
+arguments.
+
+ [OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
 
 Calls the function func1, supplying func2 as the block.  func1 will be
 called with the argument arg1.  func2 receives the value from yield as
 the first argument, arg2 as the second argument.
  
+When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
+This function is obsolete since 1.9; use rb_block_call instead.
+
  VALUE rb_yield(VALUE val)
 
 Evaluates the block with value val.
 
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
 
 Calls the function func1, with arg1 as the argument.  If an exception
 occurs during func1, it calls func2 with arg2 as the argument.  The
 return value of rb_rescue() is the return value from func1 if no
 exception occurs, from func2 otherwise.
 
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+ VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
 
 Calls the function func1 with arg1 as the argument, then calls func2
 with arg2 if execution terminated.  The return value from
-rb_ensure() is that of func1.
+rb_ensure() is that of func1 when no exception occured.
+
+ VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
+
+Calls the function func with arg as the argument.  If no exception
+occured during func, it returns the result of func and *state is zero.
+Otherwise, it returns Qnil and sets *state to nonzero.  If state is
+NULL, it is not set in both cases.
+
+ void rb_jump_tag(int state)
+
+Continues the exception caught by rb_protect() and rb_eval_string_protect().
+state must be the returned value from those functions.  This function
+never return to the caller.
 
 ** Exceptions and Errors
 
@@ -1033,7 +1299,7 @@ Specifies the name of the script ($0).
 
 ** Hooks for the Interpreter Events
 
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_t events)
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
 
 Adds a hook function for the specified interpreter events.
 events should be Or'ed value of:
@@ -1050,13 +1316,57 @@ events should be Or'ed value of:
 
 The definition of rb_event_hook_func_t is below:
 
- typedef void (*rb_event_hook_func_t)(rb_event_t event, NODE *node,
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
  				      VALUE self, ID id, VALUE klass)
 
+The third argument `data' to rb_add_event_hook() is passed to the hook
+function as the second argument, which was the pointer to the current
+NODE in 1.8.  See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
+
  int rb_remove_event_hook(rb_event_hook_func_t func)
 
 Removes the specified hook function.
 
+** Macros for the Compatibilities
+
+Some macros to check API compatibilities are available by default.
+
+ NORETURN_STYLE_NEW
+
+Means that NORETURN macro is functional style instead of prefix.
+
+ HAVE_RB_DEFINE_ALLOC_FUNC
+
+Means that function rb_define_alloc_func() is provided, that means the
+allocation framework is used.  This is same as the result of
+have_func("rb_define_alloc_func", "ruby.h").
+
+ HAVE_RB_REG_NEW_STR
+
+Means that function rb_reg_new_str() is provided, that creates Regexp
+object from String object.  This is same as the result of
+have_func("rb_reg_new_str", "ruby.h").
+
+ HAVE_RB_IO_T
+
+Means that type rb_io_t is provided.
+
+ USE_SYMBOL_AS_METHOD_NAME
+
+Means that Symbols will be returned as method names, e.g.,
+Module#methods, #singleton_methods and so on.
+
+ HAVE_RUBY_*_H
+
+Defined in ruby.h and means correspoinding header is available.  For
+instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
+mere st.h.
+
+ RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
+
+Means that rb_add_event_hook() takes the third argument `data', to be
+passed to the given event hook function.
+
 Appendix C. Functions Available in extconf.rb
 
 These functions are available in extconf.rb:
@@ -1120,7 +1430,7 @@ this method, the compilation will not be done.
  find_executable(bin, path)
 
 Finds command in path, which is File::PATH_SEPARATOR-separated list of
-directories.  If path is nil or omitted, environment varialbe PATH
+directories.  If path is nil or omitted, environment variable PATH
 will be used.  Returns the path name of the command if it is found,
 otherwise nil.
 
@@ -1149,7 +1459,7 @@ Returns an array of the added directories ([include_dir, lib_dir]).
  pkg_config(pkg)
 
 Obtains the information for pkg by pkg-config command.  The actual
-command name can be overriden by --with-pkg-config command line
+command name can be overridden by --with-pkg-config command line
 option.
 
 /*
diff --git a/README.EXT.ja b/README.EXT.ja
index 30c4d520ba..f2d7609ff5 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -35,10 +35,12 @@ Ruby�ˤϥ桼�����Ȥ���ǽ���Τ���ʲ��Υ����פ�����ޤ���
 	T_STRING	ʸ����
 	T_REGEXP	����ɽ��
 	T_ARRAY		����
-	T_FIXNUM	Fixnum(31bitĹ����)
 	T_HASH		Ϣ������
 	T_STRUCT	(Ruby��)��¤��
 	T_BIGNUM	¿��Ĺ����
+	T_FIXNUM	Fixnum(31bit�ޤ���63bitĹ����)
+	T_COMPLEX	ʣ�ǿ�
+	T_RATIONAL	ͭ����
 	T_FILE		������
 	T_TRUE		��
 	T_FALSE		��
@@ -50,9 +52,8 @@ Ruby�ˤϥ桼�����Ȥ���ǽ���Τ���ʲ��Υ����פ�����ޤ���
 	T_ICLASS
 	T_MATCH
 	T_UNDEF
-	T_VARMAP
-	T_SCOPE
 	T_NODE
+	T_ZOMBIE
 
 �ۤȤ�ɤΥ����פ�C�ι�¤�ΤǼ�������Ƥ��ޤ���
 
@@ -95,28 +96,40 @@ FIXNUM��NIL�˴ؤ��ƤϤ���®��Ƚ�̥ޥ������Ѱդ���Ƥ��ޤ���
 
 1.3 VALUE��C�Υǡ������Ѵ�����
 
-�ǡ��������פ�T_NIL, T_FALSE, T_TRUE�Ǥ�������ǡ����Ϥ��줾
-��nil, false, true�Ǥ������Υǡ��������פΥ��֥������ȤϤҤ�
+�ǡ��������פ�T_NIL��T_FALSE��T_TRUE�Ǥ�������ǡ����Ϥ��줾
+��nil��false��true�Ǥ������Υǡ��������פΥ��֥������ȤϤҤ�
 �Ĥ��Ĥ���¸�ߤ��ޤ���
 
-�ǡ��������פ�T_FIXNUM�λ��������31bit�Υ����������������
-����FIXNUM��C���������Ѵ����뤿��ˤϥޥ�����FIX2INT()�פ��
-���ޤ������줫�顤FIXNUM�˸¤餺Ruby�Υǡ������������Ѵ�����
-��NUM2INT()�פȤ����ޥ���������ޤ������Υޥ����ϥǡ�������
-�פΥ����å�̵���ǻȤ��ޤ�(�������Ѵ��Ǥ��ʤ����ˤ��㳰��
-ȯ������)��Ʊ�ͤ˥����å�̵���ǻȤ����Ѵ��ޥ�����double��
-���Ф���NUM2DBL()�פ�����ޤ���
-
-char* ����Ф���硢version 1.6 �����Ǥϡ�STR2CSTR()�פ�
-�����ޥ�����ȤäƤ��ޤ������������ to_str() �ˤ����ۤ�
-���Ѵ���̤� GC ������ǽ�������뤿�ᡢversion 1.7 �ʹߤǤ�
-obsolete �Ȥʤꡢ����� StringValue() �� StringValuePtr()
-��Ȥ�����侩���Ƥ��ޤ���StringValue(var) �� var �� String
- �Ǥ���в��⤻���������Ǥʤ���� var �� var.to_str() �η�̤�
-�֤�������ޥ�����StringValuePtr(var) ��Ʊ�ͤ� var ���֤�����
-�Ƥ��� var ��ʸ����ɽ�����Ф��� char* ���֤��ޥ����Ǥ���var ��
-���Ƥ�ľ���֤����������������Τǡ�var �� lvalue �Ǥ���ɬ�פ�
-����ޤ���
+�ǡ��������פ�T_FIXNUM�λ��������31bit�ޤ���63bit�Υ�������
+���������Ǥ���long�Υ�������32bit�Υץ�åȥե�����Ǥ����
+31bit�ˡ�long�Υ�������64bit�Υץ�åȥե�����Ǥ����63bit
+�ˤʤ�ޤ�. FIXNUM �� C ���������Ѵ����뤿��ˤϥޥ���
+��FIX2INT()�פޤ��ϡ�FIX2LONG()�פ�Ȥ��ޤ��������Υޥ���
+����Ѥ���ݤˤϻ����˥ǡ��������פ�FIXNUM�Ǥ��뤳�Ȥ��ǧ��
+��ɬ�פ�����ޤ��������Ū��®���Ѵ���Ԥ����Ȥ��Ǥ��ޤ�����
+������FIX2LONG()�פ��㳰��ȯ�����ޤ��󤬡���FIX2INT()�פ���
+����̤�int�Υ������˼��ޤ�ʤ����ˤ��㳰��ȯ�����ޤ���
+���줫�顤FIXNUM�˸¤餺Ruby�Υǡ������������Ѵ�����
+��NUM2INT()�פ���ӡ�NUM2LONG()�פȤ����ޥ���������ޤ�����
+���Υޥ����ϥޥ����ϥǡ��������פΥ����å�̵���ǻȤ��ޤ�
+(�������Ѵ��Ǥ��ʤ����ˤ��㳰��ȯ������)��Ʊ�ͤ˥����å�̵
+�ǻȤ����Ѵ��ޥ�����double����Ф���NUM2DBL()�פ�����ޤ���
+
+char* ����Ф���硤 StringValue() �� StringValuePtr() 
+��Ȥ��ޤ���
+StringValue(var) �� var �� String 
+�Ǥ���в��⤻���������Ǥʤ���� var �� var.to_str() �η��
+���֤�������ޥ�����StringValuePtr(var) ��Ʊ�ͤ� var ��
+String ���֤������Ƥ��� var �ΥХ�����ɽ�����Ф��� char* ��
+�֤��ޥ����Ǥ���var �����Ƥ�ľ���֤����������������Τǡ�
+var �� lvalue �Ǥ���ɬ�פ�����ޤ���
+�ޤ���StringValuePtr() ��������� StringValueCStr() �Ȥ�����
+�����⤢��ޤ���StringValueCStr(var) �� var �� String ���֤�
+�����Ƥ��� var ��ʸ����ɽ�����Ф��� char* ���֤��ޤ����֤���
+��ʸ����������ˤ� nul ʸ�����ղä���ޤ����ʤ�������� nul
+ʸ�����ޤޤ����� ArgumentError ��ȯ�����ޤ���
+������StringValuePtr() �Ǥϡ������� nul ʸ���������ݾڤϤʤ���
+����� nul ʸ�����ޤޤ�Ƥ����ǽ���⤢��ޤ���
 
 ����ʳ��Υǡ��������פ��б�����C�ι�¤�Τ�����ޤ����б���
 �빽¤�ΤΤ���VALUE�Ϥ��Τޤޥ��㥹��(���Ѵ�)����й�¤�Τ�
@@ -129,10 +142,11 @@ obsolete �Ȥʤꡢ����� StringValue() �� StringValuePtr()
 ruby.h�ǤϹ�¤�Τإ��㥹�Ȥ���ޥ������RXXXXX()��(������ʸ
 ���ˤ������)�Ȥ���̾�����󶡤���Ƥ��ޤ�(��: RSTRING())��
 
-�㤨�С�ʸ����str��Ĺ�������뤿��ˤϡ�RSTRING(str)->len�פ�
-����ʸ����str��char*�Ȥ������뤿��ˤϡ�RSTRING(str)->ptr��
-�Ȥ��ޤ�������ξ��ˤϡ����줾���RARRAY(ary)->len�ס�
-��RARRAY(ary)->ptr�פȤʤ�ޤ���
+��¤�Τ���ǡ�������Ф��ޥ������󶡤���Ƥ��ޤ���ʸ����
+str��Ĺ�������뤿��ˤϡ�RSTRING_LEN(str)�פȤ���ʸ����str��
+char*�Ȥ������뤿��ˤϡ�RSTRING_PTR(str)�פȤ��ޤ��������
+���ˤϡ����줾���RARRAY_LEN(ary)�ס���RARRAY_PTR(ary)�פ�
+�ʤ�ޤ���
 
 Ruby�ι�¤�Τ�ľ�ܥ�������������˵���Ĥ��ʤ���Фʤ�ʤ���
 �Ȥϡ������ʸ����ι�¤�Τ���Ȥϻ��Ȥ�������ǡ�ľ���ѹ���
@@ -165,7 +179,8 @@ FIXNUM�˴ؤ��Ƥ��Ѵ��ޥ������ͳ����ɬ�פ�����ޤ���C������
 ����VALUE���Ѵ�����ޥ����ϰʲ��Τ�Τ�����ޤ���ɬ�פ˱���
 �ƻȤ�ʬ���Ƥ���������
 
-  INT2FIX()	��Ȥ�������31bit����˼��ޤ뼫���������
+  INT2FIX()	��Ȥ�������31bit�ޤ���63bit����˼��ޤ뼫��
+		�������
   INT2NUM()	Ǥ�դ���������VALUE��
 
 INT2NUM()��������FIXNUM���ϰϤ˼��ޤ�ʤ���硤Bignum���Ѵ�
@@ -187,6 +202,7 @@ Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
     ������Ruby��ʸ������������롥
 
   rb_str_new2(const char *ptr)
+  rb_str_new_cstr(const char *ptr)
 
     C��ʸ���󤫤�Ruby��ʸ������������롥���δؿ��ε�ǽ��
     rb_str_new(ptr, strlen(ptr))��Ʊ���Ǥ��롥
@@ -198,13 +214,59 @@ Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
     �Ǥ��롥
 
   rb_tainted_str_new2(const char *ptr)
+  rb_tainted_str_new_cstr(const char *ptr)
 
     C��ʸ���󤫤�����ޡ������ղä��줿Ruby��ʸ������������롥
 
+  rb_sprintf(const char *format, ...)
+  rb_vsprintf(const char *format, va_list ap)
+
+    C��ʸ����format��³��������printf(3)�Υե����ޥåȤˤ������ä�
+    ��������Ruby��ʸ������������롥
+
   rb_str_cat(VALUE str, const char *ptr, long len)
 
     Ruby��ʸ����str��len�Х��Ȥ�ʸ����ptr���ɲä��롥
 
+  rb_str_cat2(VALUE str, const char* ptr)
+
+    Ruby��ʸ����str��C��ʸ����ptr���ɲä��롥���δؿ��ε�ǽ��
+    rb_str_cat(str, ptr, strlen(ptr))��Ʊ���Ǥ��롥
+
+  rb_str_catf(VALUE str, const char* format, ...)
+  rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+    C��ʸ����format��³��������printf(3)�Υե����ޥåȤˤ������ä�
+    ��������Ruby��ʸ����str���ɲä��롥���δؿ��ε�ǽ�ϡ����줾��
+    rb_str_cat2(str, rb_sprintf(format, ...)) ��
+    rb_str_cat2(str, rb_vsprintf(format, ap)) ��Ʊ���Ǥ��롥
+
+  rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+  
+    ���ꤵ�줿���󥳡��ǥ��󥰤�Ruby��ʸ�������������.
+     
+  rb_usascii_str_new(const char *ptr, long len)
+  rb_usascii_str_new_cstr(const char *ptr)
+
+    ���󥳡��ǥ��󥰤�US-ASCII��Ruby��ʸ�������������.
+
+  rb_str_resize(VALUE str, long len)
+
+    Ruby��ʸ����Υ�������len�Х��Ȥ��ѹ����롥str��Ĺ������
+    �ʤƥ��åȤ���Ƥ��ʤ���Фʤ�ʤ���len������Ĺ������û
+    �����ϡ�len�Х��Ȥ�ۤ�����ʬ�����ƤϼΤƤ��롥len����
+    ��Ĺ������Ĺ�����ϡ�����Ĺ����ۤ�����ʬ�����Ƥ���¸��
+    ��ʤ��ǥ��ߤˤʤ�����������δؿ��θƤӽФ��ˤ�ä�
+    RSTRING_PTR(str)���ѹ�����뤫�⤷��ʤ����Ȥ����ա�
+
+  rb_str_set_len(VALUE str, long len)
+
+    Ruby��ʸ����Υ�������len�Х��Ȥ˥��åȤ��롥str���ѹ���
+    ǽ�Ǥʤ�����㳰��ȯ�����롥RSTRING_LEN(str)�Ȥ�̵�ط��ˡ�
+    len�Х��ȤޤǤ����Ƥ���¸����롥len��str�����̤�ۤ��Ƥ�
+    �ƤϤʤ�ʤ���
+
+
  ������Ф���ؿ�
 
   rb_ary_new()
@@ -224,14 +286,32 @@ Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
 
     �����Ϳ����n���Ǥ�������������롥
 
+  rb_ary_to_ary(VALUE obj)
+
+    ���֥������Ȥ�������Ѵ�����.
+    Object#to_ary��Ʊ���Ǥ���.
+
+ ¾�ˤ����������ؿ���¿������. ������
+ ����ary��������Ϥ��ʤ���Фʤ�ʤ�. ����ʤ���
+ �������Ǥ�.
+
+  rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+    Array#[]��Ʊ��.
+
+  rb_ary_entry(VALUE ary, long offset)
+
+    ary[offset]
+
+  rb_ary_subseq(VALUE ary, long beg, long len)
+
+    ary[beg, len]
+
   rb_ary_push(VALUE ary, VALUE val)
   rb_ary_pop(VALUE ary)
   rb_ary_shift(VALUE ary)
   rb_ary_unshift(VALUE ary, VALUE val)
 
-    Array��Ʊ̾�Υ᥽�åɤ�Ʊ��Ư���򤹤�ؿ�����1������ɬ��
-    ����Ǥʤ���Фʤ�ʤ���
-
 2��Ruby�ε�ǽ��Ȥ�
 
 ����Ū��Ruby�ǽ񤱤뤳�Ȥ�C�Ǥ�񤱤ޤ���Ruby���Τ�Τ�C�ǵ�
@@ -294,19 +374,26 @@ argc����λ��ϰ����ο��ǤϤʤ�����������ꤷ�����Ȥˤʤ�ޤ���
 argc��-1�λ��ϰ����������������Ϥ���ޤ���argc��-2�λ��ϰ�
 ����Ruby������Ȥ����Ϥ���ޤ���
 
-�᥽�åɤ��������ؿ��Ϥ⤦��Ĥ���ޤ����ҤȤĤ�private��
-���åɤ��������ؿ��ǡ�������rb_define_method()��Ʊ���Ǥ���
+�᥽�åɤ��������ؿ��Ϥޤ������Ĥ�����ޤ�. �ҤȤĤϥ᥽�å�
+̾�Ȥ���ID����ޤ�. ID�ˤĤ��Ƥ�2.2.2�򻲾�.
+
+  void rb_define_method_id(VALUE klass, ID name, 
+                           VALUE (*func)(ANYARGS), int argc)
+
+private/protected�ʥ᥽�åɤ��������դ��Ĥδؿ�������ޤ�.
 
   void rb_define_private_method(VALUE klass, const char *name, 
 				VALUE (*func)(), int argc)
+  void rb_define_protected_method(VALUE klass, const char *name, 
+			          VALUE (*func)(), int argc)
 
 private�᥽�åɤȤϴؿ������Ǥ����ƤӽФ����Ȥν���ʤ��᥽��
 �ɤǤ���
 
-�⤦�ҤȤĤϥ⥸�塼��ؿ�����������ΤǤ����⥸�塼��ؿ�
-�Ȥϥ⥸�塼����ðۥ᥽�åɤǤ��ꡤƱ����private�᥽�åɤ�
-�⤢���ΤǤ�����򤢤����Math�⥸�塼���sqrt()�ʤɤ�����
-���ޤ������Υ᥽�åɤ�
+�Ǹ�ˡ� rb_define_module�ؿ��ϥ⥸�塼��ؿ���������ޤ���
+�⥸�塼��ؿ��Ȥϥ⥸�塼����ðۥ᥽�åɤǤ��ꡤƱ����
+private�᥽�åɤǤ⤢���ΤǤ�����򤢤����Math�⥸�塼��
+��sqrt()�ʤɤ��������ޤ������Υ᥽�åɤ�
 
   Math.sqrt(4)
 
@@ -327,20 +414,24 @@ private�᥽�åɤȤϴؿ������Ǥ����ƤӽФ����Ȥν���ʤ��᥽��
   void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
 
 
-�᥽�åɤ���̾��������뤿��δؿ��ϰʲ����̤�Ǥ���
+�᥽�åɤ���̾��������뤿��δؿ��ϰʲ����̤�Ǥ���
 
   void rb_define_alias(VALUE module, const char* new, const char* old);
 
+°���μ���������᥽�åɤ��������ˤ�
+
+  void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
 ���饹�᥽�å�allocate������������������ꤹ�뤿��δؿ���
-�ʲ����̤�Ǥ���
+�ʲ����̤�Ǥ���
 
   void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
   void rb_undef_alloc_func(VALUE klass);
 
-func�ϥ��饹������Ȥ��Ƽ�����äơ�������������Ƥ�줿����
-�����󥹤��֤��ʤ��ƤϤʤ�ޤ��󡣤��Υ��󥹥��󥹤ϡ�������
-�������ʤɤ�ޤޤʤ����Ǥ�������ֶ��פΤޤޤˤ��Ƥ������ۤ�
-���褤�Ǥ��礦��
+func�ϥ��饹������Ȥ��Ƽ�����äơ�������������Ƥ�줿����
+�����󥹤��֤��ʤ��ƤϤʤ�ޤ��󡥤��Υ��󥹥��󥹤ϡ�������
+�������ʤɤ�ޤޤʤ����Ǥ�������ֶ��פΤޤޤˤ��Ƥ������ۤ�
+���褤�Ǥ��礦��
 
 2.1.3 ������
 
@@ -374,16 +465,26 @@ C����Ruby�ε�ǽ��ƤӽФ���äȤ��ñ����ˡ�Ȥ��ơ�ʸ�����
 ����ɾ���ϸ��ߤδĶ��ǹԤ��ޤ����Ĥޤꡤ���ߤΥ��������ѿ�
 �ʤɤ�����Ѥ��ޤ���
 
+ɾ�����㳰��ȯ�����뤫�⤷��ʤ����Ȥ����դ��ޤ��礦. ������
+�ʴؿ��⤢��ޤ�.
+
+  VALUE rb_eval_string_protect(const char *str, int *state)
+
+���δؿ��ϥ��顼��ȯ�������nil���֤��ޤ��������ơ��������ˤ�
+*state�ϥ����ˡ�����ʤ����󥼥��ˤʤ�ޤ���
+
+
 2.2.2 ID�ޤ��ϥ���ܥ�
 
 C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ����Ȥ�Ǥ���
 �����������ˡ�Ruby���󥿥ץ꥿��ǥ᥽�åɤ��ѿ�̾����ꤹ��
 ���˻Ȥ��Ƥ���ID�ˤĤ����������Ƥ����ޤ��礦��
 
-ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby�Ǥ�ID���б�����
-���֥������ȤȤ��ƥ���ܥ�(Symbol)�����ꡤ
+ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby����Ǥ�
 
  :���̻�
+�ޤ���
+ :"Ǥ�դ�ʸ����"
 
 �ǥ��������Ǥ��ޤ���C���餳�����������뤿��ˤϴؿ�
 
@@ -394,14 +495,6 @@ ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby�Ǥ�ID���б�����
 
   rb_to_id(VALUE symbol)
 
-ID���饷��ܥ�����뤿��ˤϰʲ��Υޥ�����Ȥ��ޤ���
-
-  VALUE ID2SYM(ID id)
-
-����ܥ뤫��ID�����뤿��ˤϰʲ��Υޥ�����Ȥ��ޤ���
-
-  ID SYM2ID(VALUE symbol)
-
 2.2.3 C����Ruby�Υ᥽�åɤ�ƤӽФ�
 
 C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ�����ˤϰʲ�
@@ -483,11 +576,17 @@ C��Ruby������ѿ���Ȥäƾ����ͭ�Ǥ��ޤ�����ͭ�Ǥ������
 �����ѿ������Ȥ��줿���ˤϴؿ�getter�����ѿ����ͤ����åȤ���
 �����ˤϴؿ�setter���ƤФ�롥hook����ꤷ�ʤ�����getter��
 setter��0����ꤷ�ޤ���
-
 # getter��setter��0�ʤ��rb_define_variable()��Ʊ���ˤʤ롥
 
-���줫�顤C�δؿ��ˤ�äƼ¸������Ruby������ѿ����������
-�ؿ�������ޤ���
+getter��setter�λ��ͤϼ����̤�Ǥ���
+
+  VALUE (*getter)(ID id, VALUE *var);
+  void (*setter)(VALUE val, ID id, VALUE *var);
+
+
+���줫�顤�б�����C���ѿ�������ʤ�Ruby������ѿ����������
+���Ȥ�Ǥ��ޤ�. �����ѿ����ͤϥեå��ؿ��Τߤˤ�äƼ���������
+����ޤ�.
 
   void rb_define_virtual_variable(const char *name,
 				  VALUE (*getter)(), void (*setter)())
@@ -497,8 +596,8 @@ getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�ޤ���
 
 getter��setter�λ��ͤϰʲ����̤�Ǥ���
 
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+  (*getter)(ID id);
+  (*setter)(VALUE val, ID id);
 
 3.3 C�Υǡ�����Ruby���֥������Ȥˤ���
 
@@ -525,6 +624,11 @@ free�Ϥ��ι�¤�Τ��⤦���פˤʤä����˸ƤФ��ؿ��Ǥ�������
 �ؿ��������١������쥯������ƤФ�ޤ������줬-1�ξ��ϡ�ñ
 ��˳�������ޤ���
 
+mark�����free�ؿ���GC�¹���˸ƤӽФ���ޤ�.
+�ʤ�, GC�¹����Ruby���֥������ȤΥ������������϶ػߤ����
+��. ��ä�, mark�����free�ؿ���Ruby���֥������ȤΥ���������
+���ϹԤ�ʤ��Ǥ�������.
+
 C�ι�¤�Τγ�����Data���֥������Ȥ�������Ʊ���˹Ԥ��ޥ�����
 ���ưʲ��Τ�Τ��󶡤���Ƥ��ޤ���
 
@@ -576,7 +680,10 @@ Ruby 1.1�����Ǥ�դΥǥ��쥯�ȥ�ǥ����ʥߥå��饤�֥����
 ����Υ�������ʣ���ξ��ˤϵդˡ֥饤�֥��̾.c�פȤ����ե�
 ����̾���򤱤�ɬ�פ�����ޤ������֥������ȥե�����ȥ⥸�塼
 �������������Ū�����������֥饤�֥��̾.o�פȤ����ե�����
-�Ȥ����ͤ��뤫��Ǥ���
+�Ȥ����ͤ��뤫��Ǥ����ޤ�����Ҥ��� mkmf �饤�֥��Τ�����
+���δؿ�������ѥ�����פ���ƥ��ȤΤ���ˡ�conftest.c�פȤ�
+���ե�����̾����Ѥ��뤳�Ȥ����դ��Ƥ����������������ե�����
+̾�Ȥ��ơ�conftest.c�פ���Ѥ��ƤϤʤ�ޤ���
 
 Ruby�ϳ�ĥ�饤�֥�������ɤ�����ˡ�Init_�饤�֥��̾�פ�
 �����ؿ���ưŪ�˼¹Ԥ��ޤ���dbm�饤�֥��ξ���Init_dbm��
@@ -584,7 +691,8 @@ Ruby�ϳ�ĥ�饤�֥�������ɤ�����ˡ�Init_�饤�֥��̾�פ�
 �����Ԥ��ޤ���dbm.c����������Ѥ��ޤ���
 
 --
-Init_dbm()
+void
+Init_dbm(void)
 {
     /* DBM���饹��������� */
     cDBM = rb_define_class("DBM", rb_cObject);
@@ -646,8 +754,7 @@ fdbm_delete()�Ϥ��Τ褦�ˤʤäƤ��ޤ���
 
 --
 static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
+fdbm_delete(VALUE obj, VALUE keystr)
 {
 	:
 }
@@ -663,10 +770,7 @@ fdbm_delete(obj, keystr)
 
 --
 static VALUE
-fdbm_s_open(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+fdbm_s_open(int argc, VALUE *argv, VALUE klass)
 {
 	:
     if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -681,22 +785,17 @@ fdbm_s_open(argc, argv, klass)
 �����ޤ���
 
 ���������Ϳ����줿��������Ϥ��뤿��δؿ���open()�Ǥ�Ȥ�
-��Ƥ���rb_scan_args()�Ǥ�����3�����˻��ꤷ���ե����ޥåȤ�
-��������4�ѿ��ʹߤ˻��ꤷ���ѿ����ͤ��������Ƥ���ޤ�������
-�ե����ޥåȤϡ���1ʸ���ܤ���ά�Ǥ��ʤ������ο�����2ʸ���ܤ�
-��ά�Ǥ�������ο�����3ʸ���ܤ��б�������̵꤬�����ޤ�ΰ�
-�������뤫�ɤ����򼨤�"*"�Ǥ���2ʸ���ܤ�3ʸ���ܤϾ�ά�Ǥ���
-����dbm.c����Ǥϡ��ե����ޥåȤ�"11"�Ǥ����顤�����Ϻ���1��
-�ǡ�2�Ĥޤǵ������Ȥ�����̣�ˤʤ�ޤ�����ά����Ƥ������
-�ѿ����ͤ�nil(C����Υ�٥�Ǥ�Qnil)�ˤʤ�ޤ���
-
-Ruby������ǰ������������Τ�indexes������ޤ��������Ϥ�
-���Ǥ���
+��Ƥ���rb_scan_args()�Ǥ�����3�����˻��ꤷ���ե����ޥåȤ˽�
+������4�ѿ��ʹߤ˻��ꤷ��VALUE�ؤλ��Ȥ��ͤ��������Ƥ����
+����
+
+
+������Ruby������Ȥ��Ƽ������᥽�åɤ���ˤ�
+Thread#initialize������ޤ��������Ϥ����Ǥ���
 
 --
 static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
+thread_initialize(VALUE thread, VALUE args)
 {
 	:
 }
@@ -735,9 +834,9 @@ Makefile������ο����ˤʤ�extconf.rb�Ȥ����ե��������
   $LDFLAGS: ��󥯻����ɲ�Ū�˻��ꤹ��ե饰(-L�ʤ�)
   $objs: ��󥯤���륪�֥������ȥե�����̾�Υꥹ��
 
-���֥������ȥե�����Υꥹ�Ȥϡ��̾�ϥ������ե�����򸡺���
-�Ƽ�ưŪ����������ޤ�����make������ǥ���������������褦��
-��������Ū�˻��ꤹ��ɬ�פ�����ޤ���
+���֥������ȥե�����Υꥹ�Ȥϡ��̾�ϥ������ե�����򸡺���
+�Ƽ�ưŪ����������ޤ�����make������ǥ���������������褦��
+��������Ū�˻��ꤹ��ɬ�פ�����ޤ���
 
 �饤�֥��򥳥�ѥ��뤹���郎·�鷺�����Υ饤�֥��򥳥�
 �ѥ��뤷�ʤ����ˤ�create_makefile��ƤФʤ����Makefile����
@@ -765,6 +864,12 @@ Makefile��ºݤ��������뤿��ˤ�
 
 �Ȥ��Ƥ���������
 
+site_ruby �ǥ��쥯�ȥ�Ǥʤ���
+vendor_ruby �ǥ��쥯�ȥ�˥��󥹥ȡ��뤹����ˤ�
+�ʲ��Τ褦�� --vendor ���ץ�����ä��Ƥ���������
+
+  ruby extconf.rb --vendor
+
 �ǥ��쥯�ȥ��ext�ʲ����Ѱդ������ˤ�Ruby���Τ�make�λ���
 ��ưŪ��Makefile����������ޤ��Τǡ����Υ��ƥåפ����פǤ���
 
@@ -807,53 +912,119 @@ Ruby�Υ������Ϥ����Ĥ���ʬ�ह�뤳�Ȥ�����ޤ������Τ�������
 
 Ruby����Υ���
 
-  class.c
-  error.c
+  class.c         : ���饹�ȥ⥸�塼��
+  error.c         : �㳰���饹���㳰����
+  gc.c            : �����ΰ����
+  load.c          : �饤�֥��Υ�����
+  object.c        : ���֥�������
+  variable.c      : �ѿ������
+
+Ruby�ι�ʸ���ϴ�
+  parse.y         : ������ϴ�ȹ�ʸ���
+    -> parse.c    : ��ư����
+  keywords        : ͽ���
+    -> lex.c      : ��ư����
+
+Ruby��ɾ���� (�̾�YARV)
+  compile.c
   eval.c
-  gc.c
-  object.c
-  parse.y
-  variable.c
+  eval_error.c
+  eval_jump.c
+  eval_safe.c
+  insns.def           : ���۵���������
+  iseq.c              : VM::ISeq�μ���
+  thread.c            : ����åɴ����ȥ���ƥ������ڤ��ؤ�
+  thread_win32.c      : ����åɼ���
+  thread_pthread.c    : Ʊ��
+  vm.c
+  vm_dump.c
+  vm_eval.c
+  vm_exec.c
+  vm_insnhelper.c
+  vm_method.c
+
+  opt_insns_unif.def  : ̿��ͻ��
+  opt_operand.def     : ��Ŭ���Τ�������
+
+    -> insn*.inc      : ��ư����
+    -> opt*.inc       : ��ư����
+    -> vm.inc         : ��ư����
+
+����ɽ�����󥸥� (����)
+  regex.c
+  regcomp.c
+  regenc.c
+  regerror.c
+  regexec.c
+  regparse.c
+  regsyntax.c
 
 �桼�ƥ���ƥ��ؿ�
 
-  dln.c
-  regex.c
-  st.c
-  util.c
+  debug.c       : C�ǥХå��ѤΥǥХå�����ܥ�
+  dln.c         : ưŪ�����ǥ���
+  st.c          : ���ѥϥå���ɽ
+  strftime.c    : ��������
+  util.c        : ����¾�Υ桼�ƥ���ƥ�
 
 Ruby���ޥ�ɤμ���
 
   dmyext.c
+  dmydln.c
+  dmyencoding.c
+  id.c
   inits.c
   main.c
   ruby.c
   version.c
 
+  gem_prelude.rb
+  prelude.rb
+
 ���饹�饤�֥��
 
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  prec.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
+  array.c       : Array
+  bignum.c      : Bignum
+  compar.c      : Comparable
+  complex.c     : Complex
+  cont.c        : Fiber, Continuation
+  dir.c         : Dir
+  enum.c        : Enumerable
+  enumerator.c  : Enumerator
+  file.c        : File
+  hash.c        : Hash
+  io.c          : IO
+  marshal.c     : Marshal
+  math.c        : Math
+  numeric.c     : Numeric, Integer, Fixnum, Float
+  pack.c        : Array#pack, String#unpack
+  proc.c        : Binding, Proc
+  process.c     : Process
+  random.c      : ���
+  range.c       : Range
+  rational.c    : Rational
+  re.c          : Regexp, MatchData
+  signal.c      : Signal
+  sprintf.c     : 
+  string.c      : String
+  struct.c      : Struct
+  time.c        : Time
+
+  defs/known_errors.def  : �㳰���饹 Errno::*
+    -> known_errors.inc  : ��ư����
+
+¿���첽
+  encoding.c    : Encoding
+  transcode.c   : Encoding::Converter
+  enc/*.c       : ���󥳡��ǥ��󥰥��饹��
+  enc/trans/*   : �����ɥݥ�����б�ɽ
+
+goruby���ޥ�ɤμ���
+  
+  goruby.c
+  golf_prelude.rb      : goruby��ͭ�Υ饤�֥��
+    -> golf_prelude.c  : ��ư����
+
 
 Appendix B. ��ĥ�Ѵؿ���ե����
 
@@ -911,10 +1082,17 @@ void Check_SafeStr(VALUE value)
 
 ** ���Ѵ�
 
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
+FIX2INT(value), INT2FIX(i)
+FIX2LONG(value), LONG2FIX(l)
+NUM2INT(value), INT2NUM(i)
+NUM2UINT(value), UINT2NUM(ui)
+NUM2LONG(value), LONG2NUM(l)
+NUM2ULONG(value), ULONG2NUM(ul)
+NUM2LL(value), LL2NUM(ll)
+NUM2ULL(value), ULL2NUM(ull)
+NUM2OFFT(value), OFFT2NUM(off)
+NUM2SIZET(value), SIZET2NUM(size)
+NUM2SSIZET(value), SSIZET2NUM(ssize)
 NUM2DBL(value)
 rb_float_new(f)
 StringValue(value)
@@ -1018,13 +1196,48 @@ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int a
 
 rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
 
-  argc, argv������Ϳ����줿������ʬ�򤹤롥fmt��ɬ�ܰ����ο�, 
-  �ղð����ο�, �Ĥ�ΰ��������뤫����ꤹ��ʸ�����, "����
-  ����*"�Ȥ��������Ǥ��롥 2 ���ܤο�����"*"�Ϥ��줾���ά��
-  ǽ�Ǥ��롥ɬ�ܰ�������Ĥ�ʤ�����0����ꤹ�롥��3������
-  �ߤ��ѿ��ؤΥݥ��󥿤�, �����������Ǥ������ѿ��˳�Ǽ����롥
-  �ղð������б����������Ϳ�����Ƥ��ʤ������ѿ���Qnil��
-  ��������롥
+  argc, argv������Ϳ����줿���ꤵ�줿�ե����ޥåȤ˽��äư�
+  ����ʬ�򤷡�³��VALUE�ؤλ��Ȥ˥��åȤ��ޤ������Υե����ޥ�
+  �Ȥϡ�ABNF�ǵ��Ҥ���Ȱʲ����̤�Ǥ���
+
+--
+scan-arg-spec  := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
+pre-arg-spec   := num-of-leading-mandatory-args [num-of-optional-args]
+post-arg-spec  := sym-for-variable-length-args [num-of-trailing-mandatory-args]
+pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
+option-hash-arg-spec := sym-for-option-hash-arg
+block-arg-spec := sym-for-block-arg
+
+num-of-leading-mandatory-args  := DIGIT ; ��Ƭ���֤�����ά��ǽ�ʰ����ο�
+num-of-optional-args           := DIGIT ; ³�����֤�����ά��ǽ�ʰ����ο�
+sym-for-variable-length-args   := "*"   ; ³�����֤�������Ĺ������
+                                        ; Ruby������Ǽ������뤿��λ���
+num-of-trailing-mandatory-args := DIGIT ; ��ü���֤�����ά��ǽ�ʰ����ο�
+sym-for-option-hash-arg        := ":"   ; ���ץ����ϥå�����������
+                                        ; ����λ���; ��ά��ǽ�ʰ�����
+                                        ; ������¿���ΰ��������ꤵ�졤
+                                        ; �Ǹ�ΰ������ϥå���ʤޤ���
+                                        ; #to_hash���Ѵ���ǽ�ˤξ���
+                                        ; ��������롥�Ǹ�ΰ�����nil��
+                                        ; ��硤����Ĺ�������꤬�ʤ���
+                                        ; ��ά��ǽ�����ο�����¿����
+                                        ; ���������ꤵ�줿���˼��������
+sym-for-block-arg              := "&"   ; ���ƥ졼���֥��å���������뤿���
+                                        ; ����
+--
+
+  �ե����ޥåȤ�"12"�ξ�硤�����Ϻ���1�Ĥǡ�3��(1+2)�ޤǵ���
+  ���Ȥ�����̣�ˤʤ�ޤ������äơ��ե����ޥå�ʸ�����³��
+  ��3�Ĥ�VALUE�ؤλ��Ȥ��֤�ɬ�פ�����ޤ��������ˤϼ�������
+  �ѿ������åȤ���ޤ����ѿ��ؤλ��Ȥ������NULL����ꤹ��
+  ���Ȥ�Ǥ������ξ��ϼ��������������ͤϼΤƤ��ޤ����ʤ���
+  ��ά��ǽ��������ά���줿�����ѿ����ͤ�nil(C����Υ�٥�Ǥ�
+  Qnil)�ˤʤ�ޤ���
+
+  �֤��ͤ�Ϳ����줿�����ο��Ǥ������ץ����ϥå��太��ӥ�
+  �ƥ졼���֥��å��Ͽ����ޤ���
 
 ** Ruby�᥽�åɸƤӽФ�
 
@@ -1051,12 +1264,12 @@ char *rb_id2name(ID id)
 
 char *rb_class2name(VALUE klass)
 
-  ���饹��̾�����֤�(�ǥХå���)�����饹��̾��������ʤ����ˤ�, 
-  ������̤ä�̾������ĥ��饹��̾�����֤���
+  ���饹��̾�����֤�(�ǥХå���)�����饹��̾��������ʤ�����
+  ��, ������̤ä�̾������ĥ��饹��̾�����֤���
 
 int rb_respond_to(VALUE obj, ID id)
 
-  obj��id�Ǽ������᥽�åɤ���Ĥ��ɤ������֤���
+  obj��id�Ǽ������᥽�åɤ���Ĥ��ɤ������֤���
 
 ** ���󥹥����ѿ�
 
@@ -1073,12 +1286,26 @@ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
 
 ** ���湽¤
 
-VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv,
+		    VALUE (*func) (ANYARGS), VALUE data2)
+
+  func��֥��å��Ȥ������ꤷ��obj��쥷���С�argc��argv�����
+  �Ȥ���mid�᥽�åɤ�ƤӽФ���func����������yield���줿�͡�
+  ���������data2�������롥ʣ�����ͤ�yield���줿���(C�Ǥ�
+  rb_yield_values()��rb_yield_values2(), rb_yield_splat())��
+  data2��Array�Ȥ��ƥѥå�����Ƥ��롥�軰, ��Ͱ�����argc��
+  argv�ˤ�ä�yield���줿�ͤ���Ф����Ȥ��Ǥ��롥
+
+[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
 
   func2��֥��å��Ȥ������ꤷ, func1�򥤥ƥ졼���Ȥ��ƸƤ֡� 
   func1�ˤ� arg1�������Ȥ����Ϥ���, func2�ˤ���1�����˥��ƥ졼
   ������Ϳ����줿��, ��2������arg2���Ϥ���롥
  
+  1.9��rb_iterate��Ȥ�����, func1�����Ruby��٥�Υ᥽�å�
+  ��ƤӽФ��ʤ���Фʤ�ʤ�.
+  1.9��obsolete�Ȥʤä�. �����rb_block_call���Ѱդ��줿.
+
 VALUE rb_yield(VALUE val)
 
   val���ͤȤ��ƥ��ƥ졼���֥��å���ƤӽФ���
@@ -1090,12 +1317,24 @@ VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
   ���ʤ��ä�����func1�������, �㳰��ȯ���������ˤ�func2����
   ���ͤǤ��롥
 
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
 
   �ؿ�func1��arg1������Ȥ��Ƽ¹Ԥ�, �¹Խ�λ��(���Ȥ��㳰��
   ȯ�����Ƥ�) func2��arg2������Ȥ��Ƽ¹Ԥ��롥����ͤ�func1
   ������ͤǤ���(�㳰��ȯ�������������ʤ�)��
 
+VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
+
+  �ؿ�func��arg������Ȥ��Ƽ¹Ԥ�, �㳰��ȯ�����ʤ���Ф�����
+  ���ͤ��֤����㳰��ȯ����������, *state����0�򥻥åȤ���
+  Qnil���֤���
+
+void rb_jump_tag(int state)
+
+  rb_protect()��rb_eval_string_protect()����ª���줿�㳰���
+  �����롥state�Ϥ����δؿ������֤��줿�ͤǤʤ���Фʤ�ʤ���
+  ���δؿ���ľ�ܤθƤӽФ��������ʤ���
+
 ** �㳰�����顼
 
 void rb_warning(const char *fmt, ...)
@@ -1145,6 +1384,77 @@ void ruby_script(char *name)
 
   Ruby�Υ�����ץ�̾($0)�����ꤹ�롥
 
+** ���󥿥ץ꥿�Υ��٥�ȤΥեå�
+
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
+
+���ꤵ�줿���󥿥ץ꥿�Υ��٥�Ȥ��Ф���եå��ؿ����ɲä��ޤ���
+events�ϰʲ����ͤ�or�Ǥʤ���Фʤ�ޤ���:
+
+	RUBY_EVENT_LINE
+	RUBY_EVENT_CLASS
+	RUBY_EVENT_END
+	RUBY_EVENT_CALL
+	RUBY_EVENT_RETURN
+	RUBY_EVENT_C_CALL
+	RUBY_EVENT_C_RETURN
+	RUBY_EVENT_RAISE
+	RUBY_EVENT_ALL
+
+rb_event_hook_func_t������ϰʲ����̤�Ǥ�:
+
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ 				      VALUE self, ID id, VALUE klass)
+
+rb_add_event_hook() ����3���� data �ϡ��եå��ؿ�����2������
+�����Ϥ���ޤ��������1.8�Ǥϸ��ߤ�NODE�ؤΥݥ��󥿤Ǥ�������
+���� RB_EVENT_HOOKS_HAVE_CALLBACK_DATA �⻲�Ȥ��Ƥ���������
+
+ int rb_remove_event_hook(rb_event_hook_func_t func)
+
+���ꤵ�줿�եå��ؿ��������ޤ���
+
+** �ߴ����Τ���Υޥ���
+
+API�θߴ���������å����뤿��˰ʲ��Υޥ������ǥե���Ȥ��������Ƥ��ޤ���
+
+NORETURN_STYLE_NEW
+
+  NORETURN �ޥ������ؿ����ޥ����Ȥ����������Ƥ��뤳�Ȥ��̣���롥
+
+HAVE_RB_DEFINE_ALLOC_FUNC
+
+  rb_define_alloc_func() �ؿ����󶡤���Ƥ��뤳�ȡ��Ĥޤ�
+  allocation framework ���Ȥ��뤳�Ȥ��̣���롥
+  have_func("rb_define_alloc_func", "ruby.h")
+  �η�̤�Ʊ����
+
+HAVE_RB_REG_NEW_STR
+
+  String���֥������Ȥ���Regexp���֥������Ȥ���
+  rb_reg_new_str() �ؿ����󶡤���Ƥ��뤳�Ȥ��̣���롥
+  have_func("rb_reg_new_str", "ruby.h").
+  �η�̤�Ʊ����
+
+HAVE_RB_IO_T
+
+  rb_io_t �����󶡤���Ƥ��뤳�Ȥ��̣���롥
+
+USE_SYMBOL_AS_METHOD_NAME
+
+  �᥽�å�̾���֤��᥽�åɡ�Module#methods, #singleton_methods
+  �ʤɤ�Symbol���֤����Ȥ��̣���롥
+
+HAVE_RUBY_*_H
+
+  ruby.h ���������Ƥ��롥�б�����إå����󶡤���Ƥ��뤳��
+  ���̣���롥���Ȥ��С�HAVE_RUBY_ST_H ���������Ƥ������
+  ñ�ʤ� st.h �ǤϤʤ� ruby/st.h ����Ѥ��롥
+
+RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
+
+  rb_add_event_hook() ���եå��ؿ����Ϥ� data ����3�����Ȥ���
+  ������뤳�Ȥ��̣���롥
 
 Appendix C. extconf.rb�ǻȤ���ؿ�����
 
@@ -1169,10 +1479,10 @@ find_library(lib, func, path...)
 
 have_func(func, header)
 
-  �إå��ե�����header�򥤥󥯥롼�ɤ��ƴؿ�func��¸�ߤ������
-  �����롥func��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�ΤǤ�
-  ����ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ���
-  �����ؿ���¸�ߤ����true���֤���
+  �إå��ե�����header�򥤥󥯥롼�ɤ��ƴؿ�func��¸�ߤ����
+  �å����롥func��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�Τ�
+  ������ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ�
+  �������ؿ���¸�ߤ����true���֤���
 
 have_var(var, header)
 
@@ -1223,7 +1533,8 @@ find_executable(command, path)
 
 with_config(withval[, default=nil])
 
-  ���ޥ�ɥ饤����--with-<withval>�ǻ��ꤵ�줿���ץ�����ͤ����롥
+  ���ޥ�ɥ饤����--with-<withval>�ǻ��ꤵ�줿���ץ������
+  �����롥
 
 enable_config(config, *defaults)
 disable_config(config, *defaults)
@@ -1232,8 +1543,9 @@ disable_config(config, *defaults)
   --disable-<config>�ǻ��ꤵ�줿�����ͤ����롥
   --enable-<config>�����ꤵ��Ƥ�������true��
   --disable-<config>�����ꤵ��Ƥ�������false���֤���
-  �ɤ������ꤵ��Ƥ��ʤ����ϡ��֥��å��Ĥ��ǸƤӽФ���Ƥ������
-  *defaults��yield������̡��֥��å��ʤ��ʤ�*defaults���֤���
+  �ɤ������ꤵ��Ƥ��ʤ����ϡ��֥��å��Ĥ��ǸƤӽФ����
+  �������*defaults��yield������̡��֥��å��ʤ��ʤ�
+  *defaults���֤���
 
 dir_config(target[, default_dir])
 dir_config(target[, default_include, default_lib])
@@ -1242,8 +1554,8 @@ dir_config(target[, default_include, default_lib])
   --with-<target>-lib�Τ����줫�ǻ��ꤵ���ǥ��쥯�ȥ��
   $CFLAGS �� $LDFLAGS ���ɲä��롥--with-<target>-dir=/path��
   --with-<target>-include=/path/include --with-<target>-lib=/path/lib
-  �������Ǥ��롥�ɲä��줿 include �ǥ��쥯�ȥ�� lib �ǥ��쥯�ȥ��
-  ������֤��� ([include_dir, lib_dir])
+  �������Ǥ��롥�ɲä��줿 include �ǥ��쥯�ȥ�� lib �ǥ���
+  ���ȥ��������֤��� ([include_dir, lib_dir])
 
 pkg_config(pkg)
 
diff --git a/README.ja b/README.ja
index df8cfc03f4..dd7f67ca59 100644
--- a/README.ja
+++ b/README.ja
@@ -20,9 +20,9 @@ Ruby�ϥƥ����Ƚ����ط���ǽ�Ϥʤɤ�ͥ�졤Perl��Ʊ�����餤����
   + ���ƥ졼���ȥ���������
   + �����١������쥯��
   + �����ʥߥå������ǥ��� (�������ƥ�����ˤ��)
-  + �ܿ������⤤��¿����UNIX���ư�������Ǥʤ���DOS��Windows��
-    Mac��BeOS�ʤɤξ�Ǥ�ư��
-
+  + �ܿ������⤤��¿����Unix-like/POSIX�ߴ��ץ�åȥե�������
+    ư�������Ǥʤ���Windows�� Mac OS X��BeOS�ʤɤξ�Ǥ�ư��
+    cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatformsJa
 
 * ����ˡ
 
@@ -34,10 +34,6 @@ Ruby�ϥƥ����Ƚ����ط���ǽ�Ϥʤɤ�ͥ�졤Perl��Ʊ�����餤����
 
 ** Subversion��
 
-�ܥ֥�����Ruby�κǿ��Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
-
-  $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
 ��ȯ��ü�Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
 
   $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
@@ -92,6 +88,10 @@ Ruby��ĥ�⥸�塼��ˤĤ����ä��礦ruby-ext�᡼��󥰥ꥹ�Ȥ�
 
   2. configure��¹Ԥ���Makefile�ʤɤ���������
 
+     �Ķ��ˤ�äƤϥǥե���Ȥ�C����ѥ����ѥ��ץ�����դ�
+     �ޤ���configure���ץ����� optflags=.. warnflags=.. ��
+     �Ǿ�񤭤Ǥ��ޤ���
+
   3. (ɬ�פʤ��)defines.h���Խ�����
 
      ¿ʬ��ɬ��̵���Ȼפ��ޤ���
@@ -116,6 +116,32 @@ Ruby��ĥ�⥸�塼��ˤĤ����ä��礦ruby-ext�᡼��󥰥ꥹ�Ȥ�
 
   7. make install
 
+     �ʲ��Υǥ��쥯�ȥ���äơ������˥ե�����򥤥󥹥ȡ�
+     �뤷�ޤ���
+
+       * ${DESTDIR}${prefix}/bin
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib
+       * ${DESTDIR}${prefix}/lib/ruby
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/share/man/man1
+       * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
+
+     Ruby��API�С������`x.y.z'�Ǥ���С�((|${MAJOR}|))��
+     `x'�ǡ�((|${MINOR}|))��`y'��((|${TEENY}|))��`z'�Ǥ���
+
+     ����: API�С�������teeny�ϡ�Ruby�ץ������ΥС�����
+     ��Ȥϰۤʤ뤳�Ȥ�����ޤ���
+
      root�Ǻ�Ȥ���ɬ�פ����뤫�⤷��ޤ���
 
 �⤷������ѥ�����˥��顼��ȯ���������ˤϥ��顼�Υ����ȥ�
@@ -130,15 +156,14 @@ UNIX�Ǥ����configure���ۤȤ�ɤκ��ۤ�ۼ����Ƥ����Ϥ���
 ���Ȥ��ݡ��Ȥ���С����Ǥ��뤫���Τ�ޤ���
 
 �������ƥ�����ˤ�äȤ��¸����Τ�GC���Ǥ���Ruby��GC���о�
-�Υ������ƥ����㤬setjmp()�ˤ�ä����ƤΥ쥸������ jmp_buf��
-��Ǽ���뤳�Ȥȡ�jmp_buf�ȥ����å���32bit���饤����Ȥ����
-���뤳�Ȥ��ꤷ�Ƥ��ޤ����ä����Ԥ���Ω���ʤ������б�����
-��˺���Ǥ��礦����Ԥβ������Ū��ñ�ǡ�gc.c�ǥ����å���
-�ޡ������Ƥ�����ʬ�˥��饤����ȤΥХ��ȿ��������餷�ƥޡ�
-�����륳���ɤ��ɲä�������ǺѤߤޤ�����defined(THINK_C)�פ�
-����Ƥ�����ʬ�򻲹ͤˤ��Ƥ�������
-
-# �ºݤˤ�Ruby��Think C�Ǥϥ���ѥ���Ǥ��ޤ���
+�Υ������ƥ����㤬setjmp()�ޤ���getcontext()�ˤ�ä����ƤΥ�
+��������jmp_buf��ucontext_t�˳�Ǽ���뤳�Ȥȡ�jmp_buf��
+ucontext_t�ȥ����å���32bit���饤����Ȥ���Ƥ��뤳�Ȥ���
+���Ƥ��ޤ����ä����Ԥ���Ω���ʤ������б������˺���Ǥ���
+������Ԥβ������Ū��ñ�ǡ�gc.c�ǥ����å���ޡ������Ƥ���
+��ʬ�˥��饤����ȤΥХ��ȿ��������餷�ƥޡ������륳���ɤ�
+�ɲä�������ǺѤߤޤ�����defined(__mc68000__)�פǳ���Ƥ�
+����ʬ�򻲹ͤˤ��Ƥ���������
 
 �쥸����������ɥ������CPU�Ǥϡ��쥸����������ɥ��򥹥���
 ���˥ե�å��夹�륢����֥饳���ɤ��ɲä���ɬ�פ����뤫����
diff --git a/ToDo b/ToDo
index b55e399edf..7e5ef523a8 100644
--- a/ToDo
+++ b/ToDo
@@ -2,6 +2,10 @@ Language Spec.
 
 - Class#allocate - basicNew
 - class Foo::Bar<Baz .. end, module Boo::Bar .. end
+- raise exception by `` error
+- a +1 to be a+1, not a(+1).
+- clarify evaluation order of operator argument (=~, .., ...)
+- :symbol => value hash in the form of {symbol: value, ...} ??
 * operator !! for rescue. ???
 * objectify characters
 * ../... outside condition invokes operator method too.
@@ -14,7 +18,6 @@ Language Spec.
 * def Class#method .. end ??
 * def Foo::Bar::baz() .. end ??
 * I18N (or M17N) script/string/regexp
-* Fixnum 0 as false ????
 * discourage use of symbol variables (e.g. $/, etc.) in manual
 * discourage use of Perlish features by giving warnings.
 * non confusing in-block local variable (is it possible?)
@@ -22,12 +25,9 @@ Language Spec.
   + variables appears within block may have independent values.
 * Regexp: make /o thread safe.
 * decide whether begin with rescue or ensure make do..while loop.
-* a +1 to be a+1, not a(+1).
 * unify == and eql? again
 * to_i returns nil if str contains no digit.
-* raise exception by `` error
 * jar like combined library package. -> RubyGems?
-* resumable Exception via Exception#resume.
 * method combination, e.g. before, after, around, etc.
 * .. or something like defadvice in Emacs.
 * property - for methods, or for objects in general.
@@ -35,8 +35,6 @@ Language Spec.
 * selector namespace - something like generic-flet in CLOS, to help RubyBehavior
 * private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
 * warn/error "bare word" method, like "foo",  you should type "foo()"
-* clarify evaluation order of operator argument (=~, .., ...)
-* :symbol => value hash in the form of {symbol: value, ...} ??
 
 Hacking Interpreter
 
@@ -83,7 +81,7 @@ Standard Libraries
 - use Mersenne Twister RNG for random.
 - deprecate Array#indexes, and Array#indices.
 - remove dependency on MAXPATHLEN.
-* String#scanf(?)
+- String#scanf(?)
 * Object#fmt(?)
 * Time::strptime
 * Integer[num], Float[num];  Fixnum[num]?
@@ -117,7 +115,7 @@ Extension Libraries
 
 Ruby Libraries
 
-* urllib.rb, nttplib.rb, etc.
+- urllib.rb, nttplib.rb, etc.
 * format like perl's
 
 Tools
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..219d1d4b47
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,610 @@
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#include "ruby/config.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef USE_ELF
+
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+#if defined(HAVE_ALLOCA_H)
+#include <alloca.h>
+#endif
+
+#ifdef HAVE_DL_ITERATE_PHDR
+# ifndef _GNU_SOURCE
+#  define _GNU_SOURCE
+# endif
+# include <link.h>
+#endif
+
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+#  define ElfW(x) Elf64##_##x
+# else
+#  define ElfW(x) Elf32##_##x
+# endif
+#endif
+
+typedef struct {
+    const char *dirname;
+    const char *filename;
+    int line;
+
+    int fd;
+    void *mapped;
+    size_t mapped_size;
+    unsigned long base_addr;
+} line_info_t;
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX];
+
+static unsigned long
+uleb128(char **p) {
+    unsigned long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    r += (unsigned long)b << s;
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static long
+sleb128(char **p) {
+    long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    if (b & 0x40) {
+		r -= (0x80 - b) << s;
+	    }
+	    else {
+		r += (b & 0x3f) << s;
+	    }
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+    if (!dir--) {
+	return "";
+    }
+    while (dir--) {
+	while (*p) p++;
+	p++;
+	if (!*p) {
+	    fprintf(stderr, "Unexpected directory number %lu in %s\n",
+		    dir, binary_filename);
+	    return "";
+	}
+    }
+    return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames,
+	      line_info_t *line)
+{
+    int i;
+    char *p = filenames;
+    char *filename;
+    unsigned long dir;
+    for (i = 1; i <= file; i++) {
+	filename = p;
+	if (!*p) {
+	    /* Need to output binary file name? */
+	    fprintf(stderr, "Unexpected file number %d in %s\n",
+		    file, binary_filename);
+	    return;
+	}
+	while (*p) p++;
+	p++;
+	dir = uleb128(&p);
+	/* last modified. */
+	uleb128(&p);
+	/* size of the file. */
+	uleb128(&p);
+
+	if (i == file) {
+	    line->filename = filename;
+	    line->dirname = get_nth_dirname(dir, include_directories);
+	}
+    }
+}
+
+static int
+get_path_from_symbol(const char *symbol, const char **p, size_t *len)
+{
+    if (symbol[0] == '0') {
+	/* libexecinfo */
+	*p   = strchr(symbol, '/');
+	if (*p == NULL) return 0;
+	*len = strlen(*p);
+    }
+    else {
+	/* glibc */
+	const char *q;
+	*p   = symbol;
+	q   = strchr(symbol, '(');
+	if (q == NULL) return 0;
+	*len = q - symbol;
+    }
+    return 1;
+}
+
+static void
+fill_line(int num_traces, void **traces,
+	  unsigned long addr, int file, int line,
+	  char *include_directories, char *filenames, line_info_t *lines)
+{
+    int i;
+    for (i = 0; i < num_traces; i++) {
+	unsigned long a = (unsigned long)traces[i] - lines[i].base_addr;
+	/* We assume one line code doesn't result >100 bytes of native code.
+       We may want more reliable way eventually... */
+	if (addr < a && a < addr + 100) {
+	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    lines[i].line = line;
+	}
+    }
+}
+
+static void
+parse_debug_line_cu(int num_traces, void **traces,
+		    char **debug_line, line_info_t *lines)
+{
+    char *p, *cu_end, *cu_start, *include_directories, *filenames;
+    unsigned long unit_length;
+    int default_is_stmt, line_base;
+    unsigned int header_length, minimum_instruction_length, line_range,
+		 opcode_base;
+    unsigned char *standard_opcode_lengths;
+
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    unsigned int column = 0;
+    int is_stmt;
+    int basic_block = 0;
+    int end_sequence = 0;
+    int prologue_end = 0;
+    int epilogue_begin = 0;
+    unsigned int isa = 0;
+
+    p = *debug_line;
+
+    unit_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+    if (unit_length == 0xffffffff) {
+	unit_length = *(unsigned long *)p;
+	p += sizeof(unsigned long);
+    }
+
+    cu_end = p + unit_length;
+
+    /*dwarf_version = *(unsigned short *)p;*/
+    p += 2;
+
+    header_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+
+    cu_start = p + header_length;
+
+    minimum_instruction_length = *(unsigned char *)p;
+    p++;
+
+    is_stmt = default_is_stmt = *(unsigned char *)p;
+    p++;
+
+    line_base = *(char *)p;
+    p++;
+
+    line_range = *(unsigned char *)p;
+    p++;
+
+    opcode_base = *(unsigned char *)p;
+    p++;
+
+    standard_opcode_lengths = (unsigned char *)p - 1;
+    p += opcode_base - 1;
+
+    include_directories = p;
+
+    /* skip include directories */
+    while (*p) {
+	while (*p) p++;
+	p++;
+    }
+    p++;
+
+    filenames = p;
+
+    p = cu_start;
+
+#define FILL_LINE()						    \
+    do {							    \
+	fill_line(num_traces, traces, addr, file, line,		    \
+		  include_directories, filenames, lines);	    \
+	basic_block = prologue_end = epilogue_begin = 0;	    \
+    } while (0)
+
+    while (p < cu_end) {
+	unsigned long a;
+	unsigned char op = *p++;
+	switch (op) {
+	case DW_LNS_copy:
+	    FILL_LINE();
+	    break;
+	case DW_LNS_advance_pc:
+	    a = uleb128(&p);
+	    addr += a;
+	    break;
+	case DW_LNS_advance_line: {
+	    long a = sleb128(&p);
+	    line += a;
+	    break;
+	}
+	case DW_LNS_set_file:
+	    file = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_set_column:
+	    column = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_negate_stmt:
+	    is_stmt = !is_stmt;
+	    break;
+	case DW_LNS_set_basic_block:
+	    basic_block = 1;
+	    break;
+	case DW_LNS_const_add_pc:
+	    a = ((255 - opcode_base) / line_range) *
+		minimum_instruction_length;
+	    addr += a;
+	    break;
+	case DW_LNS_fixed_advance_pc:
+	    a = *(unsigned char *)p++;
+	    addr += a;
+	    break;
+	case DW_LNS_set_prologue_end:
+	    prologue_end = 1;
+	    break;
+	case DW_LNS_set_epilogue_begin:
+	    epilogue_begin = 1;
+	    break;
+	case DW_LNS_set_isa:
+	    isa = (unsigned int)uleb128(&p);
+	    break;
+	case 0:
+	    a = *(unsigned char *)p++;
+	    op = *p++;
+	    switch (op) {
+	    case DW_LNE_end_sequence:
+		end_sequence = 1;
+		FILL_LINE();
+		addr = 0;
+		file = 1;
+		line = 1;
+		column = 0;
+		is_stmt = default_is_stmt;
+		end_sequence = 0;
+		isa = 0;
+		break;
+	    case DW_LNE_set_address:
+		addr = *(unsigned long *)p;
+		p += sizeof(unsigned long);
+		break;
+	    case DW_LNE_define_file:
+		fprintf(stderr, "Unsupported operation in %s\n",
+			binary_filename);
+		break;
+	    case DW_LNE_set_discriminator:
+		/* TODO:currently ignore */
+		uleb128(&p);
+		break;
+	    default:
+		fprintf(stderr, "Unknown extended opcode: %d in %s\n",
+			op, binary_filename);
+	    }
+	    break;
+	default: {
+	    unsigned long addr_incr;
+	    unsigned long line_incr;
+	    a = op - opcode_base;
+	    addr_incr = (a / line_range) * minimum_instruction_length;
+	    line_incr = line_base + (a % line_range);
+	    addr += (unsigned int)addr_incr;
+	    line += (unsigned int)line_incr;
+	    FILL_LINE();
+	}
+	}
+    }
+    *debug_line = p;
+}
+
+static void
+parse_debug_line(int num_traces, void **traces,
+		 char *debug_line, unsigned long size, line_info_t *lines)
+{
+    char *debug_line_end = debug_line + size;
+    while (debug_line < debug_line_end) {
+	parse_debug_line_cu(num_traces, traces, &debug_line, lines);
+    }
+    if (debug_line != debug_line_end) {
+	fprintf(stderr, "Unexpected size of .debug_line in %s\n",
+		binary_filename);
+    }
+}
+
+/* read file and fill lines */
+static void
+fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
+	   line_info_t *current_line, line_info_t *lines);
+
+static void
+follow_debuglink(char *debuglink, int num_traces, void **traces, char **syms,
+		 line_info_t *current_line, line_info_t *lines)
+{
+    /* Ideally we should check 4 paths to follow gnu_debuglink,
+       but we handle only one case for now as this format is used
+       by some linux distributions. See GDB's info for detail. */
+    static const char global_debug_dir[] = "/usr/lib/debug";
+    char *p, *subdir;
+
+    p = strrchr(binary_filename, '/');
+    if (!p) {
+	return;
+    }
+    p[1] = '\0';
+
+    subdir = (char *)alloca(strlen(binary_filename) + 1);
+    strcpy(subdir, binary_filename);
+    strcpy(binary_filename, global_debug_dir);
+    strncat(binary_filename, subdir,
+	    PATH_MAX - strlen(binary_filename) - 1);
+    strncat(binary_filename, debuglink,
+	    PATH_MAX - strlen(binary_filename) - 1);
+
+    munmap(current_line->mapped, current_line->mapped_size);
+    close(current_line->fd);
+    fill_lines(num_traces, traces, syms, 0, current_line, lines);
+}
+
+/* read file and fill lines */
+static void
+fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
+	   line_info_t *current_line, line_info_t *lines)
+{
+    int i;
+    char *shstr;
+    char *section_name;
+    ElfW(Ehdr) *ehdr;
+    ElfW(Shdr) *shdr, *shstr_shdr;
+    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    int fd;
+    off_t filesize;
+    char *file;
+
+    fd = open(binary_filename, O_RDONLY);
+    if (fd < 0) {
+	return;
+    }
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+	int e = errno;
+	close(fd);
+	fprintf(stderr, "lseek: %s\n", strerror(e));
+	return;
+    }
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+	int e = errno;
+	close(fd);
+	fprintf(stderr, "mmap: %s\n", strerror(e));
+	return;
+    }
+
+    current_line->fd = fd;
+    current_line->mapped = file;
+    current_line->mapped_size = filesize;
+
+    for (i = 0; i < num_traces; i++) {
+	const char *path;
+	size_t len;
+	if (get_path_from_symbol(syms[i], &path, &len) &&
+		!strncmp(path, binary_filename, len)) {
+	    lines[i].line = -1;
+	}
+    }
+
+    ehdr = (ElfW(Ehdr) *)file;
+    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+    shstr_shdr = shdr + ehdr->e_shstrndx;
+    shstr = file + shstr_shdr->sh_offset;
+
+    for (i = 0; i < ehdr->e_shnum; i++) {
+	section_name = shstr + shdr[i].sh_name;
+	if (!strcmp(section_name, ".debug_line")) {
+	    debug_line_shdr = shdr + i;
+	    break;
+	} else if (!strcmp(section_name, ".gnu_debuglink")) {
+	    gnu_debuglink_shdr = shdr + i;
+	}
+    }
+
+    if (!debug_line_shdr) {
+	/* This file doesn't have .debug_line section,
+	   let's check .gnu_debuglink section instead. */
+	if (gnu_debuglink_shdr && check_debuglink) {
+	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+			     num_traces, traces, syms,
+			     current_line, lines);
+	}
+	return;
+    }
+
+    parse_debug_line(num_traces, traces,
+		     file + debug_line_shdr->sh_offset,
+		     debug_line_shdr->sh_size,
+		     lines);
+}
+
+#ifdef HAVE_DL_ITERATE_PHDR
+
+typedef struct {
+    int num_traces;
+    char **syms;
+    line_info_t *lines;
+} fill_base_addr_state_t;
+
+static int
+fill_base_addr(struct dl_phdr_info *info, size_t size, void *data)
+{
+    int i;
+    fill_base_addr_state_t *st = (fill_base_addr_state_t *)data;
+    for (i = 0; i < st->num_traces; i++) {
+	const char *path;
+	size_t len;
+	size_t name_len = strlen(info->dlpi_name);
+
+	if (get_path_from_symbol(st->syms[i], &path, &len) &&
+		(len == name_len || (len > name_len && path[len-name_len-1] == '/')) &&
+		!strncmp(path+len-name_len, info->dlpi_name, name_len)) {
+	    st->lines[i].base_addr = info->dlpi_addr;
+	}
+    }
+    return 0;
+}
+
+#endif /* HAVE_DL_ITERATE_PHDR */
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **trace, char **syms)
+{
+    int i;
+    /* async-signal unsafe */
+    line_info_t *lines = (line_info_t *)calloc(num_traces,
+					       sizeof(line_info_t));
+
+    /* Note that line info of shared objects might not be shown
+       if we don't have dl_iterate_phdr */
+#ifdef HAVE_DL_ITERATE_PHDR
+    fill_base_addr_state_t fill_base_addr_state;
+
+    fill_base_addr_state.num_traces = num_traces;
+    fill_base_addr_state.syms = syms;
+    fill_base_addr_state.lines = lines;
+    /* maybe async-signal unsafe */
+    dl_iterate_phdr(fill_base_addr, &fill_base_addr_state);
+#endif /* HAVE_DL_ITERATE_PHDR */
+
+    for (i = 0; i < num_traces; i++) {
+	const char *path;
+	size_t len;
+	if (lines[i].line) {
+	    continue;
+	}
+
+	if (!get_path_from_symbol(syms[i], &path, &len)) {
+	    continue;
+	}
+
+	strncpy(binary_filename, path, len);
+	binary_filename[len] = '\0';
+
+	fill_lines(num_traces, trace, syms, 1, &lines[i], lines);
+    }
+
+    /* fprintf may not be async-signal safe */
+    for (i = 0; i < num_traces; i++) {
+	line_info_t *line = &lines[i];
+
+	if (line->line > 0) {
+	    fprintf(stderr, "%s ", syms[i]);
+	    if (line->filename) {
+		if (line->dirname && line->dirname[0]) {
+		    fprintf(stderr, "%s/", line->dirname);
+		}
+		fprintf(stderr, "%s", line->filename);
+	    } else {
+		fprintf(stderr, "???");
+	    }
+	    fprintf(stderr, ":%d\n", line->line);
+	} else {
+	    fprintf(stderr, "%s\n", syms[i]);
+	}
+    }
+
+    for (i = 0; i < num_traces; i++) {
+	line_info_t *line = &lines[i];
+	if (line->fd) {
+	    munmap(line->mapped, line->mapped_size);
+	    close(line->fd);
+	}
+    }
+    free(lines);
+}
+
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..3782d89e07
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#ifdef USE_ELF
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, char **syms);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 503a7adba3..e427cb3320 100644
--- a/array.c
+++ b/array.c
@@ -3,29 +3,36 @@
   array.c -
 
   $Author$
-  $Date$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-2003 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
   Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
   Copyright (C) 2000  Information-technology Promotion Agency, Japan
 
 **********************************************************************/
 
-#include "ruby.h"
-#include "util.h"
-#include "st.h"
+#include "ruby/ruby.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "ruby/encoding.h"
+#include "internal.h"
+
+#ifndef ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include <assert.h>
+
+#define numberof(array) (int)(sizeof(array) / sizeof((array)[0]))
 
 VALUE rb_cArray;
+
 static ID id_cmp;
 
 #define ARY_DEFAULT_SIZE 16
-#define ARY_MAX_SIZE (LONG_MAX / sizeof(VALUE))
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
 
 void
-rb_mem_clear(mem, size)
-    register VALUE *mem;
-    register long size;
+rb_mem_clear(register VALUE *mem, register long size)
 {
     while (size--) {
 	*mem++ = Qnil;
@@ -33,134 +40,311 @@ rb_mem_clear(mem, size)
 }
 
 static inline void
-memfill(mem, size, val)
-    register VALUE *mem;
-    register long size;
-    register VALUE val;
+memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
 	*mem++ = val;
     }
 }
 
-#define ARY_TMPLOCK  FL_USER1
+# define ARY_SHARED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+    (assert(ARY_EMBED_P(a)), \
+     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+#define FL_SET_EMBED(a) do { \
+    assert(!ARY_SHARED_P(a)); \
+    assert(!OBJ_FROZEN(a)); \
+    FL_SET((a), RARRAY_EMBED_FLAG); \
+} while (0)
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+    long tmp_n = (n); \
+    assert(ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), (n)); \
+    } \
+    else { \
+        ARY_SET_HEAP_LEN((ary), (n)); \
+    } \
+    assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do  { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do  { \
+    assert(!OBJ_FROZEN(ary)); \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+    } \
+    else { \
+        RARRAY(ary)->as.heap.len += (n); \
+    } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_CAPA(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!ARY_SHARED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(ARY_SHARED_P(ary)); \
+    assert(ARY_SHARED_ROOT_P(value)); \
+    RARRAY(ary)->as.heap.aux.shared = (value); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+    assert(ARY_SHARED_ROOT_P(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+    assert(RARRAY_LEN(ary) <= capacity);
+    assert(!OBJ_FROZEN(ary));
+    assert(!ARY_SHARED_P(ary));
+    if (capacity > RARRAY_EMBED_LEN_MAX) {
+        if (ARY_EMBED_P(ary)) {
+            long len = ARY_EMBED_LEN(ary);
+            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+            FL_UNSET_EMBED(ary);
+            ARY_SET_PTR(ary, ptr);
+            ARY_SET_HEAP_LEN(ary, len);
+        }
+        else {
+            REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, (capacity));
+        }
+        ARY_SET_CAPA(ary, (capacity));
+    }
+    else {
+        if (!ARY_EMBED_P(ary)) {
+            long len = RARRAY_LEN(ary);
+            VALUE *ptr = RARRAY_PTR(ary);
+            if (len > capacity) len = capacity;
+            MEMCPY(RARRAY(ary)->as.ary, ptr, VALUE, len);
+            FL_SET_EMBED(ary);
+            ARY_SET_LEN(ary, len);
+            xfree(ptr);
+        }
+    }
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+    long new_capa = ARY_CAPA(ary) / 2;
+
+    if (new_capa < ARY_DEFAULT_SIZE) {
+	new_capa = ARY_DEFAULT_SIZE;
+    }
+    if (new_capa >= ARY_MAX_SIZE - min) {
+	new_capa = (ARY_MAX_SIZE - min) / 2;
+    }
+    new_capa += min;
+    ary_resize_capa(ary, new_capa);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared)
+{
+    if (shared) {
+	long num = ARY_SHARED_NUM(shared) - 1;
+	if (num == 0) {
+	    rb_ary_free(shared);
+	    rb_gc_force_recycle(shared);
+	}
+	else if (num > 0) {
+	    ARY_SET_SHARED_NUM(shared, num);
+	}
+    }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+    rb_ary_decrement_share(shared);
+    FL_UNSET_SHARED(ary);
+}
 
 static inline void
-rb_ary_modify_check(ary)
-    VALUE ary;
+rb_ary_unshare_safe(VALUE ary)
 {
-    if (OBJ_FROZEN(ary)) rb_error_frozen("array");
-    if (FL_TEST(ary, ARY_TMPLOCK))
-	rb_raise(rb_eRuntimeError, "can't modify array during iteration");
-    if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
-	rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+    }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared)
+{
+    long num = ARY_SHARED_NUM(shared);
+    if (num >= 0) {
+	ARY_SET_SHARED_NUM(shared, num + 1);
+    }
+    return shared;
 }
 
 static void
-rb_ary_modify(ary)
-    VALUE ary;
+rb_ary_set_shared(VALUE ary, VALUE shared)
 {
-    VALUE *ptr;
+    rb_ary_increment_share(shared);
+    FL_SET_SHARED(ary);
+    ARY_SET_SHARED(ary, shared);
+}
 
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+    rb_check_frozen(ary);
+    if (!OBJ_UNTRUSTED(ary) && rb_safe_level() >= 4)
+	rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
     rb_ary_modify_check(ary);
-    if (FL_TEST(ary, ELTS_SHARED)) {
-	ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
-	FL_UNSET(ary, ELTS_SHARED);
-	RARRAY(ary)->aux.capa = RARRAY(ary)->len;
-	MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-	RARRAY(ary)->ptr = ptr;
+    if (ARY_SHARED_P(ary)) {
+        long len = RARRAY_LEN(ary);
+        if (len <= RARRAY_EMBED_LEN_MAX) {
+            VALUE *ptr = ARY_HEAP_PTR(ary);
+            VALUE shared = ARY_SHARED(ary);
+            FL_UNSET_SHARED(ary);
+            FL_SET_EMBED(ary);
+            MEMCPY(ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared);
+            ARY_SET_EMBED_LEN(ary, len);
+        }
+        else {
+            VALUE *ptr = ALLOC_N(VALUE, len);
+            MEMCPY(ptr, RARRAY_PTR(ary), VALUE, len);
+            rb_ary_unshare(ary);
+            ARY_SET_CAPA(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
     }
 }
 
 VALUE
-rb_ary_freeze(ary)
-    VALUE ary;
+rb_ary_freeze(VALUE ary)
 {
     return rb_obj_freeze(ary);
 }
 
 /*
  *  call-seq:
- *     array.frozen?  -> true or false
+ *     ary.frozen?  -> true or false
  *
  *  Return <code>true</code> if this array is frozen (or temporarily frozen
  *  while being sorted).
  */
 
 static VALUE
-rb_ary_frozen_p(ary)
-    VALUE ary;
+rb_ary_frozen_p(VALUE ary)
 {
     if (OBJ_FROZEN(ary)) return Qtrue;
-    if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
     return Qfalse;
 }
 
-static VALUE ary_alloc _((VALUE));
 static VALUE
-ary_alloc(klass)
-    VALUE klass;
+ary_alloc(VALUE klass)
 {
     NEWOBJ(ary, struct RArray);
     OBJSETUP(ary, klass, T_ARRAY);
-
-    ary->len = 0;
-    ary->ptr = 0;
-    ary->aux.capa = 0;
+    FL_SET_EMBED((VALUE)ary);
+    ARY_SET_EMBED_LEN((VALUE)ary, 0);
 
     return (VALUE)ary;
 }
 
 static VALUE
-ary_new(klass, len)
-    VALUE klass;
-    long len;
+ary_new(VALUE klass, long capa)
 {
-    VALUE ary = ary_alloc(klass);
+    VALUE ary;
 
-    if (len < 0) {
+    if (capa < 0) {
 	rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
-    if (len > ARY_MAX_SIZE) {
+    if (capa > ARY_MAX_SIZE) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-    if (len == 0) len++;
-    RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
-    RARRAY(ary)->aux.capa = len;
+    ary = ary_alloc(klass);
+    if (capa > RARRAY_EMBED_LEN_MAX) {
+        FL_UNSET_EMBED(ary);
+        ARY_SET_PTR(ary, ALLOC_N(VALUE, capa));
+        ARY_SET_CAPA(ary, capa);
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
 
     return ary;
 }
 
 VALUE
-rb_ary_new2(len)
-    long len;
+rb_ary_new2(long capa)
 {
-    return ary_new(rb_cArray, len);
+    return ary_new(rb_cArray, capa);
 }
 
 
 VALUE
-rb_ary_new()
+rb_ary_new(void)
 {
-    return rb_ary_new2(ARY_DEFAULT_SIZE);
+    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
 }
 
-#ifdef HAVE_STDARG_PROTOTYPES
 #include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
 
 VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
 rb_ary_new3(long n, ...)
-#else
-rb_ary_new3(n, va_alist)
-    long n;
-    va_dcl
-#endif
 {
     va_list ar;
     VALUE ary;
@@ -168,63 +352,152 @@ rb_ary_new3(n, va_alist)
 
     ary = rb_ary_new2(n);
 
-    va_init_list(ar, n);
+    va_start(ar, n);
     for (i=0; i<n; i++) {
-	RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+	RARRAY_PTR(ary)[i] = va_arg(ar, VALUE);
     }
     va_end(ar);
 
-    RARRAY(ary)->len = n;
+    ARY_SET_LEN(ary, n);
     return ary;
 }
 
 VALUE
-rb_ary_new4(n, elts)
-    long n;
-    const VALUE *elts;
+rb_ary_new4(long n, const VALUE *elts)
 {
     VALUE ary;
 
     ary = rb_ary_new2(n);
     if (n > 0 && elts) {
-	MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+	MEMCPY(RARRAY_PTR(ary), elts, VALUE, n);
+	ARY_SET_LEN(ary, n);
     }
 
-    /* This assignment to len will be moved to the above "if" block in Ruby 1.9 */
-    RARRAY(ary)->len = n;
-
     return ary;
 }
 
 VALUE
-rb_assoc_new(car, cdr)
-    VALUE car, cdr;
+rb_ary_tmp_new(long capa)
 {
-    VALUE ary;
+    return ary_new(0, capa);
+}
 
-    ary = rb_ary_new2(2);
-    RARRAY(ary)->ptr[0] = car;
-    RARRAY(ary)->ptr[1] = cdr;
-    RARRAY(ary)->len = 2;
+void
+rb_ary_free(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	xfree(ARY_HEAP_PTR(ary));
+    }
+}
 
-    return ary;
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+    }
+    else {
+	return 0;
+    }
+}
+
+static inline void
+ary_discard(VALUE ary)
+{
+    rb_ary_free(ary);
+    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
 }
 
 static VALUE
-to_ary(ary)
-    VALUE ary;
+ary_make_shared(VALUE ary)
+{
+    assert(!ARY_EMBED_P(ary));
+    if (ARY_SHARED_P(ary)) {
+	return ARY_SHARED(ary);
+    }
+    else if (ARY_SHARED_ROOT_P(ary)) {
+	return ary;
+    }
+    else if (OBJ_FROZEN(ary)) {
+	ary_resize_capa(ary, ARY_HEAP_LEN(ary));
+	FL_SET_SHARED_ROOT(ary);
+	ARY_SET_SHARED_NUM(ary, 1);
+	return ary;
+    }
+    else {
+	NEWOBJ(shared, struct RArray);
+	OBJSETUP(shared, 0, T_ARRAY);
+        FL_UNSET_EMBED(shared);
+
+        ARY_SET_LEN((VALUE)shared, RARRAY_LEN(ary));
+        ARY_SET_PTR((VALUE)shared, RARRAY_PTR(ary));
+	FL_SET_SHARED_ROOT(shared);
+	ARY_SET_SHARED_NUM((VALUE)shared, 1);
+	FL_SET_SHARED(ary);
+	ARY_SET_SHARED(ary, (VALUE)shared);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
+    }
+}
+
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+    if (RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE subst = rb_ary_new2(RARRAY_LEN(ary));
+        MEMCPY(ARY_EMBED_PTR(subst), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
+        ARY_SET_EMBED_LEN(subst, RARRAY_LEN(ary));
+        return subst;
+    }
+    else {
+        return rb_ary_increment_share(ary_make_shared(ary));
+    }
+}
+
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+    return rb_ary_new3(2, car, cdr);
+}
+
+static VALUE
+to_ary(VALUE ary)
 {
     return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
 VALUE
-rb_check_array_type(ary)
-    VALUE ary;
+rb_check_array_type(VALUE ary)
 {
     return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
-static VALUE rb_ary_replace _((VALUE, VALUE));
+/*
+ *  call-seq:
+ *     Array.try_convert(obj) -> array or nil
+ *
+ *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
+ *  converted array or +nil+ if +obj+ cannot be converted for any reason.
+ *  This method can be used to check if an argument is an array.
+ *
+ *     Array.try_convert([1])   #=> [1]
+ *     Array.try_convert("1")   #=> nil
+ *
+ *     if tmp = Array.try_convert(arg)
+ *       # the argument is an array
+ *     elsif tmp = String.try_convert(arg)
+ *       # the argument is a string
+ *     end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+    return rb_check_array_type(ary);
+}
 
 /*
  *  call-seq:
@@ -232,56 +505,76 @@ static VALUE rb_ary_replace _((VALUE, VALUE));
  *     Array.new(array)
  *     Array.new(size) {|index| block }
  *
- *  Returns a new array. In the first form, the new array is
- *  empty. In the second it is created with _size_ copies of _obj_
- *  (that is, _size_ references to the same
- *  _obj_). The third form creates a copy of the array
- *  passed as a parameter (the array is generated by calling
- *  to_ary  on the parameter). In the last form, an array
- *  of the given size is created. Each element in this array is
- *  calculated by passing the element's index to the given block and
- *  storing the return value.
- *
- *     Array.new
- *     Array.new(2)
- *     Array.new(5, "A")
- * 
- *     # only one copy of the object is created
+ *  Returns a new array.
+ *
+ *  In the first form, if no arguments are sent, the new array will be empty.
+ *  When a +size+ and an optional +obj+ are sent, an array is created with
+ *  +size+ copies of +obj+.  Take notice that all elements will reference the
+ *  same object +obj+.
+ *
+ *  The second form creates a copy of the array passed as a parameter (the
+ *  array is generated by calling to_ary on the parameter).
+ *
+ *    first_array = ["Matz", "Guido"]
+ *
+ *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ *    first_array.equal? second_array       #=> false
+ *
+ *  In the last form, an array of the given size is created.  Each element in
+ *  this array is created by passing the element's index to the given block
+ *  and storing the return value.
+ *
+ *    Array.new(3){ |index| index ** 2 }
+ *    # => [0, 1, 4]
+ *
+ *  == Common gotchas
+ *
+ *  When sending the second parameter, the same object will be used as the
+ *  value for all the array elements:
+ *
  *     a = Array.new(2, Hash.new)
+ *     # => [{}, {}]
+ *
  *     a[0]['cat'] = 'feline'
- *     a
+ *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
  *     a[1]['cat'] = 'Felix'
- *     a
- * 
- *     # here multiple copies are created
+ *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ *  Since all the Array elements store the same hash, changes to one of them
+ *  will affect them all.
+ *
+ *  If multiple copies are what you want, you should use the block
+ *  version which uses the result of that block each time an element
+ *  of the array needs to be initialized:
+ *
  *     a = Array.new(2) { Hash.new }
  *     a[0]['cat'] = 'feline'
- *     a
- * 
- *     squares = Array.new(5) {|i| i*i}
- *     squares
- * 
- *     copy = Array.new(squares)
+ *     a # => [{"cat"=>"feline"}, {}]
+ *
  */
 
 static VALUE
-rb_ary_initialize(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 {
     long len;
     VALUE size, val;
 
     rb_ary_modify(ary);
-    if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
-	RARRAY(ary)->len = 0;
+    if (argc == 0) {
+	if (ARY_OWNS_HEAP_P(ary) && RARRAY_PTR(ary)) {
+	    xfree(RARRAY_PTR(ary));
+	}
+        rb_ary_unshare_safe(ary);
+        FL_SET_EMBED(ary);
+	ARY_SET_EMBED_LEN(ary, 0);
 	if (rb_block_given_p()) {
 	    rb_warning("given block not used");
 	}
 	return ary;
     }
-
+    rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
 	val = rb_check_array_type(size);
 	if (!NIL_P(val)) {
@@ -297,10 +590,8 @@ rb_ary_initialize(argc, argv, ary)
     if (len > ARY_MAX_SIZE) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-    if (len > RARRAY(ary)->aux.capa) {
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
-	RARRAY(ary)->aux.capa = len;
-    }
+    rb_ary_modify(ary);
+    ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
 	long i;
 
@@ -309,20 +600,19 @@ rb_ary_initialize(argc, argv, ary)
 	}
 	for (i=0; i<len; i++) {
 	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    RARRAY(ary)->len = i + 1;
+	    ARY_SET_LEN(ary, i + 1);
 	}
     }
     else {
-	memfill(RARRAY(ary)->ptr, len, val);
-	RARRAY(ary)->len = len;
+	memfill(RARRAY_PTR(ary), len, val);
+	ARY_SET_LEN(ary, len);
     }
-
     return ary;
 }
 
 
-/* 
-* Returns a new array populated with the given objects. 
+/*
+* Returns a new array populated with the given objects.
 *
 *   Array.[]( 1, 'a', /^A/ )
 *   Array[ 1, 'a', /^A/ ]
@@ -330,33 +620,25 @@ rb_ary_initialize(argc, argv, ary)
 */
 
 static VALUE
-rb_ary_s_create(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
 {
-    VALUE ary = ary_alloc(klass);
-
-    if (argc > 0) {
-	RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
-	MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+    VALUE ary = ary_new(klass, argc);
+    if (argc > 0 && argv) {
+        MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+        ARY_SET_LEN(ary, argc);
     }
-    RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
 
     return ary;
 }
 
 void
-rb_ary_store(ary, idx, val)
-    VALUE ary;
-    long idx;
-    VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
 {
     if (idx < 0) {
-	idx += RARRAY(ary)->len;
+	idx += RARRAY_LEN(ary);
 	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld out of array",
-		    idx - RARRAY(ary)->len);
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     idx - RARRAY_LEN(ary), -RARRAY_LEN(ary));
 	}
     }
     else if (idx >= ARY_MAX_SIZE) {
@@ -364,34 +646,87 @@ rb_ary_store(ary, idx, val)
     }
 
     rb_ary_modify(ary);
-    if (idx >= RARRAY(ary)->aux.capa) {
-	long new_capa = RARRAY(ary)->aux.capa / 2;
+    if (idx >= ARY_CAPA(ary)) {
+	ary_double_capa(ary, idx);
+    }
+    if (idx > RARRAY_LEN(ary)) {
+	rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary),
+		     idx-RARRAY_LEN(ary) + 1);
+    }
 
-	if (new_capa < ARY_DEFAULT_SIZE) {
-	    new_capa = ARY_DEFAULT_SIZE;
-	}
-	if (new_capa >= ARY_MAX_SIZE - idx) {
-	    new_capa = (ARY_MAX_SIZE - idx) / 2;
-	}
-	new_capa += idx;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
-	RARRAY(ary)->aux.capa = new_capa;
+    if (idx >= RARRAY_LEN(ary)) {
+	ARY_SET_LEN(ary, idx + 1);
     }
-    if (idx > RARRAY(ary)->len) {
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
-		     idx-RARRAY(ary)->len + 1);
+    RARRAY_PTR(ary)[idx] = val;
+}
+
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
+{
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
+
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+        VALUE result = ary_alloc(klass);
+        MEMCPY(ARY_EMBED_PTR(result), RARRAY_PTR(ary) + offset, VALUE, len);
+        ARY_SET_EMBED_LEN(result, len);
+        return result;
     }
+    else {
+        VALUE shared, result = ary_alloc(klass);
+        FL_UNSET_EMBED(result);
 
-    if (idx >= RARRAY(ary)->len) {
-	RARRAY(ary)->len = idx + 1;
+        shared = ary_make_shared(ary);
+        ARY_SET_PTR(result, RARRAY_PTR(ary));
+        ARY_SET_LEN(result, RARRAY_LEN(ary));
+        rb_ary_set_shared(result, shared);
+
+        ARY_INCREASE_PTR(result, offset);
+        ARY_SET_LEN(result, len);
+        return result;
+    }
+}
+
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+}
+
+enum ary_take_pos_flags
+{
+    ARY_TAKE_FIRST = 0,
+    ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last(int argc, VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    VALUE nv;
+    long n;
+    long offset = 0;
+
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    if (n > RARRAY_LEN(ary)) {
+	n = RARRAY_LEN(ary);
     }
-    RARRAY(ary)->ptr[idx] = val;
+    else if (n < 0) {
+	rb_raise(rb_eArgError, "negative array size");
+    }
+    if (last) {
+	offset = RARRAY_LEN(ary) - n;
+    }
+    return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
+static VALUE rb_ary_push_1(VALUE ary, VALUE item);
+
 /*
  *  call-seq:
- *     array << obj            -> array
- *  
+ *     ary << obj            -> ary
+ *
  *  Append---Pushes the given object on to the end of this array. This
  *  expression returns the array itself, so several appends
  *  may be chained together.
@@ -402,248 +737,262 @@ rb_ary_store(ary, idx, val)
  */
 
 VALUE
-rb_ary_push(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
+{
+    rb_ary_modify(ary);
+    return rb_ary_push_1(ary, item);
+}
+
+static VALUE
+rb_ary_push_1(VALUE ary, VALUE item)
 {
-    rb_ary_store(ary, RARRAY(ary)->len, item);
+    long idx = RARRAY_LEN(ary);
+
+    if (idx >= ARY_CAPA(ary)) {
+	ary_double_capa(ary, idx);
+    }
+    RARRAY_PTR(ary)[idx] = item;
+    ARY_SET_LEN(ary, idx + 1);
     return ary;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.push(obj, ... )   -> array
- *  
+ *     ary.push(obj, ... )   -> ary
+ *
  *  Append---Pushes the given object(s) on to the end of this array. This
  *  expression returns the array itself, so several appends
  *  may be chained together.
  *
  *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")  
+ *     a.push("d", "e", "f")
  *             #=> ["a", "b", "c", "d", "e", "f"]
  */
 
 static VALUE
-rb_ary_push_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
 {
+    rb_ary_modify(ary);
     while (argc--) {
-	rb_ary_push(ary, *argv++);
+	rb_ary_push_1(ary, *argv++);
     }
     return ary;
 }
 
+VALUE
+rb_ary_pop(VALUE ary)
+{
+    long n;
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) == 0) return Qnil;
+    if (ARY_OWNS_HEAP_P(ary) &&
+	RARRAY_LEN(ary) * 3 < ARY_CAPA(ary) &&
+	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+    {
+	ary_resize_capa(ary, RARRAY_LEN(ary) * 2);
+    }
+    n = RARRAY_LEN(ary)-1;
+    ARY_SET_LEN(ary, n);
+    return RARRAY_PTR(ary)[n];
+}
+
 /*
  *  call-seq:
- *     array.pop  -> obj or nil
- *  
- *  Removes the last element from <i>self</i> and returns it, or
+ *     ary.pop    -> obj or nil
+ *     ary.pop(n) -> new_ary
+ *
+ *  Removes the last element from +self+ and returns it, or
  *  <code>nil</code> if the array is empty.
- *     
- *     a = [ "a", "m", "z" ]
- *     a.pop   #=> "z"
- *     a       #=> ["a", "m"]
+ *
+ *  If a number _n_ is given, returns an array of the last n elements
+ *  (or less) just like <code>array.slice!(-n, n)</code> does.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.pop     #=> "d"
+ *     a.pop(2)  #=> ["b", "c"]
+ *     a         #=> ["a"]
  */
 
-VALUE
-rb_ary_pop(ary)
-    VALUE ary;
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
 {
-    rb_ary_modify_check(ary);
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (!FL_TEST(ary, ELTS_SHARED) &&
-	    RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
-	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
-	RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+    VALUE result;
+
+    if (argc == 0) {
+	return rb_ary_pop(ary);
     }
-    return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    return result;
 }
 
-static VALUE
-ary_make_shared(ary)
-    VALUE ary;
+VALUE
+rb_ary_shift(VALUE ary)
 {
-    if (!FL_TEST(ary, ELTS_SHARED)) {
-	NEWOBJ(shared, struct RArray);
-	OBJSETUP(shared, rb_cArray, T_ARRAY);
+    VALUE top;
 
-	shared->len = RARRAY(ary)->len;
-	shared->ptr = RARRAY(ary)->ptr;
-	shared->aux.capa = RARRAY(ary)->aux.capa;
-	RARRAY(ary)->aux.shared = (VALUE)shared;
-	FL_SET(ary, ELTS_SHARED);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) == 0) return Qnil;
+    top = RARRAY_PTR(ary)[0];
+    if (!ARY_SHARED_P(ary)) {
+	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+	    MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
+            ARY_INCREASE_LEN(ary, -1);
+	    return top;
+	}
+        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+	RARRAY_PTR(ary)[0] = Qnil;
+	ary_make_shared(ary);
     }
-    else {
-	return RARRAY(ary)->aux.shared;
+    else if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
+	RARRAY_PTR(ary)[0] = Qnil;
     }
+    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
+    ARY_INCREASE_LEN(ary, -1);
+
+    return top;
 }
 
 /*
  *  call-seq:
- *     array.shift   ->   obj or nil
- *  
- *  Returns the first element of <i>self</i> and removes it (shifting all
+ *     ary.shift    -> obj or nil
+ *     ary.shift(n) -> new_ary
+ *
+ *  Returns the first element of +self+ and removes it (shifting all
  *  other elements down by one). Returns <code>nil</code> if the array
  *  is empty.
- *     
+ *
+ *  If a number _n_ is given, returns an array of the first n elements
+ *  (or less) just like <code>array.slice!(0, n)</code> does.
+ *
  *     args = [ "-m", "-q", "filename" ]
- *     args.shift   #=> "-m"
- *     args         #=> ["-q", "filename"]
+ *     args.shift     #=> "-m"
+ *     args           #=> ["-q", "filename"]
+ *
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift(2)  #=> ["-m", "-q"]
+ *     args           #=> ["filename"]
  */
 
-VALUE
-rb_ary_shift(ary)
-    VALUE ary;
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE top;
+    VALUE result;
+    long n;
 
-    rb_ary_modify_check(ary);
-    if (RARRAY(ary)->len == 0) return Qnil;
-    top = RARRAY(ary)->ptr[0];
-    if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE && !FL_TEST(ary, ELTS_SHARED)) {
-	MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
-    }
-    else {
-	if (!FL_TEST(ary, ELTS_SHARED)) {
-	    RARRAY(ary)->ptr[0] = Qnil;
-	}
-	ary_make_shared(ary);
-	RARRAY(ary)->ptr++;		/* shift ptr */
+    if (argc == 0) {
+	return rb_ary_shift(ary);
     }
-    RARRAY(ary)->len--;
-
-    return top;
-}
 
-VALUE
-rb_ary_unshift(ary, item)
-    VALUE ary, item;
-{
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
-	long capa_inc = RARRAY(ary)->aux.capa / 2;
-	if (capa_inc < ARY_DEFAULT_SIZE) {
-	    capa_inc = ARY_DEFAULT_SIZE;
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    n = RARRAY_LEN(result);
+    if (ARY_SHARED_P(ary)) {
+	if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
+	    rb_mem_clear(RARRAY_PTR(ary), n);
 	}
-	RARRAY(ary)->aux.capa += capa_inc;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+        ARY_INCREASE_PTR(ary, n);
     }
+    else {
+	MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+n, VALUE, RARRAY_LEN(ary)-n);
+    }
+    ARY_INCREASE_LEN(ary, -n);
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-
-    RARRAY(ary)->len++;
-    RARRAY(ary)->ptr[0] = item;
-
-    return ary;
+    return result;
 }
 
 /*
  *  call-seq:
- *     array.unshift(obj, ...)  -> array
- *  
- *  Prepends objects to the front of <i>array</i>.
- *  other elements up one.
- *     
+ *     ary.unshift(obj, ...)  -> ary
+ *
+ *  Prepends objects to the front of +self+,
+ *  moving other elements upwards.
+ *
  *     a = [ "b", "c", "d" ]
  *     a.unshift("a")   #=> ["a", "b", "c", "d"]
  *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_unshift_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
-    long len = RARRAY(ary)->len;
+    long len;
 
+    rb_ary_modify(ary);
     if (argc == 0) return ary;
-
-    /* make rooms by setting the last item */
-    rb_ary_store(ary, len + argc - 1, Qnil);
+    if (ARY_CAPA(ary) <= (len = RARRAY_LEN(ary)) + argc) {
+	ary_double_capa(ary, len + argc);
+    }
 
     /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
-    MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
-    
+    MEMMOVE(RARRAY_PTR(ary) + argc, RARRAY_PTR(ary), VALUE, len);
+    MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+    ARY_INCREASE_LEN(ary, argc);
+
     return ary;
 }
 
+VALUE
+rb_ary_unshift(VALUE ary, VALUE item)
+{
+    return rb_ary_unshift_m(1,&item,ary);
+}
+
 /* faster version - use this if you don't need to treat negative offset */
 static inline VALUE
-rb_ary_elt(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_elt(VALUE ary, long offset)
 {
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (offset < 0 || RARRAY(ary)->len <= offset) {
+    if (RARRAY_LEN(ary) == 0) return Qnil;
+    if (offset < 0 || RARRAY_LEN(ary) <= offset) {
 	return Qnil;
     }
-    return RARRAY(ary)->ptr[offset];
+    return RARRAY_PTR(ary)[offset];
 }
 
 VALUE
-rb_ary_entry(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_entry(VALUE ary, long offset)
 {
     if (offset < 0) {
-	offset += RARRAY(ary)->len;
+	offset += RARRAY_LEN(ary);
     }
     return rb_ary_elt(ary, offset);
 }
 
-static VALUE
-rb_ary_subseq(ary, beg, len)
-    VALUE ary;
-    long beg, len;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
 {
-    VALUE klass, ary2, shared;
-    VALUE *ptr;
+    VALUE klass;
 
-    if (beg > RARRAY(ary)->len) return Qnil;
+    if (beg > RARRAY_LEN(ary)) return Qnil;
     if (beg < 0 || len < 0) return Qnil;
 
-    if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
-	len = RARRAY(ary)->len - beg;
-	if (len < 0)
-	    len = 0;
+    if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
+	len = RARRAY_LEN(ary) - beg;
     }
     klass = rb_obj_class(ary);
     if (len == 0) return ary_new(klass, 0);
 
-    shared = ary_make_shared(ary);
-    ptr = RARRAY(ary)->ptr;
-    ary2 = ary_alloc(klass);
-    RARRAY(ary2)->ptr = ptr + beg;
-    RARRAY(ary2)->len = len;
-    RARRAY(ary2)->aux.shared = shared;
-    FL_SET(ary2, ELTS_SHARED);
-
-    return ary2;
+    return ary_make_partial(ary, klass, beg, len);
 }
 
-/* 
+/*
  *  call-seq:
- *     array[index]                -> obj      or nil
- *     array[start, length]        -> an_array or nil
- *     array[range]                -> an_array or nil
- *     array.slice(index)          -> obj      or nil
- *     array.slice(start, length)  -> an_array or nil
- *     array.slice(range)          -> an_array or nil
+ *     ary[index]                -> obj     or nil
+ *     ary[start, length]        -> new_ary or nil
+ *     ary[range]                -> new_ary or nil
+ *     ary.slice(index)          -> obj     or nil
+ *     ary.slice(start, length)  -> new_ary or nil
+ *     ary.slice(range)          -> new_ary or nil
  *
  *  Element Reference---Returns the element at _index_,
  *  or returns a subarray starting at _start_ and
  *  continuing for _length_ elements, or returns a subarray
  *  specified by _range_.
  *  Negative indices count backward from the end of the
- *  array (-1 is the last element). Returns nil if the index
+ *  array (-1 is the last element). Returns +nil+ if the index
  *  (or starting index) are out of range.
  *
  *     a = [ "a", "b", "c", "d", "e" ]
@@ -662,22 +1011,16 @@ rb_ary_subseq(ary, beg, len)
  */
 
 VALUE
-rb_ary_aref(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aref(int argc, VALUE *argv, VALUE ary)
 {
     VALUE arg;
     long beg, len;
 
     if (argc == 2) {
-	if (SYMBOL_P(argv[0])) {
-	    rb_raise(rb_eTypeError, "Symbol as array index");
-	}
 	beg = NUM2LONG(argv[0]);
 	len = NUM2LONG(argv[1]);
 	if (beg < 0) {
-	    beg += RARRAY(ary)->len;
+	    beg += RARRAY_LEN(ary);
 	}
 	return rb_ary_subseq(ary, beg, len);
     }
@@ -689,11 +1032,8 @@ rb_ary_aref(argc, argv, ary)
     if (FIXNUM_P(arg)) {
 	return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    if (SYMBOL_P(arg)) {
-	rb_raise(rb_eTypeError, "Symbol as array index");
-    }
     /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
       case Qfalse:
 	break;
       case Qnil:
@@ -704,15 +1044,13 @@ rb_ary_aref(argc, argv, ary)
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
-/* 
+/*
  *  call-seq:
- *     array.at(index)   ->   obj  or nil
+ *     ary.at(index)   ->   obj  or nil
  *
  *  Returns the element at _index_. A
- *  negative index counts from the end of _self_.  Returns +nil+
+ *  negative index counts from the end of +self+.  Returns +nil+
  *  if the index is out of range. See also <code>Array#[]</code>.
- *  (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
- *  as it does not accept ranges and so on.)
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.at(0)     #=> "a"
@@ -720,101 +1058,75 @@ rb_ary_aref(argc, argv, ary)
  */
 
 static VALUE
-rb_ary_at(ary, pos)
-    VALUE ary, pos;
+rb_ary_at(VALUE ary, VALUE pos)
 {
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
 /*
  *  call-seq:
- *     array.first   ->   obj or nil
- *     array.first(n) -> an_array
+ *     ary.first     ->   obj or nil
+ *     ary.first(n)  ->   new_ary
  *
  *  Returns the first element, or the first +n+ elements, of the array.
  *  If the array is empty, the first form returns <code>nil</code>, and the
  *  second form returns an empty array.
  *
  *     a = [ "q", "r", "s", "t" ]
- *     a.first    #=> "q"
- *     a.first(1) #=> ["q"]
- *     a.first(3) #=> ["q", "r", "s"]
+ *     a.first     #=> "q"
+ *     a.first(2)  #=> ["q", "r"]
  */
 
 static VALUE
-rb_ary_first(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY(ary)->len == 0) return Qnil;
-	return RARRAY(ary)->ptr[0];
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_PTR(ary)[0];
     }
     else {
-	VALUE nv, result;
-	long n, i;
-
-	rb_scan_args(argc, argv, "01", &nv);
-	n = NUM2LONG(nv);
-	if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
-	result = rb_ary_new2(n);
-	for (i=0; i<n; i++) {
-	    rb_ary_push(result, RARRAY(ary)->ptr[i]);
-	}
-	return result;
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
 
 /*
  *  call-seq:
- *     array.last     ->  obj or nil
- *     array.last(n)  ->  an_array
- *  
- *  Returns the last element(s) of <i>self</i>. If the array is empty,
+ *     ary.last     ->  obj or nil
+ *     ary.last(n)  ->  new_ary
+ *
+ *  Returns the last element(s) of +self+. If the array is empty,
  *  the first form returns <code>nil</code>.
- *     
- *     [ "w", "x", "y", "z" ].last   #=> "z"
+ *
+ *     a = [ "w", "x", "y", "z" ]
+ *     a.last     #=> "z"
+ *     a.last(2)  #=> ["y", "z"]
  */
 
-static VALUE
-rb_ary_last(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+VALUE
+rb_ary_last(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY(ary)->len == 0) return Qnil;
-	return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_PTR(ary)[RARRAY_LEN(ary)-1];
     }
     else {
-	VALUE nv, result;
-	long n, i;
-
-	rb_scan_args(argc, argv, "01", &nv);
-	n = NUM2LONG(nv);
-	if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
-	result = rb_ary_new2(n);
-	for (i=RARRAY(ary)->len-n; n--; i++) {
-	    rb_ary_push(result, RARRAY(ary)->ptr[i]);
-	}
-	return result;
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *     array.fetch(index)                    -> obj
- *     array.fetch(index, default )          -> obj
- *     array.fetch(index) {|index| block }   -> obj
- *  
+ *     ary.fetch(index)                    -> obj
+ *     ary.fetch(index, default )          -> obj
+ *     ary.fetch(index) {|index| block }   -> obj
+ *
  *  Tries to return the element at position <i>index</i>. If the index
  *  lies outside the array, the first form throws an
  *  <code>IndexError</code> exception, the second form returns
  *  <i>default</i>, and the third form returns the value of invoking
  *  the block, passing in the index. Negative values of <i>index</i>
  *  count from the end of the array.
- *     
+ *
  *     a = [ 11, 22, 33, 44 ]
  *     a.fetch(1)               #=> 22
  *     a.fetch(-1)              #=> 44
@@ -823,10 +1135,7 @@ rb_ary_last(argc, argv, ary)
  */
 
 static VALUE
-rb_ary_fetch(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
 {
     VALUE pos, ifnone;
     long block_given;
@@ -840,40 +1149,61 @@ rb_ary_fetch(argc, argv, ary)
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY(ary)->len;
+	idx +=  RARRAY_LEN(ary);
     }
-    if (idx < 0 || RARRAY(ary)->len <= idx) {
+    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
 	if (block_given) return rb_yield(pos);
 	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld out of array", idx);
+	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
 	}
 	return ifnone;
     }
-    return RARRAY(ary)->ptr[idx];
+    return RARRAY_PTR(ary)[idx];
 }
 
 /*
  *  call-seq:
- *     array.index(obj)   ->  int or nil
- *  
- *  Returns the index of the first object in <i>self</i> such that is 
- *  <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- *  no match is found.
- *     
+ *     ary.index(obj)           ->  int or nil
+ *     ary.index {|item| block} ->  int or nil
+ *     ary.index                ->  an_enumerator
+ *
+ *  Returns the index of the first object in +self+ such that the object is
+ *  <code>==</code> to <i>obj</i>. If a block is given instead of an
+ *  argument, returns index of first object for which <em>block</em> is true.
+ *  Returns <code>nil</code> if no match is found.
+ *  See also <code>Array#rindex</code>.
+ *
+ *  If neither block nor argument is given, an enumerator is returned instead.
+ *
  *     a = [ "a", "b", "c" ]
- *     a.index("b")   #=> 1
- *     a.index("z")   #=> nil
+ *     a.index("b")        #=> 1
+ *     a.index("z")        #=> nil
+ *     a.index{|x|x=="b"}  #=> 1
+ *
+ *  This is an alias of <code>#find_index</code>.
  */
 
 static VALUE
-rb_ary_index(ary, val)
-    VALUE ary;
-    VALUE val;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
+    VALUE val;
     long i;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], val))
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
+		return LONG2NUM(i);
+	    }
+	}
+	return Qnil;
+    }
+    rb_scan_args(argc, argv, "1", &val);
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	if (rb_equal(RARRAY_PTR(ary)[i], val))
 	    return LONG2NUM(i);
     }
     return Qnil;
@@ -881,147 +1211,173 @@ rb_ary_index(ary, val)
 
 /*
  *  call-seq:
- *     array.rindex(obj)    ->  int or nil
- *  
- *  Returns the index of the last object in <i>array</i> 
- *  <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- *  no match is found.
- *     
+ *     ary.rindex(obj)           ->  int or nil
+ *     ary.rindex {|item| block} ->  int or nil
+ *     ary.rindex                ->  an_enumerator
+ *
+ *  Returns the index of the last object in +self+
+ *  <code>==</code> to <i>obj</i>. If a block is given instead of an
+ *  argument, returns index of first object for which <em>block</em> is
+ *  true, starting from the last object.
+ *  Returns <code>nil</code> if no match is found.
+ *  See also <code>Array#index</code>.
+ *
+ *  If neither block nor argument is given, an enumerator is returned instead.
+ *
  *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")   #=> 3
- *     a.rindex("z")   #=> nil
+ *     a.rindex("b")             #=> 3
+ *     a.rindex("z")             #=> nil
+ *     a.rindex { |x| x == "b" } #=> 3
  */
 
 static VALUE
-rb_ary_rindex(ary, val)
-    VALUE ary;
-    VALUE val;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
-    long i = RARRAY(ary)->len;
+    VALUE val;
+    long i = RARRAY_LEN(ary);
 
-    while (i--) {
-	if (i > RARRAY(ary)->len) {
-	    i = RARRAY(ary)->len;
-	    continue;
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	while (i--) {
+	    if (RTEST(rb_yield(RARRAY_PTR(ary)[i])))
+		return LONG2NUM(i);
+	    if (i > RARRAY_LEN(ary)) {
+		i = RARRAY_LEN(ary);
+	    }
 	}
-	if (rb_equal(RARRAY(ary)->ptr[i], val))
+	return Qnil;
+    }
+    rb_scan_args(argc, argv, "1", &val);
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    while (i--) {
+	if (rb_equal(RARRAY_PTR(ary)[i], val))
 	    return LONG2NUM(i);
+	if (i > RARRAY_LEN(ary)) {
+	    i = RARRAY_LEN(ary);
+	}
     }
     return Qnil;
 }
 
-/*
- *  call-seq:
- *     array.indexes( i1, i2, ... iN )   -> an_array
- *     array.indices( i1, i2, ... iN )   -> an_array
- *  
- *  Deprecated; use <code>Array#values_at</code>.
- */
-
-static VALUE
-rb_ary_indexes(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
-{
-    VALUE new_ary;
-    long i;
-
-    rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
-    new_ary = rb_ary_new2(argc);
-    for (i=0; i<argc; i++) {
-	rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
-    }
-
-    return new_ary;
-}
-
 VALUE
-rb_ary_to_ary(obj)
-    VALUE obj;
+rb_ary_to_ary(VALUE obj)
 {
-    if (TYPE(obj) == T_ARRAY) {
-	return obj;
-    }
-    if (rb_respond_to(obj, rb_intern("to_ary"))) {
-	return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
-    }
+    VALUE tmp = rb_check_array_type(obj);
+
+    if (!NIL_P(tmp)) return tmp;
     return rb_ary_new3(1, obj);
 }
 
 static void
-rb_ary_splice(ary, beg, len, rpl)
-    VALUE ary;
-    long beg, len;
-    VALUE rpl;
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
 {
     long rlen;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     if (beg < 0) {
-	beg += RARRAY(ary)->len;
+	beg += RARRAY_LEN(ary);
 	if (beg < 0) {
-	    beg -= RARRAY(ary)->len;
-	    rb_raise(rb_eIndexError, "index %ld out of array", beg);
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     beg - RARRAY_LEN(ary), -RARRAY_LEN(ary));
 	}
     }
-    if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
-	len = RARRAY(ary)->len - beg;
+    if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
+	len = RARRAY_LEN(ary) - beg;
     }
 
-    if (NIL_P(rpl)) {
+    if (rpl == Qundef) {
 	rlen = 0;
     }
     else {
 	rpl = rb_ary_to_ary(rpl);
-	rlen = RARRAY(rpl)->len;
+	rlen = RARRAY_LEN(rpl);
     }
     rb_ary_modify(ary);
-
-    if (beg >= RARRAY(ary)->len) {
+    if (beg >= RARRAY_LEN(ary)) {
 	if (beg > ARY_MAX_SIZE - rlen) {
 	    rb_raise(rb_eIndexError, "index %ld too big", beg);
 	}
 	len = beg + rlen;
-	if (len >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
-	    RARRAY(ary)->aux.capa = len;
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
 	}
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
+	rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), beg - RARRAY_LEN(ary));
 	if (rlen > 0) {
-	    MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+	    MEMCPY(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
 	}
-	RARRAY(ary)->len = len;
+	ARY_SET_LEN(ary, len);
     }
     else {
 	long alen;
 
-	if (beg + len > RARRAY(ary)->len) {
-	    len = RARRAY(ary)->len - beg;
-	}
-
-	alen = RARRAY(ary)->len + rlen - len;
-	if (alen >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
-	    RARRAY(ary)->aux.capa = alen;
+	alen = RARRAY_LEN(ary) + rlen - len;
+	if (alen >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, alen);
 	}
 
 	if (len != rlen) {
-	    MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
-		    VALUE, RARRAY(ary)->len - (beg + len));
-	    RARRAY(ary)->len = alen;
+	    MEMMOVE(RARRAY_PTR(ary) + beg + rlen, RARRAY_PTR(ary) + beg + len,
+		    VALUE, RARRAY_LEN(ary) - (beg + len));
+	    ARY_SET_LEN(ary, alen);
 	}
 	if (rlen > 0) {
-	    MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
 	}
     }
 }
 
-/* 
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary  an array
+ * \param len  new size
+ * \return     \a ary
+ * \post       the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+    long olen;
+
+    rb_ary_modify(ary);
+    olen = RARRAY_LEN(ary);
+    if (len == olen) return ary;
+    if (len > ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", len);
+    }
+    if (len > olen) {
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
+	}
+	rb_mem_clear(RARRAY_PTR(ary) + olen, len - olen);
+        ARY_SET_LEN(ary, len);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE tmp[RARRAY_EMBED_LEN_MAX];
+	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+	ary_discard(ary);
+	MEMCPY(ARY_EMBED_PTR(ary), tmp, VALUE, len);
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else {
+	if (olen > len + ARY_DEFAULT_SIZE) {
+	    REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len);
+	    ARY_SET_CAPA(ary, len);
+	}
+	ARY_SET_HEAP_LEN(ary, len);
+    }
+    return ary;
+}
+
+/*
  *  call-seq:
- *     array[index]         = obj                     ->  obj
- *     array[start, length] = obj or an_array or nil  ->  obj or an_array or nil
- *     array[range]         = obj or an_array or nil  ->  obj or an_array or nil
+ *     ary[index]         = obj                      ->  obj
+ *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
+ *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
  *
  *  Element Assignment---Sets the element at _index_,
  *  or replaces a subarray starting at _start_ and
@@ -1030,11 +1386,10 @@ rb_ary_splice(ary, beg, len, rpl)
  *  the current capacity of the array, the array grows
  *  automatically. A negative indices will count backward
  *  from the end of the array. Inserts elements if _length_ is
- *  zero. If +nil+ is used in the second and third form,
- *  deletes elements from _self_. An +IndexError+ is raised if a
- *  negative index points past the beginning of the array. See also
+ *  zero. An +IndexError+ is raised if a negative index points
+ *  past the beginning of the array. See also
  *  <code>Array#push</code>, and <code>Array#unshift</code>.
- * 
+ *
  *     a = Array.new
  *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
  *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -1042,38 +1397,31 @@ rb_ary_splice(ary, beg, len, rpl)
  *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
  *     a[0..2] = "A"               #=> ["A", "4"]
  *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A"]
+ *     a[1..-1] = nil              #=> ["A", nil]
+ *     a[1..-1] = []               #=> ["A"]
  */
 
 static VALUE
-rb_ary_aset(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
 
     if (argc == 3) {
-	if (SYMBOL_P(argv[0])) {
-	    rb_raise(rb_eTypeError, "Symbol as array index");
-	}
-	if (SYMBOL_P(argv[1])) {
-	    rb_raise(rb_eTypeError, "Symbol as subarray length");
-	}
-	rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
+	rb_ary_modify_check(ary);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	rb_ary_splice(ary, beg, len, argv[2]);
 	return argv[2];
     }
     if (argc != 2) {
 	rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
     }
+    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
 	offset = FIX2LONG(argv[0]);
 	goto fixnum;
     }
-    if (SYMBOL_P(argv[0])) {
-	rb_raise(rb_eTypeError, "Symbol as array index");
-    }
-    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
 	/* check if idx is Range */
 	rb_ary_splice(ary, beg, len, argv[1]);
 	return argv[1];
@@ -1087,31 +1435,29 @@ fixnum:
 
 /*
  *  call-seq:
- *     array.insert(index, obj...)  -> array
- *  
+ *     ary.insert(index, obj...)  -> ary
+ *
  *  Inserts the given values before the element with the given index
  *  (which may be negative).
- *     
+ *
  *     a = %w{ a b c d }
  *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
  *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
  */
 
 static VALUE
-rb_ary_insert(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 {
     long pos;
 
-    if (argc == 1) return ary;
     if (argc < 1) {
 	rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
     }
+    rb_ary_modify_check(ary);
+    if (argc == 1) return ary;
     pos = NUM2LONG(argv[0]);
     if (pos == -1) {
-	pos = RARRAY(ary)->len;
+	pos = RARRAY_LEN(ary);
     }
     if (pos < 0) {
 	pos++;
@@ -1122,53 +1468,61 @@ rb_ary_insert(argc, argv, ary)
 
 /*
  *  call-seq:
- *     array.each {|item| block }   ->   array
- *  
- *  Calls <i>block</i> once for each element in <i>self</i>, passing that
+ *     ary.each {|item| block }   -> ary
+ *     ary.each                   -> an_enumerator
+ *
+ *  Calls <i>block</i> once for each element in +self+, passing that
  *  element as a parameter.
- *     
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.each {|x| print x, " -- " }
- *     
+ *
  *  produces:
- *     
+ *
  *     a -- b -- c --
  */
 
 VALUE
-rb_ary_each(ary)
-    VALUE ary;
+rb_ary_each(VALUE array)
 {
     long i;
+    volatile VALUE ary = array;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	rb_yield(RARRAY(ary)->ptr[i]);
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_yield(RARRAY_PTR(ary)[i]);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.each_index {|index| block }  ->  array
- *  
+ *     ary.each_index {|index| block }  -> ary
+ *     ary.each_index                   -> an_enumerator
+ *
  *  Same as <code>Array#each</code>, but passes the index of the element
  *  instead of the element itself.
- *     
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *
  *     a = [ "a", "b", "c" ]
  *     a.each_index {|x| print x, " -- " }
- *     
+ *
  *  produces:
- *     
+ *
  *     0 -- 1 -- 2 --
  */
 
 static VALUE
-rb_ary_each_index(ary)
-    VALUE ary;
+rb_ary_each_index(VALUE ary)
 {
     long i;
+    RETURN_ENUMERATOR(ary, 0, 0);
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
+    for (i=0; i<RARRAY_LEN(ary); i++) {
 	rb_yield(LONG2NUM(i));
     }
     return ary;
@@ -1176,29 +1530,31 @@ rb_ary_each_index(ary)
 
 /*
  *  call-seq:
- *     array.reverse_each {|item| block } 
- *  
- *  Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
+ *     ary.reverse_each {|item| block }   -> ary
+ *     ary.reverse_each                   -> an_enumerator
+ *
+ *  Same as <code>Array#each</code>, but traverses +self+ in reverse
  *  order.
- *     
+ *
  *     a = [ "a", "b", "c" ]
  *     a.reverse_each {|x| print x, " " }
- *     
+ *
  *  produces:
- *     
+ *
  *     c b a
  */
 
 static VALUE
-rb_ary_reverse_each(ary)
-    VALUE ary;
+rb_ary_reverse_each(VALUE ary)
 {
-    long len = RARRAY(ary)->len;
+    long len;
 
+    RETURN_ENUMERATOR(ary, 0, 0);
+    len = RARRAY_LEN(ary);
     while (len--) {
-	rb_yield(RARRAY(ary)->ptr[len]);
-	if (RARRAY(ary)->len < len) {
-	    len = RARRAY(ary)->len;
+	rb_yield(RARRAY_PTR(ary)[len]);
+	if (RARRAY_LEN(ary) < len) {
+	    len = RARRAY_LEN(ary);
 	}
     }
     return ary;
@@ -1206,286 +1562,268 @@ rb_ary_reverse_each(ary)
 
 /*
  *  call-seq:
- *     array.length -> int
- *  
- *  Returns the number of elements in <i>self</i>. May be zero.
- *     
+ *     ary.length -> int
+ *
+ *  Returns the number of elements in +self+. May be zero.
+ *
  *     [ 1, 2, 3, 4, 5 ].length   #=> 5
  */
 
 static VALUE
-rb_ary_length(ary)
-    VALUE ary;
+rb_ary_length(VALUE ary)
 {
-    return LONG2NUM(RARRAY(ary)->len);
+    long len = RARRAY_LEN(ary);
+    return LONG2NUM(len);
 }
 
 /*
  *  call-seq:
- *     array.empty?   -> true or false
- *  
- *  Returns <code>true</code> if <i>self</i> array contains no elements.
- *     
+ *     ary.empty?   -> true or false
+ *
+ *  Returns <code>true</code> if +self+ contains no elements.
+ *
  *     [].empty?   #=> true
  */
 
 static VALUE
-rb_ary_empty_p(ary)
-    VALUE ary;
+rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0)
+    if (RARRAY_LEN(ary) == 0)
 	return Qtrue;
     return Qfalse;
 }
 
 VALUE
-rb_ary_dup(ary)
-    VALUE ary;
+rb_ary_dup(VALUE ary)
 {
-    VALUE dup = rb_ary_new2(RARRAY(ary)->len);
-
-    DUPSETUP(dup, ary);
-    MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-    RARRAY(dup)->len = RARRAY(ary)->len;
+    VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+    MEMCPY(RARRAY_PTR(dup), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
     return dup;
 }
 
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_PTR(ary));
+}
+
 extern VALUE rb_output_fs;
 
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
 static VALUE
-inspect_join(ary, arg)
-    VALUE ary;
-    VALUE *arg;
+recursive_join(VALUE obj, VALUE argp, int recur)
 {
-    return rb_ary_join(arg[0], arg[1]);
+    VALUE *arg = (VALUE *)argp;
+    VALUE ary = arg[0];
+    VALUE sep = arg[1];
+    VALUE result = arg[2];
+    int *first = (int *)arg[3];
+
+    if (recur) {
+	rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+	ary_join_1(obj, ary, sep, 0, result, first);
+    }
+    return Qnil;
 }
 
-VALUE
-rb_ary_join(ary, sep)
-    VALUE ary, sep;
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
-    long len = 1, i;
-    int taint = Qfalse;
-    VALUE result, tmp;
-
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
+    long i;
+    VALUE val;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
-	len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
-    }
-    if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
+    if (max > 0) rb_enc_copy(result, RARRAY_PTR(ary)[0]);
+    for (i=0; i<max; i++) {
+	val = RARRAY_PTR(ary)[i];
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, val);
+	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+	if (OBJ_UNTRUSTED(val)) OBJ_TAINT(result);
     }
-    result = rb_str_buf_new(len);
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	tmp = RARRAY(ary)->ptr[i];
-	switch (TYPE(tmp)) {
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+    VALUE val, tmp;
+
+    for (; i<RARRAY_LEN(ary); i++) {
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+
+	val = RARRAY_PTR(ary)[i];
+	switch (TYPE(val)) {
 	  case T_STRING:
+	  str_join:
+	    rb_str_buf_append(result, val);
+	    *first = FALSE;
 	    break;
 	  case T_ARRAY:
-	    if (rb_inspecting_p(tmp)) {
-		tmp = rb_str_new2("[...]");
+	    obj = val;
+	  ary_join:
+	    if (val == ary) {
+		rb_raise(rb_eArgError, "recursive array join");
 	    }
 	    else {
-		VALUE args[2];
+		VALUE args[4];
 
-		args[0] = tmp;
+		args[0] = val;
 		args[1] = sep;
-		tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+		args[2] = result;
+		args[3] = (VALUE)first;
+		rb_exec_recursive(recursive_join, obj, (VALUE)args);
 	    }
 	    break;
 	  default:
-	    tmp = rb_obj_as_string(tmp);
+	    tmp = rb_check_string_type(val);
+	    if (!NIL_P(tmp)) {
+		val = tmp;
+		goto str_join;
+	    }
+	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+	    if (!NIL_P(tmp)) {
+		obj = val;
+		val = tmp;
+		goto ary_join;
+	    }
+	    val = rb_obj_as_string(val);
+	    if (*first) {
+		rb_enc_copy(result, val);
+		*first = FALSE;
+	    }
+	    goto str_join;
 	}
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, tmp);
-	if (OBJ_TAINTED(tmp)) taint = Qtrue;
+    }
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+    long len = 1, i;
+    int taint = FALSE;
+    int untrust = FALSE;
+    VALUE val, tmp, result;
+
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+    if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = TRUE;
+    if (OBJ_UNTRUSTED(ary) || OBJ_UNTRUSTED(sep)) untrust = TRUE;
+
+    if (!NIL_P(sep)) {
+	StringValue(sep);
+	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	val = RARRAY_PTR(ary)[i];
+	tmp = rb_check_string_type(val);
+
+	if (NIL_P(tmp) || tmp != val) {
+	    int first;
+	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+	    rb_enc_associate(result, rb_usascii_encoding());
+	    if (taint) OBJ_TAINT(result);
+	    if (untrust) OBJ_UNTRUST(result);
+	    ary_join_0(ary, sep, i, result);
+	    first = i == 0;
+	    ary_join_1(ary, ary, sep, i, result, &first);
+	    return result;
+	}
+
+	len += RSTRING_LEN(tmp);
     }
 
+    result = rb_str_buf_new(len);
     if (taint) OBJ_TAINT(result);
+    if (untrust) OBJ_UNTRUST(result);
+    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
+
     return result;
 }
 
 /*
  *  call-seq:
- *     array.join(sep=$,)    -> str
- *  
+ *     ary.join(sep=$,)    -> str
+ *
  *  Returns a string created by converting each element of the array to
  *  a string, separated by <i>sep</i>.
- *     
+ *
  *     [ "a", "b", "c" ].join        #=> "abc"
  *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
  */
 
 static VALUE
-rb_ary_join_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
     rb_scan_args(argc, argv, "01", &sep);
     if (NIL_P(sep)) sep = rb_output_fs;
-    
-    return rb_ary_join(ary, sep);
-}
-
-/*
- *  call-seq:
- *     array.to_s -> string
- *  
- *  Returns _self_<code>.join</code>.
- *     
- *     [ "a", "e", "i", "o" ].to_s   #=> "aeio"
- *
- */
-
-VALUE
-rb_ary_to_s(ary)
-    VALUE ary;
-{
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    
-    return rb_ary_join(ary, rb_output_fs);
-}
-
-static ID inspect_key;
-
-struct inspect_arg {
-    VALUE (*func)();
-    VALUE arg1, arg2;
-};
-
-static VALUE
-inspect_call(arg)
-    struct inspect_arg *arg;
-{
-    return (*arg->func)(arg->arg1, arg->arg2);
-}
-
-static VALUE
-get_inspect_tbl(create)
-    int create;
-{
-    VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-
-    if (NIL_P(inspect_tbl)) {
-	if (create) {
-	  tbl_init:
-	    inspect_tbl = rb_ary_new();
-	    rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
-	}
-    }
-    else if (TYPE(inspect_tbl) != T_ARRAY) {
-	rb_warn("invalid inspect_tbl value");
-	if (create) goto tbl_init;
-	rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
-	return Qnil;
-    }
-    return inspect_tbl;
-}
-
-static VALUE
-inspect_ensure(obj)
-    VALUE obj;
-{
-    VALUE inspect_tbl;
-
-    inspect_tbl = get_inspect_tbl(Qfalse);
-    if (!NIL_P(inspect_tbl)) {
-	rb_ary_pop(inspect_tbl);
-    }
-    return 0;
-}
-
-VALUE
-rb_protect_inspect(func, obj, arg)
-    VALUE (*func)(ANYARGS);
-    VALUE obj, arg;
-{
-    struct inspect_arg iarg;
-    VALUE inspect_tbl;
-    VALUE id;
-
-    inspect_tbl = get_inspect_tbl(Qtrue);
-    id = rb_obj_id(obj);
-    if (rb_ary_includes(inspect_tbl, id)) {
-	return (*func)(obj, arg);
-    }
-    rb_ary_push(inspect_tbl, id);
-    iarg.func = func;
-    iarg.arg1 = obj;
-    iarg.arg2 = arg;
-
-    return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
-}
-
-VALUE
-rb_inspecting_p(obj)
-    VALUE obj;
-{
-    VALUE inspect_tbl;
 
-    inspect_tbl = get_inspect_tbl(Qfalse);
-    if (NIL_P(inspect_tbl)) return Qfalse;
-    return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
+    return rb_ary_join(ary, sep);
 }
 
 static VALUE
-inspect_ary(ary)
-    VALUE ary;
+inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
     int tainted = OBJ_TAINTED(ary);
+    int untrust = OBJ_UNTRUSTED(ary);
     long i;
     VALUE s, str;
 
+    if (recur) return rb_usascii_str_new_cstr("[...]");
     str = rb_str_buf_new2("[");
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	s = rb_inspect(RARRAY(ary)->ptr[i]);
-	if (OBJ_TAINTED(s)) tainted = Qtrue;
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	s = rb_inspect(RARRAY_PTR(ary)[i]);
+	if (OBJ_TAINTED(s)) tainted = TRUE;
+	if (OBJ_UNTRUSTED(s)) untrust = TRUE;
 	if (i > 0) rb_str_buf_cat2(str, ", ");
+	else rb_enc_copy(str, s);
 	rb_str_buf_append(str, s);
     }
     rb_str_buf_cat2(str, "]");
     if (tainted) OBJ_TAINT(str);
+    if (untrust) OBJ_UNTRUST(str);
     return str;
 }
 
 /*
  *  call-seq:
- *     array.inspect  -> string
+ *     ary.to_s -> string
+ *     ary.inspect  -> string
  *
- *  Create a printable version of <i>array</i>.
+ *  Creates a string representation of +self+.
  */
 
 static VALUE
-rb_ary_inspect(ary)
-    VALUE ary;
+rb_ary_inspect(VALUE ary)
+{
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+    return rb_exec_recursive(inspect_ary, ary, 0);
+}
+
+VALUE
+rb_ary_to_s(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
-    if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
-    return rb_protect_inspect(inspect_ary, ary, 0);
+    return rb_ary_inspect(ary);
 }
 
 /*
  *  call-seq:
- *     array.to_a     -> array
- *  
- *  Returns _self_. If called on a subclass of Array, converts
+ *     ary.to_a     -> ary
+ *
+ *  Returns +self+. If called on a subclass of Array, converts
  *  the receiver to an Array object.
  */
 
 static VALUE
-rb_ary_to_a(ary)
-    VALUE ary;
+rb_ary_to_a(VALUE ary)
 {
     if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY(ary)->len);
+	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
 	rb_ary_replace(dup, ary);
 	return dup;
     }
@@ -1494,267 +1832,448 @@ rb_ary_to_a(ary)
 
 /*
  *  call-seq:
- *     array.to_ary -> array
- *  
- *  Returns _self_.
+ *     ary.to_ary -> ary
+ *
+ *  Returns +self+.
  */
 
 static VALUE
-rb_ary_to_ary_m(ary)
-    VALUE ary;
+rb_ary_to_ary_m(VALUE ary)
 {
     return ary;
 }
 
+static void
+ary_reverse(p1, p2)
+    VALUE *p1, *p2;
+{
+    while (p1 < p2) {
+	VALUE tmp = *p1;
+	*p1++ = *p2;
+	*p2-- = tmp;
+    }
+}
+
 VALUE
-rb_ary_reverse(ary)
-    VALUE ary;
+rb_ary_reverse(VALUE ary)
 {
     VALUE *p1, *p2;
-    VALUE tmp;
 
     rb_ary_modify(ary);
-    if (RARRAY(ary)->len > 1) {
-	p1 = RARRAY(ary)->ptr;
-	p2 = p1 + RARRAY(ary)->len - 1;	/* points last item */
-
-	while (p1 < p2) {
-	    tmp = *p1;
-	    *p1++ = *p2;
-	    *p2-- = tmp;
-	}
+    if (RARRAY_LEN(ary) > 1) {
+	p1 = RARRAY_PTR(ary);
+	p2 = p1 + RARRAY_LEN(ary) - 1;	/* points last item */
+	ary_reverse(p1, p2);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.reverse!   -> array 
- *  
- *  Reverses _self_ in place.
- *     
+ *     ary.reverse!   -> ary
+ *
+ *  Reverses +self+ in place.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.reverse!       #=> ["c", "b", "a"]
  *     a                #=> ["c", "b", "a"]
  */
 
 static VALUE
-rb_ary_reverse_bang(ary)
-    VALUE ary;
+rb_ary_reverse_bang(VALUE ary)
 {
     return rb_ary_reverse(ary);
 }
 
 /*
  *  call-seq:
- *     array.reverse -> an_array
- *  
- *  Returns a new array containing <i>self</i>'s elements in reverse order.
- *     
+ *     ary.reverse -> new_ary
+ *
+ *  Returns a new array containing +self+'s elements in reverse order.
+ *
  *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
  *     [ 1 ].reverse               #=> [1]
  */
 
 static VALUE
-rb_ary_reverse_m(ary)
-    VALUE ary;
+rb_ary_reverse_m(VALUE ary)
 {
-    return rb_ary_reverse(rb_ary_dup(ary));
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+
+    if (len > 0) {
+	VALUE *p1 = RARRAY_PTR(ary);
+	VALUE *p2 = RARRAY_PTR(dup) + len - 1;
+	do *p2-- = *p1++; while (--len > 0);
+    }
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
+}
+
+static inline long
+rotate_count(long cnt, long len)
+{
+    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+}
+
+VALUE
+rb_ary_rotate(VALUE ary, long cnt)
+{
+    rb_ary_modify(ary);
+
+    if (cnt != 0) {
+	VALUE *ptr = RARRAY_PTR(ary);
+	long len = RARRAY_LEN(ary);
+
+	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+	    --len;
+	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+	    if (len > 0) ary_reverse(ptr, ptr + len);
+	    return ary;
+	}
+    }
+
+    return Qnil;
+}
+
+/*
+ *  call-seq:
+ *     ary.rotate!(cnt=1) -> ary
+ *
+ *  Rotates +self+ in place so that the element at +cnt+ comes first,
+ *  and returns +self+.  If +cnt+ is negative then it rotates in
+ *  the opposite direction.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate!        #=> ["b", "c", "d", "a"]
+ *     a                #=> ["b", "c", "d", "a"]
+ *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
+ *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
+ */
+
+static VALUE
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
+{
+    long n = 1;
+
+    switch (argc) {
+      case 1: n = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+    rb_ary_rotate(ary, n);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.rotate(cnt=1) -> new_ary
+ *
+ *  Returns new array by rotating +self+ so that the element at
+ *  +cnt+ in +self+ is the first element of the new array. If +cnt+
+ *  is negative then it rotates in the opposite direction.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate         #=> ["b", "c", "d", "a"]
+ *     a                #=> ["a", "b", "c", "d"]
+ *     a.rotate(2)      #=> ["c", "d", "a", "b"]
+ *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
+ */
+
+static VALUE
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE rotated, *ptr, *ptr2;
+    long len, cnt = 1;
+
+    switch (argc) {
+      case 1: cnt = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+
+    len = RARRAY_LEN(ary);
+    rotated = rb_ary_new2(len);
+    if (len > 0) {
+	cnt = rotate_count(cnt, len);
+	ptr = RARRAY_PTR(ary);
+	ptr2 = RARRAY_PTR(rotated);
+	len -= cnt;
+	MEMCPY(ptr2, ptr + cnt, VALUE, len);
+	MEMCPY(ptr2 + len, ptr, VALUE, cnt);
+    }
+    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+    return rotated;
 }
 
 struct ary_sort_data {
     VALUE ary;
-    VALUE *ptr;
-    long len;
+    int opt_methods;
+    int opt_inited;
 };
 
-static void
-ary_sort_check(data)
-    struct ary_sort_data *data;
+enum {
+    sort_opt_Fixnum,
+    sort_opt_String,
+    sort_optimizable_count
+};
+
+#define STRING_P(s) (TYPE(s) == T_STRING && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
+
+static VALUE
+sort_reentered(VALUE ary)
 {
-    if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
-	rb_raise(rb_eArgError, "array modified during sort");
+    if (RBASIC(ary)->klass) {
+	rb_raise(rb_eRuntimeError, "sort reentered");
     }
+    return Qnil;
 }
 
 static int
-sort_1(a, b, data)
-    VALUE *a, *b;
-    struct ary_sort_data *data;
+sort_1(const void *ap, const void *bp, void *dummy)
 {
-    VALUE retval = rb_yield_values(2, *a, *b);
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    n = rb_cmpint(retval, *a, *b);
-    ary_sort_check(data);
+    retval = rb_yield_values(2, a, b);
+    n = rb_cmpint(retval, a, b);
+    sort_reentered(data->ary);
     return n;
 }
 
 static int
-sort_2(ap, bp, data)
-    VALUE *ap, *bp;
-    struct ary_sort_data *data;
+sort_2(const void *ap, const void *bp, void *dummy)
 {
-    VALUE retval;
-    VALUE a = *ap, b = *bp;
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b)) {
+    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
 	if ((long)a > (long)b) return 1;
 	if ((long)a < (long)b) return -1;
 	return 0;
     }
-    if (TYPE(a) == T_STRING) {
-	if (TYPE(b) == T_STRING) return rb_str_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+	return rb_str_cmp(a, b);
     }
 
     retval = rb_funcall(a, id_cmp, 1, b);
     n = rb_cmpint(retval, a, b);
-    ary_sort_check(data);
+    sort_reentered(data->ary);
 
     return n;
 }
 
-static VALUE
-sort_internal(ary)
-    VALUE ary;
-{
-    struct ary_sort_data data;
-
-    data.ary = ary;
-    data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
-    qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
-	  rb_block_given_p()?sort_1:sort_2, &data);
-    return ary;
-}
-
-static VALUE
-sort_unlock(ary)
-    VALUE ary;
-{
-    FL_UNSET(ary, ARY_TMPLOCK);
-    return ary;
-}
-
 /*
  *  call-seq:
- *     array.sort!                   -> array
- *     array.sort! {| a,b | block }  -> array 
- *  
- *  Sorts _self_. Comparisons for
+ *     ary.sort!                   -> ary
+ *     ary.sort! {| a,b | block }  -> ary
+ *
+ *  Sorts +self+. Comparisons for
  *  the sort will be done using the <code><=></code> operator or using
  *  an optional code block. The block implements a comparison between
  *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
  *  <code>Enumerable#sort_by</code>.
- *     
+ *
  *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort! {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
-rb_ary_sort_bang(ary)
-    VALUE ary;
+rb_ary_sort_bang(VALUE ary)
 {
     rb_ary_modify(ary);
-    if (RARRAY(ary)->len > 1) {
-	FL_SET(ary, ARY_TMPLOCK);	/* prohibit modification during sort */
-	rb_ensure(sort_internal, ary, sort_unlock, ary);
+    assert(!ARY_SHARED_P(ary));
+    if (RARRAY_LEN(ary) > 1) {
+	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+	struct ary_sort_data data;
+
+	RBASIC(tmp)->klass = 0;
+	data.ary = tmp;
+	data.opt_methods = 0;
+	data.opt_inited = 0;
+	ruby_qsort(RARRAY_PTR(tmp), RARRAY_LEN(tmp), sizeof(VALUE),
+		   rb_block_given_p()?sort_1:sort_2, &data);
+
+        if (ARY_EMBED_P(tmp)) {
+            assert(ARY_EMBED_P(tmp));
+            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+                rb_ary_unshare(ary);
+            }
+            FL_SET_EMBED(ary);
+            MEMCPY(RARRAY_PTR(ary), ARY_EMBED_PTR(tmp), VALUE, ARY_EMBED_LEN(tmp));
+            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+        }
+        else {
+            assert(!ARY_EMBED_P(tmp));
+            if (ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+                assert(!ARY_EMBED_P(ary));
+                FL_UNSET_SHARED(ary);
+                ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+            }
+            else {
+                assert(!ARY_SHARED_P(tmp));
+                if (ARY_EMBED_P(ary)) {
+                    FL_UNSET_EMBED(ary);
+                }
+                else if (ARY_SHARED_P(ary)) {
+                    /* ary might be destructively operated in the given block */
+                    rb_ary_unshare(ary);
+                }
+                else {
+                    xfree(ARY_HEAP_PTR(ary));
+                }
+                ARY_SET_PTR(ary, RARRAY_PTR(tmp));
+                ARY_SET_HEAP_LEN(ary, RARRAY_LEN(tmp));
+                ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+            }
+            /* tmp was lost ownership for the ptr */
+            FL_UNSET(tmp, FL_FREEZE);
+            FL_SET_EMBED(tmp);
+            ARY_SET_EMBED_LEN(tmp, 0);
+            FL_SET(tmp, FL_FREEZE);
+	}
+        /* tmp will be GC'ed. */
+        RBASIC(tmp)->klass = rb_cArray;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.sort                   -> an_array 
- *     array.sort {| a,b | block }  -> an_array 
- *  
- *  Returns a new array created by sorting <i>self</i>. Comparisons for
+ *     ary.sort                   -> new_ary
+ *     ary.sort {| a,b | block }  -> new_ary
+ *
+ *  Returns a new array created by sorting +self+. Comparisons for
  *  the sort will be done using the <code><=></code> operator or using
  *  an optional code block. The block implements a comparison between
  *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
  *  <code>Enumerable#sort_by</code>.
- *     
+ *
  *     a = [ "d", "a", "e", "c", "b" ]
  *     a.sort                    #=> ["a", "b", "c", "d", "e"]
  *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
-rb_ary_sort(ary)
-    VALUE ary;
+rb_ary_sort(VALUE ary)
 {
     ary = rb_ary_dup(ary);
     rb_ary_sort_bang(ary);
     return ary;
 }
 
+
+static VALUE
+sort_by_i(VALUE i)
+{
+    return rb_yield(i);
+}
+
 /*
  *  call-seq:
- *     array.collect {|item| block }  -> an_array
- *     array.map     {|item| block }  -> an_array
- *  
- *  Invokes <i>block</i> once for each element of <i>self</i>. Creates a 
+ *     ary.sort_by! {| obj | block }    -> ary
+ *     ary.sort_by!                     -> an_enumerator
+ *
+ *  Sorts +self+ in place using a set of keys generated by mapping the
+ *  values in +self+ through the given block.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+    VALUE sorted;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rb_ary_modify(ary);
+    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+    rb_ary_replace(ary, sorted);
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.collect {|item| block }  -> new_ary
+ *     ary.map     {|item| block }  -> new_ary
+ *     ary.collect                  -> an_enumerator
+ *     ary.map                      -> an_enumerator
+ *
+ *  Invokes <i>block</i> once for each element of +self+. Creates a
  *  new array containing the values returned by the block.
  *  See also <code>Enumerable#collect</code>.
- *     
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
  *     a = [ "a", "b", "c", "d" ]
  *     a.collect {|x| x + "!" }   #=> ["a!", "b!", "c!", "d!"]
  *     a                          #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_collect(ary)
-    VALUE ary;
+rb_ary_collect(VALUE ary)
 {
     long i;
     VALUE collect;
 
-    if (!rb_block_given_p()) {
-	return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
-    }
-
-    collect = rb_ary_new2(RARRAY(ary)->len);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
+    RETURN_ENUMERATOR(ary, 0, 0);
+    collect = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_push(collect, rb_yield(RARRAY_PTR(ary)[i]));
     }
     return collect;
 }
 
-/* 
+
+/*
  *  call-seq:
- *     array.collect! {|item| block }   ->   array
- *     array.map!     {|item| block }   ->   array
+ *     ary.collect! {|item| block }   -> ary
+ *     ary.map!     {|item| block }   -> ary
+ *     ary.collect                    -> an_enumerator
+ *     ary.map                        -> an_enumerator
  *
- *  Invokes the block once for each element of _self_, replacing the
+ *  Invokes the block once for each element of +self+, replacing the
  *  element with the value returned by _block_.
  *  See also <code>Enumerable#collect</code>.
- *   
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
  *     a = [ "a", "b", "c", "d" ]
  *     a.collect! {|x| x + "!" }
  *     a             #=>  [ "a!", "b!", "c!", "d!" ]
  */
 
 static VALUE
-rb_ary_collect_bang(ary)
-    VALUE ary;
+rb_ary_collect_bang(VALUE ary)
 {
     long i;
 
+    RETURN_ENUMERATOR(ary, 0, 0);
     rb_ary_modify(ary);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_store(ary, i, rb_yield(RARRAY_PTR(ary)[i]));
     }
     return ary;
 }
 
 VALUE
-rb_values_at(obj, olen, argc, argv, func)
-    VALUE obj;
-    long olen;
-    int argc;
-    VALUE *argv;
-    VALUE (*func) _((VALUE,long));
+rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VALUE, long))
 {
     VALUE result = rb_ary_new2(argc);
     long beg, len, i, j;
@@ -1781,15 +2300,15 @@ rb_values_at(obj, olen, argc, argv, func)
     return result;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.values_at(selector,... )  -> an_array
+ *     ary.values_at(selector,... )  -> new_ary
  *
  *  Returns an array containing the elements in
- *  _self_ corresponding to the given selector(s). The selectors
- *  may be either integer indices or ranges. 
+ *  +self+ corresponding to the given selector(s). The selectors
+ *  may be either integer indices or ranges.
  *  See also <code>Array#select</code>.
- * 
+ *
  *     a = %w{ a b c d e f }
  *     a.values_at(1, 3, 5)
  *     a.values_at(1, 3, 5, 7)
@@ -1798,36 +2317,37 @@ rb_values_at(obj, olen, argc, argv, func)
  */
 
 static VALUE
-rb_ary_values_at(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
+    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
 }
 
+
 /*
  *  call-seq:
- *     array.select {|item| block } -> an_array
- *  
- *  Invokes the block passing in successive elements from <i>array</i>,
+ *     ary.select {|item| block } -> new_ary
+ *     ary.select                 -> an_enumerator
+ *
+ *  Invokes the block passing in successive elements from +self+,
  *  returning an array containing those elements for which the block
  *  returns a true value (equivalent to <code>Enumerable#select</code>).
- *     
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
  *     a = %w{ a b c d e f }
  *     a.select {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
  */
 
 static VALUE
-rb_ary_select(ary)
-    VALUE ary;
+rb_ary_select(VALUE ary)
 {
     VALUE result;
     long i;
 
-    result = rb_ary_new2(RARRAY(ary)->len);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
+    RETURN_ENUMERATOR(ary, 0, 0);
+    result = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
 	    rb_ary_push(result, rb_ary_elt(ary, i));
 	}
     }
@@ -1836,14 +2356,76 @@ rb_ary_select(ary)
 
 /*
  *  call-seq:
- *     array.delete(obj)            -> obj or nil 
- *     array.delete(obj) { block }  -> obj or nil
- *  
- *  Deletes items from <i>self</i> that are equal to <i>obj</i>. If
+ *     ary.select! {|item| block } -> ary or nil
+ *     ary.select!                 -> an_enumerator
+ *
+ *  Invokes the block passing in successive elements from
+ *  +self+, deleting elements for which the block returns a
+ *  false value. It returns +self+ if changes were made,
+ *  otherwise it returns <code>nil</code>.
+ *  See also <code>Array#keep_if</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+    long i1, i2;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rb_ary_modify(ary);
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE v = RARRAY_PTR(ary)[i1];
+	if (!RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	i2++;
+    }
+
+    if (RARRAY_LEN(ary) == i2) return Qnil;
+    if (i2 < RARRAY_LEN(ary))
+	ARY_SET_LEN(ary, i2);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.keep_if {|item| block } -> ary
+ *     ary.keep_if                 -> an_enumerator
+ *
+ *  Deletes every element of +self+ for which <i>block</i> evaluates
+ *  to false.
+ *  See also <code>Array#select!</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.keep_if {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rb_ary_select_bang(ary);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.delete(obj)            -> obj or nil
+ *     ary.delete(obj) { block }  -> obj or nil
+ *
+ *  Deletes items from +self+ that are equal to <i>obj</i>.
+ *  If any items are found, returns <i>obj</i>.   If
  *  the item is not found, returns <code>nil</code>. If the optional
  *  code block is given, returns the result of <i>block</i> if the item
- *  is not found.
- *     
+ *  is not found.  (To remove <code>nil</code> elements and
+ *  get an informative return value, use #compact!)
+ *
  *     a = [ "a", "b", "b", "b", "c" ]
  *     a.delete("b")                   #=> "b"
  *     a                               #=> ["a", "c"]
@@ -1852,22 +2434,24 @@ rb_ary_select(ary)
  */
 
 VALUE
-rb_ary_delete(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
 {
+    VALUE v = item;
     long i1, i2;
 
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	VALUE e = RARRAY(ary)->ptr[i1];
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE e = RARRAY_PTR(ary)[i1];
 
-	if (rb_equal(e, item)) continue;
+	if (rb_equal(e, item)) {
+	    v = e;
+	    continue;
+	}
 	if (i1 != i2) {
 	    rb_ary_store(ary, i2, e);
 	}
 	i2++;
     }
-    if (RARRAY(ary)->len == i2) {
+    if (RARRAY_LEN(ary) == i2) {
 	if (rb_block_given_p()) {
 	    return rb_yield(item);
 	}
@@ -1875,24 +2459,21 @@ rb_ary_delete(ary, item)
     }
 
     rb_ary_modify(ary);
-    if (RARRAY(ary)->len > i2) {
-	RARRAY(ary)->len = i2;
-	if (i2 * 2 < RARRAY(ary)->aux.capa &&
-	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
-	    RARRAY(ary)->aux.capa = i2 * 2;
+    if (RARRAY_LEN(ary) > i2) {
+	ARY_SET_LEN(ary, i2);
+	if (i2 * 2 < ARY_CAPA(ary) &&
+	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+	    ary_resize_capa(ary, i2*2);
 	}
     }
 
-    return item;
+    return v;
 }
 
 VALUE
-rb_ary_delete_at(ary, pos)
-    VALUE ary;
-    long pos;
+rb_ary_delete_at(VALUE ary, long pos)
 {
-    long i, len = RARRAY(ary)->len;
+    long len = RARRAY_LEN(ary);
     VALUE del;
 
     if (pos >= len) return Qnil;
@@ -1902,23 +2483,22 @@ rb_ary_delete_at(ary, pos)
     }
 
     rb_ary_modify(ary);
-    del = RARRAY(ary)->ptr[pos];
-    for (i = pos + 1; i < len; i++, pos++) {
-	RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
-    }
-    RARRAY(ary)->len = pos;
+    del = RARRAY_PTR(ary)[pos];
+    MEMMOVE(RARRAY_PTR(ary)+pos, RARRAY_PTR(ary)+pos+1, VALUE,
+	    RARRAY_LEN(ary)-pos-1);
+    ARY_INCREASE_LEN(ary, -1);
 
     return del;
 }
 
 /*
  *  call-seq:
- *     array.delete_at(index)  -> obj or nil
- *  
+ *     ary.delete_at(index)  -> obj or nil
+ *
  *  Deletes the element at the specified index, returning that element,
  *  or <code>nil</code> if the index is out of range. See also
  *  <code>Array#slice!</code>.
- *     
+ *
  *     a = %w( ant bat cat dog )
  *     a.delete_at(2)    #=> "cat"
  *     a                 #=> ["ant", "bat", "dog"]
@@ -1926,28 +2506,21 @@ rb_ary_delete_at(ary, pos)
  */
 
 static VALUE
-rb_ary_delete_at_m(ary, pos)
-    VALUE ary, pos;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
 {
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
 /*
  *  call-seq:
- *     array.slice!(index)         -> obj or nil
- *     array.slice!(start, length) -> sub_array or nil
- *     array.slice!(range)         -> sub_array or nil 
- *  
+ *     ary.slice!(index)         -> obj or nil
+ *     ary.slice!(start, length) -> new_ary or nil
+ *     ary.slice!(range)         -> new_ary or nil
+ *
  *  Deletes the element(s) given by an index (optionally with a length)
- *  or by a range. Returns the deleted object, subarray, or
- *  <code>nil</code> if the index is out of range. Equivalent to:
- *     
- *     def slice!(*args)
- *       result = self[*args]
- *       self[*args] = nil
- *       result
- *     end
- *     
+ *  or by a range. Returns the deleted object (or objects), or
+ *  <code>nil</code> if the index is out of range.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.slice!(1)     #=> "b"
  *     a               #=> ["a", "c"]
@@ -1958,194 +2531,269 @@ rb_ary_delete_at_m(ary, pos)
  */
 
 static VALUE
-rb_ary_slice_bang(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
     VALUE arg1, arg2;
-    long pos, len;
+    long pos, len, orig_len;
 
-    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
-	pos = NUM2LONG(arg1);
-	len = NUM2LONG(arg2);
+    rb_ary_modify_check(ary);
+    if (argc == 2) {
+	pos = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
       delete_pos_len:
+	if (len < 0) return Qnil;
+	orig_len = RARRAY_LEN(ary);
 	if (pos < 0) {
-	    pos = RARRAY(ary)->len + pos;
+	    pos += orig_len;
+	    if (pos < 0) return Qnil;
+	}
+	else if (orig_len < pos) return Qnil;
+	if (orig_len < pos + len) {
+	    len = orig_len - pos;
 	}
-	arg2 = rb_ary_subseq(ary, pos, len);
-	rb_ary_splice(ary, pos, len, Qnil);	/* Qnil/rb_ary_new2(0) */
+	if (len == 0) return rb_ary_new2(0);
+	arg2 = rb_ary_new4(len, RARRAY_PTR(ary)+pos);
+	RBASIC(arg2)->klass = rb_obj_class(ary);
+	rb_ary_splice(ary, pos, len, Qundef);
 	return arg2;
     }
 
-    if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
-	goto delete_pos_len;
+    if (argc != 1) {
+	/* error report */
+	rb_scan_args(argc, argv, "11", NULL, NULL);
+    }
+    arg1 = argv[0];
+
+    if (!FIXNUM_P(arg1)) {
+	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+	  case Qtrue:
+	    /* valid range */
+	    goto delete_pos_len;
+	  case Qnil:
+	    /* invalid range */
+	    return Qnil;
+	  default:
+	    /* not a range */
+	    break;
+	}
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
-/*
- *  call-seq:
- *     array.reject! {|item| block }  -> array or nil
- *  
- *  Equivalent to <code>Array#delete_if</code>, deleting elements from
- *  _self_ for which the block evaluates to true, but returns
- *  <code>nil</code> if no changes were made. Also see
- *  <code>Enumerable#reject</code>.
- */
+static VALUE
+ary_reject(VALUE orig, VALUE result)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(orig); i++) {
+	VALUE v = RARRAY_PTR(orig)[i];
+	if (!RTEST(rb_yield(v))) {
+	    rb_ary_push_1(result, v);
+	}
+    }
+    return result;
+}
 
 static VALUE
-rb_ary_reject_bang(ary)
-    VALUE ary;
+ary_reject_bang(VALUE ary)
 {
-    long i1, i2;
+    long i;
+    VALUE result = Qnil;
 
-    rb_ary_modify(ary);
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	VALUE v = RARRAY(ary)->ptr[i1];
-	if (RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
+    rb_ary_modify_check(ary);
+    for (i = 0; i < RARRAY_LEN(ary); ) {
+	VALUE v = RARRAY_PTR(ary)[i];
+	if (RTEST(rb_yield(v))) {
+	    rb_ary_delete_at(ary, i);
+	    result = ary;
+	}
+	else {
+	    i++;
 	}
-	i2++;
     }
-    if (RARRAY(ary)->len == i2) return Qnil;
-    if (i2 < RARRAY(ary)->len)
-	RARRAY(ary)->len = i2;
+    return result;
+}
 
-    return ary;
+/*
+ *  call-seq:
+ *     ary.reject! {|item| block }  -> ary or nil
+ *     ary.reject!                  -> an_enumerator
+ *
+ *  Equivalent to <code>Array#delete_if</code>, deleting elements from
+ *  +self+ for which the block evaluates to true, but returns
+ *  <code>nil</code> if no changes were made.
+ *  The array is changed instantly every time the block is called and
+ *  not after the iteration is over.
+ *  See also <code>Enumerable#reject</code> and <code>Array#delete_if</code>.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_reject_bang(VALUE ary)
+{
+    RETURN_ENUMERATOR(ary, 0, 0);
+    return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *     array.reject {|item| block }  -> an_array
- *  
- *  Returns a new array containing the items in _self_
+ *     ary.reject {|item| block }  -> new_ary
+ *     ary.reject                  -> an_enumerator
+ *
+ *  Returns a new array containing the items in +self+
  *  for which the block is not true.
+ *  See also <code>Array#delete_if</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
  */
 
 static VALUE
-rb_ary_reject(ary)
-    VALUE ary;
+rb_ary_reject(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_reject_bang(ary);
-    return ary;
+    VALUE rejected_ary;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rejected_ary = rb_ary_new();
+    ary_reject(ary, rejected_ary);
+    return rejected_ary;
 }
 
 /*
  *  call-seq:
- *     array.delete_if {|item| block }  -> array
- *  
- *  Deletes every element of <i>self</i> for which <i>block</i> evaluates
- *  to <code>true</code>.
- *     
+ *     ary.delete_if {|item| block }  -> ary
+ *     ary.delete_if                  -> an_enumerator
+ *
+ *  Deletes every element of +self+ for which <i>block</i> evaluates
+ *  to true.
+ *  The array is changed instantly every time the block is called and
+ *  not after the iteration is over.
+ *  See also <code>Array#reject!</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.delete_if {|x| x >= "b" }   #=> ["a"]
  */
 
 static VALUE
-rb_ary_delete_if(ary)
-    VALUE ary;
+rb_ary_delete_if(VALUE ary)
 {
-    rb_ary_reject_bang(ary);
+    RETURN_ENUMERATOR(ary, 0, 0);
+    ary_reject_bang(ary);
     return ary;
 }
 
+static VALUE
+take_i(VALUE val, VALUE *args, int argc, VALUE *argv)
+{
+    if (args[1]-- == 0) rb_iter_break();
+    if (argc > 1) val = rb_ary_new4(argc, argv);
+    rb_ary_push(args[0], val);
+    return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+    VALUE result = rb_check_array_type(obj);
+    VALUE args[2];
+
+    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+    result = rb_ary_new2(n);
+    args[0] = result; args[1] = (VALUE)n;
+    rb_block_call(obj, rb_intern("each"), 0, 0, take_i, (VALUE)args);
+    return result;
+}
+
+
 /*
  *  call-seq:
- *     array.zip(arg, ...)                   -> an_array
- *     array.zip(arg, ...) {| arr | block }  -> nil
- *  
+ *     ary.zip(arg, ...)                   -> new_ary
+ *     ary.zip(arg, ...) {| arr | block }  -> nil
+ *
  *  Converts any arguments to arrays, then merges elements of
- *  <i>self</i> with corresponding elements from each argument. This
+ *  +self+ with corresponding elements from each argument. This
  *  generates a sequence of <code>self.size</code> <em>n</em>-element
  *  arrays, where <em>n</em> is one more that the count of arguments. If
  *  the size of any argument is less than <code>enumObj.size</code>,
- *  <code>nil</code> values are supplied. If a block given, it is
+ *  <code>nil</code> values are supplied. If a block is given, it is
  *  invoked for each output array, otherwise an array of arrays is
  *  returned.
- *     
+ *
  *     a = [ 4, 5, 6 ]
  *     b = [ 7, 8, 9 ]
- *     
  *     [1,2,3].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
  *     [1,2].zip(a,b)         #=> [[1, 4, 7], [2, 5, 8]]
  *     a.zip([1,2],[8])       #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
  */
 
 static VALUE
-rb_ary_zip(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 {
     int i, j;
     long len;
-    VALUE result;
+    VALUE result = Qnil;
 
+    len = RARRAY_LEN(ary);
     for (i=0; i<argc; i++) {
-	argv[i] = to_ary(argv[i]);
+	argv[i] = take_items(argv[i], len);
     }
-    if (rb_block_given_p()) {
-	for (i=0; i<RARRAY(ary)->len; i++) {
-	    VALUE tmp = rb_ary_new2(argc+1);
-
-	    rb_ary_push(tmp, rb_ary_elt(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	    }
-	    rb_yield(tmp);
-	}
-	return Qnil;
+    if (!rb_block_given_p()) {
+	result = rb_ary_new2(len);
     }
-    len = RARRAY(ary)->len;
-    result = rb_ary_new2(len);
-    for (i=0; i<len; i++) {
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
 	VALUE tmp = rb_ary_new2(argc+1);
 
 	rb_ary_push(tmp, rb_ary_elt(ary, i));
 	for (j=0; j<argc; j++) {
 	    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
 	}
-	rb_ary_push(result, tmp);
+	if (NIL_P(result)) {
+	    rb_yield(tmp);
+	}
+	else {
+	    rb_ary_push(result, tmp);
+	}
     }
     return result;
 }
 
 /*
  *  call-seq:
- *     array.transpose -> an_array
- *  
- *  Assumes that <i>self</i> is an array of arrays and transposes the
+ *     ary.transpose -> new_ary
+ *
+ *  Assumes that +self+ is an array of arrays and transposes the
  *  rows and columns.
- *     
+ *
  *     a = [[1,2], [3,4], [5,6]]
  *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
  */
 
 static VALUE
-rb_ary_transpose(ary)
-    VALUE ary;
+rb_ary_transpose(VALUE ary)
 {
     long elen = -1, alen, i, j;
     VALUE tmp, result = 0;
 
-    alen = RARRAY(ary)->len;
+    alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
 	tmp = to_ary(rb_ary_elt(ary, i));
 	if (elen < 0) {		/* first element */
-	    elen = RARRAY(tmp)->len;
+	    elen = RARRAY_LEN(tmp);
 	    result = rb_ary_new2(elen);
 	    for (j=0; j<elen; j++) {
 		rb_ary_store(result, j, rb_ary_new2(alen));
 	    }
 	}
-	else if (elen != RARRAY(tmp)->len) {
-	    rb_raise(rb_eIndexError, "element size differs (%d should be %d)",
-		     RARRAY(tmp)->len, elen);
+	else if (elen != RARRAY_LEN(tmp)) {
+	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+		     RARRAY_LEN(tmp), elen);
 	}
 	for (j=0; j<elen; j++) {
 	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
@@ -2156,75 +2804,102 @@ rb_ary_transpose(ary)
 
 /*
  *  call-seq:
- *     array.replace(other_array)  -> array
- *  
- *  Replaces the contents of <i>self</i> with the contents of
- *  <i>other_array</i>, truncating or expanding if necessary.
- *     
+ *     ary.replace(other_ary)  -> ary
+ *
+ *  Replaces the contents of +self+ with the contents of
+ *  <i>other_ary</i>, truncating or expanding if necessary.
+ *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
  *     a                              #=> ["x", "y", "z"]
  */
 
-static VALUE
-rb_ary_replace(copy, orig)
-    VALUE copy, orig;
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
 {
-    VALUE shared;
-
-    rb_ary_modify(copy);
+    rb_ary_modify_check(copy);
     orig = to_ary(orig);
     if (copy == orig) return copy;
-    shared = ary_make_shared(orig);
-    if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
-	free(RARRAY(copy)->ptr);
-    RARRAY(copy)->ptr = RARRAY(orig)->ptr;
-    RARRAY(copy)->len = RARRAY(orig)->len;
-    RARRAY(copy)->aux.shared = shared;
-    FL_SET(copy, ELTS_SHARED);
 
+    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE *ptr;
+        VALUE shared = 0;
+
+        if (ARY_OWNS_HEAP_P(copy)) {
+            xfree(RARRAY_PTR(copy));
+        }
+        else if (ARY_SHARED_P(copy)) {
+            shared = ARY_SHARED(copy);
+            FL_UNSET_SHARED(copy);
+        }
+        FL_SET_EMBED(copy);
+        ptr = RARRAY_PTR(orig);
+        MEMCPY(RARRAY_PTR(copy), ptr, VALUE, RARRAY_LEN(orig));
+        if (shared) {
+            rb_ary_decrement_share(shared);
+        }
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    }
+    else {
+        VALUE shared = ary_make_shared(orig);
+        if (ARY_OWNS_HEAP_P(copy)) {
+            xfree(RARRAY_PTR(copy));
+        }
+        else {
+            rb_ary_unshare_safe(copy);
+        }
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, RARRAY_PTR(orig));
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+        rb_ary_set_shared(copy, shared);
+    }
     return copy;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.clear    ->  array
+ *     ary.clear    -> ary
  *
- *  Removes all elements from _self_.
+ *  Removes all elements from +self+.
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.clear    #=> [ ]
  */
 
 VALUE
-rb_ary_clear(ary)
-    VALUE ary;
+rb_ary_clear(VALUE ary)
 {
-    rb_ary_modify(ary);
-    RARRAY(ary)->len = 0;
-    if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
-	RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary)) {
+	if (!ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
+    }
+    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.fill(obj)                                -> array
- *     array.fill(obj, start [, length])              -> array
- *     array.fill(obj, range )                        -> array
- *     array.fill {|index| block }                    -> array
- *     array.fill(start [, length] ) {|index| block } -> array
- *     array.fill(range) {|index| block }             -> array
- *  
- *  The first three forms set the selected elements of <i>self</i> (which
+ *     ary.fill(obj)                                -> ary
+ *     ary.fill(obj, start [, length])              -> ary
+ *     ary.fill(obj, range )                        -> ary
+ *     ary.fill {|index| block }                    -> ary
+ *     ary.fill(start [, length] ) {|index| block } -> ary
+ *     ary.fill(range) {|index| block }             -> ary
+ *
+ *  The first three forms set the selected elements of +self+ (which
  *  may be the entire array) to <i>obj</i>. A <i>start</i> of
  *  <code>nil</code> is equivalent to zero. A <i>length</i> of
  *  <code>nil</code> is equivalent to <i>self.length</i>. The last three
  *  forms fill the array with the value of the block. The block is
  *  passed the absolute index of each element to be filled.
- *     
+ *  Negative values of <i>start</i> count from the end of the array.
+ *
  *     a = [ "a", "b", "c", "d" ]
  *     a.fill("x")              #=> ["x", "x", "x", "x"]
  *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
@@ -2234,18 +2909,15 @@ rb_ary_clear(ary)
  */
 
 static VALUE
-rb_ary_fill(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
     VALUE item, arg1, arg2;
     long beg = 0, end = 0, len = 0;
     VALUE *p, *pend;
-    int block_p = Qfalse;
+    int block_p = FALSE;
 
     if (rb_block_given_p()) {
-	block_p = Qtrue;
+	block_p = TRUE;
 	rb_scan_args(argc, argv, "02", &arg1, &arg2);
 	argc += 1;		/* hackish */
     }
@@ -2255,20 +2927,20 @@ rb_ary_fill(argc, argv, ary)
     switch (argc) {
       case 1:
 	beg = 0;
-	len = RARRAY(ary)->len;
+	len = RARRAY_LEN(ary);
 	break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
 	    break;
 	}
 	/* fall through */
       case 3:
 	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
 	if (beg < 0) {
-	    beg = RARRAY(ary)->len + beg;
+	    beg = RARRAY_LEN(ary) + beg;
 	    if (beg < 0) beg = 0;
 	}
-	len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
+	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
 	break;
     }
     rb_ary_modify(ary);
@@ -2279,13 +2951,12 @@ rb_ary_fill(argc, argv, ary)
 	rb_raise(rb_eArgError, "argument too big");
     }
     end = beg + len;
-    if (end > RARRAY(ary)->len) {
-	if (end >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
-	    RARRAY(ary)->aux.capa = end;
+    if (RARRAY_LEN(ary) < end) {
+	if (end >= ARY_CAPA(ary)) {
+	    ary_resize_capa(ary, end);
 	}
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
-	RARRAY(ary)->len = end;
+	rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+	ARY_SET_LEN(ary, end);
     }
 
     if (block_p) {
@@ -2294,12 +2965,12 @@ rb_ary_fill(argc, argv, ary)
 
 	for (i=beg; i<end; i++) {
 	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY(ary)->len) break;
-	    RARRAY(ary)->ptr[i] = v;
+	    if (i>=RARRAY_LEN(ary)) break;
+	    RARRAY_PTR(ary)[i] = v;
 	}
     }
     else {
-	p = RARRAY(ary)->ptr + beg;
+	p = RARRAY_PTR(ary) + beg;
 	pend = p + len;
 	while (p < pend) {
 	    *p++ = item;
@@ -2308,62 +2979,61 @@ rb_ary_fill(argc, argv, ary)
     return ary;
 }
 
-/* 
+/*
  *  call-seq:
- *     array + other_array   -> an_array
+ *     ary + other_ary   -> new_ary
  *
  *  Concatenation---Returns a new array built by concatenating the
  *  two arrays together to produce a third array.
- * 
+ *
  *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
  */
 
 VALUE
-rb_ary_plus(x, y)
-    VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
 {
     VALUE z;
     long len;
 
     y = to_ary(y);
-    len = RARRAY(x)->len + RARRAY(y)->len;
+    len = RARRAY_LEN(x) + RARRAY_LEN(y);
     z = rb_ary_new2(len);
-    MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
-    MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
-    RARRAY(z)->len = len;
+    MEMCPY(RARRAY_PTR(z), RARRAY_PTR(x), VALUE, RARRAY_LEN(x));
+    MEMCPY(RARRAY_PTR(z) + RARRAY_LEN(x), RARRAY_PTR(y), VALUE, RARRAY_LEN(y));
+    ARY_SET_LEN(z, len);
     return z;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.concat(other_array)   ->  array
+ *     ary.concat(other_ary)   -> ary
+ *
+ *  Appends the elements of <i>other_ary</i> to +self+.
  *
- *  Appends the elements in other_array to _self_.
- *  
  *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
  */
 
 
 VALUE
-rb_ary_concat(x, y)
-    VALUE x, y;
+rb_ary_concat(VALUE x, VALUE y)
 {
+    rb_ary_modify_check(x);
     y = to_ary(y);
-    if (RARRAY(y)->len > 0) {
-	rb_ary_splice(x, RARRAY(x)->len, 0, y);
+    if (RARRAY_LEN(y) > 0) {
+	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
     }
     return x;
 }
 
 
-/* 
+/*
  *  call-seq:
- *     array * int     ->    an_array
- *     array * str     ->    a_string
+ *     ary * int     -> new_ary
+ *     ary * str     -> new_string
  *
  *  Repetition---With a String argument, equivalent to
  *  self.join(str). Otherwise, returns a new array
- *  built by concatenating the _int_ copies of _self_.
+ *  built by concatenating the _int_ copies of +self+.
  *
  *
  *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -2372,11 +3042,10 @@ rb_ary_concat(x, y)
  */
 
 static VALUE
-rb_ary_times(ary, times)
-    VALUE ary, times;
+rb_ary_times(VALUE ary, VALUE times)
 {
-    VALUE ary2, tmp;
-    long i, len;
+    VALUE ary2, tmp, *ptr, *ptr2;
+    long t, len;
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
@@ -2384,29 +3053,43 @@ rb_ary_times(ary, times)
     }
 
     len = NUM2LONG(times);
-    if (len == 0) return ary_new(rb_obj_class(ary), 0);
+    if (len == 0) {
+	ary2 = ary_new(rb_obj_class(ary), 0);
+	goto out;
+    }
     if (len < 0) {
 	rb_raise(rb_eArgError, "negative argument");
     }
-    if (ARY_MAX_SIZE/len < RARRAY(ary)->len) {
+    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
 	rb_raise(rb_eArgError, "argument too big");
     }
-    len *= RARRAY(ary)->len;
+    len *= RARRAY_LEN(ary);
 
     ary2 = ary_new(rb_obj_class(ary), len);
-    RARRAY(ary2)->len = len;
-
-    for (i=0; i<len; i+=RARRAY(ary)->len) {
-	MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-    }
+    ARY_SET_LEN(ary2, len);
+
+    ptr = RARRAY_PTR(ary);
+    ptr2 = RARRAY_PTR(ary2);
+    t = RARRAY_LEN(ary);
+    if (0 < t) {
+        MEMCPY(ptr2, ptr, VALUE, t);
+        while (t <= len/2) {
+            MEMCPY(ptr2+t, ptr2, VALUE, t);
+            t *= 2;
+        }
+        if (t < len) {
+            MEMCPY(ptr2+t, ptr2, VALUE, len-t);
+        }
+    }
+  out:
     OBJ_INFECT(ary2, ary);
 
     return ary2;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.assoc(obj)   ->  an_array  or  nil
+ *     ary.assoc(obj)   -> new_ary  or  nil
  *
  *  Searches through an array whose elements are also arrays
  *  comparing _obj_ with the first element of each contained array
@@ -2425,17 +3108,15 @@ rb_ary_times(ary, times)
  */
 
 VALUE
-rb_ary_assoc(ary, key)
-    VALUE ary, key;
+rb_ary_assoc(VALUE ary, VALUE key)
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY(ary)->len; ++i) {
-	v = RARRAY(ary)->ptr[i];
-	if (TYPE(v) == T_ARRAY &&
-	    RARRAY(v)->len > 0 &&
-	    rb_equal(RARRAY(v)->ptr[0], key))
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = rb_check_array_type(RARRAY_PTR(ary)[i]);
+	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+	    rb_equal(RARRAY_PTR(v)[0], key))
 	    return v;
     }
     return Qnil;
@@ -2443,51 +3124,50 @@ rb_ary_assoc(ary, key)
 
 /*
  *  call-seq:
- *     array.rassoc(key) -> an_array or nil
- *  
+ *     ary.rassoc(obj) -> new_ary or nil
+ *
  *  Searches through the array whose elements are also arrays. Compares
- *  <em>key</em> with the second element of each contained array using
+ *  _obj_ with the second element of each contained array using
  *  <code>==</code>. Returns the first contained array that matches. See
  *  also <code>Array#assoc</code>.
- *     
+ *
  *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
  *     a.rassoc("two")    #=> [2, "two"]
  *     a.rassoc("four")   #=> nil
  */
 
 VALUE
-rb_ary_rassoc(ary, value)
-    VALUE ary, value;
+rb_ary_rassoc(VALUE ary, VALUE value)
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY(ary)->len; ++i) {
-	v = RARRAY(ary)->ptr[i];
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = RARRAY_PTR(ary)[i];
 	if (TYPE(v) == T_ARRAY &&
-	    RARRAY(v)->len > 1 &&
-	    rb_equal(RARRAY(v)->ptr[1], value))
+	    RARRAY_LEN(v) > 1 &&
+	    rb_equal(RARRAY_PTR(v)[1], value))
 	    return v;
     }
     return Qnil;
 }
 
 static VALUE
-recursive_equal(ary1, ary2)
-    VALUE ary1, ary2;
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
 {
     long i;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
 	if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
 	    return Qfalse;
     }
     return Qtrue;
 }
 
-/* 
+/*
  *  call-seq:
- *     array == other_array   ->   bool
+ *     ary == other_ary   ->   bool
  *
  *  Equality---Two arrays are equal if they contain the same number
  *  of elements and if each element is equal to (according to
@@ -2500,8 +3180,7 @@ recursive_equal(ary1, ary2)
  */
 
 static VALUE
-rb_ary_equal(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_equal(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (TYPE(ary2) != T_ARRAY) {
@@ -2510,18 +3189,17 @@ rb_ary_equal(ary1, ary2)
 	}
 	return rb_equal(ary2, ary1);
     }
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    if (rb_inspecting_p(ary1)) return Qfalse;
-    return rb_protect_inspect(recursive_equal, ary1, ary2);
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
 }
 
 static VALUE
-recursive_eql(ary1, ary2)
-    VALUE ary1, ary2;
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
 {
     long i;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
 	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
 	    return Qfalse;
     }
@@ -2530,96 +3208,92 @@ recursive_eql(ary1, ary2)
 
 /*
  *  call-seq:
- *     array.eql?(other)  -> true or false
+ *     ary.eql?(other)  -> true or false
  *
- *  Returns <code>true</code> if _array_ and _other_ are the same object,
+ *  Returns <code>true</code> if +self+ and _other_ are the same object,
  *  or are both arrays with the same content.
  */
 
 static VALUE
-rb_ary_eql(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_eql(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (TYPE(ary2) != T_ARRAY) return Qfalse;
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    if (rb_inspecting_p(ary1)) return Qfalse;
-    return rb_protect_inspect(recursive_eql, ary1, ary2);
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
-static VALUE recursive_hash _((VALUE ary));
-
 static VALUE
-recursive_hash(ary)
-    VALUE ary;
+recursive_hash(VALUE ary, VALUE dummy, int recur)
 {
-    long i, h;
+    long i;
+    st_index_t h;
     VALUE n;
 
-    h = RARRAY(ary)->len;
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	h = (h << 1) | (h<0 ? 1 : 0);
-	n = rb_hash(RARRAY(ary)->ptr[i]);
-	h ^= NUM2LONG(n);
+    h = rb_hash_start(RARRAY_LEN(ary));
+    if (recur) {
+	h = rb_hash_uint(h, NUM2LONG(rb_hash(rb_cArray)));
+    }
+    else {
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    n = rb_hash(RARRAY_PTR(ary)[i]);
+	    h = rb_hash_uint(h, NUM2LONG(n));
+	}
     }
+    h = rb_hash_end(h);
     return LONG2FIX(h);
 }
 
 /*
  *  call-seq:
- *     array.hash   -> fixnum
+ *     ary.hash   -> fixnum
  *
  *  Compute a hash-code for this array. Two arrays with the same content
  *  will have the same hash code (and will compare using <code>eql?</code>).
  */
 
 static VALUE
-rb_ary_hash(ary)
-    VALUE ary;
+rb_ary_hash(VALUE ary)
 {
-    if (rb_inspecting_p(ary)) {
-	return LONG2FIX(0);
-    }
-    return rb_protect_inspect(recursive_hash, ary, 0);
+    return rb_exec_recursive_outer(recursive_hash, ary, 0);
 }
 
 /*
  *  call-seq:
- *     array.include?(obj)   -> true or false
- *  
+ *     ary.include?(obj)   -> true or false
+ *
  *  Returns <code>true</code> if the given object is present in
- *  <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
+ *  +self+ (that is, if any object <code>==</code> <i>anObject</i>),
  *  <code>false</code> otherwise.
- *     
+ *
  *     a = [ "a", "b", "c" ]
  *     a.include?("b")   #=> true
  *     a.include?("z")   #=> false
  */
 
 VALUE
-rb_ary_includes(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
 {
     long i;
-    
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	if (rb_equal(RARRAY_PTR(ary)[i], item)) {
 	    return Qtrue;
 	}
     }
     return Qfalse;
 }
 
-VALUE
-recursive_cmp(ary1, ary2)
-    VALUE ary1, ary2;
+
+static VALUE
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
 {
     long i, len;
 
-    len = RARRAY(ary1)->len;
-    if (len > RARRAY(ary2)->len) {
-	len = RARRAY(ary2)->len;
+    if (recur) return Qundef;	/* Subtle! */
+    len = RARRAY_LEN(ary1);
+    if (len > RARRAY_LEN(ary2)) {
+	len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
 	VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
@@ -2630,13 +3304,13 @@ recursive_cmp(ary1, ary2)
     return Qundef;
 }
 
-/* 
+/*
  *  call-seq:
- *     array <=> other_array   ->  -1, 0, +1
+ *     ary <=> other_ary   ->  -1, 0, +1 or nil
  *
  *  Comparison---Returns an integer (-1, 0,
  *  or +1) if this array is less than, equal to, or greater than
- *  other_array.  Each object in each array is compared
+ *  <i>other_ary</i>.  Each object in each array is compared
  *  (using <=>). If any value isn't
  *  equal, then that inequality is the return value. If all the
  *  values found are equal, then the return is based on a
@@ -2644,81 +3318,120 @@ recursive_cmp(ary1, ary2)
  *  ``equal'' according to <code>Array#<=></code> if and only if they have
  *  the same length and the value of each element is equal to the
  *  value of the corresponding element in the other array.
- *  
+ *
  *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
  *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
  *
  */
 
 VALUE
-rb_ary_cmp(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_cmp(VALUE ary1, VALUE ary2)
 {
     long len;
     VALUE v;
 
-    ary2 = to_ary(ary2);
+    ary2 = rb_check_array_type(ary2);
+    if (NIL_P(ary2)) return Qnil;
     if (ary1 == ary2) return INT2FIX(0);
-    if (rb_inspecting_p(ary1)) return INT2FIX(0);
-    v = rb_protect_inspect(recursive_cmp, ary1, ary2);
+    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
     if (v != Qundef) return v;
-    len = RARRAY(ary1)->len - RARRAY(ary2)->len;
+    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
     return INT2FIX(-1);
 }
 
 static VALUE
-ary_make_hash(ary1, ary2)
-    VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
 {
-    VALUE hash = rb_hash_new();
     long i;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_hash_aset(hash, RARRAY_PTR(ary)[i], Qtrue);
     }
-    if (ary2) {
-	for (i=0; i<RARRAY(ary2)->len; i++) {
-	    rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
+    return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(void)
+{
+    VALUE hash = rb_hash_new();
+
+    RBASIC(hash)->klass = 0;
+    return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+	    rb_hash_aset(hash, k, v);
 	}
     }
     return hash;
 }
 
-/* 
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash_by(hash, ary);
+}
+
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+    if (RHASH(hash)->ntbl) {
+	st_table *tbl = RHASH(hash)->ntbl;
+	RHASH(hash)->ntbl = 0;
+	st_free_table(tbl);
+    }
+}
+
+/*
  *  call-seq:
- *     array - other_array    -> an_array
+ *     ary - other_ary    -> new_ary
  *
  *  Array Difference---Returns a new array that is a copy of
  *  the original array, removing any items that also appear in
- *  other_array. (If you need set-like behavior, see the
+ *  <i>other_ary</i>. (If you need set-like behavior, see the
  *  library class Set.)
  *
  *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
  */
 
 static VALUE
-rb_ary_diff(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
     volatile VALUE hash;
     long i;
 
-    hash = ary_make_hash(to_ary(ary2), 0);
+    hash = ary_make_hash(to_ary(ary2));
     ary3 = rb_ary_new();
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (st_lookup(RHASH_TBL(hash), RARRAY_PTR(ary1)[i], 0)) continue;
 	rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
+    ary_recycle_hash(hash);
     return ary3;
 }
 
-/* 
+/*
  *  call-seq:
- *     array & other_array
+ *     ary & other_ary      -> new_ary
  *
  *  Set Intersection---Returns a new array
  *  containing elements common to the two arrays, with no duplicates.
@@ -2728,168 +3441,231 @@ rb_ary_diff(ary1, ary2)
 
 
 static VALUE
-rb_ary_and(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_and(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, ary3, v, vv;
+    VALUE hash, ary3, v;
+    st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
-	    RARRAY(ary1)->len : RARRAY(ary2)->len);
-    hash = ary_make_hash(ary2, 0);
+    ary3 = rb_ary_new2(RARRAY_LEN(ary1) < RARRAY_LEN(ary2) ?
+	    RARRAY_LEN(ary1) : RARRAY_LEN(ary2));
+    hash = ary_make_hash(ary2);
+
+    if (RHASH_EMPTY_P(hash))
+        return ary3;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	v = vv = rb_ary_elt(ary1, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	vv = (st_data_t)(v = rb_ary_elt(ary1, i));
+	if (st_delete(RHASH_TBL(hash), &vv, 0)) {
 	    rb_ary_push(ary3, v);
 	}
     }
+    ary_recycle_hash(hash);
 
     return ary3;
 }
 
-/* 
+/*
  *  call-seq:
- *     array | other_array     ->  an_array
+ *     ary | other_ary     -> new_ary
  *
  *  Set Union---Returns a new array by joining this array with
- *  other_array, removing duplicates.
+ *  <i>other_ary</i>, removing duplicates.
  *
  *     [ "a", "b", "c" ] | [ "c", "d", "a" ]
  *            #=> [ "a", "b", "c", "d" ]
  */
 
 static VALUE
-rb_ary_or(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, ary3;
-    VALUE v, vv;
+    VALUE hash, ary3, v;
+    st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
-    hash = ary_make_hash(ary1, ary2);
+    ary3 = rb_ary_new2(RARRAY_LEN(ary1)+RARRAY_LEN(ary2));
+    hash = ary_add_hash(ary_make_hash(ary1), ary2);
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	v = vv = rb_ary_elt(ary1, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	vv = (st_data_t)(v = rb_ary_elt(ary1, i));
+	if (st_delete(RHASH_TBL(hash), &vv, 0)) {
 	    rb_ary_push(ary3, v);
 	}
     }
-    for (i=0; i<RARRAY(ary2)->len; i++) {
-	v = vv = rb_ary_elt(ary2, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+    for (i=0; i<RARRAY_LEN(ary2); i++) {
+	vv = (st_data_t)(v = rb_ary_elt(ary2, i));
+	if (st_delete(RHASH_TBL(hash), &vv, 0)) {
 	    rb_ary_push(ary3, v);
 	}
     }
+    ary_recycle_hash(hash);
     return ary3;
 }
 
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
+}
+
 /*
  *  call-seq:
- *     array.uniq! -> array or nil
- *  
- *  Removes duplicate elements from _self_.
+ *     ary.uniq!                -> ary or nil
+ *     ary.uniq! { |item| ... } -> ary or nil
+ *
+ *  Removes duplicate elements from +self+. If a block is given,
+ *  it will use the return value of the block for comparison.
  *  Returns <code>nil</code> if no changes are made (that is, no
  *  duplicates are found).
- *     
+ *
  *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   #=> ["a", "b", "c"]
+ *     a.uniq!   # => ["a", "b", "c"]
+ *
  *     b = [ "a", "b", "c" ]
- *     b.uniq!   #=> nil
+ *     b.uniq!   # => nil
+ *
+ *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
  */
 
 static VALUE
-rb_ary_uniq_bang(ary)
-    VALUE ary;
+rb_ary_uniq_bang(VALUE ary)
 {
-    VALUE hash, v, vv;
+    VALUE hash, v;
     long i, j;
 
-    hash = ary_make_hash(ary, 0);
-
-    if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
-	return Qnil;
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) <= 1)
+        return Qnil;
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	if (RARRAY_LEN(ary) == (i = RHASH_SIZE(hash))) {
+	    return Qnil;
+	}
+	ARY_SET_LEN(ary, 0);
+	if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
+	ary_resize_capa(ary, i);
+	st_foreach(RHASH_TBL(hash), push_value, ary);
     }
-    for (i=j=0; i<RARRAY(ary)->len; i++) {
-	v = vv = rb_ary_elt(ary, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_store(ary, j++, v);
+    else {
+	hash = ary_make_hash(ary);
+	if (RARRAY_LEN(ary) == (long)RHASH_SIZE(hash)) {
+	    return Qnil;
+	}
+	for (i=j=0; i<RARRAY_LEN(ary); i++) {
+	    st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
+	    if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+		rb_ary_store(ary, j++, v);
+	    }
 	}
+	ARY_SET_LEN(ary, j);
     }
-    RARRAY(ary)->len = j;
+    ary_recycle_hash(hash);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.uniq   -> an_array
- *  
- *  Returns a new array by removing duplicate values in <i>self</i>.
- *     
+ *     ary.uniq                -> new_ary
+ *     ary.uniq { |item| ... } -> new_ary
+ *
+ *  Returns a new array by removing duplicate values in +self+. If a block
+ *  is given, it will use the return value of the block for comparison.
+ *
  *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   #=> ["a", "b", "c"]
+ *     a.uniq   # => ["a", "b", "c"]
+ *
+ *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
  */
 
 static VALUE
-rb_ary_uniq(ary)
-    VALUE ary;
+rb_ary_uniq(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_uniq_bang(ary);
-    return ary;
+    VALUE hash, uniq, v;
+    long i;
+
+    if (RARRAY_LEN(ary) <= 1)
+        return rb_ary_dup(ary);
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
+	st_foreach(RHASH_TBL(hash), push_value, uniq);
+    }
+    else {
+	hash = ary_make_hash(ary);
+	uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
+	    if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+		rb_ary_push(uniq, v);
+	    }
+	}
+    }
+    ary_recycle_hash(hash);
+
+    return uniq;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.compact!    ->   array  or  nil
+ *     ary.compact!    -> ary  or  nil
  *
- *  Removes +nil+ elements from array.
- *  Returns +nil+ if no changes were made.
+ *  Removes +nil+ elements from the array.
+ *  Returns +nil+ if no changes were made, otherwise returns
+ *  <i>ary</i>.
  *
  *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
  *     [ "a", "b", "c" ].compact!           #=> nil
  */
 
 static VALUE
-rb_ary_compact_bang(ary)
-    VALUE ary;
+rb_ary_compact_bang(VALUE ary)
 {
     VALUE *p, *t, *end;
+    long n;
 
     rb_ary_modify(ary);
-    p = t = RARRAY(ary)->ptr;
-    end = p + RARRAY(ary)->len;
-    
+    p = t = RARRAY_PTR(ary);
+    end = p + RARRAY_LEN(ary);
+
     while (t < end) {
 	if (NIL_P(*t)) t++;
 	else *p++ = *t++;
     }
-    if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+    n = p - RARRAY_PTR(ary);
+    if (RARRAY_LEN(ary) == n) {
 	return Qnil;
     }
-    RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
-    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    ARY_SET_LEN(ary, n);
+    if (n * 2 < ARY_CAPA(ary) && ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, n * 2);
+    }
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.compact     ->  an_array
+ *     ary.compact     -> new_ary
  *
- *  Returns a copy of _self_ with all +nil+ elements removed.
+ *  Returns a copy of +self+ with all +nil+ elements removed.
  *
  *     [ "a", nil, "b", nil, "c", nil ].compact
  *                       #=> [ "a", "b", "c" ]
  */
 
 static VALUE
-rb_ary_compact(ary)
-    VALUE ary;
+rb_ary_compact(VALUE ary)
 {
     ary = rb_ary_dup(ary);
     rb_ary_compact_bang(ary);
@@ -2898,146 +3674,1015 @@ rb_ary_compact(ary)
 
 /*
  *  call-seq:
- *     array.nitems -> int
- *  
- *  Returns the number of non-<code>nil</code> elements in _self_.
- *  May be zero.
- *     
- *     [ 1, nil, 3, nil, 5 ].nitems   #=> 3
+ *     ary.count      -> int
+ *     ary.count(obj) -> int
+ *     ary.count { |item| block }  -> int
+ *
+ *  Returns the number of elements.  If an argument is given, counts
+ *  the number of elements which equals to <i>obj</i>.  If a block is
+ *  given, counts the number of elements yielding a true value.
+ *
+ *     ary = [1, 2, 4, 2]
+ *     ary.count             #=> 4
+ *     ary.count(2)          #=> 2
+ *     ary.count{|x|x%2==0}  #=> 3
+ *
  */
 
 static VALUE
-rb_ary_nitems(ary)
-    VALUE ary;
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long n = 0;
-    VALUE *p, *pend;
 
-    p = RARRAY(ary)->ptr;
-    pend = p + RARRAY(ary)->len;
+    if (argc == 0) {
+	VALUE *p, *pend;
+
+	if (!rb_block_given_p())
+	    return LONG2NUM(RARRAY_LEN(ary));
+
+	for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
+	    if (RTEST(rb_yield(*p))) n++;
+	}
+    }
+    else {
+	VALUE obj, *p, *pend;
 
-    while (p < pend) {
-	if (!NIL_P(*p)) n++;
-	p++;
+	rb_scan_args(argc, argv, "1", &obj);
+	if (rb_block_given_p()) {
+	    rb_warn("given block not used");
+	}
+	for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
+	    if (rb_equal(*p, obj)) n++;
+	}
     }
+
     return LONG2NUM(n);
 }
 
-static long
-flatten(ary, idx, ary2, memo)
-    VALUE ary;
-    long idx;
-    VALUE ary2, memo;
+static VALUE
+flatten(VALUE ary, int level, int *modified)
 {
-    VALUE id;
-    long i = idx;
-    long n, lim = idx + RARRAY(ary2)->len;
-
-    id = rb_obj_id(ary2);
-    if (rb_ary_includes(memo, id)) {
-	rb_raise(rb_eArgError, "tried to flatten recursive array");
-    }
-    rb_ary_push(memo, id);
-    rb_ary_splice(ary, idx, 1, ary2);
-    while (i < lim) {
-	VALUE tmp;
-
-	tmp = rb_check_array_type(rb_ary_elt(ary, i));
-	if (!NIL_P(tmp)) {
-	    n = flatten(ary, i, tmp, memo);
-	    i += n; lim += n;
+    long i = 0;
+    VALUE stack, result, tmp, elt;
+    st_table *memo;
+    st_data_t id;
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    result = ary_new(0, RARRAY_LEN(ary));
+    memo = st_init_numtable();
+    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+    *modified = 0;
+
+    while (1) {
+	while (i < RARRAY_LEN(ary)) {
+	    elt = RARRAY_PTR(ary)[i++];
+	    tmp = rb_check_array_type(elt);
+	    if (RBASIC(result)->klass) {
+		rb_raise(rb_eRuntimeError, "flatten reentered");
+	    }
+	    if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
+		rb_ary_push(result, elt);
+	    }
+	    else {
+		*modified = 1;
+		id = (st_data_t)tmp;
+		if (st_lookup(memo, id, 0)) {
+		    st_free_table(memo);
+		    rb_raise(rb_eArgError, "tried to flatten recursive array");
+		}
+		st_insert(memo, id, (st_data_t)Qtrue);
+		rb_ary_push(stack, ary);
+		rb_ary_push(stack, LONG2NUM(i));
+		ary = tmp;
+		i = 0;
+	    }
+	}
+	if (RARRAY_LEN(stack) == 0) {
+	    break;
 	}
-	i++;
+	id = (st_data_t)ary;
+	st_delete(memo, &id, 0);
+	tmp = rb_ary_pop(stack);
+	i = NUM2LONG(tmp);
+	ary = rb_ary_pop(stack);
     }
-    rb_ary_pop(memo);
 
-    return lim - idx - 1;	/* returns number of increased items */
+    st_free_table(memo);
+
+    RBASIC(result)->klass = rb_class_of(ary);
+    return result;
 }
 
 /*
  *  call-seq:
- *     array.flatten! -> array or nil
- *  
- *  Flattens _self_ in place.
+ *     ary.flatten!        -> ary or nil
+ *     ary.flatten!(level) -> array or nil
+ *
+ *  Flattens +self+ in place.
  *  Returns <code>nil</code> if no modifications were made (i.e.,
- *  <i>array</i> contains no subarrays.)
- *     
+ *  <i>ary</i> contains no subarrays.)  If the optional <i>level</i>
+ *  argument determines the level of recursion to flatten.
+ *
  *     a = [ 1, 2, [3, [4, 5] ] ]
  *     a.flatten!   #=> [1, 2, 3, 4, 5]
  *     a.flatten!   #=> nil
  *     a            #=> [1, 2, 3, 4, 5]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
-rb_ary_flatten_bang(ary)
-    VALUE ary;
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long i = 0;
-    int mod = 0;
-    VALUE memo = Qnil;
+    int mod = 0, level = -1;
+    VALUE result, lv;
 
-    while (i<RARRAY(ary)->len) {
-	VALUE ary2 = RARRAY(ary)->ptr[i];
-	VALUE tmp;
+    rb_scan_args(argc, argv, "01", &lv);
+    rb_ary_modify_check(ary);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return Qnil;
 
-	tmp = rb_check_array_type(ary2);
-	if (!NIL_P(tmp)) {
-	    if (NIL_P(memo)) {
-		memo = rb_ary_new();
-	    }
-	    i += flatten(ary, i, tmp, memo);
-	    mod = 1;
-	}
-	i++;
+    result = flatten(ary, level, &mod);
+    if (mod == 0) {
+	ary_discard(result);
+	return Qnil;
     }
-    if (mod == 0) return Qnil;
+    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+    rb_ary_replace(ary, result);
+    if (mod) ARY_SET_EMBED_LEN(result, 0);
+
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.flatten -> an_array
- *  
+ *     ary.flatten -> new_ary
+ *     ary.flatten(level) -> new_ary
+ *
  *  Returns a new array that is a one-dimensional flattening of this
  *  array (recursively). That is, for every element that is an array,
- *  extract its elements into the new array.
- *     
+ *  extract its elements into the new array.  If the optional
+ *  <i>level</i> argument determines the level of recursion to flatten.
+ *
  *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
  *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
  *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
-rb_ary_flatten(ary)
-    VALUE ary;
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    rb_scan_args(argc, argv, "01", &lv);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return ary_make_shared_copy(ary);
+
+    result = flatten(ary, level, &mod);
+    OBJ_INFECT(result, ary);
+
+    return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static VALUE sym_random;
+
+#define RAND_UPTO(max) (long)(rb_random_real(randgen)*(max))
+
+/*
+ *  call-seq:
+ *     ary.shuffle!              -> ary
+ *     ary.shuffle!(random: rng) -> ary
+ *
+ *  Shuffles elements in +self+ in place.
+ *  If +rng+ is given, it will be used as the random number generator.
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE *ptr, opts, *snap_ptr, randgen = rb_cRandom;
+    long i, snap_len;
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	randgen = rb_hash_lookup2(opts, sym_random, randgen);
+    }
+    if (argc > 0) {
+	rb_raise(rb_eArgError, "wrong number of arguments (%d for 0)", argc);
+    }
+    rb_ary_modify(ary);
+    i = RARRAY_LEN(ary);
+    ptr = RARRAY_PTR(ary);
+    snap_len = i;
+    snap_ptr = ptr;
+    while (i) {
+	long j = RAND_UPTO(i);
+	VALUE tmp;
+	if (snap_len != RARRAY_LEN(ary) || snap_ptr != RARRAY_PTR(ary)) {
+	    rb_raise(rb_eRuntimeError, "modified during shuffle");
+	}
+	tmp = ptr[--i];
+	ptr[i] = ptr[j];
+	ptr[j] = tmp;
+    }
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.shuffle              -> new_ary
+ *     ary.shuffle(random: rng) -> new_ary
+ *
+ *  Returns a new array with elements of this array shuffled.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle                 #=> [2, 3, 1]
+ *
+ *  If +rng+ is given, it will be used as the random number generator.
+ *
+ *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_flatten_bang(ary);
+    rb_ary_shuffle_bang(argc, argv, ary);
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.sample                  -> obj
+ *     ary.sample(random: rng)     -> obj
+ *     ary.sample(n)               -> new_ary
+ *     ary.sample(n, random: rng)  -> new_ary
+ *
+ *  Choose a random element or +n+ random elements from the array. The elements
+ *  are chosen by using random and unique indices into the array in order to
+ *  ensure that an element doesn't repeat itself unless the array already
+ *  contained duplicate elements. If the array is empty the first form returns
+ *  <code>nil</code> and the second form returns an empty array.
+ *
+ *  If +rng+ is given, it will be used as the random number generator.
+ */
+
+
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE nv, result, *ptr;
+    VALUE opts, randgen = rb_cRandom;
+    long n, len, i, j, k, idx[10];
+    double rnds[numberof(idx)];
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	randgen = rb_hash_lookup2(opts, sym_random, randgen);
+    }
+    ptr = RARRAY_PTR(ary);
+    len = RARRAY_LEN(ary);
+    if (argc == 0) {
+	if (len == 0) return Qnil;
+	if (len == 1) {
+	    i = 0;
+	}
+	else {
+	    double x = rb_random_real(randgen);
+	    if ((len = RARRAY_LEN(ary)) == 0) return Qnil;
+	    i = (long)(x * len);
+	}
+	return RARRAY_PTR(ary)[i];
+    }
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+    if (n > len) n = len;
+    if (n <= numberof(idx)) {
+	for (i = 0; i < n; ++i) {
+	    rnds[i] = rb_random_real(randgen);
+	}
+    }
+    len = RARRAY_LEN(ary);
+    ptr = RARRAY_PTR(ary);
+    if (n > len) n = len;
+    switch (n) {
+      case 0:
+	return rb_ary_new2(0);
+      case 1:
+	i = (long)(rnds[0] * len);
+	return rb_ary_new4(1, &ptr[i]);
+      case 2:
+	i = (long)(rnds[0] * len);
+	j = (long)(rnds[1] * (len-1));
+	if (j >= i) j++;
+	return rb_ary_new3(2, ptr[i], ptr[j]);
+      case 3:
+	i = (long)(rnds[0] * len);
+	j = (long)(rnds[1] * (len-1));
+	k = (long)(rnds[2] * (len-2));
+	{
+	    long l = j, g = i;
+	    if (j >= i) l = i, g = ++j;
+	    if (k >= l && (++k >= g)) ++k;
+	}
+	return rb_ary_new3(3, ptr[i], ptr[j], ptr[k]);
+    }
+    if (n <= numberof(idx)) {
+	VALUE *ptr_result;
+	long sorted[numberof(idx)];
+	sorted[0] = idx[0] = (long)(rnds[0] * len);
+	for (i=1; i<n; i++) {
+	    k = (long)(rnds[i] * --len);
+	    for (j = 0; j < i; ++j) {
+		if (k < sorted[j]) break;
+		++k;
+	    }
+	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+	    sorted[j] = idx[i] = k;
+	}
+	result = rb_ary_new2(n);
+	ptr_result = RARRAY_PTR(result);
+	for (i=0; i<n; i++) {
+	    ptr_result[i] = ptr[idx[i]];
+	}
+    }
+    else {
+	VALUE *ptr_result;
+	result = rb_ary_new4(len, ptr);
+	RBASIC(result)->klass = 0;
+	ptr_result = RARRAY_PTR(result);
+	RB_GC_GUARD(ary);
+	for (i=0; i<n; i++) {
+	    j = RAND_UPTO(len-i) + i;
+	    nv = ptr_result[j];
+	    ptr_result[j] = ptr_result[i];
+	    ptr_result[i] = nv;
+	}
+	RBASIC(result)->klass = rb_cArray;
+    }
+    ARY_SET_LEN(result, n);
+
+    return result;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.cycle(n=nil) {|obj| block }  -> nil
+ *     ary.cycle(n=nil)                 -> an_enumerator
+ *
+ *  Calls <i>block</i> for each element repeatedly _n_ times or
+ *  forever if none or +nil+ is given.  If a non-positive number is
+ *  given or the array is empty, does nothing.  Returns +nil+ if the
+ *  loop has finished without getting interrupted.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *
+ *     a = ["a", "b", "c"]
+ *     a.cycle {|x| puts x }  # print, a, b, c, a, b, c,.. forever.
+ *     a.cycle(2) {|x| puts x }  # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+    long n, i;
+    VALUE nv = Qnil;
+
+    rb_scan_args(argc, argv, "01", &nv);
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if (NIL_P(nv)) {
+        n = -1;
+    }
+    else {
+        n = NUM2LONG(nv);
+        if (n <= 0) return Qnil;
+    }
+
+    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            rb_yield(RARRAY_PTR(ary)[i]);
+        }
+    }
+    return Qnil;
+}
+
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC(s)->klass = rb_cString)
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC(a)->klass = rb_cArray)
+
+/*
+ * Recursively compute permutations of r elements of the set [0..n-1].
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * index: what index we're filling in now
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(long n, long r, long *p, long index, char *used, VALUE values)
+{
+    long i,j;
+    for (i = 0; i < n; i++) {
+	if (used[i] == 0) {
+	    p[index] = i;
+	    if (index < r-1) {             /* if not done yet */
+		used[i] = 1;               /* mark index used */
+		permute0(n, r, p, index+1, /* recurse */
+			 used, values);
+		used[i] = 0;               /* index unused */
+	    }
+	    else {
+		/* We have a complete permutation of array indexes */
+		/* Build a ruby array of the corresponding values */
+		/* And yield it to the associated block */
+		VALUE result = rb_ary_new2(r);
+		VALUE *result_array = RARRAY_PTR(result);
+		const VALUE *values_array = RARRAY_PTR(values);
+
+		for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
+		ARY_SET_LEN(result, r);
+		rb_yield(result);
+		if (RBASIC(values)->klass) {
+		    rb_raise(rb_eRuntimeError, "permute reentered");
+		}
+	    }
+	}
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.permutation { |p| block }          -> ary
+ *     ary.permutation                        -> an_enumerator
+ *     ary.permutation(n) { |p| block }       -> ary
+ *     ary.permutation(n)                     -> an_enumerator
+ *
+ * When invoked with a block, yield all permutations of length <i>n</i>
+ * of the elements of <i>ary</i>, then return the array itself.
+ * If <i>n</i> is not specified, yield all permutations of all elements.
+ * The implementation makes no guarantees about the order in which
+ * the permutations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3]
+ *     a.permutation.to_a     #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *     a.permutation(1).to_a  #=> [[1],[2],[3]]
+ *     a.permutation(2).to_a  #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ *     a.permutation(3).to_a  #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *     a.permutation(0).to_a  #=> [[]] # one permutation of length 0
+ *     a.permutation(4).to_a  #=> []   # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE num;
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_ENUMERATOR(ary, argc, argv);   /* Return enumerator if no block */
+    rb_scan_args(argc, argv, "01", &num);
+    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+
+    if (r < 0 || n < r) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0 = tmpbuf(n,sizeof(long));
+	long *p = (long*)RSTRING_PTR(t0);
+	volatile VALUE t1 = tmpbuf(n,sizeof(char));
+	char *used = (char*)RSTRING_PTR(t1);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC(ary0)->klass = 0;
+
+	MEMZERO(used, char, n); /* initialize array */
+
+	permute0(n, r, p, 0, used, ary0); /* compute and yield permutations */
+	tmpbuf_discard(t0);
+	tmpbuf_discard(t1);
+	RBASIC(ary0)->klass = rb_cArray;
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.combination(n) { |c| block }    -> ary
+ *     ary.combination(n)                  -> an_enumerator
+ *
+ * When invoked with a block, yields all combinations of length <i>n</i>
+ * of elements from <i>ary</i> and then returns <i>ary</i> itself.
+ * The implementation makes no guarantees about the order in which
+ * the combinations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3, 4]
+ *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
+ *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ *     a.combination(4).to_a  #=> [[1,2,3,4]]
+ *     a.combination(0).to_a  #=> [[]] # one combination of length 0
+ *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);
+    RETURN_ENUMERATOR(ary, 1, &num);
+    len = RARRAY_LEN(ary);
+    if (n < 0 || len < n) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < len; i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else {
+	volatile VALUE t0 = tmpbuf(n+1, sizeof(long));
+	long *stack = (long*)RSTRING_PTR(t0);
+	volatile VALUE cc = tmpary(n);
+	VALUE *chosen = RARRAY_PTR(cc);
+	long lev = 0;
+
+	MEMZERO(stack, long, n);
+	stack[0] = -1;
+	for (;;) {
+	    chosen[lev] = RARRAY_PTR(ary)[stack[lev+1]];
+	    for (lev++; lev < n; lev++) {
+		chosen[lev] = RARRAY_PTR(ary)[stack[lev+1] = stack[lev]+1];
+	    }
+	    rb_yield(rb_ary_new4(n, chosen));
+	    if (RBASIC(t0)->klass) {
+		rb_raise(rb_eRuntimeError, "combination reentered");
+	    }
+	    do {
+		if (lev == 0) goto done;
+		stack[lev--]++;
+	    } while (stack[lev+1]+n == len+lev+1);
+	}
+    done:
+	tmpbuf_discard(t0);
+	tmpary_discard(cc);
+    }
     return ary;
 }
 
+/*
+ * Recursively compute repeated permutations of r elements of the set
+ * [0..n-1].
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * index: what index we're filling in now
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(long n, long r, long *p, long index, VALUE values)
+{
+    long i, j;
+    for (i = 0; i < n; i++) {
+	p[index] = i;
+	if (index < r-1) {              /* if not done yet */
+	    rpermute0(n, r, p, index+1, values); /* recurse */
+	}
+	else {
+	    /* We have a complete permutation of array indexes */
+	    /* Build a ruby array of the corresponding values */
+	    /* And yield it to the associated block */
+	    VALUE result = rb_ary_new2(r);
+	    VALUE *result_array = RARRAY_PTR(result);
+	    const VALUE *values_array = RARRAY_PTR(values);
+
+	    for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
+	    ARY_SET_LEN(result, r);
+	    rb_yield(result);
+	    if (RBASIC(values)->klass) {
+		rb_raise(rb_eRuntimeError, "repeated permute reentered");
+	    }
+	}
+    }
+}
 
-/* Arrays are ordered, integer-indexed collections of any object. 
- * Array indexing starts at 0, as in C or Java.  A negative index is 
- * assumed to be relative to the end of the array---that is, an index of -1 
- * indicates the last element of the array, -2 is the next to last 
- * element in the array, and so on. 
+/*
+ *  call-seq:
+ *     ary.repeated_permutation(n) { |p| block } -> ary
+ *     ary.repeated_permutation(n)               -> an_enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length
+ * <i>n</i> of the elements of <i>ary</i>, then return the array itself.
+ * The implementation makes no guarantees about the order in which
+ * the repeated permutations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2]
+ *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
+ *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
+ */
+
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_ENUMERATOR(ary, 1, &num);      /* Return enumerator if no block */
+    r = NUM2LONG(num);                    /* Permutation size from argument */
+
+    if (r < 0) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0 = tmpbuf(r, sizeof(long));
+	long *p = (long*)RSTRING_PTR(t0);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC(ary0)->klass = 0;
+
+	rpermute0(n, r, p, 0, ary0); /* compute and yield repeated permutations */
+	tmpbuf_discard(t0);
+	RBASIC(ary0)->klass = rb_cArray;
+    }
+    return ary;
+}
+
+static void
+rcombinate0(long n, long r, long *p, long index, long rest, VALUE values)
+{
+    long j;
+    if (rest > 0) {
+	for (; index < n; ++index) {
+	    p[r-rest] = index;
+	    rcombinate0(n, r, p, index, rest-1, values);
+	}
+    }
+    else {
+	VALUE result = rb_ary_new2(r);
+	VALUE *result_array = RARRAY_PTR(result);
+	const VALUE *values_array = RARRAY_PTR(values);
+
+	for (j = 0; j < r; ++j) result_array[j] = values_array[p[j]];
+	ARY_SET_LEN(result, r);
+	rb_yield(result);
+	if (RBASIC(values)->klass) {
+	    rb_raise(rb_eRuntimeError, "repeated combination reentered");
+	}
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.repeated_combination(n) { |c| block } -> ary
+ *     ary.repeated_combination(n)               -> an_enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of
+ * length <i>n</i> of elements from <i>ary</i> and then returns
+ * <i>ary</i> itself.
+ * The implementation makes no guarantees about the order in which
+ * the repeated combinations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3]
+ *     a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
+ *     a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ *     a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ *                                     #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ *     a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ *                                     #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ *                                     #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ *     a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);                 /* Combination size from argument */
+    RETURN_ENUMERATOR(ary, 1, &num);   /* Return enumerator if no block */
+    len = RARRAY_LEN(ary);
+    if (n < 0) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < len; i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else if (len == 0) {
+	/* yield nothing */
+    }
+    else {
+	volatile VALUE t0 = tmpbuf(n, sizeof(long));
+	long *p = (long*)RSTRING_PTR(t0);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC(ary0)->klass = 0;
+
+	rcombinate0(len, n, p, 0, n, ary0); /* compute and yield repeated combinations */
+	tmpbuf_discard(t0);
+	RBASIC(ary0)->klass = rb_cArray;
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.product(other_ary, ...)                -> new_ary
+ *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *
+ *  Returns an array of all combinations of elements from all arrays.
+ *  The length of the returned array is the product of the length
+ *  of +self+ and the argument arrays.
+ *  If given a block, <i>product</i> will yield all combinations
+ *  and return +self+ instead.
+ *
+ *
+ *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ *     [1,2].product()            #=> [[1],[2]]
+ *     [1,2].product([])          #=> []
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+    int n = argc+1;    /* How many arrays we're operating on */
+    volatile VALUE t0 = tmpary(n);
+    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
+    long i,j;
+    long resultlen = 1;
+
+    RBASIC(t0)->klass = 0;
+    RBASIC(t1)->klass = 0;
+
+    /* initialize the arrays of arrays */
+    ARY_SET_LEN(t0, n);
+    arrays[0] = ary;
+    for (i = 1; i < n; i++) arrays[i] = Qnil;
+    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+    /* initialize the counters for the arrays */
+    for (i = 0; i < n; i++) counters[i] = 0;
+
+    /* Otherwise, allocate and fill in an array of results */
+    if (rb_block_given_p()) {
+	/* Make defensive copies of arrays; exit if any is empty */
+	for (i = 0; i < n; i++) {
+	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
+	    arrays[i] = ary_make_shared_copy(arrays[i]);
+	}
+    }
+    else {
+	/* Compute the length of the result array; return [] if any is empty */
+	for (i = 0; i < n; i++) {
+	    long k = RARRAY_LEN(arrays[i]), l = resultlen;
+	    if (k == 0) {
+		result = rb_ary_new2(0);
+		goto done;
+	    }
+	    resultlen *= k;
+	    if (resultlen < k || resultlen < l || resultlen / k != l) {
+		rb_raise(rb_eRangeError, "too big to product");
+	    }
+	}
+	result = rb_ary_new2(resultlen);
+    }
+    for (;;) {
+	int m;
+	/* fill in one subarray */
+	VALUE subarray = rb_ary_new2(n);
+	for (j = 0; j < n; j++) {
+	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+	}
+
+	/* put it on the result array */
+	if(NIL_P(result)) {
+	    FL_SET(t0, FL_USER5);
+	    rb_yield(subarray);
+	    if (! FL_TEST(t0, FL_USER5)) {
+		rb_raise(rb_eRuntimeError, "product reentered");
+	    }
+	    else {
+		FL_UNSET(t0, FL_USER5);
+	    }
+	}
+	else {
+	    rb_ary_push(result, subarray);
+	}
+
+	/*
+	 * Increment the last counter.  If it overflows, reset to 0
+	 * and increment the one before it.
+	 */
+	m = n-1;
+	counters[m]++;
+	while (counters[m] == RARRAY_LEN(arrays[m])) {
+	    counters[m] = 0;
+	    /* If the first counter overflows, we are done */
+	    if (--m < 0) goto done;
+	    counters[m]++;
+	}
+    }
+done:
+    tmpary_discard(t0);
+    tmpbuf_discard(t1);
+
+    return NIL_P(result) ? ary : result;
+}
+
+/*
+ *  call-seq:
+ *     ary.take(n)               -> new_ary
+ *
+ *  Returns first n elements from <i>ary</i>.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take(3)             #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+    long len = NUM2LONG(n);
+    if (len < 0) {
+	rb_raise(rb_eArgError, "attempt to take negative size");
+    }
+    return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ *  call-seq:
+ *     ary.take_while {|arr| block }   -> new_ary
+ *     ary.take_while                  -> an_enumerator
+ *
+ *  Passes elements to the block until the block returns +nil+ or +false+,
+ *  then stops iterating and returns an array of all prior elements.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take_while {|i| i < 3 }   #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+    }
+    return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *     ary.drop(n)               -> new_ary
+ *
+ *  Drops first n elements from +ary+ and returns the rest of
+ *  the elements in an array.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop(3)             #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+    VALUE result;
+    long pos = NUM2LONG(n);
+    if (pos < 0) {
+	rb_raise(rb_eArgError, "attempt to drop negative size");
+    }
+
+    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+    if (result == Qnil) result = rb_ary_new();
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.drop_while {|arr| block }   -> new_ary
+ *     ary.drop_while                  -> an_enumerator
+ *
+ *  Drops elements up to, but not including, the first element for
+ *  which the block returns +nil+ or +false+ and returns an array
+ *  containing the remaining elements.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+    }
+    return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+
+
+/* Arrays are ordered, integer-indexed collections of any object.
+ * Array indexing starts at 0, as in C or Java.  A negative index is
+ * assumed to be relative to the end of the array---that is, an index of -1
+ * indicates the last element of the array, -2 is the next to last
+ * element in the array, and so on.
  */
 
 void
-Init_Array()
+Init_Array(void)
 {
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
     rb_define_alloc_func(rb_cArray, ary_alloc);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
     rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
 
-    rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
     rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+    rb_define_alias(rb_cArray,  "to_s", "inspect");
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
     rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
@@ -3055,8 +4700,8 @@ Init_Array()
     rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
-    rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
-    rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
+    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
@@ -3065,20 +4710,24 @@ Init_Array()
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
     rb_define_alias(rb_cArray,  "size", "length");
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
-    rb_define_method(rb_cArray, "index", rb_ary_index, 1);
-    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
-    rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
-    rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
+    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
     rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
     rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
     rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
     rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
     rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
     rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
     rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -3110,10 +4759,24 @@ Init_Array()
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
     rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
-    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
-    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
-    rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
 
     id_cmp = rb_intern("<=>");
-    inspect_key = rb_intern("__inspect_key__");
+    sym_random = ID2SYM(rb_intern("random"));
 }
diff --git a/atomic.h b/atomic.h
new file mode 100644
index 0000000000..5b3fb99024
--- /dev/null
+++ b/atomic.h
@@ -0,0 +1,56 @@
+#ifndef RUBY_ATOMIC_H
+#define RUBY_ATOMIC_H
+
+#ifdef _WIN32
+#if defined _MSC_VER && _MSC_VER > 1200
+#pragma intrinsic(_InterlockedOr)
+#endif
+typedef LONG rb_atomic_t;
+
+# define ATOMIC_SET(var, val) InterlockedExchange(&(var), (val))
+# define ATOMIC_INC(var) InterlockedIncrement(&(var))
+# define ATOMIC_DEC(var) InterlockedDecrement(&(var))
+#if defined __GNUC__
+# define ATOMIC_OR(var, val) __asm__("lock\n\t" "orl\t%1, %0" : "=m"(var) : "Ir"(val))
+#elif defined _MSC_VER && _MSC_VER <= 1200
+# define ATOMIC_OR(var, val) rb_w32_atomic_or(&(var), (val))
+static inline void
+rb_w32_atomic_or(volatile rb_atomic_t *var, rb_atomic_t val)
+{
+#ifdef _M_IX86
+    __asm mov eax, var;
+    __asm mov ecx, val;
+    __asm lock or [eax], ecx;
+#else
+#error unsupported architecture
+#endif
+}
+#else
+# define ATOMIC_OR(var, val) _InterlockedOr(&(var), (val))
+#endif
+# define ATOMIC_EXCHANGE(var, val) InterlockedExchange(&(var), (val))
+
+#elif defined HAVE_GCC_ATOMIC_BUILTINS
+/* @shyouhei hack to support atomic operations in case of gcc. Gcc
+ * has its own pseudo-insns to support them.  See info, or
+ * http://gcc.gnu.org/onlinedocs/gcc/Atomic-Builtins.html */
+
+typedef unsigned int rb_atomic_t; /* Anything OK */
+# define ATOMIC_SET(var, val)  __sync_lock_test_and_set(&(var), (val))
+# define ATOMIC_INC(var) __sync_fetch_and_add(&(var), 1)
+# define ATOMIC_DEC(var) __sync_fetch_and_sub(&(var), 1)
+# define ATOMIC_OR(var, val) __sync_or_and_fetch(&(var), (val))
+# define ATOMIC_EXCHANGE(var, val) __sync_lock_test_and_set(&(var), (val))
+
+#else
+typedef int rb_atomic_t;
+extern rb_atomic_t ruby_atomic_exchange(rb_atomic_t *ptr, rb_atomic_t val);
+
+# define ATOMIC_SET(var, val) ((var) = (val))
+# define ATOMIC_INC(var) (++(var))
+# define ATOMIC_DEC(var) (--(var))
+# define ATOMIC_OR(var, val) ((var) |= (val))
+# define ATOMIC_EXCHANGE(var, val) ruby_atomic_exchange(&(var), (val))
+#endif
+
+#endif /* RUBY_ATOMIC_H */
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
index b5546104d0..1cd26a8643 100644
--- a/bcc32/Makefile.sub
+++ b/bcc32/Makefile.sub
@@ -3,9 +3,19 @@
 SHELL = $(COMSPEC)
 MKFILES = Makefile
 
+!ifndef MFLAGS
+MFLAGS=-
+!endif
+
 #### Start of system configuration section. ####
+!ifndef OS
 OS = bccwin32
-RT = $(OS)
+!endif
+!if !defined(RT)
+!error RT not defined.  Retry from configure pass.
+!endif
+
+arch = $(ARCH)-$(OS)
 
 ## variables may be overridden by $(compile_dir)/Makefile
 !ifndef srcdir
@@ -23,7 +33,7 @@ RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
 RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
 !endif
 !ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
+RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)$(TEENY)
 !endif
 !ifndef icondirs
 !ifdef ICONDIRS
@@ -36,7 +46,6 @@ iconinc=-I$(icondirs: = -I)
 !endif
 ###############
 
-VPATH = $(srcdir):$(srcdir)/missing
 .SUFFIXES: .y
 
 !ifndef CC
@@ -49,15 +58,21 @@ CPP = cpp32
 RC = brcc32
 !endif
 !ifndef YACC
-YACC = byacc
+YACC = bison
 !endif
 !ifndef AR
 AR = tlib
 !endif
+!ifndef BASERUBY
+BASERUBY = ruby
+!endif
 
 PURIFY =
 AUTOCONF = autoconf
+IFCHANGE = $(srcdir:/=\)\win32\ifchange.bat
 RM = $(srcdir:/=\)\win32\rm.bat
+CP = copy > nul
+MV = move > nul
 
 !if !defined(PROCESSOR_ARCHITECTURE)
 PROCESSOR_ARCHITECTURE = x86
@@ -94,14 +109,11 @@ exec_prefix = $(prefix)
 libdir = $(exec_prefix)/lib
 !endif
 !if !defined(datadir)
-datadir = /share
+datadir = $(prefix)/share
 !endif
 !ifndef EXTOUT
 EXTOUT = .ext
 !endif
-!ifndef RIDATADIR
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-!endif
 !ifndef TESTUI
 TESTUI = console
 !endif
@@ -109,13 +121,24 @@ TESTUI = console
 TESTS =
 !endif
 !ifndef RDOCTARGET
-RDOCTARGET = install-nodoc
+RDOCTARGET = install-doc
 !endif
 
 OUTFLAG       = -o
+COUTFLAG      = -o
 !ifndef CFLAGS
 CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
 !endif
+!ifndef DEFS
+DEFS =
+!endif
+!ifndef CPPFLAGS
+CPPFLAGS =
+!endif
+CPPFLAGS = $(DEFS) $(CPPFLAGS)
+!ifndef CXXFLAGS
+CXXFLAGS = $(CFLAGS)
+!endif
 !ifndef LDFLAGS
 LDFLAGS = -S:$(STACK)
 !endif
@@ -129,15 +152,15 @@ EXTLIBS =
 MEMLIB =
 !endif
 LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj crypt.obj erf.obj win32.obj
+MISSING = acosh.obj cbrt.obj crypt.obj erf.obj lgamma_r.obj strlcat.obj strlcpy.obj tgamma.obj win32.obj
 
 !ifndef STACK
 STACK = 0x2000000
 !endif
 
-XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)/missing
+XCFLAGS = -DRUBY_EXPORT -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir) -I$(srcdir)/missing
 
-ARFLAGS = /a
+ARFLAGS = /a /p32
 LD = ilink32 -q -Gn
 LDSHARED  = $(LD)
 XLDFLAGS  = -Tpe c0x32.obj
@@ -153,8 +176,8 @@ EXEEXT = .exe
 PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
 WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
 RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT) $(MINIRUBYOPT)
-RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
+MINIRUBY = .\miniruby$(EXEEXT) -I$(srcdir)/lib $(MINIRUBYOPT)
+RUNRUBY = .\$(PROGRAM) -i"$(EXTOUT)/$(arch)" "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
 
 ORGLIBPATH = $(LIB)
 
@@ -164,32 +187,43 @@ LIBRUBY_A     = $(RUBY_SO_NAME)-static.lib
 LIBRUBY_SO    = $(RUBY_SO_NAME).dll
 LIBRUBY       = $(RUBY_SO_NAME).lib
 LIBRUBYARG    = $(LIBRUBY)
+THREAD_MODEL  = win32
 
 PREP          = miniruby$(EXEEXT)
 
 OBJEXT        = obj
+ASMEXT        = asm
 
 INSTALLED_LIST= .installed.list
 
+MKMAIN_CMD    = mkmain.bat
+
+SRC_FILE      = $(<:\=/)
+
 WINMAINOBJ    = winmain.$(OBJEXT)
-MINIOBJS      = dmydln.$(OBJEXT)
+ARCHMINIOBJS  = dmydln.$(OBJEXT)
+
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+hdrdir = $(srcdir)/include
+VPATH = $(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/enc;$(srcdir)/missing;$(srcdir)/win32
 
-.path.c = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.h = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
+.path.c = .;$(srcdir);$(srcdir)/enc;$(srcdir)/win32;$(srcdir)/missing
+.path.ci = $(srcdir)
+.path.inc = .;$(srcdir)
+.path.def = .;$(srcdir)
+.path.h = .;$(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
 .path.y = $(srcdir)
 .path. = $(srcdir)
 
 .c.obj:
-	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
+	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -c $(<:/=\)
+
+.c.asm:
+	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -S $(<:\=/)
 
 .rc.res:
 	$(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
 
-.y.c:
-	$(YACC) $(YFLAGS) $(<:\=/)
-	sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
-	@del y.tab.c
-
 all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
 
 ruby: $(PROGRAM)
@@ -197,32 +231,52 @@ rubyw: $(WPROGRAM)
 
 !include $(srcdir)/common.mk
 
-PHONY: Makefile
+$(MKFILES): $(srcdir)/bcc32/Makefile.sub $(srcdir)/bcc32/configure.bat $(srcdir)/bcc32/setup.mak
+	$(COMSPEC) /C $(srcdir:/=\)\bcc32\configure.bat $(configure_args)
+	@echo $(MKFILES) should be updated, re-run $(MAKE).
+	@$(MAKE) > nul -q -f &&|
+PHONY: nul
+	@exit
+|
+
+PHONY: nul
 
+RUBY_CONFIG_H = $(arch_hdrdir)/ruby/config.h
 CONFIG_H = ./.config.h.time
 
 config: config.status
 
 config.status: $(CONFIG_H)
 
+guard = INCLUDE_RUBY_CONFIG_H
+
 $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
-	@$(srcdir:/=\)\win32\ifchange.bat config.h &&|
+	@if not exist $(arch_hdrdir:/=\) md $(arch_hdrdir:/=\)
+	@if not exist $(arch_hdrdir:/=\)\ruby md $(arch_hdrdir:/=\)\ruby
+	@$(IFCHANGE) $(RUBY_CONFIG_H:/=\) &&|
+\#ifndef $(guard)
+\#define $(guard) 1
+\#define NO_BIG_INLINE 1
 \#define HAVE_SYS_TYPES_H 1
 \#define HAVE_SYS_STAT_H 1
 \#define HAVE_STDLIB_H 1
 \#define HAVE_STRING_H 1
 \#define HAVE_MEMORY_H 1
+\#define HAVE_LONG_LONG 1
 \#define HAVE_OFF_T 1
 \#define SIZEOF_INT 4
 \#define SIZEOF_SHORT 2
 \#define SIZEOF_LONG 4
 \#define SIZEOF_LONG_LONG 0
 \#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 4
+\#define SIZEOF_OFF_T 8
 \#define SIZEOF_VOIDP 4
 \#define SIZEOF_FLOAT 4
 \#define SIZEOF_DOUBLE 8
 \#define SIZEOF_TIME_T 4
+\#define SIZEOF_RLIM_T 0
+\#define SIZEOF_SIZE_T 4
+\#define SIZEOF_PTRDIFF_T 4
 \#define HAVE_PROTOTYPES 1
 \#define TOKEN_PASTE(x,y) x\#\#y
 \#define HAVE_STDARG_PROTOTYPES 1
@@ -238,6 +292,32 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
 \#define rb_pid_t int
 \#define HAVE_STRUCT_STAT_ST_RDEV 1
 \#define HAVE_ST_RDEV 1
+!if $(BORLANDC) < 0x0580
+\#define int8_t signed char
+\#define uint8_t unsigned char
+\#define int16_t short
+\#define uint16_t unsigned short
+\#define int32_t int
+\#define uint32_t unsigned int
+\#define int64_t __int64
+\#define uint64_t unsigned __int64
+\#define ssize_t int
+!endif
+\#define HAVE_INT8_T 1
+\#define HAVE_UINT8_T 1
+\#define SIZEOF_INT8_T 1
+\#define HAVE_INT16_T 1
+\#define HAVE_UINT16_T 1
+\#define SIZEOF_INT32_T 2
+\#define HAVE_INT32_T 1
+\#define HAVE_UINT32_T 1
+\#define SIZEOF_INT32_T 4
+\#define HAVE_INT64_T 1
+\#define HAVE_UINT64_T 1
+\#define SIZEOF_INT64_T 8
+\#define HAVE_INTPTR_T 1
+\#define HAVE_UINTPTR_T 1
+\#define HAVE_SSIZE_T 1
 \#define GETGROUPS_T int
 \#define RETSIGTYPE void
 \#define HAVE_ALLOCA 1
@@ -253,6 +333,8 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
 \#define HAVE_STRTOD 1
 \#define HAVE_STRTOL 1
 \#define HAVE_STRTOUL 1
+\#define HAVE_SNPRINTF 1
+\#define HAVE_VSNPRINTF 1
 \#define HAVE_ISNAN 1
 \#define HAVE_FINITE 1
 \#define HAVE_HYPOT 1
@@ -260,7 +342,10 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
 \#define HAVE_WAITPID 1
 \#define HAVE_FSYNC 1
 \#define HAVE_GETCWD 1
-\#define HAVE_CHSIZE 1
+\#define HAVE_TRUNCATE 1
+\#define HAVE_FTRUNCATE 1
+\#define HAVE_FSEEKO 1
+\#define HAVE_FTELLO 1
 \#define HAVE_TIMES 1
 \#define HAVE_FCNTL 1
 \#define HAVE_LINK 1
@@ -272,19 +357,20 @@ $(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
 \#define RSHIFT(x,y) ((x)>>(int)y)
 \#define FILE_COUNT level
 \#define FILE_READPTR curp
+\#define RUBY_SETJMP(env) setjmp(env)
+\#define RUBY_LONGJMP(env,val) longjmp(env,val)
+\#define RUBY_JMP_BUF jmp_buf
 \#define inline __inline
 \#define NEED_IO_SEEK_BETWEEN_RW 1
 \#define STACK_GROW_DIRECTION -1
 \#define DEFAULT_KCODE KCODE_NONE
+\#define LOAD_RELATIVE 1
 \#define DLEXT ".so"
-\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
-\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_LIB_PREFIX "/lib/ruby"
 \#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+\#endif /* $(guard) */
 |
-	@exit > $@
+	@exit > $(@:/=\)
 
 config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
 	@echo Creating $@
@@ -294,13 +380,14 @@ s,@SHELL@,$$(COMSPEC),;t t
 s,@BUILD_FILE_SEPARATOR@,\,;t t
 s,@PATH_SEPARATOR@,;,;t t
 s,@CFLAGS@,$(CFLAGS),;t t
+s,@DEFS@,$(DEFS),;t t
 s,@CPPFLAGS@,$(CPPFLAGS),;t t
 s,@CXXFLAGS@,$(CXXFLAGS),;t t
 s,@FFLAGS@,$(FFLAGS),;t t
 s,@LDFLAGS@,,;t t
 s,@LIBS@,$(LIBS),;t t
 s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,,;t t
+s,@prefix@,$(prefix),;t t
 s,@program_transform_name@,s,,,,;t t
 s,@bindir@,$${exec_prefix}/bin,;t t
 s,@sbindir@,$${exec_prefix}/sbin,;t t
@@ -314,6 +401,7 @@ s,@includedir@,$${prefix}/include,;t t
 s,@oldincludedir@,/usr/include,;t t
 s,@infodir@,$${prefix}/info,;t t
 s,@mandir@,$${prefix}/man,;t t
+s,@ridir@,$${prefix}/share/ri,;t t
 s,@build@,$(CPU)-pc-$(OS),;t t
 s,@build_alias@,$(CPU)-$(OS),;t t
 s,@build_cpu@,$(CPU),;t t
@@ -331,14 +419,17 @@ s,@target_vendor@,pc,;t t
 s,@target_os@,$(OS),;t t
 s,@CC@,$(CC),;t t
 s,@CPP@,cpp32,;t t
+s,@CXX@,$$(CC),;t t
+s,@LD@,$(LD),;t t
 s,@YACC@,$(YACC),;t t
 s,@RANLIB@,,;t t
 s,@AR@,$(AR),;t t
 s,@ARFLAGS@,$(ARFLAGS) ,;t t
 s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,$(SET_MAKE),;t t
+s,@SET_MAKE@,MFLAGS = -$$(MAKEFLAGS),;t t
+s,@RM@,$$(top_srcdir:/=\)\win32\rm.bat,;t t
 s,@CP@,copy > nul,;t t
-s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
+s,@LIBOBJS@, $(MISSING),;t t
 s,@ALLOCA@,$(ALLOCA),;t t
 s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
 s,@EXEEXT@,.exe,;t t
@@ -378,23 +469,30 @@ s,@SOLIBS@,$(SOLIBS),;t t
 s,@DLDLIBS@,$(DLDLIBS),;t t
 s,@ENABLE_SHARED@,yes,;t t
 s,@OUTFLAG@,$(OUTFLAG),;t t
+s,@COUTFLAG@,$(COUTFLAG),;t t
 s,@CPPOUTFILE@,,;t t
 s,@LIBPATHFLAG@, -L"%s",;t t
 s,@RPATHFLAG@,,;t t
 s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
+s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS:/=\), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE:/=\), $$(RESFILE:/=\),;t t
+s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
+s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
 s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
 s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
 s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
 s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
 s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
+s,@cleanlibs@,$$*.tds,;t t
+s,@cleanobjs@,$$*-$$(arch).def $$*.il? $$*.lib,;t t
 s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
 s,@EXPORT_PREFIX@,_,;t t
 s,@arch@,$(ARCH)-$(OS),;t t
 s,@sitearch@,$(ARCH)-$(OS),;t t
 s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
+s,@vendordir@,$${prefix}/lib/ruby/vendor_ruby,;t t
+s,@rubyhdrdir@,$$(includedir)/ruby-$$(MAJOR).$$(MINOR).$$(TEENY),;t t
+s,@sitehdrdir@,$$(rubyhdrdir)/site_ruby,;t t
+s,@vendorhdrdir@,$$(rubyhdrdir)/vendor_ruby,;t t
 s,@configure_args@,--enable-shared $(configure_args),;t t
 s,@configure_input@,$$configure_input,;t t
 s,@srcdir@,$(srcdir),;t t
@@ -403,7 +501,7 @@ s,@top_srcdir@,$(srcdir),;t t
 
 miniruby$(EXEEXT):
 		@echo $(LIBS)
-		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
+		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS) $(COMMONOBJS:/=\) $(DMYEXT),$@,nul,$(LIBS)
 
 $(PROGRAM):	$(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
 		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
@@ -428,13 +526,16 @@ $(LIBRUBY): $(LIBRUBY_SO)
 $(RUBYDEF):	$(LIBRUBY_A) $(PREP)
 		$(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
 
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
+$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb $(srcdir)/revision.h $(srcdir)/win32/resource.rb
 		@$(MINIRUBY) $(srcdir)/win32/resource.rb \
 			-ruby_name=$(RUBY_INSTALL_NAME) \
 			-rubyw_name=$(RUBYW_INSTALL_NAME) \
 			-so_name=$(RUBY_SO_NAME) \
 			. $(icondirs) $(srcdir)/win32
 
+lex.c: {$(srcdir)}lex.c.blt
+	copy "$(?:/=\)" $@
+
 post-install-bin::
 	@$(NULLCMD)
 post-install-lib::
@@ -449,18 +550,27 @@ post-install-doc::
 	@$(NULLCMD)
 
 clean-local::
-		@$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
+		@$(RM) $(WINMAINOBJ) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
 		@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
+		@$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF) ext\ripper\y.output
 
 distclean-local::
 		@$(RM) ext\config.cache $(RBCONFIG:/=\)
-		@$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
 		@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
 
+clean-ext distclean-ext realclean-ext::
+		@for /R ext %I in (.) do @if exist %I\Makefile ( \
+		    echo $(@:-ext=)ing %~nI & \
+		    cd %I & \
+		    $(MAKE) $(MFLAGS) $(@:-ext=) & \
+		    cd %CD% \
+		)
+
 ext/extinit.obj: ext/extinit.c $(SETUP)
-	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
+	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
 
 main.$(OBJEXT): win32.h
+ascii.$(OBJEXT): win32.h
 array.$(OBJEXT): win32.h
 bignum.$(OBJEXT): win32.h
 class.$(OBJEXT): win32.h
@@ -469,6 +579,7 @@ dir.$(OBJEXT): dir.h win32.h
 dln.$(OBJEXT): win32.h
 enum.$(OBJEXT): win32.h
 error.$(OBJEXT): win32.h
+euc_jp.$(OBJEXT): win32.h
 eval.$(OBJEXT): win32.h
 file.$(OBJEXT): win32.h
 gc.$(OBJEXT): win32.h
@@ -486,14 +597,21 @@ prec.$(OBJEXT): win32.h
 random.$(OBJEXT): win32.h
 range.$(OBJEXT): win32.h
 re.$(OBJEXT): win32.h
-regex.$(OBJEXT): win32.h
+regcomp.$(OBJEXT): win32.h
+regenc.$(OBJEXT): win32.h
+regerror.$(OBJEXT): win32.h
+regexec.$(OBJEXT): win32.h
+reggnu.$(OBJEXT): win32.h
+regparse.$(OBJEXT): win32.h
 ruby.$(OBJEXT): win32.h
 signal.$(OBJEXT): win32.h
+sjis.$(OBJEXT): win32.h
 sprintf.$(OBJEXT): win32.h
 st.$(OBJEXT): win32.h
 string.$(OBJEXT): win32.h
 struct.$(OBJEXT): win32.h
 time.$(OBJEXT): win32.h
+utf_8.$(OBJEXT): win32.h
 util.$(OBJEXT): win32.h
 variable.$(OBJEXT): win32.h
 version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
index c27a1261f1..cd33eec0a1 100644
--- a/bcc32/README.bcc32
+++ b/bcc32/README.bcc32
@@ -16,7 +16,7 @@
      * ilink32
 
 (3) If you want to build from CVS source, following commands are required.
-     * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
+     * bison ((<URL:http://gnuwin32.sourceforge.net/packages/bison.htm>))
      * sed   ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
 
 (4) We strongly recommend to build ruby on C++Builder, to link following files.
@@ -30,7 +30,13 @@
 == How to compile and install
 
 (1) Execute bcc32\configure.bat on your build directory.
-     ex. c:\ruby-1.6.7>bcc32\configure.bat
+     ex. c:\src\ruby> bcc32\configure.bat
+    You can specify the target platform as an argument.
+    For example, run `((%configure i686-bccwin32%))'
+    You can also specify the install directory.
+    For example, run `((%configure --prefix=<install_directory>%))'
+    Default of the install directory is /usr .
+    The default ((|<PLATFORM>|)) is `(({i386-bccwin32}))'.
      
 (2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
     if you want to change the name of the executable files. 
@@ -41,20 +47,7 @@
 
 (4) Run `((%make test%))'
 
-(5) Run `((%make DESTDIR=<install_directory> install%))'
-
-    This command will create following directories and install files onto them.
-      * <install_directory>\bin
-      * <install_directory>\lib
-      * <install_directory>\lib\ruby
-      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
-      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
-      * <install_directory>\lib\ruby\site_ruby
-      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
-      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
-      * <install_directory>\man\man1
-    If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
-    The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
+(5) Run `((%make install%))'
 
 (6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
     usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
@@ -90,10 +83,10 @@ in Japanese, but you can download at least.
 
     C:
     cd \ruby
-    bcc32\configure
+    bcc32\configure --prefix=/usr/local
     make
     make test
-    make DESTDIR=/usr/local install
+    make install
 
 * Build on the relative directory from the ruby source directory and CPU type 
   i386.
@@ -108,10 +101,10 @@ in Japanese, but you can download at least.
     cd \ruby
     mkdir bccwin32
     cd bccwin32
-    ..\bcc32\configure target i386-bccwin32
+    ..\bcc32\configure --prefix=/usr/local
     make
     make test
-    make DESTDIR=/usr/local install
+    make install
 
 * Build on the different drive.
 
@@ -122,10 +115,10 @@ in Japanese, but you can download at least.
 
     D:
     cd D:\build\ruby
-    C:\src\ruby\bcc32\configure
+    C:\src\ruby\bcc32\configure --prefix=C:/usr/local
     make
     make test
-    make DESTDIR=C:/usr/local install
+    make install
 
 == Bugs
 
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
index 143ad947f0..8cdfc64b03 100755
--- a/bcc32/configure.bat
+++ b/bcc32/configure.bat
@@ -6,70 +6,120 @@
 echo> ~tmp~.mak ####
 echo>> ~tmp~.mak conf = %0
 echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak 	@del ~tmp~.mak
+echo>> ~tmp~.mak 	@del ~setup~.mak
 echo>> ~tmp~.mak 	@-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
+if exist pathlist.tmp del pathlist.tmp
+if exist confargs.mk del confargs.mk
 :loop
 if "%1" == "" goto :end
 if "%1" == "--prefix" goto :prefix
+if "%1" == "prefix" goto :prefix
 if "%1" == "--srcdir" goto :srcdir
 if "%1" == "srcdir" goto :srcdir
 if "%1" == "--target" goto :target
 if "%1" == "target" goto :target
 if "%1" == "--with-static-linked-ext" goto :extstatic
 if "%1" == "--program-suffix" goto :suffix
-if "%1" == "--program-name" goto :progname
+if "%1" == "RUBY_SUFFIX" goto :suffix
+if "%1" == "--program-name" goto :installname
+if "%1" == "--install-name" goto :installname
+if "%1" == "RUBY_INSTALL_NAME" goto :installname
+if "%1" == "--so-name" goto :soname
+if "%1" == "RUBY_SO_NAME" goto :soname
 if "%1" == "--enable-install-doc" goto :enable-rdoc
 if "%1" == "--disable-install-doc" goto :disable-rdoc
 if "%1" == "--extout" goto :extout
+if "%1" == "EXTOUT" goto :extout
+if "%1" == "--with-baseruby" goto :baseruby
+if "%1" == "BASERUBY" goto :baseruby
+if "%1" == "--path" goto :path
 if "%1" == "-h" goto :help
 if "%1" == "--help" goto :help
-  echo>> ~tmp~.mak 	"%1" \
+  echo>>confargs.tmp 	%1 \
   shift
 goto :loop
 :srcdir
-  echo>> ~tmp~.mak 	-D"srcdir=%2" \
+  echo>> ~tmp~.mak 	-Dsrcdir=%2 \
+  echo>>confargs.tmp 	--srcdir=%2 \
   shift
   shift
 goto :loop
 :prefix
-  echo>> ~tmp~.mak 	-D"prefix=%2" \
+  echo>> ~tmp~.mak 	-Dprefix=%2 \
+  echo>>confargs.tmp 	%1=%2 \
   shift
   shift
 goto :loop
 :suffix
-  echo>> ~tmp~.mak 	-D"RUBY_SUFFIX=%2" \
+  echo>>confargs.mk !ifndef RUBY_SUFFIX
+  echo>>confargs.mk RUBY_SUFFIX = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
   shift
   shift
 goto :loop
 :installname
-  echo>> ~tmp~.mak 	-D"RUBY_INSTALL_NAME=%2" \
+  echo>>confargs.mk !ifndef RUBY_INSTALL_NAME
+  echo>>confargs.mk RUBY_INSTALL_NAME = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
   shift
   shift
 goto :loop
 :soname
-  echo>> ~tmp~.mak 	-D"RUBY_SO_NAME=%2" \
+  echo>>confargs.mk !ifndef RUBY_SO_NAME
+  echo>>confargs.mk RUBY_SO_NAME = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
   shift
   shift
 goto :loop
 :target
-  echo>> ~tmp~.mak 	"%2" \
+  echo>> ~tmp~.mak 	%2 \
+  echo>>confargs.tmp 	--target=%2 \
   shift
   shift
 goto :loop
 :extstatic
-  echo>> ~tmp~.mak 	-D"EXTSTATIC=static" \
+  echo>>confargs.mk !ifndef EXTSTATIC
+  echo>>confargs.mk EXTSTATIC = static
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1 \
   shift
 goto :loop
 :enable-rdoc
-  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-doc" \
+  echo>>confargs.mk !ifndef RDOCTARGET
+  echo>>confargs.mk RDOCTARGET = install-doc
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1 \
   shift
 goto :loop
 :disable-rdoc
-  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-nodoc" \
+  echo>>confargs.mk !ifndef RDOCTARGET
+  echo>>confargs.mk RDOCTARGET = install-nodoc
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1 \
   shift
 goto :loop
 :extout
-  echo>> ~tmp~.mak 	-D"EXTOUT=%2" \
+  echo>>confargs.mk !ifndef EXTOUT
+  echo>>confargs.mk EXTOUT = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:baseruby
+  echo>>confargs.mk !ifndef BASERUBY
+  echo>>confargs.mk BASERUBY = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:path
+  echo>>pathlist.tmp %2;\
+  echo>>confargs.tmp 	%1=%2 \
   shift
   shift
 goto :loop
@@ -82,11 +132,32 @@ goto :loop
   echo System types:
   echo   --target=TARGET         configure for TARGET [i386-bccwin32]
   echo Optional Package:
+  echo   --with-baseruby=RUBY    use RUBY as baseruby [ruby]
   echo   --with-static-linked-ext link external modules statically
   echo   --enable-install-doc    install rdoc indexes during install
+  del *.tmp
   del ~tmp~.mak
 goto :exit
 :end
-echo>> ~tmp~.mak 	-Dbcc32dir="$(@D)"
-make -s -f ~tmp~.mak
+echo>> ~tmp~.mak 	-Dbcc32dir=$(@D)
+if not exist confargs.tmp goto :noconfargs
+    echo>>confargs.mk configure_args = \
+    type>>confargs.mk confargs.tmp
+    echo.>>confargs.mk
+    echo>>confargs.mk ####
+:noconfargs
+if not exist pathlist.tmp goto :nopathlist
+    echo>>confargs.mk pathlist = \
+    type>>confargs.mk pathlist.tmp
+    echo.>>confargs.mk
+    echo>>confargs.mk ####
+    echo>>confargs.mk PATH = $(pathlist:;=/bin;)$(PATH)
+    echo>>confargs.mk INCLUDE = $(pathlist:;=/include;)
+    echo>>confargs.mk LIB = $(pathlist:;=/lib;)
+:nopathlist
+if exist confargs.mk copy confargs.mk ~setup~.mak > nul
+type>>~setup~.mak ~tmp~.mak
+del *.tmp > nul
+del ~tmp~.mak > nul
+make -s -f ~setup~.mak
 :exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
index dc523e2541..888ab2e2a6 100755
--- a/bcc32/mkexports.rb
+++ b/bcc32/mkexports.rb
@@ -1,27 +1,26 @@
 #!./miniruby -s
 
-$name = $library = $description = nil
+$:.unshift(File.expand_path("../..", __FILE__))
+require 'win32/mkexports'
 
-SYM = {}
-STDIN.reopen(open("nul"))
-ARGV.each do |obj|
-  IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
-    next unless /(?:PUBDEF|PUBD32)/ =~ l
-    SYM[$1] = true if /'(.*?)'/ =~ l
+class Exports::Bcc < Exports
+  def forwarding(internal, export)
+    internal[/\A_?/]+export
   end
-end
 
-exports = []
-if $name
-  exports << "Name " + $name
-elsif $library
-  exports << "Library " + $library
-end
-exports << "Description " + $description.dump if $description
-exports << "EXPORTS" << SYM.keys.sort
+  def each_line(objs, &block)
+    objs.each do |obj|
+      opt = /\.(?:so|dll)\z/i =~ obj ? "-ee" : "-oiPUBDEF -oiPUBD32"
+      IO.foreach("|tdump -q #{opt} #{obj.tr('/', '\\')} < nul", &block)
+    end
+  end
 
-if $output
-  open($output, 'w') {|f| f.puts exports.join("\n")}
-else
-  puts exports.join("\n")
+  def each_export(objs)
+    objdump(objs) do |l|
+      next unless /(?:PUBDEF|PUBD32|EXPORT)/ =~ l
+      yield $1 if /'(.*?)'/ =~ l
+    end
+    yield "_strcasecmp", "_stricmp"
+    yield "_strncasecmp", "_strnicmp"
+  end
 end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
index b7a2539d0a..df2fd3c128 100644
--- a/bcc32/setup.mak
+++ b/bcc32/setup.mak
@@ -15,7 +15,7 @@ prefix = /usr
 OS = bccwin32
 RT = $(OS)
 BANG = !
-APPEND = echo>>$(MAKEFILE)
+APPEND = echo.>>$(MAKEFILE)
 !ifdef MAKEFILE
 MAKE = $(MAKE) -f $(MAKEFILE)
 !else
@@ -30,7 +30,9 @@ i586-$(OS): -prologue- -i586- -epilogue-
 i686-$(OS): -prologue- -i686- -epilogue-
 alpha-$(OS): -prologue- -alpha- -epilogue-
 
--prologue-: nul
+-prologue-: -basic-vars- -version- -system-vars-
+
+-basic-vars-: nul
 	@echo Creating $(MAKEFILE)
 	@type > $(MAKEFILE) &&|
 \#\#\# Makefile for ruby $(OS) \#\#\#
@@ -40,36 +42,79 @@ $(BANG)endif
 $(BANG)ifndef prefix
 prefix = $(prefix:\=/)
 $(BANG)endif
-$(BANG)ifndef EXTSTATIC
-EXTSTATIC = $(EXTSTATIC)
-$(BANG)endif
-!if defined(RDOCTARGET)
-$(BANG)ifndef RDOCTARGET
-RDOCTARGET = $(RDOCTARGET)
-$(BANG)endif
+$(BANG)if !defined(BASERUBY)
+!if defined(BASERUBY)
+BASERUBY = $(BASERUBY)
+!endif
+|
+!if !defined(BASERUBY)
+	@for %I in (ruby.exe) do @echo BASERUBY = "%~$$PATH:I" >> $(MAKEFILE)
 !endif
-!if defined(EXTOUT)
-$(BANG)ifndef EXTOUT
-EXTOUT = $(EXTOUT)
+	@type >> $(MAKEFILE) &&|
 $(BANG)endif
+|
+!if exist(confargs.mk)
+	@type confargs.mk >> $(MAKEFILE)
+	@del confargs.mk
 !endif
+
+-system-vars-: -runtime- -bormm-
+
+-bormm-: nul
+	@-ilink32 -q -Gn -x usebormm.lib > nul
+	@-if exist usebormm.tds $(APPEND) MEMLIB = usebormm.lib
+	@if exist usebormm.* del usebormm.*
+
+-osname-: nul
+	@echo OS =  >>$(MAKEFILE)
+
+-runtime-: nul
+	type > conftest.c &&|
+\#include <stdio.h>
+int main(){printf("");return 0;}
 |
-	@type > usebormm.bat &&|
-@echo off
-ilink32 -Gn -x usebormm.lib > nul
-if exist usebormm.tds echo MEMLIB = usebormm.lib
+	bcc32 conftest.c cw32i.lib > nul
+	tdump conftest.exe < nul > conftest.i
+	grep "^Imports from CC" conftest.i > conftest.c
+	cpp32 -P- -DFile=\# -DImports=RTNAME -Dfrom== conftest.c > nul
+	$(MAKE) > nul -DBANG=$(BANG) -f &&|
+-runtime-: nul
+$(BANG)include conftest.i
+RT = $$(RTNAME:.DLL=)
+OS = $$(RT:CC32=)
+-runtime-:
+	del conftest.*
+$(BANG)if "$$(OS)" == "50"
+	echo OS = bccwin32 >> $(MAKEFILE)
+$(BANG)else
+	echo OS = bccwin32_$$(OS) >> $(MAKEFILE)
+$(BANG)endif
 |
-	@usebormm.bat >> $(MAKEFILE)
-	@del usebormm.*
+	@echo RT = $$(OS) >> $(MAKEFILE)
 
+-version-: nul
 	@cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
+\#define RUBY_REVISION 0
 \#include "version.h"
-MAJOR = RUBY_VERSION_MAJOR
-MINOR = RUBY_VERSION_MINOR
-TEENY = RUBY_VERSION_TEENY
+MAJOR = RUBY_API_VERSION_MAJOR
+MINOR = RUBY_API_VERSION_MINOR
+TEENY = RUBY_API_VERSION_TEENY
+
+BORLANDC = __BORLANDC__
 |
-	@type $(MAKEFILE).i >> $(MAKEFILE)
+	@$(MAKE) > nul -DBANG=$(BANG) -f &&,
+-version-: nul
+$(BANG)include $(MAKEFILE)
+$(BANG)include $(MAKEFILE).i
+-version-:
 	@del $(MAKEFILE).i
+	@type >> $(MAKEFILE) &&|
+MAJOR = $$(MAJOR)
+MINOR = $$(MINOR)
+TEENY = $$(TEENY)
+BORLANDC = $$(BORLANDC)
+|
+,
 
 -generic-: nul
 !if defined(PROCESSOR_ARCHITECTURE) ||  defined(PROCESSOR_LEVEL)
@@ -84,7 +129,6 @@ $(BANG)ifndef PROCESSOR_LEVEL
 PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
 $(BANG)endif
 !endif
-
 |
 !endif
 
@@ -114,11 +158,14 @@ $(BANG)endif
 	@$(APPEND) PROCESSOR_LEVEL = 6
 	@$(APPEND) !endif
 
+-epilogue-: -encs-
+
+-encs-: nul
+	@$(MAKE) -f $(srcdir)/win32/enc-setup.mak srcdir="$(srcdir)" MAKEFILE=$(MAKEFILE)
+
 -epilogue-: nul
 	@type >> $(MAKEFILE) &&|
 
-\# OS = $(OS)
-\# RT = $(RT)
 \# RUBY_INSTALL_NAME = ruby
 \# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
 \# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
@@ -129,5 +176,4 @@ $(BANG)endif
 \# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
 $(BANG)include $$(srcdir)/bcc32/Makefile.sub
 |
-	@$(srcdir:/=\)\win32\rm.bat config.h config.status
 	@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..89069db7ab
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i+=1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..01d2ae3219
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i=0
+while i<300000
+  i+=1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7b2f2da5a7
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i=0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i+=1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..7b167af774
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,18 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..fcdbb96e0e
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,17 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..43d35e1131
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i=0
+while i<30_000_000 # benchmark loop 1
+  i+=1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..e514989661
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i=0
+while i< 6_000_000 # benchmark loop 2
+  i+=1
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..6a26465578
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,57 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+def STDOUT.write_ *args
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 12 # 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..56b9410632
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i=0
+while i<10
+  i+=1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..d8b461290c
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i+=1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..f8d26797aa
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i+=1
+  result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..99cf6a91cc
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values ( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop accross the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the curent row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a muliple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # follwing reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is acheived via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/bm_so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
new file mode 100644
index 0000000000..019b8b6382
--- /dev/null
+++ b/benchmark/bm_so_nsieve_bits.rb
@@ -0,0 +1,42 @@
+#!/usr/bin/ruby
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/bm_so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
new file mode 100644
index 0000000000..c7d6fbfb4d
--- /dev/null
+++ b/benchmark/bm_so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize (q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
new file mode 100644
index 0000000000..57f700b863
--- /dev/null
+++ b/benchmark/bm_so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+  (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i=0
+while i<N
+  i+=1
+  gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
new file mode 100644
index 0000000000..3f1b138bd1
--- /dev/null
+++ b/benchmark/bm_so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+  k+=1
+  count = 0
+  flags = flags0.dup
+  i = 2
+  while i<8192
+    i+=1
+    if flags[i]
+      # remove all multiples of prime: i
+      j = i*i
+      while j < 8192
+        j += i
+        flags[j] = nil
+      end
+      count += 1
+    end
+  end
+end
+count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/bm_so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..0a97883974
--- /dev/null
+++ b/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  m{
+  }
+end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..066916dc31
--- /dev/null
+++ b/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i+= 1
+  j = Const
+  k = Const
+end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..b1948f7621
--- /dev/null
+++ b/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i=0
+while i<30_000_000 # benchmark loop 1
+  i+=1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..3ba56427f4
--- /dev/null
+++ b/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i+= 1
+  j = @a
+  k = @a
+end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..c8076c6ab6
--- /dev/null
+++ b/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i+= 1
+  @a = 1
+  @b = 2
+end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..ccb773278f
--- /dev/null
+++ b/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  a.length
+  b.length
+end
+
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..9254a0ca9b
--- /dev/null
+++ b/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i+= 1
+  obj1 != obj2
+end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..ee9d0f3605
--- /dev/null
+++ b/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i+= 1
+  !obj
+end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..3af12bb0f3
--- /dev/null
+++ b/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  begin
+  rescue
+  end
+end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..8e9bcb0129
--- /dev/null
+++ b/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  m
+end
+
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..611baf6b99
--- /dev/null
+++ b/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  a, b = b, a
+end
+
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..7713ae9f25
--- /dev/null
+++ b/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..cd09788a85
--- /dev/null
+++ b/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i=0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i+=1
+  end
+end
+
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..06c0d01baa
--- /dev/null
+++ b/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..e72b4661ac
--- /dev/null
+++ b/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  eval("1")
+end
+
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..f92e39a73f
--- /dev/null
+++ b/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..01b1c478cb
--- /dev/null
+++ b/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m.synchronize{}
+end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..921457d817
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i+=1
+end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..bf09837dd7
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i+=1
+end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..3f51056bf9
--- /dev/null
+++ b/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+  b
+end
+
+pr = m{
+  a = 1
+}
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  pr.call
+end
+
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..428099e55a
--- /dev/null
+++ b/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i=0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+  /hoge/ =~ str
+  i+=1
+end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..37c79fb1c3
--- /dev/null
+++ b/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+  def m
+  end
+end
+
+o = C.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  o.__send__ :m
+end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..d4f0b647de
--- /dev/null
+++ b/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+  def m
+    1
+  end
+end
+
+class CC < C
+  def m
+    super()
+  end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  obj.m
+  i+=1
+end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..775f4d37e6
--- /dev/null
+++ b/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m 100, 200
+end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..7e90df1822
--- /dev/null
+++ b/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+  def m a
+    1
+  end
+end
+
+class CC < C
+  def m a
+    super
+  end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+  obj.m 10
+  i+=1
+end
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
new file mode 100644
index 0000000000..a25c372f06
--- /dev/null
+++ b/benchmark/bm_vm3_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i=0
+while i<200_000
+  i+=1
+
+  Class.new{
+    def m; end
+  }
+end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
new file mode 100755
index 0000000000..7db9829d44
--- /dev/null
+++ b/benchmark/bm_vm3_gc.rb
@@ -0,0 +1,7 @@
+#! /usr/bin/ruby
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+  t = Thread.new{}
+  while t.alive?
+    Thread.pass
+  end
+}
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
new file mode 100644
index 0000000000..325a66d587
--- /dev/null
+++ b/benchmark/bm_vm_thread_create_join.rb
@@ -0,0 +1,6 @@
+i=0
+while i<100_000 # benchmark loop 3
+  i+=1
+  Thread.new{
+  }.join
+end
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
new file mode 100644
index 0000000000..588506e87c
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i=0
+    while i<lmax
+      i+=1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
new file mode 100644
index 0000000000..d700b146d4
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i=0
+    while i<lmax
+      i+=1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
new file mode 100644
index 0000000000..f502b6ac84
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i=0
+    while i<max
+      i+=1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..56b5b0a956
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,8 @@
+1000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i=0
+while i<10000
+  i += 1
+end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
new file mode 100644
index 0000000000..272d231eba
--- /dev/null
+++ b/benchmark/bm_vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Mesure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+  lmax.times{
+    w.write('a')
+  }
+  p "w:exit"
+}, Thread.new{
+  lmax.times{
+    r.read(1)
+  }
+  p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/bmx_temp.rb b/benchmark/bmx_temp.rb
new file mode 100644
index 0000000000..0b4b219ca2
--- /dev/null
+++ b/benchmark/bmx_temp.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i=0
+while i<800000 # benchmark loop 2
+  i+=1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
new file mode 100644
index 0000000000..7dab292a15
--- /dev/null
+++ b/benchmark/driver.rb
@@ -0,0 +1,270 @@
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+  require 'optparse'
+rescue LoadError
+  if first
+    first = false
+    $:.unshift File.join(File.dirname(__FILE__), '../lib')
+    retry
+  else
+    raise
+  end
+end
+
+require 'benchmark'
+require 'pp'
+
+class BenchmarkDriver
+  def self.benchmark(opt)
+    driver = self.new(opt[:execs], opt[:dir], opt)
+    begin
+      driver.run
+    ensure
+      driver.show_results
+    end
+  end
+
+  def output *args
+    puts(*args)
+    @output and @output.puts(*args)
+  end
+
+  def message *args
+    output(*args) if @verbose
+  end
+
+  def message_print *args
+    if @verbose
+      print(*args)
+      STDOUT.flush
+      @output and @output.print(*args)
+    end
+  end
+
+  def progress_message *args
+    unless STDOUT.tty?
+      STDERR.print(*args)
+      STDERR.flush
+    end
+  end
+
+  def initialize execs, dir, opt = {}
+    @execs = execs.map{|e|
+      e.strip!
+      next if e.empty?
+
+      if /(.+)::(.+)/ =~ e
+        # ex) ruby-a::/path/to/ruby-a
+        v = $1.strip
+        e = $2
+      else
+        v =  `#{e} -v`.chomp
+        v.sub!(/ patchlevel \d+/, '')
+      end
+      [e, v]
+    }.compact
+
+    @dir = dir
+    @repeat = opt[:repeat] || 1
+    @repeat = 1 if @repeat < 1
+    @pattern = opt[:pattern] || nil
+    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+    @output = opt[:output] ? open(opt[:output], 'w') : nil
+    @loop_wl1 = @loop_wl2 = nil
+    @opt = opt
+
+    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+    @results = []
+
+    if @verbose
+      @start_time = Time.now
+      message @start_time
+      @execs.each_with_index{|(e, v), i|
+        message "target #{i}: #{v}"
+      }
+    end
+  end
+
+  def average results
+    results.inject(:+) / results.length
+  end
+
+  def show_results
+    output
+
+    if @verbose
+      message '-----------------------------------------------------------'
+      message 'raw data:'
+      message
+      message PP.pp(@results, "", 79)
+      message
+      message "Elapesed time: #{Time.now - @start_time} (sec)"
+    end
+
+    output '-----------------------------------------------------------'
+    output 'benchmark results:'
+
+    if @verbose and @repeat > 1
+      output "minimum results in each #{@repeat} measurements."
+    end
+
+    difference = "\taverage difference" if @execs.length == 2
+    total_difference = 0
+
+    output "name\t#{@execs.map{|(e, v)| v}.join("\t")}#{difference}"
+    @results.each{|v, result|
+      rets = []
+      s = nil
+      result.each_with_index{|e, i|
+        r = e.min
+        case v
+        when /^vm1_/
+          if @loop_wl1
+            r -= @loop_wl1[i]
+            s = '*'
+          end
+        when /^vm2_/
+          if @loop_wl2
+            r -= @loop_wl2[i]
+            s = '*'
+          end
+        end
+        rets << sprintf("%.3f", r)
+      }
+
+      if difference
+        diff = average(result.last) - average(result.first)
+        total_difference += diff
+        rets << sprintf("%.3f", diff)
+      end
+
+      output "#{v}#{s}\t#{rets.join("\t")}"
+    }
+
+    if difference and @verbose
+      output '-----------------------------------------------------------'
+      output "average total difference is #{total_difference}"
+    end
+  end
+
+  def files
+    flag = {}
+    vm1 = vm2 = wl1 = wl2 = false
+    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+      next if @pattern && /#{@pattern}/ !~ File.basename(file)
+      case file
+      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+        flag[$1] = true
+      end
+      file
+    }.compact
+
+    if flag['vm1'] && !flag['whileloop']
+      @files << File.join(@dir, 'bm_loop_whileloop.rb')
+    elsif flag['vm2'] && !flag['whileloop2']
+      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+    end
+
+    @files.sort!
+    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+    @files
+  end
+
+  def run
+    files.each_with_index{|file, i|
+      @i = i
+      r = measure_file(file)
+
+      if /bm_loop_whileloop.rb/ =~ file
+        @loop_wl1 = r[1].map{|e| e.min}
+      elsif /bm_loop_whileloop2.rb/ =~ file
+        @loop_wl2 = r[1].map{|e| e.min}
+      end
+    }
+  end
+
+  def measure_file file
+    name = File.basename(file, '.rb').sub(/^bm_/, '')
+    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+    load prepare_file if FileTest.exist?(prepare_file)
+
+    if @verbose
+      output
+      output '-----------------------------------------------------------'
+      output name
+      output
+      output File.read(file)
+      output
+    end
+
+    result = [name]
+    result << @execs.map{|(e, v)|
+      (0...@repeat).map{
+        message_print "#{v}\t"
+        progress_message '.'
+
+        m = measure(e, file)
+        message "#{m}"
+        m
+      }
+    }
+    @results << result
+    result
+  end
+
+  def measure executable, file
+    cmd = "#{executable} #{file}"
+    m = Benchmark.measure{
+      `#{cmd}`
+    }
+
+    if $? != 0
+      raise "\`#{cmd}\' exited with abnormal status (#{$?})"
+    end
+
+    m.real
+  end
+end
+
+if __FILE__ == $0
+  opt = {
+    :execs => ['ruby'],
+    :dir => './',
+    :repeat => 1,
+    :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}",
+  }
+
+  parser = OptionParser.new{|o|
+    o.on('-e', '--executables [EXECS]',
+         "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e|
+      opt[:execs] = e.split(/;/)
+    }
+    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+      opt[:dir] = d
+    }
+    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+      opt[:pattern] = p
+    }
+    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+      opt[:repeat] = n.to_i
+    }
+    o.on('-o', '--output-file [FILE]', "Output file"){|o|
+      opt[:output] = o
+    }
+    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+      opt[:quiet] = q
+    }
+    o.on('-v', '--verbose'){|v|
+      opt[:verbose] = v
+    }
+  }
+
+  parser.parse!(ARGV)
+  BenchmarkDriver.benchmark(opt)
+end
+
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+		    : Ack($_[0]-1, 1))
+	: $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+    if (not M):
+        return( N + 1 )
+    if (not N):
+        return( Ack(M-1, 1) )
+    return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+    NUM = 9
+    sys.setrecursionlimit(10000)
+    Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+  (cond ((zero? m) (+ n 1))
+	((zero? n) (ack (- m 1) 1))
+	(else      (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+  loop
+  ack
+  fib
+  tak
+  fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+  ruby-cyg
+  ../../../test6/miniruby
+  perl
+  python
+  gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+  .rb
+  .rb
+  .pl
+  .py
+  .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+  m = Benchmark.measure{
+    #p cmd
+    system(cmd)
+  }
+  [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+  r = []
+  Lang.each_with_index{|l, idx|
+    cmd = "#{l} #{b}#{Ext[idx]}"
+    r << bench(cmd)
+  }
+  Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+  my $n = @_[0];
+  if($n < 2){
+    return 1;
+  }
+  else{
+    return $n * fact($n-1);
+  }
+}
+
+for($i=0; $i<10000; $i++){
+  &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..01593965d9
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+	r = 1
+	for x in range(2, n):
+		r *= x
+	return r
+
+def factR(n):
+	if n < 2:
+		return 1
+	else:
+		return n * factR(n-1)
+
+for i in range(10000):
+	factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..7e97b22b39
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+  if n < 2
+    1
+  else
+    n * fact(n-1)
+  end
+end
+
+i=0
+while i<10000
+  i+=1
+  fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+        (if (< n 2)
+            1
+          (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+  (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+  my $n = $_[0];
+  if($n < 3){
+    return 1;
+  }
+  else{
+    return fib($n-1) + fib($n-2);
+  }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+  if n < 3:
+    return 1
+  else:
+    return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+        (if (< n 3)
+            1
+          (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+	pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..d43cef61f3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i=0
+while i<30000000
+  i+=1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+    local($x, $y, $z) = @_;
+    if (!($y < $x)) {
+	return $z;
+    } else {
+	return &tak(&tak($x - 1, $y, $z),
+		    &tak($y - 1, $z, $x),
+		    &tak($z - 1, $x, $y));
+    }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+	if not(y<x):
+		return z
+	else:
+		return tak(tak(x-1, y, z),
+		           tak(y-1, z, x),
+		           tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+        (if (not (< y x))
+            z
+          (tak (tak (- x 1) y z)
+               (tak (- y 1) z x)
+               (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
new file mode 100644
index 0000000000..ee2138cdb2
--- /dev/null
+++ b/benchmark/prepare_so_count_words.rb
@@ -0,0 +1,15 @@
+# prepare 'wc.input'
+
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..f28f4460a1
--- /dev/null
+++ b/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require File.join(File.dirname(__FILE__), 'make_fasta_output')
+prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..7f089109de
--- /dev/null
+++ b/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require File.join(File.dirname(__FILE__), 'make_fasta_output')
+prepare_fasta_output(2_500_000)
diff --git a/benchmark/report.rb b/benchmark/report.rb
new file mode 100644
index 0000000000..d2dc56b1e1
--- /dev/null
+++ b/benchmark/report.rb
@@ -0,0 +1,79 @@
+#
+# YARV benchmark driver
+#
+
+require 'yarvutil'
+require 'benchmark'
+require 'rbconfig'
+
+def exec_command type, file, w
+  <<-EOP
+  $DRIVER_PATH = '#{File.dirname($0)}'
+  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
+  require 'benchmark'
+  require 'yarvutil'
+#  print '#{type}'
+  begin
+    puts Benchmark.measure{
+      #{w}('#{file}')
+    }.utime
+  rescue Exception => exec_command_error_variable
+    puts "\t" + exec_command_error_variable.message
+  end
+  EOP
+end
+
+def benchmark cmd
+  rubybin = ENV['RUBY'] || RbConfig.ruby
+
+  IO.popen(rubybin, 'r+'){|io|
+    io.write cmd
+    io.close_write
+    return io.gets
+  }
+end
+
+def ruby_exec file
+  prog = exec_command 'ruby', file, 'load'
+  benchmark prog
+end
+
+def yarv_exec file
+  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
+  benchmark prog
+end
+
+$wr = $wy = nil
+
+def measure bench
+  file = File.dirname($0) + "/bm_#{bench}.rb"
+  r = ruby_exec(file).to_f
+  y = yarv_exec(file).to_f
+  puts "#{bench}\t#{r}\t#{y}"
+end
+
+def measure2
+  r = ruby_exec.to_f
+  y = yarv_exec.to_f
+  puts r/y
+end
+
+if $0 == __FILE__
+  %w{
+    whileloop
+    whileloop2
+    times
+    const
+    method
+    poly_method
+    block
+    rescue
+    rescue2
+  }.each{|bench|
+    measure bench
+  }
+end
+
+
+
+
diff --git a/benchmark/run.rb b/benchmark/run.rb
new file mode 100644
index 0000000000..0cd2363849
--- /dev/null
+++ b/benchmark/run.rb
@@ -0,0 +1,127 @@
+#
+# Ruby benchmark driver
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$matzrubyonly = false
+$rubyonly = false
+
+$results  = []
+
+# prepare 'wc.input'
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
+
+def bm file
+  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
+  return if prog.empty?
+
+  /[a-z]+_(.+)\.rb/ =~ file
+  bm_name = $1
+  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
+  puts "#{bm_name}: "
+
+
+puts <<EOS unless $matzrubyonly || $rubyonly
+#{prog}
+--
+EOS
+  begin
+    result = [bm_name]
+    result << matzruby_exec(file) unless $rubyonly
+    result << ruby_exec(file) unless $matzrubyonly
+    $results << result
+
+  rescue Exception => e
+    puts
+    puts "** benchmark failure: #{e}"
+    puts e.backtrace
+  end
+end
+
+def benchmark file, bin
+  m = Benchmark.measure{
+    `#{bin} #{$opts} #{file}`
+  }
+  sec = '%.3f' % m.real
+  puts " #{sec}"
+  sec
+end
+
+def ruby_exec file
+  print 'ruby'
+  benchmark file, $ruby_program
+end
+
+def matzruby_exec file
+  print 'matz'
+  rubylib = ENV['RUBYLIB']
+  ENV['RUBYLIB'] = ''
+  r = benchmark file, $matzruby_program
+  ENV['RUBYLIB'] = rubylib
+  r
+end
+
+if $0 == __FILE__
+  ARGV.each{|arg|
+    case arg
+    when /\A--ruby=(.+)/
+      $ruby_program = $1
+    when /\A--matzruby=(.+)/
+      $matzruby_program = $1
+    when /\A--opts=(.+)/
+      $opts = $1
+    when /\A(-r|--only-ruby)\z/
+      $rubyonly = true
+    when /\A(-m|--only-matzruby)\z/
+      $matzrubyonly = true
+    end
+  }
+  ARGV.delete_if{|arg|
+    /\A-/ =~ arg
+  }
+
+  puts "MatzRuby:"
+  system("#{$matzruby_program} -v")
+  puts "Ruby:"
+  system("#{$ruby_program} -v")
+  puts
+
+  if ARGV.empty?
+    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
+      bm file
+    }
+  else
+    ARGV.each{|file|
+      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
+        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
+        bm ef
+      }
+    }
+  end
+
+  puts
+  puts "-- benchmark summary ---------------------------"
+  $results.each{|res|
+    print res.shift, "\t"
+    (res||[]).each{|result|
+      /([\d\.]+)/ =~ result
+      print $1 + "\t" if $1
+    }
+    puts
+  }
+end
+
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
new file mode 100644
index 0000000000..97c5cef045
--- /dev/null
+++ b/benchmark/runc.rb
@@ -0,0 +1,27 @@
+#
+#
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$rubybin = ENV['RUBY'] || RbConfig.ruby
+
+def runfile file
+  puts file
+  file = File.join(File.dirname($0), 'contrib', file)
+  Benchmark.bm{|x|
+    x.report('ruby'){
+      system("#{$rubybin} #{file}")
+    }
+    x.report('yarv'){
+      system("#{$rubybin} -rite -I.. #{file}")
+    }
+  }
+end
+
+ARGV.each{|file|
+  runfile file
+}
+
+
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
new file mode 100644
index 0000000000..41143fbac0
--- /dev/null
+++ b/benchmark/wc.input.base
@@ -0,0 +1,25 @@
+Subject:      Re: Who was Izchak Miller?
+From:         "Jane D. Anonymous" <nobody@yale.edu>
+Date:         1996/04/28
+Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+To:           75176.2330@compuserve.com
+Content-Type: text/plain; charset=us-ascii
+Organization: Yale University
+X-Url:        news:4lk6vl$gde@ns.oar.net
+Mime-Version: 1.0
+Newsgroups:   rec.games.roguelike.nethack
+X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+Hello there, Izchak Miller was my father.  When I was younger I spent 
+many a night, hunched over the keyboard with a cup of tea, playing 
+nethack with him and my brother.  my dad was a philosopher with a strong 
+weakness for fantasy/sci fi.  I remember when he started to get involved 
+with the Nethack team- my brother's Dungeons and Dragons monster book 
+found a regular place beside my dad's desk. it's nice to see him living 
+on in the game he loved so much :-).  
+                                                                  Tamar Miller
+
+The following is a really long word of 5000 characters:
+
+wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index c23b76b1fe..04df7ba4ea 100644
--- a/bignum.c
+++ b/bignum.c
@@ -3,89 +3,206 @@
   bignum.c -
 
   $Author$
-  $Date$
   created at: Fri Jun 10 00:48:55 JST 1994
 
-  Copyright (C) 1993-2003 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
 
 **********************************************************************/
 
-#include "ruby.h"
-#include "rubysig.h"
+#include "ruby/ruby.h"
+#include "ruby/util.h"
+#include "internal.h"
 
+#ifdef HAVE_STRINGS_H
+#include <strings.h>
+#endif
 #include <math.h>
+#include <float.h>
 #include <ctype.h>
 #ifdef HAVE_IEEEFP_H
 #include <ieeefp.h>
 #endif
+#include <assert.h>
 
 VALUE rb_cBignum;
 
+static VALUE big_three = Qnil;
+
 #if defined __MINGW32__
 #define USHORT _USHORT
 #endif
 
-#define BDIGITS(x) ((BDIGIT*)RBIGNUM(x)->digits)
+#define BDIGITS(x) (RBIGNUM_DIGITS(x))
 #define BITSPERDIG (SIZEOF_BDIGITS*CHAR_BIT)
 #define BIGRAD ((BDIGIT_DBL)1 << BITSPERDIG)
-#define DIGSPERLONG ((unsigned int)(SIZEOF_LONG/SIZEOF_BDIGITS))
+#define BIGRAD_HALF ((BDIGIT)(BIGRAD >> 1))
+#define DIGSPERLONG (SIZEOF_LONG/SIZEOF_BDIGITS)
 #if HAVE_LONG_LONG
-# define DIGSPERLL ((unsigned int)(SIZEOF_LONG_LONG/SIZEOF_BDIGITS))
+# define DIGSPERLL (SIZEOF_LONG_LONG/SIZEOF_BDIGITS)
 #endif
 #define BIGUP(x) ((BDIGIT_DBL)(x) << BITSPERDIG)
-#define BIGDN(x) RSHIFT(x,BITSPERDIG)
+#define BIGDN(x) RSHIFT((x),BITSPERDIG)
 #define BIGLO(x) ((BDIGIT)((x) & (BIGRAD-1)))
 #define BDIGMAX ((BDIGIT)-1)
 
-#define BIGZEROP(x) (RBIGNUM(x)->len == 0 || \
+#define BIGZEROP(x) (RBIGNUM_LEN(x) == 0 || \
 		     (BDIGITS(x)[0] == 0 && \
-		      (RBIGNUM(x)->len == 1 || bigzero_p(x))))
+		      (RBIGNUM_LEN(x) == 1 || bigzero_p(x))))
+
+#define BIGNUM_DEBUG 0
+#if BIGNUM_DEBUG
+#define ON_DEBUG(x) do { x; } while (0)
+static void
+dump_bignum(VALUE x)
+{
+    long i;
+    printf("%c0x0", RBIGNUM_SIGN(x) ? '+' : '-');
+    for (i = RBIGNUM_LEN(x); i--; ) {
+	printf("_%08"PRIxBDIGIT, BDIGITS(x)[i]);
+    }
+    printf(", len=%lu", RBIGNUM_LEN(x));
+    puts("");
+}
+
+static VALUE
+rb_big_dump(VALUE x)
+{
+    dump_bignum(x);
+    return x;
+}
+#else
+#define ON_DEBUG(x)
+#endif
 
-static int bigzero_p(VALUE);
 static int
-bigzero_p(x)
-    VALUE x;
+bigzero_p(VALUE x)
 {
     long i;
-    for (i = 0; i < RBIGNUM(x)->len; ++i) {
-	if (BDIGITS(x)[i]) return 0;
+    BDIGIT *ds = BDIGITS(x);
+
+    for (i = RBIGNUM_LEN(x) - 1; 0 <= i; i--) {
+	if (ds[i]) return 0;
     }
     return 1;
 }
 
+int
+rb_bigzero_p(VALUE x)
+{
+    return BIGZEROP(x);
+}
+
+int
+rb_cmpint(VALUE val, VALUE a, VALUE b)
+{
+    if (NIL_P(val)) {
+	rb_cmperr(a, b);
+    }
+    if (FIXNUM_P(val)) {
+        long l = FIX2LONG(val);
+        if (l > 0) return 1;
+        if (l < 0) return -1;
+        return 0;
+    }
+    if (TYPE(val) == T_BIGNUM) {
+	if (BIGZEROP(val)) return 0;
+	if (RBIGNUM_SIGN(val)) return 1;
+	return -1;
+    }
+    if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
+    if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
+    return 0;
+}
+
+#define RBIGNUM_SET_LEN(b,l) \
+    ((RBASIC(b)->flags & RBIGNUM_EMBED_FLAG) ? \
+     (void)(RBASIC(b)->flags = \
+	    (RBASIC(b)->flags & ~RBIGNUM_EMBED_LEN_MASK) | \
+	    ((l) << RBIGNUM_EMBED_LEN_SHIFT)) : \
+     (void)(RBIGNUM(b)->as.heap.len = (l)))
+
+static void
+rb_big_realloc(VALUE big, long len)
+{
+    BDIGIT *ds;
+    if (RBASIC(big)->flags & RBIGNUM_EMBED_FLAG) {
+	if (RBIGNUM_EMBED_LEN_MAX < len) {
+	    ds = ALLOC_N(BDIGIT, len);
+	    MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, RBIGNUM_EMBED_LEN_MAX);
+	    RBIGNUM(big)->as.heap.len = RBIGNUM_LEN(big);
+	    RBIGNUM(big)->as.heap.digits = ds;
+	    RBASIC(big)->flags &= ~RBIGNUM_EMBED_FLAG;
+	}
+    }
+    else {
+	if (len <= RBIGNUM_EMBED_LEN_MAX) {
+	    ds = RBIGNUM(big)->as.heap.digits;
+	    RBASIC(big)->flags |= RBIGNUM_EMBED_FLAG;
+	    RBIGNUM_SET_LEN(big, len);
+	    if (ds) {
+		MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
+		xfree(ds);
+	    }
+	}
+	else {
+	    if (RBIGNUM_LEN(big) == 0) {
+		RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+	    }
+	    else {
+		REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
+	    }
+	}
+    }
+}
+
+void
+rb_big_resize(VALUE big, long len)
+{
+    rb_big_realloc(big, len);
+    RBIGNUM_SET_LEN(big, len);
+}
+
 static VALUE
-bignew_1(klass, len, sign)
-    VALUE klass;
-    long len;
-    int sign;
+bignew_1(VALUE klass, long len, int sign)
 {
     NEWOBJ(big, struct RBignum);
     OBJSETUP(big, klass, T_BIGNUM);
-    big->sign = sign?1:0;
-    big->len = len;
-    big->digits = ALLOC_N(BDIGIT, len);
+    RBIGNUM_SET_SIGN(big, sign?1:0);
+    if (len <= RBIGNUM_EMBED_LEN_MAX) {
+	RBASIC(big)->flags |= RBIGNUM_EMBED_FLAG;
+	RBIGNUM_SET_LEN(big, len);
+    }
+    else {
+	RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+	RBIGNUM(big)->as.heap.len = len;
+    }
 
     return (VALUE)big;
 }
 
-#define bignew(len,sign) bignew_1(rb_cBignum,len,sign)
+#define bignew(len,sign) bignew_1(rb_cBignum,(len),(sign))
 
 VALUE
-rb_big_clone(x)
-    VALUE x;
+rb_big_new(long len, int sign)
 {
-    VALUE z = bignew_1(CLASS_OF(x), RBIGNUM(x)->len, RBIGNUM(x)->sign);
+    return bignew(len, sign != 0);
+}
 
-    MEMCPY(BDIGITS(z), BDIGITS(x), BDIGIT, RBIGNUM(x)->len);
+VALUE
+rb_big_clone(VALUE x)
+{
+    long len = RBIGNUM_LEN(x);
+    VALUE z = bignew_1(CLASS_OF(x), len, RBIGNUM_SIGN(x));
+
+    MEMCPY(BDIGITS(z), BDIGITS(x), BDIGIT, len);
     return z;
 }
 
 /* modify a bignum by 2's complement */
 static void
-get2comp(x)
-    VALUE x;
+get2comp(VALUE x)
 {
-    long i = RBIGNUM(x)->len;
+    long i = RBIGNUM_LEN(x);
     BDIGIT *ds = BDIGITS(x);
     BDIGIT_DBL num;
 
@@ -96,51 +213,56 @@ get2comp(x)
 	num += ds[i];
 	ds[i++] = BIGLO(num);
 	num = BIGDN(num);
-    } while (i < RBIGNUM(x)->len);
+    } while (i < RBIGNUM_LEN(x));
     if (num != 0) {
-	REALLOC_N(RBIGNUM(x)->digits, BDIGIT, ++RBIGNUM(x)->len);
+	rb_big_resize(x, RBIGNUM_LEN(x)+1);
 	ds = BDIGITS(x);
-	ds[RBIGNUM(x)->len-1] = RBIGNUM(x)->sign ? ~0 : 1;
+	ds[RBIGNUM_LEN(x)-1] = 1;
     }
 }
 
 void
-rb_big_2comp(x)			/* get 2's complement */
-    VALUE x;
+rb_big_2comp(VALUE x)			/* get 2's complement */
 {
     get2comp(x);
 }
 
-static VALUE
-bigtrunc(x)
-    VALUE x;
+static inline VALUE
+bigtrunc(VALUE x)
 {
-    long len = RBIGNUM(x)->len;
+    long len = RBIGNUM_LEN(x);
     BDIGIT *ds = BDIGITS(x);
 
     if (len == 0) return x;
     while (--len && !ds[len]);
-    RBIGNUM(x)->len = ++len;
+    if (RBIGNUM_LEN(x) > len+1) {
+	rb_big_resize(x, len+1);
+    }
     return x;
 }
 
-static VALUE
+static inline VALUE
 bigfixize(VALUE x)
 {
-    long len = RBIGNUM(x)->len;
+    long len = RBIGNUM_LEN(x);
     BDIGIT *ds = BDIGITS(x);
 
-    if (len*SIZEOF_BDIGITS <= sizeof(VALUE)) {
+    if (len == 0) return INT2FIX(0);
+    if ((size_t)(len*SIZEOF_BDIGITS) <= sizeof(long)) {
 	long num = 0;
+#if 2*SIZEOF_BDIGITS > SIZEOF_LONG
+	num = (long)ds[0];
+#else
 	while (len--) {
-	    num = BIGUP(num) + ds[len];
+	    num = (long)(BIGUP(num) + ds[len]);
 	}
+#endif
 	if (num >= 0) {
-	    if (RBIGNUM(x)->sign) {
+	    if (RBIGNUM_SIGN(x)) {
 		if (POSFIXABLE(num)) return LONG2FIX(num);
 	    }
 	    else {
-		if (NEGFIXABLE(-(long)num)) return LONG2FIX(-(long)num);
+		if (NEGFIXABLE(-num)) return LONG2FIX(-num);
 	    }
 	}
     }
@@ -157,15 +279,13 @@ bignorm(VALUE x)
 }
 
 VALUE
-rb_big_norm(x)
-    VALUE x;
+rb_big_norm(VALUE x)
 {
     return bignorm(x);
 }
 
 VALUE
-rb_uint2big(n)
-    unsigned long n;
+rb_uint2big(VALUE n)
 {
     BDIGIT_DBL num = n;
     long i = 0;
@@ -181,13 +301,12 @@ rb_uint2big(n)
 
     i = DIGSPERLONG;
     while (--i && !digits[i]) ;
-    RBIGNUM(big)->len = i+1;
+    RBIGNUM_SET_LEN(big, i+1);
     return big;
 }
 
 VALUE
-rb_int2big(n)
-    long n;
+rb_int2big(SIGNED_VALUE n)
 {
     long neg = 0;
     VALUE big;
@@ -198,33 +317,132 @@ rb_int2big(n)
     }
     big = rb_uint2big(n);
     if (neg) {
-	RBIGNUM(big)->sign = 0;
+	RBIGNUM_SET_SIGN(big, 0);
     }
     return big;
 }
 
 VALUE
-rb_uint2inum(n)
-    unsigned long n;
+rb_uint2inum(VALUE n)
 {
     if (POSFIXABLE(n)) return LONG2FIX(n);
     return rb_uint2big(n);
 }
 
 VALUE
-rb_int2inum(n)
-    long n;
+rb_int2inum(SIGNED_VALUE n)
 {
     if (FIXABLE(n)) return LONG2FIX(n);
     return rb_int2big(n);
 }
 
-#ifdef HAVE_LONG_LONG
+#if SIZEOF_LONG % SIZEOF_BDIGITS != 0
+# error unexpected SIZEOF_LONG : SIZEOF_BDIGITS ratio
+#endif
 
+/*
+ * buf is an array of long integers.
+ * buf is ordered from least significant word to most significant word.
+ * buf[0] is the least significant word and
+ * buf[num_longs-1] is the most significant word.
+ * This means words in buf is little endian.
+ * However each word in buf is native endian.
+ * (buf[i]&1) is the least significant bit and
+ * (buf[i]&(1<<(SIZEOF_LONG*CHAR_BIT-1))) is the most significant bit
+ * for each 0 <= i < num_longs.
+ * So buf is little endian at whole on a little endian machine.
+ * But buf is mixed endian on a big endian machine.
+ */
 void
-rb_quad_pack(buf, val)
-    char *buf;
-    VALUE val;
+rb_big_pack(VALUE val, unsigned long *buf, long num_longs)
+{
+    val = rb_to_int(val);
+    if (num_longs == 0)
+        return;
+    if (FIXNUM_P(val)) {
+        long i;
+        long tmp = FIX2LONG(val);
+        buf[0] = (unsigned long)tmp;
+        tmp = tmp < 0 ? ~0L : 0;
+        for (i = 1; i < num_longs; i++)
+            buf[i] = (unsigned long)tmp;
+        return;
+    }
+    else {
+        long len = RBIGNUM_LEN(val);
+        BDIGIT *ds = BDIGITS(val), *dend = ds + len;
+        long i, j;
+        for (i = 0; i < num_longs && ds < dend; i++) {
+            unsigned long l = 0;
+            for (j = 0; j < DIGSPERLONG && ds < dend; j++, ds++) {
+                l |= ((unsigned long)*ds << (j * BITSPERDIG));
+            }
+            buf[i] = l;
+        }
+        for (; i < num_longs; i++)
+            buf[i] = 0;
+        if (RBIGNUM_NEGATIVE_P(val)) {
+            for (i = 0; i < num_longs; i++) {
+                buf[i] = ~buf[i];
+            }
+            for (i = 0; i < num_longs; i++) {
+                buf[i]++;
+                if (buf[i] != 0)
+                    return;
+            }
+        }
+    }
+}
+
+/* See rb_big_pack comment for endianness of buf. */
+VALUE
+rb_big_unpack(unsigned long *buf, long num_longs)
+{
+    while (2 <= num_longs) {
+        if (buf[num_longs-1] == 0 && (long)buf[num_longs-2] >= 0)
+            num_longs--;
+        else if (buf[num_longs-1] == ~0UL && (long)buf[num_longs-2] < 0)
+            num_longs--;
+        else
+            break;
+    }
+    if (num_longs == 0)
+        return INT2FIX(0);
+    else if (num_longs == 1)
+        return LONG2NUM((long)buf[0]);
+    else {
+        VALUE big;
+        BDIGIT *ds;
+        long len = num_longs * DIGSPERLONG;
+        long i;
+        big = bignew(len, 1);
+        ds = BDIGITS(big);
+        for (i = 0; i < num_longs; i++) {
+            unsigned long d = buf[i];
+#if SIZEOF_LONG == SIZEOF_BDIGITS
+            *ds++ = d;
+#else
+            int j;
+            for (j = 0; j < DIGSPERLONG; j++) {
+                *ds++ = BIGLO(d);
+                d = BIGDN(d);
+            }
+#endif
+        }
+        if ((long)buf[num_longs-1] < 0) {
+            get2comp(big);
+            RBIGNUM_SET_SIGN(big, 0);
+        }
+        return bignorm(big);
+    }
+}
+
+#define QUAD_SIZE 8
+
+#if SIZEOF_LONG_LONG == QUAD_SIZE && SIZEOF_BDIGITS*2 == SIZEOF_LONG_LONG
+
+void
+rb_quad_pack(char *buf, VALUE val)
 {
     LONG_LONG q;
 
@@ -233,26 +451,25 @@ rb_quad_pack(buf, val)
 	q = FIX2LONG(val);
     }
     else {
-	long len = RBIGNUM(val)->len;
+	long len = RBIGNUM_LEN(val);
 	BDIGIT *ds;
 
-	if (len > SIZEOF_LONG_LONG/SIZEOF_BDIGITS)
-	    rb_raise(rb_eRangeError, "bignum too big to convert into `quad int'");
+	if (len > SIZEOF_LONG_LONG/SIZEOF_BDIGITS) {
+	    len = SIZEOF_LONG_LONG/SIZEOF_BDIGITS;
+	}
 	ds = BDIGITS(val);
 	q = 0;
 	while (len--) {
 	    q = BIGUP(q);
 	    q += ds[len];
 	}
-	if (!RBIGNUM(val)->sign) q = -q;
+	if (!RBIGNUM_SIGN(val)) q = -q;
     }
     memcpy(buf, (char*)&q, SIZEOF_LONG_LONG);
 }
 
 VALUE
-rb_quad_unpack(buf, sign)
-    const char *buf;
-    int sign;
+rb_quad_unpack(const char *buf, int sign)
 {
     unsigned LONG_LONG q;
     long neg = 0;
@@ -282,22 +499,32 @@ rb_quad_unpack(buf, sign)
 
     i = DIGSPERLL;
     while (i-- && !digits[i]) ;
-    RBIGNUM(big)->len = i+1;
+    RBIGNUM_SET_LEN(big, i+1);
 
     if (neg) {
-	RBIGNUM(big)->sign = 0;
+	RBIGNUM_SET_SIGN(big, 0);
     }
     return bignorm(big);
 }
 
 #else
 
-#define QUAD_SIZE 8
+static int
+quad_buf_complement(char *buf, size_t len)
+{
+    size_t i;
+    for (i = 0; i < len; i++)
+        buf[i] = ~buf[i];
+    for (i = 0; i < len; i++) {
+        buf[i]++;
+        if (buf[i] != 0)
+            return 0;
+    }
+    return 1;
+}
 
 void
-rb_quad_pack(buf, val)
-    char *buf;
-    VALUE val;
+rb_quad_pack(char *buf, VALUE val)
 {
     long len;
 
@@ -306,39 +533,29 @@ rb_quad_pack(buf, val)
     if (FIXNUM_P(val)) {
 	val = rb_int2big(FIX2LONG(val));
     }
-    len = RBIGNUM(val)->len * SIZEOF_BDIGITS;
+    len = RBIGNUM_LEN(val) * SIZEOF_BDIGITS;
     if (len > QUAD_SIZE) {
-	rb_raise(rb_eRangeError, "bignum too big to convert into `quad int'");
+        len = QUAD_SIZE;
     }
     memcpy(buf, (char*)BDIGITS(val), len);
-    if (!RBIGNUM(val)->sign) {
-	len = QUAD_SIZE;
-	while (len--) {
-	    *buf = ~*buf;
-	    buf++;
-	}
+    if (RBIGNUM_NEGATIVE_P(val)) {
+        quad_buf_complement(buf, QUAD_SIZE);
     }
 }
 
-#define BNEG(b) (RSHIFT(((BDIGIT*)b)[QUAD_SIZE/SIZEOF_BDIGITS-1],BITSPERDIG-1) != 0)
+#define BNEG(b) (RSHIFT(((BDIGIT*)(b))[QUAD_SIZE/SIZEOF_BDIGITS-1],BITSPERDIG-1) != 0)
 
 VALUE
-rb_quad_unpack(buf, sign)
-    const char *buf;
-    int sign;
+rb_quad_unpack(const char *buf, int sign)
 {
     VALUE big = bignew(QUAD_SIZE/SIZEOF_BDIGITS, 1);
 
     memcpy((char*)BDIGITS(big), buf, QUAD_SIZE);
     if (sign && BNEG(buf)) {
-	long len = QUAD_SIZE;
 	char *tmp = (char*)BDIGITS(big);
 
-	RBIGNUM(big)->sign = 0;
-	while (len--) {
-	    *tmp = ~*tmp;
-	    tmp++;
-	}
+	RBIGNUM_SET_SIGN(big, 0);
+        quad_buf_complement(tmp, QUAD_SIZE);
     }
 
     return bignorm(big);
@@ -347,10 +564,7 @@ rb_quad_unpack(buf, sign)
 #endif
 
 VALUE
-rb_cstr_to_inum(str, base, badcheck)
-    const char *str;
-    int base;
-    int badcheck;
+rb_cstr_to_inum(const char *str, int base, int badcheck)
 {
     const char *s = str;
     char *end;
@@ -362,23 +576,20 @@ rb_cstr_to_inum(str, base, badcheck)
     VALUE z;
     BDIGIT *zds;
 
+#undef ISDIGIT
+#define ISDIGIT(c) ('0' <= (c) && (c) <= '9')
 #define conv_digit(c) \
     (!ISASCII(c) ? -1 : \
-     isdigit(c) ? ((c) - '0') : \
-     islower(c) ? ((c) - 'a' + 10) : \
-     isupper(c) ? ((c) - 'A' + 10) : \
+     ISDIGIT(c) ? ((c) - '0') : \
+     ISLOWER(c) ? ((c) - 'a' + 10) : \
+     ISUPPER(c) ? ((c) - 'A' + 10) : \
      -1)
 
     if (!str) {
 	if (badcheck) goto bad;
 	return INT2FIX(0);
     }
-    if (badcheck) {
-	while (ISSPACE(*str)) str++;
-    }
-    else {
-	while (ISSPACE(*str) || *str == '_') str++;
-    }
+    while (ISSPACE(*str)) str++;
 
     if (str[0] == '+') {
 	str++;
@@ -449,7 +660,7 @@ rb_cstr_to_inum(str, base, badcheck)
 	break;
       default:
 	if (base < 2 || 36 < base) {
-	    rb_raise(rb_eArgError, "illegal radix %d", base);
+	    rb_raise(rb_eArgError, "invalid radix %d", base);
 	}
 	if (base <= 32) {
 	    len = 5;
@@ -459,8 +670,15 @@ rb_cstr_to_inum(str, base, badcheck)
 	}
 	break;
     }
-    if (*str == '0') {		/* squeeze preceeding 0s */
-	while (*++str == '0');
+    if (*str == '0') {		/* squeeze preceding 0s */
+	int us = 0;
+	while ((c = *++str) == '0' || c == '_') {
+	    if (c == '_') {
+		if (++us >= 2)
+		    break;
+	    } else
+		us = 0;
+	}
 	if (!(c = *str) || ISSPACE(c)) --str;
     }
     c = *str;
@@ -471,10 +689,10 @@ rb_cstr_to_inum(str, base, badcheck)
     }
     len *= strlen(str)*sizeof(char);
 
-    if (len <= (sizeof(VALUE)*CHAR_BIT)) {
-	unsigned long val = strtoul((char*)str, &end, base);
+    if ((size_t)len <= (sizeof(long)*CHAR_BIT)) {
+	unsigned long val = STRTOUL(str, &end, base);
 
-	if (*end == '_') goto bigparse;
+	if (str < end && *end == '_') goto bigparse;
 	if (badcheck) {
 	    if (end == str) goto bad; /* no number */
 	    while (*end && ISSPACE(*end)) end++;
@@ -490,7 +708,7 @@ rb_cstr_to_inum(str, base, badcheck)
 	}
 	else {
 	    VALUE big = rb_uint2big(val);
-	    RBIGNUM(big)->sign = sign;
+	    RBIGNUM_SET_SIGN(big, sign);
 	    return bignorm(big);
 	}
     }
@@ -503,10 +721,11 @@ rb_cstr_to_inum(str, base, badcheck)
     for (i=len;i--;) zds[i]=0;
     while ((c = *str++) != 0) {
 	if (c == '_') {
-	    if (badcheck) {
-		if (nondigit) goto bad;
-		nondigit = c;
+	    if (nondigit) {
+		if (badcheck) goto bad;
+		break;
 	    }
+	    nondigit = c;
 	    continue;
 	}
 	else if ((c = conv_digit(c)) < 0) {
@@ -535,7 +754,7 @@ rb_cstr_to_inum(str, base, badcheck)
 	while (*str && ISSPACE(*str)) str++;
 	if (*str) {
 	  bad:
-	    rb_invalid_str(s, "Integer");
+	    rb_invalid_str(s, "Integer()");
 	}
     }
 
@@ -543,39 +762,40 @@ rb_cstr_to_inum(str, base, badcheck)
 }
 
 VALUE
-rb_str_to_inum(str, base, badcheck)
-    VALUE str;
-    int base;
-    int badcheck;
+rb_str_to_inum(VALUE str, int base, int badcheck)
 {
     char *s;
     long len;
+    VALUE v = 0;
+    VALUE ret;
 
     StringValue(str);
     if (badcheck) {
 	s = StringValueCStr(str);
     }
     else {
-	s = RSTRING(str)->ptr;
+	s = RSTRING_PTR(str);
     }
     if (s) {
-	len = RSTRING(str)->len;
+	len = RSTRING_LEN(str);
 	if (s[len]) {		/* no sentinel somehow */
-	    char *p = ALLOCA_N(char, len+1);
+	    char *p = ALLOCV(v, len+1);
 
 	    MEMCPY(p, s, char, len);
 	    p[len] = '\0';
 	    s = p;
 	}
     }
-    return rb_cstr_to_inum(s, base, badcheck); 
+    ret = rb_cstr_to_inum(s, base, badcheck);
+    if (v)
+	ALLOCV_END(v);
+    return ret;
 }
 
 #if HAVE_LONG_LONG
 
-VALUE
-rb_ull2big(n)
-    unsigned LONG_LONG n;
+static VALUE
+rb_ull2big(unsigned LONG_LONG n)
 {
     BDIGIT_DBL num = n;
     long i = 0;
@@ -591,13 +811,12 @@ rb_ull2big(n)
 
     i = DIGSPERLL;
     while (i-- && !digits[i]) ;
-    RBIGNUM(big)->len = i+1;
+    RBIGNUM_SET_LEN(big, i+1);
     return big;
 }
 
-VALUE
-rb_ll2big(n)
-    LONG_LONG n;
+static VALUE
+rb_ll2big(LONG_LONG n)
 {
     long neg = 0;
     VALUE big;
@@ -608,114 +827,222 @@ rb_ll2big(n)
     }
     big = rb_ull2big(n);
     if (neg) {
-	RBIGNUM(big)->sign = 0;
+	RBIGNUM_SET_SIGN(big, 0);
     }
     return big;
 }
 
 VALUE
-rb_ull2inum(n)
-    unsigned LONG_LONG n;
+rb_ull2inum(unsigned LONG_LONG n)
 {
     if (POSFIXABLE(n)) return LONG2FIX(n);
     return rb_ull2big(n);
 }
 
 VALUE
-rb_ll2inum(n)
-    LONG_LONG n;
+rb_ll2inum(LONG_LONG n)
 {
     if (FIXABLE(n)) return LONG2FIX(n);
     return rb_ll2big(n);
 }
 
 #endif  /* HAVE_LONG_LONG */
- 
+
 VALUE
-rb_cstr2inum(str, base)
-    const char *str;
-    int base;
+rb_cstr2inum(const char *str, int base)
 {
     return rb_cstr_to_inum(str, base, base==0);
 }
 
 VALUE
-rb_str2inum(str, base)
-    VALUE str;
-    int base;
+rb_str2inum(VALUE str, int base)
 {
     return rb_str_to_inum(str, base, base==0);
 }
 
 const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-VALUE
-rb_big2str0(x, base, trim)
-    VALUE x;
-    int base;
-    int trim;
+
+static VALUE bigsqr(VALUE x);
+static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
+
+#define POW2_P(x) (((x)&((x)-1))==0)
+
+static inline int
+ones(register unsigned long x)
 {
-    volatile VALUE t;
-    BDIGIT *ds;
-    long i, j, hbase;
-    VALUE ss;
-    char *s;
+#if SIZEOF_LONG == 8
+# define MASK_55 0x5555555555555555UL
+# define MASK_33 0x3333333333333333UL
+# define MASK_0f 0x0f0f0f0f0f0f0f0fUL
+#else
+# define MASK_55 0x55555555UL
+# define MASK_33 0x33333333UL
+# define MASK_0f 0x0f0f0f0fUL
+#endif
+    x -= (x >> 1) & MASK_55;
+    x = ((x >> 2) & MASK_33) + (x & MASK_33);
+    x = ((x >> 4) + x) & MASK_0f;
+    x += (x >> 8);
+    x += (x >> 16);
+#if SIZEOF_LONG == 8
+    x += (x >> 32);
+#endif
+    return (int)(x & 0x7f);
+#undef MASK_0f
+#undef MASK_33
+#undef MASK_55
+}
+
+static inline unsigned long
+next_pow2(register unsigned long x)
+{
+    x |= x >> 1;
+    x |= x >> 2;
+    x |= x >> 4;
+    x |= x >> 8;
+    x |= x >> 16;
+#if SIZEOF_LONG == 8
+    x |= x >> 32;
+#endif
+    return x + 1;
+}
+
+static inline int
+floor_log2(register unsigned long x)
+{
+    x |= x >> 1;
+    x |= x >> 2;
+    x |= x >> 4;
+    x |= x >> 8;
+    x |= x >> 16;
+#if SIZEOF_LONG == 8
+    x |= x >> 32;
+#endif
+    return (int)ones(x) - 1;
+}
+
+static inline int
+ceil_log2(register unsigned long x)
+{
+    return floor_log2(x) + !POW2_P(x);
+}
+
+#define LOG2_KARATSUBA_DIGITS 7
+#define KARATSUBA_DIGITS (1L<<LOG2_KARATSUBA_DIGITS)
+#define MAX_BIG2STR_TABLE_ENTRIES 64
+
+static VALUE big2str_power_cache[35][MAX_BIG2STR_TABLE_ENTRIES];
+
+static void
+power_cache_init(void)
+{
+    int i, j;
+    for (i = 0; i < 35; ++i) {
+	for (j = 0; j < MAX_BIG2STR_TABLE_ENTRIES; ++j) {
+	    big2str_power_cache[i][j] = Qnil;
+	}
+    }
+}
+
+static inline VALUE
+power_cache_get_power0(int base, int i)
+{
+    if (NIL_P(big2str_power_cache[base - 2][i])) {
+	big2str_power_cache[base - 2][i] =
+	    i == 0 ? rb_big_pow(rb_int2big(base), INT2FIX(KARATSUBA_DIGITS))
+		   : bigsqr(power_cache_get_power0(base, i - 1));
+	rb_gc_register_mark_object(big2str_power_cache[base - 2][i]);
+    }
+    return big2str_power_cache[base - 2][i];
+}
+
+static VALUE
+power_cache_get_power(int base, long n1, long* m1)
+{
+    int i, m;
+    long j;
+    VALUE t;
+
+    if (n1 <= KARATSUBA_DIGITS)
+	rb_bug("n1 > KARATSUBA_DIGITS");
+
+    m = ceil_log2(n1);
+    if (m1) *m1 = 1 << m;
+    i = m - LOG2_KARATSUBA_DIGITS;
+    if (i >= MAX_BIG2STR_TABLE_ENTRIES)
+	i = MAX_BIG2STR_TABLE_ENTRIES - 1;
+    t = power_cache_get_power0(base, i);
+
+    j = KARATSUBA_DIGITS*(1 << i);
+    while (n1 > j) {
+	t = bigsqr(t);
+	j *= 2;
+    }
+    return t;
+}
+
+/* big2str_muraken_find_n1
+ *
+ * Let a natural number x is given by:
+ * x = 2^0 * x_0 + 2^1 * x_1 + ... + 2^(B*n_0 - 1) * x_{B*n_0 - 1},
+ * where B is BITSPERDIG (i.e. BDIGITS*CHAR_BIT) and n_0 is
+ * RBIGNUM_LEN(x).
+ *
+ * Now, we assume n_1 = min_n \{ n | 2^(B*n_0/2) <= b_1^(n_1) \}, so
+ * it is realized that 2^(B*n_0) <= {b_1}^{2*n_1}, where b_1 is a
+ * given radix number. And then, we have n_1 <= (B*n_0) /
+ * (2*log_2(b_1)), therefore n_1 is given by ceil((B*n_0) /
+ * (2*log_2(b_1))).
+ */
+static long
+big2str_find_n1(VALUE x, int base)
+{
+    static const double log_2[] = {
+	1.0,              1.58496250072116, 2.0,
+	2.32192809488736, 2.58496250072116, 2.8073549220576,
+	3.0,              3.16992500144231, 3.32192809488736,
+	3.4594316186373,  3.58496250072116, 3.70043971814109,
+	3.8073549220576,  3.90689059560852, 4.0,
+	4.08746284125034, 4.16992500144231, 4.24792751344359,
+	4.32192809488736, 4.39231742277876, 4.4594316186373,
+	4.52356195605701, 4.58496250072116, 4.64385618977472,
+	4.70043971814109, 4.75488750216347, 4.8073549220576,
+	4.85798099512757, 4.90689059560852, 4.95419631038688,
+	5.0,              5.04439411935845, 5.08746284125034,
+	5.12928301694497, 5.16992500144231
+    };
+    long bits;
+
+    if (base < 2 || 36 < base)
+	rb_bug("invalid radix %d", base);
 
     if (FIXNUM_P(x)) {
-	return rb_fix2str(x, base);
+	bits = (SIZEOF_LONG*CHAR_BIT - 1)/2 + 1;
     }
-    i = RBIGNUM(x)->len;
-    if (BIGZEROP(x)) {
-	return rb_str_new2("0");
+    else if (BIGZEROP(x)) {
+	return 0;
     }
-    if (i >= LONG_MAX/SIZEOF_BDIGITS/CHAR_BIT) {
+    else if (RBIGNUM_LEN(x) >= LONG_MAX/BITSPERDIG) {
 	rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
     }
-    j = SIZEOF_BDIGITS*CHAR_BIT*i;
-    switch (base) {
-      case 2: break;
-      case 3:
-	j = j * 53L / 84 + 1;
-	break;
-      case 4: case 5: case 6: case 7:
-	j = (j + 1) / 2;
-	break;
-      case 8: case 9:
-	j = (j + 2) / 3;
-	break;
-      case 10: case 11: case 12: case 13: case 14: case 15:
-	j = j * 28L / 93 + 1;
-	break;
-      case 16: case 17: case 18: case 19: case 20: case 21:
-      case 22: case 23: case 24: case 25: case 26: case 27:
-      case 28: case 29: case 30: case 31:
-	j = (j + 3) / 4;
-	break;
-      case 32: case 33: case 34: case 35: case 36:
-	j = (j + 4) / 5;
-	break;
-      default:
-	rb_raise(rb_eArgError, "illegal radix %d", base);
-	break;
+    else {
+	bits = BITSPERDIG*RBIGNUM_LEN(x);
     }
-    j++;			/* space for sign */
 
-    hbase = base * base;
-#if SIZEOF_BDIGITS > 2
-    hbase *= hbase;
-#endif
+    return (long)ceil(bits/log_2[base - 2]);
+}
 
-    t = rb_big_clone(x);
-    ds = BDIGITS(t);
-    ss = rb_str_new(0, j+1);
-    s = RSTRING(ss)->ptr;
+static long
+big2str_orig(VALUE x, int base, char* ptr, long len, long hbase, int trim)
+{
+    long i = RBIGNUM_LEN(x), j = len;
+    BDIGIT* ds = BDIGITS(x);
 
-    s[0] = RBIGNUM(x)->sign ? '+' : '-';
-    TRAP_BEG;
-    while (i && j > 1) {
+    while (i && j > 0) {
 	long k = i;
 	BDIGIT_DBL num = 0;
 
-	while (k--) {
+	while (k--) {               /* x / hbase */
 	    num = BIGUP(num) + ds[k];
 	    ds[k] = (BDIGIT)(num / hbase);
 	    num %= hbase;
@@ -723,24 +1050,93 @@ rb_big2str0(x, base, trim)
 	if (trim && ds[i-1] == 0) i--;
 	k = SIZEOF_BDIGITS;
 	while (k--) {
-	    s[--j] = ruby_digitmap[num % base];
+	    ptr[--j] = ruby_digitmap[num % base];
 	    num /= base;
-	    if (!trim && j <= 1) break;
+	    if (j <= 0) break;
 	    if (trim && i == 0 && num == 0) break;
 	}
     }
-    if (trim) {while (s[j] == '0') j++;}
-    i = RSTRING(ss)->len - j;
-    if (RBIGNUM(x)->sign) {
-	memmove(s, s+j, i);
-	RSTRING(ss)->len = i-1;
+    if (trim) {
+	while (j < len && ptr[j] == '0') j++;
+	MEMMOVE(ptr, ptr + j, char, len - j);
+	len -= j;
+    }
+    return len;
+}
+
+static long
+big2str_karatsuba(VALUE x, int base, char* ptr,
+		  long n1, long len, long hbase, int trim)
+{
+    long lh, ll, m1;
+    VALUE b, q, r;
+
+    if (BIGZEROP(x)) {
+	if (trim) return 0;
+	else {
+	    memset(ptr, '0', len);
+	    return len;
+	}
+    }
+
+    if (n1 <= KARATSUBA_DIGITS) {
+	return big2str_orig(x, base, ptr, len, hbase, trim);
+    }
+
+    b = power_cache_get_power(base, n1, &m1);
+    bigdivmod(x, b, &q, &r);
+    lh = big2str_karatsuba(q, base, ptr, (len - m1)/2,
+			   len - m1, hbase, trim);
+    rb_big_resize(q, 0);
+    ll = big2str_karatsuba(r, base, ptr + lh, m1/2,
+			   m1, hbase, !lh && trim);
+    rb_big_resize(r, 0);
+
+    return lh + ll;
+}
+
+VALUE
+rb_big2str0(VALUE x, int base, int trim)
+{
+    int off;
+    VALUE ss, xx;
+    long n1, n2, len, hbase;
+    char* ptr;
+
+    if (FIXNUM_P(x)) {
+	return rb_fix2str(x, base);
+    }
+    if (BIGZEROP(x)) {
+	return rb_usascii_str_new2("0");
+    }
+
+    if (base < 2 || 36 < base)
+	rb_raise(rb_eArgError, "invalid radix %d", base);
+
+    n2 = big2str_find_n1(x, base);
+    n1 = (n2 + 1) / 2;
+    ss = rb_usascii_str_new(0, n2 + 1); /* plus one for sign */
+    ptr = RSTRING_PTR(ss);
+    ptr[0] = RBIGNUM_SIGN(x) ? '+' : '-';
+
+    hbase = base*base;
+#if SIZEOF_BDIGITS > 2
+    hbase *= hbase;
+#endif
+    off = !(trim && RBIGNUM_SIGN(x)); /* erase plus sign if trim */
+    xx = rb_big_clone(x);
+    RBIGNUM_SET_SIGN(xx, 1);
+    if (n1 <= KARATSUBA_DIGITS) {
+	len = off + big2str_orig(xx, base, ptr + off, n2, hbase, trim);
     }
     else {
-	memmove(s+1, s+j, i);
-	RSTRING(ss)->len = i;
+	len = off + big2str_karatsuba(xx, base, ptr + off, n1,
+				      n2, hbase, trim);
     }
-    s[RSTRING(ss)->len] = '\0';
-    TRAP_END;
+    rb_big_resize(xx, 0);
+
+    ptr[len] = '\0';
+    rb_str_resize(ss, len);
 
     return ss;
 }
@@ -748,16 +1144,16 @@ rb_big2str0(x, base, trim)
 VALUE
 rb_big2str(VALUE x, int base)
 {
-    return rb_big2str0(x, base, Qtrue);
+    return rb_big2str0(x, base, 1);
 }
 
 /*
  *  call-seq:
- *     big.to_s(base=10)   =>  string
- *  
+ *     big.to_s(base=10)   ->  string
+ *
  *  Returns a string containing the representation of <i>big</i> radix
  *  <i>base</i> (2 through 36).
- *     
+ *
  *     12345654321.to_s         #=> "12345654321"
  *     12345654321.to_s(2)      #=> "1011011111110110111011110000110001"
  *     12345654321.to_s(8)      #=> "133766736061"
@@ -766,87 +1162,84 @@ rb_big2str(VALUE x, int base)
  */
 
 static VALUE
-rb_big_to_s(argc, argv, x)
-    int argc;
-    VALUE *argv;
-    VALUE x;
+rb_big_to_s(int argc, VALUE *argv, VALUE x)
 {
-    VALUE b;
     int base;
 
-    rb_scan_args(argc, argv, "01", &b);
     if (argc == 0) base = 10;
-    else base = NUM2INT(b);
+    else {
+	VALUE b;
+
+	rb_scan_args(argc, argv, "01", &b);
+	base = NUM2INT(b);
+    }
     return rb_big2str(x, base);
 }
 
-static unsigned long
-big2ulong(x, type)
-    VALUE x;
-    char *type;
+static VALUE
+big2ulong(VALUE x, const char *type, int check)
 {
-    long len = RBIGNUM(x)->len;
+    long len = RBIGNUM_LEN(x);
     BDIGIT_DBL num;
     BDIGIT *ds;
 
-    if (len > SIZEOF_LONG/SIZEOF_BDIGITS)
-	rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+    if (len > DIGSPERLONG) {
+	if (check)
+	    rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+	len = DIGSPERLONG;
+    }
     ds = BDIGITS(x);
     num = 0;
     while (len--) {
 	num = BIGUP(num);
 	num += ds[len];
     }
-    return num;
+    return (VALUE)num;
 }
 
-unsigned long
-rb_big2ulong_pack(x)   
-    VALUE x;  
-{   
-    unsigned long num = big2ulong(x, "unsigned long");
-    if (!RBIGNUM(x)->sign) {
-	return -num;
+VALUE
+rb_big2ulong_pack(VALUE x)
+{
+    VALUE num = big2ulong(x, "unsigned long", FALSE);
+    if (!RBIGNUM_SIGN(x)) {
+	return (VALUE)(-(SIGNED_VALUE)num);
     }
     return num;
-}  
+}
 
-unsigned long
-rb_big2ulong(x)
-    VALUE x;
+VALUE
+rb_big2ulong(VALUE x)
 {
-    unsigned long num = big2ulong(x, "unsigned long");
+    VALUE num = big2ulong(x, "unsigned long", TRUE);
 
-    if (!RBIGNUM(x)->sign) {
+    if (!RBIGNUM_SIGN(x)) {
 	if ((long)num < 0) {
 	    rb_raise(rb_eRangeError, "bignum out of range of unsigned long");
 	}
-	return -num;
+	return (VALUE)(-(SIGNED_VALUE)num);
     }
     return num;
 }
 
-long
-rb_big2long(x)
-    VALUE x;
+SIGNED_VALUE
+rb_big2long(VALUE x)
 {
-    unsigned long num = big2ulong(x, "long");
+    VALUE num = big2ulong(x, "long", TRUE);
 
-    if ((long)num < 0 && (RBIGNUM(x)->sign || (long)num != LONG_MIN)) {
+    if ((long)num < 0 &&
+	(RBIGNUM_SIGN(x) || (long)num != LONG_MIN)) {
 	rb_raise(rb_eRangeError, "bignum too big to convert into `long'");
     }
-    if (!RBIGNUM(x)->sign) return -(long)num;
+    if (!RBIGNUM_SIGN(x)) return -(SIGNED_VALUE)num;
     return num;
 }
 
 #if HAVE_LONG_LONG
 
 static unsigned LONG_LONG
-big2ull(x, type)
-    VALUE x;
-    char *type;
+big2ull(VALUE x, const char *type)
 {
-    long len = RBIGNUM(x)->len;
+    long len = RBIGNUM_LEN(x);
     BDIGIT_DBL num;
     BDIGIT *ds;
 
@@ -862,34 +1255,32 @@ big2ull(x, type)
 }
 
 unsigned LONG_LONG
-rb_big2ull(x)
-    VALUE x;
+rb_big2ull(VALUE x)
 {
     unsigned LONG_LONG num = big2ull(x, "unsigned long long");
 
-    if (!RBIGNUM(x)->sign) return -num;
+    if (!RBIGNUM_SIGN(x))
+	return (VALUE)(-(SIGNED_VALUE)num);
     return num;
 }
 
 LONG_LONG
-rb_big2ll(x)
-    VALUE x;
+rb_big2ll(VALUE x)
 {
     unsigned LONG_LONG num = big2ull(x, "long long");
 
-    if ((LONG_LONG)num < 0 && (RBIGNUM(x)->sign
+    if ((LONG_LONG)num < 0 && (RBIGNUM_SIGN(x)
 			       || (LONG_LONG)num != LLONG_MIN)) {
 	rb_raise(rb_eRangeError, "bignum too big to convert into `long long'");
     }
-    if (!RBIGNUM(x)->sign) return -(LONG_LONG)num;
+    if (!RBIGNUM_SIGN(x)) return -(LONG_LONG)num;
     return num;
 }
 
 #endif  /* HAVE_LONG_LONG */
 
 static VALUE
-dbl2big(d)
-    double d;
+dbl2big(double d)
 {
     long i = 0;
     BDIGIT c;
@@ -921,62 +1312,126 @@ dbl2big(d)
 }
 
 VALUE
-rb_dbl2big(d)
-    double d;
+rb_dbl2big(double d)
 {
     return bignorm(dbl2big(d));
 }
 
-double
-rb_big2dbl(x)
-    VALUE x;
+static int
+nlz(BDIGIT x)
+{
+    BDIGIT y;
+    int n = BITSPERDIG;
+#if BITSPERDIG > 64
+    y = x >> 64; if (y) {n -= 64; x = y;}
+#endif
+#if BITSPERDIG > 32
+    y = x >> 32; if (y) {n -= 32; x = y;}
+#endif
+#if BITSPERDIG > 16
+    y = x >> 16; if (y) {n -= 16; x = y;}
+#endif
+    y = x >>  8; if (y) {n -=  8; x = y;}
+    y = x >>  4; if (y) {n -=  4; x = y;}
+    y = x >>  2; if (y) {n -=  2; x = y;}
+    y = x >>  1; if (y) {return n - 2;}
+    return n - x;
+}
+
+static double
+big2dbl(VALUE x)
 {
     double d = 0.0;
-    long i = RBIGNUM(x)->len;
-    BDIGIT *ds = BDIGITS(x);
+    long i = (bigtrunc(x), RBIGNUM_LEN(x)), lo = 0, bits;
+    BDIGIT *ds = BDIGITS(x), dl;
 
-    while (i--) {
-	d = ds[i] + BIGRAD*d;
+    if (i) {
+	bits = i * BITSPERDIG - nlz(ds[i-1]);
+	if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
+	    d = HUGE_VAL;
+	}
+	else {
+	    if (bits > DBL_MANT_DIG+1)
+		lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
+	    else
+		bits = 0;
+	    while (--i > lo) {
+		d = ds[i] + BIGRAD*d;
+	    }
+	    dl = ds[i];
+	    if (bits && (dl & (1UL << (bits %= BITSPERDIG)))) {
+		int carry = dl & ~(~(BDIGIT)0 << bits);
+		if (!carry) {
+		    while (i-- > 0) {
+			if ((carry = ds[i]) != 0) break;
+		    }
+		}
+		if (carry) {
+		    dl &= (BDIGIT)~0 << bits;
+		    dl += (BDIGIT)1 << bits;
+		    if (!dl) d += 1;
+		}
+	    }
+	    d = dl + BIGRAD*d;
+	    if (lo) {
+		if (lo > INT_MAX / BITSPERDIG)
+		    d = HUGE_VAL;
+		else if (lo < INT_MIN / BITSPERDIG)
+		    d = 0.0;
+		else
+		    d = ldexp(d, (int)(lo * BITSPERDIG));
+	    }
+	}
     }
+    if (!RBIGNUM_SIGN(x)) d = -d;
+    return d;
+}
+
+double
+rb_big2dbl(VALUE x)
+{
+    double d = big2dbl(x);
+
     if (isinf(d)) {
-	rb_warn("Bignum out of Float range");
-	d = HUGE_VAL;
+	rb_warning("Bignum out of Float range");
+	if (d < 0.0)
+	    d = -HUGE_VAL;
+	else
+	    d = HUGE_VAL;
     }
-    if (!RBIGNUM(x)->sign) d = -d;
     return d;
 }
 
 /*
  *  call-seq:
  *     big.to_f -> float
- *  
+ *
  *  Converts <i>big</i> to a <code>Float</code>. If <i>big</i> doesn't
  *  fit in a <code>Float</code>, the result is infinity.
- *     
+ *
  */
 
 static VALUE
-rb_big_to_f(x)
-    VALUE x;
+rb_big_to_f(VALUE x)
 {
-    return rb_float_new(rb_big2dbl(x));
+    return DBL2NUM(rb_big2dbl(x));
 }
 
 /*
  *  call-seq:
- *     big <=> numeric   => -1, 0, +1
- *  
+ *     big <=> numeric   -> -1, 0, +1 or nil
+ *
  *  Comparison---Returns -1, 0, or +1 depending on whether <i>big</i> is
  *  less than, equal to, or greater than <i>numeric</i>. This is the
  *  basis for the tests in <code>Comparable</code>.
- *     
+ *
  */
 
-static VALUE
-rb_big_cmp(x, y)
-    VALUE x, y;
+VALUE
+rb_big_cmp(VALUE x, VALUE y)
 {
-    long xlen = RBIGNUM(x)->len;
+    long xlen = RBIGNUM_LEN(x);
+    BDIGIT *xds, *yds;
 
     switch (TYPE(y)) {
       case T_FIXNUM:
@@ -987,40 +1442,156 @@ rb_big_cmp(x, y)
 	break;
 
       case T_FLOAT:
-	return rb_dbl_cmp(rb_big2dbl(x), RFLOAT(y)->value);
+	{
+	    double a = RFLOAT_VALUE(y);
+
+	    if (isinf(a)) {
+		if (a > 0.0) return INT2FIX(-1);
+		else return INT2FIX(1);
+	    }
+	    return rb_dbl_cmp(rb_big2dbl(x), a);
+	}
 
       default:
-	return rb_num_coerce_cmp(x, y);
+	return rb_num_coerce_cmp(x, y, rb_intern("<=>"));
     }
 
-    if (RBIGNUM(x)->sign > RBIGNUM(y)->sign) return INT2FIX(1);
-    if (RBIGNUM(x)->sign < RBIGNUM(y)->sign) return INT2FIX(-1);
-    if (xlen < RBIGNUM(y)->len)
-	return (RBIGNUM(x)->sign) ? INT2FIX(-1) : INT2FIX(1);
-    if (xlen > RBIGNUM(y)->len)
-	return (RBIGNUM(x)->sign) ? INT2FIX(1) : INT2FIX(-1);
+    if (RBIGNUM_SIGN(x) > RBIGNUM_SIGN(y)) return INT2FIX(1);
+    if (RBIGNUM_SIGN(x) < RBIGNUM_SIGN(y)) return INT2FIX(-1);
+    if (xlen < RBIGNUM_LEN(y))
+	return (RBIGNUM_SIGN(x)) ? INT2FIX(-1) : INT2FIX(1);
+    if (xlen > RBIGNUM_LEN(y))
+	return (RBIGNUM_SIGN(x)) ? INT2FIX(1) : INT2FIX(-1);
+
+    xds = BDIGITS(x);
+    yds = BDIGITS(y);
 
-    while(xlen-- && (BDIGITS(x)[xlen]==BDIGITS(y)[xlen]));
+    while(xlen-- && (xds[xlen]==yds[xlen]));
     if (-1 == xlen) return INT2FIX(0);
-    return (BDIGITS(x)[xlen] > BDIGITS(y)[xlen]) ?
-	(RBIGNUM(x)->sign ? INT2FIX(1) : INT2FIX(-1)) :
-	    (RBIGNUM(x)->sign ? INT2FIX(-1) : INT2FIX(1));
+    return (xds[xlen] > yds[xlen]) ?
+	(RBIGNUM_SIGN(x) ? INT2FIX(1) : INT2FIX(-1)) :
+	    (RBIGNUM_SIGN(x) ? INT2FIX(-1) : INT2FIX(1));
+}
+
+static VALUE
+big_op(VALUE x, VALUE y, int op)
+{
+    VALUE rel;
+    int n;
+
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+      case T_BIGNUM:
+	rel = rb_big_cmp(x, y);
+	break;
+
+      case T_FLOAT:
+	{
+	    double a = RFLOAT_VALUE(y);
+
+	    if (isinf(a)) {
+		if (a > 0.0) rel = INT2FIX(-1);
+		else rel = INT2FIX(1);
+		break;
+	    }
+	    rel = rb_dbl_cmp(rb_big2dbl(x), a);
+	    break;
+	}
+
+      default:
+	{
+	    ID id = 0;
+	    switch (op) {
+		case 0: id = '>'; break;
+		case 1: id = rb_intern(">="); break;
+		case 2: id = '<'; break;
+		case 3: id = rb_intern("<="); break;
+	    }
+	    return rb_num_coerce_relop(x, y, id);
+	}
+    }
+
+    if (NIL_P(rel)) return Qfalse;
+    n = FIX2INT(rel);
+
+    switch (op) {
+	case 0: return n >  0 ? Qtrue : Qfalse;
+	case 1: return n >= 0 ? Qtrue : Qfalse;
+	case 2: return n <  0 ? Qtrue : Qfalse;
+	case 3: return n <= 0 ? Qtrue : Qfalse;
+    }
+    return Qundef;
+}
+
+/*
+ * call-seq:
+ *   big > real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * greater than that of <code>real</code>.
+ */
+
+static VALUE
+big_gt(VALUE x, VALUE y)
+{
+    return big_op(x, y, 0);
+}
+
+/*
+ * call-seq:
+ *   big >= real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * greater than or equal to that of <code>real</code>.
+ */
+
+static VALUE
+big_ge(VALUE x, VALUE y)
+{
+    return big_op(x, y, 1);
+}
+
+/*
+ * call-seq:
+ *   big < real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * less than that of <code>real</code>.
+ */
+
+static VALUE
+big_lt(VALUE x, VALUE y)
+{
+    return big_op(x, y, 2);
+}
+
+/*
+ * call-seq:
+ *   big <= real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * less than or equal to that of <code>real</code>.
+ */
+
+static VALUE
+big_le(VALUE x, VALUE y)
+{
+    return big_op(x, y, 3);
 }
 
 /*
  *  call-seq:
- *     big == obj  => true or false
- *  
+ *     big == obj  -> true or false
+ *
  *  Returns <code>true</code> only if <i>obj</i> has the same value
  *  as <i>big</i>. Contrast this with <code>Bignum#eql?</code>, which
  *  requires <i>obj</i> to be a <code>Bignum</code>.
- *     
+ *
  *     68719476736 == 68719476736.0   #=> true
  */
 
-static VALUE
-rb_big_eq(x, y)
-    VALUE x, y;
+VALUE
+rb_big_eq(VALUE x, VALUE y)
 {
     switch (TYPE(y)) {
       case T_FIXNUM:
@@ -1029,320 +1600,1055 @@ rb_big_eq(x, y)
       case T_BIGNUM:
 	break;
       case T_FLOAT:
-        {
+	{
 	    volatile double a, b;
 
-	    a = RFLOAT(y)->value;
-	    if (isnan(a)) return Qfalse;
+	    a = RFLOAT_VALUE(y);
+	    if (isnan(a) || isinf(a)) return Qfalse;
 	    b = rb_big2dbl(x);
 	    return (a == b)?Qtrue:Qfalse;
 	}
       default:
 	return rb_equal(y, x);
     }
-    if (RBIGNUM(x)->sign != RBIGNUM(y)->sign) return Qfalse;
-    if (RBIGNUM(x)->len != RBIGNUM(y)->len) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,RBIGNUM(y)->len) != 0) return Qfalse;
+    if (RBIGNUM_SIGN(x) != RBIGNUM_SIGN(y)) return Qfalse;
+    if (RBIGNUM_LEN(x) != RBIGNUM_LEN(y)) return Qfalse;
+    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,RBIGNUM_LEN(y)) != 0) return Qfalse;
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     big.eql?(obj)   => true or false
- *  
+ *     big.eql?(obj)   -> true or false
+ *
  *  Returns <code>true</code> only if <i>obj</i> is a
  *  <code>Bignum</code> with the same value as <i>big</i>. Contrast this
  *  with <code>Bignum#==</code>, which performs type conversions.
- *     
+ *
  *     68719476736.eql?(68719476736.0)   #=> false
  */
 
 static VALUE
-rb_big_eql(x, y)
-    VALUE x, y;
+rb_big_eql(VALUE x, VALUE y)
 {
     if (TYPE(y) != T_BIGNUM) return Qfalse;
-    if (RBIGNUM(x)->sign != RBIGNUM(y)->sign) return Qfalse;
-    if (RBIGNUM(x)->len != RBIGNUM(y)->len) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,RBIGNUM(y)->len) != 0) return Qfalse;
+    if (RBIGNUM_SIGN(x) != RBIGNUM_SIGN(y)) return Qfalse;
+    if (RBIGNUM_LEN(x) != RBIGNUM_LEN(y)) return Qfalse;
+    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,RBIGNUM_LEN(y)) != 0) return Qfalse;
     return Qtrue;
 }
 
 /*
  * call-seq:
- *    -big   =>  other_big
+ *    -big   ->  integer
  *
- * Unary minus (returns a new Bignum whose value is 0-big)
+ * Unary minus (returns an integer whose value is 0-big)
  */
 
-static VALUE
-rb_big_uminus(x)
-    VALUE x;
+VALUE
+rb_big_uminus(VALUE x)
 {
     VALUE z = rb_big_clone(x);
 
-    RBIGNUM(z)->sign = !RBIGNUM(x)->sign;
+    RBIGNUM_SET_SIGN(z, !RBIGNUM_SIGN(x));
 
     return bignorm(z);
 }
 
 /*
  * call-seq:
- *     ~big  =>  integer
+ *     ~big  ->  integer
  *
  * Inverts the bits in big. As Bignums are conceptually infinite
  * length, the result acts as if it had an infinite number of one
  * bits to the left. In hex representations, this is displayed
  * as two periods to the left of the digits.
- *  
+ *
  *   sprintf("%X", ~0x1122334455)    #=> "..FEEDDCCBBAA"
  */
 
 static VALUE
-rb_big_neg(x)
-    VALUE x;
+rb_big_neg(VALUE x)
 {
     VALUE z = rb_big_clone(x);
-    long i;
     BDIGIT *ds;
+    long i;
 
-    if (!RBIGNUM(x)->sign) get2comp(z);
+    if (!RBIGNUM_SIGN(x)) get2comp(z);
     ds = BDIGITS(z);
-    i = RBIGNUM(x)->len;
-    if (!i) return INT2FIX(~0);
-    while (i--) ds[i] = ~ds[i];
-    RBIGNUM(z)->sign = !RBIGNUM(z)->sign;
-    if (RBIGNUM(x)->sign) get2comp(z);
+    i = RBIGNUM_LEN(x);
+    if (!i) return INT2FIX(~(SIGNED_VALUE)0);
+    while (i--) {
+	ds[i] = ~ds[i];
+    }
+    RBIGNUM_SET_SIGN(z, !RBIGNUM_SIGN(z));
+    if (RBIGNUM_SIGN(x)) get2comp(z);
 
     return bignorm(z);
 }
 
+static void
+bigsub_core(BDIGIT *xds, long xn, BDIGIT *yds, long yn, BDIGIT *zds, long zn)
+{
+    BDIGIT_DBL_SIGNED num;
+    long i;
+
+    for (i = 0, num = 0; i < yn; i++) {
+	num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    while (num && i < xn) {
+	num += xds[i];
+	zds[i++] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    while (i < xn) {
+	zds[i] = xds[i];
+	i++;
+    }
+    assert(i <= zn);
+    while (i < zn) {
+	zds[i++] = 0;
+    }
+}
+
 static VALUE
-bigsub(x, y)
-    VALUE x, y;
+bigsub(VALUE x, VALUE y)
 {
     VALUE z = 0;
-    BDIGIT *zds;
-    BDIGIT_DBL_SIGNED num;
-    long i = RBIGNUM(x)->len;
-    
-    /* if x is larger than y, swap */
-    if (RBIGNUM(x)->len < RBIGNUM(y)->len) {
+    long i = RBIGNUM_LEN(x);
+    BDIGIT *xds, *yds;
+
+    /* if x is smaller than y, swap */
+    if (RBIGNUM_LEN(x) < RBIGNUM_LEN(y)) {
 	z = x; x = y; y = z;	/* swap x y */
     }
-    else if (RBIGNUM(x)->len == RBIGNUM(y)->len) {
+    else if (RBIGNUM_LEN(x) == RBIGNUM_LEN(y)) {
+	xds = BDIGITS(x);
+	yds = BDIGITS(y);
 	while (i > 0) {
 	    i--;
-	    if (BDIGITS(x)[i] > BDIGITS(y)[i]) {
+	    if (xds[i] > yds[i]) {
 		break;
 	    }
-	    if (BDIGITS(x)[i] < BDIGITS(y)[i]) {
+	    if (xds[i] < yds[i]) {
 		z = x; x = y; y = z;	/* swap x y */
 		break;
 	    }
 	}
     }
 
-    z = bignew(RBIGNUM(x)->len, z==0);
+    z = bignew(RBIGNUM_LEN(x), z==0);
+    bigsub_core(BDIGITS(x), RBIGNUM_LEN(x),
+		BDIGITS(y), RBIGNUM_LEN(y),
+		BDIGITS(z), RBIGNUM_LEN(z));
+
+    return z;
+}
+
+static VALUE bigadd_int(VALUE x, long y);
+
+static VALUE
+bigsub_int(VALUE x, long y0)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long xn;
+    BDIGIT_DBL_SIGNED num;
+    long i, y;
+
+    y = y0;
+    xds = BDIGITS(x);
+    xn = RBIGNUM_LEN(x);
+
+    z = bignew(xn, RBIGNUM_SIGN(x));
     zds = BDIGITS(z);
 
-    for (i = 0, num = 0; i < RBIGNUM(y)->len; i++) { 
-	num += (BDIGIT_DBL_SIGNED)BDIGITS(x)[i] - BDIGITS(y)[i];
+#if SIZEOF_BDIGITS == SIZEOF_LONG
+    num = (BDIGIT_DBL_SIGNED)xds[0] - y;
+    if (xn == 1 && num < 0) {
+	RBIGNUM_SET_SIGN(z, !RBIGNUM_SIGN(x));
+	zds[0] = (BDIGIT)-num;
+	RB_GC_GUARD(x);
+	return bignorm(z);
+    }
+    zds[0] = BIGLO(num);
+    num = BIGDN(num);
+    i = 1;
+#else
+    num = 0;
+    for (i=0; i<(int)(sizeof(y)/sizeof(BDIGIT)); i++) {
+	num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
 	zds[i] = BIGLO(num);
 	num = BIGDN(num);
-    } 
-    while (num && i < RBIGNUM(x)->len) {
-	num += BDIGITS(x)[i];
+	y = BIGDN(y);
+    }
+#endif
+    while (num && i < xn) {
+	num += xds[i];
 	zds[i++] = BIGLO(num);
 	num = BIGDN(num);
     }
-    while (i < RBIGNUM(x)->len) {
-	zds[i] = BDIGITS(x)[i];
+    while (i < xn) {
+	zds[i] = xds[i];
 	i++;
     }
-    
-    return z;
+    if (num < 0) {
+	z = bigsub(x, rb_int2big(y0));
+    }
+    RB_GC_GUARD(x);
+    return bignorm(z);
 }
 
 static VALUE
-bigadd(x, y, sign)
-    VALUE x, y;
-    int sign;
+bigadd_int(VALUE x, long y)
 {
     VALUE z;
+    BDIGIT *xds, *zds;
+    long xn, zn;
     BDIGIT_DBL num;
-    long i, len;
+    long i;
 
-    sign = (sign == RBIGNUM(y)->sign);
-    if (RBIGNUM(x)->sign != sign) {
-	if (sign) return bigsub(y, x);
-	return bigsub(x, y);
-    }
+    xds = BDIGITS(x);
+    xn = RBIGNUM_LEN(x);
 
-    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
-	len = RBIGNUM(x)->len + 1;
-        z = x; x = y; y = z;
+    if (xn < 2) {
+	zn = 3;
     }
     else {
-	len = RBIGNUM(y)->len + 1;
+	zn = xn + 1;
     }
-    z = bignew(len, sign);
+    z = bignew(zn, RBIGNUM_SIGN(x));
+    zds = BDIGITS(z);
 
-    len = RBIGNUM(x)->len;
-    for (i = 0, num = 0; i < len; i++) {
-	num += (BDIGIT_DBL)BDIGITS(x)[i] + BDIGITS(y)[i];
-	BDIGITS(z)[i] = BIGLO(num);
+#if SIZEOF_BDIGITS == SIZEOF_LONG
+    num = (BDIGIT_DBL)xds[0] + y;
+    zds[0] = BIGLO(num);
+    num = BIGDN(num);
+    i = 1;
+#else
+    num = 0;
+    for (i=0; i<(int)(sizeof(y)/sizeof(BDIGIT)); i++) {
+	num += (BDIGIT_DBL)xds[i] + BIGLO(y);
+	zds[i] = BIGLO(num);
 	num = BIGDN(num);
+	y = BIGDN(y);
     }
-    len = RBIGNUM(y)->len;
-    while (num && i < len) {
-	num += BDIGITS(y)[i];
-	BDIGITS(z)[i++] = BIGLO(num);
+#endif
+    while (num && i < xn) {
+	num += xds[i];
+	zds[i++] = BIGLO(num);
 	num = BIGDN(num);
     }
-    while (i < len) {
-	BDIGITS(z)[i] = BDIGITS(y)[i];
+    if (num) zds[i++] = (BDIGIT)num;
+    else while (i < xn) {
+	zds[i] = xds[i];
 	i++;
     }
-    BDIGITS(z)[i] = (BDIGIT)num;
+    assert(i <= zn);
+    while (i < zn) {
+	zds[i++] = 0;
+    }
+    RB_GC_GUARD(x);
+    return bignorm(z);
+}
+
+static void
+bigadd_core(BDIGIT *xds, long xn, BDIGIT *yds, long yn, BDIGIT *zds, long zn)
+{
+    BDIGIT_DBL num = 0;
+    long i;
+
+    if (xn > yn) {
+	BDIGIT *tds;
+	tds = xds; xds = yds; yds = tds;
+	i = xn; xn = yn; yn = i;
+    }
+
+    i = 0;
+    while (i < xn) {
+	num += (BDIGIT_DBL)xds[i] + yds[i];
+	zds[i++] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    while (num && i < yn) {
+	num += yds[i];
+	zds[i++] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    while (i < yn) {
+	zds[i] = yds[i];
+	i++;
+    }
+    if (num) zds[i++] = (BDIGIT)num;
+    assert(i <= zn);
+    while (i < zn) {
+	zds[i++] = 0;
+    }
+}
+
+static VALUE
+bigadd(VALUE x, VALUE y, int sign)
+{
+    VALUE z;
+    long len;
+
+    sign = (sign == RBIGNUM_SIGN(y));
+    if (RBIGNUM_SIGN(x) != sign) {
+	if (sign) return bigsub(y, x);
+	return bigsub(x, y);
+    }
+
+    if (RBIGNUM_LEN(x) > RBIGNUM_LEN(y)) {
+	len = RBIGNUM_LEN(x) + 1;
+    }
+    else {
+	len = RBIGNUM_LEN(y) + 1;
+    }
+    z = bignew(len, sign);
+
+    bigadd_core(BDIGITS(x), RBIGNUM_LEN(x),
+		BDIGITS(y), RBIGNUM_LEN(y),
+		BDIGITS(z), RBIGNUM_LEN(z));
 
     return z;
 }
 
 /*
  *  call-seq:
- *     big + other  => Numeric
+ *     big + other  -> Numeric
  *
  *  Adds big and other, returning the result.
  */
 
 VALUE
-rb_big_plus(x, y)
-    VALUE x, y;
+rb_big_plus(VALUE x, VALUE y)
 {
+    long n;
+
     switch (TYPE(y)) {
       case T_FIXNUM:
-	y = rb_int2big(FIX2LONG(y));
-	/* fall through */
+	n = FIX2LONG(y);
+	if ((n > 0) != RBIGNUM_SIGN(x)) {
+	    if (n < 0) {
+		n = -n;
+	    }
+	    return bigsub_int(x, n);
+	}
+	if (n < 0) {
+	    n = -n;
+	}
+	return bigadd_int(x, n);
+
       case T_BIGNUM:
 	return bignorm(bigadd(x, y, 1));
 
       case T_FLOAT:
-	return rb_float_new(rb_big2dbl(x) + RFLOAT(y)->value);
+	return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, '+');
     }
 }
 
 /*
  *  call-seq:
- *     big - other  => Numeric
+ *     big - other  -> Numeric
  *
  *  Subtracts other from big, returning the result.
  */
 
 VALUE
-rb_big_minus(x, y)
-    VALUE x, y;
+rb_big_minus(VALUE x, VALUE y)
 {
+    long n;
+
     switch (TYPE(y)) {
       case T_FIXNUM:
-	y = rb_int2big(FIX2LONG(y));
-	/* fall through */
+	n = FIX2LONG(y);
+	if ((n > 0) != RBIGNUM_SIGN(x)) {
+	    if (n < 0) {
+		n = -n;
+	    }
+	    return bigadd_int(x, n);
+	}
+	if (n < 0) {
+	    n = -n;
+	}
+	return bigsub_int(x, n);
+
       case T_BIGNUM:
 	return bignorm(bigadd(x, y, 0));
 
       case T_FLOAT:
-	return rb_float_new(rb_big2dbl(x) - RFLOAT(y)->value);
+	return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, '-');
     }
 }
 
-VALUE
-rb_big_mul0(x, y)
-    VALUE x, y;
+static long
+big_real_len(VALUE x)
 {
-    long i, j;
-    BDIGIT_DBL n = 0;
-    VALUE z;
-    BDIGIT *zds;
+    long i = RBIGNUM_LEN(x);
+    BDIGIT *xds = BDIGITS(x);
+    while (--i && !xds[i]);
+    return i + 1;
+}
 
-    if (FIXNUM_P(x)) x = rb_int2big(FIX2LONG(x));
-    switch (TYPE(y)) {
-      case T_FIXNUM:
-	y = rb_int2big(FIX2LONG(y));
-	break;
+static VALUE
+bigmul1_single(VALUE x, VALUE y)
+{
+    BDIGIT_DBL n;
+    VALUE z = bignew(2, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
+    BDIGIT *xds, *yds, *zds;
 
-      case T_BIGNUM:
-	break;
+    xds = BDIGITS(x);
+    yds = BDIGITS(y);
+    zds = BDIGITS(z);
 
-      case T_FLOAT:
-	return rb_float_new(rb_big2dbl(x) * RFLOAT(y)->value);
+    n = (BDIGIT_DBL)xds[0] * yds[0];
+    zds[0] = BIGLO(n);
+    zds[1] = (BDIGIT)BIGDN(n);
 
-      default:
-	return rb_num_coerce_bin(x, y);
-    }
+    return z;
+}
 
-    j = RBIGNUM(x)->len + RBIGNUM(y)->len + 1;
-    z = bignew(j, RBIGNUM(x)->sign==RBIGNUM(y)->sign);
+static VALUE
+bigmul1_normal(VALUE x, VALUE y)
+{
+    long xl = RBIGNUM_LEN(x), yl = RBIGNUM_LEN(y), i, j = xl + yl + 1;
+    BDIGIT_DBL n = 0;
+    VALUE z = bignew(j, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
+    BDIGIT *xds, *yds, *zds;
+
+    xds = BDIGITS(x);
+    yds = BDIGITS(y);
     zds = BDIGITS(z);
     while (j--) zds[j] = 0;
-    for (i = 0; i < RBIGNUM(x)->len; i++) {
-	BDIGIT_DBL dd = BDIGITS(x)[i]; 
+    for (i = 0; i < xl; i++) {
+	BDIGIT_DBL dd;
+	dd = xds[i];
 	if (dd == 0) continue;
 	n = 0;
-	for (j = 0; j < RBIGNUM(y)->len; j++) {
-	    BDIGIT_DBL ee = n + (BDIGIT_DBL)dd * BDIGITS(y)[j];
+	for (j = 0; j < yl; j++) {
+	    BDIGIT_DBL ee = n + (BDIGIT_DBL)dd * yds[j];
 	    n = zds[i + j] + ee;
 	    if (ee) zds[i + j] = BIGLO(n);
 	    n = BIGDN(n);
 	}
 	if (n) {
-	    zds[i + j] = n;
+	    zds[i + j] = (BDIGIT)n;
+	}
+    }
+    rb_thread_check_ints();
+    return z;
+}
+
+static VALUE bigmul0(VALUE x, VALUE y);
+
+/* balancing multiplication by slicing larger argument */
+static VALUE
+bigmul1_balance(VALUE x, VALUE y)
+{
+    VALUE z, t1, t2;
+    long i, xn, yn, r, n;
+    BDIGIT *yds, *zds, *t1ds;
+
+    xn = RBIGNUM_LEN(x);
+    yn = RBIGNUM_LEN(y);
+    assert(2 * xn <= yn || 3 * xn <= 2*(yn+2));
+
+    z = bignew(xn + yn, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
+    t1 = bignew(xn, 1);
+
+    yds = BDIGITS(y);
+    zds = BDIGITS(z);
+    t1ds = BDIGITS(t1);
+
+    for (i = 0; i < xn + yn; i++) zds[i] = 0;
+
+    n = 0;
+    while (yn > 0) {
+	r = xn > yn ? yn : xn;
+	MEMCPY(t1ds, yds + n, BDIGIT, r);
+	RBIGNUM_SET_LEN(t1, r);
+	t2 = bigmul0(x, t1);
+	bigadd_core(zds + n, RBIGNUM_LEN(z) - n,
+		    BDIGITS(t2), big_real_len(t2),
+		    zds + n, RBIGNUM_LEN(z) - n);
+	yn -= r;
+	n += r;
+    }
+
+    return z;
+}
+
+/* split a bignum into high and low bignums */
+static void
+big_split(VALUE v, long n, volatile VALUE *ph, volatile VALUE *pl)
+{
+    long hn = 0, ln = RBIGNUM_LEN(v);
+    VALUE h, l;
+    BDIGIT *vds = BDIGITS(v);
+
+    if (ln > n) {
+	hn = ln - n;
+	ln = n;
+    }
+
+    if (!hn) {
+	h = rb_uint2big(0);
+    }
+    else {
+	while (--hn && !vds[hn + ln]);
+	h = bignew(hn += 2, 1);
+	MEMCPY(BDIGITS(h), vds + ln, BDIGIT, hn - 1);
+	BDIGITS(h)[hn - 1] = 0; /* margin for carry */
+    }
+
+    while (--ln && !vds[ln]);
+    l = bignew(ln += 2, 1);
+    MEMCPY(BDIGITS(l), vds, BDIGIT, ln - 1);
+    BDIGITS(l)[ln - 1] = 0; /* margin for carry */
+
+    *pl = l;
+    *ph = h;
+}
+
+/* multiplication by karatsuba method */
+static VALUE
+bigmul1_karatsuba(VALUE x, VALUE y)
+{
+    long i, n, xn, yn, t1n, t2n;
+    VALUE xh, xl, yh, yl, z, t1, t2, t3;
+    BDIGIT *zds;
+
+    xn = RBIGNUM_LEN(x);
+    yn = RBIGNUM_LEN(y);
+    n = yn / 2;
+    big_split(x, n, &xh, &xl);
+    if (x == y) {
+	yh = xh; yl = xl;
+    }
+    else big_split(y, n, &yh, &yl);
+
+    /* x = xh * b + xl
+     * y = yh * b + yl
+     *
+     * Karatsuba method:
+     *   x * y = z2 * b^2 + z1 * b + z0
+     *   where
+     *     z2 = xh * yh
+     *     z0 = xl * yl
+     *     z1 = (xh + xl) * (yh + yl) - z2 - z0
+     *
+     *  ref: http://en.wikipedia.org/wiki/Karatsuba_algorithm
+     */
+
+    /* allocate a result bignum */
+    z = bignew(xn + yn, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
+    zds = BDIGITS(z);
+
+    /* t1 <- xh * yh */
+    t1 = bigmul0(xh, yh);
+    t1n = big_real_len(t1);
+
+    /* copy t1 into high bytes of the result (z2) */
+    MEMCPY(zds + 2 * n, BDIGITS(t1), BDIGIT, t1n);
+    for (i = 2 * n + t1n; i < xn + yn; i++) zds[i] = 0;
+
+    if (!BIGZEROP(xl) && !BIGZEROP(yl)) {
+	/* t2 <- xl * yl */
+	t2 = bigmul0(xl, yl);
+	t2n = big_real_len(t2);
+
+	/* copy t2 into low bytes of the result (z0) */
+	MEMCPY(zds, BDIGITS(t2), BDIGIT, t2n);
+	for (i = t2n; i < 2 * n; i++) zds[i] = 0;
+    }
+    else {
+	t2 = Qundef;
+	t2n = 0;
+
+	/* copy 0 into low bytes of the result (z0) */
+	for (i = 0; i < 2 * n; i++) zds[i] = 0;
+    }
+
+    /* xh <- xh + xl */
+    if (RBIGNUM_LEN(xl) > RBIGNUM_LEN(xh)) {
+	t3 = xl; xl = xh; xh = t3;
+    }
+    /* xh has a margin for carry */
+    bigadd_core(BDIGITS(xh), RBIGNUM_LEN(xh),
+		BDIGITS(xl), RBIGNUM_LEN(xl),
+		BDIGITS(xh), RBIGNUM_LEN(xh));
+
+    /* yh <- yh + yl */
+    if (x != y) {
+	if (RBIGNUM_LEN(yl) > RBIGNUM_LEN(yh)) {
+	    t3 = yl; yl = yh; yh = t3;
+	}
+	/* yh has a margin for carry */
+	bigadd_core(BDIGITS(yh), RBIGNUM_LEN(yh),
+		    BDIGITS(yl), RBIGNUM_LEN(yl),
+		    BDIGITS(yh), RBIGNUM_LEN(yh));
+    }
+    else yh = xh;
+
+    /* t3 <- xh * yh */
+    t3 = bigmul0(xh, yh);
+
+    i = xn + yn - n;
+    /* subtract t1 from t3 */
+    bigsub_core(BDIGITS(t3), big_real_len(t3), BDIGITS(t1), t1n, BDIGITS(t3), big_real_len(t3));
+
+    /* subtract t2 from t3; t3 is now the middle term of the product */
+    if (t2 != Qundef) bigsub_core(BDIGITS(t3), big_real_len(t3), BDIGITS(t2), t2n, BDIGITS(t3), big_real_len(t3));
+
+    /* add t3 to middle bytes of the result (z1) */
+    bigadd_core(zds + n, i, BDIGITS(t3), big_real_len(t3), zds + n, i);
+
+    return z;
+}
+
+static void
+biglsh_bang(BDIGIT *xds, long xn, unsigned long shift)
+{
+    long const s1 = shift/BITSPERDIG;
+    int const s2 = (int)(shift%BITSPERDIG);
+    int const s3 = BITSPERDIG-s2;
+    BDIGIT* zds;
+    BDIGIT num;
+    long i;
+    if (s1 >= xn) {
+	MEMZERO(xds, BDIGIT, xn);
+	return;
+    }
+    zds = xds + xn - 1;
+    xn -= s1 + 1;
+    num = xds[xn]<<s2;
+    do {
+	*zds-- = num | xds[--xn]>>s3;
+	num = xds[xn]<<s2;
+    }
+    while (xn > 0);
+    *zds = num;
+    for (i = s1; i > 0; --i)
+	*zds-- = 0;
+}
+
+static void
+bigrsh_bang(BDIGIT* xds, long xn, unsigned long shift)
+{
+    long s1 = shift/BITSPERDIG;
+    int s2 = (int)(shift%BITSPERDIG);
+    int s3 = BITSPERDIG - s2;
+    int i;
+    BDIGIT num;
+    BDIGIT* zds;
+    if (s1 >= xn) {
+	MEMZERO(xds, BDIGIT, xn);
+	return;
+    }
+
+    i = 0;
+    zds = xds + s1;
+    num = *zds++>>s2;
+    do {
+	xds[i++] = (BDIGIT)(*zds<<s3) | num;
+	num = *zds++>>s2;
+    }
+    while (i < xn - s1 - 1);
+    xds[i] = num;
+    MEMZERO(xds + xn - s1, BDIGIT, s1);
+}
+
+static void
+big_split3(VALUE v, long n, volatile VALUE* p0, volatile VALUE* p1, volatile VALUE* p2)
+{
+    VALUE v0, v12, v1, v2;
+
+    big_split(v, n, &v12, &v0);
+    big_split(v12, n, &v2, &v1);
+
+    *p0 = bigtrunc(v0);
+    *p1 = bigtrunc(v1);
+    *p2 = bigtrunc(v2);
+}
+
+static VALUE big_lshift(VALUE, unsigned long);
+static VALUE big_rshift(VALUE, unsigned long);
+static VALUE bigdivrem(VALUE, VALUE, volatile VALUE*, volatile VALUE*);
+
+static VALUE
+bigmul1_toom3(VALUE x, VALUE y)
+{
+    long n, xn, yn, zn;
+    VALUE x0, x1, x2, y0, y1, y2;
+    VALUE u0, u1, u2, u3, u4, v1, v2, v3;
+    VALUE z0, z1, z2, z3, z4, z, t;
+    BDIGIT* zds;
+
+    xn = RBIGNUM_LEN(x);
+    yn = RBIGNUM_LEN(y);
+    assert(xn <= yn);  /* assume y >= x */
+
+    n = (yn + 2) / 3;
+    big_split3(x, n, &x0, &x1, &x2);
+    if (x == y) {
+	y0 = x0; y1 = x1; y2 = x2;
+    }
+    else big_split3(y, n, &y0, &y1, &y2);
+
+    /*
+     * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
+     *
+     * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
+     * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
+     *
+     * z(b) = x(b) * y(b)
+     * z(b) = z0 * b^0 + z1 * b^1 + z2 * b^2 + z3 * b^3 + z4 * b^4
+     * where:
+     *   z0 = x0 * y0
+     *   z1 = x0 * y1 + x1 * y0
+     *   z2 = x0 * y2 + x1 * y1 + x2 * y0
+     *   z3 = x1 * y2 + x2 * y1
+     *   z4 = x2 * y2
+     *
+     * Toom3 method (a.k.a. Toom-Cook method):
+     * (Step1) calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4),
+     * where:
+     *   b0 = 0, b1 = 1, b2 = -1, b3 = -2, b4 = inf,
+     *   z(0)   = x(0)   * y(0)   = x0 * y0
+     *   z(1)   = x(1)   * y(1)   = (x0 + x1 + x2) * (y0 + y1 + y2)
+     *   z(-1)  = x(-1)  * y(-1)  = (x0 - x1 + x2) * (y0 - y1 + y2)
+     *   z(-2)  = x(-2)  * y(-2)  = (x0 - 2 * (x1 - 2 * x2)) * (y0 - 2 * (y1 - 2 * y2))
+     *   z(inf) = x(inf) * y(inf) = x2 * y2
+     *
+     * (Step2) interpolating z0, z1, z2, z3, z4, and z5.
+     *
+     * (Step3) Substituting base value into b of the polynomial z(b),
+     */
+
+    /*
+     * [Step1] calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4)
+     */
+
+    /* u1 <- x0 + x2 */
+    u1 = bigtrunc(bigadd(x0, x2, 1));
+
+    /* x(-1) : u2 <- u1 - x1 = x0 - x1 + x2 */
+    u2 = bigtrunc(bigsub(u1, x1));
+
+    /* x(1) : u1 <- u1 + x1 = x0 + x1 + x2 */
+    u1 = bigtrunc(bigadd(u1, x1, 1));
+
+    /* x(-2) : u3 <- 2 * (u2 + x2) - x0 = x0 - 2 * (x1 - 2 * x2) */
+    u3 = bigadd(u2, x2, 1);
+    if (BDIGITS(u3)[RBIGNUM_LEN(u3)-1] & BIGRAD_HALF) {
+	rb_big_resize(u3, RBIGNUM_LEN(u3) + 1);
+	BDIGITS(u3)[RBIGNUM_LEN(u3)-1] = 0;
+    }
+    biglsh_bang(BDIGITS(u3), RBIGNUM_LEN(u3), 1);
+    u3 = bigtrunc(bigadd(bigtrunc(u3), x0, 0));
+
+    if (x == y) {
+	v1 = u1; v2 = u2; v3 = u3;
+    }
+    else {
+	/* v1 <- y0 + y2 */
+	v1 = bigtrunc(bigadd(y0, y2, 1));
+
+	/* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
+	v2 = bigtrunc(bigsub(v1, y1));
+
+	/* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
+	v1 = bigtrunc(bigadd(v1, y1, 1));
+
+	/* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
+	v3 = bigadd(v2, y2, 1);
+	if (BDIGITS(v3)[RBIGNUM_LEN(v3)-1] & BIGRAD_HALF) {
+	    rb_big_resize(v3, RBIGNUM_LEN(v3) + 1);
+	    BDIGITS(v3)[RBIGNUM_LEN(v3)-1] = 0;
 	}
+	biglsh_bang(BDIGITS(v3), RBIGNUM_LEN(v3), 1);
+	v3 = bigtrunc(bigadd(bigtrunc(v3), y0, 0));
     }
 
+    /* z(0) : u0 <- x0 * y0 */
+    u0 = bigtrunc(bigmul0(x0, y0));
+
+    /* z(1) : u1 <- u1 * v1 */
+    u1 = bigtrunc(bigmul0(u1, v1));
+
+    /* z(-1) : u2 <- u2 * v2 */
+    u2 = bigtrunc(bigmul0(u2, v2));
+
+    /* z(-2) : u3 <- u3 * v3 */
+    u3 = bigtrunc(bigmul0(u3, v3));
+
+    /* z(inf) : u4 <- x2 * y2 */
+    u4 = bigtrunc(bigmul0(x2, y2));
+
+    /* for GC */
+    v1 = v2 = v3 = Qnil;
+
+    /*
+     * [Step2] interpolating z0, z1, z2, z3, z4, and z5.
+     */
+
+    /* z0 <- z(0) == u0 */
+    z0 = u0;
+
+    /* z4 <- z(inf) == u4 */
+    z4 = u4;
+
+    /* z3 <- (z(-2) - z(1)) / 3 == (u3 - u1) / 3 */
+    z3 = bigadd(u3, u1, 0);
+    bigdivrem(z3, big_three, &z3, NULL); /* TODO: optimize */
+    bigtrunc(z3);
+
+    /* z1 <- (z(1) - z(-1)) / 2 == (u1 - u2) / 2 */
+    z1 = bigtrunc(bigadd(u1, u2, 0));
+    bigrsh_bang(BDIGITS(z1), RBIGNUM_LEN(z1), 1);
+
+    /* z2 <- z(-1) - z(0) == u2 - u0 */
+    z2 = bigtrunc(bigadd(u2, u0, 0));
+
+    /* z3 <- (z2 - z3) / 2 + 2 * z(inf) == (z2 - z3) / 2 + 2 * u4 */
+    z3 = bigtrunc(bigadd(z2, z3, 0));
+    bigrsh_bang(BDIGITS(z3), RBIGNUM_LEN(z3), 1);
+    t = big_lshift(u4, 1); /* TODO: combining with next addition */
+    z3 = bigtrunc(bigadd(z3, t, 1));
+
+    /* z2 <- z2 + z1 - z(inf) == z2 + z1 - u4 */
+    z2 = bigtrunc(bigadd(z2, z1, 1));
+    z2 = bigtrunc(bigadd(z2, u4, 0));
+
+    /* z1 <- z1 - z3 */
+    z1 = bigtrunc(bigadd(z1, z3, 0));
+
+    /*
+     * [Step3] Substituting base value into b of the polynomial z(b),
+     */
+
+    zn = 6*n + 1;
+    z = bignew(zn, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
+    zds = BDIGITS(z);
+    MEMCPY(zds, BDIGITS(z0), BDIGIT, RBIGNUM_LEN(z0));
+    MEMZERO(zds + RBIGNUM_LEN(z0), BDIGIT, zn - RBIGNUM_LEN(z0));
+    bigadd_core(zds +   n, zn -   n, BDIGITS(z1), big_real_len(z1), zds +   n, zn -   n);
+    bigadd_core(zds + 2*n, zn - 2*n, BDIGITS(z2), big_real_len(z2), zds + 2*n, zn - 2*n);
+    bigadd_core(zds + 3*n, zn - 3*n, BDIGITS(z3), big_real_len(z3), zds + 3*n, zn - 3*n);
+    bigadd_core(zds + 4*n, zn - 4*n, BDIGITS(z4), big_real_len(z4), zds + 4*n, zn - 4*n);
+    z = bignorm(z);
+
+    return bignorm(z);
+}
+
+/* efficient squaring (2 times faster than normal multiplication)
+ * ref: Handbook of Applied Cryptography, Algorithm 14.16
+ *      http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
+ */
+static VALUE
+bigsqr_fast(VALUE x)
+{
+    long len = RBIGNUM_LEN(x), i, j;
+    VALUE z = bignew(2 * len + 1, 1);
+    BDIGIT *xds = BDIGITS(x), *zds = BDIGITS(z);
+    BDIGIT_DBL c, v, w;
+
+    for (i = 2 * len + 1; i--; ) zds[i] = 0;
+    for (i = 0; i < len; i++) {
+	v = (BDIGIT_DBL)xds[i];
+	if (!v) continue;
+	c = (BDIGIT_DBL)zds[i + i] + v * v;
+	zds[i + i] = BIGLO(c);
+	c = BIGDN(c);
+	v *= 2;
+	for (j = i + 1; j < len; j++) {
+	    w = (BDIGIT_DBL)xds[j];
+	    c += (BDIGIT_DBL)zds[i + j] + BIGLO(v) * w;
+	    zds[i + j] = BIGLO(c);
+	    c = BIGDN(c);
+	    if (BIGDN(v)) c += w;
+	}
+	if (c) {
+	    c += (BDIGIT_DBL)zds[i + len];
+	    zds[i + len] = BIGLO(c);
+	    c = BIGDN(c);
+	}
+	if (c) zds[i + len + 1] += (BDIGIT)c;
+    }
     return z;
 }
 
+#define KARATSUBA_MUL_DIGITS 70
+#define TOOM3_MUL_DIGITS 150
+
+
+/* determine whether a bignum is sparse or not by random sampling */
+static inline VALUE
+big_sparse_p(VALUE x)
+{
+    long c = 0, n = RBIGNUM_LEN(x);
+
+    if (          BDIGITS(x)[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (c <= 1 && BDIGITS(x)[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (c <= 1 && BDIGITS(x)[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+
+    return (c <= 1) ? Qtrue : Qfalse;
+}
+
+static VALUE
+bigmul0(VALUE x, VALUE y)
+{
+    long xn, yn;
+
+    xn = RBIGNUM_LEN(x);
+    yn = RBIGNUM_LEN(y);
+
+    /* make sure that y is longer than x */
+    if (xn > yn) {
+	VALUE t;
+	long tn;
+	t = x; x = y; y = t;
+	tn = xn; xn = yn; yn = tn;
+    }
+    assert(xn <= yn);
+
+    /* normal multiplication when x is small */
+    if (xn < KARATSUBA_MUL_DIGITS) {
+      normal:
+	if (x == y) return bigsqr_fast(x);
+	if (xn == 1 && yn == 1) return bigmul1_single(x, y);
+	return bigmul1_normal(x, y);
+    }
+
+    /* normal multiplication when x or y is a sparse bignum */
+    if (big_sparse_p(x)) goto normal;
+    if (big_sparse_p(y)) return bigmul1_normal(y, x);
+
+    /* balance multiplication by slicing y when x is much smaller than y */
+    if (2 * xn <= yn) return bigmul1_balance(x, y);
+
+    if (xn < TOOM3_MUL_DIGITS) {
+	/* multiplication by karatsuba method */
+	return bigmul1_karatsuba(x, y);
+    }
+    else if (3*xn <= 2*(yn + 2))
+	return bigmul1_balance(x, y);
+    return bigmul1_toom3(x, y);
+}
+
 /*
  *  call-seq:
- *     big * other  => Numeric
+ *     big * other  -> Numeric
  *
  *  Multiplies big and other, returning the result.
  */
 
 VALUE
-rb_big_mul(x, y)
-    VALUE x, y;
+rb_big_mul(VALUE x, VALUE y)
 {
-    return bignorm(rb_big_mul0(x, y));
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = rb_int2big(FIX2LONG(y));
+	break;
+
+      case T_BIGNUM:
+	break;
+
+      case T_FLOAT:
+	return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
+
+      default:
+	return rb_num_coerce_bin(x, y, '*');
+    }
+
+    return bignorm(bigmul0(x, y));
+}
+
+struct big_div_struct {
+    long nx, ny;
+    BDIGIT *yds, *zds;
+    VALUE stop;
+};
+
+static VALUE
+bigdivrem1(void *ptr)
+{
+    struct big_div_struct *bds = (struct big_div_struct*)ptr;
+    long nx = bds->nx, ny = bds->ny;
+    long i, j, nyzero;
+    BDIGIT *yds = bds->yds, *zds = bds->zds;
+    BDIGIT_DBL t2;
+    BDIGIT_DBL_SIGNED num;
+    BDIGIT q;
+
+    j = nx==ny?nx+1:nx;
+    for (nyzero = 0; !yds[nyzero]; nyzero++);
+    do {
+	if (bds->stop) return Qnil;
+	if (zds[j] ==  yds[ny-1]) q = (BDIGIT)BIGRAD-1;
+	else q = (BDIGIT)((BIGUP(zds[j]) + zds[j-1])/yds[ny-1]);
+	if (q) {
+           i = nyzero; num = 0; t2 = 0;
+	    do {			/* multiply and subtract */
+		BDIGIT_DBL ee;
+		t2 += (BDIGIT_DBL)yds[i] * q;
+		ee = num - BIGLO(t2);
+		num = (BDIGIT_DBL)zds[j - ny + i] + ee;
+		if (ee) zds[j - ny + i] = BIGLO(num);
+		num = BIGDN(num);
+		t2 = BIGDN(t2);
+	    } while (++i < ny);
+	    num += zds[j - ny + i] - t2;/* borrow from high digit; don't update */
+	    while (num) {		/* "add back" required */
+		i = 0; num = 0; q--;
+		do {
+		    BDIGIT_DBL ee = num + yds[i];
+		    num = (BDIGIT_DBL)zds[j - ny + i] + ee;
+		    if (ee) zds[j - ny + i] = BIGLO(num);
+		    num = BIGDN(num);
+		} while (++i < ny);
+		num--;
+	    }
+	}
+	zds[j] = q;
+    } while (--j >= ny);
+    return Qnil;
 }
 
 static void
-bigdivrem(x, y, divp, modp)
-    VALUE x, y;
-    VALUE *divp, *modp;
+rb_big_stop(void *ptr)
+{
+    VALUE *stop = (VALUE*)ptr;
+    *stop = Qtrue;
+}
+
+static VALUE
+bigdivrem(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
 {
-    long nx = RBIGNUM(x)->len, ny = RBIGNUM(y)->len;
+    struct big_div_struct bds;
+    long nx = RBIGNUM_LEN(x), ny = RBIGNUM_LEN(y);
     long i, j;
-    VALUE yy, z;
+    VALUE z, yy, zz;
     BDIGIT *xds, *yds, *zds, *tds;
     BDIGIT_DBL t2;
-    BDIGIT_DBL_SIGNED num;
     BDIGIT dd, q;
 
     if (BIGZEROP(y)) rb_num_zerodiv();
+    xds = BDIGITS(x);
     yds = BDIGITS(y);
-    if (nx < ny || (nx == ny && BDIGITS(x)[nx - 1] < BDIGITS(y)[ny - 1])) {
+    if (nx < ny || (nx == ny && xds[nx - 1] < yds[ny - 1])) {
 	if (divp) *divp = rb_int2big(0);
 	if (modp) *modp = x;
-	return;
+	return Qnil;
     }
-    xds = BDIGITS(x);
     if (ny == 1) {
 	dd = yds[0];
 	z = rb_big_clone(x);
@@ -1353,23 +2659,24 @@ bigdivrem(x, y, divp, modp)
 	    zds[i] = (BDIGIT)(t2 / dd);
 	    t2 %= dd;
 	}
-	RBIGNUM(z)->sign = RBIGNUM(x)->sign==RBIGNUM(y)->sign;
+	RBIGNUM_SET_SIGN(z, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
 	if (modp) {
-	    *modp = rb_uint2big((unsigned long)t2);
-	    RBIGNUM(*modp)->sign = RBIGNUM(x)->sign;
+	    *modp = rb_uint2big((VALUE)t2);
+	    RBIGNUM_SET_SIGN(*modp, RBIGNUM_SIGN(x));
 	}
 	if (divp) *divp = z;
-	return;
+	return Qnil;
     }
-    z = bignew(nx==ny?nx+2:nx+1, RBIGNUM(x)->sign==RBIGNUM(y)->sign);
+
+    z = bignew(nx==ny?nx+2:nx+1, RBIGNUM_SIGN(x)==RBIGNUM_SIGN(y));
     zds = BDIGITS(z);
     if (nx==ny) zds[nx+1] = 0;
     while (!yds[ny-1]) ny--;
 
     dd = 0;
     q = yds[ny-1];
-    while ((q & (1<<(BITSPERDIG-1))) == 0) {
-	q <<= 1;
+    while ((q & (BDIGIT)(1UL<<(BITSPERDIG-1))) == 0) {
+	q <<= 1UL;
 	dd++;
     }
     if (dd) {
@@ -1383,6 +2690,7 @@ bigdivrem(x, y, divp, modp)
 	    t2 = BIGDN(t2);
 	}
 	yds = tds;
+	RB_GC_GUARD(y) = yy;
 	j = 0;
 	t2 = 0;
 	while (j<nx) {
@@ -1398,45 +2706,29 @@ bigdivrem(x, y, divp, modp)
 	while (j--) zds[j] = xds[j];
     }
 
-    j = nx==ny?nx+1:nx;
-    do {
-	if (zds[j] ==  yds[ny-1]) q = BIGRAD-1;
-	else q = (BDIGIT)((BIGUP(zds[j]) + zds[j-1])/yds[ny-1]);
-	if (q) {
-	    i = 0; num = 0; t2 = 0;
-	    do {			/* multiply and subtract */
-		BDIGIT_DBL ee;
-		t2 += (BDIGIT_DBL)yds[i] * q;
-		ee = num - BIGLO(t2);
-		num = (BDIGIT_DBL)zds[j - ny + i] + ee;
-		if (ee) zds[j - ny + i] = BIGLO(num);
-		num = BIGDN(num);
-		t2 = BIGDN(t2);
-	    } while (++i < ny);
-	    num += zds[j - ny + i] - t2;/* borrow from high digit; don't update */
-	    while (num) {		/* "add back" required */
-		i = 0; num = 0; q--;
-		do {
-		    BDIGIT_DBL ee = num + yds[i];
-		    num = (BDIGIT_DBL)zds[j - ny + i] + ee;
-		    if (ee) zds[j - ny + i] = BIGLO(num);
-		    num = BIGDN(num);
-		} while (++i < ny);
-		num--;
-	    }
-	}
-	zds[j] = q;
-    } while (--j >= ny);
+    bds.nx = nx;
+    bds.ny = ny;
+    bds.zds = zds;
+    bds.yds = yds;
+    bds.stop = Qfalse;
+    if (nx > 10000 || ny > 10000) {
+	rb_thread_blocking_region(bigdivrem1, &bds, rb_big_stop, &bds.stop);
+    }
+    else {
+	bigdivrem1(&bds);
+    }
+
     if (divp) {			/* move quotient down in z */
-	*divp = rb_big_clone(z);
-	zds = BDIGITS(*divp);
+	*divp = zz = rb_big_clone(z);
+	zds = BDIGITS(zz);
 	j = (nx==ny ? nx+2 : nx+1) - ny;
 	for (i = 0;i < j;i++) zds[i] = zds[i+ny];
-	RBIGNUM(*divp)->len = i;
+	if (!zds[i-1]) i--;
+	RBIGNUM_SET_LEN(zz, i);
     }
     if (modp) {			/* normalize remainder */
-	*modp = rb_big_clone(z);
-	zds = BDIGITS(*modp);
+	*modp = zz = rb_big_clone(z);
+	zds = BDIGITS(zz);
 	while (--ny && !zds[ny]); ++ny;
 	if (dd) {
 	    t2 = 0; i = ny;
@@ -1447,40 +2739,31 @@ bigdivrem(x, y, divp, modp)
 		t2 = BIGUP(q);
 	    }
 	}
-	RBIGNUM(*modp)->len = ny;
-	RBIGNUM(*modp)->sign = RBIGNUM(x)->sign;
+	if (!zds[ny-1]) ny--;
+	RBIGNUM_SET_LEN(zz, ny);
+	RBIGNUM_SET_SIGN(zz, RBIGNUM_SIGN(x));
     }
+    return z;
 }
 
 static void
-bigdivmod(x, y, divp, modp)
-    VALUE x, y;
-    VALUE *divp, *modp;
+bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
 {
     VALUE mod;
 
     bigdivrem(x, y, divp, &mod);
-    if (RBIGNUM(x)->sign != RBIGNUM(y)->sign && !BIGZEROP(mod)) {
+    if (RBIGNUM_SIGN(x) != RBIGNUM_SIGN(y) && !BIGZEROP(mod)) {
 	if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
 	if (modp) *modp = bigadd(mod, y, 1);
     }
-    else {
-	if (divp) *divp = *divp;
-	if (modp) *modp = mod;
+    else if (modp) {
+	*modp = mod;
     }
 }
 
-/*
- *  call-seq:
- *     big / other     => Numeric
- *     big.div(other)  => Numeric
- *
- *  Divides big by other, returning the result.
- */
 
 static VALUE
-rb_big_div(x, y)
-    VALUE x, y;
+rb_big_divide(VALUE x, VALUE y, ID op)
 {
     VALUE z;
 
@@ -1493,10 +2776,18 @@ rb_big_div(x, y)
 	break;
 
       case T_FLOAT:
-	return rb_float_new(rb_big2dbl(x) / RFLOAT(y)->value);
+	{
+	    double div = rb_big2dbl(x) / RFLOAT_VALUE(y);
+	    if (op == '/') {
+		return DBL2NUM(div);
+	    }
+	    else {
+		return rb_dbl2big(div);
+	    }
+	}
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, op);
     }
     bigdivmod(x, y, &z, 0);
 
@@ -1505,16 +2796,43 @@ rb_big_div(x, y)
 
 /*
  *  call-seq:
- *     big % other         => Numeric
- *     big.modulo(other)   => Numeric
+ *     big / other     -> Numeric
+ *
+ * Performs division: the class of the resulting object depends on
+ * the class of <code>numeric</code> and on the magnitude of the
+ * result.
+ */
+
+VALUE
+rb_big_div(VALUE x, VALUE y)
+{
+    return rb_big_divide(x, y, '/');
+}
+
+/*
+ *  call-seq:
+ *     big.div(other)  -> integer
+ *
+ * Performs integer division: returns integer value.
+ */
+
+VALUE
+rb_big_idiv(VALUE x, VALUE y)
+{
+    return rb_big_divide(x, y, rb_intern("div"));
+}
+
+/*
+ *  call-seq:
+ *     big % other         -> Numeric
+ *     big.modulo(other)   -> Numeric
  *
  *  Returns big modulo other. See Numeric.divmod for more
  *  information.
  */
 
-static VALUE
-rb_big_modulo(x, y)
-    VALUE x, y;
+VALUE
+rb_big_modulo(VALUE x, VALUE y)
 {
     VALUE z;
 
@@ -1527,7 +2845,7 @@ rb_big_modulo(x, y)
 	break;
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, '%');
     }
     bigdivmod(x, y, 0, &z);
 
@@ -1536,16 +2854,15 @@ rb_big_modulo(x, y)
 
 /*
  *  call-seq:
- *     big.remainder(numeric)    => number
- *  
+ *     big.remainder(numeric)    -> number
+ *
  *  Returns the remainder after dividing <i>big</i> by <i>numeric</i>.
- *     
+ *
  *     -1234567890987654321.remainder(13731)      #=> -6966
  *     -1234567890987654321.remainder(13731.24)   #=> -9906.22531493148
  */
 static VALUE
-rb_big_remainder(x, y)
-    VALUE x, y;
+rb_big_remainder(VALUE x, VALUE y)
 {
     VALUE z;
 
@@ -1558,37 +2875,22 @@ rb_big_remainder(x, y)
 	break;
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, rb_intern("remainder"));
     }
     bigdivrem(x, y, 0, &z);
 
     return bignorm(z);
 }
 
-static VALUE big_lshift _((VALUE, unsigned long));
-static VALUE big_rshift _((VALUE, unsigned long));
-
-static VALUE big_shift(x, n)
-    VALUE x;
-    int n;
-{
-    if (n < 0)
-	return big_lshift(x, (unsigned int)n);
-    else if (n > 0)
-	return big_rshift(x, (unsigned int)n);
-    return x;
-}
-
 /*
  *  call-seq:
- *     big.divmod(numeric)   => array
- *  
+ *     big.divmod(numeric)   -> array
+ *
  *  See <code>Numeric#divmod</code>.
- *     
+ *
  */
 VALUE
-rb_big_divmod(x, y)
-    VALUE x, y;
+rb_big_divmod(VALUE x, VALUE y)
 {
     VALUE div, mod;
 
@@ -1601,54 +2903,148 @@ rb_big_divmod(x, y)
 	break;
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, rb_intern("divmod"));
     }
     bigdivmod(x, y, &div, &mod);
 
     return rb_assoc_new(bignorm(div), bignorm(mod));
 }
 
+static int
+bdigbitsize(BDIGIT x)
+{
+    int size = 1;
+    int nb = BITSPERDIG / 2;
+    BDIGIT bits = (~0 << nb);
+
+    if (!x) return 0;
+    while (x > 1) {
+	if (x & bits) {
+	    size += nb;
+	    x >>= nb;
+	}
+	x &= ~bits;
+	nb /= 2;
+	bits >>= nb;
+    }
+
+    return size;
+}
+
+static VALUE big_lshift(VALUE, unsigned long);
+static VALUE big_rshift(VALUE, unsigned long);
+
+static VALUE
+big_shift(VALUE x, long n)
+{
+    if (n < 0)
+	return big_lshift(x, (unsigned long)-n);
+    else if (n > 0)
+	return big_rshift(x, (unsigned long)n);
+    return x;
+}
+
+static VALUE
+big_fdiv(VALUE x, VALUE y)
+{
+#define DBL_BIGDIG ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)
+    VALUE z;
+    long l, ex, ey;
+    int i;
+
+    bigtrunc(x);
+    l = RBIGNUM_LEN(x) - 1;
+    ex = l * BITSPERDIG;
+    ex += bdigbitsize(BDIGITS(x)[l]);
+    ex -= 2 * DBL_BIGDIG * BITSPERDIG;
+    if (ex) x = big_shift(x, ex);
+
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = rb_int2big(FIX2LONG(y));
+      case T_BIGNUM: {
+	bigtrunc(y);
+	l = RBIGNUM_LEN(y) - 1;
+	ey = l * BITSPERDIG;
+	ey += bdigbitsize(BDIGITS(y)[l]);
+	ey -= DBL_BIGDIG * BITSPERDIG;
+	if (ey) y = big_shift(y, ey);
+      bignum:
+	bigdivrem(x, y, &z, 0);
+	l = ex - ey;
+#if SIZEOF_LONG > SIZEOF_INT
+	{
+	    /* Visual C++ can't be here */
+	    if (l > INT_MAX) return DBL2NUM(INFINITY);
+	    if (l < INT_MIN) return DBL2NUM(0.0);
+	}
+#endif
+	return DBL2NUM(ldexp(big2dbl(z), (int)l));
+      }
+      case T_FLOAT:
+	y = dbl2big(ldexp(frexp(RFLOAT_VALUE(y), &i), DBL_MANT_DIG));
+	ey = i - DBL_MANT_DIG;
+	goto bignum;
+    }
+    rb_bug("big_fdiv");
+    /* NOTREACHED */
+}
+
 /*
  *  call-seq:
- *     big.quo(numeric) -> float
- *  
+  *     big.fdiv(numeric) -> float
+ *
  *  Returns the floating point result of dividing <i>big</i> by
  *  <i>numeric</i>.
- *     
- *     -1234567890987654321.quo(13731)      #=> -89910996357705.5
- *     -1234567890987654321.quo(13731.24)   #=> -89909424858035.7
- *     
+ *
+ *     -1234567890987654321.fdiv(13731)      #=> -89910996357705.5
+ *     -1234567890987654321.fdiv(13731.24)   #=> -89909424858035.7
+ *
  */
 
-static VALUE
-rb_big_quo(x, y)
-    VALUE x, y;
+
+VALUE
+rb_big_fdiv(VALUE x, VALUE y)
 {
-    double dx = rb_big2dbl(x);
-    double dy;
+    double dx, dy;
 
+    dx = big2dbl(x);
     switch (TYPE(y)) {
       case T_FIXNUM:
 	dy = (double)FIX2LONG(y);
+	if (isinf(dx))
+	    return big_fdiv(x, y);
 	break;
 
       case T_BIGNUM:
 	dy = rb_big2dbl(y);
+	if (isinf(dx) || isinf(dy))
+	    return big_fdiv(x, y);
 	break;
 
       case T_FLOAT:
-	dy = RFLOAT(y)->value;
+	dy = RFLOAT_VALUE(y);
+	if (isnan(dy))
+	    return y;
+	if (isinf(dx))
+	    return big_fdiv(x, y);
 	break;
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, rb_intern("fdiv"));
     }
-    return rb_float_new(dx / dy);
+    return DBL2NUM(dx / dy);
+}
+
+static VALUE
+bigsqr(VALUE x)
+{
+    return bigtrunc(bigmul0(x, x));
 }
 
 /*
  *  call-seq:
- *     big ** exponent   #=> numeric
+ *     big ** exponent   -> numeric
  *
  *  Raises _big_ to the _exponent_ power (which may be an integer, float,
  *  or anything that will coerce to a number). The result may be
@@ -1660,16 +3056,17 @@ rb_big_quo(x, y)
  */
 
 VALUE
-rb_big_pow(x, y)
-    VALUE x, y;
+rb_big_pow(VALUE x, VALUE y)
 {
     double d;
-    long yy;
-    
+    SIGNED_VALUE yy;
+
     if (y == INT2FIX(0)) return INT2FIX(1);
     switch (TYPE(y)) {
       case T_FLOAT:
-	d = RFLOAT(y)->value;
+	d = RFLOAT_VALUE(y);
+	if ((!RBIGNUM_SIGN(x) && !BIGZEROP(x)) && d != round(d))
+	    return rb_funcall(rb_complex_raw1(x), rb_intern("**"), 1, y);
 	break;
 
       case T_BIGNUM:
@@ -1679,48 +3076,103 @@ rb_big_pow(x, y)
 
       case T_FIXNUM:
 	yy = FIX2LONG(y);
-	if (yy > 0) {
-	    VALUE z = x;
-	    const long BIGLEN_LIMIT = 1024*1024 / SIZEOF_BDIGITS;
 
-	    if ((RBIGNUM(x)->len > BIGLEN_LIMIT) ||
-		(RBIGNUM(x)->len > BIGLEN_LIMIT / yy)) {
+	if (yy < 0)
+	    return rb_funcall(rb_rational_raw1(x), rb_intern("**"), 1, y);
+	else {
+	    VALUE z = 0;
+	    SIGNED_VALUE mask;
+	    const long xlen = RBIGNUM_LEN(x) - 1;
+	    const long xbits = ffs(RBIGNUM_DIGITS(x)[xlen]) + SIZEOF_BDIGITS*BITSPERDIG*xlen;
+	    const long BIGLEN_LIMIT = BITSPERDIG*1024*1024;
+
+	    if ((xbits > BIGLEN_LIMIT) || (xbits * yy > BIGLEN_LIMIT)) {
 		rb_warn("in a**b, b may be too big");
 		d = (double)yy;
 		break;
 	    }
-	    for (;;) {
-		yy -= 1;
-		if (yy == 0) break;
-		while (yy % 2 == 0) {
-		    yy /= 2;
-		    x = rb_big_mul0(x, x);
-		    bigtrunc(x);
+	    for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
+		if (z) z = bigsqr(z);
+		if (yy & mask) {
+		    z = z ? bigtrunc(bigmul0(z, x)) : x;
 		}
-		z = rb_big_mul0(z, x);
-		bigtrunc(z);
 	    }
 	    return bignorm(z);
 	}
-	d = (double)yy;
+	/* NOTREACHED */
 	break;
 
       default:
-	return rb_num_coerce_bin(x, y);
+	return rb_num_coerce_bin(x, y, rb_intern("**"));
     }
-    return rb_float_new(pow(rb_big2dbl(x), d));
+    return DBL2NUM(pow(rb_big2dbl(x), d));
+}
+
+static inline VALUE
+bit_coerce(VALUE x)
+{
+    while (!FIXNUM_P(x) && TYPE(x) != T_BIGNUM) {
+	if (TYPE(x) == T_FLOAT) {
+	    rb_raise(rb_eTypeError, "can't convert Float into Integer");
+	}
+	x = rb_to_int(x);
+    }
+    return x;
+}
+
+static VALUE
+bigand_int(VALUE x, long y)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long xn, zn;
+    long i;
+    char sign;
+
+    if (y == 0) return INT2FIX(0);
+    sign = (y > 0);
+    xds = BDIGITS(x);
+    zn = xn = RBIGNUM_LEN(x);
+#if SIZEOF_BDIGITS == SIZEOF_LONG
+    if (sign) {
+	y &= xds[0];
+	return LONG2NUM(y);
+    }
+#endif
+
+    z = bignew(zn, RBIGNUM_SIGN(x) || sign);
+    zds = BDIGITS(z);
+
+#if SIZEOF_BDIGITS == SIZEOF_LONG
+    i = 1;
+    zds[0] = xds[0] & y;
+#else
+    {
+	BDIGIT_DBL num = y;
+
+	for (i=0; i<(int)(sizeof(y)/sizeof(BDIGIT)); i++) {
+	    zds[i] = xds[i] & BIGLO(num);
+	    num = BIGDN(num);
+	}
+    }
+#endif
+    while (i < xn) {
+	zds[i] = sign?0:xds[i];
+	i++;
+    }
+    if (!RBIGNUM_SIGN(z)) get2comp(z);
+    return bignorm(z);
 }
 
 /*
  * call-seq:
- *     big & numeric   =>  integer
+ *     big & numeric   ->  integer
  *
  * Performs bitwise +and+ between _big_ and _numeric_.
  */
 
 VALUE
-rb_big_and(xx, yy)
-    VALUE xx, yy;
+rb_big_and(VALUE xx, VALUE yy)
 {
     volatile VALUE x, y, z;
     BDIGIT *ds1, *ds2, *zds;
@@ -1728,33 +3180,33 @@ rb_big_and(xx, yy)
     char sign;
 
     x = xx;
-    y = rb_to_int(yy);
+    y = bit_coerce(yy);
+    if (!RBIGNUM_SIGN(x)) {
+	x = rb_big_clone(x);
+	get2comp(x);
+    }
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+	return bigand_int(x, FIX2LONG(y));
     }
-    if (!RBIGNUM(y)->sign) {
+    if (!RBIGNUM_SIGN(y)) {
 	y = rb_big_clone(y);
 	get2comp(y);
     }
-    if (!RBIGNUM(x)->sign) {
-	x = rb_big_clone(x);
-	get2comp(x);
-    }
-    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
-	l1 = RBIGNUM(y)->len;
-	l2 = RBIGNUM(x)->len;
+    if (RBIGNUM_LEN(x) > RBIGNUM_LEN(y)) {
+	l1 = RBIGNUM_LEN(y);
+	l2 = RBIGNUM_LEN(x);
 	ds1 = BDIGITS(y);
 	ds2 = BDIGITS(x);
-	sign = RBIGNUM(y)->sign;
+	sign = RBIGNUM_SIGN(y);
     }
     else {
-	l1 = RBIGNUM(x)->len;
-	l2 = RBIGNUM(y)->len;
+	l1 = RBIGNUM_LEN(x);
+	l2 = RBIGNUM_LEN(y);
 	ds1 = BDIGITS(x);
 	ds2 = BDIGITS(y);
-	sign = RBIGNUM(x)->sign;
+	sign = RBIGNUM_SIGN(x);
     }
-    z = bignew(l2, RBIGNUM(x)->sign || RBIGNUM(y)->sign);
+    z = bignew(l2, RBIGNUM_SIGN(x) || RBIGNUM_SIGN(y));
     zds = BDIGITS(z);
 
     for (i=0; i<l1; i++) {
@@ -1763,20 +3215,55 @@ rb_big_and(xx, yy)
     for (; i<l2; i++) {
 	zds[i] = sign?0:ds2[i];
     }
-    if (!RBIGNUM(z)->sign) get2comp(z);
+    if (!RBIGNUM_SIGN(z)) get2comp(z);
+    return bignorm(z);
+}
+
+static VALUE
+bigor_int(VALUE x, long y)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long xn, zn;
+    long i;
+    char sign;
+
+    sign = (y >= 0);
+    xds = BDIGITS(x);
+    zn = xn = RBIGNUM_LEN(x);
+    z = bignew(zn, RBIGNUM_SIGN(x) && sign);
+    zds = BDIGITS(z);
+
+#if SIZEOF_BDIGITS == SIZEOF_LONG
+    i = 1;
+    zds[0] = xds[0] | y;
+#else
+    {
+	BDIGIT_DBL num = y;
+
+	for (i=0; i<(int)(sizeof(y)/sizeof(BDIGIT)); i++) {
+	    zds[i] = xds[i] | BIGLO(num);
+	    num = BIGDN(num);
+	}
+    }
+#endif
+    while (i < xn) {
+	zds[i] = sign?xds[i]:(BDIGIT)(BIGRAD-1);
+	i++;
+    }
+    if (!RBIGNUM_SIGN(z)) get2comp(z);
     return bignorm(z);
 }
 
 /*
  * call-seq:
- *     big | numeric   =>  integer
+ *     big | numeric   ->  integer
  *
  * Performs bitwise +or+ between _big_ and _numeric_.
  */
 
 VALUE
-rb_big_or(xx, yy)
-    VALUE xx, yy;
+rb_big_or(VALUE xx, VALUE yy)
 {
     volatile VALUE x, y, z;
     BDIGIT *ds1, *ds2, *zds;
@@ -1784,56 +3271,90 @@ rb_big_or(xx, yy)
     char sign;
 
     x = xx;
-    y = rb_to_int(yy);
+    y = bit_coerce(yy);
+
+    if (!RBIGNUM_SIGN(x)) {
+	x = rb_big_clone(x);
+	get2comp(x);
+    }
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+	return bigor_int(x, FIX2LONG(y));
     }
-    if (!RBIGNUM(y)->sign) {
+    if (!RBIGNUM_SIGN(y)) {
 	y = rb_big_clone(y);
 	get2comp(y);
     }
-    if (!RBIGNUM(x)->sign) {
-	x = rb_big_clone(x);
-	get2comp(x);
-    }
-    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
-	l1 = RBIGNUM(y)->len;
-	l2 = RBIGNUM(x)->len;
+    if (RBIGNUM_LEN(x) > RBIGNUM_LEN(y)) {
+	l1 = RBIGNUM_LEN(y);
+	l2 = RBIGNUM_LEN(x);
 	ds1 = BDIGITS(y);
 	ds2 = BDIGITS(x);
-	sign = RBIGNUM(y)->sign;
+	sign = RBIGNUM_SIGN(y);
     }
     else {
-	l1 = RBIGNUM(x)->len;
-	l2 = RBIGNUM(y)->len;
+	l1 = RBIGNUM_LEN(x);
+	l2 = RBIGNUM_LEN(y);
 	ds1 = BDIGITS(x);
 	ds2 = BDIGITS(y);
-	sign = RBIGNUM(x)->sign;
+	sign = RBIGNUM_SIGN(x);
     }
-    z = bignew(l2, RBIGNUM(x)->sign && RBIGNUM(y)->sign);
+    z = bignew(l2, RBIGNUM_SIGN(x) && RBIGNUM_SIGN(y));
     zds = BDIGITS(z);
 
     for (i=0; i<l1; i++) {
 	zds[i] = ds1[i] | ds2[i];
     }
     for (; i<l2; i++) {
-	zds[i] = sign?ds2[i]:(BIGRAD-1);
+	zds[i] = sign?ds2[i]:(BDIGIT)(BIGRAD-1);
     }
-    if (!RBIGNUM(z)->sign) get2comp(z);
-
+    if (!RBIGNUM_SIGN(z)) get2comp(z);
     return bignorm(z);
 }
 
+static VALUE
+bigxor_int(VALUE x, long y)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long xn, zn;
+    long i;
+    char sign;
+
+    sign = (y >= 0) ? 1 : 0;
+    xds = BDIGITS(x);
+    zn = xn = RBIGNUM_LEN(x);
+    z = bignew(zn, !(RBIGNUM_SIGN(x) ^ sign));
+    zds = BDIGITS(z);
+
+#if SIZEOF_BDIGITS == SIZEOF_LONG
+    i = 1;
+    zds[0] = xds[0] ^ y;
+#else
+    {
+	BDIGIT_DBL num = y;
+
+	for (i=0; i<(int)(sizeof(y)/sizeof(BDIGIT)); i++) {
+	    zds[i] = xds[i] ^ BIGLO(num);
+	    num = BIGDN(num);
+	}
+    }
+#endif
+    while (i < xn) {
+	zds[i] = sign?xds[i]:~xds[i];
+	i++;
+    }
+    if (!RBIGNUM_SIGN(z)) get2comp(z);
+    return bignorm(z);
+}
 /*
  * call-seq:
- *     big ^ numeric   =>  integer
+ *     big ^ numeric   ->  integer
  *
  * Performs bitwise +exclusive or+ between _big_ and _numeric_.
  */
 
 VALUE
-rb_big_xor(xx, yy)
-    VALUE xx, yy;
+rb_big_xor(VALUE xx, VALUE yy)
 {
     volatile VALUE x, y;
     VALUE z;
@@ -1842,35 +3363,36 @@ rb_big_xor(xx, yy)
     char sign;
 
     x = xx;
-    y = rb_to_int(yy);
+    y = bit_coerce(yy);
+
+    if (!RBIGNUM_SIGN(x)) {
+	x = rb_big_clone(x);
+	get2comp(x);
+    }
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+	return bigxor_int(x, FIX2LONG(y));
     }
-    if (!RBIGNUM(y)->sign) {
+    if (!RBIGNUM_SIGN(y)) {
 	y = rb_big_clone(y);
 	get2comp(y);
     }
-    if (!RBIGNUM(x)->sign) {
-	x = rb_big_clone(x);
-	get2comp(x);
-    }
-    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
-	l1 = RBIGNUM(y)->len;
-	l2 = RBIGNUM(x)->len;
+    if (RBIGNUM_LEN(x) > RBIGNUM_LEN(y)) {
+	l1 = RBIGNUM_LEN(y);
+	l2 = RBIGNUM_LEN(x);
 	ds1 = BDIGITS(y);
 	ds2 = BDIGITS(x);
-	sign = RBIGNUM(y)->sign;
+	sign = RBIGNUM_SIGN(y);
     }
     else {
-	l1 = RBIGNUM(x)->len;
-	l2 = RBIGNUM(y)->len;
+	l1 = RBIGNUM_LEN(x);
+	l2 = RBIGNUM_LEN(y);
 	ds1 = BDIGITS(x);
 	ds2 = BDIGITS(y);
-	sign = RBIGNUM(x)->sign;
+	sign = RBIGNUM_SIGN(x);
     }
-    RBIGNUM(x)->sign = RBIGNUM(x)->sign?1:0;
-    RBIGNUM(y)->sign = RBIGNUM(y)->sign?1:0;
-    z = bignew(l2, !(RBIGNUM(x)->sign ^ RBIGNUM(y)->sign));
+    RBIGNUM_SET_SIGN(x, RBIGNUM_SIGN(x)?1:0);
+    RBIGNUM_SET_SIGN(y, RBIGNUM_SIGN(y)?1:0);
+    z = bignew(l2, !(RBIGNUM_SIGN(x) ^ RBIGNUM_SIGN(y)));
     zds = BDIGITS(z);
 
     for (i=0; i<l1; i++) {
@@ -1879,7 +3401,7 @@ rb_big_xor(xx, yy)
     for (; i<l2; i++) {
 	zds[i] = sign?ds2[i]:~ds2[i];
     }
-    if (!RBIGNUM(z)->sign) get2comp(z);
+    if (!RBIGNUM_SIGN(z)) get2comp(z);
 
     return bignorm(z);
 }
@@ -1887,23 +3409,22 @@ rb_big_xor(xx, yy)
 static VALUE
 check_shiftdown(VALUE y, VALUE x)
 {
-    if (!RBIGNUM(x)->len) return INT2FIX(0);
-    if (RBIGNUM(y)->len > SIZEOF_LONG / SIZEOF_BDIGITS) {
-	return RBIGNUM(x)->sign ? INT2FIX(0) : INT2FIX(-1);
+    if (!RBIGNUM_LEN(x)) return INT2FIX(0);
+    if (RBIGNUM_LEN(y) > SIZEOF_LONG / SIZEOF_BDIGITS) {
+	return RBIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(-1);
     }
     return Qnil;
 }
 
 /*
  * call-seq:
- *     big << numeric   =>  integer
+ *     big << numeric   ->  integer
  *
  * Shifts big left _numeric_ positions (right if _numeric_ is negative).
  */
 
 VALUE
-rb_big_lshift(x, y)
-    VALUE x, y;
+rb_big_lshift(VALUE x, VALUE y)
 {
     long shift;
     int neg = 0;
@@ -1918,35 +3439,33 @@ rb_big_lshift(x, y)
 	    break;
 	}
 	else if (TYPE(y) == T_BIGNUM) {
-	    if (!RBIGNUM(y)->sign) {
+	    if (!RBIGNUM_SIGN(y)) {
 		VALUE t = check_shiftdown(y, x);
 		if (!NIL_P(t)) return t;
 		neg = 1;
 	    }
-	    shift = big2ulong(y, "long", Qtrue);
+	    shift = big2ulong(y, "long", TRUE);
 	    break;
 	}
 	y = rb_to_int(y);
     }
 
-    if (neg) return big_rshift(x, shift);
-    return big_lshift(x, shift);
+    x = neg ? big_rshift(x, shift) : big_lshift(x, shift);
+    return bignorm(x);
 }
 
 static VALUE
-big_lshift(x, shift)
-    VALUE x;
-    unsigned long shift;
+big_lshift(VALUE x, unsigned long shift)
 {
     BDIGIT *xds, *zds;
     long s1 = shift/BITSPERDIG;
-    int s2 = shift%BITSPERDIG;
+    int s2 = (int)(shift%BITSPERDIG);
     VALUE z;
     BDIGIT_DBL num = 0;
     long len, i;
 
-    len = RBIGNUM(x)->len;
-    z = bignew(len+s1+1, RBIGNUM(x)->sign);
+    len = RBIGNUM_LEN(x);
+    z = bignew(len+s1+1, RBIGNUM_SIGN(x));
     zds = BDIGITS(z);
     for (i=0; i<s1; i++) {
 	*zds++ = 0;
@@ -1958,19 +3477,18 @@ big_lshift(x, shift)
 	num = BIGDN(num);
     }
     *zds = BIGLO(num);
-    return bignorm(z);
+    return z;
 }
 
 /*
  * call-seq:
- *     big >> numeric   =>  integer
+ *     big >> numeric   ->  integer
  *
  * Shifts big right _numeric_ positions (left if _numeric_ is negative).
  */
 
 VALUE
-rb_big_rshift(x, y)
-    VALUE x, y;
+rb_big_rshift(VALUE x, VALUE y)
 {
     long shift;
     int neg = 0;
@@ -1985,54 +3503,52 @@ rb_big_rshift(x, y)
 	    break;
 	}
 	else if (TYPE(y) == T_BIGNUM) {
-	    if (RBIGNUM(y)->sign) {
+	    if (RBIGNUM_SIGN(y)) {
 		VALUE t = check_shiftdown(y, x);
 		if (!NIL_P(t)) return t;
 	    }
 	    else {
 		neg = 1;
 	    }
-	    shift = big2ulong(y, "long", Qtrue);
+	    shift = big2ulong(y, "long", TRUE);
 	    break;
 	}
 	y = rb_to_int(y);
     }
 
-    if (neg) return big_lshift(x, shift);
-    return big_rshift(x, shift);
+    x = neg ? big_lshift(x, shift) : big_rshift(x, shift);
+    return bignorm(x);
 }
 
 static VALUE
-big_rshift(x, shift)
-    VALUE x;
-    unsigned long shift;
+big_rshift(VALUE x, unsigned long shift)
 {
     BDIGIT *xds, *zds;
     long s1 = shift/BITSPERDIG;
-    int s2 = shift%BITSPERDIG;
+    int s2 = (int)(shift%BITSPERDIG);
     VALUE z;
     BDIGIT_DBL num = 0;
     long i, j;
     volatile VALUE save_x;
 
-    if (s1 > RBIGNUM(x)->len) {
-	if (RBIGNUM(x)->sign)
+    if (s1 > RBIGNUM_LEN(x)) {
+	if (RBIGNUM_SIGN(x))
 	    return INT2FIX(0);
 	else
 	    return INT2FIX(-1);
     }
-    if (!RBIGNUM(x)->sign) {
+    if (!RBIGNUM_SIGN(x)) {
 	save_x = x = rb_big_clone(x);
 	get2comp(x);
     }
     xds = BDIGITS(x);
-    i = RBIGNUM(x)->len; j = i - s1;
+    i = RBIGNUM_LEN(x); j = i - s1;
     if (j == 0) {
-	if (RBIGNUM(x)->sign) return INT2FIX(0);
+	if (RBIGNUM_SIGN(x)) return INT2FIX(0);
 	else return INT2FIX(-1);
     }
-    z = bignew(j, RBIGNUM(x)->sign);
-    if (!RBIGNUM(x)->sign) {
+    z = bignew(j, RBIGNUM_SIGN(x));
+    if (!RBIGNUM_SIGN(x)) {
 	num = ((BDIGIT_DBL)~0) << BITSPERDIG;
     }
     zds = BDIGITS(z);
@@ -2041,48 +3557,48 @@ big_rshift(x, shift)
 	zds[j] = BIGLO(num);
 	num = BIGUP(xds[i]);
     }
-    if (!RBIGNUM(x)->sign) {
+    if (!RBIGNUM_SIGN(x)) {
 	get2comp(z);
     }
-    return bignorm(z);
+    return z;
 }
 
 /*
  *  call-seq:
  *     big[n] -> 0, 1
- *  
+ *
  *  Bit Reference---Returns the <em>n</em>th bit in the (assumed) binary
  *  representation of <i>big</i>, where <i>big</i>[0] is the least
  *  significant bit.
- *     
+ *
  *     a = 9**15
  *     50.downto(0) do |n|
  *       print a[n]
  *     end
- *     
+ *
  *  <em>produces:</em>
- *     
+ *
  *     000101110110100000111000011110010100111100010111001
- *     
+ *
  */
 
 static VALUE
-rb_big_aref(x, y)
-    VALUE x, y;
+rb_big_aref(VALUE x, VALUE y)
 {
     BDIGIT *xds;
     BDIGIT_DBL num;
-    unsigned long shift;
+    VALUE shift;
     long i, s1, s2;
 
     if (TYPE(y) == T_BIGNUM) {
-	if (!RBIGNUM(y)->sign)
+	if (!RBIGNUM_SIGN(y))
 	    return INT2FIX(0);
-	if (RBIGNUM(bigtrunc(y))->len > SIZEOF_LONG/SIZEOF_BDIGITS) {
+	bigtrunc(y);
+	if (RBIGNUM_LEN(y) > DIGSPERLONG) {
 	  out_of_range:
-	    return RBIGNUM(x)->sign ? INT2FIX(0) : INT2FIX(1);
+	    return RBIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
 	}
-	shift = big2ulong(y, "long", Qfalse);
+	shift = big2ulong(y, "long", FALSE);
     }
     else {
 	i = NUM2LONG(y);
@@ -2092,8 +3608,8 @@ rb_big_aref(x, y)
     s1 = shift/BITSPERDIG;
     s2 = shift%BITSPERDIG;
 
-    if (s1 >= RBIGNUM(x)->len) goto out_of_range;
-    if (!RBIGNUM(x)->sign) {
+    if (s1 >= RBIGNUM_LEN(x)) goto out_of_range;
+    if (!RBIGNUM_SIGN(x)) {
 	xds = BDIGITS(x);
 	i = 0; num = 1;
 	while (num += ~xds[i], ++i <= s1) {
@@ -2110,23 +3626,18 @@ rb_big_aref(x, y)
 
 /*
  * call-seq:
- *   big.hash   => fixnum
+ *   big.hash   -> fixnum
  *
  * Compute a hash based on the value of _big_.
  */
 
 static VALUE
-rb_big_hash(x)
-    VALUE x;
+rb_big_hash(VALUE x)
 {
-    long i, len, key;
-    BDIGIT *digits;
+    st_index_t hash;
 
-    key = 0; digits = BDIGITS(x); len = RBIGNUM(x)->len;
-    for (i=0; i<len; i++) {
-	key ^= *digits++;
-    }
-    return LONG2FIX(key);
+    hash = rb_memhash(BDIGITS(x), sizeof(BDIGIT)*RBIGNUM_LEN(x)) ^ RBIGNUM_SIGN(x);
+    return INT2FIX(hash);
 }
 
 /*
@@ -2134,8 +3645,7 @@ rb_big_hash(x)
  */
 
 static VALUE
-rb_big_coerce(x, y)
-    VALUE x, y;
+rb_big_coerce(VALUE x, VALUE y)
 {
     if (FIXNUM_P(y)) {
 	return rb_assoc_new(rb_int2big(FIX2LONG(y)), x);
@@ -2154,61 +3664,70 @@ rb_big_coerce(x, y)
 /*
  *  call-seq:
  *     big.abs -> aBignum
- *  
+ *
  *  Returns the absolute value of <i>big</i>.
- *     
+ *
  *     -1234567890987654321.abs   #=> 1234567890987654321
  */
 
 static VALUE
-rb_big_abs(x)
-    VALUE x;
+rb_big_abs(VALUE x)
 {
-    if (!RBIGNUM(x)->sign) {
+    if (!RBIGNUM_SIGN(x)) {
 	x = rb_big_clone(x);
-	RBIGNUM(x)->sign = 1;
+	RBIGNUM_SET_SIGN(x, 1);
     }
     return x;
 }
 
-VALUE
-rb_big_rand(max, rand_buf)
-    VALUE max;
-    double *rand_buf;
-{
-    VALUE v;
-    long len = RBIGNUM(max)->len;
-
-    if (BIGZEROP(max)) {
-	return rb_float_new(rand_buf[0]);
-    }
-    v = bignew(len,1);
-    len--;
-    BDIGITS(v)[len] = BDIGITS(max)[len] * rand_buf[len];    
-    while (len--) {
-	BDIGITS(v)[len] = ((BDIGIT)~0) * rand_buf[len];
-    }
-
-    return v;
-}
-
 /*
  *  call-seq:
  *     big.size -> integer
- *  
+ *
  *  Returns the number of bytes in the machine representation of
  *  <i>big</i>.
- *     
+ *
  *     (256**10 - 1).size   #=> 12
  *     (256**20 - 1).size   #=> 20
  *     (256**40 - 1).size   #=> 40
  */
 
 static VALUE
-rb_big_size(big)
-    VALUE big;
+rb_big_size(VALUE big)
+{
+    return LONG2FIX(RBIGNUM_LEN(big)*SIZEOF_BDIGITS);
+}
+
+/*
+ *  call-seq:
+ *     big.odd? -> true or false
+ *
+ *  Returns <code>true</code> if <i>big</i> is an odd number.
+ */
+
+static VALUE
+rb_big_odd_p(VALUE num)
+{
+    if (BDIGITS(num)[0] & 1) {
+	return Qtrue;
+    }
+    return Qfalse;
+}
+
+/*
+ *  call-seq:
+ *     big.even? -> true or false
+ *
+ *  Returns <code>true</code> if <i>big</i> is an even number.
+ */
+
+static VALUE
+rb_big_even_p(VALUE num)
 {
-    return LONG2FIX(RBIGNUM(big)->len*SIZEOF_BDIGITS);
+    if (BDIGITS(num)[0] & 1) {
+	return Qfalse;
+    }
+    return Qtrue;
 }
 
 /*
@@ -2218,19 +3737,19 @@ rb_big_size(big)
  *  Fixnum. When a calculation involving
  *  Bignum objects returns a result that will fit in a
  *  Fixnum, the result is automatically converted.
- *     
+ *
  *  For the purposes of the bitwise operations and <code>[]</code>, a
  *  Bignum is treated as if it were an infinite-length
  *  bitstring with 2's complement representation.
- *     
+ *
  *  While Fixnum values are immediate, Bignum
  *  objects are not---assignment and parameter passing work with
  *  references to objects, not the objects themselves.
- *     
+ *
  */
 
 void
-Init_Bignum()
+Init_Bignum(void)
 {
     rb_cBignum = rb_define_class("Bignum", rb_cInteger);
 
@@ -2242,11 +3761,11 @@ Init_Bignum()
     rb_define_method(rb_cBignum, "*", rb_big_mul, 1);
     rb_define_method(rb_cBignum, "/", rb_big_div, 1);
     rb_define_method(rb_cBignum, "%", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "div", rb_big_div, 1);
+    rb_define_method(rb_cBignum, "div", rb_big_idiv, 1);
     rb_define_method(rb_cBignum, "divmod", rb_big_divmod, 1);
     rb_define_method(rb_cBignum, "modulo", rb_big_modulo, 1);
     rb_define_method(rb_cBignum, "remainder", rb_big_remainder, 1);
-    rb_define_method(rb_cBignum, "quo", rb_big_quo, 1);
+    rb_define_method(rb_cBignum, "fdiv", rb_big_fdiv, 1);
     rb_define_method(rb_cBignum, "**", rb_big_pow, 1);
     rb_define_method(rb_cBignum, "&", rb_big_and, 1);
     rb_define_method(rb_cBignum, "|", rb_big_or, 1);
@@ -2258,9 +3777,22 @@ Init_Bignum()
 
     rb_define_method(rb_cBignum, "<=>", rb_big_cmp, 1);
     rb_define_method(rb_cBignum, "==", rb_big_eq, 1);
+    rb_define_method(rb_cBignum, ">", big_gt, 1);
+    rb_define_method(rb_cBignum, ">=", big_ge, 1);
+    rb_define_method(rb_cBignum, "<", big_lt, 1);
+    rb_define_method(rb_cBignum, "<=", big_le, 1);
+    rb_define_method(rb_cBignum, "===", rb_big_eq, 1);
     rb_define_method(rb_cBignum, "eql?", rb_big_eql, 1);
     rb_define_method(rb_cBignum, "hash", rb_big_hash, 0);
     rb_define_method(rb_cBignum, "to_f", rb_big_to_f, 0);
     rb_define_method(rb_cBignum, "abs", rb_big_abs, 0);
+    rb_define_method(rb_cBignum, "magnitude", rb_big_abs, 0);
     rb_define_method(rb_cBignum, "size", rb_big_size, 0);
+    rb_define_method(rb_cBignum, "odd?", rb_big_odd_p, 0);
+    rb_define_method(rb_cBignum, "even?", rb_big_even_p, 0);
+
+    power_cache_init();
+
+    big_three = rb_uint2big(3);
+    rb_gc_register_mark_object(big_three);
 }
diff --git a/bin/erb b/bin/erb
index a6fcd5370c..6b92ac2284 100755
--- a/bin/erb
+++ b/bin/erb
@@ -1,6 +1,6 @@
 #!/usr/bin/env ruby
 # Tiny eRuby --- ERB2
-# Copyright (c) 1999-2000,2002 Masatoshi SEKI 
+# Copyright (c) 1999-2000,2002 Masatoshi SEKI
 # You can redistribute it and/or modify it under the same terms as Ruby.
 
 require 'erb'
@@ -12,18 +12,28 @@ class ERB
       arg = self.shift
       return nil if arg == '--'
       if arg =~ /^-(.)(.*)/
-        return arg if $1 == '-'
-        raise 'unknown switch "-"' if $2.index('-')
-        self.unshift "-#{$2}" if $2.size > 0
+        if $1 == '-'
+          arg, @maybe_arg = arg.split(/=/, 2)
+          return arg
+        end
+        raise 'unknown switch "-"' if $2[0] == ?- and $1 != 'T'
+        if $2.size > 0
+          self.unshift "-#{$2}"
+          @maybe_arg = $2
+        else
+          @maybe_arg = nil
+        end
         "-#{$1}"
       else
         self.unshift arg
         nil
       end
     end
-    
+
     def ARGV.req_arg
-      self.shift || raise('missing argument')
+      (@maybe_arg || self.shift || raise('missing argument')).tap {
+        @maybe_arg = nil
+      }
     end
 
     def trim_mode_opt(trim_mode, disable_percent)
@@ -67,25 +77,16 @@ class ERB
           when '-T'                        # trim mode
             arg = ARGV.req_arg
             if arg == '-'
-              trim_mode = arg 
+              trim_mode = arg
               next
             end
             raise "invalid trim mode #{arg.dump}" unless arg =~ /^[0-2]$/
             trim_mode = arg.to_i
-          when '-K'                        # KCODE
+          when '-E', '--encoding'
             arg = ARGV.req_arg
-            case arg.downcase
-            when 'e', '-e', 'euc'
-              $KCODE = 'EUC'
-            when 's', '-s', 'sjis'
-              $KCODE = 'SJIS'
-            when 'u', '-u', 'utf8'
-              $KCODE = 'UTF8'
-            when 'n', '-n', 'none'
-              $KCODE = 'NONE'
-            else
-              raise "invalid KCODE #{arg.dump}"
-            end
+            set_encoding(*arg.split(/:/, 2))
+          when '-U'
+            set_encoding(Encoding::UTF_8, Encoding::UTF_8)
           when '-P'
             disable_percent = true
           when '--help'
@@ -96,22 +97,24 @@ class ERB
         end
       rescue                               # usage
         STDERR.puts $!.to_s
-        STDERR.puts File.basename($0) + 
+        STDERR.puts File.basename($0) +
           " [switches] [inputfile]"
         STDERR.puts <<EOU
   -x               print ruby script
   -n               print ruby script with line number
   -v               enable verbose mode
   -d               set $DEBUG to true
-  -r [library]     load a library
-  -K [kcode]       specify KANJI code-set
-  -S [safe_level]  set $SAFE (0..4)
-  -T [trim_mode]   specify trim_mode (0..2, -)
+  -r library       load a library
+  -S safe_level    set $SAFE (0..4)
+  -E ex[:in]       set default external/internal encodings
+  -U               set default encoding to UTF-8.
+  -T trim_mode     specify trim_mode (0..2, -)
   -P               ignore lines which start with "%"
 EOU
         exit 1
       end
 
+      $<.set_encoding(Encoding::ASCII_8BIT, nil)
       src = $<.read
       filename = $FILENAME
       exit 2 unless src
@@ -120,10 +123,8 @@ EOU
       erb.filename = filename
       if output
         if number
-          l = 1
-          for line in erb.src
-            puts "%3d %s"%[l, line]
-            l += 1
+          erb.src.each_line.with_index do |line, l|
+            puts "%3d %s"%[l+1, line]
           end
         else
           puts erb.src
@@ -133,6 +134,19 @@ EOU
       end
     end
     module_function :run
+
+    def set_encoding(extern, intern = nil)
+      verbose, $VERBOSE = $VERBOSE, nil
+      Encoding.default_external = extern unless extern.nil? || extern.empty?
+      Encoding.default_internal = intern unless intern.nil? || intern.empty?
+      [$stdin, $stdout, $stderr].each do |io|
+        io.set_encoding(extern, intern)
+      end
+    ensure
+      $VERBOSE = verbose
+    end
+    module_function :set_encoding
+    class << self; private :set_encoding; end
   end
 end
 
diff --git a/bin/gem b/bin/gem
new file mode 100755
index 0000000000..a4ec754abb
--- /dev/null
+++ b/bin/gem
@@ -0,0 +1,25 @@
+#!/usr/bin/env ruby
+#--
+# Copyright 2006 by Chad Fowler, Rich Kilmer, Jim Weirich and others.
+# All rights reserved.
+# See LICENSE.txt for permissions.
+#++
+
+require 'rubygems'
+require 'rubygems/gem_runner'
+require 'rubygems/exceptions'
+
+required_version = Gem::Requirement.new ">= 1.8.7"
+
+unless required_version.satisfied_by? Gem.ruby_version then
+  abort "Expected Ruby Version #{required_version}, is #{Gem.ruby_version}"
+end
+
+args = ARGV.clone
+
+begin
+  Gem::GemRunner.new.run args
+rescue Gem::SystemExitException => e
+  exit e.exit_code
+end
+
diff --git a/bin/irb b/bin/irb
index f277bc4b69..6c8465c802 100644..100755
--- a/bin/irb
+++ b/bin/irb
@@ -1,9 +1,8 @@
 #!/usr/bin/env ruby
 #
-#   irb.rb - intaractive ruby
-#   	$Release Version: 0.9.5 $
+#   irb.rb - interactive ruby
+#   	$Release Version: 0.9.6 $
 #   	$Revision$
-#   	$Date$
 #   	by Keiju ISHITSUKA(keiju@ruby-lang.org)
 #
 
diff --git a/bin/rake b/bin/rake
new file mode 100755
index 0000000000..0de43c97ec
--- /dev/null
+++ b/bin/rake
@@ -0,0 +1,32 @@
+#!/usr/bin/env ruby
+
+#--
+# Copyright (c) 2003, 2004, 2005, 2006, 2007  Jim Weirich
+#
+# Permission is hereby granted, free of charge, to any person obtaining a copy
+# of this software and associated documentation files (the "Software"), to
+# deal in the Software without restriction, including without limitation the
+# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
+# sell copies of the Software, and to permit persons to whom the Software is
+# furnished to do so, subject to the following conditions:
+#
+# The above copyright notice and this permission notice shall be included in
+# all copies or substantial portions of the Software.
+#
+# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+# FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS
+# IN THE SOFTWARE.
+#++
+
+begin
+  require 'rubygems'
+rescue LoadError
+end
+
+require 'rake'
+
+Rake.application.run
diff --git a/bin/rdoc b/bin/rdoc
index fe619137fd..20d866c220 100644..100755
--- a/bin/rdoc
+++ b/bin/rdoc
@@ -5,63 +5,36 @@
 #
 #  Copyright (c) 2003 Dave Thomas
 #  Released under the same terms as Ruby
-#
-#  $Revision$
-
-## Transitional Hack ####
-#
-#  RDoc was initially distributed independently, and installed
-#  itself into <prefix>/lib/ruby/site_ruby/<ver>/rdoc...
-#
-#  Now that RDoc is part of the distribution, it's installed into
-#  <prefix>/lib/ruby/<ver>, which unfortunately appears later in the
-#  search path. This means that if you have previously installed RDoc,
-#  and then install from ruby-lang, you'll pick up the old one by
-#  default. This hack checks for the condition, and readjusts the
-#  search path if necessary.
-
-def adjust_for_existing_rdoc(path)
-  
-  $stderr.puts %{
-  It seems as if you have a previously-installed RDoc in
-  the directory #{path}.
-
-  Because this is now out-of-date, you might want to consider
-  removing the directories:
-
-    #{File.join(path, "rdoc")}
-
-  and
-
-    #{File.join(path, "markup")}
-
-  }
 
-  # Move all the site_ruby directories to the end
-  p $:
-  $:.replace($:.partition {|path| /site_ruby/ !~ path}.flatten)
-  p $:
-end
-
-$:.each do |path|
-  if /site_ruby/ =~ path 
-    rdoc_path = File.join(path, 'rdoc', 'rdoc.rb')
-    if File.exists?(rdoc_path)
-      adjust_for_existing_rdoc(path)
-      break
-    end
-  end
+begin
+  gem 'rdoc'
+rescue NameError => e # --disable-gems
+  raise unless e.name == :gem
+rescue Gem::LoadError
 end
 
-## End of Transitional Hack ##
-
-
 require 'rdoc/rdoc'
 
 begin
   r = RDoc::RDoc.new
-  r.document(ARGV)
-rescue RDoc::RDocError => e
-  $stderr.puts e.message
-  exit(1)
+  r.document ARGV
+rescue SystemExit
+  raise
+rescue Exception => e
+  if $DEBUG_RDOC then
+    $stderr.puts e.message
+    $stderr.puts "#{e.backtrace.join "\n\t"}"
+    $stderr.puts
+  elsif Interrupt === e then
+    $stderr.puts
+    $stderr.puts 'Interrupted'
+  else
+    $stderr.puts "uh-oh! RDoc had a problem:"
+    $stderr.puts e.message
+    $stderr.puts
+    $stderr.puts "run with --debug for full backtrace"
+  end
+
+  exit 1
 end
+
diff --git a/bin/ri b/bin/ri
index fb3e00eda3..7fbed0c099 100755
--- a/bin/ri
+++ b/bin/ri
@@ -1,49 +1,12 @@
 #!/usr/bin/env ruby
-# usage:
-#
-#   ri  name...
-#
-# where name can be 
-#
-#   Class | Class::method | Class#method | Class.method | method
-#
-# All names may be abbreviated to their minimum unbiguous form. If a name
-# _is_ ambiguous, all valid options will be listed.
-#
-# The form '.' method matches either class or instance methods, while 
-# #method matches only instance and ::method matches only class methods.
-#
-#
-# == Installing Documentation
-#
-# 'ri' uses a database of documentation built by the RDoc utility.
-# 
-# So, how do you install this documentation on your system?
-# It depends on how you installed Ruby.
-#
-# <em>If you installed Ruby from source files</em> (that is, if it some point
-# you typed 'make' during the process :), you can install the RDoc
-# documentation yourself. Just go back to the place where you have 
-# your Ruby source and type
-#
-#    make install-doc
-#
-# You'll probably need to do this as a superuser, as the documentation
-# is installed in the Ruby target tree (normally somewhere under 
-# <tt>/usr/local</tt>.
-#
-# <em>If you installed Ruby from a binary distribution</em> (perhaps
-# using a one-click installer, or using some other packaging system),
-# then the team that produced the package probably forgot to package
-# the documentation as well. Contact them, and see if they can add
-# it to the next release.
-#
 
+begin
+  gem 'rdoc'
+rescue NameError => e # --disable-gems
+  raise unless e.name == :gem
+rescue Gem::LoadError
+end
 
-require 'rdoc/ri/ri_driver'
-
-######################################################################
-
-ri = RiDriver.new
-ri.process_args
+require 'rdoc/ri/driver'
 
+RDoc::RI::Driver.run ARGV
diff --git a/bin/testrb b/bin/testrb
index ff49cb5466..e9046eb147 100755
--- a/bin/testrb
+++ b/bin/testrb
@@ -1,5 +1,10 @@
 #!/usr/bin/env ruby
 require 'test/unit'
-(r = Test::Unit::AutoRunner.new(true)).process_args(ARGV) or
-  abort r.options.banner + " tests..."
-exit r.run
+tests = Test::Unit::AutoRunner.new(true)
+tests.options.banner.sub!(/\[options\]/, '\& tests...')
+unless tests.process_args(ARGV)
+  abort tests.options.banner
+end
+files = tests.to_run
+$0 = files.size == 1 ? File.basename(files[0]) : files.to_s
+exit tests.run
diff --git a/bootstraptest/pending.rb b/bootstraptest/pending.rb
new file mode 100644
index 0000000000..744c0adac1
--- /dev/null
+++ b/bootstraptest/pending.rb
@@ -0,0 +1,39 @@
+assert_equal 'A', %q{
+  class A
+    @@a = 'A'
+    def a=(x)
+      @@a = x
+    end
+    def a
+      @@a
+    end
+  end
+
+  B = A.dup
+  B.new.a = 'B'
+  A.new.a
+}, '[ruby-core:17019]'
+
+assert_equal 'ok', %q{
+  def m
+    lambda{
+      proc{
+        return :ng1
+      }
+    }.call.call
+    :ng2
+  end
+
+  begin
+    m()
+  rescue LocalJumpError
+    :ok
+  end
+}
+
+assert_normal_exit %q{
+  r = Range.allocate
+  def r.<=>(o) true end
+  r.instance_eval { initialize r, r }
+  r.inspect
+}
diff --git a/bootstraptest/runner.rb b/bootstraptest/runner.rb
new file mode 100755
index 0000000000..df58ca58f3
--- /dev/null
+++ b/bootstraptest/runner.rb
@@ -0,0 +1,393 @@
+"exec" "${RUBY-ruby}" "-x" "$0" "$@"; true # -*- mode: ruby; coding: utf-8 -*-
+#!./ruby
+# $Id$
+
+# NOTE:
+# Never use optparse in this file.
+# Never use test/unit in this file.
+# Never use Ruby extensions in this file.
+
+begin
+  require 'fileutils'
+  require 'tmpdir'
+rescue LoadError
+  $:.unshift File.join(File.dirname(__FILE__), '../lib')
+  retry
+end
+
+if !Dir.respond_to?(:mktmpdir)
+  # copied from lib/tmpdir.rb
+  def Dir.mktmpdir(prefix_suffix=nil, tmpdir=nil)
+    case prefix_suffix
+    when nil
+      prefix = "d"
+      suffix = ""
+    when String
+      prefix = prefix_suffix
+      suffix = ""
+    when Array
+      prefix = prefix_suffix[0]
+      suffix = prefix_suffix[1]
+    else
+      raise ArgumentError, "unexpected prefix_suffix: #{prefix_suffix.inspect}"
+    end
+    tmpdir ||= Dir.tmpdir
+    t = Time.now.strftime("%Y%m%d")
+    n = nil
+    begin
+      path = "#{tmpdir}/#{prefix}#{t}-#{$$}-#{rand(0x100000000).to_s(36)}"
+      path << "-#{n}" if n
+      path << suffix
+      Dir.mkdir(path, 0700)
+    rescue Errno::EEXIST
+      n ||= 0
+      n += 1
+      retry
+    end
+
+    if block_given?
+      begin
+        yield path
+      ensure
+        FileUtils.remove_entry_secure path
+      end
+    else
+      path
+    end
+  end
+end
+
+def main
+  @ruby = File.expand_path('miniruby')
+  @verbose = false
+  $stress = false
+  dir = nil
+  quiet = false
+  tests = nil
+  ARGV.delete_if {|arg|
+    case arg
+    when /\A--ruby=(.*)/
+      @ruby = $1
+      @ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
+      @ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
+      @ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+      true
+    when /\A--sets=(.*)/
+      tests = Dir.glob("#{File.dirname($0)}/test_{#{$1}}*.rb").sort
+      puts tests.map {|path| File.basename(path) }.inspect
+      true
+    when /\A--dir=(.*)/
+      dir = $1
+      true
+    when /\A(--stress|-s)/
+      $stress = true
+    when /\A(-q|--q(uiet))\z/
+      quiet = true
+      true
+    when /\A(-v|--v(erbose))\z/
+      @verbose = true
+    when /\A(-h|--h(elp)?)\z/
+      puts(<<-End)
+Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
+        --sets=NAME,NAME,...        Name of test sets.
+        --dir=DIRECTORY             Working directory.
+                                    default: /tmp/bootstraptestXXXXX.tmpwd
+    -s, --stress                    stress test.
+    -v, --verbose                   Output test name before exec.
+    -q, --quiet                     Don\'t print header message.
+    -h, --help                      Print this message and quit.
+End
+      exit true
+    else
+      false
+    end
+  }
+  if tests and not ARGV.empty?
+    $stderr.puts "--tests and arguments are exclusive"
+    exit false
+  end
+  tests ||= ARGV
+  tests = Dir.glob("#{File.dirname($0)}/test_*.rb").sort if tests.empty?
+  pathes = tests.map {|path| File.expand_path(path) }
+
+  unless quiet
+    puts Time.now
+    if defined?(RUBY_DESCRIPTION)
+      puts "Driver is #{RUBY_DESCRIPTION}"
+    elsif defined?(RUBY_PATCHLEVEL)
+      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}#{RUBY_PLATFORM}) [#{RUBY_PLATFORM}]"
+    else
+      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}) [#{RUBY_PLATFORM}]"
+    end
+    puts "Target is #{`#{@ruby} -v`.chomp}"
+    puts
+    $stdout.flush
+  end
+
+  in_temporary_working_directory(dir) {
+    exec_test pathes
+  }
+end
+
+def exec_test(pathes)
+  @count = 0
+  @error = 0
+  @errbuf = []
+  @location = nil
+  pathes.each do |path|
+    $stderr.print "\n#{File.basename(path)} "
+    $stderr.puts if @verbose
+    load File.expand_path(path)
+  end
+  $stderr.puts
+  if @error == 0
+    if @count == 0
+      $stderr.puts "No tests, no problem"
+    else
+      $stderr.puts "PASS all #{@count} tests"
+    end
+    exit true
+  else
+    @errbuf.each do |msg|
+      $stderr.puts msg
+    end
+    $stderr.puts "FAIL #{@error}/#{@count} tests failed"
+    exit false
+  end
+end
+
+def show_progress(message = '')
+  if @verbose
+    $stderr.print "\##{@count} #{@location} "
+  end
+  faildesc = yield
+  if !faildesc
+    $stderr.print '.'
+    $stderr.puts if @verbose
+  else
+    $stderr.print 'F'
+    $stderr.puts if @verbose
+    error faildesc, message
+  end
+rescue Exception => err
+  $stderr.print 'E'
+  $stderr.puts if @verbose
+  error err.message, message
+end
+
+def assert_check(testsrc, message = '', opt = '')
+  show_progress(message) {
+    result = get_result_string(testsrc, opt)
+    check_coredump
+    yield(result)
+  }
+end
+
+def assert_equal(expected, testsrc, message = '')
+  newtest
+  assert_check(testsrc, message) {|result|
+    if expected == result
+      nil
+    else
+      desc = "#{result.inspect} (expected #{expected.inspect})"
+      pretty(testsrc, desc, result)
+    end
+  }
+end
+
+def assert_match(expected_pattern, testsrc, message = '')
+  newtest
+  assert_check(testsrc, message) {|result|
+    if expected_pattern =~ result
+      nil
+    else
+      desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
+      pretty(testsrc, desc, result)
+    end
+  }
+end
+
+def assert_not_match(unexpected_pattern, testsrc, message = '')
+  newtest
+  assert_check(testsrc, message) {|result|
+    if unexpected_pattern !~ result
+      nil
+    else
+      desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
+      pretty(testsrc, desc, result)
+    end
+  }
+end
+
+def assert_valid_syntax(testsrc, message = '')
+  newtest
+  assert_check(testsrc, message, '-c') {|result|
+    result if /Syntax OK/ !~ result
+  }
+end
+
+def assert_normal_exit(testsrc, *rest)
+  newtest
+  opt = {}
+  opt = rest.pop if Hash === rest.last
+  message, ignore_signals = rest
+  message ||= ''
+  timeout = opt[:timeout]
+  show_progress(message) {
+    faildesc = nil
+    filename = make_srcfile(testsrc)
+    old_stderr = $stderr.dup
+    timeout_signaled = false
+    begin
+      $stderr.reopen("assert_normal_exit.log", "w")
+      io = IO.popen("#{@ruby} -W0 #{filename}")
+      pid = io.pid
+      th = Thread.new {
+        io.read
+        io.close
+        $?
+      }
+      if !th.join(timeout)
+        Process.kill :KILL, pid
+        timeout_signaled = true
+      end
+      status = th.value
+    ensure
+      $stderr.reopen(old_stderr)
+      old_stderr.close
+    end
+    if status.signaled?
+      signo = status.termsig
+      signame = Signal.list.invert[signo]
+      unless ignore_signals and ignore_signals.include?(signame)
+        sigdesc = "signal #{signo}"
+        if signame
+          sigdesc = "SIG#{signame} (#{sigdesc})"
+        end
+        if timeout_signaled
+          sigdesc << " (timeout)"
+        end
+        faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
+        stderr_log = File.read("assert_normal_exit.log")
+        if !stderr_log.empty?
+          faildesc << "\n" if /\n\z/ !~ faildesc
+          stderr_log << "\n" if /\n\z/ !~ stderr_log
+          stderr_log.gsub!(/^.*\n/) { '| ' + $& }
+          faildesc << stderr_log
+        end
+      end
+    end
+    faildesc
+  }
+end
+
+def assert_finish(timeout_seconds, testsrc, message = '')
+  newtest
+  show_progress(message) {
+    faildesc = nil
+    filename = make_srcfile(testsrc)
+    io = IO.popen("#{@ruby} -W0 #{filename}")
+    pid = io.pid
+    waited = false
+    tlimit = Time.now + timeout_seconds
+    while Time.now < tlimit
+      if Process.waitpid pid, Process::WNOHANG
+        waited = true
+        break
+      end
+      sleep 0.1
+    end
+    if !waited
+      Process.kill(:KILL, pid)
+      Process.waitpid pid
+      faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
+    end
+    io.close
+    faildesc
+  }
+end
+
+def flunk(message = '')
+  newtest
+  show_progress('') { message }
+end
+
+def pretty(src, desc, result)
+  src = src.sub(/\A.*\n/, '')
+  (/\n/ =~ src ? "\n#{adjust_indent(src)}" : src) + "  #=> #{desc}"
+end
+
+INDENT = 27
+
+def adjust_indent(src)
+  untabify(src).gsub(/^ {#{INDENT}}/o, '').gsub(/^/, '   ')
+end
+
+def untabify(str)
+  str.gsub(/^\t+/) {' ' * (8 * $&.size) }
+end
+
+def make_srcfile(src)
+  filename = 'bootstraptest.tmp.rb'
+  File.open(filename, 'w') {|f|
+    f.puts "GC.stress = true" if $stress
+    f.puts "print(begin; #{src}; end)"
+  }
+  filename
+end
+
+def get_result_string(src, opt = '')
+  if @ruby
+    filename = make_srcfile(src)
+    begin
+      `#{@ruby} -W0 #{opt} #{filename}`
+    ensure
+      raise CoreDumpError, "core dumped" if $? and $?.coredump?
+    end
+  else
+    eval(src).to_s
+  end
+end
+
+def newtest
+  @location = File.basename(caller(2).first)
+  @count += 1
+  cleanup_coredump
+end
+
+def error(msg, additional_message)
+  @errbuf.push "\##{@count} #{@location}: #{msg}  #{additional_message}"
+  @error += 1
+end
+
+def in_temporary_working_directory(dir)
+  if dir
+    Dir.mkdir dir
+    Dir.chdir(dir) {
+      yield
+    }
+  else
+    Dir.mktmpdir(["bootstraptest", ".tmpwd"]) {|d|
+      Dir.chdir(d) {
+        yield
+      }
+    }
+  end
+end
+
+def cleanup_coredump
+  FileUtils.rm_f 'core'
+  FileUtils.rm_f Dir.glob('core.*')
+  FileUtils.rm_f @ruby+'.stackdump' if @ruby
+end
+
+class CoreDumpError < StandardError; end
+
+def check_coredump
+  if File.file?('core') or not Dir.glob('core.*').empty? or
+      (@ruby and File.exist?(@ruby+'.stackdump'))
+    raise CoreDumpError, "core dumped"
+  end
+end
+
+main
diff --git a/bootstraptest/test_attr.rb b/bootstraptest/test_attr.rb
new file mode 100644
index 0000000000..721a847145
--- /dev/null
+++ b/bootstraptest/test_attr.rb
@@ -0,0 +1,36 @@
+assert_equal 'ok', %q{
+  module M
+    class A
+      class << self
+        attr_accessor :at
+        def workflow_rule
+          yield self
+        end
+
+        def eval_str(str)
+          eval(str)
+        end
+      end
+    end
+  end
+  begin
+    M::A.eval_str(<<-END)
+    workflow_rule do |r|
+      r.at 1
+    end
+    END
+  rescue ArgumentError => e
+    print "ok"
+  end
+}, '[ruby-core:14641]'
+
+assert_equal %{ok}, %{
+  class A
+    attr :m
+  end
+  begin
+    A.new.m(3)
+  rescue ArgumentError => e
+    print "ok"
+  end
+}, '[ruby-core:15120]'
diff --git a/bootstraptest/test_autoload.rb b/bootstraptest/test_autoload.rb
new file mode 100644
index 0000000000..e8df6684b6
--- /dev/null
+++ b/bootstraptest/test_autoload.rb
@@ -0,0 +1,110 @@
+assert_equal 'ok', %q{
+  File.unlink('zzz.rb') if File.file?('zzz.rb')
+  instance_eval do
+    autoload :ZZZ, './zzz.rb'
+    begin
+      ZZZ
+    rescue LoadError
+      :ok
+    end
+  end
+}, '[ruby-dev:43816]'
+
+assert_equal 'ok', %q{
+  open('zzz.rb', 'w') {|f| f.puts '' }
+  instance_eval do
+    autoload :ZZZ, './zzz.rb'
+    begin
+      ZZZ
+    rescue NameError
+      :ok
+    end
+  end
+}, '[ruby-dev:43816]'
+
+assert_equal 'ok', %q{
+  open('zzz.rb', 'w') {|f| f.puts 'class ZZZ; def self.ok;:ok;end;end'}
+  instance_eval do
+    autoload :ZZZ, './zzz.rb'
+    ZZZ.ok
+  end
+}, '[ruby-dev:43816]'
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz.rb"
+  ZZZ.ok
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz.rb"
+  require "./zzz.rb"
+  ZZZ.ok
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz.rb"
+  proc{$SAFE=4; ZZZ.ok}.call
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz.rb"
+  require "./zzz.rb"
+  proc{$SAFE=4; ZZZ.ok}.call
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def hoge;:ok;end;end"}
+  autoload :ZZZ, File.join(Dir.pwd, 'zzz.rb')
+  module M; end
+  Thread.new{M.instance_eval('$SAFE=4; ZZZ.new.hoge')}.value
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def hoge;:ok;end;end"}
+  autoload :ZZZ, File.join(Dir.pwd, 'zzz.rb')
+  module M; end
+  Thread.new{$SAFE=4; M.instance_eval('ZZZ.new.hoge')}.value
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def hoge;:ok;end;end"}
+  autoload :ZZZ, File.join(Dir.pwd, 'zzz.rb')
+  Thread.new{$SAFE=4; eval('ZZZ.new.hoge')}.value
+}
+
+assert_equal 'ok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def hoge;:ok;end;end"}
+  autoload :ZZZ, File.join(Dir.pwd, 'zzz.rb')
+  module M; end
+  Thread.new{eval('$SAFE=4; ZZZ.new.hoge')}.value
+}
+
+assert_equal 'okok', %q{
+  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
+  autoload :ZZZ, "./zzz.rb"
+  t1 = Thread.new {ZZZ.ok}
+  t2 = Thread.new {ZZZ.ok}
+  [t1.value, t2.value].join
+}
+
+assert_finish 5, %q{
+  autoload :ZZZ, File.expand_path(__FILE__)
+  begin
+    ZZZ
+  rescue NameError
+  end
+}, '[ruby-core:21696]'
+
+assert_equal 'A::C', %q{
+  open("zzz.rb", "w") {}
+  class A
+    autoload :C, "./zzz"
+    class C
+    end
+    C
+  end
+}
diff --git a/bootstraptest/test_block.rb b/bootstraptest/test_block.rb
new file mode 100644
index 0000000000..ea6768cc25
--- /dev/null
+++ b/bootstraptest/test_block.rb
@@ -0,0 +1,567 @@
+assert_equal %q{1}, %q{
+  1.times{
+    begin
+      a = 1
+    ensure
+      foo = nil
+    end
+  }
+}
+assert_equal %q{2}, %q{
+  [1,2,3].find{|x| x == 2}
+}
+assert_equal %q{2}, %q{
+  class E
+    include Enumerable
+    def each(&block)
+      [1, 2, 3].each(&block)
+    end
+  end
+  E.new.find {|x| x == 2 }
+}
+assert_equal %q{6}, %q{
+  sum = 0
+  for x in [1, 2, 3]
+    sum += x
+  end
+  sum
+}
+assert_equal %q{15}, %q{
+  sum = 0
+  for x in (1..5)
+    sum += x
+  end
+  sum
+}
+assert_equal %q{0}, %q{
+  sum = 0
+  for x in []
+    sum += x
+  end
+  sum
+}
+assert_equal %q{1}, %q{
+  ans = []
+  1.times{
+    for n in 1..3
+      a = n
+      ans << a
+    end
+  }
+}
+assert_equal %q{1..3}, %q{
+  ans = []
+  for m in 1..3
+    for n in 1..3
+      a = [m, n]
+      ans << a
+    end
+  end
+}
+assert_equal %q{[1, 2, 3]}, %q{
+  (1..3).to_a
+}
+assert_equal %q{[4, 8, 12]}, %q{
+  (1..3).map{|e|
+    e * 4
+  }
+}
+assert_equal %q{[1, 2, 3]}, %q{
+  class C
+    include Enumerable
+    def each
+      [1,2,3].each{|e|
+        yield e
+      }
+    end
+  end
+
+  C.new.to_a
+}
+assert_equal %q{[4, 5, 6]}, %q{
+  class C
+    include Enumerable
+    def each
+      [1,2,3].each{|e|
+        yield e
+      }
+    end
+  end
+
+  C.new.map{|e|
+    e + 3
+  }
+}
+assert_equal %q{100}, %q{
+  def m
+    yield
+  end
+  def n
+    yield
+  end
+
+  m{
+    n{
+      100
+    }
+  }
+}
+assert_equal %q{20}, %q{
+  def m
+    yield 1
+  end
+
+  m{|ib|
+    m{|jb|
+      i = 20
+    }
+  }
+}
+assert_equal %q{2}, %q{
+  def m
+    yield 1
+  end
+
+  m{|ib|
+    m{|jb|
+      ib = 20
+      kb = 2
+    }
+  }
+}
+assert_equal %q{3}, %q{
+  def iter1
+    iter2{
+      yield
+    }
+  end
+
+  def iter2
+    yield
+  end
+
+  iter1{
+    jb = 2
+    iter1{
+      jb = 3
+    }
+    jb
+  }
+}
+assert_equal %q{2}, %q{
+  def iter1
+    iter2{
+      yield
+    }
+  end
+
+  def iter2
+    yield
+  end
+
+  iter1{
+    jb = 2
+    iter1{
+      jb
+    }
+    jb
+  }
+}
+assert_equal %q{2}, %q{
+  def m
+    yield 1
+  end
+  m{|ib|
+    ib*2
+  }
+}
+assert_equal %q{92580}, %q{
+  def m
+    yield 12345, 67890
+  end
+  m{|ib,jb|
+    ib*2+jb
+  }
+}
+assert_equal %q{[10, nil]}, %q{
+  def iter
+    yield 10
+  end
+
+  a = nil
+  [iter{|a|
+    a
+  }, a]
+}
+assert_equal %q{21}, %q{
+  def iter
+    yield 10
+  end
+
+  iter{|a|
+    iter{|a|
+      a + 1
+    } + a
+  }
+}
+assert_equal %q{[10, 20, 30, 40, nil, nil, nil, nil]}, %q{
+  def iter
+    yield 10, 20, 30, 40
+  end
+
+  a = b = c = d = nil
+  iter{|a, b, c, d|
+    [a, b, c, d]
+  } + [a, b, c, d]
+}
+assert_equal %q{[10, 20, 30, 40, nil, nil]}, %q{
+  def iter
+    yield 10, 20, 30, 40
+  end
+
+  a = b = nil
+  iter{|a, b, c, d|
+    [a, b, c, d]
+  } + [a, b]
+}
+assert_equal %q{[1]}, %q{
+  $a = []
+
+  def iter
+    yield 1
+  end
+
+  def m
+    x = iter{|x|
+      $a << x
+      y = 0
+    }
+  end
+  m
+  $a
+}
+assert_equal %q{[1, [2]]}, %q{
+  def iter
+    yield 1, 2
+  end
+
+  iter{|a, *b|
+    [a, b]
+  }
+}
+assert_equal %q{[[1, 2]]}, %q{
+  def iter
+    yield 1, 2
+  end
+
+  iter{|*a|
+    [a]
+  }
+}
+assert_equal %q{[1, 2, []]}, %q{
+  def iter
+    yield 1, 2
+  end
+
+  iter{|a, b, *c|
+    [a, b, c]
+  }
+}
+assert_equal %q{[1, 2, nil, []]}, %q{
+  def iter
+    yield 1, 2
+  end
+
+  iter{|a, b, c, *d|
+    [a, b, c, d]
+  }
+}
+assert_equal %q{1}, %q{
+  def m
+    yield
+  end
+  m{
+    1
+  }
+}
+assert_equal %q{15129}, %q{
+  def m
+    yield 123
+  end
+  m{|ib|
+    m{|jb|
+      ib*jb
+    }
+  }
+}
+assert_equal %q{2}, %q{
+  def m a
+    yield a
+  end
+  m(1){|ib|
+    m(2){|jb|
+      ib*jb
+    }
+  }
+}
+assert_equal %q{9}, %q{
+  sum = 0
+  3.times{|ib|
+    2.times{|jb|
+      sum += ib + jb
+    }}
+  sum
+}
+assert_equal %q{10}, %q{
+  3.times{|bl|
+    break 10
+  }
+}
+assert_equal %q{[1, 2]}, %q{
+  def iter
+    yield 1,2,3
+  end
+
+  iter{|i, j|
+    [i, j]
+  }
+}
+assert_equal %q{[1, nil]}, %q{
+  def iter
+    yield 1
+  end
+
+  iter{|i, j|
+    [i, j]
+  }
+}
+
+assert_equal '0', %q{
+def m()
+end
+m {|(v0,*,(*)),|}
+m {|(*v0,(*)),|}
+m {|(v0,*v1,(*)),|}
+m {|((v0,*v1,v2)),|}
+m {|(v0,*v1,v2),|}
+m {|(v0,*v1,(v2)),|}
+m {|((*),*v0,v1),|}
+m {|((v0),*v1,v2),|}
+m {|(v0,v1,*v2,v3),|}
+m {|v0,(v1,*v2,v3),|}
+m {|(v0,*v1,v2),v3,|}
+m {|(v0,*v1,v2)|}
+m {|(v0,*v1,v2),&v3|}
+m {|(v0,*v1,v2),*|}
+m {|(v0,*v1,v2),*,&v3|}
+m {|*,(v0,*v1,v2)|}
+m {|*,(v0,*v1,v2),&v3|}
+m {|v0,*,(v1,*v2,v3)|}
+m {|v0,*,(v1,*v2,v3),&v4|}
+m {|(v0,*v1,v2),*,v3|}
+m {|(v0,*v1,v2),*,v3,&v4|}
+m {|(v0, *v1, v2)|}
+m {|(*,v)|}
+0
+}, "block parameter (shouldn't SEGV: [ruby-dev:31143])"
+
+assert_equal 'nil', %q{
+  def m
+    yield
+  end
+  m{|&b| b}.inspect
+}, '[ruby-dev:31147]'
+
+assert_equal 'nil', %q{
+  def m()
+    yield
+  end
+  m {|(v,(*))|}.inspect
+}, '[ruby-dev:31160]'
+
+assert_equal 'nil', %q{
+  def m()
+    yield
+  end
+  m {|(*,a,b)|}.inspect
+}, '[ruby-dev:31153]'
+
+assert_equal 'nil', %q{
+  def m()
+    yield
+  end
+  m {|((*))|}.inspect
+}
+
+assert_equal %q{[1, 1, [1, nil], [1, nil], [1, nil], [1, nil], [1, 1], 1, [1, nil], [1, nil], [1, nil], [1, nil], [[1, 1], [1, 1]], [1, 1], [1, 1], [1, 1], [1, nil], [1, nil], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[1, 1], [1, 1]], [[1, 1], [1, 1]], [[1, 1], [1, 1]], [1, 1], [1, 1], [[[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[1, 1], [1, 1]], [[1, 1], [1, 1]]]}, %q{
+def m(ary = [])
+  yield(ary)
+end
+
+$ans = []
+o = 1
+5.times{
+  v,(*) = o; $ans << o
+  m(o){|(v,(*))| $ans << v}
+  ((x, y)) = o; $ans << [x, y]
+  m(o){|((x, y))| $ans << [x, y]}
+  (((x, y))) = o; $ans << [x, y]
+  m(o){|(((x, y)))| $ans << [x, y]}
+  o = [o, o]
+}; $ans
+}
+
+assert_equal '0', %q{
+  def m()
+    yield [0]
+  end
+  m {|*,v| v}.inspect
+}, '[ruby-dev:31437]'
+assert_equal '[0]', %q{
+  def m
+    yield [0]
+  end
+  m{|v, &b| v}.inspect
+}, '[ruby-dev:31440]'
+assert_equal 'ok', %q{
+  begin
+    lambda{|a|}.call(1, 2)
+  rescue ArgumentError
+    :ok
+  else
+    :ng
+  end
+}, '[ruby-dev:31464]'
+assert_equal 'ok', %q{
+  begin
+    lambda{|&b|}.call(3)
+  rescue ArgumentError
+    :ok
+  else
+    :ng
+  end
+}, '[ruby-dev:31472]'
+assert_equal 'ok', %q{
+  class C
+    def each
+      yield [1,2]
+      yield 1,2
+    end
+  end
+  vs1 = []
+  C.new.each {|*v| vs1 << v }
+  vs2 = []
+  C.new.to_enum.each {|*v| vs2 << v }
+  vs1 == vs2 ? :ok : :ng
+}, '[ruby-dev:32329]'
+
+assert_normal_exit %q{
+  e = [1,2,3].each
+  10000.times {
+    e = [e].each
+  }
+  Thread.new { GC.start }.join
+}, '[ruby-dev:32604]'
+
+
+assert_equal '[nil, []]', %q{
+  def m() yield nil,[] end
+  l = lambda {|*v| v}
+  GC.stress=true
+  r = m(&l)
+  GC.stress=false
+  r.inspect
+}, '[ruby-dev:32567]'
+
+assert_equal NilClass.to_s, %q{
+  r = false; 1.times{|&b| r = b}; r.class
+}
+
+assert_equal 'ok', %q{
+  class C
+    define_method(:foo) do |arg, &block|
+      if block then block.call else arg end
+    end
+  end
+  C.new.foo("ng") {"ok"}
+}, '[ruby-talk:266422]'
+
+assert_equal 'ok', %q{
+  class C
+    define_method(:xyz) do |o, k, &block|
+      block.call(o, k)
+    end
+  end
+  C.new.xyz("o","k") {|o, k| o+k}
+}, '[ruby-core:20544]'
+
+assert_equal 'ok', %q{
+  class C
+    define_method(:xyz) do |*args, &block|
+      block.call(*args)
+    end
+  end
+  C.new.xyz("o","k") {|*args| args.join("")}
+}, '[ruby-core:20544]'
+
+assert_equal 'ok', %q{
+  STDERR.reopen(STDOUT)
+  class C
+    define_method(:foo) do |&block|
+      block.call if block
+    end
+    result = "ng"
+    new.foo() {result = "ok"}
+    result
+  end
+}
+
+assert_equal "ok", %q{
+  class Bar
+    def bar; :ok; end
+  end
+  def foo
+    yield(Bar.new) if block_given?
+  end
+  foo(&:bar)
+}, '[ruby-core:14279]'
+
+assert_normal_exit %q{
+  class Controller
+    def respond_to(&block)
+      responder = Responder.new
+      block.call(responder)
+      responder.respond
+    end
+    def test_for_bug
+      respond_to{|format|
+        format.js{
+          puts "in test"
+          render{|obj|
+            puts obj
+          }
+        }
+      }
+    end
+    def render(&block)
+      puts "in render"
+    end
+  end
+
+  class Responder
+    def method_missing(symbol, &block)
+      puts "enter method_missing"
+      @response = Proc.new{
+        puts 'in method missing'
+        block.call
+      }
+      puts "leave method_missing"
+    end
+    def respond
+      @response.call
+    end
+  end
+  t = Controller.new
+  t.test_for_bug
+}, '[ruby-core:14395]'
+
diff --git a/bootstraptest/test_class.rb b/bootstraptest/test_class.rb
new file mode 100644
index 0000000000..664dd2f166
--- /dev/null
+++ b/bootstraptest/test_class.rb
@@ -0,0 +1,159 @@
+# class
+assert_equal 'true',    %q( class C; end
+                            Object.const_defined?(:C) )
+assert_equal 'Class',   %q( class C; end
+                            C.class )
+assert_equal 'C',       %q( class C; end
+                            C.name )
+assert_equal 'C',       %q( class C; end
+                            C.new.class )
+assert_equal 'C',       %q( class C; end
+                            C.new.class.name )
+assert_equal 'Class',   %q( class C; end
+                            C.new.class.class )
+
+# inherited class
+assert_equal 'true',    %q( class A; end
+                            class C < A; end
+                            Object.const_defined?(:C) )
+assert_equal 'Class',   %q( class A; end
+                            class C < A; end
+                            C.class )
+assert_equal 'C',       %q( class A; end
+                            class C < A; end
+                            C.name )
+assert_equal 'C',       %q( class A; end
+                            class C < A; end
+                            C.new.class )
+assert_equal 'C',       %q( class A; end
+                            class C < A; end
+                            C.new.class.name )
+assert_equal 'Class',   %q( class A; end
+                            class C < A; end
+                            C.new.class.class )
+
+# module
+assert_equal 'true',    %q( module M; end
+                            Object.const_defined?(:M) )
+assert_equal 'Module',  %q( module M; end
+                            M.class )
+assert_equal 'M',       %q( module M; end
+                            M.name )
+assert_equal 'C',       %q( module M; end
+                            class C; include M; end
+                            C.new.class )
+
+# nested class
+assert_equal 'A::B',    %q( class A; end
+                            class A::B; end
+                            A::B )
+assert_equal 'A::B',    %q( class A; end
+                            class A::B; end
+                            A::B.name )
+assert_equal 'A::B',    %q( class A; end
+                            class A::B; end
+                            A::B.new.class )
+assert_equal 'Class',   %q( class A; end
+                            class A::B; end
+                            A::B.new.class.class )
+assert_equal 'A::B::C', %q( class A; end
+                            class A::B; end
+                            class A::B::C; end
+                            A::B::C )
+assert_equal 'A::B::C', %q( class A; end
+                            class A::B; end
+                            class A::B::C; end
+                            A::B::C.name )
+assert_equal 'Class',   %q( class A; end
+                            class A::B; end
+                            class A::B::C; end
+                            A::B::C.class )
+assert_equal 'A::B::C', %q( class A; end
+                            class A::B; end
+                            class A::B::C; end
+                            A::B::C.new.class )
+assert_equal 'Class',   %q( class A; end
+                            class A::B; end
+                            class A::B::C; end
+                            A::B::C.new.class.class )
+assert_equal 'A::B2',   %q( class A; end
+                            class A::B; end
+                            class A::B2 < A::B; end
+                            A::B2 )
+assert_equal 'Class',   %q( class A; end
+                            class A::B; end
+                            class A::B2 < A::B; end
+                            A::B2.class )
+
+# reopen
+assert_equal 'true',    %q( class C; end;  c1 = ::C
+                            class C; end;  c2 = ::C
+                            c1.equal?(c2) )
+assert_equal '1',       %q( class C; end
+                            class A; end
+                            begin class C < A; end; rescue TypeError; 1 end )
+assert_equal '1',       %q( class C; end
+                            begin module C; end; rescue TypeError; 1 end )
+assert_equal '1',       %q( C = 1   # [yarv-dev:782]
+                            begin class C; end; rescue TypeError; 1 end )
+assert_equal '1',       %q( C = 1   # [yarv-dev:800]
+                            begin module C; end; rescue TypeError; 1 end )
+
+# colon2, colon3
+assert_equal '1',       %q( class A; end;  A::C = 1;  A::C )
+assert_equal '1',       %q( A = 7;  begin A::C = 7; rescue TypeError; 1 end )
+assert_equal '1',       %q( begin 7::C = 7; rescue TypeError; 1 end )
+assert_equal 'C',       %q( class A; class ::C; end end;  C )
+assert_equal 'Class',   %q( class A; class ::C; end end;  C.class )
+assert_equal 'OK',      %q( class A; ::C = "OK"; end;  C )
+assert_equal 'String',  %q( class A; ::C = "OK"; end;  C.class )
+
+# class/module dup
+assert_equal 'Class',   %q( class C; end;  C.dup.class )
+assert_equal 'Module',  %q( module M; end;  M.dup.class )
+
+
+assert_equal "ok", %q{
+  module Foo
+  end
+
+  begin
+    def foo(&b)
+      Foo.module_eval &b
+    end
+    foo{
+      def bar
+      end
+    }
+    bar()
+  rescue NameError
+    :ok
+  end
+}, '[ruby-core:14378]'
+
+assert_equal '3', %q{
+  $i = 0
+  class C
+    def self.const_missing *args
+      $i+=1
+    end
+  end
+
+  3.times{
+    C::FOO
+  }
+  $i
+}
+
+assert_match /::C\z/, %q{
+  c = nil
+  Module.new{|m| c = class m::C; name; end}
+  c
+}, '[ruby-dev:38456]'
+
+assert_normal_exit %q{
+  s = Symbol.dup
+  class << s
+  end
+  s.allocate.to_s
+}, '[ruby-core:30843]'
diff --git a/bootstraptest/test_eval.rb b/bootstraptest/test_eval.rb
new file mode 100644
index 0000000000..c347d50ac9
--- /dev/null
+++ b/bootstraptest/test_eval.rb
@@ -0,0 +1,321 @@
+assert_equal %q{ok}, %q{
+  def m
+    a = :ok
+    $b = binding
+  end
+  m
+  eval('a', $b)
+}
+assert_equal %q{[:ok, :ok2]}, %q{
+  def m
+    a = :ok
+    $b = binding
+  end
+  m
+  eval('b = :ok2', $b)
+  eval('[a, b]', $b)
+}
+assert_equal %q{[nil, 1]}, %q{
+  $ans = []
+  def m
+    $b = binding
+  end
+  m
+  $ans << eval(%q{
+    $ans << eval(%q{
+      a
+    }, $b)
+    a = 1
+  }, $b)
+  $ans
+}
+assert_equal %q{C}, %q{
+  Const = :top
+  class C
+    Const = :C
+    def m
+      binding
+    end
+  end
+  eval('Const', C.new.m)
+}
+assert_equal %q{top}, %q{
+  Const = :top
+  a = 1
+  class C
+    Const = :C
+    def m
+      eval('Const', TOPLEVEL_BINDING)
+    end
+  end
+  C.new.m
+}
+assert_equal %q{:ok
+ok}, %q{
+  class C
+    $b = binding
+  end
+  eval %q{
+    def m
+      :ok
+    end
+  }, $b
+  p C.new.m
+}
+assert_equal %q{ok}, %q{
+  b = proc{
+    a = :ok
+    binding
+  }.call
+  a = :ng
+  eval("a", b)
+}
+assert_equal %q{C}, %q{
+  class C
+    def foo
+      binding
+    end
+  end
+  C.new.foo.eval("self.class.to_s")
+}
+assert_equal %q{1}, %q{
+  eval('1')
+}
+assert_equal %q{1}, %q{
+  eval('a=1; a')
+}
+assert_equal %q{1}, %q{
+  a = 1
+  eval('a')
+}
+assert_equal %q{ok}, %q{
+  __send__ :eval, %{
+    :ok
+  }
+}
+assert_equal %q{ok}, %q{
+  1.__send__ :instance_eval, %{
+    :ok
+  }
+}
+assert_equal %q{1}, %q{
+  1.instance_eval{
+    self
+  }
+}
+assert_equal %q{foo}, %q{
+  'foo'.instance_eval{
+    self
+  }
+}
+assert_equal %q{1}, %q{
+  class Fixnum
+    Const = 1
+  end
+  1.instance_eval %{
+    Const
+  }
+}
+assert_equal %q{top}, %q{
+  Const = :top
+  class C
+    Const = :C
+  end
+  C.module_eval{
+    Const
+  }
+}
+assert_equal %q{C}, %q{
+  Const = :top
+  class C
+    Const = :C
+  end
+  C.class_eval %{
+    def m
+      Const
+    end
+  }
+  C.new.m
+}
+assert_equal %q{top}, %q{
+  Const = :top
+  class C
+    Const = :C
+  end
+  C.class_eval{
+    def m
+      Const
+    end
+  }
+  C.new.m
+}
+assert_equal %q{[:top, :C, :top, :C]}, %q{
+  Const = :top
+  class C
+    Const = :C
+  end
+  $nest = false
+  $ans = []
+  def m
+    $ans << Const
+    C.module_eval %{
+      $ans << Const
+      Boo = false unless defined? Boo
+      unless $nest
+        $nest = true
+        m
+      end
+    }
+  end
+  m
+  $ans
+}
+assert_equal %q{[10, main]}, %q{
+  $nested = false
+  $ans = []
+  $pr = proc{
+    $ans << self
+    unless $nested
+      $nested = true
+      $pr.call
+    end
+  }
+  class C
+    def initialize &b
+      10.instance_eval(&b)
+    end
+  end
+  C.new(&$pr)
+  $ans
+}
+
+%w[break next redo].each do |keyword|
+  assert_match %r"Can't escape from eval with #{keyword}\z", %{
+    begin
+      eval "0 rescue #{keyword}"
+    rescue SyntaxError => e
+      e.message
+    end
+  }, '[ruby-dev:31372]'
+end
+
+assert_normal_exit %q{
+  STDERR.reopen(STDOUT)
+  class Foo
+     def self.add_method
+       class_eval("def some-bad-name; puts 'hello' unless @some_variable.some_function(''); end")
+     end
+  end
+  Foo.add_method
+}, '[ruby-core:14556] reported by Frederick Cheung'
+
+assert_equal 'ok', %q{
+  class Module
+    def my_module_eval(&block)
+      module_eval(&block)
+    end
+  end
+  class String
+    Integer.my_module_eval do
+      def hoge; end
+    end
+  end
+  if Integer.instance_methods(false).map{|m|m.to_sym}.include?(:hoge) &&
+     !String.instance_methods(false).map{|m|m.to_sym}.include?(:hoge)
+    :ok
+  else
+    :ng
+  end
+}, "[ruby-dev:34236]"
+
+assert_equal 'ok', %q{
+  begin
+    eval("class nil::Foo; end")
+    :ng
+  rescue Exception
+    :ok
+  end
+}
+
+assert_equal 'ok', %q{
+  begin
+    0.instance_eval { def m() :m end }
+    1.m
+    :ng
+  rescue Exception
+    :ok
+  end
+}, '[ruby-dev:34579]'
+
+assert_equal 'ok', %q{
+  begin
+    12.instance_eval { @@a }
+  rescue NameError
+    :ok
+  end
+}, '[ruby-core:16794]'
+
+assert_equal 'ok', %q{
+  begin
+    12.instance_exec { @@a }
+  rescue NameError
+    :ok
+  end
+}, '[ruby-core:16794]'
+
+assert_equal 'ok', %q{
+  begin
+    nil.instance_eval {
+      def a() :a end
+    }
+  rescue TypeError
+    :ok
+  end
+}, '[ruby-core:16796]'
+
+assert_equal 'ok', %q{
+  begin
+    nil.instance_exec {
+      def a() :a end
+    }
+  rescue TypeError
+    :ok
+  end
+}, '[ruby-core:16796]'
+
+assert_normal_exit %q{
+  eval("", method(:proc).call {}.binding)
+}
+
+assert_equal "", %q{
+  b = binding
+  10.times{
+    eval('', b)
+  }
+  begin
+    eval('1.times{raise}', b)
+  rescue => e
+    e.message
+  end
+}, '[ruby-dev:35392]'
+
+assert_equal "[:x]", %q{
+  def kaboom!
+    yield.eval("local_variables")
+  end
+
+  for x in enum_for(:kaboom!)
+    binding
+  end
+}, '[ruby-core:25125]'
+
+assert_normal_exit %q{
+  hash = {}
+  ("aaaa".."matz").each_with_index do |s, i|
+    hash[s] = i
+  end
+  begin
+    eval "class C; @@h = #{hash.inspect}; end"
+  rescue SystemStackError
+  end
+}, '[ruby-core:25714]'
diff --git a/bootstraptest/test_exception.rb b/bootstraptest/test_exception.rb
new file mode 100644
index 0000000000..f7d5eeaa07
--- /dev/null
+++ b/bootstraptest/test_exception.rb
@@ -0,0 +1,416 @@
+assert_equal %q{2}, %q{
+  begin
+    1+1
+  ensure
+    2+2
+  end
+}
+assert_equal %q{4}, %q{
+  begin
+    1+1
+    begin
+      2+2
+    ensure
+      3+3
+    end
+  ensure
+    4+4
+  end
+}
+assert_equal %q{4}, %q{
+  begin
+    1+1
+    begin
+      2+2
+    ensure
+      3+3
+    end
+  ensure
+    4+4
+    begin
+      5+5
+    ensure
+      6+6
+    end
+  end
+}
+assert_equal %q{NilClass}, %q{
+  a = nil
+  1.times{|e|
+    begin
+    rescue => err
+    end
+    a = err.class
+  }
+  a
+}
+assert_equal %q{RuntimeError}, %q{
+  a = nil
+  1.times{|e|
+    begin
+      raise
+    rescue => err
+    end
+    a = err.class
+  }
+  a
+}
+assert_equal %q{}, %q{
+  $!
+}
+assert_equal %q{FOO}, %q{
+  begin
+    raise "FOO"
+  rescue
+    $!
+  end
+}
+assert_equal %q{FOO}, %q{
+  def m
+    $!
+  end
+  begin
+    raise "FOO"
+  rescue
+    m()
+  end
+}
+assert_equal %q{[#<RuntimeError: BAR>, #<RuntimeError: FOO>]}, %q{
+  $ans = []
+  def m
+    $!
+  end
+  begin
+    raise "FOO"
+  rescue
+    begin
+      raise "BAR"
+    rescue
+      $ans << m()
+    end
+    $ans << m()
+  end
+  $ans
+}
+assert_equal %q{[#<RuntimeError: FOO>, #<RuntimeError: FOO>]}, %q{
+  $ans = []
+  def m
+    $!
+  end
+
+  begin
+    begin
+      raise "FOO"
+    ensure
+      $ans << m()
+    end
+  rescue
+    $ans << m()
+  end
+}
+assert_equal %q{[nil]}, %q{
+  $ans = []
+  def m
+    $!
+  end
+  def m2
+    1.times{
+      begin
+        return
+      ensure
+        $ans << m
+      end
+    }
+  end
+  m2
+  $ans
+}
+assert_equal %q{ok}, %q{
+  begin
+    raise
+  rescue
+    :ok
+  end
+}
+assert_equal %q{ok}, %q{
+  begin
+    raise
+  rescue
+    :ok
+  ensure
+    :ng
+  end
+}
+assert_equal %q{RuntimeError}, %q{
+  begin
+    raise
+  rescue => e
+    e.class
+  end
+}
+assert_equal %q{ng}, %q{
+  begin
+    raise
+  rescue StandardError
+    :ng
+  rescue Exception
+    :ok
+  end
+}
+assert_equal %q{c}, %q{
+  begin
+    begin
+      raise "a"
+    rescue
+      raise "b"
+    ensure
+      raise "c"
+    end
+  rescue => e
+    e.message
+  end
+}
+assert_equal %q{33}, %q{
+  def m a, b
+    a + b
+  end
+  m(1, begin
+         raise
+       rescue
+         2
+       end) +
+  m(10, begin
+         raise
+       rescue
+         20
+       ensure
+         30
+       end)
+}
+assert_equal %q{3}, %q{
+  def m a, b
+    a + b
+  end
+  m(begin
+      raise
+    rescue
+      1
+    end,
+    begin
+      raise
+    rescue
+      2
+    end)
+}
+assert_equal %q{ok3}, %q{
+  class E1 < Exception
+  end
+
+  def m
+    yield
+  end
+
+  begin
+    begin
+      begin
+        m{
+          raise
+        }
+      rescue E1
+        :ok2
+      ensure
+      end
+    rescue
+      :ok3
+    ensure
+    end
+  rescue E1
+    :ok
+  ensure
+  end
+}
+assert_equal %q{7}, %q{
+  $i = 0
+  def m
+    iter{
+      begin
+        $i += 1
+        begin
+          $i += 2
+          break
+        ensure
+
+        end
+      ensure
+        $i += 4
+      end
+      $i = 0
+    }
+  end
+
+  def iter
+    yield
+  end
+  m
+  $i
+}
+assert_equal %q{10}, %q{
+  $i = 0
+  def m
+    begin
+      $i += 1
+      begin
+        $i += 2
+        return
+      ensure
+        $i += 3
+      end
+    ensure
+      $i += 4
+    end
+    p :end
+  end
+  m
+  $i
+}
+assert_equal %q{1}, %q{
+  begin
+    1
+  rescue
+    2
+  end
+}
+assert_equal %q{4}, %q{
+  begin
+    1
+    begin
+      2
+    rescue
+      3
+    end
+    4
+  rescue
+    5
+  end
+}
+assert_equal %q{3}, %q{
+  begin
+    1
+  rescue
+    2
+  else
+    3
+  end
+}
+assert_equal %q{2}, %q{
+  begin
+    1+1
+  rescue
+    2+2
+  ensure
+    3+3
+  end
+   }
+assert_equal %q{2}, %q{
+  begin
+    1+1
+  rescue
+    2+2
+  ensure
+    3+3
+  end
+   }
+assert_equal %q{6}, %q{
+  begin
+    1+1
+  rescue
+    2+2
+  else
+    3+3
+  ensure
+    4+4
+  end
+   }
+assert_equal %q{12}, %q{
+ begin
+   1+1
+   begin
+     2+2
+   rescue
+     3+3
+   else
+     4+4
+   end
+ rescue
+   5+5
+ else
+   6+6
+ ensure
+   7+7
+ end
+   }
+assert_equal %q{ok}, %q{ #
+  proc{
+    begin
+      raise
+      break
+    rescue
+      :ok
+    end
+  }.call
+}
+assert_equal %q{}, %q{
+  proc do
+    begin
+      raise StandardError
+      redo
+    rescue StandardError
+    end
+  end.call
+}
+
+##
+assert_match /undefined method `foo\'/, %q{#`
+  STDERR.reopen(STDOUT)
+  class C
+    def inspect
+      bar {}
+    end
+
+    def bar
+      raise
+    ensure
+    end
+  end
+  C.new.foo
+}, "[ruby-dev:31407]"
+
+assert_equal 'nil', %q{
+  doit = false
+  exc = nil
+  t = Thread.new {
+    begin
+      doit = true
+      sleep 10
+    ensure
+      exc = $!
+    end
+  }
+  Thread.pass until doit
+  t.kill
+  t.join
+  exc.inspect
+}, '[ruby-dev:32608]'
+
+assert_equal 'exception class/object expected', %q{
+  class ZeroDivisionError
+    def self.new(message)
+      42
+    end
+  end
+  begin
+    1/0
+  rescue Exception => e
+    e.message
+  end
+}, '[ruby-core:24767]'
diff --git a/bootstraptest/test_finalizer.rb b/bootstraptest/test_finalizer.rb
new file mode 100644
index 0000000000..22a16b1220
--- /dev/null
+++ b/bootstraptest/test_finalizer.rb
@@ -0,0 +1,8 @@
+assert_normal_exit %q{
+a1,a2,b1,b2=Array.new(4){""}
+ObjectSpace.define_finalizer(b2,proc{})
+ObjectSpace.define_finalizer(b1,proc{b1.inspect})
+
+ObjectSpace.define_finalizer(a2,proc{a1.inspect})
+ObjectSpace.define_finalizer(a1,proc{})
+}, '[ruby-dev:35778]'
diff --git a/bootstraptest/test_flip.rb b/bootstraptest/test_flip.rb
new file mode 100644
index 0000000000..ff194868b2
--- /dev/null
+++ b/bootstraptest/test_flip.rb
@@ -0,0 +1 @@
+assert_equal %q{E}, %q{$_ = "E"; eval("nil if true..~/^E/",nil,"-e"); $_}
diff --git a/bootstraptest/test_flow.rb b/bootstraptest/test_flow.rb
new file mode 100644
index 0000000000..fc93a5a46c
--- /dev/null
+++ b/bootstraptest/test_flow.rb
@@ -0,0 +1,564 @@
+assert_equal %q{[1, 2, 4, 5, 6, 7, 8]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each{; $a << 2
+    break; $a << 3
+  }; $a << 4
+  begin; $a << 5
+  ensure; $a << 6
+  end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 6, 7, 8]}, %q{$a = []; begin;  ; $a << 1
+  begin; $a << 2
+    [1,2].each do; $a << 3
+      break; $a << 4
+    end; $a << 5
+  ensure; $a << 6
+  end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{ok}, %q{
+  ["a"].inject("ng"){|x,y|
+    break :ok
+  }
+}
+assert_equal %q{ok}, %q{
+  unless ''.respond_to? :lines
+    class String
+      def lines
+        self
+      end
+    end
+  end
+
+  ('a').lines.map{|e|
+    break :ok
+  }
+}
+assert_equal %q{[1, 2, 4, 5]}, %q{$a = []; begin; ; $a << 1
+  ["a"].inject("ng"){|x,y|; $a << 2
+    break :ok; $a << 3
+  }; $a << 4
+; $a << 5
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 4, 5]}, %q{$a = []; begin; ; $a << 1
+  ('a'..'b').map{|e|; $a << 2
+    break :ok; $a << 3
+  }; $a << 4
+; $a << 5
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each do; $a << 2
+    begin; $a << 3
+      break; $a << 4
+    ensure; $a << 5
+    end; $a << 6
+  end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 9, 10]}, %q{$a = []; begin; ; $a << 1
+  i=0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    begin; $a << 5
+    ensure; $a << 6
+      break; $a << 7
+    end; $a << 8
+  end; $a << 9
+; $a << 10
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 7, 10, 11]}, %q{$a = []; begin; ; $a << 1
+  i=0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    begin; $a << 5
+      raise; $a << 6
+    ensure; $a << 7
+      break; $a << 8
+    end; $a << 9
+  end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 7, 10, 11]}, %q{$a = []; begin; ; $a << 1
+  i=0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    begin; $a << 5
+      raise; $a << 6
+    rescue; $a << 7
+      break; $a << 8
+    end; $a << 9
+  end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each do; $a << 2
+    begin; $a << 3
+      raise StandardError; $a << 4
+    ensure; $a << 5
+      break; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each do; $a << 2
+    begin; $a << 3
+      raise StandardError; $a << 4
+    rescue; $a << 5
+      break; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 6, 8, 10, 11]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each do; $a << 2
+    begin; $a << 3
+      begin; $a << 4
+        break; $a << 5
+      ensure; $a << 6
+      end; $a << 7
+    ensure; $a << 8
+    end; $a << 9
+  end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 14, 15]}, %q{$a = []; begin; ; $a << 1
+  i = 0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    j = 0; $a << 5
+    while j<3; $a << 6
+      j+=1; $a << 7
+      begin; $a << 8
+        raise; $a << 9
+      rescue; $a << 10
+        break; $a << 11
+      end; $a << 12
+    end; $a << 13
+  end; $a << 14
+; $a << 15
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 16, 17]}, %q{$a = []; begin; ; $a << 1
+  i = 0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    j = 0; $a << 5
+    while j<3; $a << 6
+      j+=1; $a << 7
+      1.times{; $a << 8
+        begin; $a << 9
+          raise; $a << 10
+        rescue; $a << 11
+          break; $a << 12
+        end; $a << 13
+      }; $a << 14
+    end; $a << 15
+  end; $a << 16
+; $a << 17
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 14, 15]}, %q{$a = []; begin; ; $a << 1
+  i = 0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    j = 0; $a << 5
+    while j<3; $a << 6
+      j+=1; $a << 7
+      begin; $a << 8
+        raise; $a << 9
+      ensure; $a << 10
+        break; $a << 11
+      end; $a << 12
+    end; $a << 13
+  end; $a << 14
+; $a << 15
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 16, 17]}, %q{$a = []; begin; ; $a << 1
+  i = 0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    j = 0; $a << 5
+    while j<3; $a << 6
+      j+=1; $a << 7
+      1.times{; $a << 8
+        begin; $a << 9
+          raise; $a << 10
+        ensure; $a << 11
+          break; $a << 12
+        end; $a << 13
+      }; $a << 14
+    end; $a << 15
+  end; $a << 16
+; $a << 17
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+  while true; $a << 2
+    begin; $a << 3
+      break; $a << 4
+    ensure; $a << 5
+      break; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 99]}, %q{
+$a = [];
+begin; ; $a << 1
+  while true; $a << 2
+    begin; $a << 3
+      break; $a << 4
+    ensure; $a << 5
+      raise; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 6, 8, 9, 10, 11]}, %q{$a = []; begin;  ; $a << 1
+  begin; $a << 2
+    [1,2].each do; $a << 3
+      begin; $a << 4
+        break; $a << 5
+      ensure; $a << 6
+      end; $a << 7
+    end; $a << 8
+  ensure; $a << 9
+  end; $a << 10
+; $a << 11
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 4, 99]}, %q{$a = []; begin; ; $a << 1
+  begin; $a << 2
+    raise StandardError; $a << 3
+  ensure; $a << 4
+  end; $a << 5
+; $a << 6
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4]}, %q{$a = []; begin;  ; $a << 1
+  begin; $a << 2
+  ensure; $a << 3
+  end ; $a << 4
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 5, 99]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each do; $a << 2
+    begin; $a << 3
+      break; $a << 4
+    ensure; $a << 5
+      raise StandardError; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{3}, %q{
+  def m a, b
+    a + b
+  end
+  m(1,
+    while true
+      break 2
+    end
+    )
+}
+assert_equal %q{4}, %q{
+  def m a, b
+    a + b
+  end
+  m(1,
+    (i=0; while i<2
+       i+=1
+       class C
+         next 2
+       end
+     end; 3)
+    )
+}
+assert_equal %q{34}, %q{
+  def m a, b
+    a+b
+  end
+  m(1, 1.times{break 3}) +
+  m(10, (1.times{next 3}; 20))
+}
+assert_equal %q{[1, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
+  3.times{; $a << 2
+    class C; $a << 3
+      break; $a << 4
+    end; $a << 5
+  }; $a << 6
+; $a << 7
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
+  3.times{; $a << 2
+    class A; $a << 3
+      class B; $a << 4
+        break; $a << 5
+      end; $a << 6
+    end; $a << 7
+  }; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 2, 3, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
+  3.times{; $a << 2
+    class C; $a << 3
+      next; $a << 4
+    end; $a << 5
+  }; $a << 6
+; $a << 7
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 2, 3, 4, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
+  3.times{; $a << 2
+    class C; $a << 3
+      class D; $a << 4
+        next; $a << 5
+      end; $a << 6
+    end; $a << 7
+  }; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
+  while true; $a << 2
+    class C; $a << 3
+      break; $a << 4
+    end; $a << 5
+  end; $a << 6
+; $a << 7
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
+  while true; $a << 2
+    class C; $a << 3
+      class D; $a << 4
+        break; $a << 5
+      end; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 3, 4, 5, 3, 4, 5, 3, 4, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+  i=0; $a << 2
+  while i<3; $a << 3
+    i+=1; $a << 4
+    class C; $a << 5
+      next 10; $a << 6
+    end; $a << 7
+  end; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{1}, %q{
+  1.times{
+    while true
+      class C
+        begin
+          break
+        ensure
+          break
+        end
+      end
+    end
+  }
+}
+assert_equal %q{[1, 2, 3, 5, 2, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
+  [1,2].each do; $a << 2
+    begin; $a << 3
+      next; $a << 4
+    ensure; $a << 5
+    end; $a << 6
+  end; $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 2, 6, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
+  o = "test"; $a << 2
+  def o.test(a); $a << 3
+    return a; $a << 4
+  ensure; $a << 5
+  end; $a << 6
+  o.test(123); $a << 7
+; $a << 8
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 4, 7, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
+  def m1 *args; $a << 2
+    ; $a << 3
+  end; $a << 4
+  def m2; $a << 5
+    m1(:a, :b, (return 1; :c)); $a << 6
+  end; $a << 7
+  m2; $a << 8
+; $a << 9
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 8, 2, 3, 4, 5, 9, 10]}, %q{$a = []; begin; ; $a << 1
+  def m(); $a << 2
+    begin; $a << 3
+      2; $a << 4
+    ensure; $a << 5
+      return 3; $a << 6
+    end; $a << 7
+  end; $a << 8
+  m; $a << 9
+; $a << 10
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 3, 11, 4, 5, 6, 7, 12, 13]}, %q{$a = []; begin; ; $a << 1
+  def m2; $a << 2
+  end; $a << 3
+  def m(); $a << 4
+    m2(begin; $a << 5
+         2; $a << 6
+       ensure; $a << 7
+         return 3; $a << 8
+       end); $a << 9
+    4; $a << 10
+  end; $a << 11
+  m(); $a << 12
+; $a << 13
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[1, 16, 2, 3, 4, 5, 6, 7, 10, 11, 17, 18]}, %q{$a = []; begin; ; $a << 1
+  def m; $a << 2
+    1; $a << 3
+    1.times{; $a << 4
+      2; $a << 5
+      begin; $a << 6
+        3; $a << 7
+        return; $a << 8
+        4; $a << 9
+      ensure; $a << 10
+        5; $a << 11
+      end; $a << 12
+      6; $a << 13
+    }; $a << 14
+    7; $a << 15
+  end; $a << 16
+  m(); $a << 17
+; $a << 18
+; rescue Exception; $a << 99; end; $a}
+assert_equal %q{[:ok, :ok2, :last]}, %q{
+  a = []
+  i = 0
+  begin
+    while i < 1
+      i+=1
+      begin
+        begin
+          next
+        ensure
+          a << :ok
+        end
+      ensure
+        a << :ok2
+      end
+    end
+  ensure
+    a << :last
+  end
+  a
+}
+assert_equal %q{[:ok, :ok2, :last]}, %q{
+  a = []
+  i = 0
+  begin
+    while i < 1
+      i+=1
+      begin
+        begin
+          break
+        ensure
+          a << :ok
+        end
+      ensure
+        a << :ok2
+      end
+    end
+  ensure
+    a << :last
+  end
+  a
+}
+assert_equal %q{[:ok, :ok2, :last]}, %q{
+  a = []
+  i = 0
+  begin
+    while i < 1
+      if i>0
+        break
+      end
+      i+=1
+      begin
+        begin
+          redo
+        ensure
+          a << :ok
+        end
+      ensure
+        a << :ok2
+      end
+    end
+  ensure
+    a << :last
+  end
+  a
+}
+assert_equal %Q{ENSURE\n}, %q{
+  def test
+    while true
+      return
+    end
+  ensure
+    puts("ENSURE")
+  end
+  test
+}, '[ruby-dev:37967]'
+
+[['[ruby-core:28129]', %q{
+  class Bug2728
+    include Enumerable
+    define_method(:dynamic_method) do
+      "dynamically defined method"
+    end
+    def each
+      begin
+        yield :foo
+      ensure
+        dynamic_method
+      end
+    end
+  end
+  e = Bug2728.new
+}],
+ ['[ruby-core:28132]', %q{
+  class Bug2729
+    include Enumerable
+    def each
+      begin
+        yield :foo
+      ensure
+        proc {}.call
+      end
+    end
+  end
+  e = Bug2729.new
+}],
+ ['[ruby-core:39125]', %q{
+  class Bug5234
+    include Enumerable
+    def each
+      begin
+        yield :foo
+      ensure
+        proc
+      end
+    end
+  end
+  e = Bug5234.new
+}],
+ ['[ruby-dev:45656]', %q{
+  class Bug6460
+    include Enumerable
+    def each
+      begin
+        yield :foo
+      ensure
+        1.times { Proc.new }
+      end
+    end
+  end
+  e = Bug6460.new
+}]].each do |bug, src|
+  assert_equal "foo", src + %q{e.detect {true}}, bug
+  assert_equal "true", src + %q{e.any? {true}}, bug
+  assert_equal "false", src + %q{e.all? {false}}, bug
+  assert_equal "true", src + %q{e.include?(:foo)}, bug
+end
diff --git a/bootstraptest/test_fork.rb b/bootstraptest/test_fork.rb
new file mode 100644
index 0000000000..384294727f
--- /dev/null
+++ b/bootstraptest/test_fork.rb
@@ -0,0 +1,69 @@
+assert_equal '0', %q{
+  begin
+    GC.stress = true
+    pid = fork {}
+    Process.wait pid
+    $?.to_i
+  rescue NotImplementedError
+    0
+  end
+}, '[ruby-dev:32404]'
+
+assert_finish 10, %q{
+  begin
+    children = (1..10).map{
+      Thread.start{fork{}}.value
+    }
+    while !children.empty? and pid = Process.wait
+      children.delete(pid)
+    end
+  rescue NotImplementedError
+  end
+}, '[ruby-core:22158]'
+
+assert_normal_exit(<<'End', '[ruby-dev:37934]')
+  Thread.new { sleep 1; Thread.kill Thread.main }
+  Process.setrlimit(:NPROC, 1)
+  fork {}
+End
+
+assert_equal 'ok', %q{
+  begin
+    if pid1 = fork
+      sleep 1
+      Process.kill("USR1", pid1)
+      _, s = Process.wait2(pid1)
+      s.success? ? :ok : :ng
+    else
+      if pid2 = fork
+        trap("USR1") { Time.now.to_s }
+        Process.wait2(pid2)
+      else
+        sleep 2
+      end
+      exit 0
+    end
+  rescue NotImplementedError
+    :ok
+  end
+}, '[ruby-core:28924]'
+
+assert_equal '[1, 2]', %q{
+  a = []
+  trap(:INT) { a.push(1) }
+  trap(:TERM) { a.push(2) }
+  pid = $$
+  begin
+    fork do
+      sleep 0.5
+      Process.kill(:INT, pid)
+      Process.kill(:TERM, pid)
+    end
+
+    sleep 1
+    a.sort
+  rescue NotImplementedError
+    [1, 2]
+  end
+}, '[ruby-dev:44005] [Ruby 1.9 - Bug #4950]'
+
diff --git a/bootstraptest/test_gc.rb b/bootstraptest/test_gc.rb
new file mode 100644
index 0000000000..eb68c9845e
--- /dev/null
+++ b/bootstraptest/test_gc.rb
@@ -0,0 +1,34 @@
+assert_normal_exit %q{
+a = []
+ms = "a".."k"
+("A".."Z").each do |mod|
+  mod = eval("module #{mod}; self; end")
+  ms.each do |meth|
+    iseq = RubyVM::InstructionSequence.compile("module #{mod}; def #{meth}; end; end")
+    GC.stress = true
+    iseq.eval
+    GC.stress = false
+  end
+  o = Object.new.extend(mod)
+  ms.each do |meth|
+    o.send(meth)
+  end
+end
+}, '[ruby-dev:39453]'
+
+assert_normal_exit %q{
+a = []
+ms = "a".."k"
+("A".."Z").each do |mod|
+  mod = eval("module #{mod}; self; end")
+  ms.each do |meth|
+    GC.stress = true
+    mod.module_eval {define_method(meth) {}}
+    GC.stress = false
+  end
+  o = Object.new.extend(mod)
+  ms.each do |meth|
+    o.send(meth)
+  end
+end
+}, '[ruby-dev:39453]'
diff --git a/bootstraptest/test_io.rb b/bootstraptest/test_io.rb
new file mode 100644
index 0000000000..7304aebc26
--- /dev/null
+++ b/bootstraptest/test_io.rb
@@ -0,0 +1,106 @@
+assert_finish 5, %q{
+  r, w = IO.pipe
+  t1 = Thread.new { r.sysread(1) }
+  t2 = Thread.new { r.sysread(1) }
+  sleep 0.1
+  w.write "a"
+  sleep 0.1
+  w.write "a"
+}, '[ruby-dev:31866]'
+
+assert_finish 10, %q{
+  begin
+    require "io/nonblock"
+    require "timeout"
+    timeout(3) do
+      r, w = IO.pipe
+      w.nonblock?
+      w.nonblock = true
+      w.write_nonblock("a" * 100000)
+      w.nonblock = false
+      t1 = Thread.new { w.write("b" * 4096) }
+      t2 = Thread.new { w.write("c" * 4096) }
+      sleep 0.5
+      r.sysread(4096).length
+      sleep 0.5
+      r.sysread(4096).length
+      t1.join
+      t2.join
+    end
+  rescue LoadError, TimeoutError, NotImplementedError
+  end
+}, '[ruby-dev:32566]'
+
+assert_finish 1, %q{
+  r, w = IO.pipe
+  Thread.new {
+  w << "ab"
+  sleep 0.1
+  w << "ab"
+  }
+  r.gets("abab")
+}
+
+assert_equal 'ok', %q{
+  require 'tmpdir'
+  begin
+    tmpname = "#{Dir.tmpdir}/ruby-btest-#{$$}-#{rand(0x100000000).to_s(36)}"
+    rw = File.open(tmpname, File::RDWR|File::CREAT|File::EXCL)
+  rescue Errno::EEXIST
+    retry
+  end
+  save = STDIN.dup
+  STDIN.reopen(rw)
+  STDIN.reopen(save)
+  rw.close
+  File.unlink(tmpname)
+  :ok
+}
+
+assert_equal 'ok', %q{
+  require 'tmpdir'
+  begin
+    tmpname = "#{Dir.tmpdir}/ruby-btest-#{$$}-#{rand(0x100000000).to_s(36)}"
+    rw = File.open(tmpname, File::RDWR|File::CREAT|File::EXCL)
+  rescue Errno::EEXIST
+    retry
+  end
+  save = STDIN.dup
+  STDIN.reopen(rw)
+  STDIN.print "a"
+  STDIN.reopen(save)
+  rw.close
+  File.unlink(tmpname)
+  :ok
+}
+
+assert_normal_exit %q{
+  ARGF.set_encoding "foo"
+}
+
+10.times do
+  assert_normal_exit %q{
+    at_exit { p :foo }
+
+    megacontent = "abc" * 12345678
+    #File.open("megasrc", "w") {|f| f << megacontent }
+
+    Thread.new { sleep rand*0.2; Process.kill(:INT, $$) }
+
+    r1, w1 = IO.pipe
+    r2, w2 = IO.pipe
+    t1 = Thread.new { w1 << megacontent; w1.close }
+    t2 = Thread.new { r2.read; r2.close }
+    IO.copy_stream(r1, w2) rescue nil
+    w2.close
+    r1.close
+    t1.join
+    t2.join
+  }, 'megacontent-copy_stream', ["INT"], :timeout => 10 or break
+end
+
+assert_normal_exit %q{
+  r, w = IO.pipe
+  STDOUT.reopen(w)
+  STDOUT.reopen(__FILE__, "r")
+}, '[ruby-dev:38131]'
diff --git a/bootstraptest/test_jump.rb b/bootstraptest/test_jump.rb
new file mode 100644
index 0000000000..595aaa7c4b
--- /dev/null
+++ b/bootstraptest/test_jump.rb
@@ -0,0 +1,308 @@
+assert_equal %q{ok}, %q{
+  def m
+    :ng1
+    mm{
+      yield
+    }
+    :ng2
+  end
+
+  def mm
+    :ng3
+    yield
+    :ng4
+  end
+
+  m{
+    break :ok
+  }
+}
+assert_equal %q{ok}, %q{
+  3.times{
+    break :ok
+  }
+}
+assert_equal %q{}, %q{
+  catch(:foo){
+    throw :foo
+  }
+}
+assert_equal %q{false}, %q{
+  catch(:foo){
+    throw :foo, false
+  }
+}
+assert_equal %q{}, %q{
+  catch(:foo){
+    throw :foo, nil
+  }
+}
+assert_equal %q{ok}, %q{
+  catch(:foo){
+    throw :foo, :ok
+  }
+}
+assert_equal %q{}, %q{
+  catch(:foo){
+    1.times{
+      throw :foo
+    }
+  }
+}
+assert_equal %q{ok}, %q{
+  catch(:foo){
+    1.times{
+      throw :foo, :ok
+    }
+  }
+}
+assert_equal %q{ok}, %q{
+  catch(:foo){
+    catch(:bar){
+      throw :foo, :ok
+    }
+    :ng
+  }
+}
+assert_equal %q{ok}, %q{
+  catch(:foo){
+    catch(:bar){
+      1.times{
+        throw :foo, :ok
+      }
+    }
+    :ng
+  }
+}
+assert_equal %q{2}, %q{
+  module Enumerable
+    def all_?
+      self.each{|e|
+        unless yield(e)
+          return false
+        end
+      }
+      true
+    end
+  end
+
+  xxx = 0
+  [1,2].each{|bi|
+    [3,4].each{|bj|
+      [true, nil, true].all_?{|be| be}
+      break
+    }
+    xxx += 1
+  }
+  xxx
+}
+assert_equal %q{ok}, %q{
+  def m
+    yield
+  end
+
+  m{
+    begin
+    ensure
+      break :ok
+    end
+  }
+}
+assert_equal %q{ok}, %q{
+  def m
+    yield
+    :ok
+  end
+  i=0
+  m{
+    if i>10
+      i*i
+    else
+      i+=1
+      next
+    end
+  }
+}
+assert_equal %q{ok}, %q{
+  def m
+    yield
+  end
+
+  m{
+    next :ok
+  }
+}
+assert_equal %q{131}, %q{
+  def m
+    yield + 10
+  end
+  i=0
+  m{
+    if i>10
+      i*i
+    else
+      i+=1
+      redo
+    end
+  }
+}
+assert_equal %q{ok}, %q{
+begin
+  eval %q{
+    1.times{
+      retry
+    }
+  }
+rescue SyntaxError
+  :ok
+end
+}
+assert_equal %q{3}, %q{
+  def m
+    return 3
+  end
+  m
+}
+assert_equal %q{ok}, %q{
+  def m
+    :ng1
+    mm{
+      return :ok
+    }
+    :ng2
+  end
+
+  def mm
+    :ng3
+    yield
+    :ng4
+  end
+  m
+}
+assert_equal %q{100}, %q{
+  $i = 0
+  def m
+    begin
+      iter{
+        return
+      }
+    ensure
+      $i = 100
+    end
+  end
+
+  def iter
+    yield
+  end
+  m
+  $i
+}
+assert_equal %q{ok}, %q{
+  def m
+    begin
+      raise
+    rescue
+      return :ok
+    end
+    :ng
+  end
+  m
+}
+assert_equal %q{1}, %q{
+  def m
+    begin
+      raise
+    rescue
+      return 1
+    end
+  end
+
+  m
+}
+assert_equal %q{1}, %q{
+  def m
+    begin
+      #
+    ensure
+      return 1
+    end
+  end
+
+  m
+}
+assert_equal 'ok', %q{
+  begin
+    catch {|t| throw t, :ok }
+  rescue ArgumentError
+    :ng
+  end
+}, '[ruby-dev:31609]'
+
+assert_equal "1", %q{
+  catch do |t|
+    begin
+      throw t, 1
+      2
+    ensure
+      3
+    end
+  end
+}, "[ruby-dev:31698]"
+
+assert_normal_exit %q{
+  f = 0
+  1.times do
+    begin
+      f += 1
+    ensure
+      redo unless f > 2
+    end
+  end
+}
+
+assert_normal_exit %q{
+  -> do
+    1.times do
+      begin
+        raise
+      rescue
+        return
+      end
+    end
+  end.call
+}
+
+assert_normal_exit %q{
+  while true
+    begin
+      raise
+      next
+    rescue
+    end
+    break
+  end
+}, '[ruby-core:28172]'
+
+assert_equal "true", %q{
+  class Object
+    def return_eigenclass
+      class << self
+        return self
+      end
+    end
+  end
+  s = "foo"
+  s.return_eigenclass == class << s; self; end
+}, '[ruby-core:21379]'
+
+assert_equal "true", %q{
+  class Object
+    def yield_eigenclass
+      class << self
+        yield self
+      end
+    end
+  end
+  s = "foo"
+  s.yield_eigenclass {|c| c == class << s; self; end }
+}, '[ruby-dev:40975]'
diff --git a/bootstraptest/test_literal.rb b/bootstraptest/test_literal.rb
new file mode 100644
index 0000000000..ab028e2c1e
--- /dev/null
+++ b/bootstraptest/test_literal.rb
@@ -0,0 +1,202 @@
+# empty program
+assert_equal '',                ''
+assert_equal '',                ' '
+assert_equal '',                "\n"
+
+# special const
+assert_equal 'true',            'true'
+assert_equal 'TrueClass',       'true.class'
+assert_equal 'false',           'false'
+assert_equal 'FalseClass',      'false.class'
+assert_equal '',                'nil'
+assert_equal 'nil',             'nil.inspect'
+assert_equal 'NilClass',        'nil.class'
+assert_equal 'sym',             ':sym'
+assert_equal ':sym',            ':sym.inspect'
+assert_equal 'Symbol',          ':sym.class'
+assert_equal '1234',            '1234'
+assert_equal 'Fixnum',          '1234.class'
+assert_equal '1234',            '1_2_3_4'
+assert_equal 'Fixnum',          '1_2_3_4.class'
+assert_equal '18',              '0x12'
+assert_equal 'Fixnum',          '0x12.class'
+assert_equal '15',              '0o17'
+assert_equal 'Fixnum',          '0o17.class'
+assert_equal '5',               '0b101'
+assert_equal 'Fixnum',          '0b101.class'
+assert_equal '123456789012345678901234567890', '123456789012345678901234567890'
+assert_equal 'Bignum',          '123456789012345678901234567890.class'
+assert_equal '2.0',             '2.0'
+assert_equal 'Float',           '1.3.class'
+
+# self
+assert_equal 'main',            'self'
+assert_equal 'Object',          'self.class'
+
+# string literal
+assert_equal 'a',               '?a'
+assert_equal 'String',          '?a.class'
+assert_equal 'A',               '?A'
+assert_equal 'String',          '?A.class'
+assert_equal "\n",              '?\n'
+assert_equal 'String',          '?\n.class'
+assert_equal ' ',               '?\ '
+assert_equal 'String',          '?\ .class'
+assert_equal 'string',          "'string'"
+assert_equal 'string',          '"string"'
+assert_equal 'string',          '%(string)'
+assert_equal 'string',          '%q(string)'
+assert_equal 'string',          '%Q(string)'
+assert_equal 'string string',   '"string string"'
+assert_equal ' ',               '" "'
+assert_equal "\0",              '"\0"'
+assert_equal "\1",              '"\1"'
+assert_equal "3",               '"\x33"'
+assert_equal "\n",              '"\n"'
+
+# dynamic string literal
+assert_equal '2',               '"#{1 + 1}"'
+assert_equal '16',              '"#{2 ** 4}"'
+assert_equal 'string',          's = "string"; "#{s}"'
+
+# dynamic symbol literal
+assert_equal 'a3c',             ':"a#{1+2}c"'
+assert_equal ':a3c',            ':"a#{1+2}c".inspect'
+assert_equal 'Symbol',          ':"a#{1+2}c".class'
+
+# xstring
+assert_equal "foo\n",           %q(`echo foo`)
+assert_equal "foo\n",           %q(s = "foo"; `echo #{s}`)
+
+# regexp
+assert_equal '',                '//.source'
+assert_equal 'Regexp',          '//.class'
+assert_equal '0',               '// =~ "a"'
+assert_equal '0',               '// =~ ""'
+assert_equal 'a',               '/a/.source'
+assert_equal 'Regexp',          '/a/.class'
+assert_equal '0',               '/a/ =~ "a"'
+assert_equal '0',               '/test/ =~ "test"'
+assert_equal '',                '/test/ =~ "tes"'
+assert_equal '0',               're = /test/; re =~ "test"'
+assert_equal '0',               'str = "test"; /test/ =~ str'
+assert_equal '0',               're = /test/; str = "test"; re =~ str'
+
+# dynacmi regexp
+assert_equal 'regexp',          %q(/re#{'ge'}xp/.source)
+assert_equal 'Regexp',          %q(/re#{'ge'}xp/.class)
+
+# array
+assert_equal 'Array',           '[].class'
+assert_equal '0',               '[].size'
+assert_equal '0',               '[].length'
+assert_equal '[]',              '[].inspect'
+assert_equal 'Array',           '[0].class'
+assert_equal '1',               '[3].size'
+assert_equal '[3]',             '[3].inspect'
+assert_equal '3',               'a = [3]; a[0]'
+assert_equal 'Array',           '[1,2].class'
+assert_equal '2',               '[1,2].size'
+assert_equal '[1, 2]',           '[1,2].inspect'
+assert_equal 'Array',           '[1,2,3,4,5].class'
+assert_equal '5',               '[1,2,3,4,5].size'
+assert_equal '[1, 2, 3, 4, 5]', '[1,2,3,4,5].inspect'
+assert_equal '1',               'a = [1,2]; a[0]'
+assert_equal '2',               'a = [1,2]; a[1]'
+assert_equal 'Array',           'a = [1 + 2, 3 + 4, 5 + 6]; a.class'
+assert_equal '[3, 7, 11]',      'a = [1 + 2, 3 + 4, 5 + 6]; a.inspect'
+assert_equal '7',               'a = [1 + 2, 3 + 4, 5 + 6]; a[1]'
+assert_equal '1',               '([0][0] += 1)'
+assert_equal '1',               '([2][0] -= 1)'
+assert_equal 'Array',           'a = [obj = Object.new]; a.class'
+assert_equal '1',               'a = [obj = Object.new]; a.size'
+assert_equal 'true',            'a = [obj = Object.new]; a[0] == obj'
+assert_equal '5',               'a = [1,2,3]; a[1] = 5; a[1]'
+assert_equal 'bar',             '[*:foo];:bar'
+assert_equal '[1, 2]',          'def nil.to_a; [2]; end; [1, *nil]'
+assert_equal '[1, 2]',          'def nil.to_a; [1, 2]; end; [*nil]'
+assert_equal '[0, 1, {2=>3}]',  '[0, *[1], 2=>3]', "[ruby-dev:31592]"
+
+
+# hash
+assert_equal 'Hash',            '{}.class'
+assert_equal '{}',              '{}.inspect'
+assert_equal 'Hash',            '{1=>2}.class'
+assert_equal '{1=>2}',          '{1=>2}.inspect'
+assert_equal '2',               'h = {1 => 2}; h[1]'
+assert_equal '0',               'h = {1 => 2}; h.delete(1); h.size'
+assert_equal '',                'h = {1 => 2}; h.delete(1); h[1]'
+assert_equal '2',               'h = {"string" => "literal", "goto" => "hell"}; h.size'
+assert_equal 'literal', 'h = {"string"=>"literal", "goto"=>"hell"}; h["string"]'
+assert_equal 'hell', 'h = {"string"=>"literal", "goto"=>"hell"}; h["goto"]'
+
+# range
+assert_equal 'Range',           '(1..2).class'
+assert_equal '1..2',            '(1..2).inspect'
+assert_equal '1',               '(1..2).begin'
+assert_equal '2',               '(1..2).end'
+assert_equal 'false',           '(1..2).exclude_end?'
+assert_equal 'Range',           'r = 1..2; r.class'
+assert_equal '1..2',            'r = 1..2; r.inspect'
+assert_equal '1',               'r = 1..2; r.begin'
+assert_equal '2',               'r = 1..2; r.end'
+assert_equal 'false',           'r = 1..2; r.exclude_end?'
+assert_equal 'Range',           '(1...3).class'
+assert_equal '1...3',           '(1...3).inspect'
+assert_equal '1',               '(1...3).begin'
+assert_equal '3',               '(1...3).end'
+assert_equal 'true',            '(1...3).exclude_end?'
+assert_equal 'Range',           'r = (1...3); r.class'
+assert_equal '1...3',           'r = (1...3); r.inspect'
+assert_equal '1',               'r = (1...3); r.begin'
+assert_equal '3',               'r = (1...3); r.end'
+assert_equal 'true',            'r = (1...3); r.exclude_end?'
+assert_equal 'Range',           'r = (1+2 .. 3+4); r.class'
+assert_equal '3..7',            'r = (1+2 .. 3+4); r.inspect'
+assert_equal '3',               'r = (1+2 .. 3+4); r.begin'
+assert_equal '7',               'r = (1+2 .. 3+4); r.end'
+assert_equal 'false',           'r = (1+2 .. 3+4); r.exclude_end?'
+assert_equal 'Range',           'r = (1+2 ... 3+4); r.class'
+assert_equal '3...7',           'r = (1+2 ... 3+4); r.inspect'
+assert_equal '3',               'r = (1+2 ... 3+4); r.begin'
+assert_equal '7',               'r = (1+2 ... 3+4); r.end'
+assert_equal 'true',            'r = (1+2 ... 3+4); r.exclude_end?'
+assert_equal 'Range',           'r = ("a".."c"); r.class'
+assert_equal '"a".."c"',        'r = ("a".."c"); r.inspect'
+assert_equal 'a',               'r = ("a".."c"); r.begin'
+assert_equal 'c',               'r = ("a".."c"); r.end'
+
+assert_equal 'String',          '__FILE__.class'
+assert_equal 'Fixnum',          '__LINE__.class'
+
+###
+
+assert_equal 'ok', %q{
+  # this cause "called on terminated object".
+  ObjectSpace.each_object(Module) {|m| m.name.inspect }
+  :ok
+}
+
+assert_normal_exit %q{
+  begin
+    r = 0**-1
+    r + r
+  rescue
+  end
+}, '[ruby-dev:34524]'
+
+assert_normal_exit %q{
+  begin
+    r = Marshal.load("\x04\bU:\rRational[\ai\x06i\x05")
+    r + r
+  rescue
+  end
+}, '[ruby-dev:34536]'
+
+assert_equal 'ok', %q{
+  "#{}""#{}ok"
+}, '[ruby-dev:38968]'
+
+assert_equal 'ok', %q{
+  "#{}o""#{}k""#{}"
+}, '[ruby-core:25284]'
diff --git a/bootstraptest/test_load.rb b/bootstraptest/test_load.rb
new file mode 100644
index 0000000000..e63c93a8f4
--- /dev/null
+++ b/bootstraptest/test_load.rb
@@ -0,0 +1,27 @@
+assert_equal 'ok', %q{
+  open("require-lock-test.rb", "w") {|f|
+    f.puts "sleep 0.1"
+    f.puts "module M"
+    f.puts "end"
+  }
+  $:.unshift Dir.pwd
+  vs = (1..2).map {|i|
+    Thread.start {
+      require "require-lock-test"
+      M
+    }
+  }.map {|t| t.value }
+  vs[0] == M && vs[1] == M ? :ok : :ng
+}, '[ruby-dev:32048]'
+
+assert_equal 'ok', %q{
+  %w[a a/foo b].each {|d| Dir.mkdir(d)}
+  open("b/foo", "w") {|f| f.puts "$ok = :ok"}
+  $:.replace(%w[a b])
+  begin
+    load "foo"
+    $ok
+  rescue => e
+    e.message
+  end
+}, '[ruby-dev:38097]'
diff --git a/bootstraptest/test_marshal.rb b/bootstraptest/test_marshal.rb
new file mode 100644
index 0000000000..7e34176169
--- /dev/null
+++ b/bootstraptest/test_marshal.rb
@@ -0,0 +1,5 @@
+
+assert_normal_exit %q{
+  Marshal.load(Marshal.dump({"k"=>"v"}), lambda {|v| v})
+}
+
diff --git a/bootstraptest/test_massign.rb b/bootstraptest/test_massign.rb
new file mode 100644
index 0000000000..0f63dd424a
--- /dev/null
+++ b/bootstraptest/test_massign.rb
@@ -0,0 +1,183 @@
+assert_equal '[[1], 2, 3]', '*v1, (a, b) = [1,[2, 3]]; [v1, a, b]'
+assert_equal '[[1], 2, 3]', '*v1,(*), (a, b) = [1,:x,[2, 3]]; [v1, a, b]'
+
+assert_equal '[]',          '*a = *nil; a'
+assert_equal '[nil]',       '*a = nil; a'
+assert_equal '2',           'a, a = 1, 2; a', "[ruby-dev:31522]"
+assert_equal '[1, 2]',      'a, b = 1, 2'
+assert_equal '[1, 2]', %q{
+  ans = []
+  trace_var(:$a){|v| ans << v}
+  trace_var(:$b){|v| ans << v}
+  $a, $b = 1, 2
+  ans
+}
+
+assert_equal 'ok', %q{
+  r = :ok
+  :ng.tap {|(r)|}
+  r
+}, '[ruby-dev:31507]'
+
+=begin
+# generated by this script:
+
+3.times{|i|
+  8.times{|e|
+    ary = (0...e).to_a
+    a,b,c,d,e,f = nil
+    vals = %w(a b c d e f)
+    vals[i] = '*' + vals[i]
+    program = "#{vals.join(", ")} = *ary"
+    eval(program)
+    ans = [a,b,c,d,e,f]
+    puts %Q{
+      assert_equal "#{ans.inspect}", %q{
+        ary = #{ary.inspect}
+        #{program}; [a, b, c, d, e, f]
+      }}
+  }
+}
+=end
+
+      assert_equal "[[], nil, nil, nil, nil, nil]", %q{
+        ary = []
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[], 0, nil, nil, nil, nil]", %q{
+        ary = [0]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[], 0, 1, nil, nil, nil]", %q{
+        ary = [0, 1]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[], 0, 1, 2, nil, nil]", %q{
+        ary = [0, 1, 2]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[], 0, 1, 2, 3, nil]", %q{
+        ary = [0, 1, 2, 3]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[], 0, 1, 2, 3, 4]", %q{
+        ary = [0, 1, 2, 3, 4]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[0], 1, 2, 3, 4, 5]", %q{
+        ary = [0, 1, 2, 3, 4, 5]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[[0, 1], 2, 3, 4, 5, 6]", %q{
+        ary = [0, 1, 2, 3, 4, 5, 6]
+        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[nil, [], nil, nil, nil, nil]", %q{
+        ary = []
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [], nil, nil, nil, nil]", %q{
+        ary = [0]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [], 1, nil, nil, nil]", %q{
+        ary = [0, 1]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [], 1, 2, nil, nil]", %q{
+        ary = [0, 1, 2]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [], 1, 2, 3, nil]", %q{
+        ary = [0, 1, 2, 3]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [], 1, 2, 3, 4]", %q{
+        ary = [0, 1, 2, 3, 4]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [1], 2, 3, 4, 5]", %q{
+        ary = [0, 1, 2, 3, 4, 5]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, [1, 2], 3, 4, 5, 6]", %q{
+        ary = [0, 1, 2, 3, 4, 5, 6]
+        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[nil, nil, [], nil, nil, nil]", %q{
+        ary = []
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, nil, [], nil, nil, nil]", %q{
+        ary = [0]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, 1, [], nil, nil, nil]", %q{
+        ary = [0, 1]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, 1, [], 2, nil, nil]", %q{
+        ary = [0, 1, 2]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, 1, [], 2, 3, nil]", %q{
+        ary = [0, 1, 2, 3]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, 1, [], 2, 3, 4]", %q{
+        ary = [0, 1, 2, 3, 4]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, 1, [2], 3, 4, 5]", %q{
+        ary = [0, 1, 2, 3, 4, 5]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+      assert_equal "[0, 1, [2, 3], 4, 5, 6]", %q{
+        ary = [0, 1, 2, 3, 4, 5, 6]
+        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
+      }
+
+
+#
+assert_equal 'ok', %q{
+  a,s=[],"aaa"
+  300.times { a<<s; s=s.succ }
+  eval <<-END__
+  GC.stress=true
+  Fiber.new do
+    #{ a.join(",") },*zzz=1
+  end.resume
+  END__
+  :ok
+}, '[ruby-dev:32581]'
+
+assert_equal 'ok', %q{
+  while true
+    *, z = 1
+    break
+  end
+  :ok
+}, '[ruby-dev:32892]'
diff --git a/bootstraptest/test_method.rb b/bootstraptest/test_method.rb
new file mode 100644
index 0000000000..2baf33539d
--- /dev/null
+++ b/bootstraptest/test_method.rb
@@ -0,0 +1,1186 @@
+# regular argument
+assert_equal '1',       'def m() 1 end; m()'
+assert_equal '1',       'def m(a) a end; m(1)'
+assert_equal '[1, 2]',  'def m(a,b) [a, b] end; m(1,2)'
+assert_equal '[1, 2, 3]', 'def m(a,b,c) [a, b, c] end; m(1,2,3)'
+assert_equal 'wrong number of arguments (1 for 0)', %q{
+  def m; end
+  begin
+    m(1)
+  rescue => e
+    e.message
+  end
+}
+
+assert_equal 'wrong number of arguments (0 for 1)', %q{
+  def m a; end
+  begin
+    m
+  rescue => e
+    e.message
+  end
+}
+
+# default argument
+assert_equal '1',       'def m(x=1) x end; m()'
+assert_equal '1',       'def m(x=7) x end; m(1)'
+assert_equal '1',       'def m(a,x=1) x end; m(7)'
+assert_equal '1',       'def m(a,x=7) x end; m(7,1)'
+assert_equal '1',       'def m(a,b,x=1) x end; m(7,7)'
+assert_equal '1',       'def m(a,b,x=7) x end; m(7,7,1)'
+assert_equal '1',       'def m(a,x=1,y=1) x end; m(7)'
+assert_equal '1',       'def m(a,x=1,y=1) y end; m(7)'
+assert_equal '1',       'def m(a,x=7,y=1) x end; m(7,1)'
+assert_equal '1',       'def m(a,x=7,y=1) y end; m(7,1)'
+assert_equal '1',       'def m(a,x=7,y=7) x end; m(7,1,1)'
+assert_equal '1',       'def m(a,x=7,y=7) y end; m(7,1,1)'
+
+# rest argument
+assert_equal '[]',      'def m(*a) a end; m().inspect'
+assert_equal '[1]',     'def m(*a) a end; m(1).inspect'
+assert_equal '[1, 2]',  'def m(*a) a end; m(1,2).inspect'
+assert_equal '[]',      'def m(x,*a) a end; m(7).inspect'
+assert_equal '[1]',     'def m(x,*a) a end; m(7,1).inspect'
+assert_equal '[1, 2]',  'def m(x,*a) a end; m(7,1,2).inspect'
+assert_equal '[]',      'def m(x,y,*a) a end; m(7,7).inspect'
+assert_equal '[1]',     'def m(x,y,*a) a end; m(7,7,1).inspect'
+assert_equal '[1, 2]',  'def m(x,y,*a) a end; m(7,7,1,2).inspect'
+assert_equal '[]',      'def m(x,y=7,*a) a end; m(7).inspect'
+assert_equal '[]',      'def m(x,y,z=7,*a) a end; m(7,7).inspect'
+assert_equal '[]',      'def m(x,y,z=7,*a) a end; m(7,7,7).inspect'
+assert_equal '[]',      'def m(x,y,z=7,zz=7,*a) a end; m(7,7,7).inspect'
+assert_equal '[]',      'def m(x,y,z=7,zz=7,*a) a end; m(7,7,7,7).inspect'
+assert_equal '1',       'def m(x,y,z=7,zz=1,*a) zz end; m(7,7,7).inspect'
+assert_equal '1',       'def m(x,y,z=7,zz=1,*a) zz end; m(7,7,7).inspect'
+assert_equal '1',       'def m(x,y,z=7,zz=7,*a) zz end; m(7,7,7,1).inspect'
+
+# block argument
+assert_equal 'Proc',    'def m(&block) block end; m{}.class'
+assert_equal 'nil',     'def m(&block) block end; m().inspect'
+assert_equal 'Proc',    'def m(a,&block) block end; m(7){}.class'
+assert_equal 'nil',     'def m(a,&block) block end; m(7).inspect'
+assert_equal '1',       'def m(a,&block) a end; m(1){}'
+assert_equal 'Proc',    'def m(a,b=nil,&block) block end; m(7){}.class'
+assert_equal 'nil',     'def m(a,b=nil,&block) block end; m(7).inspect'
+assert_equal 'Proc',    'def m(a,b=nil,&block) block end; m(7,7){}.class'
+assert_equal '1',       'def m(a,b=nil,&block) b end; m(7,1){}'
+assert_equal 'Proc',    'def m(a,b=nil,*c,&block) block end; m(7){}.class'
+assert_equal 'nil',     'def m(a,b=nil,*c,&block) block end; m(7).inspect'
+assert_equal '1',       'def m(a,b=nil,*c,&block) a end; m(1).inspect'
+assert_equal '1',       'def m(a,b=1,*c,&block) b end; m(7).inspect'
+assert_equal '1',       'def m(a,b=7,*c,&block) b end; m(7,1).inspect'
+assert_equal '[1]',     'def m(a,b=7,*c,&block) c end; m(7,7,1).inspect'
+
+# splat
+assert_equal '1',       'def m(a) a end; m(*[1])'
+assert_equal '1',       'def m(x,a) a end; m(7,*[1])'
+assert_equal '1',       'def m(x,y,a) a end; m(7,7,*[1])'
+assert_equal '1',       'def m(a,b) a end; m(*[1,7])'
+assert_equal '1',       'def m(a,b) b end; m(*[7,1])'
+assert_equal '1',       'def m(x,a,b) b end; m(7,*[7,1])'
+assert_equal '1',       'def m(x,y,a,b) b end; m(7,7,*[7,1])'
+assert_equal '1',       'def m(a,b,c) a end; m(*[1,7,7])'
+assert_equal '1',       'def m(a,b,c) b end; m(*[7,1,7])'
+assert_equal '1',       'def m(a,b,c) c end; m(*[7,7,1])'
+assert_equal '1',       'def m(x,a,b,c) a end; m(7,*[1,7,7])'
+assert_equal '1',       'def m(x,y,a,b,c) a end; m(7,7,*[1,7,7])'
+
+# hash argument
+assert_equal '1',       'def m(h) h end; m(7=>1)[7]'
+assert_equal '1',       'def m(h) h end; m(7=>1).size'
+assert_equal '1',       'def m(h) h end; m(7=>1, 8=>7)[7]'
+assert_equal '2',       'def m(h) h end; m(7=>1, 8=>7).size'
+assert_equal '1',       'def m(h) h end; m(7=>1, 8=>7, 9=>7)[7]'
+assert_equal '3',       'def m(h) h end; m(7=>1, 8=>7, 9=>7).size'
+assert_equal '1',       'def m(x,h) h end; m(7, 7=>1)[7]'
+assert_equal '1',       'def m(x,h) h end; m(7, 7=>1, 8=>7)[7]'
+assert_equal '1',       'def m(x,h) h end; m(7, 7=>1, 8=>7, 9=>7)[7]'
+assert_equal '1',       'def m(x,y,h) h end; m(7,7, 7=>1)[7]'
+assert_equal '1',       'def m(x,y,h) h end; m(7,7, 7=>1, 8=>7)[7]'
+assert_equal '1',       'def m(x,y,h) h end; m(7,7, 7=>1, 8=>7, 9=>7)[7]'
+
+# block argument
+assert_equal '1',       %q(def m(&block) mm(&block) end
+                           def mm() yield 1 end
+                           m {|a| a })
+assert_equal '1',       %q(def m(x,&block) mm(x,&block) end
+                           def mm(x) yield 1 end
+                           m(7) {|a| a })
+assert_equal '1',       %q(def m(x,y,&block) mm(x,y,&block) end
+                           def mm(x,y) yield 1 end
+                           m(7,7) {|a| a })
+
+# recursive call
+assert_equal '1',       %q(def m(n) n == 0 ? 1 : m(n-1) end; m(5))
+
+# instance method
+assert_equal '1',       %q(class C; def m() 1 end end;  C.new.m)
+assert_equal '1',       %q(class C; def m(a) a end end;  C.new.m(1))
+assert_equal '1',       %q(class C; def m(a = 1) a end end;  C.new.m)
+assert_equal '[1]',     %q(class C; def m(*a) a end end;  C.new.m(1).inspect)
+assert_equal '1',       %q( class C
+                              def m() mm() end
+                              def mm() 1 end
+                            end
+                            C.new.m )
+
+# singleton method (const)
+assert_equal '1',       %q(class C; def C.m() 1 end end;  C.m)
+assert_equal '1',       %q(class C; def C.m(a) a end end;  C.m(1))
+assert_equal '1',       %q(class C; def C.m(a = 1) a end end;  C.m)
+assert_equal '[1]',     %q(class C; def C.m(*a) a end end;  C.m(1).inspect)
+assert_equal '1',       %q(class C; end; def C.m() 1 end;  C.m)
+assert_equal '1',       %q(class C; end; def C.m(a) a end;  C.m(1))
+assert_equal '1',       %q(class C; end; def C.m(a = 1) a end;  C.m)
+assert_equal '[1]',     %q(class C; end; def C.m(*a) a end;  C.m(1).inspect)
+assert_equal '1',       %q(class C; def m() 7 end end; def C.m() 1 end;  C.m)
+assert_equal '1',       %q( class C
+                              def C.m() mm() end
+                              def C.mm() 1 end
+                            end
+                            C.m )
+
+# singleton method (lvar)
+assert_equal '1',       %q(obj = Object.new; def obj.m() 1 end;  obj.m)
+assert_equal '1',       %q(obj = Object.new; def obj.m(a) a end;  obj.m(1))
+assert_equal '1',       %q(obj = Object.new; def obj.m(a=1) a end;  obj.m)
+assert_equal '[1]',     %q(obj = Object.new; def obj.m(*a) a end;  obj.m(1))
+assert_equal '1',       %q(class C; def m() 7 end; end
+                           obj = C.new
+                           def obj.m() 1 end
+                           obj.m)
+
+# inheritance
+assert_equal '1',       %q(class A; def m(a) a end end
+                           class B < A; end
+                           B.new.m(1))
+assert_equal '1',       %q(class A; end
+                           class B < A; def m(a) a end end
+                           B.new.m(1))
+assert_equal '1',       %q(class A; def m(a) a end end
+                           class B < A; end
+                           class C < B; end
+                           C.new.m(1))
+
+# include
+assert_equal '1',       %q(class A; def m(a) a end end
+                           module M; end
+                           class B < A; include M; end
+                           B.new.m(1))
+assert_equal '1',       %q(class A; end
+                           module M; def m(a) a end end
+                           class B < A; include M; end
+                           B.new.m(1))
+
+# alias
+assert_equal '1',       %q( def a() 1 end
+                            alias m a
+                            m() )
+assert_equal '1',       %q( class C
+                              def a() 1 end
+                              alias m a
+                            end
+                            C.new.m )
+assert_equal '1',       %q( class C
+                              def a() 1 end
+                              alias :m a
+                            end
+                            C.new.m )
+assert_equal '1',       %q( class C
+                              def a() 1 end
+                              alias m :a
+                            end
+                            C.new.m )
+assert_equal '1',       %q( class C
+                              def a() 1 end
+                              alias :m :a
+                            end
+                            C.new.m )
+assert_equal '1',       %q( class C
+                              def a() 1 end
+                              alias m a
+                              undef a
+                            end
+                            C.new.m )
+
+# undef
+assert_equal '1',       %q( class C
+                              def m() end
+                              undef m
+                            end
+                            begin C.new.m; rescue NoMethodError; 1 end )
+assert_equal '1',       %q( class A
+                              def m() end
+                            end
+                            class C < A
+                              def m() end
+                              undef m
+                            end
+                            begin C.new.m; rescue NoMethodError; 1 end )
+assert_equal '1',       %q( class A; def a() end end   # [yarv-dev:999]
+                            class B < A
+                              def b() end
+                              undef a, b
+                            end
+                            begin B.new.a; rescue NoMethodError; 1 end )
+assert_equal '1',       %q( class A; def a() end end   # [yarv-dev:999]
+                            class B < A
+                              def b() end
+                              undef a, b
+                            end
+                            begin B.new.b; rescue NoMethodError; 1 end )
+
+assert_equal '3',  %q{
+  def m1
+    1
+  end
+  alias m2 m1
+  alias :"#{'m3'}" m1
+  m1 + m2 + m3
+}, '[ruby-dev:32308]'
+assert_equal '1', %q{
+  def foobar
+  end
+  undef :"foo#{:bar}"
+  1
+}, '[ruby-dev:32308]'
+assert_equal '1', %q{
+  def foobar
+    1
+  end
+  alias :"bar#{:baz}" :"foo#{:bar}"
+  barbaz
+}, '[ruby-dev:32308]'
+
+# private
+assert_equal '1',       %q( class C
+                              def m() mm() end
+                              def mm() 1 end
+                              private :mm
+                            end
+                            C.new.m )
+assert_equal '1',       %q( class C
+                              def m() 7 end
+                              private :m
+                            end
+                            begin C.m; rescue NoMethodError; 1 end )
+assert_equal '1',       %q( class C
+                              def C.m() mm() end
+                              def C.mm() 1 end
+                              private_class_method :mm
+                            end
+                            C.m )
+assert_equal '1',       %q( class C
+                              def C.m() 7 end
+                              private_class_method :m
+                            end
+                            begin C.m; rescue NoMethodError; 1 end )
+assert_equal '1',       %q( class C; def m() 1 end end
+                            C.new.m   # cache
+                            class C
+                              alias mm m; private :mm
+                            end
+                            C.new.m
+                            begin C.new.mm; 7; rescue NoMethodError; 1 end )
+
+# nested method
+assert_equal '1',       %q( class C
+                              def m
+                                def mm() 1 end
+                              end
+                            end
+                            C.new.m
+                            C.new.mm )
+assert_equal '1',       %q( class C
+                              def m
+                                def mm() 1 end
+                              end
+                            end
+                            instance_eval "C.new.m; C.new.mm" )
+
+# method_missing
+assert_equal ':m',      %q( class C
+                              def method_missing(mid, *args) mid end
+                            end
+                            C.new.m.inspect )
+assert_equal ':mm',     %q( class C
+                              def method_missing(mid, *args) mid end
+                            end
+                            C.new.mm.inspect )
+assert_equal '[1, 2]',  %q( class C
+                              def method_missing(mid, *args) args end
+                            end
+                            C.new.m(1,2).inspect )
+assert_equal '1',       %q( class C
+                              def method_missing(mid, *args) yield 1 end
+                            end
+                            C.new.m {|a| a })
+assert_equal 'nil',     %q( class C
+                              def method_missing(mid, *args, &block) block end
+                            end
+                            C.new.m.inspect )
+
+# send
+assert_equal '1',       %q( class C; def m() 1 end end;
+                            C.new.__send__(:m) )
+assert_equal '1',       %q( class C; def m() 1 end end;
+                            C.new.send(:m) )
+assert_equal '1',       %q( class C; def m(a) a end end;
+                            C.new.send(:m,1) )
+assert_equal '1',       %q( class C; def m(a,b) a end end;
+                            C.new.send(:m,1,7) )
+assert_equal '1',       %q( class C; def m(x,a=1) a end end;
+                            C.new.send(:m,7) )
+assert_equal '1',       %q( class C; def m(x,a=7) a end end;
+                            C.new.send(:m,7,1) )
+assert_equal '[1, 2]',  %q( class C; def m(*a) a end end;
+                            C.new.send(:m,1,2).inspect )
+assert_equal '1',       %q( class C; def m() 7 end; private :m end
+                            begin C.new.public_send(:m); rescue NoMethodError; 1 end )
+assert_equal '1',       %q( class C; def m() 1 end; private :m end
+                            C.new.send(:m) )
+
+# with block
+assert_equal '[[:ok1, :foo], [:ok2, :foo, :bar]]',
+%q{
+  class C
+    def [](a)
+      $ary << [yield, a]
+    end
+    def []=(a, b)
+      $ary << [yield, a, b]
+    end
+  end
+
+  $ary = []
+  C.new[:foo, &lambda{:ok1}]
+  C.new[:foo, &lambda{:ok2}] = :bar
+  $ary
+}
+
+# with
+assert_equal '[:ok1, [:ok2, 11]]', %q{
+  class C
+    def []
+      $ary << :ok1
+      10
+    end
+    def []=(a)
+      $ary << [:ok2, a]
+    end
+  end
+  $ary = []
+  C.new[]+=1
+  $ary
+}
+
+# splat and block arguments
+assert_equal %q{[[[:x, :y, :z], NilClass], [[1, :x, :y, :z], NilClass], [[1, 2, :x, :y, :z], NilClass], [[:obj], NilClass], [[1, :obj], NilClass], [[1, 2, :obj], NilClass], [[], Proc], [[1], Proc], [[1, 2], Proc], [[], Proc], [[1], Proc], [[1, 2], Proc], [[:x, :y, :z], Proc], [[1, :x, :y, :z], Proc], [[1, 2, :x, :y, :z], Proc]]}, %q{
+def m(*args, &b)
+  $result << [args, b.class]
+end
+$result = []
+ary = [:x, :y, :z]
+obj = :obj
+b = Proc.new{}
+
+m(*ary)
+m(1,*ary)
+m(1,2,*ary)
+m(*obj)
+m(1,*obj)
+m(1,2,*obj)
+m(){}
+m(1){}
+m(1,2){}
+m(&b)
+m(1,&b)
+m(1,2,&b)
+m(*ary,&b)
+m(1,*ary,&b)
+m(1,2,*ary,&b)
+$result
+}
+
+# aset and splat
+assert_equal '4', %q{class Foo;def []=(a,b,c,d);end;end;Foo.new[1,*a=[2,3]]=4}
+assert_equal '4', %q{class Foo;def []=(a,b,c,d);end;end;def m(&blk)Foo.new[1,*a=[2,3],&blk]=4;end;m{}}
+
+# post test
+assert_equal %q{[1, 2, :o1, :o2, [], 3, 4, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4)}
+
+assert_equal %q{[1, 2, 3, :o2, [], 4, 5, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5)}
+
+assert_equal %q{[1, 2, 3, 4, [], 5, 6, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6)}
+
+assert_equal %q{[1, 2, 3, 4, [5], 6, 7, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7)}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6], 7, 8, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8)}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6, 7], 8, 9, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8, 9)}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8], 9, 10, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10)}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8, 9], 10, 11, NilClass, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11)}
+
+assert_equal %q{[1, 2, :o1, :o2, [], 3, 4, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4){}}
+
+assert_equal %q{[1, 2, 3, :o2, [], 4, 5, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5){}}
+
+assert_equal %q{[1, 2, 3, 4, [], 5, 6, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6){}}
+
+assert_equal %q{[1, 2, 3, 4, [5], 6, 7, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7){}}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6], 7, 8, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8){}}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6, 7], 8, 9, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8, 9){}}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8], 9, 10, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10){}}
+
+assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8, 9], 10, 11, Proc, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
+end
+; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11){}}
+
+assert_equal %q{[1, 2, :o1, :o2, [], 3, 4, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, x, y]
+end
+; m(1, 2, 3, 4)}
+
+assert_equal %q{[1, 2, 3, :o2, [], 4, 5, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, x, y]
+end
+; m(1, 2, 3, 4, 5)}
+
+assert_equal %q{[1, 2, 3, 4, [], 5, 6, nil, nil]}, %q{
+def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)
+  x, y = :x, :y if $foo
+  [m1, m2, o1, o2, r, p1, p2, x, y]
+end
+; m(1, 2, 3, 4, 5, 6)}
+
+
+#
+# super
+#
+=begin
+# below programs are generated by this program:
+
+BASE = <<EOS__
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; <TEST>; super; end; end
+EOS__
+
+tests = {
+%q{
+  def m
+} => %q{
+  C1.new.m
+},
+#
+%q{
+  def m a
+} => %q{
+  C1.new.m 1
+},
+%q{
+  def m a
+    a = :a
+} => %q{
+  C1.new.m 1
+},
+#
+%q{
+  def m a, o=:o
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+},
+%q{
+  def m a, o=:o
+    a = :a
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+},
+%q{
+  def m a, o=:o
+    o = :x
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+},
+#
+%q{
+  def m a, *r
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+  C1.new.m 1, 2, 3
+},
+%q{
+  def m a, *r
+    r = [:x, :y]
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+  C1.new.m 1, 2, 3
+},
+#
+%q{
+  def m a, o=:o, *r
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+  C1.new.m 1, 2, 3
+  C1.new.m 1, 2, 3, 4
+},
+#
+%q{
+  def m a, o=:o, *r, &b
+} => %q{
+  C1.new.m 1
+  C1.new.m 1, 2
+  C1.new.m 1, 2, 3
+  C1.new.m 1, 2, 3, 4
+  C1.new.m(1){}
+  C1.new.m(1, 2){}
+  C1.new.m(1, 2, 3){}
+  C1.new.m(1, 2, 3, 4){}
+},
+#
+"def m(m1, m2, o1=:o1, o2=:o2, p1, p2)" =>
+%q{
+C1.new.m(1,2,3,4)
+C1.new.m(1,2,3,4,5)
+C1.new.m(1,2,3,4,5,6)
+},
+#
+"def m(m1, m2, *r, p1, p2)" =>
+%q{
+C1.new.m(1,2,3,4)
+C1.new.m(1,2,3,4,5)
+C1.new.m(1,2,3,4,5,6)
+C1.new.m(1,2,3,4,5,6,7)
+C1.new.m(1,2,3,4,5,6,7,8)
+},
+#
+"def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)" =>
+%q{
+C1.new.m(1,2,3,4)
+C1.new.m(1,2,3,4,5)
+C1.new.m(1,2,3,4,5,6)
+C1.new.m(1,2,3,4,5,6,7)
+C1.new.m(1,2,3,4,5,6,7,8)
+C1.new.m(1,2,3,4,5,6,7,8,9)
+},
+
+###
+}
+
+
+tests.each{|setup, methods| setup = setup.dup; setup.strip!
+  setup = BASE.gsub(/<TEST>/){setup}
+  methods.split(/\n/).each{|m| m = m.dup; m.strip!
+    next if m.empty?
+    expr = "#{setup}; #{m}"
+    result = eval(expr)
+    puts "assert_equal %q{#{result.inspect}}, %q{\n#{expr}}"
+    puts
+  }
+}
+
+=end
+
+assert_equal %q{[:C0_m, [1, 2, :o1, :o2, 3, 4]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, p1, p2); super; end; end
+; C1.new.m(1,2,3,4)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, :o2, 4, 5]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6)}
+
+assert_equal %q{[:C0_m, [1, :o]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, 2]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r; super; end; end
+; C1.new.m 1, 2, 3}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r; super; end; end
+; C1.new.m 1, 2, 3, 4}
+
+assert_equal %q{[:C0_m, [:a]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a
+    a = :a; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6,7)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7, 8]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6,7,8)}
+
+assert_equal %q{[:C0_m, [1, :o]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, 2]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m 1, 2, 3}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m 1, 2, 3, 4}
+
+assert_equal %q{[:C0_m, [1, :o]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m(1){}}
+
+assert_equal %q{[:C0_m, [1, 2]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m(1, 2){}}
+
+assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m(1, 2, 3){}}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o, *r, &b; super; end; end
+; C1.new.m(1, 2, 3, 4){}}
+
+assert_equal %q{[:C0_m, [1, :x]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o
+    o = :x; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, :x]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o
+    o = :x; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:C0_m, [:a, :o]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o
+    a = :a; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [:a, 2]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o
+    a = :a; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:C0_m, [1]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, :x, :y]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, *r
+    r = [:x, :y]; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, :x, :y]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, *r
+    r = [:x, :y]; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:C0_m, [1, :x, :y]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, *r
+    r = [:x, :y]; super; end; end
+; C1.new.m 1, 2, 3}
+
+assert_equal %q{[:C0_m, [1, 2, :o1, :o2, 3, 4]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, :o2, 4, 5]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6,7)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7, 8]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6,7,8)}
+
+assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7, 8, 9]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
+; C1.new.m(1,2,3,4,5,6,7,8,9)}
+
+assert_equal %q{[:C0_m, [1]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, *r; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, 2]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, *r; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, *r; super; end; end
+; C1.new.m 1, 2, 3}
+
+assert_equal %q{[:C0_m, []]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m; super; end; end
+; C1.new.m}
+
+assert_equal %q{[:C0_m, [1, :o]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o; super; end; end
+; C1.new.m 1}
+
+assert_equal %q{[:C0_m, [1, 2]]}, %q{
+class C0; def m *args; [:C0_m, args]; end; end
+class C1 < C0; def m a, o=:o; super; end; end
+; C1.new.m 1, 2}
+
+assert_equal %q{[:ok, :ok, :ok, :ok, :ok, :ok, :ng, :ng]}, %q{
+  $ans = []
+  class Foo
+    def m
+    end
+  end
+
+  c1 = c2 = nil
+
+  lambda{
+    $SAFE = 4
+    c1 = Class.new{
+      def m
+      end
+    }
+    c2 = Class.new(Foo){
+      alias mm m
+    }
+  }.call
+
+  def test
+    begin
+      yield
+    rescue SecurityError
+      $ans << :ok
+    else
+      $ans << :ng
+    end
+  end
+
+  o1 = c1.new
+  o2 = c2.new
+
+  test{o1.m}
+  test{o2.mm}
+  test{o1.send :m}
+  test{o2.send :mm}
+  test{o1.public_send :m}
+  test{o2.public_send :mm}
+  test{o1.method(:m).call}
+  test{o2.method(:mm).call}
+  $ans
+}
+
+assert_equal 'ok', %q{
+  class C
+    def x=(n)
+    end
+    def m
+      self.x = :ok
+    end
+  end
+  C.new.m
+}
+
+assert_equal 'ok', %q{
+  proc{
+    $SAFE = 1
+    class C
+      def m
+        :ok
+      end
+    end
+  }.call
+  C.new.m
+}, '[ruby-core:11998]'
+
+assert_equal 'ok', %q{
+  proc{
+    $SAFE = 2
+    class C
+      def m
+        :ok
+      end
+    end
+  }.call
+  C.new.m
+}, '[ruby-core:11998]'
+
+assert_equal 'ok', %q{
+  proc{
+    $SAFE = 3
+    class C
+      def m
+        :ng
+      end
+    end
+  }.call
+  begin
+    C.new.m
+  rescue SecurityError
+    :ok
+  end
+}, '[ruby-core:11998]'
+
+assert_equal 'ok', %q{
+  class B
+    def m() :fail end
+  end
+  class C < B
+    undef m
+    begin
+      remove_method :m
+    rescue NameError
+    end
+  end
+  begin
+    C.new.m
+  rescue NameError
+    :ok
+  end
+}, '[ruby-dev:31816], [ruby-dev:31817]'
+
+assert_normal_exit %q{
+  begin
+    Process.setrlimit(Process::RLIMIT_STACK, 4_202_496)
+    # FreeBSD fails this less than 4M + 8K bytes.
+  rescue Exception
+    exit
+  end
+  class C
+    attr "a" * (10*1024*1024)
+  end
+}, '[ruby-dev:31818]'
+
+assert_equal 'ok', %q{
+  class Module
+    def define_method2(name, &block)
+      define_method(name, &block)
+    end
+  end
+  class C
+    define_method2(:m) {|x, y| :fail }
+  end
+  begin
+    C.new.m([1,2])
+  rescue ArgumentError
+    :ok
+  end
+}
+
+assert_not_match /method_missing/, %q{
+  STDERR.reopen(STDOUT)
+  variable_or_mehtod_not_exist
+}
+
+assert_equal '[false, false, false, false, true, true]', %q{
+  class C
+    define_method(:foo) {
+      block_given?
+    }
+  end
+
+  C.new.foo {}
+
+  class D
+    def foo
+      D.module_eval{
+        define_method(:m1){
+          block_given?
+        }
+      }
+    end
+    def bar
+      D.module_eval{
+        define_method(:m2){
+          block_given?
+        }
+      }
+    end
+  end
+
+  D.new.foo
+  D.new.bar{}
+  [C.new.foo, C.new.foo{}, D.new.m1, D.new.m1{}, D.new.m2, D.new.m2{}]
+}, '[ruby-core:14813]'
+
+assert_equal 'ok', %q{
+  class Foo
+    define_method(:foo) do |&b|
+      b.call
+    end
+  end
+  Foo.new.foo do
+    break :ok
+  end
+}, '[ruby-dev:36028]'
+
+assert_equal '[1, 2, [3, 4]]', %q{
+  def regular(a, b, *c)
+    [a, b, c]
+  end
+  regular(*[], 1, *[], *[2, 3], *[], 4)
+}, '[ruby-core:19413]'
+
+assert_equal '[1, [:foo, 3, 4, :foo]]', %q{
+  def regular(a, *b)
+    [a, b]
+  end
+  a = b = [:foo]
+  regular(1, *a, *[3, 4], *b)
+}
+
+assert_equal '["B", "A"]', %q{
+  class A
+    def m
+      'A'
+    end
+  end
+
+  class B < A
+    define_method(:m) do
+      ['B', super()]
+    end
+  end
+
+  class C < B
+  end
+
+  C.new.m
+}
+
+assert_equal 'ok', %q{
+  module Foo
+    def foo
+      begin
+        super
+      rescue NoMethodError
+        :ok
+      end
+    end
+    module_function :foo
+  end
+  Foo.foo
+}, '[ruby-dev:37587]'
+
+assert_equal 'Object#foo', %q{
+  class Object
+    def self.foo
+      "Object.foo"
+    end
+    def foo
+      "Object#foo"
+    end
+  end
+
+  module Foo
+    def foo
+      begin
+        super
+      rescue NoMethodError
+        :ok
+      end
+    end
+    module_function :foo
+  end
+  Foo.foo
+}, '[ruby-dev:37587]'
+
+assert_normal_exit %q{
+  class BasicObject
+    remove_method :method_missing
+  end
+  begin
+    "a".lalala!
+  rescue NoMethodError => e
+    e.message == "undefined method `lalala!' for \"a\":String" ? :ok : :ng
+  end
+}, '[ruby-core:22298]'
+
+assert_equal 'ok', %q{
+  "hello"[0] ||= "H"
+  "ok"
+}
+
+assert_equal 'ok', %q{
+  "hello"[0, 1] ||= "H"
+  "ok"
+}
+
+assert_equal 'ok', %q{
+  class C
+    define_method(:foo) do
+      C.class_eval { remove_method(:foo) }
+      super()
+    end
+  end
+  begin
+    C.new.foo
+  rescue NoMethodError
+    'ok'
+  end
+}
+assert_equal 'ok', %q{
+  [0][0, &proc{}] += 21
+  'ok'
+}, '[ruby-core:30534]'
+
diff --git a/bootstraptest/test_objectspace.rb b/bootstraptest/test_objectspace.rb
new file mode 100644
author	Yusuke Endoh <mame@ruby-lang.org>	2019-11-18 09:12:50 -0600
committer	Yusuke Endoh <mame@ruby-lang.org>	2019-11-18 09:12:50 -0600
commit	373769c93995abeeb546bdcd9e6527c77aefa1d4 (patch)
tree	cefefc55ddfe9d5616dfd6376ded994c0e1cdb57 /tool/m4/ruby_check_signedness.m4
parent	f09fc1b0344e65aeb9c11aaeb23c99954265fe4d (diff)